2016-01-01
It was with great sadness that we learnt that Irene Vichou, our much appreciated ATLAS colleague, had passed away in April after an illness. Irene started work at CERN as a PhD student of the University of Athens with the West Area Omega experiment. From 1993, she worked with the ATLAS LAr calorimeter group from LAL Orsay, participating in calorimeter prototype beam tests and doing ATLAS’s first full simulation of photon and electron identification by calorimeters. In 1996, Irene joined the ATLAS Tile calorimeter community, and was a very active member of the collaboration from then on, initially working with the IFAE Barcelona team. She was involved in the first prototypes of caesium radioactive source calibration systems, optimising the optical uniformity of the Tile calorimeter. In the year 2000, Irene joined the University of Athens team at ATLAS. She worked on commissioning an important test bench to qualify the 10,000 photo-multiplier blocks assembled for the ATLAS Tile calorime...
Hurricane Irene Poster (August 27, 2011)
National Oceanic and Atmospheric Administration, Department of Commerce — Hurricane Irene poster. Color composite GOES image shows Irene moving through the North Carolina Outer Banks on August 27, 2011. Poster size is 36"x27"
Aldehyde Dehydrogenase 1 and Raf Kinase Inhibitor Protein ...
African Journals Online (AJOL)
Xiang-Xiu Sun1, Qing-Shan Ma2, Tian-Feng Liu1, Ying Chen1, Yan Dong1 and. Lin-Lin Zhang1* ... cancer was developed and studied by histological examination. Immunohistochemical and .... (diaminobenzidine) Kit. Western blot analysis.
Roos, Irene
2008-01-01
Tallinnas Lutheri kvartalis läbi kahe korruse paiknevast näidiskorterist. Sisustajad Irene Roos ja Ester Penjam. Paekiviseina kasutati sisustuselemendina, Philipsi valgustid jagasid ruumi eri tsoonideks. 9 värv. ill
Current status of the IREN project
International Nuclear Information System (INIS)
Furman, W.I.
1997-01-01
A current status and a corrected time-schedule of the project of the new Intense Resonance Neutron pulsed source (IREN) realized in JINR (Dubna) for experiments dealing with fundamental and applied nuclear physics studies are discussed. This source is the upgraded variant of the existing IBR-30 pulsed booster. It consists of the 200 MeV electron linac and supplying by an electron beam the photo-neutron converter placed in the center of the very fast multiplying subcritical core. The existing buildings and beam infrastructure are planned to adopt for the new IREN source. The aim of the project is to improve essentially an energy resolution of the time-of-flight spectrometer and to increase twice (up to 10 15 n/sec) an integral neutron yield. An implementation of the IREN project has started in June 1994 with the planned end in December 1997. But due to mainly insufficient financing the approved time-schedule is shifted. Now most optimistic time of start-up of the neutron source is the end of 1999
Energy Technology Data Exchange (ETDEWEB)
Noordenbos, G. [Joke Smit Instituut voor Vrouwenstudies, Universiteit Leiden, Leiden (Netherlands)
2003-07-01
Marie Curie was awarded the Nobel Prize in 1903 and in 1911. Also her daughter, Irene Joliot-Curie, received a Nobel Prize for science in 1935. In this book an overview is given of the academic world at that time: limited access to universities for women, the carriers of both women in physics and their pioneering research and discoveries, the refusal of Marie Curie by the French Academy of Sciences, the awarding of the Nobel Prize and the assignment of Irene Joliot-Curie as the first female minister in France, the impact of the two World Wars, their married and private lives and the constant smear campaign of the press against both women. The lives and works of both women are hold against the light of the present position of women in physical sciences. [Dutch] In 1903, precies honderd jaar geleden, ontving Marie Curie als eerste vrouw de Nobelprijs voor de Wetenschap, gevolgd door een tweede Nobelprijs in 1911. Ook haar dochter Irene Joliot-Curie kreeg de Nobelprijs voor de wetenschap in 1935. Marie and Irene Curie schetst een breed beeld van de academische wereld waarin beide vrouwen zich bewogen: de beperkte toegang van vrouwen tot de universiteit, hun carrisres in de natuurkunde en baanbrekende ontdekkingen, de afwijzing van Marie door de Franse Academie des Sciences, de toekenning van de Nobelprijs en de benoeming van Irene als eerste vrouwelijke minister in Frankrijk, de invloed van de twee Wereldoorlogen, hun huwelijks- en priveleven en de niet aflatende hetze van de pers tegen beiden. In de door mannen gedomineerde wereld van de natuurwetenschappen liep de uitzonderingspositie van beide vrouwen als rode draad door hun curieuze levens. Het leven en werk van de Curies wordt geactualiseerd door deze tegen het licht te houden van de huidige positie van vrouwen in de natuurwetenschappen. Het bereiken van de top van de wetenschap door vrouwen blijkt nog steeds uitzonderlijk.
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science. H CHEN. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...
Dr. Irene Sänger-Bredt, a life for astronautics
Zaganescu, Nicolae-Florin
2004-12-01
Irene Bredt (b.1911 at Bonn) obtained her Doctorate in Physics in 1937; in the same year she became a scientific researcher at the German Research Center for Aviation at Trauen, led by Prof. Dr. Eugen Sänger. Soon, the young but efficient Dr. Irene Bredt became the first assistant of Dr. Sänger, who married her (1951). During 1973-1978, Dr. Bredt was in correspondence with Prof. Dr. Nikolae-Florin Zaganescu and helped him to familiarize the Romanian readers with Prof. Sänger's life and achievements. As for Dr. Bredt's life, she specified three main periods of her activity: 1937-1942, when she was researcher in charge of thermodynamic problems of liquid-fuelled rocket engines at Trauen 1942-1945, when she was Senior Researcher in charge of Ramjet in flight performances at Ainring, and also coauthored the Top Secret Technical report entitled 'A Rocket Engine for a Long-Range Bomber', which was finished in 1941 but edited only in 1944 the post world war II period, when she was Scientific Advisor or Director at various civil and military research institutes, universities, etc. Dr. Irene Sänger-Bredt helped her husband to develop many scientific theories like Ramjet thermodynamic theory, and photon rocket theory and also in establishing IAF and IAA. In 1970, Dr. Irene Sänger-Bredt was honored with 'Hermann Oberth Gold Medal' for her impressive scientific activity.
Kodumaine ja nooruslik / Piret Veigel, Irene Roos
Veigel, Piret, 1961-
2003-01-01
Arhitekt Vahur Sova projekteeritud ökomaja eeskujul kujundatud elutuba. Värvivalik on inspireeritud looduse sügistalvistest toonidest ja naturaalsetest materjalidest. Stilistid Piret Veigel ja Irene Roos. Vineerkapi on kujundanud Tarmo Luisk, laua Jan J. Graps, sirmi Igor Volkov
Irene Merik 80 : avara kultuuritunnetusega kodu-uurija / Eva Maaring
Maaring, Eva
2011-01-01
1987. aastast on Irene Merik Tallinna Linnamuuseumi kodu-uurimisringi ja Eesti Muinsuskaitse Seltsi, 1989. aastast Eestirootslaste Kultuuri Seltsi liige. Juubilar on uurinud eelkõige Tallinna ajalugu
Horseshoes in modified Chen's attractors
International Nuclear Information System (INIS)
Huang Yan; Yang Xiaosong
2005-01-01
In this paper we study dynamics of a class of modified Chen's attractors, we show that these attractors are chaotic by giving a rigorous verification for existence of horseshoes in these systems. We prove that the Poincare maps derived from these modified Chen's attractors are semi-conjugate to the 2-shift map
Two wives in science service: Marie Curie and Irene Joliot-Curie
International Nuclear Information System (INIS)
Bordry, M.
1996-01-01
This paper relates the life and the scientific works of Marie Curie and of her daughter Irene Joliot-Curie in their historical context. Several details are given about their laboratory works, their relations with students, the creation of the Radium Institute and the role they played during the two world wars. The progress of their works towards their main scientific discoveries (polonium, radium, artificial radioactivity, transuranium compounds etc..) is illustrated with some extracts of their personal correspondence with relatives. The paper evokes also the Nobel prices received by Pierre and Marie Curie and by Irene and Frederic Joliot and the creation of the CEA by Frederic Joliot in 1946. (J.S.). 6 photos
Titanisierung von Implantatoberflächen
Zimmermann, Hanngörg; Heinlein, Markus; Guldner, Norbert W.
Titan gilt seit Jahrzehnten als einer der wichtigsten Implantatwerkstoffe in der Medizin. Neben den guten mechanischen Eigenschaften (Leichtigkeit, hohe Festigkeit etc.), besitzen Titanimplantate vor allem eine hervorragende Körperverträglichkeit, so dass die Implantate optimal in den humanen Organismus integriert werden [1]. Ist jedoch aufgrund der Anforderungen an das Implantat eine hohe Flexibilität und/ oder Elastizität gefragt, so scheidet der Werkstoff Titan aufgrund seiner spröden und unflexiblen Materialeigenschaften aus. Die Folge ist der Einsatz von Implantatmaterialien, sowohl künstlichen als auch biologischen Ursprungs, welche nicht selten eine unzureichende Biokompatibilität aufweisen und somit zu Fremdköper- und immunologischen Reaktionen und Einkapselung des Implantates führen können. Die Erhöhung der Körperverträglichkeit, eine Adaption an das biologische Umfeld und eine hohe Biokompatibilität sind demzufolge die wichtigsten Eigenschaften bei der bedarfsgerechten Herstellung von Implantaten und Implantatoberflächen. Zur Gestaltung von innovativen, biokompatiblen Oberflächen stehen unterschiedliche technische Lösungsansätze zur Verfügung. Zum einen besteht die Möglichkeit, geeignete Oberflächeneigenschaften aus dem Grundmaterial selbst zu optimieren. Dies geschieht unter anderem durch Modifikation der Werkstoffoberflächen in Form von Texturierungen und Oberflächenrauhigkeiten. Zum anderen können die Oberflächeneigenschaften unabhängig von denen des Trägermaterials gestaltet werden. Durch Funktionalisierung der Oberflächen mit geeigneten Beschichtungen oder der Zugabe von Medikamenten (Drug Eluting) werden die Kunststoffimplantate dahingehend verändert, dass eine Steigerung der Körperakzeptanz erreicht wird. Die Titanbeschichtung von Implantatoberflächen kombiniert die positiven Materialeigenschaften von Titan und Polymer.
DEFF Research Database (Denmark)
Gimpel, Denise
been the first to write children’s literature. In 1914 she was among the first group of women to gain a Boxer Indemnity grant to study in America. The reiteration of these many “firsts” has led to a rather stereotypical portrait of Chen Hengzhe in Chinese sources and, as a result, in most Western...
Future neutron data activity on the neutron source IREN
International Nuclear Information System (INIS)
Janeva, N.B.; Koyumdjieva, N.T.; Grigoriev, Y.V.; Gundorin, N.A.; Mareev, Y.D.; Kopatch, Y.N.; Pikelner, L.B.; Shvetsov, V.N.; Sedyshev, P.V.; Zeinalov, S.; Ruskov, I.N.
2011-01-01
The global energy demand continues to rise and nuclear power has a potential to be part of the solution of energy problem. Complete and accurate information about the nuclear reactions ensures developing and operating nuclear reactors to reach high efficiencies and adequate safety standards. This demands many nuclear data of improved quality, including covariance nuclear data and correlations. The new neutron source IREN (1 stage) has been put in operation at the end of 2009. The first stage includes the construction of the LUE-200 linear accelerator and non multiplying target. The first measured TOF spectra have been presented recently. The facility is in continuous completion and improvement (according to the full version in the project). The program for neutron data investigation on the IREN neutron source is in preparation. The measuring targets for neutron cross-sections TOF spectra would be selected between isotopes of construction materials, fission products and minor actinides. Now the experimental facilities are in preparation - detectors, innovative electronics equipment and systems for data acquisition and analysis. (authors)
International Nuclear Information System (INIS)
Hughes, B.D.; Frankel, N.E.; Ninham, B.W.
1990-01-01
An alternative view is presented of the Chen's generalization of a formula of classic algebraic number theory, based on the Mellin transformation and Reimann's zeta function. The advantages of the Mellin transform, as a method with a primary role in asymptotic analysis, are outlined. 10 refs
Tropical storm Irene flood of August 2011 in northwestern Massachusetts
Bent, Gardner C.; Olson, Scott A.; Massey, Andrew J.
2016-09-02
A Presidential disaster was declared in northwestern Massachusetts, following flooding from tropical storm Irene on August 28, 2011. During the storm, 3 to 10 inches of rain fell on soils that were susceptible to flash flooding because of wet antecedent conditions. The gage height at one U.S. Geological Survey streamgage rose nearly 20 feet in less than 4 hours because of the combination of saturated soils and intense rainfall. On August 28, 2011, in the Deerfield and Hoosic River Basins in northwestern Massachusetts, new peaks of record were set at six of eight U.S. Geological Survey long-term streamgages with 46 to 100 years of record. Additionally, high-water marks were surveyed and indirect measurements of peak discharge were calculated at two discontinued streamgages in the Deerfield and Hoosic River Basins with 24 and 61 years of record, respectively. This data resulted in new historic peaks of record at the two discontinued streamgages from tropical storm Irene.
Stability analysis of distributed order fractional chen system.
Aminikhah, H; Refahi Sheikhani, A; Rezazadeh, H
2013-01-01
We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results.
Stability Analysis of Distributed Order Fractional Chen System
Aminikhah, H.; Refahi Sheikhani, A.; Rezazadeh, H.
2013-01-01
We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results. PMID:24489508
Complete synchronization of two Chen-Lee systems
International Nuclear Information System (INIS)
Sheu, L-J; Chen, J-H; Chen, H-K; Tam, L-M; Lao, S-K; Chen, W-C; Lin, K-T
2008-01-01
This study demonstrates that complete synchronization of two Chen-Lee chaotic systems can be easily achieved. The upper bound of the Chen-Lee chaotic system is estimated numerically. A controller is designed to synchronize two chaotic systems. Sufficient conditions for synchronization are obtained using Lyapunov's direct method. Two numerical examples are presented to verify the proposed synchronization approach
Hurricane Irene: a Wake Up Call for New York City?
Aerts, J.C.J.H.; Botzen, W.J.W.
2012-01-01
The weakening of Irene from a Category 3 hurricane to a tropical storm resulted in less damage in New York City (NYC) than initially was anticipated. It is widely recognized that the storm surge and associated flooding could have been much more severe. In a recent study, we showed that a direct hit
Eine praktische Anwendung von CMC-Flächen in der Bionik
Apeltauer, Christian
2011-01-01
Die vorliegende Arbeit beschäftigt sich mit den theoretischen Grundlagen für die Entwicklung von Oberflächen, die unter Wasser möglichst lange eine Luftschicht an sich halten können. Ein natürliches Vorbild für solche Oberflächen ist die Pflanze Salvinia molesta; technisch interessieren solche Oberflächen zur Verringerung des Wasserwiderstandes von Schiffen und als Schutz vor Besiedlung durch Wasserorganismen. Wichtigste Gleichung bei der Entwicklung solcher Oberflächen ist...
International Nuclear Information System (INIS)
Anan'ev, V.D.; Furman, W.I.; Kobets, V.V.; Meshkov, I.N.; Pyataev, V.G.; Shirkov, G.D.; Shvets, V.A.; Sumbaev, A.P.; Kuatbekov, R.P.; Tret'yakov, I.T.; Frolov, A.R.; Gurov, S.M.; Logachev, P.V.; Pavlov, V.M.; Skarbo, B.A.
2005-01-01
An accelerator-driven subcritical system (200 MeV electron linac + metallic plutonium subcritical core) IREN is constructed at the Joint Institute for Nuclear Research (JINR). The new pulsed neutron source IREN is optimized for maximal yield of resonance neutrons (1-10 5 eV). The S-band electron linac with a pulse duration near 200 ns, repetition rate up to 150 Hz and the mean beam power 10 kW delivers 200-MeV electrons onto a specially designed tungsten target (an electron-neutron converter) situated in the center of a very compact and fast subcritical assembly with K eff 15 per second. A mean fission power of the multiplying target is planned to be near 15 kW. The current status of the project is presented
Source, conveyance and fate of suspended sediments following Hurricane Irene. New England, USA
Yellen, Brian; Woodruff, Jon D.; Kratz, Laura N.; Mabee, Steven B.; Morrison, Jonathan; Martini, Anna M.
2014-01-01
Hurricane Irene passed directly over the Connecticut River valley in late August, 2011. Intense precipitation and high antecedent soil moisture resulted in record flooding, mass wasting and fluvial erosion, allowing for observations of how these rare but significant extreme events affect a landscape still responding to Pleistocene glaciation and associated sediment emplacement. Clays and silts from upland glacial deposits, once suspended in the stream network, were routed directly to the mouth of the Connecticut River, resulting in record-breaking sediment loads fifteen-times greater than predicted from the pre-existing rating curve. Denudation was particularly extensive in mountainous areas. We calculate that sediment yield during the event from the Deerfield River, a steep tributary comprising 5% of the entire Connecticut River watershed, exceeded at minimum 10–40 years of routine sediment discharge and accounted for approximately 40% of the total event sediment discharge from the Connecticut River. A series of surface sediment cores taken in floodplain ponds adjacent to the tidal section of the Connecticut River before and after the event provides insight into differences in sediment sourcing and routing for the Irene event compared to periods of more routine flooding. Relative to routine conditions, sedimentation from Irene was anomalously inorganic, fine grained, and enriched in elements commonly found in chemically immature glacial tills and glaciolacustrine material. These unique sedimentary characteristics document the crucial role played by extreme precipitation from tropical disturbances in denuding this landscape.
Mechanical analysis of Chen chaotic system
International Nuclear Information System (INIS)
Liang, Xiyin; Qi, Guoyuan
2017-01-01
The Chen chaotic system is transformed into Kolmogorov type system, which is decomposed into four types of torques: inertial torque, internal torque, dissipation and external torque. By the combinations of different torques, five cases are studied to discover key factors of chaos generation and the physical meaning. The conversion among Hamiltonian energy, kinetic energy and potential energy is investigated in these five cases. The relationship between the energies and the parameters is studied. It concludes that the combination of these four types of torques is necessary conditions to produce chaos, and any combination of three types of torques cannot produce chaos in Chen system.
On a conjecture of Chen-Guo-Wang
Ning, Bo; Zheng, Yu
2015-01-01
Towards confirming Sun's conjecture on the strict log-concavity of combinatorial sequence involving the n$th$ Bernoulli number, Chen, Guo and Wang proposed a conjecture about the log-concavity of the function $\\theta(x)=\\sqrt[x]{2\\zeta(x)\\Gamma(x+1)}$ for $x\\in (6,\\infty)$, where $\\zeta(x)$ is the Riemann zeta function and $\\Gamma(x)$ is the Gamma function. In this paper, we first prove this conjecture along the spirit of Zhu's previous work. Second, we extend Chen et al.'s conjecture in the ...
DEFF Research Database (Denmark)
Gimpel, Denise
Chen Hengzhe has been celebrated as China’s first female professor, first professor of Western history, first person to publish a history of the West that was not a translation into Chinese. She is moreover celebrated as one of the first to write fiction and poetry in the vernacular and to have......; they speak to important questions in China today. This study, then, is not a biography of a person; it is an attempt to understand the way in which foreign influences (narratives of being, organizing, thinking, writing) seep into a person’s life and work and meld with the “home” influences (narratives...
Adaptive synchronization of hyperchaotic Chen system with uncertain parameters
International Nuclear Information System (INIS)
Park, Ju H.
2005-01-01
This article addresses control for the chaos synchronization of hyperchaotic Chen system with five uncertain parameters. Based on the Lyapunov stability theory, an adaptive control law is derived to make the states of two identical hyperchaotic Chen systems asymptotically synchronized. Finally, a numerical simulations is presented to show the effectiveness of the proposed chaos synchronization scheme
Pension Fund - ELECTIONS - Irene SEIS
2002-01-01
CERN - EUROPEAN ORGANIZATION FOR NUCLEAR RESEARCH PENSION FUND This candidature has been duly registered and is hereby presented in accordance with paragraph 6.h of the Regulations for Elections to the Governing Board of the Pension Fund. Candidate: Name: SEIS First Name : Irene Our Pension Fund (that of CERN and ESO personnel) is for most of us the only social protection when we retire. Its purpose is to give us a pension, which permits to maintain a certain standard of living for us, and for our dependants. I have worked in the Governing Board of the Pension Fund, as well as in numerous working groups on pension matters, since 11 years, either in my role as a Staff Association delegate, or as a member of the Governing Board. In both environments, I defend the principles of solidarity, which are part of our social security system, and I stand up for maintaining its primary principle, being a defined benefit scheme. Another of my preoccupations is the long-term future of the fund, including the gu...
Chaos in the fractional order Chen system and its control
International Nuclear Information System (INIS)
Li Chunguang; Chen Guanrong
2004-01-01
In this letter, we study the chaotic behaviors in the fractional order Chen system. We found that chaos exists in the fractional order Chen system with order less than 3. The lowest order we found to have chaos in this system is 2.1. Linear feedback control of chaos in this system is also studied
A simple observer of the generalized Chen chaotic systems
International Nuclear Information System (INIS)
Sun, Y.-J.
2009-01-01
In this paper, the generalized Chen chaotic system is considered and the state observation problem of such a system is investigated. Based on the time-domain approach, a simple observer for the generalized Chen chaotic system is proposed to guarantee the global exponential stability of the resulting error system. Furthermore, the guaranteed exponential convergence rate can be correctly estimated. Finally, a numerical example is provided to illustrate the use of the main result.
The age grading and the Chen-Ruan cup product
DEFF Research Database (Denmark)
A. Hepworth, Richard
2010-01-01
We prove that the obstruction bundle used to define the cup-product in Chen-Ruan cohomology is determined by the so-called `age grading' or `degree-shifting numbers'. Indeed, the obstruction bundle can be directly computed using the age grading. We obtain a Kunneth Theorem for Chen-Ruan cohomology...... as a direct consequence of an elementary property of the age grading, and explain how several other results - including associativity of the cup-product - can be proved in a similar way....
Immunogenicity of novel sulfadimethoxide conjugates | Chen ...
African Journals Online (AJOL)
Immunogenicity of novel sulfadimethoxide conjugates. L Chen, J Su, X Zhang, L Li, X He. Abstract. Sulfadimethoxine (SDM) is an antibiotic commonly added to animal feeds. Anti-SDM antibodies are useful for the detection of residual SDM in foods, feeds and biological fluids by ELISA. In this study, we show that SDM is ...
Alternative implementation of the chaotic Chen-Lee system
International Nuclear Information System (INIS)
Sheu, L.-J.; Tam, L.-M.; Chen, H.-K.; Lao, S.-K.
2009-01-01
The chaotic Chen-Lee system was developed with a formalism based on the Euler equations for the motion of a rigid body. It was proved that this system is the governing set of equations for gyro motion with feedback control. Recently, studies were conducted to explore the dynamic behavior of this system, including fractional order behavior, the generation of hyperchaos and perturbation analysis, control and anti-control of chaos, synchronization, etc. In this study, we further explore (1) the stability of the equilibrium points and (2) the implementation of an electronic circuit using the Chen-Lee system. It is shown that not only is this system related to gyro motion but can also be applied to electronic circuits for encryption purposes.
Tropospheric Ozone Climatology over Irene, South Africa, From 1990-1994 and 1998-2002
Diab, R. D.; Thompson, A. M.; Marl, K.; Ramsay, L.; Coetzee, G. J. R.
2004-01-01
This paper describes ozone profiles from sonde data during the period of NASA s TRACE-A and the more recent SHADOZ (Southern Hemisphere Additional Ozonesondes) period. The data were taken by the South African Weather Service at the Irene (25 deg.54 min S; 28 deg. 13 min. E) station near Pretoria, South Africa, an area that is a unique mixture of local industry, heavy biofuels use and importation of biomass burning ozone from neighboring countries to the north. The main findings are: (1) With its geographical position at the edge of the subtropical transition zone, mid- latitude dynamical influences are evident at Irene, predominantly in winter when upper tropospheric ozone is enhanced as a result of stratospheric-tropospheric exchange. (2) There has been an increase in the near-surface ozone amount between the early 1990s and a decade later, presumably due to an influx of rural population toward the Johannesburg-Pretoria area, as well as with industrial growth and development. (3) Most significant for developing approaches for satellite ozone profile climatologies, cluster analysis has enabled the delineation of a background and "most polluted" profile. Enhancements of at least 30% occur throughout the troposphere in spring and in certain layers increases of 100 % are observed.
Hopf bifurcation analysis of Chen circuit with direct time delay feedback
International Nuclear Information System (INIS)
Hai-Peng, Ren; Wen-Chao, Li; Ding, Liu
2010-01-01
Direct time delay feedback can make non-chaotic Chen circuit chaotic. The chaotic Chen circuit with direct time delay feedback possesses rich and complex dynamical behaviours. To reach a deep and clear understanding of the dynamics of such circuits described by delay differential equations, Hopf bifurcation in the circuit is analysed using the Hopf bifurcation theory and the central manifold theorem in this paper. Bifurcation points and bifurcation directions are derived in detail, which prove to be consistent with the previous bifurcation diagram. Numerical simulations and experimental results are given to verify the theoretical analysis. Hopf bifurcation analysis can explain and predict the periodical orbit (oscillation) in Chen circuit with direct time delay feedback. Bifurcation boundaries are derived using the Hopf bifurcation analysis, which will be helpful for determining the parameters in the stabilisation of the originally chaotic circuit
Directory of Open Access Journals (Sweden)
G. Clain
2009-03-01
Full Text Available This paper presents a climatology and trends of tropospheric ozone in the Southwestern Indian Ocean (Reunion Island and South Africa (Irene and Johannesburg. This study is based on a multi-instrumental dataset: PTU-O3 ozonesondes, DIAL LIDAR and MOZAIC airborne instrumentation.
The seasonal profiles of tropospheric ozone at Reunion Island have been calculated from two different data sets: ozonesondes and LIDAR. The two climatological profiles are similar, except in austral summer when the LIDAR profiles show greater values in the free troposphere, and in the upper troposphere when the LIDAR profiles show lower values during all seasons. These results show that the climatological value of LIDAR profiles must be discussed with care since LIDAR measurements can be performed only under clear sky conditions, and the upper limit of the profile depends on the signal strength.
In addition, linear trends have been calculated from ozonesonde data at Reunion and Irene. Considering the whole tropospheric column, the trend is slightly positive for Reunion, and more clearly positive for Irene. Trend calculations have also been made separating the troposphere into three layers, and separating the dataset into seasons. Results show that the positive trend for Irene is governed by the lower layer that is affected by industrial pollution and biomass burning. On the contrary, for Reunion Island, the strongest trends are observed in the upper troposphere, and in winter when stratosphere-troposphere exchange is more frequently expected.
Synchronization and anti-synchronization coexist in Chen-Lee chaotic systems
International Nuclear Information System (INIS)
Chen, J.-H.; Chen, H.-K.; Lin, Y.-K.
2009-01-01
This study demonstrates that synchronization and anti-synchronization can coexist in Chen-Lee chaotic systems by direct linear coupling. Based on Lyapunov's direct method, a linear controller was designed to assure that two different types of synchronization can simultaneously be achieved. Further, the hybrid projective synchronization of Chen-Lee chaotic systems was studied using a nonlinear control scheme. The nonlinear controller was designed according to the Lyapunov stability theory to guarantee the hybrid projective synchronization, including synchronization, anti-synchronization, and projective synchronization. Finally, numerical examples are presented in order to illustrate the proposed synchronization approach.
Dynamics of the chemical composition of rainwater throughout Hurricane Irene
Directory of Open Access Journals (Sweden)
K. M. Mullaugh
2013-03-01
Full Text Available Sequential sampling of rainwater from Hurricane Irene was carried out in Wilmington, NC, USA on 26 and 27 August 2011. Eleven samples were analyzed for pH, major ions (Cl−, NO3−, SO42−, Na+, K+, Mg2+, Ca2+, NH4+, dissolved organic carbon (DOC and hydrogen peroxide (H2O2. Hurricane Irene contributed 16% of the total rainwater and 18% of the total chloride wet deposition received in Wilmington NC during all of 2011. This work highlights the main physical factors influencing the chemical composition of tropical storm rainwater: wind speed, wind direction, back trajectory and vertical mixing, time of day and total rain volume. Samples collected early in the storm, when winds blew out of the east, contained dissolved components indicative of marine sources (salts from sea spray and low DOC. The sea-salt components in the samples had two maxima in concentration during the storm the first of which occurred before the volume of rain had sufficiently washed out sea salt from the atmosphere and the second when back trajectories showed large volumes of marine surface air were lifted. As the storm progressed and winds shifted to a westerly direction, the chemical composition of the rainwater became characteristic of terrestrial storms (high DOC and NH4+ and low sea salt. This work demonstrates that tropical storms are not only responsible for significant wet deposition of marine components to land, but terrestrial components can also become entrained in rainwater, which can then be delivered to coastal waters via wet deposition. This study also underscores why analysis of one composite sample can lead to an incomplete interpretation of the factors that influence the chemically divergent analytes in rainwater during extreme weather events.
Parametric study of the fractional-order Chen-Lee system
International Nuclear Information System (INIS)
Tam, L.M.; Tou, W.M.S.
2008-01-01
The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q 1 = q 2 = q 3 = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found
Parametric study of the fractional-order Chen-Lee system
Energy Technology Data Exchange (ETDEWEB)
Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Tou, W.M.S. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)
2008-08-15
The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q{sub 1} = q{sub 2} = q{sub 3} = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found.
Physical startup of the first stage of the IREN facility
International Nuclear Information System (INIS)
Belozerov, A.V.; Boettcher, Yu.; Bulycheva, Yu.K.
2010-01-01
It is reported on the startup of the first stage of the Intense REsonance Neutron source installation (IREN) at the Frank Laboratory of Neutron Physics of the Joint Institute for Nuclear Research. The general scheme and current status of the electron linear accelerator with accelerating structure on an S-band traveling wave (f = 2856 MHz) are presented. Results of adjustment of the basic functional systems of the linac and the measured parameters of the beam (pulse current of the beam 1.5 A, electron energy 30 MeV; duration of a pulse current 100 ns; rep. rate 25 Hz) are reported. The integral neutron yield from a nonmultiplying target reaches (3-5)·10 10 s -1
2009-01-01
Küsimusele vastavad Rahvusooper Estonia balleti kunstiline juht Toomas Edur, koolitaja Tauri Tallermaa, haridus- ja teadusministeeriumi osakonnajuhataja Irene Käosaar, Tartu Karlova Gümnaasiumi direktor Undel Kokk ja näitleja Andrus Vaarik
Dynamics of fractional-ordered Chen system with delay
Indian Academy of Sciences (India)
Though this subject has a history of more than 300 years, utility and applicability of fractional calculus to various branches of science and engineering have been real- ... variants of Chen system and see the qualitative changes in attractor and ...
Craddock, Hillary A; Walsh, Lauren; Strauss-Riggs, Kandra; Schor, Kenneth
2016-08-01
Hurricanes Sandy and Irene damaged and destroyed homes, businesses, and infrastructure, and recovery after these storms took years. The goal of this article was to learn from the lived experience of local-level decision-makers actively involved in the long-term disaster recovery process after Hurricanes Irene and Sandy. Respondents provided professional recommendations, based on their experience, to assist other organizations in preparing for, responding to, and recovering from disasters. Semi-structured interviews were conducted with professionals actively involved in recovery from Hurricane Irene or Hurricane Sandy in 5 different communities. Transcripts were qualitatively analyzed. Respondents' advice fell into 5 main categories: planning and evaluation, education and training, fundraising and donations management, building relationships, and disaster behavioral health. The lived experience of those in disaster recovery can provide guidance for planning, education, and training both within and outside their communities in order to better respond to and recover from future disasters. These data help to facilitate a community of practice by compiling and sharing the lived experience of leaders who experienced large-scale disasters, and the outcomes of this analysis help to show what areas of planning require special attention in the phases of preparedness, response, and recovery. (Disaster Med Public Health Preparedness. 2016;10:623-630).
Comparing numerical methods for the solutions of the Chen system
International Nuclear Information System (INIS)
Noorani, M.S.M.; Hashim, I.; Ahmad, R.; Bakar, S.A.; Ismail, E.S.; Zakaria, A.M.
2007-01-01
In this paper, the Adomian decomposition method (ADM) is applied to the Chen system which is a three-dimensional system of ODEs with quadratic nonlinearities. The ADM yields an analytical solution in terms of a rapidly convergent infinite power series with easily computable terms. Comparisons between the decomposition solutions and the classical fourth-order Runge-Kutta (RK4) numerical solutions are made. In particular we look at the accuracy of the ADM as the Chen system changes from a non-chaotic system to a chaotic one. To highlight some computational difficulties due to a high Lyapunov exponent, a comparison with the Lorenz system is given
Metsis, Irene
2009-01-01
Skanska EMV administratsioonijuhi Irene Metsise, AS-i Elisa Eesti tegevdirektori Sami Seppäneni ja Pindi Kinnisvara juhatuse liikme Peep Soomani soovitused negatiivse sõnumi edastamiseks töötajale. Vt. samas: 4 nõuannet juhile, kuidas end keeruliseks vestluseks ette valmistada
Impulsive synchronization of Chen's hyperchaotic system
International Nuclear Information System (INIS)
Haeri, Mohammad; Dehghani, Mahsa
2006-01-01
In this Letter the impulsive synchronization of the Chen's hyperchaotic systems is discussed. Some new and sufficient conditions on varying impulsive distance are established in order to guarantee the synchronizabillity of the systems using the synchronization method. In particular, some simple conditions are derived in synchronizing the systems by equal impulsive distances. Two illustrative examples are provided to show the feasibility and the effectiveness of the proposed method. The boundaries of the stable regions are also estimated
Ningrum, R. W.; Surarso, B.; Farikhin; Safarudin, Y. M.
2018-03-01
This paper proposes the combination of Firefly Algorithm (FA) and Chen Fuzzy Time Series Forecasting. Most of the existing fuzzy forecasting methods based on fuzzy time series use the static length of intervals. Therefore, we apply an artificial intelligence, i.e., Firefly Algorithm (FA) to set non-stationary length of intervals for each cluster on Chen Method. The method is evaluated by applying on the Jakarta Composite Index (IHSG) and compare with classical Chen Fuzzy Time Series Forecasting. Its performance verified through simulation using Matlab.
Lapikova, Natalja
2008-01-01
Küsimusele vastavad Tallinna Haridusameti hariduskorralduse teenistuse üldhariduse osakonna vanemspetsialist Natalja Lapikova, Tallinna Kesklinna Vene Gümnaasiumi direktor Vjatšeslav Gussarov ja HTM-i rahvusvähemuste hariduse osakonna juhataja Irene Käosaar
Sociology in Times of Crisis: Chen Da, National Salvation and the Indigenization of Knowledge
Directory of Open Access Journals (Sweden)
Ana Maria Candela
2015-08-01
Full Text Available Chen Da was one of the foremost sociologists of China from the 1920s to the 1940s. His intellectual habitus took shape from the long crisis that defined Chinese intellectual life from the mid-19th to mid-20th centuries, a period of continuous imperial assault on Chinese sovereignty. As China integrated into the capitalist world-system, neo-Confucian structures of knowledge came into question. Intellectuals took up sociology to guide China’s transition from an empire to a nation-state. Through his studies on labor, migration, and population, Chen Da contributed to the institutionalization of sociology in China. Chen sought to craft a theory of Chinese development that followed universal trajectories of progress but was also attuned to the complexity of Chinese society on the ground. Through his efforts to indigenize sociology, Chen developed a non-Marxist historical materialism, a deterritorialized and pluralistic conceptualization of China as a nation, and a theory of eugenic transformation centered on the concept of “mode of living.” The questions which Chen Da confronted are emblematic of the predicament faced by Chinese social scientists today, who again struggle with the dynamics of a deterritorialzied “Greater China,” rising social fragmentation, and refigured eugenic discourses and policies that aim to craft the Chinese people into ideal national subjects fit for post-socialist development.
A numeric-analytic method for approximating the chaotic Chen system
International Nuclear Information System (INIS)
Mossa Al-sawalha, M.; Noorani, M.S.M.
2009-01-01
The epitome of this paper centers on the application of the differential transformation method (DTM) the renowned Chen system which is described as a three-dimensional system of ODEs with quadratic nonlinearities. Numerical comparisons are made between the DTM and the classical fourth-order Runge-Kutta method (RK4). Our work showcases the precision of the DTM as the Chen system transforms from a non-chaotic system to a chaotic one. Since the Lyapunov exponent for this system is much higher compared to other chaotic systems, we shall highlight the difficulties of the simulations with respect to its accuracy. We wrap up our investigations to reveal that this direct symbolic-numeric scheme is effective and accurate.
Chang, Zhi-Min; Yang, Lin; Zhang, Zheng-Guang; Chen, Xiang-Sheng
2015-12-11
Two new species of the issid genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae): Neotetricodes longispinus Chang et Chen sp. nov. (China: Yunnan) and Neotetricodes xiphoideus Chang et Chen sp. nov. (China: Yunnan) are described and illustrated. The generic characteristic is redefined. A checklist and key to the species of the genus are provided. The female genitalia of the genus are firstly described.
How Memory Is Tested Influences What Is Measured: Reply to Wyble and Chen (2017)
Swallow, Khena M.; Jiang, Yuhong V.; Tan, Deborah H.
2017-01-01
In this response to Wyble and Chen's (2017) commentary on attribute amnesia, we hope to achieve several goals. First, we clarify how our view diverges from that described by Wyble and Chen. We argue that because the surprise memory test is disruptive, it is an insensitive tool for measuring the persistence of recently attended target attributes in…
Brief communication "Hurricane Irene: a wake-up call for New York City?"
Directory of Open Access Journals (Sweden)
J. C. J. H. Aerts
2012-06-01
Full Text Available The weakening of Irene from a Category 3 hurricane to a tropical storm resulted in less damage in New York City (NYC than initially was anticipated. It is widely recognized that the storm surge and associated flooding could have been much more severe. In a recent study, we showed that a direct hit to the city from a hurricane may expose an enormous number of people to flooding. A major hurricane has the potential to cause large-scale damage in NYC. The city's resilience to flooding can be increased by improving and integrating flood insurance, flood zoning, and building code policies.
Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe
Spinner, Kaspar H.
2014-01-01
Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe. - In: Standardorientierung im Lese- und Literaturunterricht der Sekundarstufe I / Cornelia Rosebrock ; Heike Wirthwein. - Baltmannsweiler : Schneider-Verl. Hohengehren, 2014. - S. 126-132
Ronald Malt or Chen Zhongwei: Who performed the first surgical replantation?
Fan, Ka-Wai
2018-01-01
This article discusses the contributions of the two pioneers of the surgical procedure of replantation-Ronald Malt in the US and Chen Zhongwei in China. Ronald Malt performed the reattachment surgery on a boy who had an accident in 1962, but he published his case report two years later in 1964. Chen Zhongwei performed a similar surgery on a worker who cut off his forearm in 1963, but he published his case report the same year. There is some debate about which one of these reputed surgeons should be given credit for being the first one to perform this breakthrough surgery, because although Malt was the first to perform the procedure, Zhongwei was the first to report it. To shed light on this controversy, criteria for scientific priority suggested by Ronald Vale and Anthony Hyman were applied. Although the criteria mainly favored Zhongwei as the pioneer of this procedure, he did not entirely fulfill one of the criteria. Therefore, the article could not present a definitive answer to the question, and it concludes by pointing out the highly commendable achievements and contributions of both Ronald Malt and Chen Zhongwei.
Chaos control of Chen chaotic dynamical system
International Nuclear Information System (INIS)
Yassen, M.T.
2003-01-01
This paper is devoted to study the problem of controlling chaos in Chen chaotic dynamical system. Two different methods of control, feedback and nonfeedback methods are used to suppress chaos to unstable equilibria or unstable periodic orbits (UPO). The Lyapunov direct method and Routh-Hurwitz criteria are used to study the conditions of the asymptotic stability of the steady states of the controlled system. Numerical simulations are presented to show these results
TEST OF THE CHEN-ROLL-ROSS MACROECONOMIC FACTOR MODEL: EVIDENCE FROM CROATIAN STOCK MARKET
Directory of Open Access Journals (Sweden)
Denis Dolinar
2015-12-01
Full Text Available This paper empirically examines the well-known Chen-Roll-Ross model on the Croatian stock market. Modifications of definitions of the Chen-Roll-Ross model variables showed as necessary because of doubtful availability and quality of input data needed. Namely, some macroeconomic and market variables are not available in the originally defined form or do not exist. In that sense this paper gives some alternative definitions for some model variables. Also, in order to improve statistical analysis, in this paper we have modified Fama-MacBeth technique in the way that second-pass regression was substituted with panel regression analysis. Based on the two-pass regression analysis of returns of 34 Croatian stocks on 4 macroeconomic variables during the seven-and-half-year observation period the following conclusion is made. In contrast to the results of Chen, Roll and Ross (1986 for the U.S. stock market, their model is not successful when describing a risk-return relation of Croatian stocks. Nevertheless, one observed version of the Chen-RollRoss model showed certain statistical significance. Namely, two risk factors in that version of the model were statistically significant: default premium, measured as risk premium for the corporate short-term bank loan financing, and term structure premium, measured on short-run basis.
Chaos synchronization between Chen system and Genesio system
International Nuclear Information System (INIS)
Wu Xianyong; Guan Zhihong; Wu Zhengping; Li Tao
2007-01-01
This Letter presents two synchronization schemes between two different chaotic systems. Active control synchronization and adaptive synchronization between Chen system and Genesio system are studied, different controllers are designed to synchronize the drive and response systems, active control synchronization is used when system parameters are known; adaptive synchronization is employed when system parameters are unknown or uncertain. Simulation results show the effectiveness of the proposed schemes
Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter
Directory of Open Access Journals (Sweden)
Yee Hooi Min
2016-01-01
Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.
