
Sample records for listeria monocytogenes lo28

  1. Listeria monocytogenes: diagnostic problems

    NARCIS (Netherlands)

    Beumer, R.R.; Hazeleger, W.C.


    The first isolation methods for the detection of Listeria spp. were generally based on the direct culture of samples on simple agar media, but isolation of the pathogenic Listeria monocytogenes was difficult. In time, new techniques were developed, based on a variety of selective and elective agents

  2. Listeria monocytogenes endocarditis. (United States)

    Sheinman, B D; Evans, T; Sage, R


    A fatal case of endocarditis due to Listeria monocytogenes is reported. Case reports of endocarditis due to this organism are rare but indicate a higher mortality than with many other causes of bacterial endocarditis. The size of the problem may be underestimated because the organism has a "diphtheroid' appearance and may be incorrectly dismissed as a contaminant.

  3. [Listeria monocytogenes in food]. (United States)

    Mícková, V


    As in recent years laboratory diagnostics of listeria has become part of food microbiology, the frequency of occurrence of the bacteria Listeria monocytogenes has been followed in various kinds of foods for a year. A total of 51 strains of L. monocytogenes (7.2%) was isolated from 700 kinds of samples (raw milk, pasteurized milk, meat surface, poultry, cheeses, thermally not treated meat products, food--industry machinery). As can be seen in Tab. I, the highest number of strains was isolated from meat surfaces (13.5%), followed by meat--industry machinery (12.72%), poultry (10%) and cheeses (5%). The lower numbers of strains were found out in thermally not treated meat products (3.8%) and in raw milk (3.3%). Pasteurized milk did not contain any strains. Our findings in raw milk (3.3%) and in pasteurized milk (0) are in agreement with the data cited e. g. by authors from the USA (Lovett et al., 1987), who mention the value of 4.2% in raw milk and the zero value in pasteurized milk. The percentage of strains monitored in cheeses (5%) can be evaluated as low as the assortment of investigated cheeses was small (all strains were isolated from soft ripening cheeses). German authors (Tham et al., 1988) speak about the 2.5% percentage of L. monocytogenes strains; this is in keeping with our findings. The findings in thermally not treated meat products (3.8%) can be evaluated as low although the number of strains found in raw meat was high.(ABSTRACT TRUNCATED AT 250 WORDS)

  4. [Hematometra & Listeria monocytogenes]. (United States)

    Gómez Arzapalo, E; Pérez Mendizábal, A; Herrera Avalos, I; Gorozpe Calvillo, J I


    The hematometra is a nosological entity that may not always be attributed to an embryonic defect of the paramesonefros; cervical-vaginal infections such as etiological possibilities due to Listeria monocytogenes (Lm), cervix malignant neoplasias, iatrogenias due to endometrial ablation with Lasser, traumatic bloody uterine curetage and because of cervical cryocoagulation or electrocoagulation are also mentioned. The case to be reported is from a woman in reproductive stage, who is 32 years old, and had menarca at the age of 13, starting her sexual life at 31, not using any method to control her fertility. When having an eight-week amenorrhea after 8 months of marriage, she visited the doctor for assumed pregnancy, within the prenatal analysis a pelvic echographic study was requested, finding out images that we concluded as hematometra, having been drained and demonstrated the presence of LM by anti-Lm antibodies, being administered Azitromicina and Espiramicina.

  5. Neuroinfections due to Listeria monocytogenes. (United States)

    Streharova, A; Babjakova, A; Moravcikova, A; Harnicarova, A; Holeckova, K; Lesnakova, A; Sladeckova, V; Seckova, S; Kisac, P; Beno, P


    Listeria monocytogenes is not a rare pathogen causing meningitis, mainly in small children and in close contacts to livestock. The pathogen is naturally resistant to cephalosporins and some glycopeptides as well, therefore despite of syndromologic diagnosis of meningitis and initial therapy with 3rd generation cephalosporins according to the guidelines therapeutic failures with clinical consequences may occur.

  6. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B H; Ingmer, H


    Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... kinase and a gene regulatory protein, the response regulator (RR). We have identified seven putative RR genes in L. monocytogenes LO28 by PCR using degenerate oligonucleotide primers. By insertional inactivation we obtained data suggesting that three of the putative RRs contribute to the pathogenicity...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two...

  7. Antimicrobial Tolerance in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Curtis, Thomas Darwin

    There are two ways in which bacteria survive killing by antibiotics. The most well-known, is antibiotic resistance, which results from the acquisition of a resistance gene or mutation that allows bacteria to grow and divide in the presence of antibiotic concentrations that would normally kill other...... that are completely refractory to antibiotics due to the inactivity of cellular processes. Persister cells have been linked to treatment failures in several bacterial infections including Mycobacterium tuberculosis, Pseudomonas aeruginosa, Staphylococcus aureus and Escherichia coli. Preceding the start of this Ph......D project, Listeria monocytogenes was observed to form these antibiotic tolerant persister cells. L. monocytogenes is a Gram-positive, foodborne pathogen that causes listeriosis, a rare, but often lethal disease, even with antibiotic treatment. It typically affects pregnant women, neonates, the elderly...

  8. Listeria monocytogenes en comidas preparadas


    Vila Brugalla, Montserrat


    Tradicionalmente Listeria monocytogenes no era considerado como un importante patógeno transmitido a través de los alimentos y, en consecuencia, no había recibido mucha atención por parte de la industria alimentaria. Los índices de listeriosis en la población humana siempre habían estado enormemente ensombrecidos por otras enfermedades transmitidas por los alimentos como la salmonelosis o la campilobacterosis, y la confirmación de brotes era poco frecuente. Sin embargo, los brotes de listerio...

  9. Fødevarebetinget listeria monocytogenes endokarditis

    DEFF Research Database (Denmark)

    Frydland, Martin; Bundgaard, Henning; Moser, Claus


    Infection with Listeria monocytogenes is rare and mainly seen in immunosuppressed patients. Infection with L. monocytogenes has a mortality rate of 30%. We present a case report of L. monocytogenes bacteraemia and endocarditis in a 70-year-old man with several co-morbidities and following four...... major surgical procedures. This illustrates the findings and characteristics in one of the 16 patients who died in 2013 and 2014 this summer due to sausage-related L. monocytogenes infection....

  10. Comparison of three Listeria monocytogenes strains in a guinea-pig model simulating food-borne exposure

    DEFF Research Database (Denmark)

    Roldgaard, Bent; Andersen, Jens Bo; Hansen, Tina Beck


    Three different Listeria monocytogenes strains, LO28 (a laboratory strain with truncated InlA), 4446 (a clinical isolate) and 7291 (a food isolate), were compared in a guinea-pig model designed to mimic food-borne exposure. The objectives were (1) to verify the applicability of the animal model f...

  11. Prevalence of Listeria monocytogenes in poultry meat

    Directory of Open Access Journals (Sweden)

    Mehmet ELMALI


    Full Text Available AbstractThe objectives of this study were i to isolate Listeria spp. and Listeria monocytogenes in broiler wing meat samples, ii to confirm the isolates by PCR, based on prs and hly A gene sequences, iii to determine the seasonal and monthly distribution of the isolates. A total of 120 broiler wing meat samples (60 packaged pieces wrapped using strech film in styrofoam plates and 60 unpackaged pieces bought from different markets in Hatay province were analysed. Listeria spp. was isolated from 57 (47.5% out of 120 samples. Fifty-four, out of 57 Listeria spp. isolates were identified as L. monocytogenes. L. monocytogenes was isolated from the samples collected during the spring, winter, summer, and autumn at the levels of 26.6%, 40%, 53.3%, 60%, respectively. In this study, the isolation rates were found to be the highest in autumn, while the isolation rates were found to be the lowest in spring. As a consequence, high prevalence of Listeria spp. and L. monocytogenes in poultry wing meat samples may pose a risk for human health. We consider that with obeying the rules of good hygiene practices (GHP, good manufacturing practices (GMP and HACCP can minimize the contamination with Listeria spp.

  12. Listeria monocytogenes and hemolytic Listeria innocua in poultry. (United States)

    Milillo, S R; Stout, J C; Hanning, I B; Clement, A; Fortes, E D; den Bakker, H C; Wiedmann, M; Ricke, S C


    Listeria monocytogenes is a ubiquitous, saprophytic, Gram-positive bacterium and occasional food-borne pathogen, often associated with ready-to-eat meat products. Because of the increased consumer interest in organic, all natural, and free range poultry products, it is important to understand L. monocytogenes in the context of such systems. Pasture-reared poultry were surveyed over the course of two 8-wk rearing periods. Cecal, soil, and grass samples were collected for Listeria isolation and characterization. Seven of 399 cecal samples (or 1.75%) were Listeria-positive. All positive cecal samples were obtained from broilers sampled at 2 wk of age. Grass and soil samples were collected from the pasture both before and after introduction of the poultry. Environmental samples collected after introduction of poultry were significantly more likely to contain Listeria (P Listeria, sigB allelic typing, and hlyA PCR tests found that both L. monocytogenes and L. innocua, including hemolytic L. innocua, were recovered from the cecal and environmental (grass/soil) samples. The sigB allelic typing also revealed that (1) positive samples could be composed of 2 or more allelic types; (2) allelic types found in cecal samples could also be found in the environment; and (3) allelic types could persist through the 2 rearing periods. Our data indicate that both pasture-reared poultry and their environment can be contaminated with L. monocytogenes and hemolytic L. innocua.

  13. Prevalence of Listeria monocytogenes in European cheeses

    DEFF Research Database (Denmark)

    Martinez Rios, Veronica; Dalgaard, Paw


    Both in Europe and worldwide cheese has caused important outbreaks of listeriosis and can be a vehicle for transmission of Listeria monocytogenes to consumers. A systematic review and meta-analysis were conducted using scientific literature and European Food Safety Authority (EFSA) reports...... understanding of L. monocytogenes prevalence in different types of cheeses and provided results that can be useful as input for quantitative microbiological risk assessment modelling....

  14. Control options for Listeria monocytogenes in seafoods

    DEFF Research Database (Denmark)

    Huss, Hans Henrik; Jørgensen, Lasse Vigel; Vogel, Birte Fonnesbech


    At least three outbreaks of listeriosis associated with seafood have been reported. Listeria monocytogenes is widely distributed in the general environment including fresh water, coastal water and live fish from these areas. Contamination or recontamination of seafood may also take place during...

  15. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.


    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  16. Listeria monocytogenes : nog steeds een probleem?

    NARCIS (Netherlands)

    Beumer, R.R.


    Listeria monocytogenes is net als vele andere bacteriële voedselpathogenen al tientallen jaren bekend. De meeste grondstoffen voor voedingsmiddelen komen uit de akker- en tuinbouw, de veehouderij en de visserij. Besmetting vindt daar plaats met micro-organismen afkomstig uit grond, fecaliën, water,

  17. 78 FR 23901 - Interagency Risk Assessment-Listeria monocytogenes (United States)


    ... Food Safety and Inspection Service Interagency Risk Assessment--Listeria monocytogenes in Retail... risk assessment (QRA), ``Interagency Risk Assessment--Listeria monocytogenes in Retail Delicatessens... and on the FSIS Web site at ). II....

  18. Antibiotic therapy for Listeria monocytogenes bacteremia. (United States)

    Hung, C C; Chang, S C; Chen, Y C; Hsieh, W C; Luh, K T


    Listeria monocytogenes has been recognized as an important pathogen in immunocompromised patients, but it has been rarely reported in Taiwan. We reviewed 13 cases of L. monocytogenes bacteremia at National Taiwan University Hospital over a 12-year period. All of the patients had underlying diseases. Fever was the most common presenting symptom, and neurologic signs were found in 6 patients. Most of the patients received penicillin G, ampicillin or piperacillin with an aminoglycoside. Corticosteroids were used in 9 of 13 patients. The overall mortality directly due to L. monocytogenes bacteremia was 31%. However, patients treated with cephalosporins or oxacillin had higher mortality than those treated with penicillin G, ampicillin or piperacillin (p = 0.05). Given the increasing number of immunosuppressed patients in Taiwan, it is likely that more cases will be encountered. Physicians in Taiwan should be aware of L. monocytogenes bacteremia and its treatment.

  19. Listeria monocytogenes survival in refrigerator dill pickles. (United States)

    Kim, Jin Kyung; D'Sa, Elaine M; Harrison, Mark A; Harrison, Judy A; Andress, Elizabeth L


    Listeria monocytogenes can survive and grow in refrigerated foods with pH values of approximately 4.0 to 5.0 and salt concentrations of 3 to 4%. Home-fermented refrigerator dill pickles fit this description. Contamination of this product with L. monocytogenes could cause serious problems because these items are not heated prior to consumption. L. monocytogenes survival and growth patterns were investigated in refrigerator dill pickles at 1.3, 3.8, and 7.6% salt concentrations. Pickling cucumbers were dipped into an inoculum of L. monocytogenes, brine mixtures were added, and cucumbers were held at room temperature for 1 week and then refrigerated for up to 3 months. The pH, NaCl percentage, titratable acidity percentage, and total populations of Listeria and aerobic, psychrotrophic, and lactic acid bacteria were measured at the addition of brine, after 2, 4, and 7 days of storage at room temperature, and then weekly during refrigerated storage. The initial Listeria population was 5.4 to 5.6 log CFU/cm2 on cucumber surfaces and 3.9 to 4.6 log CFU/g internally. There was an approximate 0.3- to 1-log increase during room temperature fermentation followed by a population decline during refrigerator storage, with a greater decrease in the brines with the highest NaCl concentration. Up to 49 days, the internal tissue of pickles with 1.3, 3.8, or 7.6% salt concentrations were presumptively positive for L. monocytogenes by the enrichment method, and at 91 days the surfaces of such pickles were still positive for L. monocytogenes. Populations of total aerobes and lactic acid bacteria increased during room temperature storage and decreased gradually during refrigerated storage.

  20. Colovesical fistula presenting as Listeria monocytogenes bacteraemia. (United States)

    Hobbs, Mark


    We present a case of colovesical fistula presenting with a clinical syndrome of urosepsis subsequently demonstrated to be due to Listeria monocytogenes bacteraemia. The patient had a history of previous rectal cancer with a low anterior resection and a covering ileostomy that had been reversed 6 months prior to this presentation. L. monocytogenes was also isolated among mixed enteric organisms on urine culture. There were no symptoms or signs of acute gastrointestinal listeriosis or meningoencephalitis. This unusual scenario prompted concern regarding the possibility of communication between bowel and bladder, which was subsequently confirmed with CT and a contrast enema. The patient recovered well with intravenous amoxicillin and to date has declined surgical management of his colovesical fistula. This case illustrates the importance of considering bowel pathology when enteric organisms such as Listeria are isolated from unusual sites.

  1. Internalization of Listeria monocytogenes in Whole Avocado. (United States)

    Chen, Yi; Evans, Peter; Hammack, Thomas S; Brown, Eric W; Macarisin, Dumitru


    In recent years, tree fruits have emerged as a new concern for Listeria monocytogenes contamination. The objective of the current study was to evaluate the potential internalization of L. monocytogenes from the surface of avocados into the edible portions of the fruit during certain postharvest practices simulated in a laboratory setting. One set of intact avocados was spot inoculated with L. monocytogenes on the stem scar, and the second set was hydrocooled in water contaminated with L. monocytogenes. Under these experimental conditions, L. monocytogenes internalized into the avocado pulp through the stem or stem scar after both spot inoculation and hydrocooling. In avocados spot inoculated with 50, 130, 500, and 1,300 CFU per fruit, bacteria were detected in the edible portion adjacent to the stem scar within 15 days postinoculation during storage at 4°C. In avocados hydrocooled in water containing L. monocytogenes at 10(6) and 10(8) CFU/ml, bacteria reached the bottom end of the fruit, and the populations in the edible portion adjacent to the stem scar reached up to 5.90 to 7.19 log CFU/g within 10 to 15 days during storage at 4°C. Dye mixed with inoculum was useful for guiding subsequent sampling, but dye penetration patterns were not always consistent with bacterial penetration.


    Directory of Open Access Journals (Sweden)

    S. Colombo


    Full Text Available The EC Regulation 2073/2005 (1 requires that food processors evaluate the capability of ready-to-use (RTE products to support the development of Listeria monocytogenes when their pH and aW values are favourable to the growth of this microorganism. It is renown that the lactic flora plays an important role in many different foods, both from a technological and a food safety standpoint. This study was aimed to observe the behaviour and the potential anti-Listeria effect of some natural lactic flora present in Italian liver patè crostini (chicken heart and liver, anchovies, onions, capers, starch, no added preservatives through the Combase Predictor – Max Growth Rate predictive software. The natural lactic flora of the crostini demonstrated a variable capability to inhibit the growth of Listeria monocytogenes which depends upon : the concentration of the lactic flora at the beginning of the shelf life period and the subsequent lag phase, the possible release of anti-Listeria substances, and the maximum growth rate.

  3. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth. (United States)

    Dailey, Rachel C; Welch, Lacinda J; Hitchins, Anthony D; Smiley, R Derike


    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. Published by Elsevier Ltd.

  4. Effect of Listeria seeligeri or Listeria welshimeri on Listeria monocytogenes detection in and recovery from buffered Listeria enrichment broth☆ (United States)

    Dailey, Rachel C.; Welch, Lacinda J.; Hitchins, Anthony D.; Smiley, R. Derike


    The presence of multiple species of Listeria in regulated food products is not uncommon and can complicate the recovery of Listeria monocytogenes particularly on a non-differentiating medium. The potential complications of Listeria seeligeri and Listeria welshimeri on the recovery of L. monocytogenes from inoculated food test samples using the U.S. Food and Drug Administration's (FDA) selective enrichment procedure was investigated. Post-enrichment enumeration, in the absence of food product, indicates that some L. seeligeri and L. monocytogenes pairings may have population differentials as great as 2.7 ± 0.1 logs with L. seeligeri being the predominant species. A similar observation was noted for L. welshimeri and L. monocytogenes pairings which resulted in population differentials as large as 3.7 ± 0.2 logs with L. welshimeri being the predominant species. Select strain pairings were used to inoculate guacamole, crab meat, broccoli, and cheese with subsequent recovery by the FDA Bacteriological Analytical Manual (BAM) method with 10 colonies per sample selected for confirmation. The presence of L. seeligeri had little effect on the recovery of L. monocytogenes. The presence of L. welshimeri resulted in the failure to recover L. monocytogenes in three out of the four food matrices. This work extends the observation that non-pathogenic species of Listeria can complicate the recovery of L. monocytogenes and that competition during selective enrichment is not limited to the presence of just Listeria innocua. PMID:25475325


    The detection of the human foodborne pathogen, Listeria monocytogenes, in food, environmental samples and clinical specimens associated with cases of listeriosis, a rare but high mortality-rate disease, requires distinguishing the pathogen from other Listeria species. Speciation...


    The detection of the human foodborne pathogen, Listeria monocytogenes, in food, environmental samples and clinical specimens associated with cases of listeriosis, a rare but high mortality-rate disease, requires distinguishing the pathogen from other Listeria species. Speciation...

  7. Listeria monocytogenes infection in pregnancy and neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Francesca Pascale


    Full Text Available Authors report a fatal neonatal sepsis caused by Listeria monocytogenes. While the diagnostic procedure aimed to identify the microrganism is described, it is emphasized the importance to recover Streptococcus agalactiae (GBS and L. monocytogenes by means of vaginal-rectal swab culture. The intrapartum screening for L. monocytogenes, by Polymerase Chain Reaction (PCR providing results in 75 minutes is also evaluated.

  8. Recombinant phage probes for Listeria monocytogenes

    Energy Technology Data Exchange (ETDEWEB)

    Carnazza, S; Gioffre, G; Felici, F; Guglielmino, S [Department of Microbiological, Genetic and Molecular Sciences, University of Messina, Messina (Italy)


    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 10{sup 4} cells ml{sup -1}. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  9. Recombinant phage probes for Listeria monocytogenes (United States)

    Carnazza, S.; Gioffrè, G.; Felici, F.; Guglielmino, S.


    Monitoring of food and environmental samples for biological threats, such as Listeria monocytogenes, requires probes that specifically bind biological agents and ensure their immediate and efficient detection. There is a need for robust and inexpensive affinity probes as an alternative to antibodies. These probes may be recruited from random peptide libraries displayed on filamentous phage. In this study, we selected from two phage peptide libraries phage clones displaying peptides capable of specific and strong binding to the L. monocytogenes cell surface. The ability of isolated phage clones to interact specifically with L. monocytogenes was demonstrated using enzyme-linked immunosorbent assay (ELISA) and confirmed by co-precipitation assay. We also assessed the sensitivity of phage-bacteria binding by PCR on phage-captured Listeria cells, which could be detected at a concentration of 104 cells ml-1. In addition, as proof-of-concept, we tested the possibility of immobilizing the affinity-selected phages to a putative biosensor surface. The quality of phage deposition was monitored by ELISA and fluorescent microscopy. Phage-bacterial binding was confirmed by high power optical phase contrast microscopy. Overall, the results of this work validate the concept of affinity-selected recombinant filamentous phages as probes for detecting and monitoring bacterial agents under any conditions that warrant their recognition, including in food products.

  10. Prevalence of Listeria monocytogenes in Idiazabal cheese Prevalencia de Listeria monocytogenes en queso Idiazabal

    Directory of Open Access Journals (Sweden)

    E. Arrese


    Full Text Available Introduction: Raw-milk cheese has been identified in risk assessment as a food of greater concern to public health due to listeriosis. Objective: To determine the prevalence and levels of Listeria monocytogenes in semi-hard Idiazabal cheese manufactured by different producers in the Basque Country at consumer level. Methodology: A total of 51 Idiazabal cheese samples were obtained from 10 separate retail establishments, chosen by stratified random sampling. Samples were tested using the official standard ISO procedure 11290-1 for detection and enumeration methods. Results and conclusion: All cheese samples tested negative for L. monocytogenes. However, 9.8% tested positive for Listeria spp., different from L. monocytogenes. Positive samples came from two brands, two were natural and three were smoked. The presence of Listeria spss. suggests that the cheese making process and the hygiene whether at milking or during cheese making could be insufficient.Introducción: Listeria monocytogenes se ha asociado a quesos elaborados a partir de leche cruda, lo que supone un importante riesgo de salud pública debido a la listeriosis. Objetivo: Estudiar la prevalencia y los niveles de L. monocytogenes en quesos Idiazabal semi-curados de distintos productores del País Vasco, a nivel de consumidor. Metodología: Se analizaron 51 muestras de queso Idiazabal procedentes de 10 establecimientos de venta al público; el muestreo fue aleatorio y estratificado. Los análisis se hicieron según el método de detección y de enumeración del procedimiento estandarizado ISO 11290-1. Resultados y conclusión: Todas las muestras dieron negativo para L. monocytogenes. Sin embargo, el 9,8% dio positivo para Listeria spp., distinta de L. monocytogenes. Las muestras positivas procedían de dos marcas, dos eran quesos naturales y tres ahumados. La presencia de Listeria spss. sugiere que el procesado del queso y la higiene durante el ordeño o durante la fabricación podr

  11. Adenovirus-based vaccine against Listeria monocytogenes

    DEFF Research Database (Denmark)

    Jensen, Søren; Steffensen, Maria Abildgaard; Jensen, Benjamin Anderschou Holbech


    The use of replication-deficient adenoviruses as vehicles for transfer of foreign genes offers many advantages in a vaccine setting, eliciting strong cellular immune responses involving both CD8(+) and CD4(+) T cells. Further improving the immunogenicity, tethering of the inserted target Ag to MHC...... class II-associated invariant chain (Ii) greatly enhances both the presentation of most target Ags, as well as overall protection against viral infection, such as lymphocytic choriomeningitis virus (LCMV). The present study extends this vaccination concept to include protection against intracellular...... bacteria, using Listeria monocytogenes as a model organism. Protection in C57BL/6 mice against recombinant L. monocytogenes expressing an immunodominant epitope of the LCMV glycoprotein (GP33) was greatly accelerated, augmented, and prolonged following vaccination with an adenoviral vaccine encoding GP...



    Torres, Kirvis; Sierra, Sara; Potou, Raul; Carrascal, Ana; Mercado, Marcela


    Listeria monocytogenes además de ser un paradigma para la investigación inmunológica se ha convertido en sistema modelo apropiado para el análisis de los mecanismos moleculares del parasitismo intracelular de otras bacterias. Investigadores en el área de la inmunología se interesaron en este microorganismo cuando se reconoció el riesgo que representaba para la salud pública y la seguridad en la industria de alimentos. Desde mediados de los años 80’s se ha investigado la biología molecular de ...

  13. VIDAS Listeria monocytogenes II (LMO2). (United States)

    Johnson, Ronald; Mills, John


    This AOAC GovVal study compared the VIDAS Listeria monocytogenes II (LMO2) to the Health Products and Food Branch MFHPB-30 reference method for detection of L. monocytogenes in ready-to-eat (RTE) meats. The VIDAS LMO2 test is an automated enzyme-linked fluorescent immunoassay for the detection of L. monocytogenes in foods. The LMO2 test, following the enrichment procedure from the MFLP-33 method, also included use of the chromogenic media, chromID Ottaviani Agosti Agar (OAA) and chromID Lmono for confirmation of LMO2 presumptive results. In previous AOAC validation studies comparing the VIDAS LMO2 method to the U.S. Food and Drug Administration Bacteriological Analytical Manual and U.S. Department of Agriculture-Food Safety and Inspection Service reference methods, LMO2 was approved as AOAC Official Method 2004.02 for the detection of L. monocytogenes in dairy products, vegetables, seafood, raw meats and poultry, and processed meats and poultry. The GovVal comparative study included 20 replicate test portions, each at two contamination levels for each matrix, where fractionally positive results (5-15 positive results/20 replicate portions tested) were obtained by at least one method at one level. Five uncontaminated controls were included. Chi-square analysis of the comparative data in this study indicates no statistical differences between the VIDAS LMO2 and the MFHPB-30 standard methods at the 5% level of significance. Confirmation of presumptive LMO2 results with the chromogenic OAA and Lmono media was shown to be equivalent to the appropriate reference method agars. The data demonstrate that the VIDAS LMO2 method is an acceptable alternative method to the MFHPB-30 standard culture method for the detection of L. monocytogenes in RTE meats, including liver paté, hot dogs, raw fermented sausage, sliced deli turkey, and sliced deli ham.

  14. Relationship between Listeria monocytogenes and Listeria spp. in seafood processing plants. (United States)

    Alali, Walid Q; Schaffner, Donald W


    The objective of this study was to evaluate the relationship between prevalence of Listeria monocytogenes as an outcome and Listeria spp. as an explanatory variable by food products, food contact surfaces, and nonfood contact surfaces in seafood processing plants by using peer-reviewed published data. Nine sets of prevalence data of L. monocytogenes and Listeria spp. were collected from published studies and used for the analyses. Based on our analysis, the relationship between L. monocytogenes prevalence and Listeria spp. prevalence in food products (incoming raw materials and finish products) was significant (P = 0.04) with (low) R² = 0.36. Furthermore, Listeria spp. were not a good indicator for L. monocytogenes when testing food contact surfaces (R² = 0.10). Listeria spp. were a good indicator for L. monocytogenes only on nonfood contact surfaces (R² = 0.90). On the other hand, the presence of Listeria spp. on food contact surfaces (R² = 0.002) and nonfood contact surfaces (R² = 0.03) was not a good indicator for L. monocytogenes presence in food products. In general, prevalence of Listeria spp. does not seem to be a good indicator for L. monocytogenes prevalence in seafood processing plants.

  15. FDA Bacteriological Analytical Manual, Chapter 10, 2003: Listeria monocytogenes (United States)

    FDA Bacteriological Analytical Manual, Chapter 10 describes procedures for analysis of food samples and may be adapted for assessment of solid, particulate, aerosol, liquid and water samples containing Listeria monocytogenes.

  16. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik


    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  17. Prevalence and growth of Listeria monocytogenes in naturally contaminated seafood

    DEFF Research Database (Denmark)

    Jørgensen, Lasse Vigel; Huss, Hans Henrik


    Listeria monocytogenes contamination of seafood varies with product category. The highest prevalence was found in cold- smoked fish (34-60%), while the lowest was found in heat- treated and cured seafood (4-12%). The prevalence of L. monocytogenes differed greatly in cold-smoked salmon between...... production sites, ranging from monocytogenes. The organism showed moderate growth...... in naturally contaminated cold-smoked, and 'gravad', fish while the growth appeared faster in hot smoked fish. Thus L. monocytogenes is not under control in these products. Finally, the prevalence and growth of L. monocytogenes in naturally contaminated cold-smoked salmon are discussed in relation...

  18. Incidence and control of Listeria monocytogenes in foods in Denmark

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk; Schlundt, Jørgen


    The Danish regulatory policy on Listeria monocytogenes in foods is based on the principles of HACCP and was developed using a health risk assessment approach. The Danish policy focuses examinations and criteria for L. monocytogenes in ready-to-eat foods and is based on a combination of inspection...

  19. Resistance of Listeria monocytogenes biofilms to sanitizing agents (United States)

    Listeria monocytogenes is notorious for its capacity to colonize the environment and equipment of food processing facilities and to persist in the processing plant ecosystem, sometimes for decades. Such persistence is mediated by multiple attributes of L. monocytogenes, including the pathogen’s capa...

  20. Listeria monocytogenes growth limits and stress resistance mechanisms

    NARCIS (Netherlands)

    Veen, van der S.


    The food-borne pathogen Listeria monocytogenes is a Gram-positive facultative anaerobic rod, which is the causative agent of listeriosis. Due to the severity of the disease and the fact that its incidence is increasing in numerous European countries, L. monocytogenes is of great public health concer

  1. Genome sequences of Listeria monocytogenes strains with resistance to arsenic (United States)

    Listeria monocytogenes frequently exhibits resistance to arsenic. We report here the draft genome sequences of eight genetically diverse arsenic-resistant L. monocytogenes strains from human listeriosis and food-associated environments. Availability of these genomes would help to elucidate the role ...

  2. Listeria monocytogenes internalizes in Romaine Lettuce grown in greenhouse conditions (United States)

    Listeria monocytogenes has been implicated in a number of outbreaks involving fresh produce, including an outbreak in 2016 resulting from contaminated packaged salads. The persistence and internalization potential of L. monocytogenes in romaine lettuce was evaluated, and the persistence of two L. mo...

  3. Survival strategies of Listeria monocytogenes - roles of regulators and transporters

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.


    Outbreaks of the food-borne pathogen Listeria monocytogenes are mainly associated with ready-to-eatfoods. Survival strategies of L. monocytogenes in relation to minimally processed foods were studied.

  4. Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

    DEFF Research Database (Denmark)

    Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.;


    Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L...... unchanged. On sausage slices, the number of colony forming units also increased rapidly for both strains in response to CO2 downshift. Large variations in rRNA content of individual cells were observed in the tested scenarios. The results demonstrate the risk of underestimating the number of infectious...

  5. Changes in growth, rRNA content, and cell morphology of Listeria monocytogenes induced by CO2 up- and downshift

    DEFF Research Database (Denmark)

    Jydegaard-Axelsen, A.M.; Aaes-Jorgensen, A.; Koch, A.G.


    Cell morphology, rRNA content, and growth were examined for Listeria monocytogenes LO28 and EGD, respectively, grown in brain-heart infusion (BHI) and on slices of sausage at 10degreesC in 100% CO2, 100% N-2, and air. In CO2, filamentous cells were formed by both strains on sausage slices and by L...... unchanged. On sausage slices, the number of colony forming units also increased rapidly for both strains in response to CO2 downshift. Large variations in rRNA content of individual cells were observed in the tested scenarios. The results demonstrate the risk of underestimating the number of infectious...


    Directory of Open Access Journals (Sweden)

    R. Mioni


    Full Text Available Challenge tests are the preferable methodology to study the behaviour of Listeria monocytogenes on ready to eat foods, according to Regulation (EC 2073/2005. Challenge testing using L. monocytogenes in seasoned salami from different food business operators showed, after seasoning of the product, a count reduction of the inoculated organisms without any further growth of the pathogen; however differences of L. monocytogenes behaviour could be observed according to different production protocols.

  7. Silver as antibacterial towards Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Simone eBelluco


    Full Text Available Listeria monocytogenes is a serious foodborne pathogen that can contaminate food during processing and can grow during food shelf-life. New types of safe and effective food contact materials embedding antimicrobial agents, like silver, can play an important role in the food industry. The present work aimed at evaluating the in vitro growth kinetics of different strains of L. monocytogenes in the presence of silver, both in its ionic and nano form. The antimicrobial effect was determined by assaying the number of culturable bacterial cells, which formed colonies after incubation in the presence of silver nanoparticles (AgNPs or silver nitrate (AgNO3. Ionic release experiments were performed in parallel. A different reduction of bacterial viability between silver ionic and nano forms was observed, with a time delayed effect exerted by AgNPs. An association between antimicrobial activity and ions concentration was shown by both silver chemical forms, suggesting the major role of ions in the antimicrobial mode of action.

  8. Isolation and Identification of Listeria monocytogenes from Retail

    Directory of Open Access Journals (Sweden)

    A.D.I. Alsheikh


    Full Text Available Listeria species are widely distributed in environment and L. monocytogenes are the causal agent of Listeriosis, the disease that can be serious and fatal to human and animals. The objectives of this study were to detect, isolate and identify Listeria monocytogenes from retail broiler chicken ready to eat meat products in restaurants-Khartoum state, Sudan. A total of 250 retail broiler chicken ready to eat meat products were collected from restaurants in Khartoum State, 50 sample from frozen chicken burger, 50 sample from frozen chicken sausages, 50 sample from frozen chicken meat balls (kofta, 50 sample from chicken shawerma and 50 sample from chicken mortedella, Listeria spp. were isolated by the conventional International Organization for Standardization method and L. monocytogenes identified by biochemical test. The results showed that out of total 250 samples, 95 (38% were found to be contaminated with Listeria spp. the isolation rate was as follows: L. monocytogenes (13.6%, L. ivanovi (20.8%, L. grayi (1.6%, L. seeligeri (0.8% and L. welshimeri (1.2%. The results presented in this study indicate the contamination of retail broiler chicken ready to eat meat products with L. monocytogenes. This study reported the occurrence and distribution of L. monocytogenes and other Listeria species in retail meat products (frozen chicken burger, frozen chicken sausages, frozen chicken meat balls (kofta, chicken shawerma and chicken mortedella, purchased from restaurants in Khartoum state Sudan.

  9. Assessment of Listeria sp. Interference Using a Molecular Assay To Detect Listeria monocytogenes in Food. (United States)

    Zittermann, Sandra I; Stanghini, Brenda; See, Ryan Soo; Melano, Roberto G; Boleszczuk, Peter; Murphy, Allana; Maki, Anne; Mallo, Gustavo V


    Detection of Listeria monocytogenes in food is currently based on enrichment methods. When L. monocytogenes is present with other Listeria species in food, the species compete during the enrichment process. Overgrowth competition of the nonpathogenic Listeria species might result in false-negative results obtained with the current reference methods. This potential issue was noted when 50 food samples artificially spiked with L. monocytogenes were tested with a real-time PCR assay and Canada's current reference method, MFHPB-30. Eleven of the samples studied were from foods naturally contaminated with Listeria species other than those used for spiking. The real-time PCR assay detected L. monocytogenes in all 11 of these samples; however, only 6 of these samples were positive by the MFHPB-30 method. To determine whether L. monocytogenes detection can be affected by other species of the same genus due to competition, an L. monocytogenes strain and a Listeria innocua strain with a faster rate of growth in the enrichment broth were artificially coinoculated at different ratios into ground pork meat samples and cultured according to the MFHPB-30 method. L. monocytogenes was detected only by the MFHPB-30 method when L. monocytogenes/L. innocua ratios were 6.0 or higher. In contrast, using the same enrichments, the real-time PCR assay detected L. monocytogenes at ratios as low as 0.6. Taken together, these findings support the hypothesis that L. monocytogenes can be outcompeted by L. innocua during the MFHPB-30 enrichment phase. However, more reliable detection of L. monocytogenes in this situation can be achieved by a PCR-based method mainly because of its sensitivity.

  10. Determination of Listeria monocytogenes Growth during Mushroom Production and Distribution

    Directory of Open Access Journals (Sweden)

    Dara Leong


    Full Text Available In the EU, food is considered safe with regard to Listeria monocytogenes if its numbers do not exceed 100 CFU/g throughout the shelf-life of the food. Therefore, it is important to determine if a food supports growth of L. monocytogenes. Challenge studies to determine the ability of a food to support growth of L. monocytogenes are essential as predictive modelling often overestimates the growth ability of L. monocytogenes. The aim of this study was to determine if growth of L. monocytogenes was supported during the production and distribution of mushrooms. A three-strain mixture of L. monocytogenes was inoculated onto three independent batches of whole mushrooms, sliced mushrooms, mushroom casing and mushroom substrate at a concentration of about 100–1000 CFU/g. The batches were incubated at potential abuse temperatures, as a worst case scenario, and at intervals during storage L. monocytogenes numbers, % moisture and pH were determined. The results showed that the sliced and whole mushrooms had the ability to support growth, while mushroom casing allowed survival but did not support growth. Mushroom substrate showed a rich background microflora that grew on Listeria selective media and this hindered enumeration of L. monocytogenes. In the case of this study, Combase predictions were not always accurate, indicating that challenge studies may be a necessary part of growth determination of L. monocytogenes.

  11. Listeria monocytogenes in renal transplant recipients Listeria monocytogenes em pacientes pós-transplante renal

    Directory of Open Access Journals (Sweden)

    Cristina Barroso HOFER


    Full Text Available Five cases of Listeria monocytogenes bacteriemia were observed from April to December 1985, among renal transplant recipients from the same hospital in São Paulo, Brazil. The patients were adults (mean age: 40.6 years, and the basic complain was fever, with no report of meningeal syndrome. Laboratory tests revealed the presence of two serovars, 1/2a and 4b, which were classified into three lysotypes. The four strains of serovar 4b showed the same antibiotype, with resistance to cefoxitin, clindamycin, oxacillin and penicillin.No período de abril a dezembro de 1985, foram observados cinco casos de listeriose em transplantados renais num mesmo hospital de São Paulo, SP. Os pacientes eram adultos (média de 40,6 anos tendo como queixa básica a febre. Laboratorialmente, em todos foram reconhecidos Listeria monocytogenes, caracterizada por dois sorovares 1/2a e 4b e três lisotipos distintos. As amostras do sorovar 4b apresentaram o mesmo antibiotipo: resistentes à cefoxitina, clindamicina, oxacilina e penicilina.

  12. Longitudinal monitoring of Listeria monocytogenes and Listeria phages in seafood processing environments in Thailand. (United States)

    Vongkamjan, Kitiya; Benjakul, Soottawat; Kim Vu, Hue Thi; Vuddhakul, Varaporn


    Listeria monocytogenes is a foodborne pathogen commonly found in environments of seafood processing, thus presenting a challenge for eradication from seafood processing facilities. Monitoring the prevalence and subtype diversity of L. monocytogenes together with phages that are specific to Listeria spp. ("Listeria phages") will provide knowledge on the bacteria-phage ecology in food processing plants. In this work, a total of 595 samples were collected from raw material, finished seafood products and environmental samples from different sites of a seafood processing plant during 17 sampling visits in 1.5 years of study. L. monocytogenes and Listeria spp. (non-monocytogenes) were found in 22 (3.7%) and 43 (7.2%) samples, respectively, whereas 29 Listeria phages were isolated from 9 (1.5%) phage-positive samples. DNA fingerprint analysis of L. monocytogenes isolates revealed 11 Random Amplified Polymorphic DNA (RAPD) profiles, with two subtypes were frequently observed over time. Our data reveal a presence of Listeria phages within the same seafood processing environments where a diverse set of L. monocytogenes subtypes was also found. Although serotype 4b was observed at lower frequency, data indicate that isolates from this seafood processing plant belonged to both epidemiologically important serotypes 1/2a and 4b, which may suggest a potential public health risk. Phages (all showed a unique genome size of 65 ± 2 kb) were classified into 9 host range groups, representing both broad- and narrow-host range. While most L. monocytogenes isolates from this facility were susceptible to phages, five isolates showed resistance to 12-20 phages. Variations in phage host range among Listeria phages isolated from food processing plant may affect a presence of a diverse set of L. monocytogenes isolates derived from the same processing environment in Thailand. Copyright © 2017 Elsevier Ltd. All rights reserved.

  13. Phage display-derived binders able to distinguish Listeria monocytogenes from other Listeria species.

    Directory of Open Access Journals (Sweden)

    Josephine Morton

    Full Text Available The objective of this study was to produce phage display-derived binders with the ability to distinguish Listeria monocytogenes from other Listeria spp., which may have potential utility to enhance detection of Listeria monocytogenes. To obtain binders with the desired binding specificity a series of surface and solution phage-display biopannings were performed. Initially, three rounds of surface biopanning against gamma-irradiated L. monocytogenes serovar 4b cells were performed followed by an additional surface biopanning round against L. monocytogenes 4b which included prior subtraction biopanning against gamma-irradiated L. innocua cells. In an attempt to further enhance binder specificity for L. monocytogenes 4b two rounds of solution biopanning were performed, both rounds included initial subtraction solution biopanning against L. innocua. Subsequent evaluations were performed on the phage clones by phage binding ELISA. All phage clones tested from the second round of solution biopanning had higher specificity for L. monocytogenes 4b than for L. innocua and three other foodborne pathogens (Salmonella spp., Escherichia coli and Campylobacter jejuni. Further evaluation with five other Listeria spp. revealed that one phage clone in particular, expressing peptide GRIADLPPLKPN, was highly specific for L. monocytogenes with at least 43-fold more binding capability to L. monocytogenes 4b than to any other Listeria sp. This proof-of-principle study demonstrates how a combination of surface, solution and subtractive biopanning was used to maximise binder specificity. L. monocytogenes-specific binders were obtained which could have potential application in novel detection tests for L. monocytogenes, benefiting both the food and medical industries.

  14. Phage display-derived binders able to distinguish Listeria monocytogenes from other Listeria species. (United States)

    Morton, Josephine; Karoonuthaisiri, Nitsara; Charlermroj, Ratthaphol; Stewart, Linda D; Elliott, Christopher T; Grant, Irene R


    The objective of this study was to produce phage display-derived binders with the ability to distinguish Listeria monocytogenes from other Listeria spp., which may have potential utility to enhance detection of Listeria monocytogenes. To obtain binders with the desired binding specificity a series of surface and solution phage-display biopannings were performed. Initially, three rounds of surface biopanning against gamma-irradiated L. monocytogenes serovar 4b cells were performed followed by an additional surface biopanning round against L. monocytogenes 4b which included prior subtraction biopanning against gamma-irradiated L. innocua cells. In an attempt to further enhance binder specificity for L. monocytogenes 4b two rounds of solution biopanning were performed, both rounds included initial subtraction solution biopanning against L. innocua. Subsequent evaluations were performed on the phage clones by phage binding ELISA. All phage clones tested from the second round of solution biopanning had higher specificity for L. monocytogenes 4b than for L. innocua and three other foodborne pathogens (Salmonella spp., Escherichia coli and Campylobacter jejuni). Further evaluation with five other Listeria spp. revealed that one phage clone in particular, expressing peptide GRIADLPPLKPN, was highly specific for L. monocytogenes with at least 43-fold more binding capability to L. monocytogenes 4b than to any other Listeria sp. This proof-of-principle study demonstrates how a combination of surface, solution and subtractive biopanning was used to maximise binder specificity. L. monocytogenes-specific binders were obtained which could have potential application in novel detection tests for L. monocytogenes, benefiting both the food and medical industries.

  15. Peptide nucleic acid fluorescence in situ hybridization for identification of Listeria genus, Listeria monocytogenes and Listeria ivanovii. (United States)

    Zhang, Xiaofeng; Wu, Shan; Li, Ke; Shuai, Jiangbing; Dong, Qiang; Fang, Weihuan


    A fluorescent in situ hybridization (FISH) method in conjunction with fluorescin-labeled peptide nucleic acid (PNA) probes (PNA-FISH) for detection of Listeria species was developed. In silico analysis showed that three PNA probes Lis-16S-1, Lm-16S-2 and Liv-16S-5 were suitable for specific identification of Listeria genus, Listeria monocytogenes and Listeria ivanovii, respectively. These probes were experimentally verified by their reactivity against 19 strains of six Listeria species (excluding newly described species Listeria marthii and Listeria rocourtiae) and eight other bacterial species. The PNA-FISH method was optimized as 30 min of hybridization with 0.2% Triton X-100 in the solution and used to identify 85 Listeria strains from individual putative Listeria colonies on PALCAM agar plates streaked from selectively enriched cultures of 780 food or food-related samples. Of the 85 Listeria strains, thirty-seven were identified as L. monocytogenes with the probe Lm-16S-2 and two as L. ivanovii with the probe Liv-16S-5 which was in agreement with the results obtained by the API LISTERIA method. Thus, the PNA-FISH protocol has the potential for identification of pathogenic Listeria spp. from food or food-related samples.

  16. Growth inhibition of Listeria monocytogenes by a nonbacteriocinogenic Carnobacterium piscicola

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Bech Hansen, T.; Garrido, P.


    Aims: This study elucidates the mechanisms by which a nonbacteriocinogenic Carnobacterium piscicola inhibits growth of Listeria monocytogenes. Methods and Results: Listeria monocytogenes was exposed to live cultures of a bacteriocin-negative variant of C. piscicola A9b in co-culture, in a diffusion...... chamber system, and to a cell-free supernatant. Suppression of maximum cell density (0-3.5 log units) of L. monocytogenes was proportional to initial levels of C. pisciola (10(3)-10(7) CFU ml(-1)). Cell-to-cell contact was not required to cause inhibition. The cell-free C. piscicola supernatant caused...... a decrease in L. monocytogenes maximum cell density, which was abolished by glucose addition but not by amino acid, vitamin or mineral addition. The fermentate also gave rise to a longer lag phase and a reduction in growth rate. These effects were independent of glucose and may have been caused by acetate...

  17. Caratterizzazione biomolecolare di listeria monocytogenes in suini regolarmente macellati


    Santoro, Cristina


    Listeria monocytogenes è un batterio patogeno responsabile di una malattia potenzialmente molto grave per l’uomo. L’infezione avviene soprattutto tramite l’ingestione di alimenti di origine animale contaminati, e può propagarsi per via transplacentare al feto. Il potenziale patogeno di L. monocytogenes è dovuto soprattutto a caratteristici fattori di virulenza con i quali alcuni ceppi sono in grado di attaccare la cellula dell’organismo ospite potendo aderire, invadere, moltiplicare e prop...

  18. Performance of stress resistant variants of Listeria monocytogenes in mixed species biofilms with Lactobacillus plantarum. (United States)

    Metselaar, Karin I; Saá Ibusquiza, Paula; Ortiz Camargo, Angela R; Krieg, Myriam; Zwietering, Marcel H; den Besten, Heidy M W; Abee, Tjakko


    Population diversity and the ability to adapt to changing environments allow Listeria monocytogenes to grow and survive under a wide range of environmental conditions. In this study, we aimed to evaluate the performance of a set of acid resistant L. monocytogenes variants in mixed-species biofilms with Lactobacillus plantarum as well as their benzalkonium chloride (BAC) resistance in these biofilms. L. monocytogenes LO28 wild type and acid resistant variants were capable of forming mixed biofilms with L. plantarum at 20°C and 30°C in BHI supplemented with manganese and glucose. Homolactic fermentation of glucose by L. plantarum created an acidic environment with pH values below the growth boundary of L. monocytogenes. Some of the variants were able to withstand the low pH in the mixed biofilms for a longer time than the WT and there were clear differences in survival between the variants which could not be correlated to (lactic) acid resistance alone. Adaptation to mild pH of liquid cultures during growth to stationary phase increased the acid resistance of some variants to a greater extent than of others, indicating differences in adaptive behaviour between the variants. Two variants that showed a high level of acid adaptation when grown in liquid cultures, showed also better performance in mixed species biofilms. There were no clear differences in BAC resistance between the wild type and variants in mixed biofilms. It can be concluded that acid resistant variants of L. monocytogenes show diversity in their adaptation to acidic conditions and their capacity to survive in mixed cultures and biofilms with L. plantarum.

  19. Inhibition of Listeria monocytogenes by Enterococcus mundtii isolated from soil. (United States)

    Bigwood, T; Hudson, J A; Cooney, J; McIntyre, L; Billington, C; Heinemann, J A; Wall, F


    Two bacterial isolates with inhibitory activity against Listeria monocytogenes and Enterococcus faecalis were obtained from soil. Genotypic and phenotypic characterization identified them as Enterococcus mundtii, a species whose ability to compete with L. monocytogenes is relatively unexplored compared to other members of the genus. The thermal stability of the inhibitory factor and its sensitivity to proteolytic enzymes indicate that it is most likely a bacteriocin. Both isolates grew at comparable rates to L. monocytogenes at 5 °C and 10 °C in vitro. One isolate killed L. monocytogenes when it reached concentrations of 10(6)-10(8) CFU ml(-1). Minimum inocula of 10(6) and 10(5) CFU ml(-1) of E. mundtii were required to reduce and maintain L. monocytogenes concentrations beneath the level of detection at 5 °C and 10 °C, respectively. In situ experiments at 5 °C showed that E. mundtii inhibited the growth of L. monocytogenes on vacuum-packed cold smoked salmon during its four week shelf life. E. mundtii could, therefore, control the growth of L. monocytogenes at low temperatures, indicating a potential application in controlling this pathogen in chilled foods. To control growth of Listeria, the concentration of E. mundtii needs to be high, but it is possible that a purified bacteriocin could be used to achieve the same effect.

  20. Antimicrobial resistance of Listeria monocytogenes and Listeria innocua from meat products and meat-processing environment. (United States)

    Gómez, Diego; Azón, Ester; Marco, Noelia; Carramiñana, Juan J; Rota, Carmina; Ariño, Agustín; Yangüela, Javier


    A total of 336 Listeria isolates from ready-to-eat (RTE) meat products and meat-processing environments, consisting of 206 Listeria monocytogenes, and 130 Listeria innocua isolates, were characterized by disc diffusion assay and minimum inhibitory concentration (MIC) values for antimicrobial susceptibility against twenty antimicrobials. Resistance to one or two antimicrobials was observed in 71 L. monocytogenes isolates (34.5%), and 56 L. innocua isolates (43.1%). Multidrug resistance was identified in 24 Listeria isolates, 18 belonging to L. innocua (13.9%) and 6 to L. monocytogenes (2.9%). Oxacillin resistance was the most common resistance phenotype and was identified in 100% Listeria isolates. A medium prevalence of resistance to clindamycin (39.3% isolates) and low incidence of resistance to tetracycline (3.9% isolates) were also detected. Listeria isolates from RTE meat products displayed higher overall antimicrobial resistance (31.3%) than those from the environment (13.4%). All the strains assayed were sensitive to the preferred antibiotics used to treat listeriosis. Results showed that although antimicrobial resistance in L. monocytogenes still occurs at a low prevalence, L. innocua can form a reservoir of resistance genes which may transfer between bacterial species, including transference to organisms capable of causing disease in humans.

  1. Influence of temperature on alkali stress adaptation in Listeria monocytogenes (United States)

    Listeria monocytogenes cells may induce alkali stress adaptation when exposed to sublethal concentrations of alkaline cleaners and sanitizers that may be frequently used in the food processing environment. In the present study, the effect of temperature on the induction and the stability of such alk...

  2. Growth of Listeria monocytogenes in Salmon Roe - a kinetic analysis (United States)

    The objective of this study was to investigate the growth kinetics of Listeria monocytogenes in unsalted and salted (3%) salmon roe. Growth curves, developed using inoculated samples incubated at constant temperatures between 5 and 30 degrees C, were analyzed by curve-fitting to the Huang and Baran...


    Directory of Open Access Journals (Sweden)

    A. Bragagnolo


    Full Text Available In recent years in the countries of the European Union have occurred profound and radical changes regarding the safety and hygiene of foodstuffs. The aim of this work is to highlight the significant changes made by the recent legislation in the control of Listeria monocytogenes.

  4. Studies on the risk assessment of Listeria monocytogenes

    NARCIS (Netherlands)

    Notermans, S.; Dufrenne, J.; Teunis, P.; Chackraborty, T.


    Humans are frequently exposed to Listeria monocytogenes, and high numbers may be ingested during consumption of certain types of food. However, epidemiological investigations show that listeriosis is a rare disease. Risk assessment studies using an animal mouse model indicate that almost all L. mono

  5. Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.; Abee, T.


    Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat

  6. Neonatal infection with Listeria monocytogenes: Rare, but serious

    NARCIS (Netherlands)

    Van Stuijvenberg, M.; Spanjaard, L.; Bergman, K.A.


    Between 1993 and 2003, three infants, two girls and a boy, were found to have an invasive infection with Listeria monocytogenes. They received intensive care including respiratory and circulatory support, antibiotics, and treatment of the neurological complications when possible. One of the girls

  7. Presence of Listeria monocytogenes in silage products of Shahrekord city

    Directory of Open Access Journals (Sweden)

    Ali Sharifzadeh


    Full Text Available Objective: To investigate the presence of Listeria monocytogenes in the silage samples. Methods: Silage samples obtained from 150 different farms in Shahrekord city (Iran and after DNA extraction, all samples were analyzed by PCR technique using one pair of primers for presence of this pathogen. The amplified products were detected on 1.5% agarose gel electrophoresis. Results: Listeria monocytogenes was isolated in 4 (2% of the 150 samples. The detection of this bacterium from silage samples in Shahrekord city indicated that these products could create a serious risk in public health of animal and human. The findings showed that in positive silage samples for Listeria monocytogenes, the pH value was about five and it was due to bacterial activity in these products. Conclusions: The quality of silage and hygiene parameters and good herd health management play an important role in the microbiological quality of herd and farm. Considering the high specificity and sensitivity of the employed PCR technique, it is recommended to be useful technique for identification of Listeria monocytogenes.

  8. Quantifying strain variability in modeling growth of Listeria monocytogenes

    NARCIS (Netherlands)

    Aryani, D.; Besten, den H.M.W.; Hazeleger, W.C.; Zwietering, M.H.


    Prediction of microbial growth kinetics can differ from the actual behavior of the target microorganisms. In the present study, the impact of strain variability on maximum specific growth rate (µmax) (h- 1) was quantified using twenty Listeria monocytogenes strains. The µmax was determined as functi

  9. Genome sequesnce of lineage III Listeria monocytogenes strain HCC23 (United States)

    More than 98% of reported human listeriosis cases are caused by Listeria monocytogenes serotypes within lineages I and II. Serotypes within lineage III (4a and 4c) are commonly isolated from environmental and food specimens. We report the first complete genome sequence of a lineage III isolate, HCC2...

  10. Overlevingsstrategieën Listeria monocytogenes bij lage temperatuur

    NARCIS (Netherlands)

    Wemekamp-Kamphuis, H.H.; Abee, T.


    Listeria monocytogenes is an important food-borne pathogen that may cause severe infections in humans. Many outbreaks caused by this organism have been associated with ready-to-eat foods wich may have undergone some form of minimal processing, or have been contaminated after processing. Ready-to-eat

  11. Influence of temperature on alkali stress adaptation in Listeria monocytogenes (United States)

    Listeria monocytogenes cells may induce alkali stress adaptation when exposed to sublethal concentrations of alkaline cleaners and sanitizers that may be frequently used in the food processing environment. In the present study, the effect of temperature on the induction and the stability of such alk...

  12. Studies on the risk assessment of Listeria monocytogenes

    NARCIS (Netherlands)

    Notermans, S.; Dufrenne, J.; Teunis, P.; Chackraborty, T.


    Humans are frequently exposed to Listeria monocytogenes, and high numbers may be ingested during consumption of certain types of food. However, epidemiological investigations show that listeriosis is a rare disease. Risk assessment studies using an animal mouse model indicate that almost all L.

  13. Recombinant Probiotic Expressing Listeria Adhesion Protein Attenuates Listeria monocytogenes Virulence In Vitro (United States)

    Koo, Ok Kyung; Amalaradjou, Mary Anne Roshni; Bhunia, Arun K.


    Background Listeria monocytogenes, an intracellular foodborne pathogen, infects immunocompromised hosts. The primary route of transmission is through contaminated food. In the gastrointestinal tract, it traverses the epithelial barrier through intracellular or paracellular routes. Strategies to prevent L. monocytogenes entry can potentially minimize infection in high-risk populations. Listeria adhesion protein (LAP) aids L. monocytogenes in crossing epithelial barriers via the paracellular route. The use of recombinant probiotic bacteria expressing LAP would aid targeted clearance of Listeria from the gut and protect high-risk populations from infection. Methodology/Principal Findings The objective was to investigate the ability of probiotic bacteria or LAP-expressing recombinant probiotic Lactobacillus paracasei (LbpLAP) to prevent L. monocytogenes adhesion, invasion, and transwell-based transepithelial translocation in a Caco-2 cell culture model. Several wild type probiotic bacteria showed strong adhesion to Caco-2 cells but none effectively prevented L. monocytogenes infection. Pre-exposure to LbpLAP for 1, 4, 15, or 24 h significantly (Pmonocytogenes in Caco-2 cells, whereas pre-exposure to parental Lb. paracasei had no significant effect. Similarly, LbpLAP pre-exposure reduced L. monocytogenes translocation by as much as 46% after 24 h. LbpLAP also prevented L. monocytogenes-mediated cell damage and compromise of tight junction integrity. Furthermore, LbpLAP cells reduced L. monocytogenes-mediated cell cytotoxicity by 99.8% after 1 h and 79% after 24 h. Conclusions/Significance Wild type probiotic bacteria were unable to prevent L. monocytogenes infection in vitro. In contrast, LbpLAP blocked adhesion, invasion, and translocation of L. monocytogenes by interacting with host cell receptor Hsp60, thereby protecting cells from infection. These data show promise for the use of recombinant probiotics in preventing L. monocytogenes infection in high

  14. Listeria spp., y L. monocytogenes EN LECHE CRUDA DE CABRA

    Directory of Open Access Journals (Sweden)

    Yolanda Albarracín C


    Full Text Available Objective. To test non-pasteurized goat’s milk from the village of ‘la Garita’, Northern Santander, for Listeria monocytogenes. Material and methods. 90 samples of non-pasteurized goat’s milk were obtained over a 4 month period; pH and temperature of each sample were measured. The INVIMA technique was used to isolate L. monocytogenes; the species was confirmed by PCR. Results. The study showed that eight goat milk providers of the zone neither had refrigeration nor pasteurized the milk. The prevalence of L. monocytogenes was 3%; 15% of the samples had other species of Listeria. The milk obtained from this zone contained the pathogen that may cause listeriosis in children less than 5 years of age, pregnant women, adults and immunologically compromised patients. Conclusions. This study shows the occurrence of this pathogen in goat’s milk and identified areas of risk for those people who drink goat’s milk.

  15. Role of Extracellular DNA during Biofilm Formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Harmsen, Morten; Lappann, Martin; Knøchel, S


    Listeria monocytogenes is a food-borne pathogen that is capable of living in harsh environments. It is believed to do this by forming biofilms, which are surface-associated multicellular structures encased in a self-produced matrix. In this paper we show that in L. monocytogenes extracellular DNA...... (eDNA) may be the only central component of the biofilm matrix and that it is necessary for both initial attachment and early biofilm formation for 41 L. monocytogenes strains that were tested. DNase I treatment resulted in dispersal of biofilms, not only in microtiter tray assays but also in flow...... cell biofilm assays. However, it was also demonstrated that in a culture without eDNA, neither Listeria genomic DNA nor salmon sperm DNA by itself could restore the capacity to adhere. A search for additional necessary components revealed that peptidoglycan (PG), specifically N-acetylglucosamine (NAG...

  16. Case of Contamination by Listeria Monocytogenes in Mozzarella Cheese (United States)

    Tolli, Rita; Bossù, Teresa; Rodas, Eda Maria Flores; Di Giamberardino, Fabiola; Di Sirio, Alessandro; Vita, Silvia; De Angelis, Veronica; Bilei, Stefano; Sonnessa, Michele; Gattuso, Antonietta; Lanni, Luigi


    Following a Listeria monocytogenes detection in a mozzarella cheese sampled at a dairy plant in Lazio Region, further investigations have been conducted both by the competent Authority and the food business operatordairy factory (as a part of dairy factory HACCP control). In total, 90 dairy products, 7 brine and 64 environmental samples have been tested. The prevalence of Listeria monocytogenes was 24.4% in mozzarella cheese, and 9.4% in environmental samples, while brines were all negatives. Forty-seven strains of L. monocytogenes have been isolated, all belonging to 4b/4e serotype. In 12 of these, the macrorestriction profile has been determined by means of pulsed field gel electrophoresis. The profiles obtained with AscI enzyme showed a 100% similarity while those obtained with ApaI a 96.78% similarity. These characteristics of the isolated strains jointly with the production process of mozzarella cheese has allowed to hypothesise an environmental contamination. PMID:27800317

  17. Rhombencephalitis caused by Listeria monocytogenes in a pastured bull. (United States)

    Matto, Carolina; Varela, Gustavo; Mota, María Inés; Gianneechini, Ruben; Rivero, Rodolfo


    A pastured 2-y-old cross-breed bull developed brainstem encephalitis (rhombencephalitis); Listeria monocytogenes was isolated from the brain. In the brainstem, there was perivascular cuffing, multiple microabscesses, and positive immunostaining for L. monocytogenes. Samples of bovine feces, water, feedstuffs, milking parlor soil, and bulk tank milk were collected from the dairy farm. Seven isolates of the genus Listeria were obtained, 6 of L. innocua and 1 of L. monocytogenes, which was found in the pasture where the bull grazed. Both isolates belonged to serotype 4b and were positive for internalins A, C, and J. According to the DNA fragment patterns of pulsed-field gel electrophoresis, the isolates were closely related. The source of infection was the pasture, implying that listeriosis should not be discounted in cases with compatible clinical signs but the absence of silage feeding.

  18. A five-gene stress survival islet (SSI-1) that contributes to the growth of Listeria monocytogenes in suboptimal conditions. (United States)

    Ryan, S; Begley, M; Hill, C; Gahan, C G M


    The aim of this study was to examine the contribution of a five-gene islet (lmo0444 - lmo0448) to the growth of Listeria monocytogenes under suboptimal conditions. Bioinformatics and PCR analyses revealed that a five-gene islet is present in c. half of all L. monocytogenes strains examined (66 in total). A deletion mutant that lacks the entire c. 8·7-kb islet was created in L. monocytogenes strain LO28. This mutant was impaired in growth at low pH and at high salt concentrations and demonstrated a decreased ability to survive and grow in a model food system (frankfurters). Transcriptional analysis revealed that the islet is self-regulated in that the product of lmo0445 regulates the expression of the other four genes. A role of the alternative stress sigma factor SigB in regulating the islet was also uncovered. The five-gene islet (herein designated as SSI-1; stress survival islet 1) contributes to the growth of L. monocytogenes under suboptimal conditions. SSI-1 may contribute to the survival of certain strains of L. monocytogenes in food environments. © 2010 The Authors. Journal compilation © 2010 The Society for Applied Microbiology.

  19. Analytical bioconjugates, aptamers, enable specific quantitative detection of Listeria monocytogenes. (United States)

    Lee, Sang-Hee; Ahn, Ji-Young; Lee, Kyeong-Ah; Um, Hyun-Ju; Sekhon, Simranjeet Singh; Sun Park, Tae; Min, Jiho; Kim, Yang-Hoon


    As a major human pathogen in the Listeria genus, Listeria monocytogenes causes the bacterial disease listeriosis, which is a serious infection caused by eating food contaminated with the bacteria. We have developed an aptamer-based sandwich assay (ABSA) platform that demonstrates a promising potential for use in pathogen detection using aptamers as analytical bioconjugates. The whole-bacteria SELEX (WB-SELEX) strategy was adopted to generate aptamers with high affinity and specificity against live L. monocytogenes. Of the 35 aptamer candidates tested, LMCA2 and LMCA26 reacted to L. monocytogenes with high binding, and were consequently chosen as sensing probes. The ABSA platform can significantly enhance the sensitivity by employing a very specific aptamer pair for the sandwich complex. The ABSA platform exhibited a linear response over a wide concentration range of L. monocytogenes from 20 to 2×10(6) CFU per mL and was closely correlated with the following relationship: y=9533.3x+1542.3 (R(2)=0.99). Our proposed ABSA platform also provided excellent specificity for the tests to distinguish L. monocytogenes from other Listeria species and other bacterial genera (3 Listeria spp., 4 Salmonella spp., 2 Vibrio spp., 3 Escherichia coli and 3 Shigella spp.). Improvements in the sensitivity and specificity have not only facilitated the reliable detection of L. monocytogenes at extremely low concentrations, but also allowed for the development of a 96-well plate-based routine assay platform for multivalent diagnostics. Copyright © 2015 Elsevier B.V. All rights reserved.

  20. Application Progress of Recombinant Attenuated Listeria monocytogenes in Tumor Immunotherapy

    Institute of Scientific and Technical Information of China (English)

    Yin Xiaojiao; Bai Lin; Yang Xu


    Much progress of application of bacterial vaccine in treatment and prevention of tumor was acquired,which showed broad prospect in clinical study of animals and humans. Listeria monocytogenes( L. monocytogenes) was considered much important by virtue of its special characteristic of biology and immunology.L. monocytogenes was ingested by professional or part-time phagocytes,survived and proliferated in the phagocytes under synergism of toxic factor secreted by itself,meanwhile,the cellular and humoral immune response was induced. Antigenic gene of specific tumor was loaded in the attenuated L. monocytogenes,which can enhance immune response of host cells. Effective cell targeted to enter tumor tissue and acted on tumor cells to induce apoptosis of tumor cells. Tumor degenerated not easy to reappear. Therefore,recombinant attenuated L. monocytogenes was a safe and effective anti-cancer vaccine vector. Now the work of researchers mainly focuses on solving practical problem in clinical application. Biological characteristics of L. monocytogenes,feasibility and superiority of L. monocytogenes as targeted vaccine vector,problem and prospect of L. monocytogenes in clinical application of anti-tumor were reviewed in this paper.

  1. Evaluation of a monoclonal antibody able to detect live Listeria monocytogenes and Listeria innocua

    DEFF Research Database (Denmark)

    Sølve, Marianne; Boel, Jeppe; Nørrung, Birgit


    A monoclonal Listeria antibody, designated B4, was evaluated. The ability of the antibody to bind to viable bacteria belonging to Listeria spp, compared to bacteria of the same species killed by beat treatment, acid or base treatment, sanitizers, and irradiation was examined. The antibody was found...... to react with viable L. monocytogenes and L. innocua, but not with heat-killed (72 degrees C, 5 min) strains of these organisms. When L. monocytogenes and L. innocua were killed by methods other than heat treatment, it was ambiguous whether the antibody detected the organism or not. It was concluded...... that the B4 antibody has potential to be used in an immune capture step to capture live L, monocytogenes and L. innocua from foods prior to identification of L. monocytogenes by polymerase chain reaction (PCR)....

