WorldWideScience

Sample records for linlin irene chen

  1. H CHEN

    Indian Academy of Sciences (India)

    Home; Journals; Bulletin of Materials Science. H CHEN. Articles written in Bulletin of Materials Science. Volume 41 Issue 2 April 2018 pp 51. Effect of oxygen vacancies on Li-storage of anatase TiO 2 (001) facets: a first principles study · H CHEN Y H DING X Q TANG W ZHANG J R YIN P ZHANG Y JIANG · More Details ...

  2. Chen Hengzhe

    DEFF Research Database (Denmark)

    Gimpel, Denise

    been the first to write children’s literature. In 1914 she was among the first group of women to gain a Boxer Indemnity grant to study in America. The reiteration of these many “firsts” has led to a rather stereotypical portrait of Chen Hengzhe in Chinese sources and, as a result, in most Western...

  3. Lutheri loft / Irene Roos

    Index Scriptorium Estoniae

    Roos, Irene

    2008-01-01

    Tallinnas Lutheri kvartalis läbi kahe korruse paiknevast näidiskorterist. Sisustajad Irene Roos ja Ester Penjam. Paekiviseina kasutati sisustuselemendina, Philipsi valgustid jagasid ruumi eri tsoonideks. 9 värv. ill

  4. Chen Hengzhe

    DEFF Research Database (Denmark)

    Gimpel, Denise

    Chen Hengzhe has been celebrated as China’s first female professor, first professor of Western history, first person to publish a history of the West that was not a translation into Chinese. She is moreover celebrated as one of the first to write fiction and poetry in the vernacular and to have......; they speak to important questions in China today. This study, then, is not a biography of a person; it is an attempt to understand the way in which foreign influences (narratives of being, organizing, thinking, writing) seep into a person’s life and work and meld with the “home” influences (narratives...

  5. Irene Vichou (1964 - 2016)

    CERN Multimedia

    2016-01-01

    It was with great sadness that we learnt that Irene Vichou, our much appreciated ATLAS colleague, had passed away in April after an illness.   Irene started work at CERN as a PhD student of the University of Athens with the West Area Omega experiment. From 1993, she worked with the ATLAS LAr calorimeter group from LAL Orsay, participating in calorimeter prototype beam tests and doing ATLAS’s first full simulation of photon and electron identification by calorimeters. In 1996, Irene joined the ATLAS Tile calorimeter community, and was a very active member of the collaboration from then on, initially working with the IFAE Barcelona team. She was involved in the first prototypes of caesium radioactive source calibration systems, optimising the optical uniformity of the Tile calorimeter. In the year 2000, Irene joined the University of Athens team at ATLAS. She worked on commissioning an important test bench to qualify the 10,000 photo-multiplier blocks assembled for the ATLAS Tile calorime...

  6. Hurricane Irene Poster (August 27, 2011)

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Hurricane Irene poster. Color composite GOES image shows Irene moving through the North Carolina Outer Banks on August 27, 2011. Poster size is 36"x27"

  7. Chen's inversion formula

    International Nuclear Information System (INIS)

    Hughes, B.D.; Frankel, N.E.; Ninham, B.W.

    1990-01-01

    An alternative view is presented of the Chen's generalization of a formula of classic algebraic number theory, based on the Mellin transformation and Reimann's zeta function. The advantages of the Mellin transform, as a method with a primary role in asymptotic analysis, are outlined. 10 refs

  8. Horseshoes in modified Chen's attractors

    International Nuclear Information System (INIS)

    Huang Yan; Yang Xiaosong

    2005-01-01

    In this paper we study dynamics of a class of modified Chen's attractors, we show that these attractors are chaotic by giving a rigorous verification for existence of horseshoes in these systems. We prove that the Poincare maps derived from these modified Chen's attractors are semi-conjugate to the 2-shift map

  9. Pension Fund - ELECTIONS - Irene SEIS

    CERN Document Server

    2002-01-01

    CERN - EUROPEAN ORGANIZATION FOR NUCLEAR RESEARCH PENSION FUND   This candidature has been duly registered and is hereby presented in accordance with paragraph 6.h of the Regulations for Elections to the Governing Board of the Pension Fund. Candidate: Name: SEIS First Name : Irene Our Pension Fund (that of CERN and ESO personnel) is for most of us the only social protection when we retire. Its purpose is to give us a pension, which permits to maintain a certain standard of living for us, and for our dependants. I have worked in the Governing Board of the Pension Fund, as well as in numerous working groups on pension matters, since 11 years, either in my role as a Staff Association delegate, or as a member of the Governing Board. In both environments, I defend the principles of solidarity, which are part of our social security system, and I stand up for maintaining its primary principle, being a defined benefit scheme. Another of my preoccupations is the long-term future of the fund, including the gu...

  10. Kodumaine ja nooruslik / Piret Veigel, Irene Roos

    Index Scriptorium Estoniae

    Veigel, Piret, 1961-

    2003-01-01

    Arhitekt Vahur Sova projekteeritud ökomaja eeskujul kujundatud elutuba. Värvivalik on inspireeritud looduse sügistalvistest toonidest ja naturaalsetest materjalidest. Stilistid Piret Veigel ja Irene Roos. Vineerkapi on kujundanud Tarmo Luisk, laua Jan J. Graps, sirmi Igor Volkov

  11. Current status of the IREN project

    International Nuclear Information System (INIS)

    Furman, W.I.

    1997-01-01

    A current status and a corrected time-schedule of the project of the new Intense Resonance Neutron pulsed source (IREN) realized in JINR (Dubna) for experiments dealing with fundamental and applied nuclear physics studies are discussed. This source is the upgraded variant of the existing IBR-30 pulsed booster. It consists of the 200 MeV electron linac and supplying by an electron beam the photo-neutron converter placed in the center of the very fast multiplying subcritical core. The existing buildings and beam infrastructure are planned to adopt for the new IREN source. The aim of the project is to improve essentially an energy resolution of the time-of-flight spectrometer and to increase twice (up to 10 15 n/sec) an integral neutron yield. An implementation of the IREN project has started in June 1994 with the planned end in December 1997. But due to mainly insufficient financing the approved time-schedule is shifted. Now most optimistic time of start-up of the neutron source is the end of 1999

  12. Irene Merik 80 : avara kultuuritunnetusega kodu-uurija / Eva Maaring

    Index Scriptorium Estoniae

    Maaring, Eva

    2011-01-01

    1987. aastast on Irene Merik Tallinna Linnamuuseumi kodu-uurimisringi ja Eesti Muinsuskaitse Seltsi, 1989. aastast Eestirootslaste Kultuuri Seltsi liige. Juubilar on uurinud eelkõige Tallinna ajalugu

  13. Mechanical analysis of Chen chaotic system

    International Nuclear Information System (INIS)

    Liang, Xiyin; Qi, Guoyuan

    2017-01-01

    The Chen chaotic system is transformed into Kolmogorov type system, which is decomposed into four types of torques: inertial torque, internal torque, dissipation and external torque. By the combinations of different torques, five cases are studied to discover key factors of chaos generation and the physical meaning. The conversion among Hamiltonian energy, kinetic energy and potential energy is investigated in these five cases. The relationship between the energies and the parameters is studied. It concludes that the combination of these four types of torques is necessary conditions to produce chaos, and any combination of three types of torques cannot produce chaos in Chen system.

  14. Dr. Irene Sänger-Bredt, a life for astronautics

    Science.gov (United States)

    Zaganescu, Nicolae-Florin

    2004-12-01

    Irene Bredt (b.1911 at Bonn) obtained her Doctorate in Physics in 1937; in the same year she became a scientific researcher at the German Research Center for Aviation at Trauen, led by Prof. Dr. Eugen Sänger. Soon, the young but efficient Dr. Irene Bredt became the first assistant of Dr. Sänger, who married her (1951). During 1973-1978, Dr. Bredt was in correspondence with Prof. Dr. Nikolae-Florin Zaganescu and helped him to familiarize the Romanian readers with Prof. Sänger's life and achievements. As for Dr. Bredt's life, she specified three main periods of her activity: 1937-1942, when she was researcher in charge of thermodynamic problems of liquid-fuelled rocket engines at Trauen 1942-1945, when she was Senior Researcher in charge of Ramjet in flight performances at Ainring, and also coauthored the Top Secret Technical report entitled 'A Rocket Engine for a Long-Range Bomber', which was finished in 1941 but edited only in 1944 the post world war II period, when she was Scientific Advisor or Director at various civil and military research institutes, universities, etc. Dr. Irene Sänger-Bredt helped her husband to develop many scientific theories like Ramjet thermodynamic theory, and photon rocket theory and also in establishing IAF and IAA. In 1970, Dr. Irene Sänger-Bredt was honored with 'Hermann Oberth Gold Medal' for her impressive scientific activity.

  15. Hurricane Irene: a Wake Up Call for New York City?

    NARCIS (Netherlands)

    Aerts, J.C.J.H.; Botzen, W.J.W.

    2012-01-01

    The weakening of Irene from a Category 3 hurricane to a tropical storm resulted in less damage in New York City (NYC) than initially was anticipated. It is widely recognized that the storm surge and associated flooding could have been much more severe. In a recent study, we showed that a direct hit

  16. Immunogenicity of novel sulfadimethoxide conjugates | Chen ...

    African Journals Online (AJOL)

    Immunogenicity of novel sulfadimethoxide conjugates. L Chen, J Su, X Zhang, L Li, X He. Abstract. Sulfadimethoxine (SDM) is an antibiotic commonly added to animal feeds. Anti-SDM antibodies are useful for the detection of residual SDM in foods, feeds and biological fluids by ELISA. In this study, we show that SDM is ...

  17. Titanisierung von Implantatoberflächen

    Science.gov (United States)

    Zimmermann, Hanngörg; Heinlein, Markus; Guldner, Norbert W.

    Titan gilt seit Jahrzehnten als einer der wichtigsten Implantatwerkstoffe in der Medizin. Neben den guten mechanischen Eigenschaften (Leichtigkeit, hohe Festigkeit etc.), besitzen Titanimplantate vor allem eine hervorragende Körperverträglichkeit, so dass die Implantate optimal in den humanen Organismus integriert werden [1]. Ist jedoch aufgrund der Anforderungen an das Implantat eine hohe Flexibilität und/ oder Elastizität gefragt, so scheidet der Werkstoff Titan aufgrund seiner spröden und unflexiblen Materialeigenschaften aus. Die Folge ist der Einsatz von Implantatmaterialien, sowohl künstlichen als auch biologischen Ursprungs, welche nicht selten eine unzureichende Biokompatibilität aufweisen und somit zu Fremdköper- und immunologischen Reaktionen und Einkapselung des Implantates führen können. Die Erhöhung der Körperverträglichkeit, eine Adaption an das biologische Umfeld und eine hohe Biokompatibilität sind demzufolge die wichtigsten Eigenschaften bei der bedarfsgerechten Herstellung von Implantaten und Implantatoberflächen. Zur Gestaltung von innovativen, biokompatiblen Oberflächen stehen unterschiedliche technische Lösungsansätze zur Verfügung. Zum einen besteht die Möglichkeit, geeignete Oberflächeneigenschaften aus dem Grundmaterial selbst zu optimieren. Dies geschieht unter anderem durch Modifikation der Werkstoffoberflächen in Form von Texturierungen und Oberflächenrauhigkeiten. Zum anderen können die Oberflächeneigenschaften unabhängig von denen des Trägermaterials gestaltet werden. Durch Funktionalisierung der Oberflächen mit geeigneten Beschichtungen oder der Zugabe von Medikamenten (Drug Eluting) werden die Kunststoffimplantate dahingehend verändert, dass eine Steigerung der Körperakzeptanz erreicht wird. Die Titanbeschichtung von Implantatoberflächen kombiniert die positiven Materialeigenschaften von Titan und Polymer.

  18. Marie and Irene Curie. The first female Nobel Prize winners; Marie en IreneCurie. De eerste vrouwelijke Nobelprijswinnaars

    Energy Technology Data Exchange (ETDEWEB)

    Noordenbos, G. [Joke Smit Instituut voor Vrouwenstudies, Universiteit Leiden, Leiden (Netherlands)

    2003-07-01

    Marie Curie was awarded the Nobel Prize in 1903 and in 1911. Also her daughter, Irene Joliot-Curie, received a Nobel Prize for science in 1935. In this book an overview is given of the academic world at that time: limited access to universities for women, the carriers of both women in physics and their pioneering research and discoveries, the refusal of Marie Curie by the French Academy of Sciences, the awarding of the Nobel Prize and the assignment of Irene Joliot-Curie as the first female minister in France, the impact of the two World Wars, their married and private lives and the constant smear campaign of the press against both women. The lives and works of both women are hold against the light of the present position of women in physical sciences. [Dutch] In 1903, precies honderd jaar geleden, ontving Marie Curie als eerste vrouw de Nobelprijs voor de Wetenschap, gevolgd door een tweede Nobelprijs in 1911. Ook haar dochter Irene Joliot-Curie kreeg de Nobelprijs voor de wetenschap in 1935. Marie and Irene Curie schetst een breed beeld van de academische wereld waarin beide vrouwen zich bewogen: de beperkte toegang van vrouwen tot de universiteit, hun carrisres in de natuurkunde en baanbrekende ontdekkingen, de afwijzing van Marie door de Franse Academie des Sciences, de toekenning van de Nobelprijs en de benoeming van Irene als eerste vrouwelijke minister in Frankrijk, de invloed van de twee Wereldoorlogen, hun huwelijks- en priveleven en de niet aflatende hetze van de pers tegen beiden. In de door mannen gedomineerde wereld van de natuurwetenschappen liep de uitzonderingspositie van beide vrouwen als rode draad door hun curieuze levens. Het leven en werk van de Curies wordt geactualiseerd door deze tegen het licht te houden van de huidige positie van vrouwen in de natuurwetenschappen. Het bereiken van de top van de wetenschap door vrouwen blijkt nog steeds uitzonderlijk.

  19. Chaos control of Chen chaotic dynamical system

    International Nuclear Information System (INIS)

    Yassen, M.T.

    2003-01-01

    This paper is devoted to study the problem of controlling chaos in Chen chaotic dynamical system. Two different methods of control, feedback and nonfeedback methods are used to suppress chaos to unstable equilibria or unstable periodic orbits (UPO). The Lyapunov direct method and Routh-Hurwitz criteria are used to study the conditions of the asymptotic stability of the steady states of the controlled system. Numerical simulations are presented to show these results

  20. Impulsive synchronization of Chen's hyperchaotic system

    International Nuclear Information System (INIS)

    Haeri, Mohammad; Dehghani, Mahsa

    2006-01-01

    In this Letter the impulsive synchronization of the Chen's hyperchaotic systems is discussed. Some new and sufficient conditions on varying impulsive distance are established in order to guarantee the synchronizabillity of the systems using the synchronization method. In particular, some simple conditions are derived in synchronizing the systems by equal impulsive distances. Two illustrative examples are provided to show the feasibility and the effectiveness of the proposed method. The boundaries of the stable regions are also estimated

  1. Tropical storm Irene flood of August 2011 in northwestern Massachusetts

    Science.gov (United States)

    Bent, Gardner C.; Olson, Scott A.; Massey, Andrew J.

    2016-09-02

    A Presidential disaster was declared in northwestern Massachusetts, following flooding from tropical storm Irene on August 28, 2011. During the storm, 3 to 10 inches of rain fell on soils that were susceptible to flash flooding because of wet antecedent conditions. The gage height at one U.S. Geological Survey streamgage rose nearly 20 feet in less than 4 hours because of the combination of saturated soils and intense rainfall. On August 28, 2011, in the Deerfield and Hoosic River Basins in northwestern Massachusetts, new peaks of record were set at six of eight U.S. Geological Survey long-term streamgages with 46 to 100 years of record. Additionally, high-water marks were surveyed and indirect measurements of peak discharge were calculated at two discontinued streamgages in the Deerfield and Hoosic River Basins with 24 and 61 years of record, respectively. This data resulted in new historic peaks of record at the two discontinued streamgages from tropical storm Irene.

  2. Future neutron data activity on the neutron source IREN

    International Nuclear Information System (INIS)

    Janeva, N.B.; Koyumdjieva, N.T.; Grigoriev, Y.V.; Gundorin, N.A.; Mareev, Y.D.; Kopatch, Y.N.; Pikelner, L.B.; Shvetsov, V.N.; Sedyshev, P.V.; Zeinalov, S.; Ruskov, I.N.

    2011-01-01

    The global energy demand continues to rise and nuclear power has a potential to be part of the solution of energy problem. Complete and accurate information about the nuclear reactions ensures developing and operating nuclear reactors to reach high efficiencies and adequate safety standards. This demands many nuclear data of improved quality, including covariance nuclear data and correlations. The new neutron source IREN (1 stage) has been put in operation at the end of 2009. The first stage includes the construction of the LUE-200 linear accelerator and non multiplying target. The first measured TOF spectra have been presented recently. The facility is in continuous completion and improvement (according to the full version in the project). The program for neutron data investigation on the IREN neutron source is in preparation. The measuring targets for neutron cross-sections TOF spectra would be selected between isotopes of construction materials, fission products and minor actinides. Now the experimental facilities are in preparation - detectors, innovative electronics equipment and systems for data acquisition and analysis. (authors)

  3. Stability analysis of distributed order fractional chen system.

    Science.gov (United States)

    Aminikhah, H; Refahi Sheikhani, A; Rezazadeh, H

    2013-01-01

    We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results.

  4. Stability Analysis of Distributed Order Fractional Chen System

    Science.gov (United States)

    Aminikhah, H.; Refahi Sheikhani, A.; Rezazadeh, H.

    2013-01-01

    We first investigate sufficient and necessary conditions of stability of nonlinear distributed order fractional system and then we generalize the integer-order Chen system into the distributed order fractional domain. Based on the asymptotic stability theory of nonlinear distributed order fractional systems, the stability of distributed order fractional Chen system is discussed. In addition, we have found that chaos exists in the double fractional order Chen system. Numerical solutions are used to verify the analytical results. PMID:24489508

  5. Adaptive synchronization of hyperchaotic Chen system with uncertain parameters

    International Nuclear Information System (INIS)

    Park, Ju H.

    2005-01-01

    This article addresses control for the chaos synchronization of hyperchaotic Chen system with five uncertain parameters. Based on the Lyapunov stability theory, an adaptive control law is derived to make the states of two identical hyperchaotic Chen systems asymptotically synchronized. Finally, a numerical simulations is presented to show the effectiveness of the proposed chaos synchronization scheme

  6. Chaos in the fractional order Chen system and its control

    International Nuclear Information System (INIS)

    Li Chunguang; Chen Guanrong

    2004-01-01

    In this letter, we study the chaotic behaviors in the fractional order Chen system. We found that chaos exists in the fractional order Chen system with order less than 3. The lowest order we found to have chaos in this system is 2.1. Linear feedback control of chaos in this system is also studied

  7. Complete synchronization of two Chen-Lee systems

    International Nuclear Information System (INIS)

    Sheu, L-J; Chen, J-H; Chen, H-K; Tam, L-M; Lao, S-K; Chen, W-C; Lin, K-T

    2008-01-01

    This study demonstrates that complete synchronization of two Chen-Lee chaotic systems can be easily achieved. The upper bound of the Chen-Lee chaotic system is estimated numerically. A controller is designed to synchronize two chaotic systems. Sufficient conditions for synchronization are obtained using Lyapunov's direct method. Two numerical examples are presented to verify the proposed synchronization approach

  8. Physical startup of the first stage of the IREN facility

    International Nuclear Information System (INIS)

    Belozerov, A.V.; Boettcher, Yu.; Bulycheva, Yu.K.

    2010-01-01

    It is reported on the startup of the first stage of the Intense REsonance Neutron source installation (IREN) at the Frank Laboratory of Neutron Physics of the Joint Institute for Nuclear Research. The general scheme and current status of the electron linear accelerator with accelerating structure on an S-band traveling wave (f = 2856 MHz) are presented. Results of adjustment of the basic functional systems of the linac and the measured parameters of the beam (pulse current of the beam 1.5 A, electron energy 30 MeV; duration of a pulse current 100 ns; rep. rate 25 Hz) are reported. The integral neutron yield from a nonmultiplying target reaches (3-5)·10 10 s -1

  9. Dynamics of the chemical composition of rainwater throughout Hurricane Irene

    Directory of Open Access Journals (Sweden)

    K. M. Mullaugh

    2013-03-01

    Full Text Available Sequential sampling of rainwater from Hurricane Irene was carried out in Wilmington, NC, USA on 26 and 27 August 2011. Eleven samples were analyzed for pH, major ions (Cl−, NO3−, SO42−, Na+, K+, Mg2+, Ca2+, NH4+, dissolved organic carbon (DOC and hydrogen peroxide (H2O2. Hurricane Irene contributed 16% of the total rainwater and 18% of the total chloride wet deposition received in Wilmington NC during all of 2011. This work highlights the main physical factors influencing the chemical composition of tropical storm rainwater: wind speed, wind direction, back trajectory and vertical mixing, time of day and total rain volume. Samples collected early in the storm, when winds blew out of the east, contained dissolved components indicative of marine sources (salts from sea spray and low DOC. The sea-salt components in the samples had two maxima in concentration during the storm the first of which occurred before the volume of rain had sufficiently washed out sea salt from the atmosphere and the second when back trajectories showed large volumes of marine surface air were lifted. As the storm progressed and winds shifted to a westerly direction, the chemical composition of the rainwater became characteristic of terrestrial storms (high DOC and NH4+ and low sea salt. This work demonstrates that tropical storms are not only responsible for significant wet deposition of marine components to land, but terrestrial components can also become entrained in rainwater, which can then be delivered to coastal waters via wet deposition. This study also underscores why analysis of one composite sample can lead to an incomplete interpretation of the factors that influence the chemically divergent analytes in rainwater during extreme weather events.

  10. A simple observer of the generalized Chen chaotic systems

    International Nuclear Information System (INIS)

    Sun, Y.-J.

    2009-01-01

    In this paper, the generalized Chen chaotic system is considered and the state observation problem of such a system is investigated. Based on the time-domain approach, a simple observer for the generalized Chen chaotic system is proposed to guarantee the global exponential stability of the resulting error system. Furthermore, the guaranteed exponential convergence rate can be correctly estimated. Finally, a numerical example is provided to illustrate the use of the main result.

  11. Comparing numerical methods for the solutions of the Chen system

    International Nuclear Information System (INIS)

    Noorani, M.S.M.; Hashim, I.; Ahmad, R.; Bakar, S.A.; Ismail, E.S.; Zakaria, A.M.

    2007-01-01

    In this paper, the Adomian decomposition method (ADM) is applied to the Chen system which is a three-dimensional system of ODEs with quadratic nonlinearities. The ADM yields an analytical solution in terms of a rapidly convergent infinite power series with easily computable terms. Comparisons between the decomposition solutions and the classical fourth-order Runge-Kutta (RK4) numerical solutions are made. In particular we look at the accuracy of the ADM as the Chen system changes from a non-chaotic system to a chaotic one. To highlight some computational difficulties due to a high Lyapunov exponent, a comparison with the Lorenz system is given

  12. The age grading and the Chen-Ruan cup product

    DEFF Research Database (Denmark)

    A. Hepworth, Richard

    2010-01-01

    We prove that the obstruction bundle used to define the cup-product in Chen-Ruan cohomology is determined by the so-called `age grading' or `degree-shifting numbers'. Indeed, the obstruction bundle can be directly computed using the age grading. We obtain a Kunneth Theorem for Chen-Ruan cohomology...... as a direct consequence of an elementary property of the age grading, and explain how several other results - including associativity of the cup-product - can be proved in a similar way....

  13. On a conjecture of Chen-Guo-Wang

    OpenAIRE

    Ning, Bo; Zheng, Yu

    2015-01-01

    Towards confirming Sun's conjecture on the strict log-concavity of combinatorial sequence involving the n$th$ Bernoulli number, Chen, Guo and Wang proposed a conjecture about the log-concavity of the function $\\theta(x)=\\sqrt[x]{2\\zeta(x)\\Gamma(x+1)}$ for $x\\in (6,\\infty)$, where $\\zeta(x)$ is the Riemann zeta function and $\\Gamma(x)$ is the Gamma function. In this paper, we first prove this conjecture along the spirit of Zhu's previous work. Second, we extend Chen et al.'s conjecture in the ...

  14. An equilibrium point stabilization strategy for the Chen system

    International Nuclear Information System (INIS)

    Alvarez-Ramirez, Jose; Cevantes, Ilse; Femat, Ricardo

    2004-01-01

    The aim of this Letter is to address the equilibrium point stabilization problem of the Chen system by employing a simple linear feedback controller derived from time-scaling the dynamics of a single variable. The controller has the advantage of being easy to implement and a rigorous stability proof is provided based on singular perturbation arguments. Results are illustrated via numerical simulations

  15. Dynamics of fractional-ordered Chen system with delay

    Indian Academy of Sciences (India)

    Though this subject has a history of more than 300 years, utility and applicability of fractional calculus to various branches of science and engineering have been real- ... variants of Chen system and see the qualitative changes in attractor and ...

  16. Generalized projective synchronization between Lorenz system and Chen's system

    International Nuclear Information System (INIS)

    Li Guohui

    2007-01-01

    On the basis of active backstepping design, this paper presents the generalized projective synchronization between two different chaotic systems: Lorenz system and Chen's system. The proposed method combines backstepping methods and active control without having to calculate the Lyapunov exponents and the eigenvalues of the Jacobian matrix, which makes it simple and convenient. Numerical simulations show that this method works very well

  17. Alternative implementation of the chaotic Chen-Lee system

    International Nuclear Information System (INIS)

    Sheu, L.-J.; Tam, L.-M.; Chen, H.-K.; Lao, S.-K.

    2009-01-01

    The chaotic Chen-Lee system was developed with a formalism based on the Euler equations for the motion of a rigid body. It was proved that this system is the governing set of equations for gyro motion with feedback control. Recently, studies were conducted to explore the dynamic behavior of this system, including fractional order behavior, the generation of hyperchaos and perturbation analysis, control and anti-control of chaos, synchronization, etc. In this study, we further explore (1) the stability of the equilibrium points and (2) the implementation of an electronic circuit using the Chen-Lee system. It is shown that not only is this system related to gyro motion but can also be applied to electronic circuits for encryption purposes.

  18. Chaos synchronization between Chen system and Genesio system

    International Nuclear Information System (INIS)

    Wu Xianyong; Guan Zhihong; Wu Zhengping; Li Tao

    2007-01-01

    This Letter presents two synchronization schemes between two different chaotic systems. Active control synchronization and adaptive synchronization between Chen system and Genesio system are studied, different controllers are designed to synchronize the drive and response systems, active control synchronization is used when system parameters are known; adaptive synchronization is employed when system parameters are unknown or uncertain. Simulation results show the effectiveness of the proposed schemes

  19. Two wives in science service: Marie Curie and Irene Joliot-Curie

    International Nuclear Information System (INIS)

    Bordry, M.

    1996-01-01

    This paper relates the life and the scientific works of Marie Curie and of her daughter Irene Joliot-Curie in their historical context. Several details are given about their laboratory works, their relations with students, the creation of the Radium Institute and the role they played during the two world wars. The progress of their works towards their main scientific discoveries (polonium, radium, artificial radioactivity, transuranium compounds etc..) is illustrated with some extracts of their personal correspondence with relatives. The paper evokes also the Nobel prices received by Pierre and Marie Curie and by Irene and Frederic Joliot and the creation of the CEA by Frederic Joliot in 1946. (J.S.). 6 photos

  20. Intense resonance neutron source (IREN) - new pulsed source for nuclear physical and applied investigations

    International Nuclear Information System (INIS)

    Anan'ev, V.D.; Furman, W.I.; Kobets, V.V.; Meshkov, I.N.; Pyataev, V.G.; Shirkov, G.D.; Shvets, V.A.; Sumbaev, A.P.; Kuatbekov, R.P.; Tret'yakov, I.T.; Frolov, A.R.; Gurov, S.M.; Logachev, P.V.; Pavlov, V.M.; Skarbo, B.A.

    2005-01-01

    An accelerator-driven subcritical system (200 MeV electron linac + metallic plutonium subcritical core) IREN is constructed at the Joint Institute for Nuclear Research (JINR). The new pulsed neutron source IREN is optimized for maximal yield of resonance neutrons (1-10 5 eV). The S-band electron linac with a pulse duration near 200 ns, repetition rate up to 150 Hz and the mean beam power 10 kW delivers 200-MeV electrons onto a specially designed tungsten target (an electron-neutron converter) situated in the center of a very compact and fast subcritical assembly with K eff 15 per second. A mean fission power of the multiplying target is planned to be near 15 kW. The current status of the project is presented

  1. Source, conveyance and fate of suspended sediments following Hurricane Irene. New England, USA

    Science.gov (United States)

    Yellen, Brian; Woodruff, Jon D.; Kratz, Laura N.; Mabee, Steven B.; Morrison, Jonathan; Martini, Anna M.

    2014-01-01

    Hurricane Irene passed directly over the Connecticut River valley in late August, 2011. Intense precipitation and high antecedent soil moisture resulted in record flooding, mass wasting and fluvial erosion, allowing for observations of how these rare but significant extreme events affect a landscape still responding to Pleistocene glaciation and associated sediment emplacement. Clays and silts from upland glacial deposits, once suspended in the stream network, were routed directly to the mouth of the Connecticut River, resulting in record-breaking sediment loads fifteen-times greater than predicted from the pre-existing rating curve. Denudation was particularly extensive in mountainous areas. We calculate that sediment yield during the event from the Deerfield River, a steep tributary comprising 5% of the entire Connecticut River watershed, exceeded at minimum 10–40 years of routine sediment discharge and accounted for approximately 40% of the total event sediment discharge from the Connecticut River. A series of surface sediment cores taken in floodplain ponds adjacent to the tidal section of the Connecticut River before and after the event provides insight into differences in sediment sourcing and routing for the Irene event compared to periods of more routine flooding. Relative to routine conditions, sedimentation from Irene was anomalously inorganic, fine grained, and enriched in elements commonly found in chemically immature glacial tills and glaciolacustrine material. These unique sedimentary characteristics document the crucial role played by extreme precipitation from tropical disturbances in denuding this landscape.