2008-04-01
Sweden, for overseeing the DNA isolation from the blood sam- ples; Heng Khai Koon and Ong Eng Hu Jason for genotyping; Lim Siew Lan and Irene Chen for...of normal and malignant breast epithelium. In The Breast: Comprehensive Management of Benign and Malignant Diseases Edited by: Bland KI, Copeland EM...life etiological model, taking also into account that certain breast cancer epidemiologic characteris- tics reflecting general principles of
Lei, Ting; Belykh, Evgenii; Dru, Alexander B; Yagmurlu, Kaan; Elhadi, Ali M; Nakaji, Peter; Preul, Mark C
2016-07-01
Chen Jingrun (1933-1996), perhaps the most prodigious mathematician of his time, focused on the field of analytical number theory. His work on Waring's problem, Legendre's conjecture, and Goldbach's conjecture led to progress in analytical number theory in the form of "Chen's Theorem," which he published in 1966 and 1973. His early life was ravaged by the Second Sino-Japanese War and the Chinese Cultural Revolution. On the verge of solving Goldbach's conjecture in 1984, Chen was struck by a bicyclist while also bicycling and suffered severe brain trauma. During his hospitalization, he was also found to have Parkinson's disease. Chen suffered another serious brain concussion after a fall only a few months after recovering from the bicycle crash. With significant deficits, he remained hospitalized for several years without making progress while receiving modern Western medical therapies. In 1988 traditional Chinese medicine experts were called in to assist with his treatment. After a year of acupuncture and oxygen therapy, Chen could control his basic bowel and bladder functions, he could walk slowly, and his swallowing and speech improved. When Chen was unable to produce complex work or finish his final work on Goldbach's conjecture, his mathematical pursuits were taken up vigorously by his dedicated students. He was able to publish Youth Math, a mathematics book that became an inspiration in Chinese education. Although he died in 1996 at the age of 63 after surviving brutal political repression, being deprived of neurological function at the very peak of his genius, and having to be supported by his wife, Chen ironically became a symbol of dedication, perseverance, and motivation to his students and associates, to Chinese youth, to a nation, and to mathematicians and scientists worldwide.
An equilibrium point stabilization strategy for the Chen system
International Nuclear Information System (INIS)
Alvarez-Ramirez, Jose; Cevantes, Ilse; Femat, Ricardo
2004-01-01
The aim of this Letter is to address the equilibrium point stabilization problem of the Chen system by employing a simple linear feedback controller derived from time-scaling the dynamics of a single variable. The controller has the advantage of being easy to implement and a rigorous stability proof is provided based on singular perturbation arguments. Results are illustrated via numerical simulations
Generalized projective synchronization between Lorenz system and Chen's system
International Nuclear Information System (INIS)
Li Guohui
2007-01-01
On the basis of active backstepping design, this paper presents the generalized projective synchronization between two different chaotic systems: Lorenz system and Chen's system. The proposed method combines backstepping methods and active control without having to calculate the Lyapunov exponents and the eigenvalues of the Jacobian matrix, which makes it simple and convenient. Numerical simulations show that this method works very well
Furman, W
2002-01-01
Brief review of the main scientific results obtained at research reactor booster IBR-30 and its predecessor IBR and IBR-1 for the period 1960 - 2001 is presented. The thesis of the scientific program for the upgrade of IBR-30 resonance neutron source IREN are adduced
From Wang-Chen System with Only One Stable Equilibrium to a New Chaotic System Without Equilibrium
Pham, Viet-Thanh; Wang, Xiong; Jafari, Sajad; Volos, Christos; Kapitaniak, Tomasz
2017-06-01
Wang-Chen system with only one stable equilibrium as well as the coexistence of hidden attractors has attracted increasing interest due to its striking features. In this work, the effect of state feedback on Wang-Chen system is investigated by introducing a further state variable. It is worth noting that a new chaotic system without equilibrium is obtained. We believe that the system is an interesting example to illustrate the conversion of hidden attractors with one stable equilibrium to hidden attractors without equilibrium.
[Professor CHEN Xiuhua's experience in the treatment of atopic dermatitis].
Quan, Xiaohong; Li, Shuqian; Li, Ying
2017-03-12
Professor CHEN Xiuhua 's clinical experiences were introduced in the intervention on atopic dermatitis with external therapies of TCM acupuncture. On the basis of the theory as cultivating the earth and clearing the heart from professor CHEN Dacan and in terms of the disease stages and skin lesion characteristics, as well as in consideration of syndrome differen-tiation, the acupoints for strengthening the spleen and clearing heart fire are selected, such as Zhongwan (CV 12), Daheng (SP 15), Shuifen (CV 9), Tianshu (ST 25), Neiguan (PC 6) and Quchi (LI 11). For the repair of skin lesion, the integration of Chinese and western medicine is used, with the internal application and external use of Chinese herbal medicines involved. The topical ointments are selected rationally. The self-blood therapy is used with acupuncture, bleeding therapy and acupoint injection applied in combination on the basis of the theory of TCM zangfu organs and modern immunological mechanism, which stimulates the nonspecific immune response in the body and strengthens acupoint stimulus effects. Medical thread therapy of Guangxi Zhuang medicine is used in moxibustion for skin damage, which effectively stops itching and promotes wound healing and skin repair.
180 MW/180 KW pulse modulator for S-band klystron of LUE-200 linac of IREN installation of JINR
Su, Kim Dong; Sumbaev, A. P.; Shvetsov, V. N.
2014-09-01
The offer on working out of the pulse modulator with 180 MW pulse power and 180 kW average power for pulse S-band klystrons of LUE-200 linac of IREN installation at the Laboratory of neutron physics (FLNP) at JINR is formulated. Main requirements, key parameters and element base of the modulator are presented. The variant of the basic scheme on the basis of 14 (or 11) stage 2 parallel PFN with the thyratron switchboard (TGI2-10K/50) and six parallel high voltage power supplies (CCPS Power Supply) is considered.
Fan, Zhenxin; Liu, Shaoying; Liu, Yang; Zhang, Xiuyue; Yue, Bisong
2011-03-01
Phylogeographical studies that focus on the southeastern margin of the Tibetan Plateau are limited. The complex terrain and unique geological history make it a particularly unusual region of the Tibetan Plateau. We carried out a phylogeographical study of two rodent species Neodon irene and Apodemus latronum using the mitochondrial cytochrome b gene sequences. High genetic diversities and deep phylogenetic splits were detected in both rodents. Some haplotypes from one sampling region fell into different evolutionary clades, but most haplotypes from the same sampling regions were clustered together with each other. The results of isolation by distance analysis further substantiated that their genetic diversities were structured along geography. Thus, there were high levels of geographical structure for both rodents. Demographic analyses implied a relatively constant population size for all samples of N. irene and A. latronum in history. However, clade B of N. irene and clade 3 of A. latronum experienced population expansions at 105-32 and 156-47 Kya, respectively. Through comparison with previous studies, we suggest the high mitochondrial DNA diversities in them are probably not a species-specific feature, but a common pattern for small mammals in this unique area. Details of the historical demography of these rodents revealed in this study could provide new insights into how rodents and possibly other small mammals in this region responded to the geological and climatic events.
Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing
Directory of Open Access Journals (Sweden)
Richard K. Payne
2016-03-01
Full Text Available Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between the expectations of the dominant religious culture and the immigrant culture in terms of the ways in which religious leaders represent themselves. Both Billy Graham and the Dalai Lama present themselves in very humble terms, consistent with the expectations of the Pietist background to American popular religion. Yogi Chen on the contrary tends toward a self-aggrandizing style, which although consistent with the competitive nature of premodern Tibetan religious culture is not congruent with the expectations of American popular religion.
Theoretical and experimental study of Chen chaotic system with notch filter feedback control
International Nuclear Information System (INIS)
Ming, Zhang Xiao; Jian-Hua, Peng; Ju-Fang, Chen
2010-01-01
Since the past two decades, the time delay feedback control method has attracted more and more attention in chaos control studies because of its simplicity and efficiency compared with other chaos control schemes. Recently, it has been proposed to suppress low-dimensional chaos with the notch filter feedback control method, which can be implemented in a laser system. In this work, we have analytically determined the controllable conditions for notch filter feedback controlling of Chen chaotic system in terms of the Hopf bifurcation theory. The conditions for notch filter feedback controlled Chen chaoitc system having a stable limit cycle solution are given. Meanwhile, we also analysed the Hopf bifurcation direction, which is very important for parameter settings in notch filter feedback control applications. Finally, we apply the notch filter feedback control methods to the electronic circuit experiments and numerical simulations based on the theoretical analysis. The controlling results of notch filter feedback control method well prove the feasibility and reliability of the theoretical analysis. (general)
Maximilien Brice
2002-01-01
L. to r.: Dr Diether Blechschmidt, Adviser for Non Member States Relations, Dr Peter Jenni, Spokesman, ATLAS Experiment, Prof. Chen, Mr Jean-Luc Baldy, Head of the LHC Civil Engineering Group and Dr John Ellis, Adviser for Non Member States Relations.
Software-Lösungen in B2B-Verkaufsgesprächen wirkungsvoll einsetzen
Thoma, Axel Michael
2017-01-01
Dieser Beitrag befasst sich mit dem Einsatz von Software-Lösungen in B2B-Verkaufsgesprächen (auf Englisch: Digital Sales Enablement). Anhand aktueller Beispiele aus der Geschäftswelt wird erklärt, wie solche Lösungen helfen (1) die Produktivität zu steigern, (2) Kunden zu aktivieren und (3) Neugeschäft zu entwickeln. Ebenfalls werden die Konzeption und Umsetzung solcher Lösungen behandelt.
Jonsson, J.E.; Afton, A.D.
2009-01-01
Body size affects foraging and forage intake rates directly via energetic processes and indirectly through interactions with social status and social behaviour. Ambient temperature has a relatively greater effect on the energetics of smaller species, which also generally are more vulnerable to predator attacks than are larger species. We examined variability in an index of intake rates and an index of alertness in Lesser Snow Geese Chen caerulescens caerulescens and Ross's Geese Chen rossii wintering in southwest Louisiana. Specifically we examined variation in these response variables that could be attributed to species, age, family size and ambient temperature. We hypothesized that the smaller Ross's Geese would spend relatively more time feeding, exhibit relatively higher peck rates, spend more time alert or raise their heads up from feeding more frequently, and would respond to declining temperatures by increasing their proportion of time spent feeding. As predicted, we found that Ross's Geese spent more time feeding than did Snow Geese and had slightly higher peck rates than Snow Geese in one of two winters. Ross's Geese spent more time alert than did Snow Geese in one winter, but alert rates differed by family size, independent of species, in contrast to our prediction. In one winter, time spent foraging and walking was inversely related to average daily temperature, but both varied independently of species. Effects of age and family size on time budgets were generally independent of species and in accordance with previous studies. We conclude that body size is a key variable influencing time spent feeding in Ross's Geese, which may require a high time spent feeding at the expense of other activities. ?? 2008 The Authors.
Huang, Weiping; Li, Naiqi
2015-03-01
Through the collection of Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China, the academic characteristics on acupuncture and moxibusiton were analyzed. The literature comparison method was adopted to compare the works of LUO Zhaoju, ZENG Tianzhi and LI Wenxian, etc. at the same period. It was discovered that CHEN Jingwen was the medical master who systematicly brought up the theory of acupoint properties earlier in the modern times. Classifying drugs based on acupoints was his academic feature. Additionally, the compatibility therapy of Chinese medicine was introduced to explain the essential ideas on the acupoints combination. The treatment was determined on the basis of zangxiang theory and the reinforcing and reducing therapy of acupuncture was emphasized in the determination of treatment and prescription. CHEN Jingwen's theory of acupoint property had been stressed and spread among the medical scholars in the Republic of China and he had made the beneficial exploration for the development of modern acupuncture and moxibustion therapy.
International Nuclear Information System (INIS)
Lucot, Michel; Obin, Norbert.
1980-10-01
The loop IRENE is an experimental device to study the behaviour of pressurized light-water fuel pins under neutron flux in the Saclay Nuclear Research Centre reactor OSIRIS. It can take 8 fuel pins and allows irradiations to be carried out under thermodynamic, hydraulic and chemical conditions corresponding to those of a PWR power reactor. A brief outline of the loop specifications is followed by an account of the difficulties raised by operating with saturation temperature at the test channel outlet and it is shown how the microprocessor loop pilots are used to solve these problems [fr
Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing
Richard K. Payne
2016-01-01
Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between ...
Le jeu de la création : Le mangeur (2005 de Ying Chen
Directory of Open Access Journals (Sweden)
Nicole Dunham
2013-11-01
Full Text Available Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005 de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants : le ventre du père, les tableaux peints par ce dernier et l’espace-temps de A., et la fenêtre. Ces éléments deviennent des aires de jeu, remettant en question les concepts de l’intérieur et de l’extérieur et du créateur et de l’œuvre. En nous servant du texte « Le Tunnel » écrit par Ying Chen, nous démontrerons que cette notion du jeu s’applique également à l’ensemble de son œuvre.
Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation
International Nuclear Information System (INIS)
Tam, L.M.; Chen, J.H.; Chen, H.K.; Wai Meng Si Tou
2008-01-01
A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, ε, and ω. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study
Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation
Energy Technology Data Exchange (ETDEWEB)
Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Chen, J.H. [Department of Mechanical Engineering, Chung Hua University, Hsinchu, Taiwan (China); Chen, H.K. [Department of Mechanical Engineering, Hsiuping Institute of Technology, Taichung, Taiwan (China); Wai Meng Si Tou [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)
2008-11-15
A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, {epsilon}, and {omega}. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study.
Między brakiem a nadmiarem. Z Ireną Grudzińską-Gross rozmawia Joanna Tokarska-Bakir
Directory of Open Access Journals (Sweden)
Joanna Tokarska-Bakir
2012-12-01
Full Text Available Between overabundance and scarcity. Joanna Tokarska-Bakir in an interview with Irena Grudzińska Gross This conversation with Irena Grudzińska-Gross starts a series of interviews in “Studia Litteraria et Historica”, which motto is the title of the essay of Jan Stanisław Bystroń “On subjects I was advised not to pursue”. Among these subjects that Irena Grudzińska-Gross names are: war, family history, women. Grudzińska-Gross tells also about the reactions to “Złote Żniwa” - a book that she wrote together with Jan Tomasz Gross, and about academic work of people of Eastern Europe living in the United States. One part of the interview concerns also a “collective hypnosis”, that Americans underwent after the 9/11 World Trade Center Attack and the price, that Susan Sontag had to pay for being critical about American militarism. Między brakiem a nadmiarem. Z Ireną Grudzińską-Gross rozmawia Joanna Tokarska-Bakir Rozmowa z Ireną Grudzińską-Gross otwiera cykl wywiadów “Studia Litteraria et Historica”, których mottem jest tytuł eseju Jana Stanisława Bystronia: “Tematy, które mi odradzano”. Wśród “odradzanych” tematów, które wymienia Irena Grudzińska-Gross są między innymi: wojna, historia rodzinna, kobiety. Grudzińska-Gross opowiada także o reakcjach na książkę “Złote żniwa”, którą napisała wraz z Janem Tomaszem Grossem oraz o pracy akademickiej osób z Europy Wschodniej w Stanach Zjednoczonych. Część rozmowy dotyczy także “zbiorowej hipnozy”, której ulegli mieszkańcy USA po ataku 11 września 2001 na World Trade Center i ceny, jaką musiała zapłacić Susan Sontag za krytykę amerykańskiego militaryzmu.
2011-11-16
... present ``Treatment of Cancer with Recombinant Immunotoxins: From Technology Transfer to the Patient.'' Dr. Pastan is an NIH Distinguished Investigator and Chief, Laboratory of Molecular Biology, National Cancer Institute Center for Cancer Research. This annual series honors Dr. Philip S. Chen, Jr. for his almost 50...
Wang, Ting; Guo, Rixin; Zhou, Guohong; Zhou, Xidan; Kou, Zhenzhen; Sui, Feng; Li, Chun; Tang, Liying; Wang, Zhuju
2016-07-21
Panax notoginseng (Burk.) F.H. Chen is a widely used traditional Chinese medicine known as Sanqi or Tianqi in China. This plant, which is distributed primarily in the southwest of China, has wide-ranging pharmacological effects and can be used to treat cardiovascular diseases, pain, inflammation and trauma as well as internal and external bleeding due to injury. This paper provides up-to-date information on investigations of this plant, including its botany, ethnopharmacology, phytochemistry, pharmacology and toxicology. The possible uses and perspectives for future investigation of this plant are also discussed. The relevant information on Panax notoginseng (Burk.) F.H. Chen was collected from numerous resources, including classic books about Chinese herbal medicine, and scientific databases, including Pubmed, SciFinder, ACS, Ebsco, Elsevier, Taylor, Wiley and CNKI. More than 200 chemical compounds have been isolated from Panax notoginseng (Burk.) F.H. Chen, including saponins, flavonoids and cyclopeptides. The plant has pharmacological effects on the cardiovascular system, immune system as well as anti-inflammatory, anti-atherosclerotic, haemostatic and anti-tumour activities, etc. Panax notoginseng is a valuable traditional Chinese medical herb with multiple pharmacological effects. This review summarizes the botany, ethnopharmacology, phytochemistry, pharmacology and toxicology of P. notoginseng, and presents the constituents and their corresponding chemical structures found in P. notoginseng comprehensively for the first time. Future research into its phytochemistry of bio-active components should be performed by using bioactivity-guided isolation strategies. Further work on elucidation of the structure-function relationship among saponins, understanding of multi-target network pharmacology of P. notoginseng, as well as developing its new clinical usage and comprehensive utilize will enhance the therapeutic potentials of P. notoginseng. Copyright © 2016
Directory of Open Access Journals (Sweden)
Christian Hammermann
2017-05-01
Full Text Available Der von Sabine Hark und Paula-Irene Villa herausgegebene Sammelband analysiert die öffentlichen Angriffe auf Gender Studies und Gender Mainstreaming, die unter dem Begriff Anti-Genderismus auftreten und verhandelt werden. Die einzelnen Beiträge untersuchen Themen und Methoden des anti-genderistischen Diskurses, seine Akteur_Innen und gesellschaftlichen Bedingung. Dabei entwerfen sie ein sehr kohärentes Porträt dieser Politiken, das allerdings von einer weiteren Untersuchung der gesellschaftlichen Bedingungen und intersektionalen Bezüge zu anderen Ressentiments profitieren würde.
Security problems for a pseudorandom sequence generator based on the Chen chaotic system
Özkaynak, Fatih; Yavuz, Sırma
2013-09-01
Recently, a novel pseudorandom number generator scheme based on the Chen chaotic system was proposed. In this study, we analyze the security weaknesses of the proposed generator. By applying a brute force attack on a reduced key space, we show that 66% of the generated pseudorandom number sequences can be revealed. Executable C# code is given for the proposed attack. The computational complexity of this attack is O(n), where n is the sequence length. Both mathematical proofs and experimental results are presented to support the proposed attack.
Morgan, Karen L. M.; Krohn, M. Dennis
2016-02-17
The U.S. Geological Survey (USGS), as part of the National Assessment of Coastal Change Hazards project, conducts baseline and storm-response photography missions to document and understand the changes in vulnerability of the Nation's coasts to extreme storms (Morgan, 2009). On August 30-31, 2011, the USGS conducted an oblique aerial photographic survey from Ocracoke Inlet, North Carolina, to Virginia Beach, Virginia, aboard a Piper Navajo Chieftain (aircraft) at an altitude of 500 feet (ft) and approximately 1,200 ft offshore. This mission was flown to collect post-Hurricane Irene data for assessing incremental changes in the beach and nearshore area since the last survey, flown in May 2008, and the data can be used in the assessment of future coastal change.
Dark energy from cosmological fluids obeying a Shan-Chen non-ideal equation of state
Bini, Donato; Geralico, Andrea; Gregoris, Daniele; Succi, Sauro
2014-01-01
We consider a Friedmann-Robertson-Walker universe with a fluid source obeying a nonideal equation of state with ‘‘asymptotic freedom,’’ namely ideal gas behavior (pressure changes directly proportional to density changes) both at low and high density regimes, following a fluid dynamical model due to Shan and Chen. It is shown that, starting from an ordinary energy density component, such fluids naturally evolve towards a universe with a substantial ‘‘dark energy’’ component at the present tim...
International Nuclear Information System (INIS)
Moreno M, A.; Moreno B, A.
2000-01-01
In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)
Zheng, Y. Y.; Chen, Y. L.; Lin, H. R.; Huang, S. Y.; Yeh, T. C. J.; Wen, J. C.
2017-12-01
Land subsidence is a very serious problem of Zhuoshui River alluvial fan, Taiwan. The main reason of land subsidence is a compression of soil, but the compression measured in the wide area is very extensive (Maryam et al., 2013; Linlin et al., 2014). Chen et al. [2010] studied the linear relationship between groundwater level and subsurface altitude variations from Global Positioning System (GPS) station in Zhuoshui River alluvial fan. But the subsurface altitude data were only from two GPS stations. Their distributions are spared and small, not enough to express the altitude variations of Zhuoshui River alluvial fan. Hung et al. [2011] used Interferometry Synthetic Aperture Radar (InSAR) to measure the surface subsidence in Zhuoshui River alluvial fan, but haven't compared with groundwater level. The study compares the correlation between rainfall events and groundwater level and compares the correlation between groundwater level and subsurface altitude, these two correlation affected by heterogeneous soil. From these relationships, a numerical model is built to simulate the land subsidence variations and estimate the coefficient of aquifer soil compressibility. Finally, the model can estimate the long-term land subsidence. Keywords: Land Subsidence, InSAR, Groundwater Level, Numerical Model, Correlation Analyses
Energy Technology Data Exchange (ETDEWEB)
Moreno M, A. [Departamento de Apoyo en Ciencias Aplicadas, Benemerita Universidad Autonoma de Puebla, 4 Sur 104, Centro Historico, 72000 Puebla (Mexico); Moreno B, A
2000-07-01
In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)
Chen-Nester-Tung quasi-local energy and Wang-Yau quasi-local mass
Liu, Jian-Liang; Yu, Chengjie
2017-10-01
In this paper, we show that the Chen-Nester-Tung (CNT) quasi-local energy with 4D isometric matching references is closely related to the Wang-Yau (WY) quasi-local energy. As a particular example, we compute the second variation of the CNT quasi-local energy for axially symmetric Kerr-like spacetimes with axially symmetric embeddings at the obvious critical point (0 , 0) and find that it is a saddle critical point in most of the cases. Also, as a byproduct, we generalize a previous result about the coincidence of the CNT quasi-local energy and Brown-York mass for axially symmetric Kerr-like spacetimes by Tam and the first author Liu and Tam (2016) to general spacetimes.
Modern process study on Chen Co and Ranwu Lake of Tibetan Plateau
Ju, J.
2013-12-01
Lakes are important junctions of geospheres. There are many lakes distributed on the Tibetan Plateau (TP). Lake sediment is one of the important media for retrieving the past environmental changes. Because of the uniqueness of environment of the TP, sediment, water and ecological system in lakes has local characteristic inevitably. Modern process research on different lakes will benefit interpreting the proxies more accurately. The development of observation station makes the observation and sampling more convenient. Modern process of lakes can be fulfilled in two ways, spatial or seasonal variation study, with a same aim finding out the dominant factors controlling the variations. Chen Co is a closed lake locating at inland area of southern Tibet. Ranwu Lake is an open lake locating at outflow area of SE Tibet. In this study, I studied the spatial and (or) seasonal variation of lake water and sediment in the two distinct types of lakes to make clear the mechanism of modern process. Particular attention was given to the pattern and degree of influence of rivers supplied by glaciers on lakes. Preliminary conclusions are outlined as follow: (1) In the lakes with glacier melt supplying rivers, the patterns of supply of the rivers to the lake are different. In close lake Chen Co, the influence of glacier melt is mainly reflected in the south lake area. In the open lake Ranwu Lake, the influence is comprehensive and direct. This difference influencing patterns how the lake sediments reflected the glacier melt under the past environmental changes. (2) The supply of Kaluxiong Qu River, supplied mainly by glacier melt, to Chen co has North-South difference: more directly to south lake area, reflecting by lower value of conductivity and pH, finer grain size and west to east transporting trend, greater deposition rate, more allogenic fine sediments, not obvious biological and endogenic deposition there. This enlightens the site selection for lake cores and interpretation of
Zhang, Xuedan; Zhang, Ruqing; Chen, Dexing
2014-01-01
Chen Ye, an official of the Southern Song Dynasty, also known as Chen Rihua as his styled name, was born in Changle, Fuzhou in the reign of Shaoxing, and died during the reign of Duanping. He had been consecutively in the positions of Jiang shi lang (Court Gentleman for Ceremonial Service), Zhi zhou (Prefect) of Lingding, the Ti xing (Judicial Commissioner) of Guangdong, the Zong ling (Overseer-general) of Sichuan, Shan ding (Reviser), Shu lin and other positions in Tongzhou, Yuanzhou. His works included 1 volume of Gu ling xian sheng nian pu (Mr. Guling's Chronological Biography), 1 volume of Tan xie (On Humor), 1 volume of Shi hua (Poetry), 8 volumes of Jin yuan li shu (Jin Yuan's Smart Technique), 3 volumes of Yi jian zhi lei bian (Classified Compilation of Yijian's Annals), (Zeng guang) Suo sui lu (Augmented Records of Trivial Matters), 5 volumes of Jia cang jing yan fang (Family-preserved Empirical Recipes). He also compiled the 8-volume Yin jiang zhi (Yinjiang's Annals), published the 2-volume Jia cang ji yao fang (Collected Essential Recipes from Family Preservation), and other proses and poetry. Jia cang jing yan fang was a formulary compiled by Chen Ye, which was lost. Altogether 74 of its recipes were cited in Fu ren da quan liang fang (Complete Effective Prescriptions for Women's Diseases), Shou qin yang lao shu (A Book for Pursuing Seniors' Longevity and Healthcare), Pu ji fang (Prescriptions for Universal Relief) and Yong le da dian (Yongle Encyclopedia).
Le jeu de la création : Le mangeur (2005) de Ying Chen
Nicole Dunham
2013-01-01
Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005) de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants...
Pitchfork bifurcation and circuit implementation of a novel Chen hyper-chaotic system
International Nuclear Information System (INIS)
Dong En-Zeng; Chen Zeng-Qiang; Chen Zai-Ping; Ni Jian-Yun
2012-01-01
In this paper, a novel four dimensional hyper-chaotic system is coined based on the Chen system, which contains two quadratic terms and five system parameters. The proposed system can generate a hyper-chaotic attractor in wide parameters regions. By using the center manifold theorem and the local bifurcation theory, a pitchfork bifurcation is demonstrated to arise at the zero equilibrium point. Numerical analysis demonstrates that the hyper-chaotic system can generate complex dynamical behaviors, e.g., a direct transition from quasi-periodic behavior to hyper-chaotic behavior. Finally, an electronic circuit is designed to implement the hyper-chaotic system, the experimental results are consist with the numerical simulations, which verifies the existence of the hyper-chaotic attractor. Due to the complex dynamic behaviors, this new hyper-chaotic system is useful in the secure communication. (general)
Wormholes supported by phantom energy from Shan-Chen cosmological fluids
Energy Technology Data Exchange (ETDEWEB)
Wang, Deng [Nankai University, Theoretical Physics Division, Chern Institute of Mathematics, Tianjin (China); Meng, Xin-He [Nankai University, Department of Physics, Tianjin (China); Institute of Theoretical Physics, CAS, State key Lab of Theoretical Physics, Beijing (China)
2016-03-15
In the present paper, the exact solutions of spherically symmetrical Einstein field equations describing wormholes supported by phantom energy that violates the null energy condition from Shan-Chen background fluid are obtained. We have considered the important case of the model parameter ψ ∼ 1, which corresponds to the ''saturation effect'', and this regime corresponds to an effective form of ''asymptotic freedom'' for the fluids, but occurring at cosmological rather than subnuclear scales. Then we investigate the allowed range for the values of the model parameters g and ω when the spacetime metrics describe wormholes and discuss the possible singularities of the solutions, finding that the obtained spacetimes are geodesically complete. Furthermore, we construct two traversable wormholes through matching our obtained interior solutions to the exterior Schwarzschild solutions and analyze the traversabilities of the wormholes. Finally, we consider the case of anisotropic pressure and discover that the transverse pressure also crosses the phantom divide -1 with the growth of the wormhole dimension, and it tends to be the same as the radial pressure with the growth of the wormhole radius. (orig.)
Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige
Giafferri, Xiaomin
2008-01-01
Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authen...
The impact of systematic landscape conservation planning on ecosystem: Chen Youlan river watershed
Chen, Chi-ju
2017-04-01
Heraclitus said that "no man ever steps in the same river twice." Everything continues to change. Land use change will keep redefine itself and subject the Earth and humankind to collateral changes. Humankind benefits from ecosystem in many ways. The ecosystem provides people with nutrients, enriches soil with sediment, and sustains all living organisms with water; these benefits are known as ecosystem services. In Taiwan, land use change has impacted ecosystem and biodiversity on various levels. Thus, we took six land use scenarios from 1999 to 2005 in Chen Youlan river watershed as our case study, intending to observe the course of ecosystem and biodiversity changes and the cause of it. Systematic Landscape conservation planning (SLCP) framework can be adopted when designing land use policy to safeguard human interests and ecosystem. This study use SLCP to develop ecosystem services and biodiversity protection strategies. Several strategies were designed by using 1999 to 2005 data as provision to protect the intactness of future ecosystem services and biodiversity. This research explores the potential and possible impacts of different land use protection strategies in the future. It is possible to identify the conservation priority of a certain region by using the Zonation meta-algorithm. This study selects the zonation critical protection area (Joint set of Yushan National Park) as strategy A, B and C. Strategy D takes Yushan National Park as a protected area; unstable hot spots in 1999/03 (Joint set of Yushan National Park) are selected as strategy E. Next, we used Kappa statistical method to find the minimal ecosystem services change and biodiversity hotspots change of the five aforementioned strategies and compared with those from 1999/03. By the Kappa statistical method, we further prioritized the important conservation areas by strategy A, B, C, E in the future. The results can not only serve as management reference for government agencies, but also develop
The flea beetle genus Meishania Chen & Wang is revised and five new species - M. cangshanensis sp. nov., M. flavipennis sp. nov., M. fulvotigera sp. nov., and M. sichuanica sp. nov. from China and M. bhutanensis sp. nov. from Bhutan - are described. All species of Meishania are illustrated and a key...
Fault detection and fault-tolerant control for nonlinear systems
Li, Linlin
2016-01-01
Linlin Li addresses the analysis and design issues of observer-based FD and FTC for nonlinear systems. The author analyses the existence conditions for the nonlinear observer-based FD systems to gain a deeper insight into the construction of FD systems. Aided by the T-S fuzzy technique, she recommends different design schemes, among them the L_inf/L_2 type of FD systems. The derived FD and FTC approaches are verified by two benchmark processes. Contents Overview of FD and FTC Technology Configuration of Nonlinear Observer-Based FD Systems Design of L2 nonlinear Observer-Based FD Systems Design of Weighted Fuzzy Observer-Based FD Systems FTC Configurations for Nonlinear Systems< Application to Benchmark Processes Target Groups Researchers and students in the field of engineering with a focus on fault diagnosis and fault-tolerant control fields The Author Dr. Linlin Li completed her dissertation under the supervision of Prof. Steven X. Ding at the Faculty of Engineering, University of Duisburg-Essen, Germany...
Horowitz, Arthur J.
2013-01-01
Hurricane Irene and Tropical Storm Lee, both of which made landfall in the U.S. between late August and early September 2011, generated record or near record water discharges in 41 coastal rivers between the North Carolina/South Carolina border and the U.S./Canadian border. Despite the discharge of substantial amounts of suspended sediment from many of these rivers, as well as the probable influx of substantial amounts of eroded material from the surrounding basins, the geochemical effects on the TOC), total nitrogen (TN), Zn, Se, Co, Cu, Pb, As, Cr, and total carbon (TC). As a group, these constituents tend to be associated either with urbanization/elevated population densities and/or wastewater/solid sludge. The limited number of significant sediment-associated chemical changes that were detected probably resulted from two potential processes: (1) the flushing of in-stream land-use affected sediments that were replaced by baseline material more representative of local geology and/or soils (declining concentrations), and/or (2) the inclusion of more heavily affected material as a result of urban nonpoint-source runoff and/or releases from flooded treatment facilities (increasing concentrations). Published 2013. This article is a U.S. Government work and is in the public domain in the USA.
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 95; Issue 1. Distribution and linkage disequilibrium analysis of polymorphisms of GH1 gene in different populations of pigs associated with body size. Yunyun Cheng Songcai Liu Dan Su Chao Lu Xin Zhang Qingyan Wu Siming Li Haoyu Fu Hao Yu Linlin Hao. Research Article ...
IRET: requirements for service platforms
Baresi, Luciano; Ripa, Gianluca; Pasquale, Liliana
2013-01-01
peer-reviewed This paper describes IRENE (Indenica Requirements ElicitatioN mEthod), a methodology to elicit and model the requirements of service platforms, and IRET (IREne Tool), the Eclipse-based modeling framework we developed for IRENE
CERN Photo Service
2008-01-01
21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.
Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige
Directory of Open Access Journals (Sweden)
Xiaomin Giafferri
2008-12-01
Full Text Available Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authenticité s’établit à travers les mécanismes de la fictionnalisation de l’Histoire. L’observation de leur manifestation est amenée à considérer deux axes principaux : l’organisation du récit et la mise en scène des personnages.
Maximilien Brice
2007-01-01
Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.
Mak, Kwok-Kei; Lai, Ching-Man; Ko, Chih-Hung; Chou, Chien; Kim, Dong-Il; Watanabe, Hiroko; Ho, Roger C M
2014-10-01
The Revised Chen Internet Addiction Scale (CIAS-R) was developed to assess Internet addiction in Chinese populations, but its psychometric properties in adolescents have not been examined. This study aimed to evaluate the factor structure and psychometric properties of CIAS-R in Hong Kong Chinese adolescents. 860 Grade 7 to 13 students (38 % boys) completed the CIAS-R, the Young's Internet Addiction Test (IAT), and the Health of the Nation Outcome Scales for Children and Adolescents (HoNOSCA) in a survey. The prevalence of Internet addiction as assessed by CIAS-R was 18 %. High internal consistency and inter-item correlations were reported for the CIAS-R. Results from the confirmatory factor analysis suggested a four-factor structure of Compulsive Use and Withdrawal, Tolerance, Interpersonal and Health-related Problems, and Time Management Problems. Moreover, results of hierarchical multiple regression supported the incremental validity of the CIAS-R to predict mental health outcomes beyond the effects of demographic differences and self-reported time spent online. The CIAS is a reliable and valid measure of internet addiction problems in Hong Kong adolescents. Future study is warranted to validate the cutoffs of the CIAS-R for identification of adolescents with Internet use problems who may have mental health needs.
Directory of Open Access Journals (Sweden)
Chih-Hung Ko
2005-12-01
Full Text Available The aim of this study was to establish the optimal cut-off points of the Chen Internet Addiction Scale (CIAS, to screen for and diagnose Internet addiction among adolescents in the community by using the well- established diagnostic criteria of Internet addiction. This survey of 454 adolescents used screening (57/58 and diagnostic (63/64 cut-off points of the CIAS, a self-reported instrument, based on the results of systematic diagnostic interviews by psychiatrists. The area under the curve of the receiver operating characteristic curve revealed that CIAS has good diagnostic accuracy (89.6%. The screening cut-off point had high sensitivity (85.6% and the diagnostic cut-off point had the highest diagnostic accuracy, classifying 87.6% of participants correctly. Accordingly, the screening point of the CIAS could provide a screening function in two-stage diagnosis, and the diagnostic point could serve as a diagnostic criterion in one-stage massive epidemiologic research.
Ground-state magnetization of the Ising spin glass: A recursive numerical method and Chen-Ma scaling
Sepehrinia, Reza; Chalangari, Fartash
2018-03-01
The ground-state properties of quasi-one-dimensional (Q1D) Ising spin glass are investigated using an exact numerical approach and analytical arguments. A set of coupled recursive equations for the ground-state energy are introduced and solved numerically. For various types of coupling distribution, we obtain accurate results for magnetization, particularly in the presence of a weak external magnetic field. We show that in the weak magnetic field limit, similar to the 1D model, magnetization exhibits a singular power-law behavior with divergent susceptibility. Remarkably, the spectrum of magnetic exponents is markedly different from that of the 1D system even in the case of two coupled chains. The magnetic exponent makes a crossover from being dependent on a distribution function to a constant value independent of distribution. We provide an analytic theory for these observations by extending the Chen-Ma argument to the Q1D case. We derive an analytical formula for the exponent which is in perfect agreement with the numerical results.
Politics in the Western Maya Region (I: Ajawil/Ajawlel and Ch'e'n
Directory of Open Access Journals (Sweden)
Péter Bíró
2011-01-01
Full Text Available In a series of articles I reflect on the use of various expressions which are connected to what we call the political in the inscriptions of the Classic Maya Western Region. These words express concepts which help to understand the intricate details of the interactions between the political entities and their internal organisations in the Classic Maya Lowlands. Words such as 7ajawil, 7ajawlel, the kennings built on the base of ch'e7n (cave, pond, the emblem glyphs and titles will be examined in light of what they tell us about the functioning of the political organisation of the Classic Period in a constrained region.En una serie de artículos como éste investigo el uso de varias palabras en las inscripciones mayas de la época Clásica de la Región Occidental vinculadas con lo que nosotros llamamos "política". Estas palabras expresan conceptos que ayudan a entender los matices de las relaciones entre las entidades políticas de las Tierras Bajas Mayas y su organización interna. Términos como ajaw'ü I ajawlel, los difrasismos con base ch'e'n (cueva, pozo, los glifos emblemas y los títulos serán examinados tomando en cuenta la información que nos proporcionan sobre el funcionamiento de la organización política de la época Clásica en una región restringida.
Franson, J. Christian; Hoffman, D.J.; Schmutz, J.A.
2009-01-01
Reduced populations of emperor geese (Chen canagica), a Bering Sea endemic, provided the need to assess plasma biochemistry values as indicators of population health. A precursory step to such an investigation was to evaluate patterns of variability in plasma biochemistry values among age, sex, and reproductive period. Plasma from 63 emperor geese was collected on their breeding grounds on the Yukon-Kuskokwim Delta in western Alaska, USA. The geese sampled included 18 incubating adult females captured, in mid June, on their nests by using bow nets, and 30 adults and 15 goslings captured in corral traps in late July and early August, when the adults were molting their wing feathers and the goslings were 5-6 weeks old. Plasma was evaluated for 15 biochemical parameters, by comparing results among age, sex, and sampling period (incubation versus wing-feather molt). Ten of the 15 biochemical parameters assayed differed among adults during incubation, the adults during molt, and the goslings at molt, whereas sex differences were noted in few parameters.
Lake, B.C.; Schmutz, J.A.; Lindberg, M.S.; Ely, Craig R.; Eldridge, W.D.; Broerman, F.J.
2008-01-01
We studied body mass of prefledging Emperor Geese Chen canagica at three locations across the Yukon-Kuskokwim Delta, Alaska, during 1990-2004 to investigate whether large-scale variation in body mass was related to interspecific competition for food. From 1990 to 2004, densities of Cackling Geese Branta hutchinsii minima more than doubled and were c. 2-5?? greater than densities of Emperor Geese, which were relatively constant over time. Body mass of prefledging Emperor Geese was strongly related (negatively) to interspecific densities of geese (combined density of Cackling and Emperor Geese) and positively related to measures of food availability (grazing lawn extent and net above-ground primary productivity (NAPP)). Grazing by geese resulted in consumption of ??? 90% of the NAPP that occurred in grazing lawns during the brood-rearing period, suggesting that density-dependent interspecific competition was from exploitation of common food resources. Efforts to increase the population size of Emperor Geese would benefit from considering competitive interactions among goose species and with forage plants. ?? 2008 The Authors.
Debris flow run off simulation and verification ‒ case study of Chen-You-Lan Watershed, Taiwan
Directory of Open Access Journals (Sweden)
M.-L. Lin
2005-01-01
Full Text Available In 1996 typhoon Herb struck the central Taiwan area, causing severe debris flow in many subwatersheds of the Chen-You-Lan river watershed. More severe cases of debris flow occurred following Chi-Chi earthquake, 1999. In order to identify the potentially affected area and its severity, the ability to simulate the flow route of debris is desirable. In this research numerical simulation of debris flow deposition process had been carried out using FLO-2D adopting Chui-Sue river watershed as the study area. Sensitivity study of parameters used in the numerical model was conducted and adjustments were made empirically. The micro-geomorphic database of Chui-Sue river watershed was generated and analyzed to understand the terrain variations caused by the debris flow. Based on the micro-geomorphic analysis, the debris deposition in the Chui-Sue river watershed in the downstream area, and the position and volume of debris deposition were determined. The simulated results appeared to agree fairly well with the results of micro-geomorphic study of the area when not affected by other inflow rivers, and the trends of debris distribution in the study area appeared to be fairly consistent.
Hirschheydt, Monika von
2015-01-01
Arvustus: Nürnberg, Reiner, Höxtermann, Ekkehard, Voigt, Martina. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts. Beiträge eines Symposiums zum 200. Gründungsjubiläum der Humboldt-Universität Berlin. Rangsdorf: Basilisken-Presse 2014
Schwab, William C.; Baldwin, Wayne E.; Denny, Jane F.
2016-01-15
This report documents the changes in seabed morphology and modern sediment thickness detected on the inner continental shelf offshore of Fire Island, New York, before and after Hurricanes Irene and Sandy made landfall. Comparison of acoustic backscatter imagery, seismic-reflection profiles, and bathymetry collected in 2011 and in 2014 show that sedimentary structures and depositional patterns moved alongshore to the southwest in water depths up to 30 meters during the 3-year period. The measured lateral offset distances range between about 1 and 450 meters with a mean of 20 meters. The mean distances computed indicate that change tended to decrease with increasing water depth. Comparison of isopach maps of modern sediment thickness show that a series of shoreface-attached sand ridges, which are the dominant sedimentary structures offshore of Fire Island, migrated toward the southwest because of erosion of the ridge crests and northeast-facing flanks as well as deposition on the southwest-facing flanks and in troughs between individual ridges. Statistics computed suggest that the modern sediment volume across the about 81 square kilometers of common sea floor mapped in both surveys decreased by 2.8 million cubic meters, which is a mean change of –0.03 meters, which is smaller than the resolution limit of the mapping systems used.
Maximilien Brice
2012-01-01
6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.