  2. Incidence of Listeria monocytogenes and Listeria spp. in a small-scale mushroom production facility. (United States)

    Viswanath, Prema; Murugesan, Latha; Knabel, Stephen J; Verghese, Bindhu; Chikthimmah, Naveen; Laborde, Luke F


    Listeria monocytogenes is a foodborne pathogen of significant concern to the agricultural and food processing industry because of its ability to grow and persist in cool and moist environments and its association with listeriosis, a disease with a very high mortality rate. Although there have been no listeriosis outbreaks attributed to fresh mushrooms in the United States, retail surveys and recalls are evidence that L. monocytogenes contamination of mushrooms (Agaricus bisporus) can occur. The objective of this study was to determine the prevalence of Listeria spp., including L. monocytogenes, in a small-scale mushroom production facility on the campus of the Pennsylvania State University in the United States. Of 184 samples taken from five production zones within the facility, 29 (15.8%) samples were positive for Listeria spp. Among the Listeria spp. isolates, L. innocua was most prevalent (10.3%) followed by L. welshimeri (3.3%), L. monocytogenes (1.6%), and L. grayi (0.5%). L. monocytogenes was recovered only from the phase I raw material composting area. Isolates of L. monocytogenes were confirmed and serotyped by multiplex PCR. The epidemiological relatedness of the three L. monocytogenes isolates to those serotypes or lineages frequently encountered in listeriosis infections was determined by multi-virulence-locus sequence typing using six virulence genes, namely, prfA, inlB, inlC, dal, clpP, and lisR. The phylogenetic positions of the three isolates in the dendrogram prepared with data from other isolates of L. monocytogenes showed that all isolates were grouped with serotype 4a, lineage IIIA. To date, this serotype has rarely been reported in foodborne disease outbreaks.

  3. A Look inside the Listeria monocytogenes Biofilms Extracellular Matrix

    Directory of Open Access Journals (Sweden)

    Angelo Colagiorgi


    Full Text Available Listeria monocytogenes is a foodborne pathogen able to persist in food industry and is responsible for a severe illness called listeriosis. The ability of L. monocytogenes to persist in environments is due to its capacity to form biofilms that are a sessile community of microorganisms embedded in a self-produced matrix of extracellular polymeric substances (EPS’s. In this review, we summarized recent efforts performed in order to better characterize the polymeric substances that compose the extracellular matrix (ECM of L. monocytogenes biofilms. EPS extraction and analysis led to the identification of polysaccharides, proteins, extracellular DNA, and other molecules within the listerial ECM. All this knowledge will be useful for increasing food protection, suggesting effective strategies for the minimization of persistence of L. monocytogenes in food industry environments.

  4. Pyelonephritis with bacteremia caused by Listeria monocytogenes: A case report. (United States)

    Uno, Shunsuke; Hase, Ryota; Toguchi, Akihiro; Otsuka, Yoshihito; Hosokawa, Naoto


    Listeria monocytogenes is a well-known cause of meningitis, colitis, and bacteremia; however, obstructive pyelonephritis caused by L. monocytogenes has never been reported. We herein report on a 90-year-old Japanese woman with obstructive pyelonephritis and bacteremia due to uterus carcinoma invading the ureter. She was admitted to our hospital complaining of fever and chills, and her physical examination revealed left costovertebral angle tenderness. Computed tomography showed hydronephrosis and complete ureteral obstruction due to tumor invasion. Blood and urine cultures upon nephrostomy revealed the growth of L. monocytogenes. We treated the patient with two weeks of intravenous ampicillin and an additional one-week treatment of oral sulfamethoxazole/trimethoprim. This case shows the importance to recognize L. monocytogenes as a potential causative agent of urinary tract infection. Copyright © 2016 Japanese Society of Chemotherapy and The Japanese Association for Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  5. Keberadaan Bakteri Listeria monocytogenes pada Keju Gouda Produksi Lokal dan Impor (PRESENCE OF LISTERIA MONOCYTOGENES IN LOCAL AND IMPORTED GOUDA CHEESES)


    Debby Fadhilah Pazra; Trioso Purnawarman; Denny Widaya Lukman


    Listeria monocytogenes is included in the foodborne pathogen, which has been associated with severaloutbreaks of human listeriosis especially in high risk groups. Listeria monocytogenes could be found inGouda cheeses because of poor hygienic and sanitation practices. In addition, this bacteria could surviveduring the making of cheese and cheese ripening process. The purpose of this study was to identify thepresence of L. monocytogenes in local and imported Gouda cheeses and how the safety lev...

  6. Comparison of the Prevalences and Diversities of Listeria Species and Listeria monocytogenes in an Urban and a Rural Agricultural Watershed. (United States)

    Stea, Emma C; Purdue, Laura M; Jamieson, Rob C; Yost, Chris K; Truelstrup Hansen, Lisbeth


    Foods and related processing environments are commonly contaminated with the pathogenic Listeria monocytogenes. To investigate potential environmental reservoirs of Listeria spp. and L. monocytogenes, surface water and point source pollution samples from an urban and a rural municipal water supply watershed in Nova Scotia, Canada, were examined over 18 months. Presumptive Listeria spp. were cultured from 72 and 35% of rural and urban water samples, respectively, with 24% of the positive samples containing two or three different Listeria spp. The L. innocua (56%) and L. welshimeri (43%) groups were predominant in the rural and urban watersheds, respectively. Analysis by the TaqMan assay showed a significantly (P Listeria spp. were associated with 70 times higher odds of isolating L. monocytogenes (odds ratio = 70; P Listeria species population and could be a potential reservoir for L. monocytogenes, especially in rural agricultural watersheds.

  7. Effect of citral and carvacrol on the susceptibility of Listeria monocytogenes and Listeria innocua to antibiotics. (United States)

    Zanini, S F; Silva-Angulo, A B; Rosenthal, A; Rodrigo, D; Martínez, A


    The aim of this study was to evaluate the antibiotic susceptibility of Listeria innocua (L. innocua) and Listeria monocytogenes (L. monocytogenes) cells in the presence of citral and carvacrol at sublethal concentrations in an agar medium. The presence of terpenes in the L. monocytogenes and L. innocua culture medium provided a reduction in the minimal inhibitory concentration (MIC) of all the antibiotics tested. These effects were dependent on the concentration of terpenes present in the culture medium. The combination of citral and carvacrol potentiated antibiotic activity by reducing the MIC values of bacitracin and colistin from 32.0 and 128.0 μg ml⁻¹ to 1.0 and 2.0 μg ml⁻¹, respectively. Thus, both Listeria species became more susceptible to these drugs. In this way, the colistin and bacitracin resistance of L. monocytogenes and L. innocua was reversed in the presence of terpenes. Results obtained in this study show that the phytochemicals citral and carvacrol potentiate antibiotic activity, reducing the MIC values of cultured L. monocytogenes and L. innocua. Phytochemicals citral and carvacrol potentiate antibiotic activity of erythromycin, bacitracin and colistin by reducing the MIC values of cultured Listeria monocytogenes and Listeria innocua. This effect in reducing the MIC values of the antibiotics tested in both micro-organisms was increased when natural antimicrobials were combined. This finding indicated that the combination among terpenes and antibiotic may contribute in reducing the required dosage of antibiotics due to the possible effect of terpenes on permeation barrier of the micro-organism cell membrane. © 2014 The Society for Applied Microbiology.

  8. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels

    Directory of Open Access Journals (Sweden)

    Qi Zhu


    Full Text Available Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis. However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water. Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges.

  9. Listeria monocytogenes in Fresh Produce: Outbreaks, Prevalence and Contamination Levels (United States)

    Zhu, Qi; Gooneratne, Ravi; Hussain, Malik Altaf


    Listeria monocytogenes, a member of the genus Listeria, is widely distributed in agricultural environments, such as soil, manure and water. This organism is a recognized foodborne pathogenic bacterium that causes many diseases, from mild gastroenteritis to severe blood and/or central nervous system infections, as well as abortion in pregnant women. Generally, processed ready-to-eat and cold-stored meat and dairy products are considered high-risk foods for L. monocytogenes infections that cause human illness (listeriosis). However, recently, several listeriosis outbreaks have been linked to fresh produce contamination around the world. Additionally, many studies have detected L. monocytogenes in fresh produce samples and even in some minimally processed vegetables. Thus L. monocytogenes may contaminate fresh produce if present in the growing environment (soil and water). Prevention of biofilm formation is an important control measure to reduce the prevalence and survival of L. monocytogenes in growing environments and on fresh produce. This article specifically focuses on fresh produce–associated listeriosis outbreaks, prevalence in growing environments, contamination levels of fresh produce, and associated fresh produce safety challenges. PMID:28282938

  10. Transferable tetracycline resistance in Listeria monocytogenes from food in Italy. (United States)

    Pourshaban, Manoocheher; Ferrini, Anna Maria; Mannoni, Veruscka; Oliva, Brunello; Aureli, Paolo


    Mechanisms of tetracycline resistance were investigated in two recent Listeria monocytogenes isolates from food, with L. innocua 52P tet(r) as a control. Tetracycline resistance was transferred conjugatively from all three strains to L. ivanovii and from one isolate and the control to Enterococcus faecalis. Molecular analysis demonstrated a chromosomal location for the tet determinant, which was identified as tetM in all cases. These studies are the first to show that L. monocytogenes from food could be a source of tetracycline resistance genes able to spread to other micro-organisms.

  11. Variations in virulence between different electrophoretic types of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nørrung, Birgit; Andersen, Jens Kirk


    A total of 245 strains of Listeria monocytogenes, representing 33 different electrophoretic types (ETs), were examined quantitatively for haemolytic activity. No significant difference was observed in the mean haemolytic activity between different ETs. Eighty four out of 91 strains examined were...... compared with 3.64 among food isolates). The explanation for this may be that more virulent strains are more prone to cause human infection. It is, however, also possible that strains oft. monocytogenes may become more virulent while multiplying in a living organism compared with multiplying in foods....

  12. Nalaz bakterije Listeria monocytogenes u ribi i ribljim proizvodima


    Rožman, Jelena; Njari, dr. sc. Bela; Kozačinski, dr. sc. Lidija


    Listerioza je bolest koja se prenosi hranom a bakterija Listeria monocytogenes je jedan od najznačajnijih javnozdravstvenih problema i uvjet prometa hrane u svijetu. Prije svega povezana je s konzumacijom gotovih proizvoda. U ovom radu je pretražena svježa riba (brancin) i riblji proizvodi (dimljena i marinirana riba, orada i brancin) na nalaz bakterije L. monocytogenes. Također, pretraženi su uzorci brisova uzeti s radnih površina i ruku djelatnika u pogonima prerade morske ribe. Bakterija L...

  13. Listeria monocytogenes response regulators important for stress tolerance and pathogenesis

    DEFF Research Database (Denmark)

    Kallipolitis, B H; Ingmer, H


    Environmental sensing by two-component signal transduction systems is likely to play a role for growth and survival of Listeria monocytogenes both during transmission in food products and within a host organism. Two-component systems typically consist of a membrane-associated sensor histidine...... of L. monocytogenes in mice. Strikingly, the mutants that were attenuated in virulence also had a decreased ability to grow in the presence of various stress conditions potentially encountered in an infection process. Thus, our data point to a connection between the ability of the putative two-component...

  14. Comparative experimental infection of Listeria monocytogenes and Listeria ivanovii in bovine trophoblasts. (United States)

    Rocha, Cláudia E; Mol, Juliana P S; Garcia, Luize N N; Costa, Luciana F; Santos, Renato L; Paixão, Tatiane A


    Listeria monocytogenes is a Gram-positive, facultative intracellular and invasive bacterium that has tropism to the placenta, and causes fetal morbidity and mortality in several mammalian species. While infection with L. monocytogenes and L. ivanovii are known as important causes of abortion and reproductive failure in cattle, the pathogenesis of maternal-fetal listeriosis in this species is poorly known. This study used the bovine chorioallantoic membrane explant model to investigate the kinetics of L. monocytogenes, L. ivanovii, and L. innocua infections in bovine trophoblastic cells for up to 8 h post infection. L. monocytogenes and L. ivanovii were able to invade and multiply in trophoblastic cells without causing cell death or inducing expression of pro-inflammatory genes. Although L. innocua was unable to multiply in bovine trophoblastic cells, it induced transcription of the pro-inflammatory mediator CXCL6. This study demonstrated for the first time the susceptibility of bovine trophoblastic cells to L. monocytogenes and L. ivanovii infection.

  15. Listeria Spp. and Listeria Monocytogenes Contamination in Ready-To-Eat Sandwiches Collected from Vending Machines (United States)

    Cossu, Francesca; Spanu, Carlo; Deidda, Silvia; Mura, Erica; Casti, Daniele; Pala, Carlo; Lamon, Sonia; Spanu, Vincenzo; Ibba, Michela; Marrocu, Elena; Piana, Andrea; De Santis, Enrico Pietro Luigi


    Ready-to-eat (RTE) food is characterised by a long shelf-life at refrigerated temperature and can be consumed as such, without any treatment. The aim of the work was to evaluate the presence of Listeria spp. and Listeria monocytogenes in RTEs collected from refrigerated vending machines placed in hospital environment and accessible to the hospitalised patients. In 4 different sampling, 55 RTEs were collected from vending machines of six hospitals located in different areas of Sardinia region. All the samples were characterised by similar manufacturing process, such as the use of modified atmosphere packaging and belonged to 5 different producers. Listeria spp. was not countable using the enumeration method in all of the analysed samples. Using the detection method, Listeria spp. was recovered from 9 sandwich samples. Interestingly, 3 of these samples (5.5%) made by the manufacturer, were positive for L. monocytogenes contamination. The risk related to the L. monocytogenes presence in RTEs proportionally increases when food is introduced in susceptible environments, such as hospitals and consumed by susceptible people. Although the RTEs analysed showed values that complied with the European microbiological criteria for foodstuffs, the availability of these products in a susceptible environment should be carefully checked. Therefore, in order to limit the possible exposition to L. monocytogenes, more information on the risk related to RTE consumption should be provided to the hospitalised patients. PMID:27800439

  16. Control of Relative Air Humidity as a Potential Means to Improve Hygiene on Surfaces: A Preliminary Approach with Listeria monocytogenes. (United States)

    Zoz, Fiona; Iaconelli, Cyril; Lang, Emilie; Iddir, Hayet; Guyot, Stéphane; Grandvalet, Cosette; Gervais, Patrick; Beney, Laurent


    Relative air humidity fluctuations could potentially affect the development and persistence of pathogenic microorganisms in their environments. This study aimed to characterize the impact of relative air humidity (RH) variations on the survival of Listeria monocytogenes, a bacterium persisting on food processing plant surfaces. To assess conditions leading to the lowest survival rate, four strains of L. monocytogenes (EGDe, CCL500, CCL128, and LO28) were exposed to different RH conditions (75%, 68%, 43% and 11%) with different drying kinetics and then rehydrated either progressively or instantaneously. The main factors that affected the survival of L. monocytogenes were RH level and rehydration kinetics. Lowest survival rates between 1% and 0.001% were obtained after 3 hours of treatment under optimal conditions (68% RH and instantaneous rehydration). The survival rate was decreased under 0.001% after prolonged exposure (16h) of cells under optimal conditions. Application of two successive dehydration and rehydration cycles led to an additional decrease in survival rate. This preliminary study, performed in model conditions with L. monocytogenes, showed that controlled ambient RH fluctuations could offer new possibilities to control foodborne pathogens in food processing environments and improve food safety.

  17. Incorporation of Listeria monocytogenes strains in raw milk biofilms. (United States)

    Weiler, Christiane; Ifland, Andrea; Naumann, Annette; Kleta, Sylvia; Noll, Matthias


    Biofilms develop successively on devices of milk production without sufficient cleaning and originate from the microbial community of raw milk. The established biofilm matrices enable incorporation of pathogens like Listeria monocytogenes, which can cause a continuous contamination of food processing plants. L. monocytogenes is frequently found in raw milk and non-pasteurized raw milk products and as part of a biofilm community in milk meters and bulk milk tanks. The aim of this study was to analyze whether different L. monocytogenes strains are interacting with the microbial community of raw milk in terms of biofilm formation in the same manner, and to identify at which stage of biofilm formation a selected L. monocytogenes strain settles best. Bacterial community structure and composition of biofilms were analyzed by a cloning and sequencing approach and terminal restriction fragment length polymorphism analysis (T-RFLP) based on the bacterial 16S rRNA gene. The chemical composition of biofilms was analyzed by Fourier transform infrared spectroscopy (FTIR), while settled L. monocytogenes cells were quantified by fluorescence in situ hybridization (FISH). Addition of individual L. monocytogenes strains to raw milk caused significant shifts in the biofilm biomass, in the chemical as well as in the bacterial community composition. Biofilm formation and attachment of L. monocytogenes cells were not serotype but strain specific. However, the added L. monocytogenes strains were not abundant since mainly members of the genera Citrobacter and Lactococcus dominated the bacterial biofilm community. Overall, added L. monocytogenes strains led to a highly competitive interaction with the raw milk community and triggered alterations in biofilm formation.

  18. Listeria monocytogenes as a vector for anti-cancer therapies.

    LENUS (Irish Health Repository)

    Tangney, Mark


    The intracellular pathogen Listeria monocytogenes represents a promising therapeutic vector for the delivery of DNA, RNA or protein to cancer cells or to prime immune responses against tumour-specific antigens. A number of biological properties make L. monocytogenes a promising platform for development as a vector for either gene therapy or as an anti-cancer vaccine vector. L. monocytogenes is particularly efficient in mediating internalization into host cells. Once inside cells, the bacterium produces specific virulence factors which lyse the vaculolar membrane and allow escape into the cytoplasm. Once in the cytosol, L. monocytogenes is capable of actin-based motility and cell-to-cell spread without an extracellular phase. The cytoplasmic location of L. monocytogenes is significant as this potentiates entry of antigens into the MHC Class I antigen processing pathway leading to priming of specific CD8(+) T cell responses. The cytoplasmic location is also beneficial for the delivery of DNA (bactofection) by L. monocytogenes whilst cell-to-cell spread may facilitate access of the vector to cells throughout the tumour. Several preclinical studies have demonstrated the ability of L. monocytogenes for intracellular gene or protein delivery in vitro and in vivo, and this vector has also displayed safety and efficacy in clinical trial. Here, we review the features of the L. monocytogenes host-pathogen interaction that make this bacterium such an attractive candidate with which to induce appropriate therapeutic responses. We focus primarily upon work that has led to attenuation of the pathogen, demonstrated DNA, RNA or protein delivery to tumour cells as well as research that shows the efficacy of L. monocytogenes as a vector for tumour-specific vaccine delivery.

  19. Targeting of the central nervous system by Listeria monocytogenes.


    Disson, Olivier; Lecuit, Marc


    Among bacteria that reach the central nervous system (CNS), Listeria monocytogenes (Lm) is one of deadliest, in human and ruminant. This facultative intracellular bacterium has the particularity to induce meningitis, meningoencephalitis and rhombencephalitis. Mechanisms by which Lm accesses the CNS remain poorly understood, but two major routes of infection have been proposed, based on clinical, in vitro and in vivo observations. A retrograde neural route is likely to occur in ruminants upon ...


    Directory of Open Access Journals (Sweden)

    T Civera


    Full Text Available Listeria monocytogenes has become one of the major concerns for food safety. Its ability to survive and replicate at low temperature, pH and high salt concentration, makes the bacterium a threat, mostly for RTE products. For these reasons, the present research was aimed at detecting the ability of growth of L. monocytogenes in RTE products retrieved from one deli store. Samples were analysed for L. monocytogenes detection, then inoculated with the pathogen (105cell/ml and stored at refrigeration temperature for the duration of their shelf-life (15-60 days. In all the products L. monocytogenes was not detected before experimental contamination. The challenge test evidenced that experimentally inoculated L. monocytogenes was not able to multiply for the duration of the entire shelf-life. These results indicated that the tested products could be considered as foods which are not able to support the growth of L. monocytogenes, as indicated by E.C. Regulation 2073/05. However, in order to guarantee consumer’s safety, it needs to be emphasized the need of a correct application of the GMPs, required for lowering the risk of initial contamination.

  1. Listeria monocytogenes does not survive ingestion by Acanthamoeba polyphaga. (United States)

    Akya, Alisha; Pointon, Andrew; Thomas, Connor


    Listeria monocytogenes is a ubiquitous bacterium capable of infecting humans, particularly pregnant women and immunocompromised individuals. Although the intracellular invasion and pathogenesis of listeriosis in mammalian tissues has been well studied, little is known about the ecology of L. monocytogenes , and in particular the environmental reservoir for this bacterium has not been identified. This study used short-term co-culture at 15, 22 and 37 degrees C to examine the interaction of L. monocytogenes strains with Acanthamoeba polyphaga ACO12. Survival of L. monocytogenes cells phagocytosed by monolayers of trophozoites was assessed by culture techniques and microscopy. A. polyphaga trophozoites eliminated bacterial cells within a few hours post-phagocytosis, irrespective of the incubation temperature used. Wild-type L. monocytogenes and a phenotypic listeriolysin O mutant were unable to either multiply or survive within trophozoites. By contrast, Salmonella enterica serovar Typhimurium C5 cells used as controls were able to survive and multiply within A. polyphaga trophozoites. The data presented indicate that A. polyphaga ACO12 is unlikely to harbour L. monocytogenes, or act as an environmental reservoir for this bacterium.

  2. Listeria monocytogenes, a down-to-earth pathogen. (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Piveteau, Pascal


    Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavor of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

  3. Inhibition of sortase A by chalcone prevents Listeria monocytogenes infection. (United States)

    Li, Hongen; Chen, Yutao; Zhang, Bing; Niu, Xiaodi; Song, Meng; Luo, Zhaoqing; Lu, Gejin; Liu, Bowen; Zhao, Xiaoran; Wang, Jianfeng; Deng, Xuming


    The critical role of sortase A in gram-positive bacterial pathogenicity makes this protein a good potential target for antimicrobial therapy. In this study, we report for the first time the crystal structure of Listeria monocytogenes sortase A and identify the active sites that mediate its transpeptidase activity. We also used a sortase A (SrtA) enzyme activity inhibition assay, simulation, and isothermal titration calorimetry analysis to discover that chalcone, an agent with little anti-L. monocytogenes activity, could significantly inhibit sortase A activity with an IC50 of 28.41 ± 5.34 μM by occupying the active site of SrtA. The addition of chalcone to a co-culture of L. monocytogenes and Caco-2 cells significantly inhibited bacterial entry into the cells and L. monocytogenes-mediated cytotoxicity. Additionally, chalcone treatment decreased the mortality of infected mice, the bacterial burden in target organs, and the pathological damage to L. monocytogenes-infected mice. In conclusion, these findings suggest that chalcone is a promising candidate for the development of treatment against L. monocytogenes infection.

  4. Evolutionary dynamics of the accessory genome of Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Henk C den Bakker

    Full Text Available Listeria monocytogenes, a foodborne bacterial pathogen, is comprised of four phylogenetic lineages that vary with regard to their serotypes and distribution among sources. In order to characterize lineage-specific genomic diversity within L. monocytogenes, we sequenced the genomes of eight strains from several lineages and serotypes, and characterized the accessory genome, which was hypothesized to contribute to phenotypic differences across lineages. The eight L. monocytogenes genomes sequenced range in size from 2.85-3.14 Mb, encode 2,822-3,187 genes, and include the first publicly available sequenced representatives of serotypes 1/2c, 3a and 4c. Mapping of the distribution of accessory genes revealed two distinct regions of the L. monocytogenes chromosome: an accessory-rich region in the first 65° adjacent to the origin of replication and a more stable region in the remaining 295°. This pattern of genome organization is distinct from that of related bacteria Staphylococcus aureus and Bacillus cereus. The accessory genome of all lineages is enriched for cell surface-related genes and phosphotransferase systems, and transcriptional regulators, highlighting the selective pressures faced by contemporary strains from their hosts, other microbes, and their environment. Phylogenetic analysis of O-antigen genes and gene clusters predicts that serotype 4 was ancestral in L. monocytogenes and serotype 1/2 associated gene clusters were putatively introduced through horizontal gene transfer in the ancestral population of L. monocytogenes lineage I and II.

  5. Listeria monocytogenes a pathogen down-to-earth

    Directory of Open Access Journals (Sweden)

    Anne-Laure eVivant


    Full Text Available Listeria monocytogenes is the causative agent of the food-borne life threatening disease listeriosis. This pathogenic bacterium received much attention in the endeavour of deciphering the cellular mechanisms that underlie the onset of infection and its ability to adapt to the food processing environment. Although information is available on the presence of L. monocytogenes in many environmental niches including soil, water, plants, foodstuff and animals, understanding the ecology of L. monocytogenes in outdoor environments has received less attention. Soil is an environmental niche of pivotal importance in the transmission of this bacterium to plants and animals. Soil composition, microbial communities and macrofauna are extrinsic edaphic factors that direct the fate of L. monocytogenes in the soil environment. Moreover, farming practices may further affect its incidence. The genome of L. monocytogenes presents an extensive repertoire of genes encoding transport proteins and regulators, a characteristic of the genome of ubiquitous bacteria. Postgenomic analyses bring new insights in the process of soil adaptation. In the present paper focussing on soil, we review these extrinsic and intrinsic factors that drive environmental adaptation of L. monocytogenes.

  6. Role of host GTPases in infection by Listeria monocytogenes. (United States)

    Ireton, Keith; Rigano, Luciano A; Dowd, Georgina C


    The bacterial pathogen Listeria monocytogenes induces internalization into mammalian cells and uses actin-based motility to spread within tissues. Listeria accomplishes this intracellular life cycle by exploiting or antagonizing several host GTPases. Internalization into human cells is mediated by the bacterial surface proteins InlA or InlB. These two modes of uptake each require a host actin polymerization pathway comprised of the GTPase Rac1, nucleation promotion factors, and the Arp2/3 complex. In addition to Rac1, InlB-mediated internalization involves inhibition of the GTPase Arf6 and participation of Dynamin and septin family GTPases. After uptake, Listeria is encased in host phagosomes. The bacterial protein GAPDH inactivates the human GTPase Rab5, thereby delaying phagosomal acquisition of antimicrobial properties. After bacterial-induced destruction of the phagosome, cytosolic Listeria uses the surface protein ActA to stimulate actin-based motility. The GTPase Dynamin 2 reduces the density of microtubules that would otherwise limit bacterial movement. Cell-to-cell spread results when motile Listeria remodel the host plasma membrane into protrusions that are engulfed by neighbouring cells. The human GTPase Cdc42, its activator Tuba, and its effector N-WASP form a complex with the potential to restrict Listeria protrusions. Bacteria overcome this restriction through two microbial factors that inhibit Cdc42-GTP or Tuba/N-WASP interaction.

  7. Animal models for oral transmission of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Sarah E F D'Orazio


    Full Text Available Listeria monocytogenes has been recognized as a food borne pathogen in humans since the 1980s, but we still understand very little about oral transmission of L. monocytogenes or the host factors that determine susceptibility to gastrointestinal infection, due to the lack of an appropriate small animal model of oral listeriosis. Early feeding trials suggested that many animals were highly resistant to oral infection, and the more reproducible intravenous or intraperitoneal routes of inoculation soon came to be favored. There are a fair number of previously published studies using an oral infection route, but the work varies widely in terms of bacterial strain choice, the methods used for oral transmission, and various manipulations used to enhance infectivity. This mini review will summarize the published literature using oral routes of L. monocytogenes infection and will highlight recent technological advances that have made oral infection a more attractive model system.

  8. Whole genome sequence-based serogrouping of Listeria monocytogenes isolates. (United States)

    Hyden, Patrick; Pietzka, Ariane; Lennkh, Anna; Murer, Andrea; Springer, Burkhard; Blaschitz, Marion; Indra, Alexander; Huhulescu, Steliana; Allerberger, Franz; Ruppitsch, Werner; Sensen, Christoph W


    Whole genome sequencing (WGS) is currently becoming the method of choice for characterization of Listeria monocytogenes isolates in national reference laboratories (NRLs). WGS is superior with regards to accuracy, resolution and analysis speed in comparison to several other methods including serotyping, PCR, pulsed field gel electrophoresis (PFGE), multilocus sequence typing (MLST), multilocus variable number tandem repeat analysis (MLVA), and multivirulence-locus sequence typing (MVLST), which have been used thus far for the characterization of bacterial isolates (and are still important tools in reference laboratories today) to control and prevent listeriosis, one of the major sources of foodborne diseases for humans. Backward compatibility of WGS to former methods can be maintained by extraction of the respective information from WGS data. Serotyping was the first subtyping method for L. monocytogenes capable of differentiating 12 serovars and national reference laboratories still perform serotyping and PCR-based serogrouping as a first level classification method for Listeria monocytogenes surveillance. Whole genome sequence based core genome MLST analysis of a L. monocytogenes collection comprising 172 isolates spanning all 12 serotypes was performed for serogroup determination. These isolates clustered according to their serotypes and it was possible to group them either into the IIa, IIc, IVb or IIb clusters, respectively, which were generated by minimum spanning tree (MST) and neighbor joining (NJ) tree data analysis, demonstrating the power of the new approach. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  9. Validation of the ANSR(®) Listeria monocytogenes Method for Detection of Listeria monocytogenes in Selected Food and Environmental Samples. (United States)

    Caballero, Oscar; Alles, Susan; Le, Quynh-Nhi; Gray, R Lucas; Hosking, Edan; Pinkava, Lisa; Norton, Paul; Tolan, Jerry; Mozola, Mark; Rice, Jennifer; Chen, Yi; Ryser, Elliot; Odumeru, Joseph


    Work was conducted to validate performance of the ANSR(®) for Listeria monocytogenes method in selected food and environmental matrixes. This DNA-based assay involves amplification of nucleic acid via an isothermal reaction based on nicking enzyme amplification technology. Following single-step sample enrichment for 16-24 h for most matrixes, the assay is completed in 40 min using only simple instrumentation. When 50 distinct strains of L. monocytogenes were tested for inclusivity, 48 produced positive results, the exceptions being two strains confirmed by PCR to lack the assay target gene. Forty-seven nontarget strains (30 species), including multiple non-monocytogenes Listeria species as well as non-Listeria, Gram-positive bacteria, were tested, and all generated negative ANSR assay results. Performance of the ANSR method was compared with that of the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook reference culture procedure for detection of L. monocytogenes in hot dogs, pasteurized liquid egg, and sponge samples taken from an inoculated stainless steel surface. In addition, ANSR performance was measured against the U.S. Food and Drug Administration Bacteriological Analytical Manual reference method for detection of L. monocytogenes in Mexican-style cheese, cantaloupe, sprout irrigation water, and guacamole. With the single exception of pasteurized liquid egg at 16 h, ANSR method performance as quantified by the number of positives obtained was not statistically different from that of the reference methods. Robustness trials demonstrated that deliberate introduction of small deviations to the normal assay parameters did not affect ANSR method performance. Results of accelerated stability testing conducted using two manufactured lots of reagents predicts stability at the specified storage temperature of 4°C of more than 1 year.

  10. A multiplex PCR for detection of Listeria monocytogenes and its lineages. (United States)

    Rawool, Deepak B; Doijad, Swapnil P; Poharkar, Krupali V; Negi, Mamta; Kale, Satyajit B; Malik, S V S; Kurkure, Nitin V; Chakraborty, Trinad; Barbuddhe, Sukhadeo B


    A novel multiplex PCR assay was developed to identify genus Listeria, and discriminate Listeria monocytogenes and its major lineages (LI, LII, LIII). This assay is a rapid and inexpensive subtyping method for screening and characterization of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Antimicrobial treatments to control Listeria monocytogenes in queso fresco. (United States)

    Lourenço, António; Kamnetz, Mary B; Gadotti, Camila; Diez-Gonzalez, Francisco


    Queso fresco, is a Hispanic non-fermented cheese highly susceptible to contamination with L. monocytogenes. This research was aimed to determine the effect of GRAS antimicrobial ingredients to control L. monocytogenes. Antimicrobials included caprylic acid (CA), Nisaplin(®) (N, 2.5% nisin), a mixture of sodium lactate and sodium diacetate (SL/SD), Lactococcus lactis sbp. lactis DPC 3147, monolaurin, and lactic acid (LA). Batches of queso fresco curds were inoculated with 10(4) CFU/g and stored at 4 °C for three weeks. During storage the count of L. monocytogenes reached 7 to 8 Log CFU/g in control samples. Most individual antimicrobial treatments resulted in less than 1 Log CFU/g reductions in final counts, with the exception of N (0.5 g/kg) and CA (2.9 g/kg) that caused more than 3 and 5 Log CFU/g differences with controls, respectively. Mixtures of ingredients were more effective in inhibiting L. monocytogenes growth, and treatments with N and CA consistently delivered 6 Log CFU/g less counts than controls. Supplementation of 12 g/kg LA to treatments with SL/SD (3%/0.22%) caused differences of more than 4 Log CFU/g in final Listeria populations. Samples treated with the binary mixtures of N and CA (0.5 and 0.7 g/kg, respectively) were evaluated in a consumer panel (n = 67). Panelists slightly preferred control and commercial over treated samples, but all samples were in average rated between "slightly liking" and "moderately liking." These experiments indicated that combined use of antimicrobial ingredients may be an effective way to control the population of Listeria monocytogenes in queso fresco.

  12. Oral Immunization with Recombinant Listeria monocytogenes Controls Virus Load after Vaginal Challenge with Feline Immunodeficiency Virus


    Stevens, Rosemary; Howard, Kristina E.; Nordone, Sushila; Burkhard, MaryJo; Dean, Gregg A


    Recombinant Listeria monocytogenes has many attractive characteristics as a vaccine vector against human immunodeficiency virus (HIV). Wild-type and attenuated Listeria strains expressing HIV Gag have been shown to induce long-lived mucosal and systemic T-cell responses in mice. Using the feline immunodeficiency virus (FIV) model of HIV we evaluated recombinant L. monocytogenes in a challenge system. Five cats were immunized with recombinant L. monocytogenes that expresses the FIV Gag and del...

  13. ISG15 counteracts Listeria monocytogenes infection (United States)

    Radoshevich, Lilliana; Impens, Francis; Ribet, David; Quereda, Juan J; Nam Tham, To; Nahori, Marie-Anne; Bierne, Hélène; Dussurget, Olivier; Pizarro-Cerdá, Javier; Knobeloch, Klaus-Peter; Cossart, Pascale


    ISG15 is an interferon-stimulated, linear di-ubiquitin-like protein, with anti-viral activity. The role of ISG15 during bacterial infection remains elusive. We show that ISG15 expression in nonphagocytic cells is dramatically induced upon Listeria infection. Surprisingly this induction can be type I interferon independent and depends on the cytosolic surveillance pathway, which senses bacterial DNA and signals through STING, TBK1, IRF3 and IRF7. Most importantly, we observed that ISG15 expression restricts Listeria infection in vitro and in vivo. We made use of stable isotope labeling in tissue culture (SILAC) to identify ISGylated proteins that could be responsible for the protective effect. Strikingly, infection or overexpression of ISG15 leads to ISGylation of ER and Golgi proteins, which correlates with increased secretion of cytokines known to counteract infection. Together, our data reveal a previously uncharacterized ISG15-dependent restriction of Listeria infection, reinforcing the view that ISG15 is a key component of the innate immune response. DOI: PMID:26259872

  14. Identification of Listeria monocytogenes on Green Mussels and Cockle Shell

    Directory of Open Access Journals (Sweden)

    Winiati Puji Rahayu


    Full Text Available AbstractGreen mussel (Perna viridis and cockle shell (Anadara granosa are one of many sources of animal protein which is many cultivated in Indonesia because their price is relatively affordable. This study was conducted to identify the presence of Listeria monocytogenes in 27 samples of green mussels and 3 samples of cockle shells using real-time Polymerase Chain Reaction (real-time PCR and biochemical methods. The target gene for amplification in real-time PCR was an hlyA gene because this gene was a determinant of virulence genes that produce listeriolysin O. Primers used in this study were forward primer DG69 (GTG CCG GGT AAA AGA CCA TA and reverse primer DG74 (CGC CAC TGA GAT ACT AT and fluorescence signals indicator using SYBR Green I. The results of analysis using real-time PCR were negative Listeria monocytogenes in all samples, while using biochemical methods there was one of 30 samples contaminated by Listeria welshimeri.

  15. Listeria monocytogenes and Listeria spp. contamination patterns in retail delicatessen establishments in three U.S. states. (United States)

    Simmons, Courtenay; Stasiewicz, Matthew J; Wright, Emily; Warchocki, Steven; Roof, Sherry; Kause, Janell R; Bauer, Nathan; Ibrahim, Salam; Wiedmann, Martin; Oliver, Haley F


    Postprocessing contamination in processing plants has historically been a significant source of Listeria monocytogenes in ready-to-eat delicatessen meats, and therefore a major cause of human listeriosis cases and outbreaks. Recent risk assessments suggest that a majority of human listeriosis cases linked to consumption of contaminated deli meats may be due to L. monocytogenes contamination that occurs at the retail level. To better understand the ecology and transmission of Listeria spp. in retail delicatessens, food and nonfood contact surfaces were tested for L. monocytogenes and other Listeria spp. in a longitudinal study conducted in 30 retail delis in three U.S. states. In phase I of the study, seven sponge samples were collected monthly for 3 months in 15 delis (5 delis per state) prior to start of daily operation; in phase II, 28 food contact and nonfood contact sites were sampled in each of 30 delis during daily operation for 6 months. Among the 314 samples collected during phase I, 6.8% were positive for L. monocytogenes. Among 4,503 samples collected during phase II, 9.5% were positive for L. monocytogenes; 9 of 30 delis showed low L. monocytogenes prevalence (Listeria spp. isolates, including 184 Listeria innocua, 48 Listeria seeligeri, and 13 Listeria welshimeri were characterized. Pulsed-field gel electrophoresis (PFGE) was used to characterize 446 L. monocytogenes isolates. PFGE showed that for 12 of 30 delis, one or more PFGE types were isolated on at least three separate occasions, providing evidence for persistence of a given L. monocytogenes subtype in the delis. For some delis, PFGE patterns for isolates from nonfood contact surfaces were distinct from patterns for occasional food contact surface isolates, suggesting limited cross-contamination between these sites in some delis. This study provides longitudinal data on L. monocytogenes contamination patterns in retail delis, which should facilitate further development of control strategies in

  16. Characterization of Listeria monocytogenes from three countries and antibiotic resistance differences among countries and Listeria monocytogenes serogroups. (United States)

    Obaidat, M M; Bani Salman, A E; Lafi, S Q; Al-Abboodi, A R


    A total of 104 Listeria monocytogenes isolates from 330 fish samples from three countries were characterized by multiplex PCR for serogrouping and virulence markers determination and tested for antibiotics resistance. A 53·8% of the isolates belonged to serogroup 1/2a, 3a; 32% belonged to 1/2b, 3b, 7; 14·4% belonged to 4b, 4d, 4e and 1% belonged to 1/2c, 3c. All isolates exhibited resistance to at least one antibiotic but the resistance rates varied among countries. The isolates exhibited high resistance to penicillin, rifampicin, clindamycin, erythromycin and tetracycline, but low resistance to amoxicillin-clavulanic acid, streptomycin, sulfamethoxazole-trimethoprim, gentamicin, chloramphenicol and kanamycin. When comparing countries, the resistance rate for rifampicin, clindamycin, erythromycin, tetracycline, amoxicillin-clavulanic acid varied among countries. When comparing serogroup, 1/2a, 3a exhibited the highest resistance to clindamycin, erythromycin, tetracycline and vancomycin while serogroup 4b, 4d, 4e exhibited the highest resistance to amoxicillin-clavulanic acid. All isolates carried inlA, inlC, inlJ and lmo2672. Listeriolysin S was carried by 42 and 30% of 4b and 1/2b isolates respectively. Significance and impact of the study: This is one of few studies to correlate antibiotic resistance with Listeria monocytogenes serogroups. The study also compared the antibiotic resistance and serogroups of L. monocytogenes isolates from three countries in one single study. The findings of this study will be helpful in improving data on the antibiotics resistance of L. monocytogenes in developing countries and enriches the epidemiological and public health studies of L. monocytogenes. © 2015 The Society for Applied Microbiology.

  17. Stress survival islet 1 (SSI-1) survey in Listeria monocytogenes reveals an insert common to listeria innocua in sequence type 121 L. monocytogenes strains. (United States)

    Hein, Ingeborg; Klinger, Sonja; Dooms, Maxime; Flekna, Gabriele; Stessl, Beatrix; Leclercq, Alexandre; Hill, Colin; Allerberger, Franz; Wagner, Martin


    Listeria monocytogenes strains (n = 117) were screened for the presence of stress survival islet 1 (SSI-1). SSI-1(+) strains (32.5%) belonged mainly to serotypes 1/2c, 3b, and 3c. All sequence type 121 (ST-121) strains included (n = 7) possessed homologues to Listeria innocua genes lin0464 and lin0465 instead of SSI-1.

  18. Diversity and distribution of Listeria monocytogenes in meat processing plants. (United States)

    Martín, Belén; Perich, Adriana; Gómez, Diego; Yangüela, Javier; Rodríguez, Alicia; Garriga, Margarita; Aymerich, Teresa


    Listeria monocytogenes is a major concern for the meat processing industry because many listeriosis outbreaks have been linked to meat product consumption. The aim of this study was to elucidate L. monocytogenes diversity and distribution across different Spanish meat processing plants. L. monocytogenes isolates (N = 106) collected from food contact surfaces of meat processing plants and meat products were serotyped and then characterised by multilocus sequence typing (MLST). The isolates were serotyped as 1/2a (36.8%), 1/2c (34%), 1/2b (17.9%) and 4b (11.3%). MLST identified ST9 as the most predominant allelic profile (33% of isolates) followed by ST121 (16%), both of which were detected from several processing plants and meat products sampled in different years, suggesting that those STs are highly adapted to the meat processing environment. Food contact surfaces during processing were established as an important source of L. monocytogenes in meat products because the same STs were obtained in isolates recovered from surfaces and products. L. monocytogenes was recovered after cleaning and disinfection procedures in two processing plants, highlighting the importance of thorough cleaning and disinfection procedures. Epidemic clone (EC) marker ECI was identified in 8.5%, ECIII was identified in 2.8%, and ECV was identified in 7.5% of the 106 isolates. Furthermore, a selection of presumably unrelated ST9 isolates was analysed by multi-virulence-locus sequence typing (MVLST). Most ST9 isolates had the same virulence type (VT11), confirming the clonal origin of ST9 isolates; however, one ST9 isolate was assigned to a new VT (VT95). Consequently, MLST is a reliable tool for identification of contamination routes and niches in processing plants, and MVLST clearly differentiates EC strains, which both contribute to the improvement of L. monocytogenes control programs in the meat industry. Copyright © 2014 Elsevier Ltd. All rights reserved.

  19. Patogénesis de Listeria monocytogenes, microorganismo zoonotico emergente

    Directory of Open Access Journals (Sweden)

    Kirvis Torres


    Full Text Available Listeria monocytogenes además de ser un paradigma para la investigación inmunológica se ha convertidoen sistema modelo apropiado para el análisis de los mecanismos moleculares del parasitismo intracelularde otras bacterias. Investigadores en el área de la inmunología se interesaron en este microorganismocuando se reconoció el riesgo que representaba para la salud pública y la seguridad en la industria dealimentos. Desde mediados de los años 80’s se ha investigado la biología molecular de los marcadores devirulencia de este microorganismo, la biología celular de las interacciones de los marcadores de virulenciacon los receptores de la célula hospedero, el citoesqueleto, las vías de transducción de señales y losmecanismos de inmunidad mediada por células del hospedero. El propósito de esta revisión es describiralgunas características taxonómicas y filogenéticas de Listeria monocytogenes , la incidencia humana yanimal de varios serotipos, la fisiopatología de la infección , modelos animales y de cultivo celular utilizadospara estudios de virulencia, las poblaciones de riesgo, manifestaciones clínicas de listeriosis humana yanimal, el tratamiento, la organización genética y evolución de los determinantes de virulencia, losmecanismos empleados para interactuar con la célula hospedera, y los mecanismos para escapar de losprocesos de muerte celular y pasar de una célula infectada a otra. La información recopilada resulta degran importancia para el personal de salud, industria, consumidores y población de riesgo; razón por lacual Listeria monocytogenes es un patógeno que representa una amenaza para la salud pública mundial.

  20. Simvastatin enhances protection against Listeria monocytogenes infection in mice by counteracting Listeria-induced phagosomal escape.

    Directory of Open Access Journals (Sweden)

    Suraj P Parihar

    Full Text Available Statins are well-known cholesterol lowering drugs targeting HMG-CoA-reductase, reducing the risk of coronary disorders and hypercholesterolemia. Statins are also involved in immunomodulation, which might influence the outcome of bacterial infection. Hence, a possible effect of statin treatment on Listeriosis was explored in mice. Statin treatment prior to subsequent L. monocytogenes infection strikingly reduced bacterial burden in liver and spleen (up to 100-fold and reduced histopathological lesions. Statin-treatment in infected macrophages resulted in increased IL-12p40 and TNF-α and up to 4-fold reduced bacterial burden within 6 hours post infection, demonstrating a direct effect of statins on limiting bacterial growth in macrophages. Bacterial uptake was normal investigated in microbeads and GFP-expressing Listeria experiments by confocal microscopy. However, intracellular membrane-bound cholesterol level was decreased, as analyzed by cholesterol-dependent filipin staining and cellular lipid extraction. Mevalonate supplementation restored statin-inhibited cholesterol biosynthesis and reverted bacterial growth in Listeria monocytogenes but not in listeriolysin O (LLO-deficient Listeria. Together, these results suggest that statin pretreatment increases protection against L. monocytogenes infection by reducing membrane cholesterol in macrophages and thereby preventing effectivity of the cholesterol-dependent LLO-mediated phagosomal escape of bacteria.

  1. Listeria monocytogenes: survival and adaptation in the gastrointestinal tract

    Directory of Open Access Journals (Sweden)

    Cormac G.M. Gahan


    Full Text Available The foodborne pathogen Listeria monocytogenes has the capacity to survive and grow in a diverse range of natural environments. The transition from a food environment to the gastrointestinal tract begins a process of adaptation that may culminate in invasive systemic disease. Here we describe recent advances in our understanding of how L. monocytogenes adapts to the gastrointestinal environment prior to initiating systemic infection. We will discuss mechanisms used by the pathogen to survive encounters with acidic environments (which include the glutamate decarboxylase and arginine deiminase systems, and those which enable the organism to cope with bile acids (including bile salt hydrolase and competition with the resident microbiota. An increased understanding of how the pathogen survives in this environment is likely to inform the future design of novel prophylactic approaches that exploit specific pharmabiotics; including probiotics, prebiotics or phages.

  2. Inhibition of Listeria monocytogenes by fatty acids and monoglycerides. (United States)

    Wang, L L; Johnson, E A


    Fatty acids and monoglycerides were evaluated in brain heart infusion broth and in milk for antimicrobial activity against the Scott A strain of Listeria monocytogenes. C12:0, C18:3, and glyceryl monolaurate (monolaurin) had the strongest activity in brain heart infusion broth and were bactericidal at 10 to 20 micrograms/ml, whereas potassium (K)-conjugated linoleic acids and C18:2 were bactericidal at 50 to 200 micrograms/ml. C14:0, C16:0, C18:0, C18:1, glyceryl monomyristate, and glyceryl monopalmitate were not inhibitory at 200 micrograms/ml. The bactericidal activity in brain heart infusion broth was higher at pH 5 than at pH 6. In whole milk and skim milk, K-conjugated linoleic acid was bacteriostatic and prolonged the lag phase especially at 4 degrees C. Monolaurin inactivated L. monocytogenes in skim milk at 4 degrees C, but was less inhibitory at 23 degrees C. Monolaurin did not inhibit L. monocytogenes in whole milk because of the higher fat content. Other fatty acids tested were not effective in whole or skim milk. Our results suggest that K-conjugated linoleic acids or monolaurin could be used as an inhibitory agent against L. monocytogenes in dairy foods.

  3. The Continuous Challenge of Characterizing the Foodborne Pathogen Listeria monocytogenes. (United States)

    Camargo, Anderson Carlos; Woodward, Joshua John; Nero, Luís Augusto


    Listeria monocytogenes is an important foodborne pathogen commonly isolated from food processing environments and food products. This organism can multiply at refrigeration temperatures, form biofilms on different materials and under various conditions, resist a range of environmental stresses, and contaminate food products by cross-contamination. L. monocytogenes is recognized as the causative agent of listeriosis, a serious disease that affects mainly individuals from high-risk groups, such as pregnant women, newborns, the elderly, and immunocompromised individuals. Listeriosis can be considered a disease that has emerged along with changing eating habits and large-scale industrial food processing. This disease causes losses of billions of dollars every year with recalls of contaminated foods and patient medical treatment expenses. In addition to the immune status of the host and the infecting dose, the virulence potential of each strain is crucial for the development of disease symptoms. While many isolates are naturally virulent, other isolates are avirulent and unable to cause disease; this may vary according to the presence of molecular determinants associated with virulence. In the last decade, the characterization of genetic profiles through the use of molecular methods has helped track and demonstrate the genetic diversity among L. monocytogenes isolates obtained from various sources. The purposes of this review were to summarize the main methods used for isolation, identification, and typing of L. monocytogenes and also describe its most relevant virulence characteristics.

  4. Infective endocarditis caused by Listeria monocytogenes forming a pseudotumor. (United States)

    Uehara Yonekawa, Akiko; Iwasaka, Sho; Nakamura, Hisataka; Fukata, Mitsuhiro; Kadowaki, Masako; Uchida, Yujiro; Odashiro, Keita; Shimoda, Shinji; Shimono, Nobuyuki; Akashi, Koichi


    A 73-year-old woman with breast cancer and metastasis under chemotherapy suffered from fever, pleural effusion and pericardial effusion. Despite the administration of treatment with cefozopran and prednisolone, the patient's fever relapsed. An electrocardiogram identified a new complete atrioventricular block and an echocardiogram revealed vegetation with an unusual pseudotumoral mass in the right atrium. Blood cultures grew Listeria monocytogenes. The patient was eventually diagnosed with right-sided infective endocarditis, which improved following the six-week administration of ampicillin and gentamicin. Homemade yoghurt was suspected to be the cause of infection in this case. Listeria endocarditis is rare; however, physicians should pay more attention to preventing this fatal disease in immunocompromised patients.

  5. Carbon dioxide and nisin act synergistically on Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nilsson, Lilian; Chen, Y.H.; Chikindas, M.L.


    This paper examines the synergistic action of carbon dioxide and nisin on Listeria monocytogenes Scott A wild-type and nisin-resistant (Nis(r)) cells grown in broth at 4 degrees C. Carbon dioxide extended the lag phase and decreased the specific growth rate of both strains, but to a greater degree...... for cultures in CO2. This synergism between nisin and CO2 was examined mechanistically by following the leakage of carboxyfluorescein (CF) from listerial liposomes. Carbon dioxide enhanced nisin-induced CF leakage, indicating that the synergistic action of CO2 and nisin occurs at the cytoplasmic membrane...

  6. Inhibition of Listeria monocytogenes by fatty acids and monoglycerides.


    Wang, L. L.; Johnson, E. A.


    Fatty acids and monoglycerides were evaluated in brain heart infusion broth and in milk for antimicrobial activity against the Scott A strain of Listeria monocytogenes. C12:0, C18:3, and glyceryl monolaurate (monolaurin) had the strongest activity in brain heart infusion broth and were bactericidal at 10 to 20 micrograms/ml, whereas potassium (K)-conjugated linoleic acids and C18:2 were bactericidal at 50 to 200 micrograms/ml. C14:0, C16:0, C18:0, C18:1, glyceryl monomyristate, and glyceryl m...


    Directory of Open Access Journals (Sweden)

    S Fisichella


    Full Text Available The aim of the present study is to investigate operative procedures that allow to minimize Listeria monocytogenes (L. m. hazard in the main traditional sausage of the internal areas of Marche (Italy: the Ciauscolo, that has received the quality trademark PGI. It is made from lean cuts of well mature pork that is finely minced, adding fat which give the salami his characteristic softness and flavour. It is characterized by having a very little maturing period that determine high aw levels and, for this peculiarity, it allows L. m development.

  8. Patogénesis de Listeria monocytogenes, microorganismo zoonotico emergente


    Kirvis Torres; Sara Sierra; Raúl Poutou; Ana Carrascal; Marcela Mercado


    Listeria monocytogenes además de ser un paradigma para la investigación inmunológica se ha convertidoen sistema modelo apropiado para el análisis de los mecanismos moleculares del parasitismo intracelularde otras bacterias. Investigadores en el área de la inmunología se interesaron en este microorganismocuando se reconoció el riesgo que representaba para la salud pública y la seguridad en la industria dealimentos. Desde mediados de los años 80’s se ha investigado la biología molecular de los ...

  9. Promyelocytic Leukemia Protein (PML) Controls Listeria monocytogenes Infection (United States)

    Ribet, David; Lallemand-Breitenbach, Valérie; Ferhi, Omar; Nahori, Marie-Anne; Varet, Hugo


    ABSTRACT The promyelocytic leukemia protein (PML) is the main organizer of stress-responsive subnuclear structures called PML nuclear bodies. These structures recruit multiple interactors and modulate their abundance or their posttranslational modifications, notably by the SUMO ubiquitin-like modifiers. The involvement of PML in antiviral responses is well established. In contrast, the role of PML in bacterial infection remains poorly characterized. Here, we show that PML restricts infection by the pathogenic bacterium Listeria monocytogenes but not by Salmonella enterica serovar Typhimurium. During infection, PML undergoes oxidation-mediated multimerization, associates with the nuclear matrix, and becomes de-SUMOylated due to the pore-forming activity of the Listeria toxin listeriolysin O (LLO). These events trigger an antibacterial response that is not observed during in vitro infection by an LLO-defective Listeria mutant, but which can be phenocopied by specific induction of PML de-SUMOylation. Using transcriptomic and proteomic microarrays, we also characterized a network of immunity genes and cytokines, which are regulated by PML in response to Listeria infection but independently from the listeriolysin O toxin. Our study thus highlights two mechanistically distinct complementary roles of PML in host responses against bacterial infection. PMID:28074026

  10. Prevalence and level of Listeria monocytogenes and other Listeria sp. in ready-to-eat minimally processed and refrigerated vegetables. (United States)

    Kovačević, Mira; Burazin, Jelena; Pavlović, Hrvoje; Kopjar, Mirela; Piližota, Vlasta


    Minimally processed and refrigerated vegetables can be contaminated with Listeria species bacteria including Listeria monocytogenes due to extensive handling during processing or by cross contamination from the processing environment. The objective of this study was to examine the microbiological quality of ready-to-eat minimally processed and refrigerated vegetables from supermarkets in Osijek, Croatia. 100 samples of ready-to-eat vegetables collected from different supermarkets in Osijek, Croatia, were analyzed for presence of Listeria species and Listeria monocytogenes. The collected samples were cut iceberg lettuces (24 samples), other leafy vegetables (11 samples), delicatessen salads (23 samples), cabbage salads (19 samples), salads from mixed (17 samples) and root vegetables (6 samples). Listeria species was found in 20 samples (20 %) and Listeria monocytogenes was detected in only 1 sample (1 %) of cut red cabbage (less than 100 CFU/g). According to Croatian and EU microbiological criteria these results are satisfactory. However, the presence of Listeria species and Listeria monocytogenes indicates poor hygiene quality. The study showed that these products are often improperly labeled, since 24 % of analyzed samples lacked information about shelf life, and 60 % of samples lacked information about storage conditions. With regard to these facts, cold chain abruption with extended use after expiration date is a probable scenario. Therefore, the microbiological risk for consumers of ready-to-eat minimally processed and refrigerated vegetables is not completely eliminated.


    Directory of Open Access Journals (Sweden)

    Imad al Kassaa


    Full Text Available Al Kassaa Imad, Khaled el Omari, Marwa Saati, Bachar Ismail and Monzer Hamze. 2016. Prevalence of Listeria monocytogenes in raw cow milk in north Lebanon. Lebanese Science Journal, 17(1: 39-45. Listeriosis, although a zoonosis, is an invasive disease that can affect newborns, pregnant women and immunocompromised adults. Clinical manifestations can be expressed by febrile gastroenteritis, invasive forms including severe sepsis, meningitis, rhombencephalitis, prenatal infections and abortions. Species of Listeria bacteria are ubiquitous and adaptable to the environment in animal and plant foods. This study aimed to determine the prevalence of Listeria monocytogenes in 100 samples of fresh cow milk collected from different areas of North Lebanon. Listeria monocytogenes was detected by using the Grand VIDAS technique (Biomérieux France. The results obtained revealed the absence of Listeria monocytogenes in all analyzed samples.

  12. Various Ready-to-Eat Products from Retail Stores Linked to Occurrence of Diverse Listeria monocytogenes and Listeria spp. Isolates. (United States)

    Vongkamjan, Kitiya; Fuangpaiboon, Janejira; Turner, Matthew P; Vuddhakul, Varaporn


    Listeriosis outbreaks have been associated with a variety of foods. This study investigated the prevalence and diversity of Listeria monocytogenes and Listeria spp. in ready-to-eat (RTE) products and evaluated the performance of a rapid detection method, the 3M molecular detection assay for L. monocytogenes (MDA-LM), for detection of L. monocytogenes. Assay results were compared with those obtained using the U.S. Food and Drug Administration standard culture method described in the Bacteriological Analytical Manual. Products (n = 200) were purchased from retail stores: 122 aquatic products, 22 products of animal origin, 18 vegetarian products, 15 deli meat products, 13 salad and vegetable products, 4 desserts, 2 egg-based products, and 4 other products. L. monocytogenes prevalence was comparable with both methods. Overall, 15 (7.5%) of 200 samples were positive for L. monocytogenes: 3% of aquatic products, 1.5% of products of animal origin, 1% of vegetarian products, and 2% of deli meat products. Compared with the standard culture method, the sensitivity, specificity, and the accuracy of the MDA-LM were 86.7% (95% confidence interval, 58.4 to 97.7%), 98.4% (95% confidence interval, 95.0 to 99.6%), and 97.5%, respectively. Using the culture-based method, 18 (9%) of 200 samples were positive for Listeria species other than L. monocytogenes. Listeria isolates from these samples were classified into nine allelic types (ATs). The majority of isolates were classified as ATs 58 and 74, which were identified as L. monocytogenes lineages I and IV, respectively. Listeria innocua and Listeria welshimeri also were represented by isolates of multiple ATs. The MDA-LM is a rapid and reliable technique for detecting L. monocytogenes in various RTE foods. Further study is needed to develop effective control strategies to reduce L. monocytogenes contamination in RTE foods.

  13. Prevalence of Listeria monocytogenes in poultry production in France. (United States)

    Chemaly, Marianne; Toquin, Marie-Therese; Le Nôtre, Yolene; Fravalo, Philippe


    This study aimed to update and create a data set from laying hens and broilers regarding contamination by Listeria monocytogenes. Two hundred laying-hen flocks were sampled, with 88 flocks reared in cages and 112 reared on the floor. One hundred forty-five broiler flocks were sampled, with 85 conventional and 60 free-range flocks. A total of 774 and 725 samples were analyzed from laying hens and broilers, respectively. L. monocytogenes was detected in 31 of 200 flocks, yielding an estimated prevalence of 15.5% in laying-hen flocks. Among positive flocks, there appeared a significant (P = 0.004) difference between caged and floor-reared hens, with a higher detection in dust samples from floor-reared hens. In positive caged hen flocks, significant (P = 0.028) differences between dust and fecal samples appeared, with a higher detection in feces than in dust samples. In broiler flocks, L. monocytogenes was isolated in 46 of 145 flocks, yielding an estimated prevalence of 32% (28% in conventional flocks versus 37% in the free-range flocks). L. monocytogenes was isolated in samples taken from conventional flocks with a lower frequency than in free-range flocks (13 versus 18%, respectively). The serotyping of L. monocytogenes strains showed that the majority belonged to type 1/2a in laying-hen flocks (74.3%) and in broiler flocks (40.5%). A significant difference (P = 0.007) between laying hens and broilers was shown for serogroup 4 and for serovar 1/2b (P = 0.007); these serogroups were more prevalent in broilers (40%) than in laying hens (5.7%).

  14. Comparison of two multiplex PCR assays for the detection of Listeria spp. and Listeria monocytogenes in biological samples

    Directory of Open Access Journals (Sweden)

    Budniak Sylwia


    Full Text Available Introduction: The aim of the study was to optimise and compare two multiplex PCR assays for the detection of Listeria spp. and Listeria monocytogenes in biological samples including the liver, brain, and blood. Material and Methods: Three strains of L. monocytogenes and single strains of each of the species: L. ivanovii, L. innocua, L. grayi, L. welshimeri, and L. seeligeri were used. Additionally, five other species of bacterium were used to evaluate the specificity of the tests. Results: Specific amplification products were obtained for both multiplex PCR assays, which confirmed the tested strains as Listeria spp. and L. monocytogenes, respectively. Isolates of other species did not yield PCR products. Conclusion: Both multiplex PCR assays proved to be significantly sensitive and highly-specific methods for the detection of Listeria strains.

  15. Listeria spp. E Listeria monocytogenes NA PRODUÇÃO DE SALSICHAS TIPO HOT DOG

    Directory of Open Access Journals (Sweden)



    Full Text Available Listeria monocytogenes is widely distributed in the environment and it has been isolated from food that were associated to outbreaks of high lethality in many countries. Thus, this bacterium represents an important pathogen to the public health. Ready-to-eat products, likecooked stuffed food, within them, frankfurters, are associated to human listeriosis in many countries. Taking into consideration the importance of the subject and the need of more data about it, the occurrence of Listeria spp. and L. monocytogenes in industrial plants, in meat raw materials, in slurry and frankfurters was investigated.These samples were collected in two production plants with SIF (Federal Inspection Service; in one of them GMP, HACCP and SOP were implemented. The results of the 1 06 microbiological analysis were submitted to the program @Risk to obtain the risk analysis; the meanvalues results showed that 7 to 9% of the frankfurters in the market may have L. monocytogenes. The analysis indicated that 88 strains of L. monocytogenes were obtained from 1 06 samples; among them, 76 werecollected in the industrial plants that participate in the experiment, and 30 were collected in the market. In serological typification, 95% of these strains were classified as serotypes 4b, 1 /2a and 1 /2b. Besides the presence of the bacterium in frankfurthers consumed inBrazil and the risk factors associated to this pathogen, the situation concerns because of the lack of epidemiological data, absence of patterns and the deficient information given to the consumer, specially information related to the presence of L. monocytogenes, particularly important to the groups at risk, as well as information related to the importance of heating the product

  16. Towards a systemic understanding of Listeria monocytogenes metabolism during infection

    Directory of Open Access Journals (Sweden)

    Thilo M Fuchs


    Full Text Available Listeria monocytogenes is a foodborne human pathogen that can cause invasive infection in susceptible animals and humans. For proliferation within hosts, this facultative intracellular pathogen uses a reservoir of specific metabolic pathways, transporter and enzymatic functions whose expression requires the coordinated activity of a complex regulatory network. The highly adapted metabolism of L. monocytogenes strongly depends on the nutrient composition of various milieus encountered during infection. Transcriptomic and proteomic studies revealed the spatial-temporal dynamic of gene expression of this pathogen during replication within cultured cells or in vivo. Metabolic clues are the utilization of unusual C2- and C3-bodies, the metabolism of pyruvate, thiamine availability, the uptake of peptides, the acquisition or biosynthesis of certain amino acids, and the degradation of glucose-phosphate via the pentose phosphate pathway. These examples illustrate the interference of in vivo conditions with energy, carbon and nitrogen metabolism, thus affecting listerial growth. The exploitation, analysis and modelling of the available data sets served as a first attempt to a systemic understanding of listerial metabolism during infection. L. monocytogenes might serve as a model organism for systems biology of a Gram-positive, facultative intracellular bacterium.

  17. Postenrichment population differentials using buffered Listeria enrichment broth: implications of the presence of Listeria innocua on Listeria monocytogenes in food test samples. (United States)

    Keys, Ashley L; Dailey, Rachel C; Hitchins, Anthony D; Smiley, R Derike


    The recovery of low levels of Listeria monocytogenes from foods is complicated by the presence of competing microorganisms. Nonpathogenic species of Listeria pose a particular problem because variation in growth rate during the enrichment step can produce more colonies of these nontarget cells on selective and/or differential media, resulting in a preferential recovery of nonpathogens, especially Listeria innocua. To gauge the extent of this statistical barrier to pathogen recovery, 10 isolates each of L. monocytogenes and L. innocua were propagated together from approximately equal initial levels using the current U. S. Food and Drug Administration's enrichment procedure. In the 100 isolate pairs, an average 1.3-log decrease was found in the 48-h enrichment L. monocytogenes population when L. innocua was present. In 98 of the 100 isolate pairs, L. innocua reached higher levels at 48 h than did L. monocytogenes, with a difference of 0.2 to 2.4 log CFU/ml. The significance of these population differences was apparent by an increase in the difficulty of isolating L. monocytogenes by the streak plating method. L. monocytogenes went completely undetected in 18 of 30 enrichment cultures even after colony isolation was attempted on Oxoid chromogenic Listeria agar. This finding suggests that although both Listeria species were present on the plate, the population differential between them restricted L. monocytogenes to areas of the plate with confluent growth and that isolated individual colonies were only L. innocua.

  18. Postenrichment Population Differentials Using Buffered Listeria Enrichment Broth: Implications of the Presence of Listeria innocua on Listeria monocytogenes in Food Test Samples† (United States)



    The recovery of low levels of Listeria monocytogenes from foods is complicated by the presence of competing microorganisms. Nonpathogenic species of Listeria pose a particular problem because variation in growth rate during the enrichment step can produce more colonies of these nontarget cells on selective and/or differential media, resulting in a preferential recovery of nonpathogens, especially Listeria innocua. To gauge the extent of this statistical barrier to pathogen recovery, 10 isolates each of L. monocytogenes and L. innocua were propagated together from approximately equal initial levels using the current U.S. Food and Drug Administration’s enrichment procedure. In the 100 isolate pairs, an average 1.3-log decrease was found in the 48-h enrichment L. monocytogenes population when L. innocua was present. In 98 of the 100 isolate pairs, L. innocua reached higher levels at 48 h than did L. monocytogenes, with a difference of 0.2 to 2.4 log CFU/ml. The significance of these population differences was apparent by an increase in the difficulty of isolating L. monocytogenes by the streak plating method. L. monocytogenes went completely undetected in 18 of 30 enrichment cultures even after colony isolation was attempted on Oxoid chromogenic Listeria agar. This finding suggests that although both Listeria species were present on the plate, the population differential between them restricted L. monocytogenes to areas of the plate with confluent growth and that isolated individual colonies were only L. innocua. PMID:24215687

  19. Visualization of gold and platinum nanoparticles interacting with Salmonella enteritidis and Listeria monocytogenes

    DEFF Research Database (Denmark)

    Sawosz, Ewa; Chwalibog, André; Szeliga, Jacek


    -Au and nano-Pt respectively), with Salmonella Enteritidis (Gram-negative) and Listeria monocytogenes (Gram-positive), to reveal possibilities of constructing bacteria-nanoparticle vehicles. Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano......-Au + Salmonella Enteritidis; nano-Au + Listeria monocytogenes; nano-Pt + Salmonella Enteritidis; nano-Pt + Listeria monocytogenes. Samples were inspected by transmission electron microscope. Results: Visualization of morphological interaction between nano-Au and Salmonella Enteritidis and Listeria monocytogenes...... of Salmonella Enteritidis, nano-Pt were seen inside bacteria cells, probably bound to DNA and partly left bacterial cells. After washing and centrifugation, some of the nano-Pt-DNA complexes were observed within Salmonella Enteritidis. Conclusion: The results indicate that the bacteria could be used...