  2. [Professor CHEN Xiuhua's experience in the treatment of atopic dermatitis].

    Science.gov (United States)

    Quan, Xiaohong; Li, Shuqian; Li, Ying

    2017-03-12

    Professor CHEN Xiuhua 's clinical experiences were introduced in the intervention on atopic dermatitis with external therapies of TCM acupuncture. On the basis of the theory as cultivating the earth and clearing the heart from professor CHEN Dacan and in terms of the disease stages and skin lesion characteristics, as well as in consideration of syndrome differen-tiation, the acupoints for strengthening the spleen and clearing heart fire are selected, such as Zhongwan (CV 12), Daheng (SP 15), Shuifen (CV 9), Tianshu (ST 25), Neiguan (PC 6) and Quchi (LI 11). For the repair of skin lesion, the integration of Chinese and western medicine is used, with the internal application and external use of Chinese herbal medicines involved. The topical ointments are selected rationally. The self-blood therapy is used with acupuncture, bleeding therapy and acupoint injection applied in combination on the basis of the theory of TCM zangfu organs and modern immunological mechanism, which stimulates the nonspecific immune response in the body and strengthens acupoint stimulus effects. Medical thread therapy of Guangxi Zhuang medicine is used in moxibustion for skin damage, which effectively stops itching and promotes wound healing and skin repair.

  3. Brief communication "Hurricane Irene: a wake-up call for New York City?"

    Directory of Open Access Journals (Sweden)

    J. C. J. H. Aerts

    2012-06-01

    Full Text Available The weakening of Irene from a Category 3 hurricane to a tropical storm resulted in less damage in New York City (NYC than initially was anticipated. It is widely recognized that the storm surge and associated flooding could have been much more severe. In a recent study, we showed that a direct hit to the city from a hurricane may expose an enormous number of people to flooding. A major hurricane has the potential to cause large-scale damage in NYC. The city's resilience to flooding can be increased by improving and integrating flood insurance, flood zoning, and building code policies.

  4. Eine praktische Anwendung von CMC-Flächen in der Bionik

    OpenAIRE

    Apeltauer, Christian

    2011-01-01

    Die vorliegende Arbeit beschäftigt sich mit den theoretischen Grundlagen für die Entwicklung von Oberflächen, die unter Wasser möglichst lange eine Luftschicht an sich halten können. Ein natürliches Vorbild für solche Oberflächen ist die Pflanze Salvinia molesta; technisch interessieren solche Oberflächen zur Verringerung des Wasserwiderstandes von Schiffen und als Schutz vor Besiedlung durch Wasserorganismen. Wichtigste Gleichung bei der Entwicklung solcher Oberflächen ist...

  5. Tropospheric Ozone Climatology over Irene, South Africa, From 1990-1994 and 1998-2002

    Science.gov (United States)

    Diab, R. D.; Thompson, A. M.; Marl, K.; Ramsay, L.; Coetzee, G. J. R.

    2004-01-01

    This paper describes ozone profiles from sonde data during the period of NASA s TRACE-A and the more recent SHADOZ (Southern Hemisphere Additional Ozonesondes) period. The data were taken by the South African Weather Service at the Irene (25 deg.54 min S; 28 deg. 13 min. E) station near Pretoria, South Africa, an area that is a unique mixture of local industry, heavy biofuels use and importation of biomass burning ozone from neighboring countries to the north. The main findings are: (1) With its geographical position at the edge of the subtropical transition zone, mid- latitude dynamical influences are evident at Irene, predominantly in winter when upper tropospheric ozone is enhanced as a result of stratospheric-tropospheric exchange. (2) There has been an increase in the near-surface ozone amount between the early 1990s and a decade later, presumably due to an influx of rural population toward the Johannesburg-Pretoria area, as well as with industrial growth and development. (3) Most significant for developing approaches for satellite ozone profile climatologies, cluster analysis has enabled the delineation of a background and "most polluted" profile. Enhancements of at least 30% occur throughout the troposphere in spring and in certain layers increases of 100 % are observed.

  6. How Memory Is Tested Influences What Is Measured: Reply to Wyble and Chen (2017)

    Science.gov (United States)

    Swallow, Khena M.; Jiang, Yuhong V.; Tan, Deborah H.

    2017-01-01

    In this response to Wyble and Chen's (2017) commentary on attribute amnesia, we hope to achieve several goals. First, we clarify how our view diverges from that described by Wyble and Chen. We argue that because the surprise memory test is disruptive, it is an insensitive tool for measuring the persistence of recently attended target attributes in…

  7. Forecasting Jakarta composite index (IHSG) based on chen fuzzy time series and firefly clustering algorithm

    Science.gov (United States)

    Ningrum, R. W.; Surarso, B.; Farikhin; Safarudin, Y. M.

    2018-03-01

    This paper proposes the combination of Firefly Algorithm (FA) and Chen Fuzzy Time Series Forecasting. Most of the existing fuzzy forecasting methods based on fuzzy time series use the static length of intervals. Therefore, we apply an artificial intelligence, i.e., Firefly Algorithm (FA) to set non-stationary length of intervals for each cluster on Chen Method. The method is evaluated by applying on the Jakarta Composite Index (IHSG) and compare with classical Chen Fuzzy Time Series Forecasting. Its performance verified through simulation using Matlab.

  8. Review of the genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae) with description of two new species.

    Science.gov (United States)

    Chang, Zhi-Min; Yang, Lin; Zhang, Zheng-Guang; Chen, Xiang-Sheng

    2015-12-11

    Two new species of the issid genus Neotetricodes Zhang et Chen (Hemiptera: Fulgoromorpha: Issidae): Neotetricodes longispinus Chang et Chen sp. nov. (China: Yunnan) and Neotetricodes xiphoideus Chang et Chen sp. nov. (China: Yunnan) are described and illustrated. The generic characteristic is redefined. A checklist and key to the species of the genus are provided. The female genitalia of the genus are firstly described.

  9. Ülehomme on õpetajate päev - milline oli teie parim õpetaja? / Toomas Edur, Tauri Tallermaa, Irene Käosaar...[jt.

    Index Scriptorium Estoniae

    2009-01-01

    Küsimusele vastavad Rahvusooper Estonia balleti kunstiline juht Toomas Edur, koolitaja Tauri Tallermaa, haridus- ja teadusministeeriumi osakonnajuhataja Irene Käosaar, Tartu Karlova Gümnaasiumi direktor Undel Kokk ja näitleja Andrus Vaarik

  10. Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe

    OpenAIRE

    Spinner, Kaspar H.

    2014-01-01

    Methodische Anregungen zu Literarischen Gesprächen in der Sekundarstufe. - In: Standardorientierung im Lese- und Literaturunterricht der Sekundarstufe I / Cornelia Rosebrock ; Heike Wirthwein. - Baltmannsweiler : Schneider-Verl. Hohengehren, 2014. - S. 126-132

  11. Sociology in Times of Crisis: Chen Da, National Salvation and the Indigenization of Knowledge

    Directory of Open Access Journals (Sweden)

    Ana Maria Candela

    2015-08-01

    Full Text Available Chen Da was one of the foremost sociologists of China from the 1920s to the 1940s. His intellectual habitus took shape from the long crisis that defined Chinese intellectual life from the mid-19th to mid-20th centuries, a period of continuous imperial assault on Chinese sovereignty. As China integrated into the capitalist world-system, neo-Confucian structures of knowledge came into question. Intellectuals took up sociology to guide China’s transition from an empire to a nation-state. Through his studies on labor, migration, and population, Chen Da contributed to the institutionalization of sociology in China. Chen sought to craft a theory of Chinese development that followed universal trajectories of progress but was also attuned to the complexity of Chinese society on the ground. Through his efforts to indigenize sociology, Chen developed a non-Marxist historical materialism, a deterritorialized and pluralistic conceptualization of China as a nation, and a theory of eugenic transformation centered on the concept of “mode of living.” The questions which Chen Da confronted are emblematic of the predicament faced by Chinese social scientists today, who again struggle with the dynamics of a deterritorialzied “Greater China,” rising social fragmentation, and refigured eugenic discourses and policies that aim to craft the Chinese people into ideal national subjects fit for post-socialist development.

  12. Hopf bifurcation analysis of Chen circuit with direct time delay feedback

    International Nuclear Information System (INIS)

    Hai-Peng, Ren; Wen-Chao, Li; Ding, Liu

    2010-01-01

    Direct time delay feedback can make non-chaotic Chen circuit chaotic. The chaotic Chen circuit with direct time delay feedback possesses rich and complex dynamical behaviours. To reach a deep and clear understanding of the dynamics of such circuits described by delay differential equations, Hopf bifurcation in the circuit is analysed using the Hopf bifurcation theory and the central manifold theorem in this paper. Bifurcation points and bifurcation directions are derived in detail, which prove to be consistent with the previous bifurcation diagram. Numerical simulations and experimental results are given to verify the theoretical analysis. Hopf bifurcation analysis can explain and predict the periodical orbit (oscillation) in Chen circuit with direct time delay feedback. Bifurcation boundaries are derived using the Hopf bifurcation analysis, which will be helpful for determining the parameters in the stabilisation of the originally chaotic circuit

  13. Synchronization and anti-synchronization coexist in Chen-Lee chaotic systems

    International Nuclear Information System (INIS)

    Chen, J.-H.; Chen, H.-K.; Lin, Y.-K.

    2009-01-01

    This study demonstrates that synchronization and anti-synchronization can coexist in Chen-Lee chaotic systems by direct linear coupling. Based on Lyapunov's direct method, a linear controller was designed to assure that two different types of synchronization can simultaneously be achieved. Further, the hybrid projective synchronization of Chen-Lee chaotic systems was studied using a nonlinear control scheme. The nonlinear controller was designed according to the Lyapunov stability theory to guarantee the hybrid projective synchronization, including synchronization, anti-synchronization, and projective synchronization. Finally, numerical examples are presented in order to illustrate the proposed synchronization approach.

  14. His Excellency Professor Jiaer Chen President, National Natural Science Foundation, People's Republic of China

    CERN Multimedia

    Maximilien Brice

    2002-01-01

    L. to r.: Dr Diether Blechschmidt, Adviser for Non Member States Relations, Dr Peter Jenni, Spokesman, ATLAS Experiment, Prof. Chen, Mr Jean-Luc Baldy, Head of the LHC Civil Engineering Group and Dr John Ellis, Adviser for Non Member States Relations.

  15. TEST OF THE CHEN-ROLL-ROSS MACROECONOMIC FACTOR MODEL: EVIDENCE FROM CROATIAN STOCK MARKET

    Directory of Open Access Journals (Sweden)

    Denis Dolinar

    2015-12-01

    Full Text Available This paper empirically examines the well-known Chen-Roll-Ross model on the Croatian stock market. Modifications of definitions of the Chen-Roll-Ross model variables showed as necessary because of doubtful availability and quality of input data needed. Namely, some macroeconomic and market variables are not available in the originally defined form or do not exist. In that sense this paper gives some alternative definitions for some model variables. Also, in order to improve statistical analysis, in this paper we have modified Fama-MacBeth technique in the way that second-pass regression was substituted with panel regression analysis. Based on the two-pass regression analysis of returns of 34 Croatian stocks on 4 macroeconomic variables during the seven-and-half-year observation period the following conclusion is made. In contrast to the results of Chen, Roll and Ross (1986 for the U.S. stock market, their model is not successful when describing a risk-return relation of Croatian stocks. Nevertheless, one observed version of the Chen-RollRoss model showed certain statistical significance. Namely, two risk factors in that version of the model were statistically significant: default premium, measured as risk premium for the corporate short-term bank loan financing, and term structure premium, measured on short-run basis.

  16. 76 FR 71048 - Sixth Annual Philip S. Chen, Jr. Distinguished Lecture on Innovation and Technology Transfer

    Science.gov (United States)

    2011-11-16

    ... present ``Treatment of Cancer with Recombinant Immunotoxins: From Technology Transfer to the Patient.'' Dr. Pastan is an NIH Distinguished Investigator and Chief, Laboratory of Molecular Biology, National Cancer Institute Center for Cancer Research. This annual series honors Dr. Philip S. Chen, Jr. for his almost 50...

  17. 180 MW/180 KW pulse modulator for S-band klystron of LUE-200 linac of IREN installation of JINR

    Science.gov (United States)

    Su, Kim Dong; Sumbaev, A. P.; Shvetsov, V. N.

    2014-09-01

    The offer on working out of the pulse modulator with 180 MW pulse power and 180 kW average power for pulse S-band klystrons of LUE-200 linac of IREN installation at the Laboratory of neutron physics (FLNP) at JINR is formulated. Main requirements, key parameters and element base of the modulator are presented. The variant of the basic scheme on the basis of 14 (or 11) stage 2 parallel PFN with the thyratron switchboard (TGI2-10K/50) and six parallel high voltage power supplies (CCPS Power Supply) is considered.

  18. Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing

    Directory of Open Access Journals (Sweden)

    Richard K. Payne

    2016-03-01

    Full Text Available Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between the expectations of the dominant religious culture and the immigrant culture in terms of the ways in which religious leaders represent themselves. Both Billy Graham and the Dalai Lama present themselves in very humble terms, consistent with the expectations of the Pietist background to American popular religion. Yogi Chen on the contrary tends toward a self-aggrandizing style, which although consistent with the competitive nature of premodern Tibetan religious culture is not congruent with the expectations of American popular religion.

  19. Parametric study of the fractional-order Chen-Lee system

    Energy Technology Data Exchange (ETDEWEB)

    Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Tou, W.M.S. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Tomas Pereira S.J., Taipa, Macau (China)

    2008-08-15

    The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q{sub 1} = q{sub 2} = q{sub 3} = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found.

  20. Parametric study of the fractional-order Chen-Lee system

    International Nuclear Information System (INIS)

    Tam, L.M.; Tou, W.M.S.

    2008-01-01

    The dynamics of fractional-order systems have attracted a great deal of attention in recent years. In this paper, the effects of parameter changes on the dynamics of the fractional-order Chen-Lee system were studied numerically. The parameter ranges used were relatively broad. The order used for the system was fixed at 2.7 (q 1 = q 2 = q 3 = 0.9). The system displays rich dynamic behaviors, such as a fixed point, periodic motion (including period-3 motion), chaotic motion, and transient chaos. The chaotic motion identified was validated by the confirmation of a positive Lyapunov exponent. Period-doubling routes to chaos in the fractional-order Chen-Lee system were also found

  1. A numeric-analytic method for approximating the chaotic Chen system

    International Nuclear Information System (INIS)

    Mossa Al-sawalha, M.; Noorani, M.S.M.

    2009-01-01

    The epitome of this paper centers on the application of the differential transformation method (DTM) the renowned Chen system which is described as a three-dimensional system of ODEs with quadratic nonlinearities. Numerical comparisons are made between the DTM and the classical fourth-order Runge-Kutta method (RK4). Our work showcases the precision of the DTM as the Chen system transforms from a non-chaotic system to a chaotic one. Since the Lyapunov exponent for this system is much higher compared to other chaotic systems, we shall highlight the difficulties of the simulations with respect to its accuracy. We wrap up our investigations to reveal that this direct symbolic-numeric scheme is effective and accurate.

  2. Review of the scientific results obtained at the research reactor-booster IBR-30 and the Program of investigations at the neutron source IREN

    CERN Document Server

    Furman, W

    2002-01-01

    Brief review of the main scientific results obtained at research reactor booster IBR-30 and its predecessor IBR and IBR-1 for the period 1960 - 2001 is presented. The thesis of the scientific program for the upgrade of IBR-30 resonance neutron source IREN are adduced

  3. Tropospheric ozone climatology at two Southern Hemisphere tropical/subtropical sites, (Reunion Island and Irene, South Africa from ozonesondes, LIDAR, and in situ aircraft measurements

    Directory of Open Access Journals (Sweden)

    G. Clain

    2009-03-01

    Full Text Available This paper presents a climatology and trends of tropospheric ozone in the Southwestern Indian Ocean (Reunion Island and South Africa (Irene and Johannesburg. This study is based on a multi-instrumental dataset: PTU-O3 ozonesondes, DIAL LIDAR and MOZAIC airborne instrumentation.

    The seasonal profiles of tropospheric ozone at Reunion Island have been calculated from two different data sets: ozonesondes and LIDAR. The two climatological profiles are similar, except in austral summer when the LIDAR profiles show greater values in the free troposphere, and in the upper troposphere when the LIDAR profiles show lower values during all seasons. These results show that the climatological value of LIDAR profiles must be discussed with care since LIDAR measurements can be performed only under clear sky conditions, and the upper limit of the profile depends on the signal strength.

    In addition, linear trends have been calculated from ozonesonde data at Reunion and Irene. Considering the whole tropospheric column, the trend is slightly positive for Reunion, and more clearly positive for Irene. Trend calculations have also been made separating the troposphere into three layers, and separating the dataset into seasons. Results show that the positive trend for Irene is governed by the lower layer that is affected by industrial pollution and biomass burning. On the contrary, for Reunion Island, the strongest trends are observed in the upper troposphere, and in winter when stratosphere-troposphere exchange is more frequently expected.

  4. Rasked vestlused. Kuidas ma talle seda ütlen / Irene Metsis, Sami Seppänen, Peep Sooman ; intervjueerinud Heli Lehtsaar

    Index Scriptorium Estoniae

    Metsis, Irene

    2009-01-01

    Skanska EMV administratsioonijuhi Irene Metsise, AS-i Elisa Eesti tegevdirektori Sami Seppäneni ja Pindi Kinnisvara juhatuse liikme Peep Soomani soovitused negatiivse sõnumi edastamiseks töötajale. Vt. samas: 4 nõuannet juhile, kuidas end keeruliseks vestluseks ette valmistada

  5. Kuidas on läinud vene koolide eestikeelsele aineõppele üleminek? / Natalja Lapikova, Vjatšeslav Gussarov, Irene Käosaar

    Index Scriptorium Estoniae

    Lapikova, Natalja

    2008-01-01

    Küsimusele vastavad Tallinna Haridusameti hariduskorralduse teenistuse üldhariduse osakonna vanemspetsialist Natalja Lapikova, Tallinna Kesklinna Vene Gümnaasiumi direktor Vjatšeslav Gussarov ja HTM-i rahvusvähemuste hariduse osakonna juhataja Irene Käosaar

  6. Software-Lösungen in B2B-Verkaufsgesprächen wirkungsvoll einsetzen

    OpenAIRE

    Thoma, Axel Michael

    2017-01-01

    Dieser Beitrag befasst sich mit dem Einsatz von Software-Lösungen in B2B-Verkaufsgesprächen (auf Englisch: Digital Sales Enablement). Anhand aktueller Beispiele aus der Geschäftswelt wird erklärt, wie solche Lösungen helfen (1) die Produktivität zu steigern, (2) Kunden zu aktivieren und (3) Neugeschäft zu entwickeln. Ebenfalls werden die Konzeption und Umsetzung solcher Lösungen behandelt.

  7. Self-Representation and Cultural Expectations: Yogi Chen and Religious Practices of Life-Writing

    OpenAIRE

    Richard K. Payne

    2016-01-01

    Explores the differences in self-representation as found in the autobiographical writings of Yogi Chen, Billy Graham, and the Dalai Lama. While the latter two are widely recognized in American popular religious culture, the former is virtually invisible outside the immigrant Chinese American community. This invisibility is consistent with fact that the religious praxes of immigrant communities remain largely under-studied. However, one additional factor appears to be the mismatch between ...

  8. Tensioned Fabric Structures with Surface in the Form of Chen-Gackstatter

    Directory of Open Access Journals (Sweden)

    Yee Hooi Min

    2016-01-01

    Full Text Available Form-finding has to be carried out for tensioned fabric structure in order to determine the initial equilibrium shape under prescribed support condition and prestress pattern. Tensioned fabric structures are normally designed to be in the form of equal tensioned surface. Tensioned fabric structure is highly suited to be used for realizing surfaces of complex or new forms. However, research study on a new form as a tensioned fabric structure has not attracted much attention. Another source of inspiration minimal surface which could be adopted as form for tensioned fabric structure is very crucial. The aim of this study is to propose initial equilibrium shape of tensioned fabric structures in the form of Chen-Gackstatter. Computational form-finding using nonlinear analysis method is used to determine the Chen-Gackstatter form of uniformly stressed surfaces. A tensioned fabric structure must curve equally in opposite directions to give the resulting surface a three dimensional stability. In an anticlastic doubly curved surface, the sum of all positive and all negative curvatures is zero. This study provides an alternative choice for structural designer to consider the Chen-Gackstatter applied in tensioned fabric structures. The results on factors affecting initial equilibrium shape can serve as a reference for proper selection of surface parameter for achieving a structurally viable surface.

  9. Ronald Malt or Chen Zhongwei: Who performed the first surgical replantation?

    Science.gov (United States)

    Fan, Ka-Wai

    2018-01-01

    This article discusses the contributions of the two pioneers of the surgical procedure of replantation-Ronald Malt in the US and Chen Zhongwei in China. Ronald Malt performed the reattachment surgery on a boy who had an accident in 1962, but he published his case report two years later in 1964. Chen Zhongwei performed a similar surgery on a worker who cut off his forearm in 1963, but he published his case report the same year. There is some debate about which one of these reputed surgeons should be given credit for being the first one to perform this breakthrough surgery, because although Malt was the first to perform the procedure, Zhongwei was the first to report it. To shed light on this controversy, criteria for scientific priority suggested by Ronald Vale and Anthony Hyman were applied. Although the criteria mainly favored Zhongwei as the pioneer of this procedure, he did not entirely fulfill one of the criteria. Therefore, the article could not present a definitive answer to the question, and it concludes by pointing out the highly commendable achievements and contributions of both Ronald Malt and Chen Zhongwei.

  10. Time budgets of Snow Geese Chen caerulescens and Ross's Geese Chen rossii in mixed flocks: Implications of body size, ambient temperature and family associations

    Science.gov (United States)

    Jonsson, J.E.; Afton, A.D.

    2009-01-01

    Body size affects foraging and forage intake rates directly via energetic processes and indirectly through interactions with social status and social behaviour. Ambient temperature has a relatively greater effect on the energetics of smaller species, which also generally are more vulnerable to predator attacks than are larger species. We examined variability in an index of intake rates and an index of alertness in Lesser Snow Geese Chen caerulescens caerulescens and Ross's Geese Chen rossii wintering in southwest Louisiana. Specifically we examined variation in these response variables that could be attributed to species, age, family size and ambient temperature. We hypothesized that the smaller Ross's Geese would spend relatively more time feeding, exhibit relatively higher peck rates, spend more time alert or raise their heads up from feeding more frequently, and would respond to declining temperatures by increasing their proportion of time spent feeding. As predicted, we found that Ross's Geese spent more time feeding than did Snow Geese and had slightly higher peck rates than Snow Geese in one of two winters. Ross's Geese spent more time alert than did Snow Geese in one winter, but alert rates differed by family size, independent of species, in contrast to our prediction. In one winter, time spent foraging and walking was inversely related to average daily temperature, but both varied independently of species. Effects of age and family size on time budgets were generally independent of species and in accordance with previous studies. We conclude that body size is a key variable influencing time spent feeding in Ross's Geese, which may require a high time spent feeding at the expense of other activities. ?? 2008 The Authors.

  11. Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation

    Energy Technology Data Exchange (ETDEWEB)

    Tam, L.M. [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)], E-mail: fstlmt@umac.mo; Chen, J.H. [Department of Mechanical Engineering, Chung Hua University, Hsinchu, Taiwan (China); Chen, H.K. [Department of Mechanical Engineering, Hsiuping Institute of Technology, Taichung, Taiwan (China); Wai Meng Si Tou [Department of Electromechanical Engineering, Faculty of Science and Technology, University of Macau, Av. Padre Thomas Pereira S.J., Taipa, Macau (China)

    2008-11-15

    A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, {epsilon}, and {omega}. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study.

  12. Security problems for a pseudorandom sequence generator based on the Chen chaotic system

    Science.gov (United States)

    Özkaynak, Fatih; Yavuz, Sırma

    2013-09-01

    Recently, a novel pseudorandom number generator scheme based on the Chen chaotic system was proposed. In this study, we analyze the security weaknesses of the proposed generator. By applying a brute force attack on a reduced key space, we show that 66% of the generated pseudorandom number sequences can be revealed. Executable C# code is given for the proposed attack. The computational complexity of this attack is O(n), where n is the sequence length. Both mathematical proofs and experimental results are presented to support the proposed attack.

  13. Generation of hyperchaos from the Chen-Lee system via sinusoidal perturbation

    International Nuclear Information System (INIS)

    Tam, L.M.; Chen, J.H.; Chen, H.K.; Wai Meng Si Tou

    2008-01-01

    A system with more than one positive Lyapunov exponent can be classified as a hyperchaotic system. In this study, a sinusoidal perturbation was designed for generating hyperchaos from the Chen-Lee chaotic system. The hyperchaos was identified by the existence of two positive Lyapunov exponents and bifurcation diagrams. The system is hyperchaotic in several different regions of the parameters c, ε, and ω. It was found that this method not only can enhance or suppress chaotic behavior, but also induces chaos in non-chaotic parameter ranges. In addition, two interesting dynamical behaviors, Hopf bifurcation and intermittency, were also found in this study

  14. Dark energy from cosmological fluids obeying a Shan-Chen non-ideal equation of state

    OpenAIRE

    Bini, Donato; Geralico, Andrea; Gregoris, Daniele; Succi, Sauro

    2014-01-01

    We consider a Friedmann-Robertson-Walker universe with a fluid source obeying a nonideal equation of state with ‘‘asymptotic freedom,’’ namely ideal gas behavior (pressure changes directly proportional to density changes) both at low and high density regimes, following a fluid dynamical model due to Shan and Chen. It is shown that, starting from an ordinary energy density component, such fluids naturally evolve towards a universe with a substantial ‘‘dark energy’’ component at the present tim...

  15. Le jeu de la création : Le mangeur (2005 de Ying Chen

    Directory of Open Access Journals (Sweden)

    Nicole Dunham

    2013-11-01

    Full Text Available Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005 de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants : le ventre du père, les tableaux peints par ce dernier et l’espace-temps de A., et la fenêtre. Ces éléments deviennent des aires de jeu, remettant en question les concepts de l’intérieur et de l’extérieur et du créateur et de l’œuvre. En nous servant du texte « Le Tunnel » écrit par Ying Chen, nous démontrerons que cette notion du jeu s’applique également à l’ensemble de son œuvre.

  16. Theoretical and experimental study of Chen chaotic system with notch filter feedback control

    International Nuclear Information System (INIS)

    Ming, Zhang Xiao; Jian-Hua, Peng; Ju-Fang, Chen

    2010-01-01

    Since the past two decades, the time delay feedback control method has attracted more and more attention in chaos control studies because of its simplicity and efficiency compared with other chaos control schemes. Recently, it has been proposed to suppress low-dimensional chaos with the notch filter feedback control method, which can be implemented in a laser system. In this work, we have analytically determined the controllable conditions for notch filter feedback controlling of Chen chaotic system in terms of the Hopf bifurcation theory. The conditions for notch filter feedback controlled Chen chaoitc system having a stable limit cycle solution are given. Meanwhile, we also analysed the Hopf bifurcation direction, which is very important for parameter settings in notch filter feedback control applications. Finally, we apply the notch filter feedback control methods to the electronic circuit experiments and numerical simulations based on the theoretical analysis. The controlling results of notch filter feedback control method well prove the feasibility and reliability of the theoretical analysis. (general)

  17. Chen Jingrun, China's famous mathematician: devastated by brain injuries on the doorstep to solving a fundamental mathematical puzzle.

    Science.gov (United States)

    Lei, Ting; Belykh, Evgenii; Dru, Alexander B; Yagmurlu, Kaan; Elhadi, Ali M; Nakaji, Peter; Preul, Mark C

    2016-07-01

    Chen Jingrun (1933-1996), perhaps the most prodigious mathematician of his time, focused on the field of analytical number theory. His work on Waring's problem, Legendre's conjecture, and Goldbach's conjecture led to progress in analytical number theory in the form of "Chen's Theorem," which he published in 1966 and 1973. His early life was ravaged by the Second Sino-Japanese War and the Chinese Cultural Revolution. On the verge of solving Goldbach's conjecture in 1984, Chen was struck by a bicyclist while also bicycling and suffered severe brain trauma. During his hospitalization, he was also found to have Parkinson's disease. Chen suffered another serious brain concussion after a fall only a few months after recovering from the bicycle crash. With significant deficits, he remained hospitalized for several years without making progress while receiving modern Western medical therapies. In 1988 traditional Chinese medicine experts were called in to assist with his treatment. After a year of acupuncture and oxygen therapy, Chen could control his basic bowel and bladder functions, he could walk slowly, and his swallowing and speech improved. When Chen was unable to produce complex work or finish his final work on Goldbach's conjecture, his mathematical pursuits were taken up vigorously by his dedicated students. He was able to publish Youth Math, a mathematics book that became an inspiration in Chinese education. Although he died in 1996 at the age of 63 after surviving brutal political repression, being deprived of neurological function at the very peak of his genius, and having to be supported by his wife, Chen ironically became a symbol of dedication, perseverance, and motivation to his students and associates, to Chinese youth, to a nation, and to mathematicians and scientists worldwide.