Zhang, Wen-Yan; Lin, Chao-Yuan
2017-04-01
The Soil Conservation Service Curve Number (SCS-CN) method, which was originally developed by the USDA Natural Resources Conservation Service, is widely used to estimate direct runoff volume from rainfall. The runoff Curve Number (CN) parameter is based on the hydrologic soil group and land use factors. In Taiwan, the national land use maps were interpreted from aerial photos in 1995 and 2008. Rapid updating of post-disaster land use map is limited due to the high cost of production, so the classification of satellite images is the alternative method to obtain the land use map. In this study, Normalized Difference Vegetation Index (NDVI) in Chen-You-Lan Watershed was derived from dry and wet season of Landsat imageries during 2003 - 2008. Land covers were interpreted from mean value and standard deviation of NDVI and were categorized into 4 groups i.e. forest, grassland, agriculture and bare land. Then, the runoff volume of typhoon events during 2005 - 2009 were estimated using SCS-CN method and verified with the measured runoff data. The result showed that the model efficiency coefficient is 90.77%. Therefore, estimating runoff by using the land cover map classified from satellite images is practicable.
Directory of Open Access Journals (Sweden)
Hongyang Zhang
2016-01-01
Full Text Available Yin-Chen-Hao-Tang (YCHT is a famous Chinese medicine formula which has long been used in clinical practice for treating various liver diseases, such as liver fibrosis. However, to date, the mechanism for its anti-fibrotic effects remains unclear. In this paper, an ultra-performance liquid chromatography-time-of-flight mass spectrometry (UPLC-TOF-MS-based metabolomic study was performed to characterize dimethylnitrosamine (DMN-induced liver fibrosis in rats and evaluate the therapeutic effects of YCHT. Partial least squares-discriminant analysis (PLS-DA showed that the model group was well separated from the control group, whereas the YCHT-treated group exhibited a tendency to restore to the controls. Seven significantly changed fibrosis-related metabolites, including unsaturated fatty acids and lysophosphatidylcholines (Lyso-PCs, were identified. Moreover, statistical analysis demonstrated that YCHT treatment could reverse the levels of most metabolites close to the normal levels. These results, along with histological and biochemical examinations, indicate that YCHT has anti-fibrotic effects, which may be due to the suppression of oxidative stress and resulting lipid peroxidation involved in hepatic fibrogenesis. This study offers new opportunities to improve our understanding of liver fibrosis and the anti-fibrotic mechanisms of YCHT.
User interface design of electronic appliances
Baumann, Konrad
2002-01-01
Foreword by Brenda Laurel. Part One: Introduction 1. Background, Bruce Thomas 2. Introduction, Konrad Baumann 3. The Interaction Design Process, Georg Rakers Part Two: User Interface Design 4. Creativity Techniques, Irene Mavrommati 5. Design Principals, Irene Mavrommati and Adrian Martel 6. Design of On-Screen Interfaces, Irene Mavrommati Part Three: Input Devices 7. Controls, Konrad Baumann 8. Keyboards, Konrad Baumann 9. Advanced Interaction Techniques, Christopher Baber and Konrad Baumann 10. Speech Control, Christopher Baber and Jan Noyes 11. Wearable Computers, Christopher Baber Part Fou
Energy Technology Data Exchange (ETDEWEB)
Nemchinsky, V A [Key College, 225 Dania Beach Blvd, Dania Beach, FL 33040 (United States)
2007-07-07
The heating history of a droplet during its flight can be divided into two phases: (a) the initial phase when evaporation, although it occurs, does not change the heat balance of the droplet much (the case considered in our previous paper and (b) the final phase when the cooling due to evaporation balances the heat flux from the plasma. The later phase is considered in Chen's comment. In our reply, a very straightforward consideration demonstrates that even in the final phase of the droplet flight, the 'rocket' effect can be significant. (reply)
Khan, Sabeel M.; Sunny, D. A.; Aqeel, M.
2017-09-01
Nonlinear dynamical systems and their solutions are very sensitive to initial conditions and therefore need to be approximated carefully. In this article, we present and analyze nonlinear solution characteristics of the periodically forced Chen system with the application of a variational method based on the concept of finite time-elements. Our approach is based on the discretization of physical time space into finite elements where each time-element is mapped to a natural time space. The solution of the system is then determined in natural time space using a set of suitable basis functions. The numerical algorithm is presented and implemented to compute and analyze nonlinear behavior at different time-step sizes. The obtained results show an excellent agreement with the classical RK-4 and RK-5 methods. The accuracy and convergence of the method is shown by comparing numerically computed results with the exact solution for a test problem. The presented method has shown a great potential in dealing with the solutions of nonlinear dynamical systems and thus can be utilized in delineating different features and characteristics of their solutions.
78 FR 79059 - Public Notice for Waiver of Aeronautical Land-Use Assurance
2013-12-27
..., Irene Porter, Program Manager, 11677 South Wayne Road, Suite 107, Romulus, Michigan 48174 Telephone... Porter, Program Manager, Federal Aviation Administration, Airports District Office, 11677 South Wayne.... FOR FURTHER INFORMATION CONTACT: Irene Porter, Program Manager, Federal Aviation Administration...
Energy Technology Data Exchange (ETDEWEB)
Wendler, Johann Jakob, E-mail: johann.wendler@med.ovgu.de [Otto von Guericke University of Magdeburg, Department of Urology, University Hospital (Germany); Ricke, Jens, E-mail: jens.Ricke@med.ovgu.de; Pech, Maciej, E-mail: macej.pech@med.ovgu.de; Fischbach, Frank, E-mail: frank.fischbach@med.ovgu.de; Jürgens, Julian, E-mail: julian.juergens@med.ovgu.de [University of Magdeburg, Department of Radiology (Germany); Siedentopf, Sandra, E-mail: sandra.siedentopf@med.ovgu.de; Roessner, Albert, E-mail: albert.roessner@med.ovgu.de [University of Magdeburg, Institute of Pathology (Germany); Porsch, Markus, E-mail: markus.porsch@med.ovgu.de; Baumunk, Daniel, E-mail: daniel.baumunk@med.ovgu.de; Schostak, Martin, E-mail: martin.schostak@med.ovgu.de [Otto von Guericke University of Magdeburg, Department of Urology, University Hospital (Germany); Köllermann, Jens, E-mail: jens.koellermann@sana.de [Sana Klinikum Offenbach Am Main, Institute of Pathology (Germany); Liehr, Uwe-Bernd, E-mail: uwe-bernd.liehr@med.ovgu.de [Otto von Guericke University of Magdeburg, Department of Urology, University Hospital (Germany)
2016-02-15
IntroductionIt is postulated that focal IRE affords complete ablation of soft-tissue tumours while protecting the healthy peritumoral tissue. Therefore, IRE may be an interesting option for minimally invasive, kidney-tissue-sparing, non-thermal ablation of renal tumours.AimWith this current pilot study (“IRENE trial”), we present the first detailed histopathological data of IRE of human RCC followed by delayed tumour resection. The aim of this interim analysis of the first three patients was to investigate the ablation efficiency of percutaneous image-guided focal IRE in RCC, to assess whether a complete ablation of T1a RCC and tissue preservation with the NanoKnife system is possible and to decide whether the ablation parameters need to be altered.MethodsFollowing resection 4 weeks after percutaneous IRE, the success of ablation and detailed histopathological description were used to check the ablation parameters.ResultsThe IRE led to a high degree of damage to the renal tumours (1 central, 2 peripheral; size range 15–17 mm). The postulated homogeneous, isomorphic damage was only partly confirmed. We found a zonal structuring of the ablation zone, negative margins and, enclosed within the ablation zone, very small tumour residues of unclear malignancy.ConclusionAccording to these initial, preliminary study results of the first three renal cases, a new zonal distribution of IRE damage was described and the curative intended, renal saving focal ablation of localised RCC below <3 cm by percutaneous IRE by the NanoKnife system appears to be possible, but needs further, systematic evaluation for this treatment method and treatment protocol.
Saleh, Firas; Ramaswamy, Venkatsundar; Georgas, Nickitas; Blumberg, Alan F.; Pullen, Julie
2016-07-01
This paper investigates the uncertainties in hourly streamflow ensemble forecasts for an extreme hydrological event using a hydrological model forced with short-range ensemble weather prediction models. A state-of-the art, automated, short-term hydrologic prediction framework was implemented using GIS and a regional scale hydrological model (HEC-HMS). The hydrologic framework was applied to the Hudson River basin ( ˜ 36 000 km2) in the United States using gridded precipitation data from the National Centers for Environmental Prediction (NCEP) North American Regional Reanalysis (NARR) and was validated against streamflow observations from the United States Geologic Survey (USGS). Finally, 21 precipitation ensemble members of the latest Global Ensemble Forecast System (GEFS/R) were forced into HEC-HMS to generate a retrospective streamflow ensemble forecast for an extreme hydrological event, Hurricane Irene. The work shows that ensemble stream discharge forecasts provide improved predictions and useful information about associated uncertainties, thus improving the assessment of risks when compared with deterministic forecasts. The uncertainties in weather inputs may result in false warnings and missed river flooding events, reducing the potential to effectively mitigate flood damage. The findings demonstrate how errors in the ensemble median streamflow forecast and time of peak, as well as the ensemble spread (uncertainty) are reduced 48 h pre-event by utilizing the ensemble framework. The methodology and implications of this work benefit efforts of short-term streamflow forecasts at regional scales, notably regarding the peak timing of an extreme hydrologic event when combined with a flood threshold exceedance diagram. Although the modeling framework was implemented on the Hudson River basin, it is flexible and applicable in other parts of the world where atmospheric reanalysis products and streamflow data are available.
Maximilien Brice
2007-01-01
Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007
Tuggle, B.N.; Crites, John L.
1984-01-01
Three species of trichostrongylid nematodes were removed from the gizzards of 25 lesser snow geese, Chen caerulescens caerulescens, collected at Winisk, Ont. A 100% prevalence of infection was noted in the sampled population with each bird harboring two or more of the following species: Epomidiostomum crami (prevalence, 92%; mean intensity, 18.7 ± 13.3), Amidostomum anseris (prevalence, 84%; mean intensity, 9.6 ± 9.8), and Amidostomum spatulatum (prevalence, 84%; mean intensity, 11.2 ± 9.8). When large burdens (>30) of both A. anseris and A. spatulatum were present in the mucosal lining of the gizzard, progressive degeneration of the epithilium and koilin linings was noted in 16% of the geese examined. Severe necrotic granulomata observed in the gizzard muscle of 36% of the geese were associated with sizable burdens (>25) of E. crami which were found burrowed in the gizzard muscle.
Yang, Qiaoling; Yang, Fan; Tang, Xiaowen; Ding, Lili; Xu, Ying; Xiong, Yinhua; Wang, Zhengtao; Yang, Li
2015-04-16
Yin-Chen-Hao-Tang (YCHT), a commonly used as a traditional chinese medicine for liver disease. Several studies indicated that YCHT may improving hepatic triglyceride metabolism and anti-apoptotic response as well as decreasing oxidative stress .However, little is known about the role of YCHT in chlorpromazine (CPZ) -induced chlolestatic liver injury. Therefore, we aimed to facilitate the understanding of the pathogenesis of cholestatic liver injury and evaluate the effect of Yin-Chen-Hao-Tang (YCHT) on chlorpromazine (CPZ)-induced cholestatic liver injury in rats based on the change of bile acids (BAs) and free fatty acids (FFAs) alone with the biochemical indicators and histological examination. We conducted an experiment on CPZ-induced cholestatic liver injury in Wistar rats with and without YCHT for nine consecutive days. Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB), total bilirubin (TBIL), total cholesterol (TC), triglycerides (TG), low density lipoprotein-cholesterol (LDL-C) were measured to evaluate the protective effect of YCHT against chlorpromazine (CPZ)-induced cholestatic liver injury. Histopathology of the liver tissue showed that pathological injuries were relieved after YCHT pretreatment. In addition, ultra-performance lipid chromatography coupled with quadrupole mass spectrometry (UPLC-MS) and gas chromatography coupled with mass spectrometry (GC-MS) was applied to determine the content of bile acids, free fatty acids, respectively. Obtained data showed that YCHT attenuated the effect of CPZ-induced cholestatic liver injury, which was manifested by the serum biochemical parameters and histopathology of the liver tissue. YCHT regulated the lipid levels as indicated by the reversed serum levels of TC, TG, and LDL-C. YCHT also regulated the disorder of BA and FFA metabolism by CPZ induction. Results indicated that YCHT exerted a protective effect on CPZ-induced cholestasis liver injury. The variance of
Writing Beyond the Wall: Translation, Cross-cultural Exchange, and Chen Ran's 'A Private Life'
Directory of Open Access Journals (Sweden)
Kay Schaffer
2006-09-01
Full Text Available The past decade has witnessed an unprecedented rise in the global flow of knowledge, nowhere more apparent in the exchange of ideas between China and modern western democracies. Our interest concerns one aspect of this global flow— the translation of Chinese women’s autobiographical writing into English. Taking Chen Ran’s A Private Life (English edition, 2004 as a point of departure, the paper explores issues of translingual practice and cross-cultural exchange. It considers what escapes or is lost in translation as well as the additive potential of the host text. It is sometimes the case that the translation can deliberately make certain ambiguities visible—whether from pragmatic, market-driven motivations or from more complex political, historical and cultural considerations. These negotiations of meaning that occur in the translation process can reverberate on the critical reception of texts in both the ‘guest’ and ‘host’ languages (Liu 1995, with open-ended, incomplete and indeterminate effects. The paper examines the effects of the omission of a brief parenthetical section of three paragraphs from one chapter of the Chinese edition of A Private Life. Yet, even that small emendation changes the original text as a cultural object and alters potential modes of its reception. In this case, the translation results in a loss of ambiguity, irony, philosophic and rhetorical sophistication while also offering additive potentials that enhance the generation of new meanings in the translingual exchange, here with reference Tiananmen and contemporary feminism in China. The translation process provides new channels for readers, writers and theorists to dialogue and communicate across gaps of difference, despite inhibiting factors like the imposition of local restraints, the universalising pressures of western modernity, and asymmetrical relations of power between guest and host language contexts.
2010-03-25
...: Irene R. Porter, Program Manager, Detroit Airports District Office, 11677 South Wayne Road, Suite 107, Romulus, MI 48174 FOR FURTHER INFORMATION CONTACT: Irene R. Porter, Program Manager, Federal Aviation... Dayton as recorded in Deed Book 1616, Page 505 and part of a 12.07 acre tract (Parcel 21) conveyed to The...
1985-01-01
Irene Truuts on suveks meestele kavandanud kombinesooni, blusooni ja püksid, sportliku ülikonna (5 moejoonist). Nr. 2, lk. 28-3: Meeste päevasest rõivastusest. Mudelite autorid Heli Kohk (6 moejoonist), Liivi Raid (5 moejoonist). Nr. 3, lk. 18-25: Meestemoest Üleliidulise Esteetikakomisjoni prognooside ja rahvusvaheliste moeajakirjade põhjal. Vaatluse all: stiilid, mantlid, joped, jakid, ülikonnad, püksid, särgid, jalatsid, peakatted, lipsud. Mudelid (6 moejoonist, 7 fotomudelit) on kavandanud Irene Truuts. Nr. 3, lk. 26-27: Kahe meeste džempri kudumise õpetus. Mudelite autorid Krista Kajandu ja Anu Stranberg. Nr. 4, lk. 30-33: Moodsad meesterõivad (7 moejoonist) kavandas kunstnik Irene Truuts.
Motomura, Hiroyuki; Causse, Romain; Béarez, Philippe; Mishra, Subhrendu Sekhar
2015-09-29
The Indo-West Pacific species, Neomerinthe erostris (Alcock 1896), originally described as Scorpaena erostris, is redescribed as a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002. Although the latter three nominal species have been regarded as valid species and N. erostris has not been reported since 1898, examinations of type specimens of the four nominal species revealed that they represent a single species. A lectotype of Scorpaena erostris is herein designated. Neomerinthe erostris is characterized by having a distinct longitudinal ridge on the lateral surface of the maxilla and a strongly rounded dorsal profile of the head.
International Nuclear Information System (INIS)
Panova, T.D.; Dmitriev, A.Yu.; Borzakov, S.B.; Khramko, K.
2017-01-01
The neutron activation analysis (NAA) of three samples of human remains of the XVI-XVII centuries from the necropolises of the Moscow Kremlin has been carried out at FLNP JINR. The samples were irradiated at two facilities: at the IREN source of resonance neutrons and at the IBR-2 reactor. Spectra of induced activity of the irradiated samples were measured by using the automatic measurement system developed at FLNP JINR. This system consists of a high-purity germanium detector with spectrometric electronics, a sample changer, and a control software. Mass fractions of arsenic, mercury and other elements were calculated by relative and absolute NAA methods. The obtained values confirmed the fact of an acute mercury poisoning of the first wife of Tsar Ivan Vasilievich the Terrible - Tsarina Anastasia Romanovna. Increased mercury content was detected in the bone remains of the son of Tsar Ivan the Terrible, Tsarevich Ivan Ivanovich, and Prince M. V. Skopin-Shuisky. The obtained results allow us to introduce into scientific circulation the exact values of mass fraction of mercury, arsenic and some other elements in the samples from the graves of Russian historical figures of the second half of XVI - early XVII centuries. [ru
Directory of Open Access Journals (Sweden)
Kristi S Shaw
2014-05-01
Full Text Available To determine if a storm event (i.e., high winds, large volumes of precipitation could alter concentrations of Vibrio vulnificus and Vibrio parahaemolyticus in aquacultured oysters (Crassostrea virginica and associated surface water and sediment, this study followed a sampling timeline before and after Hurricane Irene impacted the Chesapeake Bay estuary in late August 2011. Aquacultured oysters were sampled from two levels in the water column: surface 0.3 m and near-bottom just above the sediment. Concentrations of each Vibrio spp. and associated virulence genes were measured in oysters with a combination of real-time PCR and most probable number enrichment methods, and in sediment and surface water with real-time PCR. While concentration shifts of each Vibrio species were apparent post-storm, statistical tests indicated no significant change in concentration change for either Vibrio species by location (surface or near bottom oysters or date sampled (oyster tissue, surface water and sediment concentrations. V. vulnificus in oyster tissue was correlated with total suspended solids (r=0.41, p=0.04, and V. vulnificus in sediment was correlated with secchi depth (r=-0.93, p< 0.01, salinity (r=-0.46, p=0.02, tidal height (r=-0.45, p=0.03, and surface water V. vulnificus (r=0.98, p< 0.01. V. parahaemolyticus in oyster tissue did not correlate with environmental measurements, but V. parahaemolyticus in sediment and surface water correlated with several measurements including secchi depth (r=-0.48, p=0.02[sediment]; r=-0.97 p< 0.01[surface water] and tidal height (r=-0.96. p< 0.01[sediment], r=-0.59,p< 0.01 [surface water]. The concentrations of Vibrio spp. were higher in oysters relative to other studies (average V. vulnificus 4x105 MPN g-1, V. parahaemolyticus 1x105 MPN g-1, and virulence-associated genes were detected in most oyster samples. This study provides a first estimate of storm-related Vibrio density changes in oyster tissues, sediment and
New World species of the genus Calliscelio Ashmead (Hymenoptera, Platygastridae, Scelioninae
Directory of Open Access Journals (Sweden)
Hua-yan Chen
2017-01-01
Full Text Available The genus Calliscelio Ashmead is presumed to be a diverse group of parasitoids of the eggs of crickets (Orthoptera: Gryllidae. A least one species has been found to be an important factor in depressing cricket pest populations. The New World species of Calliscelio are revised. Forty-two species are recognized, 3 are redescribed: C. bisulcatus (Kieffer, C. laticinctus Ashmead, C. rubriclavus (Ashmead, comb. n.; and 38 are described as new: C. absconditum Chen & Johnson, sp. n., C. absum Chen & Johnson, sp. n., C. alcoa Chen & Masner, sp. n., C. amadoi Chen & Johnson, sp. n., C. armila Chen & Masner, sp. n., C. bidens Chen & Masner, sp. n., C. brachys Chen & Johnson, sp. n., C. brevinotaulus Chen & Johnson, sp. n., C. brevitas Chen & Johnson, sp. n., C. carinigena Chen & Johnson, sp. n., C. crater Chen & Johnson, sp. n., C. crena Chen & Johnson, sp. n., C. eboris Chen & Johnson, sp. n., C. extenuatus Chen & Johnson, sp. n., C. flavicauda Chen & Johnson, sp. n., C. foveolatus Chen & Johnson, sp. n., C. gatineau Chen & Johnson, sp. n., C. glaber Chen & Masner, sp. n., C. granulatus Chen & Masner, sp. n., C. latifrons Chen & Johnson, sp. n., C. levis Chen & Johnson, sp. n., C. longius Chen & Johnson, sp. n., C. magnificus Chen & Masner, sp. n., C. migma Chen & Johnson, sp. n., C. minutia Chen & Johnson, sp. n., C. paraglaber Chen & Johnson, sp. n., C. pararemigio Chen & Masner, sp. n., C. prolixus Chen & Johnson, sp. n., C. punctatifrons Chen & Johnson, sp. n., C. remigio Chen & Masner, sp. n., C. ruga Chen & Johnson, sp. n., C. rugicoxa Chen & Masner, sp. n., C. sfina Chen & Johnson, sp. n., C. storea Chen & Johnson, sp. n., C. suni Chen & Johnson, sp. n., C. telum Chen & Johnson, sp. n., C. torqueo Chen & Johnson, sp. n., C. virga Chen & Johnson, sp. n. Four species are treated as junior synonyms of Calliscelio rubriclavus (Ashmead: Anteris nigriceps Ashmead, syn. n., Caloteleia marlattii Ashmead, syn. n., Caloteleia grenadensis Ashmead, syn. n
Diabetes in Combat: Effect of Military Deployment on Diabetes Mellitus in Air Force Personnel
2017-04-01
Irene; irene. folaron.mil@ mail.mil 916-2672 16. AUTHORSHIP AND CO-AUTHOR(S) List in the order they will appear in the manuscript. LAST NAME. FIRST...respectively, P=0.17). Likewise, subgroup analyses of gender , rank, and age showed no significant difference in A 1 C before and after deployment. ln...6.5% vs. 6.7% respectively, P=0.17). Likewise, subgroup analyses of gender , rank, and age showed no significant difference in A 1 C before and
Panova, T. D.; Dmitriev, A. Yu.; Borzakov, S. B.; Hramco, C.
2018-01-01
A neutron activation analysis (NAA) of three samples of human remains of the 16th and 17th centuries from the necropolises of the Moscow Kremlin has been carried out at FLNP JINR. The samples were irradiated at two facilities: the IREN source of resonance neutrons and the IBR-2 reactor. Spectra of the induced activity of the irradiated samples were measured by using the automatic measurement system developed at the Frank Laboratory of Neutron Physics (FLNP) of the Joint Institute for Nuclear Research (JINR). This system consists of a high-purity germanium detector with spectrometric electronics, a sample changer, and control software. Mass fraction of arsenic, mercury, and some other elements were calculated using two NAA methods—relative and absolute. The obtained values confirm the fact of acute mercury poisoning of Anastasia Romanovna, the first wife of Tsar Ivan Vasil'evich the Terrible, the first Russian Tsarina (died in 1560). High levels of mercury were detected in the bone remains of Tsarevich Ivan Ivanovich (died in 1581), the son of Tsar Ivan the Terrible, and Prince Mikhail Vasil'evich Skopin-Shuiskii (died in 1610). The results provide an opportunity to introduce into scientific circulation the exact values of mass fraction of mercury, arsenic, and other elements in the samples taken from the burials of the Russian historical figures of the second half of 16th-early 17th century.
2017-10-01
Reports an error in "Is Political Behavior a Viable Coping Strategy to Perceived Organizational Politics? Unveiling the Underlying Resource Dynamics" by Shuhua Sun and Huaizhong Chen ( Journal of Applied Psychology , Advanced Online Publication, May 22, 2017, np). In the article, Table 1 contained a formatting error. Correlation coefficient values in the last four cells of column 6 were misplaced with correlation coefficient values in the last four cells of column 7. All versions of this article have been corrected. (The following abstract of the original article appeared in record 2017-22542-001.) We conduct a theory-driven empirical investigation on whether political behavior, as a coping strategy to perceived organizational politics, creates resource trade-offs in moderating the relationship between perceived organizational politics and task performance. Drawing on conservation of resources theory, we hypothesize that political behavior mitigates the adverse effect of perceived organizational politics on task performance via psychological empowerment, yet exacerbates its adverse effect on task performance via emotional exhaustion. Three-wave multisource data from a sample of 222 employees and their 75 supervisors were collected for hypothesis testing. Findings supported our hypotheses. Our study enhances understandings of the complex resource dynamics of using political behavior to cope with perceived organizational politics and highlights the need to move stress-coping research from a focus on the stress-buffering effect of coping on outcomes to a focus on the underlying competing resource dynamics. (PsycINFO Database Record (c) 2017 APA, all rights reserved).
Schmutz, J.A.; Laing, K.K.
2002-01-01
Broods of geese spend time feeding according to availability and quality of food plants, subject to inherent foraging and digestive constraints. We studied behavioral patterns of broods of Emperor Geese (Chen canagica) on the Yukon–Kuskokwim Delta, Alaska, and examined how feeding and alert behavior varied in relation to habitat and goose density. During 1994–1996, time spent feeding by Emperor Goose goslings and adult females was positively related to multispecies goose densities near observation blinds, and not to just Emperor Goose density. Similarly, body mass of Emperor Goose goslings was more strongly related (negatively) to multispecies goose densities than intraspecific densities. A grazing experiment in 1995 indicated that most above ground primary production by Carex subspathacea, a preferred food plant, was consumed by grazing geese. Those results demonstrate that interspecific competition for food occurred, with greatest support for goslings whose behavioral repertoire is limited primarily to feeding, digesting, and resting. Although the more abundant Cackling Canada Geese (Branta canadensis minima) differed from Emperor Geese in their preferred use of habitats during brooding rearing (Schmutz 2001), the two species occurred in equal abundance in habitats preferred by Emperor Goose broods. Thus, Cackling Canada Geese were a numerically significant competitor with Emperor Geese. Comparing these results to an earlier study, time spent feeding by goslings, adult females, and adult males were greater during 1993–1996 than during 1985–1986. During the interval between those studies, densities of Cackling Canada Geese increased two to three times whereas Emperor Goose numbers remained approximately stable, which implies that interspecific competition affected foraging behavior over a long time period. These density-dependent changes in foraging behavior and body mass indicate that interspecific competition affects nutrient acquisition and gosling
Hurricane Havoc - Mapping the Mayhem with NOAA's National Water Model
Aggett, G. R.; Stone, M.
2017-12-01
With Hurricane Irene as an example, this work demonstrates the versatility of NOAA's new National Water Model (NWM) as a tool for analyzing hydrologic hazards before, during, and after events. Hurricane Irene made landfall on the coast of North Carolina on August 27, 2011, and made its way up the East Coast over the next 3 days. This storm caused widespread flooding across the Northeast, where rain totals over 20" and wind speeds of 100mph were recorded, causing loss of life and significant damage to infrastructure. Large portions of New York and Vermont were some of the hardest hit areas. This poster will present a suite of post-processed products, derived from NWM output, that are currently being developed at NOAA's National Water Center in Tuscaloosa, AL. The National Water Model is allowing NOAA to expand its water prediction services to the approximately 2.7 million stream reaches across the U.S. The series of forecasted and real-time analysis products presented in this poster will demonstrate the strides NOAA is taking to increase preparedness and aid response to severe hydrologic events, like Hurricane Irene.
50 years with nuclear fission, April 25-28, 1989. A prelude to fission: France
International Nuclear Information System (INIS)
Savic, P.
1989-01-01
A personal account of the events leading to the 1938 discovery, by Irene Joliot-Curie and the author, of the unidentified element R 3.5h will be presented, as well as the experimental methods proving the R 3.5h had chemical properties similar to lanthanum which in turn led Hahn and Strassmann to the discovery of fission in 1939. The author points out that Irene Curie's intuition indicated the path towards the solution of the problem of uranium irradiated by neutrons, which made possible the discovery of fission by Hahn and Strassmann. Further applications of fission became possible by tremendous efforts and excellent contributions of scientists in the USA
Renschler, Chris S.; Wang, Zhihao
2017-10-01
In light of climate and land use change, stakeholders around the world are interested in assessing historic and likely future flood dynamics and flood extents for decision-making in watersheds with dams as well as limited availability of stream gages and costly technical resources. This research evaluates an assessment and communication approach of combining GIS, hydraulic modeling based on latest remote sensing and topographic imagery by comparing the results to an actual flood event and available stream gages. On August 28th 2011, floods caused by Hurricane Irene swept through a large rural area in New York State, leaving thousands of people homeless, devastating towns and cities. Damage was widespread though the estimated and actual floods inundation and associated return period were still unclear since the flooding was artificially increased by flood water release due to fear of a dam break. This research uses the stream section right below the dam between two stream gages North Blenheim and Breakabeen along Schoharie Creek as a case study site to validate the approach. The data fusion approach uses a GIS, commonly available data sources, the hydraulic model HEC-RAS as well as airborne LiDAR data that were collected two days after the flood event (Aug 30, 2011). The aerial imagery of the airborne survey depicts a low flow event as well as the evidence of the record flood such as debris and other signs of damage to validate the hydrologic simulation results with the available stream gauges. Model results were also compared to the official Federal Emergency Management Agency (FEMA) flood scenarios to determine the actual flood return period of the event. The dynamic of the flood levels was then used to visualize the flood and the actual loss of the Old Blenheim Bridge using Google Sketchup. Integration of multi-source data, cross-validation and visualization provides new ways to utilize pre- and post-event remote sensing imagery and hydrologic models to better
Directory of Open Access Journals (Sweden)
Li Xi-Ying
2013-02-01
postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915, O. ambiguus Weng & Chen, 2005 (not Wesmael, 1835 and O. mitis Chen & Weng, 2005 (not Fischer, 1963 are primary homonyms and are renamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. and O. wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005 comb. n., Diachasmimorpha longicaudata (Ashmead, 1905 and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957 comb. n. is new for China and Hunan; Xynobius maculipennis (Enderlein, 1912 comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005 comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005 comb. n., A. tracta (Weng & Chen, 2005 comb. n., Areotetes laevigatus (Weng & Chen, 2005 comb. n., Phaedrotoma dimidia (Chen & Weng, 2005 comb. n., P. improcera (Weng & Chen, 2005 comb. n., P. amputata (Weng & Chen, 2005 comb. n., P. larga (Weng & Chen, 2005 comb. n., P. osculas (Weng & Chen, 2005 comb. n., P. postuma (Chen & Weng, 2005 comb. n., P. rugulosa (Chen & Weng, 2005 comb. n., P. tabularis (Weng & Chen, 2005 comb. n., Rhogadopsis apii (Chen & Weng, 2005 comb. n., R. dimidia (Chen & Weng, 2005 comb. n., R. diutia (Chen & Weng, 2005 comb. n., R. longuria (Chen & Weng, 2005 comb. n., R. pratellae (Weng & Chen, 2005 comb. n., R. pratensis (Weng & Chen, 2005 comb. n., R. sculpta (Chen & Weng, 2005 comb. n., R. sulcifer (Fischer, 1975 comb. n., R. tabidula (Weng & Chen, 2005 comb. n., Xynobius complexus (Weng & Chen, 2005 comb. n
China Report, Political, Sociological and Military Affairs, No. 445.
1983-08-11
2052 0981], Chen Dingming [7115 7844 6900], Jin Xiulan [6855 4423 5695] (F, Mongolian), Zhao Nanqi [6392 0589 6386] Korean), Suo Jingxian [4792...Pen Center and the Guangzhou Pen Center will be headed by Chen Huangmei, another vice-president of the China center and a noted critic. The...1728 4426 6311], Zhang Tengxiao [1728 7506 7197], Chen Dingmou [7115 0002 5399], Chen Lunfen [7115 0243 5358] (F), Chen Xitong [7115 1585 0681
Technical Digest of the 1998 Summer Topical Meeting on Organic Optics and Optoelectronics
1998-07-01
Larry Dalton, University of Southern California, Los Angeles, CA Harold Fetterman , University of California, Los Angeles, CA Steve Forrest...OPTIC MODULATORS H. Fetterman , D. Chen, A. Udupa. D. Bhattachaya, B. Tsap University of Califonia, Los Angeles 90024 S. Lee, A. Chen, J. Chen, W...Chen, H.R. Fetterman , A. Chen, W.H. Steier, and L. R. Dalton, Appl. Phys. Lett. 70, (1997). 2. T.A. Tumolillo and P.R. Ashley, Appl. Phys. Lett. 62
2009-01-01
Tutv. rmt.: Kõve, Villu. Varaliste tehingute süsteem Eestis : [doktoritöö] / juhendaja: Irene Kull. - Tartu : Tartu Ülikooli Kirjastus, 2009. - 437 lk. - (Dissertationes iuridicae Universitatis Tartuensis ; 22)
Gómez Cadenas, J J
2008-01-01
Enero, 1999. Unas extrañas burbujas se han colocado en el acelerador de particulas del CERN (Ginebra). Ante el riesgo de que esto desencadene una catástrofe a escala mundial, el centro ordena detener el experimento. Años después, Irene, una joven y promotedora científica, es contratada en la división de Física Teórica del CERN. Allí coincide con el mayor Espinosa, destinado a la sede suiza de la ONU para trabajar en un proyecto contra la proliferación de armas nucleares. La misión de Espinosa resulta ser mucho más arriesgada de lo que parecía. Irene ambiciosa y rebelde, toma una decisión de efectos imprevisibles.
A new leader for Lithuania's ruling party? / Kestutis Girnius
Girnius, Kestutis K.
2011-01-01
Irene Degutiene, kes on reitingult president Dalia Grybauskaite järel teine poliitik Leedus, tahab asendada erakonna Isamaaliit – Leedu Kristlikud Demokraadid praegust esimeest Andrius Kubiliust, kes on ka riigi peaminister
Institute of Scientific and Technical Information of China (English)
陳智超
2010-01-01
Every historian should answer two questions related to each other, i. e. what is the relationship between history and reality and what is that between historiography and reality. Moreover, Chinese historians should answer other two questions also re-lated to each other, namely what is the relationship between China and the West and what is that between Chinese culture and Western culture. Based on their own outlook on the ancient and the present as well as on China and the West, every conscious Chinese historian of the 20 th century was bound to cherish a definite sense of responsi-bility and determined what role they played and what way they chose when taking on this responsibility. The present paper expounds Prof. Chen Yuan’ s answers to the above questions andhis practice concerned with them in the four stages of his lifetime.
Li, Xi-Ying; van Achterberg, Cornelis; Tan, Ji-Cai
2013-01-01
van Achterberg & Li, gen. n. (type species: Areotetes carinuliferus sp. n.) and Coleopioides van Achterberg & Li, gen. n. (type species: Coleopioides postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915), Opius ambiguus Weng & Chen, 2005 (not Wesmael, 1835) and Opius mitis Chen & Weng, 2005 (not Fischer, 1963) are primary homonymsandarerenamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. andOpius wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005) comb. n.,Diachasmimorpha longicaudata (Ashmead, 1905) and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957) comb. n. is new for China and Hunan; Xynobius maculipennis(Enderlein, 1912) comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005) comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005) comb. n., Apodesmia tracta (Weng & Chen, 2005) comb. n., Areotetes laevigatus (Weng & Chen, 2005) comb. n., Phaedrotoma dimidia (Chen & Weng, 2005) comb. n., Phaedrotoma improcera (Weng & Chen, 2005) comb. n., Phaedrotoma amputata (Weng & Chen, 2005) comb. n., Phaedrotoma larga (Weng & Chen, 2005) comb. n., Phaedrotoma osculas (Weng & Chen, 2005) comb. n., Phaedrotoma postuma (Chen & Weng, 2005) comb. n., Phaedrotoma rugulosa (Chen & Weng, 2005) comb. n., Phaedrotoma tabularis (Weng & Chen, 2005) comb. n., Rhogadopsis apii (Chen & Weng, 2005) comb. n., Rhogadopsis dimidia (Chen & Weng, 2005) comb. n., Rhogadopsis diutia (Chen & Weng, 2005) comb. n., Rhogadopsis
Reference: 291 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 291 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16244906i Chai Mao-Feng...d chloroplast protection. 4 553-64 16244906 2005 Nov Plant molecular biology An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Chen Ye-Miao|Wang Xue-Chen
PENi kirjandusauhinnad selgunud : [sõnum
2002-01-01
Nabokovi-preemia Mario Vargas Llosale; Laura Pelsi auhind Tony Kushnerile ja Maria Irene Fornesile; uudsena noortele kirjanike määratava Robert Binghami auhinna saavad Carolyn Cooke, Matthew Klam ja Manil Suri
Talons and beaks are viable but underutilized samples for detecting ...
African Journals Online (AJOL)
Talons and beaks are viable but underutilized samples for detecting organophosphorus and carbamate pesticide poisoning in raptors. Ngaio Richards, Irene Zorrilla, Joseph Lalah, Peter Otieno, Isabel Fernandez, Monica Calvino, Joaquin Garcia ...
DEFF Research Database (Denmark)
Wilmot-Dear, Christine Melanie; Friis, Ib; Govaerts, R. H. A.
2014-01-01
(H. Lév.) C.J. Chen in Chen et al. as the correct name for the variety named in the revision as B. zollingeriana Wedd. var. podocarpa (W.T. Wang) W.T. Wang & C.J. Chen in Chen et al., (3) that the combination B. spicata (Thunb.) Thunb., based on Urtica spicata Thunb., is not illegitimate, as stated...
U.S. Environmental Protection Agency — These data describe the chromatography characteristics of the MARGA instrument software as compared to an alternative, independent technique for chromatogram...
A Narrative Enrichment Programme in literacy development of ...
African Journals Online (AJOL)
speaking Grade 3 learners in monolingual rural schools. Irene Brand ... used to assess how learners recount the various narrative components and the chronology. Keywords: children, meaning-making, drawings, early writings, multimodal pedagogies ...
ICT and Pragmatism: Creating sustainable Employment for ...
African Journals Online (AJOL)
OE Osuagwu, VC Agbasonu, C Ndigwe, E Irene, U Sulaiman ... deep challenges in Nigeria's labour market, where the nation's rapid economic growth has not ... Key Words: e-commerce, online transaction, broadband stimulus, unemployment.
Professor Peep Veski meie meenutustes
2014-01-01
Mälestusi Tartu Ülikooli Farmaatsia instituudi juhatajast Peep Veskist jagavad: Eve-Irene Lepist, Urve Paaver, Karin Kogermann, Kristian Semjonov, Jaak Koppel, Kristin Raudsepp, Imre Klebovich, Filiz Hincal, A. Atilla Hincal ja Elmar Arak
Tampere Teatrisuve maiuspalaks olid soomlased / Tiiu Laks
Laks, Tiiu, 1984-
2006-01-01
38. Tampere teatrisuvest (Tamperen teatterikesä), vaatluse all on soomlaste menutükid - Anna Krogeruse "Armastusest minu vastu" (lav. Irene Aho, Soome Rahvusteater) ja William Shakespeare'i "Richard III" (lav. Juha Luukkonen, Vaasa Linnateater)
Abutting Absence : Love Letters from Two Eras / Tiina Kirss
Kirss, Tiina, 1957-
2008-01-01
Irene Lääne ja Toomas Hiio koostatud raamatust "Ühtekuuluvuse teel : Johan Laidoneri kirjad abikaasale" (Tallinn : Varrak, 2008) ja Käbi Laretei raamatust "Kuhu kadus kõik see armastus?" (Tallinn : SE & JS, 2008)
the iniprovement and application of genetic resources in animal
African Journals Online (AJOL)
Animal and Dairy Science Reseorch Instiute, Irene, 1675. In the process of abandoning ... genetic improvement of the industry on a national basis. Quantitatively the ..... rapidly developing, challenging and competitive world with its modern ...
Directory of Open Access Journals (Sweden)
Marcela L. Monné
2005-06-01
Full Text Available As espécies do gênero Strangalia Audinet-Serville do Norte e Centro-Oeste do Brasil são revistas. Strangalia xanthomelaena sp. nov. é descrita de Rondônia e Mato Grosso, Brasil. Dois novos sinônimos são propostos: Ophistomis irene Gounelle, 1911 = Euryptera albicollis Pascoe, 1860; O. paraensis Bates, 1870 = O. bivittatus Bates, 1870. São fornecidas ilustrações e chave para identificação das espécies.The species of the genus Strangalia from northern and central Brazil are revised. Strangalia xanthomelaena sp. nov. is described from Rondônia and Mato Grosso, Brazil. Two new synonyms are proposed: Ophistomis irene Gounelle, 1911 = Euryptera albicollis Pascoe, 1860; O. paraensis Bates, 1870 = O. bivittatus Bates, 1870. Illustrations and key for identification are provided.
Учебные программы: новости и мифы / Юлия Тоцкая
Тоцкая, Юлия
2010-01-01
Narvas toimunud briifingul selgitas Haridus- ja Teadusministeeriumi üldharidusosakonna juhataja Irene Käosaar uuendusi õppekavades ja uut põhikooli- ning gümnaasiumiseadust, sealhulgas ka vene õppekeelega koolide eestikeelsele õppele ülemineku küsimusi
Arvo Pärt ajas ja ajatuses / Igor Garšnek
Garšnek, Igor, 1958-
2010-01-01
Mõtteid Arvo Pärdi muusikast ajendatuna ETVs 2. septembril kavas olnud saadetest: "Arvo Pärt Istanbulis " ja "Arvo Pärdi autorikontsert Istanbulis", mis kajastasid 7. juunil Hagia Irene kirikus esiettekandel tulnud helilooja uusimat teost "Aadama itk"
Seven new species of Begonia (Begoniaceae) in Northern Vietnam and Southern China
Chen, Wen-Hong; Radbouchoom, Sirilak; Nguyen, Hieu Quang; Nguyen, Hiep Tien; Nguyen4, Khang Sinh; Shui, Yu-Min
2018-01-01
Abstract Since 2016, KIB (Kunming Institute of Botany) and CPC (Centre for Plant Conservation of Vietnam) have conducted several surveys in the transboundary karst regions in Northern Vietnam and Southern China and seven new species in the genus Begonia Linn. (Begoniaceae) are firstly described. Amongst them, two species, Begonia albopunctata Y.M. Shui, W.H. Chen & H.Q. Nguyen and B. erectocarpa H.Q. Nguyen, Y.M. Shui & W.H. Chen, respectively belong to section Sphenanthera with berry fruits and section Leprosae with clavate berry fruits; four species, B. gulongshanensis Y.M. Shui & W. H. Chen, B. minissima H.Q. Nguyen, Y.M. Shui & W.H. Chen, B. mollissima Y.M. Shui, H.Q. Nguyen & W.H. Chen, B. rhytidophylla Y.M. Shui & W.H. Chen, belong to section Coelocentrum with parietal placentation; one species, Begonia bambusetorum H.Q. Nguyen, Y.M. Shui & W.H. Chen, belongs to section Diploclinium with 3-loculed ovary and capsules. The diagnostic characters of these species are described and illustrated in the text and photographs. PMID:29416422
David Oistrahhi festival läheneb lõpule / Toivo Traks
Traks, Toivo
2006-01-01
Kontsertidest David Oistrahhi festivali raames: saksa viola da gamba mängija Holger Faust-Peters ja klavessinist Iren Lill 19. juulil Pärnu Eliisabeti kirikus, briti laulja Patricia Rozario ja RTE Vanbrugh Quartet 20. juulil Eliisabeti kirikus
A decade towards better health in Chile.