  20. Characteristics of the biologically active 35-kDa metalloprotease virulence factor from Listeria monocytogenes

    NARCIS (Netherlands)

    Coffey, A; van den Burg, B; Veltman, R; Abee, T

    Listeria monocytogenes, a facultative intracellular pathogen, synthesizes an extracellular protease which is responsible for the maturation of phosphatidylcholine phospholipase C (lecithinase), a virulence factor involved in cell-to-cell spread. This work describes the environmental parameters

  1. Effects of ultraviolet-B exposure on the resistance to Listeria monocytogenes in the rat

    NARCIS (Netherlands)

    Goettsch W; Garssen J; de Klerk A; Herremans MMPT; Dortant P; de Gruijl FR; van Loveren H; LPI; VIR; UU


    Een Listeria monocytogenes infectiemodel in de rat werd gebruikt om de immuunsuppressieve activiteit van ultraviolet-B straling (UVB) te onderzoeken. Ratten werden dagelijks blootgesteld aan suberythemale hoeveelheden UVB straling gedurende 5 of 7 opeenvolgende dagen. Twee verschillende UV bronnen

  2. Internalization of Listeria monocytogenes in cantaloupes during dump tank washing and hydrocooling (United States)

    Recent listeriosis outbreaks and recalls associated with cantaloupes urge for studies to understand the mechanisms of cantaloupe contamination by Listeria monocytogenes. Postharvest practices such as washing and hydrocooling were suggested to facilitate the contamination of fresh fruits by human pat...

  3. Listeria monocytogenes Prevalence and Characteristics in Retail Raw Foods in China

    National Research Council Canada - National Science Library

    Wu, Shi; Wu, Qingping; Zhang, Jumei; Chen, Moutong; Yan, Ze An; Hu, Huijuan


    The prevalence and levels of Listeria monocytogenes in retail raw foods covering most provincial capitals in China were studied with testing of 1036 samples of vegetables, edible mushrooms, raw meat...

  4. Transcriptional and phenotypic responses of Listeria monocytogenes to chlorine dioxide. (United States)

    Pleitner, Aaron M; Trinetta, Valentina; Morgan, Mark T; Linton, Richard L; Oliver, Haley F


    Significant food-borne disease outbreaks have occurred from consumption of ready-to-eat foods, including produce, contaminated with Listeria monocytogenes. Challenging food matrices (e.g., cantaloupe, sprouts) with limited processing steps postharvest to reduce pathogen loads have underscored a need for new mitigation strategies. Chlorine dioxide (ClO2) is increasingly being used in produce and other food systems to reduce food-borne pathogen levels. The goal of this study was to characterize the transcriptional response and survival of L. monocytogenes 10403S exposed to ClO2. The transcriptional profile of log-phase cells exposed to 300 mg/liter ClO2 for 15 min was defined by whole-genome microarray. A total of 340 genes were significantly differentially expressed. Among the differentially expressed genes, 223 were upregulated (fold change ≥ 1.5; adjusted P value < 0.05) in role categories responsible for protein fate, cellular processes, and energy metabolism. There were 113 and 16 genes differentially expressed belonging to regulatory networks of σ(B) and CtsR, respectively. We assessed L. monocytogenes 10403S survival after exposure to 100, 300, and 500 mg/liter aqueous ClO2 in brain heart infusion (BHI) broth; there was a significant difference between cells exposed to 500 mg/liter ClO2 and those exposed to all other conditions over time (P value < 0.05). Isogenic ΔsigB and ΔctsR mutants exposed to 300 mg/liter ClO2 were more sensitive to ClO2 than the wild type under the same conditions. These results provide an initial insight into the mechanisms that L. monocytogenes employs to survive sublethal ClO2 and further our understanding of the inactivation mechanisms of this increasingly used sanitizer.

  5. How Listeria monocytogenes organizes its surface for virulence

    Directory of Open Access Journals (Sweden)

    Filipe eCarvalho


    Full Text Available Listeria monocytogenes is a Gram-positive pathogen responsible for the manifestation of human listeriosis, an opportunistic foodborne disease with an associated high mortality rate. The key to the pathogenesis of listeriosis is the capacity of this bacterium to trigger its internalization by non-phagocytic cells and to survive and even replicate within phagocytes. The arsenal of virulence proteins deployed by L. monocytogenes to successfully promote the invasion and infection of host cells has been progressively unveiled over the past decades. A large majority of them are located at the cell envelope, which provides an interface for the establishment of close interactions between these bacterial factors and their host targets. Along the multistep pathways carrying these virulence proteins from the inner side of the cytoplasmic membrane to their cell envelope destination, a multiplicity of auxiliary proteins must act on the immature polypeptides to ensure that they not only maturate into fully functional effectors but also are placed or guided to their correct position in the bacterial surface. As the major scaffold for surface proteins, the cell wall and its metabolism are critical elements in listerial virulence. Conversely, the crucial physical support and protection provided by this structure make it an ideal target for the host immune system. Therefore, mechanisms involving fine modifications of cell envelope components are activated by L. monocytogenes to render it less recognizable by the innate immunity sensors or more resistant to the activity of antimicrobial effectors. This review provides a state-of-the-art compilation of the mechanisms used by L. monocytogenes to organize its surface for virulence, with special focus on those proteins that work behind the frontline, either supporting virulence effectors or ensuring the survival of the bacterium within its host.

  6. How Listeria monocytogenes organizes its surface for virulence (United States)

    Carvalho, Filipe; Sousa, Sandra; Cabanes, Didier


    Listeria monocytogenes is a Gram-positive pathogen responsible for the manifestation of human listeriosis, an opportunistic foodborne disease with an associated high mortality rate. The key to the pathogenesis of listeriosis is the capacity of this bacterium to trigger its internalization by non-phagocytic cells and to survive and even replicate within phagocytes. The arsenal of virulence proteins deployed by L. monocytogenes to successfully promote the invasion and infection of host cells has been progressively unveiled over the past decades. A large majority of them is located at the cell envelope, which provides an interface for the establishment of close interactions between these bacterial factors and their host targets. Along the multistep pathways carrying these virulence proteins from the inner side of the cytoplasmic membrane to their cell envelope destination, a multiplicity of auxiliary proteins must act on the immature polypeptides to ensure that they not only maturate into fully functional effectors but also are placed or guided to their correct position in the bacterial surface. As the major scaffold for surface proteins, the cell wall and its metabolism are critical elements in listerial virulence. Conversely, the crucial physical support and protection provided by this structure make it an ideal target for the host immune system. Therefore, mechanisms involving fine modifications of cell envelope components are activated by L. monocytogenes to render it less recognizable by the innate immunity sensors or more resistant to the activity of antimicrobial effectors. This review provides a state-of-the-art compilation of the mechanisms used by L. monocytogenes to organize its surface for virulence, with special focus on those proteins that work “behind the frontline”, either supporting virulence effectors or ensuring the survival of the bacterium within its host. PMID:24809022

  7. Ecology of Listeria spp. in a fish farm and molecular typing of Listeria monocytogenes from fish farming and processing companies. (United States)

    Miettinen, Hanna; Wirtanen, Gun


    This study focused on the ecology of Listeria monocytogenes in a fish farm by following the changes in its occurrence in different types of samples for a three year period. In addition, L. monocytogenes isolates from different seafood industry areas were compared with pulsed field gel electrophoresis (PFGE) typing to discover possible associations between primary production, further processing and final products. Weather conditions were found to have a strong influence on the probability of finding Listeria spp. in a fish farm environment. The number of samples contaminated with Listeria spp. was typically bigger after rainy periods. Brook and river waters as well as other runoff waters seemed to be the main contamination source at the farm studied. The farmed fish originally found to carry L. monocytogenes become gradually Listeria free. The time needed for the purification of the fish was several months. The sea bottom soil samples were the ones that preserved the L. monocytogenes contamination the longest time. It can be stated that the fish and fish farm equipment studied did not spread listeria contamination. On the contrary, they were found to suffer from listeria contamination coming from outside sources like the brook water. There was a wide range of different L. monocytogenes PFGE-pulsotypes (30) found at 15 Finnish fish farms and fish processing factories. L. monocytogenes isolates from the final products often belonged to the same pulsotypes as did the isolates from the processing environment as well as from the raw fish. This suggests that, in addition to the fish processing factory environment, the fish raw materials are important sources of L. monocytogenes contamination in final products.

  8. Distribution of the bacteria Listeria monocytogenes in the western part of the Sea of Okhotsk (United States)

    Terekhova, V. E.; Sosnin, V. A.; Buzoleva, L. S.; Shakirov, R. B.


    The Amur River’s influence on the distribution of the opportunistic bacteria Listeria monocytogenes in the western part of the Sea of Okhotsk is discussed. The presence of Listeria in the seawater, sea ice, and sediments on the northeastern Sakhalin shelf and slope supports the idea of its connection with the Amur River discharge. The hypothesis of the allochtonic parentage of L. monocytogenes in the sea’s development is proved.

  9. Vascular Endograft Infection with Listeria monocytogenes reated with Surgical Debridement but without Graft Removal

    Directory of Open Access Journals (Sweden)

    Beate Tanner-Steinmann


    Full Text Available The awareness of Listeria monocytogenes as a pathogen in meningitis and bacteremia in immunosuppressed patients is high. We report a case of vascular graft infection due to Listeria monocytogenes as an example of a less well-known manifestation of listeriosis and focus on the possible treatment procedures emphasizing a management with surgical debridement but preservation of the endograft, in contrast to the gold standard treatment of vascular graft infections which consists of a removal of the graft.

  10. Lineage specific recombination rates and microevolution in Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Nightingale Kendra K


    Full Text Available Abstract Background The bacterium Listeria monocytogenes is a saprotroph as well as an opportunistic human foodborne pathogen, which has previously been shown to consist of at least two widespread lineages (termed lineages I and II and an uncommon lineage (lineage III. While some L. monocytogenes strains show evidence for considerable diversification by homologous recombination, our understanding of the contribution of recombination to L. monocytogenes evolution is still limited. We therefore used STRUCTURE and ClonalFrame, two programs that model the effect of recombination, to make inferences about the population structure and different aspects of the recombination process in L. monocytogenes. Analyses were performed using sequences for seven loci (including the house-keeping genes gap, prs, purM and ribC, the stress response gene sigB, and the virulence genes actA and inlA for 195 L. monocytogenes isolates. Results Sequence analyses with ClonalFrame and the Sawyer's test showed that recombination is more prevalent in lineage II than lineage I and is most frequent in two house-keeping genes (ribC and purM and the two virulence genes (actA and inlA. The relative occurrence of recombination versus point mutation is about six times higher in lineage II than in lineage I, which causes a higher genetic variability in lineage II. Unlike lineage I, lineage II represents a genetically heterogeneous population with a relatively high proportion (30% average of genetic material imported from external sources. Phylograms, constructed with correcting for recombination, as well as Tajima's D data suggest that both lineages I and II have suffered a population bottleneck. Conclusion Our study shows that evolutionary lineages within a single bacterial species can differ considerably in the relative contributions of recombination to genetic diversification. Accounting for recombination in phylogenetic studies is critical, and new evolutionary models that

  11. Prevalence of Listeria monocytogenes in raw bovine milk and milk products from central highlands of Ethiopia. (United States)

    Seyoum, Eyasu Tigabu; Woldetsadik, Daniel Asrat; Mekonen, Tesfu Kassa; Gezahegn, Haile Alemayehu; Gebreyes, Wondwossen Abebe


    Listeria monocytogenes is of major significance in human and veterinary medicine. Most human Listeria infections are foodborne and the association of contaminated milk and dairy produce consumption with human listeriosis is noteworthy. In Ethiopia, there is limited data regarding the prevalence of L. monocytogenes in raw bovine milk and dairy products. The aim of this study was, therefore, to determine the prevalence of L. monocytogenes in raw bovine milk and dairy produce. A total of 443 milk and milk product samples were microbiologically analyzed following methods recommended by the U.S. Food and Drug Administration Bacteriological Analytical Manual to isolate Listeria spp. The overall prevalence of Listeria spp. was 28.4% and specifically that of L. monocytogenes was 5.6%. Taking the prevalence of Listeria spp. into consideration, cheese was found to be highly contaminated at 60%, followed by pasteurized milk samples (40%), raw milk (18.9%) and yoghurt (5%). Considering the prevalence of Listeria monocytogenes only, raw milk had the lowest contamination while cheese had the highest, followed by pasteurized milk and yoghurt. Raw milk and milk products produced in urban and peri-urban areas of central Ethiopia were contaminated with pathogenic bacteria, L. monocytogenes. The detection of this pathogen in raw milk and milk products warrants an urgent regulatory mechanism to be put in place and also the potential role of milk processing plants in the contamination of dairy products should be investigated.

  12. Genetic dissection of DivIVA functions in Listeria monocytogenes. (United States)

    Kaval, Karan Gautam; Hauf, Samuel; Rismondo, Jeanine; Hahn, Birgitt; Halbedel, Sven


    DivIVA is a membrane binding protein that clusters at curved membrane regions such as the cell poles and the membrane invaginations occurring during cell division. DivIVA proteins recruit many other proteins to these subcellular sites through direct protein-protein interactions. DivIVA-dependent functions are typically associated with cell growth and division, even though species-specific differences in the spectrum of DivIVA functions and their causative interaction partners exist. DivIVA from the Gram-positive human pathogen Listeria monocytogenes has at least three different functions. In this bacterium, DivIVA is required for precise positioning of the septum at mid-cell, it contributes to secretion of autolysins required for breakdown of peptidoglycan at the septum after completion of cell division, and it is essential for flagellar motility. While the DivIVA interaction partners for control of division site selection are well-established, the proteins connecting DivIVA with autolysin secretion or swarming motility are completely unknown. We set out to identify divIVA alleles, in which these three DivIVA functions could be separated, since the question of the degree to which the three functions of L. monocytogenes DivIVA are interlinked could not be answered before. Here, we identify such alleles, and our results show that division site selection, autolysin secretion, and swarming represent three discrete pathways that are independently influenced by DivIVA. These findings provide the required basis for the identification of DivIVA interaction partners controlling autolysin secretion and swarming in the future.IMPORTANCE DivIVA of the pathogenic bacterium Listeria monocytogenes is a central scaffold protein that influences at least three different cellular processes, namely cell division, protein secretion and bacterial motility. How DivIVA coordinates these rather unrelated processes is not known. We here identify variants of L. monocytogenes DivIVA, in which

  13. InlB-mediated Listeria monocytogenes internalization requires a balanced phospholipase D activity maintained through phospho-cofilin

    NARCIS (Netherlands)

    Han, Xuelin; Yu, Rentao; Ji, Lei; Zhen, Dongyu; Tao, Sha; Li, Shuai; Sun, Yansong; Huang, Liuyu; Feng, Zhe; Li, Xianping; Han, Gaige; Schmidt, Martina; Han, Li

    Internalization of Listeria monocytogenes into non-phagocytic cells is tightly controlled by host cell actin dynamics and cell membrane alterations. However, knowledge about the impact of phosphatidylcholine cleavage driven by host cell phospholipase D (PLD) on Listeria internalization into

  14. Transfer of antibiotic resistance from Enterococcus faecium of fermented meat origin to Listeria monocytogenes and Listeria innocua. (United States)

    Jahan, M; Holley, R A


    Listeria monocytogenes is an important foodborne pathogen that can cause infection in children, pregnant women, the immunocompromised and the elderly. Antibiotic resistance in this species would represent a significant public health problem since the organism has a high fatality/case ratio and resistance may contribute to failure of therapeutic treatment. This study was designed to explore whether the in vitro transferability of antibiotic resistance from enterococci to Listeria spp. could occur. It was found that 2/8 Listeria strains were able to acquire tetracycline resistance from Enterococcus faecium. Listeria monocytogenes GLM-2 acquired the resistance determinant tet(M) and additional streptomycin resistance through in vitro mating with Ent. faecium S27 isolated from commercial fermented dry sausage. Similarly, Listeria innocua became more resistant to tetracycline, but the genetic basis for this change was not confirmed. It has been suggested that enterococci may transfer antibiotic resistance genes via transposons to Listeria spp., and this may explain, in part, the origin of their antibiotic resistance. Thus, the presence of enterococci in food should not be ignored since they may actively contribute to enhanced antibiotic resistance of L. monocytogenes and other pathogens. Acquisition of antibiotic resistance by pathogenic bacteria in the absence of antibiotic pressure represents an unquantified threat to human health. In the present work resistance to tetracycline and streptomycin were transferred by nonplasmid-based conjugation from Enterococcus faecium isolated from fermented sausage to Listeria monocytogenes and Listeria innocua. Thus, natural transfer of antibiotic resistance to Listeria strains may occur in the future which reinforces the concern about the safety of enterococcal strains present in foods. © 2016 The Society for Applied Microbiology.

  15. Detection of Listeria monocytogenes in CSF from Three Patients with Meningoencephalitis by Next-Generation Sequencing (United States)

    Yao, Ming; Zhou, Jiali; Zhu, Yicheng; Zhang, Yinxin; Lv, Xia; Sun, Ruixue; Shen, Ao; Ren, Haitao; Cui, Liying


    Background and Purpose Encephalitis caused by Listeria monocytogenes (L. monocytogenes) is rare but sometimes fatal. Early diagnosis is difficult using routine cerebrospinal fluid (CSF) tests, while next-generation sequencing (NGS) is increasingly being used for the detection and characterization of pathogens. Methods This study set up and applied unbiased NGS to detect L. monocytogenes in CSF collected from three cases of clinically suspected listeria meningoencephalitis. Results Three cases of patients with acute/subacute meningoencephalitis are reported. Magnetic resonance imaging and blood cultures led to a suspected diagnosis of L. monocytogenes, while the CSF cultures were negative. Unbiased NGS of CSF identified and sequenced reads corresponding to L. monocytogenes in all three cases. Conclusions This is the first report highlighting the feasibility of applying NGS of CSF as a diagnostic method for central nervous system (CNS) L. monocytogenes infection. Routine application of this technology in clinical microbiology will significantly improve diagnostic methods for CNS infectious diseases.

  16. Stability of sublethal acid stress adaptaion and induced cross protection against lauric arginate in Listeria monocytogenes (United States)

    The stability of acid stress adaptation in Listeria monocytogenes and its induced cross protection effect against GRAS (generally recognized as safe) antimicrobial compounds has never been investigated before. In the present study, the acid stress adaptation in L. monocytogenes was initially induced...

  17. Listeria monocytogenes DNA glycosylase AdiP affects flagellar motility, biofilm formation, virulence, and stress responses (United States)

    The temperature-dependent alteration of flagellar motility gene expression is critical for the foodborne pathogen Listeria monocytogenes to respond to a changing environment. In this study, a genetic determinant, L. monocytogenes f2365_0220 (lmof2365_0220), encoding a putative protein that is struct...

  18. A dynamical systems approach to actin-based motility in Listeria monocytogenes (United States)

    Hotton, S.


    A simple kinematic model for the trajectories of Listeria monocytogenes is generalized to a dynamical system rich enough to exhibit the resonant Hopf bifurcation structure of excitable media and simple enough to be studied geometrically. It is shown how L. monocytogenes trajectories and meandering spiral waves are organized by the same type of attracting set.

  19. Influence of temperature on acid-stress adaptation in Listeria monocytogenes (United States)

    Several factors play critical roles in controlling the induction of acid-stress adaptation in L. monocytogenes. Our findings show that temperature plays a significant role in the induction of acid-stress adaptation in Listeria monocytogenes and two distinct patterns were observed: (I) Presence of su...

  20. Listeria monocytogenes detection and behaviour in food and in the environment.

    NARCIS (Netherlands)

    Beumer, R.R.


    In this thesis, Listeria monocytogenes, a bacterial pathogen was studied, with emphasis on the detection and behaviour in food and environment.Epidemics of foodborne listeriosis have raised concern about the incidence of L. monocytogenes in foods. In the past 10-15 years listeriosis has emerged as a

  1. Diversity assessment of Listeria monocytogenes biofilm formation: Impact of growth condition, serotype and strain origin

    NARCIS (Netherlands)

    Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.


    The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that wer

  2. A novel suicide plasmid for efficient gene mutation in Listeria monocytogenes (United States)

    Although several plasmids have been used in Listeria monocytogenes for generating mutants by allelic exchange, construction of L. monocytogenes mutants has been inefficient due to lack of effective selection markers for first and second recombination events. To address this problem, we have develope...

  3. Betaine and L-carnitine transport by Listeria monocytogenes Scott A in response to osmotic signals

    NARCIS (Netherlands)

    Verheul, Annette; Glaasker, Erwin; Poolman, Bert; Abee, Tjakko


    The naturally occurring compatible solutes betaine and L-carnitine allow the food-borne pathogen Listeria monocytogenes to adjust to environments of high osmotic strength. Previously, it was demonstrated that L. monocytogenes possesses an ATP-dependent L-carnitine transporter. The present study reve

  4. Isolation and characterization of an atypical Listeria monocytogenes associated with a canine urinary tract infection (United States)

    Listeria monocytogenes, a well-described cause of encephalitis and abortion in ruminants and of food-borne illness in humans, is rarely associated with disease in companion animals. A case of urinary tract infection associated with an atypical, weakly hemolytic L. monocytogenes strain is described i...

  5. Determination of thermal inactivation kinetics of Listeria monocytogenes in chicken meat by isothermal and dynamic methods (United States)

    The objective of this research is to determine the thermal inactivation kinetics of Listeria monocytogenes in chicken breast meat using both isothermal and dynamic conditions. A four-strain cocktail of L. monocytogenes was inoculated to chicken breast meat. Isothermal studies were performed by sub...

  6. Performance of stress resistant variants of Listeria monocytogenes in mixed species biofilms with Lactobacillus plantarum

    NARCIS (Netherlands)

    Metselaar, K.I.; Saa Ibusquiza, P.; Ortiz Camargo, A.R.; Krieg, M.; Zwietering, M.H.; Besten, den H.M.W.; Abee, T.


    Population diversity and the ability to adapt to changing environments allow Listeria monocytogenes to grow and survive under a wide range of environmental conditions. In this study, we aimed to evaluate the performance of a set of acid resistant L. monocytogenes variants in mixed-species biofilms w

  7. Surface attachment of Listeria monocytogenes is induced by sublethal concentrations of alcohol at low temperatures. (United States)

    Gravesen, Anne; Lekkas, Charidimos; Knøchel, Susanne


    Sublethal concentrations of ethanol or isopropanol increased attachment of Listeria monocytogenes at 10, 20, or 30 degrees C; no induction occurred at 37 degrees C. The alcohol induction phenotype was retained in sigB and cesRK mutants; however, the degree of induction was affected. These results suggest that alcohol may contribute to the persistence of L. monocytogenes.

  8. Physiology of Listeria monocytogenes in relation to food components and biopreservation.

    NARCIS (Netherlands)

    Verheul, A.


    Listeria monocytogenes is an important foodborne pathogen that has been responsible for severe infections in humans. The ubiquitous distribution of L. monocytogenes in the environment and its ability to grow at refrigeration temperature and at high osmolarity are of paramount importance for its haz

  9. Betaine and L-carnitine transport by Listeria monocytogenes Scott A in response to osmotic signals

    NARCIS (Netherlands)

    Verheul, Annette; Glaasker, Erwin; Poolman, Bert; Abee, Tjakko


    The naturally occurring compatible solutes betaine and L-carnitine allow the food-borne pathogen Listeria monocytogenes to adjust to environments of high osmotic strength. Previously, it was demonstrated that L. monocytogenes possesses an ATP-dependent L-carnitine transporter. The present study

  10. The fate of Listeria monocytogenes in brine and on Gouda cheese following artificial contamination during brining

    NARCIS (Netherlands)

    Wemmenhove, E.; Beumer, R.R.; Hooijdonk, van A.C.M.; Zwietering, M.H.; Wells-Bennik, M.H.J.


    The fate of 3 different Listeria monocytogenes strains (Scott A, 2F and 6E) was studied independently in brine and on factory-scale Gouda cheeses that had been submerged in brine that was artificially contaminated with these individual strains. Viable numbers of L. monocytogenes in the brine

  11. Diversity assessment of Listeria monocytogenes biofilm formation: Impact of growth condition, serotype and strain origin

    NARCIS (Netherlands)

    Kadam, S.R.; Besten, den H.M.W.; Veen, van der S.; Zwietering, M.H.; Moezelaar, R.; Abee, T.


    The foodborne pathogen Listeria monocytogenes has the ability to produce biofilms in food-processing environments and then contaminate food products, which is a major concern for food safety. The biofilm forming behavior of 143 L. monocytogenes strains was determined in four different media that

  12. Microbiological criteria for Listeria monocytogenes in foods under special consideration of risk assessment approaches

    DEFF Research Database (Denmark)

    Nørrung, Birgit


    This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L. m...

  13. Listeria monocytogenes Meningitis in an Immunosuppressed Patient with Autoimmune Hepatitis and IgG4 Subclass Deficiency

    DEFF Research Database (Denmark)

    Gaini, Shahin


    A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode...... revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis...... and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine....

  14. Modeling the inactivation of Salmonella Typhimurium, Listeria monocytogenes, and Salmonella Enteritidis on poultry products exposed to pulsed UV light

    National Research Council Canada - National Science Library

    Keklik, Nene M; Demirci, Ali; Puri, Virendra M; Heinemann, Paul H


    Pulsed UV light inactivation of Salmonella Typhimurium on unpackaged and vacuum-packaged chicken breast, Listeria monocytogenes on unpackaged and vacuum-packaged chicken frankfurters, and Salmonella...

  15. Physiological damages of Listeria monocytogenes treated by high hydrostatic pressure. (United States)

    Ritz, M; Tholozan, J L; Federighi, M; Pilet, M F


    High hydrostatic pressure is a new food preservation technology known for its capacity to inactivate spoilage and pathogenic microorganisms. This study investigated the damages inflicted on Listeria monocytogenes cells treated by high pressure for 10 min at 400 MPa in pH 5.6 citrate buffer. Under these conditions, no cell growth occurred after 48 h on plate count agar. Scanning electron microscopy (SEM) revealed that cellular morphology was not really affected. Measuring propidium iodide (PI) staining followed by flow cytometry demonstrated that membrane integrity was damaged in a small part of the population, although the membrane potential evaluated by oxonol fluorescence or measured by analytical methods was reduced from - 86 to - 5 mV. These results for the first time showed that such combined methods as fluorescent dyes monitored by flow cytometry and physiological activity measurements provide valuable indications on cellular viability.

  16. Spontaneous Bacterial Peritonitis Caused by Infection with Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Michael Vincent F. Tablang


    Full Text Available Spontaneous bacterial peritonitis is a severe and life-threatening complication in patients with ascites caused by advanced liver disease. The organisms most commonly involved are coliform bacteria and third-generation cephalosporins are the empiric antibiotics of choice. This is an uncommon case of spontaneous bacterial peritonitis caused by Listeria monocytogenes in a female patient with liver cirrhosis from autoimmune hepatitis. She did not improve with ceftriaxone and her course was complicated by hepatic encephalopathy, seizures and multi-organ failure. This case emphasizes that a high index of suspicion should be maintained for timely diagnosis and treatment. Listerial peritonitis should be suspected in patients with end-stage liver disease and inadequate response to conventional antibiotics within 48–72 h. Ampicillin/sulbactam should be initiated while awaiting results of ascitic fluid or blood culture.

  17. Effect of Filling Type and Heating Method on Prevalence of Listeria species and Listeria monocytogenes in Dumplings Produced in Poland. (United States)

    Szymczak, Barbara; Dąbrowski, Waldemar


    The count of Listeria monocytogenes was determined, before and after heat treatment, in 200 samples of dumplings of 9 brands and with different types of stuffing. Analyses were conducted according to ISO 11290-1 standard and with real-time PCR method. The highest count of L. monocytogenes was found in meat dumplings (10(2) to 10(4) CFU/g), whereas products with white cheese-potato stuffing and vegetable-mushroom stuffing contained significantly less Listeria, 20 to 80 and 5 to 32 CFU/g, respectively. In cooled meat dumplings the extent of contamination depended significantly on the producer. In addition, a significant (P Listeria sp. and L. monocytogenes were isolated from cooked dumplings with fruits (strawberries or blueberries).

  18. The SOS response of Listeria monocytogenes is involved in stress resistance and mutagenesis

    NARCIS (Netherlands)

    Veen, van der S.; Schalkwijk, van S.; Molenaar, D.; Vos, de W.M.; Abee, T.; Wells-Bennik, M.H.J.


    The SOS response is a conserved pathway that is activated under certain stress conditions and is regulated by the repressor LexA and the activator RecA. The food-borne pathogen Listeria monocytogenes contains RecA and LexA homologs, but their roles in Listeria have not been established. In this stud

  19. Symptomatic hydrocephalus in a newborn infected with listeria monocytogenes Hidrocefalia sintomática em um recém-nascido infectado com Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Analía L. Laciar


    Full Text Available Central nervous system infections caused by Listeria monocytogenes produce a wide range of clinical symptoms which include cerebral abscesses, meningitis and nonmeningitic parenchymal cerebritis. A case study is presented of early listeriosis with signs of meningitis accompanied with septicemia and complicated with severe hydrocephalus.As infecções do sistema nervoso central produzidas por Listeria monocytogenes provocam una grande variedade de sintomas clínicos que incluem abscessos cerebrais, meningites e cerebrites parenquimáticas não meningíticas. Apresenta-se um caso de listeriose precoce com sinais de meningite acompanhada de septicemia e agravado com hidrocefalia grave.

  20. Prevalence, antimicrobial susceptibility and virulotyping of Listeria species and Listeria monocytogenes isolated from open-air fish markets. (United States)

    Jamali, Hossein; Paydar, Mohammadjavad; Ismail, Salmah; Looi, Chung Yeng; Wong, Won Fen; Radmehr, Behrad; Abedini, Atefeh


    The aim of this study was to investigate the prevalence and characterization of Listeria species and Listeria monocytogenes isolated from raw fish and open-air fish market environments. Eight hundred and sixty two samples including raw fish and fish market environments (samples from workers' hands, workers' knives, containers and work surface) were collected from the open-air fish markets in the Northern region of Iran. Listeria spp. was isolated from 104/488 (21.3%) raw fish and 29/374 (7.8%) of samples from open-air fish market environment. The isolates of Listeria spp. included L. innocua (35.3%), L. monocytogenes (32.3%), L. seeligeri (18%), and L. ivanovii (14.3%). Of the 43 L. monocytogenes isolates, 31 (72.1%), 10 (23.3%) and 2 (4.7%) belonged to serovars 1/2a, 4b, and 1/2b, respectively. The inlA, inlB, inlC, inlJ, actA, hlyA, iap, plcA, and prfA virulence-associated genes were detected in almost all of the L. monocytogenes isolates. The Listeria spp. isolates showed high resistance against tetracycline (23.3%), penicillin G, and cephalothin (each 16.5%). Besides, we observed significant resistance level to tetracycline (27.9%), ampicillin (20.9%), cephalothin, penicillin G, and streptomycin (each 16.3%) in the L. monocytogenes isolates. All of the isolates were susceptible to cefotaxime, gentamicin, kanamycin, and pefloxacin. We found that tetM (25.6%), tetA (23.3%), ampC (14%), and penA (11.6%) were the most prevalent antibiotic resistance genes in the L. monocytogenes isolates. Recovery of potentially pathogenic L. monocytogenes from raw fish and environment of open-air fish market samples in this study is a convincing evidence for the zoonotic potential of listeriosis.

  1. Bacteriophage predation promotes serovar diversification in Listeria monocytogenes. (United States)

    Eugster, Marcel R; Morax, Laurent S; Hüls, Vanessa J; Huwiler, Simona G; Leclercq, Alexandre; Lecuit, Marc; Loessner, Martin J


    Listeria monocytogenes is a bacterial pathogen classified into distinct serovars (SVs) based on somatic and flagellar antigens. To correlate phenotype with genetic variation, we analyzed the wall teichoic acid (WTA) glycosylation genes of SV 1/2, 3 and 7 strains, which differ in decoration of the ribitol-phosphate backbone with N-acetylglucosamine (GlcNAc) and/or rhamnose. Inactivation of lmo1080 or the dTDP-l-rhamnose biosynthesis genes rmlACBD (lmo1081-1084) resulted in loss of rhamnose, whereas disruption of lmo1079 led to GlcNAc deficiency. We found that all SV 3 and 7 strains actually originate from a SV 1/2 background, as a result of small mutations in WTA rhamnosylation and/or GlcNAcylation genes. Genetic complementation of different SV 3 and 7 isolates using intact alleles fully restored a characteristic SV 1/2 WTA carbohydrate pattern, including antisera reactions and phage adsorption. Intriguingly, phage-resistant L. monocytogenes EGDe (SV 1/2a) isolates featured the same glycosylation gene mutations and were serotyped as SV 3 or 7 respectively. Again, genetic complementation restored both carbohydrate antigens and phage susceptibility. Taken together, our data demonstrate that L. monocytogenes SV 3 and 7 originate from point mutations in glycosylation genes, and we show that phage predation represents a major driving force for serovar diversification and evolution of L. monocytogenes.


    Directory of Open Access Journals (Sweden)

    T. K. CABEÇA


    Full Text Available

    The purpose of this study was to assess the action of various disinfectants used in food industry against biofilm cells of Listeria monocytogenes formed on stainless steel surfaces during 24, 72 and 120 hours. Numbers of viable biofilm cells decreased after treatment with all the tested disinfectants (iodine, biguanide, quaternary ammonium compounds, peracetic acid and sodium hypochlorite. Sodium hypochlorite was the most effective disinfectant against the biofilm cells, while biguanide and iodine were the least. Scanning electron microscopy observations demonstrated attached cells on stainless steel surfaces after treatment with all the disinfectants. These observations showed that microorganisms were not completely removed from stainless steel surfaces after treatment with the disinfectants, however, the attachment did not means the viability of remaining cells. The biofilm age in hours (24, 72 and 120 had no apparent influence on resistance of microbiological cells to the disinfectants under study. In conclusion biofilm cells of L. monocytogenes can withstand disinfectants action.

  3. Phenotypic and Genotypic Characterization of Atypical Listeria monocytogenes and Listeria innocua Isolated from Swine Slaughterhouses and Meat Markets

    Directory of Open Access Journals (Sweden)

    Luisa Zanolli Moreno


    Full Text Available In the last decade, atypical Listeria monocytogenes and L. innocua strains have been detected in food and the environment. Because of mutations in the major virulence genes, these strains have different virulence intensities in eukaryotic cells. In this study, we performed phenotypic and genotypic characterization of atypical L. monocytogenes and L. innocua isolates obtained from swine slaughterhouses and meat markets. Forty strains were studied, including isolates of L. monocytogenes and L. innocua with low-hemolytic activity. The isolates were characterized using conventional phenotypic Listeria identification tests and by the detection and analysis of L. monocytogenes-specific genes. Analysis of 16S rRNA was used for the molecular identification of the Listeria species. The L. monocytogenes isolates were positive for all of the virulence genes studied. The atypical L. innocua strains were positive for hly, plcA, and inlC. Mutations in the InlC, InlB, InlA, PI-PLC, PC-PLC, and PrfA proteins were detected in the atypical isolates. Further in vitro and transcriptomic studies are being developed to confirm the role of these mutations in Listeria virulence.

  4. Reliable and Rapid Identification of Listeria monocytogenes and Listeria Species by Artificial Neural Network-Based Fourier Transform Infrared Spectroscopy† (United States)

    Rebuffo, Cecilia A.; Schmitt, Jürgen; Wenning, Mareike; von Stetten, Felix; Scherer, Siegfried


    Differentiation of the species within the genus Listeria is important for the food industry but only a few reliable methods are available so far. While a number of studies have used Fourier transform infrared (FTIR) spectroscopy to identify bacteria, the extraction of complex pattern information from the infrared spectra remains difficult. Here, we apply artificial neural network technology (ANN), which is an advanced multivariate data-processing method of pattern analysis, to identify Listeria infrared spectra at the species level. A hierarchical classification system based on ANN analysis for Listeria FTIR spectra was created, based on a comprehensive reference spectral database including 243 well-defined reference strains of Listeria monocytogenes, L. innocua, L. ivanovii, L. seeligeri, and L. welshimeri. In parallel, a univariate FTIR identification model was developed. To evaluate the potentials of these models, a set of 277 isolates of diverse geographical origins, but not included in the reference database, were assembled and used as an independent external validation for species discrimination. Univariate FTIR analysis allowed the correct identification of 85.2% of all strains and of 93% of the L. monocytogenes strains. ANN-based analysis enhanced differentiation success to 96% for all Listeria species, including a success rate of 99.2% for correct L. monocytogenes identification. The identity of the 277-strain test set was also determined with the standard phenotypical API Listeria system. This kit was able to identify 88% of the test isolates and 93% of L. monocytogenes strains. These results demonstrate the high reliability and strong potential of ANN-based FTIR spectrum analysis for identification of the five Listeria species under investigation. Starting from a pure culture, this technique allows the cost-efficient and rapid identification of Listeria species within 25 h and is suitable for use in a routine food microbiological laboratory. PMID

  5. Frequency of contamination Listeria monocytogenes of raw dried cured vacuum packed sausages

    Directory of Open Access Journals (Sweden)

    Hristo Daskalov


    Full Text Available The aim of this study was to collect actual data concerning the frequency of contamination with Listeria monocytogenes of some very popular in Bulgaria raw dried cured vacuum packed sausages, produced from October 2004 till May 2008. 148 vacuum-packed samples were taken from 9 different food business operators during all seasons of the year. The samples were analyzed according to USDA method for meat foods. Ten specimens were positive for presence of Listeria monocytogenes equal to 6,75% of all tested samples. In two other raw dried cured sausages L.welshimeri and L.innocua were found, but these species are not pathogenic for consumers. In the period before the official implementation of HACCP system (01.01.2006 in Bulgaria, 52 samples were examined and 5 Listeria monocytogenes isolates were found (~10%. 2,5 years after the HACCP implementation, 96 specimens from the same meat factories were tested and 5 Listeria monocytogenes isolates (5,2% were detected. Samples taken from lots, produced in winter time were contaminated with Listeria monocytogenes more often (7 of all 10 than specimens taken during other seasons. Data were discussed through the point of view of the effectiveness of hygienic practices and HACCP system application. Also, application of ‘microbiological criterion’ set in COMMISSION REGULATION (EC No 2073/2005 for ready-to-eat foods unable to support the growth of L. monocytogenes was considered.

  6. Eugenol in combination with lactic acid bacteria attenuates Listeria monocytogenes virulence in vitro and in invertebrate model Galleria mellonella. (United States)

    Upadhyay, Abhinav; Upadhyaya, Indu; Mooyottu, Shankumar; Venkitanarayanan, Kumar


    Listeria monocytogenes is a human enteric pathogen that causes severe foodborne illness in high-risk populations. Crossing the intestinal barrier is the first critical step for Listeria monocytogenes infection. Therefore, reducing L. monocytogenes colonization and invasion of intestinal epithelium and production of virulence factors could potentially control listeriosis in humans. This study investigated the efficacy of sub-inhibitory concentration (SIC) of the plant-derived antimicrobial eugenol, either alone, or in combination with five lactic acid bacteria (LAB), namely Bifidobacterium bifidum (NRRL-B41410), Lactobacillus reuteri (B-14172), Lactobacillus fermentum (B-1840), Lactobacillus plantarum (B-4496) and Lactococcus lactis subspecies lactis (B-633) in reducing Listeria monocytogenes adhesion to and invasion of human intestinal epithelial cells (Caco-2). Additionally, the effect of the aforementioned treatments on Listeria monocytogenes listeriolysin production, epithelial E-cadherin binding and expression of virulence genes was investigated. Moreover, the in vivo efficacy of eugenol-LAB treatments in reducing Listeria monocytogenes virulence in the invertebrate model Galleria mellonella was studied. Eugenol and LAB, either alone or in combination, significantly reduced Listeria monocytogenes adhesion to and invasion of intestinal cells (P eugenol-LAB treatments decreased Listeria monocytogenes haemolysin production, E-cadherin binding and virulence gene expression (P eugenol-LAB treatments significantly enhanced the survival rates of G. mellonella infected with lethal doses of Listeria monocytogenes (P eugenol either alone or in combination with LAB, and justify further investigations in a mammalian model.

  7. Keberadaan Bakteri Listeria monocytogenes pada Keju Gouda Produksi Lokal dan Impor (PRESENCE OF LISTERIA MONOCYTOGENES IN LOCAL AND IMPORTED GOUDA CHEESES

    Directory of Open Access Journals (Sweden)

    Debby Fadhilah Pazra


    Full Text Available Listeria monocytogenes is included in the foodborne pathogen, which has been associated with severaloutbreaks of human listeriosis especially in high risk groups. Listeria monocytogenes could be found inGouda cheeses because of poor hygienic and sanitation practices. In addition, this bacteria could surviveduring the making of cheese and cheese ripening process. The purpose of this study was to identify thepresence of L. monocytogenes in local and imported Gouda cheeses and how the safety level of the Goudacheese against contamination of L. monocytogenes. This study used the conventional method in accordancewith the Bacteriological Analytical Manual, US Food and Drug Administration and Bergey’s Manual ofDeterminative Bacteriology to detect the presence of L. monocytogenes at 15 samples of local Gouda cheeseand 15 samples of imported Gouda cheese sold in supermarkets in Jakarta and Bogor. The results of thisstudy showed that was not found L. monocytogenes in local and imported Gouda cheese. It could be concludedthat is Gouda cheese relatively safe from L. monocytogenes and meets Indonesian National Standard.

  8. Isolation and detection of Listeria monocytogenes in poultry meat by standard culture methods and PCR (United States)

    Kureljušić, J.; Rokvić, N.; Jezdimirović, N.; Kureljušić, B.; Pisinov, B.; Karabasil, N.


    Listeria is the genus of a bacteria found in soil and water and some animals, including poultry and cattle. It can be present in raw milk and food made from raw milk. It can also live in food processing plants and contaminate a variety of processed meats. Microscopically, Listeria species appear as small, Gram-positive rods, which are sometimes arranged in short chains. In direct smears, they can be coccoid, so they can be mistaken for streptococci. Longer cells can resemble corynebacteria. Flagella are produced at room temperature but not at 37°C. Haemolytic activity on blood agar has been used as a marker to distinguish Listeria monocytogenes among other Listeria species, but it is not an absolutely definitive criterion. Further biochemical characterization is necessary to distinguish between the different Listeria species. The objective of this study was to detect, isolate and identify Listeria monocytogenes from poultry meat. Within a period of six months from January to June 2017, a total of 15 samples were collected. Three samples were positive for the presence of Listeria monocytogenes. Biochemical and microbiological tests as well as PCR technique using specific primers were used to confirm L. Monocytogenes in the samples.

  9. Sensitive enumeration of Listeria monocytogenes and other Listeria species in various naturally contaminated matrices using a membrane filtration method. (United States)

    Barre, Léna; Brasseur, Emilie; Doux, Camille; Lombard, Bertrand; Besse, Nathalie Gnanou


    For the enumeration of Listeria monocytogenes (L. monocytogenes) in food, a sensitive enumeration method has been recently developed. This method is based on a membrane filtration of the food suspension followed by transfer of the filter on a selective medium to enumerate L. monocytogenes. An evaluation of this method was performed with several categories of foods naturally contaminated with L. monocytogenes. The results obtained with this technique were compared with those obtained from the modified reference EN ISO 11290-2 method for the enumeration of L. monocytogenes in food, and are found to provide more precise results. In most cases, the filtration method enabled to examine a greater quantity of food thus greatly improving the sensitivity of the enumeration. However, it was hardly applicable to some food categories because of filtration problems and background microbiota interference.

  10. Microbiological criteria for Listeria monocytogenes in foods under special consideration of risk assessment approaches

    DEFF Research Database (Denmark)

    Nørrung, Birgit


    This paper shortly summarizes data related to risk assessment of Listeria monocytogenes. From available data on risk assessment, it is concluded that the levels of L. monocytogenes consumed is an important factor affecting the incidence of listeriosis. Foods that do not support the growth of L....... monocytogenes are unlikely to be a source of listeriosis, whereas foods that support the growth to high levels, should be the target of risk management efforts. Based on current epidemiological information from several countries, a concentration of L. monocytogenes not exceeding 100/g of food at the time...

  11. Spontaneous bacterial peritonitis due to Listeria monocytogenes: importance of enrichment culture. (United States)

    Jayasinghe, Saroj; Connor, Martin; Donaldson, Shona; Austin, Hannah; Foster, Adele


    A case of Listeria monocytogenes induced spontaneous bacterial peritonitis (SBP) is reported in a patient with primary biliary cirrhosis. It is an indolent illness and may not show a neutrophil reaction in peritoneal fluid. Enrichment broth was required to isolate L monocytogenes in the patient. This is not routinely used in the UK and therefore isolates may be missed. L monocytogenes remains sensitive to ampicillin, penicillin and gentamicin, but is resistant to cephalosporin antibiotics. The rising incidence of listeriosis in the population suggests that the incidence of SBP from L monocytogenes is likely to increase.

  12. Gene expression profiling of a nisin-sensitive Listeria monocytogenes Scott A CtsR deletion mutant (United States)

    Listeria monocytogenes is a food-borne pathogen of significant threat to public health. Nisin is the only bacteriocin that can be used as a food preservative. Due to its antimicrobial activity, it can be used to control Listeria monocytogenes in food; however, the antimicrobial mechanism of nisin ...

  13. Low, medium and high heat tolerant strains of Listeria monocytogenes and increased heat stress resistance after exposure to sublethal heat (United States)

    Listeria monocytogenes exhibits sophisticated adaptive mechanisms to counteract higher levels of lethal acid, heat, salt or oxidative stresses after pre-exposure to sublethal concentrations of homogenous stress. A group of 37 strains representing all 13 serotypes of Listeria monocytogenes with initi...

  14. A study on the effects of some laboratory-derived genetic mutations on biofilm formation by Listeria monocytogenes

    Digital Repository Service at National Institute of Oceanography (India)

    Kumar, S.; Parvathi, A.; George, J.; Krohne, G.; Karunasagar, Indrani; Karunasagar, Iddya

    and transmission of Listeria monocytogenes in ready-to-eat products in retail and food service environments. J Food Prot 70: 2172-2198 McLaughlan AM, Foster SJ (1998). Molecular characterization of an autolytic amidase of Listeria monocytogenes EGD. Microbiol...

  15. Characterization and antibiotic susceptibility of Listeria monocytogenes isolated from poultry and red meat in Morocco

    Directory of Open Access Journals (Sweden)

    Hayat Ennaji


    Full Text Available Hayat Ennaji1,2, Mohammed Timinouni2, My Mustapha Ennaji3, Mohammed Hassar1, Nozha Cohen11Laboratoire de Microbiologie et Hygiène des Aliments et de l’Environnement, Institut Pasteur du Maroc., Casablanca, Morocco; 2Laboratoire de Microbiologie et Biologie Moléculaire, Institut Pasteur du Maroc., Casablanca, Morocco; 3Laboratoire de Virologie et Hygiène and Microbiologie., Faculté des Sciences et Techniques - Mohammedia, Université Hassan II, Mohammedia, MoroccoAbstract: This study was carried out on 426 samples of raw meats collected from butcheries and supermarkets in Casablanca, Morocco. The samples were examined for the occurrence of Listeria species. Strains of Listeria monocytogenes were characterized by several biochemical tests and confirmed by polymerase chain reaction (PCR. β-hemolytic cultures and nonhemolytic isolates were tested for biochemical properties with the Listeria API test. Among the 43 Listeria species isolates; we identified 10 strains for L. monocytogenes (23.3%, 31 strains for L. innocua (72.1% and 2 strains for L. welshimeri (4.6%. Strains of L. monocytogenes were separated by multiplex PCR; two serogroups IIb and IVb were thus differentiated. Antibiotic susceptibility of L. monocytogenes to 21 antibiotics was determined by the disk diffusion method. All isolates were susceptible to a wide range of the tested antibiotics with the exception of nalidixic acid, colistine and cephalosporins second and third generation for which they were all resistant.Keywords: antibiotic susceptibility, Listeria monocytogenes, meat, PCR

  16. [Bacteriostatic and/or bactericidal extract of Aloe vera gel on cultures of Listeria monocytogenes]. (United States)

    Ramírez Mérida, Luis Guillermo; Morón de Salim, Alba; Catinella, Rosangela; Castillo, Luis


    Listeria monocytogenes is a bacteria responsible for food borne diseases (FBD). The effect of Aloe vera gel extract as a possible bacteriostatic and/or bactericidal against Listeria monocytogenes, was checked by determined the minimum inhibitory concentration (MIC), the time of minimum inhibition (TMI) and minimum bactericidal concentration (MBC) solutions extract of Aloe vera gel in different concentrations on cultures of Listeria monocytogenes ATCC 7635. We applied the agar diffusion method, using solutions of extract of Aloe vera gel at concentrations of 0 to 100% for the MIC. The TMI was determined by growth curves in trypticase soy broth with an initial inoculum of Listeria monocytogenes ATCC 7635 of 108 CFU/mL in each solution. It was determined that the MIC was 10% extract of Aloe vera gel and TMI was 5 hours at concentrations of 10%, 20% and 30% of Aloe vera, while concentrations of 50, 80, 90 and 100%, the time was 8 hours. It was found that indeed the Aloe vera gel is bacteriostatic power on Listeria monocytogenes (p < 0.001), but yet, no bactericidal effect was obtained in our study.

  17. Comparative evaluation of the VIDAS Listeria monocytogenes Xpress (LMX) for the detection of Listeria monocytogenes in a variety of foods. (United States)

    Johnson, Ronald; Mills, John; Pittet, Jean-Louis; Hughes, Denise


    The VIDAS Listeria monocytogenes Xpress (LMX) test is an enzyme-linked fluorescent immunoassay designed for use with the automated VIDAS or mini-VIDAS instruments for the specific detection of L. monocytogenes using a 26 h proprietary enrichment broth. The VIDAS LMX method was validated according to harmonized AOAC Research Institute (RI) and Official Methods of Analysis guidelines in both the AOAC Performance Tested Method (PTM) and GovVal programs. In the PTM comparison studies, the VIDAS LMX method was compared to the U.S. Department of Agriculture-Food Safety and Inspection Service Microbiology Laboratory Guidebook, the U.S. Food and Drug Administration Bacteriological Analytical Manual, and AOAC Official Methods. The comparative food studies consisted of two main parts: internal testing and AOAC independent laboratory testing, which included seven food matrixes (deli ham, processed cheese, vanilla ice cream, cooked shrimp, smoked white fish, frozen spinach, and peanut butter). As part of the AOAC R1 GovVal program, the VIDAS LMX method was compared to the Health Canada MFHPB-30 method for the detection of L. monocytogenes in five ready-to-eat (RTE) meats (hot dogs, deli turkey, deli ham, fermented sausage, and liver paté). Twenty replicates of each inoculation level and five uninoculated controls were evaluated in each study. The LMX method also included the use ofchromogenic media, chromID Ottaviani Agosti agar and chromID L. mono. agar, for confirmation of LMX presumptive results. In both the PTM and GovVal evaluations, there were no significant differences in the Chi-square values for the LMX method when compared to reference methods. The additional parameters tested in the PTM evaluation (inclusivity, exclusivity, ruggedness, stability, and lot-to-lot) satisfied the AOAC RI performance requirements. In both the PTM and GovVal validation studies, the VIDAS LMX method demonstrated reliability as a rapid qualitative method for next-day detection of L

  18. Listeria monocytogenes infection of HD11, chicken macrophage-like cells. (United States)

    Jarvis, N A; Donaldson, J R; O'Bryan, C A; Ricke, S C; Crandall, P G


    Listeria monocytogenes can be carried by and infect poultry, although the clinical disease in birds is rare. Escape from macrophage phagocytosis is a key step in pathogenesis for L. monocytogenes. Therefore, we investigated the infection of the chicken macrophage-like cell line HD11 with 2 strains of L. monocytogenes EGD-e and Scott A. After infection, L. monocytogenes was quantified by spread plating and HD11 was quantified with trypan blue exclusion stain before enumeration. The standard macrophage killing protocols require washing the cell monolayers 3 times with PBS, which was found to negatively influence HD11 monolayers. Maximum bacterial densities within macrophages were not different between the 2 Listeria strains. HD11 required more than 11 h to effectively reduce intracellular L. monocytogenes Scott A, and Scott A was more susceptible to HD11 killing than EGD-e. It appears that Listeria infection initially causes attenuation of HD11 growth, and infected HD11 cells do not begin to lyse until at least 11 h post infection. These results suggest that there are subtle strain to strain differences in response to HD11 macrophage phagocytosis. The long lead-time required for HD11 to kill L. monocytogenes cells means that there is sufficient time available for chicken macrophages to circulate in the blood and transfer the intracellular Listeria to multiple tissues. © 2016 Poultry Science Association Inc.

  19. Antimicrobial susceptibility and antibiotic resistance gene transfer analysis of foodborne, clinical, and environmental Listeria spp. isolates including Listeria monocytogenes. (United States)

    Bertsch, David; Muelli, Mirjam; Weller, Monika; Uruty, Anaïs; Lacroix, Christophe; Meile, Leo


    The aims of this study were to assess antibiotic resistance pheno- and genotypes in foodborne, clinical, and environmental Listeria isolates, as well as to elucidate the horizontal gene transfer potential of detected resistance genes. A small fraction of in total 524 Listeria spp. isolates (3.1%) displayed acquired antibiotic resistance mainly to tetracycline (n = 11), but also to clindamycin (n = 4) and trimethoprim (n = 3), which was genotypically confirmed. In two cases, a tetracycline resistance phenotype was observed together with a trimethoprim resistance phenotype, namely in a clinical L. monocytogenes strain and in a foodborne L. innocua isolate. Depending on the applied guidelines, a differing number of isolates (n = 2 or n = 20) showed values for ampicillin that are on the edge between intermediate susceptibility and resistance. Transferability of the antibiotic resistance genes from the Listeria donors, elucidated in vitro by filter matings, was demonstrated for genes located on transposons of the Tn916 family and for an unknown clindamycin resistance determinant. Transfer rates of up to 10(-5) transconjugants per donor were obtained with a L. monocytogenes recipient and up to 10(-7) with an Enterococcus faecalis recipient, respectively. Although the prevalence of acquired antibiotic resistance in Listeria isolates from this study was rather low, the transferability of these resistances enables further spread in the future. This endorses the importance of surveillance of L. monocytogenes and other Listeria spp. in terms of antibiotic susceptibility.

  20. L-glutamine Induces Expression of Listeria monocytogenes Virulence Genes (United States)

    Lobel, Lior; Burg-Golani, Tamar; Sigal, Nadejda; Rose, Jessica; Livnat-Levanon, Nurit; Lewinson, Oded; Herskovits, Anat A.


    The high environmental adaptability of bacteria is contingent upon their ability to sense changes in their surroundings. Bacterial pathogen entry into host poses an abrupt and dramatic environmental change, during which successful pathogens gauge multiple parameters that signal host localization. The facultative human pathogen Listeria monocytogenes flourishes in soil, water and food, and in ~50 different animals, and serves as a model for intracellular infection. L. monocytogenes identifies host entry by sensing both physical (e.g., temperature) and chemical (e.g., metabolite concentrations) factors. We report here that L-glutamine, an abundant nitrogen source in host serum and cells, serves as an environmental indicator and inducer of virulence gene expression. In contrast, ammonia, which is the most abundant nitrogen source in soil and water, fully supports growth, but fails to activate virulence gene transcription. We demonstrate that induction of virulence genes only occurs when the Listerial intracellular concentration of L-glutamine crosses a certain threshold, acting as an on/off switch: off when L-glutamine concentrations are below the threshold, and fully on when the threshold is crossed. To turn on the switch, L-glutamine must be present, and the L-glutamine high affinity ABC transporter, GlnPQ, must be active. Inactivation of GlnPQ led to complete arrest of L-glutamine uptake, reduced type I interferon response in infected macrophages, dramatic reduction in expression of virulence genes, and attenuated virulence in a mouse infection model. These results may explain observations made with other pathogens correlating nitrogen metabolism and virulence, and suggest that gauging of L-glutamine as a means of ascertaining host localization may be a general mechanism. PMID:28114430

  1. Stochastically modeling Listeria monocytogenes growth in farm tank milk. (United States)

    Albert, Isabelle; Pouillot, Régis; Denis, Jean-Baptiste


    This article presents a Listeria monocytogenes growth model in milk at the farm bulk tank stage. The main objective was to judge the feasibility and value to risk assessors of introducing a complex model, including a complete thermal model, within a microbial quantitative risk assessment scheme. Predictive microbiology models are used under varying temperature conditions to predict bacterial growth. Input distributions are estimated based on data in the literature, when it is available. If not, reasonable assumptions are made for the considered context. Previously published results based on a Bayesian analysis of growth parameters are used. A Monte Carlo simulation that forecasts bacterial growth is the focus of this study. Three scenarios that take account of the variability and uncertainty of growth parameters are compared. The effect of a sophisticated thermal model taking account of continuous variations in milk temperature was tested by comparison with a simplified model where milk temperature was considered as constant. Limited multiplication of bacteria within the farm bulk tank was modeled. The two principal factors influencing bacterial growth were found to be tank thermostat regulation and bacterial population growth parameters. The dilution phenomenon due to the introduction of new milk was the main factor affecting the final bacterial concentration. The results show that a model that assumes constant environmental conditions at an average temperature should be acceptable for this process. This work may constitute a first step toward exposure assessment for L. monocytogenes in milk. In addition, this partly conceptual work provides guidelines for other risk assessments where continuous variation of a parameter needs to be taken into account.

  2. Prevalence of Listeria monocytogenes in the river receiving the effluent of municipal wastewater treatment plant

    Directory of Open Access Journals (Sweden)

    Atefeh Taherkhani


    Full Text Available Aims: The objective of this study was to evaluate the prevalence of Listeria spp. in the river water before and after discharge of the effluent of the municipal wastewater treatment plant (WWTP in Isfahan, Iran. Materials and Methods: A total of 66 samples were collected bi-weekly over 4 months from eleven discrete sampling locations in Zayandehrood River, Iran. Three sampling sites were located above the discharge point and five sites were located after the discharge point of WWTP. Samples were also collected from the influent and the effluent of WWTP. Listeria spp. were isolated using a selective enrichment procedure and a subculture onto polymyxin-acriflavine-lithium chloride-ceftazidime-esculin-mannitol Agar. All isolates were subjected to standard biochemical tests. Results: L. monocytogenes was isolated from influent (83%, effluent (50% and (18.5% river water. Listeria spp. was not found before the discharge point in river water. However, L. monocytogenes was isolated in samples collected from 200 m (33%, 500 m (33%, 2 km (16.5%, 5 km (16.5% and 10 km (16.5% downstream from the WWTP. Listeria innocua (9% and Listeria seeligeri (10% were the second most frequently isolated species. Conclusion: During the wastewater treatment, Listeria spp. is not removed completely. L. monocytogenes is widely distributed in the Zayandehrood river. L. monocytogenes released into surface water demonstrates a potential risk for public health. These results indicate the need for appropriate water management in order to reduce human and animal exposure to such pathogens.

  3. A riboswitch-regulated antisense RNA in Listeria monocytogenes. (United States)

    Mellin, J R; Tiensuu, Teresa; Bécavin, Christophe; Gouin, Edith; Johansson, Jörgen; Cossart, Pascale


    Riboswitches are ligand-binding elements located in 5' untranslated regions of messenger RNAs, which regulate expression of downstream genes. In Listeria monocytogenes, a vitamin B12-binding (B12) riboswitch was identified, not upstream of a gene but downstream, and antisense to the adjacent gene, pocR, suggesting it might regulate pocR in a nonclassical manner. In Salmonella enterica, PocR is a transcription factor that is activated by 1,2-propanediol, and subsequently activates expression of the pdu genes. The pdu genes mediate propanediol catabolism and are implicated in pathogenesis. As enzymes involved in propanediol catabolism require B12 as a cofactor, we hypothesized that the Listeria B12 riboswitch might be involved in pocR regulation. Here we demonstrate that the B12 riboswitch is transcribed as part of a noncoding antisense RNA, herein named AspocR. In the presence of B12, the riboswitch induces transcriptional termination, causing aspocR to be transcribed as a short transcript. In contrast, in the absence of B12, aspocR is transcribed as a long antisense RNA, which inhibits pocR expression. Regulation by AspocR ensures that pocR, and consequently the pdu genes, are maximally expressed only when both propanediol and B12 are present. Strikingly, AspocR can inhibit pocR expression in trans, suggesting it acts through a direct interaction with pocR mRNA. Together, this study demonstrates how pocR and the pdu genes can be regulated by B12 in bacteria and extends the classical definition of riboswitches from elements governing solely the expression of mRNAs to a wider role in controlling transcription of noncoding RNAs.

  4. Effect of octenidine hydrochloride on planktonic cells and biofilms of Listeria monocytogenes. (United States)

    Amalaradjou, Mary Anne Roshni; Norris, Carol E; Venkitanarayanan, Kumar


    Listeria monocytogenes is a food-borne pathogen capable of forming biofilms and persisting in food processing environments for extended periods of time, thereby potentially contaminating foods. The efficacy of octenidine hydrochloride (OH) for inactivating planktonic cells and preformed biofilms of L. monocytogenes was investigated at 37, 21, 8, and 4 degrees C in the presence and absence of organic matter (rehydrated nonfat dry milk). OH rapidly killed planktonic cells and biofilms of L. monocytogenes at all four temperatures. Moreover, OH was equally effective in killing L. monocytogenes biofilms on polystyrene and stainless steel matrices in the presence and absence of organic matter. The results underscore OH's ability to prevent establishment of L. monocytogenes biofilms by rapidly killing planktonic cells and to eliminate preformed biofilms, thus suggesting that it could be used as a disinfectant to prevent L. monocytogenes from persisting in food processing environments.

  5. Inhibition of listeriolysin O oligomerization by lutein prevents Listeria monocytogenes infection. (United States)

    Liu, Bowen; Teng, Zihao; Wang, Jianfeng; Lu, Gejin; Deng, Xuming; Li, Li


    The foodborne pathogenic bacterial species Listeria monocytogenes (L. monocytogenes) has caused incalculable damages to public health, and its successful infection requires various virulence factors, including Listeriolysin O (LLO). By forming pores in phagosomal membranes and even in some organelles, LLO plays an indispensable role in the ability of L. monocytogenes to escape from host immune attacks. Because of its critical role, LLO offers an appropriate therapeutic target against L. monocytogenes infection. Here, lutein, a natural small molecule existing widely in fruits and vegetables, is demonstrated as an effective inhibitor of LLO that works by blocking its oligomerization during invasion without showing significant bacteriostatic activity. Further assays applying lutein in cell culture models of invasion and in animal models showed that lutein could effectively inhibit L. monocytogenes infection. Overall, our results indicate that lutein may represent a promising and novel therapeutic agent against L. monocytogenes infection. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. Antibacterial activity of aromatic plants essential oils from Serbia against the Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Klaus Anita


    Full Text Available The purpose of this study was to examine the effectiveness of selected essential oils for the control of the growth and survival of pathogenic bacteria Listeria monocytogenes ATCC 19112 and Listeria monocytogenes ATCC 19115, which are of significant importance in food hygiene. Essential oils extracted from Salvia officinalis L., Rosmarinus officinalis L., Majorana hortensis Moench., Thymus vulgaris L., Carum carvi L., Pimpinella anisum L. and Coriandrum sativum L. were evaluated. Antibacterial activity was done by the disk diffusion method in the presence of pure essential oils and four suspensions in alcohol. The best results obtained with Thymus vulgaris and Majorana hortensis essential oils, which were acting microbicidaly on both observed strains of Listeria monocytogenes, even in the small concentration. Because some of the essential oils were highly inhibitory even in small quantities to selected pathogenic bacteria, they may provide alternatives to conventional antimicrobial additives in foods. .

  7. Isolation and Identification of Listeria monocytogenes in Processed Meat by a Combined Cultural-molecular Method

    Directory of Open Access Journals (Sweden)

    Angela Ingianni


    Full Text Available The isolation and identification of Listeria monocytogenes in processed meat samples by a combined cultural-molecular method is described. It allows the identification of Listeria strains by means of a hybridization technique with a specific DNA probe directed to the listerial internalin gene. The specificity of this method was found to be 100% and sensitivity was as low as 1 CFU/2.5 g of food sample. A total of 278 meat samples were tested in comparison with PCR and conventional cultural assays. A total of 42 (15.4% L. monocytogenes were detected. PCR analysis gave 3 false negative results and culture failed to detect the Listeria in 5 cases. With this cultural-molecular method the identification and quantitative detection of L. monocytogenes were achieved within 36 hours and no false positive or negative tests were obtained, thus fitting most food industry requirements.

  8. Thermal inactivation and growth potential of Listeria monocytogenes in smoked tench

    Directory of Open Access Journals (Sweden)

    Raffaella Branciari


    Full Text Available An experimental study for the evaluation of Listeria monocytogenes inactivation during a hot smoking process in tench was performed using Listeria innocua strains. Furthermore, the survival of L. monocytogenes in smoked tench was determined after post-processing in contaminated samples, evaluating the growth potential during storage. L. innocua was not detected after the smoking process. In the challenge test, the growth potential of L. monocytogenes was 5.68 log colony forming unit g−1. The results showed that hot smoking at an inner temperature around 72°C is able to eliminate the microorganism. Nevertheless, the product is able to support the growth of the pathogen if post-process contamination occurs, as the food is suitable for Listeria multiplication. Product recontamination should be prevented by means of appropriate application of hygiene measures.

  9. Genetic characteristics of Japanese clinical Listeria monocytogenes isolates.

    Directory of Open Access Journals (Sweden)

    Satoko Miya

    Full Text Available Listeria monocytogenes causes foodborne illnesses through consumption of ready-to-eat foods. Although 135-201annual listeriosis cases have been estimated in Japan, the details regarding the clinical isolates such as infection source, virulence level, and other genetic characteristics, are not known. In order to uncover the trends of listeriosis in Japan and use the knowledge for prevention measures to be taken, the genetic characteristics of the past human clinical isolates needs to be elucidated. For this purpose, multilocus tandem-repeat sequence analysis (MLTSA and multi-virulence-locus sequence typing (MVLST were used in this study. The clinical isolates showed a variety of genetically distant genotypes, indicating they were from sporadic cases. However, the MVLST profiles of 7 clinical isolates were identical to those of epidemic clone (EC I isolates, which have caused several serious outbreaks in other countries, suggesting the possibility that they have strong virulence potential and originated from a single outbreak. Moreover, 6 Japanese food isolates shared their genotypes with ECI isolates, indicating that there may be risks for listeriosis outbreak in Japan. This is the first investigational study on genetic characteristics of Japanese listeriosis isolates. The listeriosis cases happened in the past are presumably sporadic, but it is still possible that some isolates with strong virulence potential have caused listeriosis outbreaks, and future listeriosis risks also exist.