  18. From Leaders, For Leaders: Advice From the Lived Experience of Leaders in Community Health Sector Disaster Recovery After Hurricanes Irene and Sandy.

    Science.gov (United States)

    Craddock, Hillary A; Walsh, Lauren; Strauss-Riggs, Kandra; Schor, Kenneth

    2016-08-01

    Hurricanes Sandy and Irene damaged and destroyed homes, businesses, and infrastructure, and recovery after these storms took years. The goal of this article was to learn from the lived experience of local-level decision-makers actively involved in the long-term disaster recovery process after Hurricanes Irene and Sandy. Respondents provided professional recommendations, based on their experience, to assist other organizations in preparing for, responding to, and recovering from disasters. Semi-structured interviews were conducted with professionals actively involved in recovery from Hurricane Irene or Hurricane Sandy in 5 different communities. Transcripts were qualitatively analyzed. Respondents' advice fell into 5 main categories: planning and evaluation, education and training, fundraising and donations management, building relationships, and disaster behavioral health. The lived experience of those in disaster recovery can provide guidance for planning, education, and training both within and outside their communities in order to better respond to and recover from future disasters. These data help to facilitate a community of practice by compiling and sharing the lived experience of leaders who experienced large-scale disasters, and the outcomes of this analysis help to show what areas of planning require special attention in the phases of preparedness, response, and recovery. (Disaster Med Public Health Preparedness. 2016;10:623-630).

  19. Pitchfork bifurcation and circuit implementation of a novel Chen hyper-chaotic system

    International Nuclear Information System (INIS)

    Dong En-Zeng; Chen Zeng-Qiang; Chen Zai-Ping; Ni Jian-Yun

    2012-01-01

    In this paper, a novel four dimensional hyper-chaotic system is coined based on the Chen system, which contains two quadratic terms and five system parameters. The proposed system can generate a hyper-chaotic attractor in wide parameters regions. By using the center manifold theorem and the local bifurcation theory, a pitchfork bifurcation is demonstrated to arise at the zero equilibrium point. Numerical analysis demonstrates that the hyper-chaotic system can generate complex dynamical behaviors, e.g., a direct transition from quasi-periodic behavior to hyper-chaotic behavior. Finally, an electronic circuit is designed to implement the hyper-chaotic system, the experimental results are consist with the numerical simulations, which verifies the existence of the hyper-chaotic attractor. Due to the complex dynamic behaviors, this new hyper-chaotic system is useful in the secure communication. (general)

  20. Le jeu de la création : Le mangeur (2005) de Ying Chen

    OpenAIRE

    Nicole Dunham

    2013-01-01

    Le théoricien James Hans définit le jeu comme une déconstruction structurante, un processus de perpétuelle remise en question. Dans Le Mangeur (2005) de Ying Chen, la narratrice revit un épisode d’une de ses vies passées où elle meurt mangée, avalée, par son père, descendant dans le « tunnel » du ventre de ce dernier. Cependant, suite à cet événement, elle se retrouve dans un autre espace-temps où elle rencontre son mari, A.. Une équivalence s’établit dans le roman entre les éléments suivants...

  1. Chen-Nester-Tung quasi-local energy and Wang-Yau quasi-local mass

    Science.gov (United States)

    Liu, Jian-Liang; Yu, Chengjie

    2017-10-01

    In this paper, we show that the Chen-Nester-Tung (CNT) quasi-local energy with 4D isometric matching references is closely related to the Wang-Yau (WY) quasi-local energy. As a particular example, we compute the second variation of the CNT quasi-local energy for axially symmetric Kerr-like spacetimes with axially symmetric embeddings at the obvious critical point (0 , 0) and find that it is a saddle critical point in most of the cases. Also, as a byproduct, we generalize a previous result about the coincidence of the CNT quasi-local energy and Brown-York mass for axially symmetric Kerr-like spacetimes by Tam and the first author Liu and Tam (2016) to general spacetimes.

  2. From Wang-Chen System with Only One Stable Equilibrium to a New Chaotic System Without Equilibrium

    Science.gov (United States)

    Pham, Viet-Thanh; Wang, Xiong; Jafari, Sajad; Volos, Christos; Kapitaniak, Tomasz

    2017-06-01

    Wang-Chen system with only one stable equilibrium as well as the coexistence of hidden attractors has attracted increasing interest due to its striking features. In this work, the effect of state feedback on Wang-Chen system is investigated by introducing a further state variable. It is worth noting that a new chaotic system without equilibrium is obtained. We believe that the system is an interesting example to illustrate the conversion of hidden attractors with one stable equilibrium to hidden attractors without equilibrium.

  3. Modern process study on Chen Co and Ranwu Lake of Tibetan Plateau

    Science.gov (United States)

    Ju, J.

    2013-12-01

    Lakes are important junctions of geospheres. There are many lakes distributed on the Tibetan Plateau (TP). Lake sediment is one of the important media for retrieving the past environmental changes. Because of the uniqueness of environment of the TP, sediment, water and ecological system in lakes has local characteristic inevitably. Modern process research on different lakes will benefit interpreting the proxies more accurately. The development of observation station makes the observation and sampling more convenient. Modern process of lakes can be fulfilled in two ways, spatial or seasonal variation study, with a same aim finding out the dominant factors controlling the variations. Chen Co is a closed lake locating at inland area of southern Tibet. Ranwu Lake is an open lake locating at outflow area of SE Tibet. In this study, I studied the spatial and (or) seasonal variation of lake water and sediment in the two distinct types of lakes to make clear the mechanism of modern process. Particular attention was given to the pattern and degree of influence of rivers supplied by glaciers on lakes. Preliminary conclusions are outlined as follow: (1) In the lakes with glacier melt supplying rivers, the patterns of supply of the rivers to the lake are different. In close lake Chen Co, the influence of glacier melt is mainly reflected in the south lake area. In the open lake Ranwu Lake, the influence is comprehensive and direct. This difference influencing patterns how the lake sediments reflected the glacier melt under the past environmental changes. (2) The supply of Kaluxiong Qu River, supplied mainly by glacier melt, to Chen co has North-South difference: more directly to south lake area, reflecting by lower value of conductivity and pH, finer grain size and west to east transporting trend, greater deposition rate, more allogenic fine sediments, not obvious biological and endogenic deposition there. This enlightens the site selection for lake cores and interpretation of

  4. The impact of systematic landscape conservation planning on ecosystem: Chen Youlan river watershed

    Science.gov (United States)

    Chen, Chi-ju

    2017-04-01

    Heraclitus said that "no man ever steps in the same river twice." Everything continues to change. Land use change will keep redefine itself and subject the Earth and humankind to collateral changes. Humankind benefits from ecosystem in many ways. The ecosystem provides people with nutrients, enriches soil with sediment, and sustains all living organisms with water; these benefits are known as ecosystem services. In Taiwan, land use change has impacted ecosystem and biodiversity on various levels. Thus, we took six land use scenarios from 1999 to 2005 in Chen Youlan river watershed as our case study, intending to observe the course of ecosystem and biodiversity changes and the cause of it. Systematic Landscape conservation planning (SLCP) framework can be adopted when designing land use policy to safeguard human interests and ecosystem. This study use SLCP to develop ecosystem services and biodiversity protection strategies. Several strategies were designed by using 1999 to 2005 data as provision to protect the intactness of future ecosystem services and biodiversity. This research explores the potential and possible impacts of different land use protection strategies in the future. It is possible to identify the conservation priority of a certain region by using the Zonation meta-algorithm. This study selects the zonation critical protection area (Joint set of Yushan National Park) as strategy A, B and C. Strategy D takes Yushan National Park as a protected area; unstable hot spots in 1999/03 (Joint set of Yushan National Park) are selected as strategy E. Next, we used Kappa statistical method to find the minimal ecosystem services change and biodiversity hotspots change of the five aforementioned strategies and compared with those from 1999/03. By the Kappa statistical method, we further prioritized the important conservation areas by strategy A, B, C, E in the future. The results can not only serve as management reference for government agencies, but also develop

  5. Wormholes supported by phantom energy from Shan-Chen cosmological fluids

    Energy Technology Data Exchange (ETDEWEB)

    Wang, Deng [Nankai University, Theoretical Physics Division, Chern Institute of Mathematics, Tianjin (China); Meng, Xin-He [Nankai University, Department of Physics, Tianjin (China); Institute of Theoretical Physics, CAS, State key Lab of Theoretical Physics, Beijing (China)

    2016-03-15

    In the present paper, the exact solutions of spherically symmetrical Einstein field equations describing wormholes supported by phantom energy that violates the null energy condition from Shan-Chen background fluid are obtained. We have considered the important case of the model parameter ψ ∼ 1, which corresponds to the ''saturation effect'', and this regime corresponds to an effective form of ''asymptotic freedom'' for the fluids, but occurring at cosmological rather than subnuclear scales. Then we investigate the allowed range for the values of the model parameters g and ω when the spacetime metrics describe wormholes and discuss the possible singularities of the solutions, finding that the obtained spacetimes are geodesically complete. Furthermore, we construct two traversable wormholes through matching our obtained interior solutions to the exterior Schwarzschild solutions and analyze the traversabilities of the wormholes. Finally, we consider the case of anisotropic pressure and discover that the transverse pressure also crosses the phantom divide -1 with the growth of the wormhole dimension, and it tends to be the same as the radial pressure with the growth of the wormhole radius. (orig.)

  6. Psychometric properties of the Revised Chen Internet Addiction Scale (CIAS-R) in Chinese adolescents.

    Science.gov (United States)

    Mak, Kwok-Kei; Lai, Ching-Man; Ko, Chih-Hung; Chou, Chien; Kim, Dong-Il; Watanabe, Hiroko; Ho, Roger C M

    2014-10-01

    The Revised Chen Internet Addiction Scale (CIAS-R) was developed to assess Internet addiction in Chinese populations, but its psychometric properties in adolescents have not been examined. This study aimed to evaluate the factor structure and psychometric properties of CIAS-R in Hong Kong Chinese adolescents. 860 Grade 7 to 13 students (38 % boys) completed the CIAS-R, the Young's Internet Addiction Test (IAT), and the Health of the Nation Outcome Scales for Children and Adolescents (HoNOSCA) in a survey. The prevalence of Internet addiction as assessed by CIAS-R was 18 %. High internal consistency and inter-item correlations were reported for the CIAS-R. Results from the confirmatory factor analysis suggested a four-factor structure of Compulsive Use and Withdrawal, Tolerance, Interpersonal and Health-related Problems, and Time Management Problems. Moreover, results of hierarchical multiple regression supported the incremental validity of the CIAS-R to predict mental health outcomes beyond the effects of demographic differences and self-reported time spent online. The CIAS is a reliable and valid measure of internet addiction problems in Hong Kong adolescents. Future study is warranted to validate the cutoffs of the CIAS-R for identification of adolescents with Internet use problems who may have mental health needs.

  7. Control of the loop IRENE in the experimental reactor OSIRIS: calculation of the departure from nucleate boiling ratio in real time

    International Nuclear Information System (INIS)

    Lucot, Michel; Obin, Norbert.

    1980-10-01

    The loop IRENE is an experimental device to study the behaviour of pressurized light-water fuel pins under neutron flux in the Saclay Nuclear Research Centre reactor OSIRIS. It can take 8 fuel pins and allows irradiations to be carried out under thermodynamic, hydraulic and chemical conditions corresponding to those of a PWR power reactor. A brief outline of the loop specifications is followed by an account of the difficulties raised by operating with saturation temperature at the test channel outlet and it is shown how the microprocessor loop pilots are used to solve these problems [fr

  8. Writing Beyond the Wall: Translation, Cross-cultural Exchange, and Chen Ran's 'A Private Life'

    Directory of Open Access Journals (Sweden)

    Kay Schaffer

    2006-09-01

    Full Text Available The past decade has witnessed an unprecedented rise in the global flow of knowledge, nowhere more apparent in the exchange of ideas between China and modern western democracies. Our interest concerns one aspect of this global flow— the translation of Chinese women’s autobiographical writing into English. Taking Chen Ran’s A Private Life (English edition, 2004 as a point of departure, the paper explores issues of translingual practice and cross-cultural exchange. It considers what escapes or is lost in translation as well as the additive potential of the host text. It is sometimes the case that the translation can deliberately make certain ambiguities visible—whether from pragmatic, market-driven motivations or from more complex political, historical and cultural considerations. These negotiations of meaning that occur in the translation process can reverberate on the critical reception of texts in both the ‘guest’ and ‘host’ languages (Liu 1995, with open-ended, incomplete and indeterminate effects. The paper examines the effects of the omission of a brief parenthetical section of three paragraphs from one chapter of the Chinese edition of A Private Life. Yet, even that small emendation changes the original text as a cultural object and alters potential modes of its reception. In this case, the translation results in a loss of ambiguity, irony, philosophic and rhetorical sophistication while also offering additive potentials that enhance the generation of new meanings in the translingual exchange, here with reference Tiananmen and contemporary feminism in China. The translation process provides new channels for readers, writers and theorists to dialogue and communicate across gaps of difference, despite inhibiting factors like the imposition of local restraints, the universalising pressures of western modernity, and asymmetrical relations of power between guest and host language contexts.

  9. Politics in the Western Maya Region (I: Ajawil/Ajawlel and Ch'e'n

    Directory of Open Access Journals (Sweden)

    Péter Bíró

    2011-01-01

    Full Text Available In a series of articles I reflect on the use of various expressions which are connected to what we call the political in the inscriptions of the Classic Maya Western Region. These words express concepts which help to understand the intricate details of the interactions between the political entities and their internal organisations in the Classic Maya Lowlands. Words such as 7ajawil, 7ajawlel, the kennings built on the base of ch'e7n (cave, pond, the emblem glyphs and titles will be examined in light of what they tell us about the functioning of the political organisation of the Classic Period in a constrained region.En una serie de artículos como éste investigo el uso de varias palabras en las inscripciones mayas de la época Clásica de la Región Occidental vinculadas con lo que nosotros llamamos "política". Estas palabras expresan conceptos que ayudan a entender los matices de las relaciones entre las entidades políticas de las Tierras Bajas Mayas y su organización interna. Términos como ajaw'ü I ajawlel, los difrasismos con base ch'e'n (cueva, pozo, los glifos emblemas y los títulos serán examinados tomando en cuenta la información que nos proporcionan sobre el funcionamiento de la organización política de la época Clásica en una región restringida.

  10. [Academic thoughts on Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China].

    Science.gov (United States)

    Huang, Weiping; Li, Naiqi

    2015-03-01

    Through the collection of Practice of acupuncture and moxibustion written by CHEN Jingwen, the acupuncture master in the Republic of China, the academic characteristics on acupuncture and moxibusiton were analyzed. The literature comparison method was adopted to compare the works of LUO Zhaoju, ZENG Tianzhi and LI Wenxian, etc. at the same period. It was discovered that CHEN Jingwen was the medical master who systematicly brought up the theory of acupoint properties earlier in the modern times. Classifying drugs based on acupoints was his academic feature. Additionally, the compatibility therapy of Chinese medicine was introduced to explain the essential ideas on the acupoints combination. The treatment was determined on the basis of zangxiang theory and the reinforcing and reducing therapy of acupuncture was emphasized in the determination of treatment and prescription. CHEN Jingwen's theory of acupoint property had been stressed and spread among the medical scholars in the Republic of China and he had made the beneficial exploration for the development of modern acupuncture and moxibustion therapy.

  11. Post-Hurricane Irene coastal oblique aerial photographs collected from Ocracoke Inlet, North Carolina, to Virginia Beach, Virginia, August 30-31, 2011

    Science.gov (United States)

    Morgan, Karen L. M.; Krohn, M. Dennis

    2016-02-17

    The U.S. Geological Survey (USGS), as part of the National Assessment of Coastal Change Hazards project, conducts baseline and storm-response photography missions to document and understand the changes in vulnerability of the Nation's coasts to extreme storms (Morgan, 2009). On August 30-31, 2011, the USGS conducted an oblique aerial photographic survey from Ocracoke Inlet, North Carolina, to Virginia Beach, Virginia, aboard a Piper Navajo Chieftain (aircraft) at an altitude of 500 feet (ft) and approximately 1,200 ft offshore. This mission was flown to collect post-Hurricane Irene data for assessing incremental changes in the beach and nearshore area since the last survey, flown in May 2008, and the data can be used in the assessment of future coastal change.

  12. Traditional uses, botany, phytochemistry, pharmacology and toxicology of Panax notoginseng (Burk.) F.H. Chen: A review.

    Science.gov (United States)

    Wang, Ting; Guo, Rixin; Zhou, Guohong; Zhou, Xidan; Kou, Zhenzhen; Sui, Feng; Li, Chun; Tang, Liying; Wang, Zhuju

    2016-07-21

    Panax notoginseng (Burk.) F.H. Chen is a widely used traditional Chinese medicine known as Sanqi or Tianqi in China. This plant, which is distributed primarily in the southwest of China, has wide-ranging pharmacological effects and can be used to treat cardiovascular diseases, pain, inflammation and trauma as well as internal and external bleeding due to injury. This paper provides up-to-date information on investigations of this plant, including its botany, ethnopharmacology, phytochemistry, pharmacology and toxicology. The possible uses and perspectives for future investigation of this plant are also discussed. The relevant information on Panax notoginseng (Burk.) F.H. Chen was collected from numerous resources, including classic books about Chinese herbal medicine, and scientific databases, including Pubmed, SciFinder, ACS, Ebsco, Elsevier, Taylor, Wiley and CNKI. More than 200 chemical compounds have been isolated from Panax notoginseng (Burk.) F.H. Chen, including saponins, flavonoids and cyclopeptides. The plant has pharmacological effects on the cardiovascular system, immune system as well as anti-inflammatory, anti-atherosclerotic, haemostatic and anti-tumour activities, etc. Panax notoginseng is a valuable traditional Chinese medical herb with multiple pharmacological effects. This review summarizes the botany, ethnopharmacology, phytochemistry, pharmacology and toxicology of P. notoginseng, and presents the constituents and their corresponding chemical structures found in P. notoginseng comprehensively for the first time. Future research into its phytochemistry of bio-active components should be performed by using bioactivity-guided isolation strategies. Further work on elucidation of the structure-function relationship among saponins, understanding of multi-target network pharmacology of P. notoginseng, as well as developing its new clinical usage and comprehensive utilize will enhance the therapeutic potentials of P. notoginseng. Copyright © 2016

  13. How Quaternary geologic and climatic events in the southeastern margin of the Tibetan Plateau influence the genetic structure of small mammals: inferences from phylogeography of two rodents, Neodon irene and Apodemus latronum.

    Science.gov (United States)

    Fan, Zhenxin; Liu, Shaoying; Liu, Yang; Zhang, Xiuyue; Yue, Bisong

    2011-03-01

    Phylogeographical studies that focus on the southeastern margin of the Tibetan Plateau are limited. The complex terrain and unique geological history make it a particularly unusual region of the Tibetan Plateau. We carried out a phylogeographical study of two rodent species Neodon irene and Apodemus latronum using the mitochondrial cytochrome b gene sequences. High genetic diversities and deep phylogenetic splits were detected in both rodents. Some haplotypes from one sampling region fell into different evolutionary clades, but most haplotypes from the same sampling regions were clustered together with each other. The results of isolation by distance analysis further substantiated that their genetic diversities were structured along geography. Thus, there were high levels of geographical structure for both rodents. Demographic analyses implied a relatively constant population size for all samples of N. irene and A. latronum in history. However, clade B of N. irene and clade 3 of A. latronum experienced population expansions at 105-32 and 156-47 Kya, respectively. Through comparison with previous studies, we suggest the high mitochondrial DNA diversities in them are probably not a species-specific feature, but a common pattern for small mammals in this unique area. Details of the historical demography of these rodents revealed in this study could provide new insights into how rodents and possibly other small mammals in this region responded to the geological and climatic events.

  14. Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige

    OpenAIRE

    Giafferri, Xiaomin

    2008-01-01

    Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authen...

  15. Między brakiem a nadmiarem. Z Ireną Grudzińską-Gross rozmawia Joanna Tokarska-Bakir

    Directory of Open Access Journals (Sweden)

    Joanna Tokarska-Bakir

    2012-12-01

    Full Text Available Between overabundance and scarcity. Joanna Tokarska-Bakir in an interview with Irena Grudzińska Gross This conversation with Irena Grudzińska-Gross starts a series of interviews in “Studia Litteraria et Historica”, which motto is the title of the essay of Jan Stanisław Bystroń “On subjects I was advised not to pursue”. Among these subjects that Irena Grudzińska-Gross names are: war, family history, women.  Grudzińska-Gross tells also about the reactions to “Złote Żniwa” - a book that she wrote together with Jan Tomasz Gross, and about academic work of people of Eastern Europe living in the United States. One part of the interview concerns also a “collective hypnosis”, that Americans underwent after the 9/11 World Trade Center Attack and the price, that Susan Sontag had to pay for being critical about American militarism.   Między brakiem a nadmiarem. Z Ireną Grudzińską-Gross rozmawia Joanna Tokarska-Bakir Rozmowa z Ireną Grudzińską-Gross otwiera cykl wywiadów “Studia Litteraria et Historica”, których mottem jest tytuł eseju Jana Stanisława Bystronia: “Tematy, które mi odradzano”. Wśród “odradzanych” tematów, które wymienia Irena Grudzińska-Gross są między innymi: wojna, historia rodzinna, kobiety. Grudzińska-Gross opowiada także o reakcjach na książkę “Złote żniwa”, którą napisała wraz z Janem Tomaszem Grossem oraz o pracy akademickiej osób z Europy Wschodniej w Stanach Zjednoczonych. Część rozmowy dotyczy także “zbiorowej hipnozy”, której ulegli mieszkańcy USA po ataku 11 września 2001 na World Trade Center i ceny, jaką musiała zapłacić Susan Sontag za krytykę amerykańskiego militaryzmu.

  16. Activation energy and R. Chen frequency factor in the Randall and Wilkins original equation for second order kinetics. Emission curve simulated in Microsoft Excel algebra

    International Nuclear Information System (INIS)

    Moreno M, A.; Moreno B, A.

    2000-01-01

    In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)

  17. The effects of Hurricane Irene and Tropical Storm Lee on the bed sediment geochemistry of U.S. Atlantic coastal rivers

    Science.gov (United States)

    Horowitz, Arthur J.

    2013-01-01

    Hurricane Irene and Tropical Storm Lee, both of which made landfall in the U.S. between late August and early September 2011, generated record or near record water discharges in 41 coastal rivers between the North Carolina/South Carolina border and the U.S./Canadian border. Despite the discharge of substantial amounts of suspended sediment from many of these rivers, as well as the probable influx of substantial amounts of eroded material from the surrounding basins, the geochemical effects on the TOC), total nitrogen (TN), Zn, Se, Co, Cu, Pb, As, Cr, and total carbon (TC). As a group, these constituents tend to be associated either with urbanization/elevated population densities and/or wastewater/solid sludge. The limited number of significant sediment-associated chemical changes that were detected probably resulted from two potential processes: (1) the flushing of in-stream land-use affected sediments that were replaced by baseline material more representative of local geology and/or soils (declining concentrations), and/or (2) the inclusion of more heavily affected material as a result of urban nonpoint-source runoff and/or releases from flooded treatment facilities (increasing concentrations). Published 2013. This article is a U.S. Government work and is in the public domain in the USA.

  18. Assessing the impact of Hurricanes Irene and Sandy on the morphology and modern sediment thickness on the inner continental shelf offshore of Fire Island, New York

    Science.gov (United States)

    Schwab, William C.; Baldwin, Wayne E.; Denny, Jane F.

    2016-01-15

    This report documents the changes in seabed morphology and modern sediment thickness detected on the inner continental shelf offshore of Fire Island, New York, before and after Hurricanes Irene and Sandy made landfall. Comparison of acoustic backscatter imagery, seismic-reflection profiles, and bathymetry collected in 2011 and in 2014 show that sedimentary structures and depositional patterns moved alongshore to the southwest in water depths up to 30 meters during the 3-year period. The measured lateral offset distances range between about 1 and 450 meters with a mean of 20 meters. The mean distances computed indicate that change tended to decrease with increasing water depth. Comparison of isopach maps of modern sediment thickness show that a series of shoreface-attached sand ridges, which are the dominant sedimentary structures offshore of Fire Island, migrated toward the southwest because of erosion of the ridge crests and northeast-facing flanks as well as deposition on the southwest-facing flanks and in troughs between individual ridges. Statistics computed suggest that the modern sediment volume across the about 81 square kilometers of common sea floor mapped in both surveys decreased by 2.8 million cubic meters, which is a mean change of –0.03 meters, which is smaller than the resolution limit of the mapping systems used.

  19. New contributions to the knowledge of Chinese flea beetle fauna (III): Revision of Meishania Chen & Wang with description of five new species (Coleoptera: Chrysomelidae: Galerucinae)

    Science.gov (United States)

    The flea beetle genus Meishania Chen & Wang is revised and five new species - M. cangshanensis sp. nov., M. flavipennis sp. nov., M. fulvotigera sp. nov., and M. sichuanica sp. nov. from China and M. bhutanensis sp. nov. from Bhutan - are described. All species of Meishania are illustrated and a key...

  20. Debris flow run off simulation and verification ‒ case study of Chen-You-Lan Watershed, Taiwan

    Directory of Open Access Journals (Sweden)

    M.-L. Lin

    2005-01-01

    Full Text Available In 1996 typhoon Herb struck the central Taiwan area, causing severe debris flow in many subwatersheds of the Chen-You-Lan river watershed. More severe cases of debris flow occurred following Chi-Chi earthquake, 1999. In order to identify the potentially affected area and its severity, the ability to simulate the flow route of debris is desirable. In this research numerical simulation of debris flow deposition process had been carried out using FLO-2D adopting Chui-Sue river watershed as the study area. Sensitivity study of parameters used in the numerical model was conducted and adjustments were made empirically. The micro-geomorphic database of Chui-Sue river watershed was generated and analyzed to understand the terrain variations caused by the debris flow. Based on the micro-geomorphic analysis, the debris deposition in the Chui-Sue river watershed in the downstream area, and the position and volume of debris deposition were determined. The simulated results appeared to agree fairly well with the results of micro-geomorphic study of the area when not affected by other inflow rivers, and the trends of debris distribution in the study area appeared to be fairly consistent.

  1. Satellite-derived land covers for runoff estimation using SCS-CN method in Chen-You-Lan Watershed, Taiwan

    Science.gov (United States)

    Zhang, Wen-Yan; Lin, Chao-Yuan

    2017-04-01

    The Soil Conservation Service Curve Number (SCS-CN) method, which was originally developed by the USDA Natural Resources Conservation Service, is widely used to estimate direct runoff volume from rainfall. The runoff Curve Number (CN) parameter is based on the hydrologic soil group and land use factors. In Taiwan, the national land use maps were interpreted from aerial photos in 1995 and 2008. Rapid updating of post-disaster land use map is limited due to the high cost of production, so the classification of satellite images is the alternative method to obtain the land use map. In this study, Normalized Difference Vegetation Index (NDVI) in Chen-You-Lan Watershed was derived from dry and wet season of Landsat imageries during 2003 - 2008. Land covers were interpreted from mean value and standard deviation of NDVI and were categorized into 4 groups i.e. forest, grassland, agriculture and bare land. Then, the runoff volume of typhoon events during 2005 - 2009 were estimated using SCS-CN method and verified with the measured runoff data. The result showed that the model efficiency coefficient is 90.77%. Therefore, estimating runoff by using the land cover map classified from satellite images is practicable.

  2. Plasma biochemistry values in emperor geese (Chen canagica) in Alaska: comparisons among age, sex, incubation, and molt.

    Science.gov (United States)

    Franson, J. Christian; Hoffman, D.J.; Schmutz, J.A.

    2009-01-01

    Reduced populations of emperor geese (Chen canagica), a Bering Sea endemic, provided the need to assess plasma biochemistry values as indicators of population health. A precursory step to such an investigation was to evaluate patterns of variability in plasma biochemistry values among age, sex, and reproductive period. Plasma from 63 emperor geese was collected on their breeding grounds on the Yukon-Kuskokwim Delta in western Alaska, USA. The geese sampled included 18 incubating adult females captured, in mid June, on their nests by using bow nets, and 30 adults and 15 goslings captured in corral traps in late July and early August, when the adults were molting their wing feathers and the goslings were 5-6 weeks old. Plasma was evaluated for 15 biochemical parameters, by comparing results among age, sex, and sampling period (incubation versus wing-feather molt). Ten of the 15 biochemical parameters assayed differed among adults during incubation, the adults during molt, and the goslings at molt, whereas sex differences were noted in few parameters.

  3. A variational numerical method based on finite elements for the nonlinear solution characteristics of the periodically forced Chen system

    Science.gov (United States)

    Khan, Sabeel M.; Sunny, D. A.; Aqeel, M.

    2017-09-01

    Nonlinear dynamical systems and their solutions are very sensitive to initial conditions and therefore need to be approximated carefully. In this article, we present and analyze nonlinear solution characteristics of the periodically forced Chen system with the application of a variational method based on the concept of finite time-elements. Our approach is based on the discretization of physical time space into finite elements where each time-element is mapped to a natural time space. The solution of the system is then determined in natural time space using a set of suitable basis functions. The numerical algorithm is presented and implemented to compute and analyze nonlinear behavior at different time-step sizes. The obtained results show an excellent agreement with the classical RK-4 and RK-5 methods. The accuracy and convergence of the method is shown by comparing numerically computed results with the exact solution for a test problem. The presented method has shown a great potential in dealing with the solutions of nonlinear dynamical systems and thus can be utilized in delineating different features and characteristics of their solutions.