Helmke, Irene
2011-10-01
In 1990, after 17 years of dictatorship, Chile started rebuilding its political system with a focus on improving social conditions and health. A recent study of the last 10 years shows some positive results. Irene Helmke reports.
Genetic analysis of female fertility traits in South African Holstein cattle
African Journals Online (AJOL)
Bobby
1 ARC-Livestock Business Division, P/Bag X2, Irene 0062, South Africa .... Descriptive statistics of all traits were computed using the Proc Means procedure of the Statistical. Analysis System (SAS ..... of Australian Holstein-Friesian cattle. Anim.
Indian Academy of Sciences (India)
IAS Admin
individual researchers or small groups would pursue their sub- jects of interest .... The task of identification ... attracted the attention of Irene Curie and her collaborator Pavel .... tions leading to elongation, and divide itself into two smaller drops.
Full Text Available ... ago 20,217 views Trainer Sandy and Irene practice Back Leg Raises, a lower body exercise from ... 19 Play next Play now Choosing Nutrient Dense Foods - Duration: 6 minutes, 19 seconds. National Institute On ...
Two new genera and three new species of Epipaschiinae Meyrick from China (Lepidoptera, Pyralidae
Directory of Open Access Journals (Sweden)
Mingqiang Wang
2017-12-01
Full Text Available Two new genera of Epipaschiinae are described. The genus Arcanusa Wang, Chen & Wu, gen. n. is established for Ar. apexiarcanusa Wang, Chen & Wu, sp. n. and Ar. sinuosa (Moore, 1888, comb. n., described in Scopocera Moore, 1888 (junior synonym of Stericta Lederer, 1863. The female genitalia of Ar. sinuosa (Moore, 1888, comb. n. are described for the first time. Androconia Wang, Chen & Wu, gen. n. is erected, including two new species, An. rallusa Wang, Chen & Wu, sp. n. and An. morulusa Wang, Chen & Wu, sp. n. Illustrations of all adults and their genitalia, and a key to the two new genera are provided.
2013-08-01
Public transit agencies play an important role in the provision of safe, reliable, and cost-effective transportation for the communities they serve. With the growing intensity and frequency of extreme weather events, such as hurricanes Irene and Sand...
Social Media for Transportation Disaster, Preparation, Response, and Recovery
2017-10-01
The Northeast United States, particularly New York State has experienced an increase in extreme 24-hour precipitation during the past 50 years (Horton et al., 2011). Recent events such as Hurricane Irene and Superstorm Sandy have revealed vulnerabili...
Directory of Open Access Journals (Sweden)
Ding H
2014-05-01
Full Text Available Hui Ding,1 Fen Yan,1 Lin-Lin Zhou,2 Xiu-Hai Ji,3 Xin-Nan Gu,1 Zhi-Wei Tang,1 Ru-Hua Chen11Department of Pulmonary Medicine, The Affiliated Yixing People's Hospital, Jiangsu University, Zhenjiang, Jiangsu Province, 2Department of Cardiology, Affiliated Cixi Hospital, Wenzhou Medical University, Wenzhou, Zhejiang Province, 3Department of Oncology, Affiliated Taicang Hospital of Traditional Chinese Medicine, Suzhou, Jiangsu Province, People's Republic of ChinaPurpose: To replicate previously confirmed telomere-length loci in a Chinese Han population with coronary heart disease (CHD, and investigate these loci and the possibility of and age at onset of CHD.Patients and methods: 1514 CHD patients and 2470 normal controls were recruited. Medical data including age, sex, body mass index, lipid profiles, history of hypertension, type 2 diabetes mellitus, and dyslipidemia were collected from all the participants. Seven previously identified single-nucleotide polymorphisms (SNPs related to leucocyte telomere length were genotyped, including rs10936599 in TERC, rs2736100 in TERT, rs7675998 in NAF1, rs9420907 in OBFC1, rs8105767 in ZNF208, rs755017 in RTEL1, and rs11125529 in ACYP2.Results: No significant difference in genotype frequencies from the Hardy–Weinberg equilibrium test was noted for all tested SNPs both in the CHD patients and the normal controls. No polymorphism was observed for rs9420907, and AA genotype was noted in both the CHD patients and the controls. Neither the genotype nor the allele frequencies of rs2736100, rs8105767, rs11125529, and rs2967374 were significantly different between the CHD patients and the normal controls. For rs10936599 and rs755017, statistical difference was found for the allele frequency but not genotype. Distributions of genotype and allele were significantly different between the two groups for rs7675998. The odds ratio for carriers of CHD was 2.127 (95% confidence interval: 1.909–2.370 for the A allele of rs
Tropical Journal of Pharmaceutical Research - Vol 15, No 3 (2016)
African Journals Online (AJOL)
Wan Wu, Wei Chen, Qiong Jin, 447-451 ... Chung-Shih Chen, Mei-Lin Wang, Rosa Huang Liu, Shih-Pin Chen, Tsong-Ming Lu, Wei-Yu Tsai, Chien-Fu Huang, ... Yan-Qiong Li, Rui Hu, Li-Hui Zhong, Qian Sun, You-Ping Yan, 527-533.
Construction of full-length cDNA library of white flower Salvia ...
African Journals Online (AJOL)
STORAGESEVER
2009-05-18
May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).
African Journals Online (AJOL)
Items 151 - 200 of 3286 ... Vol 25, No 1 (2016), An appeal for large scale production of ... Dziedzom Komi de Souza, Irene Offei Owusu, Joseph Otchere, Michelle ... treatment of cutaneous larva migrans in an adult Ghanaian male: a case report ...
Retrieval of relative humidity from CSIR-NLC mobile LIDAR backscatter measurements
CSIR Research Space (South Africa)
Tesfaye, M
2009-09-01
Full Text Available data was collected over 23 hours. The above data sets were used to determine the retrieved relative humidity and compared with Irene (near to Pretoria) weather balloon humidity measurements. The results of the comparative study are presented...
Full Text Available ... Go4Life exercises to improve your strength! Stronger muscles can make it easier to do everyday things like ... 513 views Trainer Sandy shows Irene that you can do Go4Life exercises anywhere, even the kitchen! CC ...
Enrico Fermi – The Complete Physicist
Indian Academy of Sciences (India)
ias
bridge in 1932 by bombarding beryllium with α-particles. In Paris, Irene Curie ... the experiments with a very simple arrangement. First ..... Pu production and the design of a Pu bomb. ..... relatively short life span of 53 years as much as Enrico.
Kevadfestival kutsub metsa ja kontserdisaali / Iren Lill
Lill, Iren
2008-01-01
Üritustest 29. maist kuni 1. juunini toimuva Türi Kevadfestivali raames: koomilise laulumängu "Lopi ja Lapi" esietendus 31. mail Oisu rahvamajas (autoriteks kirjanik Leelo Tungal ja helilooja Tõnis Kaumann), Kadri-Ann Sumera kontsert pealkirjaga "Metsastseenid" 29. mail, Alo Põldmäe loodusfotode näituse "Muusikaline Neeruti" avamine, ansambli Svetilen kontsert 30. mail Türi kirikus, regilaulude laulmine Jaak Johansoni ja Riina Roose eestvedamisel ürituse "Ööülikool" raames 30. mail, festivali lõppkontsert Türi kirikus 1. juunil (esineb organist Ulla Krigul)
Neutron transport in irradiation loops (IRENE loop)
International Nuclear Information System (INIS)
Sarsam, Maher.
1980-09-01
This thesis is composed of two parts with different aspects. Part one is a technical description of the loop and its main ancillary facilities as well as of the safety and operational regulations. The measurement methods on the model of the ISIS reactor and on the loop in the OSIRIS reactor are described. Part two deals with the possibility of calculating the powers dissipated by each rod of the fuel cluster, using appropriate computer codes, not only in the reflector but also in the core and to suggest a method of calculation [fr
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Chen Bin1 Zeng Zhirong1 Wu Xiaoqin1 Chen Minhu1 Li Mei1 Gao Xiang1 Chen Baili1 Hu Pinjin1. Department of Gastroenterology, the First Affiliated Hospital, Sun Yat-sen University, 58 Zhongshan II Road, Guangzhou 510080, People's Republic of China ...
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
Influence of free water content on the compressive mechanical behaviour of cement mortar under high strain rate · Jikai Zhou Xudong Chen Longqiang Wu Xiaowei Kan ... pp 111-117. Mechanical properties of concrete to cyclic uniaxial tensile loading using variable waveforms · YUZHI CHEN XUDONG CHEN JINGWU BU.
76 FR 68803 - New York Disaster Number NY-00108
2011-11-07
.../ 2011. Incident: Hurricane Irene. Incident Period: 08/26/2011 through 09/05/2011. DATES: Effective Date..., Processing and Disbursement Center, 14925 Kingsport Road, Fort Worth, TX 76155. FOR FURTHER INFORMATION...., Suite 6050, Washington, DC 20416. SUPPLEMENTARY INFORMATION: The notice of the President's major...
Learning from Change: Issues and Experiences in Participatory ...
International Development Research Centre (IDRC) Digital Library (Canada)
Learning from Change: Issues and Experiences in Participatory Monitoring and Evaluation. Book cover Learning from Change: Issues and Experiences in Participatory Monitoring and Evaluation. Directeur(s) : Marisol Estrella, Jutta Blauert, Dindo Campilan, John Gaventa, Julian Gonsalves, Irene Guijt, Deb Johnson, and ...
African Journals Online (AJOL)
... underutilized samples for detecting organophosphorus and carbamate pesticide poisoning in raptors · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Ngaio Richards, Irene Zorrilla, Joseph Lalah, Peter Otieno, Isabel Fernandez, Monica Calvino, Joaquin Garcia ...
African Journals Online (AJOL)
... but underutilized samples for detecting organophosphorus and carbamate pesticide poisoning in raptors · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Ngaio Richards, Irene Zorrilla, Joseph Lalah, Peter Otieno, Isabel Fernandez, Monica Calvino, Joaquin Garcia ...
76 FR 60512 - New York; Emergency and Related Determinations
2011-09-29
... from Hurricane Irene beginning on August 25, 2011, and continuing, are of sufficient severity and... as adversely affected by this declared emergency: Bronx, Kings, New York, Queens, Richmond, Nassau..., Disaster Housing Assistance to Individuals and Households In Presidentially Declared Disaster Areas; 97.049...
Women at CERN: Once upon a time…
Antonella Del Rosso
2015-01-01
In 1995, a working group was set up to address the gender imbalance at CERN. Twenty years later, the people involved in the endeavour celebrated the long series of achievements recorded by today’s Diversity Office. Situation in 1995: 14% women/total employees. Categories requiring university-level education = 5% women/total. Top: The working group that submitted a report to the Management with recommendations to increase the number of women working at CERN (1995). From left to right: Maria Fidecaro, Sudeshna Datta-Cockerill, Irene Seis, Eva-Maria Gröniger-Voss, Linda Griffiths. Bottom: In 2015, the working group celebrates the achievements of the Diversity policy together with the various people who have been involved in its implementation. From left to right: Maria Fidecaro, Geneviève Guinot, Eva-Maria Gröniger-Voss, Sudeshna Datta-Cockerill, Irene Seis, Josi Schinzel, Doris Chromek-Burckhart. &nbs...
African Journals Online (AJOL)
Items 51 - 100 of 1309 ... Li-Long Liu, Kai Xu, Lu-Mei Kang, Shu-Ping Jiang, Qing-Hua Wang, ... CR Sewani-Rusike, JE Iputo, EJ Ndebia, M Gondwe, DR Kamadyaapa ... K-M Man, W-C Chen, H-M Wang, H-Y Chen, J-L Shen, L-D Chen, F-J Tsai, ...
Data denial experiments for extratropical transition
Directory of Open Access Journals (Sweden)
Doris Anwender
2012-11-01
Full Text Available Data denial experiments using the European Centre for Medium-Range Weather Forecasts (ECMWF model are designed to investigate the value of targeted observations for historical extratropical transition (ET cases over the Atlantic. The impact of removing data from specified locations linked to the ET development is therefore examined. It is shown that the impact of denying data in the near tropical cyclone (TC environment is, on average, as important as denying data in mid-latitude sensitive regions determined using extratropical singular vectors (SV. The impact of data denial over TC regions propagates downstream from the Atlantic towards Europe, with a maximum degradation at day 4. This degradation is mainly attributed to the data denial at the TC stage, i.e. before ET is completed. When data are denied on mid-latitude sensitive regions, the largest degradation is found around day 2 and also after the day 4 forecast. In general, the loss of information content is larger when data are denied in mid-latitude sensitive areas because these identify dynamically active regions. In both denial experiments, aircraft and satellite radiance data are the most influential observations. For the selected case of Hurricane Irene, the largest degradations are found for forecasts initialised while Irene reached its peak intensity. If observations are denied in the near storm environment, the TC mostly disappears from the analysis and the subsequent forecast. This allows the impact of Irene on the formation of the downstream cut-off low to be investigated.
76 FR 58329 - New York Disaster Number NY-00108
2011-09-20
.../ 2011. Incident: Hurricane Irene. Incident Period: 08/26/2011 through 09/05/2011. Effective Date: 09/08... and Disbursement Center, 14925 Kingsport Road, Fort Worth, TX 76155. FOR FURTHER INFORMATION CONTACT...., Suite 6050, Washington, DC 20416. SUPPLEMENTARY INFORMATION: The notice of the Presidential disaster...
76 FR 58328 - New York Disaster Number NY-00108
2011-09-20
.../ 2011. Incident: Hurricane Irene. Incident Period: 08/26/2011 through 09/05/2011. Effective Date: 09/10... and Disbursement Center, 14925 Kingsport Road, Fort Worth, TX 76155. FOR FURTHER INFORMATION CONTACT...., Suite 6050, Washington, DC 20416. SUPPLEMENTARY INFORMATION: The notice of the Presidential disaster...
76 FR 74837 - Puerto Rico Disaster Number PR-00014
2011-12-01
...), dated 08/ 27/2011. Incident: Hurricane Irene. Incident Period: 08/21/2011 through 08/24/2011. Effective..., Processing and Disbursement Center, 14925 Kingsport Road, Fort Worth, TX 76155. FOR FURTHER INFORMATION...., Suite 6050, Washington, DC 20416. SUPPLEMENTARY INFORMATION: The notice of the President's major...
2003-01-01
Esinesid MOKSiga seotud kunstnikud ja rühmitused: John Grzinich, OPA: Slobodanka Stevceska, Denis Saraginovski (Obsessive Possessive Aggression, Makedoonia), Kaarel Vulla, Irene Roos, Jane Remm, OMP: maalikunstnikud Maris Palgi, Eva Orav ja ajakirjanik Maia Möller, Pink Punk: Kristin Kalamees, Margus Tamm, Sandra Jõgeva
Law and Power in the Middle Ages
DEFF Research Database (Denmark)
International konferenceantologi med bidrag fra Gerd Althoff, Dominique Bauer, Bruce C Brasington, Charlotte Christensen-Nugues, Michael H Gelting, John Gillingham, Eldbjørg Haug, John Hudson, Brigitte Meijns, Hans Jacob Orning, Anne Irene Riisøy, Matthew Strickland, Jo Rune Ugulen, og Sally N Va...
Diseño y evaluación de un programa de habilidades para la salud en niños en comunidades rurales /
Anaya González, Cecilia Irene sustentante.
2009-01-01
tesis que para obtener el grado de Doctor en Psicología, presenta Cecilia Irene Anaya González ; asesor Susan Pick Steiner. 197 páginas : ilustraciones. Doctorado en Psicología UNAM, Facultad de Psicología, 2009
Ocean Circulation and Dynamics on the West Antarctic Peninsula Continental Shelf
2007-09-01
Pena-Molino, Stephanie Waterman, Ted Durland, Leif Tomas, Irene Garcia, Fiamma Straneo, Luc Rainville, Mary-Louise 6 Timmermans, Malcolm Scully, Dave...R., Atkinson, A., Korb, A., Whitehouse, M., Ward, P., Rodhouse, P., Enderlein, P., Hirst, A., Martin, A., Hill, S., Staniland, I., Pond, D., Briggs
76 FR 61374 - Massachusetts; Emergency and Related Determinations
2011-10-04
... Hurricane Irene beginning on August 26, 2011, and continuing, are of sufficient severity and magnitude to... Commonwealth of Massachusetts have been designated as adversely affected by this declared emergency: Emergency... Unemployment Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing Assistance to...
76 FR 60849 - Vermont; Emergency and Related Determinations
2011-09-30
... from Hurricane Irene beginning on August 26, 2011, and continuing, are of sufficient severity and... State of Vermont have been designated as adversely affected by this declared emergency: The entire State... Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing Assistance to...
76 FR 60850 - Delaware; Emergency and Related Determinations
2011-09-30
... determined that the emergency conditions in the State of Delaware resulting from Hurricane Irene beginning on... have been designated as adversely affected by this declared emergency: The entire State of Delaware for... Management Assistance Grant; 97.048, Disaster Housing Assistance to Individuals and Households in...
76 FR 60512 - Virginia; Emergency and Related Determinations
2011-09-29
... Hurricane Irene beginning on August 26, 2011, and continuing, are of sufficient severity and magnitude to... Commonwealth of Virginia have been designated as adversely affected by this declared emergency: Accomack..., Disaster Housing Assistance to Individuals and Households in Presidentially Declared Disaster Areas; 97.049...
76 FR 61726 - North Carolina; Emergency and Related Determinations
2011-10-05
... Hurricane Irene beginning on August 25, 2011, and continuing, are of sufficient severity and magnitude to... State of North Carolina have been designated as adversely affected by this declared emergency: Carteret... Grant; 97.048, Disaster Housing Assistance to Individuals and Households in Presidentially Declared...
76 FR 61373 - Connecticut; Emergency and Related Determinations
2011-10-04
... determined that the emergency conditions in the State of Connecticut resulting from Hurricane Irene beginning... designated as adversely affected by this declared emergency: All eight counties in the State of Connecticut... Management Assistance Grant; 97.048, Disaster Housing Assistance to Individuals and Households In...
76 FR 61728 - Pennsylvania; Major Disaster and Related Determinations
2011-10-05
... Commonwealth of Pennsylvania resulting from Hurricane Irene during the period of August 26-30, 2011, is of... Commonwealth of Pennsylvania have been designated as adversely affected by this major disaster: Chester... Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing Assistance to...
76 FR 60850 - Rhode Island; Emergency and Related Determinations
2011-09-30
... Hurricane Irene beginning on August 26, 2011, and continuing, are of sufficient severity and magnitude to... State of Rhode Island have been designated as adversely affected by this declared emergency: Providence..., Disaster Unemployment Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing...
76 FR 61372 - Pennsylvania; Emergency and Related Determinations
2011-10-04
... resulting from Hurricane Irene beginning on August 26, 2011, and continuing, are of sufficient severity and... following areas of the Commonwealth of Pennsylvania have been designated as adversely affected by this..., Disaster Housing Assistance to Individuals and Households in Presidentially Declared Disaster Areas; 97.049...
THE MICROBIOLOGY OF SOUTH AFRICAN DRIED SAUSAGE
African Journals Online (AJOL)
THE MICROBIOLOGY OF SOUTH AFRICAN DRIED SAUSAGE. W.H. Holzapfel and A.N. Hail. Receipt of MS s.3.76. Department of Microbiology and Plant Pathology, University of hetoria and. Animol and Dairv Science Reseorch Institute, Irene. OPSOMMING: DIE MIKROBIOLOGIE VAN SUID.AFRIKAANSE DROiWORS.
Directory of Open Access Journals (Sweden)
Zhilin Chen
2017-02-01
Full Text Available Three new species of the genus Gnamptogenys Roger, 1863 are described from southern China: Gnamptogenys dentihumera Chen, Lattke & Zhou, sp. n., Gnamptogenys nanlingensis Chen, Lattke & Zhou, sp. n. and Gnamptogenys quadrutinodules Chen, Lattke & Zhou, sp. n. A distribution map and an identification key to workers for the known species of China are provided.
Reference: 418 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available 418 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16856986i Chai Mao-Feng...cid responses in Arabidopsis. 5 665-74 16856986 2006 Sep The Plant journal An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Wang Xue-Chen|Wei Peng-Cheng|Yang Shuhua
76 FR 62133 - Puerto Rico Disaster Number PR-00014
2011-10-06
...-DR), dated 08/27/2011. Incident: Hurricane Irene. Incident Period: 08/21/2011 through 08/24/2011... INFORMATION CONTACT: A. Escobar, Office of Disaster Assistance, U.S. Small Business Administration, 409 3rd Street, SW., Suite 6050, Washington, DC 20416. SUPPLEMENTARY INFORMATION: The notice of the Presidential...
Solid medical waste management in Africa
African Journals Online (AJOL)
user
databases searched using the same search terms included Web of. Science, Embase, Scopus, Proquest and African ..... Shannon, Taubman Library, University of Michigan, Ann. Arbor, USA, Ms. Irene Rattenborg, ..... Healthcare waste management in clinics in a rural health district in. KwaZulu-Natal. South Afr J Epidemiol ...
Tagasisidet peab töötajale vahendama ülemus / Mait Raava
Raava, Mait
2004-01-01
Autor teeb lühiülevaate 360ʻ ja teiste tagasiside meetodite rakendamisest maailmas alates 1950ndatest aastatest ning juhib tähelepanu vigadele, mida meetodi rakendamisel on tehtud. Kommenteerib Irene Metsis. Skeem: Juht saab tagasiside nelja kanali kaudu. Vt. samas: Rollist tulenevalt on tagasiside erinev
Journal of the Cameroon Academy of Sciences - Vol 1, No 1 (2001)
African Journals Online (AJOL)
Utilisation du papier filtre dans la gestion de programme de lute contre le SIDA au Cameroun, EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Marie-Claire Okomo Assoumou, Dieudonné Adiogo, Irene Yatabene Bobcokono, Peter Ndumbe, 9-13 ...
Growth, carcase and meat characteristics of stress susceptible and ...
African Journals Online (AJOL)
Growth, carcase and meat characteristics of stress susceptible and stress resistant. South African Landrace gilts. P.H. Heinze*. Animal and Dairy Science Research Institute, Private Bag X2, Irene, 1675Republic of South Africa. G. Mitchell. Department of Physiology, Medical School, University of the Witwatersrand, York ...
76 FR 60513 - Puerto Rico; Emergency and Related Determinations
2011-09-29
... resulting from Hurricane Irene beginning on August 21, 2011, and continuing, are of sufficient severity and... adversely affected by this declared emergency: All 78 municipalities in the Commonwealth of Puerto Rico for... Unemployment Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing Assistance to...
76 FR 61372 - New Hampshire; Emergency and Related Determinations
2011-10-04
... Hurricane Irene beginning on August 26, 2011, and continuing, are of sufficient severity and magnitude to... following areas of the State of New Hampshire have been designated as adversely affected by this declared... Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing Assistance to...
76 FR 60516 - Virginia; Major Disaster and Related Determinations
2011-09-29
... resulting from Hurricane Irene during the period of August 26-28, 2011, is of sufficient severity and... of the Commonwealth of Virginia have been designated as adversely affected by this major disaster... Unemployment Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing Assistance to...
Indian Academy of Sciences (India)
Smith and Carson ... Z. Physikal. Chenn., 1908, 6, 200. 13. Ephraim ... Z. anord. Chen., 190S, 58, 33S. 14. Wright ... J. Chen. Soc, 1915, 107, 1527. 15. Amadori ... Gazetta, 1922, 1, 52, 387. 16. Mori ... J. Chen. Soc., Japa), 1923, 44, 730. 17. Waradachari and Subra- Proc. Ind. Acad, Sci., 1936, 3 A, 428. Ilala. 18. Hervey and ...
Calycosin regulates glucocorticoid-induced apoptosis via Nrf2/ARE ...
African Journals Online (AJOL)
Lifeng Fu1, WeiLiang Wu2, Jian Zhu2, Shu Qiang2, Jansong Chen2* ... Results: CA reduced the apoptosis and accumulation of ROS in DEX-treated cells. ..... its downstream effectors (Figure 5 A-C). However .... Cao J, Chen Z, Zhu Y, Li Y, Guo C, Gao K, Chen L, Shi ... Hong W. Experimental study on the effect of Calycosin.
Lombard, Pamela J.; Bent, Gardner C.
2015-01-01
A series of nine digital flood-inundation maps were developed for an 8-mile reach of the Hoosic River in North Adams and Williamstown, Massachusetts, by the U.S. Geological Survey (USGS) in cooperation with the Federal Emergency Management Agency. The coverage of the maps extends from the confluence with the North Branch Hoosic River to the Vermont State line. Peak flows with 20-, 10-, 4-, 2-, 1-, 0.5-, and 0.2-percent annual exceedance probabilities were computed for the reach from updated flood-frequency analyses. These peak flows were routed through a one-dimensional step-backwater hydraulic model to obtain the corresponding peak water-surface elevations, and to place the tropical storm Irene flood of August 28, 2011 into historical context. The hydraulic model was calibrated by using the current (2014) stage-discharge relation at the USGS streamgage Hoosic River near Williamstown, Massachusetts (01332500), and from documented high-water marks from the tropical storm Irene flood, which had approximately a 1-percent annual exceedance probability.
Indian Academy of Sciences (India)
Beak P and Chen C W 1985 Tetrahedron Lett. 4979. Boatman R J, Whitlock B J and Whitlock H W 1977 J. An. Chen. Soc. 99 4822. Diamond S E, Szalkiewicz A and Mares F 1979 J. Ann. Chen. Soc. 101 490. Ellefson C R 1979 J. Org. Chem. 44 1533. Gschwend H W and Rodriguez H R 1979 Organic reactions 26 Chapter I.
Bereavement Care Provision in Europe
DEFF Research Database (Denmark)
Guldin, Mai-Britt; Murphy, Irene; Keegan, Orla
2015-01-01
The Bereavement Care Taskforce of the EAPC has conducted a survey on bereavement care service provision in Europe. Mai-Britt Guldin, Irene Murphy, Orla Keegan, Barbara Monroe, Maria Antonia Lacasta Reverte and Inger Benkel report on the results. One of the key findings is that not all palliative...
African Journals Online (AJOL)
Items 1 - 50 of 154 ... Vol 68, No 1 (2015), A preliminary assessment of the palate and tongue for detecting organophosphorus and carbamate pesticide exposure in the degraded carcasses of vultures and other animals, Abstract PDF PDF. Ngaio L Richards, Irene Zorilla, Isabel Fernandez, Monica Calvino, Joaquin Garcia, ...
76 FR 64959 - District of Columbia; Major Disaster and Related Determinations
2011-10-19
... of Columbia resulting from Hurricane Irene during the period of August 26 to September 1, 2011, is of... following areas of the District of Columbia have been designated as adversely affected by this major... Unemployment Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing Assistance to...
76 FR 64959 - Delaware; Major Disaster and Related Determinations
2011-10-19
... resulting from Hurricane Irene during the period of August 25-31, 2011, is of sufficient severity and... State of Delaware have been designated as adversely affected by this major disaster: Kent and Sussex... Unemployment Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing Assistance to...
National Research Council Canada - National Science Library
1993-01-01
...; AGRICULTURE - Further Reform of Grain Circulation, Prices Advocated, Chen Yaobang on Market Challenges Facing Agriculture, Chen Yaobang on Restructuring of Crop Planting, MILITARY, PUBLIC SECURITY...
Standardinng initial cooling of sheep semen before freezing
African Journals Online (AJOL)
sheep semen before freezing. C. Kemp. Animal and Dairy Science Research Institute, Private Bag X2,. Irene, 1675 Republic of South Africa. Received 6 June 1985. A practical and repeatable method for the cooling, during the processing phase, of sheep semen, with the aim of minimizing inter-experiment variation is ...
DR. MIKA MAJALE MEMORIAL LECTURE
African Journals Online (AJOL)
He had four children Irene Majale,. Prof. Mike Majale (Architect) Victoria Majale Ojiambo and Chris Majale. Dr. Majale died on 21st April 1978. As an orthopaedic Surgeon he worked at Kenyatta. National Hospital (KNH), Kabete Orthopaedic Unit and. Armed Forces Memorial Hospital. He did not do any private practice.
"Vesi - elu lähte mineraal" / Marju Riisikamp
Riisikamp, Marju, 1958-
2009-01-01
5.-7. juunini toimunud III Türi kevadfestivalist, kus leidsid aset järgmised kultuurisündmused: luuleõhtu, Raadioteatri kuuldemäng-põimik, Ööülikooli päevase osakonna loengud, fotonäitus, filmiõhtu, loodusmatkad ja kontserdid. Festivali algataja, kunstiline juht ja produtsent Iren Lill
The influence of reproduction and lambing season of the Dohne ...
African Journals Online (AJOL)
The influence of reproduction and lambing season of the Dohne. Merino on different wool production traits. Ortrud Steinhagen. Animal and Dair-v Science Research Institute, Private Bag X2, Irene,. 1675 Republic of South Africa. P.J. de Wet. Department of Sheep and Wool Science, University of Stellenbosch,. Stellenbosch ...
Eesmaa, Lauri
2004-01-01
Académie Franȧise'i romaanipreemia sai Bernard du Boucheron romaani "Court serpent" ("Lühike madu") eest. Goncourt'i preemia sai Laurent Gaudé romaani "La soleil des Scorta" ("Scortade päike" eest). Redaunot' preemia määrati postuumselt Irene Némirovsky romaanile "Suite Franȧise"
Berg, Tanya
2017-01-01
This case study explores one teacher's integration of Alexander Technique and the work of neuromuscular retrainer Irene Dowd in ballet pedagogy to establish a somatic approach to teaching, learning, and performing ballet technique. This case study highlights the teacher's unique teaching method called IMAGE TECH for dancers (ITD) and offers…
Negotiations: Experienced vs. Inexperienced Negotiators
1990-12-01
Alange , Shauna E., "Ethics in Government Procurement? Edition I1," Briefing Papers, No 87-8, July 1987. 176 12. Guimera, Irene, "Small Business and the...Exercises, and Cases, Preface by Roy J. Lewicki and Joseph Litterer, Homewood, Illinois: Irwin, 1985, pp. 156-164. Johnson, W. Stanfield, and Alange
Hybrid Chaos Synchronization of Four-Scroll Systems via Active Control
Karthikeyan, Rajagopal; Sundarapandian, Vaidyanathan
2014-03-01
This paper investigates the hybrid chaos synchronization of identical Wang four-scroll systems (Wang, 2009), identical Liu-Chen four-scroll systems (Liu and Chen, 2004) and non-identical Wang and Liu-Chen four-scroll systems. Active control method is the method adopted to achieve the hybrid chaos synchronization of the four-scroll chaotic systems addressed in this paper and our synchronization results are established using Lyapunov stability theory. Since the Lyapunov exponents are not required for these calculations, the active control method is effective and convenient to hybrid synchronize identical and different Wang and Liu-Chen four-scroll chaotic systems. Numerical simulations are also shown to illustrate and validate the hybrid synchronization results derived in this paper.
New Jurassic tettigarctid cicadas from China with a novel example of disruptive coloration
Directory of Open Access Journals (Sweden)
Jun Chen
2016-12-01
Full Text Available Tettigarctidae is the most primitive family of Cicadoidea, with only two relict species. Although they are relatively well known from Eurasia, Australia, Africa, and South America, their Mesozoic examples are typically preserved only as isolated forewings. Herein, a new genus Sanmai Chen, Zhang, and B. Wang with three new species (Sanmai kongi Chen, Zhang, and B. Wang, S. mengi Chen, Zhang, and B. Wang, and S. xuni Chen, Zhang, and B. Wang are described based on fossil specimens from the Middle–Upper Jurassic of northeastern China, with well-preserved body structures, forewing and hindwing venations, making it the hitherto best known extinct tettigarctid taxon. The new genus, provisionally assigned to the tribe Turutanoviini, provides some new information about the evolution and palaeobiogeography of Mesozoic Tettigarctidae. The genus Paraprosbole is synonymized with Shuraboprosbole. In addition, the coloration pattern of forewing, prominent on some specimens of Sanmai kongi Chen, Zhang, and B. Wang sp. nov. and Sanmai xuni Chen, Zhang, and B. Wang sp. nov., represents a novel example of disruptive coloration in Tettigarctidae, which can effectively break up the body outline as well as surface, and so likely enabled these cicadas to reduce the detectability of potential predators.
Soil Behavior Under Blast Loading
2010-12-01
in detail (Lade 2005, Prevost and Popescu 1996, Chen and Baladi 1985). Models that are appropriate to be implemented into finite element programs...Chen and Baladi 1985). As the soil strain hardens, both the cone and the end cap expand. This concept of cap envelope was a major step forward...hardening cap model (Chen and Baladi 1985) 17 The modified Cam-clay model was developed at Cambridge University by Roscoe et al. (1963). This
Big data during crisis : lessons from Hurricane Irene.
2015-03-01
Transportation networks connect people with the goods and services that they require on a daily basis. : In a disaster or emergency, they serve the same role, but often for more urgent needs. Transportation : networks provide access to food, water, s...
Infrastructure for Peace: The African Experience | Irene | African ...
African Journals Online (AJOL)
Over the years, unhealthy competitions for limited resources in man's environment and election triggered violence among others have been consistently increasing threats to peace and security as well as various business- related economic activities in many communities in Africa. There are attempts by Government at ...
African Journals Online (AJOL)
NaOH treatment. P.H. Henning* and D.G. Steyn. Animal and Dairy Science Research Institute, Private Bag X2,. Irene, 1675 Republic of South Africa. Different portions (stalks, cobs, plant leaves, and cob leaves) from mature dry maize plants remaining after grain harvest were collected on two occasions, 8 weeks apart.
1.8. Brand*, HA Badenhorst, FK 8iebrits and EH Kemm JP Hayes et ...
African Journals Online (AJOL)
Brand*, H.A. Badenhorst, F.K. 8iebrits and E.H. Kemm. Animal and Dairy Science Research Institute, Private Bag X2, Irene 1675, Republic of South Africa. J.P. Hayes. Department of Poultry Science, University of Stellenbosch, Stellenbosch 7600, Republic of South Africa. The experiment was conducted to compare the ...
Inimene tähistaeva all / Marju Riisikamp
Riisikamp, Marju, 1958-
2011-01-01
12. - 15. maini toimunud 5. Türi kevadfestivalist alapealkirjaga "Tähistaevas", festivali korraldaja Iren Lill. Festivali kavas olid raadio Ööülikooli salvestused, loengud, fotonäitus, animafilmi töötuba, tähetorni Orion, Mart Saare majamuuseumi külastus Hüpassaares, loodusmatkad, Urmas Sisaski autoriõhtu ja teised kontserdid
African Journals Online (AJOL)
Precious
The profile of Irene Salami, a new Nigerian female academic and dramatist is ... in the kingdom. Paraphrasing Brimstone, one sees in Emotan's .... What the play does is to try to carve a direction for Nona, ... Spousal support for career tracking and political ambition ... excluded or included in the scheme of things, men cannot.
Let Lakatos Be! A Commentary on "Would the Real Lakatos Please Stand Up"
Sriraman, Bharath
2008-01-01
In this commentary, some remarks are offered on David Pimm, Mary Beisiegel, and Irene Meglis' article "Would the Real Lakatos Please Stand up." The commentary focuses on relatively recent developments in the philosophy of mathematics based on the work of Lakatos; on theory development in mathematics education; and offers critique on whether…
J.D. Shelby; G.M. Chescheir; R.W. Skaggs; D.M. Amatya
2006-01-01
This study evaluated hydrologic and water-quality data collected on a coastal-plain research watershed during a series of hurricanes and tropical storms that hit coastal North Carolina in 1999, including hurricanes Dennis, Floyd, and Irene. DU ring September and October 1999, the research watershed received approximately 555 mm of rainfall associated with hurricanes....
Byzantine Hymns in Churches of Constantinople - An Archaeological Soundscape
DEFF Research Database (Denmark)
Troelsgård, Christian; Rindel, Jens Holger
2010-01-01
Ved hjælp af digitale 3D-modeller genskabes de gamle kirkerums akustik. Under det EU-støttede projekt CAHRISMA (2000-2003), hvori Ørsted-DTU deltog, blev opbygget modeller af de tre justinianske kirker, Hagia Sophia, Hagia Irene, og Sergios og Bacchos. De stilles her til rådighed af firmaet ODEON...
Mis võiks olla ühist Johan Laidoneril ja Ingmar Bergmanil / Tiiu Laks
Laks, Tiiu, 1984-
2008-01-01
Laretei, Käbi. Kuhu kadus kõik see armastus? : Ingmari kirjad Käbile / tõlge rootsi keelest Anu Saluäär. Tallinn : SE&JS, 2008 ; Laidoner, Johan. Ühtekuuluvuse teel : Johan Laidoneri kirjad abikaasale / koostanud [ja toimetanud] Irene Lään ja Toomas Hiio ; vene keelest tõlkinud Jüri Ojamaa. Tallinn : Varrak, 2008
DEFF Research Database (Denmark)
Pedersen, Nils Arne
2008-01-01
Gennem en detaljeret historisk-filologisk argumentation viser artiklen dels, at det nyligt publicerede koptiske Judasevangelium næppe kan være en oversættelse af det Judasevangelium, som Irenæus nævner, dels at det forudsætter kendskab til en ældre, skriftlig evangelielitteratur. På denne baggrun...
Kinetic investigation on enantioselective hydrolytic resolution of ...
African Journals Online (AJOL)
Kinetic investigation on enantioselective hydrolytic resolution of epichlorohydrin by crude epoxide hydrolase from domestic duck liver. X Ling, D Lu, J Wang, J Chen, L Ding, J Chen, H Chai, P Ouyang ...
77 FR 11620 - Notice of Request for the Extension of a Currently Approved Information Collection
2012-02-27
... Reduction Act of 1995, this notice announces the intention of the Federal Transit Administration (FTA) to... INFORMATION CONTACT: Roy Chen, FTA Office of Technology, (202) 366-0462, or email: royweishun.chen@dot.gov...
Gender Trouble and the Tragic Black Woman Hybrids in Clotel, Quicksand and Passing
Directory of Open Access Journals (Sweden)
Hayder Naji Shanbooj Alolaiwi
2017-05-01
Full Text Available The African-American female character's description in Clotel, Quicksand and Passing are very impressive, among whom Clotel, Clare and Irene are depicted as one of the most important “passing” figures for the whole story. Though sharing some similarities with the traditional Black women in the past African-American novels, Clotel, Clare and Irene are very different. The strong connection with as well as variations than the usual gender pattern are mixed within these women. It is only by this new approach that the reader can re-think Black woman and build a new African-American female identity. Taking into the consideration an ecofeminist point of view, this paper is going to study the points of similarities with and differences from the traditional Black Women in the novel, unwrap on the developing subject identity of Black women in this novel, in order to prove that in this novel female subject identity is more than a true representation of essentialism and dualism, in a special and unique realistic perspective.
Bent, Gardner C.; Lombard, Pamela J.; Dudley, Robert W.
2015-10-27
A series of 10 digital flood-inundation maps were developed for a 3.3-mile reach of the North River in Colrain, Charlemont, and Shelburne, Massachusetts, by the U.S. Geological Survey in cooperation with the Federal Emergency Management Agency. The coverage of the maps extends from the confluence of the East and West Branch North Rivers to the Deerfield River. Peak-flow estimates at the 50-, 20-, 10-, 4-, 2-, 1-, 0.5-, and 0.2-percent annual exceedance probabilities were computed for the reach from updated flood-frequency analyses. These peak flows were routed through a one-dimensional step-backwater hydraulic model to obtain the corresponding peak water-surface elevations and to place the tropical storm Irene flood of August 28, 2011, into historical context. The hydraulic model was calibrated by using the current [2015] stage-discharge relation at the U.S. Geological Survey streamgage North River at Shattuckville, MA (station number 01169000), and from documented high-water marks from the tropical storm Irene flood, which had a peak flow with approximately a 0.2-percent annual exceedance probability.
Stratified coastal ocean interactions with tropical cyclones
Glenn, S. M.; Miles, T. N.; Seroka, G. N.; Xu, Y.; Forney, R. K.; Yu, F.; Roarty, H.; Schofield, O.; Kohut, J.