  10. Comparative Genomics of the Listeria monocytogenes ST204 Subgroup (United States)

    Fox, Edward M.; Allnutt, Theodore; Bradbury, Mark I.; Fanning, Séamus; Chandry, P. Scott


    The ST204 subgroup of Listeria monocytogenes is among the most frequently isolated in Australia from a range of environmental niches. In this study we provide a comparative genomics analysis of food and food environment isolates from geographically diverse sources. Analysis of the ST204 genomes showed a highly conserved core genome with the majority of variation seen in mobile genetic elements such as plasmids, transposons and phage insertions. Most strains (13/15) harbored plasmids, which although varying in size contained highly conserved sequences. Interestingly 4 isolates contained a conserved plasmid of 91,396 bp. The strains examined were isolated over a period of 12 years and from different geographic locations suggesting plasmids are an important component of the genetic repertoire of this subgroup and may provide a range of stress tolerance mechanisms. In addition to this 4 phage insertion sites and 2 transposons were identified among isolates, including a novel transposon. These genetic elements were highly conserved across isolates that harbored them, and also contained a range of genetic markers linked to stress tolerance and virulence. The maintenance of conserved mobile genetic elements in the ST204 population suggests these elements may contribute to the diverse range of niches colonized by ST204 isolates. Environmental stress selection may contribute to maintaining these genetic features, which in turn may be co-selecting for virulence markers relevant to clinical infection with ST204 isolates. PMID:28066377

  11. Distinct Neurotoxicity Profile of Listeriolysin O from Listeria monocytogenes (United States)

    Maurer, Jana; Hupp, Sabrina; Bischoff, Carolin; Foertsch, Christina; Mitchell, Timothy J.; Chakraborty, Trinad; Iliev, Asparouh I.


    Cholesterol-dependent cytolysins (CDCs) are protein toxins that originate from Gram-positive bacteria and contribute substantially to their pathogenicity. CDCs bind membrane cholesterol and build prepores and lytic pores. Some effects of the toxins are observed in non-lytic concentrations. Two pathogens, Streptococcus pneumoniae and Listeria monocytogenes, cause fatal bacterial meningitis, and both produce toxins of the CDC family—pneumolysin and listeriolysin O, respectively. It has been demonstrated that pneumolysin produces dendritic varicosities (dendrite swellings) and dendritic spine collapse in the mouse neocortex, followed by synaptic loss and astrocyte cell shape remodeling without elevated cell death. We utilized primary glial cultures and acute mouse brain slices to examine the neuropathological effects of listeriolysin O and to compare it to pneumolysin with identical hemolytic activity. In cultures, listeriolysin O permeabilized cells slower than pneumolysin did but still initiated non-lytic astrocytic cell shape changes, just as pneumolysin did. In an acute brain slice culture system, listeriolysin O produced dendritic varicosities in an NMDA-dependent manner but failed to cause dendritic spine collapse and cortical astrocyte reorganization. Thus, listeriolysin O demonstrated slower cell permeabilization and milder glial cell remodeling ability than did pneumolysin and lacked dendritic spine collapse capacity but exhibited equivalent dendritic pathology. PMID:28098781

  12. Pathways of Listeria monocytogenes contamination in the meat processing industry. (United States)

    Nesbakken, T; Kapperud, G; Caugant, D A


    One hundred and thirty-three isolates of Listeria monocytogenes from deboned fresh meat, production environment, cold cuts from five meat processing plants and from one plant producing cured dried sausages, were characterized using multilocus enzyme electrophoresis. On the basis of electrophoretically demonstrable allelic variation at 21 enzyme loci, 21 electrophoretic types (ETs) were distinguished. Analysis of the genetic relationships among the 21 ETs revealed two distinct clusters: Cluster A and Cluster B. With the exception of two isolates from one plant, all isolates from deboned fresh meat belonged to Cluster B. During processing of cold cuts, however, isolates belonging to Cluster A became more frequent, and only one of the 37 isolates from cold cuts belonged to Cluster B. In contrast, six of the nine isolates from cured dried sausages had ETs in Cluster B. One clone of Cluster A, ET-6 was isolated from cold cuts in four of six plants. This is one of the ETs most frequently recovered from patients in Norway. Isolates of ET-6 were further characterized using restriction fragment length polymorphism (RFLP) analysis of chromosomal DNA. Six distinct restriction patterns were distinguished among the 44 ET-6 strains. In one plant, four different RFLP patterns could be identified. Two clone variants seemed to have colonized different areas in this plant for at least four years. However, in each of the other plants, all ET-6 isolates had the same RFLP patterns.

  13. Distinct Neurotoxicity Profile of Listeriolysin O from Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Jana Maurer


    Full Text Available Cholesterol-dependent cytolysins (CDCs are protein toxins that originate from Gram-positive bacteria and contribute substantially to their pathogenicity. CDCs bind membrane cholesterol and build prepores and lytic pores. Some effects of the toxins are observed in non-lytic concentrations. Two pathogens, Streptococcus pneumoniae and Listeria monocytogenes, cause fatal bacterial meningitis, and both produce toxins of the CDC family—pneumolysin and listeriolysin O, respectively. It has been demonstrated that pneumolysin produces dendritic varicosities (dendrite swellings and dendritic spine collapse in the mouse neocortex, followed by synaptic loss and astrocyte cell shape remodeling without elevated cell death. We utilized primary glial cultures and acute mouse brain slices to examine the neuropathological effects of listeriolysin O and to compare it to pneumolysin with identical hemolytic activity. In cultures, listeriolysin O permeabilized cells slower than pneumolysin did but still initiated non-lytic astrocytic cell shape changes, just as pneumolysin did. In an acute brain slice culture system, listeriolysin O produced dendritic varicosities in an NMDA-dependent manner but failed to cause dendritic spine collapse and cortical astrocyte reorganization. Thus, listeriolysin O demonstrated slower cell permeabilization and milder glial cell remodeling ability than did pneumolysin and lacked dendritic spine collapse capacity but exhibited equivalent dendritic pathology.

  14. Comparative Genomics of the Listeria monocytogenes ST204 Subgroup. (United States)

    Fox, Edward M; Allnutt, Theodore; Bradbury, Mark I; Fanning, Séamus; Chandry, P Scott


    The ST204 subgroup of Listeria monocytogenes is among the most frequently isolated in Australia from a range of environmental niches. In this study we provide a comparative genomics analysis of food and food environment isolates from geographically diverse sources. Analysis of the ST204 genomes showed a highly conserved core genome with the majority of variation seen in mobile genetic elements such as plasmids, transposons and phage insertions. Most strains (13/15) harbored plasmids, which although varying in size contained highly conserved sequences. Interestingly 4 isolates contained a conserved plasmid of 91,396 bp. The strains examined were isolated over a period of 12 years and from different geographic locations suggesting plasmids are an important component of the genetic repertoire of this subgroup and may provide a range of stress tolerance mechanisms. In addition to this 4 phage insertion sites and 2 transposons were identified among isolates, including a novel transposon. These genetic elements were highly conserved across isolates that harbored them, and also contained a range of genetic markers linked to stress tolerance and virulence. The maintenance of conserved mobile genetic elements in the ST204 population suggests these elements may contribute to the diverse range of niches colonized by ST204 isolates. Environmental stress selection may contribute to maintaining these genetic features, which in turn may be co-selecting for virulence markers relevant to clinical infection with ST204 isolates.

  15. Rapid Identification and Classification of Listeria spp. and Serotype Assignment of Listeria monocytogenes Using Fourier Transform-Infrared Spectroscopy and Artificial Neural Network Analysis


    Romanolo, K. F.; Gorski, L; Wang, S.; C R Lauzon


    The use of Fourier Transform-Infrared Spectroscopy (FT-IR) in conjunction with Artificial Neural Network software NeuroDeveloper™ was examined for the rapid identification and classification of Listeria species and serotyping of Listeria monocytogenes. A spectral library was created for 245 strains of Listeria spp. to give a biochemical fingerprint from which identification of unknown samples were made. This technology was able to accurately distinguish the Listeria species with 99.03% accura...

  16. [Enterocin-35, a bacteriocin with activity against Listeria monocytogenes. Possible use in the food industry]. (United States)

    Concha, R; Farías, M E; Kümmerlin, R; Sesma, F


    The in vitro inhibitory activity of enterocin-35 produced by Enterococcus faecium CRL 35, was studied against Listeria monocytogenes, isolated from seafoods. Optimal growth conditions of the enterocin-35 producing strain, for higher bacteriocin production and improve the extraction and purification of these peptides, were applied. A crude extract of enterocin-35 was assayed in a frozen seafood artificially contaminated with Listeria monocytogenes isolate, simulating at laboratory scale an eventual application of this biopreservant in a routine production process at factory level. The feasibility of biopreservation of seafoods by means of bacteriocins is proposed and discussed.

  17. Rapid detection of Listeria monocytogenes in milk using confocal micro-Raman spectroscopy and chemometric analysis. (United States)

    Wang, Junping; Xie, Xinfang; Feng, Jinsong; Chen, Jessica C; Du, Xin-jun; Luo, Jiangzhao; Lu, Xiaonan; Wang, Shuo


    Listeria monocytogenes is a facultatively anaerobic, Gram-positive, rod-shape foodborne bacterium causing invasive infection, listeriosis, in susceptible populations. Rapid and high-throughput detection of this pathogen in dairy products is critical as milk and other dairy products have been implicated as food vehicles in several outbreaks. Here we evaluated confocal micro-Raman spectroscopy (785 nm laser) coupled with chemometric analysis to distinguish six closely related Listeria species, including L. monocytogenes, in both liquid media and milk. Raman spectra of different Listeria species and other bacteria (i.e., Staphylococcus aureus, Salmonella enterica and Escherichia coli) were collected to create two independent databases for detection in media and milk, respectively. Unsupervised chemometric models including principal component analysis and hierarchical cluster analysis were applied to differentiate L. monocytogenes from Listeria and other bacteria. To further evaluate the performance and reliability of unsupervised chemometric analyses, supervised chemometrics were performed, including two discriminant analyses (DA) and soft independent modeling of class analogies (SIMCA). By analyzing Raman spectra via two DA-based chemometric models, average identification accuracies of 97.78% and 98.33% for L. monocytogenes in media, and 95.28% and 96.11% in milk were obtained, respectively. SIMCA analysis also resulted in satisfied average classification accuracies (over 93% in both media and milk). This Raman spectroscopic-based detection of L. monocytogenes in media and milk can be finished within a few hours and requires no extensive sample preparation. Copyright © 2015 Elsevier B.V. All rights reserved.

  18. Functional impact of mutational activation on the Listeria monocytogenes central virulence regulator PrfA


    Miner, Maurine D.; Port, Gary C.; Freitag, Nancy E.


    The transcriptional activator PrfA is required for the expression of virulence factors necessary for Listeria monocytogenes pathogenesis. PrfA is believed to become activated following L. monocytogenes entry into the cytosol of infected host cells resulting in the induction of target genes whose products are required for bacterial intracellular growth and cell-to-cell spread. Several mutations have been identified that appear to lock PrfA into its highly activated cytosolic form (known as prf...

  19. Listeria monocytogenes incidence changes and diversity in some Brazilian dairy industries and retail products

    DEFF Research Database (Denmark)

    Oxaran, Virginie; In Lee, Sarah Hwa; Chaul, Luiza Toubas


    Listeria monocytogenes can cause listeriosis, a severe foodborne disease. In Brazil, despite very few reported cases of listeriosis, the pathogen has been repeatedly isolated from dairies. This has led the government to implement specific legislation to reduce the hazard. Here, we determined the ....... monocytogenes in dairies and retail products emphasize the need for continuous surveillance of this pathogen in the Brazilian dairy industry. (C) 2017 Elsevier Ltd. All rights reserved....

  20. Contamination of cooked peeled shrimp (Pandalus borealis) by Listeria monocytogenes during processing at two processing plants. (United States)

    Gudmundsdóttir, Sigrún; Gudbjörnsdóttir, Birna; Einarsson, Hjörleifur; Kristinsson, Karl G; Kristjansson, Már


    Listeria spp. and Listeria monocytogenes contamination was evaluated in cooked peeled shrimp (final or semifinal product, 82 samples) and the shrimp-processing environment (two plants, 613 samples) in eight surveys conducted from 1998 through 2001. Listeria was detected in 12.5% (78) of the 695 samples (11.2% of the samples were positive for L. monocytogenes), but none of the samples of final product contained Listeria. One hundred seventy-two L. monocytogenes isolates were characterized by pulsed-field gel electrophoresis. Cleavage with macrorestriction enzymes AscI and ApaI yielded 14 different pulsotypes in the plants; two types were dominant, one in each plant. Sixty-three of the 106 isolates in plant A and 43 of the 66 isolates in plant B were of the dominant types. Certain strains, mainly of serotypes 1/2c and 4b and pulsotypes 1A and 2H, were persistent for long periods in both plants. Adaptation of good hygienic practices in the processing plants, including strict rules concerning traffic of staff and equipment, and existing hygienic requirements appeared to be effective in preventing contamination between areas within plants and in the final product. The persistence of Listeria strains in these two processing plants indicates the importance of detecting the places in the processing environment (e.g., transporters, equipment, floors, and drains) where L. monocytogenes can survive so that cleaning and disinfection efforts can be directed to such niches.

  1. Listeria monocytogenes-induced bacterial peritonitis caused by contaminated cheese in a patient with haemochromatosis. (United States)

    Galan, S R; Kann, P H; Gress, T M; Michl, P


    Infections with Listeria monocytogenes can present clinically with a wide range of different organ manifestations such as gastroenteritis, meningoencephalitis or osteomyelitis, posing a serious threat, particularly to immunocompromised patients. We present the case of a 76-year-old female patient with advanced liver disease due to underlying haemochromatosis, who was admitted to the hospital with increasing abdominal pain. She was diagnosed with spontaneous bacterial peritonitis caused by infection with Listeria monocytogenes, which she had acquired after consuming contaminated cheese from a local supermarket chain. To the best of our knowledge, this is the first case to describe Listeria-induced spontaneous bacterial peritonitis in a patient with haemochromatosis. Both end-stage liver disease and hereditary haemochromatosis on their own impair the local and systemic immune response, thereby representing predisposing factors for acquiring Listeria monocytogenes infection. This case demonstrates a rare organ manifestation of Listeria monocytogenes infection, which can be life-threatening if not diagnosed and treated adequately, and underlines the need to identify possible sources of infection in order to apply measures to prevent the further spread of the contaminated food.


    Directory of Open Access Journals (Sweden)

    Mahzad Hosseini


    Full Text Available The aim of this study was to compare the MPN-PCR (Most Probable Number- Polymerase Chain Reaction and MPN-Culture methods in enumerating of Listeria monocytogenes in milk. In order to compare the accuracy of these methods, 103 cell/ml Listeria monocytogenes and different background bacteria which may be present in raw milk, were inoculated in sterilized milk. After preparing serial dilutions, three replicates per dilution were inoculated in tubes containing listeria enrichment broth. After 48 hours of incubation, for MPN-Culture three inoculated replicates were subcultured on Oxford agar and suspected colonies were confirmed by performing by biochemical tests. For MPN-PCR assay, the DNA extraction was performed from the three inoculated replicates which were already used for MPN-Culture and PCR assay was performed using primers specific for Listeria monocytogenes. The experiment was repeated three times and the average of enumerated bacteria was calculated by each method separately. Statistical analysis using one sample Wilcoxon signed rank test showed that enumeration by MPN-PCR method was more accurate than enumeration by MPN-Culture method. The result of this study showed that MPN-PCR method in comparision with MPN-Culture even in the presence of different background microorganisms is more rapid and reliable. It is concluded that MPN-PCR method facilitates the enumeration of Listeria monocytogenes without excessive work and could be considered as an alternative to MPN-Culture technique.

  3. Comparative Evaluation of Veriflow® Listeria monocytogenes to USDA and AOAC Culture Based Methods for the Detection of Listeria monocytogenes in Food. (United States)

    Joelsson, Adam C; Brown, Ashley S; Puri, Amrita; Keough, Martin P; Gaudioso, Zara E; Siciliano, Nicholas A; Snook, Adam E


    Veriflow® Listeria monocytogenes (LM) is a molecular based assay for the presumptive detection of Listeria monocytogenes from environmental surfaces, dairy, and ready-to-eat (RTE) food matrixes (hot dogs and deli meat). The assay utilizes a PCR detection method coupled with a rapid, visual, flow-based assay that develops in 3 min post PCR amplification and requires only 24 h of enrichment for maximum sensitivity. The Veriflow LM system eliminates the need for sample purification, gel electrophoresis, or fluorophore-based detection of target amplification, and does not require complex data analysis. This Performance Tested Method(SM) validation study demonstrated the ability of the Veriflow LM method to detect low levels of artificially inoculated L. monocytogenes in seven distinct environmental and food matrixes. In each unpaired reference comparison study, probability of detection analysis indicated no significant difference between the Veriflow LM method and the U.S. Department of Agriculture, Food Safety and Inspection Service Microbiology Laboratory Guidebook 8.08 or AOAC 993.12 reference method. Fifty strains of L. monocytogenes were detected in the inclusivity study, while 39 nonspecific organisms were undetected in the exclusivity study. The study results show that Veriflow LM is a sensitive, selective, and robust assay for the presumptive detection of L. monocytogenes sampled from environmental, dairy, or RTE (hot dogs and deli meat) food matrixes.

  4. A trip in the "New Microbiology" with the bacterial pathogen Listeria monocytogenes.



    International audience; Listeria monocytogenes is a food-borne pathogen causing an opportunistic disease called listeriosis. This bacterium invades and replicates in most cell types, due to its multiple strategies to exploit host molecular mechanisms. Research aiming at unravelling Listeria invasion and intracellular lifestyle has led to a number of key discoveries in infection biology, cell biology and also microbiology. In this review, we report on our most recent advances in understanding ...

  5. The overgrowth of Listeria monocytogenes by other Listeria spp. in food samples undergoing enrichment cultivation has a nutritional basis. (United States)

    Besse, Nathalie Gnanou; Barre, Lena; Buhariwalla, Colin; Vignaud, Marie Léone; Khamissi, Elissa; Decourseulles, Emilie; Nirsimloo, Marjorie; Chelly, Minyar; Kalmokoff, Martin


    The isolation of Listeria monocytogenes from food is carried out using a double enrichment. In cases where multiple Listeria species are present within the original sample, L. monocytogenes can be overgrown during enrichment by other species of listeria present in the original sample. From a practical perspective, this can result in a false negative or complicate the ability of public health investigators to match food and clinical isolates. We have further investigated this phenomenon by analysing the growth kinetics of single species and pairs of different species over the ISO 11290-1 enrichment process. The overgrowth of a strain of L. monocytogenes by a strain of Listeria innocua resulted primarily from interactions which occurred in late exponential phase, where it was observed that growth of both strains stopped when the dominant strain reached stationary phase. In a second mixed culture, the dominant L. monocytogenes strain suppressed the exponential growth rate of the second Listeria welshimeri strain. Both findings suggest that the overgrowth could partially be explained in terms of a nutritional competition. Multi-factor analysis of Fraser broth constituents and growth temperatures using both stressed and non-stressed inoculants failed to identify any single factor in the ISO 11290-1 methodology which would contribute to the overgrowth phenomenon in our model system. Furthermore, species was not a significant factor in observed differences in growth parameters among a wider array of strains which had been stressed or not stressed prior to grown in Fraser broths, even though some strains had significantly faster growth rates than others. Limiting diffusion in Fraser broth through the addition of agar significantly reduced the extent of the overgrowth in experiments using mixtures of strains originally isolated from foods where overgrowth had been previously observed. Taken together, these findings support that the overgrowth phenomenon in most instances

  6. Sublethal injury and virulence changes in Listeria monocytogenes and Listeria innocua treated with antimicrobials carvacrol and citral. (United States)

    Silva, A; Genovés, S; Martorell, P; Zanini, S F; Rodrigo, D; Martinez, A


    The aim of this study was to evaluate the effect of two antimicrobial substances, carvacrol and citral, on Listeria monocytogenes and Listeria innocua cells, as well as possible virulence changes in injured cells, using Caenorhabditis elegans as a model test. The results indicated that the percentage of sublethal damage was higher in L. monocytogenes than in L. innocua. The results of the study carried out by using C. elegans indicated that C. elegans fed in a lawn of L. monocytogenes previously treated with carvacrol showed a loss in life span (p ≤ 0.05) as compared with L. monocytogenes treated with citral, Escherichia coli OP50 as a negative control, and treated and untreated L. innocua. Egg laying was also affected: worms fed in a lawn of treated and untreated L. monocytogenes laid fewer eggs than those fed in a lawn of treated and untreated L. innocua or fed with OP50 as a negative control. Worms fed in a lawn of treated and untreated L. innocua also laid fewer eggs than those fed with OP50 as a negative control. A phenotype named bag of worms and an undescribed new one, "vulva inflammation", were also observed.

  7. Comparative Study of the Effects of Citral on the Growth and Injury of Listeria innocua and Listeria monocytogenes Cells (United States)

    Silva-Angulo, Angela B.; Zanini, Surama F.; Rosenthal, Amauri; Rodrigo, Dolores; Klein, Günter; Martínez, Antonio


    This study investigates the effect of citral on growth and on the occurrence of sublethal damage in Listeria innocua Serovar 6a (CECT 910) and Listeria monocytogenes Serovar 4b (CECT 4032) cells that were exposed to citral as a natural antimicrobial agent. Two initial inoculum concentrations were considered in this investigation: 102 and 106 cfu/mL. Citral exhibited antilisterial activity against L. innocua and L. monocytogenes, and the observed effects were dependent on the concentration of citral present in the culture medium (0, 0.150 and 0.250 μL/mL) (p ≤ 0.05). L. innocua had a shorter lag phase than L. monocytogenes, and the two species had nearly identical maximum specific growth rates. These results indicate that L. innocua could be used as surrogate for L. monocytogenes when testing the effects of this antimicrobial. Significant differences in the lag phase and growth rate were observed between the small and large inoculum concentration (p ≤ 0.05). Citral-treated L. innocua and L. monocytogenes that were recovered on selective medium (i.e., TSA-YE-SC) had a shorter lag phase and a higher maximum specific growth rate than cells that were recovered on non-selective medium (i.e., TSA-YE) (p ≤ 0.05). This result suggests that damage occurs at sublethal concentrations of citral. PMID:25643164

  8. MHC class Jb-restricted cell responses to Listeria monocytogenes infection. (United States)

    Kerksiek, K M; Pamer, E G


    Murine infection with Listeria monocytogenes induces CD8+ T cell responses specific for bacterial peptides that are presented on the infected cell surface by MHC class Ia and MHC class Ib molecules. We have used MHC tetramers to demonstrate that CD8+ T cells restricted by the H2-M3 MHC class Ib molecules constitute a substantial portion of the T cell response to L. monocytogenes infection. The in vivo size and kinetics of MHC class Ib-restricted T cell populations suggests that they play a prominent role in bacterial clearance following primary L. monocytogenes infection.

  9. Listeria monocytogenes in poultry and poultry products: Epidemiological investigations in seven Danish abattoirs

    DEFF Research Database (Denmark)

    Ojeniyi, B.; Wegener, Henrik Caspar; Jensen, N.E.


    abattoirs including poultry processing line samples, and final products were also examined for L. monocytogenes. Listeria monocytogenes was isolated in 0 . 3% to 18 . 7% of the samples collected in the different abattoirs. Epidemiological typing of 247 L. monocytogenes isolates, including serotyping, phage...... typing, pulsed-field gel electrophoresis and ribotyping revealed 62 different clones. Based upon typability and discriminatory power, DNA typing methods used were found equally suitable as epidemiological markers. Serotyping and phage typing were not found useful as epidemiological markers for poultry...

  10. Sigma B Contributes to PrfA-Mediated Virulence in Listeria monocytogenes


    Nadon, Celine A.; Bowen, Barbara M.; Wiedmann, Martin; Boor, Kathryn J.


    Transcription of the Listeria monocytogenes positive regulatory factor A protein (PrfA) is initiated from either of two promoters immediately upstream of prfA (prfAp1 and prfAp2) or from the upstream plcA promoter. We demonstrate that prfAp2 is a functional σB-dependent promoter and that a sigB deletion mutation affects the virulence phenotype of L. monocytogenes. Thus, the alternative sigma factor σB contributes to virulence in L. monocytogenes.

  11. Incidence and characterization of Listeria monocytogenes in foods available in Taiwan.


    Wong, H. C.; Chao, W L; Lee, S. J.


    A variety of foods were examined for the incidence of Listeria monocytogenes, and the bacterial isolates were further characterized. L. monocytogenes was selected on LiCl-phenylethanol-moxalactam agar after enrichments and identified by several biochemical, mobility, and CAMP tests. L. monocytogenes was isolated from 58.8% of pork samples, 50% of chicken carcasses, 38% of turkey parts, 34% of frozen semiready foods, 24% of beef steaks, 12.2% of vegetables, 10.5% of seafoods, and 4.4% of froze...

  12. Listeria monocytogenes Infection in a Sugar Glider (Petaurus breviceps) - New Mexico, 2011. (United States)

    Nichols, M; Takacs, N; Ragsdale, J; Levenson, D; Marquez, C; Roache, K; Tarr, C L


    Listeria monocytogenes is a Gram-positive, facultative anaerobic, rod-shaped bacterium that can infect and cause disease in many species. In this case report, we describe a case of L. monocytogenes infection causing sepsis in a sugar glider (Petaurus breviceps). The sugar glider consumed a varied diet consisting of human food items, including cantaloupe. A nationwide outbreak of L. monocytogenes foodborne illness associated with cantaloupes occurred simultaneously with this incident case. In this case, the bacterial strains from the outbreak and glider were genetically distinct. Although rare, veterinarians should be aware of the emergence of foodborne pathogens' ability to infect exotic animals residing in domestic environments.

  13. Benzalkonium tolerance genes and outcome in Listeria monocytogenes meningitis. (United States)

    Kremer, P H C; Lees, J A; Koopmans, M M; Ferwerda, B; Arends, A W M; Feller, M M; Schipper, K; Valls Seron, M; van der Ende, A; Brouwer, M C; van de Beek, D; Bentley, S D


    Listeria monocytogenes is a food-borne pathogen that can cause meningitis. The listerial genotype ST6 has been linked to increasing rates of unfavourable outcome over time. We investigated listerial genetic variation and the relation with clinical outcome in meningitis. We sequenced 96 isolates from adults with listerial meningitis included in two prospective nationwide cohort studies by whole genome sequencing, and evaluated associations between bacterial genetic variation and clinical outcome. We validated these results by screening listerial genotypes of 445 cerebrospinal fluid and blood isolates from patients over a 30-year period from the Dutch national surveillance cohort. We identified a bacteriophage, phiLMST6 co-occurring with a novel plasmid, pLMST6, in ST6 isolates to be associated with unfavourable outcome in patients (p 2.83e-05). The plasmid carries a benzalkonium chloride tolerance gene, emrC, conferring decreased susceptibility to disinfectants used in the food-processing industry. Isolates harbouring emrC were growth inhibited at higher levels of benzalkonium chloride (median 60 mg/L versus 15 mg/L; p <0.001), and had higher MICs for amoxicillin and gentamicin compared with isolates without emrC (both p <0.001). Transformation of pLMST6 into naive strains led to benzalkonium chloride tolerance and higher MICs for gentamicin. These results show that a novel plasmid, carrying the efflux transporter emrC, is associated with increased incidence of ST6 listerial meningitis in the Netherlands. Suggesting increased disease severity, our findings warrant consideration of disinfectants used in the food-processing industry that select for resistance mechanisms and may, inadvertently, lead to increased risk of poor disease outcome. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  14. Acanthamoeba feature a unique backpacking strategy to trap and feed on Listeria monocytogenes and other motile bacteria

    DEFF Research Database (Denmark)

    Doyscher, Dominik; Fieseler, Lars; Dons, Lone Elisabet


    Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.?monocytogenes, wher......Despite its prominent role as an intracellular human pathogen, Listeria monocytogenes normally features a saprophytic lifestyle, and shares many environmental habitats with predatory protozoa. Earlier studies claimed that Acanthamoeba may act as environmental reservoirs for L.......?monocytogenes, whereas others failed to confirm this hypothesis. Our findings support the latter and provide clear evidence that L.?monocytogenes is unable to persist in Acanthamoeba castellanii and A.?polyphaga. Instead, external Listeria cells are rapidly immobilized on the surface of Acanthamoeba trophozoites...... that formation of backpacks is not specific for L.?monocytogenes, and independent of bacterial pathogenicity or virulence. Hence, backpacking appears to represent a unique and highly effective strategy of Acanthamoeba to trap and feed on motile bacteria....

  15. Inhibitory Effect of Nisin on Listeria monocytogenes Inoculated into Surimi and Minced Meat

    Directory of Open Access Journals (Sweden)

    Masoud Rezaei


    Full Text Available Background & Objective: Listeria monocytogenes has already established as an important food born pathogen which induce listeriosis in human. Use of bacteriocins to provide food safety has been increased dramatically. Nisin has a wide spectrum inhibitory effect than the other bacteriocins and inhibits food-borne pathogens such as L. monocytogenes and many other Gram-positive spoilage microorganisms. The purpose of this study was to investigate the inhibitory effect of Nisin on population of Listeria monocytogenes and the role of changes in food components on the antilisterial properties of Nisin. Materials & Methods: The minced meat and surimi samples were inoculated by 1×104 cfu/g of L. monocytogenes. Then samples exposed to Nisin at the levels of 500 or 1000 IU/g were prepared. All treatments after packaging in plastic bags were kept for 12 days at refrigerator temperature. Samples were cultured on CHROMagarTM Listeria every 2 days and the number of listeria monocytogenes was counted. Results: two different concentrations of Nisin (500 or 1000 IU/g was not able to inhibit L. monocytogenes below the acceptable level for raw food (100 cells per g in minced meat and surimi of silver carp. But the number of bacteria reduces more in fish surimi as compared to the mince meal. Also, antilisterial activity of Nisin was reduced during the storage period. Conclusion: Inhibitory property of Nisin against L. monocytogenes in surimi significantly was higher than the minced (P<0.05. So it is possible the antilisterial properties of Nisin will increase by elimination of some enzymes during processing.

  16. Assessment of Listeria monocytogenes virulence in the Galleria mellonella insect larvae model (United States)

    Rakic Martinez, Mira; Ferguson, Martine; Datta, Atin R.


    Several animal models have been used to understand the molecular basis of the pathogenicity, infectious dose and strain to strain variation of Listeria monocytogenes. The greater wax worm Galleria mellonella, as an alternative model, provides some useful advantages not available with other models and has already been described as suitable for the virulence assessment of various pathogens including L. monocytogenes. The objectives of this study are: 1) confirming the usefulness of this model with a wide panel of Listeria spp. including non-pathogenic L. innocua, L. seeligeri, L. welshimeri and animal pathogen L. ivanovii; 2) assessment of virulence of several isogenic in-frame deletion mutants in virulence and stress related genes of L. monocytogenes and 3) virulence assessment of paired food and clinical isolates of L. monocytogenes from 14 major listeriosis outbreaks occurred worldwide between 1980 and 2015. Larvae injected with different concentrations of Listeria were incubated at 37°C and monitored over seven days for time needed to kill 50% of larvae (LT50) and to determine change of bacterial population in G. mellonella, 2 and 24 hours post-inoculation. Non-pathogenic members of Listeria and L. ivanovii showed significantly (P monocytogenes strains. Isogenic mutants of L. monocytogenes with the deletions in prfA, plcA, hly, actA and virR genes, also showed significantly (P monocytogenes strains related to non-invasive (gastroenteritis) outbreaks of listeriosis showed significantly (P < 0.05) lower virulence than isolates of the same serotype obtained from outbreaks with invasive symptoms. The difference, however, was dose and strain- dependent. No significant differences in virulence were observed among the serotype tested in this study. PMID:28898264

  17. Molecular analysis of the iap gene of Listeria monocytogenes isolated from cheeses in Rio Grande do Sul, Brazil Análise molecular do gene iap de Listeria monocytogenes isoladas de queijos no Estado do Rio Grande do Sul, Brasil

    Directory of Open Access Journals (Sweden)

    Jozi Fagundes de Mello


    Full Text Available The polymorphic region sequences in the iap gene were analyzed in 25 strains of Listeria monocytogenes isolated from cheeses in the state of Rio Grande do Sul, and compared with reference strains. This investigation distinguished two clusters of L. monocytogenes: I (20 strains and II (5 strains.A seqüência da região polimórfica do gene iap foi analisada em 25 cepas de Listeria monocytogenes isoladas de queijo no Estado do Rio Grande do Sul e comparadas com cepas referências. Esta investigação distinguiu L. monocytogenes em dois grupos: I (20 cepas e II (5 cepas.

  18. Listeria monocytogenes following orthotopic liver transplantation: Central nervous system involvement and review of the literature

    Institute of Scientific and Technical Information of China (English)


    Listeria monocytogene is a well-recognized cause of bacteremia in immunocompromised individuals, including solid organ transplant recipients, but has been rarely reported following orthotopic liver transplantation. We describe a case of listeria meningitis that occurred within a week after liver transplantation. The patient developed a severe headache that mimicked tacrolimus encephalopathy, and was subsequently diagnosed with listeria meningitis by cerebrospinal fluid culture. The infection was successfully treated with three-week course of intravenous ampicillin. Recurrent hepatitis C followed and was successfully treated with interferon alfa and ribavirin. Fourteen cases of listeriosis after orthotopic liver transplantation have been reported in the English literature. Most reported cases were successfully treated with intravenous ampicillin. There were four cases of listeria meningitis, and the mortality of them was 50%.Early detection and treatment of listeria meningitis are the key to obtaining a better prognosis.

  19. Mathematical modelling of growth of Listeria  monocytogenes in raw chilled pork. (United States)

    Ye, K; Wang, K; Liu, M; Liu, J; Zhu, L; Zhou, G


    The aim of this study was to analyse the growth kinetics of Listeria monocytogenes in naturally contaminated chilled pork. A cocktail of 26 meat-borne L. monocytogenes was inoculated to raw or sterile chilled pork to observe its growth at 4, 10, 16, 22 and 28°C respectively. The growth data were fitted by the Baranyi model and Ratkowsky square-root model. Results showed that the Baranyi model and Ratkowsky square-root model could describe the growth characteristics of L. monocytogenes at different temperatures reasonably well in raw chilled pork (1·0 ≤ Bf ≤ Af ≤ 1·1). Compared with the growth of L. monocytogenes in sterile chilled pork, the background microflora had no impact on the growth parameters of L. monocytogenes, except for the lag phase at low temperature storage. The microbial predictive models developed in this study can be used to predict the growth of L. monocytogenes during natural spoilage, and construct quantitative risk assessments in chilled pork. This study simulated the actual growth of Listeria monocytogenes in chilled pork to the maximum extent, and described its growth characteristics of L. monocytogenes during natural spoilage. This study showed that the background microflora had no impact on the growth parameters of L. monocytogenes, except for the lag phase at low temperature storage. The models developed in this study can be used to predict the growth of L. monocytogenes during refrigerated storage. © 2017 The Society for Applied Microbiology.

  20. An insight into the isolation, enumeration and molecular detection of Listeria monocytogenes in food

    Directory of Open Access Journals (Sweden)

    Jodi Woan-Fei Law


    Full Text Available Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria Enrichment Broth (BLEB, Fraser broth and University of Vermont Medium (UVM Listeria enrichment broth are recommended by regulatory agencies such as FDA-BAM, USDA-FSIS and ISO. Many plating media are available for the isolation of L. monocytogenes, for instance, PALCAM, Oxford and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. MPN technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction (PCR, multiplex polymerase chain reaction (mPCR, real-time/quantitative polymerase chain reaction (qPCR, nucleic acid sequence-based amplification (NASBA, loop-mediated isothermal amplification (LAMP, DNA microarray and Next Generation Sequencing (NGS technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labour-saving. In future, there are chances for the development of new techniques for the detection and identification of foodborne with improved features.

  1. An insight into the isolation, enumeration, and molecular detection of Listeria monocytogenes in food (United States)

    Law, Jodi Woan-Fei; Ab Mutalib, Nurul-Syakima; Chan, Kok-Gan; Lee, Learn-Han


    Listeria monocytogenes, a foodborne pathogen that can cause listeriosis through the consumption of food contaminated with this pathogen. The ability of L. monocytogenes to survive in extreme conditions and cause food contaminations have become a major concern. Hence, routine microbiological food testing is necessary to prevent food contamination and outbreaks of foodborne illness. This review provides insight into the methods for cultural detection, enumeration, and molecular identification of L. monocytogenes in various food samples. There are a number of enrichment and plating media that can be used for the isolation of L. monocytogenes from food samples. Enrichment media such as buffered Listeria enrichment broth, Fraser broth, and University of Vermont Medium (UVM) Listeria enrichment broth are recommended by regulatory agencies such as Food and Drug Administration-bacteriological and analytical method (FDA-BAM), US Department of Agriculture-Food and Safety (USDA-FSIS), and International Organization for Standardization (ISO). Many plating media are available for the isolation of L. monocytogenes, for instance, polymyxin acriflavin lithium-chloride ceftazidime aesculin mannitol, Oxford, and other chromogenic media. Besides, reference methods like FDA-BAM, ISO 11290 method, and USDA-FSIS method are usually applied for the cultural detection or enumeration of L. monocytogenes. most probable number technique is applied for the enumeration of L. monocytogenes in the case of low level contamination. Molecular methods including polymerase chain reaction, multiplex polymerase chain reaction, real-time/quantitative polymerase chain reaction, nucleic acid sequence-based amplification, loop-mediated isothermal amplification, DNA microarray, and next generation sequencing technology for the detection and identification of L. monocytogenes are discussed in this review. Overall, molecular methods are rapid, sensitive, specific, time- and labor-saving. In future, there are

  2. Modeling and predicting the growth boundary of Listeria monocytogenes in lightly preserved seafood

    DEFF Research Database (Denmark)

    Mejlholm, Ole; Dalgaard, Paw


    The antimicrobial effect of diacetate and lactate against Listeria monocytogenes was evaluated in challenge tests with vacuum-packaged or modified atmosphere packaged (MAP) cold-smoked salmon, marinated salmon, cold-smoked Greenland halibut, marinated Greenland halibut, and gravad salmon. MAP cold...

  3. Survival of Listeria monocytogenes on a conveyor belt material with or without antimicrobial additives

    NARCIS (Netherlands)

    Chaitiemwong, N.; Hazeleger, W.C.; Beumer, R.R.


    Survival of Listeria monocytogenes on a conveyor belt material with or without antimicrobial additives, in the absence or presence of food debris from meat, fish and vegetables and at temperatures of 10, 25 and 37 °C was investigated. The pathogen survived best at 10 °C, and better at 25 °C than at

  4. Effect of temperature and salt on thermal inactivation of Listeria monocytogenes in Salmon Roe (United States)

    Listeria monocytogenes is a potentially fatal foodborne pathogen that can be found in ready-to-eat seafood products, such as fresh salmon roe. Once contaminated, salmon roe must be decontaminated prior to human consumption. This study was conducted to determine the thermal inactivation kinetics of...

  5. Oxygen restriction increases the infection potential of Listeria monocytogenes - a transcriptional analysis

    DEFF Research Database (Denmark)

    Andersen, Jens Bo; Bergström, Anders; Knudsen, Gitte Maegaard

    Listeria monocytogenes has been implicated in several food borne outbreaks as well as sporadic cases of disease during the last two decades. Increased understanding of the biology of this organism is important in the prevention of food borne listeriosis. This is highly relevant for safety...

  6. Extracting additional risk managers information from a risk assessment of Listeria monocytogenes in deli meats

    NARCIS (Netherlands)

    Pérez-Rodríguez, F.; Asselt, van E.D.; García-Gimeno, R.M.; Zurera, G.; Zwietering, M.H.


    The risk assessment study of Listeria monocytogenes in ready-to-eat foods conducted by the U.S. Food and Drug Administration is an example of an extensive quantitative microbiological risk assessment that could be used by risk analysts and other scientists to obtain information and by managers and s

  7. Prevalence of Listeria monocytogenes in European cheeses: A systematic review and meta-analysis

    DEFF Research Database (Denmark)

    Martinez Rios, Veronica; Dalgaard, Paw

    Both in Europe and worldwide cheese has cause important outbreaks of listeriosis and can be a vehicle for transmission of Listeria monocytogenes to consumers. A systematic review and meta-analysis were conducted using scientific literature and European Food Safety Authority (EFSA) reports...

  8. Draft Genome Sequences of Historical Listeria monocytogenes from Human Listeriosis, 1933 (United States)

    We report here the draft genome sequences of two Listeria monocytogenes strains from some of the earliest reported cases of human listeriosis in North America. The strains were isolated in 1933 from patients in Massachusetts and Connecticut, USA, and belong to the widely disseminated hypervirulent c...

  9. Draft Genome Sequences of Two Historical Listeria monocytogenes Strains from Human Listeriosis Cases in 1933 (United States)

    Lee, Sangmi; Ward, Todd J.; Orwig, Nathane; Altermann, Eric; Jima, Dereje; Parsons, Cameron; Kathariou, Sophia


    We report here the draft genome sequences of two Listeria monocytogenes strains from some of the earliest reported cases of human listeriosis in North America. The strains were isolated in 1933 from patients in Massachusetts and Connecticut, USA, and belong to the widely disseminated hypervirulent clonal complex 1 (CC1) and CC2. PMID:27932656

  10. Multiparameter viability assay for stress profiling applied to the food pathogen Listeria monocytogenes F2365

    NARCIS (Netherlands)

    Nocker, A.; Caspers, M.; Esveld-Amanatidou, A.; Vossen, J. van der; Schuren, F.; Montijn, R.; Kort, R.


    A novel generic approach for stress profiling was applied to Listeria monocytogenes strain F2365. This food-borne pathogen was exposed to gradients of five different stresses of increasing intensity, typically ranging from moderate to lethal conditions. The stress factors included heat, acidic pH, a

  11. Antimicrobial activity of nisin incorporated in pectin and polylactic acid composite films against Listeria monocytogenes (United States)

    Extruded composite films from 20% pectin and 80% polylactic acids (PLA) were developed and nisin was loaded into films by a diffusion post extrusion. Inhibitory activities of the films against Listeria monocytogenes were evaluated in brain heart infusion (BHI) broth, liquid egg white and orange juic...

  12. Fate of Listeria monocytogenes in Gouda microcheese: No growth, and substantial inactivation after extended ripening times

    NARCIS (Netherlands)

    Wemmenhove, E.; Stampelou, I.; Hooijdonk, van A.C.M.; Zwietering, M.H.; Wells-Bennik, M.H.J.


    This challenge study demonstrates that Listeria monocytogenes does not grow in Gouda cheese: during the first 8 weeks of ripening no growth was observed and between 8 and 52 weeks viable numbers declined significantly in a well-established Gouda microcheese system. Cheese milk was artificially conta


    Directory of Open Access Journals (Sweden)

    Jaroslav Pochop


    Full Text Available The aim of this study was to follow the contamination of food with Listeria monocytogenes by using Step One real time polymerase chain reaction (PCR. We used the PrepSEQ Rapid Spin Sample Preparation Kit for isolation of DNA and SensiFAST SYBR Hi-ROX Kit for the real-time PCR performance. In 24 samples of food of animal origin without incubation were detected strains of Listeria monocytogenes in 15 samples (swabs. Nine samples were negative. Our results indicated that the real-time PCR assay developed in this study could sensitively detect Listeria monocytogenes in food of animal origin without incubation. This could prevent infection caused by Listeria monocytogenes, and also could benefit food manufacturing companies by extending their product’s shelf-life as well as saving the cost of warehousing their food products while awaiting pathogen testing results. The rapid real-time PCR-based method performed very well compared to the conventional method. It is a fast, simple, specific and sensitive way to detect nucleic acids, which could be used in clinical diagnostic tests in the future.

  14. Control of Listeria monocytogenes in Turkey Deli Loaves using Organic Acids as Formulation Ingredients (United States)

    The growth of Listeria monocytogenes (LM) in further processed meat products has become a major concern and an important food safety issue. The meat and poultry industries have incorporated interventions such as organic acids in marinades in order to inhibit the growth of LM. In this study, organic...

  15. Identification of a sigma B-dependent small noncoding RNA in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Nielsen, Jesper Sejrup; Olsen, Anders Steno; Bonde, Mette


    In Listeria monocytogenes, the alternative sigma factor sigma(B) plays important roles in stress tolerance and virulence. Here, we present the identification of SbrA, a novel small noncoding RNA that is produced in a sigma(B)-dependent manner. This finding adds the sigma(B) regulon to the growing...

  16. Morphological change and decreasing transfer rate of biofilm-featured Listeria monocytogenes EGDe (United States)

    Listeria monocytogenes, a lethal foodborne pathogen, has the ability to resist the hostile food-processing environment and, thus, frequently contaminates ready-to-eat foods during processing. It is commonly accepted that L. monocytogenes’ tendency to generate biofilms on various surfaces enhances it...

  17. Evaluation of Listeria monocytogenes survival and infectivity in non-traditional agricultural waters (United States)

    Introduction: Listeria monocytogenes (Lm) is an enteric bacterium that can be found in environmental reservoirs. Restricted water availability for agriculture has increased interest in surface and reuse water sources which could potentially transmit Lm. Purpose: Persistence and infectivity of Lm re...

  18. The study of effect bacteriocin producing Lactoco ccus lactis on Listeria monocytogenes and Bacillus cereus

    Directory of Open Access Journals (Sweden)

    M. Mirhossieni, M.Sc


    Full Text Available AbstractBackground and purpose: Dairy products often associated with problems such as short shelf life and poor hygiene control. A novel approach is to utilize bacteriocin or bacteriocin producer strains, to control undesirable micro flora as Listeria monocytogenes and Bacillus cereus in foods. Hence, we studied the effect of nisin like producing Lactococcus lactis against Listeria monocytogenes and Bacillus cereus, in order to compare the isolated strain within different countries.Materials and Methods: In this research we studied the effect of nisin like producing Lactococcus lactis, with producer spot test method. We also used supernatant from 24 h culture of Lactoccus lactis. Moreover, we studied the effect of bacteriocin on Listeria monocytogenes and Bacillus cereus growth curves.Results: The growth of both strains was inhibited by the bacteriocin. Conclusion: According to our results, the bacteriocin could be used in liquid food with bacteriocin added directly or as a starter culture in fermentation. This would inhibit the growth of Listeria monocytogenes; furthermore, Bacillus cereus is used to reduce food poisoning for fermented food products.

  19. Combined action of nisin and carvacrol on Bacillus cereus and Listeria monocytogenes

    NARCIS (Netherlands)

    Pol, I.E.; Smid, E.J.


    Nisin, a small antimicrobial protein, was tested for its bactericidal action against Listeria monocytogenes and Bacillus cereus and a typical biphasic reduction of the viable count was observed. The reduction was most fast during the first 10 min of exposure, while the viable count remained stable i

  20. Fate of Listeria monocytogenes in Gouda microcheese: No growth, and substantial inactivation after extended ripening times

    NARCIS (Netherlands)

    Wemmenhove, E.; Stampelou, I.; Hooijdonk, van A.C.M.; Zwietering, M.H.; Wells-Bennik, M.H.J.


    This challenge study demonstrates that Listeria monocytogenes does not grow in Gouda cheese: during the first 8 weeks of ripening no growth was observed and between 8 and 52 weeks viable numbers declined significantly in a well-established Gouda microcheese system. Cheese milk was artificially

  1. Tackling the true prevalence of Listeria monocytogenes in 16 tons of frankfurters (United States)

    Given its ubiquity, persistence, and pathogenicity in our food supply, Listeria monocytogenes remains a serious threat to public health. To minimize the load and occurrence of the pathogen and concomitantly continue efforts to develop and implement effective interventions to ensure that an infectio...

  2. Direct, quantitative detection of Listeria monocytogenes in fresh raw whole milk by qPCR (United States)

    The development and optimization of a method to detect and quantify Listeria monocytogenes in raw milk is described here. Three-step treatment of samples with EDTA, SDS, DNase and trypsin was combined with centrifugation to concentrate bacteria from 10 mL of raw milk and reduce or eliminate potenti...

  3. Prevalence of Listeria monocytogenes in European cheeses: A systematic review and meta-analysis

    DEFF Research Database (Denmark)

    Martinez Rios, Veronica; Dalgaard, Paw

    Both in Europe and worldwide cheese has cause important outbreaks of listeriosis and can be a vehicle for transmission of Listeria monocytogenes to consumers. A systematic review and meta-analysis were conducted using scientific literature and European Food Safety Authority (EFSA) reports...... as input for quantitative risk assessment modelling....

  4. Genome comparison of Listeria monocytogenes serotype 4a strain HCC23 with selected lineage I and lineage II L. monocytogenes strains and other Listeria strains

    Directory of Open Access Journals (Sweden)

    Debarati Paul


    Full Text Available More than 98% of reported human listeriosis cases are caused by specific serotypes within genetic lineages I and II. The genome sequence of Listeria monocytogenes lineage III strain HCC23 (serotype 4a enables whole genomic comparisons across all three L. monocytogenes lineages. Protein cluster analysis indicated that strain HCC23 has the most unique protein pairs with nonpathogenic species Listeria innocua. Orthology analysis of the genome sequences of representative strains from the three L. monocytogenes genetic lineages and L. innocua (CLIP11262 identified 319 proteins unique to nonpathogenic strains HCC23 and CLIP11262 and 58 proteins unique to pathogenic strains F2365 and EGD-e. BLAST comparison of these proteins with all the sequenced L. monocytogenes and L. innocua revealed 126 proteins unique to serotype 4a and/or L. innocua; 14 proteins were only found in pathogenic serotypes. Some of the 58 proteins unique to pathogenic strains F2365 and EGD-e were previously published and are already known to contribute to listerial virulence.

  5. An outbreak of an unusual strain of Listeria monocytogenes infection in North-East Scotland. (United States)

    Okpo, Emmanuel; Leith, Jayne; Smith-Palmer, Alison; Bell, John; Parks, Duncan; Browning, Fiona; Byers, Lynn; Corrigan, Helen; Webster, Diana; Karcher, Anne M; Murray, Andrew; Storey, Tom


    Listeria monocytogenes infection is an important cause of illness and hospitalization in vulnerable individuals. In the present study, we describe a community outbreak of Listeria monocytogenes in the North-East region of Scotland, which was epidemiologically, environmentally and microbiologically linked to a local meat product and ready-to-eat product manufacturer. Infected individuals were interviewed, and an environmental investigation was conducted. Clinical and environmental samples were tested by culture, and isolates were typed by fluorescent amplified fragment length polymorphism (fAFLP). Three cases of Listeria monocytogenes were linked geographically, had the same serotype (1/2a) and were indistinguishable by fAFLP type XII.6. The human, food and environmental isolates were of the same serotype and were indistinguishable by molecular typing. This is the first community outbreak of L. monocytogenes reported in Scotland since the current outbreak surveillance was established in 1996. Epidemiological and laboratory evidence indicated poor hand hygiene, unhygienic practices and cross-contamination throughout the manufacturing process of ready-to-eat foods as a possible cause of the outbreak. More stringent control of commercial food establishments that provide ready-to-eat food and the need to advise specifically vulnerable groups, e.g., pregnant women, of the risk of L. monocytogenes in ready-to-eat food is urgently needed. Copyright © 2015 King Saud Bin Abdulaziz University for Health Sciences. Published by Elsevier Ltd. All rights reserved.

  6. Applicability of the EN ISO 11290-1 standard method for Listeria monocytogenes detection in presence of new Listeria species. (United States)

    Barre, Léna; Angelidis, Apostolos S; Boussaid, Djouher; Brasseur, Emilie Decourseulles; Manso, Eléonore; Gnanou Besse, Nathalie


    During the past six years, new species of the genus Listeria have been isolated from foods and other environmental niches worldwide. The Standard method EN ISO 11290-1 that is currently under revision will include in its scope all Listeria species in addition to L. monocytogenes. The objective of this project was to evaluate the ability of the Standard EN ISO 11290-1 method to detect and identify the newly discovered Listeria spp., and to assess potential over-growth effects of the new species in mixed cultures with L. monocytogenes during each step of the enrichment process. This objective was addressed by the generation of necessary data on the behavior of the new species during the pre-enrichment and the enrichment steps of the reference method as well as data on their phenotypic characteristics on rich and selective media used for isolation and identification. Most of the new Listeria species developed well on selective agar media for Listeria, however the recovery of some species was difficult due to poor growth in Half Fraser and Fraser broth. Good results (consistently positive) were obtained for confirmation at the genus level via the catalase test, the Gram test and the blueish appearance test on non-selective medium, but not with the VP test, as most of the new species yielded a negative result. In the light of results obtained in co-culture experiments and inhibition tests, and considering the growth rates in Half Fraser and Fraser broths, the new species do not seem to interfere with the detection of L. monocytogenes. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. [Monitoring of a HACCP (Hazard Analysis Critical Control Point) plan for Listeria monocytogenes control]. (United States)

    Mengoni, G B; Apraiz, P M


    The monitoring of a HACCP (Hazard Analysis Critical Control Point) plan for the Listeria monocytogenes control in the cooked and frozen meat section of a thermo-processing meat plant was evaluated. Seventy "non-product-contact" surface samples and fourteen finished product samples were examined. Thirty eight positive sites for the presence of Listeria sp. were obtained. Twenty-two isolates were identified as L. monocytogenes, two as L. seeligeri and fourteen as L. innocua. Non isolates were obtained from finished product samples. The detection of L. monocytogenes in cooked and frozen meat section environment showed the need for the HACCP plan to eliminate or prevent product contamination in the post-thermal step.

  8. Teichoic acid is the major polysaccharide present in the Listeria monocytogenes biofilm matrix. (United States)

    Brauge, Thomas; Sadovskaya, Irina; Faille, Christine; Benezech, Thierry; Maes, Emmanuel; Guerardel, Yann; Midelet-Bourdin, Graziella


    The aim of this study was to characterize the Listeria monocytogenes biofilm and particularly the nature of the carbohydrates in the biofilm extracellular matrix and culture supernatant versus to cell wall carbohydrates. Listeria monocytogenes serotype 1/2a and 4b strains were able to form complex biofilms embedded in an extracellular matrix. The soluble carbohydrates from biofilm extracellular matrix and culture supernatant were identified as teichoic acids, structurally identical to cell wall teichoic acids. In addition, the DSS 1130 BFA2 strain had a serotype 1/2a teichoic acid lacking N-acetyl glucosamine glycosylation due to a mutation in the lmo2550 gene. Consequently, we hypothesized that the extracellular teichoic acids in L. monocytogenes biofilms have the same origin as cell wall teichoic acid. © FEMS 2015. All rights reserved. For permissions, please e-mail:

  9. Visualization of gold and platinum nanoparticles interacting with Salmonella Enteritidis and Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Ewa Sawosz


    Full Text Available Ewa Sawosz1, André Chwalibog2, Jacek Szeliga3, Filip Sawosz2, Marta Grodzik1, Marlena Rupiewicz1, Tomasz Niemiec1, Katarzyna Kacprzyk11Division of Biotechnology and Biochemistry of Nutrition, Warsaw University of Life Sciences, Warsaw, Poland; 2Department of Basic Animal and Veterinary Sciences, University of Copenhagen, Copenhagen, Denmark; 3Division of Microbiology of Analytical Centre, Warsaw University of Life Sciences, Warsaw, PolandPurpose: Rapid development of nanotechnology has recently brought significant attention to the extraordinary biological features of nanomaterials. The objective of the present ­investigation was to evaluate morphological characteristics of the assembles of gold and platinum nanoparticles (nano-Au and nano-Pt respectively, with Salmonella Enteritidis (Gram-negative and Listeria monocytogenes (Gram-positive, to reveal possibilities of constructing bacteria-nanoparticle vehicles.Methods: Hydrocolloids of nano-Au or nano-Pt were added to two bacteria suspensions in the following order: nano-Au + Salmonella Enteritidis; nano-Au + Listeria monocytogenes; nano-Pt + Salmonella Enteritidis; nano-Pt + Listeria monocytogenes. Samples were inspected by transmission electron microscope.Results: Visualization of morphological interaction between nano-Au and Salmonella Enteritidis and Listeria monocytogenes, showed that nano-Au were aggregated within flagella or biofilm network and did not penetrate the bacterial cell. The analysis of morphological effects of interaction of nano-Pt with bacteria revealed that nano-Pt entered cells of Listeria monocytogenes and were removed from the cells. In the case of Salmonella Enteritidis, nano-Pt were seen inside bacteria cells, probably bound to DNA and partly left bacterial cells. After washing and centrifugation, some of the nano-Pt-DNA complexes were observed within Salmonella Enteritidis.Conclusion: The results indicate that the bacteria could be used as a vehicle to deliver nano

  10. Listeria monocytogenes endophthalmitis - case report and review of risk factors and treatment outcomes. (United States)

    Bajor, Anna; Luhr, Anke; Brockmann, Dorothee; Suerbaum, Sebastian; Framme, Carsten; Sedlacek, Ludwig


    The majority of cases of endophthalmitis are caused by exogenous pathogens; only 5-10 % are of endogenous origin. One cause of these rare cases of endogenous endophthalmitis is Listeria monocytogenes. Twenty-six cases of endophthalmitis due to this pathogen have been published over the last twenty years. The aim of this review is to summarize the main risk factors and common clinical findings of endogenous endophthalmitis due to Listeria monocytogenes. We report on a 62-year-old female presenting with a sterile hypopyon iritis with secondary glaucoma and an underlying rheumatoid disease. In microbiological analysis we identified Listeria monocytogenes. Further we searched through all published cases for typical signs, risk factors, details of medical and surgical treatment and outcome of endogenous endophthalmitis due to this rare pathogen. Ocular symptoms in almost all of these published cases included pain, redness of the eye, and decreased vision. Main clinical features included elevated intraocular pressure and fibrinous anterior chamber reaction, as well as a dark hypopyon. While the infection is typically spread endogenously, neither an exogenous nor endogenous source of infection could be identified in most cases. Immunocompromised patients are at higher risk of being infected than immunocompetent patients. The clinical course of endophthalmitis caused by Listeria monocytogenes had different visual outcomes. In some cases, the infection led to enucleation, blindness, or strong visual loss, whereas most patients showed a tendency of visual improvement during therapy. Early diagnosis and treatment initiation are crucial factors in the outcome of endogenous endophthalmitis caused by Listeria monocytogenes. This possible differential diagnosis should be kept in mind while treating patients with presumable sterile hypopyon and anterior uveitis having a high intraocular pressure. A bacterial source should be considered with a prompt initiation of systemic

  11. Rapid identification and classification of Listeria spp. and serotype assignment of Listeria monocytogenes using fourier transform-infrared spectroscopy and artificial neural network analysis (United States)

    The use of Fourier Transform-Infrared Spectroscopy (FT-IR) in conjunction with Artificial Neural Network software, NeuroDeveloper™ was examined for the rapid identification and classification of Listeria species and serotyping of Listeria monocytogenes. A spectral library was created for 245 strains...

  12. Lack of PPARγ in myeloid cells confers resistance to Listeria monocytogenes infection.

    Directory of Open Access Journals (Sweden)

    Zeinab Abdullah

    Full Text Available The peroxisomal proliferator-activated receptor γ (PPARγ is a nuclear receptor that controls inflammation and immunity. Innate immune defense against bacterial infection appears to be compromised by PPARγ. The relevance of PPARγ in myeloid cells, that organize anti-bacterial immunity, for the outcome of immune responses against intracellular bacteria such as Listeria monocytogenes in vivo is unknown. We found that Listeria monocytogenes infection of macrophages rapidly led to increased expression of PPARγ. This prompted us to investigate whether PPARγ in myeloid cells influences innate immunity against Listeria monocytogenes infection by using transgenic mice with myeloid-cell specific ablation of PPARγ (LysMCre×PPARγ(flox/flox. Loss of PPARγ in myeloid cells results in enhanced innate immune defense against Listeria monocytogenes infection both, in vitro and in vivo. This increased resistance against infection was characterized by augmented levels of bactericidal factors and inflammatory cytokines: ROS, NO, IFNγ TNF IL-6 and IL-12. Moreover, myeloid cell-specific loss of PPARγ enhanced chemokine and adhesion molecule expression leading to improved recruitment of inflammatory Ly6C(hi monocytes to sites of infection. Importantly, increased resistance against Listeria infection in the absence of PPARγ was not accompanied by enhanced immunopathology. Our results elucidate a yet unknown regulatory network in myeloid cells that is governed by PPARγ and restrains both listeriocidal activity and recruitment of inflammatory monocytes during Listeria infection, which may contribute to bacterial immune escape. Pharmacological interference with PPARγ activity in myeloid cells might represent a novel strategy to overcome intracellular bacterial infection.

  13. Listeriosis outbreak in dairy cattle caused by an unusual Listeria monocytogenes serotype 4b strain. (United States)

    Bundrant, Brittany N; Hutchins, Tony; den Bakker, Henk C; Fortes, Esther; Wiedmann, Martin


    A listeriosis outbreak, in dairy cattle, with a high case mortality and acute death after onset of symptoms was investigated using gross pathology and bacteriologic approaches, including molecular characterization of a clinical Listeria monocytogenes isolate. In a herd of 315 animals, 9 animals showed clinical symptoms consistent with listeriosis, including 3 animals that died within 2-4 days after acute onset of clinical signs, 4 animals that were euthanized, and 2 that survived. Initial EcoRI ribotyping and serotyping indicated that this outbreak was caused by an unusual L. monocytogenes serotype 4b strain, which was classified into lineage III. Further characterization of this isolate by DNA sequencing-based subtyping methods indicated that the strain responsible for this outbreak represented a unique genotype as supported by its classification into a new sigB allelic type, which has not been identified previously among >290 isolates, and by compelling phylogenetic evidence. While lineage III isolates are generally rare, they seem to be more common among L. monocytogenes isolates from animals with clinical signs of listeriosis. This is the first report of a particularly severe clinical course of disease associated with infection by a lineage III strain. The high prevalence of Listeria spp., including L. monocytogenes, in the farm environments may favor emergence and evolution of novel, and possibly more virulent, L. monocytogenes strains. Continued monitoring of animal listeriosis cases and outbreaks may not only improve animal health but also aid in the early discovery of newly emerging L. monocytogenes strains.

  14. Effect of honokiol on exotoxin proteins listeriolysin O and p60 secreted by Listeria monocytogenes. (United States)

    Meng, Rizeng; Zhao, Ziwen; Guo, Na; Liu, Zonghui; Zhao, Xingchen; Li, Wenli; Li, Xiaoxu; Shi, Ce; Nie, Dandan; Wang, Weilin; Liu, Tao; Ma, Wenchen; Yu, Lu; Li, Juan


    Listeria monocytogenes is considered one of the most important foodborne pathogens. The virulence-related proteins listeriolysin O (LLO) and p60 are critical factors involved in Listeria pathogenesis. In the present study, we investigated the effect of honokiol on LLO and p60 secreted from L. monocytogenes. A listeriolysin assay was used to investigate the haemolytic activities of L. monocytogenes exposed to honokiol, and the secretion of LLO and p60 was detected by immunoblot analysis. Additionally, the influence of honokiol on the transcription of LLO and p60 genes (hly and iap, respectively) was analysed by real-time reverse transcription PCR. TNF-α release assays were performed to elucidate the biological relevance of changes in LLO and p60 secretion induced by honokiol. According to the data, honokiol showed good anti-L. monocytogenes activity, with MICs of 8-16 μg ml(-1), and the secretion of LLO and p60 was decreased by honokiol. In addition, the transcription of hly and iap was inhibited by honokiol. Our results indicate that TNF-α production by RAW264.7 cells stimulated with L. monocytogenes supernatants was inhibited by honokiol. Based on these data, we propose that honokiol could be used as a promising natural compound against L. monocytogenes and its virulence factors.

  15. Atlas(®) Listeria monocytogenes LmG2 Detection Assay Using Transcription Mediated Amplification to Detect Listeria monocytogenes in Selected Foods and Stainless Steel Surface. (United States)

    Bres, Vanessa; Yang, Hua; Hsu, Ernie; Ren, Yan; Cheng, Ying; Wisniewski, Michele; Hanhan, Maesa; Zaslavsky, Polina; Noll, Nathan; Weaver, Brett; Campbell, Paul; Reshatoff, Michael; Becker, Michael


    The Atlas Listeria monocytogenes LmG2 Detection Assay, developed by Roka Bioscience Inc., was compared to a reference culture method for seven food types (hot dogs, cured ham, deli turkey, chicken salad, vanilla ice cream, frozen chocolate cream pie, and frozen cheese pizza) and one surface (stainless steel, grade 316). A 125 g portion of deli turkey was tested using a 1:4 food:media dilution ratio, and a 25 g portion for all other foods was tested using 1:9 food:media dilution ratio. The enrichment time and media for Roka's method was 24 to 28 h for 25 g food samples and environmental surfaces, and 44 to 48 h for 125 g at 35 ± 2°C in PALCAM broth containing 0.02 g/L nalidixic acid. Comparison of the Atlas Listeria monocytogenes LmG2 Detection Assay to the reference method required an unpaired approach. For each matrix, 20 samples inoculated at a fractional level and five samples inoculated at a high level with a different strain of Listeria monocytogenes were tested by each method. The Atlas Listeria monocytogenes LmG2 Detection Assay was compared to the Official Methods of Analysis of AOAC INTERNATIONAL 993.12 method for dairy products, the U.S. Department of Agriculture, Food Safety and Inspection Service, Microbiology Laboratory Guidebook 8.08 method for ready-to-eat meat and environmental samples, and the U.S. Food and Drug Administration Bacteriological Analytical Manual, Chapter 10 method for frozen foods. In the method developer studies, Roka's method, at 24 h (or 44 h for 125 g food samples), had 126 positives out of 200 total inoculated samples, compared to 102 positives for the reference methods at 48 h. In the independent laboratory studies, vanilla ice cream, deli turkey and stainless steel grade 316 were evaluated. Roka's method, at 24 h (or 44 h for 125 g food samples), had 64 positives out of 75 total inoculated samples compared to 54 positives for the reference methods at 48 h. The Atlas Listeria monocytogenes LmG2 Detection Assay detected all 50

  16. Listeria monocytogenes and the inflammasome: from cytosolic bacteriolysis to tumor immunotherapy (United States)

    Theisen, Erin; Sauer, John-Demian


    Inflammasomes are cytosolic innate immune surveillance systems that recognize a variety of danger signals, including those from pathogens. Listeria monocytogenes is a Gram-positive intracellular bacterium evolved to live within the harsh environment of the host cytosol. Further, L. monocytogenes can activate a robust cell-mediated immune response that is being harnessed as an immunotherapeutic platform. Access to the cytosol is critical for both causing disease and for inducing a protective immune response, and it is hypothesized that the cytosolic innate immune system, including the inflammasome, is critical for both host protection and induction of long term immunity. L. monocytogenes can activate a variety of inflammasomes via its pore-forming toxin Listeriolysin-O, flagellin, or DNA released through bacteriolysis; however, inflammasome activation attenuates L. monocytogenes, and as such, L. monocytogenes has evolved a variety of ways to limit inflammasome activation. Surprisingly, inflammasome activation also impairs the host cell-mediated immune response. Thus understanding how L. monocytogenes activates or avoids detection by the inflammasome is critical to understand the pathogenesis of L. monocytogenes and improve the cell-mediated immune response generated to L. monocytogenes for more effective immunotherapies. PMID:27460808

  17. Modeling the growth of Listeria monocytogenes on cut cantaloupe, honeydew and watermelon. (United States)

    Danyluk, Michelle D; Friedrich, Loretta M; Schaffner, Donald W


    A recent outbreak linked to whole cantaloupes underscores the importance of understanding growth kinetics of Listeria monocytogenes in cut melons at different temperatures. Whole cantaloupe, watermelon, and honeydew purchased from a local supermarket were cut into 10 ± 1 g cubes. A four-strain cocktail of L. monocytogenes from food related outbreaks was used to inoculate fruit, resulting in ~10(3) CFU/10 g. Samples were stored at 4, 10, 15, 20, or 25 °C and L. monocytogenes were enumerated at appropriate time intervals. The square root model was used to describe L. monocytogenes growth rate as a function of temperature. The model was compared to prior models for Salmonella and Escherichia coli O157:H7 growth on cut melon, as well as models for L. monocytogenes on cantaloupe and L. monocytogenes ComBase models. The current model predicts faster growth of L. monocytogenes vs. Salmonella and E. coli O157:H7 at temperatures below 20 °C, and agrees with estimates from ComBase Predictor, and a corrected published model for L. monocytogenes on cut cantaloupe. The model predicts ~4 log CFU increase following 15 days at 5 °C, and ∼1 log CFU increase following 6 days at 4 °C. The model can also be used in subsequent quantitative microbial risk assessments.