  4. Screening for Internet Addiction: An Empirical Study on Cut-off Points for the Chen Internet Addiction Scale

    Directory of Open Access Journals (Sweden)

    Chih-Hung Ko

    2005-12-01

    Full Text Available The aim of this study was to establish the optimal cut-off points of the Chen Internet Addiction Scale (CIAS, to screen for and diagnose Internet addiction among adolescents in the community by using the well- established diagnostic criteria of Internet addiction. This survey of 454 adolescents used screening (57/58 and diagnostic (63/64 cut-off points of the CIAS, a self-reported instrument, based on the results of systematic diagnostic interviews by psychiatrists. The area under the curve of the receiver operating characteristic curve revealed that CIAS has good diagnostic accuracy (89.6%. The screening cut-off point had high sensitivity (85.6% and the diagnostic cut-off point had the highest diagnostic accuracy, classifying 87.6% of participants correctly. Accordingly, the screening point of the CIAS could provide a screening function in two-stage diagnosis, and the diagnostic point could serve as a diagnostic criterion in one-stage massive epidemiologic research.

  5. Ground-state magnetization of the Ising spin glass: A recursive numerical method and Chen-Ma scaling

    Science.gov (United States)

    Sepehrinia, Reza; Chalangari, Fartash

    2018-03-01

    The ground-state properties of quasi-one-dimensional (Q1D) Ising spin glass are investigated using an exact numerical approach and analytical arguments. A set of coupled recursive equations for the ground-state energy are introduced and solved numerically. For various types of coupling distribution, we obtain accurate results for magnetization, particularly in the presence of a weak external magnetic field. We show that in the weak magnetic field limit, similar to the 1D model, magnetization exhibits a singular power-law behavior with divergent susceptibility. Remarkably, the spectrum of magnetic exponents is markedly different from that of the 1D system even in the case of two coupled chains. The magnetic exponent makes a crossover from being dependent on a distribution function to a constant value independent of distribution. We provide an analytic theory for these observations by extending the Chen-Ma argument to the Q1D case. We derive an analytical formula for the exponent which is in perfect agreement with the numerical results.

  6. Serum Metabolomic Characterization of Liver Fibrosis in Rats and Anti-Fibrotic Effects of Yin-Chen-Hao-Tang

    Directory of Open Access Journals (Sweden)

    Hongyang Zhang

    2016-01-01

    Full Text Available Yin-Chen-Hao-Tang (YCHT is a famous Chinese medicine formula which has long been used in clinical practice for treating various liver diseases, such as liver fibrosis. However, to date, the mechanism for its anti-fibrotic effects remains unclear. In this paper, an ultra-performance liquid chromatography-time-of-flight mass spectrometry (UPLC-TOF-MS-based metabolomic study was performed to characterize dimethylnitrosamine (DMN-induced liver fibrosis in rats and evaluate the therapeutic effects of YCHT. Partial least squares-discriminant analysis (PLS-DA showed that the model group was well separated from the control group, whereas the YCHT-treated group exhibited a tendency to restore to the controls. Seven significantly changed fibrosis-related metabolites, including unsaturated fatty acids and lysophosphatidylcholines (Lyso-PCs, were identified. Moreover, statistical analysis demonstrated that YCHT treatment could reverse the levels of most metabolites close to the normal levels. These results, along with histological and biochemical examinations, indicate that YCHT has anti-fibrotic effects, which may be due to the suppression of oxidative stress and resulting lipid peroxidation involved in hepatic fibrogenesis. This study offers new opportunities to improve our understanding of liver fibrosis and the anti-fibrotic mechanisms of YCHT.

  7. Body mass of prefledging Emperor Geese Chen canagica: Large-scale effects of interspecific densities and food availability

    Science.gov (United States)

    Lake, B.C.; Schmutz, J.A.; Lindberg, M.S.; Ely, Craig R.; Eldridge, W.D.; Broerman, F.J.

    2008-01-01

    We studied body mass of prefledging Emperor Geese Chen canagica at three locations across the Yukon-Kuskokwim Delta, Alaska, during 1990-2004 to investigate whether large-scale variation in body mass was related to interspecific competition for food. From 1990 to 2004, densities of Cackling Geese Branta hutchinsii minima more than doubled and were c. 2-5?? greater than densities of Emperor Geese, which were relatively constant over time. Body mass of prefledging Emperor Geese was strongly related (negatively) to interspecific densities of geese (combined density of Cackling and Emperor Geese) and positively related to measures of food availability (grazing lawn extent and net above-ground primary productivity (NAPP)). Grazing by geese resulted in consumption of ??? 90% of the NAPP that occurred in grazing lawns during the brood-rearing period, suggesting that density-dependent interspecific competition was from exploitation of common food resources. Efforts to increase the population size of Emperor Geese would benefit from considering competitive interactions among goose species and with forage plants. ?? 2008 The Authors.

  8. Le fictif et le réel dans L’Empereur et l’assassin de Chen Kaige

    Directory of Open Access Journals (Sweden)

    Xiaomin Giafferri

    2008-12-01

    Full Text Available Comme tout texte historique littéraire refait l’Histoire en la manipulant, le récit filmique est doublement mensongère du fait de sa double représentation : le décor et les acteurs représentent une situation qui est la fiction, et le film lui-même représente sous forme d’images juxtaposées cette première représentation. Sans vouloir faire la part du réel et de l’imaginaire, le présent travail tente de montrer comment, dans le film L’empereur et l’assassin de Chen Kaige, l’illusion de l’authenticité s’établit à travers les mécanismes de la fictionnalisation de l’Histoire. L’observation de leur manifestation est amenée à considérer deux axes principaux : l’organisation du récit et la mise en scène des personnages.

  9. Aldehyde Dehydrogenase 1 and Raf Kinase Inhibitor Protein ...

    African Journals Online (AJOL)

    Xiang-Xiu Sun1, Qing-Shan Ma2, Tian-Feng Liu1, Ying Chen1, Yan Dong1 and. Lin-Lin Zhang1* ... cancer was developed and studied by histological examination. Immunohistochemical and .... (diaminobenzidine) Kit. Western blot analysis.

  10. First Delayed Resection Findings After Irreversible Electroporation (IRE) of Human Localised Renal Cell Carcinoma (RCC) in the IRENE Pilot Phase 2a Trial

    Energy Technology Data Exchange (ETDEWEB)

    Wendler, Johann Jakob, E-mail: johann.wendler@med.ovgu.de [Otto von Guericke University of Magdeburg, Department of Urology, University Hospital (Germany); Ricke, Jens, E-mail: jens.Ricke@med.ovgu.de; Pech, Maciej, E-mail: macej.pech@med.ovgu.de; Fischbach, Frank, E-mail: frank.fischbach@med.ovgu.de; Jürgens, Julian, E-mail: julian.juergens@med.ovgu.de [University of Magdeburg, Department of Radiology (Germany); Siedentopf, Sandra, E-mail: sandra.siedentopf@med.ovgu.de; Roessner, Albert, E-mail: albert.roessner@med.ovgu.de [University of Magdeburg, Institute of Pathology (Germany); Porsch, Markus, E-mail: markus.porsch@med.ovgu.de; Baumunk, Daniel, E-mail: daniel.baumunk@med.ovgu.de; Schostak, Martin, E-mail: martin.schostak@med.ovgu.de [Otto von Guericke University of Magdeburg, Department of Urology, University Hospital (Germany); Köllermann, Jens, E-mail: jens.koellermann@sana.de [Sana Klinikum Offenbach Am Main, Institute of Pathology (Germany); Liehr, Uwe-Bernd, E-mail: uwe-bernd.liehr@med.ovgu.de [Otto von Guericke University of Magdeburg, Department of Urology, University Hospital (Germany)

    2016-02-15

    IntroductionIt is postulated that focal IRE affords complete ablation of soft-tissue tumours while protecting the healthy peritumoral tissue. Therefore, IRE may be an interesting option for minimally invasive, kidney-tissue-sparing, non-thermal ablation of renal tumours.AimWith this current pilot study (“IRENE trial”), we present the first detailed histopathological data of IRE of human RCC followed by delayed tumour resection. The aim of this interim analysis of the first three patients was to investigate the ablation efficiency of percutaneous image-guided focal IRE in RCC, to assess whether a complete ablation of T1a RCC and tissue preservation with the NanoKnife system is possible and to decide whether the ablation parameters need to be altered.MethodsFollowing resection 4 weeks after percutaneous IRE, the success of ablation and detailed histopathological description were used to check the ablation parameters.ResultsThe IRE led to a high degree of damage to the renal tumours (1 central, 2 peripheral; size range 15–17 mm). The postulated homogeneous, isomorphic damage was only partly confirmed. We found a zonal structuring of the ablation zone, negative margins and, enclosed within the ablation zone, very small tumour residues of unclear malignancy.ConclusionAccording to these initial, preliminary study results of the first three renal cases, a new zonal distribution of IRE damage was described and the curative intended, renal saving focal ablation of localised RCC below <3 cm by percutaneous IRE by the NanoKnife system appears to be possible, but needs further, systematic evaluation for this treatment method and treatment protocol.

  11. A retrospective streamflow ensemble forecast for an extreme hydrologic event: a case study of Hurricane Irene and on the Hudson River basin

    Science.gov (United States)

    Saleh, Firas; Ramaswamy, Venkatsundar; Georgas, Nickitas; Blumberg, Alan F.; Pullen, Julie

    2016-07-01

    This paper investigates the uncertainties in hourly streamflow ensemble forecasts for an extreme hydrological event using a hydrological model forced with short-range ensemble weather prediction models. A state-of-the art, automated, short-term hydrologic prediction framework was implemented using GIS and a regional scale hydrological model (HEC-HMS). The hydrologic framework was applied to the Hudson River basin ( ˜ 36 000 km2) in the United States using gridded precipitation data from the National Centers for Environmental Prediction (NCEP) North American Regional Reanalysis (NARR) and was validated against streamflow observations from the United States Geologic Survey (USGS). Finally, 21 precipitation ensemble members of the latest Global Ensemble Forecast System (GEFS/R) were forced into HEC-HMS to generate a retrospective streamflow ensemble forecast for an extreme hydrological event, Hurricane Irene. The work shows that ensemble stream discharge forecasts provide improved predictions and useful information about associated uncertainties, thus improving the assessment of risks when compared with deterministic forecasts. The uncertainties in weather inputs may result in false warnings and missed river flooding events, reducing the potential to effectively mitigate flood damage. The findings demonstrate how errors in the ensemble median streamflow forecast and time of peak, as well as the ensemble spread (uncertainty) are reduced 48 h pre-event by utilizing the ensemble framework. The methodology and implications of this work benefit efforts of short-term streamflow forecasts at regional scales, notably regarding the peak timing of an extreme hydrologic event when combined with a flood threshold exceedance diagram. Although the modeling framework was implemented on the Hudson River basin, it is flexible and applicable in other parts of the world where atmospheric reanalysis products and streamflow data are available.

  12. Rezension zu: Sabine Hark, Paula-Irene Villa (Hg.: Anti-Genderismus. Sexualität und Geschlecht als Schauplätze aktueller politischer Auseinandersetzungen. Bielefeld: transcript Verlag 2015.

    Directory of Open Access Journals (Sweden)

    Christian Hammermann

    2017-05-01

    Full Text Available Der von Sabine Hark und Paula-Irene Villa herausgegebene Sammelband analysiert die öffentlichen Angriffe auf Gender Studies und Gender Mainstreaming, die unter dem Begriff Anti-Genderismus auftreten und verhandelt werden. Die einzelnen Beiträge untersuchen Themen und Methoden des anti-genderistischen Diskurses, seine Akteur_Innen und gesellschaftlichen Bedingung. Dabei entwerfen sie ein sehr kohärentes Porträt dieser Politiken, das allerdings von einer weiteren Untersuchung der gesellschaftlichen Bedingungen und intersektionalen Bezüge zu anderen Ressentiments profitieren würde.

  13. Activation energy and R. Chen frequency factor in the Randall and Wilkins original equation for second order kinetics. Emission curve simulated in Microsoft Excel algebra; Energia de activacion y factor de frecuencia de R. Chen en la ecuacion original de Randall y Wilkins para cinetica de segundo orden. Curva de emision simulada en algebra de Microsoft Excel

    Energy Technology Data Exchange (ETDEWEB)

    Moreno M, A. [Departamento de Apoyo en Ciencias Aplicadas, Benemerita Universidad Autonoma de Puebla, 4 Sur 104, Centro Historico, 72000 Puebla (Mexico); Moreno B, A

    2000-07-01

    In this work the incorporation of activation energy and frequency factor parameters proposed by R. Chen are presented in the original formulation of Randall and wilkins second order kinetics. The results concordance are compared between the calculus following the R. Chen methodology with those ones obtained by direct incorporation of the previously indicated in the Randall-Wilkins-Levy expression for a simulated thermoluminescent emission curve of two peaks with maximum peak temperature (tm): t m1=120 and t m2=190. (Author)

  14. Variation in foraging behavior and body mass in broods of Emperor Geese (Chen canagica): Evidence for interspecific density dependence

    Science.gov (United States)

    Schmutz, J.A.; Laing, K.K.

    2002-01-01

    Broods of geese spend time feeding according to availability and quality of food plants, subject to inherent foraging and digestive constraints. We studied behavioral patterns of broods of Emperor Geese (Chen canagica) on the Yukon–Kuskokwim Delta, Alaska, and examined how feeding and alert behavior varied in relation to habitat and goose density. During 1994–1996, time spent feeding by Emperor Goose goslings and adult females was positively related to multispecies goose densities near observation blinds, and not to just Emperor Goose density. Similarly, body mass of Emperor Goose goslings was more strongly related (negatively) to multispecies goose densities than intraspecific densities. A grazing experiment in 1995 indicated that most above ground primary production by Carex subspathacea, a preferred food plant, was consumed by grazing geese. Those results demonstrate that interspecific competition for food occurred, with greatest support for goslings whose behavioral repertoire is limited primarily to feeding, digesting, and resting. Although the more abundant Cackling Canada Geese (Branta canadensis minima) differed from Emperor Geese in their preferred use of habitats during brooding rearing (Schmutz 2001), the two species occurred in equal abundance in habitats preferred by Emperor Goose broods. Thus, Cackling Canada Geese were a numerically significant competitor with Emperor Geese. Comparing these results to an earlier study, time spent feeding by goslings, adult females, and adult males were greater during 1993–1996 than during 1985–1986. During the interval between those studies, densities of Cackling Canada Geese increased two to three times whereas Emperor Goose numbers remained approximately stable, which implies that interspecific competition affected foraging behavior over a long time period. These density-dependent changes in foraging behavior and body mass indicate that interspecific competition affects nutrient acquisition and gosling

  15. [Textual research on Chen Ye and his Jia cang jing yan fang (Family-preserved Empirical Recipes) of the Song Dynasty].

    Science.gov (United States)

    Zhang, Xuedan; Zhang, Ruqing; Chen, Dexing

    2014-01-01

    Chen Ye, an official of the Southern Song Dynasty, also known as Chen Rihua as his styled name, was born in Changle, Fuzhou in the reign of Shaoxing, and died during the reign of Duanping. He had been consecutively in the positions of Jiang shi lang (Court Gentleman for Ceremonial Service), Zhi zhou (Prefect) of Lingding, the Ti xing (Judicial Commissioner) of Guangdong, the Zong ling (Overseer-general) of Sichuan, Shan ding (Reviser), Shu lin and other positions in Tongzhou, Yuanzhou. His works included 1 volume of Gu ling xian sheng nian pu (Mr. Guling's Chronological Biography), 1 volume of Tan xie (On Humor), 1 volume of Shi hua (Poetry), 8 volumes of Jin yuan li shu (Jin Yuan's Smart Technique), 3 volumes of Yi jian zhi lei bian (Classified Compilation of Yijian's Annals), (Zeng guang) Suo sui lu (Augmented Records of Trivial Matters), 5 volumes of Jia cang jing yan fang (Family-preserved Empirical Recipes). He also compiled the 8-volume Yin jiang zhi (Yinjiang's Annals), published the 2-volume Jia cang ji yao fang (Collected Essential Recipes from Family Preservation), and other proses and poetry. Jia cang jing yan fang was a formulary compiled by Chen Ye, which was lost. Altogether 74 of its recipes were cited in Fu ren da quan liang fang (Complete Effective Prescriptions for Women's Diseases), Shou qin yang lao shu (A Book for Pursuing Seniors' Longevity and Healthcare), Pu ji fang (Prescriptions for Universal Relief) and Yong le da dian (Yongle Encyclopedia).

  16. Impact of Hurricane Irene on Vibrio vulnificus and Vibrio parahaemolyticus concentrations in surface water, sediment and cultured oysters in the Chesapeake Bay, Maryland, USA

    Directory of Open Access Journals (Sweden)

    Kristi S Shaw

    2014-05-01

    Full Text Available To determine if a storm event (i.e., high winds, large volumes of precipitation could alter concentrations of Vibrio vulnificus and Vibrio parahaemolyticus in aquacultured oysters (Crassostrea virginica and associated surface water and sediment, this study followed a sampling timeline before and after Hurricane Irene impacted the Chesapeake Bay estuary in late August 2011. Aquacultured oysters were sampled from two levels in the water column: surface 0.3 m and near-bottom just above the sediment. Concentrations of each Vibrio spp. and associated virulence genes were measured in oysters with a combination of real-time PCR and most probable number enrichment methods, and in sediment and surface water with real-time PCR. While concentration shifts of each Vibrio species were apparent post-storm, statistical tests indicated no significant change in concentration change for either Vibrio species by location (surface or near bottom oysters or date sampled (oyster tissue, surface water and sediment concentrations. V. vulnificus in oyster tissue was correlated with total suspended solids (r=0.41, p=0.04, and V. vulnificus in sediment was correlated with secchi depth (r=-0.93, p< 0.01, salinity (r=-0.46, p=0.02, tidal height (r=-0.45, p=0.03, and surface water V. vulnificus (r=0.98, p< 0.01. V. parahaemolyticus in oyster tissue did not correlate with environmental measurements, but V. parahaemolyticus in sediment and surface water correlated with several measurements including secchi depth (r=-0.48, p=0.02[sediment]; r=-0.97 p< 0.01[surface water] and tidal height (r=-0.96. p< 0.01[sediment], r=-0.59,p< 0.01 [surface water]. The concentrations of Vibrio spp. were higher in oysters relative to other studies (average V. vulnificus 4x105 MPN g-1, V. parahaemolyticus 1x105 MPN g-1, and virulence-associated genes were detected in most oyster samples. This study provides a first estimate of storm-related Vibrio density changes in oyster tissues, sediment and

  17. Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

    CERN Multimedia

    Maximilien Brice

    2007-01-01

    Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa exchanging gifts at luncheon and signing the Guest Book on 1st November 2007 with CERN Director-General R. Aymar.

  18. 21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.

    CERN Multimedia

    CERN Photo Service

    2008-01-01

    21 October 2008 - LHC Inauguration - IHEP Beijing representative Prof. Chen, People's Republic of China, welcomed by CERN Director-General R. Aymar, CERN Chief Scientific Officer J. Engelen and CERN Financial Officer S. Lettow.

  19. 6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.

    CERN Multimedia

    Maximilien Brice

    2012-01-01

    6 June 2012 - Chinese Nanjing University President J.Chen in the ATLAS visitor centre with Member of the ATLAS Collaboration I. Wingerter and International Relations Office Adviser E. Tsesmelis. M. Qi, Nanjing University and ATLAS Collaboration, accompanies the delegation.

  20. The prevalence and pathogenicity of gizzard nematodes of the genera Amidostomum and Epomidiostomum (Trichostrongylidae) in the lesser snow goose (Chen caerulescens caerulescens)

    Science.gov (United States)

    Tuggle, B.N.; Crites, John L.

    1984-01-01

    Three species of trichostrongylid nematodes were removed from the gizzards of 25 lesser snow geese, Chen caerulescens caerulescens, collected at Winisk, Ont. A 100% prevalence of infection was noted in the sampled population with each bird harboring two or more of the following species: Epomidiostomum crami (prevalence, 92%; mean intensity, 18.7 ± 13.3), Amidostomum anseris (prevalence, 84%; mean intensity, 9.6 ± 9.8), and Amidostomum spatulatum (prevalence, 84%; mean intensity, 11.2 ± 9.8). When large burdens (>30) of both A. anseris and A. spatulatum were present in the mucosal lining of the gizzard, progressive degeneration of the epithilium and koilin linings was noted in 16% of the geese examined. Severe necrotic granulomata observed in the gizzard muscle of 36% of the geese were associated with sizable burdens (>25) of E. crami which were found burrowed in the gizzard muscle.

  1. Chlorpromazine-induced perturbations of bile acids and free fatty acids in cholestatic liver injury prevented by the Chinese herbal compound Yin-Chen-Hao-Tang.

    Science.gov (United States)

    Yang, Qiaoling; Yang, Fan; Tang, Xiaowen; Ding, Lili; Xu, Ying; Xiong, Yinhua; Wang, Zhengtao; Yang, Li

    2015-04-16

    Yin-Chen-Hao-Tang (YCHT), a commonly used as a traditional chinese medicine for liver disease. Several studies indicated that YCHT may improving hepatic triglyceride metabolism and anti-apoptotic response as well as decreasing oxidative stress .However, little is known about the role of YCHT in chlorpromazine (CPZ) -induced chlolestatic liver injury. Therefore, we aimed to facilitate the understanding of the pathogenesis of cholestatic liver injury and evaluate the effect of Yin-Chen-Hao-Tang (YCHT) on chlorpromazine (CPZ)-induced cholestatic liver injury in rats based on the change of bile acids (BAs) and free fatty acids (FFAs) alone with the biochemical indicators and histological examination. We conducted an experiment on CPZ-induced cholestatic liver injury in Wistar rats with and without YCHT for nine consecutive days. Serum levels of alanine aminotransferase (ALT), aspartate aminotransferase (AST), albumin (ALB), total bilirubin (TBIL), total cholesterol (TC), triglycerides (TG), low density lipoprotein-cholesterol (LDL-C) were measured to evaluate the protective effect of YCHT against chlorpromazine (CPZ)-induced cholestatic liver injury. Histopathology of the liver tissue showed that pathological injuries were relieved after YCHT pretreatment. In addition, ultra-performance lipid chromatography coupled with quadrupole mass spectrometry (UPLC-MS) and gas chromatography coupled with mass spectrometry (GC-MS) was applied to determine the content of bile acids, free fatty acids, respectively. Obtained data showed that YCHT attenuated the effect of CPZ-induced cholestatic liver injury, which was manifested by the serum biochemical parameters and histopathology of the liver tissue. YCHT regulated the lipid levels as indicated by the reversed serum levels of TC, TG, and LDL-C. YCHT also regulated the disorder of BA and FFA metabolism by CPZ induction. Results indicated that YCHT exerted a protective effect on CPZ-induced cholestasis liver injury. The variance of

  2. [Reiner Nürnberg, Ekkehard Höxtermann, Martina Voigt. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts] / Monika von Hirschheydt

    Index Scriptorium Estoniae

    Hirschheydt, Monika von

    2015-01-01

    Arvustus: Nürnberg, Reiner, Höxtermann, Ekkehard, Voigt, Martina. Elisabeth Schiemann 1881-1972. Vom AußBruch der Genetik und der Frauen in den UmBrüchen des 20. Jahrhunderts. Beiträge eines Symposiums zum 200. Gründungsjubiläum der Humboldt-Universität Berlin. Rangsdorf: Basilisken-Presse 2014

  3. Analysis of arsenic and mercury content in human remains of the 16th and 17th centuries from Moscow Kremlin necropolises by neutron activation analysis at the IREN facility and the IBR-2 reactor FLNP JINR

    Science.gov (United States)

    Panova, T. D.; Dmitriev, A. Yu.; Borzakov, S. B.; Hramco, C.

    2018-01-01

    A neutron activation analysis (NAA) of three samples of human remains of the 16th and 17th centuries from the necropolises of the Moscow Kremlin has been carried out at FLNP JINR. The samples were irradiated at two facilities: the IREN source of resonance neutrons and the IBR-2 reactor. Spectra of the induced activity of the irradiated samples were measured by using the automatic measurement system developed at the Frank Laboratory of Neutron Physics (FLNP) of the Joint Institute for Nuclear Research (JINR). This system consists of a high-purity germanium detector with spectrometric electronics, a sample changer, and control software. Mass fraction of arsenic, mercury, and some other elements were calculated using two NAA methods—relative and absolute. The obtained values confirm the fact of acute mercury poisoning of Anastasia Romanovna, the first wife of Tsar Ivan Vasil'evich the Terrible, the first Russian Tsarina (died in 1560). High levels of mercury were detected in the bone remains of Tsarevich Ivan Ivanovich (died in 1581), the son of Tsar Ivan the Terrible, and Prince Mikhail Vasil'evich Skopin-Shuiskii (died in 1610). The results provide an opportunity to introduce into scientific circulation the exact values of mass fraction of mercury, arsenic, and other elements in the samples taken from the burials of the Russian historical figures of the second half of 16th-early 17th century.

  4. Qualitative and quantitative analysis of arsenic and mercury in human remains of the XVI-XVII centuries from the Moscow Kremlin necropolises by neutron activation analysis at the IREN facility and the IBR-2 reactor of FLNP, JINR

    International Nuclear Information System (INIS)

    Panova, T.D.; Dmitriev, A.Yu.; Borzakov, S.B.; Khramko, K.

    2017-01-01

    The neutron activation analysis (NAA) of three samples of human remains of the XVI-XVII centuries from the necropolises of the Moscow Kremlin has been carried out at FLNP JINR. The samples were irradiated at two facilities: at the IREN source of resonance neutrons and at the IBR-2 reactor. Spectra of induced activity of the irradiated samples were measured by using the automatic measurement system developed at FLNP JINR. This system consists of a high-purity germanium detector with spectrometric electronics, a sample changer, and a control software. Mass fractions of arsenic, mercury and other elements were calculated by relative and absolute NAA methods. The obtained values confirmed the fact of an acute mercury poisoning of the first wife of Tsar Ivan Vasilievich the Terrible - Tsarina Anastasia Romanovna. Increased mercury content was detected in the bone remains of the son of Tsar Ivan the Terrible, Tsarevich Ivan Ivanovich, and Prince M. V. Skopin-Shuisky. The obtained results allow us to introduce into scientific circulation the exact values of mass fraction of mercury, arsenic and some other elements in the samples from the graves of Russian historical figures of the second half of XVI - early XVII centuries. [ru

  5. "Is political behavior a viable coping strategy to perceived organizational politics? Unveiling the underlying resource dynamics": Correction to Sun and Chen (2017).

    Science.gov (United States)

    2017-10-01

    Reports an error in "Is Political Behavior a Viable Coping Strategy to Perceived Organizational Politics? Unveiling the Underlying Resource Dynamics" by Shuhua Sun and Huaizhong Chen ( Journal of Applied Psychology , Advanced Online Publication, May 22, 2017, np). In the article, Table 1 contained a formatting error. Correlation coefficient values in the last four cells of column 6 were misplaced with correlation coefficient values in the last four cells of column 7. All versions of this article have been corrected. (The following abstract of the original article appeared in record 2017-22542-001.) We conduct a theory-driven empirical investigation on whether political behavior, as a coping strategy to perceived organizational politics, creates resource trade-offs in moderating the relationship between perceived organizational politics and task performance. Drawing on conservation of resources theory, we hypothesize that political behavior mitigates the adverse effect of perceived organizational politics on task performance via psychological empowerment, yet exacerbates its adverse effect on task performance via emotional exhaustion. Three-wave multisource data from a sample of 222 employees and their 75 supervisors were collected for hypothesis testing. Findings supported our hypotheses. Our study enhances understandings of the complex resource dynamics of using political behavior to cope with perceived organizational politics and highlights the need to move stress-coping research from a focus on the stress-buffering effect of coping on outcomes to a focus on the underlying competing resource dynamics. (PsycINFO Database Record (c) 2017 APA, all rights reserved).

  6. Multi-source data fusion and modeling to assess and communicate complex flood dynamics to support decision-making for downstream areas of dams: The 2011 hurricane irene and schoharie creek floods, NY

    Science.gov (United States)

    Renschler, Chris S.; Wang, Zhihao

    2017-10-01

    In light of climate and land use change, stakeholders around the world are interested in assessing historic and likely future flood dynamics and flood extents for decision-making in watersheds with dams as well as limited availability of stream gages and costly technical resources. This research evaluates an assessment and communication approach of combining GIS, hydraulic modeling based on latest remote sensing and topographic imagery by comparing the results to an actual flood event and available stream gages. On August 28th 2011, floods caused by Hurricane Irene swept through a large rural area in New York State, leaving thousands of people homeless, devastating towns and cities. Damage was widespread though the estimated and actual floods inundation and associated return period were still unclear since the flooding was artificially increased by flood water release due to fear of a dam break. This research uses the stream section right below the dam between two stream gages North Blenheim and Breakabeen along Schoharie Creek as a case study site to validate the approach. The data fusion approach uses a GIS, commonly available data sources, the hydraulic model HEC-RAS as well as airborne LiDAR data that were collected two days after the flood event (Aug 30, 2011). The aerial imagery of the airborne survey depicts a low flow event as well as the evidence of the record flood such as debris and other signs of damage to validate the hydrologic simulation results with the available stream gauges. Model results were also compared to the official Federal Emergency Management Agency (FEMA) flood scenarios to determine the actual flood return period of the event. The dynamic of the flood levels was then used to visualize the flood and the actual loss of the Old Blenheim Bridge using Google Sketchup. Integration of multi-source data, cross-validation and visualization provides new ways to utilize pre- and post-event remote sensing imagery and hydrologic models to better

  7. Two phases of droplet evaporation during plasma arc spraying: reply to Chen's comment about the 'rocket' effect under conditions of thermal plasma spraying

    Energy Technology Data Exchange (ETDEWEB)

    Nemchinsky, V A [Key College, 225 Dania Beach Blvd, Dania Beach, FL 33040 (United States)

    2007-07-07

    The heating history of a droplet during its flight can be divided into two phases: (a) the initial phase when evaporation, although it occurs, does not change the heat balance of the droplet much (the case considered in our previous paper and (b) the final phase when the cooling due to evaporation balances the heat flux from the plasma. The later phase is considered in Chen's comment. In our reply, a very straightforward consideration demonstrates that even in the final phase of the droplet flight, the 'rocket' effect can be significant. (reply)

  8. Redescription of the Indo-West Pacific scorpionfish (Scorpaenidae), Neomerinthe erostris (Alcock 1896), a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002.