2016-01-01
Hurricane-intensity forecast improvements currently lag the progress achieved for hurricane tracks. Integrated ocean observations and simulations during hurricane Irene (2011) reveal that the wind-forced two-layer circulation of the stratified coastal ocean, and resultant shear-induced mixing, led to significant and rapid ahead-of-eye-centre cooling (at least 6 °C and up to 11 °C) over a wide swath of the continental shelf. Atmospheric simulations establish this cooling as the missing contribution required to reproduce Irene's accelerated intensity reduction. Historical buoys from 1985 to 2015 show that ahead-of-eye-centre cooling occurred beneath all 11 tropical cyclones that traversed the Mid-Atlantic Bight continental shelf during stratified summer conditions. A Yellow Sea buoy similarly revealed significant and rapid ahead-of-eye-centre cooling during Typhoon Muifa (2011). These findings establish that including realistic coastal baroclinic processes in forecasts of storm intensity and impacts will be increasingly critical to mid-latitude population centres as sea levels rise and tropical cyclone maximum intensities migrate poleward. PMID:26953963
1992-01-01
AND PROPERTIES OF WIDE BAND-GAP Il-VI STRAINED- LAYER SUPERLATTICE 227 Hailong Wang. Jie Cui. Aidong Shen. Liang Xu, Yunliang Chen. and Yuhua Shen IN...WANG JIE CUI AIDONG SHEN LIANG XU YUNLIANG CHEN AND YUHUA SHEN Shanghai Institute of Optics and Fine Mechanics, Academia Sinica P.O.Box 800-216 Shanghai...He Zujou, Cao Huazhe, Su Wuda, Chen Zhongcai, Zhon Feng and Wang Erguang, Thin Solid Films, 139,261(1986). 22) Xin Li and T.L.Tansley, J.AppI.Phys
Effects of water stress and seed mass on germination and ...
African Journals Online (AJOL)
enoh
2012-03-01
Mar 1, 2012 ... polyvinylpyrrolidone; TCA, trichloroacetic acid; NBT, nitroblue tetrazolium; TBA ..... seeds had weaker resistances to moderate stress (-0.6. MPa) compared with .... Chen YN,Chen YP,Li WH,Zhang HF (2003). Response of ...
Blazar Sequence in Fermi Era Liang Chen
Indian Academy of Sciences (India)
Abstract. In this paper, we review the latest research results on the topic of blazar sequence. It seems that the blazar sequence is phenomenally ruled out, while the theoretical blazar sequence still holds. We point out that black hole mass is a dominated parameter accounting for high-power- high-synchrotron-peaked and ...
African Journals Online (AJOL)
Bobcokono, Irene Yatabene. Vol 1, No 1 (2001) - Articles Utilisation du papier filtre dans la gestion de programme de lute contre le SIDA au Cameroun Details PDF · AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and ...
English for lawyers / Liina Soobik ; [preface: Peep Pruks
Soobik, Liina, 1955-
2001-01-01
Kasutatud tekstide autorid: Peep Pruks, Merit-Ene Ilja, Ilona Nurmela, Kristi Raba, Andreas Kangur, Raul Narits, Peeter Roosma, Kalle Merusk, Maret Altnurme, Jaan Ginter, Aare Tark, Norman Aas, Lasse Lehis, Hannes Veinla, Jaan Sootak, Eerik Kergandberg, Paul Varul, Jaanus Ots, Urve Liin, Irene Kull, Merle Muda, Gaabriel Tavits, Andres Vutt, Kadri Siibak, Ellen Ridaste, Heiki Pisuke, Andrus Siibak
Aasia Reini ääres / Kaire Nurk
Nurk, Kaire, 1960-
2002-01-01
Näitusest CHINaRT" Duisburgis Küppersmühle muuseumis. Eksponeeritud 40 hiina kunstniku peamiselt 2002. a. valminud teosed. Kuraatorid Walter Smerling, Fan Di. Oberhauseni lossis näitus "Hiina - traditsioon ja modernsus", kus on väljas tööd Kölni kunstikogujate Peter ja Irene Ludwigi kogust, Hiina rahvusmuuseumist Pekingis, Uli Siggi erakogust Luzernist jm
Livres | Page 24 | CRDI - Centre de recherches pour le ...
International Development Research Centre (IDRC) Digital Library (Canada)
L'Évaluation et le suivi participatifs présente une vue d'ensemble des thèmes et expériences communs aux approches participatives du suivi et de l'évaluation de divers secteurs et institutio. Directeur(s) : Marisol Estrella, with Jutta Blauert, Dindo Campilan, John Gaventa, Julian Gonsalves, Irene Guijt, Deb Johnson et ...
Feed intake, live mass-gain, body composition and protein ...
African Journals Online (AJOL)
Feed intake, live mass-gain, body composition and protein deposition in pigs fed three protein levels. E.H. Kemm,* F.K. Siebrits, M.N. Ras and H.A. Badenhorst. Animal and Dairy Science Research Institute, Private Bag X2, Irene 1675, Republic of South Africa. A group of 82 genetically lean and 90 obese Landrace pigs was ...
How Many Women Are Affected by or at Risk of Preeclampsia?
... pregnancy outcomes: Differences among 4 racial/ethnic groups. American Journal of Public Health, 95 (9), 1545–1551. Lin, H. C., Chen, S. F., Lin, H. C., & Chen, Y. H. (2010). Increased risk of adverse pregnancy outcomes ...
Proceedings – Mathematical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Yanheng Chen1 2 Guiyun Chen1. School of Mathematics and Statistics, Southwest University, Chongqing 400715, People's Republic of China; School of Mathematics and Statistics, Chongqing Three Gorges University, Chongqing 404100, People's Republic of China ...
Directory of Open Access Journals (Sweden)
O. J. Boock
1956-01-01
Full Text Available No presente trabalho são relatadas experiências com 12 variedades de batatinha (Solanum tuberosum L., recebidas da Holanda (Prinslander, Irene, Froma e Barima, Alemanha (Merkur, Sabina, Linda e Concordia e Suécia Konsuragis, Eigenheimer, Voran e Jätte-Bintje. Essas experiências, em número de seis, das quais três no chamado período "da sêca" (março-julho e três no "das águas" (setembro-janeiro, foram executadas nas localidades de Campinas, Louveira o Capão Bonito, no Estado de São Paulo. Ficou evidenciado o seguinte: a dado o bom estado de brotação dos tubérculos, as porcentagens de falhas no plantio "da sêca" foram baixas; já no plantio "das águas", as variedades de brotação lenta, como "Voran" e "Sabina", falharam muito; b "Prinslander" e "Konsuragis" resistiram bem à sêca prolongada, e "Barima" o "Linda" mostraram ser muito sensíveis; c "Linda", "Voran" e "Merkur", principalmente a primeira destas, apresentaram boa resistência a Phytophthora infestans, e "Jätte-Bintje" foi muito suscetível; "Voran", "Irene", "Prinslander" e "Barima" não ofereceram resistência a Alternaria solani; d "Merkur" e "Konsuragis" foram as mais produtivas para as duas épocas de plantio, sendo que "nas águas", "Eigenheimer", "Barima", "Concordia" e Jätte-Bintje", também produziram bem. Outros aspectos relacionados com variedades foram estudados.Twelve potato varieties imported from Holland (Prinslander, Irene, Froma, and Barima, Germany (Merkur, Sabina, Linda, and Concordia, and Sweden (Konsuragis, Eigenheimer, Voran, and Jätte-Bintje were compared in six experiments carried out at three different localities in the state of São Paulo (Campinas, Louveira, and Capão Bonito. The experiments were planted twice a year, once during the so-called dry season (March lo July, and another time during the rainy season (September to March. The following results were obtained: a plantings made in the dry season had a good stand, whereas this was
The validity and accuracy in foot-to-foot bioelectrical impedance ...
African Journals Online (AJOL)
The validity and accuracy in foot-to-foot bioelectrical impedance analysis measuring models referenced by dual-energy X-ray absorptiometry in body composition in standing position. KC Hsieh, HK Lu, CH Chen, TR Jang, YY Chen, MF Kao ...
The positioning device of beam probes for accelerator LUE-200
International Nuclear Information System (INIS)
Becher, Yu.; Kalmykov, A.V.; Minashkin, M.F.; Sumbaev, A.P.
2011-01-01
The description of a device for the positioning of sliding beam probes which is the part of the beam diagnostic system for the LUE-200 electron linac of IREN installation is presented. The device provides remote control of input-output operation of beam probes of five diagnostic stations established in an accelerating tract and in the beam transportation channel of the accelerator
2008-06-01
exchange. However, there is no evidence of intensive agriculture. Flotation samples from Middle Woodland sites lack any abundance of squash, maize...separated into the Hollywood and provisional Silver Bluff phases. Holly- wood ceramics include check stamped, Mississippi plain, burnished plain...66). Irene ceramics are dominated by filfot cross motifs and rims decorated with cane punctations and riveted nodes. Silver Bluff phase ceramics
Piigaste pansionaadimõis / Helju Koger
Koger, Helju, 1943-
2007-01-01
Põlvamaal Piigaste mõisa endises häärberis avatud pansionist. Sisekujundaja Irene Sepping, kelle jooniste järgi tegi osa elutubade mööblist Wako Värkstuba. Pargi korrastamise plaanist. Kordategemist ootavad muinsuskaitse all olevad puukuur, sammastega ait-kuivati ja tall-tõllakuur. Lühidalt mõisa ajaloost. Kommenteerivad I. Sepping ja pansioni juhataja Kerti Seeme. 10 vaadet
Maritime Geo-Fence Letter Report
2016-07-01
1 Classification | CG-926 RDC | author | audience | month year Maritime Geo-Fence Letter Report Authors: Irene Gonin and Gregory...Johnson Distribution Statement A: Approved for public release; distribution is unlimited. July 2016 Report No. CG-D-10-16 Maritime Geo-Fence...United States Coast Guard Research & Development Center 1 Chelsea Street New London, CT 06320 Maritime Geo-Fence Letter Report 1
Mechanisms of all-trans retinoic acid-induced differentiation of acute ...
Indian Academy of Sciences (India)
Author Affiliations. Ji-Wang Zhang1 Jian Gu1 Zhen-Yi Wang1 Sai-Juan Chen1 Zhu Chen1. Shanghai Institute of Hematology, Ruijin Hospital Affiliated to Shanghai Second Medical University, 197 Ruijin Road II, Shanghai 200025, People's Republic of China ...
New St-chromosome-specific molecular markers for identifying ...
Indian Academy of Sciences (India)
et al. 1994) or JJsSt (Chen et al. 1998) was widely used in wheat breeding programme (Chen .... Japan). Table 1. The features of primers used in this study. Homologous ..... Redinbaugh M. G., Jones T. A. and Zhang Y. T. 2000 Ubiquity of.
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
YUZHI CHEN1 2 XUDONG CHEN2 JINGWU BU3. Architectural Engineering Institute, Jinling Institute of Technology, Nanjing 211169, China; College of Civil and Transportation Engineering, Hobai University, Nanjing 210098, China; College of Water Conservancy and Hydropower Engineering, Hohai University, Nanjing ...
LDRD 2013 Annual Report: Laboratory Directed Research and Development Program Activities
Energy Technology Data Exchange (ETDEWEB)
Bookless, W. [Brookhaven National Lab. (BNL), Upton, NY (United States)
2013-12-31
This LDRD project establishes a research program led by Jingguang Chen, who has started a new position as a Joint Appointee between BNL and Columbia University as of FY2013. Under this project, Dr. Chen will establish a new program in catalysis science at BNL and Columbia University. The LDRD program will provide initial research funding to start research at both BNL and Columbia. At BNL, Dr. Chen will initiate laboratory research, including hiring research staff, and will collaborate with the existing BNL catalysis and electrocatalysis research groups. At Columbia, a subcontract to Dr. Chen will provide startup funding for his laboratory research, including initial graduate student costs. The research efforts will be linked under a common Catalysis Program in Sustainable Fuels. The overall impact of this project will be to strengthen the BNL catalysis science program through new linked research thrusts and the addition of an internationally distinguished catalysis scientist.
Enhancement of Radiation Therapy in Prostate Cancer by DNA-PKcs Inhibitor
2015-09-01
Center, Urology Habib , Amyn; UTSouthwestern Medical Center, Neurology & Neurotherapeutics Chen, Benjamin; UTSouthwestern Medical Center, Radiation...Tsong Hsieh 3,5,7 , Amyn A. Habib 4,5,6 , Benjamin Chen 1,4 and Debabrata Saha 1,4 1 Department of Radiation Oncology, 3 Department of Urology, 4
The effects of reciprocal cross on inheritance of DNA methylation in ...
African Journals Online (AJOL)
enoh
2012-03-20
Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).
Pitfalls in VAR based return decompositions: A clarification
DEFF Research Database (Denmark)
Engsted, Tom; Pedersen, Thomas Quistgaard; Tanggaard, Carsten
in their analysis is not "cashflow news" but "inter- est rate news" which should not be zero. Consequently, in contrast to what Chen and Zhao claim, their decomposition does not serve as a valid caution against VAR based decompositions. Second, we point out that in order for VAR based decompositions to be valid......Based on Chen and Zhao's (2009) criticism of VAR based return de- compositions, we explain in detail the various limitations and pitfalls involved in such decompositions. First, we show that Chen and Zhao's interpretation of their excess bond return decomposition is wrong: the residual component...
Lombard, Pamela J.; Bent, Gardner C.
2015-09-02
The U.S. Geological Survey developed flood elevations in cooperation with the Federal Emergency Management Agency for a 30-mile reach of the Deerfield River from the confluence of the Cold River tributary to the Connecticut River in the towns of Charlemont, Buckland, Shelburne, Conway, Deerfield, and Greenfield in Franklin County, Massachusetts to assist land owners, and emergency management workers prepare for and recover from floods. Peak flows with 50-, 20-, 10-, 4-, 2-, 1-, 0.5-, and 0.2-percent annual exceedance probabilities were computed for the reach from updated flood-frequency analyses. These peak flows were routed through a one-dimensional step-backwater hydraulic model to obtain the corresponding peak water-surface elevations and to place the tropical storm Irene flood of August 28, 2011 into historical context. The hydraulic model was calibrated by using current [2015] stage-discharge relations at two U.S. Geological Survey streamgages in the study reach—Deerfield River at Charlemont, MA (01168500) and Deerfield River near West Deerfield, MA (01170000)—and from documented high-water marks from the tropical storm Irene flood, which had between a 1- and 0.2-percent AEP.
African Journal of Traditional, Complementary and Alternative ...
African Journals Online (AJOL)
Anti-tumour effects of polysaccharides isolated from Artemisia Annua L by inducing cell apoptosis and immunomodulatory anti-hepatoma effects of polysaccharides · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Chen, J Chen, X Wang, C Liu, 15-22.
Trend analysis and change point detection of annual and seasonal ...
Indian Academy of Sciences (India)
elevation ranges from 0 m in the coastal areas of the. Persian Gulf to over ... been explained by Kang and Yusof (2012); Dhorde ...... J L 2004 Detection of statistically significant trends in ... Sun H, Chen Y, Li W, Li F, Chen Y, Hao X and Yang Y.
The Response of Small Scale Rigid Targets to Shallow Buried Explosive Detonations
2011-09-01
properties as applied in this work was based on some of the standard defini- tions of soil constitutive properties as found in, e.g., Chen and Baladi [18...Technology Corporation; 2007. [18] Chen WF, Baladi GY. Soil plasticity: theory and implementation. New York: Elsevier Science; 1985. [19] Zimmerman
Enhanced Thermal Transport of Surfaces with Superhydrophobic Coatings
2015-07-01
resistance conferred by superhydrophobic fluorinated polyacrylate-silica composite coatings on cold-rolled steel. Journal of Applied Polymer Science... thiolates on metals as a form of nanotechnology. ChemInform. 2005:36. doi: 10.1002/chin.200532281. 9. Chen C-H, Cai Q, Tsai C, Chen C-L, Xiong G
Evaluation of effectiveness in a novel wound healing ointment ...
African Journals Online (AJOL)
Evaluation of effectiveness in a novel wound healing ointment-crocodile oil burn ointment. Hua-Liang Li, Yi-Tao Deng, Zi-Ran Zhang, Qi-Rui Fu, Ya-Hui Zheng, Xing-Mei Cao, Jing Nie, Li-Wen Fu, Li-Ping Chen, You-Xiong Xiong, Dong-Yan Shen, Qing-Xi Chen ...
2014-09-18
22:477– 505 , 2007. [21] Bushnell, Michael L. and Vishwani Agrawal. Essentials of Electronic Testing for Digital, Memory, and Mixed-Signal VLSI...Investigation”. Knowledge and information systems, 10(4):453–472, 2006. [68] Liang, Nia -Chiang, Ping-Chieh Chen, Tony Sun, Guang Yang, Ling-Jyh Chen
A comparative study assessing a new tool for occluding ...
African Journals Online (AJOL)
0.630, p=0.068 and p=0.047, respectively) (Table 2). A comparative study assessing a new tool for occluding parenchymal blood flow during liver resection for hepatocellular carcinoma. S Zhou, X-J Xue, R-R Li, D-F Chen, W-Y Chen, G-X Liu, ...
A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBand EFHC2gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN SONG YULAI ...
The roles of electronic books in the transformation of learning and instruction
Huang, Ronghuai; Chen, Nian-Shing; Kang, Myunghee; McKenney, Susan; Churchill, Daniel
2014-01-01
Huang, R., Chen, N., Kang, M. McKenney, S. & Churchill, D. (2013). The roles of electronic books in the transformation of learning and instruction. In N. Chen, R. Huang, Kinshuk, Y. Li, D. G. Sampson (Eds.) Proceedings of the IEEE 13th International Conference on Advanced Learning Technologies
2009-09-01
this project: A. Noman M. Ahsanuzzaman, Steve Acree, Nandita Basu, Sten Berglund, Carol Bratt, Gordon Brown, Xaisong Chen, Jaehyun Cho, Pat Clark...A.S.C. Chen (eds). Chapelle, F.H., J.S. Widdowson, J.S. Bruner, E. Mendez , and C.C. Casey (2003). Methodology for Estimating Times of Remediation
A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBitalic> and EFHC2italic> gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN ...
Sadhana | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Sadhana. B Chen. Articles written in Sadhana. Volume 38 Issue 4 August 2013 pp 557-569. Flexibility-based structural damage identification using Gauss–Newton method · B Chen S Nagarajaiah · More Details Abstract Fulltext PDF. Structural damage will change the dynamic characteristics, including ...
Directory of Open Access Journals (Sweden)
Celmira Laza Vásquez
2008-12-01
Full Text Available Madeleine Leininger en su teoría enfermería transcultural, pone énfasis en la coherencia entre las intervenciones de enfermería y el sistema de valores así como el contexto cultural que rodea al sujeto de cuidado. Por tanto la enfermera debe buscar estrategias que le permitan ser sensible a la concepción que tienen las personas de sus problemas de salud con el fin de mediar entre el contexto cultural y las necesidades de cuidado de la persona. Por medio de un relato biográfico se da la oportunidad a los sujetos de cuidado de expresar la complejidad de su realidad y sobre todo la experiencia de la persona frente sus procesos de salud - enfermedad. El presente artículo tiene como objetivo narrar en la voz de su protagonista, la experiencia de vida de una partera tradicional de la región del Magdalena medio colombiano. En la narración, se entrecruzan las creencias y acervos culturales propios de la región rural del departamento de Antioquia y que determinan las prácticas de cuidado para la atención de la mujer durante el parto y el puerperio.Madeleine Leininger in her theory of multicultural infirmary emphasizes coherence, participation, system of values and patient’s treatment as well. For this reason infirmary must find strategies allowing the concept of sensibility and the awareness people have of their health problems in order to deal with their own urban context and their needs for self care through a biographic narration. The patients have the opportunity to express their true reality and mainly their own experience about health and illness - process. The purpose of this article is to reveal experiences narrated by the protagonist (an urban midwife from the Magdalena region, "a Colombian area". This true story is full of believes and unique cultural details from the rural region of the department (state of Antioquia where they set methods for woman’s care during delivery and after it.
International Nuclear Information System (INIS)
Aegerter, I.
1988-01-01
Dr.phil.nat. Irene Aegerter gave this presentation in the ATS monthly meeting in November 1988. In the presentation she gives an introduction to the Swiss energy management and policy. But above all, she explains the peculiar Swiss way to vote or arrange referendum several times a year, and clarifies the development of the public opinion according to these votes during the last ten years
Infrastructure Innovation: Case Study of the Gautrain
CSIR Research Space (South Africa)
van der Merwe, J
2017-10-01
Full Text Available ROODEPOORT NALEDI COSMO RUIMSIG BLUE HILLS SAMRAND LAKEVIEW RHODESFIELD BOKSBURG RANDBURG HONEYDEW EAST RAND MALL OR TAMBO LANSERIA K: Additional Rolling Stock (The Future) Capacity Constraints – Gautrain Project Background Need... RHODESFIELD O.R. TAMBO SAMRAND IRENE TSHWANE EAST HAZELDEAN MAMELODI OLIEVENHOUTSBOSCH SUNNINGHILL FOURWAYS COSMO LITTLE FALLS ROODEPOORT JABULANI RANDBURG LANSERIA EAST RAND MALL BOKSBURG SANDTON 2 LEGEND North – South Commuter East...
Cloning and Expressing Recombinant Protective Antigen Domains of B. anthracis
2011-09-01
future predictive modeling toolkits. 1 1. Introduction The use of Bacillus anthracis as a bio - weapon in the United States in 2001 affirmed the need...for improved sensing and detection of biological weapons of mass destruction (WMD). Protective Antigen (PA) protein of Bacillus anthracis is the...Cloning and Expressing Recombinant Protective Antigen Domains of B. anthracis by Deborah A. Sarkes, Joshua M. Kogot, Irene Val-Addo
Assessing Conventional Army Demands and Requirements for Ultra-Light Tactical Mobility
2015-01-01
hour Enemy or adversary actions Population Decision points Reserve Fires Engineer PMO AMD CBRN Intelligence R&S Avn Bde M o ve m en t an d m an eu ve...LDMove on Route Irish Seize on OBJ Irene 2nd BCT Cross LDMove on Route Longstreet Seize on OBJ Rose 3rd BCT FPOL with 1st BCT Airdrop resupply AMD Avn Bde
Directory of Open Access Journals (Sweden)
Mauricio Pérez-Abril
2009-06-01
Full Text Available ResumenEl artículo presenta dos líneas de pensamiento, desde las cuales se tensionan algunos postulados relacionados con la legitimidad de la investigación cualitativa, en relación con asuntos como la validez como camino para ganar dicha legitimidad. En el texto se toma posición por la investigación, fundamentalmente, como una actividad de producción discursiva, que se rige por la argumentación como la vía para garantizar su legitimidad. Acudiendo, principalmente, a planteamientos claves de Roland Barthes, Jesús Ibáñez e Irene Vasilachis, se esboza una perspectiva epistemológica que se inserta en el debate actual sobre la investigación cualitativa en las ciencias sociales. AbstractThis article presents two lines of thought that provoke tension among some postulates related to legitimacy in qualitative research; those related to issues like validity as a way to achieve legitimacy. I take a stance for research, basically, as an activity of discursive production that follows argumentation to guarantee its legitimacy. Finding support in some key ideas from Roland Barthes, Jesús Ibáñez and Irene Vasilachis, I depict an epistemological perspective that falls within the current discussion about qualitative research in social science. ResumoO artigo apresenta duas linhas de pensamento, desde as quais se cogitam alguns postulados relacionados com a legitimidade da pesquisa qualitativa, em relação com assuntos como a validade como caminho para ganhar tal legitimidade. No texto toma-se posição pela pesquisa, fundamentalmente, como uma atividade de produção discursiva, que se rege pela argumentação como a via para garantir sua legitimidade. Acudindo, principalmente, a propostas chave de Roland Barthes, Jesús Ibáñez e Irene Vasilachis, se esboça uma perspectiva epistemológica que se insere no debate atual sobre a pesquisa qualitativa nas ciências sociais.
THREE NEW SPECIES OF CRAMBINAE(LEPIDOPTERA : PYRALIDAE) IN CHINA
Institute of Scientific and Technical Information of China (English)
CHENTie-mei; SONGShi-mei; YUANDe-cheng
2003-01-01
Three new species of Crambinae from China, Eschata truncata Song & Chen, sp. nov., Eschata tricornia Song & Chen, sp. nov., Pseudargyria acuta Song & Chen, sp. nov. and the female of Girdharia tau-romma Kapur are described, with figures and illustrations of genitalia provided. E. truncata resembles E.smithi Bleszynski, but valva with one short truncated process in costa; E. tricornia differed from all recorded species by valva with a triangular process on dorsum; P. acuta resembles P. marginepunctalis (Hampson), but with cucullus rapidly pointed and aedeagus with one group of cornuti. E. bleszynskiella Minet is proposed as a junior synonym of E. shanghaiensis Wang & Sung.
2011-09-01
applied in this work was based on some of the standard definitions of soil constitutive properties as found in, e.g., Chen and Baladi [20], and...Livermore, CA. [20] Chen, W. F., and Baladi , G. Y., 1985. Soil Plasticity: Theory and Implementation. Elsevier Science, New York. [21] Zimmerman, H.D
Canivez, Gary L.; Kush, Joseph C.
2013-01-01
Weiss, Keith, Zhu, and Chen (2013a) and Weiss, Keith, Zhu, and Chen (2013b), this issue, report examinations of the factor structure of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) and Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV), respectively; comparing Wechsler Hierarchical Model (W-HM) and…
75 FR 4509 - Uniform Criteria for State Observational Surveys of Seat Belt Use
2010-01-28
... statistical issues: Ms. Chou-Lin Chen, Chief, Mathematical Analysis Division, National Center for Statistics..., Washington, DC 20590. Telephone number: 202-366-1048; E- mail: Chou-Lin.Chen@dot.gov . For legal issues: Ms..., and reduce burden. E. Paperwork Reduction Act Under the Paperwork Reduction Act of 1995, a person is...
Journal of Genetics | Indian Academy of Sciences
Indian Academy of Sciences (India)
... Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 95; Issue 1. Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome. Fengjie Yang Yaxian Chen Yu Zhang Liru Qiu Yu Chen Jianhua Zhou. Research Note Volume 95 Issue 1 March 2016 pp 161- ...
A reviewof the pharmacologicalmechanism of traditional Chinese ...
African Journals Online (AJOL)
A reviewof the pharmacologicalmechanism of traditional Chinese medicine in the intervention of coronary heart disease and stroke. W Zhang, K Gao, K Gao, J Liu, J Liu, H Zhao, H Zhao, J Wang, J Wang, Y Li, Y Li, G Murtaza, G Murtaza, J Chen, J Chen, W Wang, W Wang ...
African Journal of Biotechnology - Vol 10, No 60 (2011)
African Journals Online (AJOL)
Microsatellite variability reveals significant genetic differentiation of giant pandas (Ailuropoda melanoleuca) in the Minshan A habitat · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Yang, R Hou, F Shen, X Yang, L Zhang, L Chen, W Chen, W Zhang, Q Zhu, Z Zhang ...
Journal of Chemical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Chemical Sciences. Chen Chai. Articles written in Journal of Chemical Sciences. Volume 126 Issue 3 May 2014 pp 813-820 Regular Articles. First total synthesis of Boehmenan · Yamu Xia Xiaoli Dai Haixin Liu Chen Chai · More Details Abstract Fulltext PDF. The first total synthesis of dilignan ...
Three novel antioxidants from Cinnamomum plants | Cheng | African ...
African Journals Online (AJOL)
Three novel antioxidants from Cinnamomum plants. K-C Cheng, H-A Chen, P-F Wu, W-L Yang, H-M Wang, C-Y Chen. Abstract. In this study, we identified three novel antioxidants, subamolide C (1), subamolide E (2) and isokotomolide A (3) from the constitutes of Cinnamomum subavenium and Cinnamomum kotoense.
van Achterberg, Cornelis; Long, Khuat Dang
2010-01-01
Abstract The species of seventeen genera of Agathidinae (Braconidae) from Vietnam are revised: Agathis Latreille, 1804, Bassus Fabricius, 1804; Biroia Szépligeti, 1900; Braunsia Kriechbaumer, 1894; Camptothlipsis Enderlein, 1920; Coccygidium de Saussure, 1892; Coronagathis gen. n. (type species: Coronagathis cornifera sp. n.); Cremnops Foerster, 1862; Disophrys Foerster, 1862; Earinus Wesmael, 1837; Euagathis Szépligeti, 1900; Gyragathis gen. n. (type species: Gyragathis quyi sp. n.), Gyrochus Enderlein, 1920; Lytopylus Foerster, 1862; Therophilus Wesmael, 1837; Troticus Brullé, 1846, and Zelodia gen. n. (type species: Zelomorpha varipes van Achterberg & Maetô, 1990). Keys to the Vietnamese species are given. Sixty-five species are recognised, of which twelve species are newly recorded for Vietnam: Bassus albifasciatus (Watanabe, 1934), Coccygidium angostura (Bhat & Gupta, 1977), Cremnops atricornis (Smith, 1874), stat. n., Disophrys erythrocephala Cameron, 1900, Gyrochus yunnanensis Wang, 1984, Lytopylus romani (Shestakov, 1940), comb. n., Therophilus festivus (Muesebeck, 1953), comb. n., Therophilus javanus (Bhat & Gupta, 1977), comb. n., Therophilus lienhuachihensis (Chou & Sharkey, 1989), comb. n., Therophilus marshi (Bhat & Gupta, 1977), comb. n., Zelodia absoluta (Chen & Yang, 1998), comb. n. and Zelodia longidorsata (Bhat & Gupta, 1977), comb. n. Forty-two species are new to science: Agathis citrinisoma sp. n., Bassus albobasalis sp. n., Bassus albozonatus sp. n., Biroia soror sp. n., Braunsia bicolorata sp. n., Braunsia devriesi sp. n., Braunsia maculifera sp. n., Braunsia nigrapiculata sp. n., Braunsia pumatica sp. n., Camptothlipsis hanoiensis sp. n., Coronagathis cornifera sp. n., Earinus aurantius sp. n., Earinus brevistigmus sp. n., Euagathis flavosoma sp. n., Disophrys maculifera sp. n., Disophrys quymanhi sp. n., Disophrys rhinoides sp. n., Gyragathis quyi sp. n., Therophilus annuliferus sp. n., Therophilus cattienensis sp. n., Therophilus
Lateral strukturierte Oberflächen zur THz-Strahlmanipulation
Jahn, David; Koch, Martin (Prof. Dr.)
2018-01-01
Die Terahertz-Zeitbereichsspektroskopie ist mittlerweile eine etablierte spektroskopische Methode im Frequenzbereich von 0;2 THz bis etwa 5 THz. Mit der stetigen Verbesserung von Zeitbereichs-Spektrometern, in den letzten Jahren hauptsächlich vorangetrieben durch die Verbesserung der Materialsysteme sowohl im photoleitenden Emitter als auch im Detektor sind heute Systeme mit bis zu 90 dB SNR und 4;5 THz Brandbreite verfügbar. Auch der Einfluss anderer Systemkomponenten, deren Beitrag zum...
C. Huang , G. Zhao , HW Zhang & YQ Chen
Indian Academy of Sciences (India)
the host stars' birth cloud with higher abundance of Si will make the cloud ... with the metallicity distribution of nearby field F, G, or K stars which are known to .... In the early stage of planetesimal accumulation, the rate of growth of planetesimal.
Chaos synchronization of the fractional-order Chen's system
International Nuclear Information System (INIS)
Zhu Hao; Zhou Shangbo; He Zhongshi
2009-01-01
In this paper, based on the stability theorem of linear fractional systems, a necessary condition is given to check the chaos synchronization of fractional systems with incommensurate order. Chaos synchronization is studied by utilizing the Pecora-Carroll (PC) method and the coupling method. The necessary condition can also be used as a tool to confirm results of a numerical simulation. Numerical simulation results show the effectiveness of the necessary condition.
Genome-Wide Chromosomal Targets of Oncogenic Transcription Factors
2008-04-01
Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka , J., Braverman, M.S., Chen, Y.J., Chen, Z., et al. 2005. Genome sequencing in microfabricated...software after filtering to exclude bad spots. qPCR validation. Primer pairs used in Figure 1 were designed to cover three peaks and three troughs in
Journal of Biosciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
Home; Journals; Journal of Biosciences. Chen Fang. Articles written in Journal of Biosciences. Volume 30 Issue 3 June 2005 pp 351-357 Articles. Expression of a ribosome inactivating protein (curcin 2) in Jatropha curcas is induced by stress · Wei Qin Huang Ming-Xing Xu Ying Zhang Xin-Shen Chen Fang · More Details ...
The Comparative Organizational Inequality Network: Toward an Economic Sociology of Inequality
Tomaskovic-Devey , Donald; Godechot, Olivier
2017-01-01
The international Comparative Organizational Inequality Network (COIN) asks: • What factors drive overall income inequality within and between workplaces? • How do workplaces exacerbate or mitigate the impact of individual distinctions, such as education level, gender, or immigrant status? • How do inequality-generating mechanisms vary as a function of institutional context? List of authors: Donald Tomaskovic-Devey with Nina Bandelj, Irene Boeckmann, István Boza, David Co...
Role of rasagiline in treating Parkinson’s disease: effect on disease progression
Fernandez, Hubert; Malaty,
2009-01-01
Irene A Malaty, Hubert H FernandezUniversity of Florida Movement Disorders Center, Gainesville, FL, USAAbstract: Rasagiline is a second generation, selective, irreversible monoamine oxidase type B (MAO-B) inhibitor. It has demonstrated efficacy in monotherapy for early Parkinson’s disease (PD) patients in one large randomized, placebo-controlled trial (TVP-1012 in Early Monotherapy for Parkinson’s Disease Outpatients), and has shown ability to reduce off time in more advan...
Sealpool nukkude orgu asub pop-voodoo / Aleksander Tsapov
Tsapov, Aleksander
2006-01-01
Ekstsentrilisest disainist. Raffaele Ianello ja Irene van Gesteli noa- ja hambaorgihoidjad, Philippe Starcki ja Critz Campbelli tugitool-valgustid, August de Martinville'i papist jahitrofee, Sebastian E. partlamp, Isabelle Leijni keraamilised kiivrid, Harry Alleni hoiupõrsas jm. High-tech kodusisustuse näiteid: Jackie Shapiro disainitud taldrikud, Frank Gehry sofa, Ingo Maureri Campari Soda lamp, Sonya Chow siilvalgusti, Mathias Bengtssoni (sünd. 1971) alumiiniumtool, Piet Houtenbosi õlilambid jm.
2014-09-01
Irene Karpenko Lauren Tyrell Olivera Calukovic Gillian Hodes June Greenberg Jessica Campbell PATIENTS AND THEIR FAMILIES Biostatistics...myelosuppression or need for >2 platelet (plt) transfusions, febrile neutropenia , or grade >2 non-heme toxicity following 177Lu- J591. PSA was assessed prior to...toxicity • Grade 4 neutropenia or thrombocytopenia > 14 days • Need for > 2 platelet transfusions or hemorrhage • Febrile neutropenia • > 3 week delay for
The genus Bryoerythrophyllum (Musci, Pottiaceae in Antarctica
Directory of Open Access Journals (Sweden)
Sollman Philip
2015-07-01
Full Text Available Antarctic material of the genus Bryoerythrophyllum P. C. Chen was studied from all specimens present in KRAM. Bryoerythrophyllum recurvirostrum (Hedw. P. C. Chen var. antarcticum L. I. Savicz & Smirnova is treated as a distinct species: B. antarcticum (L. I. Savicz & Smirnova P. Sollman, stat. nov. Three species are now known in the Antarctic region: B. antarcticum, B. recurvirostrum and B. rubrum (Jur. ex Geh. P. C. Chen. Bryoerythrophyllum rubrum is reported for the first time from the Antarctic. It is a bipolar species. A key to the taxa is given. These species are described and briefly discussed, with notes on illustrations, reproduction, habitat, world range, distribution and elevation in Antarctica.
(DEPSCOR FY 09) Obfuscation and Deobfuscation of Intent of Computer Programs
2012-12-21
increased as the malware distribution mechanism has moved to the web through infected sites. In this use a site is hacked so as to distribute malware to...Simpósio Brasileiro em Segurança da Informaçao e de Sistemas Computacionais (2009). (Chen et al., 2012) Jundong Chen, Matthias R. Brust, Vir V. Phoha
The effects of growth time on the quality of graphene synthesized by ...
Indian Academy of Sciences (India)
by LPCVD. A JAFARI, R ALIPOUR∗ and M GHORANNEVISS ..... Li T, Hass J, Marchenkoy A N, Conrad E H, First P N and de ... Ni Z H, Chen W, Fan X F, Kuo J L, Yu T, Wee A T S ... Chen S, Cai W, Piner R D, Suk J W, Wu Y, Ren Y, Kang Y.
African Journals Online (AJOL)
Vol 9, No 1 (2006), Splenectomy in a rural surgical practice, Abstract PDF. E Alufohai, OO Odusanya. Vol 20, No 9 (2017), Spontaneous Retropharyngeal Emphysema: A Case Report, Abstract PDF. T-H Chi, C-C Hung, R-F Chen, C-H Yuan, J-C Chen. Vol 5, No 2 (2002), Spontaneous Rupture Of A Massive Hydrocephalus ...
Phase relation of LaFe11· 6Si1· 4 compounds annealed at different ...
Indian Academy of Sciences (India)
Home; Journals; Bulletin of Materials Science; Volume 35; Issue 2. Phase relation of LaFe11.6Si1.4 compounds annealed at different high-temperature and the magnetic property of LaFe11.6−CoSi1.4 compounds. Xiang Chen Yungui Chen Yongbai Tang. Volume 35 Issue 2 April 2012 pp 175-182 ...
Hsieh, Hui-Chen
2016-01-01
Developing the ability to speak English is a daunting task that has long been omitted in a test-driven pedagogy context (Chang, 2011; Li, 2012a, 2012b; Chen & Tsai, 2012; Katchen, 1989, 1995). Since speaking is not tested for school admissions, most students are not motivated to learn it (Chang, 2011; Chen & Tsai, 2012). Now, globalization…
8-channel system for neutron-nuclear investigations by time-of-flight method
International Nuclear Information System (INIS)
Shvetsov, V.N.; Enik, T.L.; Mitsyna, L.V.; Popov, A.B.; Salamatin, I.M.; Sedyshev, P.V.; Sirotin, A.P.; Astakhova, N.V.; Salamatin, K.M.
2011-01-01
In connection with commissioning of the IREN pulsed resonance neutron source, new electronics and appropriate software are developed for registration of time-of-flight spectra with small width of the channel (10 ns). The hardware-software system is intended for research of the IREN neutron beam characteristics, properties of new detectors, and also for performance of precision experiments under conditions of low intensity or registration of rare events. The time encoder is the key element of the system hardware. It is developed on the basis of the Cypress-technologies. The unit can measure time intervals for signals intensity up to 10 5 for each of eight inputs. Using a USB interface provides system mobility. The TOF System Software includes the control program, driver software layer, data sorting program and data processing utilities and other units, performed as executable applications. The interprocess communication between units is provided by network and/or by specially designed interface based on the mechanism of named files mapped into memory. This method provides fastest possible communication between processes. The developed methods of integrating the executable components into a system provide a distributed system, improve the reusing of the software and provide the ability to assemble the system by the user
Vehicle/Guideway Interaction in Maglev Systems
1992-03-01
Technology Division Materials and Components in Maglev Systems Technology Division Materials and Components Technology Division byY. Cai, S. S. Chen, and D. M...Transportation Systems Reports (UC-330, Vehicle/Guideway Interaction in Maglev Systems by Y. Cai and S. S. Chen Materials and Components Technology Division D. M...Surface Irregularities ...................................... 32 4 Vehicle/Guideway Interaction in Transrapid Maglev System .................. 34 4.1
Indian Academy of Sciences (India)
20. Nevill GA and Cook D 1969 Can. J. Chen. 47 743. 21. Glasel GA 1969 Org. Magn. Reson. 1481. 22. Soundarajan S 1958 Trans. Faraday Soc. 54147. 23. Rein R 1971 Int. J. Quant. Chem., Symp, 4341. 24. Woet D 1972.J. Am. Chen, Soc. 94.8213. 25. Bideau.JP, Huong PV and Toure S 1976 Acta Crystallogr. B32481.
2010-02-19
... Company Ltd., 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan; and (4) Yi-Lan Chen, a.k.a., Kevin Chen, 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan, and 7th Floor, Number 17... the requirements of the Paperwork Reduction Act of 1995 (44 U.S.C. 3501 et seq.) (PRA), unless that...
Schattman, Rachel E.; Conner, David; Méndez, V. Ernesto
2016-01-01
Abstract Little research has been conducted on how agricultural producers in the northeastern United States conceptualize climate-related risk and how these farmers address risk through on-farm management strategies. Two years following Tropical Storm Irene, our team interviewed 15 farmers in order to investigate their perceptions of climate-related risk and how their decision-making was influenced by these perceptions. Our results show that Vermont farmers are concerned with both ecological ...
Consistency Properties for Growth Model Parameters Under an Infill Asymptotics Domain
2010-09-01
Gompertz in 1825 [15], was initially used for actuarial projections. Winsor’s 1932 reparameterization of the Gompertz curve in [38] is given by f(t;K, a, b...these assumptions it is possible to construct a pathological example which, while mathematically interesting, is of no practical use to a practitioner...Abramowitz, Milton and Irene A. Stegun. Handbook of Mathematical Functions . Washington D.C.: National Bureau of Standards, 1972. [2] Allgower, E. L
Rita Bottoms: Polyartist Librarian
Bottoms, Rita; Reti, Irene; Regional History Project, UCSC Library
2005-01-01
Project Director Irene Reti conducted fourteen hours of interviews with Rita Bottoms, Head of Special Collections at the University Library, UC Santa Cruz, shortly before her retirement in March 2003. This oral history provides a vivid and intimate look at thirty-seven years behind the scenes in the library's Special Collections. For thirty-seven years Bottoms dedicated herself to collecting work by some of the most eminent writers and photographers of the twentieth century, includin...
TANGKO, IRENE LASTRY FARDANI
2012-01-01
Non Performing Loan (NPL)Analisis Pengaruh Capital Adequacy Ratio (CAR) dan Non Performing Loan (NPL) Terhadap Loan to Deposit Ratio (LDR) Pada Bank BUMN Persero Di Indonesia Analysis ofEffect ofCapitalAdequacy Ratio (CAR) and theNon-PerformingLoan(NPL) AgainstLoanto DepositRatio (LDR) Thestate-owned bankinIndonesiaPersero Irene Lastry Fardani Tangko Otto R. Payangan Maat pono Penelitian ini bertujuan untuk menganalisis pengaruh Capital Adequacy Ratio (CAR) dan Non Performin...
Ahearn, Elizabeth A.; Lombard, Pamela J.