  18. Survival of Salmonella enterica, Escherichia coli O157:H7, and Listeria monocytogenes on inoculated walnut kernels during storage

    National Research Council Canada - National Science Library

    Blessington, Tyann; Mitcham, Elizabeth J; Harris, Linda J


    ...:H7, and Listeria monocytogenes was evaluated on walnut kernels. Kernels were separately inoculated with an aqueous preparation of the pathogens at 3 to 10 log CFU/g, dried for 7 days, and then stored at 23...

  19. Listeria monocytogenes Meningitis in an Immunosuppressed Patient with Autoimmune Hepatitis and IgG4 Subclass Deficiency

    Directory of Open Access Journals (Sweden)

    Shahin Gaini


    Full Text Available A 51-year-old Caucasian woman with Listeria monocytogenes meningitis was treated and discharged after an uncomplicated course. Her medical history included immunosuppressive treatment with prednisolone and azathioprine for autoimmune hepatitis. A diagnostic work-up after the meningitis episode revealed that she had low levels of the IgG4 subclass. To our knowledge, this is the first case report describing a possible association between autoimmune hepatitis and the occurrence of Listeria monocytogenes meningitis, describing a possible association between Listeria monocytogenes meningitis and deficiency of the IgG4 subclass and finally describing a possible association between Listeria monocytogenes meningitis and immunosuppressive therapy with prednisolone and azathioprine.

  20. The species-specific mode of action of the antimicrobial peptide subtilosin against Listeria monocytogenes Scott A

    NARCIS (Netherlands)

    Kuijk, van S.J.A.; Noll, K.S.; Chikindas, M.L.


    Aims: To elucidate the molecular mechanism of action of the antimicrobial peptide subtilosin against the foodborne pathogen Listeria monocytogenes Scott A. Methods and Results: Subtilosin was purified from a culture of Bacillus amylliquefaciens. The minimal inhibitory concentration of subtilosin aga

  1. Antimicrobial effect of blueberry (Vaccinium corymbosum L.) extracts against the growth of Listeria monocytogenes and Salmonella Enteritidis (United States)

    We studied the antimicrobial effects of berry extracts obtained from four cultivars (Elliott, Darrow, Bluecrop and Duke) of blueberry (Vaccinium corymbosum L.) on the growth of Listeria monocytogenes and Salmonella Enteritidis. The minimal inhibitory concentration (MIC) and minimal bactericidal conc...

  2. Listeria monocytogenes contamination in dairy plants: evaluation of Listeria monocytogenes environmental contamination in two cheese-making plants using sheeps milk

    Directory of Open Access Journals (Sweden)

    Michela Ibba


    Full Text Available Listeria monocytogenes harbouring niches established in the processing plant support post-process contamination of dairy products made from pasteurised or thermised milk. The present study investigated L. monocytogenes environmental contamination in two sheep’s milk cheese-making plants. Persistence of contamination in the area at higher risk was also investigated. During a one-year survey 7 samplings were carried out in each dairy plant, along the production lines of Pecorino Romano and ricotta salata cheese. A total of 613 environmental samples collected from food contact and non-food contact surfaces were analysed according to ISO 11290-1:2005 standard method. Identification of the isolated strains was carried out by polymerase chain reaction. L. monocytogenes prevalence was 23.2% in dairy A and 13.1% in dairy B, respectively. The higher prevalence rate was found in the following areas: salting, products washing, packaging, ricotta salata storage and Pecorino Romano ripening rooms. L. monocytogenes was never found in the cheese-making area. The probability of observing samples positive for the presence of L. monocytogenes was asso- ciated with dairy plant, sampling area and the period of cheese-making (P<0.001. The greater persistence of contamination over time was observed in the washing, salting, and Pecorino Romano ripening areas. The control of persistent environmental contamination relies on the identification of L. monocytogenes niches within the processing environment and the prevention of harborage sites formation. The importance of strict cleaning and sanitising procedure in controlling L. monocytogenes environmental contamination is confirmed by the lower level of contamination observed after these procedures were correctly implemented.

  3. Heat resistance of an outbreak strain of Listeria monocytogenes in hot dog batter. (United States)

    Mazzotta, A S; Gombas, D E


    The heat resistance of a strain of Listeria monocytogenes responsible for a listeriosis outbreak in hot dogs was not higher than the heat resistance of other L. monocytogenes strains when tested in tryptic soy broth and in laboratory-prepared hot dog batter. For the thermal death time experiments, the cells were grown to stationary phase or were starved in phosphate-buffered saline, pH 7, for 6 h at 30 degrees C. Starvation increased the heat resistance of L. monocytogenes in broth but not in hot dog batter. D-values in hot dog batter were higher than in broth. For the hot dog formulation used in this study, cooking the hot dog batter for 30 s at 71.1 degrees C (160 degrees F), or its equivalent using a z-value of 6 degrees C (11 degrees F), would inactivate 5 logs of L. monocytogenes.

  4. A putative ABC transporter is involved in negative regulation of biofilm formation by Listeria monocytogenes

    DEFF Research Database (Denmark)

    Zhu, Xinna; Long, Fei; Chen, Yonghui


    Listeria monocytogenes may persist for long periods in food processing environments. In some instances, this may be due to aggregation or biofilm formation. To investigate the mechanism controlling biofilm formation in the food-borne pathogen L. monocytogenes, we characterized LM-49, a mutant...... with enhanced ability of biofilm-formation generated via transposon Tn917 mutagenesis of L. monocytogenes 4b G. In this mutant, a Tn917 insertion has disrupted the coding region of the gene encoding a putative ATP binding cassette (ABC) transporter permease identical to Lmof2365_1771 (a putative ABC......-transporter permease) presented in the sequenced strain L. monocytogenes str. 4b F2365. This disrupted gene, denoted lm.G_1771, encoded a protein with 10 transmembrane helixes. The revertant, LM-49RE, was obtained by replacing lm.G_1771::Tn917 with lm.G_1771 via homologous recombination. We found that LM-49RE formed...

  5. Modeling the growth of Listeria monocytogenes in soft blue-white cheese

    DEFF Research Database (Denmark)

    Rosshaug, Per Sand; Detmer, Ann; Ingmer, Hanne


    The aim of this study was to develop a predictive model simulating growth over time of the pathogenic bacterium Listeria monocytogenes in a soft blue-white cheese. The physicochemical properties in a matrix such as cheese are essential controlling factors influencing the growth of L. monocytogenes....... We developed a predictive tertiary model of the bacterial growth of L. monocytogenes as a function of temperature, pH, NaCl, and lactic acid. We measured the variations over time of the physicochemical properties in the cheese. Our predictive model was developed based on broth data produced...... production and retail conditions showed that the number of L. monocytogenes cells increases 3 to 3.5 log within the shelf life of the cheese....

  6. Inhibitory effect of liposome-entrapped lemongrass oil on the growth of Listeria monocytogenes in cheese. (United States)

    Cui, H Y; Wu, J; Lin, L


    Listeria monocytogenes infection in dairy products is of mounting public concern. To inhibit bacterial growth, we engineered stimuli-responsive liposomes containing lemongrass oil for this study. The controlled release of liposome-entrapped lemongrass oil is triggered by listerolysin O, secreted by L. monocytogenes. We investigated the antibiotic activities of lemongrass oil liposomes against L. monocytogenes in cheese. We also assessed their possible effects on the quality of the cheese. Liposomes containing lemongrass oil (5.0mg/mL) presented the optimal polydispersity index (0.246), zeta-potential (-58.9mV) and entrapment efficiency (25.7%). The liposomes displayed satisfactory antibiotic activity against L. monocytogenes in cheese over the storage period at 4°C. We observed no effects on the physical and sensory properties of the cheese after the liposome treatment. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

  7. Heat resistance of Listeria monocytogenes in vegetables: evaluation of blanching processes. (United States)

    Mazzotta, A S


    The heat resistance of a Listeria monocytogenes composite (serotypes 1/2a, 1/2b, and 4b) was determined in fresh broccoli florets, sweet green peppers, onions, mushrooms, and peas using an end-point procedure in polyester pouches. The heat resistance of L. monocytogenes was higher in peas (D(60 degrees C) = 1.0 min) and mushrooms (D(60 degrees C) = 0.7 min) than in other vegetables tested (D(60 degrees C) in onions = 0.2 min) and was highest when cells were subjected to starvation before the thermal death time experiments (D(60 degrees C) of starved L. monocytogenes in mushrooms = 1.6 min). The results showed that blanching can be used as an antilisterial treatment (inactivation of 5 logs of L. monocytogenes) when the cold spot of vegetables is treated for at least 10 s at 75 degrees C or instantaneously (<1 s) at temperatures above 82 degrees C.

  8. Thermal inactivation of Listeria monocytogenes during rapid and slow heating in sous vide cooked beef. (United States)

    Hansen, T B; Knøchel, S


    Heating at slowly rising temperatures is suspected to enhance thermotolerance in Listeria monocytogenes and, since anaerobic environments have been shown to facilitate resuscitation of heat-injured cells of this micro-organism, concern may arise about the possibility of L. monocytogenes surviving in minimally preserved products. The effect of rapid ( > 10 degrees C min-1) and slow (0.3 and 0.6 degrees C min-1) heating on survival of L. monocytogenes in sous vide cooked beef was therefore examined at mild processing temperatures of 56 degrees, 60 degrees and 64 degrees C. No statistically significant difference (P = 0.70) was observed between the tested heating regimes. Since the average pH of beef was low (5.6), and little or no effect was observed, a pH-dependency of heat shock-induced thermotolerance in L. monocytogenes is suggested to account for this result.

  9. Evaluation of Listeria monocytogenes survival in ice cream mixes flavored with herbal tea using Taguchi method. (United States)

    Ozturk, Ismet; Golec, Adem; Karaman, Safa; Sagdic, Osman; Kayacier, Ahmed


    In this study, the effects of the incorporation of some herbal teas at different concentrations into the ice cream mix on the population of Listeria monocytogenes were studied using Taguchi method. The ice cream mix samples flavored with herbal teas were prepared using green tea and sage at different concentrations. Afterward, fresh culture of L. monocytogenes was inoculated into the samples and the L. monocytogenes was counted at different storage periods. Taguchi method was used for experimental design and analysis. In addition, some physicochemical properties of samples were examined. Results suggested that there was some effect, although little, on the population of L. monocytogenes when herbal tea was incorporated into the ice cream mix. Additionally, the use of herbal tea caused a decrease in the pH values of the samples and significant changes in the color values.

  10. New perspectives on the gastrointestinal mode of transmission in invasive Listeria monocytogenes infection

    Energy Technology Data Exchange (ETDEWEB)

    Schlech, W.F. III


    The route or mechanism of transmission of Listeria monocytogenes from its rural veterinary reservoir to newborn and older human populations has been obscure. Anecdotal reports of milk-borne infection from cows with Listeria mastitis have been published, but intensive investigations of small outbreaks of L. monocytogenes infections in humans have not supported a gastrointestinal mode of infection. Several recent studies, however, strongly suggest this possibility, and case-control studies of epidemic listeriosis in the Canadian Maritime provinces in 1981 documented an association between ingestion of uncooked vegetables and the development of illness (p = 0.02). In that study, coleslaw from a regional producer which was distributed throughout the Maritimes was considered to be the vehicle of transmission. Cabbage, the raw product in the production of coleslaw, was contaminated at a farm prior to arrival at the plant. Contamination occurred through fertilization with raw manure from a flock of sheep known to harbor L. monocytogenes. Therefore, an indirect link was established between Listeria monocytogenes infection of sheep on a cabbage farm and subsequent development of invasive listeriosis in humans. This study supports findings from other epidemiologic studies of human listeriosis and is consistent with results of investigations into the mode of transmission of natural and laboratory-acquired listeriosis in animals. 34 references.

  11. Molecular characterization and antibiogram of Listeria monocytogenes isolated from chicken and mutton of retail markets

    Directory of Open Access Journals (Sweden)

    Vinay Kumar B. N., Nadeem Fairoze , Madhavaprasad C. B.


    Full Text Available Objective: To isolate Listeria monocytogenes from chicken and mutton meat sold at retail outlets and to characterize isolates for virulence determinants. Methods: Listeria monocytogenes was isolated from chicken and mutton meat samples using ISO: 11290 method. Multiplex PCR was performed for the detection of virulence associated genes. Results: Out of 198 retail meat samples (72 chicken and 126 mutton analyzed, Listeria monocytogenes was isolated from 4.5% (8.3% chicken and 2.3% mutton samples. All the 9 isolates (6 from chicken and 3 from mutton belonged to 1/2a servar and carried virulence genes viz. haemolysin (hlyA, phosphatidylinositol phospholipase (plcA, actin polymerization protein (actA and invasive associative protein p60 (Iap. Conclusion: L. monocytogenes is an organism of food safety and public health significance, its recovery from the meat sold at retail outlets indicated breach in the quality assurance. J Microbiol Infect Dis 2016;6(2: 65-68

  12. Detection of Listeria monocytogenes in cheese with the magnetic immuno-polymerase chain reaction assay. (United States)

    Fluit, A C; Torensma, R; Visser, M J; Aarsman, C J; Poppelier, M J; Keller, B H; Klapwijk, P; Verhoef, J


    A new detection system, the magnetic immuno-polymerase chain reaction (PCR) assay (MIPA) has been developed to detect Listeria monocytogenes in food. This method separates Listeria cells from PCR-inhibitory factors present in enrichment broths containing food samples by using magnetic beads coated with specific monoclonal antibodies (MAbs). The separated bacteria were lysed, and the supernatant containing the bacterial DNA was subjected to the PCR. Detection of L. monocytogenes in three naturally contaminated cheese samples with two different MAbs and PCR primers specific for the gene encoding the delayed-hypersensitivity factor showed that with MAb 55 all three samples were positive whereas with MAb A two samples were positive. A further improvement of the method was obtained by using a PCR step based on the listeriolysin O gene. A MIPA employing MAb 55 and the listeriolysin O gene primer set detected L. monocytogenes after 24 h of culture in Listeria Enrichment Broth samples from Port Salut artificially contaminated with 40 CFU/25 g. We could detect 1 CFU of L. monocytogenes per g of cheese after a second enrichment for 24 h in Fraser broth. The analysis time including both enrichments is approximately 55 h.

  13. Magnetic bead based immuno-detection of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables using the Bio-Plex suspension array system. (United States)

    Day, J B; Basavanna, U


    Listeriosis, a disease contracted via the consumption of foods contaminated with pathogenic Listeria species, can produce severe symptoms and high mortality in susceptible people and animals. The development of molecular methods and immuno-based techniques for detection of pathogenic Listeria in foods has been challenging due to the presence of assay inhibiting food components. In this study, we utilize a macrophage cell culture system for the isolation and enrichment of Listeria monocytogenes and Listeria ivanovii from infant formula and leafy green vegetables for subsequent identification using the Luminex xMAP technique. Macrophage monolayers were exposed to infant formula, lettuce and celery contaminated with L. monocytogenes or L. ivanovii. Magnetic microspheres conjugated to Listeria specific antibody were used to capture Listeria from infected macrophages and then analyzed using the Bio-Plex 200 analyzer. As few as 10 CFU/mL or g of L. monocytogenes was detected in all foods tested. The detection limit for L. ivanovii was 10 CFU/mL in infant formula and 100 CFU/g in leafy greens. Microsphere bound Listeria obtained from infected macrophage lysates could also be isolated on selective media for subsequent confirmatory identification. This method presumptively identifies L. monocytogenes and L. ivanovii from infant formula, lettuce and celery in less than 28 h with confirmatory identifications completed in less than 48 h.

  14. A novel Listeria monocytogenes-based DNA delivery system for cancer gene therapy.

    LENUS (Irish Health Repository)

    van Pijkeren, Jan Peter


    Bacteria-mediated transfer of plasmid DNA to mammalian cells (bactofection) has been shown to have significant potential as an approach to express heterologous proteins in various cell types. This is achieved through entry of the entire bacterium into cells, followed by release of plasmid DNA. In a murine model, we show that Listeria monocytogenes can invade and spread in tumors, and establish the use of Listeria to deliver genes to tumors in vivo. A novel approach to vector lysis and release of plasmid DNA through antibiotic administration was developed. Ampicillin administration facilitated both plasmid transfer and safety control of vector. To further improve on the gene delivery system, we selected a Listeria monocytogenes derivative that is more sensitive to ampicillin, and less pathogenic than the wild-type strain. Incorporation of a eukaryotic-transcribed lysin cassette in the plasmid further increased bacterial lysis. Successful gene delivery of firefly luciferase to growing tumors in murine models and to patient breast tumor samples ex vivo was achieved. The model described encompasses a three-phase treatment regimen, involving (1) intratumoral administration of vector followed by a period of vector spread, (2) systemic ampicillin administration to induce vector lysis and plasmid transfer, and (3) systemic administration of combined moxifloxacin and ampicillin to eliminate systemic vector. For the first time, our results reveal the potential of Listeria monocytogenes for in vivo gene delivery.

  15. Modeling the effect of temperature on survival rate of Listeria monocytogenes in yogurt. (United States)

    Szczawiński, J; Szczawińska, M E; Łobacz, A; Jackowska-Tracz, A


    The aim of the study was to (i) evaluate the behavior of Listeria monocytogenes in a commercially produced yogurt, (ii) determine the survival/inactivation rates of L. monocytogenes during cold storage of yogurt and (iii) to generate primary and secondary mathematical models to predict the behavior of these bacteria during storage at different temperatures. The samples of yogurt were inoculated with the mixture of three L. monocytogenes strains and stored at 3, 6, 9, 12 and 15°C for 16 days. The number of listeriae was determined after 0, 1, 2, 3, 5, 7, 9, 12, 14 and 16 days of storage. From each sample a series of decimal dilutions were prepared and plated onto ALOA agar (agar for Listeria according to Ottaviani and Agosti). It was found that applied temperature and storage time significantly influenced the survival rate of listeriae (ppH value of the samples (pyogurt stored under temperature range from 3 to 15°C, however, the polynomial model gave a better fit to the experimental data.

  16. Validation of the Applied Biosystems 7500 Fast Instrument for Detection of Listeria monocytogenes with the SureTect Listeria monocytogenes PCR Assay. (United States)


    In 2013, the Thermo Scientific™ SureTect™ Listeria monocytogenes Real-Time PCR Assay was certified by the AOAC Research Institute (RI) Performance Tested Methods (SM) program as a rapid method for the detection of L. monocytogenes from a wide range of food matrixes and surface samples. This report details the method modification studies undertaken to extend the analysis of this PCR assay to the Applied Biosystems™ 7500 Fast PCR Instrument and Applied Biosystems RapidFinder™ Express 2.0 software allowing the use of the SureTect assay on a 96 well format PCR cycler in addition to the current workflow, which uses the 24 well Thermo Scientific PikoReal™ PCR Instrument and Thermo Scientific SureTect software. Because this study was deemed by AOAC-RI to be a level 2 method modification study, a representative range of food matrixes covering raw ground turkey, 2% fat pasteurized milk, and bagged lettuce as well as stainless steel surface samples were analyzed with the Applied Biosystems 7500 Fast PCR Instrument and RapidFinder Express 2.0 software. All testing was conducted in comparison to the reference method detailed in International Organization for Standardization (ISO) 6579:2002. No significant difference by probability of detection statistical analysis was found between the SureTect Listeria monocytogenes PCR Assay or the ISO reference method methods for any of the matrixes analyzed during the study.

  17. Validation of the Applied Biosystems 7500 Fast Instrument for Detection of Listeria monocytogenes with the SureTect Listeria monocytogenes PCR Assay. (United States)

    Cloke, Jonathan; Arizanova, Julia; Crabtree, David; Simpson, Helen; Evans, Katharine; Vaahtoranta, Laura; Palomäki, Jukka-Pekka; Artimo, Paulus; Huang, Feng; Liikanen, Maria; Koskela, Suvi


    In 2013, the Thermo Scientific™ SureTect™ Listeria monocytogenes Real-Time PCR Assay was certified by the AOAC Research Institute (RI) Performance Tested Methods(SM) program as a rapid method for the detection of L. monocytogenes from a wide range of food matrixes and surface samples. This report details the method modification studies undertaken to extend the analysis of this PCR assay to the Applied Biosystems™ 7500 Fast PCR Instrument and Applied Biosystems RapidFinder™ Express 2.0 software allowing the use of the SureTect assay on a 96 well format PCR cycler in addition to the current workflow, which uses the 24 well Thermo Scientific PikoReal™ PCR Instrument and Thermo Scientific SureTect software. Because this study was deemed by AOAC-RI to be a level 2 method modification study, a representative range of food matrixes covering raw ground turkey, 2% fat pasteurized milk, and bagged lettuce as well as stainless steel surface samples were analyzed with the Applied Biosystems 7500 Fast PCR Instrument and RapidFinder Express 2.0 software. All testing was conducted in comparison to the reference method detailed in International Organization for Standardization (ISO) 6579:2002. No significant difference by probability of detection statistical analysis was found between the SureTect Listeria monocytogenes PCR Assay or the ISO reference method methods for any of the matrixes analyzed during the study.

  18. Molecular ecology of Listeria monocytogenes and other Listeria species in small and very small ready-to-eat meat processing plants. (United States)

    Williams, Shanna K; Roof, Sherry; Boyle, Elizabeth A; Burson, Dennis; Thippareddi, Harshavardhan; Geornaras, Ifigenia; Sofos, John N; Wiedmann, Martin; Nightingale, Kendra


    A longitudinal study was conducted to track Listeria contamination patterns in ready-to-eat meats from six small or very small meat processing plants located in three states over 1 year. A total of 688 environmental sponge samples were collected from nonfood contact surfaces during bimonthly visits to each plant. Overall, L. monocytogenes was isolated from 42 (6.1%) environmental samples, and its prevalence ranged from 1.7 to 10.8% across different plants. Listeria spp., other than L. monocytogenes, were isolated from 9.5% of samples overall, with the prevalence ranging from 1.5 to 18.3% across different plants. The prevalence of L. monocytogenes correlated well with that of other Listeria spp. for some but not all plants. One L. monocytogenes isolate representing each positive sample was characterized by molecular serotyping, EcoRI ribotyping, and pulsed-field gel electrophoresis typing. Seven sample sites tested positive for L. monocytogenes on more than one occasion, and the same ribotype was detected more than once at five of these sites. Partial sigB sequencing was used to speciate other Listeria spp. isolates and assign an allelic type to each isolate. Other Listeria spp. were isolated more than once from 14 sample sites, and the same sigB allelic type was recovered at least twice from seven of these sites. One plant was colonized by an atypical hemolytic L. innocua strain. Our findings indicate that small and very small meat processing plants that produce ready-to-eat meat products are characterized by a varied prevalence of Listeria, inconsistent correlation between contamination by L. monocytogenes and other Listeria spp., and a unique Listeria molecular ecology.

  19. Self-contained chlorine dioxide generation and delivery pods for controlling Listeria monocytogenes in model floor drains. (United States)

    Listeria monocytogenes is a foodborne pathogen that has been associated with poultry products. This organism is ubiquitous in nature and has been found to enter poultry further processing plants on incoming raw product. Once in the plant, L. monocytogenes can become a long term persistent colonize...

  20. Population Structure of Listeria monocytogenes Serotype 4b Isolates from Sporadic Human Listeriosis in the United States, 2003-2008 (United States)

    Listeria monocytogenes can cause severe foodborne disease (listeriosis). Serotype 4b strains have resulted in numerous outbreaks, repeatedly involving three epidemic clones (ECI, ECII, and ECIa). Little is known about population structure of L. monocytogenes serotype 4b from sporadic listeriosis, ev...

  1. Population Genetic Structure of Listeria monocytogenes Strains as Determined by Pulsed-Field Gel Electrophoresis and Multilocus Sequence Typing

    DEFF Research Database (Denmark)

    Henri, Clémentine; Félix, Benjamin; Guillier, Laurent


    Listeria monocytogenes is a ubiquitous bacterium that may cause the foodborne illness listeriosis. Only a small amount of data about the population genetic structure of strains isolated from food is available. This study aimed to provide an accurate view of the L. monocytogenes food strain...

  2. Directed evolution and targeted mutagenesis to murinize Listeria monocytogenes internalin A for enhanced infectivity in the murine oral infection model.

    LENUS (Irish Health Repository)

    Monk, Ian R


    Internalin A (InlA) is a critical virulence factor which mediates the initiation of Listeria monocytogenes infection by the oral route in permissive hosts. The interaction of InlA with the host cell ligand E-cadherin efficiently stimulates L. monocytogenes entry into human enterocytes, but has only a limited interaction with murine cells.

  3. Effect of salt, smoke compound and temperature on the survival of Listeria monocytogenes in salmon during simulated smoking processes (United States)

    In smoked fish processes, smoking is the only step that is capable of inactivating pathogens, such as Listeria monocytogenes, that contaminate the raw fish. The objectives of this study were to examine and develop a model to describe the survival of L. monocytogenes in salmon as affected by salt, s...

  4. Occurrence and Antimicrobial Resistance of Listeria monocytogenes Recovered from Blue Crab Meat and Blue Crab Processing Plants (United States)

    Listeria monocytogenes is widely distributed in the environment. The ubiquitous nature of this bacterium can result in contamination of foods. Listeriosis is a food-borne disease caused by consumption of L. monocytogenes-contaminated food. It is a public health problem of low incidence but high mort...

  5. Determining If Phylogenetic Relatedness of Listeria Monocytogenes Isolates Corresponds to Persistence in Poultry Processing Plants Using Whole-Genome Sequencing (United States)

    Introduction: Controlling Listeria monocytogenes on ready-to-eat meat and poultry products and in food processing facilities is challenging. Surveys have found that some L. monocytogenes types are more persistent in processing facilities than others, but the reason is unknown. It is possible persist...

  6. Spatial and Temporal Factors Associated with an Increased Prevalence of Listeria monocytogenes in Spinach Fields in New York State (United States)

    Weller, Daniel; Wiedmann, Martin


    While rain and irrigation events have been associated with an increased prevalence of foodborne pathogens in produce production environments, quantitative data are needed to determine the effects of various spatial and temporal factors on the risk of produce contamination following these events. This study was performed to quantify these effects and to determine the impact of rain and irrigation events on the detection frequency and diversity of Listeria species (including L. monocytogenes) and L. monocytogenes in produce fields. Two spinach fields, with high and low predicted risks of L. monocytogenes isolation, were sampled 24, 48, 72, and 144 to 192 h following irrigation and rain events. Predicted risk was a function of the field's proximity to water and roads. Factors were evaluated for their association with Listeria species and L. monocytogenes isolation by using generalized linear mixed models (GLMMs). In total, 1,492 (1,092 soil, 334 leaf, 14 fecal, and 52 water) samples were collected. According to the GLMM, the likelihood of Listeria species and L. monocytogenes isolation from soil samples was highest during the 24 h immediately following an event (odds ratios [ORs] of 7.7 and 25, respectively). Additionally, Listeria species and L. monocytogenes isolates associated with irrigation events showed significantly lower sigB allele type diversity than did isolates associated with precipitation events (P = monocytogenes contamination. Small changes in management practices (e.g., not irrigating fields before harvest) may therefore reduce the risk of L. monocytogenes contamination of fresh produce. PMID:26116668

  7. Potential Bio-Control Agent from Rhodomyrtus tomentosa against Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Grace Fiyinfoluwa Odedina


    Full Text Available Listeria monocytogenes is an important foodborne pathogen implicated in many outbreaks of listeriosis. This study aimed at screening for the potential use of Rhodomyrtus tomentosa ethanolic leaf extract as a bio-control agent against L. monocytogenes. Twenty-two L. monocytogenes isolates were checked with 16 commercial antibiotics and isolates displayed resistance to 10 antibiotics. All the tested isolates were sensitive to the extract with inhibition zones ranging from 14 to 16 mm. Minimum inhibitory concentration (MIC and minimum bactericidal concentration (MBC values ranged from 16 to 32 µg/mL and 128 to 512 µg/mL, respectively. Time-kill assay showed that the extract had remarkable bactericidal effects on L. monocytogenes. The extract at a concentration of 16 µg/mL reduced tolerance to 10% NaCl in L. monocytogenes in 4 h. Stationary phase L. monocytogenes cells were rapidly inactivated by greater than 3-log units within 30 min of contact time with R. tomentosa extract at 128 µg/mL. Electron microscopy revealed fragmentary bacteria with changes in the physical and morphological properties. Our study demonstrates the potential of the extract for further development into a bio-control agent in food to prevent the incidence of L. monocytogenes contamination.

  8. The fate of two Listeria monocytogenes serotypes in "cig kofte" at different storage temperatures. (United States)

    Durmaz, Hisamettin; Sagun, Emrullah; Sancak, Hakan; Sagdic, Osman


    Cig kofte is a traditional Turkish food prepared from minced beef, bulgur, onions, garlic and varieties of spices. It is generally consumed within a few hours. However, leftovers can be kept in refrigerator or in room temperature up to 24h until they are consumed. In this study, survival and growth of two Listeria monocytogenes serotypes were investigated in cig kofte during the storage. For this purpose, the prepared samples were separately contaminated with serotypes 1/2b or 4b of L. monocytogenes at the level of 10(4)CFU/g and stored at 4°C and 21°C. L. monocytogenes colonies were counted at the beginning, 3rd, 6th, 12th and 24th hours of the storage. At 4°C, L. monocytogenes 4b significantly increased (P0.05) during the storage period. At 21°C, both L. monocytogenes 1/2b and 4b increased significantly (Pcig kofte did not inhibit the growths of L. monocytogenes serotypes during the storage. These results indicated that L. monocytogenes was able to survive and grow in cig kofte at the both storage temperatures of 4°C and 21°C and cig kofte seemed to be a suitable medium for this pathogen.

  9. Ultra deep sequencing of Listeria monocytogenes sRNA transcriptome revealed new antisense RNAs.

    Directory of Open Access Journals (Sweden)

    Sebastian Behrens

    Full Text Available Listeria monocytogenes, a gram-positive pathogen, and causative agent of listeriosis, has become a widely used model organism for intracellular infections. Recent studies have identified small non-coding RNAs (sRNAs as important factors for regulating gene expression and pathogenicity of L. monocytogenes. Increased speed and reduced costs of high throughput sequencing (HTS techniques have made RNA sequencing (RNA-Seq the state-of-the-art method to study bacterial transcriptomes. We created a large transcriptome dataset of L. monocytogenes containing a total of 21 million reads, using the SOLiD sequencing technology. The dataset contained cDNA sequences generated from L. monocytogenes RNA collected under intracellular and extracellular condition and additionally was size fractioned into three different size ranges from 150 nt. We report here, the identification of nine new sRNAs candidates of L. monocytogenes and a reevaluation of known sRNAs of L. monocytogenes EGD-e. Automatic comparison to known sRNAs revealed a high recovery rate of 55%, which was increased to 90% by manual revision of the data. Moreover, thorough classification of known sRNAs shed further light on their possible biological functions. Interestingly among the newly identified sRNA candidates are antisense RNAs (asRNAs associated to the housekeeping genes purA, fumC and pgi and potentially their regulation, emphasizing the significance of sRNAs for metabolic adaptation in L. monocytogenes.

  10. Ultra Deep Sequencing of Listeria monocytogenes sRNA Transcriptome Revealed New Antisense RNAs (United States)

    Behrens, Sebastian; Widder, Stefanie; Mannala, Gopala Krishna; Qing, Xiaoxing; Madhugiri, Ramakanth; Kefer, Nathalie; Mraheil, Mobarak Abu; Rattei, Thomas; Hain, Torsten


    Listeria monocytogenes, a gram-positive pathogen, and causative agent of listeriosis, has become a widely used model organism for intracellular infections. Recent studies have identified small non-coding RNAs (sRNAs) as important factors for regulating gene expression and pathogenicity of L. monocytogenes. Increased speed and reduced costs of high throughput sequencing (HTS) techniques have made RNA sequencing (RNA-Seq) the state-of-the-art method to study bacterial transcriptomes. We created a large transcriptome dataset of L. monocytogenes containing a total of 21 million reads, using the SOLiD sequencing technology. The dataset contained cDNA sequences generated from L. monocytogenes RNA collected under intracellular and extracellular condition and additionally was size fractioned into three different size ranges from 150 nt. We report here, the identification of nine new sRNAs candidates of L. monocytogenes and a reevaluation of known sRNAs of L. monocytogenes EGD-e. Automatic comparison to known sRNAs revealed a high recovery rate of 55%, which was increased to 90% by manual revision of the data. Moreover, thorough classification of known sRNAs shed further light on their possible biological functions. Interestingly among the newly identified sRNA candidates are antisense RNAs (asRNAs) associated to the housekeeping genes purA, fumC and pgi and potentially their regulation, emphasizing the significance of sRNAs for metabolic adaptation in L. monocytogenes. PMID:24498259

  11. InlB-mediated Listeria monocytogenes internalization requires a balanced phospholipase D activity maintained through phospho-cofilin

    NARCIS (Netherlands)

    Han, Xuelin; Yu, Rentao; Ji, Lei; Zhen, Dongyu; Tao, Sha; Li, Shuai; Sun, Yansong; Huang, Liuyu; Feng, Zhe; Li, Xianping; Han, Gaige; Schmidt, Martina; Han, Li


    Internalization of Listeria monocytogenes into non-phagocytic cells is tightly controlled by host cell actin dynamics and cell membrane alterations. However, knowledge about the impact of phosphatidylcholine cleavage driven by host cell phospholipase D (PLD) on Listeria internalization into epitheli

  12. Behaviour of Listeria monocytogenes during the manufacture and ripening of Manchego and Chihuahua Mexican cheeses. (United States)

    Solano-López, C; Hernández-Sánchez, H


    The ability of Listeria monocytogenes to survive the Mexican Manchego and Chihuahua cheese-making processes and its persistence during the ripening stages of both cheeses was examined. Commercial pasteurized and homogenized whole milk was inoculated with Listeria monocytogenes (strain ATCC 19114) to a level between 2 x 10(6) and 9 x 10(6) CFU/ml. The milk was used to make Mexican Manchego and Chihuahua cheeses in a 25-l vat. Mexican Manchego cheese was ripened for 5 days and Chihuahua cheese for 6 weeks at 12 degrees C and 85% RH. Listeria present in the cheese was enumerated by diluting samples in sterile 0.1% peptone water and plating on Oxford agar. Duplicate samples were taken at each step of the manufacturing process. During the first week of ripening samples were taken daily from both cheeses. For Chihuahua cheese, samples were taken weekly after the first week of the ripening stage. During the manufacture of Mexican Manchego cheese, Listeria counts remained relatively constant at 10(6) CFU/ml, while with Chihuahua cheese there was a one log decrease in numbers (10(6) to 10(5) CFU/ml). After pressing both curds overnight, numbers of bacteria decreased in Mexican Manchego cheese to 8.2 x 10(5) but increased in Chihuahua cheese from 1.7 x 10(5) to 1.2 x 10(6) CFU/ml. During the ripening stage, counts of Listeria remained constant in both cheeses. However, since the Chihuahua cheese ripening stage is about 6 weeks, the number of bacteria decreased from 2 x 10(6) to 4 x 10(4) CFU/g. The results show that Listeria monocytogenes is able to survive the manufacture and ripening processes of both Mexican cheeses.

  13. Listeria monocytogenes protein fraction induces dendritic cells maturation and T helper 1 immune responses.

    Directory of Open Access Journals (Sweden)

    Azad Saei


    Full Text Available Fully mature dendritic cells (DCs play pivotal role in inducing immune responses and converting naïve T lymphocytes into functional Th1 cells. We aimed to evaluate Listeria Monocytogenes-derived protein fractions to induce DC maturation and stimulating T helper (Th1 immune responses.In the present study, we fractionated Listeria Monocytogenes-derived proteins by adding of ammonium sulfate in a stepwise manner. DCs were also generated from C57BL/6 mice bone marrow precursor cells. Then, the effects of protein fractions on bone marrow derived DC (BMDC maturation were evaluated. In addition, we assessed the capacity of activated DCs to induce cytokine production and proliferation of lymphocytes.Listeria-derived protein fractions induced fully mature DCs expressing high costimulatory molecules such as CD80, CD86 and CD40. DCs that were activated by selected F3 fraction had low capacity to uptake exogenous antigens while secreted high levels of Interleukine (IL-12. Moreover, lymphocytes cultured with activated BMDCs produced high amounts of IFN-γ and showed higher proliferation than control. Listeria derived protein fractions differently influenced DC maturation.In conclusion, Listeria protein activated-BMDCs can be used as a cell based vaccine to induce anti-tumor immune responses.

  14. Listeria monocytogenes Is Resistant to Lysozyme through the Regulation, Not the Acquisition, of Cell Wall-Modifying Enzymes


    Burke, TP; Loukitcheva, A; Zemansky, J; Wheeler, R; Boneca, IG; Portnoy, DA


    Listeria monocytogenes is a Gram-positive facultative intracellular pathogen that is highly resistant to lysozyme, a ubiquitous enzyme of the innate immune system that degrades cell wall peptidoglycan. Two peptidoglycan-modifying enzymes, PgdA and OatA, confer lysozyme resistance on L. monocytogenes; however, these enzymes are also conserved among lysozyme-sensitive nonpathogens. We sought to identify additional factors responsible for lysozyme resistance in L. monocytogenes. A forward geneti...

  15. Modelling and predicting the simultaneous growth of Listeria monocytogenes and spoilage micro-organisms in cold-smoked salmon

    DEFF Research Database (Denmark)

    Gimenez, B.; Dalgaard, Paw


    Aims: To evaluate and model the simultaneous growth of Listeria monocytogenes and spoilage micro-organisms in cold-smoked salmon.Methods and Results: Growth kinetics of L. monocytogenes, lactic acid bacteria (LAB), Enterobacteriaceae, enterococci and Photobacterium phosphoreum were determined...... in two series of challenge tests with sliced and vacuum-packed cold-smoked salmon (SVP-CSS). The product contained a high level of smoke components and at 2degreesC levels of L. monocytogenes increased...

  16. Listeria monocytogenes Is Resistant to Lysozyme through the Regulation, Not the Acquisition, of Cell Wall-Modifying Enzymes


    Burke, Thomas P.; Loukitcheva, Anastasia; Zemansky, Jason; Wheeler, Richard; Boneca, Ivo G.; Portnoy, Daniel A.


    Listeria monocytogenes is a Gram-positive facultative intracellular pathogen that is highly resistant to lysozyme, a ubiquitous enzyme of the innate immune system that degrades cell wall peptidoglycan. Two peptidoglycan-modifying enzymes, PgdA and OatA, confer lysozyme resistance on L. monocytogenes; however, these enzymes are also conserved among lysozyme-sensitive nonpathogens. We sought to identify additional factors responsible for lysozyme resistance in L. monocytogenes. A forward geneti...

  17. The challenge of setting risk-based microbiological criteria for Listeria monocytogenes

    DEFF Research Database (Denmark)

    Andersen, Jens Kirk; Nørrung, Birgit


    After more than 20 years of work with discussing the setting of microbiological criteria for Listeria monocytogenes in foods, Codex Alimentarius on Food Hygiene has finalised a proposal that was recently adopted by the Codex Alimentarius Commission. The effort of developing procedures for making...... the microbiological criteria risk-based to the greatest extent possible has challenged scientists and managers during this long time period. Yet, the establishment of microbiological criteria for L. monocytogenes is still being discussed and several approaches are possible. Setting of microbiological criteria...

  18. Occurrence of Listeria monocytogenes in silages assessed by fluorescent in situ hybridization


    Oliveira, M.; Guerra, M.; F. Bernardo


    Avaliou-se a qualidade microbiológica da silagem produzida em Portugal e otimizaram-se alguns aspectos relacionados com a eficácia de detecção de Listeria monocytogenes mediante protocolo baseado na técnica de hibridação in situ fluorescente (FISH) para detecção directa desse microrganismo em amostras de silagens. O protocolo foi aplicado a 74 amostras, em simultâneo com o método bacteriológico convencional. Este último permitiu a detecção de L. monocytogenes em 11 silos (15%). Por meio do pr...

  19. Sensitivity of Listeria monocytogenes to sanitizers used in the meat processing industry. (United States)

    Romanova, Nadya; Favrin, Stacy; Griffiths, Mansel W


    Nineteen Listeria monocytogenes strains were characterized by automated ribotyping, pulsed-field gel electrophoresis, and plasmid profiling to determine the relationship between genotype and sanitizer resistance. Isolates within a ribogroup had a consistent sensitivity or resistance phenotype except for ribogroup C isolates. All isolates with resistance phenotypes harbored two plasmids. The sensitivity of L. monocytogenes strains to quaternary ammonium compounds (QACs) was correlated with sensitivity to sanitizers and antibiotics with other modes of action. All isolates tested contained the mdrL gene, which encodes an efflux pump that confers resistance to QACs and is both chromosome and plasmid borne.

  20. Identification, cloning, and characterization of the Ima operon, whose gene products are unique to Listeria monocytogenes.



    The lmaA gene of Listeria monocytogenes encodes a protein capable of inducing delayed-type hypersensitivity reactions in L. monocytogenes-immune mice (S. Göhmann, M. Leimeister-Wachter, E. Schiltz, W. Goebel, and T. Chakraborty, M. Microbiol. 4:1091-1099, 1990). Here we show that it is the last gene of the lma operon, which now comprises four genes, lmaDCBA. Maxicell analysis of peptides encoded by the lma operon identified four polypeptides of 16.7, 16.4, 14.9, and 21 kDa which correspond to...

  1. Desiccation of adhering and biofilm Listeria monocytogenes on stainless steel: Survival and transfer to salmon products

    DEFF Research Database (Denmark)

    Hansen, Lisbeth Truelstrup; Vogel, Birte Fonnesbech


    The foodborne bacterial pathogen, Listeria monocytogenes, commonly contaminates foods during processing, where the microorganisms are potentially subjected to low relative humidity (RH) conditions for extended periods of time. The objective of this study was to examine survival during desiccation...... (43% RH and 15°C) of biofilm L. monocytogenes N53-1 cells on stainless steel coupons and to assess subsequent transfer to salmon products. Formation of static biofilm (2days at 100% RH and 15°C) prior to desiccation for 23days significantly (P...

  2. Rapid colorimetric sensing platform for the detection of Listeria monocytogenes foodborne pathogen. (United States)

    Alhogail, Sahar; Suaifan, Ghadeer A R Y; Zourob, Mohammed


    Listeria monocytogenes is a serious cause of human foodborne infections worldwide, which needs spending billions of dollars for inspection of bacterial contamination in food every year. Therefore, there is an urgent need for rapid, in-field and cost effective detection techniques. In this study, rapid, low-cost and simple colorimetric assay was developed using magnetic nanoparticles for the detection of listeria bacteria. The protease from the listeria bacteria was detected using D-amino acid substrate. D-amino acid substrate was linked to the carboxylic acid on the magnetic nanoparticles using EDC/NHS chemistry. The cysteine residue at the C-terminal of the substrate was used for the self-assembled monolayer formation on the gold sensor surface, which in turn the black magnetic nanobeads will mask the golden color. The color will change from black to golden color upon the cleavage of the specific peptide sequence by the Listeria protease. The sensor was tested with serial dilutions of Listeria bacteria. It was found that the appearance of the gold surface area is proportional to the bacterial concentrations in CFU/ml. The lowest detection limit of the developed sensor for Listeria was found to be 2.17×10(2) colony forming unit/ml (CFU/ml). The specificity of the biosensor was tested against four different foodborne associated bacteria (Escherichia coli, Salmonella, Shigella flexnerii and Staphylococcus aureus). Finally, the sensor was tested with artificially spiked whole milk and ground meat spiked with listeria.

  3. Listeria monocytogenes alters mast cell phenotype, mediator and osteopontin secretion in a listeriolysin-dependent manner.

    Directory of Open Access Journals (Sweden)

    Catherine E Jobbings

    Full Text Available Whilst mast cells participate in the immune defence against the intracellular bacterium Listeria monocytogenes, there is conflicting evidence regarding the ability of L. monocytogenes to infect mast cells. It is known that the pore-forming toxin listeriolysin (LLO is important for mast cell activation, degranulation and the release of pro-inflammatory cytokines. Mast cells, however, are a potential source of a wide range of cytokines, chemokines and other mediators including osteopontin, which contributes to the clearing of L. monocytogenes infections in vivo, although its source is unknown. We therefore aimed to resolve the controversy of mast cell infection by L. monocytogenes and investigated the extent of mediator release in response to the bacterium. In this paper we show that the infection of bone marrow-derived mast cells by L. monocytogenes is inefficient and LLO-independent. LLO, however, is required for calcium-independent mast cell degranulation as well as for the transient and selective downregulation of cell surface CD117 (c-kit on mast cells. We demonstrate that in addition to the key pro-inflammatory cytokines TNF-α and IL-6, mast cells release a wide range of other mediators in response to L. monocytogenes. Osteopontin, IL-2, IL-4, IL-13 and granulocyte macrophage colony-stimulating factor (GM-CSF, and chemokines including CCL2, CCL3, CCL4 and CCL5 are released in a MyD88-dependent manner. The wide range of mediators released by mast cells in response to L. monocytogenes may play an important role in the recruitment and activation of a variety of immune cells in vivo. The cocktail of mediators, however, is unlikely to skew the immune response to a particular effector response. We propose that mast cells provide a hitherto unreported source of osteopontin, and may provide an important role in co-ordinating the immune response during Listeria infection.

  4. Estudio mediante PCR múltiple de serotipos de Listeria monocytogenes aislados en Argentina Study by multiplex PCR of Listeria monocytogenes serotypes isolated in Argentine

    Directory of Open Access Journals (Sweden)

    R. Callejo


    Full Text Available Se comparó una PCR múltiple recientemente validada para la caracterización de serotipos de Listeria monocytogenes con el método tradicional de serotipificación. Se estudiaron 342 aislamientos de origen humano, alimentario, veterinario y ambiental obtenidos durante el período 1992-2005. La concordancia entre ambos métodos para los serotipos 1/2a, 1/2b y 1/2c fue del 100%, y para el serotipo 4b fue del 98%. La serotipificación constituye una herramienta importante como primer nivel de diferenciación de cepas de L. monocytogenes para llevar a cabo la vigilancia epidemiológica y, sobre todo, el estudio de brotes. La PCR múltiple es una técnica alternativa rápida, de bajo costo y fácilmente adaptable en laboratorios de bacteriología clínica y bromatología.A multiplex PCR assay, recently validated to characterize the serotypes of Listeria monocytogenes was evaluated in comparison to conventional serotyping. Three hundred forty two L. monocytogenes strains isolated from human, food, animal and environmental sources during the 1992-2005 period were assayed. The concordance between the two methods for serotypes 1/2a, 1/2b and 1/2c was 100%, whereas for serotype 4b it was 98%. Serotyping is a useful tool for first line strain differentiation during epidemiological surveillance and outbreaks. The multiplex PCR assay offers a fast and low-cost alternative, which is easily adaptable to clinical bacteriology and bromatology laboratories.

  5. Epidemiological Survey of Listeria monocytogenes in a gravlax salmon processing line Epidemiologia de Listeria monocytogenes em uma linha de processamento de salmão gravlax

    Directory of Open Access Journals (Sweden)

    C.D. Cruz


    Full Text Available Listeria monocytogenes is a cause of concern to food industries, mainly for those producing ready-to-eat (RTE products. This microorganism can survive processing steps such as curing and cold smoking and is capable of growing under refrigeration temperatures. Its presence in RTE fish products with extended shelf life may be a risk to the susceptible population. One example of such a product is gravlax salmon; a refrigerated fish product not exposed to listericidal processes and was the subject of this study. In order to evaluate the incidence and dissemination of L. monocytogenes 415 samples were collected at different steps of a gravlax salmon processing line in São Paulo state, Brazil. L. monocytogenes was confirmed in salmon samples (41%, food contact surfaces (32%, non-food contact surfaces (43% and of food handlers' samples (34%, but could not be detected in any ingredient. 179 L. monocytogenes isolates randomly selected were serogrouped and typed by PFGE. Most of L. monocytogenes strains belonged to serogroup 1 (73%. 61 combined pulsotypes were found and a dendrogram identified six clusters: most of the strains (120 belonged to cluster A. It was suggested that strains arriving into the plant via raw material could establish themselves in the processing environment contaminating the final product. The wide dissemination of L. monocytogenes in this plant indicates that a great effort has to be taken to eliminate the microorganism from these premises, even though it was not observed multiplication of the microorganism in the final product stored at 4ºC up to 90 days.Listeria monocytogenes é um patógenode grande preocupação para as indústrias alimentícias, principalmente aquelas produtoras de alimentos prontos para consumo (RTE. Este microrganismo pode sobreviver às etapas de cura e defumação a frio, além de tolerar temperaturas de refrigeração. A presença de L. monocytogenes em pescados RTE com vida de prateleira longa

  6. The occurrence of Listeria monocytogenes in imported ready-to-eat foods in Japan. (United States)

    Okada, Yumiko; Monden, Shuko; Igimi, Shizunobu; Yamamoto, Shigeki


    Quantitative analyses of Listeria monocytogenes in imported ready-to-eat (RTE) foods sold at retail stores in Japan were performed. Of the 77 non-cooked meat products, 6 samples (7.8%) tested positive. The levels of contamination of 4 of the samples were below 100 colony-forming units (CFU)/g, which is the microbiological criterion for L. monocytogenes in RTE foods as determined by Codex. However, Listeria cells at levels of 100 and 400 CFU/g were detected in a salami sample and a raw ham sample, respectively. All of the 70 cheese samples and the 3 samples made from raw ham and cheese showed negative test results. These results suggest that imported RTE foods are potential sources of the causative agent of listeriosis.

  7. RNA- and protein-mediated control of Listeria monocytogenes virulence gene expression (United States)

    Lebreton, Alice; Cossart, Pascale


    ABSTRACT The model opportunistic pathogen Listeria monocytogenes has been the object of extensive research, aiming at understanding its ability to colonize diverse environmental niches and animal hosts. Bacterial transcriptomes in various conditions reflect this efficient adaptability. We review here our current knowledge of the mechanisms allowing L. monocytogenes to respond to environmental changes and trigger pathogenicity, with a special focus on RNA-mediated control of gene expression. We highlight how these studies have brought novel concepts in prokaryotic gene regulation, such as the ‘excludon’ where the 5′-UTR of a messenger also acts as an antisense regulator of an operon transcribed in opposite orientation, or the notion that riboswitches can regulate non-coding RNAs to integrate complex metabolic stimuli into regulatory networks. Overall, the Listeria model exemplifies that fine RNA tuners act together with master regulatory proteins to orchestrate appropriate transcriptional programmes. PMID:27217337

  8. Matrix-assisted Laser Desorption Ionization-Time of Flight Mass Spectrometry (MALDI-TOF MS) Can Precisely Discriminate the Lineages of Listeria monocytogenes and Species of Listeria. (United States)

    Ojima-Kato, Teruyo; Yamamoto, Naomi; Takahashi, Hajime; Tamura, Hiroto


    The genetic lineages of Listeria monocytogenes and other species of the genus Listeria are correlated with pathogenesis in humans. Although matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) has become a prevailing tool for rapid and reliable microbial identification, the precise discrimination of Listeria species and lineages remains a crucial issue in clinical settings and for food safety. In this study, we constructed an accurate and reliable MS database to discriminate the lineages of L. monocytogenes and the species of Listeria (L. monocytogenes, L. innocua, L. welshimeri, L. seeligeri, L. ivanovii, L. grayi, and L. rocourtiae) based on the S10-spc-alpha operon gene encoded ribosomal protein mass spectrum (S10-GERMS) proteotyping method, which relies on both genetic information (genomics) and observed MS peaks in MALDI-TOF MS (proteomics). The specific set of eight biomarkers (ribosomal proteins L24, L6, L18, L15, S11, S9, L31 type B, and S16) yielded characteristic MS patterns for the lineages of L. monocytogenes and the different species of Listeria, and led to the construction of a MS database that was successful in discriminating between these organisms in MALDI-TOF MS fingerprinting analysis followed by advanced proteotyping software Strain Solution analysis. We also confirmed the constructed database on the proteotyping software Strain Solution by using 23 Listeria strains collected from natural sources.

  9. Biotic and abiotic soil properties influence survival of Listeria monocytogenes in soil.

    Directory of Open Access Journals (Sweden)

    Aude Locatelli

    Full Text Available Listeria monocytogenes is a food-borne pathogen responsible for the potentially fatal disease listeriosis and terrestrial ecosystems have been hypothesized to be its natural reservoir. Therefore, identifying the key edaphic factors that influence its survival in soil is critical. We measured the survival of L. monocytogenes in a set of 100 soil samples belonging to the French Soil Quality Monitoring Network. This soil collection is meant to be representative of the pedology and land use of the whole French territory. The population of L. monocytogenes in inoculated microcosms was enumerated by plate count after 7, 14 and 84 days of incubation. Analysis of survival profiles showed that L. monocytogenes was able to survive up to 84 days in 71% of the soils tested, in the other soils (29% only a short-term survival (up to 7 to 14 days was observed. Using variance partitioning techniques, we showed that about 65% of the short-term survival ratio of L. monocytogenes in soils was explained by the soil chemical properties, amongst which the basic cation saturation ratio seems to be the main driver. On the other hand, while explaining a lower amount of survival ratio variance (11%, soil texture and especially clay content was the main driver of long-term survival of L. monocytogenes in soils. In order to assess the effect of the endogenous soils microbiota on L. monocytogenes survival, sterilized versus non-sterilized soils microcosms were compared in a subset of 9 soils. We found that the endogenous soil microbiota could limit L. monocytogenes survival especially when soil pH was greater than 7, whereas in acidic soils, survival ratios in sterilized and unsterilized microcosms were not statistically different. These results point out the critical role played by both the endogenous microbiota and the soil physic-chemical properties in determining the survival of L. monocytogenes in soils.

  10. A note on challenge trials to determine the growth of Listeria monocytogenes on mushrooms (Agaricus bisporus

    Directory of Open Access Journals (Sweden)

    Leong Dara


    Full Text Available In the EU, food is considered safe with regard to Listeria monocytogenes if the number of micro-organisms does not exceed 100 colony forming units (cfu/g throughout its shelf-life. Therefore, it is important to determine if a food supports growth of L. monocytogenes. Guidelines for conducting challenge tests for growth assessment of L. monocytogenes on foods were published by the European Union Reference Laboratory (EURL in 2014. The aim of this study was to use these guidelines to determine if refrigerated, fresh, whole, closed-cap, prepackaged mushrooms (Agaricus bisporus support the growth of L. monocytogenes. Three batches of mushrooms were artificially inoculated at approximately 100 cfu/g with a three-strain mix of L. monocytogenes and incubated for 2 days at 8°C followed by 4 days at 12°C. L. monocytogenes numbers were determined (in triplicate for each batch on days 0, 2 and 6. Water activity, pH and total bacterial counts were also determined. There was no increase in the number of L. monocytogenes above the threshold of 0.5 log cfu/g in any of the replicates. In 8 of 9 replicates, the numbers decreased indicating that A. bisporus do not support the growth of L. monocytogenes. As the EU regulations allow < 100 cfu/g if the food cannot support growth of L. monocytogenes, the significance of this study is that mushrooms with < 100 cfu/g may be within the regulations and therefore, quantitative rather than qualitative determination may be required.

  11. Growth kinetics of Listeria monocytogenes and spoilage microorganisms in fresh-cut cantaloupe. (United States)

    Fang, Ting; Liu, Yanhong; Huang, Lihan


    The main objective of this study was to investigate the growth kinetics of Listeria monocytogenes and background microorganisms in fresh-cut cantaloupe. Fresh-cut cantaloupe samples, inoculated with three main serotypes (1/2a, 1/2b, and 4b) of L. monocytogenes, were incubated at different temperatures, ranging from 4 to 43 °C, to develop kinetic growth models. During storage studies, the population of both background microorganisms and L. monocytogenes began to increase almost immediately, with little or no lag phase for most growth curves. All growth curves, except for two growth curves of L. monocytogenes 1/2a at 4 °C, developed to full curves (containing exponential and stationary phases), and can be described by a 3-parameter logistic model. There was no significant difference (P = 0.28) in the growth behaviors and the specific growth rates of three different serotypes of L. monocytogenes inoculated to fresh-cut cantaloupe. The effect of temperature on the growth of L. monocytogenes and spoilage microorganisms was evaluated using three secondary models. For L. monocytogenes, the minimum and maximum growth temperatures were estimated by both the Ratkowsky square-root and Cardinal parameter models, and the optimum temperature and the optimum specific growth rate by the Cardinal parameter model. An Arrhenius-type model provided more accurate estimation of the specific growth rate of L. monocytogenes at temperatures <4 °C. The kinetic models developed in this study can be used by regulatory agencies and food processors for conducting risk assessment of L. monocytogenes in fresh-cut cantaloupe, and for estimating the shelf-life of fresh-cut products.

  12. Sublethal Triclosan Exposure Decreases Susceptibility to Gentamicin and Other Aminoglycosides in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Christensen, Ellen Gerd; Gram, Lone; Kastbjerg, Vicky Gaedt


    The human food-borne pathogen Listeria monocytogenes is capable of persisting in food processing plants despite cleaning and sanitation and is likely exposed to sublethal biocide concentrations. This could potentially affect susceptibility of the bacterium to biocides and other antimicrobial agen...... is commonly used in listeriosis treatment. The triclosan-induced resistance is, hence, of great concern. Further investigations are needed to determine the molecular mechanisms underlying the effect of triclosan....

  13. Scanning electron microscopy of Listeria monocytogenes biofilms on stainless steel surfaces


    Milanov Dubravka; Ašanin Ružica; Vidić Branka; Krnjaić D.; Petrović Jelena; Savić Sara


    Listeria monocytogenes is the causative agent of numerous epidemics and sporadic cases of illness in humans. Food is the principal route of infection. Raw materials of animal and vegetable origin are the potential sources of contamination with this bacterium, particularly the foodstuff undergoing minimal processing procedures. However, in the recent years, emphasis has been increasingly laid on the importance of post-processing contamination occurring through the contact of products with cont...

  14. Diffusion-Weighted Magnetic Resonance Imaging in Rhombencephalitis due to Listeria monocytogenes

    Energy Technology Data Exchange (ETDEWEB)

    Hatipoglu, H.G.; Onbasioglu Gurbuz, M.; Sakman, B.; Yuksel, E. [Dept. of Radiology, Ankara Numune Education and Research Hospital, Ankara (Turkey)


    We present diffusion-weighted imaging findings of a case of rhombencephalitis due to Listeria monocytogenes. It is a rare, life-threatening disorder. The diagnosis is difficult by clinical findings only. In this report, we aim to draw attention to the role of conventional and diffusion-weighted magnetic resonance imaging findings. To our knowledge, this is the first case report in the literature with apparent diffusion coefficient values of diseased brain parenchyma.

  15. Listeria monocytogenes that lyse in the macrophage cytosol trigger AIM2-mediated pyroptosis


    Sauer, John-Demian; Witte, Chelsea E.; Zemansky, Jason; Hanson, Bill; Lauer, Peter; Portnoy, Daniel A.


    To gain insight into the mechanisms by which host cells detect cytosolic invasion by intracellular pathogens, a genetic screen was performed to identify Listeria monocytogenes mutants that induced altered levels of host cell death. A mutation in lmo2473 resulted in hyper-stimulation of host cell death and IL-1β secretion (pyroptosis) following bacteriolysis in the macrophage cytosol. In addition, strains engineered to lyse in the cytosol by expression of both bacteriophage holin and lysin or ...

  16. Defining the Growth/No-Growth Boundary for Listeria monocytogenes in Shelf Stable Pocket Sandwiches (United States)


    conducted with Listeria monocytogenes, another pathogen of concern for ready-to-eat meat products , because it was not considered a hazard...lists the finished product pH and Aw. Code Honey Barbeque Beef Sandwich pH Aw BC Control No Omissions 4.77 0.90 Meat Filling No Glycerol, No Rice...ethyl alcohol. These findings are consistent with yeast spoilage of these products . Water activity and pH were measured starting during week 2

  17. Effect of hydrophobicity on the adhesion of Listeria monocytogenes to stainless steel and polypropylene


    Lima, Joana; Teixeira, P.; Azeredo, Joana; Oliveira, Rosário


    The retention of bacteria on food processing surfaces increases the risk of cross-contamination of these microorganisms in food. Listeria monocytogenes is a foodborne pathogen of significant concern in the food industry. This bacteria occurs widely in the environment and has been isolated from a range of sources including vegetables, processed foods, silage and soil (Cox et al., 1989). It is well known that initial bacterial adhesion to a surface is determinant to surface co...

  18. Identification of Listeria monocytogenes on Green Mussels (Perna viridis) and Cockle Shell (Anadara granosa)


    Winiati Puji Rahayu; Rini Riniati; Siti Nurjanah; Caecillia Chrismie Nurwitri


    Green mussel (Perna viridis) and cockle shell (Anadara granosa) are one of many sources of animalprotein which is many cultivated in Indonesia because their price is relatively affordable. This study wasconducted to identify the presence of Listeria monocytogenes in 27 samples of green mussels and 3 samplesof cockle shells using real-time Polymerase Chain Reaction (real-time PCR) and biochemical methods. Thetarget gene for amplification in real-time PCR was an hlyA gene because this gene was ...

  19. Listeria monocytogenes that lyse in the macrophage cytosol trigger AIM2-mediated pyroptosis


    Sauer, John-Demian; Witte, Chelsea E.; Zemansky, Jason; Hanson, Bill; Lauer, Peter; Portnoy, Daniel A.


    To gain insight into the mechanisms by which host cells detect cytosolic invasion by intracellular pathogens, a genetic screen was performed to identify Listeria monocytogenes mutants that induced altered levels of host cell death. A mutation in lmo2473 resulted in hyper-stimulation of host cell death and IL-1β secretion (pyroptosis) following bacteriolysis in the macrophage cytosol. In addition, strains engineered to lyse in the cytosol by expression of both bacteriophage holin and lysin or ...

  20. Comparative Efficacies of Antibiotics in a Rat Model of Meningoencephalitis Due to Listeria monocytogenes


    Michelet, Christian; Leib, Stephen L.; Bentue-Ferrer, Daniele; Täuber, Martin G.


    The antibacterial activities of amoxicillin-gentamicin, trovafloxacin, trimethoprim-sulfamethoxazole (TMP-SMX) and the combination of trovafloxacin with TMP-SMX were compared in a model of meningoencephalitis due to Listeria monocytogenes in infant rats. At 22 h after intracisternal infection, the cerebrospinal fluid was cultured to document meningitis, and the treatment was started. Treatment was instituted for 48 h, and efficacy was evaluated 24 h after administration of the last dose. All ...

  1. Cross-contamination between processing equipment and deli meats by Listeria monocytogenes. (United States)

    Lin, Chia-Min; Takeuchi, Kazue; Zhang, Lei; Dohm, Cynthia B; Meyer, Joseph D; Hall, Paul A; Doyle, Michael P


    Contamination of luncheon meats by Listeria monocytogenes has resulted in outbreaks of listeriosis and major product recalls. Listeriae can survive on processing equipment such as meat slicers which serve as a potential contamination source. This study was conducted to determine (i) the dynamics of cross-contamination of L. monocytogenes from a commercial slicer and associated equipment onto sliced meat products, (ii) the influence of sample size on the efficacy of the BAX-PCR and U.S. Department of Agriculture-Food Safety and Inspection Service enrichment culture assays to detect L. monocytogenes on deli meat, and (iii) the fate of L. monocytogenes on sliced deli meats of different types during refrigerated storage. Three types of deli meats, uncured oven-roasted turkey, salami, and bologna containing sodium diacetate and potassium lactate, were tested. A five-strain mixture of L. monocytogenes was inoculated at ca.10(3) CFU onto the blade of a commercial slicer. Five consecutive meat slices were packed per package, then vacuum sealed, stored at 4 degrees C, and sampled at 1 and 30 days postslicing. Two sample sizes, 25 g and contents of the entire package of meat, were assayed. Total numbers of L. monocytogenes-positive samples, including the two sample sizes and two sampling times, were 80, 9, and 3 for turkey, salami, and bologna, respectively. A higher percentage of turkey meat samples were L. monocytogenes positive when contents of the entire package were assayed than when the 25-g sample was assayed (12.5 and 7.5%, respectively). Lower inoculum populations of ca. 10(1) or 10(2) CFU of L. monocytogenes on the slicer blade were used for an additional evaluation of oven-roasted turkey using two additional sampling times of 60 and 90 days postslicing. L. monocytogenes-positive samples were not detected until 60 days postslicing, and more positive samples were detected at 90 days than at 60 days postslicing. When BAX-PCR and enrichment culture assays were

  2. Listeria monocytogenes en alimentos: ¿son todos los aislamientos igual de virulentos? Foodborne Listeria monocytogenes: are all the isolates equally virulent?