    Science.gov (United States)

    Motomura, Hiroyuki; Causse, Romain; Béarez, Philippe; Mishra, Subhrendu Sekhar

    2015-09-29

    The Indo-West Pacific species, Neomerinthe erostris (Alcock 1896), originally described as Scorpaena erostris, is redescribed as a senior synonym of Scorpaena gibbifrons Fowler 1938, N. rotunda Chen 1981, and N. bathyperimensis Zajonz & Klausewitz 2002. Although the latter three nominal species have been regarded as valid species and N. erostris has not been reported since 1898, examinations of type specimens of the four nominal species revealed that they represent a single species. A lectotype of Scorpaena erostris is herein designated. Neomerinthe erostris is characterized by having a distinct longitudinal ridge on the lateral surface of the maxilla and a strongly rounded dorsal profile of the head.

  9. Kevadfestival kutsub metsa ja kontserdisaali / Iren Lill

    Index Scriptorium Estoniae

    Lill, Iren

    2008-01-01

    Üritustest 29. maist kuni 1. juunini toimuva Türi Kevadfestivali raames: koomilise laulumängu "Lopi ja Lapi" esietendus 31. mail Oisu rahvamajas (autoriteks kirjanik Leelo Tungal ja helilooja Tõnis Kaumann), Kadri-Ann Sumera kontsert pealkirjaga "Metsastseenid" 29. mail, Alo Põldmäe loodusfotode näituse "Muusikaline Neeruti" avamine, ansambli Svetilen kontsert 30. mail Türi kirikus, regilaulude laulmine Jaak Johansoni ja Riina Roose eestvedamisel ürituse "Ööülikool" raames 30. mail, festivali lõppkontsert Türi kirikus 1. juunil (esineb organist Ulla Krigul)

  10. Neutron transport in irradiation loops (IRENE loop)

    International Nuclear Information System (INIS)

    Sarsam, Maher.

    1980-09-01

    This thesis is composed of two parts with different aspects. Part one is a technical description of the loop and its main ancillary facilities as well as of the safety and operational regulations. The measurement methods on the model of the ISIS reactor and on the loop in the OSIRIS reactor are described. Part two deals with the possibility of calculating the powers dissipated by each rod of the fuel cluster, using appropriate computer codes, not only in the reflector but also in the core and to suggest a method of calculation [fr

  11. Flood inundation maps and water-surface profiles for tropical storm Irene and selected annual exceedance probability floods for Flint Brook and the Third Branch White River in Roxbury, Vermont

    Science.gov (United States)

    Ahearn, Elizabeth A.; Lombard, Pamela J.

    2014-01-01

    Flint Brook, a tributary to the Third Branch White River in Roxbury, Vermont, has a history of flooding the Vermont Fish and Wildlife Department’s Roxbury Fish Culture Station (the hatchery) and surrounding infrastructure. Flooding resulting from tropical storm Irene on August 28–29, 2011, caused widespread destruction in the region, including extensive and costly damages to the State-owned hatchery and the transportation infrastructure in the Town of Roxbury, Vermont. Sections of State Route 12A were washed out, and several bridges and culverts on Oxbow Road, Thurston Hill Road, and the New England Central Railroad in Roxbury were heavily damaged. Record high peak-discharge estimates of 2,140 cubic feet per second (ft3/s) and 4,320 ft3/s were calculated for Flint Brook at its confluence with the Third Branch White River and for the Third Branch White River at about 350 feet (ft) downstream from the hatchery, respectively. The annual exceedance probabilities (AEPs) of the peak discharges for Flint Brook and the Third Branch White River were less than 0.2 percent (less than a one in 500 chance of occurring in a given year). Hydrologic and hydraulic analyses of Flint Brook and the Third Branch White River were done to investigate flooding at the hatchery in Roxbury and support efforts by the Federal Emergency Management Agency to assist State and local mitigation and reconstruction efforts. During the August 2011 flood, the majority of flow from Flint Brook (97 percent or 2,070 ft3/s) diverged from its primary watercourse due to a retaining wall failure immediately upstream of Oxbow Road and inundated the hatchery. Although a minor amount of flow from the Third Branch White River could have overtopped State Route 12A and spilled into the hatchery, the Third Branch White River did not cause flood damages or exacerbate flooding at the hatchery during the August 2011 flood. The Third Branch White River which flows adjacent to the hatchery does not flood the hatchery

  12. Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

    CERN Multimedia

    Maximilien Brice

    2007-01-01

    Chinese Commission of Science Technology and Industry for National Defense Senior Vice Minister CHEN Qiufa visiting ALICE experiment on 1st November 2007 with CERN Director-General R. Aymar and Adviser J.-P. Revol. Thursday, 1st and Friday, 2nd November 2007

  13. Blazar Sequence in Fermi Era Liang Chen

    Indian Academy of Sciences (India)

    Abstract. In this paper, we review the latest research results on the topic of blazar sequence. It seems that the blazar sequence is phenomenally ruled out, while the theoretical blazar sequence still holds. We point out that black hole mass is a dominated parameter accounting for high-power- high-synchrotron-peaked and ...

  14. MARGA_Chen et al_2016

    Data.gov (United States)

    U.S. Environmental Protection Agency — These data describe the chromatography characteristics of the MARGA instrument software as compared to an alternative, independent technique for chromatogram...

  15. Big data during crisis : lessons from Hurricane Irene.

    Science.gov (United States)

    2015-03-01

    Transportation networks connect people with the goods and services that they require on a daily basis. : In a disaster or emergency, they serve the same role, but often for more urgent needs. Transportation : networks provide access to food, water, s...

  16. Infrastructure for Peace: The African Experience | Irene | African ...

    African Journals Online (AJOL)

    Over the years, unhealthy competitions for limited resources in man's environment and election triggered violence among others have been consistently increasing threats to peace and security as well as various business- related economic activities in many communities in Africa. There are attempts by Government at ...

  17. Die ergonomies ideale inrigting van rekenaarsentrums in skole / Irene Slabbert

    OpenAIRE

    Slabbert, Irene

    2011-01-01

    Computer technology and digital media are an integral part of present–day society. Consequently, learners are exposed to computers from an early age. What is lacking however, is that learners are not protected against the health and safety hazards of using computers. Learners have a constitutional right to work in a healthy and safe environment that is free of all hazards. Computer centres in schools therefore need to be ergonomically equipped to keep the best interests of lear...

  18. 古今中西之間--陳垣與20世紀中國史學%Between the Ancient and the Present and between China and the West:Prof. Chen Yuan and Chinese Historiography in the 20 th Century

    Institute of Scientific and Technical Information of China (English)

    陳智超

    2010-01-01

    Every historian should answer two questions related to each other, i. e. what is the relationship between history and reality and what is that between historiography and reality. Moreover, Chinese historians should answer other two questions also re-lated to each other, namely what is the relationship between China and the West and what is that between Chinese culture and Western culture. Based on their own outlook on the ancient and the present as well as on China and the West, every conscious Chinese historian of the 20 th century was bound to cherish a definite sense of responsi-bility and determined what role they played and what way they chose when taking on this responsibility. The present paper expounds Prof. Chen Yuan’ s answers to the above questions andhis practice concerned with them in the four stages of his lifetime.

  19. Food Fortification to Prevent and Control Iron Deficiency | Chen ...

    African Journals Online (AJOL)

    It is essential to prevent the fortification iron from reacting with the absorption inhibitors. To ensure adequate absorption therefore, various factors must be considered before initiating a fortification programme. These include cost effectiveness of fortification in increasing absorbable iron, palatability of the fortified food and the ...

  20. Lateral strukturierte Oberflächen zur THz-Strahlmanipulation

    OpenAIRE

    Jahn, David; Koch, Martin (Prof. Dr.)

    2018-01-01

    Die Terahertz-Zeitbereichsspektroskopie ist mittlerweile eine etablierte spektroskopische Methode im Frequenzbereich von 0;2 THz bis etwa 5 THz. Mit der stetigen Verbesserung von Zeitbereichs-Spektrometern, in den letzten Jahren hauptsächlich vorangetrieben durch die Verbesserung der Materialsysteme sowohl im photoleitenden Emitter als auch im Detektor sind heute Systeme mit bis zu 90 dB SNR und 4;5 THz Brandbreite verfügbar. Auch der Einfluss anderer Systemkomponenten, deren Beitrag zum...

  1. Massive Star Formation: Accreting from Companion X. Chen1 ...

    Indian Academy of Sciences (India)

    Abstract. We report the possible accretion from companion in the mas- sive star forming region (G350.69–0.49). This region seems to be a binary system composed of a diffuse object (possible nebulae or UC HII region) and a Massive Young Stellar Object (MYSO) seen in Spitzer IRAC image. The diffuse object and MYSO ...

  2. Initiation and Propagation of Coronal Mass Ejections P. F. Chen

    Indian Academy of Sciences (India)

    Introduction. Coronal mass ejections (CMEs) have been observed for over 30 years. They keep being an intriguing research topic, not only because they are now realized to be the major driver for space weather disturbances, which are intimately connected to human activities, but also because they themselves are full of ...

  3. Mitochondrial genome of Taiwan pig ( Sus Scrofa ) | Chen | African ...

    African Journals Online (AJOL)

    The purpose of this study is to investigate the complete nucleotide sequence of the mitochondrial genome of the Taiwan Lanyu pig (Sus scrofa) and its phylogenetic relationships with other pig breeds. Thirty-four forward and reverse primers were designed. Sequencing was performed in both directions. The results showed ...

  4. Chemische Reaktionen auf Oberflächen - eine SFG Studie

    OpenAIRE

    Kirsch, Harald

    2014-01-01

    This thesis focused on the investigation of chemical reactions on surfaces by usage of Sum Frequency Generation (SFG) spectroscopy and Thermal Desorption Spectroscopy (TDS). Understanding of chemical reactions on surfaces is of critical importance for modification and optimization of a variety of environmental and industrial processes, but the complexity of the ongoing reactions under "realistic" conditions often hinders an understanding on a molecular level. The aim of this work was to get i...

  5. C. Huang , G. Zhao , HW Zhang & YQ Chen

    Indian Academy of Sciences (India)

    the host stars' birth cloud with higher abundance of Si will make the cloud ... with the metallicity distribution of nearby field F, G, or K stars which are known to .... In the early stage of planetesimal accumulation, the rate of growth of planetesimal.

  6. Chaos synchronization of the fractional-order Chen's system

    International Nuclear Information System (INIS)

    Zhu Hao; Zhou Shangbo; He Zhongshi

    2009-01-01

    In this paper, based on the stability theorem of linear fractional systems, a necessary condition is given to check the chaos synchronization of fractional systems with incommensurate order. Chaos synchronization is studied by utilizing the Pecora-Carroll (PC) method and the coupling method. The necessary condition can also be used as a tool to confirm results of a numerical simulation. Numerical simulation results show the effectiveness of the necessary condition.

  7. Early Life Processes, Endocrine Mediators and Number of Susceptible Cells in Relation to Breast Cancer Risk

    Science.gov (United States)

    2008-04-01

    Sweden, for overseeing the DNA isolation from the blood sam- ples; Heng Khai Koon and Ong Eng Hu Jason for genotyping; Lim Siew Lan and Irene Chen for...of normal and malignant breast epithelium. In The Breast: Comprehensive Management of Benign and Malignant Diseases Edited by: Bland KI, Copeland EM...life etiological model, taking also into account that certain breast cancer epidemiologic characteris- tics reflecting general principles of

  8. Relación heterófilo/linfocito, frecuencia espontánea de eritrocitos micronucleados y prolongaciones nucleares en el ganso nevado (Chen caerulescens: Una propuesta como posible biomonitor de estrés y genotóxicos ambientales

    Directory of Open Access Journals (Sweden)

    Martha C. Martínez Quintanilla

    2017-04-01

    Full Text Available Existen organismos silvestres que son altamente vulnerables ante estresores antropogénicos y naturales, estos organismos pueden ser de utilidad para evaluar la salud ambiental mediante diferentes indicadores confiables, sencillos, rápidos, económicos para determinar y si es posible reducir estos efectos negativos. En este estudio proponemos al ganso nevado (Chen caerulescens como posible biomonitor de estrés y genotóxicos ambientales mediante la relación heterófilo/linfocito (H/L, la prueba de micronúcleos (EMN, prolongaciones nucleares en eritrocitos (EPN y eritrocitos policromáticos (EPC. Durante la temporada de caza (2012-2013 en el humedal de Málaga, Durango, México, colectamos 18 organismos. Los eritrocitos fueron las células más abundantes, de núcleo y morfología elípticos, de tamaño 12.68 ± 0.89 µm. Observamos heterófilos (11.07±1.32 µm, eosinófilos (9.67±1.26 µm, basófilos (5.75 ± 0.78 µm, monocitos (10.49±1.36 µm y linfocitos (6.53±1.0 µm. No identificamos alteración en las proporciones ni en la morfología de leucocitos, sin embargo, es necesario un mayor número de organismos para establecer los parámetros sanguíneos de base normal para esta especie. La relación h/l fue de 0.41 ± 0.11 este valor es similar a lo reportado para esta y otras especies de aves consideradas como sanas. Establecimos la frecuencia basal de EMN (2.6±1.45, epn (249.2 ± 89.74 y EPC (156.5 ± 50. El ganso nevado es un organismo que se perfila como buen candidato a biomonitor ambiental debido a la frecuencia basal de su relación H/L, EMN, EPN y EPC, pero debe probarse en condiciones estandarizadas y a través de estudios en zonas con y sin contaminación.

  9. Irene Galeano: El saber de una partera tradicional del Magdalena medio Irene Galeano: the knowledge of a traditional midwife in the Magdalena zone

    Directory of Open Access Journals (Sweden)

    Celmira Laza Vásquez

    2008-12-01

    Full Text Available Madeleine Leininger en su teoría enfermería transcultural, pone énfasis en la coherencia entre las intervenciones de enfermería y el sistema de valores así como el contexto cultural que rodea al sujeto de cuidado. Por tanto la enfermera debe buscar estrategias que le permitan ser sensible a la concepción que tienen las personas de sus problemas de salud con el fin de mediar entre el contexto cultural y las necesidades de cuidado de la persona. Por medio de un relato biográfico se da la oportunidad a los sujetos de cuidado de expresar la complejidad de su realidad y sobre todo la experiencia de la persona frente sus procesos de salud - enfermedad. El presente artículo tiene como objetivo narrar en la voz de su protagonista, la experiencia de vida de una partera tradicional de la región del Magdalena medio colombiano. En la narración, se entrecruzan las creencias y acervos culturales propios de la región rural del departamento de Antioquia y que determinan las prácticas de cuidado para la atención de la mujer durante el parto y el puerperio.Madeleine Leininger in her theory of multicultural infirmary emphasizes coherence, participation, system of values and patient’s treatment as well. For this reason infirmary must find strategies allowing the concept of sensibility and the awareness people have of their health problems in order to deal with their own urban context and their needs for self care through a biographic narration. The patients have the opportunity to express their true reality and mainly their own experience about health and illness - process. The purpose of this article is to reveal experiences narrated by the protagonist (an urban midwife from the Magdalena region, "a Colombian area". This true story is full of believes and unique cultural details from the rural region of the department (state of Antioquia where they set methods for woman’s care during delivery and after it.

  10. Obrazovanije na russkom potshti bessmertno / Irene Käosaar ; interv. Anastassia Belitshko-Popovitsh

    Index Scriptorium Estoniae

    Käosaar, Irene

    2008-01-01

    Haridus- ja teadusministeeriumi rahvusvähemuste hariduse osakonna juhataja vastab küsimustele, mis puudutavad venekeelset haridust Eestis ja üleminekut eestikeelsele õppele. Kommenteerib Lauri Leesi

  11. Young performance artist experimenting in youth work / Irene Hütsi, Kai Valtna

    Index Scriptorium Estoniae

    Hütsi, Irene

    2013-01-01

    MIMO projekt 2010-2013: 2011. ja 2012. a. Eesti linnades toimunud rahvusvahelise muusikaloome alase koolitus- ja noorteprojekti MIMO (Moving in! Moving on!) raames toimunust. Viljandi Kultuuriakadeemia töötubadest, mida viisid läbi akadeemia tudengid Eesti väikelinnade koolides ja noortekeskustes

  12. Eesti jääb tugevaks, kui jätkab valitud teel / Irene Mia

    Index Scriptorium Estoniae

    Mia, Irene

    2005-01-01

    Maailma Majandusfoorumi analüütiku hinnangul jääb Eesti ka järgmistel aastatel maailma kõige konkurentsivõimelisemate riikide hulka, kui ta jätkab sama teed. Väla on toodud ka parandamist vajavad valdkonnad. Lisa: Eesti koht 2004. aastal majanduskasvu indeksis

  13. Economic loss caused by GMOs in Estonia / Irene Kull, Villu Kõve

    Index Scriptorium Estoniae

    Kull, Irene, 1961-

    2008-01-01

    Lepinguvälisest vastutusest, tootja vastutusest, vastutusest suurema ohu allikaga tekitatud kahju eest, geneetiliselt muundatud organismidega tekitatud kahjust, varaline kahjust, mittevaraline kahjust

  14. A Simple Model to Describe the Relationship among Rainfall, Groundwater and Land Subsidence under a Heterogeneous Aquifer

    Science.gov (United States)

    Zheng, Y. Y.; Chen, Y. L.; Lin, H. R.; Huang, S. Y.; Yeh, T. C. J.; Wen, J. C.

    2017-12-01

    Land subsidence is a very serious problem of Zhuoshui River alluvial fan, Taiwan. The main reason of land subsidence is a compression of soil, but the compression measured in the wide area is very extensive (Maryam et al., 2013; Linlin et al., 2014). Chen et al. [2010] studied the linear relationship between groundwater level and subsurface altitude variations from Global Positioning System (GPS) station in Zhuoshui River alluvial fan. But the subsurface altitude data were only from two GPS stations. Their distributions are spared and small, not enough to express the altitude variations of Zhuoshui River alluvial fan. Hung et al. [2011] used Interferometry Synthetic Aperture Radar (InSAR) to measure the surface subsidence in Zhuoshui River alluvial fan, but haven't compared with groundwater level. The study compares the correlation between rainfall events and groundwater level and compares the correlation between groundwater level and subsurface altitude, these two correlation affected by heterogeneous soil. From these relationships, a numerical model is built to simulate the land subsidence variations and estimate the coefficient of aquifer soil compressibility. Finally, the model can estimate the long-term land subsidence. Keywords: Land Subsidence, InSAR, Groundwater Level, Numerical Model, Correlation Analyses

  15. Chen et al., Afr J Tradit Complement Altern Med. (2012) 9(2):234 ...

    African Journals Online (AJOL)

    AJTCAM

    E-mail: qidongfanjian@sina.com .... under an inverted microscope. ... Stars image analyzing equipment (Shanghai, P.R. China) was used to analyze the image ... Inverted microscope: The cultured neurons in the control group grew well and ...

  16. Critical node lifetimes in random networks via the Chen-Stein method

    NARCIS (Netherlands)

    Franceschetti, M.; Meester, R.W.J.

    2006-01-01

    This correspondence considers networks where nodes are connected randomly and can fail at random times. It provides scaling laws that allow to find the critical time at which isolated nodes begin to appear in the system as its size tends to infinity. Applications are in the areas of sensor and

  17. Chen et al., Afr J Tradit Complement Altern Med. (2016) 13(1):25-32 ...

    African Journals Online (AJOL)

    PROF ADEWUNMI

    The phosphorylation of PKA substrate was not activated after 48 hours of treatment with ephedrine and anisodamine. Conclusion: Ephedrine and anisodamine inhibit the proliferation of SKBR3 cells via a significantly change of intracellular cAMP concentration. Key words: anisodamine, breast cancer, cyclic adenosine ...

  18. Q. Shen1, X. Chen1, Jiyune Yi2, DR Jiang1 & YJ Yun3

    Indian Academy of Sciences (India)

    imately six months to cover the 2-yr pulsation cycle of VX Sgr. We used a special phase referencing ... but the υ = 2 line has relatively few maser features, most of which reside in the. Southern and Northern parts. ... stronger masers of both the lines appear, among which the main features reside in the inner shell and show ...

  19. Chen and Xiaodong Afr J Tradit Complement Altern Med. (2013) 10 ...

    African Journals Online (AJOL)

    AJTCAM

    As an ancient medicine, Solanum nigrum Linne has been playing an important role in the treatment of cancer in China since ancient times. It is reported in the literatures that Solanum nigrum Linne can inhibit tumour cell growth and promote apoptosis of tumour cells, and has immunomodulatory and cytotoxic effects (Son et ...

  20. In search of low cost titanium: the Fray Farthing Chen (FFC) Cambridge process

    CSIR Research Space (South Africa)

    Oosthuizen, SJ

    2010-10-01

    Full Text Available delivering a sponge product, aimed at replacing Kroll sponge alone, does not have potential for large reduction in overall titanium cost. Significant cost savings can only be achieved by also reducing the large number of process steps required to process... the sponge to mill product, including sponge purification, comminution, electrode forming, Vacuum Arc Re-melting, Hot and cold rolling. Presently, economy of scale in the production of titanium dictates that it is most cost effective to cast the largest...

  1. In search of low cost titanium: the fray farthing chen (FFC) cambridge process

    CSIR Research Space (South Africa)

    Oosthuizen, SJ

    2011-03-01

    Full Text Available delivering a sponge product, aimed at replacing Kroll sponge alone, does not have potential for large reduction in overall titanium cost. Significant cost savings can be achieved only by also reducing the large number of process steps required... to process the sponge to mill product, including sponge purification, comminution, electrode forming, vacuum arc re-melting, and hot and cold rolling. Presently, economy of scale in the production of titanium dictates that it is most cost...

  2. Chen et al., Afr J Tradit Complement Altern Med. (2014) 11(1):15-22

    African Journals Online (AJOL)

    cadewumi

    x300mm,Japan ) column. The columns were eluted with 0.1M nitric acid and calibrated with ..... Mushiake, H, Tsunoda, T, Nukatsuka,M, Shimao K, Fukushima M, Tahara H. (2005). Dendritic cells might be one of key factors for eliciting antitumor ...

  3. Calibrating the Shan-Chen lattice Boltzmann model for immiscible displacement in porous media

    DEFF Research Database (Denmark)

    Christensen, Britt Stenhøj Baun; Schaap, M.G.; Wildenschild, D.

    2006-01-01

    The lattice Boltzmann (LB) modeling technique is increasingly being applied in a variety of fields where computational fluid dynamics are investigated. In our field of interest, environmentally related flow processes in porous media, the use of the LB method is still not common. For the LB...

  4. Beiträge zur Beugungstheorie elektromagnetischer Wellen an Kanten vollkommen leitender Flächen

    OpenAIRE

    Zinal, Sherko

    2011-01-01

    Den Kern der vorliegenden Arbeit bilden die Untersuchung sowie die Formulierung von Lösungsansätzen für ein elementares, elektromagnetisches Beugungsproblem; einer undendlich langen Schlitzleitung mit einseitig begrenzter etallisierungsplatte (Abschnitt 1.2). Motiviert wird dieses Beugungsproblem im Hinblick auf die Beugungsproblematik planarer Strahler (Antennen) mit endlich ausgedehnter Grundmetallisierung (Abschnitt 1.1). In Kapitel 2 wird ein Stromlinien-Modell zur Formulierung des Beugun...

  5. VizieR Online Data Catalog: IRS spectra with features of crystalline silicates (Chen+, 2016)

    Science.gov (United States)

    Chen, R.; Luo, A.; Liu, J.; Jiang, B.

    2018-04-01

    Spectra taken by the IRS (Houck et al. 2004ApJS..154...18H) on the Spitzer space telescope (Werner et al. 2004ApJS..154....1W) are now publicly available. These spectra are produced using the bksub.tbl products from SL and LL modules of final SSC pipeline, version 18.18. From the IRS data archive, we found a collection of 16986 low-resolution spectra. The spectra are merged by four slits: SL2 (5.21-7.56 μm), SL1 (7.57-14.28 μm), LL2 (14.29-20.66 μm), and LL1 (20.67-38.00 μm). As crystalline silicates have no features in the SL2 band, we choose the spectra that include all the other three bands: SL1, LL2, and LL1 so that the object has a continuous spectrum from about 7.5-38 μm. In this way, five of the seven infrared complexes of crystalline silicates are covered, i.e., the 10, 18, 23, 28, and 33 μm complexes. (5 data files).

  6. Die Beifuß-Ambrosie auf Ackerflächen - ein Problem?

    Directory of Open Access Journals (Sweden)

    Verschwele, Arnd

    2014-07-01

    Full Text Available Common ragweed (Ambrosia artemisiifolia is spreading on agricultural fields in Germany, mainly in Brandenburg and Bayern. Competitive crops like winter cereals and oilseed-rape can reduce growth of this plant better than spring crops. In maize or cereals a chemical control is possible, but problems may arise because of the late emergence of ragweed and its high ability to regrowth. In crops like sunflower or lupines herbicide choice is limited and thus preventive control measures are crucial. An integrated approach is needed in order to avoid yield losses and to stop the spreading of ragweed in Germany.

  7. Effects of different cleaning treatments on heavy metal removal of Panax notoginseng (Burk) F. H. Chen.

    Science.gov (United States)

    Dahui, Liu; Na, Xu; Li, Wang; Xiuming, Cui; Lanping, Guo; Zhihui, Zhang; Jiajin, Wang; Ye, Yang

    2014-01-01

    The quality and safety of Panax notoginseng products has become a focus of concern in recent years. Contamination with heavy metals is one of the important factors as to P. notoginseng safety. Cleaning treatments can remove dust, soil, impurities or even heavy metals and pesticide residues on agricultural products. But effects of cleaning treatments on the heavy metal content of P. notoginseng roots have still not been studied. In order to elucidate this issue, the effects of five different cleaning treatments (CK, no treatment; T1, warm water (50°C) washing; T2, tap water (10°C) washing; T3, drying followed by polishing; and T4, drying followed by tap water (10°C) washing) on P. notoginseng roots' heavy metal (Cu, Pb, Cd, As and Hg) contents were studied. The results showed that heavy metal (all five) content in the three parts all followed the order of hair root > rhizome > root tuber under the same treatment. Heavy metal removals were in the order of Hg > As > Pb > Cu > Cd. Removal efficiencies of the four treatments were in the order of T2 > T1 > T3 > T4. Treatments (T1-T4) could decrease the contents of heavy metal in P. notoginseng root significantly. Compared with the requirements of WM/T2-2004, P. notoginseng roots' heavy metal contents of Cu, Pb, As and Hg were safe under treatments T1 and T2. In conclusion, the cleaning process after production was necessary and could reduce the content of heavy metals significantly. Fresh P. notoginseng root washed with warm water (T2) was the most efficient treatment to remove heavy metal and should be applied in production.

  8. Chen et al., Afr J Tradit Complement Altern Med. (2011) 8(4):467-476

    African Journals Online (AJOL)

    AJTCAM

    Keywords: Shen-qi-di-huang decoction, proteinuria, nephrin, adriamycin nephropathy. Introduction. Proteinuria is a clinical signature of podocyte injury resulting in many renal diseases. The slit diaphragm (SD) which connects neighboring foot processes of podocytes represents a critical structure of protein filtration (Tarabra ...

  9. AtCCX1 transports Na + and K + in Pitch pastoris | Chen | African ...

    African Journals Online (AJOL)

    Compartmentation of Na+ into vacuoles is an important way for cells to avoid the toxic effects of salt. Here, Arabidopsis AtCCX1 was studied in Pitch pastoris GS115. Yeast expressing AtCCX1 grew better in high H+ concentration medium and high salt medium than original strain and increased Na+ accumulation and ...

  10. First record of molluscs naturally infected with Angiostrongylus cantonensis (Chen, 1935 (Nematoda: Metastrongylidae in Brazil

    Directory of Open Access Journals (Sweden)

    Roberta Lima Caldeira

    2007-11-01

    Full Text Available Seeking the identification of Angiostrongylus cantonensis as a potential etiological agent of three clinical cases of eosinophilic meningitis, mollusc specimens were collected in the state of Espírito Santo, Brazil. The snails were identified as Sarasinula marginata (45 specimens, Subulina octona (157, Achatina fulica (45 and Bradybaena similaris (23. Larvae obtained were submitted to polymerase chain reaction and restriction fragment length polymorphism diagnosis. Their genetic profile were corresponded to A. cantonensis. Rattus norvegicus experimentally infected with third-stage larvae, developed menigoencephalitis, and parasites became sexually mature in the lungs. Additionally, larvae obtained from A. fulica snails, from São Vicente, state of São Paulo, also showed genetic profiles of this nematode. This is the first record of Brazilian molluscs infected with this nematode species.