2014-01-01
Flint Brook, a tributary to the Third Branch White River in Roxbury, Vermont, has a history of flooding the Vermont Fish and Wildlife Department’s Roxbury Fish Culture Station (the hatchery) and surrounding infrastructure. Flooding resulting from tropical storm Irene on August 28–29, 2011, caused widespread destruction in the region, including extensive and costly damages to the State-owned hatchery and the transportation infrastructure in the Town of Roxbury, Vermont. Sections of State Route 12A were washed out, and several bridges and culverts on Oxbow Road, Thurston Hill Road, and the New England Central Railroad in Roxbury were heavily damaged. Record high peak-discharge estimates of 2,140 cubic feet per second (ft3/s) and 4,320 ft3/s were calculated for Flint Brook at its confluence with the Third Branch White River and for the Third Branch White River at about 350 feet (ft) downstream from the hatchery, respectively. The annual exceedance probabilities (AEPs) of the peak discharges for Flint Brook and the Third Branch White River were less than 0.2 percent (less than a one in 500 chance of occurring in a given year). Hydrologic and hydraulic analyses of Flint Brook and the Third Branch White River were done to investigate flooding at the hatchery in Roxbury and support efforts by the Federal Emergency Management Agency to assist State and local mitigation and reconstruction efforts. During the August 2011 flood, the majority of flow from Flint Brook (97 percent or 2,070 ft3/s) diverged from its primary watercourse due to a retaining wall failure immediately upstream of Oxbow Road and inundated the hatchery. Although a minor amount of flow from the Third Branch White River could have overtopped State Route 12A and spilled into the hatchery, the Third Branch White River did not cause flood damages or exacerbate flooding at the hatchery during the August 2011 flood. The Third Branch White River which flows adjacent to the hatchery does not flood the hatchery
Die ergonomies ideale inrigting van rekenaarsentrums in skole / Irene Slabbert
Slabbert, Irene
2011-01-01
Computer technology and digital media are an integral part of present–day society. Consequently, learners are exposed to computers from an early age. What is lacking however, is that learners are not protected against the health and safety hazards of using computers. Learners have a constitutional right to work in a healthy and safe environment that is free of all hazards. Computer centres in schools therefore need to be ergonomically equipped to keep the best interests of lear...
On the Unsteady-Motion Theory of Magnetic Forces for Maglev
1993-11-01
DivisionEnergy Technology Division Forces for Maglev Energy Technology DivisionEnergy Technology Division by S. S. Chen, S. Zhu, and Y. Cai APQ 4 袲...On the Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S. Chen, S. Zhu, and Y. Cai Energy Technology Division November 1993 Work supported...vi On The Unsteady-Motion Theory of Magnetic Forces for Maglev by S. S
On integral equation methods for electromagnetic scattering by biperiodic structures
Bugert, Beatrice
2014-01-01
In der vorliegenden Arbeit verwenden wir Integralgleichungsmethoden, um die Streuung von zeitharmonischen elektromagnetischen ebenen Wellen an biperiodischen mehrschichtigen Strukturen zu untersuchen. Solche Strukturen modellieren wir durch die vertikale Anordnung einer endlichen Anzahl an sich nicht schneidenden, polyedrisch Lipschitz regulären Grenzflächen. Wir unterscheiden Streuobjekte bestehend aus einer Oberfläche und solche bestehend aus mindestens zwei Oberflächen. Das elektromagnetis...
Ühinemise ja iseolemise vastuseis. Ideaalid ja reaalsus / Rein Tootmaa
Tootmaa, Rein
2001-01-01
Mängufilmid "Keiser ja palgamõrtsukas" ("Jing ke ci qin wang") : režissöör Chen Kaige : Jaapan-Hiina-Prantsusmaa 1999 ja "Tiiger ja draakon" ("Wo hu chang long") : režissöör Ang Lee : Hiina-Hongkong-Ameerika Ühendriigid 2000. Lisa : Aare Ermeli koostatud Chen Kaige ja Ang Lee loomingu lühikokkuvõtted. Kokkuvõte inglise keeles lk. 128
DEFF Research Database (Denmark)
Henriksen, Knud; Sporring, Jon; Hornbæk, Kasper
2004-01-01
reviews and provides a mathematical foundation for virtual trackballs. The first, but still popular, virtual trackball was described by Chen et al. [CHECK END OF SENTENCE]. We show that the virtual trackball by Chen et al. does not rotate the object along the intended great circular arc on the virtual...... trackball and we give a correction. Another popular virtual trackball is Shoemake's quaternion implementation [CHECK END OF SENTENCE], which we show to be a special case of the virtual trackball by Chen et al.. Shoemake extends the scope of the virtual trackball to the full screen. Unfortunately, Shoemake......'s virtual trackball is inhomogeneous and discontinuous with consequences for usability. Finally, we review Bell's virtual trackball [CHECK END OF SENTENCE] and discuss studies of the usability of virtual trackballs....
2018-02-01
Retracted Review article: Nucleophagy in Human Disease: Beyond the Physiological Role. [Tohoku J. Exp. Med., 2018, 244 (1), 75-81. doi: 10.1620/tjem.244.75.] The above Review article was published online on January 27, 2018. Soon after its publication (on February 1, 2018), Dr. Nian Fu and Prof. Linxi Chen informed the Editor-in-Chief, The Tohoku Journal of Experimental Medicine (TJEM), about serious violation of publication ethics. Indeed, Dr. Nian Fu and Prof. Linxi Chen were astonished to find their names as coauthors of this Review article, because they were not involved in the submission process of this Review article and they do not know any of other coauthors. In addition, the Review article is similar to their unpublished manuscript. After a thorough investigation in accordance with the recommendations of the Committee on Publication Ethics (COPE), the Editor-in-Chief of TJEM decided to retract this Review article. The reasons for Retraction are summarized below: forged authors and an unexpected case of plagiarism. Forged authors: Dr. Nian Fu and Prof. Linxi Chen were added as co-authors of the Review article without their knowledge. In fact, the signature provided by Prof. Linxi Chen is apparently different from the signature of a coauthor, named Linxi Chen, on the AUTHORS’ RESPONSIBILITY FORM, provided by the corresponding author of the Review article. More critically, the signature provided by Dr. Nian Fu is completely different from the signature of Nian Fu, because the Chinese characters are different between the two signatures. In addition, the replies from three authors (Ming Zhou, Hongwen Ji and Yong Xia) clearly indicate that they misunderstand the identity of Dr. Nina Fu. We also attempted to contact two authors, named Nian Fu and Linxi Chen, via e-mail. As expected, the forged authors did not respond to our inquiries, despite that their e-mail addresses appear to be active. An unexpected case of plagiarism: This Review article is similar to the
Kunath, Irene; Alizo, María Alexandra; Graterol, Angela
2008-01-01
Presentación. Presentation. Rengifo, Diana Economía / Economy: Los sistemas de información para el cuadro de mando integral en pequeñas y medianas empresas industriales en Maracaibo - estado Zulia. The systems of information for the of integral control design in small and medium companies industrial in Maracaibo, Zulia state. Kunath Irene; Alizo, María Alexandra; Graterol, Angela. Educación / Education: Los hipermapas. Alternativa pedagógica y didáctica para la...
A Póetica da obra Efecto Mariposa
Witt - Universidade de Brasília, Anelise
2016-01-01
Este artigo busca discutir conceitos emergentes da instalação interativa Efecto Mariposa de Patrício Gonzalez. É através dos estudos dos semioticistas Iuri Lótman e Irene Machado, e do pesquisador em arte e tecnologia, Milton Sogabe que este texto se desenvolve. O conceito de “explosão” elaborado por Lótman, bem como o de falsa interface de Sogabe são norteadores para a análise da obra de Gonzalez.
Possibility of some radionuclides production using high energy electron Bremsstrahlung
International Nuclear Information System (INIS)
Balzhinnyam, N.; Belov, A.G.; Gehrbish, Sh; Maslov, O.D.; Shvetsov, V.N.; Ganbold, G.
2008-01-01
The method of some radionuclides production using high energy Bremsstrahlung of electron accelerators and determination of photonuclear reaction yield and specific activities for some radionuclides is described. Photonuclear reaction yield and specific activities for some radionuclides are determined for 117m Sn, 111 In and 195m Pt. Based on the experimental data obtained at low energy (E e- e- = 75 MeV) of the IREN facility (FLNR, JINR) at irradiation of high purity platinum and tin metals
1989-05-17
brand , which symbolizes feudal autocracy, in that the new form has been posited in the hopes that reform can forcefully be implemented so as to...ucts; name- brand and high-quality products; products of energy, communications, transportation, and raw mate- rial industries; aid agriculture...1986 election. Chen Weiye fought a skillful battle although he had been seen as an underdog . The smashing victory of Chen Weiye and Huang Wentai plus
Viets, Carmen
2001-01-01
Faseroptische SERS-Sensoren wurden durch die Beschichtung der Endflächen von optischen Fasern mit rauhen Metallfilmen erzeugt. Zu den verschiedenen Präparationstechniken, die angewendet und verglichen wurden, gehörten das langsame Aufdampfen von Metall-Inselfilmen und das Bedampfen von Nanopartikeln, aufgerauhten oder elektronenlithographisch strukturierten Oberflächen mit Metallfilmen. Der Einfluß der Laserleistung auf die Messungen mit SERS-Sensoren wurde untersucht, und es wurden maximale ...
Unconventional Density Wave and Superfluidity in Cold Atom Systems
2014-06-01
Tsai, Chairperson Professor Kirill Shtengel Professor Vivek Aji 3 Copyright by Chen-Yen Lai 2014 4 The Dissertation of Chen-Yen Lai is approved...thank my dissertation committee members, Professor Vivek Aji and Pro- fessor Kirill Shtengel, for their help, kindness, insightful comments and...near balance to a stripe-CDW ( red ) as the imbalance increases. The insert shows the strong imbalance region, where single species p-wave majority
Quasi-Static Evolution, Catastrophe, and Failed Eruption of Solar Flux Ropes
2016-12-30
Ropes James Chen Beam Physics Branch Plasma Physics Division December 30, 2016 Approved for public release; distribution is unlimited. i REPORT...pressure gradient force combine to balance the major radial hoop force. The macroscopic forces on the flux ropes and onset conditions are quantified...Solar physics theory 67-4989-07 Quasi-Static Evolution, Catastrophe, and “Failed” Eruption of Solar Flux Ropes James Chen1 Plasma Physics Division
Aerial Logistics Management for Carrier Onboard Delivery
2016-09-01
NAVAL POSTGRADUATE SCHOOL MONTEREY, CALIFORNIA THESIS AERIAL LOGISTICS MANAGEMENT FOR CARRIER ONBOARD DELIVERY by Samuel L. Chen September 2016...AND SUBTITLE AERIAL LOGISTICS MANAGEMENT FOR CARRIER ONBOARD DELIVERY 5. FUNDING NUMBERS 6. AUTHOR(S) Samuel L. Chen 7. PERFORMING ORGANIZATION NAME(S...delivery (COD) is the use of aircraft to transport people and cargo from a forward logistics site (FLS) to a carrier strike group (CSG). The goal of
The Role of Protein Elongation Factor eEF1A2 in Breast Cancer
2006-09-01
apoptosis . A summary of common EMT markers is listed in Table I. Importantly, these developmental regulators can induce EMT in a nondevelopmental...1978; Chen et al., 1997), apoptosis (Chen et al., 1997), and metabolic regulation (Bissell et al., 1977) has been known for decades, the molecular...marks the Spemann organizer in vertebrate gastrulation and is one of the fi rst identifi ed regulators of embryological patterning (De Robertis et al
Massive Star Formation: Accreting from Companion X. Chen1 ...
Indian Academy of Sciences (India)
Abstract. We report the possible accretion from companion in the mas- sive star forming region (G350.69–0.49). This region seems to be a binary system composed of a diffuse object (possible nebulae or UC HII region) and a Massive Young Stellar Object (MYSO) seen in Spitzer IRAC image. The diffuse object and MYSO ...
Mitochondrial genome of Taiwan pig ( Sus Scrofa ) | Chen | African ...
African Journals Online (AJOL)
The purpose of this study is to investigate the complete nucleotide sequence of the mitochondrial genome of the Taiwan Lanyu pig (Sus scrofa) and its phylogenetic relationships with other pig breeds. Thirty-four forward and reverse primers were designed. Sequencing was performed in both directions. The results showed ...
Food Fortification to Prevent and Control Iron Deficiency | Chen ...
African Journals Online (AJOL)
It is essential to prevent the fortification iron from reacting with the absorption inhibitors. To ensure adequate absorption therefore, various factors must be considered before initiating a fortification programme. These include cost effectiveness of fortification in increasing absorbable iron, palatability of the fortified food and the ...
Chemische Reaktionen auf Oberflächen - eine SFG Studie
Kirsch, Harald
2014-01-01
This thesis focused on the investigation of chemical reactions on surfaces by usage of Sum Frequency Generation (SFG) spectroscopy and Thermal Desorption Spectroscopy (TDS). Understanding of chemical reactions on surfaces is of critical importance for modification and optimization of a variety of environmental and industrial processes, but the complexity of the ongoing reactions under "realistic" conditions often hinders an understanding on a molecular level. The aim of this work was to get i...
Existence of positive periodic solution of mutualism system with several delays
International Nuclear Information System (INIS)
Wu Haihui; Xia Yonghui; Lin Muren
2008-01-01
In this paper, by using Mawhin coincidence degree, some sufficient conditions are obtained for the global existence of positive periodic solutions of a mutualism systems with bounded and unbounded delays. Our results generalize significantly improve those of Gopalsamy and He [Gopalsamy K, He XZ. Persistence, attractivity, and delay in facultative mutualism. J Math Anal Appl 1997;215:154-73], Yang et al. [Yang F, Jiang D, Ying A. Existence of positive solution of multidelays facultative mutualism system. J Eng Math 2002;3:64-8], Chen et al. [Chen FD, Shi JL, Chen XX. Periodicity in Lotka-Volterra facultative mutualism system with several delays. J Eng Math 2004;21(3)] and Xia and Lin [Xia YH, Lin M, Existence of positive periodic solution of mutualism system with infinite delays. Ann Diff Eqs 2005;21(3):448-53
Robust anonymous authentication scheme for telecare medical information systems.
Xie, Qi; Zhang, Jun; Dong, Na
2013-04-01
Patient can obtain sorts of health-care delivery services via Telecare Medical Information Systems (TMIS). Authentication, security, patient's privacy protection and data confidentiality are important for patient or doctor accessing to Electronic Medical Records (EMR). In 2012, Chen et al. showed that Khan et al.'s dynamic ID-based authentication scheme has some weaknesses and proposed an improved scheme, and they claimed that their scheme is more suitable for TMIS. However, we show that Chen et al.'s scheme also has some weaknesses. In particular, Chen et al.'s scheme does not provide user's privacy protection and perfect forward secrecy, is vulnerable to off-line password guessing attack and impersonation attack once user's smart card is compromised. Further, we propose a secure anonymity authentication scheme to overcome their weaknesses even an adversary can know all information stored in smart card.
Directory of Open Access Journals (Sweden)
Chang R
2014-01-01
Full Text Available Run Chang,1 Linlin Sun,1 Thomas J Webster1,21Department of Chemical Engineering, Northeastern University, Boston, MA, USA; 2Center of Excellence for Advanced Materials Research, King Abdulaziz University, Jeddah, Saudi ArabiaAbstract: Curcumin is a natural phenolic compound extracted from the plant Curcuma longa L. In previous studies, curcumin has been shown to have anticancer, antioxidant, and anti-inflammatory effects. In this study, the cytotoxicity of different concentrations (5, 10, 25, 50, 75, and 100 µM of curcumin dissolved in dimethyl sulfoxide was compared between MG-63 osteosarcoma and healthy human osteoblast cells. Consequently, the viability of osteosarcoma cells was less than 50% at a concentration of 10 µM compared to the control sample without curcumin, but healthy osteoblast cells had at least 80% viability throughout all the concentrations tested. The results demonstrated that MG-63 osteosarcoma cells were much more sensitive in terms of cytotoxicity to curcumin, while the healthy human osteoblasts exhibited a higher healthy viability after 24 hours of curcumin treatment. Therefore, this study showed that at the right concentrations (5 µM to 25 µM, curcumin, along with a proper nanoparticle drug delivery carrier, may selectively kill bone cancer cells over healthy bone cells.Keywords: curcumin, osteosarcoma, human osteoblast, viability, bone cancer
Transparent and Stretchable High-Performance Supercapacitors Based on Wrinkled Graphene Electrodes
2013-12-18
2, 870–875. 38. Chen, T.; Dai, L. Carbon Nanomaterials for High- Performance Supercapacitors . Mater. Today 2013, 16, 272–280. 39. Stoller, M. D...High-Performance Supercapacitors Based onWrinkledGraphene Electrodes Tao Chen,† Yuhua Xue,† Ajit K. Roy,‡ and Liming Dai†,* †Center of Advanced Science...electrodes and the associated supercapacitor cells cannot be both trans- parent and stretchable.1318 It is highly desirable to integrate the
Wang, Xiaolin; Wang,Qingbing; Li,Jianfeng; An,Sai; Chen,Yi; Jiang,Chen
2015-01-01
Qingbing Wang,1,2 Jianfeng Li,3 Sai An,3 Yi Chen,1 Chen Jiang,3 Xiaolin Wang1,2 1Department of Interventional Radiology, Zhongshan Hospital, Fudan University, 2Shanghai Institute of Medical Imaging, 3Key Laboratory of Smart Drug Delivery, Ministry of Education, Department of Pharmaceutics, School of Pharmacy, Fudan University, Shanghai, People’s Republic of China Background: Gene therapy is a very promising technology for treatment of pancreatic ductal adenocarci...
2013-01-01
Mian BM. Hedgehog Signaling Pathway Activation in Bladder Transitional Cell Carcinoma (TCC). J Urol., 2010, 184(1):344-351. PMID: 20488474 3...Tanner MJ, Welliver RC Jr, Chen M, Shtutman M, Godoy A, Smith G, Mian BM, Buttyan R. Effects of Androgen Receptor and Androgen on Gene Expression in...activities. Proc. Natl. Acad. Sci. USA, 2012, 109(34):13799-804. PMID: 22869755 Manuscripts in Preparation 1. Chen M* (co-first author), Li N*, Carkner
CLEAR: Cross-Layer Exploration for Architecting Resilience
2017-03-01
unavailable, or in an economy mode (low resilience, low power mode) when ABFT is available. However, the overheads outweigh benefits (details in [Cheng 16b...layer r Design, Automation , & Test in Europe, 2010. [Chen 05] Chen, Z. and J. Dong table real number codes based on random m Lecture Notes in...tolerate soft errors in processor c ACM/EDAC/IEEE Design Automation Conf., 2016. [Cheng 16b] Cheng, E., et al. -layer exploration for architecting
Agent Reasoning Transparency: The Influence of Information Level on Automation-Induced Complacency
2017-06-30
automation performance using working memory capacity. Ergonomics . 2014;57(3):295–318. Barber D, Davis L, Nicholson D, Finkelstein N, Chen JYC. The...ELEMENT NUMBER 6. AUTHOR(S) Julia L Wright, Jessie YC Chen, Michael J Barnes, and Peter A Hancock 5d. PROJECT NUMBER 5e. TASK NUMBER 5f. WORK ...Appendix C. Cube Comparisons Test 131 Appendix D. Spatial Orientation Test 135 Appendix E. National Aeronautics and Space Administration-Task Load Index
Two Japanese scientists and the Curie family, Nobuo Yamada and Toshiko Yuasa
International Nuclear Information System (INIS)
Kawashima, Keiko
2012-01-01
This article presents two Japanese scientists, a man and a woman, who worked with Pierre and Marie Curie, and with Irene and Pierre Joliot-Curie. Nobuo Yamada (1896-1927) was the first Japanese researcher at the French Radium Institute; he was a specialist of researches on helium. Toshiko Yuasa was the first Japanese scientist to obtain a permanent appointment in France. Her researches were a contribution to the investigation of the continuous spectrum of beta radiation emitted by artificial radioactive bodies
Kraft Foods, Inc. in India — The Cadbury Acquisition
V. S. Pai; Ram Subramanian
2014-01-01
When the United States-based Kraft Foods, Inc. (KFI) acquired the United Kingdom-based Cadbury plc, KFI got entry into the Indian market. KFI CEO, Irene Rosenfeld had targeted the developing markets as key for the company to achieve a 5% organic growth rate and the strong position of Cadbury India augured well for expanding KFI's presence in that market. However, after nearly a year since the acquisition, KFI was moving slowly in India and appeared content to consolidate Cadbury's market pres...
Rođak, Bruno
2016-01-01
Tema ovog rada je 2.5D animacija i primjena te tehnike animiranja pri izradi kratkometražnog animiranog filma. Kroz pisani dio ovog rada pokrivaju se svi koraci uključeni u izradu animiranog filma. Obrada se pažnja na korake tog procesa raširene kroz pretprodukciju, produkciju i postprodukciju. Realizacija praktičnog djela rada je napravljena pomodu programa Adobe After Effects, Adobe Photoshop-a, Blendera i Adobe Premiera Pro. Realizacija kroz navedene programe de bit detaljno opisana korak ...
Congressmember Sam Farr: Five Decades of Public Service
Reti, Irene H.; Farr, Sam
2017-01-01
Congressmember Sam Farr (born July 4, 1941) represented California’s Central Coast in the United States House of Representatives for twenty-three years until his retirement from office in 2016. Farr also served six years as a member of the Monterey County Board of Supervisors and twelve years in the California State Assembly. This oral history, a transcript of twenty-five hours of interviews conducted by Irene Reti, director of the UCSC Library’s Regional History Project, during the period i...
Retos de la comunicación educativa en el siglo XXI
VV.AA,
2012-01-01
Lourdes LATAPÍ RUIZ, El aislamiento originado por las TICS. Irene FERNÁNDEZ MONFERRER ; Pedro ARENAS WILSON, Escuela, medios y aprendizaje : perspectiva crítica para la aplicación de habilidades educomunicativas en el aula. Almudena ESTEBAN ; Andrés ROSENBERG, La importancia de despertar inquietudes. Myriam CATRILEO ; María Alejandra HERNÁNDEZ, Escuela virtual, una alternativa para el cambio de saberes. Lorena CAIMANQUE ; Luis RIVERA, Enseñanza : una de las más altas poesías. Cheng Cheng TANG...
Chen YC; Ho HO; Chiu CC; Sheu MT
2013-01-01
Ying-Chen Chen,1,* Hsiu-O Ho,1,* Chiao-Chi Chiu,1 Ming-Thau Sheu1,2 1School of Pharmacy, College of Pharmacy, Taipei Medical University, 2Clinical Research Center and Traditional Herbal Medicine Research Center, Taipei Medical University Hospital, Taipei, Taiwan*These authors contributed equally to this workAbstract: In this study, alendronate, the most commonly used biphosphonate for treating osteoporosis, was formulated as gastroretentive dosage form (GRDF) tablets to enhance its oral bioav...
Chen,Wei; Ju,Jing; Yang,Yehong; Wang,Hao; Chen,Wenjie; Zhao,Xuelan; Ye,Hongying; Zhang,Yu
2018-01-01
Wei Chen,1 Jing Ju,1 Yehong Yang,2 Hao Wang,3 Wenjie Chen,1 Xuelan Zhao,1 Hongying Ye,2 Yu Zhang1 1Department of Geriatrics, Huashan Hospital, Fudan University, Shanghai, China; 2Department of Endocrinology, Huashan Hospital, Fudan University, Shanghai, China; 3Core Center of Animal Facility, School of Medicine, Fudan University, Shanghai, China Introduction: Diabetic cardiomyopathy is characterized by an imbalance between myocyte death and regeneration mediated by the progressive loss of c...
Reforming China’s Criminal Procedure Law
Winckler, Hugo
2014-01-01
Sources:- Wang Jianxun, “The provisions of the reform of criminal procedural law legalising secret investigations are a step backwards,” Caijing wang, 5 September 2011.- Chen Youxi, “The legalisation of secret investigations is an important violation of political integrity,” Zhongguo wangluo dianshitai – CNTV web site, Opinion section, 27 November 2011.- Wu Zhehua, “Chen Weidong discusses reform of the criminal procedure law: Behind each article there is a story,” Zhongguoguangbo wang, 8 Marc...
Chen, Ming; Anderson, Erik; Hill, Geoffrey; Chen, John J; Patrianakos, Thomas
2015-01-01
Ming Chen,1 Erik Anderson,2 Geoffrey Hill,3 John J Chen,4 Thomas Patrianakos2 1Department of Surgery, University of Hawaii, Honolulu, HI, 2Department of Ophthalmology, John H Stroger, Jr Hospital of Cook County, Chicago, IL, 3Department of Ophthalmology, UT Southwestern Medical Center, Dallas, TX, 4Biostatistics Core, John A Burns School of Medicine, University of Hawaii, Honolulu, HI, USA Purpose: To compare cumulative dissipated energy between two phacoemulsification mac...
Chen, Ming; Sweeney, Henry W; Luke, Becky; Chen, Mindy; Brown, Mathew
2009-01-01
Ming Chen1, Henry W Sweeney2, Becky Luke3, Mindy Chen4, Mathew Brown51University of Hawaii, Honolulu, Hawaii, USA; 2Research Support Services, the Queens Medical Center, Honolulu, Hawaii, USA; 3Surgical Suite, Honolulu, Hawaii, USA; 4University of California, Irvine, CA, USA; 5University of California, San Diego, CA, USAAbstract: Cumulative dissipated energy (CDE) was used with Infiniti® Vision System (Alcon Labs) as an energy delivery guide to compare four different phaco techniques ...
Chen, Ming
2009-01-01
Ming Chen1, Henry W Sweeney2, Becky Luke3, Mindy Chen4, Mathew Brown51University of Hawaii, Honolulu, Hawaii, USA; 2Research Support Services, the Queens Medical Center, Honolulu, Hawaii, USA; 3Surgical Suite, Honolulu, Hawaii, USA; 4University of California, Irvine, CA, USA; 5University of California, San Diego, CA, USAAbstract: Cumulative dissipated energy (CDE) was used with Infiniti® Vision System (Alcon Labs) as an energy delivery guide to compare four different phaco techniques ...
Tung, Li-Chen; Lin, Chin-Kai; Hsieh, Ching-Lin; Chen, Ching-Chi; Huang, Chin-Tsan; Wang, Chun-Hou
2013-01-01
Li-Chen Tung,1,# Chin-Kai Lin,2,# Ching-Lin Hsieh,3,4 Ching-Chi Chen,1 Chin-Tsan Huang,1 Chun-Hou Wang5,6 1Department of Physical Medicine and Rehabilitation, Chi Mei Medical Center, Tainan, 2Program of Early Intervention, Department of Early Childhood Education, National Taichung University of Education, Taichung, 3School of Occupational Therapy, College of Medicine, National Taiwan University, Taipei, 4Department of Physical Medicine and Rehabilitation, National Taiwan University Hospital, ...
Lanthanide metal-organic frameworks
International Nuclear Information System (INIS)
Cheng, Peng
2015-01-01
This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).
Lanthanide metal-organic frameworks
Energy Technology Data Exchange (ETDEWEB)
Cheng, Peng (ed.) [Nankai Univ., Tianjin (China). Dept. of Chemistry
2015-03-01
This book contains the following nine chapters: lanthanide metal-organic frameworks: syntheses, properties, and potential applications (Stephen Fordham, Xuan Wang, Mathieu Bosch, Hong-Cai Zhou); 2. chiral lanthanide metal-organic frameworks (Weisheng Liu, Xiaoliang Tang); 3. Porous lanthanide metal-organic frameworks for gas storage and separation (Bin Li, Banglin Chen); 4. Luminescent lanthanide metal-organic frameworks (Xue-Zhi Song, Shu-Yan Song, Hong-Jie Zhang); 5. Metal-organic frameworks based on lanthanide clusters (Lian Chen, Feilong Jiang, Kang Zhou, Mingyan Wu, Maochun Hong); 6. metal-organic frameworks with d-f cyanide bridges: structural diversity, bonding regime, and magnetism (Marilena Ferbinteanu, Fanica Cimpoesu, Stefania Tanase); 7. transition-lanthanide heterometal-organic frameworks: synthesis, structures, and properties (Wei Shi, Ke Liu, Peng Cheng); 8: MOFs of uranium and the actinides (Juan Su, Jiesheng Chen); 9. Nanostructured and/or nanoscale lanthanide metal-organic frameworks (Zhonghao Zhang, Zhiping Zheng).
2004-01-01
EKLi volikogu töökoosolek 5. IV. SA ERF alllfondina loodud Olev Soansi mälestusfondi toetamisest, EKLi 2005. a. aastanäituse korraldamisest Tallinna Kunstihoones, vajalikest täiendustest ja muudatustest põhikirjas, mis puudutavad tehinguid Tallinna Kunstihoone ja selle galeriiga. Võeti vastu tööjuhised SA Tallinna Kunstihoone Fondi nõukogule. EKLi uued liikmed: Kaarel Eelma, Piret Hirv, Sandra Jõgeva, Irene Jürna, Kristin Kalamees, Kristiina Laurits, Eve Margus-Villems, Villu Plink, Lembe Ruben, Katrin Sipelgas, Margus Tamm, Tanel Veenre
Economic loss caused by GMOs in Estonia / Irene Kull, Villu Kõve
Kull, Irene, 1961-
2008-01-01
Lepinguvälisest vastutusest, tootja vastutusest, vastutusest suurema ohu allikaga tekitatud kahju eest, geneetiliselt muundatud organismidega tekitatud kahjust, varaline kahjust, mittevaraline kahjust
Scattering of plane waves by rough surfaces in the sense of Born approximation
Arnold, Thomas
2014-01-01
Das Thema dieser Arbeit ist die Streuung elektromagnetischer ebener Wellen an rauen Oberflächen, also an ebenen Oberflächen mit glatten und beschränkten Störungen. Darüber hinaus wird ein kleiner Kontrast der Materialkonstanten zwischen dem Deckmaterial und dem Material unter der rauen Oberfläche angenommen. Unter diesen Voraussetzungen wird ein Fernfeld-Formel für das gestreute Feld mit Hilfe von Born-Approximation und Fourier-Techniken hergeleitet. Dieser Ansatz basiert auf einer Modifikati...
Distributed mechatronics controller for modular wall climbing robot
CSIR Research Space (South Africa)
Tlale, NS
2006-07-01
Full Text Available - climbing robot for inspection in nuclear power plants.”, Proc. IEEE Int. Conf. on Robotics and Automation, pp. 409-1414. (Chen 2001) Chen, D-. J., 2001, “Architecture for Systematic Development of Mechatronics Software Systems”, Licentiate Thesis... provide a more cost effective solution to the problem (Luk et al 1991). Such robots are termed service robots by the International Service Robot Association (ISRA) (Pransky 1996). They are defined as machines that sense, think, and act to benefit (or...
Bai,Fang; Yin,You; Chen,Ting; Chen,Jihui; Ge,Meixin; Lu,Yunshu; Xie,Fangyuan; Zhang,Jian; Wu,Kejin; Liu,Yan
2018-01-01
Fang Bai,1–3,* You Yin,4,* Ting Chen,1,* Jihui Chen,1 Meixin Ge,2 Yunshu Lu,2 Fangyuan Xie,5 Jian Zhang,1 Kejin Wu,3 Yan Liu1,6 1Department of Pharmacy, Xinhua Hospital, Shanghai Jiao Tong University School of Medicine, Shanghai, 2Department of General Surgery, Xinhua Hospital, Affiliated to Shanghai Jiao Tong University, School of Medicine, Shanghai, 3Department of Breast Surgery, Obstetrics and Gynaecology Hospital, Fudan University, Shanghai, 4Department of Neurology, Changzheng...
Chen,Hong; Xu,Hong; Meng,Yugang; Zhang,Yun; Chen,Junying; Wei,Xiaoning
2016-01-01
Hong Chen,1 Hong Xu,1 Yu-gang Meng,1 Yun Zhang,2 Jun-ying Chen,1 Xiao-ning Wei1 1Department of Gynaecology, The First Affiliated Hospital of Guangxi Medical University, Nanning, Guangxi, 2Department of Gynaecology, The People’s Hospital of Suzhou High Tech District, Suzhou, Jiangsu, People’s Republic of China Background: Uterine leiomyoma is one of the most common benign tumors in women. It dramatically decreases the quality of life in the affected women. However, there ...
Directory of Open Access Journals (Sweden)
Haoyu Liu
2017-03-01
Full Text Available A second species of Qingryllus Chen & Zheng is described and illustrated, Q. jiguanshanensis sp. n., from Sichuan, China. This new species is similar to Q. striofemorus Chen & Zheng, 1995, but differs from the latter by the posterior margin of pronotum being distinctly widened, the veins of tegmina yellowish-white only on lateral side of dorsal area, and the epiphallus distinctly widened posteriorly. A distribution map of the species of this genus and habitus photographs of the new species are presented.
2012-08-06
K2-2 COMPUTATIONAL STUDY OF EXTERNAL FIXATION DEVICES SURFACE HEATING IN 1.5T AND 3T MRI SYSTEMS Yan Liu*1, Jianxiang Shen1, Ji Chen1, Wolfgang...communications have been ex- panding rapidly with the proliferation of consumer wireless devices such as smart phones, tablet PCs, handheld gaming devices, and...Computational Study of External Fixation Devices Surface Heating in 1.5T and 3T MRI Systems Yan Liu* (1) , Jianxiang Shen (1) , Ji Chen (1) , and
Is the Chinese Army the Real Winner in PLA Reforms
2016-10-01
44 Commentary / The Chinese Army and PLA Reforms JFQ 83, 4th Quarter 2016 Is the Chinese Army the Real Winner in PLA Reforms? By Phillip C. Saunders...and John Chen G round force officers run China’s military, the People’s Liberation Army ( PLA ). About 70 percent of PLA soldiers serve in the PLA ...Saunders and Chen 45 services and arms of the PLA ” has meant reductions in “technologically backward” PLAA units and personnel increases for the other
International Nuclear Information System (INIS)
Taherkhani, Farid; Akbarzadeh, Hamed; Feyzi, Mostafa; Rafiee, Hamid Reza
2015-01-01
Molecular dynamics simulation has been implemented for doping effect on melting temperature, heat capacity, self-diffusion coefficient of gold–copper bimetallic nanostructure with 55 total gold and copper atom numbers and its bulk alloy. Trend of melting temperature for gold–copper bimetallic nanocluster is not same as melting temperature copper–gold bulk alloy. Molecular dynamics simulation of our result regarding bulk melting temperature is consistence with available experimental data. Molecular dynamics simulation shows that melting temperature of gold–copper bimetallic nanocluster increases with copper atom fraction. Semi-empirical potential model and quantum Sutton–Chen potential models do not change melting temperature trend with copper doping of gold–copper bimetallic nanocluster. Self-diffusion coefficient of copper atom is greater than gold atom in gold–copper bimetallic nanocluster. Semi-empirical potential within the tight-binding second moment approximation as new application potential model for melting temperature of gold–copper bulk structure shows better result in comparison with EAM, Sutton–Chen potential, and quantum Sutton–Chen potential models
Energy Technology Data Exchange (ETDEWEB)
Taherkhani, Farid, E-mail: faridtaherkhani@gmail.com, E-mail: f.taherkhani@razi.ac.ir [Razi University, Department of Physical Chemistry (Iran, Islamic Republic of); Akbarzadeh, Hamed [Hakim Sabzevari University, Department of Chemistry (Iran, Islamic Republic of); Feyzi, Mostafa; Rafiee, Hamid Reza [Razi University, Department of Physical Chemistry (Iran, Islamic Republic of)
2015-01-15
Molecular dynamics simulation has been implemented for doping effect on melting temperature, heat capacity, self-diffusion coefficient of gold–copper bimetallic nanostructure with 55 total gold and copper atom numbers and its bulk alloy. Trend of melting temperature for gold–copper bimetallic nanocluster is not same as melting temperature copper–gold bulk alloy. Molecular dynamics simulation of our result regarding bulk melting temperature is consistence with available experimental data. Molecular dynamics simulation shows that melting temperature of gold–copper bimetallic nanocluster increases with copper atom fraction. Semi-empirical potential model and quantum Sutton–Chen potential models do not change melting temperature trend with copper doping of gold–copper bimetallic nanocluster. Self-diffusion coefficient of copper atom is greater than gold atom in gold–copper bimetallic nanocluster. Semi-empirical potential within the tight-binding second moment approximation as new application potential model for melting temperature of gold–copper bulk structure shows better result in comparison with EAM, Sutton–Chen potential, and quantum Sutton–Chen potential models.
Ricci, Karen A; Griffin, Anne R; Heslin, Kevin C; Kranke, Derrick; Dobalian, Aram
2015-06-01
Hospital-evacuation decisions are rarely straightforward in protracted advance-warning events. Previous work provides little insight into the decision-making process around evacuation. This study was conducted to identify factors that most heavily influenced the decisions to evacuate the US Department of Veterans Affairs (VA) New York Harbor Healthcare System's (NYHHS; New York USA) Manhattan Campus before Hurricane Irene in 2011 and before Superstorm Sandy in 2012. Semi-structured interviews with 11 senior leaders were conducted on the processes and factors that influenced the evacuation decisions prior to each event. The most influential factor in the decision to evacuate the Manhattan Campus before Hurricane Irene was New York City's (NYC's) hospital-evacuation mandate. As a federal facility, the Manhattan VA medical center (VAMC) was exempt from the city's order, but decision makers felt compelled to comply. In the case of Superstorm Sandy, corporate memory of a similar 1992 storm that crippled the Manhattan facility drove the decision to evacuate before the storm hit. Results suggest that hospital-evacuation decisions are confounded by political considerations and are influenced by past disaster experience. Greater shared situational awareness among at-risk hospitals, along with a more coordinated approach to evacuation decision making, could reduce pressure on hospitals to make these high-stakes decisions. Systematic mechanisms for collecting, documenting, and sharing lessons learned from past disasters are sorely needed at the institutional, local, and national levels.
Li, Feng; Chen, Yan; Liu, Shubo; Qi, Jian; Wang, Weiying; Wang, Chenhua; Zhong, Ruiyue; Chen, Zhijun; Li, Xiaoming; Guan, Yuanzhou; Kong, Wei; Zhang, Yong
2017-01-01
Feng Li,1 Yan Chen,1,2 Shubo Liu,1 Jian Qi,1 Weiying Wang,1 Chenhua Wang,1 Ruiyue Zhong,1 Zhijun Chen,1 Xiaoming Li,1 Yuanzhou Guan,1 Wei Kong,1,2 Yong Zhang1,2 1National Engineering Laboratory for AIDS Vaccine, School of Life Sciences, Jilin University, Changchun, 2Key Laboratory for Molecular Enzymology and Engineering, the Ministry of Education, School of Life Sciences, Jilin University, Changchun, China Abstract: Zein-based nano/microparticles have been demonstrated to be promising carr...
International Nuclear Information System (INIS)
Hu Manfeng; Xu Zhenyuan; Zhang Rong; Hu Aihua
2007-01-01
Based on the active control idea and the invariance principle of differential equations, a general scheme of adaptive full state hybrid projective synchronization (FSHPS) and parameters identification of a class of chaotic (hyper-chaotic) systems with linearly dependent uncertain parameters is proposed in this Letter. With this effective scheme parameters identification and FSHPS of chaotic and hyper-chaotic systems can be realized simultaneously. Numerical simulations on the chaotic Chen system and the hyper-chaotic Chen system are presented to verify the effectiveness of the proposed scheme
2013-10-01
Wu K, Wang L, Jiao X, Ju X, Li Z, Ertel A, Addya S, McCue P, Lisanti MP, Wang C, Davis RJ, Mardon G, Pestell RG. Androgen therapy resistant...Li Z, Hu J, Chen K, Wu J, Pestell RG. DACH1 inhibited prostate cancer cellular proliferation and Interleukon-6 signaling. AACR 103rd Annual Meeting...March 31 – April 4, 2012, Chicago, IL. Wang J, Cai S, Chen K, Sun Y, Li S, Pestell RG, Wu K. Regulation of AR transcriptional activity and
Directory of Open Access Journals (Sweden)
Martha C. Martínez Quintanilla
2017-04-01
Full Text Available Existen organismos silvestres que son altamente vulnerables ante estresores antropogénicos y naturales, estos organismos pueden ser de utilidad para evaluar la salud ambiental mediante diferentes indicadores confiables, sencillos, rápidos, económicos para determinar y si es posible reducir estos efectos negativos. En este estudio proponemos al ganso nevado (Chen caerulescens como posible biomonitor de estrés y genotóxicos ambientales mediante la relación heterófilo/linfocito (H/L, la prueba de micronúcleos (EMN, prolongaciones nucleares en eritrocitos (EPN y eritrocitos policromáticos (EPC. Durante la temporada de caza (2012-2013 en el humedal de Málaga, Durango, México, colectamos 18 organismos. Los eritrocitos fueron las células más abundantes, de núcleo y morfología elípticos, de tamaño 12.68 ± 0.89 µm. Observamos heterófilos (11.07±1.32 µm, eosinófilos (9.67±1.26 µm, basófilos (5.75 ± 0.78 µm, monocitos (10.49±1.36 µm y linfocitos (6.53±1.0 µm. No identificamos alteración en las proporciones ni en la morfología de leucocitos, sin embargo, es necesario un mayor número de organismos para establecer los parámetros sanguíneos de base normal para esta especie. La relación h/l fue de 0.41 ± 0.11 este valor es similar a lo reportado para esta y otras especies de aves consideradas como sanas. Establecimos la frecuencia basal de EMN (2.6±1.45, epn (249.2 ± 89.74 y EPC (156.5 ± 50. El ganso nevado es un organismo que se perfila como buen candidato a biomonitor ambiental debido a la frecuencia basal de su relación H/L, EMN, EPN y EPC, pero debe probarse en condiciones estandarizadas y a través de estudios en zonas con y sin contaminación.