    Directory of Open Access Journals (Sweden)

    V. López


    Full Text Available Listeria monocytogenes es un patógeno humano que se transmite a través de los alimentos y que causa infecciones graves, con una alta tasa de mortalidad. A pesar de la ubicuidad del microorganismo, la tasa real de la enfermedad es bastante baja y se asocia casi siempre a condiciones predisponentes. Tradicionalmente se consideraba que los aislamientos presentes en los alimentos y en el ambiente tenían la misma capacidad patogénica que los aislamientos de origen clínico. Pero el análisis de mutaciones en los genes de determinados factores de virulencia (internalina, hemolisina, fosfolipasas, proteína de superficie ActA y proteína reguladora PrfA, los estudios cuantitativos realizados con cultivos celulares y la genética de poblaciones, están replanteando la discusión sobre la variabilidad de la virulencia de L. monocytogenes. A pesar de todos estos avances, no existe un único marcador que permita comprobar la virulencia de los aislamientos naturales de esta especie. Probablemente en el futuro, la combinación de diferentes marcadores moleculares permitirá detectar los alimentos contaminados sólo por los clones virulentos de L. monocytogenes, con lo que se mejorará la prevención de la listeriosis humana transmitida por alimentos.Listeria monocytogenes is a foodborne human pathogen responsible for invasive infections presenting overall a high mortality. Despite the ubiquity of the microorganism, the actual disease rate is quite low and the disease is most often associated with an underlying predisposition. Foodborne and environmental isolates were traditionally considered of similar pathogenicity compared to clinical isolates. But the analysis of mutations in the genes encoding specific virulence factors (internalin, hemolysin, phospholipases, surface protein ActA and regulator protein PrfA, quantitative studies with cell cultures and population genetics have raised considerable concerns about virulence differences among L

  3. Phenotypic and Genotypic Characteristics of Listeria monocytogenes Isolated From Dairy and Meat Products

    Directory of Open Access Journals (Sweden)



    Full Text Available Background Listeria monocytogenes is a foodborne pathogen and a serious threat to the public health in the world. Consumption of traditional foods such as dairy and meat products can be a major reason for relative abundance and isolation of these bacteria. Objectives The purpose of this study was to determine the phenotypic and genotypic characteristics of L. monocytogenes strains isolated from dairy and meat products. Materials and Methods A total of 317 dairy products and meat-processed samples were collected. Antibiotic susceptibility test was performed on each sample by the disk diffusion method (Kirby Bauer. Five reference loci were used for typing of L. monocytogenes strains by MLVA (Multiple Locus VNTR Analysis Technique. Results A total of 24 L. monocytogenes isolates were collected from the dairy and meat products. Resistance of isolated L. monocytogenes strains to penicillin G were 54.54% (from dairy products and 46.15% (from processed meat. Genetic relatedness of isolates were assessed by MLVA. Out of 13 different types, type 2 with 6 strains and type 3 with 4 strains, were the most common types. Conclusions MLVA analysis showed that samples obtained from different sources could have similar genetic profile. As a result, administration of penicillin in patients with listeriosis (especially pregnant women and antibiotic susceptibility test are recommended. The fast and accurate methods such as MLVA for tracking of pollution sources of L. monocytogenes are recommended during outbreaks.

  4. Rapid and sensitive detection of Listeria monocytogenes by loop-mediated isothermal amplification. (United States)

    Tang, Meng-Jun; Zhou, Sheng; Zhang, Xiao-Yan; Pu, Jun-Hua; Ge, Qing-Lian; Tang, Xiu-Jun; Gao, Yu-Shi


    Loop-mediated isothermal amplification (LAMP) was designed for detection of Listeria monocytogenes, which is an important food-borne kind of pathogenic bacteria causing human and animal disease. The primers set for the hlyA gene consist of six primers targeting eight regions on specific gene. The LAMP assay could be performed within 40 min at 65°C in a water bath. Amplification products were visualized by calcein and manganous ion and agarose gel electrophoresis. Sensitivity of the LAMP assay for detection of L. monocytogenes in pure cultures was 2.0 CFU per reaction. The LAMP assay was 100-fold higher sensitive than that of the conventional PCR assay. Taking this way, 60 chicken samples were investigated for L. monocytogenes. The accuracy of LAMP was shown to be 100% when compared to the "gold standard" culture-biotechnical, while the PCR assay failed to detect L. monocytogenes in two of the positive samples. It is shown that LAMP assay can be used as a sensitive, rapid, and simple detection tool for the detection of L. monocytogenes and will facilitate the surveillance for contamination of L. monocytogenes in food.

  5. Characterization of a Mutant Listeria monocytogenes Strain Expressing Green Fluorescent Protein

    Institute of Scientific and Technical Information of China (English)

    Ling-Li JIANG; Hou-Hui SONG; Xue-Yan CHEN; Chun-Lin KE; Jing-Jing XU; Ning CHEN; Wei-Huan FANG


    To construct a recombinant strain of Listeria monocytogenes for the expression of heterologous genes, homologous recombination was utilized for insertional mutation, targeting its listeriolysin O gene(hly). The gene encoding green fluorescent protein (GFP) was used as the indicator of heterologous gene expression. The gene gfp was inserted into hly downstream from its promoter and signal sequence by an overlapping extension polymerase chain reaction, and was then cloned into the shuttle plasmid pKSV7 for allelic exchange with the L. monocytogenes chromosome. Homologous recombination was achieved by growing the electro-transformed L. monocytogenes cells on chloramphenicol plates at a non-permissive temperature.Sequencing analysis indicated correct insertion of the target gene in-frame with the signal sequence. The recombinant strain expressed GFP constitutively as revealed by fluorescence microscopy. The mutant strain L. monocytogenes hly-gfp lost its hemolytic activity as visualized on the blood agar or when analyzed with the culture supernatant samples. Such insertional mutation resulted in a reduced virulence of about 2 logs less than its parent strain L. monocytogenes 10403s as shown by the 50%-lethal-dose assays in the mouse and embryonated chicken egg models. These results thus demonstrate that mutated L. monocytogenes could be a potential carrier for the expression of heterologous passenger genes or could act as an indicator organism in the food industry.

  6. Susceptibility of Listeria monocytogenes biofilms and planktonic cultures to hydrogen peroxide in food processing environments. (United States)

    Yun, Hyun Sun; Kim, Younghoon; Oh, Sejong; Jeon, Woo Min; Frank, Joseph F; Kim, Sae Hun


    Recent studies have indicated that Listeria monocytogenes formed biofilms on the surface of food processing equipment, and may survive sanitization treatments. The purpose of this study was to compare the susceptibility of L. monocytogenes grown in either a biofilm or planktonic culture when exposed to hydrogen peroxide (H(2)O(2)). Twelve strains of biofilm-forming L. monocytogenes and their planktonic counterparts were treated with various concentrations of H(2)O(2) (1, 6, and 10%), and the cell survival was then determined at 10-min exposure intervals. When grown as a biofilm, L. monocytogenes was significantly more resistant to H(2)O(2) than under planktonic culture conditions. Planktonic L. monocytogenes strains exhibited significantly different susceptibility to 1% H(2)O(2). Equally interestingly, biofilms of the 12 L. monocytogenes strains also inhibited different survival rates after being treated with 6 and 10% H(2)O(2). However, most of the biofilms recovered to a population of 2-9 log CFU/glass fiber filter (GFF) after a 24-h re-growth period. These results indicate that there was no significant correlation between the H(2)O(2) resistance of biofilm- and planktonic-cultured cells, and suggest that different mechanisms for the resistance to sanitation or disinfection underly the persistence of certain strains in food-processing environments.

  7. Listeria monocytogenes isolated in ready-to-eat food in South Bačka region of Vojvodina province, Serbia

    Directory of Open Access Journals (Sweden)

    Gusman Vera


    Full Text Available Listeria monocytogenes is pathogenic bacterium that can contaminate food products during and after processing. As ready-to-eat food does not undergo any treatment to ensure its safety before consumption, the risk of foodborne disease must be considered if this pathogen is present in the food. As diseases caused by contaminated food are an important public health problem today, the aim of this study was to determine the prevalence of Listeria monocytogenes in different ready-to-eat food products. In the seven-month period from June 1 to December 31, 2011, a total of 1 380 food samples were examined in the Division of Sanitary Bacteriology, Center for Microbiology, Institute of Public Health of Vojvodina in Novi Sad. A total of 912 samples were analyzed for the presence of Listeria monocytogenes according to ISO 11290-2. The identity of suspected Listeria monocytogenes was confirmed using the VITEK 2 Compact system (BioMerieux, France. Out of 912 samples, Listeria monocytogenes was detected in 18 (1.97%. Listeria monocytogenes was mostly found in cooked meals (in 6 samples out of 18, sandwiches (4 samples and frozen food, such as ice-cream and frozen vegetables (4 samples. It was also found in tofu bread spreads (2 samples, cream cheese (1 sample and cakes (1 sample. The presence of Listeria monocytogenes in some ready-to-eat food could present a public health hazard, particularly to the high-risk population group, because of the high mortality rate associated with listeriosis and the widespread nature of the organism. Monitoring of listeriosis is essential to prevent foodborne outbreaks, and in assessing human health risk in ready-to-eat foods.

  8. Eradication of high viable loads of Listeria monocytogenes contaminating food-contact surfaces

    Directory of Open Access Journals (Sweden)

    Silvia ede Candia


    Full Text Available This study demonstrates the efficacy of cold gaseous ozone treatments at low concentrations in the eradication of high Listeria monocytogenes viable cell loads from glass, polypropylene, stainless steel and expanded polystyrene food-contact surfaces. Using a step by step approach, involving the selection of the most resistant strain-surface combinations, 11 Listeria spp. strains resulted inactivated by a continuous ozone flow at 1.07 mg m-3 after 24 or 48 h of cold incubation, depending on both strain and surface evaluated. Increasing the inoculum level to 9 log CFU coupon-1, the best inactivation rate was obtained after 48h of treatment at 3.21 mg m-3 ozone concentration when cells were deposited onto stainless steel and expanded polystyrene coupons, resulted the most resistant food-contact surfaces in the previous assays.The addition of naturally microbiologically contaminated meat extract to a high load of L. monocytogenes LMG 23775 cells, the most resistant strain out of the 11 assayed Listeria spp. strains, led to its complete inactivation after four days of treatment.To the best of our knowledge, this is the first report describing the survival of L. monocytogenes and the effect of ozone treatment under cold storage conditions on expanded polystyrene, a commonly-used material in food packaging. These results could be useful for reducing pathogen cross-contamination phenomena during cold food storage.

  9. Detection of Listeria monocytogenes with short peptide fragments from class IIa bacteriocins as recognition elements. (United States)

    Azmi, Sarfuddin; Jiang, Keren; Stiles, Michael; Thundat, Thomas; Kaur, Kamaljit


    We employed a direct peptide-bacteria binding assay to screen peptide fragments for high and specific binding to Listeria monocytogenes. Peptides were screened from a peptide array library synthesized on cellulose membrane. Twenty four peptide fragments (each a 14-mer) were derived from three potent anti-listerial peptides, Leucocin A, Pediocin PA1, and Curvacin A, that belong to class IIa bacteriocins. Fragment Leu10 (GEAFSAGVHRLANG), derived from the C-terminal region of Leucocin A, displayed the highest binding among all of the library fragments toward several pathogenic Gram-positive bacteria, including L. monocytogenes, Enterococcus faecalis, and Staphylococcus aureus. The specific binding of Leu10 to L. monocytogenes was further validated using microcantilever (MCL) experiments. Microcantilevers coated with gold were functionalized with peptides by chemical conjugation using a cysteamine linker to yield a peptide density of ∼4.8×10(-3) μmol/cm2 for different peptide fragments. Leu10 (14-mer) functionalized MCL was able to detect Listeria with same sensitivity as that of Leucocin A (37-mer) functionalized MCL, validating the use of short peptide fragments in bacterial detection platforms. Fragment Leu10 folded into a helical conformation in solution, like that of native Leucocin A, suggesting that both Leu10 and Leucocin A may employ a similar mechanism for binding target bacteria. The results show that peptide-conjugated microcantilevers can function as highly sensitive platforms for Listeria detection and hold potential to be developed as biosensors for pathogenic bacteria.

  10. Prevalence of Listeria species in camel sausages from retail markets in Aydin province in Turkey and RAPD analysis of Listeria monocytogenes Isolates

    Directory of Open Access Journals (Sweden)

    Ozbey Gokben


    Full Text Available Abstract Samples were taken from 100 camel sausages from the different retail markets in Aydin province in the south-west of Turkey and they were tested for the presence of Listeria spp by biochemical methods. Samples were enriched using Listeria Enrichment Broth and they were inoculated onto Listeria Selective Agar. Listeria monocytogenes was isolated from nine samples (9%, Listeria innocua from 14 samples (14% and Listeria welshimeri from two samples(2%. A 701 bp fragment of listeriolysin O sequence for L. monocytogenes was amplified using specific primers by polymerase chain reaction (PCR for confirmation of the identification. A random primer (OPA-11 was used in a random amplified polymorphic DNA (RAPD assay. This detected five different band profiles amongst the L. monocytogenes isolates, indicating a relatively large amount of genetic heterogeneity amongst the nine isolates. The study has highlighted the need for improved strategies for food safety, in particular appropriate hygienic precautions to avoid contamination of sausage during the manufacturing process and appropriate preservation techniques during storage and transport, to prevent transmission of Listeria spp to consumers at home and abroad.

  11. Biocontrole de Listeria monocytogenes por Pediococcus acidilactici em couve minimamente processada Biocontrol of Listeria monocytogenes by Pediococcus acidilactici in fresh-cut kale

    Directory of Open Access Journals (Sweden)

    Wanessa Altimiras Costa


    Full Text Available Este estudo avaliou um sistema de biocontrole para inibição de Listeria monocytogenes em couve minimamente processada, objetivando sua segurança durante estocagem sob refrigeração e em condições de abuso de temperatura. O potencial inibitório de bactérias láticas tolerantes ao sal e psicrotróficas contaminantes naturais da couve e Lactobacillus plantarum, Lactobacillus delbrueckii ATCC 9649 e Lactobacillus casei CCT 1465 foram avaliadas contra L. monocytogenes. O isolado de couve identificado como P. acidilactici CCA3 inibiu L. monocytogenes a 10 e 15 °C em ágar MRS e foi selecionado como possível agente de biocontrole. O número de L. monocytogenes na couve minimamente processada aumentou 3,7 e 4,7 ciclos logarítmicos a 5 e 10 °C, respectivamente, após 20 dias de armazenamento e 4,6 ciclos logarítmicos após oito dias a 15 °C. Entretanto, quando 10(8 UFC.g-1 de P. acidilactici CCA3 foram inoculados no produto processado, o crescimento de L. monocytogenes reduziu 2,3 ciclos logarítmicos sob temperatura abusiva de 15 °C. A acidez titulável e as características sensoriais da couve não foram alteradas pela presença de CCA3 ao longo do período de vida útil. Estes resultados sugerem o potencial de aplicação dos bioconservantes na couve minimamente processada, que necessitam estar associados à refrigeração e sanitização para garantir segurança.This study evaluated a biological control system for the inhibition of Listeria monocytogenes in minimally processed kale focusing on its freshness under refrigeration and extreme temperatures. The inhibitory potential of salt and cold tolerant lactic bacteria from natural microflora of kale, Lactobacillus delbrueckii ATCC 9649, Lactobacillus plantarum, and Lactobacillus casei CCT 1465 strains were evaluated against L. monocytogenes. Pediococcus acidilactici CCA3 isolated from kale exhibited a large inhibition zone of L. monocytogenes at 10 and 15 °C in MRS agar and was

  12. Infectious Dose of Listeria monocytogenes in Outbreak Linked to Ice Cream, United States, 2015. (United States)

    Pouillot, Régis; Klontz, Karl C; Chen, Yi; Burall, Laurel S; Macarisin, Dumitru; Doyle, Matthew; Bally, Kären M; Strain, Errol; Datta, Atin R; Hammack, Thomas S; Van Doren, Jane M


    The relationship between the number of ingested Listeria monocytogenes cells in food and the likelihood of developing listeriosis is not well understood. Data from an outbreak of listeriosis linked to milkshakes made from ice cream produced in 1 factory showed that contaminated products were distributed widely to the public without any reported cases, except for 4 cases of severe illness in persons who were highly susceptible. The ingestion of high doses of L. monocytogenes by these patients infected through milkshakes was unlikely if possible additional contamination associated with the preparation of the milkshake is ruled out. This outbreak illustrated that the vast majority of the population did not become ill after ingesting a low level of L. monocytogenes but raises the question of listeriosis cases in highly susceptible persons after distribution of low-level contaminated products that did not support the growth of this pathogen.

  13. Changes in Gene Expression during Adaptation of Listeria monocytogenes to the Soil Environment (United States)

    Piveteau, Pascal; Depret, Géraldine; Pivato, Barbara; Garmyn, Dominique; Hartmann, Alain


    Listeria monocytogenes is a ubiquitous opportunistic pathogen responsible for listeriosis. In order to study the processes underlying its ability to adapt to the soil environment, whole-genome arrays were used to analyse transcriptome modifications 15 minutes, 30 minutes and 18 h after inoculation of L. monocytogenes EGD-e in soil extracts. Growth was observed within the first day of incubation and large numbers were still detected in soil extract and soil microcosms one year after the start of the experiment. Major transcriptional reprofiling was observed. Nutrient acquisition mechanisms (phosphoenolpyruvate-dependent phosphotransferase systems and ABC transporters) and enzymes involved in catabolism of specific carbohydrates (β-glucosidases; chitinases) were prevalent. This is consistent with the overrepresentation of the CodY regulon that suggests that in a nutrient depleted environment, L. monocytogenes recruits its extensive repertoire of transporters to acquire a range of substrates for energy production. PMID:21966375

  14. The use of Listeria monocytogenes as a DNA delivery vector for cancer gene therapy.

    LENUS (Irish Health Repository)

    Tangney, Mark


    Listeria monocytogenes is an intracellular pathogen that lyses the phagosomal vacuole of infected cells, proliferates in the host cell cytoplasm and can actively enter adjacent cells. The pathogen is therefore well suited to exploitation as a vector for the delivery of DNA to target cells as the lifecycle favors cellular targeting with vector amplification and the potential for cell-to-cell spread. We have recently demonstrated DNA transfer by L. monocytogenes in growing tumors in murine models. Our approach exploited an ampicillin sensitive stain of L. monocytogenes which can be lysed through systemic administration of ampicillin to facilitate release of plasmid DNA for expression by infected mammalian cells. Here, we discuss the implications of this technology and the potential for future improvements of the system.

  15. Effect of ripeness stage during processing on Listeria monocytogenes growth on fresh-cut 'Conference' pears. (United States)

    Colás-Medà, Pilar; Abadias, Maribel; Alegre, Isabel; Usall, Josep; Viñas, Inmaculada


    There are several factors that affect the shelf life of fresh-cut fruit, including the cultivar, the ripeness stage of the fruit during processing and the fruit's storage atmosphere and temperature. The effect of fruit ripeness during processing on the survival and growth of Listeria monocytogenes on fresh-cut 'Conference' pear slices at different temperatures (5, 10 and 20 °C) was studied. The four ripeness stages studied in this work (assessed by a fruit's firmness) were mature-green (54-60 N), partially ripe (43-53 N), ripe (31-42 N) and overripe (fresh-cut pear, the growth potential of L. monocytogenes increased with increasing temperature. A pear's ripeness stage during processing is an important consideration to ensure the quality of a fresh-cut pear, but it is not as important for preventing L. monocytogenes growth at common storage temperatures. Copyright © 2015 Elsevier Ltd. All rights reserved.

  16. Antibacterial activity of bacteriocin-like substance P34 on Listeria monocytogenes in chicken sausage (United States)

    Sant’Anna, Voltaire; Quadros, Deoni A.F.; Motta, Amanda S.; Brandelli, Adriano


    The antimicrobial activity of the bacteriocin-like substance (BLS) P34 against Listeria monocytogenes was investigated in chicken sausage. The BLS was applied to chicken sausages (256 AU g−1) previously inoculated with a suspension of 102 cfu g−1 of L. monocytogenes. BLS P34 inhibited the indicator microorganism in situ in all incubation times for up to 10 days at 5 °C. The effectiveness of BLS P34 was increased when it was added in combination with nisin. The bacteriocin was also tested in natural eatable natural bovine wrapping (salty semi-dried tripe) against the same indicator microorganism, also showing inhibitory capability in vitro. BLS P34 showed potential to control L. monocytogenes in refrigerated meat products. PMID:24688506

  17. Inhibition Effect of Herbal Preservatives on Listeria monocytogenes on Chilled Pork

    Institute of Scientific and Technical Information of China (English)

    LIU Liu; KONG Baohua; DIAO Xinping; LIU Jing


    This study investigated the growth situation of Listeria monocytogenes on chilled pork and the effect of herbal preservatives on this pathogen.The inhibitions of herbal preservatives were identified. The minimum inhibitory concentrations (MIC) of cinnamon and clove were all 0.79 mg·mL-1,while the rosemary was 1.58 mg.mL-1.And the composite herbal preservatives were got through orthogonal experiment.The optimum proportion was as following on agar medium:1.16 mg·mL-1 cinnamon+2.38 mg·mL-1 rosemary+3.17mg·mL-1 clove (herb combination number 5),while on chilled pork,the strong inhibition of L.monocytogenes was showed,which demonstrated that the surface application of herb combination resulted in an effective delay of L.monocytogenes growth.

  18. Optimizing the balance between host and environmental survival skills: lessons learned from Listeria monocytogenes (United States)

    Xayarath, Bobbi; Freitag, Nancy E


    Environmental pathogens – organisms that survive in the outside environment but maintain the capacity to cause disease in mammals – navigate the challenges of life in habitats that range from water and soil to the cytosol of host cells. The bacterium Listeria monocytogenes has served for decades as a model organism for studies of host–pathogen interactions and for fundamental paradigms of cell biology. This ubiquitous saprophy te has recently become a model for understanding how an environmental bacterium switches to life within human cells. This review describes how L. monocytogenes balances life in disparate environments with the help of a critical virulence regulator known as PrfA. Understanding L. monocytogenes survival strategies is important for gaining insight into how environmental microbes become pathogens. PMID:22827306

  19. Listeria monocytogenes cross-contamination of cheese: risk throughout the food supply chain. (United States)

    Sauders, B D; D'Amico, D J


    Listeria monocytogenes has been the most common microbial cause of cheese-related recalls in both the United States and Canada in recent years. Since L. monocytogenes is inactivated by pasteurization, the majority of these cases have been linked to environmental and cross-contamination of fresh-soft, soft-ripened, and semi-soft cheeses. Cross-contamination of foods with L. monocytogenes is a continuous risk throughout the food supply chain and presents unique challenges for subsequent illness and outbreak investigations. Reports on outbreaks of listeriosis attributed to cross-contamination downstream from primary processing help highlight the critical role of epidemiological investigation coupled with coordinated molecular subtyping and surveillance in the recognition and investigation of complex foodborne outbreaks. Despite their complexity, environmental sampling throughout the supply chain coupled with improved genotyping approaches and concomitant analysis of foodborne illness epidemiological exposure data are needed to help resolve these and similar cases more rapidly and with greater confidence.

  20. Antibacterial activity of bacteriocin-like substance P34 on Listeria monocytogenes in chicken sausage

    Directory of Open Access Journals (Sweden)

    Voltaire Sant'Anna


    Full Text Available The antimicrobial activity of the bacteriocin-like substance (BLS P34 against Listeria monocytogenes was investigated in chicken sausage. The BLS was applied to chicken sausages (256 AU g-1 previously inoculated with a suspension of 10² cfu g-1 of L. monocytogenes. BLS P34 inhibited the indicator microorganism in situ in all incubation times for up to 10 days at 5 °C. The effectiveness of BLS P34 was increased when it was added in combination with nisin. The bacteriocin was also tested in natural eatable natural bovine wrapping (salty semi-dried tripe against the same indicator microorganism, also showing inhibitory capability in vitro. BLS P34 showed potential to control L. monocytogenes in refrigerated meat products.

  1. Listeria monocytogenes and other contaminants in fresh cheese and cream from Zagreb city area domestic production

    Directory of Open Access Journals (Sweden)

    Ksenija Markov


    Full Text Available The purpose of this research was to determine whether the cream cheese and cream that are produced in the traditional manner at home and are free to sale on Zagreb markets, meet microbiological requirements for foodstuffs (OG 46/94, 20/01, 40/01. Particular attention is given to research of bacteria Listeria monocytogenes presence in these foods, because of its exceptional hazards to human health. It was found that a majority of 64 (53 % from a total of 120 studied dairy products samples were contaminated with microbial pathogens, of which 16 % are waste in the cream cheese, and 37 % in cream samples. 39 samples of cheese and 50 samples of cream did not fulfil the conditions prescribed by the Croatian Guidelines, primarily due to the contamination with yeasts and moulds. In 10 cheese and cream samples where L. monocytogenes is proven by classical microbiological methods, PCR method confirmed L. monocytogenes in only one cream sample.

  2. Microbial diversity and structure are drivers of the biological barrier effect against Listeria monocytogenes in soil. (United States)

    Vivant, Anne-Laure; Garmyn, Dominique; Maron, Pierre-Alain; Nowak, Virginie; Piveteau, Pascal


    Understanding the ecology of pathogenic organisms is important in order to monitor their transmission in the environment and the related health hazards. We investigated the relationship between soil microbial diversity and the barrier effect against Listeria monocytogenes invasion. By using a dilution-to-extinction approach, we analysed the consequence of eroding microbial diversity on L. monocytogenes population dynamics under standardised conditions of abiotic parameters and microbial abundance in soil microcosms. We demonstrated that highly diverse soil microbial communities act as a biological barrier against L. monocytogenes invasion and that phylogenetic composition of the community also has to be considered. This suggests that erosion of diversity may have damaging effects regarding circulation of pathogenic microorganisms in the environment.

  3. Antibacterial activity of bacteriocin-like substance P34 on Listeria monocytogenes in chicken sausage. (United States)

    Sant'Anna, Voltaire; Quadros, Deoni A F; Motta, Amanda S; Brandelli, Adriano


    The antimicrobial activity of the bacteriocin-like substance (BLS) P34 against Listeria monocytogenes was investigated in chicken sausage. The BLS was applied to chicken sausages (256 AU g(-1)) previously inoculated with a suspension of 10(2) cfu g(-1) of L. monocytogenes. BLS P34 inhibited the indicator microorganism in situ in all incubation times for up to 10 days at 5 °C. The effectiveness of BLS P34 was increased when it was added in combination with nisin. The bacteriocin was also tested in natural eatable natural bovine wrapping (salty semi-dried tripe) against the same indicator microorganism, also showing inhibitory capability in vitro. BLS P34 showed potential to control L. monocytogenes in refrigerated meat products.

  4. Use Carum copticum essential oil for controlling the Listeria monocytogenes growth in fish model system

    Directory of Open Access Journals (Sweden)

    Soghra Rabiey


    Full Text Available This study was conducted to evaluate the antibacterial effect of Carum copticum essential oil (Ajowan EO against Listeria monocytogenes in fish model system. Ajowan EO chemical composition was determined by gas chromatography/mass spectral analysis and the highest concentration of Carum copticum essential oil without any significant changes on sensory properties of kutum fish (Rutilus frisii kutum was assigned. Then the inhibitory effect of Ajowan EO at different concentrations in presence of salt and smoke component was tested on L. monocytogenes growth in fish peptone broth (FPB, kutum broth and cold smoked kutum broth at 4 ºC for 12 days. Ajowan EO completely decreased the number of L. monocytogenes in FPB after 12 days of storage, however, antimicrobial effect of EO significantly reduced in kutum and cold smoked kutum broth. Addition of 4% NaCl and smoke component improved the anti-listerial activity of Ajowan EO in all fish model broths.

  5. Use Carum copticum essential oil for controlling the Listeria monocytogenes growth in fish model system. (United States)

    Rabiey, Soghra; Hosseini, Hedayat; Rezaei, Masoud


    This study was conducted to evaluate the antibacterial effect of Carum copticum essential oil (Ajowan EO) against Listeria monocytogenes in fish model system. Ajowan EO chemical composition was determined by gas chromatography/mass spectral analysis and the highest concentration of Carum copticum essential oil without any significant changes on sensory properties of kutum fish (Rutilus frisii kutum) was assigned. Then the inhibitory effect of Ajowan EO at different concentrations in presence of salt and smoke component was tested on L. monocytogenes growth in fish peptone broth (FPB), kutum broth and cold smoked kutum broth at 4 °C for 12 days. Ajowan EO completely decreased the number of L. monocytogenes in FPB after 12 days of storage, however, antimicrobial effect of EO significantly reduced in kutum and cold smoked kutum broth. Addition of 4% NaCl and smoke component improved the anti-listerial activity of Ajowan EO in all fish model broths.

  6. An improved cloning vector for construction of gene replacements in Listeria monocytogenes. (United States)

    Li, Guojie; Kathariou, S


    Listeria monocytogenes is a gram-positive, facultative intracellular bacterium implicated in severe food-borne illness (listeriosis) in humans. The construction of well-defined gene replacements in the genome of L. monocytogenes has been instrumental to several genetic studies of the virulence and other attributes of the organism. Construction of such mutations by currently available procedures, however, tends to be labor intensive, and gene replacement mutants are sometimes difficult to recover due to lack of direct selection for the construct. In this study we describe the construction and use of plasmid vector pGF-EM, which can be conjugatively transferred from Escherichia coli S17-1 to L. monocytogenes and which provides the genetic means for direct selection of gene replacements.

  7. Optical immunosensors for detection of Listeria monocytogenes and Salmonella enteritidis from food (United States)

    Bhunia, Arun K.; Geng, Tao; Lathrop, Amanda; Valadez, Angela; Morgan, Mark T.


    Listeria monocytogenes and Salmonella are two major foodborne pathogens of significant concern. Two optical evanescent wave immunosensors were evaluated for detection: Antibody-coupled fiber-optic biosensor and a surface plasmon resonant (SPR) immunosensor. In the fiber-optic sensor, polyclonal antibodies for the test organisms were immobilized on polystyrene fiber wave -guides using streptavidin - biotin chemistry. Cyanine 5 -labeled monoclonal antibodies C11E9 (for L. monocytogenes) and SF-11 (for Salmonella Enteritidis) were used to generate a specific fluorescent signal. Signal acquisition was performed by launching a laser-light (635 nm) from an Analyte-2000. This immunosensor was able to detect 103 - 109 cfu/ml of L. monocytogenes or 106-109 cfu/ml of Salmonella Enteritidis and the assays were conducted at near real-time with results obtained within one hour of sampling. The assays were specific and showed signal even in the presence of other microorganisms such as E. coli, Enterococcus faecalis or Salmonella Typhimurium. In the SPR system, IAsys instrument (resonant mirror sensor) was used. Monoclonal antibody-C11E9 was directly immobilized onto a carboxylate cuvette. Whole Listeria cells at various concentrations did not yield any signal while surface protein extracts did. Crude protein extracts from L. monocytogenes and L. innocua had average binding responses of around 150 arc sec (0.25 ng/mm2), which was significantly different from L. grayi, L. ivanovii, or L. welshimeri with average responses of Salmonella Enteritidis.

  8. Exploring the chicken embryo as a possible model for studying Listeria monocytogenes pathogenicity

    Directory of Open Access Journals (Sweden)

    Jonas eGripenland


    Full Text Available Listeria monocytogenes is a bacterial pathogen capable of causing severe infections in humans, often with fatal outcomes. Many different animal models exist to study L. monocytogenes pathogenicity, and we have investigated the chicken embryo as an infection model: What are the benefits and possible drawbacks? We have compared a defined wild-type strain with its isogenic strains lacking well-characterized virulence factors. Our results show that wild-type L. monocytogenes, already at a relatively low infection dose (~5 x 102 cfu, caused death of the chicken embryo within 36 hours, in contrast to strains lacking the main transcriptional activator of virulence, PrfA, or the cytolysin LLO. Surprisingly, strains lacking the major adhesins InlA and InlB caused similar mortality as the wild-type strain. In conclusion, our results suggest that the chicken embryo is a practical model to study L. monocytogenes infections, especially when analyzing alternative virulence pathways independent of the InlA and InlB adhesins. However, the route of infection might be different from a human infection. The chicken embryo model and other Listeria infection models are discussed.

  9. A Dual Microscopy-Based Assay To Assess Listeria monocytogenes Cellular Entry and Vacuolar Escape. (United States)

    Quereda, Juan J; Pizarro-Cerdá, Javier; Balestrino, Damien; Bobard, Alexandre; Danckaert, Anne; Aulner, Nathalie; Shorte, Spencer; Enninga, Jost; Cossart, Pascale


    Listeria monocytogenes is a Gram-positive bacterium and a facultative intracellular pathogen that invades mammalian cells, disrupts its internalization vacuole, and proliferates in the host cell cytoplasm. Here, we describe a novel image-based microscopy assay that allows discrimination between cellular entry and vacuolar escape, enabling high-content screening to identify factors specifically involved in these two steps. We first generated L. monocytogenes and Listeria innocua strains expressing a β-lactamase covalently attached to the bacterial cell wall. These strains were then incubated with HeLa cells containing the Förster resonance energy transfer (FRET) probe CCF4 in their cytoplasm. The CCF4 probe was cleaved by the bacterial surface β-lactamase only in cells inoculated with L. monocytogenes but not those inoculated with L. innocua, thereby demonstrating bacterial access to the host cytoplasm. Subsequently, we performed differential immunofluorescence staining to distinguish extracellular versus total bacterial populations in samples that were also analyzed by the FRET-based assay. With this two-step analysis, bacterial entry can be distinguished from vacuolar rupture in a single experiment. Our novel approach represents a powerful tool for identifying factors that determine the intracellular niche of L. monocytogenes.

  10. The evolution and epidemiology of Listeria monocytogenes in Europe and the United States. (United States)

    Lomonaco, Sara; Nucera, Daniele; Filipello, Virginia


    Listeria monocytogenes is an opportunistic food-borne pathogen responsible for listeriosis, a disease associated with high mortality rates. L. monocytogenes causes invasive syndromes and case-fatality can be as high as 30%, in specific high-risk population groups such as the elderly, immuno-compromised individuals, fetuses and newborns. Acquisition of the disease is mainly due to consumption of contaminated (predominantly ready-to-eat) food. We aimed to provide a state-of-the-art collection of different likely evolutionary models, based on recombination and positive selection, and the phylogenetic relationship between lineages of L. monocytogenes and between them and other Listeria species. We described the most recent findings in comparative pan-genomics, considering the core and accessory genome in relation to virulence and adaptation to different environments. Finally, this review illustrates L. monocytogenes epidemiology and transmission in humans, foods and animals, the surveillance systems of the European Union and United States and the application of molecular techniques as a core tool in epidemiological investigation. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Effect of Legionella pneumophila sonicate on killing of Listeria monocytogenes by human polymorphonuclear neutrophils and monocytes

    DEFF Research Database (Denmark)

    Rechnitzer, C; Bangsborg, Jette Marie; Shand, G H


    polymorphonuclear neutrophils and monocytes. Preincubation of neutrophils with L. pneumophila sonicate did not affect phagocytosis of L. monocytogenes, whereas Listeria killing was significantly inhibited at sonicate concentrations of 1 and 2 mg/ml. The phenol phase of a phenol-water extraction, containing most...... of the lipopolysaccharide (LPS), had no inhibitory effect on the listericidal activity of neutrophils. Killing of Listeria by monocytes was inhibited in a similar manner. The inhibitory activity was mainly recovered in the sonicate fraction above 100 kDa, suggesting that components organized in larger molecular complexes...... are most likely to represent the inhibitory factors. The inhibitory activity of L. pneumophila sonic extract appears to be related to inhibition of killing mechanisms since uptake of Listeria was not affected by the sonicate. Our observations indicate that as Legionella infection progresses, bacterial...

  12. Aerobic plate counts and ATP levels correlate with Listeria monocytogenes detection in retail delis. (United States)

    Hammons, Susan R; Stasiewicz, Matthew J; Roof, Sherry; Oliver, Haley F


    Listeria monocytogenes is a foodborne pathogen that causes an estimated 1,591 cases of illness and 255 deaths annually in the United States, the majority of which are attributed to ready-to-eat deli meats processed in retail delis. Because retail delis distribute product directly to consumers, rapid methods to validate cleaning and sanitation are needed to improve retail food safety. This study investigated the relationships among ATP levels, standard aerobic plate count (APC), and L. monocytogenes presence in fully operational delis. Fifteen full-service delis were concurrently sampled for ATP, APC, and L. monocytogenes during preoperational hours once monthly for 3 months. Fifteen additional delis were recruited for 6 months of operational sampling (n = 30). A 1-log increase in APC was equivalent to a 3.3-fold increase in the odds of detecting L. monocytogenes (P < 0.001) and a 1.9-log increase in L monocytogenes population (P = 0.03). An ATP level increase of 1 log relative light unit correlated to a 0.22-log increase in APC (P < 0.001). A preoperational ATP level mean increase by 1 log relative light unit increased the odds of detecting L. monocytogenes concurrently fourfold. A 0.5-log increase in mean ATP level during preoperational sampling corresponded to a 2% increase in the predicted L. monocytogenes prevalence during operation (P < 0.01). Additionally, 10 statistically representative sites were identified and recommended for use in sanitation monitoring programs. Our data support the use of ATP as a rapid method to validate effective cleaning and sanitation to reduce L. monocytogenes in retail delis.

  13. Antimicrobial Activity of Chitosan Films With Essential Oils Against Listeria monocytogenes on Cabbage (United States)

    Jovanovic, Gordana D.; Klaus, Anita S.; P. Niksic, Miomir


    Background The highest incidence of listeriosis, due to consumption of ready-to-eat foods and fresh, shredded, minimally processed vegetables, occurs among pregnant women and the elderly. In order to reduce the prevalence of listeriosis among consumers, better protective measures are recommended. Chitosan films, with or without added essential oils, represent a modern, safe method of preserving the quality of such vegetables and significantly reducing the incidence of Listeria monocytogenes in these foods. Objectives The present study was conducted to evaluate the antimicrobial properties of composite chitosan-gelatin films with and without essential oils against two strains of L. monocytogenes, ATCC 19115 and ATCC 19112, in fresh shredded cabbage. Methods Shredded cabbage was inoculated with L. monocytogenes and packed between two layers of the chitosan composite film, then placed in Petri dishes. The prepared samples were stored at 4°C then analyzed for total viable count on PALCAM agar while incubated at 37°C, every 24 hours for 7 days. Results Average L. monocytogenes content ranged from 4.2 - 5.4 log CFU/g, reaching values of 7.2 - 8.6 log CFU/g in samples of untreated cabbage. A complete reduction of L. monocytogenes ATCC 19115 on cabbage was achieved after 120 hours in the presence of 0.5% chitosan film, whereas reduction of L. monocytogenes ATCC 19112 was achieved after 144 hours. In the presence of 1% chitosan film, the bacteria withered more quickly and complete reduction of both species of L. monocytogenes was achieved after 96 hours. Conclusions All tested formulations of chitosan films exhibited strong antimicrobial activity on the growth of both strains of L. monocytogenes on cabbage. The best effect was achieved with a 1% chitosan concentration. The addition of essential oils increased the antimicrobial activity of all tested films. PMID:27800143

  14. Growth Potential of Listeria Monocytogenes and Staphylococcus Aureus on Fresh-Cut Tropical Fruits. (United States)

    Feng, Ke; Hu, Wenzhong; Jiang, Aili; Xu, Yongping; Sarengaowa; Li, Xiaobo; Bai, Xue


    The objective of this study was to evaluate the fate of Staphylococcus aureus, Listeria monocytogenes, and natural microbiota on fresh-cut tropical fruits (pitaya, mango, papaya and pineapple) with commercial PVC film at different storage temperature (5, 13, and 25 °C). The results showed that S. aureus, L. monocytogenes, and natural microbiota increased significantly on fresh-cut tropical fruits at 25 °C. Both pathogen and natural microbiota were able to grow on fresh-cut tropical fruits at 13 °C. The maximum population of L. monocytogenes was higher than that of S. aureus on fresh-cut tropical fruits. L. monocytogenes and S. aureus could survive without growth on fresh-cut pitaya, mango, and papaya at 5 °C. The population of L. monocytogenes declined significantly on fresh-cut pineapple at all temperature, indicating composition of fresh-cut pineapple could inhibit growth of L. monocytogenes. However, S. aureus was still able to grow on fresh-cut pineapple at storage temperature. Thus, this study suggests that 4 kinds of fresh-cut tropical fruits (pitaya, mango, papaya, and pineapple) should be stored at low temperature to extend shelf life as well as to ensure the safety of fresh-cut fruits. The data collected in this study demonstrated that L. monocytogenes and S. aureus were able to grow on fresh-cut tropical fruits at different temperatures. These results could be of interest in knowing the capacity of tropical fruits to support the growth of L. monocytogenes and S. aureus. This information may also be useful to local and state regulatory officials responsible for food safety.

  15. Control of Listeria monocytogenes in turkey deli loaves using organic acids as formulation ingredients. (United States)

    Lloyd, T; Alvarado, C Z; Brashears, M M; Thompson, L D; McKee, S R; Berrang, M


    The growth of Listeria monocytogenes in further-processed meat products has become a major concern and an important food safety issue. The meat and poultry industries have incorporated interventions such as organic acids in marinades to inhibit the growth of L. monocytogenes. In this study, organic acids were utilized in the raw product and as a postcook dip to determine their inhibitory effect on the growth of L. monocytogenes in turkey deli loaves. The turkey deli loaves were processed, cooked, cooled, inoculated with streptomycin-resistant L. monocytogenes, and then dipped. Treatments were potassium lactate (PL) in the raw product with sodium lactate (SL), sodium diacetate (SD) dip, PL with SL/PL/SD dip, SL with SL/SD dip, and SL with SL/PL/SD dip. There was also a positive (inoculated) and negative (noninoculated) control, which was dipped in distilled water. Days 0, 7, 14, 21, 28, 42, and 56 were sampled for L. monocytogenes. There were no differences (P>0.05) among the organic acid treatments in the turkey deli loaves at any time points; therefore, all of the treatments increased the lag phase of L. monocytogenes, extending the shelf-life of the product. However, there was a difference between the treatments and the positive control at d 7, 14, 21, 28, 42, and 56. The growth of L. monocytogenes increased immediately in the positive control, whereas the negative control appeared to have no growth. These organic acids can provide meat processors with a useful method for extending the lag phase of L. monocytogenes in ready-to-eat meat and poultry products.

  16. In Vitro Evaluation of Bacteriocins Activity Against Listeria monocytogenes Biofilm Formation. (United States)

    Camargo, Anderson Carlos; de Paula, Otávio Almeida Lino; Todorov, Svetoslav Dimitrov; Nero, Luís Augusto


    The present study aimed to assess the activity of cell-free supernatant (CFS) containing bacteriocins on the formation and maintenance of biofilms developed by Listeria monocytogenes, and the associated effect of bacteriocins and ethylene-diamine-tetra-acetic acid (EDTA) on the formed biofilm. CFS from 9 lactic acid bacteria (LAB) strains was tested for inhibitory activity against 85 L. monocytogenes isolates and 21 LAB strains. Then, 12 L. monocytogenes strains were selected based on genetic profiles and sensitivity to CFS and were subjected to an in vitro assay to assess biofilm formation in microtiter plates, considering different culture media and incubation conditions. Based on these results, 6 L. monocytogenes strains were subjected to the same in vitro procedure to assess biofilm formation, being co-inoculated with CFS. In addition, these strains were subjected to the same in vitro procedure, modified by adding the CFS after biofilm formation. Relevant decrease in biofilm formation was observed in the first experiment, but CFS added after biofilm formation did not eliminate them. CFS from Lactobacillus curvatus ET31 were selected due to its anti-biofilm activity, being associated to EDTA at different concentrations and tested for biofilm control of three strains of L. monocytogenes, using the same in vitro procedure described previously. Concentrated bacteriocin presented poor performance in eliminating formed biofilms, and EDTA concentration presented no evident interference on biofilm elimination. Twelve selected L. monocytogenes strains were positive for investigated virulence makers and negative for luxS gene, recognized as being involved in biofilm formation. Selected L. monocytogenes strains were able to produce biofilms under different conditions. CFSs have the potential to prevent biofilm formation, but they were not able to destroy already formed biofilms. Nevertheless, low concentrations of CFS combined with EDTA caused a relevant reduction in

  17. The survival of Listeria monocytogenes during long term desiccation is facilitated by sodium chloride and organic material

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Hansen, Lisbeth Truelstrup; Mordhorst, Hanne


    One specific DNA-subtype, as determined by RAPD, of Listeria monocytogenes persisted in a fish slaughterhouse for years, even during months with no production where the plant was cleaned and kept dry. We hypothesised that tolerance to desiccation could be a factor in explaining the persistence of L...... monocytogenes in food processing environments and the purpose of the present study was to determine ability of L monocytogenes to survive desiccation on stainless steel under simulated food processing conditions. Viable counts of eight different L. monocytogenes strains exposed to different soils and relative...... humidities (RHs) during desiccation decreased significantly (p...

  18. Listeria monocytogenes : the nature, public health aspects and ...

    African Journals Online (AJOL)

    Animal Production Research Advances ... New food borne infectious diseases have continued to emerge world over in the food industries. ... Its' public health importance cannot be over emphasized as L. monocytogenes causes huge economic ... It is therefore, suggested that proper control strategies, good quality control ...

  19. Detection and isolation of Listeria monocytogenes from food samples: implications of sublethal injury. (United States)

    Donnelly, Catherine W


    Detection of L. monocytogenes is often limited by the performance of the enrichment media used to support bacterial growth to detectable levels. Because Listeria may exist at extremely low levels in foods, sample enrichment protocols must amplify these low initial populations to detectable limits. Listeria may also exist in an injured state in food products as a result of processing treatments such as heating, freezing, exposure to acids, or exposure to sanitizing compounds. Selective agents in enrichment media normally used for recovery of Listeria may inhibit repair and detection of sublethally injured Listeria, which may go on to repair, grow, and regain pathogenicity. Simple modifications to existing regulatory protocols, such as those that use more than one enrichment broth, raise sensitivity of detection to 90%. This review shows the efficacy of repair/enrichment strategies, which increase sensitivity of detection to 97.5-98.8% compared with 65-70% by standard regulatory protocols. Ribotype analysis of isolates obtained from meat samples reveals a complex microbial ecology, with striking differences in both number and distribution of distinct genetic types of Listeria, depending upon whether samples are enriched in selective or repair/enrichment media. In studies on enrichment of dairy environmental samples in University of Vermont medium and Listeria repair broth (UVM and LRB), combining these 2 primary enrichment media into a single tube of Fraser broth for dual secondary enrichment yielded a significantly higher percentage (p samples than did use of either LRB or UVM alone. Refinement of conventional Listeria recovery methods should consider the importance of the enrichment step, the nutritional needs of specific genetic types, and the physiological condition of Listeria isolates in foods.

  20. Oxygen restriction increases the infective potential of Listeria monocytogenes in vitro in Caco-2 cells and in vivo in guinea pigs

    DEFF Research Database (Denmark)

    Andersen, Jens Bo; Roldgaard, Bent; Christensen, Bjarke Bak


    Background: Listeria monocytogenes has been implicated in several food borne outbreaks as well as sporadic cases of disease. Increased understanding of the biology of this organism is important in the prevention of food borne listeriosis. The infectivity of Listeria monocytogenes ScottA, cultivated...

  1. Infecção natural por Listeria monocytogenes em cobaios Cavia porcellus Natural infection by Listeria monocytogenes in guinea pigs (Cavia porcellus

    Directory of Open Access Journals (Sweden)

    Hugo Henrique Ferreira


    Full Text Available Listeriose foi identificada em quatro porcos-da-índia (Cavia porcellus enviados para diagnóstico postmortem. Dois cobaios (1 e 2, apresentaram especialmente nódulos esbranquiçados multifocais no fígado e ceco, alterações que corresponderam microscopicamente a múltiplos focos necróticos associados com estruturas bacterianas basofílicas, degeneração gordurosa difusa e infiltrado linfocitário periportal. Lesões similares estavam presentes no intestino delgado, ceco e baço desses dois cobaios. Os outros cobaios (3 e 4 apresentavam exclusivamente alterações pulmonares caracterizadas por coloração avermelhada difusa e áreas esbranquiçadas multifocais na superfície pleural associadas histologicamente com infiltrado neutrofílico multifocal acentuado nos lúmens alveolar e bronquiolar, além de edema interseptal e alveolar, trombos vasculares e numerosos macrófagos alveolares (pneumonia supurativa. Em seções histológicas coradas pelo Brown-Hopps, foram identificadas estruturas bacilares Gram-positivas. A avaliação imuno-histoquímica para anticorpos antiListeria monocytogenes revelou marcação fortemente positiva nos focos necróticos do fígado, ceco, baço, útero, estômago e linfonodos mesentéricos dos dois cobaios com listeriose sistêmica. Nos cobaios com pneumonia supurativa, observou-se intensa marcação nos lúmens alveolares. L. monocytogenes foi isolada de amostras de fígado e de casca de arroz utilizada como cama dos cobaios. Sugere-se que as lesões pulmonares foram consequentes à aspiração de partículas da cama de casca de arroz contaminada com L. monocytogenes.Listeriosis was identified in four guinea pigs (Cavia porcellus received for post mortem evaluation. Two animals showed multifocal white nodules in the liver and cecum. These changes corresponded microscopically to multiple necrotic foci associated with basophilic bacterial structures, diffuse lipid vacuolation, and periportal lymphocytic

  2. Urban prevalence of Listeria spp. and Listeria monocytogenes in public lavatories and on shoe soles of facility patrons in the European capital city Vienna. (United States)

    Schoder, D; Schmalwieser, A; Szakmary-Brändle, K; Stessl, B; Wagner, M


    The aim of this study was to determine the prevalence of Listeria spp. and Listeria monocytogenes (L. monocytogenes) in urban public lavatories and on shoe soles of facility patrons in a European capital city. More than 91% of all municipal public lavatories in Vienna close to public hubs were included in this study. Overall, 373 swab samples of public lavatories and shoes of facility patrons were enriched, according to ISO 11290-1. Listeria monocytogenes isolates were subtyped using pulsed-field gel electrophoresis. A total of 24 samples were positive for Listeria spp., yielding an overall prevalence of 6.4% (24/373). Listeria monocytogenes was found in 2.1% (8/373) of all samples. Swabs from lavatories in parks, container lavatories and lavatories at markets had the highest prevalences of 20.7% (6/29), 20% (2/10) and 12.5% (1/8) Listeria spp., respectively. These detection rates were statistically significantly higher than those associated with lavatories in shopping centres (P = 0.003, P = 0.002, P = 0.02) and at public transport locations (P = 0.0004, P = 0.005, P = 0.02). Shoes sampled at Christmas markets showed the highest Listeria spp. and L. monocytogenes prevalences of 80% (4/5) and 40% (2/5), respectively. With regard to shoe type, Listeria spp. detection rates were 14.3% (3/21; winter boots), 13.3% (2/15; hiking boots), sport shoes (5.9%; 2/34) and brogues (5.1%; 4/79). No Listeria spp. were found on shoe soles that had smooth treads (0/76), while Listeria spp. were detected on 19.5% (8/41) of medium depth tread shoe types and on 9.4% (3/32) of deep tread shoes. These data suggest that soil environment is still one of the most important reservoirs for the foodborne pathogen L. monocytogenes. © 2014 Blackwell Verlag GmbH.

  3. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes (United States)

    Todoriki, Setsuko; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka; Kanamori, Norihito; Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio; Kawamoto, Shinichi


    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a 60Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 °C. Additionally, the m-RNA levels of β-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  4. Suppression of Listeria monocytogenes by the Native Micro-Flora in Teewurst Sausage

    Directory of Open Access Journals (Sweden)

    Michline Brice


    Full Text Available Modern consumers are interested in the use of non-chemical methods to control pathogens when heat sterilization is not an option. Such is the case with teewurst sausage, a raw spreadable sausage and a popular German commodity. Although Listeria was not found in teewurst, the optimal microbial growing conditions of teewurst coupled with the ubiquity of L. monocytogenes in nature, makes the possibility of contamination of products very possible. This pilot study was conducted to examine teewurst’s native micro-flora’s ability to suppress the outgrowth of L. monocytogenes at 10 °C using standard plate counts and PCR-DGGE. Traditional plating methods showed L. monocytogenes growth significantly decreased when in competition with the teewurst’s native micro-flora (p < 0.05. The native micro-flora of the teewurst suppressed the overall growth of L. monocytogenes by an average of two logs, under these conditions. Denaturing Gradient Gel Electrophoresis (DGGE amplicons with unique banding patterns were extracted from DGGE gel for identification. Brochothrix thermosphacta and Lactobacillus curvatus were identified as a part of the teewurst’s native micro-flora. Although the native micro-flora did not decrease L. monocytogenes to below limits of detection, it was enough of a decrease to warrant further investigation.

  5. Route of Infection Determines the Impact of Type I Interferons on Innate Immunity to Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Elisabeth Kernbauer

    Full Text Available Listeria monocytogenes is a food-borne pathogen which causes mild to life threatening disease in humans. Ingestion of contaminated food delivers the pathogen to the gastrointestinal tract, where it crosses the epithelial barrier and spreads to internal organs. Type I interferons (IFN-I are produced during infection and decrease host resistance after systemic delivery of L. monocytogenes. Here we show that mice benefit from IFN-I production following infection with L. monocytogenes via the gastrointestinal route. Intragastric infection lead to increased lethality of IFN-I receptor chain 1-deficient (Ifnar1-/- animals and to higher bacterial numbers in liver and spleen. Compared to infection from the peritoneum, bacteria infecting via the intestinal tract localized more often to periportal and pericentral regions of the liver and less frequently to the margins of liver lobes. Vigorous replication of intestine-borne L. monocytogenes in the livers of Ifnar1-/- mice 48 h post infection was accompanied by the formation of large inflammatory infiltrates in this organ and massive death of surrounding hepatocytes. This was not observed in Ifnar1-/- mice after intraperitoneal infection. The inflammatory response to infection is shaped by alterations in splenic cytokine production, particularly IFNγ, which differs after intragastric versus intraperitoneal infection. Taken together, our data suggest that the adverse or beneficial role of a cytokine may vary with the route of infection and that IFN-I are not harmful when infection with L. monocytogenes occurs via the natural route.

  6. Effect of gamma-irradiation on the survival of Listeria monocytogenes and allergenicity of cherry tomatoes

    Energy Technology Data Exchange (ETDEWEB)

    Todoriki, Setsuko [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)], E-mail:; Bari, Latiful; Kitta, Kazumi; Ohba, Mika; Ito, Yasuhiro; Tsujimoto, Yuka [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan); Kanamori, Norihito [Japan International Research Center for Agricultural Science, Tsukuba, Ibaraki 305-8686 (Japan); Yano, Erika; Moriyama, Tatsuya; Kawamura, Yukio [School of Agriculture, Kinki University, Nara-city, Nara 631-8505 (Japan); Kawamoto, Shinichi [National Food Research Institute, Tsukuba, Ibaraki 305-8642 (Japan)


    The presence of Listeria monocytogenes in fresh produce is a growing concern because of the possibility of food-borne illness. Ionizing radiation is an effective non-thermal means of eliminating pathogenic bacteria in fresh produce; however, the effect of ionizing irradiation on the allergenic properties of the host commodities remains unknown. This study aimed (i) to determine the effective dose of gamma-irradiation in eliminating L. monocytogenes on whole cherry tomatoes and (ii) to evaluate the effect of gamma-irradiation on the allergenic properties of tomato proteins. Cherry tomatoes that were inoculated with a mixture of five L. monocytogenes strains were treated with gamma-rays from a {sup 60}Co source. A 1.25 kGy dose of gamma-irradiation was found to be sufficient to eliminate L. monocytogenes on whole cherry tomatoes. The immunoblot profile of serum samples obtained from two patients with tomato allergy revealed that gamma-irradiation did not affect the allergenicity of tomato proteins for up to 7 days after irradiation when the tomatoes were stored at 20 deg. C. Additionally, the m-RNA levels of {beta}-fructofuranosidase, polygalacturonase, pectin esterase, and superoxide dismutase, the main allergenic proteins in tomato, were not affected by the applied irradiation dose. Thus, this study demonstrated that a 1.25 kGy dose of gamma-irradiation effectively eliminates L. monocytogenes on cherry tomatoes without affecting the expression of allergenic proteins in the fruits.

  7. High-pressure processing of Gorgonzola cheese: influence on Listeria monocytogenes inactivation and on sensory characteristics. (United States)

    Carminati, D; Gatti, M; Bonvini, B; Neviani, E; Mucchetti, G


    The presence of Listeria monocytogenes on the rind of Gorgonzola cheese is difficult to avoid. This contamination can easily occur as a consequence of handling during ripening. The aims of this study were to determine the efficiency of high-pressure processing (HPP) for inactivation of L. monocytogenes on cheese rind and to evaluate the influence of HPP treatments on sensory characteristics. Gorgonzola cheese rinds, after removal, were inoculated (about 7.0 log CFU/g) with L. monocytogenes strains previously isolated from other Gorgonzola cheeses. The inoculated cheese rinds were processed with an HPP apparatus under conditions of pressure and time ranging from 400 to 700 MPa for 1 to 15 min. Pressures higher than 600 MPa for 10 min or 700 MPa for 5 min reduced L. monocytogenes more than 99%. A reduction higher than 99.999% was achieved pressurizing cheese rinds at 700 MPa for 15 min. Lower pressure or time treatments were less effective and varied in effectiveness with the cheese sample. Changes in sensory properties possibly induced by the HPP were evaluated on four different Gorgonzola cheeses. A panel of 18 members judged the treated and untreated cheeses in a triangle test. Only one of the four pressurized cheeses was evaluated as different from the untreated sample. HPP was effective in the reduction of L. monocytogenes on Gorgonzola cheese rinds without significantly changing its sensory properties. High-pressure technology is a useful tool to improve the safety of this type of cheese.

  8. Molecular characterization of Listeria monocytogenes isolated from animal products in a city of Northern Brazil

    Directory of Open Access Journals (Sweden)

    Lilyan Rosmery Luizaga de Monteiro


    Full Text Available Listeria monocytogenes, a foodborne pathogen causes listeriosis, a fatal disease in about 30% of cases that affects mainly immunocompromised persons. The aim of this research was to characterize L. monocytogenes pulsed-field gel electrophoresis (PFGE types isolated from meat products collected at public markets in Araguaina city, TO. Sixty samples of raw ground beef and frescal sausage were analyzed during the second half of 2008. Five out of 30 samples (16.7% of raw ground beef tested positive for L. monocytogenes, three of which were classified as serotype 1/2b and two as serotype 4b. Among the 30 samples of sausage collected, two strains of L. monocytogenes were isolated (6.7%, one of them belonging to serotype 1/2a and the other belonging to serotype 1/2b. The restriction enzymes used were ApaI and SmaI. Similarities among the strains were determined by Dice coefficient. The macro restriction profile obtained by using SmaI enzyme allowed the distribution of seven strains in two clusters, two pulsotypes and two subtypes. The result indicates that L. monocytogenes isolates, belonging to serotype 4b, 1/2a and 1/2b, are strongly correlated within the same serotype group, and in some cases among different serotypes, suggesting that they have a common source.

  9. Pathogen-nematode interaction: Nitrogen supply of Listeria monocytogenes during growth in Caenorhabditis elegans. (United States)

    Kern, Tanja; Kutzner, Erika; Eisenreich, Wolfgang; Fuchs, Thilo M


    Listeria monocytogenes is a Gram-positive facultatively intracellular human pathogen. Due to its saprophytic lifestyle, L. monocytogenes is assumed to infect and proliferate within soil organisms such as Caenorhabditis elegans. However, little is known about the nutrient usages and metabolite fluxes in this bacterium-nematode interaction. Here, we established a nematode colonization model for L. monocytogenes and a method for the efficient separation of the pathogen from the nematodal gut. Following (15)N labelling of C. elegans and gas chromatography-mass spectrometry-based (15)N isotopologue analysis, we detected a high basal metabolic rate of the nematode, and observed a significant metabolic flux from nitrogenous compounds of the nematode to listerial proteins during proliferation of the pathogen in the worm's intestine. For comparison, we also measured the N fluxes from the gut content into listerial proteins using completely (15)N-labelled Escherichia coli OP50 as food for C. elegans. In both settings, L. monocytogenes prefers the direct incorporation of histidine, arginine and lysine over their de novo biosynthesis. Our data suggest that colonization of nematodes is a strategy of L. monocytogenes to increase its access to N-rich nutrients.

  10. Dynamics of Listeria monocytogenes colonisation in a newly-opened meat processing facility. (United States)

    Bolocan, Andrei Sorin; Nicolau, Anca Ioana; Alvarez-Ordóñez, Avelino; Borda, Daniela; Oniciuc, Elena Alexandra; Stessl, Beatrix; Gurgu, Leontina; Wagner, Martin; Jordan, Kieran


    This study determined the colonisation scenario of Listeria monocytogenes in a newly-opened ready-to-eat meat processing facility using a combination of classical microbiology and molecular biology techniques. Samples (n=183), including food contact surfaces, non-food contact surfaces, raw materials and food samples, collected on four sampling occasions, were analysed for L. monocytogenes by the ISO 11290:1996 standard method and by real-time PCR applied to the second enrichment broth from the ISO method. No L. monocytogenes were detected on the first sampling occasion, but by the second sampling occasion a persistent clone had colonised the facility. Analysis of the second enrichment of the ISO method by real-time PCR was more sensitive for the detection of L. monocytogenes than the ISO method alone. In order to reduce the risk of cross contamination and the public health risk, awareness and proactive measures are required to control L. monocytogenes from the first days of production in a newly opened meat processing facility. Copyright © 2015 Elsevier Ltd. All rights reserved.

  11. Role of Efflux Pumps in Adaptation and Resistance of Listeria monocytogenes to Benzalkonium Chloride (United States)

    Romanova, N. A.; Wolffs, P. F. G.; Brovko, L. Y.; Griffiths, M. W.


    In this study, potential mechanisms underlying resistance and adaptation to benzalkonium chloride (BC) in Listeria monocytogenes were investigated. Two groups of strains were studied. The first group consisted of strains naturally sensitive to BC which could be adapted to BC. The second group consisted of naturally resistant strains. For all adapted isolates, there was a correlation between the resistance to BC and ethidium bromide, but this was not the case for the naturally resistant isolates. To investigate the role of efflux pumps in adaptation or resistance, reserpine, an efflux pump inhibitor, was added to the strains. Addition of reserpine to the sensitive and adapted strains resulted in a decrease in the MIC for BC, whereas no such decrease was observed for the resistant strains, indicating that efflux pumps played no role in the innate resistance of certain strains of L. monocytogenes to this compound. Two efflux pumps (MdrL and Lde) have been described in L. monocytogenes. Studies showed low and intermediate levels of expression of the genes encoding the efflux pumps for two selected resistant strains, H7764 and H7962, respectively. Adaptation to BC of sensitive isolates of L. monocytogenes resulted in significant increases in expression of mdrl (P < 0.05), but no such increase was observed for lde for two adapted strains of L. monocytogenes, LJH 381 (P = 0.91) and C719 (P = 0.11). This indicates that the efflux pump Mdrl is at least partly responsible for the adaptation to BC. PMID:16672496

  12. Removal of Listeria monocytogenes dual-species biofilms using combined enzyme-benzalkonium chloride treatments. (United States)

    Rodríguez-López, Pedro; Carballo-Justo, Alba; Draper, Lorraine A; Cabo, Marta L


    The effects of pronase (PRN), cellulase (CEL) or DNaseI alone or combined with benzalkonium chloride (BAC) against Listeria monocytogenes-carrying biofilms were assayed. The best removal activity against L. monocytogenes-Escherichia coli biofilms was obtained using DNaseI followed by PRN and CEL. Subsequently, a modified logistic model was used to quantify the combined effects of PRN or DNaseI with BAC. A better BAC performance after PRN compared to DNaseI eradicating L. monocytogenes was observed. In E. coli the effects were the opposite. Finally, effects of DNaseI and DNaseI-BAC treatments were compared against two different L. monocytogenes-carrying biofilms. DNaseI-BAC was more effective against L. monocytogenes when co-cultured with E. coli. Nonetheless, comparing the removal effects after BAC addition, these were higher in mixed-biofilms with Pseudomonas fluorescens. However, a high number of released viable cells was observed after combined treatments. These results open new perspectives of enzymes as an anti-biofilm strategy for environmental pathogen control.

  13. Rapid and visual detection of Listeria monocytogenes based on nanoparticle cluster catalyzed signal amplification. (United States)

    Zhang, Lisha; Huang, Ru; Liu, Weipeng; Liu, Hongxing; Zhou, Xiaoming; Xing, Da


    Foodborne pathogens pose a significant threat to human health worldwide. The identification of foodborne pathogens needs to be rapid, accurate and convenient. Here, we constructed a nanoparticle cluster (NPC) catalyzed signal amplification biosensor for foodborne pathogens visual detection. In this work, vancomycin (Van), a glycopeptide antibiotic for Gram-positive bacteria, was used as the first molecular recognition agent to capture Listeria monocytogenes (L. monocytogenes). Fe3O4 NPC modified aptamer, was used as the signal amplification nanoprobe, specifically recognize to the cell wall of L. monocytogenes. As vancomycin and aptamer recognize L. monocytogenes at different sites, the sandwich recognition showed satisfied specificity. Compared to individual Fe3O4 nanoparticle (NP), NPC exhibit collective effect-enhanced catalytic activity for the color reaction of chromogenic substrate. The change in absorbance or color could represent the concentration of target. Using the Fe3O4 NPC-based signal amplification method, L. monocytogenes whole cells could be directly assayed within a linear range of 5.4×10(3)-10(8) cfu/mL and a visual limit of detection of 5.4×10(3) cfu/mL. Fe3O4 NPC-based method was more sensitive than the Fe3O4 NP-based method. All these attractive characteristics of highly sensitivity, visual and labor-saving, make the biosensor possess a potential application for foodborne pathogenic bacteria detection. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Inhibition of Listeria monocytogenes biofilms by bacteriocin-producing bacteria isolated from mushroom substrate. (United States)

    Bolocan, A S; Pennone, V; O'Connor, P M; Coffey, A; Nicolau, A I; McAuliffe, O; Jordan, K


    This study was designed to investigate the ability of naturally occurring bacteria isolated from mushroom substrate to prevent biofilm formation by Listeria monocytogenes or to remove existing biofilms in mushroom production facilities. It is generally recognized that L. monocytogenes forms biofilms that can facilitate its survival in food-processing environments. Eleven bacteriocin-producing isolates were identified and the bacteriocins characterized based on heat and enzyme inactivation studies. Further characterization was undertaken by MALDI-TOF mass spectrometry, PCR and sequencing. Production of nisin Z (by Lactococcus lactis isolates), subtilomycin (by Bacillus subtilis isolates) and lichenicidin (by Bacillus licheniformis and Bacillus sonorensis isolates) was detected. In co-culture with L. monocytogenes, the bacteriocin-producing strains could prevent biofilm formation and reduce pre-formed biofilms. Mushroom substrate can be a source of bacteriocin-producing bacteria that can antagonize L. monocytogenes. The results highlight the potential of bacteriocin-producing strains from mushroom substrate to reduce L. monocytogenes biofilm in food production environments, contributing to a reduction in the risk of food contamination from the environment. © 2016 The Society for Applied Microbiology.

  15. Identification of a Peptide-Pheromone that Enhances Listeria monocytogenes Escape from Host Cell Vacuoles (United States)

    Xayarath, Bobbi; Alonzo, Francis; Freitag, Nancy E.