  11. VizieR Online Data Catalog: YSO candidates in the Magellanic Bridge (Chen+, 2014)

    Science.gov (United States)

    Chen, C.-H. R.; Indebetouw, R.; Muller, E.; Kawamura, A.; Gordon, K. D.; Sewilo, M.; Whitney, B. A.; Fukui, Y.; Madden, S. C.; Meade, M. R.; Meixner, M.; Oliveira, J. M.; Robitaille, T. P.; Seale, J. P.; Shiao, B.; van Loon, J. Th.

    2017-06-01

    The Spitzer observations of the Bridge were obtained as part of the Legacy Program "Surveying the Agents of Galaxy Evolution in the Tidally-Stripped, Low-Metallicity Small Magellanic Cloud" (SAGE-SMC; Gordon et al. 2011AJ....142..102G). These observations included images taken at 3.6, 4.5, 5.8, and 8.0 um bands with the InfraRed Array Camera (IRAC) and at 24, 70, and 160 um bands with the Multiband Imaging Photometer for Spitzer (MIPS). The details of data processing are given in Gordon et al. (2011AJ....142..102G). To construct multi-wavelength SEDs for sources in the Spitzer catalog, we have expanded it by adding photometry from optical and NIR surveys covering the Bridge, i.e., BRI photometry from the Super COSMOS Sky Surveys (SSS; Hambly et al. 2001MNRAS.326.1279H) and JHKs photometry from the Two Micron All Sky Survey (2MASS; Skrutskie et al. 2006AJ....131.1163S, Cat. VII/233). (5 data files).

  12. Was kommt nach dem Handel? Umnutzung von Einzelhandelsflächen und deren Beitrag zur Stadtentwicklung

    OpenAIRE

    Sperle, Tilman

    2012-01-01

    In der Stadt europäischen Typs sind Stadt und Handel eng miteinander verwoben. Die Bedeutung des Handels geht weit über dessen originäre Versorgungsfunktion hinaus. Für die städtischen Zentren und Nebenzentren übernimmt er sowohl gestaltende als auch soziale Funktionen und trägt mit seiner belebenden Wirkung maßgeblich zum urbanen Leben bei. Mit dem tief greifenden Strukturwandel im Einzelhandel verändert sich diese Beziehung zwischen Stadt und Handel dramatisch, Trading-down-Prozesse geh...

  13. VizieR Online Data Catalog: Sample of Fermi Blazars (Chen+, 2016)

    Science.gov (United States)

    Chen, Y.-Y.; Zhang, X.; Xiong, D.-R.; Wang, S.-J.; Yu, X.-L.

    2016-04-01

    We tried to select a large number of blazars with reliable redshift, radio core and extended radio luminosity at 1.4GHz. Firstly, we considered the following samples of blazars to get the radio core luminosity and extended luminosity at 1.4GHz: Kharb et al. (2010, J/ApJ/710/764), Antonucci & Ulvestad (1985ApJ...294..158A), Cassaro et al. (1999A&AS..139..601C), Murphy et al. (1993MNRAS.264..298M), Landt & Bignall (2008MNRAS.391..967L), Caccianiga & Marcha (2004, Cat. J/MNRAS/348/973), Giroletti et al. (2004). We cross-correlated these samples with the Fermi LAT Third Source Catalog (3FGL), and we acquired the 3FGL spectral index and energy flux at 0.1-100GeV from clean sources in 3FGL (Fermi-LAT Collaboration 2015, J/ApJS/218/23) Using these catalogs, we compiled 201 Fermi blazars. (1 data file).

  14. Diskrepanz: Die EU-Frauenpolitik zwischen Deregulierung und Gleichheitsansprüchen

    Directory of Open Access Journals (Sweden)

    Ingrid Biermann

    2003-03-01

    Full Text Available In von neun Autorinnen verfassten Beiträgen gibt der Band Einblicke in zentrale Felder der EU-Politik: die europäische Wirtschafts- und Währungsunion (EWWU, die Strukturpolitik, die Gleichstellungspolitik und das Gender Mainstreaming, die Osterweiterung sowie die Ausarbeitung einer europäischen Verfassung. Damit werden wesentliche Teile des Maastricht-Vertrags (1992, des Amsterdamer Vertrags (1997 und des Nizza-Vertrags (2000 behandelt. Hierdurch bildet dieser Band eine wichtige Grundlage für die Diskussion über die Frauenpolitik der EU.

  15. VizieR Online Data Catalog: Quasars narrow absorption lines from SDSS (Chen+, 2015)

    Science.gov (United States)

    Chen, Z.-F.; Gu, Q.-S.; Chen, Y.-M.; Cao, Y.

    2017-11-01

    The Baryon Oscillation Spectroscopic Survey (BOSS: Eisenstein et al. 2011AJ....142...72E; Paris et al. 2012, Cat. VII/269) is the main dark-time legacy survey of the third stage of the SDSS, which used the same 2.5-m telescope (Gunn et al. 2006AJ....131.2332G; Ross et al. 2012, J/ApJS/199/3) as the first and second stages of the SDSS (hereafter SDSS-I/II). SDSS-I/II spectra have a wavelength coverage from 3800-9200Å with a spectral resolution of 1800-2200 (e.g. York et al. 2000AJ....120.1579Y). BOSS spectra span a range from 3600-10500Å at a resolution of 1300-2500 (Paris et al. 2012, Cat. VII/269). During the first two years, BOSS detected 87822 quasars over an area of 3275 deg2, including 7932 quasars that were observed by SDSS-I/II as well. Quasars observed by both SDSS-I/II and BOSS provide a remarkable chance to study the variabilities of absorption lines in a large population. Throughout this work, we take the quasar emission redshifts provided by Hewett & Wild (2010, J/MNRAS/405/2302, http://das.sdss.org/va/HewettWilddr7qso_newz/) directly. (2 data files).

  16. REVIEW: LOVE IN LHASA Lhasa hong chen 拉萨红尘

    Directory of Open Access Journals (Sweden)

    Reviewed by Wu Jing 吴晶

    2018-05-01

    Full Text Available Published in 2002, Love in Lhasa is Baima's first novel. The background is the 1980s at a time when China was engaging in fast-paced development of industrialization and commercialization as part of the Reform and Opening Up that began in the late 1970s. Most of the novel's episodes are set on the Tibetan Plateau where local Tibetans are affected by the trend of modernization. Young people in particular have increased opportunities to go out and see the world and also experience more challenges in dealing with issues of self-identity, and exploring the meaning of their existence. Against such a fast-changing social background, Tibetan women are faced with poignant life choices, especially as compared to traditional women. The novel's plot unfolds with the parallel life trajectories of the two female characters, Langsa and Yama, who are classmates and close friends at Tibet Military College. After graduation, the two young women leave the army and work in non-military areas as nurses. Langsa, the narrator, falls in love with a pilgrim, Varma, who comes from an isolated part of Tibet where Tibetan, Hui, and Han nationalities live together. They enjoy their otherworldly, extremely romantic relationship, and in the end, choose to live a reclusive life in the unknown hinterlands of Tibet. In contrast, Yama, the heroine, undergoes more complicated love experiences. Yama is the focus of this novel, embodying qualities of a "lost girl," such as beauty, rebelliousness, freedom-loving, desire, dreamer, degradation, and despair. After a pre-marriage affair with Di, a young Han man, she marries Zedan, a Tibetan, and her first real love. Disappointed by domestic life, she succumbs to temptation and has an extra-marital affair with Xu Nan in Shanghai. ...

  17. Cross-validation and hypothesis testing in neuroimaging: An irenic comment on the exchange between Friston and Lindquist et al.

    Science.gov (United States)

    Reiss, Philip T

    2015-08-01

    The "ten ironic rules for statistical reviewers" presented by Friston (2012) prompted a rebuttal by Lindquist et al. (2013), which was followed by a rejoinder by Friston (2013). A key issue left unresolved in this discussion is the use of cross-validation to test the significance of predictive analyses. This note discusses the role that cross-validation-based and related hypothesis tests have come to play in modern data analyses, in neuroimaging and other fields. It is shown that such tests need not be suboptimal and can fill otherwise-unmet inferential needs. Copyright © 2015 Elsevier Inc. All rights reserved.

  18. Versuchter Totschlag durch Manipulation der Organzuteilung für Transplantationen? / Detlev Sternberg-Lieben, Irene Sternberg-Lieben

    Index Scriptorium Estoniae

    Sternberg-Lieben, Detlev

    2018-01-01

    Saksamaa kõrgema kohtu otsusest, mis puudutab Göttingeni haiglas toimunud juhtumit, kus maksasiirdamine tehti alkohili tarbivale patsiendile, Saksmaal kehtestatud seaduse kohaselt tohib maksasiirdamise teha vaid siis, kui organi saaja ei ole kuus kuud alkoholi tarbinud. Lahendit vaata lk. 46-52

  19. Oluline lepingurikkumine taganemisõiguse eeldusena : [magistritöö] / Monika Palu ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Palu, Monika

    2009-01-01

    Olulise lepingurikkumise mõistest ja selle rakendusalast, objektiivsetest elementidest, tahtlusest või raskest hooletusest kohustuse rikkumisel olulise lepingurikkumise subjektiivsete elementidena, rikkumise liikidest

  20. Frantsiisilepingu eelne teavitamiskohustus : [bakalaureusetöö] / Epp Aasaru ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Aasaru, Epp

    2003-01-01

    Frantsiisilepingu olemus ja õiguslik reguleerimine, teavitamiskohustus, õiguskaitsevahendid teavitamiskohustuse rikkumisel (täitmisnõue, tehingu tühistamine, lepingust taganemine ja ülesütlemine, kahjuhüvitisnõuded)

  1. Gonzalez Gonzalez Irene, Spanish Education in Morocco, 1912-1956: Cultural Interactions in a Colonial Context (recension)

    OpenAIRE

    Seri-Hersch , Iris

    2015-01-01

    International audience; À l’aube du XXe siècle, l’Espagne en tant que puissance coloniale mondiale vacille suite à la perte de ses territoires antillais et océaniens au profit des États-Unis. L’impérialisme espagnol se recentre désormais sur le continent africain, tout en se heurtant aux ambitions rivales de la France, de la Grande-Bretagne et de l’Allemagne. Le Maroc constitue un théâtre majeur de ces rivalités inter-impériales. En 1912, une série de traités franco-hispano-marocains divise l...

  2. Versuchter Totschlag durch Manipulation der Organzuteilung für Transplantationen? / Detlev Sternberg-Lieben, Irene Sternberg-Lieben

    Index Scriptorium Estoniae

    Sternberg-Lieben, Detlev

    2018-01-01

    Saksamaa kõrgema kohtu otsusest, mis puudutab Göttingeni haiglas toimunud juhtumit, kus maksasiirdamine tehti alkoholi tarbivale patsiendile. Saksmaal kehtestatud seaduse kohaselt tohib maksasiirdamise teha vaid siis, kui organi saaja ei ole kuus kuud alkoholi tarbinud. Lahendit vt lk. 46-52

  3. VAT on leasing : [teadusmagistritöö] / Denis Polman ; Tartu Ülikool, õigusteaduskond ; juhendajad: Irene Kull, Lasse Lehis

    Index Scriptorium Estoniae

    Polman, Denis

    2003-01-01

    Liisingu mõiste erinevusi, liisingtehingute käibemaksustamise ülevaade, liisingutehingute käive Euroopa Liidu ühtse käibemaksusüsteemi seisukohalt, liisingu käibemaksukäsitlus Eestis. - Kaitses 16. 01. 2004. a. Tartu Ülikoolis

  4. Versuchter Totschlag durch Manipulation der Organzuteilung für Transplantationen? / Detlev Sternberg-Lieben, Irene Sternberg-Lieben

    Index Scriptorium Estoniae

    Sternberg-Lieben, Detlev

    2018-01-01

    Saksamaa kõrgema kohtu otsusest, mis puudutab Göttingeni haiglas toimunud juhtumit, kus maksasiirdamine tehti alkoholi tarbivale patsiendile, Saksmaal kehtestatud seaduse kohaselt tohib maksasiirdamise teha vaid siis, kui organi saaja ei ole kuus kuud alkoholi tarbinud. Lahendit vaata lk. 46-52

  5. IRET: requirements for service platforms

    OpenAIRE

    Baresi, Luciano; Ripa, Gianluca; Pasquale, Liliana

    2013-01-01

    peer-reviewed This paper describes IRENE (Indenica Requirements ElicitatioN mEthod), a methodology to elicit and model the requirements of service platforms, and IRET (IREne Tool), the Eclipse-based modeling framework we developed for IRENE

  6. Die Erfassung von städtischen Oberflächen mittels EDV-gestützter Luftbildauswertung : ein Beitrag zur klimatologischen und luftklimatischen Bewertung von städtischen Teilflächen

    Directory of Open Access Journals (Sweden)

    M. Sandtner

    Full Text Available The article shows that the computer-aided, analogous-visual, stereometric interpretation of large-scale colour-infrared (CIR aerial photographs and subsequent data processing in a Geographical Information System (GIS can provide fundamental data necessary to describe aspects of urban ecology in a scale relevant for city-planning. This is exemplified by an evaluation of urban areas concerning their climates and airpollution using maps of urban surfaces (scale1:2500. An argumentation relying on such detailed and current basic data can stress the importance of environmental aspects in contrast to competing public and private interests in the process of city planning.

  7. Erste Erfahrungen mit RDA an wissenschaftlichen Universalbibliotheken in Deutschland - Ergebnisse aus Fokusgruppengesprächen mit Katalogisierenden

    Directory of Open Access Journals (Sweden)

    Heidrun Wiesenmüller

    2017-04-01

    Full Text Available Einige Monate nach dem Umstieg auf das neue Regelwerk "Resource Description and Access" (RDA wurden an 18 großen deutschen wissenschaftlichen Universalbibliotheken Fokusgruppengespräche mit Katalogisierererinnen und Katalogisierern durchgeführt. Die Katalogisierenden wurden u.a. befragt, wie sicher sie sich bei der Anwendung von RDA fühlen, was sie am neuen Regelwerk gut oder schlecht finden, wie sie den Aufwand im Vergleich zum früheren Regelwerk RAK einschätzen, welche Informations- und Hilfsmittel sie verwenden und wie sie zu den regelmäßigen Änderungen im Standard stehen. Der vorliegende Aufsatz dokumentiert die Ergebnisse der Gespräche.   Several months after the introduction of the new cataloging standard "Resource Description and Access" (RDA, focus-group interviews with catalogers were conducted at 18 large academic and state libraries in Germany. Among other things, the catalogers were asked how confident they feel in applying RDA, which aspects of the new cataloging code they like or do not like, how they estimate the expenditure of time in comparison to the former cataloging code RAK, which sources they use to get help or information, and what they think about the frequent changes to the new standard. The paper presents the results of these interviews.

  8. Organisation der Lektoratsarbeit in Öffentlichen Bibliotheken, ihre Stärken und Schwächen

    OpenAIRE

    Umlauf, Konrad

    2011-01-01

    Die Praxis der Lektoratsarbeit an Öffentlichen Bibliotheken wurde 2010 mit einer Online-Befragung unter Biblothekspersonal erhoben. Die Fragen richten sich auf die Aufbauorganisation (Anteil der Lektoren unter dem Personal, den am Bestandsaufbau beteiligten Personalgruppen, die Lektoratsaufgaben im Einzelnen, typische Aufgaben der Lektoren neben den Lektoratsaufgaben, insbes. Verbindung von Lektoratsaufgaben mit Auskunftsdienst), die Ablauforganisation (Entscheidungsablauf und Kaufsitzungen, ...

  9. Chem TV: Choices I, v. 1.5.1 (by B. A. Luceigh, P. Ngo, and J. Chen)

    Science.gov (United States)

    Kraig Steffen, L.

    1999-08-01

    CHEM TV: Sunland, CA, 1998. 24.95, students; 59.95, faculty. This CD-ROM presents a series of interactive overviews and drills for students of organic chemistry. The material covered is generally taught in the first semester. This suite is much more than a simple presentation of material and, for students sufficiently motivated to take the time and work with the problems, will provide valuable review. Five interactive spaces are provided: concentration drills that emphasize recall of related structures/names, reagents/reactions, and stereochemistry; a structural review based on epinephrine; interactive synthesis projects; arcade game reagent review; and a set of timed self-tests. The CD-ROM installed and ran without problem on a Power PC Mac and on a Pentium running Windows 95. The program did fail to run when a student reviewing it switched to a very new version of Windows Quick Time. Most of the drills ran without a problem, although at times it was unclear how to respond to queries. I turned off the music, which would be much less annoying if the loops were simply longer. Publishers are flooding the market with add-on computer-based materials for the various levels of chemistry. Many constitute little more than a stack of overheads. This is one that may be of sufficient value to warrant the extra cost. A large number of examples are provided for many of the areas covered. Most of the graphical interfaces are clear and easy to manipulate, with the exception of a couple of mechanistic screens that had hard-to-figure-out arrows. Two sections, or modules, are of special note. The first of these is the synthesis challenges, where students must choose reactants, reagents, and reaction conditions for a particular reaction. These synthesis problems are well thought out and can be challenging. It is unfortunate that there are only five of them. The Self-Tests module is also of great practical value, forcing students to work through a variety of topics (200 problems) with limited time allotted per test. The structures are clear and easy to view and include a large number of three-dimensional molecular models that help make the connection between simple line drawings and actual molecules. More feedback information on incorrect answers would be nice, although it is obvious that this can balloon into an unworkable situation if every possible "wrong" answer is considered. The structure summary, which uses a single complicated molecule to review a large range of structural topics, is a good integrated look at bonding, stereochemistry, and conformational analysis. The concentration game is informative, albeit a bit obtuse on a few of the answers! The selection drills, a shooting gallery game with various chemical targets, seems a bit silly, but then if one can learn to recognize all the major reducing agents by snagging butterflies with faux nets than this could be helpful! With its varying levels of difficulty, this set of modules should be accessible even to weaker students and yet will provide a challenge for the more advanced. A great future addition would be an interactive module builder that allows faculty to modify existing questions and add their own. How can one effectively use this program? The relatively low cost does make it accessible for individual students to purchase, perhaps as a "recommended" item for the class. Another very practical option is to purchase 5-10 copies (assuming a class size of around 30-40) and make them available through a common computer laboratory (or an appropriate network site-license arrangement) or for check-out to small groups of students. One drawback is that only about 1/3 of the major topics that fill the year in organic are covered. I have used some of the drills as in-class interactive examples with a projector and laptop. This type of interactive tutorial-quiz-based program is a welcome change from the simple textbook on a CD-ROM approach. Given easy access to computers and an environment that encourages individual and small-group interactions, I believe this program can be a worthwhile aid for students of organic chemistry.

  10. Helical Magnetic Fields in AGN Jets Y. J. Chen1,2,∗ , G.-Y. Zhao1,2 ...

    Indian Academy of Sciences (India)

    Abstract. We establish a simple model to describe the helical mag- netic fields in AGN jets projected on the sky plane and the line-of-sight. This kind of profile has been detected in the polarimetric VLBI observa- tion of many blazar objects, suggesting the existence of helical magnetic fields in these sources. Key words.

  11. VizieR Online Data Catalog: New IR photometric study of Ap and Am stars (Chen+, 2017)

    Science.gov (United States)

    Chen, P. S.; Liu, J. Y.; Shan, H. G.

    2018-05-01

    In the General Catalog of Ap and Am stars (Renson & Manfroid 2009, Cat. III/260) 8265 stars are included in which, as Renson & Manfroid (2009, Cat. III/260) described, only 426 stars are of the "well known confirmed sample". We take these 426 stars as our working sample. The cross-identifications of 2MASS/WISE counterparts for all Ap, Am, and HgMn stars listed in this paper are made from Cutri et al. (2012, Cat. II/311) by using the radius of 2 arcsec. All 426 Ap, Am, and HgMn stars have 2MASS and/or WISE counterparts, which are listed in Table 3. The cross-identifications of IRAS counterparts are made according to the positional error ellipse of the source, because it has a 95% confidence level (IRAS Explanatory Supplement, Beichman et al. 1988, Cat. II/274). Finally, 202 stars are found to have the IRAS counterparts from IRAS PSC/FSC, which is listed in Table 4. (5 data files).

  12. J. Chen1, Z.-Q. Shen1, H. Sudou3, S. Iguchi4, Y. Murata5

    Indian Academy of Sciences (India)

    4National Astronomical Observatory of Japan, Tokyo 181-8588, Japan. 5The Institute of Space and Astronautical Science, JAXA, Kanagawa 229-8510, Japan. 6Research Center for Space and Cosmic Evolution, Ehime University,. Matsuyama 790-8577, Japan. ∗ e-mail: gyzhao@shao.ac.cn. Abstract. It was argued that 3C ...

  13. X-ray Time Lags in TeV Blazars X. Chen1,∗ , G. Fossati1, E. Liang1 ...

    Indian Academy of Sciences (India)

    Abstract. We use Monte Carlo/Fokker–Planck simulations to study the. X-ray time lags. Our results show that soft lags will be observed as long as the decay of the flare is dominated by radiative cooling, even when acceleration and cooling time scales are similar. Hard lags can be pro- duced in the presence of a competitive ...

  14. Trichodina nobilis Chen, 1963 and Trichodina reticulata Hirschmann et Partsch, 1955 from ornamental freshwater fishes in Brazil

    Directory of Open Access Journals (Sweden)

    ML Martins

    Full Text Available In the present work Trichodina reticulata and T. nobilis (Ciliophora: Trichodinidae are morphologically characterised from ornamental freshwater fish culture in the State of Santa Catarina, Brazil. The prevalence of infection and a list of comparative measurements are discussed. We examined "southern platyfish" Xiphophorus maculatus (n = 35, "goldfish" Carassius auratus (n = 31, "guppy" Poecilia reticulata (n = 20, "sailfin molly" Poecilia latipinna (n = 6, "beta" Betta splendens (n = 2 and "spotted headstander" Chilodus punctatus (n = 1. After being anesthetised in a benzocaine solution, fishes were examined for parasitological evaluation. A total of 51.57% fishes were parasitised by Trichodina spp. Carassius auratus was the most parasitised species, followed by X. maculatus and P. reticulata. Beta splendens, C. punctatus and P. latipinna were not parasitised by any trichodinid species. Two species of Trichodina were collected from the skin of fish: T. nobilis was found in C. auratus, P. reticulata and X. maculatus and T. reticulata was only observed in C. auratus. The importance of adequate handling in ornamental fish culture are also discussed.

  15. Lepingust taganemisest olulise lepingurikkumise tõttu modernses lepinguõiguses : [bakalaureusetöö] / Marko Mehilane ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Mehilane, Marko, 1978-

    2003-01-01

    Lepingust taganemine olulise lepingurikkumise tõttu ÜRO rahvusvaheliste müügilepingute konventsioonis, UNIDROIT rahvusvaheliste kaubanduslepingute printsiipides, Euroopa lepinguõiguse printsiipides ja võlaõigusseaduses, oluline lepingurikkumine - võimalus ühetaoliseks tõlgendamiseks

  16. Õiguste kuritarvitamise keeld Eesti tsiviilõiguses : [bakalaureusetöö] / Gerly Lõhmus ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Lõhmus, Gerly, 1988-

    2010-01-01

    Õiguste kuritarvitamise keelust Eesti tsiviilõiguses, kohaldamise eeldustest, liikidest. Õiguste kuritarvitamisest kahju tekitamise eesmärgil, tagajärgedest, eristamisest heade kommete vastasest käitumisest

  17. EMC3-eIRENE simulation of impurity transport in comparison with EUV emission measurements in the stochastic layer of LHD: effects of force balance and transport coefficients

    Energy Technology Data Exchange (ETDEWEB)

    Dai, S. [National Institute for Fusion Science, Toki (Japan); Key Laboratory of Materials Modification by Laser, Ion and Electron Beams (Ministry of Education), School of Physics and Optoelectronic Technology, Dalian University of Technology, Dalian (China); Kobayashi, M.; Morita, S.; Oishi, T.; Suzuki, Y. [National Institute for Fusion Science, Toki (Japan); Department of Fusion Science, School of Physical Sciences, SOKENDAI (The Graduate University for Advanced Studies), Toki (Japan); Kawamura, G. [National Institute for Fusion Science, Toki (Japan); Zhang, H.M.; Huang, X.L. [Department of Fusion Science, School of Physical Sciences, SOKENDAI (The Graduate University for Advanced Studies), Toki (Japan); Feng, Y. [Max-Planck-Institut fuer Plasmaphysik, Greifswald (Germany); Wang, D.Z. [Key Laboratory of Materials Modification by Laser, Ion and Electron Beams (Ministry of Education), School of Physics and Optoelectronic Technology, Dalian University of Technology, Dalian (China); Collaboration: The LHD experiment group

    2016-08-15

    The transport properties and line emissions of the intrinsic carbon in the stochastic layer of the Large Helical Device have been investigated with the three-dimensional edge transport code EMC3-EIRENE. The simulations of impurity transport and emissivity have been performed to study the dedicated experiment in which the carbon emission distributions are measured by a space-resolved EUV spectrometer system. A discrepancy of the CIV impurity emission between the measurement and simulation is obtained, which is studied with the variation of the ion thermal force, friction force and the perpendicular diffusivity in the impurity transport model. An enhanced ion thermal force or a reduced friction force in the modelling can increase the CIV impurity emission at the inboard X-point region. Furthermore, the impact of the perpendicular diffusivity Dimp is studied which shows that the CIV impurity emission pattern is very sensitive to Dimp. It is found that the simulation results with the increased Dimp tend to be closer to the experimental observation. (copyright 2016 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)

  18. Elukutselise võistkonnasportlase õiguslikust seisundist ja õiguste kaitsest : [bakalaureusetöö] / Liina Teras ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Teras, Liina

    1999-01-01

    Spordisuhete reguleerimisest: seadusandlik, spordisisene, lepinguõiguslik. Võistkonnasportlase õiguslik seisund, mängijaleping - sõlmimine, poolte kohustused, lepingu rikkumine ja lõpetamine, kahju hüvitamine, õigusvaidluste lahendamine ja kohtupraktika

  19. Nõudeõiguse loovutamine ja võla ülekandmine : [bakalaureusetöö] / Liina Pohlak ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Pohlak, Liina

    1995-01-01

    Nõudeõiguse loovutamine (ajalooline kujunemine, mõiste ja tingimused, vorminõuded, loovutamise kord, tagajärjed, võlgniku kaitse), võla ülekandmine (ajalooline kujunemine, mõiste, kord, tagajärjed). Vt. ka: Juridica (1995) nr. 6, lk. 238-240

  20. Korteriomandist tulenevad õigussuhted (probleemide võrdlev käsitlus) : [bakalaureusetöö] / Kaupo Paal ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Paal, Kaupo, 1977-

    2000-01-01

    Korteriomandi kujunemine, eeldused, põhjused, ajaloolis-võrdlev ülevaade, korteriomandi olemus - sellest tulenevad õigused ja kohustused, korteriomanike ühisus Saksamaal, Šveitsis, Skandinaaviamaades, Eestis

  1. Sõltuvussuhtes sõlmitud käendusleping : [magistritöö] / Laura Kask ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Kask, Laura, 1988-

    2013-01-01

    Käendusest kui isiklikust tagatisest, perekondlikest sõltuvussuhetest käenduslepingus, sõltuvussuhtest juriidiliste isikute kohustuste käendamisel, sõltuvussuhtes sõlmitud globaalsest tagatiskokkuleppest

  2. Hard to Believe : Produced by Ken Stone and Irene Silber, 2015, Swoop Films and Stone Soup Productions (New York, 56 minutes, unrated).

    Science.gov (United States)

    Northam, Holly Louise

    2016-06-01

    This article presents a review of Hard to Believe, a compelling documentary reporting the forced organ procurement and death of Chinese prisoners of conscience. The documentary is targeted to ignite political and public pressure to stop these practices that are thought to be motivated by financial and political gain. Narrated by journalist and author Ethan Gutmann, the documentary pricks at the collective conscience, as credible witnesses provide evidence that point to an abrogation of every ethical principle ascribed to legitimate organ procurement.

  3. Väärtpaberite pantimise õiguslikud aspektid : [bakalaureusetöö] / Ardo-Heiki Ingar ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Ingar, Ardo-Heiki

    2006-01-01

    Väärtpaberitagatistest Eesti õiguskorras, tagamistehingud ja tagatised, väärtpaberitehingute tagamine pandiga, Euroopa Parlamendi ja nõukogu finantstagatiskokkulepete direktiivi rakendamine Eesti õiguskorras, Eesti väärtpaberitagatiste regulatsiooni vastavus EBRD poolt

  4. Rezension von: Julia Reuter, Paula-Irene Villa (Hg.: Postkoloniale Soziologie. Empirische Befunde, theoretische Anschlüsse, politische Intervention. Bielefeld: transcript Verlag 2010.

    Directory of Open Access Journals (Sweden)

    Ruth Streicher

    2010-05-01

    Full Text Available Welche Inspirationen und Anforderungen ergeben sich aus dem Projekt der ‚Dekolonisierung‘ der Soziologie auf der theoretischen, konzeptionellen und empirischen Ebene für die deutsche soziologische Debatte? Die im Band versammelten Beiträge bieten erste Versuche zur Beantwortung dieser Fragen. Während Selbstreflexivität großgeschrieben wird, mangelt es auch diesem Band noch an empirischer Fundierung der postkolonialen Kritik.