Handbook of continued fractions for special functions
Cuyt, Annie
2008-01-01
Special functions are pervasive in all fields of science and industry. The most well-known application areas are in physics, engineering, chemistry, computer science and statistics. Because of their importance, several books and websites (see for instance http: functions.wolfram.com) and a large collection of papers have been devoted to these functions. Of the standard work on the subject, the Handbook of mathematical functions with formulas, graphs and mathematical tables edited by Milton Abramowitz and Irene Stegun, the American National Institute of Standards claims to have sold over 700 00
Elimination of water pathogens with solar radiation using an automated sequential batch CPC reactor
CSIR Research Space (South Africa)
Polo-López, MI
2011-11-01
Full Text Available Ireland BT37 0QB, United Kingdom f Department of Physiology and Medical Physics, Royal College of Surgeons in Ireland, Dublin 2, Ireland ? Corresponding author. Tel.: +34 950 387957; fax: +34 950 365015. E-mail addresses: mpolo@psa.es (M.I. Polo...-L?pez), pilar.fernandez@psa.es (P. Fern?ndez-Ib?nez), euniceubombajaswa@yahoo.com (E. Ubomba-Jaswa), christian.navntoft@solarmate.com.ar (C.Navntoft), irene.garcia@psa.es (I. Garc?a-Fern?ndez), psm.dunlop@ulster.ac.uk (P.S.M. Dunlop), j.byrne@ulster.ac.uk (J...
[Women in natural sciences--Nobel Prize winners].
Zuskin, Eugenija; Mustajbegović, Jadranka; Lipozencić, Jasna; Kolcić, Ivana; Spoljar-Vrzina, Sanja; Polasek, Ozren
2006-01-01
Alfred Bernhard Nobel was the founder of the Nobel Foundation, which has been awarding world-known scientists since 1901, for their contribution to the welfare of mankind. The life and accomplishments of Alfred Bernhard Nobel are described as well as scientific achivements of 11 women, Nobel prize winners in the field of physics, chemistry, physiology and/or medicine. They are Marie Sklodowska Curie, Maria Goeppert Mayer, Irene Joliot-Curie, Dorothy Crowfoot Hodgkin, Gerty Theresa Radnitz Cori, Rosalyn Sussman Yalow, Barbara McClintock, Rita Levi-Montalcini, Gertrude Elion, Christine Nusslein-Volhard and Linda B. Buck.
Imenovanje jednonitnih homopolimera i kopolimera na osnovi podrijetla (I. dio
Directory of Open Access Journals (Sweden)
Vida Jarm
2018-04-01
Full Text Available Prethodne IUPAC-ove preporuke imenovanja (nomenklature jednonitnih polimera na osnovi podrijetla (NOP odnosile su se uglavnom na kopolimere, nelinearne polimere, združene polimere i generičke polimere. Pravila navedena u ovim preporukama omogućuju jasnije i preciznije imenovanje polimera na osnovi podrijetla, kako homopolimera tako i kopolimera. Prikazani sveobuhvatni sustav imenovanja polimera na osnovi podrijetla prihvatljiva je alternativa sustavu imenovanja polimera na osnovi strukture. Zbog raširene i česte uporabe dodatno su opisane i preporuke za uporabu uvriježenih imena polimera.
A Brief Introduction of Air Traffic Management
Institute of Scientific and Technical Information of China (English)
1997-01-01
Air Traffic Management (ATM) started publication in 1995 by Air Traffic Management Bureau of CAAC. It is the first magazine about ATM field in CAAC. The chairman of Editorial Board of ATM is Mr. Bao Peide, Vice Minister of CAAC. Mr. Chen Ziye, Vice President of the 1st Research Institute of CAAC and Chen Xuhua, General Director of Air Traffic Management Bureau are vice chairmen of the editorial board, and six general directors of local air traffic management bureau and some professors and experts are members of the editorial board.
A glimpse into the littoral nutrient dynamics of a lake system connected to the sea
CSIR Research Space (South Africa)
Taljaard, Susan
2018-01-01
Full Text Available -situ sources are those situated in the floodplains of water bodies such as septic tank systems from low-lying developments (e.g. Chen, 1988; Fraterrigo and Downing, 2008). The smaller, dynamic and more linear nature of over 80% of South Africa’s estuaries... of agricultural watersheds in central Navarre (Spain). Agric. Water Manage. 95 1111–1128. https://doi.org/10.1016/j.agwat.2008.06.013 CHEN M (1988) Pollution of ground water by nutrients and fecal coliforms from lakeshore septic tank systems. Water Air Soil...
清末民初における『レ・ミゼラブル』の移入と日本 : 陳景韓訳「哀史之一節逸犯」を例として
梁, 艶; Liang, Yan
2011-01-01
Victor Hugo was introduced into China through his Japanese translations. However, the route of the reception of his masterpiece Les Misérables in China has not yet been explained clearly. In this paper, I will take Ai Shi Zhi Yi Jie Yi Fan, a Chinese translation by Chen Jinghan of a part of Les Misérables, as an example to see how Les Misérables was introduced into China. By examining Japanese translations of Les Misérables, I come to the conclusion that Chen was influenced by Kuroiwa Ruikô's...
The Secret of Guided Missile Re-Entry,
1986-06-25
I RD-PAI169 598 THE SECRET OF GUIDED MISSILE RE-ENTRY(U) FOREIGN / I TECHNOLOGY DIV NRIGHT-PATTERSON RFB OH J CHEN ET AL. I 25 JUN 96 FTD-ID(RS)T...TECHNOLOGY DIVISION THE SECRET OF GUIDED MISSILE RE-ENTRY by Chen Jingzhong, An Sehua J L 0 7 ’:;85’ ’ 0 *Approved for public release; Distribution...unlimite t d. :. 86 7 034.. FTD- ID(RS)T-0459-86 HUMAN TRANSLATION FTD-ID(RS)T-0459-86 25 June 1986 MICROFICHE NR: F - - 0Q 9? THE SECRET OF GUIDED
Initiation and Propagation of Coronal Mass Ejections P. F. Chen
Indian Academy of Sciences (India)
Introduction. Coronal mass ejections (CMEs) have been observed for over 30 years. They keep being an intriguing research topic, not only because they are now realized to be the major driver for space weather disturbances, which are intimately connected to human activities, but also because they themselves are full of ...
Die Beifuß-Ambrosie auf Ackerflächen - ein Problem?
Directory of Open Access Journals (Sweden)
Verschwele, Arnd
2014-07-01
Full Text Available Common ragweed (Ambrosia artemisiifolia is spreading on agricultural fields in Germany, mainly in Brandenburg and Bayern. Competitive crops like winter cereals and oilseed-rape can reduce growth of this plant better than spring crops. In maize or cereals a chemical control is possible, but problems may arise because of the late emergence of ragweed and its high ability to regrowth. In crops like sunflower or lupines herbicide choice is limited and thus preventive control measures are crucial. An integrated approach is needed in order to avoid yield losses and to stop the spreading of ragweed in Germany.
Diskrepanz: Die EU-Frauenpolitik zwischen Deregulierung und Gleichheitsansprüchen
Directory of Open Access Journals (Sweden)
Ingrid Biermann
2003-03-01
Full Text Available In von neun Autorinnen verfassten Beiträgen gibt der Band Einblicke in zentrale Felder der EU-Politik: die europäische Wirtschafts- und Währungsunion (EWWU, die Strukturpolitik, die Gleichstellungspolitik und das Gender Mainstreaming, die Osterweiterung sowie die Ausarbeitung einer europäischen Verfassung. Damit werden wesentliche Teile des Maastricht-Vertrags (1992, des Amsterdamer Vertrags (1997 und des Nizza-Vertrags (2000 behandelt. Hierdurch bildet dieser Band eine wichtige Grundlage für die Diskussion über die Frauenpolitik der EU.
Graphene oxide-modified ZnO particles: synthesis, characterization, and antibacterial properties
Directory of Open Access Journals (Sweden)
Zhong LL
2015-08-01
Full Text Available Linlin Zhong, Kyusik Yun Department of Bionanotechnology, Gachon University, Gyeonggi-do, Republic of Korea Abstract: Nanosized ZnO particles with diameters of 15 nm were prepared with a solution precipitation method at low cost and high yield. The synthesis of the particles was functionalized by the organic solvent dimethylformamide, and the particles were covalently bonded to the surface of graphene oxide. The morphology of the graphene oxide sheets and ZnO particles was confirmed with field emission scanning electron microscopy and biological atomic force microscopy. Fourier transform infrared spectroscopy and X-ray diffraction were used to analyze the physical and chemical properties of the ZnO/graphene oxide composites that differed from those of the individual components. Enhanced electrochemical properties were detected with cyclic voltammetry, with a redox peak of the composites at 0.025 mV. Excellent antibacterial activity of ZnO/graphene oxide composites was observed with a microdilution method in which minimum inhibitory concentrations of 6.25 µg/mL for Escherichia coli and Salmonella typhimurium, 12.5 µg/mL for Bacillus subtilis, and 25 µg/mL for Enterococcus faecalis. After further study of the antibacterial mechanism, we concluded that a vast number of reactive oxygen species formed on the surface of composites, improving antibacterial properties. Keywords: graphene oxide, ZnO, characterization, antibacterial property
Optimum profit model considering production, quality and sale problem
Chen, Chung-Ho; Lu, Chih-Lun
2011-12-01
Chen and Liu ['Procurement Strategies in the Presence of the Spot Market-an Analytical Framework', Production Planning and Control, 18, 297-309] presented the optimum profit model between the producers and the purchasers for the supply chain system with a pure procurement policy. However, their model with a simple manufacturing cost did not consider the used cost of the customer. In this study, the modified Chen and Liu's model will be addressed for determining the optimum product and process parameters. The authors propose a modified Chen and Liu's model under the two-stage screening procedure. The surrogate variable having a high correlation with the measurable quality characteristic will be directly measured in the first stage. The measurable quality characteristic will be directly measured in the second stage when the product decision cannot be determined in the first stage. The used cost of the customer will be measured by adopting Taguchi's quadratic quality loss function. The optimum purchaser's order quantity, the producer's product price and the process quality level will be jointly determined by maximising the expected profit between them.
Choi, Younsung; Nam, Junghyun; Lee, Donghoon; Kim, Jiye; Jung, Jaewook; Won, Dongho
2014-01-01
An anonymous user authentication scheme allows a user, who wants to access a remote application server, to achieve mutual authentication and session key establishment with the server in an anonymous manner. To enhance the security of such authentication schemes, recent researches combined user's biometrics with a password. However, these authentication schemes are designed for single server environment. So when a user wants to access different application servers, the user has to register many times. To solve this problem, Chuang and Chen proposed an anonymous multiserver authenticated key agreement scheme using smart cards together with passwords and biometrics. Chuang and Chen claimed that their scheme not only supports multiple servers but also achieves various security requirements. However, we show that this scheme is vulnerable to a masquerade attack, a smart card attack, a user impersonation attack, and a DoS attack and does not achieve perfect forward secrecy. We also propose a security enhanced anonymous multiserver authenticated key agreement scheme which addresses all the weaknesses identified in Chuang and Chen's scheme.
[A review for a traditional Chinese medical journal Shou Shi Yi Bao].
Xiao, Mei-Hua; Sun, Wen-Zhong
2009-06-01
Shou Shi Yi Bao was a journal of traditional Chinese medicine (TCM) during the period from 1935 to 1937, and was originated by Chen Huan-yun, a TCM physician in Suzhou. It is mainly to transmit the knowledge of TCM and to promote the epidemic prevention capacity of local public. The editorial characteristics and historical value of the journal were explored in initial background, staff writers, editorial policies, contents and the Editor Chen's medical ideas. Shou Shi Yi Bao was supported by many famous TCM physicians, although the journal was originated from the civil society. It was an academic TCM journal with perfect practicability for orientating to the public and highlighting the academic spirit. Chen Huan-yun was a resolute defender of TCM, and had many opinions on clinical practice and lots of scientific suggestions on TCM development. Shou Shi Yi Bao reflected the main characteristics of TCM journals in 1930s. The journal was one of the important documents to study the TCM history during the period of the Republic of China in Jiangsu Province, and it also set a stage for the struggle between TCM and Western medicine at that time. The documentary information of the journal has literature and history values in reflecting the historical process of TCM self-improvement. The success of the journal was due to not only the broken-up sectarian bias and cooperation of the TCM practitioners but also the preponderant geographic and cultural circumstances of Suzhou as well as Chen Huan-yun's profound knowledge in traditional Chinese culture and medicine.
2012-02-10
Cremer , J-Y Chen, C.K. Westbrook, L.Q. Maurice, J. Propul. Power 18 (1) (2002) 192–198. K. Harstad, J. Bellan / Combustion and Flame 157 (2010) 1594... Cremer , J.-Y. Chen, C.K. Westbrook, L.Q. Maurice, J. Propuls. Power 18 (1) (2002) 192–198. a 10-9 10-7 10-5 10-3 10-1 101 N oh (m ol /m 3 ) T0 = 800...Caltech by the Army Research Office under the direction of Drs. David Mann, Kevin McNesby and Ralph Anthenien. References 1U. C. Müeller, N. Peters, A
Spiegelberg, Jakob; Rusz, Ján
2015-12-01
In the framework of the slice transition operator technique, a general multislice theory for electron scattering in crystals is developed. To achieve this generalization, we combine the approaches for inelastic scattering derived by Yoshioka [J. Phys. Soc. Jpn. 12, 6 (1957)] and backscattering based on the formalism of Chen and Van Dyck [Ultramicroscopy 70, 29-44 (1997)]. A computational realization of the obtained equations is suggested. The proposed computational scheme is tested on elastic backscattering of electrons, where we consider single backscattering in analogy to the computational scheme proposed by Chen and Van Dyck. Copyright © 2015 Elsevier B.V. All rights reserved.
Obrazovanije na russkom potshti bessmertno / Irene Käosaar ; interv. Anastassia Belitshko-Popovitsh
Käosaar, Irene
2008-01-01
Haridus- ja teadusministeeriumi rahvusvähemuste hariduse osakonna juhataja vastab küsimustele, mis puudutavad venekeelset haridust Eestis ja üleminekut eestikeelsele õppele. Kommenteerib Lauri Leesi
Young performance artist experimenting in youth work / Irene Hütsi, Kai Valtna
Hütsi, Irene
2013-01-01
MIMO projekt 2010-2013: 2011. ja 2012. a. Eesti linnades toimunud rahvusvahelise muusikaloome alase koolitus- ja noorteprojekti MIMO (Moving in! Moving on!) raames toimunust. Viljandi Kultuuriakadeemia töötubadest, mida viisid läbi akadeemia tudengid Eesti väikelinnade koolides ja noortekeskustes
Living Shoreline Designs in Urban Systems: Examples from New York and Baltimore Harbors
Doss, T.
2017-12-01
In the aftermath of Hurricanes Irene and Sandy, there was a renewed interest in protecting our shorelines and restoring community resiliency by using natural and nature based features. We observed in the wake of these storms that those shorelines that had been protected by natural features sustained less damage. But how well can we mimic these natural features? And how do we determine which strategy is best along a given shoreline? A series of living shoreline pilot projects are presented, highlighting the design and construction for the different strategies and how they are being monitored and adapted to sea level rise.
2009-01-01
Sisu: Programm. Õigusteaduse rollist Eesti Vabariigi põhiseaduse aluspõhimõtete sisustamisel / Raul Narits. Keskkonnaõiguse kodifitseerimise teaduslikud alused / Hannes Veinla. "Kord Vestmann peal ja Piibeleht all, siis jälle..." : praktika ja õigusteaduse vahekord õiguse kujundamisel 19. sajandi Läänemereprovintsides / Marju Luts-Sootak. Teaduslik analüüs tsiviilõigusloomes / Paul Varul. Õiguslaenud ja võrdlev õigusteadus Eesti eraõiguse süsteemi kujundamisel / Irene Kull. Professor Meruski juubeliks / Märt Rask. Kolleegi kiituseks / Raul Narits. Professor Kalle Merusk : õpetaja ja inimene / Ivo Pilving. Kalle Merusk : valikbibliograafia 1990-2009 / koost. Maia Ruttu
Morville, Peter
2010-01-01
What people are saying about Search Patterns "Search Patterns is a delight to read -- very thoughtful and thought provoking. It's the most comprehensive survey of designing effective search experiences I've seen." --Irene Au, Director of User Experience, Google "I love this book! Thanks to Peter and Jeffery, I now know that search (yes, boring old yucky who cares search) is one of the coolest ways around of looking at the world." --Dan Roam, author, The Back of the Napkin (Portfolio Hardcover) "Search Patterns is a playful guide to the practical concerns of search interface design. It cont
CSIR Research Space (South Africa)
Sivakumar, V
2009-01-01
Full Text Available obtained from HALOE datasets 6 3.3. SHADOZ mean Ozone The mean ozone obtained from SHADOZ ozonesonde insitu measurement; from Nairobi located at 1.27°S and 36.8°E, Malindi at 2.99°S and 40.2°E and Irene at 25.9°S and 28.22°E, stations are displayed... - 2090. 8 2. Lohmann, M.S., et al., Water vapor profile using LEO - LEO Intersatellite Links. Danish Metereological Institute. Atmospheric Ionosphere Research. 3. Jones, R.L. and Mitchell,J.F.B., (1991) Climate change - is water vapor...
Zárate, Arturo; Apolinar, Leticia Manuel; Saucedo, Renata; Basurto, Lourdes
2015-01-01
The Nobel Prize was established by Alfred Nobel in 1901 to award people who have made outstanding achievements in physics, chemistry and medicine. So far, from 852 laureates, 45 have been female. Marie Curie was the first woman to receive the Nobel Prize in 1903 for physics and eight years later also for chemistry It is remarkable that her daughter Irene and her husband also received the Nobel Prize for chemistry in 1935. Other two married couples, Cori and Moser, have also been awarded the Nobel Prize. The present commentary attempts to show the female participation in the progress of scientific activities.
International Nuclear Information System (INIS)
Fradkin, P.L.
1989-01-01
When the United States government conducted atmospheric nuclear tests in southern Nevada during the 1950s and early 1960s, radioactive fallout drifted downwind onto citizens. The case of Irene Allen v. The United States of America, filed on August 30, 1979, brought to public awareness the plight of residents of Nevada, Utah, and Arizona. Within the context of the trial, this book provides an overview of the development and atmospheric testing of nuclear weapons by the United States, focusing on Shot Harry, the most radioactive of the 105 atmospheric tests conducted from 1951 to 1962
Directory of Open Access Journals (Sweden)
Gordon C. K. Cheung
2010-04-01
Full Text Available Taiwan’s Legislative Yuan and Presidential elections in January and March 2008 respectively re-orientated cross-Strait relations from hostility to co-operation. On 4 November 2008, Chen Yunlin, head of the Association for Relations Across the Taiwan Straits (ARATS, and Chiang Pin-kun (Jiang Bingkun, chairman of Taiwan’s Straits Exchange Foundation (SEF, meeting in the Second Chiang-Chen Talks in Taiwan, took a historical step in the further development of cross-Strait relations. Agreements were signed on direct air and sea transport, postal services and food-safety security. On 22 December 2009, the Fourth Chiang- Chen Talks took place in Taizhong and more substantial and technical agreements were signed on agriculture, inspection/ accreditation and fisheries. It seems that continuous integration between China and Taiwan is inevitable. To address the implications of this process for Taiwan’s domestic economy, four dimensions of the current cross-Strait relationship are scrutinized: guanxi, plutocracy, legalism and the idea of a Chinese Common Market. It is argued that in order to intensify economic co-operation across the Taiwan Strait, more institutionalization of the cross-Strait relationship must be brought about.
Vibration mechanism of fuel rod in axial flow
International Nuclear Information System (INIS)
Kang, Heung Seok; Yoon, Kyung Ho; Kim, Hyung Kyu; Song, Kee Nam
1998-08-01
This is a review on the previous researches for the vibration of fuel rod induced by axial flow. The analysis methods are classified into three categories accordingly as the researchers postulate the vibration to be self-excited, forced and parametric; the self-excited mechanism by Burgreen and Quinn, the forced one by Reavis, Gorman, kanazawa, and S. Chen, and the parametric one by Y. Chen. Quinn supposed that the centrifugal force by flow exaggerated the natural bow in the cylinder, and the flexural force by it diminished the bow by turns; this interactive motion leaded cylinder to vibration. The supporters to the forced mechanism considered the forces arising from pressure perturbation within the boundary layers as vibrating sources. Y. Chen insisted that the cylinder could only be excited to vibration in resonance by the small oscillation of mean flow velocity. The previous studies were based on the simple boundary conditions such as hinged-hinged or fixed-fixed single span. Therefore, for the more accurate prediction of the fuel rod vibration in reactor, the further studies need to reflect the actual boundary conditions of the fuel rod like axial force and continuous supports by grids. (author). 25 refs
Adaptive feedback synchronization of Lue system
International Nuclear Information System (INIS)
Han, X.; Lu, J.-A.; Wu, X.
2004-01-01
This letter further improves and extends the works of Chen and Lue [Chaos, Solitons and Fractals 14 (2002) 643] and Wang et al. [Phys. Lett. A 312 (2003) 34]. In detail, the linear feedback synchronization and adaptive feedback synchronization for Lue system are discussed. And the lower bound of the feedback gain in linear feedback synchronization is presented. The adaptive feedback synchronization with only one controller is designed, which improves the proof in the work by Wang et al. The adaptive synchronization with two controllers for completely uncertain Lue system is also discussed, which extends the work of Chen and Lue. Also, numerical simulations show the effectiveness of these methods
Pollen Flora of Yuenyang Lake Nature Preserve, Taiwan (IV
Directory of Open Access Journals (Sweden)
Yu-Fa Wang
2002-06-01
Full Text Available Yuenyang Lake is an acidic lake situated within a nature preserve in northern Taiwan. The pollen of nineteen taxa, belonging to five families, was collected from this nature preserve and investigated with light and scanning electron microscopy. The results of this investigation are supplementary work to the previous publications in this journal (Chen and Wang, 1999, 2001; Wang and Chen, 2001. A total of 4 pollen classes were identified on the basis of the aperture on the pollen wall: 3-colpate, 6-colpate, 3-colporate, and 4-7-colporate pollen. These results could be useful in the reconstruction of vegetation history around the Yuenyang Lake.
Nguyen, Tung T; Tran, Binh T T; Nguyen, Anh D
2014-09-22
The 'acaecate' Pheretima group from Vietnam is revised, with description of a new species, Polypheretima mekongmontis sp. nov. A total of 18 species of three genera, Metapheretima Michaelsen, 1928, Planapheretima Michaelsen, 1934, and Polypheretima Michaelsen, 1934 has been recorded from Vietnam. Caecate species of Planapheretima are included here as well. Planapheretima arboricola (Rosa, 1890), Pl. lacertina (Chen, 1946), Pl. tenebrica (Chen, 1946), Polypheretima elongata (Perrier, 1872), and Po. taprobanae (Beddard, 1892) are originally recorded from other countries; all remaining species are native to Vietnam. The species Polypheretima tani (Thai, 1996) and Po. tiencanhensis (Pham, 1995) are transferred to the genus Metapheretima. A key to species and distribution maps are also presented.
Critical node lifetimes in random networks via the Chen-Stein method
Franceschetti, M.; Meester, R.W.J.
2006-01-01
This correspondence considers networks where nodes are connected randomly and can fail at random times. It provides scaling laws that allow to find the critical time at which isolated nodes begin to appear in the system as its size tends to infinity. Applications are in the areas of sensor and
Chen and Xiaodong Afr J Tradit Complement Altern Med. (2013) 10 ...
African Journals Online (AJOL)
AJTCAM
As an ancient medicine, Solanum nigrum Linne has been playing an important role in the treatment of cancer in China since ancient times. It is reported in the literatures that Solanum nigrum Linne can inhibit tumour cell growth and promote apoptosis of tumour cells, and has immunomodulatory and cytotoxic effects (Son et ...
VizieR Online Data Catalog: Sample of Fermi Blazars (Chen+, 2016)
Chen, Y.-Y.; Zhang, X.; Xiong, D.-R.; Wang, S.-J.; Yu, X.-L.
2016-04-01
We tried to select a large number of blazars with reliable redshift, radio core and extended radio luminosity at 1.4GHz. Firstly, we considered the following samples of blazars to get the radio core luminosity and extended luminosity at 1.4GHz: Kharb et al. (2010, J/ApJ/710/764), Antonucci & Ulvestad (1985ApJ...294..158A), Cassaro et al. (1999A&AS..139..601C), Murphy et al. (1993MNRAS.264..298M), Landt & Bignall (2008MNRAS.391..967L), Caccianiga & Marcha (2004, Cat. J/MNRAS/348/973), Giroletti et al. (2004). We cross-correlated these samples with the Fermi LAT Third Source Catalog (3FGL), and we acquired the 3FGL spectral index and energy flux at 0.1-100GeV from clean sources in 3FGL (Fermi-LAT Collaboration 2015, J/ApJS/218/23) Using these catalogs, we compiled 201 Fermi blazars. (1 data file).
REVIEW: LOVE IN LHASA Lhasa hong chen 拉萨红尘
Directory of Open Access Journals (Sweden)
Reviewed by Wu Jing 吴晶
2018-05-01
Full Text Available Published in 2002, Love in Lhasa is Baima's first novel. The background is the 1980s at a time when China was engaging in fast-paced development of industrialization and commercialization as part of the Reform and Opening Up that began in the late 1970s. Most of the novel's episodes are set on the Tibetan Plateau where local Tibetans are affected by the trend of modernization. Young people in particular have increased opportunities to go out and see the world and also experience more challenges in dealing with issues of self-identity, and exploring the meaning of their existence. Against such a fast-changing social background, Tibetan women are faced with poignant life choices, especially as compared to traditional women. The novel's plot unfolds with the parallel life trajectories of the two female characters, Langsa and Yama, who are classmates and close friends at Tibet Military College. After graduation, the two young women leave the army and work in non-military areas as nurses. Langsa, the narrator, falls in love with a pilgrim, Varma, who comes from an isolated part of Tibet where Tibetan, Hui, and Han nationalities live together. They enjoy their otherworldly, extremely romantic relationship, and in the end, choose to live a reclusive life in the unknown hinterlands of Tibet. In contrast, Yama, the heroine, undergoes more complicated love experiences. Yama is the focus of this novel, embodying qualities of a "lost girl," such as beauty, rebelliousness, freedom-loving, desire, dreamer, degradation, and despair. After a pre-marriage affair with Di, a young Han man, she marries Zedan, a Tibetan, and her first real love. Disappointed by domestic life, she succumbs to temptation and has an extra-marital affair with Xu Nan in Shanghai. ...
Medical imaging. From nuclear medicine to neuro-sciences
International Nuclear Information System (INIS)
2003-03-01
Nuclear medicine and functional imaging were born of the CEA's ambition to promote and develop nuclear applications in the fields of biology and health. Nuclear medicine is based on the use of radioactive isotopes for diagnostic and therapeutic purposes. It could never have developed so rapidly without the progress made in atomic and nuclear physics. One major breakthrough was the discovery of artificial radioelements by Irene and Frederic Joliot in 1934, when a short-lived radioactive isotope was created for the first time ever. Whether natural or synthetic, isotopes possess the same chemical properties as their non-radioactive counterparts. The only difference is that they are unstable and this instability causes disintegration, leading to radiation emission. All we need are suitable detection tools to keep track of them. 'The discovery of artificial radioelements is at the root of the most advanced medical imaging techniques'. The notion of tracer dates back to 1913. Invented by George de Hevesy, it lies at the root of nuclear medicine. By discovering how to produce radioactive isotopes, Irene and Frederic Joliot provided biology researchers with nuclear tools of unrivalled efficiency. Today, nuclear medicine and functional imaging are the only techniques capable of giving us extremely precise information about living organisms in a non-traumatic manner and without upsetting their balance. Positron emission tomography (PET) and nuclear magnetic resonance imaging (MRI) are the main imaging techniques used at the CEA in its neuro-imaging research activities. These techniques are now developing rapidly and becoming increasingly important not only in the neuroscience world, but also for innovative therapies and cancer treatment. (authors)
Directory of Open Access Journals (Sweden)
Sun HY
2017-04-01
Full Text Available Hongyu Sun,* Jing Zhou,* Zhu Huang,* Linlin Qu,* Ning Lin,* Chengxiao Liang, Ruiwu Dai, Lijun Tang, Fuzhou Tian General Surgery Center, Chengdu Military General Hospital, Chengdu, China *These authors contributed equally to this work Abstract: Carbon nanotubes (CNTs provide an essential 2-D microenvironment for cardiomyocyte growth and function. However, it remains to be elucidated whether CNT nanostructures can promote cell–cell integrity and facilitate the formation of functional tissues in 3-D hydrogels. Here, single-walled CNTs were incorporated into collagen hydrogels to fabricate (CNT/Col hydrogels, which improved mechanical and electrical properties. The incorporation of CNTs (up to 1 wt% exhibited no toxicity to cardiomyocytes and enhanced cell adhesion and elongation. Through the use of immunohistochemical staining, transmission electron microscopy, and intracellular calcium-transient measurement, the incorporation of CNTs was found to improve cell alignment and assembly remarkably, which led to the formation of engineered cardiac tissues with stronger contraction potential. Importantly, cardiac tissues based on CNT/Col hydrogels were noted to have better functionality. Collectively, the incorporation of CNTs into the Col hydrogels improved cell alignment and the performance of cardiac constructs. Our study suggests that CNT/Col hydrogels offer a promising tissue scaffold for cardiac constructs, and might serve as injectable biomaterials to deliver cell or drug molecules for cardiac regeneration following myocardial infarction in the near future. Keywords: carbon nanotubes, collagen hydrogel, cardiac constructs, cell alignment, tissue functionality
Gold nanoparticles enlighten the future of cancer theranostics
Directory of Open Access Journals (Sweden)
Guo J
2017-08-01
Full Text Available Jianfeng Guo,1 Kamil Rahme,2–4 Yan He,1 Lin-Lin Li,5 Justin D Holmes,3,4 Caitriona M O’Driscoll6 1School of Pharmaceutical Sciences, Jilin University, Changchun, China; 2Department of Sciences, Faculty of Natural and Applied Science, Notre Dame University (Louaize, Zouk Mosbeh, Lebanon; 3Department of Chemistry, Tyndall National Institute, University College Cork, Cork, 4AMBER@CRANN, Trinity College Dublin, Dublin, Ireland; 5The First Hospital of Jilin University, Changchun, China; 6Pharmacodelivery Group, School of Pharmacy, University College Cork, Cork, Ireland Abstract: Development of multifunctional nanomaterials, one of the most interesting and advanced research areas in the field of nanotechnology, is anticipated to revolutionize cancer diagnosis and treatment. Gold nanoparticles (AuNPs are now being widely utilized in bioimaging and phototherapy due to their tunable and highly sensitive optical and electronic properties (the surface plasmon resonance. As a new concept, termed “theranostics,” multifunctional AuNPs may contain diagnostic and therapeutic functions that can be integrated into one system, thereby simultaneously facilitating diagnosis and therapy and monitoring therapeutic responses. In this review, the important properties of AuNPs relevant to diagnostic and phototherapeutic applications such as structure, shape, optics, and surface chemistry are described. Barriers for translational development of theranostic AuNPs and recent advances in the application of AuNPs for cancer diagnosis, photothermal, and photodynamic therapy are discussed. Keywords: multifunctional gold nanoparticles, cancer bioimaging, cancer photothermal and photodynamic therapy
Oberflächenstrukturierung metallischer Werkstoffe, z. B. für stents
Stöver, Michael; Wintermantel, Erich
Eine topologische Oberflächenmodifikation von metallischen Implantaten kann aus verschiedenen Gründen sinnvoll sein. Im Allgemeinen lassen sich zwei Hauptziele unterscheiden. Zum einen dienen Oberflächen dazu, bestimmte Zellreaktionen zu forcieren. Die Anwendungsbeispiele reichen hier von sehr rauen Oberflächen in Fällen wo eine gute Integration eines Permanentimplantates in das Gewebe erwünscht ist bis hin zu glatt polierten Oberflächen. Letztere werden in erster Linie dort eingesetzt, wo das Implantat in direktem Kontakt mit Blut ist. Ein Beispiel für die Erforderlichkeit einer hohen Rauheit (Rz > 100 μm) sind meist aus Titan gefertigte Schäfte von Gelenksimplantaten [1,2]. Die Autoren machten den Vorschlag, die Aufrauung von Titan- und Edelstahl-Stents analog der Aufrauung bei Hüftprothesenschäften zu versuchen, um eine noch bessere Biokompatibilität zu erreichen. [7, 8 ,9]. Sehr glatte Oberflächen, in der Regel mit Rz Werten von unter 0,1 μm, sind z. B. bei Herzklappenprothesen und der Innenseite von Gefäßstützen gefordert. Mittlere Rauheiten werden oft bei temporären Implantaten eingesetzt, in die in reguliertem Maße Gewebe einwachsen, allerdings keine unlösbare Verbindung bilden sollen. Sehr genau eingestellt werden müssen auch die Oberflächentopographien bei Implantaten in sehr empfindlichen Gebieten wie z. B. der Gehirnregion. Hierbei muss eine gute Verankerung im Gewebe vorhanden sein, um ein Verrutschen des Implantates zu verhindern. Zum anderen darf keine überschüssige Zellproliferation entstehen, um ein Einwachsen in sensible Regionen zu verhindern. Zum anderen werden Oberflächenmikrostrukturen genutzt, um Wirkstoffe in Implantate einzubringen, die lokal über einen bestimmten Zeitraum freigesetzt werden sollen. Als wichtigste Wirkstoffe sind hier Antibiotika und entzündungshemmende Mittel sowie im kardiovaskulären Bereich Proliferationshemmer zu nennen.
清江浦运河与运口考%A Study On Qingjiang Pu Canal and Transport
Institute of Scientific and Technical Information of China (English)
荀德麟
2015-01-01
The digging of Qingjiang Pu canal and the rise of Qingjiang Pu city are closely linked with Chen Xu-an who administered water transport for thirty years. He was a founder and establisher of the river system in Ming and Qing Dynasties. Chen Xuan followed the old canal———the sand river and dug Qingjiang Pu ( not named Qingjiang Pu) , most of which was dug on the old course of the original beneaped sand-river canal dug by Qiao Weiyue in Song dynasty ( called Qingjiang Pu after Yuan Yanyou five years) . Chen Xuan built four floodgates in the Qingjiang Pu canal, and the riverway between the Mopan mouth and the Yachen mouth was a newly section dug by Chen Xuan ( of course, it is not excluded that part of the other old rivers or water courses was used for this section) .%清江浦运河的开凿与清江浦城的兴起,与陈瑄息息相关,陈瑄督理河漕凡三十年,是明清时期漕运制度的确立者和奠基人。陈瑄循沙河旧渠,开凿清江浦(非命名清江浦),大部分是在原来淤浅的宋乔维岳沙河运河(元延祐五年后称清江浦)旧渠上开凿的。陈瑄在清江浦运河上建四道闸,磨盘口至鸭陈口的这一段河道,是陈瑄新开挖的部分。
Koguteos Rootsi põllumajanduse ajaloost / Ülle Tarkiainen
Tarkiainen, Ülle
2004-01-01
Rets. rmt.: Welinder, Stig, Pedersen, Ellen Anne. Jordbrukets första femtusen år 4000 f. Kr.-1000 e. Kr. Det svenska jordbrukets historia I. Borås, 1998 ; Myrdal, Janken. Jordbruket under feodalismen 1000-1700. Det svenska jordbrukets historia II. Borås, 1999 ; Gadd, Carl-Johan. Den agrara revolutionen 1700-1870. Det svenska jordbrukets historia III. Borås, 2000 ; Morell, Mats. Jordbruket i industrisamhället 1870-1945. Det svenska jordbrukets historia IV. Borås, 2001 ; Flygare, Irene A., Isacson, Maths. Jordbruket i välfärdssamhället 1945-2000. Det svenska jordbrukets historia V. Örebro, 2003
International Nuclear Information System (INIS)
Barashenkov, V.S.; Puzynin, I.V.; Sisakyan, A.N.; Polanski, A.
1999-01-01
We present a Plutonium Based Energy Amplifier Testing Concept, which employs a plutonium subcritical assembly and a 660 MeV proton accelerator operating in the JINR Laboratory of Nuclear Problems. Fuel designed for the pulsed neutron source IREN (Laboratory of Neutron Physics, JINR) will be adopted for the core of the assembly. To make the present conceptual design of the Plutonium Energy Amplifier we have chosen a nominal unit capacity of 20 kW (thermal). This corresponds to the multiplication coefficient K eff ranging between 0.94 and 0.95 and the energetic gain about 20. Accelerated current is in the range of 1-1.6μA
Qualification of a digital radiographic equipment for thin weld inspection
International Nuclear Information System (INIS)
Boulanger, G.; Furlan, J.
1988-04-01
The level of quality asked for welding plugs to fuel pins requires to test all the welds, that is to say about 200 000 welds of the fuel assemblies of the fast reactor Super-Phenix. X-ray radiography is one of the tests. Before the operation was done on a film by the personnel automatic selection of tested material and image processing are substituted to the film in the digital radiographic equipment IRENE. Main advantages are: elimination of human factor in defect appreciation, reliability of image processing and instant availability. On 1000 welds a good correlation is obtained between results on films and those of image processing [fr
Atomic Pioneers Book 3 From the Late 19th to the Mid-20th Century
Energy Technology Data Exchange (ETDEWEB)
Hiebert, Ray [University of Maryland; Hiebert, Roselyn
1973-01-01
This book tells the story of the atom by presenting a brief account of the lives and work of 24 atomic scientists who brought the world into the complex Age of the Atom by mid-20th century. The 24 are: Albert Einstein, James Franck, Max Born, Peter J.W. Debye, Niels Bohr, George von Hevesy, Henry G.J. Moseley, Gustav Hertz, Erwin Schrodinger, Otto Stern, James Chadwick, Arthur H. Compton, Louis Victor de Broglie, Harold C. Urey, John D. Cockcroft, Patrick M.S. Blackett, Isidor I. Rabi, Leo Szilard, Jean Frederic Joliot-Curie, Irene Joliot-Curie, Wolfgang Pauli, Ernest O. Lawrence, Enrico Fermi, and Robert J. Van de Graaff.
Taiwan in 2004: Elections, Referenda, and Other Democratic Challenges
National Research Council Canada - National Science Library
Dumbaugh, Kerry
2005-01-01
.... In both the presidential and legislative election campaigns, Chen emphasized gaining a separate international identity for Taiwan -- an emphasis to which Beijing strenuously objected as dangerously...
Institute of Scientific and Technical Information of China (English)
无
2009-01-01
Chen et al.proposed the concepts of effective temperature of photon and entropy constant of photon in a recent paper [Chen Z S,Mo S P,Hu P.Recent progress in thermodynamics of radiation―exergy of radiation,effective temperature of photon and entropy constant of photon.Sci China Ser E-Tech Sci,2008,51(8):1096―1109] by enduing a single photon with macroscale thermodynamic parameters such as exergy and entropy.This paper argues that applying these concepts and their inferences to macro-scale thermodynamic system will lead to the results which conflict with macroscale thermodynamic laws.This means that the concepts of effective temperature of photon and entropy constant of photon are not correct.
A Brief Introduction of Air Traffic Management
Institute of Scientific and Technical Information of China (English)
1997-01-01
Air Traffic Management(ATM)started publication in 1995 by Air Traffic Management Bureauof CAAC.It is the first magazine about ATM field in CAAC.The chairman of Editorial Board ofATM is Mr.Bao Peide,Vice Minister of CAAC.Mr.Chen Ziye,Vice President of the 1st ResearchInstitute of CAAC and Chen Xuhua,General Director of Air Traffic Management Bureau are vicechairmen of the editorial board,and six general directors of local air traffic management bureau andsome professors and experts are members of the editorial board.ATM includes more than 20 columns,which are communication,navigation,surveillance,air trafficmanagement,special articles(policy,planning and management of implementation of CNS/ATM
Relativistic Chiral Kinetic Theory
International Nuclear Information System (INIS)
Stephanov, Mikhail
2016-01-01
This very brief review of the recent progress in chiral kinetic theory is based on the results of Refs. [J.-Y. Chen, D. T. Son, M. A. Stephanov, H.-U. Yee, Y. Yin, Lorentz Invariance in Chiral Kinetic Theory, Phys. Rev. Lett. 113 (18) (2014) 182302. doi: (10.1103/PhysRevLett.113.182302); J.-Y. Chen, D. T. Son, M. A. Stephanov, Collisions in Chiral Kinetic Theory, Phys. Rev. Lett. 115 (2) (2015) 021601. doi: (10.1103/PhysRevLett.115.021601); M. A. Stephanov, H.-U. Yee, The no-drag frame for anomalous chiral fluid, Phys. Rev. Lett. 116 (12) (2016) 122302. doi: (10.1103/PhysRevLett.116.122302)].
Relativistic Chiral Kinetic Theory
Energy Technology Data Exchange (ETDEWEB)
Stephanov, Mikhail
2016-12-15
This very brief review of the recent progress in chiral kinetic theory is based on the results of Refs. [J.-Y. Chen, D. T. Son, M. A. Stephanov, H.-U. Yee, Y. Yin, Lorentz Invariance in Chiral Kinetic Theory, Phys. Rev. Lett. 113 (18) (2014) 182302. doi: (10.1103/PhysRevLett.113.182302); J.-Y. Chen, D. T. Son, M. A. Stephanov, Collisions in Chiral Kinetic Theory, Phys. Rev. Lett. 115 (2) (2015) 021601. doi: (10.1103/PhysRevLett.115.021601); M. A. Stephanov, H.-U. Yee, The no-drag frame for anomalous chiral fluid, Phys. Rev. Lett. 116 (12) (2016) 122302. doi: (10.1103/PhysRevLett.116.122302)].
New Techniques for Thermo-electrochemical Analysis of Lithium-ion Batteries for Space Applications
Walker, William; Ardebili, H.
2013-01-01
The overall goal of this study was achieved: Replicated the numerical assessment performed by Chen et. al. (2005). Displayed the ability of Thermal Desktop to be coupled with thermo-electrochemical analysis techniques. such that the local heat generated on the cells is a function of the model itself using logic blocks and arrays. Differences in the TD temperature vs. depth of discharge profiles and Chen's was most likely due to differences in two primary areas: Contact regions and conductance values. Differences in density and specific heat values. center dot The model results are highly dependent on the accuracy of the material properties with respect to the multiple layers of an individual cell.