    Listeria monocytogenes is a Gram-positive facultative intracellular bacterial pathogen that invades mammalian cells and escapes from membrane-bound vacuoles to replicate within the host cell cytosol. Gene products required for intracellular bacterial growth and bacterial spread to adjacent cells are regulated by a transcriptional activator known as PrfA. PrfA becomes activated following L. monocytogenes entry into host cells, however the signal that stimulates PrfA activation has not yet been defined. Here we provide evidence for L. monocytogenes secretion of a small peptide pheromone, pPplA, which enhances the escape of L. monocytogenes from host cell vacuoles and may facilitate PrfA activation. The pPplA pheromone is generated via the proteolytic processing of the PplA lipoprotein secretion signal peptide. While the PplA lipoprotein is dispensable for pathogenesis, bacteria lacking the pPplA pheromone are significantly attenuated for virulence in mice and have a reduced efficiency of bacterial escape from the vacuoles of nonprofessional phagocytic cells. Mutational activation of PrfA restores virulence and eliminates the need for pPplA-dependent signaling. Experimental evidence suggests that the pPplA peptide may help signal to L. monocytogenes its presence within the confines of the host cell vacuole, stimulating the expression of gene products that contribute to vacuole escape and facilitating PrfA activation to promote bacterial growth within the cytosol. PMID:25822753

  16. Meningoencephalitis and Listeria monocytogenes, Toxoplasma gondii and Brucella spp. coinfection in a dolphin in Italy. (United States)

    Grattarola, Carla; Giorda, Federica; Iulini, Barbara; Pintore, Maria Domenica; Pautasso, Alessandra; Zoppi, Simona; Goria, Maria; Romano, Angelo; Peletto, Simone; Varello, Katia; Garibaldi, Fulvio; Garofolo, Giuliano; Di Francesco, Cristina Esmeralda; Marsili, Letizia; Bozzetta, Elena; Di Guardo, Giovanni; Dondo, Alessandro; Mignone, Walter; Casalone, Cristina


    Listeria monocytogenes, Toxoplasma gondii and Brucella spp. can infect a wide range of species, including humans. In cetaceans, meningoencephalitis has been associated with T. gondii and Brucella spp. infection, whereas to our knowledge, L. monocytogenes infection has not previously been reported. Meningoencephalitis and L. monocytogenes, T. gondii and Brucella spp. were identified by means of both direct and indirect laboratory techniques in an adult female striped dolphin Stenella coeruleoalba found stranded in January 2015 on the Ligurian Sea coast, northwestern Italy. The animal was emaciated, and histopathology disclosed severe meningoencephalitis. The nature of the inflammatory response and intra-lesional protozoa were consistent with a mixed infection by L. monocytogenes, T. gondii and Brucella spp. We believe this is an unprecedented case of infection by 3 zoonotic pathogens and also the first bacteriologically confirmed case report of neurolisteriosis in cetaceans. Cerebral toxoplasmosis and neurobrucellosis may have led to the animal's disorientation and stranding, with L. monocytogenes having likely exacerbated the coinfection leading to the demise of this dolphin.

  17. An ecological perspective of Listeria monocytogenes biofilms in food processing facilities. (United States)

    Valderrama, Wladir B; Cutter, Catherine N


    Listeria monocytogenes can enter the food chain at virtually any point. However, food processing environments seem to be of particular importance. From an ecological point of view, food processing facilities are microbial habitats that are constantly disturbed by cleaning and sanitizing procedures. Although L. monocytogenes is considered ubiquitous in nature, it is important to recognize that not all L. monocytogenes strains appear to be equally distributed; the distribution of the organism seems to be related to certain habitats. Currently, no direct evidence exists that L. monocytogenes-associated biofilms have played a role in food contamination or foodborne outbreaks, likely because biofilm isolation and identification are not part of an outbreak investigation, or the definition of biofilm is unclear. Because L. monocytogenes is known to colonize surfaces, we suggest that contamination patterns may be studied in the context of how biofilm formation is influenced by the environment within food processing facilities. In this review, direct and indirect epidemiological and phenotypic evidence of lineage-related biofilm formation capacity to specific ecological niches will be discussed. A critical view on the development of the biofilm concept, focused on the practical implications, strengths, and weaknesses of the current definitions also is discussed. The idea that biofilm formation may be an alternative surrogate for microbial fitness is proposed. Furthermore, current research on the influence of environmental factors on biofilm formation is discussed.

  18. A new bovine conjunctiva model shows that Listeria monocytogenes invasion is associated with lysozyme resistance. (United States)

    Warren, Jessica; Owen, A Rhys; Glanvill, Amy; Francis, Asher; Maboni, Grazieli; Nova, Rodrigo J; Wapenaar, Wendela; Rees, Catherine; Tötemeyer, Sabine


    Listerial keratoconjunctivitis ('silage eye') is a wide spread problem in ruminants causing economic losses to farmers and impacts negatively on animal welfare. It results from direct entry of Listeria monocytogenes into the eye, often following consumption of contaminated silage. An isolation protocol for bovine conjunctival swabbing was developed and used to sample both infected and healthy eyes bovine eyes (n=46). L. monocytogenes was only isolated from one healthy eye sample, and suggests that this organism can be present without causing disease. To initiate a study of this disease, an infection model was developed using isolated conjunctiva explants obtained from cattle eyes post slaughter. Conjunctiva were cultured and infected for 20 h with a range of L. monocytogenes isolates (n=11), including the healthy bovine eye isolate and also strains isolated from other bovine sources, such as milk or clinical infections. Two L. monocytogenes isolates (one from a healthy eye and one from a cattle abortion) were markedly less able to invade conjunctiva explants, but one of those was able to efficiently infect Caco2 cells indicating that it was fully virulent. These two isolates were also significantly more sensitive to lysozyme compared to most other isolates tested, suggesting that lysozyme resistance is an important factor when infecting bovine conjunctiva. In conclusion, we present the first bovine conjunctiva explant model for infection studies and demonstrate that clinical L. monocytogenes isolates from cases of bovine keratoconjunctivitis are able to infect these tissues.

  19. Use of germicidal UV light to reduce low numbers of Listeria monocytogenes on raw chicken meat. (United States)

    Berrang, M E; Meinersmann, R J; Frank, J F


    Listeria monocytogenes is a common constituent of the microbiological community in poultry processing plants and can be found in low numbers on raw poultry. Raw meat is the most important source of this pathogen in commercial cooking facilities. Germicidal UV light was tested as a means to kill L. monocytogenes inoculated onto broiler breast fillets. Treatments at 800 μW/ cm(2) for 5 s to 5 min of exposure were tested against inocula of 35 to 60 cells per fillet. All fillets were sampled by rinsing in enrichment broth, and surviving pathogens were quantified using most-probable-number (MPN) analysis. Five replications each with 5 fillets per treatment were analyzed to achieve 25 sample fillets per treatment. All treatment times resulted in a significant decrease in L. monocytogenes numbers compared with paired untreated controls. Treated samples retained 0.2 to 1.5 MPN L. monocytogenes per fillet, and exposure time had no significant effect on the number of surviving cells. A 5-s treatment with germicidal UV light has potential as an intervention method to limit the transfer of L. monocytogenes on raw skinless breast fillets from a slaughter plant to a cooking plant.

  20. Antimicrobial activity of chitosan coatings and films against Listeria monocytogenes on black radish. (United States)

    Jovanović, Gordana D; Klaus, Anita S; Nikšić, Miomir P


    The antibacterial activity of chitosan coatings prepared with acetic or lactic acid, as well as of composite chitosan-gelatin films prepared with essential oils, was evaluated in fresh shredded black radish samples inoculated with Listeria monocytogenes ATCC 19115 and L. monocytogenes ATCC 19112 during seven days of storage at 4°C. The chitosan coating prepared with acetic acid showed the most effective antibacterial activity. All tested formulations of chitosan films exhibited strong antimicrobial activity on the growth of L. monocytogenes on black radish, although a higher inhibition of pathogens was achieved at higher concentrations of chitosan. The antimicrobial effect of chitosan films was even more pronounced with the addition of essential oils. Chitosan-gelatin films with thyme essential oils showed the most effective antimicrobial activity. A reduction of 2.4log10CFU/g for L. monocytogenes ATCC 19115 and 2.1log10CFU/g for L. monocytogenes ATCC 19112 was achieved in the presence of 1% chitosan film containing 0.2% of thyme essential oil after 24h of storage. Copyright © 2016 Asociación Argentina de Microbiología. Publicado por Elsevier España, S.L.U. All rights reserved.

  1. Impact of genetically regulated T cell proliferation on acquired resistance to Listeria monocytogenes. (United States)

    Berche, P; Decreusefond, C; Theodorou, I; Stiffel, C


    Two lines of mice genetically selected for high and low in vitro responses to PHA were used to evaluate the impact of T cell polyclonal expansion on acquired resistance to Listeria monocytogenes. The selective breeding induced two major consequences in low responder mice: (1) a reduction of the number of L3T4+ cells and (2) a restriction of T cell expansion upon PHA stimulation, predominantly affecting the Lyt-2+ subset, and associated with an abridgment of IL-2 production. In vivo PHA stimulation induced anti-Listeria protection in high responder mice, but was much less effective in low responder mice. Flow cytometer analysis revealed that T cell proliferation was also reduced in low responder mice during the course of Listeria infection, implying both L3T4+ and Lyt-2+ subsets. This defect did not apparently influence the kinetics of bacterial elimination in host tissues, which was similar in both lines during primary Listeria infection. In contrast, the expression of delayed-type hypersensitivity to Listeria antigens and the level of immunologic memory were significantly reduced in low responder mice. In vivo selective T cell depletion by anti-L3T4 or anti-Lyt-2 mAb allowed us to demonstrate the predominant role of Lyt-2+ cells in protection and that of L3T4+ cells in the expression of delayed-type hypersensitivity.

  2. Reducing levels of Listeria monocytogenes contamination on raw salmon with acidified sodium chlorite. (United States)

    Su, Yi-Cheng; Morrissey, Michael T


    The antimicrobial activity of acidified sodium chlorite (ASC) against Listeria monocytogenes in salmon was studied. Raw salmon (whole fish and fillets) inoculated with L. monocytogenes (10(3) CFU/cm2 or 10(4) CFU/g) were washed with ASC solution (50 ppm) for 1 min and stored at -18 degrees C for 1 month (whole salmon) or in ice for 7 days (fillets). L. monocytogenes populations were determined for whole salmon after frozen storage and for fillets on days 1, 3, 5, and 7 of storage. A wash with ASC solution followed by ASC glazing did not reduce L. monocytogenes on the skin of whole salmon during frozen storage. However, the wash resulted in an L. monocytogenes reduction of 0.5 log CFU/g for salmon fillets. The populations of L. monocytogenes in fillets increased slowly during ice storage, but the growth of these populations was retarded by ASC ice. By day 7, the populations were 0.25 log units smaller in fillets stored in ASC ice and 0.62 log units smaller in fillets that had been washed with ASC solution and stored in ASC ice than in control fillets. Treatment with ASC also reduced total plate counts (TPCs) by 0.43 log CFU/cm2 on the skin of whole salmon and by 0.31 log CFU/g in fillets. The TPCs for skin decreased during frozen storage but increased gradually for fillets stored at 5 degrees C or in ice. However, TPCs of ASC-treated samples were lower than those for controls at any point during the study. Washing with ASC solution significantly (P < 0.05) reduced TPCs on the skin of whole salmon and in fillets, as well as L. monocytogenes in fillets. The antimicrobial activity of ASC was enhanced when salmon was washed with ASC solution and stored in ASC ice.

  3. Examination of Listeria monocytogenes in Seafood Processing Facilities and Smoked Salmon in the Republic of Ireland. (United States)

    Leong, Dara; Alvarez-Ordóñez, Avelino; Zaouali, Sarah; Jordan, Kieran


    Listeria monocytogenes is a foodborne pathogen that causes listeriosis, a relatively rare but life-threatening disease primarily affecting immunocompromised individuals. The aim of this study was to determine the prevalence of L. monocytogenes in the seafood processing industry in the Republic of Ireland. The occurrence of L. monocytogenes was determined by regular sampling of both food samples and processing environment swabs at eight seafood processing facilities over two calendar years. All samples were analyzed by the International Organization for Standardization 11290-1 standard method, and the isolates were characterized by PCR, pulsed-field gel electrophoresis, serotyping, and the occurrence of some genes related to survival under stress (SSI-1, Tn6188, and bcrABC). A prevalence of 2.5% in 508 samples (433 environmental swabs and 75 food samples) was found. From the isolates obtained, eight different pulsed-field gel electrophoresis profiles were identified, two occurring in more than one facility and one occurring in food and the environment. Five of the eight pulsotypes identified contained at least one of the three stress survival-related genes tested. The tolerance of the isolates to benzalkonium chloride, a representative quaternary ammonium compound, was also examined and ranged from 5.5 ± 0.5 to 8.5 ± 0.5 ppm of benzalkonium chloride. To evaluate the ability of smoked salmon to support the growth of L. monocytogenes, including the T4 widespread pulsotype that was isolated, a challenge test was performed on cold-smoked salmon obtained from two separate producers. The results showed clearly that both types of smoked salmon supported the growth of L. monocytogenes. Although occurrence of L. monocytogenes on seafood was low, this study showed that the smoked salmon used in this study can support the growth of L. monocytogenes; therefore, vigilance is required in the processing facilities to reduce the associated risk.

  4. Rapid detection of Listeria monocytogenes by real-time PCR in processed meat and dairy products. (United States)

    Heo, Eun Jeong; Song, Bo Ra; Park, Hyun Jung; Kim, Young Jo; Moon, Jin San; Wee, Sung Hwan; Kim, Jin-Seok; Yoon, Yohan


    The objectives of this study were to evaluate the detection of Listeria monocytogenes in different ready-to-eat foods using real-time PCR (RT-PCR). Various concentrations (10(0) to 10(5) CFU/ml) of L. monocytogenes ATCC 19115 were inoculated into ham, sausage, ground meat, processed milk, cheese, and infant formula. L. monocytogenes ATCC 19115 in the samples was then enumerated on Oxford agar, and DNA was extracted from the samples before and after incubation at 36°C for 4 h. A set of primers and hybridization probe designed in this study was then used to detect the pathogen. The standard curve was then prepared by plotting cycle threshold values for each dilution versus L. monocytogenes cell counts (log CFU). The specificity of the set of primers and hybridization probe was appropriate. A 4-h incubation at 36°C before DNA extraction produced optimum standard curves in comparison to the results for a 0-h incubation. Thus, a 4-h incubation at 36°C was applied for monitoring L. monocytogenes in collected food samples. To monitor L. monocytogenes in foods, 533 samples (ham, 129; sausage, 226; ground meat, 72; processed cheese, 54; processed milk, 42; and infant formula, 10) were collected from retail markets and from the step before pasteurization in plants. Of all 533 samples, 4 samples (0.8%) showed positive signals in RT-PCR. Two samples from hams (1.6%) and two samples from sausages (0.9%) were determined to be positive for L. monocytogenes at processed meat and milk products.

  5. Tolerance to quaternary ammonium compound disinfectants may enhance growth of Listeria monocytogenes in the food industry. (United States)

    Møretrø, Trond; Schirmer, Bjørn C T; Heir, Even; Fagerlund, Annette; Hjemli, Pernille; Langsrud, Solveig


    The antibacterial effect of disinfectants is crucial for the control of Listeria monocytogenes in food processing environments. Tolerance of L. monocytogenes to sublethal levels of disinfectants based on quaternary ammonium compounds (QAC) is conferred by the resistance determinants qacH and bcrABC. The presence and distribution of these genes have been anticipated to have a role in the survival and growth of L. monocytogenes in food processing environments where QAC based disinfectants are in common use. In this study, a panel of 680 L. monocytogenes from nine Norwegian meat- and salmon processing plants were grouped into 36 MLVA profiles. The presence of qacH and bcrABC was determined in 101 isolates from the 26 most common MLVA profiles. Five MLVA profiles contained qacH and two contained bcrABC. Isolates with qacH and bcrABC showed increased tolerance to the QAC Benzalkonium chloride (BC), with minimal inhibitory concentrations (MICs) of 5-12, 10-13 and monocytogenes when the sample BC levels were high (>100ppm). A sample with lower BC concentrations (14ppm of chain length C-12 and 2.7ppm of chain length C-14) inhibited growth of L. monocytogenes not containing bcrABC or qacH, compared to strains with these genes. The study has shown that L. monocytogenes harbouring the QAC resistance genes qacH and bcrABC are prevalent in the food industry and that residuals of QAC may be present in concentrations after sanitation in the industry that result in a growth advantage for bacteria with such resistance genes. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Evolution and Diversity of Listeria monocytogenes from Clinical and Food Samples in Shanghai, China

    Directory of Open Access Journals (Sweden)

    Jianmin Zhang


    Full Text Available Listeria monocytogenes is a significant foodborne pathogen causing severe systemic infections in humans with high mortality rates. The objectives of this work were to establish a phylogenetic framework of L. monocytogenes from China and to investigate sequence diversity among different serotypes. We selected 17 L. monocytogenes strains recovered from patients and foods in China representing serotypes 1/2a, 1/2b, and 1/2c. Draft genome sequences were determined using Illumina MiSeq technique and associated protocols. Open reading frames were assigned using prokaryotic genome annotation pipeline by NCBI. Twenty-four published genomes were included for comparative genomic and phylogenetic analysis. More than 154,000 single nucleotide polymorphisms (SNPs were identified from multiple genome alignment and used to reconstruct maximum likelihood phylogenetic tree. The 41 genomes were differentiated into lineages I and II, which consisted of 4 and 11 subgroups, respectively. A clinical strain from China (SHL009 contained significant SNP differences compared to the rest genomes, whereas clinical strain SHL001 shared most recent common ancestor with strain SHL017 from food. Moreover, clinical strains SHL004 and SHL015 clustered together with two strains (08-5578 and 08-5923 recovered from an outbreak in Canada. Partial sequences of a plasmid found in the Canadian strain were also present in SHL004. We investigated the presence of various genes and gene clusters associated with virulence and subgroup-specific genes, including internalins, L. monocytogenes pathogenicity islands (LIPIs, L. monocytogenes genomic islands (LGIs, stress survival islet 1 (SSI-1, and clustered regularly interspaced short palindromic repeats (CRISPR/cas system. A novel genomic island, denoted as LGI-2 was identified. Comparative sequence analysis revealed differences among the L. monocytogenes strains related to virulence, survival abilities, and attributes against foreign genetic

  7. Metal ion homeostasis in Listeria monocytogenes and importance in host-pathogen interactions. (United States)

    Jesse, Helen E; Roberts, Ian S; Cavet, Jennifer S


    Listeria monocytogenes is responsible for one of the most life-threatening food-borne infections and the leading cause of food-poisoning associated deaths in the UK. Infection may be of the unborn/newly born infant where disease may manifest as listeric abortion, stillbirth or late-onset neonatal listeriosis, while in adults, infection usually affects the central nervous system causing meningitis. Crucial to the survival of L. monocytogenes, both inside and outside the host, is its ability to acquire metals which act as cofactors for a broad range of its cellular proteins. However, L. monocytogenes must also protect itself against the innate toxicity of metals. The importance of metals in host-pathogen interactions is illustrated by the restriction of metals (including zinc and iron) in vertebrates in response to infection and the use of high levels of metals (copper and zinc) as part of the antimicrobial defences within host phagocytes. As such, L. monocytogenes is equipped with various mechanisms to tightly control its cellular metal pools and avoid metal poisoning. These include multiple DNA-binding metal-responsive transcription factors, metal-acquisition, metal-detoxification and metal-storage systems, some of which represent key L. monocytogenes virulence determinants. This review discusses current knowledge of the role of metals in L. monocytogenes infections, with a focus on the mechanisms that contribute to zinc and copper homeostasis in this organism. The requirement to precisely control cellular metal levels may impose a vulnerability to L. monocytogenes which can be exploited in antimicrobials and therapeutics.

  8. Hygiene and Safety in the Meat Processing Environment from Butcher Shops: Microbiological Contamination and Listeria monocytogenes. (United States)

    Silva, Danilo Augusto Lopes da; Dias, Mariane Rezende; Cossi, Marcus Vinícius Coutinho; Castilho, Natália Parma Augusto de; Camargo, Anderson Carlos; Nero, Lúis Augusto


    The quality and safety of meat products can be estimated by assessing their contamination by hygiene indicator microorganisms and some foodborne pathogens, with Listeria monocytogenes as a major concern. To identify the main sources of microbiological contamination in the processing environment of three butcher shops, surface samples were obtained from the hands of employees, tables, knives, inside butcher displays, grinders, and meat tenderizers (24 samples per point). All samples were subjected to enumeration of hygiene indicator microorganisms and detection of L. monocytogenes, and the obtained isolates were characterized by their serogroups and virulence genes. The results demonstrated the absence of relevant differences in the levels of microbiological contamination among butcher shops; samples with counts higher than reference values indicated inefficiency in adopted hygiene procedures. A total of 87 samples were positive for Listeria spp. (60.4%): 22 from tables, 20 from grinders, 16 from knives, 13 from hands, 9 from meat tenderizers, and 7 from butcher shop displays. Thirty-one samples (21.5%) were positive for L. monocytogenes, indicating the presence of the pathogen in meat processing environments. Seventy-four L. monocytogenes isolates were identified, with 52 from serogroups 1/2c or 3c and 22 from serogroups 4b, 4d, 4a, or 4c. All 74 isolates were positive for hlyA, iap, plcA, actA, and internalins (inlA, inlB, inlC, and inlJ). The establishment of appropriate procedures to reduce microbial counts and control the spread of L. monocytogenes in the final steps of the meat production chain is of utmost importance, with obvious effects on the quality and safety of meat products for human consumption.


    Directory of Open Access Journals (Sweden)

    Edith Burbano


    Full Text Available Objective. The aim of this study was to validate a method for detecting L. monocytogenes in raw milk.Materials and methods. The extraction procedure carried out using a chaotropic agent like NaI, toreduce fat in the sample to 0.2% w/v, which is the lowest limit for detection in the Gerber method, toavoid the polymerization. The raw milk samples were analyzed by using the traditional gold standardmethod for L. monocytogenes. Detection PCR was done on the specificity of primers that recognize theListeria genus by amplifying a specific fragment of about 938bp of the 16S rDNA. Several primer setswere use: L1 (CTCCATAAAGGTGACCCT, U1 (CAGCMGCCGCGGTAATWC, LF (CAAACGTTAACAACGCAGTAand LR (TCCAGAGTGATCGATGTTAA that recognize the hlyA gene of L. monocytogenes, amplifying a 750bpfragment. Results. The DNA of 39 strains evidenced high specificity of the technique since all the strainsof L. monocytogenes amplified the fragments 938bp and 750bp, specifically for genus and species,respectively. The detection limit of the PCR was 101 CFU/ml. T he PCR reproducibility showed a Kappa of0.85; the specificity and sensitivity of 100% were found, predictive positive and negative values were of100% respectively. Conclusions. These results demonstrate that is possible to detect of Listeria spp. byusing any of the three methods since they share the same sensitivity and specificity. One hundred percentof the predictive value for PCR (alternative method provides high reliability, and allows the detection ofthe positive samples. The extraction procedure combined with a PCR method can reduce in 15 days thetime of identification of L. monocytogenes in raw milk. This PCR technique could be adapted and validatedto be use for other types of food such as poultry, meat products and cheeses

  10. Comparative genomics and transcriptomics of lineages I, II, and III strains of Listeria monocytogenes (United States)


    Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99) and 4b (CLIP80459), and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence of attenuated lineages

  11. Listeriaphages and coagulin C23 act synergistically to kill Listeria monocytogenes in milk under refrigeration conditions. (United States)

    Rodríguez-Rubio, Lorena; García, Pilar; Rodríguez, Ana; Billington, Craig; Hudson, J Andrew; Martínez, Beatriz


    Bacteriophages and bacteriocins are promising biocontrol tools in food. In this work, two Listeria bacteriophages, FWLLm1 and FWLLm3, were assessed in combination with the bacteriocin coagulin C23 to inhibit Listeria monocytogenes. Preliminary results under laboratory conditions demonstrated that both antimicrobials act synergistically when they were applied in suboptimal concentrations. The combined approach was further assessed in milk contaminated with 5×10(4) CFU/ml L. monocytogenes 2000/47 and stored at 4 °C for 10 days. When used alone, phage FWLLm1 added at 5×10(6) PFU/ml, FWLLm3 at 5×10(5) PFU/ml and coagulin C23 at 584 AU/ml kept L. monocytogenes 2000/47 counts lower than the untreated control throughout storage. However, when used in combination, inhibition was enhanced and in the presence of FWLLm1 and coagulin C23, L. monocytogenes 2000/47 counts were under the detection limits (less than 10 CFU/ml) from day 4 until the end of the experiment. Resistant mutants towards phages and coagulin C23 could be obtained, but cross-resistance was not detected. Mutants resistant to FWLLm3 and coagulin C23 were also recovered from surviving colonies after cold storage in milk which may explain the failure of this combination to inhibit L. monocytogenes. Remarkably, the fraction of resistant mutants isolated from the combined treatment was lower than that from each antimicrobial alone, suggesting that synergy between bacteriocins and phages could be due to a lower rate of resistance development and the absence of cross-resistance. Copyright © 2015 Elsevier B.V. All rights reserved.

  12. Oral immunization with recombinant listeria monocytogenes controls virus load after vaginal challenge with feline immunodeficiency virus. (United States)

    Stevens, Rosemary; Howard, Kristina E; Nordone, Sushila; Burkhard, MaryJo; Dean, Gregg A


    Recombinant Listeria monocytogenes has many attractive characteristics as a vaccine vector against human immunodeficiency virus (HIV). Wild-type and attenuated Listeria strains expressing HIV Gag have been shown to induce long-lived mucosal and systemic T-cell responses in mice. Using the feline immunodeficiency virus (FIV) model of HIV we evaluated recombinant L. monocytogenes in a challenge system. Five cats were immunized with recombinant L. monocytogenes that expresses the FIV Gag and delivers an FIV Env-expressing DNA vaccine (LMgag/pND14-Lc-env). Control cats were either sham immunized or immunized with wild-type L. monocytogenes (LM-wt). At 1 year after vaginal challenge, provirus could not be detected in any of the nine tissues evaluated from cats immunized with the recombinant bacteria but was detected in at least one tissue in 8 of 10 control animals. Virus was isolated from bone marrow of four of five LMgag/pND14-Lc-env-immunized cats by use of a stringent coculture system but required CD8(+) T-cell depletion, indicating CD8(+) T-cell suppression of virus replication. Control animals had an inverted CD4:CD8 ratio in mesenteric lymph node and were depleted of both CD4(+) and CD8(+) intestinal epithelial T cells, while LMgag/pND14-Lc-env-immunized animals showed no such abnormalities. Vaginal FIV-specific immunoglobulin A was present at high titer in three LMgag/pND14-Lc-env-immunized cats before challenge and in all five at 1 year postchallenge. This study demonstrates that recombinant L. monocytogenes conferred some control of viral load after vaginal challenge with FIV.

  13. Comparative genomics and transcriptomics of lineages I, II, and III strains of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Hain Torsten


    Full Text Available Abstract Background Listeria monocytogenes is a food-borne pathogen that causes infections with a high-mortality rate and has served as an invaluable model for intracellular parasitism. Here, we report complete genome sequences for two L. monocytogenes strains belonging to serotype 4a (L99 and 4b (CLIP80459, and transcriptomes of representative strains from lineages I, II, and III, thereby permitting in-depth comparison of genome- and transcriptome -based data from three lineages of L. monocytogenes. Lineage III, represented by the 4a L99 genome is known to contain strains less virulent for humans. Results The genome analysis of the weakly pathogenic L99 serotype 4a provides extensive evidence of virulence gene decay, including loss of several important surface proteins. The 4b CLIP80459 genome, unlike the previously sequenced 4b F2365 genome harbours an intact inlB invasion gene. These lineage I strains are characterized by the lack of prophage genes, as they share only a single prophage locus with other L. monocytogenes genomes 1/2a EGD-e and 4a L99. Comparative transcriptome analysis during intracellular growth uncovered adaptive expression level differences in lineages I, II and III of Listeria, notable amongst which was a strong intracellular induction of flagellar genes in strain 4a L99 compared to the other lineages. Furthermore, extensive differences between strains are manifest at levels of metabolic flux control and phosphorylated sugar uptake. Intriguingly, prophage gene expression was found to be a hallmark of intracellular gene expression. Deletion mutants in the single shared prophage locus of lineage II strain EGD-e 1/2a, the lma operon, revealed severe attenuation of virulence in a murine infection model. Conclusion Comparative genomics and transcriptome analysis of L. monocytogenes strains from three lineages implicate prophage genes in intracellular adaptation and indicate that gene loss and decay may have led to the emergence

  14. Listeria monocytogenes meningoencephalitis: molecular methods for diagnosis and for monitoring the response to chemotherapy

    Directory of Open Access Journals (Sweden)

    Andrea Piana


    Full Text Available

    Background. Listeria monocytogenes is one of the most important human foodborne pathogens; it may be responsible for several disorders, like meningoencephalitis. Listerial isolation in cerebrospinal fluid (CSF is often difficult using microbiologic traditional assays. The aim of this study is to evaluate the reliability of molecular techniques as an alternative tool in order to identify Listeria monocytogenes meningitis and in particular, to evaluate a real-time PCR and a conventional PCR for the target hlyA gene.

    Methods. In 2000-2004, 145 patients, without T-cell immunodeficiency, affected by meningoencephalitis of unknown origin were admitted to the Infectious Diseases Institute of Sassari, Italy; a lumbar puncture was performed at the time of hospital admission. Two different PCR techniques, i.e. RT-PCR and a conventional PCR, were performed in order to detect CNS listerial infection, in conjunction with traditional microbiologic assays.

    Results. We identified fourteen patients affected by listerial meningitis using RT-PCR and conventional PCR. All but one of the CSF cultures were negative for L. monocytogenes. Molecular techniques were performed on the CSF samples collected during follow-up revealing that signal intensity decreased by 40%, 80% and 100% at day 15, 30 and 55 respectively, from the start of antibiotic treatment.

    Conclusions. Considering the seriousness of CNS involvement caused by L. monocytogenes infection, prompt diagnosis is necessary in order to rapidly start specific treatment. Conventional PCR and RT-PCR are rapid assays for L. monocytogenes diagnosis and they might be useful for monitoring the efficacy of antibiotic therapy

  15. Effect of eugenol on growth and listeriolysin o production by Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Cristina Tostes Filgueiras


    Full Text Available The inhibitory effect of eugenol, a naturally occurring compound mainly present in the essential oil fraction of cloves, was studied on the growth and listeriolysin O (LLO production by Listeria monocytogenes. Potassium efflux from cells promoted by eugenol was also determined after 24 h incubation in phosphate buffered saline. Eugenol promoted a delay on the growth of L. monocytogenes at concentrations of 100, 300 and 500 µg mL-1and above 800 µg mL-1 the effect was bactericidal. Production of LLO by L. monocytogenes in the presence of eugenol was reduced 80-100%. An accumulation of external K+ was observed above 300 µg mL-1 of eugenol which indicated that the cell membrane was affected. The results showed the effectiveness of eugenol in controlling growth and LLO production of L. monocytogenes cells.O efeito inibitório do eugenol, o principal constituinte do óleo essencial de cravo, foi avaliado sobre o crescimento e produção de listeriolisina O (LLO por Listeria monocytogenes. O efluxo de íons potássio das células também foi determinado após 24 h de incubação em solução tampão, contendo eugenol. Concentrações de 100, 300 e 500 µg mL-1 de eugenol promoveram a inibição do crescimento de L. monocytogenes e, em concentrações acima de 800 µg mL-1, constatou-se um efeito bactericida. O crescimento de L. monocytogenes na presença de eugenol resultou na inibição de 80 a 100% da produção de LLO. O efluxo de K+ promovido pelo eugenol indicou que a membrana celular foi afetada. Estes resultados indicam a efetividade do eugenol para o controle do crescimento e da produção de LLO por L. monocytogenes.



    M. Barile; A. Mormile; R Mercogliano; N. Murru


    Listeria monocytogenes is the causative agent of listeriosis typically caused by ready-to-eat processed food that have a refrigerated shelf-life, but lightly preserved fish products also belong to a high-risk category. Aim of the work was to evaluate antimicrobial activity linked bacteriocin-producing of LAB isolated from gilthead breams and sea basses fillets packaged in modified atmospheres. Fifty-five LAB strains were screened against 21 strains of Listeria monocytogenes, 1 Listeria innocu...

  17. Listeria monocytogenes meningitis in an immunocompetent 18-year old patient as a possible diagnostic and therapeutical problem

    Directory of Open Access Journals (Sweden)

    Vrbić Miodrag


    Full Text Available Introduction. Listeria monocytogenes is the third most frequent cause of bacterial meningitis in adults. It commonly affects persons with defective cell-mediated immunity or advanced age, and only a few patients with no underlying predisposition have been reported. Case report. We presented an previously healthy, 18-year-old man with typical clinical features of meningitis. On the account of earlier treatment with ceftriaxone and cerebrospinal fluid finding, an assumption of partially treated bacterial meningitis was made. The initial treatment with vancomycin and ceftriaxone, substituted on day 4 with meropenem, did not produce any clinical effect. On day 6 Listeria monocytogenes was isolated and, even as late as that, the administration of ampicillin was followed by complete recovery of the patient. Conclusion. In younger, immunocompetent individuals, in spite of the existent diagnostic and therapeutic problems, the subacute course of Listeria monocytogenes meningitis provides enough time for appropriate treatment and favorable disease outcome.

  18. Leucocins 4010 from Leuconostoc carnosum cause a matrix related decrease in intracellular pH of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Fang, Weihuan; Budde, Birgitte Bjørn; Siegumfeldt, Henrik


    A mixed culture of single cells of Listeria monocytogenes and the bacteriocin producing Leuconostoc carnosum 4010 showed growth inhibition of L. monocytogenes, although the intracellular pH (pHi) of L. monocytogenes followed by fluorescence ratio imaging microscopy was not affected. Furthermore, L...

  19. Single cell swimming dynamics of Listeria monocytogenes using a nanoporous microfluidic platform

    Energy Technology Data Exchange (ETDEWEB)

    Wright, Evan [University of Guelph, Canada; Neethirajan, Suresh [University of Guelph; Warriner, Keith [University of Guelph; Retterer, Scott T [ORNL; Srijanto, Bernadeta R [ORNL


    Listeria monocytogenes remains a significant foodborne pathogen due to its virulence and ability to become established in food processing facilities. The pathogen is characterized by its ability to grow over a wide temperature range and withstand a broad range of stresses. The following reports on the chemotaxis and motility of the L. monocytogenes when exposed to relatively small concentrations of acetic acid. Using the developed nanoporous microfluidic device to precisely modulate the cellular environment, we exposed the individual Listeria cells to acetic acid and, in real time and with high resolution, observed how the cells reacted to the change in their surroundings. Our results showed that concentrations of acetic acid below 10 mM had very little, if any, effect on the motility. However, when exposed to 100 mM acetic acid, the cells exhibited a sharp drop in velocity and displayed a more random pattern of motion. These results indicate that at appropriate concentrations, acetic acid has the ability to disable the flagellum of the cells, thus impairing their motility. This drop in motility has numerous effects on the cell; its main effects being the obstruction of the cell's ability to properly form biofilms and a reduction in the overall infectivity of the cells. Since these characteristics are especially useful in controlling the proliferation of L. monocytogenes, acetic acid shows potential for application in the food industry as an active compound in designing a food packaging environment and as an antimicrobial agent.

  20. Mechanism involved in phagocytosis and killing of Listeria monocytogenes by Acanthamoeba polyphaga. (United States)

    Akya, Alisha; Pointon, Andrew; Thomas, Connor


    Intra-cellular pathogen, Listeria monocytogenes, is capable of invasion and survival within mammalian cells. However, Acanthamoeba polyphaga trophozoites phagocytose and rapidly degrade Listeria cells. In order to provide more information on amoeba phagocytosis and killing mechanisms, this study used several inhibitor agents known to affect the phagocytosis and killing of bacteria by eukaryotes. Amoebae were pre-treated with mannose, cytochalasin D, wortmannin, suramin, ammonium chloride, bafilomycin A and monensin followed by co-culture with bacteria. Phagocytosis and killing of bacterial cells by amoeba trophozoites was assessed using plate counting methods and microscopy. The data presented indicates that actin polymerisation and cytoskeletal rearrangement are involved in phagocytosis of L. monocytogenes cells by A. polyphaga trophozoites. Further, both phagosomal acidification and phagosome-lysosome fusion are involved in killing and degradation of L. monocytogenes cells by A. polyphaga. However, the mannose-binding protein receptor does not play an important role in uptake of bacteria by amoeba trophozoites. In conclusion, this data reveals the similar principles of molecular mechanisms used by different types of eukaryotes in uptake and killing of bacteria.

  1. Evaluation of the antibacterial activity of bergamot essential oils on different Listeria monocytogenes strains

    Directory of Open Access Journals (Sweden)

    Stefania M. Marotta


    Full Text Available Essential oils are aromatic and volatile substances extracted from plants and characterized by antimicrobial activity. The aim of the present study was to evaluate the antibacterial activity (agar disc-diffusion method of seven different bergamot essential oils (BEOs on eight Listeria monocytogenes strains. Minimal inhibitory concentration (MIC of most efficient BEOs was estimated. Extremely variable results for agar disc-diffusion method for L. monocytogenes strains were reported. One of the tested microorganisms resulted insensible to all the BEOs; 3 strains showed an inhibition from weak to null and the remaining 4 a variable susceptibility. Among the BEOs tested, one showed a strong activity against four pathogenic strains. Four BEOs revealed weak, moderate or null activity in all the 7 sensitive strains, while for two oils only a weak or no activity was reported. MIC values were 0.625 μL/mL for the most efficient BEO, 2.5 and 5 μL/mL for the other samples that showed moderate inhibition. Experiment results are significantly related to the strains tested (P<0.01, rather than the BEO employed (P>0.01. In conclusion, we can consider BEO as a natural technological hurdle for Listeria monocytogenes in combination with other preservation strategies. Finally, this study underlines the necessity to evaluate the antimicrobial activity of EOs on a significant strains number of the same bacteria.

  2. Evaluation of the Antibacterial Activity of Bergamot Essential Oils on Different Listeria Monocytogenes Strains. (United States)

    Marotta, Stefania M; Giarratana, Filippo; Parco, Alessio; Neri, Domenico; Ziino, Graziella; Giuffrida, Alessandro; Panebianco, Antonio


    Essential oils are aromatic and volatile substances extracted from plants and characterized by antimicrobial activity. The aim of the present study was to evaluate the antibacterial activity (agar disc-diffusion method) of seven different bergamot essential oils (BEOs) on eight Listeria monocytogenes strains. Minimal inhibitory concentration (MIC) of most efficient BEOs was estimated. Extremely variable results for agar disc-diffusion method for L. monocytogenes strains were reported. One of the tested microorganisms resulted insensible to all the BEOs; 3 strains showed an inhibition from weak to null and the remaining 4 a variable susceptibility. Among the BEOs tested, one showed a strong activity against four pathogenic strains. Four BEOs revealed weak, moderate or null activity in all the 7 sensitive strains, while for two oils only a weak or no activity was reported. MIC values were 0.625 μL/mL for the most efficient BEO, 2.5 and 5 μL/mL for the other samples that showed moderate inhibition. Experiment results are significantly related to the strains tested (P0.01). In conclusion, we can consider BEO as a natural technological hurdle for Listeria monocytogenes in combination with other preservation strategies. Finally, this study underlines the necessity to evaluate the antimicrobial activity of EOs on a significant strains number of the same bacteria.

  3. An Internalin A Probe-Based Genosensor for Listeria monocytogenes Detection and Differentiation

    Directory of Open Access Journals (Sweden)

    Laura Bifulco


    Full Text Available Internalin A (InlA, a protein required for Listeria monocytogenes virulence, is encoded by the inlA gene, which is only found in pathogenic strains of this genus. One of the best ways to detect and confirm the pathogenicity of the strain is the detection of one of the virulence factors produced by the microorganism. This paper focuses on the design of an electrochemical genosensor used to detect the inlA gene in Listeria strains without labelling the target DNA. The electrochemical sensor was obtained by immobilising an inlA gene probe (single-stranded oligonucleotide on the surfaces of screen-printed gold electrodes (Au-SPEs by means of a mercaptan-activated self-assembled monolayer (SAM. The hybridisation reaction occurring on the electrode surface was electrochemically transduced by differential pulse voltammetry (DPV using methylene blue (MB as an indicator. The covalently immobilised single-stranded DNA was able to selectively hybridise to its complementary DNA sequences in solution to form double-stranded DNA on the gold surface. A significant decrease of the peak current of the voltammogram (DPV upon hybridisation of immobilised ssDNA was recorded. Whole DNA samples of L. monocytogenes strains could be discriminated from other nonpathogenic Listeria species DNA with the inlA gene DNA probe genosensor.

  4. Differentiation of different mixed Listeria strains and also acid-injured, heat-injured, and repaired cells of Listeria monocytogenes using fourier transform infrared spectroscopy. (United States)

    Nyarko, Esmond; Donnelly, Catherine


    Fourier transform infrared (FT-IR) spectroscopy was used to differentiate mixed strains of Listeria monocytogenes and mixed strains of L. monocytogenes and Listeria innocua. FT-IR spectroscopy was also applied to investigate the hypothesis that heat-injured and acid-injured cells would return to their original physiological integrity following repair. Thin smears of cells on infrared slides were prepared from cultures for mixed strains of L. monocytogenes, mixed strains of L. monocytogenes and L. innocua, and each individual strain. Heat-injured and acid-injured cells were prepared by exposing harvested cells of L. monocytogenes strain R2-764 to a temperature of 56 ± 0.2°C for 10 min or lactic acid at pH 3 for 60 min, respectively. Cellular repair involved incubating aliquots of acid-injured and heat-injured cells separately in Trypticase soy broth supplemented with 0.6% yeast extract for 22 to 24 h; bacterial thin smears on infrared slides were prepared for each treatment. Spectral collection was done using 250 scans at a resolution of 4 cm(-1) in the mid-infrared wavelength region. Application of multivariate discriminant analysis to the wavelength region from 1,800 to 900 cm(-1) separated the individual L. monocytogenes strains. Mixed strains of L. monocytogenes and L. monocytogenes cocultured with L. innocua were successfully differentiated from the individual strains when the discriminant analysis was applied. Different mixed strains of L. monocytogenes were also successfully separated when the discriminant analysis was applied. A data set for injury and repair analysis resulted in the separation of acid-injured, heat-injured, and intact cells; repaired cells clustered closer to intact cells when the discriminant analysis (1,800 to 600 cm(-1)) was applied. FT-IR spectroscopy can be used for the rapid source tracking of L. monocytogenes strains because it can differentiate between different mixed strains and individual strains of the pathogen.

  5. Control of Listeria monocytogenes in food production plants

    Directory of Open Access Journals (Sweden)

    Dimitrijević Mirjana


    Full Text Available L. monocytogenes has been established in different plants for the production of food, including dairy plants, abattoirs, plants for the processing of fish, as well as those for the production of ready-to-eat (RTE food and this fact is being considered as the primary mechanism of food contamination with this bacteria. There is also the factor of numerous and diverse contaminated production equipment, because it has certain parts that are inaccessible for the necessary cleaning and disinfection. The temperature, position, as well as the material of the work surface are also linked to the contamination of plants with this bacteria. Investigations carried out so far have helped toward the better understanding of the manner and time of contamination of food items in the course of the production process, but there are still unresolved problems, including most certainly the biggest one - the adherence of bacteria and the creation of a biofilm, when the bacteria is in that condition more resistant to so-called stress factors which are usually used in the food industry for the purpose of decontamination of the surfaces with which foods come into contact. The control of L. monocytogenes in food production plants is possible primarily by using an integrated programme, compatible with the systems Hazard Analysis Critical Control Point (HACCP and Good Hygiene Practice (GHP, necessary in the production of food that is safe for the consumer. Essentially, the control measures that can contribute to reducing the incidence of findings of L.monocytogenes in the finished product, as well as the reducing of the level of contamination with this bacteria are linked, on the one hand, with hygiene procedures in the production process, and, on the other, with the applied technological procedures.

  6. Phylogenetic analysis of the Listeria monocytogenes based on sequencing of 16S rRNA and hlyA genes. (United States)

    Soni, Dharmendra Kumar; Dubey, Suresh Kumar


    The discrimination between Listeria monocytogenes and Listeria species has been detected. The 16S rRNA and hlyA were PCR amplified with set of oligonucleotide primers with flank 1,500 and 456 bp fragments, respectively. Based on the differences in 16S rRNA and hlyA genes, a total 80 isolates from different environmental, food and clinical samples confirmed it to be L. monocytogenes. The 16S rRNA sequence similarity suggested that the isolates were similar to the previously reported ones from different habitats by others. The phylogenetic interrelationships of the genus Listeria were investigated by sequencing of 16S rRNA and hlyA gene. The 16S rRNA sequence indicated that genus Listeria is comprised of following closely related but distinct lines of descent, one is the L. monocytogenes species group (including L. innocua, L. ivanovii, L. seeligeri and L. welshimeri) and other, the species L. grayi, L. rocourtiae and L. fleischmannii. The phylogenetic tree based on hlyA gene sequence clearly differentiates between the L. monocytogenes, L. ivanovii and L. seeligeri. In the present study, we identified 80 isolates of L. monocytogenes originating from different clinical, food and environmental samples based on 16S rRNA and hlyA gene sequence similarity.

  7. Evidence that PrfA, the pleiotropic activator of virulence genes in Listeria monocytogenes, can be present but inactive.


    Renzoni, A; Klarsfeld, A; Dramsi, S.; Cossart, P


    All virulence genes of Listeria monocytogenes identified to date are positively regulated by PrfA, a transcriptional activator belonging to the Crp-Fnr family. Low temperature and cellobiose are two environmental signals known to repress expression of virulence genes in L. monocytogenes. In the present work, we analyzed the effect of temperature and cellobiose on the expression of the PrfA protein. At low temperature, PrfA was undetected, although prfA monocistronic transcripts are present. I...

  8. Listeria monocytogenes meningitis in an elderly, alcoholic male

    Directory of Open Access Journals (Sweden)

    Meena Dias


    Full Text Available Listeriosis is a zoonotic infection seen normally in herd animals. Humans can be infected by consumption of raw meat, fish, milk, vegetables or canned refrigerated foods. There are many reports of listeriosis in pregnant females, neonates and immune-compromised individuals. However, due to limited clinical suspicion in India, only a few cases has been reported, most of them in neonates. We report here a case of Listeria meningitis in an elderly alcoholic male who was treated successfully with ampicillin and vancomycin.

  9. Inactivation of Listeria monocytogenes on hams shortly after vacuum packaging by spray application of lauric arginate. (United States)

    Taormina, P J; Dorsa, W J


    This study measured and compared the short-term efficacy levels of lauric arginate (LAE) as a postlethality treatment against Listeria monocytogenes present on varied surfaces of large-diameter hams. Preliminary in vitro work demonstrated a 5-log inactivation of L. monocytogenes in 5,000- and 9,090-ppm LAE solutions within 180 min at 4.4 and 23 degrees C. Six different whole-muscle ham types were inoculated with L. monocytogenes at ca. 7-log CFU per ham and spray treated with between 15 and 29 ml of a 9,090-ppm LAE solution, or an equal volume of water (control), prior to vacuum packaging. After 48 h at 4.4 degrees C, populations were recovered from ham and interior packaging surfaces by using a surface rinse method with Dey-Engley neutralizing broth followed by plating on modified Oxford medium. Logarithmic reductions of L. monocytogenes exceeding 2 log CFU/cm(2) of ham surfaces were achieved by LAE treatment on all ham types. Hams with 1,129 cm(2) of surface area that had been processed by drenching in liquid smoke had 3.84 and 2.67 CFU/cm(2) 48 h following treatment with 18 ml of water or LAE, respectively, but increasing treatment volumes to 22 ml significantly reduced (P < 0.05) L. monocytogenes levels to 0.65 log CFU/cm(2). This study demonstrated the efficacy of LAE against L. monocytogenes on several ham types, thereby validating it as a postlethality treatment for inactivation of the pathogen.

  10. Inhibition of Listeria monocytogenes and Salmonella by combinations of oriental mustard, malic acid, and EDTA. (United States)

    Olaimat, Amin N; Holley, Richard A


    The antimicrobial activities of oriental mustard extract alone or combined with malic acid and EDTA were investigated against Salmonella spp. or Listeria monocytogenes at different temperatures. Five strain Salmonella or L. monocytogenes cocktails were separately inoculated in Brain Heart Infusion broth containing 0.5% (w/v) aqueous oriental mustard extract and incubated at 4 °C to 21 °C for 21 d. For inhibitor combination tests, Salmonella Typhimurium 02:8423 and L. monocytogenes 2-243 were individually inoculated in Mueller Hinton broth containing the mustard extract with either or both 0.2% (w/v) malic acid and 0.2% (w/v) EDTA and incubated at 10 °C or 21 °C for 10 to 14 d. Mustard extract inhibited growth of the L. monocytogenes cocktail at 4 °C up to 21 d (2.3 log10 CFU/mL inhibition) or at 10 °C for 7 d (2.4 log10 CFU/mL inhibition). Salmonella spp. viability was slightly, but significantly reduced by mustard extract at 4 °C by 21 d. Although hydrolysis of sinigrin in mustard extract by both pathogens was 2 to 6 times higher at 21 °C than at 4 °C to 10 °C, mustard was not inhibitory at 21 °C, perhaps because of the instability of its hydrolysis product (allyl isothiocyanate). At 21 °C, additive inhibitory effects of mustard extract with EDTA or malic acid led to undetectable levels of S. Typhimurium and L. monocytogenes by 7 d and 10 d, respectively. At 10 °C, S. Typhimurium was similarly susceptible, but combinations of antimicrobials were not more inhibitory to L. monocytogenes than the individual agents.

  11. PCR experion automated electrophoresis system to detect Listeria monocytogenes in foods. (United States)

    Delibato, Elisabetta; Gattuso, Antonietta; Minucci, Angelo; Auricchio, Bruna; De Medici, Dario; Toti, Laura; Castagnola, Massimo; Capoluongo, Ettore; Gianfranceschi, Monica Virginia


    Listeria monocytogenes is frequently found as a contaminant in raw and ready-to-eat foods. The ability of L. monocytogenes to multiply at refrigeration temperatures and to grow in a wide range of pH values is of particular concern for food safety. According to the European Union regulation on microbiological criteria for foodstuffs, L. monocytogenes must be absent in some categories of ready-to-eat foods. The standard microbiological method for L. monocytogenes detection in foods (ISO 11290-1: 1996 (ISO, International Organization for Standardization)) is cost and time consuming. Developments of rapid, cost-effective and automated diagnostic methods to detect food-borne pathogens in foods continue to be a major concern for the industry and public health. The aim of this study was the development of a rapid, sensitive and specific molecular detection method for L. monocytogenes. To this purpose, we have applied a capillary electrophoresis method to a PCR protocol (PCR-EES (EES, experion automated electrophoresis system)) for detecting L. monocytogenes in food. In particular, a microfluidic chip-based automated electrophoresis system (experion automated electrophoresis system, Bio-Rad Laboratories, USA) was used for the rapid and automatic analysis of the amplicons. Fifty naturally contaminated samples were analysed with this method and the results were compared with those obtained with ISO method. Moreover, the microfluidic chip-based automated electrophoresis system was compared with classical gel electrophoresis (PCR-CGE). The results showed that after 24 h of culture enrichment, the PCR-EES showed a relative accuracy of 100% with ISO, while using PCR-CGE decreased it down to 96%. After 48 h of enrichment, both PCR-EES and PCR-CGE showed an accuracy of 100% with ISO.

  12. Inhibition of Listeria monocytogenes by propionic acid-based ingredients in cured deli-style Turkey. (United States)

    Glass, Kathleen A; McDonnell, Lindsey M; Von Tayson, Roxanne; Wanless, Brandon; Badvela, Mani


    Listeria monocytogenes growth can be controlled on ready-to-eat meats through the incorporation of antimicrobial ingredients into the formulation or by postlethality kill steps. However, alternate approaches are needed to provide options that reduce sodium content but maintain protection against pathogen growth in meats after slicing. The objective of this study was to determine the inhibition of L. monocytogenes by propionic acid-based ingredients in high-moisture, cured turkey stored at 4 or 7°C. Six formulations of sliced, cured (120 ppm of NaNO2 ), deli-style turkey were tested, including control without antimicrobials, 3.2% lactate-diacetate blend (LD), 0.4% of a liquid propionate-benzoate-containing ingredient, or 0.3, 0.4, and 0.5% of a liquid propionate-containing ingredient. Products were inoculated with 5 log CFU L. monocytogenes per 100-g package (3 log CFU/ml rinsate), vacuum-sealed, and stored at 4 or 7°C for up to 12 weeks; and populations were enumerated by plating on modified Oxford agar. As expected, the control without antimicrobials supported rapid growth, with >2 log average per ml rinsate increase within 4 weeks of storage at 4°C, whereas growth was observed at 6 weeks for the LD treatment. For both replicate trials, all treatments that contained liquid propionate or propionate-benzoate limited L. monocytogenes growth to an increase of 1-log increase) was observed in individual samples for all propionate-containing treatments at weeks 10, 11, and 12. As expected, L. monocytogenes grew more rapidly when products were stored at 7°C, but trends in relative inhibition were similar to those observed at 4°C. These results verify that propionate-based ingredients inhibit growth of L. monocytogenes on sliced, high-moisture, cured turkey and can be considered as an alternative to reduce sodium-based salts while maintaining food safety.

  13. Inactivation of Listeria monocytogenes on Frozen Red Raspberries by Using UV-C Light. (United States)

    Liao, Yen-Te; Syamaladevi, Roopesh M; Zhang, Hongchao; Killinger, Karen; Sablani, Shyam


    In this study, the efficacy of UV-C treatment was determined on the reduction of foodborne pathogens on artificially contaminated frozen food surfaces. At first, the UV-C inactivation rates on 100 μl of the respective cocktails of Escherichia coli O157:H7, Salmonella , and Listeria monocytogenes covered underneath 0.5-cm-thick ice were examined. Simultaneously, the energy percentage of UV-C transmitted through the ice was determined. The experiments showed that more than 65% of the UV-C light energy passed through the ice and that UV-C susceptibility was in the descending order of E. coli O157:H7, Salmonella , and L. monocytogenes . L. monocytogenes , the most UV-C-resistant strain, was then selected to test on frozen raspberries. The UV-C inactivation kinetic data of L. monocytogenes were well described using the Weibull equation. During 720 s of UV-C exposure, with a total dose of 7.8 × 10(2) mJ/cm(2), a 1.5-log CFU/g reduction of L. monocytogenes population on the surface of frozen red raspberries was noted. No significant differences in total anthocyanins, total phenolics, and total antioxidant activity were observed between UV-C-treated and untreated frozen berries immediately after treatment. At the end of 9 months of storage at -35°C, UV-C-treated berries had statistically lower total phenolics, higher total anthocyanins, and similar total antioxidant activity compared with untreated berries. This study shows that UV-C light can be used to reduce the L. monocytogenes population on frozen raspberries.

  14. Fat content increases the lethality of ultra-high-pressure homogenization on Listeria monocytogenes in milk. (United States)

    Roig-Sagués, A X; Velázquez, R M; Montealegre-Agramont, P; López-Pedemonte, T J; Briñez-Zambrano, W J; Guamis-López, B; Hernandez-Herrero, M M


    Listeria monocytogenes CCUG 15526 was inoculated at a concentration of approximately 7.0 log(10) cfu/mL in milk samples with 0.3, 3.6, 10, and 15% fat contents. Milk samples with 0.3 and 3.6% fat content were also inoculated with a lower load of approximately 3.0 log(10) cfu/mL. Inoculated milk samples were subjected to a single cycle of ultra-high-pressure homogenization (UHPH) treatment at 200, 300, and 400 MPa. Microbiological analyses were performed 2 h after the UHPH treatments and after 5, 8, and 15 d of storage at 4 degrees C. Maximum lethality values were observed in samples treated at 400 MPa with 15 and 10% fat (7.95 and 7.46 log(10) cfu/mL), respectively. However, in skimmed and 3.6% fat milk samples, complete inactivation was not achieved and, during the subsequent 15 d of storage at 4 degrees C, L. monocytogenes was able to recover and replicate until achieving initial counts. In milk samples with 10 and 15% fat, L. monocytogenes recovered to the level of initial counts only in the milk samples treated at 200 MPa but not in the milk samples treated at 300 and 400 MPa. When the load of L. monocytogenes was approximately 3.0 log(10) cfu/mL in milk samples with 0.3 and 3.6% fat, complete inactivation was not achieved and L. monocytogenes was able to recover and grow during the subsequent cold storage. Fat content increased the maximum temperature reached during UHPH treatment; this could have contributed to the lethal effect achieved, but the amount of fat of the milk had a stronger effect than the temperature on obtaining a higher death rate of L. monocytogenes.

  15. Molecular Serotyping and Pathogenic Potential of Listeria monocytogenes Isolated from Milk and Milk Products in Tamil Nadu, India. (United States)

    Karthikeyan, Raman; Gunasekaran, Paramasamy; Rajendhran, Jeyaprakash


    Listeria monocytogenes, an important bacterial pathogen, is responsible for foodborne illnesses worldwide. Examination of food samples for the presence of L. monocytogenes and assessment of their pathogenicity is usually an effective strategy in the prevention of listeriosis. In the present study, we have tested 307 samples of milk and milk products from various places in Tamil Nadu, India for the presence of L. monocytogenes using ISO 11290 and U.S. Food and Drug Administration Bacteriological Analytical Manual methods. 16S rDNA sequencing and duplex polymerase chain reaction (PCR) analysis for prs and iap genes were used to identify L. monocytogenes at the species level. Fifteen of the 307 samples screen tested positive for L. monocytogenes. Molecular serotyping of the L. monocytogenes isolates by multiplex PCR revealed the predominance of the serogroups 1/2a and 4b. Fourteen of the 15 isolates contained all the virulence genes (inlA, inlB, hlyA, and plcA) screened for using multiplex PCR. Only one isolate of L. monocytogenes was negative for the plcA gene and in vitro phosphatidylinositol-phospholipase C activity. L. monocytogenes strains that belong to the serogroup 4b exhibited higher nematocidal activity against Caenorhabditis elegans than the serogroup 1/2a. Worms infected with L. monocytogenes were symptomatic with aberrant contraction of body muscles, loss of pharyngeal pumping, and decreased locomotion, which highlights the pathogenic potential of the L. monocytogenes isolates.

  16. Influence of sublethal concentrations of common disinfectants on expression of virulence genes in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Larsen, M. H.; Gram, Lone


    Listeria monocytogenes is a food-borne human pathogen that causes listeriosis, a relatively rare infection with a high fatality rate. The regulation of virulence gene expression is influenced by several environmental factors, and the aim of the present study was to determine how disinfectants used...... routinely in the food industry affect the expression of different virulence genes in L. monocytogenes when added at sublethal concentrations. An agar-based assay was developed to screen the effect of disinfectants on virulence gene promoter expression and was validated at the transcriptional level...... by Northern blot analysis. Eleven disinfectants representing four different groups of active components were evaluated in this study. Disinfectants with the same active ingredients had a similar effect on gene expression. Peroxy and chlorine compounds reduced the expression of the virulence genes...

  17. Characterization of the interaction between the human pathogen Listeria monocytogenes and the model host C. elegans

    DEFF Research Database (Denmark)

    Simonsen, Karina Trankjær; Nielsen, Jesper Sejrup; Thomsen, Line E.;

    . elegans. Finally, we have developed a liquid based killing assay which enables us to set up a high-throughput screening system for the identification of L. monocytogenes virulence genes required for host-pathogen interactions.     References:   [1]: Kurz, C. L., and Ewbank, J. J. (2007) Curr Opin....... In addition, C. elegans is a promising model for the identification of novel virulence factors in various pathogens. A large number of human, animal, plant and insect pathogens have been shown to kill the worm, when C. elegans was allowed to feed on pathogens in stead of its normal laboratory diet [1......, which has been shown to kill C. elegans through the production of a toxic secondary metabolite [3] and Staphylococcus aureus, which establishes a persistent infection in the gut of the worm, leading to its death [4].   Recently, the facultative intracellular human pathogen Listeria monocytogenes has...

  18. Two-dimensional fluorescence difference gel electrophoresis analysis of Listeria monocytogenes submitted to a redox shock. (United States)

    Ignatova, Maria; Guével, Blandine; Com, Emmanuelle; Haddad, Nabila; Rossero, Albert; Bogard, Philippe; Prévost, Hervé; Guillou, Sandrine


    The influence of redox alteration on the growth and proteomic pattern of Listeria monocytogenes was investigated. A redox shock was induced in cultures by addition of 3mM ferricyanide (FeCN) and 6mM dithiothreitol (DTT) to increase or to decrease respectively the redox potential naturally occurring at the beginning of growth. In both conditions, the reducing and oxidizing redox shock had a strong influence, decreasing the maximum growth rate by half compared to a control culture. The proteomic analysis of L. monocytogenes performed by two-dimensional difference gel electrophoresis (2D-DIGE) exhibited twenty-three proteins differentially expressed (P<0.05), among these, many were oxidoreductases, and proteins involved in cellular metabolism (glycolysis, protein synthesis), detoxification (kat) or adhesion (Lmo1634).

  19. Adhesion of Salmonella Enteritidis and Listeria monocytogenes on stainless steel welds. (United States)

    Casarin, Letícia Sopeña; Brandelli, Adriano; de Oliveira Casarin, Fabrício; Soave, Paulo Azevedo; Wanke, Cesar Henrique; Tondo, Eduardo Cesar


    Pathogenic microorganisms are able to adhere on equipment surfaces, being possible to contaminate food during processing. Salmonella spp. and Listeria monocytogenes are important pathogens that can be transmitted by food, causing severe foodborne diseases. Most surfaces of food processing industry are made of stainless steel joined by welds. However currently, there are few studies evaluating the influence of welds in the microorganism's adhesion. Therefore the purpose of the present study was to investigate the adhesion of Salmonella Enteritidis and L. monocytogenes on surface of metal inert gas (MIG), and tungsten inert gas (TIG) welding, as well as to evaluate the cell and surface hydrophobicities. Results demonstrated that both bacteria adhered to the surface of welds and stainless steel at same levels. Despite this, bacteria and surfaces demonstrated different levels of hydrophobicity/hydrophilicity, results indicated that there was no correlation between adhesion to welds and stainless steel and the hydrophobicity.

  20. Listeria monocytogenes that lyse in the macrophage cytosol trigger AIM2-mediated pyroptosis (United States)

    Sauer, John-Demian; Witte, Chelsea E.; Zemansky, Jason; Hanson, Bill; Lauer, Peter; Portnoy, Daniel A.


    Summary To gain insight into the mechanisms by which host cells detect cytosolic invasion by intracellular pathogens, a genetic screen was performed to identify Listeria monocytogenes mutants that induced altered levels of host cell death. A mutation in lmo2473 resulted in hyper-stimulation of host cell death and IL-1β secretion (pyroptosis) following bacteriolysis in the macrophage cytosol. In addition, strains engineered to lyse in the cytosol by expression of both bacteriophage holin and lysin or induced to lyse by treatment with ampicillin stimulated pyroptosis. Pyroptosis was independent of the Nlrp3 and Nlrc4 receptors, but dependent on ASC and AIM2. Importantly, wild type L. monocytogenes were also found to lyse, albeit at low levels, and trigger AIM2-dependent pyroptosis. Since AIM2 is activated by DNA, these data suggested that pyroptosis is triggered by bacterial DNA released during lysis. PMID:20417169

  1. Triclosan-Induced Aminoglycoside-Tolerant Listeria monocytogenes Isolates Can Appear as Small-Colony Variants

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Hein-Kristensen, Line; Gram, Lone


    Exposure of the human food-borne pathogen Listeria monocytogenes to sublethal concentrations of triclosan can cause resistance to several aminoglycosides. Aminoglycoside-resistant isolates exhibit two colony morphologies: normal-size and pinpoint colonies. The purposes of the present study were...... to characterize the small colonies of L. monocytogenes and to determine if specific genetic changes could explain the triclosan-induced aminoglycoside resistance in both pinpoint and normal-size isolates. Isolates from the pinpoint colonies grew poorly under aerated conditions, but growth was restored by addition......, and addition of heme caused the pinpoint isolates to revert to normal colony size. Triclosan-induced gentamicin-resistant isolates had mutations in several different genes, and it cannot be directly concluded how the different mutations caused gentamicin resistance. However, since many of the mutations...

  2. Antibiotic susceptibility in benzalkonium chloride-resistant and -susceptible Listeria monocytogenes strains. (United States)

    Ortiz, Sagrario; López, Pilar; López, Victoria; Martínez-Suárez, Joaquín V


    This study aimed to investigate whether Listeria monocytogenes strains with resistance to a commonly used biocide display any cross-resistance to antibiotics. Using pulsed-field gel electrophoresis (PFGE), 29 different PFGE types were previously identified in an Iberian pig abattoir and processing plant. Only three PFGE types were resistant to benzalkonium chloride (BAC), but they represented a significant proportion of the PFGE types surviving in the plant after 4 years. In the present study, a subset of 29 strains, representing the 29 different PFGE types, underwent antibiotic susceptibility testing. Antibiotic susceptibility was assessed by Etest, utilizing 12 commonly prescribed antibiotics. All of the 29 strains were susceptible to all of the antibiotics tested. The study revealed that this group of different PFGE types of L. monocytogenes, including those resistant to BAC, possesses uniform sensitivity to antibiotics.

  3. Effect of monolaurin and lactic acid on Listeria monocytogenes attached to catfish fillets. (United States)

    Verhaegh, E G; Marshall, D L; Oh, D H


    The purpose of this study was to determine the effects of monolaurin and lactic acid, singly or combined, on Listeria monocytogenes attached to catfish fillets. Skinless catfish fillets were inoculated with L. monocytogenes and dip treated in monolaurin and/or lactic acid solution for various time periods. Results showed that monolaurin up to 400 micrograms/ml had no influence on counts. Conversely, lactic acid-treated fillets had reduced counts compared to controls. Dipping in 0.85, 1.70, or 2.55% lactic acid for 30 min reduced counts by 0.9, 1.4, or 1.3 logs, respectively. Extending the dipping time to 60 min resulted in little additional decrease in counts. Combining monolaurin with lactic acid yielded results similar to lactic acid alone. Hence, population reduction ability resides with lactic acid and not monolaurin.

  4. Prevalence and phylogenetic characterization of Listeria monocytogenes isolated from processed meat marketed in Egypt

    Directory of Open Access Journals (Sweden)

    Yasmin Mohamed


    Full Text Available Because of its high case fatality rate, listeriosis locates among the most frequent causes of death due to food-borne illness. In this study, a total of 150 processed meat samples were collected from Giza Governorate, Egypt. Phenotypic and genotypic identification of Listeria monocytogenes was performed using PCR incorporating listeriolysin O virulence gene hlyA followed by DNA sequence analysis. L. monocytogenes was confirmed in 4% of each of beef burger, minced meat, and luncheon samples. Phylogenetic analysis showed that all the six Egyptian isolates have high homology with Colombian isolate (EF030606, except one Egyptian isolate which showed high homology with Indian isolate (EU840690. The public health significance of these pathogens as well as recommended sanitary measures were discussed.