  5. Teavitamiskohustus ja tarbija kaitse elektrooniliste sidevahendite kaudu sõlmitavates lepingutes (direktiivi ettepanek) : [bakalaureusetöö] / Erik Salur ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Salur, Erik

    2009-01-01

    Tarbijakaitselistest eesmärkidest teavitamiskohustuse kehtestamisel, elektrooniliste sidevahenditega sõlmitud lepingutest kui reguleerimisobjektidest, nõuetest edastatava teabe sisule ja vormile, teavitamiskohustuste rikkumise tagajärgedest

  6. Pilveteenuse osutamisel tekkiva õigussuhte kvalifitseerimine Eesti õiguses : [magistritöö] / Kristel Tuul ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Tuul, Kristel, 1990-

    2014-01-01

    Pilveteenuse mõistest ja pilveteenuste liikidest, pilveteenuse osutamisel sõlmitava lepingu esemest, pilveteenuse lepingu subjektidest, pilveteenuse lepingu sisu kujunemisest, pilveteenuse lepingu sisu vastavusest litsentsi-, teenuse osutamise ja kasutuslepingu tunnustele

  7. Hepatit A geçiren hastada akut ürtiker ve Guillain-Barre like sendromun birlikteliği

    OpenAIRE

    GERENLİ, Nelgin Esenrodoplu; GÜVEN, Feray; UYGUR, Nihan; AKYÜZ, Ümit; SAY, Aysu

    2004-01-01

    Hepatitis A infection (HAV) may present with extrahepatic manifestations rather than causing typical hepatitis. These are: urticarial rash, vasculitis, arthritis, transient arthralgia, hemolytic anemia, thrombocytopenia, cryoglobulinemia, . Guillain-Barre Syndrome and polymyositis. We report a case of 4.5 years old boy with a rare association of acute HAV infection and urticarial rash accompanied by Guillain-Barre like Syndrome.

  8. Eluruumi kvaliteedi mittevastavus lepingutingimustele müüja ja kinnisvaramaakleri vastutuse alusena : [magistritöö] / Monika Pihlak ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Pihlak, Monika, 1990-

    2015-01-01

    Kinnisasjadele eluruumidena esitatavatest nõuetest, ostja teadmisest või teadma pidamisest asja mittevastavusest, müüja teavitamiskohustusest, VÕS § 218 lg 1 kui vastutusstandardist ja rikkumisele tuginemisest, maakleri teavitamiskohustusest ja selle rikkumise tagajärgedest

  9. Kohustiste mittetäitmine ja selle õiguslikud tagajärjed : [bakalaureusetöö] / Krista Soa ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Soa, Krista

    1995-01-01

    Kohustiste mittetäitmise mõiste, liigid ja õiguslikud tagajärjed, kahjude hüvitamise kohustus kohustise mittetäitmisel, natuuras täitmisele sundimine ja ühepoolse lõpetamise õigus kohustise mittetäitmisel

  10. Hoiuleping - Rooma eraõigusest võlaõigusseaduse eelnõuni : [bakalaureusetöö] / Ergo Blumfeldt ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Blumfeldt, Ergo, 1975-

    2000-01-01

    Hoiulepingu piiritlemine tänapäeva võlaõigusseaduse süsteemis, hoiulepingu kui iseseisva lepinguliigi väljakujunemine Rooma õiguses, hoiuleping kehtivas õiguses ning võlaõigusseaduse eelnõus

  11. Eluasemelaenu lepingupoolte huvide kaitse - abinõude kriitika ja lahendused : [bakalaureusetöö] / Susann Mikli ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Mikli, Susann, 1988-

    2010-01-01

    Eluasemelaenu lepingust ja täitmise tagamisest, krediidiandja ja krediidisaaja positsioonist eluasemelaenulepingu sõlmimisel, eluasemelaenu tagamise probleemi lahendustest Euroopa riikides, lahendusvõimalustest Eesti õiguses

  12. Vastuväited globaalse tagatiskokkuleppe realiseerimisnõudele : [magistritöö] / Kaspar Koppel ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Koppel, Kaspar, 1988-

    2014-01-01

    Globaalsest tagatiskokkuleppe mõistest ja kasutamisest, globaalse tagatiskokkuleppe tühisusest vastuolu tõttu heade kommetega, globaalse tagatiskokkuleppe tühisusest tüüptingimusena ja vastuolust hea usu põhimõttega

  13. Kohustiste täitmine ja tagamise vahendid : [bakalaureusetöö] / Marek Sepp ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Sepp, Marek

    1994-01-01

    Kohustiste täitmine, nõuetekohase täitmise printsiip, vastastikune täitmine, deponeerimine, kohustiste täitmine natuuras; kohustiste täitmise tagamine (käendus, garantii, leppetrahv, käsiraha, pant)

  14. Die bydrae van enkele liggaamlike opvoedkundiges tot die ontwikkeling van die vak in Suid-Afrika vanaf die begin van die twintigste eeu / Rosalie Irene de Klerk

    OpenAIRE

    De Klerk, Rosalie Irene

    1986-01-01

    The main objective of this study was to document, systematize and analyse the contributions of some leading Physical Educationists to the establishment and development of Physical Education in South Africa. The main methodological approach used to realise this objective was the historical-analytical method, by which the data were systematized and analysed thematically and chronologically. With a view to the systematization of data, tilt! following main aspects were chosen ac...

  15. Üürniku poolt asjale tehtud kulutuste hüvitamine : [magistritöö] / Kristjan Mugra ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Mugra, Kristjan

    2011-01-01

    Kulutuste hüvitamise eesmärgist, lepingulisel alusel hüvitamisele kuuluvatest kulutustest, asja omaniku nõusolekul tehtud muudatuste ja parenduste hüvitamisest, nõuetest lepinguvälistel alustel

  16. Seaduses kohustuse kohta sätestatu kohaldamine mittetäielikele kohustustele : [bakalaureusetöö] / Glen Roosaar ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Roosaar, Glen, 1986-

    2013-01-01

    Eraõiguse üldsätete kohaldamisest mittetäielike kohustustele, õiguspõhimõtete rollist mittetäielike kohustuste sisustamisel, kohustuse rikkumisest ja vastutuse sätete kohaldamisest mittetäielikele kohustustele, mittetäieliku kohustuse ümberkujundamisest täielikuks kohustuseks

  17. Association between previously identified loci affecting telomere length and coronary heart disease (CHD in Han Chinese population

    Directory of Open Access Journals (Sweden)

    Ding H

    2014-05-01

    Full Text Available Hui Ding,1 Fen Yan,1 Lin-Lin Zhou,2 Xiu-Hai Ji,3 Xin-Nan Gu,1 Zhi-Wei Tang,1 Ru-Hua Chen11Department of Pulmonary Medicine, The Affiliated Yixing People's Hospital, Jiangsu University, Zhenjiang, Jiangsu Province, 2Department of Cardiology, Affiliated Cixi Hospital, Wenzhou Medical University, Wenzhou, Zhejiang Province, 3Department of Oncology, Affiliated Taicang Hospital of Traditional Chinese Medicine, Suzhou, Jiangsu Province, People's Republic of ChinaPurpose: To replicate previously confirmed telomere-length loci in a Chinese Han population with coronary heart disease (CHD, and investigate these loci and the possibility of and age at onset of CHD.Patients and methods: 1514 CHD patients and 2470 normal controls were recruited. Medical data including age, sex, body mass index, lipid profiles, history of hypertension, type 2 diabetes mellitus, and dyslipidemia were collected from all the participants. Seven previously identified single-nucleotide polymorphisms (SNPs related to leucocyte telomere length were genotyped, including rs10936599 in TERC, rs2736100 in TERT, rs7675998 in NAF1, rs9420907 in OBFC1, rs8105767 in ZNF208, rs755017 in RTEL1, and rs11125529 in ACYP2.Results: No significant difference in genotype frequencies from the Hardy–Weinberg equilibrium test was noted for all tested SNPs both in the CHD patients and the normal controls. No polymorphism was observed for rs9420907, and AA genotype was noted in both the CHD patients and the controls. Neither the genotype nor the allele frequencies of rs2736100, rs8105767, rs11125529, and rs2967374 were significantly different between the CHD patients and the normal controls. For rs10936599 and rs755017, statistical difference was found for the allele frequency but not genotype. Distributions of genotype and allele were significantly different between the two groups for rs7675998. The odds ratio for carriers of CHD was 2.127 (95% confidence interval: 1.909–2.370 for the A allele of rs

  18. On Meng Chen-shun's Romance Theory and His Opera and Drama Greation%孟称舜"传情"理论及其戏曲创作

    Institute of Scientific and Technical Information of China (English)

    刘伟

    2002-01-01

    孟称舜戏曲深受汤显祖的影响,前期剧作和"传情"理论表现出对"至情"的赞颂和对封建礼教的批判.作为生活在明清易代时期的落魄文人,他又与那个时代和环境紧密相连,由于受到当时社会、思想等多种因素的影响,其传情理论和戏曲创作都发生了很大的变化.他以"诚"为主体,他"情正"与"言道"结合的"言情"倾向,是他的特色,也是他的局限.

  19. 论陈亮事功主义伦理思想的基本特征%On Chen Liang's Essential Features of Utilitarian Ethics

    Institute of Scientific and Technical Information of China (English)

    朱晓鹏

    2005-01-01

    陈亮是永康学派的创始人.他的事功主义伦理思想的基本特征是"理欲统一"的道德观、"义利合一"的价值观和"学为成人"的人生观.这种事功主义伦理思想具有创新精神,对中国传统的伦理观是一种挑战,对后世产生了深远的影响.

  20. Diskrepanz: Die EU-Frauenpolitik zwischen Deregulierung und Gleichheitsansprüchen Internal Discrepancies: EU Women’s Policies between Deregulation and Claims to Equality

    Directory of Open Access Journals (Sweden)

    Ingrid Biermann

    2003-03-01

    Full Text Available In von neun Autorinnen verfassten Beiträgen gibt der Band Einblicke in zentrale Felder der EU-Politik: die europäische Wirtschafts- und Währungsunion (EWWU, die Strukturpolitik, die Gleichstellungspolitik und das Gender Mainstreaming, die Osterweiterung sowie die Ausarbeitung einer europäischen Verfassung. Damit werden wesentliche Teile des Maastricht-Vertrags (1992, des Amsterdamer Vertrags (1997 und des Nizza-Vertrags (2000 behandelt. Hierdurch bildet dieser Band eine wichtige Grundlage für die Diskussion über die Frauenpolitik der EU.This anthology, consisting of nine essays written by women authors, offers insights into central areas of EU politics: the European Economic and Currency Union, structural policies, policies dealing with gender equality, the expansion of the EU, as well as the creation of a new European constitution. These policies include relevant parts of the 1992 Maastricht Treaty, the 1997 Treaty of Amsterdam, and the 2000 Treaty of Nizza. The information and insights presented here make this book an important basis for any discussions about EU women’s policies.

  1. Bya rog prog zhu, The raven crest : the life and teachings of bDe chen 'od gsal rdo rje treasure revealer of contemporary Tibet

    NARCIS (Netherlands)

    Terrone, Antonio

    2010-01-01

    This research starts from the historical assertion that notwithstanding their claim of increased religious tolerance, the dramatic post-Mao political campaigns have continued to weaken the pervasive force of religious faith, traditional monastery-centered religious power, religious leadership, and

  2. Discussion of “Nanoscale Fluid Mechanics and Energy Conversion” (Chen, X., Xu, B., and Liu, L., 2014, ASME Appl. Mech. Rev., 66(5), p. 050803)

    NARCIS (Netherlands)

    Eijkel, Jan C.T.

    2014-01-01

    The authors of the paper “Nanoscale Fluid Mechanics and Energy Conversion” have presented an overview of recent applications of nanofluidic phenomena for energy conversion and storage. The discussion given here aims to place this paper in a broader context of literature and theory.

  3. Redescription of Paragaleus tengi (Chen, 1963) (Carcharhiniformes: Hemigaleidae) and first record of Paragaleus randalli Compagno, Krupp & Carpenter, 1996 from the western North Pacific.

    Science.gov (United States)

    White, William T; Harris, Mark

    2013-01-01

    Paragaleus tengi was previously considered to be the only member of this genus occurring in the Western Pacific, with Paragaleus randalli occurring in the Indian Ocean and allopatric in distribution. Recent molecular and morphological studies showed that P. randalli also occurs in the Western Pacific with records from Thailand, Malaysia and Indonesia previously mostly incorrectly attributed to P. tengi. This paper provides a redescription of P. tengi and confirms the presence of P. randalli from off Taiwan in the western North Pacific. These two species are morphologically very similar in appearance but differ in meristics, dentition, some coloration attributes and minor morphological characters. The conservation status of these two species needs to be reassessed based on this new information.

  4. How Structural Deficiencies Hamper Estonia’s Catching-up Process. Strukturschwächen als Hemmnis für Estlands Aufholprozess

    Directory of Open Access Journals (Sweden)

    Klaus Schrader

    2016-10-01

    Full Text Available Estonia is widely regarded as a paramount example for a successful transformation of a socialist economic system to a functioning market economy. Against the backdrop of this positive image which contrasts strongly with the crisis scenarios in Southern Europe the remaining problems of Estonia are often ignored. Estonia has hardly succeeded in catching-up economically with the richer countries of the EU. In this paper the authors raise the question why the catching-up process of Estonia is not as successful as it could have been expected from the policy performance during the last decades. It turns out that Estonia faces a serious productivity problem, particularly in the manufacturing sector producing tradable goods which is normally the driving engine behind economic and technological catching-up. The Estonian economy has failed to undergo the necessary structural change towards technologically more advanced employment structures and export patterns. Accordingly, Estonian economic policy needs to create a suitable business environment to support this kind of structural change.

  5. 78 FR 79059 - Public Notice for Waiver of Aeronautical Land-Use Assurance

    Science.gov (United States)

    2013-12-27

    ..., Irene Porter, Program Manager, 11677 South Wayne Road, Suite 107, Romulus, Michigan 48174 Telephone... Porter, Program Manager, Federal Aviation Administration, Airports District Office, 11677 South Wayne.... FOR FURTHER INFORMATION CONTACT: Irene Porter, Program Manager, Federal Aviation Administration...

  6. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 95; Issue 1. Distribution and linkage disequilibrium analysis of polymorphisms of GH1 gene in different populations of pigs associated with body size. Yunyun Cheng Songcai Liu Dan Su Chao Lu Xin Zhang Qingyan Wu Siming Li Haoyu Fu Hao Yu Linlin Hao. Research Article ...

  7. New World species of the genus Calliscelio Ashmead (Hymenoptera, Platygastridae, Scelioninae

    Directory of Open Access Journals (Sweden)

    Hua-yan Chen

    2017-01-01

    Full Text Available The genus Calliscelio Ashmead is presumed to be a diverse group of parasitoids of the eggs of crickets (Orthoptera: Gryllidae. A least one species has been found to be an important factor in depressing cricket pest populations. The New World species of Calliscelio are revised. Forty-two species are recognized, 3 are redescribed: C. bisulcatus (Kieffer, C. laticinctus Ashmead, C. rubriclavus (Ashmead, comb. n.; and 38 are described as new: C. absconditum Chen & Johnson, sp. n., C. absum Chen & Johnson, sp. n., C. alcoa Chen & Masner, sp. n., C. amadoi Chen & Johnson, sp. n., C. armila Chen & Masner, sp. n., C. bidens Chen & Masner, sp. n., C. brachys Chen & Johnson, sp. n., C. brevinotaulus Chen & Johnson, sp. n., C. brevitas Chen & Johnson, sp. n., C. carinigena Chen & Johnson, sp. n., C. crater Chen & Johnson, sp. n., C. crena Chen & Johnson, sp. n., C. eboris Chen & Johnson, sp. n., C. extenuatus Chen & Johnson, sp. n., C. flavicauda Chen & Johnson, sp. n., C. foveolatus Chen & Johnson, sp. n., C. gatineau Chen & Johnson, sp. n., C. glaber Chen & Masner, sp. n., C. granulatus Chen & Masner, sp. n., C. latifrons Chen & Johnson, sp. n., C. levis Chen & Johnson, sp. n., C. longius Chen & Johnson, sp. n., C. magnificus Chen & Masner, sp. n., C. migma Chen & Johnson, sp. n., C. minutia Chen & Johnson, sp. n., C. paraglaber Chen & Johnson, sp. n., C. pararemigio Chen & Masner, sp. n., C. prolixus Chen & Johnson, sp. n., C. punctatifrons Chen & Johnson, sp. n., C. remigio Chen & Masner, sp. n., C. ruga Chen & Johnson, sp. n., C. rugicoxa Chen & Masner, sp. n., C. sfina Chen & Johnson, sp. n., C. storea Chen & Johnson, sp. n., C. suni Chen & Johnson, sp. n., C. telum Chen & Johnson, sp. n., C. torqueo Chen & Johnson, sp. n., C. virga Chen & Johnson, sp. n. Four species are treated as junior synonyms of Calliscelio rubriclavus (Ashmead: Anteris nigriceps Ashmead, syn. n., Caloteleia marlattii Ashmead, syn. n., Caloteleia grenadensis Ashmead, syn. n

  8. Commentary on: "An integrated metabolic atlas of clear cell renal cell carcinoma." Hakimi AA, Reznik E, Lee CH, Creighton CJ, Brannon AR, Luna A, Aksoy BA, Liu EM, Shen R, Lee W, Chen Y, Stirdivant SM, Russo P, Chen YB, Tickoo SK, Reuter VE, Cheng EH, Sander C, Hsieh JJ.: Cancer Cell. 2016 Jan 11;29(1):104-16.

    Science.gov (United States)

    Lee, Byron H

    2017-09-01

    Dysregulated metabolism is a hallmark of cancer, manifested through alterations in metabolites. We performed metabolomic profiling on 138 matched clear cell renal cell carcinoma (ccRCC)/normal tissue pairs and found that ccRCC is characterized by broad shifts in central carbon metabolism, one-carbon metabolism, and antioxidant response. Tumor progression and metastasis were associated with metabolite increases in glutathione and cysteine/methionine metabolism pathways. We develop an analytic pipeline and visualization tool (metabolograms) to bridge the gap between TCGA transcriptomic profiling and our metabolomic data, which enables us to assemble an integrated pathway-level metabolic atlas and to demonstrate discordance between transcriptome and metabolome. Lastly, expression profiling was performed on a high-glutathione cluster, which corresponds to a poor-survival subgroup in the ccRCC TCGA cohort. Copyright © 2017 Elsevier Inc. All rights reserved.

  9. Uso de plâncton silvestre, fermento fresco e levedura desidratada na alimentação de larvas do cascudo chinelo, Loricariichthys platymetopon (Isbrüchen & Nijssen, 1979 (Osteichthyes, Loricariidae Natural plankton, fresh ferment and dehydrated yeast utilization at Loricariichthys platymetopon (Isbrüchen & Nijssen, 1979 (Osteichthyes, Loricariidae, cascudo chinelo, fry feeding

    Directory of Open Access Journals (Sweden)

    Claudemir Martins Soares

    2002-05-01

    Full Text Available Objetivando avaliar a utilização de diferentes alimentos para larvas do cascudo chinelo Loricariichthys platymetopon (Osteichthyes, Loricariidae, 240 larvas com cinco dias pós-eclosão foram distribuídas em 20 aquários (12 L. Foram utilizados cinco tratamentos com quatro repetições cada, os quais consistiram do emprego de diferentes tipos de alimentos como: plâncton (P, fermento (F, levedura desidratada (LD e as combinações P+F e P+LD por 15 dias consecutivos. O F e a LD foram fornecidos à vontade três vezes ao dia, enquanto o P foi fornecido pela manhã, após os aquários serem sifonados. Os valores da temperatura, pH, condutividade elétrica e oxigênio dissolvido se mantiveram dentro de níveis aceitáveis para a aquicultura. Os valores de biomassa/aquário das larvas alimentadas com P+LD foram superiores aos dos alimentados com P, F e P+F, entretanto não diferiram daqueles com o uso de LD. As larvas alimentadas com P+LD apresentaram valores de peso final médio superiores às dos demais tratamentos, sendo que F levou a valores de peso final médio inferiores em comparação ao uso de P, LD e P+F. Observou-se menor sobrevivência com o uso de P em comparação a LD e P+LD. Conclui-se que se pode utilizar P+LD na criação do cascudo chinelo em suas fases iniciais de desenvolvimento.Aiming to evaluate different foods effects in the rearing of Loricariichthys platymetopon (Osteichthyes, Loricariidae fry, 240 5-day-after-hatch specimens were distributed in 20 aquarium glasses (12 L. Five treatments, with four repetitions each, were tested, consisting in: plankton (P, fresh ferment (F, dehydrated yeast (DY and the combinations P+F and P+DY, for 15 days. F and DY were given ad libitum three times a day, and P only in the morning, after the aquariums siphoning. Temperature, pH, electric conductivity and dissolved oxygen were in levels acceptable for fish. The fry biomass per aquarium values were higher for the P + DY treatment, when compared to P, F and P+F, but equal to DY. Also, P +DY-fed fry showed higher mean final weight than all the other treatments. F-treated fry showed mean final weight lower than the ones treated with P, DY and P+F. The P treatment showed lower survival rate than DY and P+DY. The results indicate that P + DY can be used for Loricariichthys platymetopon fry rearing during their initial development phases.

  10. 研究/電子資源使用統計標準與規範之探討/陳雪華;許嘉珍;朱雅琦 | Study of the Electronic Resources Usage Statistics Standards and Guidelines/ Hsueh-Hua Chen;Chia-Chen Hsu;Ya-Chi Chu

    Directory of Open Access Journals (Sweden)

    陳雪華、許嘉珍、朱雅琦

    2007-04-01

    Full Text Available

    近年來,由於資訊科技的進步,圖書館中的電子資源數量快速增加,所佔預算金額比例也大幅增長。圖書館希望能夠透過評鑑電子資源的使用,以便能夠在電 子資源館藏發展等方面做出正確的決策。由於體認到電子資源使用統計之重要性,圖書館界與相關組織紛紛發展或修訂圖書館統計標準,增列電子資源使用統計的項 目以充分反映圖書館電子資源使用之狀況。本文主要採用文獻分析法以及內容分析法,收集探討並比較近軍來國內外電子資源使用統計之相關規範及標準,包含 ISO 2789、 ICOLC Guidelines、州ANSI/NISO Z39.7、CNS13151、ARL E-Metrlcs、E-Measures Project、以及Project COUNTER等。

    Recently, due to the advances of information technology, electronic resources are gradually replacing print resources as the largest consumer of library acquisition budgets. Logically, libraries want to evaluate the usage of electronic resources and incorporate the results into their decision making regarding electronic resource acquisition. Over these years, there is a general awareness among libraries to develop statistics standards and guidelines for library electronic resources usage. In this paper, literature review and content analysis methods are used to compare several library statistics standards, including: ISO 2789 、ICOLC Guidelines、ANSI/NISO Z39.7、CNS13151、ARL E-Metrics、E-Measures Project、and Project COUNTER etc.

    頁次:89-102

  11. Privaatautonoomia piiramine hinna ja saadava väärtuse vahekorra määramisel : [magistritöö] / Vadim Doronin ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Doronin, Vadim

    2010-01-01

    Privaatautonoomia põhimõttest ja õigluse argumendist lepingu sisu hindamisel. Ajaloolises perspektiivis privaatautonoomia põhimõttest ning hinna ja saadava väärtuse vahekorrast lepingus. Liigkasuvõtmisest

  12. Hinnanguvõimalusega tühiste tüüptingimuste näidiskataloog võlaõigusseaduse eelnõus : [bakalaureusetöö] / Kaidi Meristo ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Meristo, Kaidi

    2000-01-01

    Tüüptingimuste registreerimise tähtsus, mõiste, üldised nõuded kehtivuseks, ebamõistlik või ebapiisavalt määratud tähtaeg, lepingutingimuste ühepoolse muutmise õigus, tahteavalduse fiktsioon, ebamõistlikult suur summa

  13. GÉNERO Y FAMILIA PODER, AMOR Y SEXUALIDAD EN LA CONSTRUCCIÓN DE LA SUBJETIVIDAD. MABEL BURIN E IRENE MELER, PAIDOS, PSICOLOGÍA PROFUNDA, BUENOS AIRES, BARCELONA, MÉXICO, 1998.

    Directory of Open Access Journals (Sweden)

    María Himelda Ramírez

    2012-03-01

    Full Text Available El texto está estructurado en cuatro partes cada una de ellas conformada por varios artículos expuestos en los seminarios, en las cuales se plantea desde una perspectiva interdisciplinaria, una lectura sobre la construcción histórica de las subjetividades masculinas y femeninas. Tratan como referentes de esa construcción las diferentes formas de familiarización en las culturas que inciden en las nuevas estructuraciones de las masculinidades y las feminidades. Las relaciones de pareja y las relaciones filiales, constituyen los ejes principales de las reflexiones expuestas en el texto. La relectura de algunos de los postulados clásicos de la teoría freudiana, la discusión de las teorías sobre el poder de inspiración foucaultiana y, los desarrollos de la terapia con perspectiva de género, constituyen las principales vertientes de la argumentación.

  14. Pärimisõiguse põhimõtete rakendamise ulatus Eesti pärimisõiguses : [teadusmagistritöö] / Urve Liin ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Liin, Urve, 1952-

    2006-01-01

    Kaitses 29. 11. 2006. a. Tartu Ülikoolis. - Koosneb U. Liini publikatsioonidest: On reform of Estonian succession law // Juridica International. III. Tartu, 1998, lk. 105-109 ; Pärimisõiguse põhimõtetest // Juridica (1999) nr. 3, lk. 141-147 ; Grundzüge des neuen estnischen Erbrechts // Jahrbuch für Ostrecht, Band 41/2. München, 2000, lk. 261-281 (kaasautor: Hausmann, Rainer) ; Abikaasa seadusjärgse pärimisõiguse reform Eestis Euroopa arengute taustal // Juridica (1998) nr. 4, lk. 174-180 ; Laws of succession in Europe and Estonia : how we got to where we are and where we should be heading // Juridica International. VI. Tartu, 2001, lk. 114-124 ; Testeerimisvõime vanuselisest alampiirist Eesti pärimisseaduses // Juridica (2000) nr. 6, lk. 343-350 ; Abikaasade vastastikusest testamendist // Juridica (2001) nr. 1, lk. 35-45 (kaasautor: Nagel, Ursula) ; Pärimisleping ja selle seosed võlaõigusega // Juridica (2003) nr. 10, lk. 697-707 ; Pärandi üleminek pärijale: vastuvõtusüsteem versus loobumissüsteem // Juridica (2003) nr. 1, lk. 45-56

  15. Reseña del libro de Irene Comins Mingol y Sonia París Albert, Investigación para la paz. Estudios filosóficos

    Directory of Open Access Journals (Sweden)

    Ramón A. Feenstra

    2012-04-01

    Full Text Available Algo va mal (siguiendo el título del libro de Tony Judt, 2010 cuando Warren Buffett, el tercer hombre más rico del mundo, ha instado en un artículo –recientemente publicado en The New York Times con el título «Dejen de mimar a los megaricos»– a la urgente necesidad de aumentar la carga impositiva de los más ricos. Buffett, explica en su artículo la insensatez de unos tiempos en los que una mayoría de los estadounidenses pelea por llegar a fin de mes «mientras que nosotros –los megaricos– continuamos obteniendo ventajas fiscales». Apunta, además, a la injusticia de un sistema financiero que le lleva a pagar un 17,4 % en impuestos, un porcentaje inferior al que tuvieron que hacer frente los 20 empleados de su oficina, cuyo rango abarcó entre el 33 % y el 41 %. Buffett señala que la política de exenciones fiscales a los ricos, cuya aplicación comenzó desde la llegada al poder de George Bush en el año 2000, ha ido acompañado de una pérdida en la creación de empleo y por ello finaliza el artículo reclamando la necesidad de tomarse en serio el «sacrificio compartido» que ha sido defendido por el presidente de los Estados Unidos, Barack Obama, pero que parece lejos de ser una política decidida por parte del conjunto de los representantes políticos estadounidenses. 

  16. Võlgniku võimalused hagi tagamise korras peatada garantii andja poolt väljamakse tegemine võlausaldajale : [magistritöö] / Kristjan Mägi ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Mägi, Kristjan

    2012-01-01

    Sõltumatu garantii tagamisfunktsioonist, võlgniku huvide kaitsest, väljamakse peatamise võimalustest ja meetmetest, hagi tagamise korras väljamakse peatamise taotluse põhistamisest ja tõenditest

  17. Töövõtu- ja käsunduslepingute sätete kohaldamine tarkvaraarenduse lepingutele : magistritöö / Maarja Lehemets ; juhendaja: Karmen Turk, kaasjuhendaja: Irene Kull ; Tartu Ülikool, sotsiaalteaduste valdkond, õigusteaduskond, eraõiguse osakon

    Index Scriptorium Estoniae

    Lehemets, Maarja, 1990-

    2018-01-01

    Tarkvarateenuse spetsiifika ja tarkvaraarenduse lepingute kvalifitseerimine, töövõtulepingu ja käsunduslepingu sätete kohaldamine tarkvaraarenduse lepingu rikkumistele ning tarkvaraarenduse lepingute lõpetmisele ja lõppemisele

  18. BELMONTE MARTÍN, Irene, La modernización de la gestión tributaria local en España. El caso de Suma Gestión Tributaria de la Diputación de Alicante

    Directory of Open Access Journals (Sweden)

    José Luis Martínez-Alonso Camps

    2018-05-01

    Full Text Available The book analyzes the modernization of public administration and, in particular, of the Spanish government, based on the study of SUMA tax management of the provincial government of Alicante (1990-2013, which is an autonomous body of it, and one of the successful examples of the local tax management. Result of the research developed in the doctoral thesis that brings cause, the work properly combines the perspectives of Political and Administrative Science and Legal Science, offering a multifaceted vision of the object analyzed.