International Nuclear Information System (INIS)
Xu Yuhua; Zhou Wuneng; Fang Jianan
2009-01-01
This paper introduces a modified Lue chaotic system, and some basic dynamical properties are studied. Based on these properties, we present hybrid dislocated control method for stabilizing chaos to unstable equilibrium and limit cycle. In addition, based on the Lyapunov stability theorem, general hybrid projective dislocated synchronization (GHPDS) is proposed, which includes complete dislocated synchronization, dislocated anti-synchronization and projective dislocated synchronization as its special item. The drive and response systems discussed in this paper can be strictly different dynamical systems (including different dimensional systems). As examples, the modified Lue chaotic system, Chen chaotic system and hyperchaotic Chen system are discussed. Numerical simulations are given to show the effectiveness of these methods.
Min, Lequan; Chen, Guanrong
This paper establishes some generalized synchronization (GS) theorems for a coupled discrete array of difference systems (CDADS) and a coupled continuous array of differential systems (CCADS). These constructive theorems provide general representations of GS in CDADS and CCADS. Based on these theorems, one can design GS-driven CDADS and CCADS via appropriate (invertible) transformations. As applications, the results are applied to autonomous and nonautonomous coupled Chen cellular neural network (CNN) CDADS and CCADS, discrete bidirectional Lorenz CNN CDADS, nonautonomous bidirectional Chua CNN CCADS, and nonautonomously bidirectional Chen CNN CDADS and CCADS, respectively. Extensive numerical simulations show their complex dynamic behaviors. These theorems provide new means for understanding the GS phenomena of complex discrete and continuously differentiable networks.
Mapping closure for probability distribution function in low frequency magnetized plasma turbulence
International Nuclear Information System (INIS)
Das, A.; Kaw, P.
1995-01-01
Recent numerical studies on the Hasegawa--Mima equation and its variants describing low frequency magnetized plasma turbulence indicate that the potential fluctuations have a Gaussian character whereas the vorticity exhibits non-Gaussian features. A theoretical interpretation for this observation using the recently developed mapping closure technique [Chen, Chen, and Kraichnan, Phys. Rev. Lett. 63, 2657 (1989)] has been provided here. It has been shown that non-Gaussian statistics for the vorticity arises because of a competition between nonlinear straining and diffusive damping whereas the Gaussianity of the statistics of φ arises because the only significant nonlinearity is associated with divergence free convection, which produces no strain terms. copyright 1995 American Institute of Physics
Energy Technology Data Exchange (ETDEWEB)
Xu Yuhua [College of Information Science and Technology, Donghua University, Shanghai 201620 (China) and Department of Maths, Yunyang Teacher' s College, Hubei 442000 (China)], E-mail: yuhuaxu2004@163.com; Zhou Wuneng [College of Information Science and Technology, Donghua University, Shanghai 201620 (China)], E-mail: wnzhou@163.com; Fang Jianan [College of Information Science and Technology, Donghua University, Shanghai 201620 (China)
2009-11-15
This paper introduces a modified Lue chaotic system, and some basic dynamical properties are studied. Based on these properties, we present hybrid dislocated control method for stabilizing chaos to unstable equilibrium and limit cycle. In addition, based on the Lyapunov stability theorem, general hybrid projective dislocated synchronization (GHPDS) is proposed, which includes complete dislocated synchronization, dislocated anti-synchronization and projective dislocated synchronization as its special item. The drive and response systems discussed in this paper can be strictly different dynamical systems (including different dimensional systems). As examples, the modified Lue chaotic system, Chen chaotic system and hyperchaotic Chen system are discussed. Numerical simulations are given to show the effectiveness of these methods.
Wang, Ting-Ting; Li, Jin-Mei; Zhou, Dong
2016-01-01
With great interest, we read the paper "Polymorphisms in IL-4/IL-13 pathway genes and glioma risk: an updated meta-analysis" (by Chen PQ et al.) [1], which has reached important conclusions about the relationship between polymorphisms in interleukin (IL)-4/IL-13 pathway genes and glioma risk. Through quantitative analysis, the meta-analysis found no association between IL-4/IL-13 pathway genetic polymorphisms and glioma risk (Chen et al. in Tumor Biol 36:121-127, 2015). The meta-analysis is the most comprehensive study of polymorphisms in the IL-4/IL-13 pathway and glioma risk. Nevertheless, some deficiencies still exist in this meta-analysis that we would like to raise.
Future Tense and Economic Decisions: Controlling for Cultural Evolution.
Roberts, Seán G; Winters, James; Chen, Keith
2015-01-01
A previous study by Chen demonstrates a correlation between languages that grammatically mark future events and their speakers' propensity to save, even after controlling for numerous economic and demographic factors. The implication is that languages which grammatically distinguish the present and the future may bias their speakers to distinguish them psychologically, leading to less future-oriented decision making. However, Chen's original analysis assumed languages are independent. This neglects the fact that languages are related, causing correlations to appear stronger than is warranted (Galton's problem). In this paper, we test the robustness of Chen's correlations to corrections for the geographic and historical relatedness of languages. While the question seems simple, the answer is complex. In general, the statistical correlation between the two variables is weaker when controlling for relatedness. When applying the strictest tests for relatedness, and when data is not aggregated across individuals, the correlation is not significant. However, the correlation did remain reasonably robust under a number of tests. We argue that any claims of synchronic patterns between cultural variables should be tested for spurious correlations, with the kinds of approaches used in this paper. However, experiments or case-studies would be more fruitful avenues for future research on this specific topic, rather than further large-scale cross-cultural correlational studies.
Dong, Yajie
2017-02-01
Quantum dots (QDs) have gone through a long journey before finding their ways into the display field. This talk will briefly touch on the history before trying to answer several key questions related to QDs applications in display: What are QDs? How are they made? What properties do they have and Why? How can these properties be used to improve color and efficiency of display, in either photoluminescence (PL) or electroluminescence (EL) mode? And what are the remaining challenges for QDs wide adoption in display industry? Lastly, some most recent progresses in our UCF lab at both PL and EL fronts will be highlighted. For PL, a cadmium-free perovskite-polymer composite films with exceptionally narrow emission green peaks (FWHM 20 nm) and good water and thermal stability will be reported. Together with red quantum dots or PFS/KSF phosphors as down-converters for blue LEDs, a white-light source with 95% Rec. 2020 color gamut was demonstrated [1]. For EL, red quantum dot light emitting devices (QLEDs) with record luminance of 165,000 Cd/m2 has been obtained at a current density of 1000 mA/cm2 with a low driving voltage of 5.8 V and CIE coordinates of (0.69, 0.31). [2] The potential of using these QLEDs for light sources for integrated sensing platform [3] or high efficiency, high color quality hybrid white OLED [4] will be discussed. [1] Y. N. Wang, J. He, H. Chen, J. S. Chen, R. D. Zhu, P. Ma, A. Towers, Y. Lin, A. J. Gesquiere, S. T. Wu, Y. J. Dong. Ultrastable, Highly Luminescent Organic-Inorganic Perovskite - Polymer Composite Films, Advanced Materials, accepted, (2016). [2] Y. J. Dong, J.M. Caruge, Z. Q. Zhou, C. Hamilton, Z. Popovic, J. Ho, M. Stevenson, G. Liu, V. Bulovic, M. Bawendi, P. T. Kazlas, S. Coe-Sullivan, and J. Steckel Ultra-bright, Highly Efficient, Low Roll-off Inverted Quantum-Dot Light Emitting Devices (QLEDs). SID Symp. Dig. Tech. Pap. 46, 270-273 (2015). [3] J. He, H. Chen, S. T. Wu, and Y. J. Dong, Integrated Sensing Platform Based on Quantum
Approximate Dispersion Relations for Waves on Arbitrary Shear Flows
Ellingsen, S. À.; Li, Y.
2017-12-01
An approximate dispersion relation is derived and presented for linear surface waves atop a shear current whose magnitude and direction can vary arbitrarily with depth. The approximation, derived to first order of deviation from potential flow, is shown to produce good approximations at all wavelengths for a wide range of naturally occuring shear flows as well as widely used model flows. The relation reduces in many cases to a 3-D generalization of the much used approximation by Skop (1987), developed further by Kirby and Chen (1989), but is shown to be more robust, succeeding in situations where the Kirby and Chen model fails. The two approximations incur the same numerical cost and difficulty. While the Kirby and Chen approximation is excellent for a wide range of currents, the exact criteria for its applicability have not been known. We explain the apparently serendipitous success of the latter and derive proper conditions of applicability for both approximate dispersion relations. Our new model has a greater range of applicability. A second order approximation is also derived. It greatly improves accuracy, which is shown to be important in difficult cases. It has an advantage over the corresponding second-order expression proposed by Kirby and Chen that its criterion of accuracy is explicitly known, which is not currently the case for the latter to our knowledge. Our second-order term is also arguably significantly simpler to implement, and more physically transparent, than its sibling due to Kirby and Chen.Plain Language SummaryIn order to answer key questions such as how the ocean surface affects the climate, erodes the coastline and transports nutrients, we must understand how waves move. This is not so easy when depth varying currents are present, as they often are in coastal waters. We have developed a modeling tool for accurately predicting wave properties in such situations, ready for use, for example, in the complex oceanographic computer models. Our
Treatment responses in adult depressive patients treated with ...
African Journals Online (AJOL)
with dexamethasone/corticotrophin-releasing hormone. Lina Zhang1*, Yanbo Chen2, ... Keywords: stress, depressive patients, hormonal response, hormonal dysregulation, sertraline, ..... interactions in depression: will cause inform cure. Mol.
77 FR 28880 - Ocean Transportation Intermediary License Applicants
2012-05-16
... (NVO & OFF), 332 Hindry Avenue, Inglewood, CA 90301, Officers: Edison Chen, Manager (Qualifying..., Schiller Park, IL 60176, Officers: Scott A. Case, Vice President (Qualifying Individual), Thomas C. Case...
Update on the Purdue University 2-second Drop Tower
Collicott, Steven
A small drop tower of approximately one second drop duration was built in the School of Aero-nautics and Astronautics at Purdue University beginning in 1998 and operated until summer 2007. This inexpensive tower in an old airplane hanger, was built largely by Yongkang Chen, now a Research Professor at Portland State University in Oregon, USA. In about 7 years of operations, the tower generated sufficient science results for Chen's PhD thesis[1] (summarized in three AIAA Journal papers[2-4]), Fitzpatrick's MS thesis[5], two industry projects for since-canceled advanced rodent habitats for ISS, and one project for NASA Marshall. In addition to the science use, Purdue undergraduate students designed, built, and performed simpler fluids experiments for their own career advancement, including a novel investigation of the impact of imperfect repeatability of initial conditions on a zero-g fluids experiment. The tower was also used for outreach to school children. It is most satisfying that Chen's PhD research in this small tower, and subsequent discussions and interactions, helped Weislogel to propose the two Vane Gap tests in his highly successful Capillary Fluids Experiment (CFE) in the International Space Station in 2006 and 2007[6]. Chen as been involved in the remodeling of these two Vane Gap cylinders for subsequent re-launch to ISS for a second round of experiments expected in 2010 and 2011. In August 2007 the School of Aeronautics and Astronautics at Purdue University moved into the new Neil Armstrong Hall of Engineering and construction on a new 2-second drop tower began. A vertical shaft of nearly 23 meters was designed into the building. An approximately 80 m2 general-use fluids lab is at the top level, and a small access room of approximately 9 m2 is at the bottom. However, construction of the new $57M building created only the space for the science facility, not the science facility itself. The science facility is under construction and this paper presents
Mapping scientific frontiers : the quest for knowledge visualization.
Energy Technology Data Exchange (ETDEWEB)
Boyack, Kevin W.
2003-08-01
Visualization of scientific frontiers is a relatively new field, yet it has a long history and many predecessors. The application of science to science itself has been undertaken for decades with notable early contributions by Derek Price, Thomas Kuhn, Diana Crane, Eugene Garfield, and many others. What is new is the field of information visualization and application of its techniques to help us understand the process of science in the making. In his new book, Chaomei Chen takes us on a journey through this history, touching on predecessors, and then leading us firmly into the new world of Mapping Scientific Frontiers. Building on the foundation of his earlier book, Information Visualization and Virtual Environments, Chen's new offering is much less a tutorial in how to do information visualization, and much more a conceptual exploration of why and how the visualization of science can change the way we do science, amplified by real examples. Chen's stated intents for the book are: (1) to focus on principles of visual thinking that enable the identification of scientific frontiers; (2) to introduce a way to systematize the identification of scientific frontiers (or paradigms) through visualization techniques; and (3) to stimulate interdisciplinary research between information visualization and information science researchers. On all these counts, he succeeds. Chen's book can be broken into two parts which focus on the first two purposes stated above. The first, consisting of the initial four chapters, covers history and predecessors. Kuhn's theory of normal science punctuated by periods of revolution, now commonly known as paradigm shifts, motivates the work. Relevant predecessors outside the traditional field of information science such as cartography (both terrestrial and celestial), mapping the mind, and principles of visual association and communication, are given ample coverage. Chen also describes enabling techniques known to information
Indian Academy of Sciences (India)
Chen Xingyuan Lorraine, University of California, Berkeley, United States ... Das Kaushik, Bengal Engineering and Science University, Kolkata de Boyer ..... Samborska Katarzyna, Institute for Ecology of Industrial Areas, Katowice, Poland.
Hung, Tran Loc; Giang, Le Truong
2016-01-01
Using the Stein-Chen method some upper bounds in Poisson approximation for distributions of row-wise triangular arrays of independent negative-binomial distributed random variables are established in this note.
Full Text Available ... Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...
Full Text Available ... Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...
Energy Technology Data Exchange (ETDEWEB)
Wang, Shi-bing, E-mail: wang-shibing@dlut.edu.cn, E-mail: wangxy@dlut.edu.cn [School of Computer and Information Engineering, Fuyang Normal University, Fuyang 236041 (China); Faculty of Electronic Information and Electrical Engineering, Dalian University of Technology, Dalian 116024 (China); Wang, Xing-yuan, E-mail: wang-shibing@dlut.edu.cn, E-mail: wangxy@dlut.edu.cn [Faculty of Electronic Information and Electrical Engineering, Dalian University of Technology, Dalian 116024 (China); Wang, Xiu-you [School of Computer and Information Engineering, Fuyang Normal University, Fuyang 236041 (China); Zhou, Yu-fei [College of Electrical Engineering and Automation, Anhui University, Hefei 230601 (China)
2016-04-15
With comprehensive consideration of generalized synchronization, combination synchronization and adaptive control, this paper investigates a novel adaptive generalized combination complex synchronization (AGCCS) scheme for different real and complex nonlinear systems with unknown parameters. On the basis of Lyapunov stability theory and adaptive control, an AGCCS controller and parameter update laws are derived to achieve synchronization and parameter identification of two real drive systems and a complex response system, as well as two complex drive systems and a real response system. Two simulation examples, namely, ACGCS for chaotic real Lorenz and Chen systems driving a hyperchaotic complex Lü system, and hyperchaotic complex Lorenz and Chen systems driving a real chaotic Lü system, are presented to verify the feasibility and effectiveness of the proposed scheme.
How Managers Sense and Seize “Hyped” Technologies
DEFF Research Database (Denmark)
Schiele, Kristen; Rydén, Pernille
A rapid proliferation of online consumer review systems has become common in diverse industries, such as tourism (Xiang and Gretzel 2010), box office movies (Duan, Gu, andWhinston 2008; Dellarocas, Zhang and Awad 2007), online books (Chevalier and Mayzlin 2006;Chen, Wu, and Yoon 2004), and video ...... (Dellarocas 2003), and the popularity of online reviews has increased acknowledgement of the potential of social media to provide the organization with information, resources, and networks (Constantinides and Fountain 2008).......A rapid proliferation of online consumer review systems has become common in diverse industries, such as tourism (Xiang and Gretzel 2010), box office movies (Duan, Gu, andWhinston 2008; Dellarocas, Zhang and Awad 2007), online books (Chevalier and Mayzlin 2006;Chen, Wu, and Yoon 2004), and video...
Important contributions of M.C. Wang and C.S. Wang Chang to non-equilibrium statistical physics
International Nuclear Information System (INIS)
Liu Jixing
2004-01-01
In the middle of the 20th century two Chinese women physicists, Ming-Chen Wang and Cheng-Shu Wang Chang made great contributions to statistical physics. The famous review article 'On the theory of the Brownian motion II' by Ming-Chen Wang and G.E. Uhlenbeck published in Rev. of Mod. Phys. in 1945 provided a complete scientific classification of stochastic processes which is still adopted by the scientific community as the standard classification. The Wang-Chang-Uhlenbeck (WCU) equation proposed jointly by C.S. Wang-Chang and Uhlenbeck became the fundamental kinetic equation for the treatment of transport properties of multi-atomic gases with internal degrees of freedom in the physics literature. These important scientific contributions are analyzed and reviewed
Directory of Open Access Journals (Sweden)
Cole G Easson
Full Text Available Marine diseases are of increasing concern for coral reef ecosystems, but often their causes, dynamics and impacts are unknown. The current study investigated the epidemiology of Aplysina Red Band Syndrome (ARBS, a disease affecting the Caribbean sponge Aplysina cauliformis, at both the individual and population levels. The fates of marked healthy and ARBS-infected sponges were examined over the course of a year. Population-level impacts and transmission mechanisms of ARBS were investigated by monitoring two populations of A. cauliformis over a three year period using digital photography and diver-collected data, and analyzing these data with GIS techniques of spatial analysis. In this study, three commonly used spatial statistics (Ripley's K, Getis-Ord General G, and Moran's Index were compared to each other and with direct measurements of individual interactions using join-counts, to determine the ideal method for investigating disease dynamics and transmission mechanisms in this system. During the study period, Hurricane Irene directly impacted these populations, providing an opportunity to assess potential storm effects on A. cauliformis and ARBS.Infection with ARBS caused increased loss of healthy sponge tissue over time and a higher likelihood of individual mortality. Hurricane Irene had a dramatic effect on A. cauliformis populations by greatly reducing sponge biomass on the reef, especially among diseased individuals. Spatial analysis showed that direct contact between A. cauliformis individuals was the likely transmission mechanism for ARBS within a population, evidenced by a significantly higher number of contact-joins between diseased sponges compared to random. Of the spatial statistics compared, the Moran's Index best represented true connections between diseased sponges in the survey area. This study showed that spatial analysis can be a powerful tool for investigating disease dynamics and transmission in a coral reef ecosystem.
Saleh, F.; Ramaswamy, V.; Wang, Y.; Georgas, N.; Blumberg, A.; Pullen, J.
2017-12-01
Estuarine regions can experience compound impacts from coastal storm surge and riverine flooding. The challenges in forecasting flooding in such areas are multi-faceted due to uncertainties associated with meteorological drivers and interactions between hydrological and coastal processes. The objective of this work is to evaluate how uncertainties from meteorological predictions propagate through an ensemble-based flood prediction framework and translate into uncertainties in simulated inundation extents. A multi-scale framework, consisting of hydrologic, coastal and hydrodynamic models, was used to simulate two extreme flood events at the confluence of the Passaic and Hackensack rivers and Newark Bay. The events were Hurricane Irene (2011), a combination of inland flooding and coastal storm surge, and Hurricane Sandy (2012) where coastal storm surge was the dominant component. The hydrodynamic component of the framework was first forced with measured streamflow and ocean water level data to establish baseline inundation extents with the best available forcing data. The coastal and hydrologic models were then forced with meteorological predictions from 21 ensemble members of the Global Ensemble Forecast System (GEFS) to retrospectively represent potential future conditions up to 96 hours prior to the events. Inundation extents produced by the hydrodynamic model, forced with the 95th percentile of the ensemble-based coastal and hydrologic boundary conditions, were in good agreement with baseline conditions for both events. The USGS reanalysis of Hurricane Sandy inundation extents was encapsulated between the 50th and 95th percentile of the forecasted inundation extents, and that of Hurricane Irene was similar but with caveats associated with data availability and reliability. This work highlights the importance of accounting for meteorological uncertainty to represent a range of possible future inundation extents at high resolution (∼m).
Directory of Open Access Journals (Sweden)
Antonio João Carvalho Ribeiro
2017-06-01
Full Text Available Um estudo experimental do processamento psicolinguístico de metáforas nominais do português brasileiro (X é um Y, p. ex., “Irene é um furacão”, foi realizado com o objetivo de evidenciar, a partir de tempos de leitura (RTs, a compreensão de expressões familiares, high-apt (“bem construídas” e cujo veículo se acha convencionalizado. Na primeira fase da pesquisa, realizaram-se dois norming studies (“estudos normativos” com vistas ao ranqueamento de metáforas nominais (p. ex. “Algumas mulheres são furacões” em relação a familiaridade, aptness (“adequação” e convencionalidade. Na segunda fase da pesquisa, um experimento de leitura automonitorada (self-paced, non-cumulative, moving-window reading foi conduzido, recorrendo, para a composição dos estímulos, às metáforas, p. ex., “Irene é um furacão”, que alcançaram, nos estudos normativos da primeira fase, ratings (ou “classificações” de “muito familiares”, “very high-apt’’ e “altamente convencionalizadas”. Evidências do português brasileiro em favor do processamento direto de metáforas foram obtidas, conforme preconiza o modelo de Class-inclusion, de Glucksberg e Keysar (1990, pois não se revelaram diferenças significativas entre os RTs médios nas três condições: “metáfora”, “literal” e “declaração literal de inclusão em classe”, em contraposição aos achados de Janus e Bever (1985, que observaram tempos de leitura de metáforas novas significativamente maiores do que os de expressões literais, conforme as predições do Modelo Pragmático Padrão de processamento indireto.
2012-08-29
... Furniture Co., Ltd. Zhangjiagang Zheng Yan Decoration Co., Ltd. Zhangjiang Sunwin Arts & Crafts Co., Ltd.... Trendex Industries Limited Wan Bao Chen Group Hong Kong Co., Ltd. World Design International Co., Ltd...
Novel alleles of 31-bp VNTR polymorphism in the human ...
Indian Academy of Sciences (India)
Author Affiliations. Yik-Yuen Gan1 Chuan-Fei Chen1. Natural Sciences and Science Education, National Institute of Education, Nanyang Technological University, 1 Nanyang Walk, Singapore 637616, Republic of Singapore ...
Full Text Available ... Living with SCI Personal Experiences by Topic Resources Peer ... Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...
Indian Academy of Sciences (India)
Journal of Earth System Science wishes to place on record the valuable ... Chen Xun-Hong, University of Nebraska-Lincoln, Nebraska, United States ... Dasgupta Somnath, Indian Institute of Science Education and Research, Kolkata.
COMPOSITION OF THE JOINT ADVISORY APPEALS BOARDS 2000/2001 EXERCISE
Human Resources Division
2001-01-01
Appointed by the Director-General Appointed by the Staff Association Members Fréderick Bordry /sl Irene Seis/it 1st deputies Christian Fabjan/ep Jean-Claude Carlier/tis 2nd deputies Sue Foffano Morna Robillard/hr Mr Bordry and Mrs Seis have drawn up the following list of staff members from among whom the Chairman of the Board may be chosen when required: Christophe Delamare/est Guy Maurin/ep Maria Dimou/it Mats Moller/as Tobias Dobers/est Alasdair smith/ep Luc Durieu/ps Marilena Streit-Bianchi/tis Lennart Jirden/spl John Poole/sl Mediators [see Administrative Circular N° 6 (Rev. 1) entitled 'Review procedure'] will also be selected from this list of ten staff members.
AtCCX1 transports Na + and K + in Pitch pastoris | Chen | African ...
African Journals Online (AJOL)
Compartmentation of Na+ into vacuoles is an important way for cells to avoid the toxic effects of salt. Here, Arabidopsis AtCCX1 was studied in Pitch pastoris GS115. Yeast expressing AtCCX1 grew better in high H+ concentration medium and high salt medium than original strain and increased Na+ accumulation and ...
Directory of Open Access Journals (Sweden)
Chen Z
2013-10-01
Full Text Available Zhipeng Chen,* Juan Chen,* Li Wu, Weidong Li, Jun Chen, Haibo Cheng, Jinhuo Pan, Baochang CaiDepartment of Pharmacy, Nanjing University of Chinese Medicine, Nanjing, People's Republic of China*These authors contributed equally to this workObjective: To evaluate the potential of hyaluronic acid (HA-coated bovine serum albumin nanoparticles (BSANPs as a novel chondrocyte-targeting drug-delivery nanomedicine.Methods: The HA-BSANPs were characterized by dynamic light scattering, transmission electron microscopy, differential scanning calorimetry, and X-ray diffraction. Fluorescence imaging was used to visualize the distribution of nanoparticles after intra-articular injection. The chondrocyte-targeting efficiency and cellular uptake mechanism of HA-BSANPs were investigated using endocytic inhibitors.Results: HA-BSANPs were successfully prepared with HA coating the surface and amorphous drug in the core. Compared with BSANPs, HA-BSANPs exhibited improved uptake by chondrocytes through a receptor-mediated active uptake mechanism. The endocytosis process of BSANPs and HA-BSANPs involved clathrin-mediated endocytosis, caveolae-mediated endocytosis, and macropinocytosis. No apparent thickening or hyperplasia of the synovium was observed in either BSANPs or HA-BSANPs. The HA-BSANPs could reside in the articular cavity of rats for more than 14 days, which was significantly longer than BSANPs.Conclusion: HA-BSANPs are a promising carrier for articular-related diseases due to elongated articular residence and improved chondrocytic accumulation.Keywords: chondrocyte, intra-articular injection, hyaluronic acid, BSA, nanoparticles
Jung, Jaewook; Kim, Jiye; Choi, Younsung; Won, Dongho
2016-08-16
In wireless sensor networks (WSNs), a registered user can login to the network and use a user authentication protocol to access data collected from the sensor nodes. Since WSNs are typically deployed in unattended environments and sensor nodes have limited resources, many researchers have made considerable efforts to design a secure and efficient user authentication process. Recently, Chen et al. proposed a secure user authentication scheme using symmetric key techniques for WSNs. They claim that their scheme assures high efficiency and security against different types of attacks. After careful analysis, however, we find that Chen et al.'s scheme is still vulnerable to smart card loss attack and is susceptible to denial of service attack, since it is invalid for verification to simply compare an entered ID and a stored ID in smart card. In addition, we also observe that their scheme cannot preserve user anonymity. Furthermore, their scheme cannot quickly detect an incorrect password during login phase, and this flaw wastes both communication and computational overheads. In this paper, we describe how these attacks work, and propose an enhanced anonymous user authentication and key agreement scheme based on a symmetric cryptosystem in WSNs to address all of the aforementioned vulnerabilities in Chen et al.'s scheme. Our analysis shows that the proposed scheme improves the level of security, and is also more efficient relative to other related schemes.
Directory of Open Access Journals (Sweden)
Tun-Pin Hsueh
2016-12-01
Full Text Available Artemisia capillaries Thunb, Gardenia jasminoides Ellis, and Rheum officinale Baill have been combined to treat jaundice for thousands of years. Studies have revealed that these herbs induce anti-hepatic fibrosis and anti-hepatic apoptosis and alleviate hepatic oxidative stress. This study aims to determine the quality and quantity of an herbal formulation (Chinese name: Yin-Chen-Hao-Tang using physical and chemical examinations. Physical examination of Yin-Chen-Hao-Tang in pharmaceutical herbal products, raw fiber powders, and decoction preparations was performed using Congo red and iodine-potassium staining. A sensitive and validated method employing ultra-high-performance liquid chromatography tandem mass spectrometry (UHPLC-MS/MS was developed to simultaneously quantify the bioactive compounds scoparone, geniposide, and rhein in the Yin-Chen-Hao-Tang formulation in different preparations. Physical examination indicated that cellulose fibers with irregular round shapes were present in the pharmaceutical herbal products. The developed UHPLC-MS/MS method showed good linearity and was well validated. The quantification results revealed that the decoction preparations had the highest amounts of geniposide and rhein. Scoparone appeared in pharmaceutical herbal products from two manufacturers. This experiment provides a qualitative and quantitative method using physical and chemical examinations to test different preparations of herbal products. The results provide a reference for clinical herbal product preparations and further pharmacokinetic research.
1,6-Diaminoperylene bisimide with a highly twisted perylene core
Indian Academy of Sciences (India)
... KEW-YU CHEN. ∗. Department of Chemical Engineering, Feng Chia University, 40724 Taichung, Taiwan, Republic of China ... chromic materials,6 and organic field-effect transis- ..... Wasielewski M R 2012 Competition between singlet fis-.
African Journals Online (AJOL)
Andries du Toit
11 Chen, et al Mainstreaming informal Employment and Gender (2004). 12 Svendsen Work (2008) at 3. ...... In the workplace, other than changes in ..... Philip K Second economy strategy: addressing inequality and economic marginalisation.
Full Text Available ... Injury Medical Expert Videos Topics menu Topics Preventing Pressure Sores Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to Home ...
THE AGINCOURT FIELD SITE - EVOLUTION AND CURRENT ...
African Journals Online (AJOL)
teaching, research and practice since C C Chen's impressive efforts at the ... HSDU tended to emphasise human resource development, for example ... innovative subdistrict and health centre programmes could be ... Agincourt Study Area. Fig.
Full Text Available ... Medical Experts People Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...
Full Text Available ... Medical Experts People Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...
Full Text Available ... Medical Experts People Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...
Directory of Open Access Journals (Sweden)
M. Sandtner
Full Text Available The article shows that the computer-aided, analogous-visual, stereometric interpretation of large-scale colour-infrared (CIR aerial photographs and subsequent data processing in a Geographical Information System (GIS can provide fundamental data necessary to describe aspects of urban ecology in a scale relevant for city-planning. This is exemplified by an evaluation of urban areas concerning their climates and airpollution using maps of urban surfaces (scale1:2500. An argumentation relying on such detailed and current basic data can stress the importance of environmental aspects in contrast to competing public and private interests in the process of city planning.
Pramana – Journal of Physics | Indian Academy of Sciences
Indian Academy of Sciences (India)
dimensional coupled double-distribution-function lattice Boltzmann models for compressible Navier–Stokes equations. RUO-FAN QIU YAN-CHENG YOU CHENG-XIANG ZHU RONG-QIAN CHEN JIAN-FENG ZHU. Research Article Volume 89 Issue ...
... P. Caulfield, Jay Wohlgemuth, Zhizong Chen, Robert Superko, Charles M. Rowland, Robert J. Glynn, Paul M. Ridker, ... See Less Ask a Laboratory Scientist Your questions will be answered by a laboratory scientist as part ...
On synchronization of three chaotic systems
International Nuclear Information System (INIS)
Yan Jianping; Li Changpin
2005-01-01
In this paper, a simple but efficient method is applied to the synchronization of three chaotic systems, i.e., the chaotic Lorenz, Chua, and Chen systems. Numerical simulations show this method works very well
Proceedings – Mathematical Sciences | Indian Academy of Sciences
Indian Academy of Sciences (India)
dimensional stochastic Navier–Stokes equations in the presence of delays. The results extend some of the existing results. Author Affiliations. Huabin Chen1. Department of Mathematics, School of Science, Nanchang University, Nanchang 330031, ...
Effect of demographic variables on public attitudes towards ...
African Journals Online (AJOL)
Jane
2011-09-30
Sep 30, 2011 ... 5Faculty of Social Sciences and Humanities, Universiti Kebangsaan Malaysia, 43600 UKM, Bangi, ..... race formulates a cultural/social network. .... Macer D, Chen Ng MA (2000). Changing Attitudes to Biotechnology in. Japan.
Synthesis, characterization and photocatalytic reactions of ...
Indian Academy of Sciences (India)
The methods used usually include various surface modifi- cations. Several ... In recent years, innovative solid catalysts have been prepared ... post-treatment with phosphoric acid (Clesla et al 1996; Chen .... The ammonia adsorption was ca-.
2012-03-06
..., 1995). Chance or stochastic events have occurred in the range of M. viminea, and may continue to make M.... 2010; Chen et al. 2011). Scientists are projecting possible impacts and responses of ecological systems...
... sugar test Genetic testing Lactic acid blood test Triglyceride level Uric acid blood test If a person ... 45. Kishnani PS, Chen Y-T. Defects in metabolism of carbohydrates. In: Kliegman RM, Stanton BF, St. ...
Clinical targeting recombinant immunotoxins for cancer therapy
Directory of Open Access Journals (Sweden)
Li M
2017-07-01
Full Text Available Meng Li,1,* Zeng-Shan Liu,1,* Xi-Lin Liu,1,* Qi Hui,2,* Shi-Ying Lu,1 Lin-Lin Qu,1 Yan-Song Li,1 Yu Zhou,1 Hong-Lin Ren,1 Pan Hu1 1Key Laboratory of Zoonosis Research, Ministry of Education, Institute of Zoonosis, College of Veterinary Medicine, China-Japan Union Hospital, The First Hospital, Jilin University, Changchun, 2School of Pharmacy, Wenzhou Medical University, Wenzhou, People’s Republic of China *These authors contributed equally to this work Abstract: Recombinant immunotoxins (RITs are proteins that contain a toxin fused to an antibody or small molecules and are constructed by the genetic engineering technique. RITs can bind to and be internalized by cells and kill cancerous or non-cancerous cells by inhibiting protein synthesis. A wide variety of RITs have been tested against different cancers in cell culture, xenograft models, and human patients during the past several decades. RITs have shown activity in therapy of several kinds of cancers, but different levels of side effects, mainly related to vascular leak syndrome, were also observed in the treated patients. High immunogenicity of RITs limited their long-term or repeat applications in clinical cases. Recent advances in the design of immunotoxins, such as humanization of antibody fragment, PEGylation, and modification of human B- and T-cell epitopes, are overcoming the above mentioned problems, which predict the use of these immunotoxins as a potential therapeutic method to treat cancer patients. Keywords: targeted therapy, hematologic malignancies, solid tumors, vascular leak syndrome, immunogenicity
Flows and stochastic Taylor series in Itô calculus
Ebrahimi-Fard, Kurusch; Malham, Simon J. A.; Patras, Frédéric; Wiese, Anke
2015-12-01
For general stochastic systems driven by continuous semimartingales an explicit formula for the logarithm of the Itô flow map is given. The computation relies on the lift to quasi-shuffle algebras of formulas involving products of Itô integrals of semimartingales. Whereas the Chen-Strichartz formula computing the logarithm of the Stratonovich flow map is classically expanded as a formal sum indexed by permutations, the analogous formula in Itô calculus is naturally indexed by surjections. This reflects the change of algebraic background involved in the transition between the two integration theories. Lastly, we extend our formula for the quasi-shuffle Chen-Strichartz series for the logarithm of the flow map to the non-commutative case. For linear matrix-valued SDEs driven by arbitrary semimartingales we obtain a similar formula.
The antileishmanial agent licochalcone A interferes with the function of parasite mitochondria
DEFF Research Database (Denmark)
Zhai, L; Blom, J; Chen, M
1995-01-01
. Khrazmi, Antimicrob. Agents Chemother. 38:1339-1344, 1994) and antimalarial (M. Chen, T.G. Theander, S.B. Christensen, L. Hviid, L. Zhai, and A. Kaharazmi, Antimicrob. Agents Chemother. 38:1470-1475, 1994) activities. We have observed that licochalcone A alters the ultrastructure of the mitochondria...... of Leishmania promastigotes (Chen et al., Antimicrob. Agents Chemother. 37:2550-2556, 1993). The present study was designed to examine this observation further and investigate the mechanism of action of antileishmanial activity of licochalcone A. Electron microscopic studies showed that licochalcone A altered...... of the parasite by the parasites. Moreover, licochalcone A inhibited the activity of the parasite mitochondrial dehydrogenase. The inhibition of the activity of the parasite mitochondrial enzyme correlated well with the changes in the ultrastructure of the mitochondria shown by electron microscopy. These findings...
Chen, Yu-Hsin
2012-10-01
When exceeding the critical power Pcr, an intense laser pulse propagating in a gas collapses into one or multiple ``filaments,'' which can extend meters in length with weakly ionized plasma and local intensity ˜ 10^13 W/cm^2 radially confined in a diameter of 1995).[0pt] [2] A. Couairon and A. Mysyrowicz, Phys. Rep. 441, 47 (2007).[0pt] [3] V. Loriot et al., Opt. Express 17, 13429 (2009).[0pt] [4] P. B'ejot et al., Phys. Rev. Lett. 104, 103903 (2010).[0pt] [5] Y.-H. Chen et al., Opt. Express 15, 7458 (2007); Opt. Express 15, 11341 (2007).[0pt] [6] J. K. Wahlstrand et al., Phys. Rev. Lett. 107, 103901 (2011).[0pt] [7] Y.-H. Chen et al., Phys. Rev. Lett. 105, 215005 (2010).
Directory of Open Access Journals (Sweden)
Gonzalo Sánchez-Molero, José Luis
2010-01-01
Full Text Available Desde 2007 la Biblioteca Histórica Marqués de Valdecilla conserva un ejemplar del Geka seiso, un libro xilográfico japonés impreso en el siglo XVIII. Su título original chino es Waik'o Cheng Tsung, o Método ortodoxo de la cirugía, en español. Esta tratado médico fue escrito al inicio del siglo anterior por Chen Shih-kung, o Chen Shigong, (c. 1555-1636, y en 1791 fue editado de nuevo en Japón por el médico imperial Ogino Gengai (1737-1806. Este ejemplar complutense proviene de la colección de Francisco Guerra Pérez-Carral. En este artículo se estudian tres aspectos del Geka seiso, en un orden cronológico inverso. Primero, su adquisición por el doctor Guerra, quien lo compró en Miami (1990, procedente el volumen de la colección del doctor norteamericano Otto Orren Fisher. A continuación se analiza el contenido de esta obra, publicada por vez primera en 1611, en China. En ella su autor (Chen Shigong incluyó sus famosos preceptos profesionales y éticos: Los cinco mandamientos y las diez exigencias. Por último se estudian, por un lado, las circunstancias históricas de esta edición en 1791, relacionada probablemente con el proceso político de restauración de los estudios Chu Hsi, y por otro lado el proceso técnico de su impresión, realizado en Kyoto por Hayashi Gonbe, Hayashi Ihe y Takemura Kahe. Finalmente se describen y comentan algunas de las características materiales de este ejemplar del Geka seiso, para su mejor comprensión por un lector occidental.Since 2007, the Historical Library "Marqués de Valdecilla" preserves a copy of Geka seiso, a Japanese blockbook printed in the eighteenth century. Its original title Chinese is Waik'o Cheng Tsung, or Orthodox method of surgery, in English. This medical treatise was written at the beginning of the previous century by Chen Shih-kung, or Chen Shigong, (c. 1555-1636, and in 1791 was printed again in Japan by the imperial doctor Gengai Ogino (1737-1806. This complutense copy
Isolation and identification of two galangin metabolites from rat urine ...
African Journals Online (AJOL)
Isolation and identification of two galangin metabolites from rat urine and determination of their in vitro hypolipidemic activity. Xuguang Zhang, Shouqian Cheng, Hailong Li, Xiaopo Zhang, Feng Chen, Youbin Li, Junqing Zhang, Yinfeng Tan ...
Probability to produce animal vaccines in insect baculovirus ...
African Journals Online (AJOL)
Administrator
2011-09-07
Sep 7, 2011 ... The insect baculovirus expression system is a valuable tool for the production of vaccine. .... vaccine expression/delivery vehicle (Yu-Chen et al., ... baculoviruses are applied in cell-based assays for drug ... Intramuscular.
Hong et al., Afr J Tradit Complement Altern Med. (2013) 10(4):66-69 ...
African Journals Online (AJOL)
AJTCAM
inflammation, annex inflammation, uterine prolapse, and neurasthenia. .... Research progress on pharmacological effects of Bidens bipinnata L. China Pharmacy. ... Clinic. 24 (3): 147-149. 8. Wang, Q., Zhang Y.N., Chen F.H. (2009). Research ...
Full Text Available ... Topic Resources Peer Counseling Blog About Media Donate Spinal Cord Injury Medical Expert Videos Topics menu Topics Sex and Fertility After Spinal Cord Injury Adult Injuries Spinal Cord Injury 101 David Chen, ...
Bulletin of Materials Science | Indian Academy of Sciences
Indian Academy of Sciences (India)
Author Affiliations. Xiaoming Liao1 Hongyang Zhu1 Guangfu Yin1 Zhongbing Huang1 Yadong Yao1 Xianchun Chen1. College of Materials Science and Engineering, Sichuan University, Chengdu 610064, P.R. of China ...
Genetics Home Reference: isobutyryl-CoA dehydrogenase deficiency
... An Y, Weavil SD, Chaing SH, Bali D, McDonald MT, Kishnani PS, Chen YT, Millington DS. Rare ... 10 All Bulletins Features What is direct-to-consumer genetic testing? What are genome editing and CRISPR- ...
Genetics Home Reference: short-chain acyl-CoA dehydrogenase deficiency
... An Y, Weavil SD, Chaing SH, Bali D, McDonald MT, Kishnani PS, Chen YT, Millington DS. Rare ... 10 All Bulletins Features What is direct-to-consumer genetic testing? What are genome editing and CRISPR- ...
... are different styles of t'ai chi, including: Chen style Hao (or Wu Shi) style Hu Lei ... medical advice, diagnoses, and treatment, consult your doctor. © 1995- The Nemours Foundation. All rights reserved. Images provided ...
... through the middle Truncus arteriosus References Fraser CD, Kane LC. Congenital heart disease. In: Townsend CM Jr, ... 62. Review Date 10/17/2017 Updated by: Michael A. Chen, MD, PhD, Associate Professor of Medicine, ...
Total anomalous pulmonary venous return
... pulmonary venous return, x-ray References Fraser CD, Kane LC. Congenital heart disease. In: Townsend CM Jr, ... 62. Review Date 10/17/2017 Updated by: Michael A. Chen, MD, PhD, Associate Professor of Medicine, ...
Laser Enhanced System for Ultra-Fine Microstructure Formation
National Research Council Canada - National Science Library
Chen, Ray T
2002-01-01
.... High-speed polymer-based EO modulator arrays and polymer-based optical true-time delay modules have been built through the existing programs involving UT Austin (Chen), USC (Steier), UCLA (Fetterman) and Univ. of Washington (Dalton...
Eesti jääb tugevaks, kui jätkab valitud teel / Irene Mia
Mia, Irene
2005-01-01
Maailma Majandusfoorumi analüütiku hinnangul jääb Eesti ka järgmistel aastatel maailma kõige konkurentsivõimelisemate riikide hulka, kui ta jätkab sama teed. Väla on toodud ka parandamist vajavad valdkonnad. Lisa: Eesti koht 2004. aastal majanduskasvu indeksis