  5. Bactericidal Antibiotics Do Not Appear To Cause Oxidative Stress in Listeria monocytogenes

    DEFF Research Database (Denmark)

    Feld, Louise; Knudsen, Gitte Maegaard; Gram, Lone


    self-destruction by internal production of hydroxyl radicals. The purpose of the present study was to determine if a similar mechanism is involved in antibiotic killing of the infectious human pathogen, Listeria monocytogenes. We treated wild-type L. monocytogenes and oxidative stress mutants (Δsod......Oxidative stress can be an important contributor to the lethal effect of bactericidal antibiotics in some bacteria, such as Escherichia coli and Staphylococcus aureus. Thus, despite the different target-specific actions of bactericidal antibiotics, they have a common mechanism leading to bacterial...... and Δfri) with three different bactericidal antibiotics and found no difference in killing kinetics. In contrast, wild-type E. coli and an oxidative stress mutant (ΔsodA ΔsodB) differed significantly in their sensitivity to bactericidal antibiotics. We conclude that bactericidal antibiotics did not appear...

  6. Metabolic responses of primary and transformed cells to intracellular Listeria monocytogenes.

    Directory of Open Access Journals (Sweden)

    Nadine Gillmaier

    Full Text Available The metabolic response of host cells, in particular of primary mammalian cells, to bacterial infections is poorly understood. Here, we compare the carbon metabolism of primary mouse macrophages and of established J774A.1 cells upon Listeria monocytogenes infection using (13C-labelled glucose or glutamine as carbon tracers. The (13C-profiles of protein-derived amino acids from labelled host cells and intracellular L. monocytogenes identified active metabolic pathways in the different cell types. In the primary cells, infection with live L. monocytogenes increased glycolytic activity and enhanced flux of pyruvate into the TCA cycle via pyruvate dehydrogenase and pyruvate carboxylase, while in J774A.1 cells the already high glycolytic and glutaminolytic activities hardly changed upon infection. The carbon metabolism of intracellular L. monocytogenes was similar in both host cells. Taken together, the data suggest that efficient listerial replication in the cytosol of the host cells mainly depends on the glycolytic activity of the hosts.

  7. Modelling the growth of Listeria monocytogenes in fresh green coconut (Cocos nucifera L.) water. (United States)

    Walter, Eduardo H M; Kabuki, Dirce Y; Esper, Luciana M R; Sant'Ana, Anderson S; Kuaye, Arnaldo Y


    The behaviour of Listeria monocytogenes in the fresh coconut water stored at 4 degrees C, 10 degrees C and 35 degrees C was studied. The coconut water was aseptically extracted from green coconuts (Cocos nucifera L.) and samples were inoculated in triplicate with a mixture of 5 strains of L. monocytogenes with a mean population of approximately 3 log(10) CFU/mL. The kinetic parameters of the bacteria were estimated from the Baranyi model, and compared with predictions of the Pathogen Modelling Program so as to predict its behaviour in the beverage. The results demonstrated that fresh green coconut water was a beverage propitious for the survival and growth of L. monocytogenes and that refrigeration at 10 degrees C or 4 degrees C retarded, but did not inhibit, growth of this bacterium. Temperature abuse at 35 degrees C considerably reduced the lagtimes. The study shows that L. monocytogenes growth in fresh green coconut water is controlled for several days by storage at low temperature, mainly at 4 degrees C. Thus, for risk population this product should only be drunk directly from the coconut or despite the sensorial alterations should be consumed pasteurized.

  8. Effectiveness of a bacteriophage in reducing Listeria monocytogenes on fresh-cut fruits and fruit juices. (United States)

    Oliveira, M; Viñas, I; Colàs, P; Anguera, M; Usall, J; Abadias, M


    Listeria monocytogenes is a serious foodborne pathogen and new strategies to control it in food are needed. Among them, bacteriophages hold attributes that appear to be attractive. The objective of this study was to investigate the efficacy of the bacteriophage Listex P100 to control L. monocytogenes growth on melon, pear and apple products (juices and slices) stored at 10 °C. L. monocytogenes grew well in untreated fruit slices. In juices, the pathogen grew in untreated melon, survived in untreated pear and decreased in untreated apple. Phage treatment was more effective on melon followed by pear, but no effect on apple products was observed. Reductions of about 1.50 and 1.00 log cfu plug(-1) for melon and pear slices were found, respectively. In juices, higher reductions were obtained in melon (8.00 log cfu mL(-1)) followed by pear (2.10 log cfu mL(-1)) after 8 days of storage. L. monocytogenes in apple juice was unaffected by phage treatment in which the phage decreased to almost undetectable numbers. These results highlight that Listex P100 could avoid pathogen growth on fresh-cut and in fruit juices with high pH during storage at 10 °C. The combination with other technologies may be required to improve the phage application on high acidity fruits. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Selective pharmacologic inhibition of a PASTA kinase increases Listeria monocytogenes susceptibility to β-lactam antibiotics. (United States)

    Pensinger, Daniel A; Aliota, Matthew T; Schaenzer, Adam J; Boldon, Kyle M; Ansari, Israr-ul H; Vincent, William J B; Knight, Benjamin; Reniere, Michelle L; Striker, Rob; Sauer, John-Demian


    While β-lactam antibiotics are a critical part of the antimicrobial arsenal, they are frequently compromised by various resistance mechanisms, including changes in penicillin binding proteins of the bacterial cell wall. Genetic deletion of the penicillin binding protein and serine/threonine kinase-associated protein (PASTA) kinase in methicillin-resistant Staphylococcus aureus (MRSA) has been shown to restore β-lactam susceptibility. However, the mechanism remains unclear, and whether pharmacologic inhibition would have the same effect is unknown. In this study, we found that deletion or pharmacologic inhibition of the PASTA kinase in Listeria monocytogenes by the nonselective kinase inhibitor staurosporine results in enhanced susceptibility to both aminopenicillin and cephalosporin antibiotics. Resistance to vancomycin, another class of cell wall synthesis inhibitors, or antibiotics that inhibit protein synthesis was unaffected by staurosporine treatment. Phosphorylation assays with purified kinases revealed that staurosporine selectively inhibited the PASTA kinase of L. monocytogenes (PrkA). Importantly, staurosporine did not inhibit a L. monocytogenes kinase without a PASTA domain (Lmo0618) or the PASTA kinase from MRSA (Stk1). Finally, inhibition of PrkA with a more selective kinase inhibitor, AZD5438, similarly led to sensitization of L. monocytogenes to β-lactam antibiotics. Overall, these results suggest that pharmacologic targeting of PASTA kinases can increase the efficacy of β-lactam antibiotics.

  10. Growth Potential of Listeria Monocytogenes in Sliced Turkey Bresaola Packed in Modified Atmosphere (United States)

    Cosciani-Cunico, Elena; D’Amico, Stefano; Sfameni, Chiara; Bertasi, Barbara; Losio, Marina N.; Serraino, Andrea; Daminelli, Paolo


    According to EC Regulation No 2073/2005, for food business operators that produce ready-to-eat (RTE) product, it is crucial to be able to demonstrate if the product supports the growth of Listeria monocytogenes. The objective of the study was therefore to evaluate the behaviour of L. monocytogenes in sliced RTE turkey bresaola (made by cured turkey breast 4.5% NaCl, 1% sodium lactate, sodium nitrite 150 ppm and flavouring) during the shelf life of the product, simulating a contamination during the slicing operation. Considering a shelf life of 90 days, as defined by manufacturer, the packages of sliced bresaola were stored at 5°C for 7 days and at 8°C for the remaining storage time (83 days). L. monocytogenes count decreased during storage test from 1.43/1.98 log cfu/g in the three batches tested to 1.03 log cfu/g in one batch and to undetectable levels in the other two batches. The results show that the investigated product is unable to support the growth of L. monocytogenes. PMID:27800323

  11. Efflux pump-mediated benzalkonium chloride resistance in Listeria monocytogenes isolated from retail food. (United States)

    Jiang, Xiaobing; Yu, Tao; Liang, Yu; Ji, Shengdong; Guo, Xiaowei; Ma, Jianmin; Zhou, Lijun


    In this study, efflux pump-mediated benzalkonium chloride (BC) resistance, including plasmid-encoded (Qac protein family and BcrABC) and chromosome-borne efflux pumps, was investigated in Listeria monocytogenes from retail food in China. Among the 59 L. monocytogenes strains, 13 (22.0%) strains were resistant to BC. The PCR results showed that bcrABC was harbored by 2 of 13 BC resistant strains. However, none of the qac genes were detected among the 59 strains. The bcrABC was absent in both of the plasmid cured strains, indicating that this BC resistance determinant was plasmid-encoded in the two bcrABC-positive strains. In the presence of reserpine, most of the bcrABC-negative strains had decreases in the MICs of BC, suggesting the existence of other efflux pumps and their role in BC resistance. After exposed to reserpine, the reduction in BC MICs was observed in the two cured strains, indicating that efflux pumps located on chromosome was also involved in BC resistance. Our findings suggest that food products may act as reservoirs for BC resistant isolates of L. monocytogenes and plasmid- and chromosome-encoded efflux pumps could mediate the BC resistance of L. monocytogenes, which is especially relevant to the adaption of this organism in food-related environments with frequent BC use.

  12. A novel gene, lstC, of Listeria monocytogenes is implicated in high salt tolerance. (United States)

    Burall, Laurel S; Simpson, Alexandra C; Chou, Luoth; Laksanalamai, Pongpan; Datta, Atin R


    Listeria monocytogenes, causative agent of human listeriosis, has been isolated from a wide variety of foods including deli meats, soft cheeses, cantaloupes, sprouts and canned mushrooms. Standard control measures for restricting microbial growth such as refrigeration and high salt are often inadequate as L. monocytogenes grows quite well in these environments. In an effort to better understand the genetic and physiological basis by which L. monocytogenes circumvents these controls, a transposon library of L. monocytogenes was screened for changes in their ability to grow in 7% NaCl and/ or at 5 °C. This work identified a transposon insertion upstream of an operon, here named lstABC, that led to a reduction in growth in 7% NaCl. In-frame deletion studies identified lstC which codes for a GNAT-acetyltransferase being responsible for the phenotype. Transcriptomic and RT-PCR analyses identified nine genes that were upregulated in the presence of high salt in the ΔlstC mutant. Further analysis of lstC and the genes affected by ΔlstC is needed to understand LstC's role in salt tolerance. Published by Elsevier Ltd.

  13. The human P-glycoprotein transporter enhances the type I interferon response to Listeria monocytogenes infection. (United States)

    Sigal, Nadejda; Kaplan Zeevi, Millie; Weinstein, Shiri; Peer, Dan; Herskovits, Anat A


    Human multidrug efflux transporters are known for their ability to extrude antibiotics and toxic compounds out of cells, yet accumulating data indicate they have additional functions in diverse physiological processes not related to drug efflux. Here, we show that the human multidrug transporter P-glycoprotein (P-gp) (also named MDR1 and ABCB1) is transcriptionally induced in the monocytic cell line THP-1 upon infection with the human intracellular bacterial pathogen Listeria monocytogenes. Notably, we found that P-gp is important for full activation of the type I interferon response elicited against L. monocytogenes bacteria. Both inhibition of P-gp function by verapamil and inhibition of its transcription using mRNA silencing led to a reduction in the magnitude of the type I response in infected cells. This function of P-gp was specific to type I interferon cytokines elicited against cytosolic replicating bacteria and was not observed in response to cyclic di-AMP (c-di-AMP), a molecule that was shown to be secreted by L. monocytogenes during infection and to trigger type I interferons. Moreover, P-gp was not involved in activation of other proinflammatory cytokines, such as those triggered by vacuolar-restricted L. monocytogenes or lipopolysaccharide (LPS). Taken together, these findings demonstrate a role for P-gp in proper development of an innate immune response against intracellular pathogens, highlighting the complexity in employing therapeutic strategies that involve inhibition of multidrug resistance (MDR) efflux pumps.

  14. In vitro Selection of DNA Aptamers and Fluorescence-Based Recognition for Rapid Detection Listeria monocytogenes

    Institute of Scientific and Technical Information of China (English)

    LIU Guo-qing; LIAN Ying-qi; GAO Chao; YU Xiao-feng; ZHU Ming; ZONG Kai; CHEN Xue-jiao; YAN Yi


    Aptamers are speciifc nucleic acid sequences that can bind to a wide range of nucleic acid and non-nucleic acid targets with high afifnity and speciifcity. Nucleic acid aptamers are selected in vitro from single stranded DNA or RNA ligands containing random sequences of up to a few hundred nucleotides. Systematic evolution of ligands by exponential enrichment (SELEX) was used to select and PCR amplify DNA sequences (aptamers) capable of binding to and detecting Listeria monocytogenes, one of the major food-borne pathogens. A simpliifed afifnity separation approach was employed, in which L. monocytogenes in exponential (log) phase of growth was used as the separation target. A lfuorescently-labeled aptamer assay scheme was devised for detecting L. monocytogenes. This report described a novel approach to the detection of L. monocytogenes using DNA aptamers. Aptamers were developed by nine rounds of SELEX. A high afifnity aptamer was successfully selected from the initial random DNA pool, and its secondary structure was also investigated. One of aptamers named e01 with the highest afifnity was further tested in aptamer-peroxidase and aptamer-lfuorescence staining protocols. This study has proved the principle that the whole-cell SELEX could be a promising technique to design aptamer-based molecular probes for dectection of pathogenic microorganisms without tedious isolation and puriifcation of complex markers or targets.

  15. Biofilm formation by Listeria monocytogenes on stainless steel surface and biotransfer potential

    Directory of Open Access Journals (Sweden)

    Maíra Maciel Mattos de Oliveira


    Full Text Available An experimental model was proposed to study biofilm formation by Listeria monocytogenes ATCC 19117 on AISI 304 (#4 stainless steel surface and biotransfer potential during this process. In this model, biofilm formation was conducted on the surface of stainless steel coupons, set on a stainless steel base with 4 divisions, each one supporting 21 coupons. Trypic Soy Broth was used as bacterial growth substrate, with incubation at 37 ºC and stirring of 50 rpm. The number of adhered cells was determined after 3, 48, 96, 144, 192 and 240 hours of biofilm formation and biotransfer potential from 96 hours. Stainless steel coupons were submitted to Scanning Electron Microscopy (SEM after 3, 144 and 240 hours. Based on the number of adhered cells and SEM, it was observed that L. monocytogenes adhered rapidly to the stainless steel surface, with mature biofilm being formed after 240 hours. The biotransfer potential of bacterium to substrate occurred at all the stages analyzed. The rapid capacity of adhesion to surface, combined with biotransfer potential throughout the biofilm formation stages, make L. monocytogenes a potential risk to the food industry. Both the experimental model developed and the methodology used were efficient in the study of biofilm formation by L. monocytogenes on stainless steel surface and biotransfer potential.

  16. Identification of Listeria monocytogenes on Green Mussels (Perna viridis and Cockle Shell (Anadara granosa

    Directory of Open Access Journals (Sweden)

    Winiati Puji Rahayu


    Full Text Available Green mussel (Perna viridis and cockle shell (Anadara granosa are one of many sources of animalprotein which is many cultivated in Indonesia because their price is relatively affordable. This study wasconducted to identify the presence of Listeria monocytogenes in 27 samples of green mussels and 3 samplesof cockle shells using real-time Polymerase Chain Reaction (real-time PCR and biochemical methods. Thetarget gene for amplification in real-time PCR was an hlyA gene because this gene was a determinant ofvirulence genes that produce listeriolysin O. Primers used in this study were forward primer DG69 (GTGCCG GGT AAA AGA CCA TA and reverse primer DG74 (CGC CAC TGA GAT ACT AT and fluorescencesignals indicator using SYBR Green I. The results of analysis using real-time PCR were negative Listeriamonocytogenes in all samples, while using biochemical methods there was one of 30 samples contaminatedby Listeria welshimeri.

  17. Evidence for the involvement of ActA in maturation of the Listeria monocytogenes phagosome

    Institute of Scientific and Technical Information of China (English)

    Mathilde A Poussin; Howard Goldfine


    @@ Dear Editor, Listeria monocytogenes (Lm), a Gram-positive facultative bacterium, is the causative agent of listeriosis, a food-borne disease affecting humans [1]. During infections, Lm enters phagosomes from which it escapes into the cytoplasm. Listeriolysin O (LLO) is essential, and two phospholipases play a role in this process [1]. Actin polymerization provides the propulsive force that moves the bacteria through the cytoplasm and into adjacent cells. It is initiated by the interaction of the N-terminal domain of ActA, a 639 amino acid membrane protein, with the host Arp2/3 complex.

  18. Rhombencephalitis Caused by Listeria monocytogenes in Humans and Ruminants: A Zoonosis on the Rise? (United States)

    Oevermann, Anna; Zurbriggen, Andreas; Vandevelde, Marc


    Listeriosis is an emerging zoonotic infection of humans and ruminants worldwide caused by Listeria monocytogenes (LM). In both host species, CNS disease accounts for the high mortality associated with listeriosis and includes rhombencephalitis, whose neuropathology is strikingly similar in humans and ruminants. This review discusses the current knowledge about listeric encephalitis, and involved host and bacterial factors. There is an urgent need to study the molecular mechanisms of neuropathogenesis, which are poorly understood. Such studies will provide a basis for the development of new therapeutic strategies that aim to prevent LM from invading the brain and spread within the CNS. PMID:20204066

  19. Rhombencephalitis Caused by Listeria monocytogenes in Humans and Ruminants: A Zoonosis on the Rise?

    Directory of Open Access Journals (Sweden)

    Anna Oevermann


    Full Text Available Listeriosis is an emerging zoonotic infection of humans and ruminants worldwide caused by Listeria monocytogenes (LM. In both host species, CNS disease accounts for the high mortality associated with listeriosis and includes rhombencephalitis, whose neuropathology is strikingly similar in humans and ruminants. This review discusses the current knowledge about listeric encephalitis, and involved host and bacterial factors. There is an urgent need to study the molecular mechanisms of neuropathogenesis, which are poorly understood. Such studies will provide a basis for the development of new therapeutic strategies that aim to prevent LM from invading the brain and spread within the CNS.

  20. Use of E-beam radiation to eliminate Listeria monocytogenes from surface mould cheese. (United States)

    Velasco, Raquel; Ordóñez, Juan A; Cambero, M Isabel; Cabeza, M Concepción


    Camembert and Brie soft cheese varieties were subjected to E-beam irradiation as a sanitation treatment. The effects of treatments on microbiota and selected physicochemical properties were also studied. The absorbed doses required to meet the food safety objective (FSO) according to EU and USDA criteria for Listeria monocytogenes were 1.27 and 2.59 kGy, respectively. The bacterial load, mainly lactic acid bacteria, was reduced by the treatment but injured cells were recovered during storage at 14°C. The radiation treatment gave rise to negligible changes in the pH and water activity at doses required to achieve microbial safety.

  1. Illuminating the landscape of host–pathogen interactions with the bacterium Listeria monocytogenes (United States)

    Cossart, Pascale


    Listeria monocytogenes has, in 25 y, become a model in infection biology. Through the analysis of both its saprophytic life and infectious process, new concepts in microbiology, cell biology, and pathogenesis have been discovered. This review will update our knowledge on this intracellular pathogen and highlight the most recent breakthroughs. Promising areas of investigation such as the increasingly recognized relevance for the infectious process, of RNA-mediated regulations in the bacterium, and the role of bacterially controlled posttranslational and epigenetic modifications in the host will also be discussed. PMID:22114192

  2. Listeria monocytogenes' Step-Like Response to Sub-Lethal Concentrations of Nisin. (United States)

    Takhistov, Paul; George, Bernice; Chikindas, Michael L


    Microbial safety of food products is often accomplished by the formulation of food-grade preservatives into the product. Because of the growing consumer demand for natural substances (including preservatives) in the composition of consumed foods, there is also a growing interest in the natural antimicrobial nisin, which has generally recognized as safe (GRAS) status for certain applications. During the products storage time, concentrations of preservative(s) are decreasing, which may eventually cause a serious problem in the food's microbial safety. Here, for the first time we report on the non-linear response of a foodborne pathogen, Listeria monocytogenes, to sub-lethal concentrations of nisin.

  3. Industrial disinfectants do not select for resistance in Listeria monocytogenes following long term exposure

    DEFF Research Database (Denmark)

    Kastbjerg, Vicky Gaedt; Gram, Lone


    Listeria monocytogenes is a food-borne pathogen that can persist for years in food processing plants. It has been hypothesized that this could be due to the development of tolerance or resistance to the disinfectants used. The purpose of the present study was to determine whether biocide resistance...... of tolerance, the populations adapted to Triquart SUPER were still sensitive to killing with this disinfectant at 0.0125%, which is much lower than in-use concentrations (1–5%). Our data are in agreement with the fact that finding strains with high acquired resistance to disinfectants is rare...

  4. Susceptibility of Listeria monocytogenes isolated from food in Italy to antibiotics. (United States)

    Aureli, Paolo; Ferrini, Anna Maria; Mannoni, Veruscka; Hodzic, Snjezana; Wedell-Weergaard, Christina; Oliva, Brunello


    The susceptibility of 148 strains of Listeria monocytogenes isolated from food to antibiotics currently used in veterinary and human therapy was determined by standard agar dilution and disk diffusion methods. The antibiotics included amikacin, amoxicillin, cefazolin, chloramphenicol, erythromycin, flumequine, fosfomycin, gentamicin, kanamycin, lincomycin, oxytetracycline, rifampicin, spiramycin, streptomycin, tetracycline, tobramycin and vancomycin. Soussy's breakpoints and MIC(50)-MIC(90) values were used to classify the strains into sensitive, moderately sensitive and resistant groups. This work is part of a wider surveillance program on listeriosis started in Italy in 1995.

  5. Listeria monocytogenes has a functional chitinolytic system and an active lytic polysaccharide monooxygenase

    DEFF Research Database (Denmark)

    Paspaliari, Dafni Katerina; Loose, Jennifer S. M.; Larsen, Marianne Halberg


    B) and a multi-modular lytic polysaccharide monooxygenase (LmLPMO10). These enzymes have been related to virulence and their role in chitin metabolism is poorly understood. It is thus of interest to functionally characterize the individual enzymes in order to shed light on their roles in vivo. Our results......Chitinases and chitin-active lytic polysaccharide monooxygenases (LPMOs) are most commonly associated with chitin metabolism, but are also reported as virulence factors in pathogenic bacteria. Listeria monocytogenes, a well-known virulent bacterium, possesses two chitinases (ChiA and Chi...

  6. Prevalence and Genetic Characteristics of Meatborne Listeria monocytogenes Isolates from Livestock Farms in Korea (United States)

    Oh, Hyemin; Kim, Sejeong; Lee, Soomin; Lee, Heeyoung; Ha, Jimyeong; Lee, Jeeyeon; Choi, Yukyung; Choi, Kyoung-Hee; Yoon, Yohan


    This study aimed to evaluate the prevalence of Listeria monocytogenes on livestock farms in Korea and determine their serotypes and genetic correlations. Twenty-five livestock farms in Korea (central: 15, south west: 7, south east: 3) were visited 2-3 times, and 2,018 samples (feces: 677, soil: 680, silage: 647, sludge: 14) were collected. Samples were enriched in LEB (Listeria enrichment broth) and Fraser broth media, and then plated on Palcam agar. The isolates were identified by PCR and 16S rRNA gene sequencing. Then, the serotypes, presence of virulence genes (actA, inlA, inlB, plcB, and hlyA), and antibiotic resistance were determined. Genetic correlations among the isolates were evaluated by analyzing the restriction digest pattern with AscI. Of the 2,018 samples, only 3 (0.15%) soil samples (FI-1-FI-3) from 1 farm in the south east region were positive for L. monocytogenes. Based on biochemical tests and multiplex PCR, the serotype of the isolates were 4ab (FI-1 and FI-3) and 3a (FI-2), which are not common in foodborne L. monocytogenes. The 3a serotype isolate was positive for all tested virulence genes, whereas the 4ab serotype isolates were only positive for hlyA, actA, and inlA. The isolates were resistant to all 12 tested antibiotics, especially FI-3. The genetic correlations among the isolates were 100% for those of the same serotype and 26.3% for those of different serotypes. These results indicate that the prevalence of L. monocytogenes on livestock farms in Korea is low; however, the isolates are pathogenic and antibiotic resistant. PMID:28115889

  7. Distribución de serotipos de Listeria monocytogenes aislados de alimentos, Colombia, 2000-2009

    Directory of Open Access Journals (Sweden)

    Ana Isabel Muñoz


    Full Text Available Introducción. Listeria monocytogenes es un patógeno facultativo intracelular, oportunista, causantede graves infecciones en humanos, como meningitis, encefalitis y bacteriemias; también, es causa deabortos. Los alimentos actúan como medio de transporte para infectar al huésped.La serotipificación ha discriminado trece serotipos: 1/2a,1/2b, 1/2c, 3a, 3b, 3c, 4a, 4ab, 4b, 4c, 4d, 4e,7. El 4b es causante de la mayoría de listeriosis en el mundo. Objetivo. Determinar la frecuencia en Colombia de los serotipos de L. monocytogenes aislados dealimentos, durante los años 2000-2009. Materiales y métodos. Se trata de un estudio descriptivo y retrospectivo. Se analizaron 1.599aislamientos, los cuales fueron confirmados como L. monocytogenes y otras especies de Listeria, conpruebas bioquímicas recomendadas por la Food and Drug Administration (Estados unidos y utilizacióndel sistema bioquímico api Listeria Biomérieux, serotipificadas con la metodología de Seeliger yHöhne. Resultados. De los 1.599 aislamientos, 1.424 fueron confirmados como L. monocytogenes. Losserotipos encontrados fueron: 1/2a con 135 (9,5 %; 1/2b, 154 (10,8 %; 1/2c, 68 (4,8 %; 3a, 4 (0,3 %;3b, 29 (2,0 %; 3c,2 (0,1 %; 4a, 44 (3,1 %; 4b, 820 (57,6 %; 4c, 6 (0,4 %; 4d- 4e, 140 (9,8 %; 4e, 17(1,2 %; 7, 2 (0,1 %; y tres no serotipificables, (0,2 %. Los aislamientos procedían principalmente deBogotá, 1.035 (73 %; de Antioquia, 199 (14 %; de Nariño, 109 (8 %; del Valle del Cauca, 50 (3,5 %,y de otros departamentos, 33 (2,3 %. Conclusión. En los aislamientos analizados, 1.424 (89 % correspondieron a L. monocytogenes,presentando una buena calidad en el aislamiento e identificación; la mayoría de estos aislamientospertenecían al serotipo 4b, 820 (57,6 %, serotipo muy virulento. Se recomienda la vigilancia obligatoriade este microorganismo.   doi:

  8. Occurrence of Listeria species in meat, chicken products and human stools in Assiut city, Egypt with PCR use for rapid identification of Listeria monocytogenes

    Directory of Open Access Journals (Sweden)

    Ashraf Mohamed Abd El-Malek

    Full Text Available The present research was conducted to check the presence of Listeria spp. in some meat and chicken products purchased from retail supermarkets in Assiut (Egypt. A total of 100 samples including 25 samples each of minced frozen beef, luncheon, frozen chicken legs and frozen chicken breast fillets were collected over a 7-month period between January and July 2009 and analyzed for the presence of Listeria spp. In addition, 28 stool cultures examined for Listeria spp. from hospitalized children resident in Assiut Pediatric University Hospital with diarrhea or fever. Out of the total 100 meat samples examined, Listeria spp. were detected in 8 (32% of minced frozen beef, 8 (32% of luncheon, 13 (52% of frozen chicken leg and 14 (56% of frozen chicken fillet samples analyzed, respectively. Regarding the examined 28 stool cultures from hospitalized children with underlying disease in Assiut Univ. hospital, 2 (7.14% were found positive for Listeria spp. For identification of L. monocytogenes using polymerase chain reaction (PCR, two primers were selected to detect 217-pb fragment ofthe prfA (transcriptional activator of the virulence factor gene for L. monocytogenes. 13 selected Listeria isolates displayed beta-haemolysis on sheep blood agar and positive CAMP test were further identified using PCR. PCR results showed that L. monocytogenes were confirmed in one of minced imported frozen meat examined, two of luncheon samples and two of frozen chicken legs with the total incidence of 5 isolates (5% from the total 100 examined food samples. This suggests the presence of a significant public health hazard linked to the consumption of these meat and chicken products sold in Assiut city contaminated with L. monocytogenes. The public health significance of these pathogens as well as recommended sanitary measures was discussed. [Veterinary World 2010; 3(8.000: 353-359

  9. Antimicrobial susceptibility of listeria monocytogenes from food products

    DEFF Research Database (Denmark)

    Aarestrup, Frank Møller; Knöchel, Susanne; Hasman, Henrik


    for susceptibility to ceftiofur, chloramphenicol, ciprofloxacin, erythromycin, florfenicol, penicillin, spectinomycin, streptomycin, tetracycline, tiamulin, trimethoprim, and co-trimoxazole, and the disinfectants benzalkonium chloride and triclosan, by determination of minimum inhibitory concentrations (MICs). All...... isolates were resistant to ceftiofur, but susceptible to the other antibiotics. A single isolate had a MIC of 4 mg/L for ciprofloxacin. For tiamulin. the MIC values were around the breakpoint used. Most isolates had MICs for triclosan at 16 mg/L. The MICs for benzalkonium chloride formed a bimodal...... distribution, with 105 isolates having a MIC of 4 mg/L and 9 isolates MICs of 16 and 32 mg/L. This study showed that Danish isolates of L. monocytogenes have not developed or acquired resistance to antimicrobial agents used for treatment or disinfection, except for benzalkonium chloride. The MICs for triclosan...

  10. Ecology of Listeria monocytogenes in the environment of raw poultry meat and raw pork meat processing plants. (United States)

    Chasseignaux, Elise; Gérault, Pascale; Toquin, Marie-Thérèse; Salvat, Gilles; Colin, Pierre; Ermel, Gwennola


    The zoonotic Listeria monocytogenes is mainly transmitted to humans by the food-borne route. This bacterium was often found in the environment of food processing plants. Therefore the aims of this study were (i) the identification of environmental factors associated with L. monocytogenes contamination on working and non-working surfaces in poultry or pork processing plants and (ii) the understanding of its survival in such environments. The physicochemical risk profiles showed that a surface in resin or plastic, rather than uneven, with organic residues, with a neutral pH, a low temperature and a high hygrometry was associated with L. monocytogenes contamination.

  11. Lactobacillus plantarum inhibits growth of Listeria monocytogenes in an in vitro continuous flow gut model, but promotes invasion of L. monocytogenes in the gut of gnotobiotic rats

    DEFF Research Database (Denmark)

    Bernbom, Nete; Licht, Tine Rask; Saadbye, Peter;


    The ability of the pediocin AcH producing Lactobacillus plantarum DDEN 11007 and its non-producing plasmid-cured isogenic variant, DDEN 12305 to prevent the persistence and growth of Listeria monocytogenes EP2 in two gastrointestinal (GI) tract models was examined. In vitro studies conducted...... in a two-stage continuous flow system showed that L. plantarum DDEN 11007 inhibited L. monocytogenes EP2 under these conditions, while less effect was seen of the non-bacteriocin producing variant. The inhibitory effect was more pronounced at pH 5 than at pH 7. No effect on persistence of L. monocytogenes...... in the GI tract was seen in gnotobiotic rats colonized with either the pediocin AcH producing or the non-bacteriocin producing variant of L. plantarum when compared to rats inoculated with L. monocytogenes EP2 alone. Surprisingly, inoculation of the gnotobiotic animals with either of the L. plantarum...

  12. Cleaning and disinfection of biofilms composed of Listeria monocytogenes and background microbiota from meat processing surfaces. (United States)

    Fagerlund, Annette; Møretrø, Trond; Heir, Even; Briandet, Romain; Langsrud, Solveig


    Surfaces of food processing premises are exposed to regular cleaning and disinfection (C&D) regimes, using biocides that are highly effective against bacteria growing as planktonic cells. However, bacteria growing in surface associated communities (biofilms) are typically more tolerant towards C&D than their individual free cells counterparts, and survival of pathogens such as Listeria monocytogenes may be affected by interspecies interactions within biofilms. In this study, Pseudomonas and Acinetobacter were the most frequently isolated genera surviving on conveyor belts subjected to C&D in meat processing plants. In the laboratory, Pseudomonas, Acinetobacter and L. monocytogenes dominated the community both in suspensions and in biofilms formed on conveyor belts, when cultures were inoculated with eleven-genera cocktails of representative bacterial strains from the identified background flora. When biofilms were exposed to daily C&D cycles, mimicking treatments used in food industry, the levels of Acinetobacter and Pseudomonas mandelii diminished, and biofilms were instead dominated by Pseudomonas putida (65-76%), Pseudomonas fluorescens (11-15%) and L. monocytogenes (3-11%). The dominance of certain species after daily C&D correlated with high planktonic growth rates at 12°C and tolerance to C&D. In single-species biofilms, L. monocytogenes developed higher tolerance to C&D over time, both for the peracetic acid and quaternary ammonium disinfectant, indicating that a broad-spectrum mechanism was involved. Survival after C&D appeared to be a common property of L. monocytogenes strains, as both persistent and sporadic subtypes showed equal survival in complex biofilms. Biofilms established preferentially in surface irregularities of conveyor belts, potentially constituting harborage sites for persistent contamination.IMPORTANCE In food industry, efficient production hygiene is a key measure to avoid accumulation of spoilage bacteria and eliminate pathogens

  13. Modelling the effect of lactic acid bacteria from starter- and aroma culture on growth of Listeria monocytogenes in cottage cheese

    DEFF Research Database (Denmark)

    Østergaard, Nina Bjerre; Eklöw, Annelie; Dalgaard, Paw


    Four mathematical models were developed and validated for simultaneous growth of mesophilic lactic acid bacteria from added cultures and Listeria monocytogenes, during chilled storage of cottage cheese with freshor cultured cream dressing. The mathematical models include the effect of temperature...... cheese to improvemodel performance. The inhibiting effect of mesophilic lactic acid bacteria from added cultures on growth of L. monocytogenes was efficiently modelled using the Jameson approach. The new models appropriately predicted the maximum population density of L. monocytogenes in cottage cheese....... The developed models were successfully validated by using 25 growth rates for L. monocytogenes, 17 growth rates for lactic acid bacteria and a total of 26 growth curves for simultaneous growth of L. monocytogenes and lactic acid bacteria in cottage cheese. These data were used in combination with bias...

  14. Tn6188 - a novel transposon in Listeria monocytogenes responsible for tolerance to benzalkonium chloride.

    Directory of Open Access Journals (Sweden)

    Anneliese Müller

    Full Text Available Controlling the food-borne pathogen Listeria (L. monocytogenes is of great importance from a food safety perspective, and thus for human health. The consequences of failures in this regard have been exemplified by recent large listeriosis outbreaks in the USA and Europe. It is thus particularly notable that tolerance to quaternary ammonium compounds such as benzalkonium chloride (BC has been observed in many L. monocytogenes strains. However, the molecular determinants and mechanisms of BC tolerance of L. monocytogenes are still largely unknown. Here we describe Tn6188, a novel transposon in L. monocytogenes conferring tolerance to BC. Tn6188 is related to Tn554 from Staphylococcus (S. aureus and other Tn554-like transposons such as Tn558, Tn559 and Tn5406 found in various Firmicutes. Tn6188 comprises 5117 bp, is integrated chromosomally within the radC gene and consists of three transposase genes (tnpABC as well as genes encoding a putative transcriptional regulator and QacH, a small multidrug resistance protein family (SMR transporter putatively associated with export of BC that shows high amino acid identity to Smr/QacC from S. aureus and to EmrE from Escherichia coli. We screened 91 L. monocytogenes strains for the presence of Tn6188 by PCR and found Tn6188 in 10 of the analyzed strains. These isolates were from food and food processing environments and predominantly from serovar 1/2a. L. monocytogenes strains harboring Tn6188 had significantly higher BC minimum inhibitory concentrations (MICs (28.5 ± 4.7 mg/l than strains without Tn6188 (14 ± 3.2 mg/l. Using quantitative reverse transcriptase PCR we could show a significant increase in qacH expression in the presence of BC. QacH deletion mutants were generated in two L. monocytogenes strains and growth analysis revealed that ΔqacH strains had lower BC MICs than wildtype strains. In conclusion, our results provide evidence that Tn6188 is responsible for BC tolerance in various L

  15. Prevalence of Listeria monocytogenes in fresh and fermented Italian sausages and ribotyping of contaminating strains. (United States)

    De Cesare, Alessandra; Mioni, Renzo; Manfreda, Gerardo


    Listeria monocytogenes has been detected in fresh as well as dry and semidry fermented sausages, rendering preparation and consumption of these products as a potential risk to human health. The aims of this study were (1) to evaluate the L. monocytogenes prevalence in 288 fresh and 237 fermented sausages produced in northern Italy; (2) to quantify the average pathogen Most Probable Number (MPN) per g of sausage; (3) to evaluate the sausage strain genetic diversity by automated PvuII ribotyping; and (4) to predict the pathogenicity lineage of these isolates determining their DuPont Identification Library Codes (DUP-IDs) by EcoRI ribotyping. The overall prevalence of L. monocytogenes in the sampled sausages was 28.2%. The percentage of L. monocytogenes positive fresh sausages was significantly higher than that of fermented sausages (i.e. 38.9 vs 15.2%), which had a pathogen load always lower than 10 MPN/g. In contrast, 16.1% of fresh sausages were contaminated by 10 to 100 MPN/g and 20.5% had more than 100 MPN/g. PvuII successfully discriminated sausage isolates with a Simpson's numerical index of discrimination of 0.637. A total of 12 and 9 different PvuII ribogroups were identified among 47 fresh and 24 fermented randomly selected sausage strains, respectively. Six of those ribogroups were shared between strains contaminating both kinds of sausages. According to the evaluation of the strain DUP-IDs, the majority of the isolates investigated in this study were part of the type II L. monocytogenes pathogenicity lineage, but type I lineage strains were identified among fermented sausage isolates. In conclusion, L. monocytogenes prevalence in Italian sausages was estimated to be around 28.2%. However, 84.2% of the samples were contaminated by less than 100 MPN of L. monocytogenes per g and the majority of L. monocytogenes contaminating strains would be classified in the type II pathogenicity lineage, including serotypes 1/2a, 1/2c and 3a.

  16. Control of Listeria monocytogenes in fresh cheese using protective lactic acid bacteria. (United States)

    Coelho, M C; Silva, C C G; Ribeiro, S C; Dapkevicius, M L N E; Rosa, H J D


    In the past years, there has been a particular focus on the application of bacteriocins produced by lactic acid bacteria (LAB) in controlling the growth of pathogenic bacteria in foods. The aim of this study was to select LAB strains with antimicrobial activity, previously isolated from a traditional Azorean artisanal cheese (Pico cheese), in order to identify those with the greatest potential in reducing Listeria monocytogenes in fresh cheese. Eight bacteriocin producer strains identified as Lactococcus lactis (1) and Enterococcus faecalis (7) were tested. In general, the bacteriocin-producing strains presented a moderate growth in fresh cheese at refrigeration temperatures (4 °C), increasing one log count in three days. They exhibited slow acidification capacity, despite the increased production of lactic acid displayed by some strains after 24h. Bacteriocin activity was only detected in the whey of fresh cheese inoculated with two Enterococcus strains, but all cheeses made with bacteriocin-producing strains inhibited L. monocytogenes growth in the agar diffusion bioassay. No significant differences were found in overall sensory evaluation made by a non-trained panel of 50-52 tasters using the isolates as adjunct culture in fresh cheese, with the exception of one Enterococcus strain. To test the effect of in situ bacteriocin production against L. monocytogenes, fresh cheese was made from pasteurized cows' milk inoculated with bacteriocin-producing LAB and artificially contaminated with approximately 10(6) CFU/mL of L. monocytogenes. The numbers of L. monocytogenes were monitored during storage of fresh cheese at refrigeration temperature (4 °C) for up to 15 days. All strains controlled the growth of L. monocytogenes, although some Enterococcus were more effective in reducing the pathogen counts. After 7 days, this reduction was of approximately 4 log units compared to the positive control. In comparison, an increase of 4 log CFU/mL in pathogen numbers was

  17. Tn6188 - a novel transposon in Listeria monocytogenes responsible for tolerance to benzalkonium chloride. (United States)

    Müller, Anneliese; Rychli, Kathrin; Muhterem-Uyar, Meryem; Zaiser, Andreas; Stessl, Beatrix; Guinane, Caitriona M; Cotter, Paul D; Wagner, Martin; Schmitz-Esser, Stephan


    Controlling the food-borne pathogen Listeria (L.) monocytogenes is of great importance from a food safety perspective, and thus for human health. The consequences of failures in this regard have been exemplified by recent large listeriosis outbreaks in the USA and Europe. It is thus particularly notable that tolerance to quaternary ammonium compounds such as benzalkonium chloride (BC) has been observed in many L. monocytogenes strains. However, the molecular determinants and mechanisms of BC tolerance of L. monocytogenes are still largely unknown. Here we describe Tn6188, a novel transposon in L. monocytogenes conferring tolerance to BC. Tn6188 is related to Tn554 from Staphylococcus (S.) aureus and other Tn554-like transposons such as Tn558, Tn559 and Tn5406 found in various Firmicutes. Tn6188 comprises 5117 bp, is integrated chromosomally within the radC gene and consists of three transposase genes (tnpABC) as well as genes encoding a putative transcriptional regulator and QacH, a small multidrug resistance protein family (SMR) transporter putatively associated with export of BC that shows high amino acid identity to Smr/QacC from S. aureus and to EmrE from Escherichia coli. We screened 91 L. monocytogenes strains for the presence of Tn6188 by PCR and found Tn6188 in 10 of the analyzed strains. These isolates were from food and food processing environments and predominantly from serovar 1/2a. L. monocytogenes strains harboring Tn6188 had significantly higher BC minimum inhibitory concentrations (MICs) (28.5 ± 4.7 mg/l) than strains without Tn6188 (14 ± 3.2 mg/l). Using quantitative reverse transcriptase PCR we could show a significant increase in qacH expression in the presence of BC. QacH deletion mutants were generated in two L. monocytogenes strains and growth analysis revealed that ΔqacH strains had lower BC MICs than wildtype strains. In conclusion, our results provide evidence that Tn6188 is responsible for BC tolerance in various L. monocytogenes

  18. Effect of growth and recovery temperatures on pressure resistance of Listeria monocytogenes. (United States)

    Shearer, Adrienne E H; Neetoo, Hudaa S; Chen, Haiqiang


    Experimental conditions can affect the outcome of bacterial stress-tolerance assays. Growth conditions that optimize microbial recovery should be established to help evaluate the effectiveness of treatment conditions for food safety. The objectives of this study were to determine the effects of growth and recovery temperatures on pressure resistance of early stationary-phase Listeria monocytogenes in milk. The tested conditions were the following: (1) L. monocytogenes was grown at various temperatures (10, 15, 20, 25, 30, 35, 40 and 43 degrees C), suspended in ultra-high temperature (UHT) -processed whole milk, pressure-treated at 400 MPa for 2 min at 21 degrees C and recovered on Tryptic Soy Agar supplemented with 0.6% yeast extract (TSAYE) at 35 degrees C; (2) L. monocytogenes was grown at 35 and 43 degrees C, pressure treated in milk (400 and 500 MPa, respectively, for 2 min at 21 degrees C) and recovered on TSAYE at various temperatures (4, 10, 15, 20, 25, 30, 35 and 40 degrees C); (3) L. monocytogenes originally grown at 35 degrees C, was pressure treated in milk (400 or 450 MPa for 2 min at 21 degrees C), and recovered on TSAYE at 10 degrees C for various time intervals (1, 2, 3, 6, 9 and 12 days) then at 35 degrees C for 5 days. There was no significant difference (P>0.05) in pressure-resistance of L. monocytogenes grown at 10 to 25 degrees C with approximately 6.5-log CFU/ml population reductions. At growth temperatures greater than 25 degrees C, pressure resistance increased with less than 1-log CFU/ml reduction observed for L. monocytogenes originally grown at 43 degrees C. After pressure treatment, regardless of growth temperature and pressure treatment, the greatest recovery of L. monocytogenes was within the 4 to 20 degrees C range; maximum recovery at 10 degrees C required approximately 24 days. The time for comparable post-pressure treatment recovery could be reduced by incubation at 10 degrees C for at least 2 days followed by incubation at 35

  19. Prevalence and antibiotic susceptibility of Listeria monocytogenes in raw milk from cattle herds within Sokoto Metropolis, Nigeria

    Directory of Open Access Journals (Sweden)

    ML Gulumbe


    Full Text Available One hundred and ninety two raw milk samples were collected from lactating cows identified in Fulani herds and small scale dairy farms within Sokoto metropolis in order to investigate the presence and determine the antibiotic susceptibility of Listeria monocytogenes in the milk. Selective culture and identification method was employed for the bacterial isolation and Kirby-Bauer technique was used for the antibiotic susceptibility test. Seventy six samples (39.58% were positive for Listeria species, which upon biochemical characterization 39(51.3% were Listeria innocua, 14(18.4% Listeria ivanovii, 17(22.4% Listeria monocytogenes, 4(5.3% Listeria welshimeri and 2(2.6% Listeria seeligeri. Antibiotic susceptibility test of the isolates revealed high resistance to ampicillin (100%, and streptomycin (80%, followed by ampiclox (70%, tetracycline (30%, then gentamycin (20% while, there was no resistance to ciprofloxacin and chloranphenicol. The findings of this study necessitate the need for extension personnel to educate the Fulani herdsmen, milk handlers and other livestock producers on the significance of hygiene especially during milking and the effect of indiscriminate use of drugs particularly antibiotics. There is also need for the agencies concerned such as the National Agency for Food and Drugs Administration and Control (NAFDAC to regulate the sales and use of both human and veterinary drugs by drug hawkers and other non-professional veterinary practitioners.

  20. Outbreak investigation identifies a single Listeria monocytogenes strain in sheep with different clinical manifestations, soil and water. (United States)

    Dreyer, M; Thomann, A; Böttcher, S; Frey, J; Oevermann, A


    Listeria (L.) monocytogenes causes orally acquired infections and is of major importance in ruminants. Little is known about L. monocytogenes transmission between farm environment and ruminants. In order to determine potential sources of infection, we investigated the distribution of L. monocytogenes genetic subtypes in a sheep farm during a listeriosis outbreak by applying four subtyping methods (MALDI-TOF-MS, MLST, MLVA and PFGE). L. monocytogenes was isolated from a lamb with septicemia and from the brainstem of three sheep with encephalitis. Samples from the farm environment were screened for the presence of L. monocytogenes during the listeriosis outbreak, four weeks and eight months after. L. monocytogenes was found only in soil and water tank swabs during the outbreak. Four weeks later, following thorough cleaning of the barn, as well as eight months later, L. monocytogenes was absent in environmental samples. All environmental and clinical L. monocytogenes isolates were found to be the same strain. Our results show that the outbreak involving two different clinical syndromes was caused by a single L. monocytogenes strain and that soil and water tanks were potential infection sources during this outbreak. However, silage cannot be completely ruled out as the bales fed prior to the outbreak were not available for analysis. Faeces samples were negative, suggesting that sheep did not act as amplification hosts contributing to environmental contamination. In conclusion, farm management appears to be a crucial factor for the limitation of a listeriosis outbreak.

  1. Detection of Listeria spp. in liquid egg products and in the egg breaking plants environment and tracking of Listeria monocytogenes by PFGE. (United States)

    Rivoal, Katell; Fablet, Aurore; Courtillon, Céline; Bougeard, Stéphanie; Chemaly, Marianne; Protais, Jocelyne


    Human listeriosis, caused by Listeria monocytogenes, is a severe bacterial infection that can lead to meningitis, cerebromeningitis, bacteremia or septicemia, with acute lethality and potentially leading to death. A study has shown that 29.5% of the caged laying hens in France are contaminated by L. monocytogenes (Chemaly et al., 2008). However, very little information regarding egg and egg product contamination is currently available. The objective of this study is to determine the sanitary status of egg products and egg breaking plants in France regarding Listeria spp. and L. monocytogenes contaminations. The sampling scheme performed in five egg breaking plants in Western France during one year have revealed that 8.5% of raw egg products were contaminated by L. monocytogenes. No pasteurized egg products have been shown to be contaminated by L. monocytogenes. However, a high level of contamination by Listeria spp., and particularly by L. innocua, has been shown with 26.2% and 1.8% of raw and pasteurized egg products contaminated, respectively. This work has also revealed the presence of Listeria spp. and L. monocytogenes in the environment of egg breaking plants with 65.1% and 8.0% of contaminated samples, respectively. The typing of 253 isolates of L. monocytogenes by PFGE using ApaI and AscI enzymes has revealed a high diversity with 46 different pulsotypes and has shown that the raw material is a source of contamination of egg breaking plants. One L. monocytogenes cluster was dominant in the 5 egg-breaking plants during the four seasons studied. The issue of which strains are better adapted to egg products must be considered and studied in depth by comparing them to pulsotypes from strains of other chains. However, the traceability of L. monocytogenes in plants during the various seasons has also made it possible to highlight the presence of strains that are specific to egg breaking plants. The study of cleaning and disinfection methods in these plants as well

  2. Predominance and Distribution of a Persistent Listeria monocytogenes Clone in a Commercial Fresh Mushroom Processing Environment. (United States)

    Murugesan, Latha; Kucerova, Zuzana; Knabel, Stephen J; LaBorde, Luke F


    A longitudinal study was conducted to determine the prevalence of Listeria spp. in a commercial fresh mushroom slicing and packaging environment. Samples were collected at three different sampling periods within a 13-month time interval. Of the 255 environmental samples collected, 18.8% tested positive for L. monocytogenes, 4.3% for L. innocua, and 2.0% for L. grayi. L. monocytogenes was most often found on wet floors within the washing and slicing and packaging areas. Each of the 171 L. monocytogenes isolates found in the environment could be placed into one of three different serotypes; 1/2c was predominant (93.6%), followed by 1/2b (3.5%) and 1/2a (2.9%). Of 58 isolates subtyped using multi-virulence-locus sequence typing, all 1/2c isolates were identified as virulence type (VT) 11 (VT11), all 1/2b isolates were VT105, and 1/2a isolates were either VT107 or VT56. VT11 was designated as the predominant and persistent clone in the environment because it was isolated repeatedly at numerous locations throughout the study. The overall predominance and persistence of VT11 indicates that it likely colonized the mushroom processing environment. Areas adjacent to the trench drain in the washing and slicing area and a floor crack in the packaging area may represent primary harborage sites (reservoirs) for VT11. Improvements made to sanitation procedures by company management after period 2 coincided with a significant (P ≤ 0.001) reduction in the prevalence of L. monocytogenes from 17.8% in period 1 and 30.7% in period 2 to 8.5% in period 3. This suggests that targeted cleaning and sanitizing procedures can be effective in minimizing the occurrence of L. monocytogenes contamination in processing facilities. Additional research is needed to understand why VT11 was predominant and persistent in the mushroom processing environment.

  3. Multifaceted Activity of Listeriolysin O, the Cholesterol-Dependent Cytolysin of Listeria monocytogenes (United States)


    The cholesterol-dependent cytolysins (CDCs) are a large family of pore-forming toxins that are produced by numerous Gram-positive bacterial pathogens. These toxins are released in the extracellular environment as water-soluble monomers or dimers that bind to cholesterol-rich membranes and assemble into large pore complexes. Depending upon their concentration, the nature of the host cell and membrane (cytoplasmic or intracellular) they target, the CDCs can elicit many different cellular responses. Among the CDCs, listeriolysin O (LLO), which is a major virulence factor of the facultative intracellular pathogen Listeria monocytogenes, is involved in several stages of the intracellular lifecycle of the bacterium and displays unique characteristics. It has long been known that following L. monocytogenes internalization into host cells, LLO disrupts the internalization vacuole, enabling the bacterium to replicate into the host cell cytosol. LLO is then used by cytosolic bacteria to spread from cell to cell, avoiding bacterial exposure to the extracellular environment. Although LLO is continuously produced during the intracellular lifecycle of L. monocytogenes, several processes limit its toxicity to ensure the survival of infected cells. It was previously thought that LLO activity was limited to mediating vacuolar escape during bacterial entry and cell to cell spreading. This concept has been challenged by compelling evidence suggesting that LLO secreted by extracellular L. monocytogenes perforates the host cell plasma membrane, triggering important host cell responses. This chapter provides an overview of the well-established intracellular activity of LLO and the multiple roles attributed to LLO secreted by extracellular L. monocytogenes. PMID:24798012

  4. Microwave oven heating for inactivation of Listeria monocytogenes on frankfurters before consumption. (United States)

    Rodríguez-Marval, Mawill; Geornaras, Ifigenia; Kendall, Patricia A; Scanga, John A; Belk, Keith E; Sofos, John N


    Microwave oven heating was evaluated for inactivation of Listeria monocytogenes on inoculated and stored frankfurters. Frankfurters formulated without/with 1.5% potassium lactate and 0.1% sodium diacetate were inoculated with L. monocytogenes (1.9 +/- 0.2 log CFU/cm(2)), vacuum-packaged, and stored (4 degrees C) to simulate conditions prior to purchase by consumers. At storage days 18, 36, and 54, packages were opened and placed at 7 degrees C, simulating aerobic storage in a household refrigerator. At 0, 3, and 7 d of aerobic storage, 2 frankfurters were placed in a bowl with water (250 mL) and treated in a household microwave oven at high (1100 W) power for 30, 45, 60, or 75 s, or medium (550 W) power for 60 or 75 s. Frankfurters and the heating water were analyzed for total microbial counts and L. monocytogenes populations. Exposure to high power for 75 s reduced pathogen levels (0.7 +/- 0.0 to 1.0 +/- 0.1 log CFU/cm(2)) to below the detection limit ( 1.5 and 5.9 log CFU/cm(2) from control levels of 1.5 +/- 0.1 to 7.2 +/- 0.5 log CFU/cm(2). Depending on treatment and storage time, the water used to reheat the frankfurters had viable L. monocytogenes counts of microwave oven at high power for 75 s to inactivate up to 3.7 log CFU/cm(2) of L. monocytogenes contamination.

  5. Highly Invasive Listeria monocytogenes Strains Have Growth and Invasion Advantages in Strain Competition. (United States)

    Zilelidou, Evangelia A; Rychli, Kathrin; Manthou, Evanthia; Ciolacu, Luminita; Wagner, Martin; Skandamis, Panagiotis N


    Multiple Listeria monocytogenes strains can be present in the same food sample; moreover, infection with more than one L. monocytogenes strain can also occur. In this study we investigated the impact of strain competition on the growth and in vitro virulence potential of L. monocytogenes. We identified two strong competitor strains, whose growth was not (or only slightly) influenced by the presence of other strains and two weak competitor strains, which were outcompeted by other strains. Cell contact was essential for growth inhibition. In vitro virulence assays using human intestinal epithelial Caco2 cells showed a correlation between the invasion efficiency and growth inhibition: the strong growth competitor strains showed high invasiveness. Moreover, invasion efficiency of the highly invasive strain was further increased in certain combinations by the presence of a low invasive strain. In all tested combinations, the less invasive strain was outcompeted by the higher invasive strain. Studying the effect of cell contact on in vitro virulence competition revealed a complex pattern in which the observed effects depended only partially on cell-contact suggesting that competition occurs at two different levels: i) during co-cultivation prior to infection, which might influence the expression of virulence factors, and ii) during infection, when bacterial cells compete for the host cell. In conclusion, we show that growth of L. monocytogenes can be inhibited by strains of the same species leading potentially to biased recovery during enrichment procedures. Furthermore, the presence of more than one L. monocytogenes strain in food can lead to increased infection rates due to synergistic effects on the virulence potential.

  6. Control of Listeria monocytogenes growth in soft cheeses by bacteriophage P100

    Directory of Open Access Journals (Sweden)

    Elaine Nóbrega Gibson Silva


    Full Text Available The purpose of this study was to determine the effect of bacteriophage P100 on strains of Listeria monocytogenes in artificially inoculated soft cheeses. A mix of L. monocytogenes 1/2a and Scott A was inoculated in Minas Frescal and Coalho cheeses (approximately 10(5 cfu/g with the bacteriophage added thereafter (8.3 x 10(7 PFU/g. Samples were analyzed immediately, and then stored at 10 ºC for seven days. At time zero, 30 min post-infection, the bacteriophage P100 reduced L. monocytogenes counts by 2.3 log units in Minas Frescal cheese and by 2.1 log units in Coalho cheese, compared to controls without bacteriophage. However, in samples stored under refrigeration for seven days, the bacteriophage P100 was only weakly antilisterial, with the lowest decimal reduction (DR for the cheeses: 1.0 log unit for Minas Frescal and 0.8 log units for Coalho cheese. The treatment produced a statistically significant decrease in the counts of viable cells (p < 0.05 and in all assays performed, we observed an increase of approximately one log cycle in the number of viable cells of L. monocytogenes in the samples under refrigeration for seven days. Moreover, a smaller effect of phages was observed. These results, along with other published data, indicate that the effectiveness of the phage treatment depends on the initial concentration of L. monocytogenes, and that a high concentration of phages per unit area is required to ensure sustained inactivation of target pathogens on food surfaces.

  7. Differential internalin A levels in biofilms of Listeria monocytogenes grown on different surfaces and nutrient conditions. (United States)

    Gilmartin, Niamh; Gião, Maria S; Keevil, Charles W; O'Kennedy, Richard


    Listeria monoctyogenes is a foodborne pathogen containing the surface protein, internalin A (InlA). The expression of this protein permits the invasion of L. monocytogenes into intestinal epithelial cells expressing the receptor E-cadherin, thus crossing the intestinal barrier and resulting in listerosis. The main aim of this work was to investigate InlA levels in different L. monocytogenes strains in both planktonic and sessile states using an anti-InlA antibody. Biofilms were grown in high and low nutrient environments on glass, stainless steel and polytetrafluoroethylene (PTFE). This study demonstrated that InlA levels varied greatly between strains and serotypes of L. monocytogenes. However, the serotypes 1/2a, 1/2b and 4b, associated with the largest number of outbreaks of listerosis consistently showed the highest InlA levels, regardless of nutrient content or planktonic or sessile state. Differences in InlA levels were also observed in biofilms grown on different surfaces such as glass, stainless steel and PTFE, with a significant reduction in InlA levels observed in biofilms on PTFE. Interestingly, although a large number of the total cells observed in biofilms formed in tap-water were non-cultivable, the virulence factor, InlA, was expressed at levels between 78 and 85%, thus indicating that these cells may still be virulent. A greater understanding of the factors that affect the levels of InlA on the surface of L. monocytogenes, is essential in the appreciation of the role of InlA in the persistence of biofilms containing L. monocytogenes and their potential to cause food borne disease.

  8. Spreading of multiple Listeria monocytogenes abscesses via central nervous system fiber tracts: case report. (United States)

    Bojanowski, Michel W; Seizeur, Romuald; Effendi, Khaled; Bourgouin, Patrick; Magro, Elsa; Letourneau-Guillon, Laurent


    Animal studies have shown that Listeria monocytogenes can probably access the brain through a peripheral intraneural route, and it has been suggested that a similar process may occur in humans. However, thus far, its spreading through the central nervous system (CNS) has not been completely elucidated. The authors present a case of multiple L. monocytogenes cerebral abscesses characterized by a pattern of distribution that suggested spread along white matter fiber tracts and reviewed the literature to identify other cases for analysis. They elected to include only those cases with 3 or more cerebral abscesses to make sure that the distribution was not random, but rather followed a pattern. In addition, they included those cases with abscesses in both the brainstem and the cerebral hemispheres, but excluded cases in which abscesses were located solely in the brainstem. Of 77 cases of L. monocytogenes CNS abscesses found in the literature, 17 involved multiple abscesses. Of those, 6 were excluded for lack of imaging and 3 because they involved only the brainstem. Of the 8 remaining cases from the literature, one was a case of bilateral abscesses that did not follow a fiber tract; another was also bilateral, but with lesions appearing to follow fiber tracts on one side; and in the remaining 6, to which the authors added their own case for a total of 7, all the abscesses were located exclusively in the same hemisphere and distributed along white matter fiber tracts. The findings suggest that after entering the CNS, L. monocytogenes travels within the axons, resulting in a characteristic pattern of distribution of multiple abscesses along the white matter fiber tracts in the brain. This report is the first description suggesting intraaxonal CNS spread of L. monocytogenes infection in humans following its entry into the brain. This distinct pattern is clearly seen on imaging and its recognition may be valuable in the diagnosis of listeriosis. This finding may allow for

  9. Real-time PCR detection of Listeria monocytogenes in infant formula and lettuce following macrophage-based isolation and enrichment. (United States)

    Day, J B; Basavanna, U


    To develop a rapid detection procedure for Listeria monocytogenes in infant formula and lettuce using a macrophage-based enrichment protocol and real-time PCR. A macrophage cell culture system was employed for the isolation and enrichment of L. monocytogenes from infant formula and lettuce for subsequent identification using real-time PCR. Macrophage monolayers were exposed to infant formula and lettuce contaminated with a serial dilution series of L. monocytogenes. As few as approx. 10 CFU ml(-1) or g(-1) of L. monocytogenes were detected in infant formula and lettuce after 16 h postinfection by real-time PCR. Internal positive PCR controls were utilized to eliminate the possibility of false-negative results. Co-inoculation with Listeria innocua did not reduce the L. monocytogenes detection sensitivity. Intracellular L. monocytogenes could also be isolated on Listeria selective media from infected macrophage lysates for subsequent confirmation. The detection method is highly sensitive and specific for L. monocytogenes in infant formula and lettuce and establishes a rapid identification time of 20 and 48 h for presumptive and confirmatory identification, respectively. The method is a promising alternative to many currently used q-PCR detection methods which employ traditional selective media for enrichment of contaminated food samples. Macrophage enrichment of L. monocytogenes eliminates PCR inhibitory food elements and contaminating food microflora which produce cleaner samples that increase the rapidity and sensitivity of detection. Published 2014. This article is a U.S. Government work and is in the public domain in the USA.

  10. Transmission electron microscopy study of Listeria monocytogenes serotype 1/2a cells exposed to sublethal heat stress and carvacrol (United States)

    The objective of this study was to investigate the morphological changes that occurred in Listeria monocytogenes serotype 1/2a cells as visualized by transmission electron microscopy (TEM) after exposure to sublethal heat stress at 48°C for 60 min and in combination with lethal concentration of carv...

  11. Recipes for Antimicrobial Wine Marinades against Bacillus cereus, Escherichia coli O157:H7, Listeria monocytogenes, and Salmonella enterica (United States)

    We evaluated bactericidal activities of several antimicrobial wine recipes consisting of red and white wine extracts of oregano leaves with added garlic juice and oregano oil against Bacillus cereus, Escherichia coli O157:H7, Listeria monocytogenes, and Salmonella enterica. Dose-response plots were...

  12. Control of Escherichia coli and Listeria monocytogenes in suckling-lamb meat evaluated using microbial challenge tests

    NARCIS (Netherlands)

    Osés, S.M.; Diez, A.M.; Gómez, E.M.; Wilches-Pérez, D.; Luning, P.A.; Jaime, I.; Rovira, J.


    Escherichia coli and Listeria monocytogenes microbial challenge tests were performed on fresh suckling-lamb meat. Hind leg slices were chilly stored under two modified atmosphere packaging (MAP) environments (A: 15%O2/60%CO2/25%N2, B: 15%O2/30%CO2/55%N2) and vacuum packaging (V). Only E. coli was re

  13. Survival and growth of Listeria monocytogenes on whole cantaloupes is dependent on site of contamination and storage temperature (United States)

    Whole cantaloupes (Cucumis melo L), marketed as ‘Rocky Ford’, were implicated in a large multi-state outbreak of listeriosis in the United States in 2011; however, survival and growth of Listeria monocytogenes on whole cantaloupes remains relatively unexplored. The research presented here evaluated ...

  14. Inactivation of Listeria monocytogenes, Salmonella spp. and Escherichia coli O157:H7 on cantaloupes by octenidine hydrochloride (United States)

    This study investigated the efficacy of a new generation disinfectant, namely octenidine dihydrochloride (OH) as wash and coating treatments for reducing Listeria monocytogenes, Salmonella spp., and Escherichia coli O157:H7 on cantaloupe surface. Cantaloupe rind plugs inoculated separately with L. m...

  15. Inactivation of Salmonella enterica and Listeria monocytogenes in cantaloupe puree by high hydrostatic pressure with/without added ascorbic acid (United States)

    The objective of this research was to evaluate and develop a method for inactivation of Salmonella enterica and Listeria monocytogenes in cantaloupe puree (CP) by high hydrostatic pressure (HHP). Cantaloupe being the most netted varieties of melons presents a greater risk of pathogen transmission. ...

  16. Dynamic kinetic analysis of growth of Listeria monocytogenes in a simulated comminuted, non-cured cooked pork product (United States)

    The objective of this study was to directly construct a tertiary growth model for Listeria monocytogenes in cooked pork and simultaneously determine the kinetic parameters using a combination of dynamic and isothermal growth curves. Growth studies were conducted using a cocktail of 5 strains of L. ...

  17. The role of Listeria monocytogenes cell wall surface anchor protein LapB in virulence, adherence, and intracellular replication (United States)

    Lmof2365_2117 is a Listeria monocytogenes putative cell wall surface anchor protein with a conserved domain found in collagen binding proteins. We constructed a deletion mutation in lmof2365_2117 in serotype 4b strain F2365, evaluated its virulence, and determined its ability to adhere and invade co...

  18. Construction of a multiple fluorescence labeling system for use in co-invasion studies of Listeria monocytogenes

    DEFF Research Database (Denmark)

    Andersen, Jens Bo; Roldgaard, Bent; Lindner, A. B.


    Background Existing virulence models are often difficult to apply for quantitative comparison of invasion potentials of Listeria monocytogenes. Well-to-well variation between cell-line based in vitro assays is practically unavoidable, and variation between individual animals is the cause of large...

  19. Genetic determinants for cadmium and arsenic resistance among Listeria monocytogenes serotype 4b isolates from sporadic human listeriosis patients (United States)

    In Listeria monocytogenes serotype 4b from sporadic listeriosis, heavy metal resistance was primarily encountered in certain clonal groups (ECI, ECII, ECIa). All arsenic-resistant isolates harbored the arsenic resistance cassette previously identified in pLI100; ECIa harbored additional arsenic resi...

  20. Inactivation of Listeria monocytogenes in Skim Milk and Liquid Egg White by Antimicrobial Bottle Coating with Polylactic Acid and Nisin (United States)

    This study was to develop an antimicrobial bottle coating method to reduce the risk of outbreaks of human listeriosis caused by contaminated liquid foods. Liquid egg white and skim milk were inoculated with Listeria monocytogenes Scott A and stored in glass jars that were coated with a mixture of po...