  19. Õpiinfokeskkond venekeelse hariduse uuendamise perioodil : õpetajate ja õpilaste hinnangud vene kooli varustatusele õpikute ja metoodilise kirjandusega 90ndate aastate lõpus / Larissa Vassiltšenko, Irene Käosaar

    Index Scriptorium Estoniae

    Vassiltšenko, Larissa

    1999-01-01

    Vene õppekeelega koolides läbi viidud uuringust 1997/98. õa., milles keskenduti õpetajate hinnangutele nende käsutuses olevale õppe-metoodilisele kirjandusele, paralleelselt õpetajatega küsitleti 7.-12. klassi õpilasi

  20. Ostu-müügi lepingust Venemaa uues tsiviilkoodeksis ja Läti tsiviilseadustikus : (võrdlevalt Eesti võlaõigusseaduse eelnõuga) : [bakalaureusetöö] / Carry Plaks ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Plaks, Carry, 1977-

    1999-01-01

    Venemaa tsiviilkoodeks, ostu-müügi leping seal, nende eriliigid, jaemüük, müügilepingu regulatsioon Läti tsiviilõiguses, eriliigid, erinevused Eesti, Läti ja Vene müügilepingute regulatsioonis

  1. Veebiplatvormile loodud kasutajakonto üleandmise nõue veebireklaami teenuse osutamise lepingus : magistritöö / Mari Anne Rosalie Valberg ; juhendaja Irene Kull ; Tartu Ülikool, õigusteaduskond, eraõiguse osakond

    Index Scriptorium Estoniae

    Valberg, Mari Anne Rosalie, 1994-

    2018-01-01

    Veebireklaami eesmärgil loodud kasutajakonto õiguslik olemus, veebiplatvormi roll veebireklaami teenuse osutamise lepingus reklaami tellija ja reklaami teostaja vahe, veebireklaami teenuse osutamiseks loodud kasutajakonto ülendmise nõude õiguslik alus ja nõuet välistavad asjaolud

  2. PACTA SUNT SERVANDA põhimõte ja eluasemelaenu ennetähtaegne ülesütlemine krediidisaaja makseraskuste tõttu : magistritöö / Kairi Toomsalu ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Toomsalu, Kairi

    2010-01-01

    Riigikogu 11. koosseisule esitatud eelnõudest ja lepinguõiguse üldpõhimõtetest, kohustuste täitmisest eluasemelaenu tagatise võõrandamisega, täitmishuvi rahuldamise muudest õiguslikest võimalustest, täitmisnõuet välistavatest või piiravatest vastuväidetest

  3. Lepingu aluseks olnud asjaolude muutumine majanduskriisi tulemusel ja kinnisasja müügilepingust taganemisõigus VÕS § 97 alusel : [bakalaureusetöö] / Marko Laur ; Tartu Ülikool, õigusteaduskond ; juhendajad: Anton Sigal, Irene Kull

    Index Scriptorium Estoniae

    Laur, Marko

    2010-01-01

    Kohustuste vahekorra muutumist tõendavatest asjaoludest majanduskriisi tingimustes. Lepingupoole subjektiivsetest võimalustest arvestada majanduskriisi mõjuga lepinguliste kohustuuste tasakaalule, lepingupoolte kokkulepetest taganemisõiguse kohta asjaolude muutumisel

  4. Bestimmung des Bodenreibungsbeiwertes und der Oberflächenreibung eisbedeckter Wasserflächen im Meiningenstrom der Darß-Zingster Boddenkette und Anwendung auf vertikal integrierte hydronumerische Modelle

    OpenAIRE

    Schönfeldt, Hans-Jürgen; Raabe, Armin; Baudler, Henning

    2016-01-01

    In einem hydronumerischen Modell zur Prognose des Strömungs- und Wasserstandsfeldes flacher Gewässer wird eine auf der Turbulenztheorie basierende Tiefenkorrektur für den Bodenreibungsbeiwertwert eingeführt und auf der Basis von Berechnungen für die DarßZingster Boddenkette überprüft. Für einen ausgewählten Meßpunkt der Darß-Zingster Boddenkette wurde der Reibungsbeiwert sowohl am Boden als auch unter einer Eisschicht experimentell bestimmt. Die Auswirkungen einer Tiefenkorrektur des Reibungs...

  5. Das Usutu-Virus als Ursache von Massensterben bei Amseln Turdus merula und anderen Vogelarten in Europa: Erfahrungen aus fünf Ausbrüchen zwischen 2001 und 2011

    OpenAIRE

    Bosch, Stefan; Schmidt-Chanasit, Jonas; Fiedler, Wolfgang

    2012-01-01

    Das Usutu-Virus (USUV) ist ein durch Stechmücken der Gattung Culex übertragenes Flavivirus. Es wurde wahrscheinlich durch Zugvögel oder Stechmücken nach Europa eingeschleppt und hat sich inzwischen dauerhaft in der einheimischen Stechmücken-und Vogelfauna etabliert. Seit seinem Erstnachweis 2001 in Österreich hat das USUV fünf größere Ausbrüche mit USUV-assoziierten Vogelsterben, vor allem unter Amseln und in Volieren gehaltenen Eulen, sowie vermutlich kleinere Ausbrüche ohne augenfälliges Vo...

  6. Monitoring Protein Conformation Changes as an Activating Step for Protein Interactions with Cross-linking/MS Analysis. / Chen, Zhuo; Rasmussen, Morten; Tahir, Salman; Clark, C.A.C; Barlow, Paul; Rappsilber, Juri

    DEFF Research Database (Denmark)

    Rasmussen, Morten

    of C3 to its active form C3b. C3 (187kDa) is a twelve domain protein (ANA, CUB, TED and MG1 to MG9). During the conversion of C3 to C3b, one domain, ANA (99 residues), is proteolytically removed and a number of domains change their position. This exposes protein-binding sites for downstream...... interactions in the complement response.   Methods 250 pmol of C3 and C3b were both cross-linked with a 1000X excess of cross-linkers. BS2G, BS3, and sulfo-EGS were applied respectively. The cross-linking products were separated with 1D-PAGE gel. Monomer bands were sliced and digested with trypsin. Cross......-terminus. The TED domain relocates as is revealed by three cross-links to the ANA domain in C3 and four cross-links to the MG1 domain in C3b, a domain that is remote in C3. In C3b case, a cross-link within the CUB domain suggests a folded structure of this domain, a matter of dispute in the competing crystal...

  7. 75 FR 14488 - Public Notice for Waiver of Aeronautical Land-Use Assurance; James N. Cox Dayton International...

    Science.gov (United States)

    2010-03-25

    ...: Irene R. Porter, Program Manager, Detroit Airports District Office, 11677 South Wayne Road, Suite 107, Romulus, MI 48174 FOR FURTHER INFORMATION CONTACT: Irene R. Porter, Program Manager, Federal Aviation... Dayton as recorded in Deed Book 1616, Page 505 and part of a 12.07 acre tract (Parcel 21) conveyed to The...

  8. JPRS Report, China

    National Research Council Canada - National Science Library

    1993-01-01

    ...; AGRICULTURE - Further Reform of Grain Circulation, Prices Advocated, Chen Yaobang on Market Challenges Facing Agriculture, Chen Yaobang on Restructuring of Crop Planting, MILITARY, PUBLIC SECURITY...

  9. Altkäemaksu või pistise võtmise või andmise kui korruptiivse käitumisega tekitatud kahju hüvitamise nõue juhtorgani liikme vastu : [magistritöö] / Asso Prii ; Tartu Ülikool, õigusteaduskond ; juhendaja: Irene Kull

    Index Scriptorium Estoniae

    Prii, Asso, 1986-

    2013-01-01

    Juriidilise isiku juhtorgani liikmest KarS-i ametialaste süütegude toimepanijana, juhtorgani liikme altkäemaksu või pistise andmise või võtmisega seotud korruptiivsest käitumisest kui kohustuse rikkumisest tsiviilõiguslikus mõttes, tekitatud kahjust

  10. User interface design of electronic appliances

    CERN Document Server

    Baumann, Konrad

    2002-01-01

    Foreword by Brenda Laurel. Part One: Introduction 1. Background, Bruce Thomas 2. Introduction, Konrad Baumann 3. The Interaction Design Process, Georg Rakers Part Two: User Interface Design 4. Creativity Techniques, Irene Mavrommati 5. Design Principals, Irene Mavrommati and Adrian Martel 6. Design of On-Screen Interfaces, Irene Mavrommati Part Three: Input Devices 7. Controls, Konrad Baumann 8. Keyboards, Konrad Baumann 9. Advanced Interaction Techniques, Christopher Baber and Konrad Baumann 10. Speech Control, Christopher Baber and Jan Noyes 11. Wearable Computers, Christopher Baber Part Fou

  11. Nomenclatural corrections to the taxonomic revision of The Old World species of Boehmeria (Urticaceae, tribus Boehmeriae) by Wilmot-Dear and Friis (2013)

    DEFF Research Database (Denmark)

    Wilmot-Dear, Christine Melanie; Friis, Ib; Govaerts, R. H. A.

    2014-01-01

    (H. Lév.) C.J. Chen in Chen et al. as the correct name for the variety named in the revision as B. zollingeriana Wedd. var. podocarpa (W.T. Wang) W.T. Wang & C.J. Chen in Chen et al., (3) that the combination B. spicata (Thunb.) Thunb., based on Urtica spicata Thunb., is not illegitimate, as stated...

  12. 專論/台灣圖書館史數位圖書館建構之研究/王梅玲;蔡明月;陳志銘;柯雲娥;蔡佳縈;陳勇汀;林怡甄 | A Digital Library Pilot Study on Taiwan Libraries' History / Mei-Ling Wang; Ming-Yueh Tsay; Chih-Ming Chen; Yun-Er Ke; Chia-Ying Tsai; Yong-Ting Chen; Yi-Jen Lin

    Directory of Open Access Journals (Sweden)

    王梅玲、蔡明月、陳志銘、柯雲娥、蔡佳縈、陳勇汀、林怡甄

    2008-04-01

    Full Text Available

    圖書館是保存與詮釋人類文化重要的機構,1990 年代開始,網際網路的進步,促成數位圖書館蓬勃發展,有人預測它就是未來的圖書館,因此,圖書館界與教育界積極參與相關研究。台灣地區歷經日據時期、重建 時期、成長時期及茁壯時期四階段,建設許多圖書館,有其豐富的主題與素材值得發展成為數位圖書館。政治大學圖書資訊與檔案學研究所有鑑於此,提出「『台灣 百無圖書館史』數位圖書館」的構想,並獲得政大「發展國際一流大學及頂尖研究中心計畫」經費支持。本研究計畫目的包括:(1探索以台彎圖書館事業史為主 題的數位圖書館建構模式;(2建構數位圖書館以支援圖書資訊學教育與研究;(3研訂圖書館事業史料文獻的Metadata與數位資料格式;(4將圖 書文獻與文物數位化以建構數位館藏;(5發展數位圖書館系統與技術;(6研發數位圖書館網站的瀏覽與檢索功能;(7探討數位圖書館支援數位學習的模 式。計畫成果共研訂六種 Metadata標準:建置746筆數位化資料;以Dspace系統平台,依據需求設計台灣百年圖書館史系統架構與網站,最後提出結論與建議。

    Libraries are important social institutions that preserve and communicate human culture and knowledge. From the beginning of 1990s, the digital library has grown up rapidly based on the progress of the Internet. Libraries and educational institutions should be actively involved in digital library research and development. The Taiwan libraries’ history can be divided into four stages: Japanese occupation period, reconstruction period, growth period and strong period. In these processes, many events and libraries with rich materials that can be developed into a digital library. Graduate Institute of Library, Information and Archival Studies, National Chengchi University, planned the Digital Library Pilot Study on Taiwan Libraries’ History and got the university support. The pilot study objectives include: (1 exploring the digital library model on Taiwan libraries' history; (2 constructing digital library to support education and research in information and library science; (3 developing Metadata standards of library documents and heritage; (4 digitalizing documents and heritage to build digital collections (5 developing digital library systems and technology; (6 researching browsing and search functions of the digital library; (7 exploring the model of the digital library supports e-learning. In this pilot study, we developed six Metadata standards, built 746 digital resources, constructed a digital library system and web site, and proposed the conclusions and suggestions finally.

    頁次:15-38

  13. China Report, Political, Sociological and Military Affairs, No. 445.

    Science.gov (United States)

    1983-08-11

    2052 0981], Chen Dingming [7115 7844 6900], Jin Xiulan [6855 4423 5695] (F, Mongolian), Zhao Nanqi [6392 0589 6386] Korean), Suo Jingxian [4792...Pen Center and the Guangzhou Pen Center will be headed by Chen Huangmei, another vice-president of the China center and a noted critic. The...1728 4426 6311], Zhang Tengxiao [1728 7506 7197], Chen Dingmou [7115 0002 5399], Chen Lunfen [7115 0243 5358] (F), Chen Xitong [7115 1585 0681

  14. Technical Digest of the 1998 Summer Topical Meeting on Organic Optics and Optoelectronics

    Science.gov (United States)

    1998-07-01

    Larry Dalton, University of Southern California, Los Angeles, CA Harold Fetterman , University of California, Los Angeles, CA Steve Forrest...OPTIC MODULATORS H. Fetterman , D. Chen, A. Udupa. D. Bhattachaya, B. Tsap University of Califonia, Los Angeles 90024 S. Lee, A. Chen, J. Chen, W...Chen, H.R. Fetterman , A. Chen, W.H. Steier, and L. R. Dalton, Appl. Phys. Lett. 70, (1997). 2. T.A. Tumolillo and P.R. Ashley, Appl. Phys. Lett. 62

  15. Genetic analysis of female fertility traits in South African Holstein cattle

    African Journals Online (AJOL)

    Bobby

    1 ARC-Livestock Business Division, P/Bag X2, Irene 0062, South Africa .... Descriptive statistics of all traits were computed using the Proc Means procedure of the Statistical. Analysis System (SAS ..... of Australian Holstein-Friesian cattle. Anim.

  16. David Oistrahhi festival läheneb lõpule / Toivo Traks

    Index Scriptorium Estoniae

    Traks, Toivo

    2006-01-01

    Kontsertidest David Oistrahhi festivali raames: saksa viola da gamba mängija Holger Faust-Peters ja klavessinist Iren Lill 19. juulil Pärnu Eliisabeti kirikus, briti laulja Patricia Rozario ja RTE Vanbrugh Quartet 20. juulil Eliisabeti kirikus

  17. Professor Peep Veski meie meenutustes

    Index Scriptorium Estoniae

    2014-01-01

    Mälestusi Tartu Ülikooli Farmaatsia instituudi juhatajast Peep Veskist jagavad: Eve-Irene Lepist, Urve Paaver, Karin Kogermann, Kristian Semjonov, Jaak Koppel, Kristin Raudsepp, Imre Klebovich, Filiz Hincal, A. Atilla Hincal ja Elmar Arak

  18. Arvo Pärt ajas ja ajatuses / Igor Garšnek

    Index Scriptorium Estoniae

    Garšnek, Igor, 1958-

    2010-01-01

    Mõtteid Arvo Pärdi muusikast ajendatuna ETVs 2. septembril kavas olnud saadetest: "Arvo Pärt Istanbulis " ja "Arvo Pärdi autorikontsert Istanbulis", mis kajastasid 7. juunil Hagia Irene kirikus esiettekandel tulnud helilooja uusimat teost "Aadama itk"

  19. Retrieval of relative humidity from CSIR-NLC mobile LIDAR backscatter measurements

    CSIR Research Space (South Africa)

    Tesfaye, M

    2009-09-01

    Full Text Available data was collected over 23 hours. The above data sets were used to determine the retrieved relative humidity and compared with Irene (near to Pretoria) weather balloon humidity measurements. The results of the comparative study are presented...

  20. PENi kirjandusauhinnad selgunud : [sõnum

    Index Scriptorium Estoniae

    2002-01-01

    Nabokovi-preemia Mario Vargas Llosale; Laura Pelsi auhind Tony Kushnerile ja Maria Irene Fornesile; uudsena noortele kirjanike määratava Robert Binghami auhinna saavad Carolyn Cooke, Matthew Klam ja Manil Suri

  1. [Tutvustus doktoritööle

    Index Scriptorium Estoniae

    2009-01-01

    Tutv. rmt.: Kõve, Villu. Varaliste tehingute süsteem Eestis : [doktoritöö] / juhendaja: Irene Kull. - Tartu : Tartu Ülikooli Kirjastus, 2009. - 437 lk. - (Dissertationes iuridicae Universitatis Tartuensis ; 22)

  2. Go4Life

    Medline Plus

    Full Text Available ... ago 20,217 views Trainer Sandy and Irene practice Back Leg Raises, a lower body exercise from ... 19 Play next Play now Choosing Nutrient Dense Foods - Duration: 6 minutes, 19 seconds. National Institute On ...

  3. A decade towards better health in Chile.

    Science.gov (United States)

    Helmke, Irene

    2011-10-01

    In 1990, after 17 years of dictatorship, Chile started rebuilding its political system with a focus on improving social conditions and health. A recent study of the last 10 years shows some positive results. Irene Helmke reports.

  4. Transit climate change adaptation assessment/asset management pilot for the Metropolitan Atlanta Rapid Transit Authority.

    Science.gov (United States)

    2013-08-01

    Public transit agencies play an important role in the provision of safe, reliable, and cost-effective transportation for the communities they serve. With the growing intensity and frequency of extreme weather events, such as hurricanes Irene and Sand...

  5. Tampere Teatrisuve maiuspalaks olid soomlased / Tiiu Laks

    Index Scriptorium Estoniae

    Laks, Tiiu, 1984-

    2006-01-01

    38. Tampere teatrisuvest (Tamperen teatterikesä), vaatluse all on soomlaste menutükid - Anna Krogeruse "Armastusest minu vastu" (lav. Irene Aho, Soome Rahvusteater) ja William Shakespeare'i "Richard III" (lav. Juha Luukkonen, Vaasa Linnateater)

  6. A Narrative Enrichment Programme in literacy development of ...

    African Journals Online (AJOL)

    speaking Grade 3 learners in monolingual rural schools. Irene Brand ... used to assess how learners recount the various narrative components and the chronology. Keywords: children, meaning-making, drawings, early writings, multimodal pedagogies ...

  7. A new leader for Lithuania's ruling party? / Kestutis Girnius

    Index Scriptorium Estoniae

    Girnius, Kestutis K.

    2011-01-01

    Irene Degutiene, kes on reitingult president Dalia Grybauskaite järel teine poliitik Leedus, tahab asendada erakonna Isamaaliit – Leedu Kristlikud Demokraadid praegust esimeest Andrius Kubiliust, kes on ka riigi peaminister

  8. Talons and beaks are viable but underutilized samples for detecting ...

    African Journals Online (AJOL)

    Talons and beaks are viable but underutilized samples for detecting organophosphorus and carbamate pesticide poisoning in raptors. Ngaio Richards, Irene Zorrilla, Joseph Lalah, Peter Otieno, Isabel Fernandez, Monica Calvino, Joaquin Garcia ...

  9. Abutting Absence : Love Letters from Two Eras / Tiina Kirss

    Index Scriptorium Estoniae

    Kirss, Tiina, 1957-

    2008-01-01

    Irene Lääne ja Toomas Hiio koostatud raamatust "Ühtekuuluvuse teel : Johan Laidoneri kirjad abikaasale" (Tallinn : Varrak, 2008) ja Käbi Laretei raamatust "Kuhu kadus kõik see armastus?" (Tallinn : SE & JS, 2008)

  10. Story of Fission

    Indian Academy of Sciences (India)

    IAS Admin

    individual researchers or small groups would pursue their sub- jects of interest .... The task of identification ... attracted the attention of Irene Curie and her collaborator Pavel .... tions leading to elongation, and divide itself into two smaller drops.

  11. Social Media for Transportation Disaster, Preparation, Response, and Recovery

    Science.gov (United States)

    2017-10-01

    The Northeast United States, particularly New York State has experienced an increase in extreme 24-hour precipitation during the past 50 years (Horton et al., 2011). Recent events such as Hurricane Irene and Superstorm Sandy have revealed vulnerabili...

  12. ICT and Pragmatism: Creating sustainable Employment for ...

    African Journals Online (AJOL)

    OE Osuagwu, VC Agbasonu, C Ndigwe, E Irene, U Sulaiman ... deep challenges in Nigeria's labour market, where the nation's rapid economic growth has not ... Key Words: e-commerce, online transaction, broadband stimulus, unemployment.

  13. the iniprovement and application of genetic resources in animal

    African Journals Online (AJOL)

    Animal and Dairy Science Reseorch Instiute, Irene, 1675. In the process of abandoning ... genetic improvement of the industry on a national basis. Quantitatively the ..... rapidly developing, challenging and competitive world with its modern ...

  14. Fault detection and fault-tolerant control for nonlinear systems

    CERN Document Server

    Li, Linlin

    2016-01-01

    Linlin Li addresses the analysis and design issues of observer-based FD and FTC for nonlinear systems. The author analyses the existence conditions for the nonlinear observer-based FD systems to gain a deeper insight into the construction of FD systems. Aided by the T-S fuzzy technique, she recommends different design schemes, among them the L_inf/L_2 type of FD systems. The derived FD and FTC approaches are verified by two benchmark processes. Contents Overview of FD and FTC Technology Configuration of Nonlinear Observer-Based FD Systems Design of L2 nonlinear Observer-Based FD Systems Design of Weighted Fuzzy Observer-Based FD Systems FTC Configurations for Nonlinear Systems< Application to Benchmark Processes Target Groups Researchers and students in the field of engineering with a focus on fault diagnosis and fault-tolerant control fields The Author Dr. Linlin Li completed her dissertation under the supervision of Prof. Steven X. Ding at the Faculty of Engineering, University of Duisburg-Essen, Germany...

  15. Use of epoxidized natural rubber as a compatibilizer in silica-filled natural rubber tire tread compounds ; Verwendung von epoxydiertem Naturkautschuk als Verträglichkeitsvermittler in Zusammensetzungen aus kieselsäuregefülltem Naturkautschuk für Reifenlaufflächen

    NARCIS (Netherlands)

    Sengloyluan, K.; Sahakaro, Kannika; Noordermeer, Jacobus W.M.

    2012-01-01

    Silica-reinforced natural rubber (NR) tire tread compounds with epoxidized natural rubber (ENR) as a compatibilizer are investigated. ENR contents of 2.5-15.0 phr, with epoxide levels of 10, 38 and 51 mol%, are used. The addition of ENRs, especially ENR-38 and ENR-51, as compatibilizers decreases

  16. 热河生物群凌源东方叶肢介的软体构造及其分类意义%SOFT BODY PRESERVATION IN THE CONCHOSTRACAN EOSESTHERIA LINGYUANENSIS CHEN FROM THE JEHOL BIOTA AND ITS TAXONOMIC SIGNIFICANCE

    Institute of Scientific and Technical Information of China (English)

    沈炎彬

    2011-01-01

    东方叶肢介(Eosestheria)是著名热河生物群中最为常见的一类甲壳动物,关于它的形态、壳瓣结构及微细纹饰特征的研究已相当详尽,但一直没有关于其软体构造的报道。本文描述的凌源东方叶肢介(Eosestheria lingyuanensis)采自辽宁北票市尖山沟村,产于下白垩统义县组的尖山沟夹层。这些软体构造包括:头部形态、眼、闭壳肌痕、雄性执握肢、体节、消化道及尾节等。通过与现生叶肢介软体形态构造比较,显示其与刺尾亚目的蚌壳虫科的代表最为亲近。从而为探讨化石与现生叶肢介之间的演化关系及建立高一级的统一分类,提供了有价值的依据。%The clam shrimp Eosestheria is an extraordinarily abundant and important member of the con-chostracan fauna from the famous Jehol Biota. Here the occurrence of partial soft body preservation in E. Lingyuanensis is reported for the first time, occurring as impressions, inside the valve, of the head, eye, adductor muscle scar, male claspers, digestive tube, and telson.The exceptionally preserved specimens were found in the Lower Cretaceous Yixian Formation at Jianshangou village, near Beipiao, in Liaoning Province of NE China. The preservation of soft parts in conchostracans is significant partly because its occurrence is very rare-known previously only from about 16 species . Worldwide and several of which are actually much less complete than the present material. Soft body characteristics are also important for accurate taxonomic determination and assessment of relationships. For example, all conchostracan males have the first pair of trunk limbs modified to form so called 'claspers', which hold to the female during mating. Some modification of the second pair of trunk limbs is seen in lae-vicaudatan conchostracans, two species of which are also known as fossils with soft body parts, butthe second pair appears not to be clasper-like in form. Eosestheria lingyuanensis on the other hand has two pairs of clearly defined claspers as in spini-caudatan conchostracans. Furthermore in its more distinct growth lines and acute rostrum as well as its two pairs of claspers it clearly belongs to the suborder Spinicaudata. Within that group, although it is similar to the Cyzicidae in its rostrum lacking an apical spine and in its short stout telson, it differs in its less developed occipital notch and larger palp with a row of pores.Although the name Conchostraca is commonly used in fossil and extant literature, recent molecular and morphological analyses show that the 'Conchostraca' appears not to be a monophyletic group. As such it has no taxonomic meaning. It has therefore been abandoned as a taxonomic unit by many authors. However, Shen et al. (2006) retain use of the 'Conchostraca', which include five suborders. Laevicaudata, Spinicaudata, Cycles-therida, Leaiina and Estheriellina. The two latter are distinct extinct groups and their soft bodies were found recently in several specimens. Leaiina with 1-5 radial carina on the carapace valve ranges from the Devonian to Permian and Estheriellina with 3-16 radial costae on the carapace valve appears in the Triassic to Cretaceous interval.

  17. Comments on X. Yin, A. Wen, Y. Chen, and T. Wang, `Studies in an optical millimeter-wave generation scheme via two parallel dual-parallel Mach-Zehnder modulators', Journal of Modern Optics, 58(8), 2011, pp. 665-673

    Science.gov (United States)

    Hasan, Mehedi; Maldonado-Basilio, Ramón; Hall, Trevor J.

    2015-04-01

    Yin et al. have described an innovative filter-less optical millimeter-wave generation scheme for octotupling of a 10 GHz RF oscillator, or sedecimtupling of a 5 GHz RF oscillator using two parallel dual-parallel Mach-Zehnder modulators (DP-MZMs). The great merit of their design is the suppression of all harmonics except those of order ? (octotupling) or all harmonics except those of order ? (sedecimtupling), where ? is an integer. A demerit of their scheme is the requirement to set a precise RF signal modulation index in order to suppress the zeroth order optical carrier. The purpose of this comment is to show that, in the case of the octotupling function, all harmonics may be suppressed except those of order ?, where ? is an odd integer, by the simple addition of an optical ? phase shift between the two DP-MZMs and an adjustment of the RF drive phases. Since the carrier is suppressed in the modified architecture, the octotupling circuit is thereby released of the strict requirement to set the drive level to a precise value without any significant increase in circuit complexity.

  18. 專論/以關鍵詞網絡探討動態性知識管理議題/陳良駒;張正宏 | Exploring Dynamic Knowledge Management Research Issues: A Keyword Network Analysis / Liang-Chu Chen; Jeng-Horng Chang

    Directory of Open Access Journals (Sweden)

    陳良駒、張正宏

    2007-10-01

    Full Text Available

    知識管理是企業邁向知識經濟時代的實務顯學,也是學術界近年來持續探討的重要研究議題。然而知識管理的面向是一種多維度的呈現,如何快速而正確的瞭 解知識管理議題的發展,是許多組織知識工作者及學術研究學者努力的目標。許多學者提出知識管理內容的架構及分類,但卻都是屬於一種由上而下的靜態設計。社 會網絡分析是呈現及量測網絡實體成員互動的技術,適合建構關係網絡的動態性。本文嘗試以關鍵詞網絡來分析國內資訊相關系所從事知識管理研究的主題及脈絡, 並透過關鍵詞的連結來建構一套動態性的知識管理研究範疇。研究成果除驗證知識管理學域中的研究重點,更透過網絡關係來連結多樣性的研究構想,進而提供產官 學界更宏觀且動態的知識管理研究建議。

    Knowledge management (KM is an important practice in a corporation and an essential issue that academic scholars intend to explore continuously in the era of knowledge economy. However, KM presents a variety of perspectives that are still undefined for many knowledge workers and academic researchers. Many scholars propose a few categories and frameworks about KM, but a static outcome. Social network analysis (SNA is a method to present and measure the interaction among network entities and it is suitable to construct the dynamic relationship networks. The purpose of this study is to acquire the research issues and contexts of KM within information-related graduate schools based on a keyword network analysis. Moreover, we build a dynamic KM research network through these linkages with keywords. The results of this study confirm the essential research perspectives in a KM domain and suggest a variety of KM research ideas which provide the industries, governments, and academic communities with a macro and dynamic KM research viewpoint.

    頁次:81-94

  19. Response to the comment by C. Kisielowski, H.A. Calderon, F.R. Chen, S. Helveg, J.R. Jinschek, P. Specht, D. Van Dyck on the article "On the influence of the electron dose-rate on the HRTEM image contrast" by J. Barthel, M. Lentzen, A. Thust, Ultramicroscopy 176 (2017) 37-45.

    Science.gov (United States)

    Barthel, Juri; Lentzen, Markus; Thust, Andreas

    2017-08-01

    In a recent article [1] we examined the influence of the applied electron dose rate on the magnitude of the image contrast in high-resolution transmission electron microscopy (HRTEM). We concluded that the magnitude of the image contrast is not substantially affected by the applied electron dose rate. This result is in obvious contradiction to numerous earlier publications by Kisielowski and coworkers [2-7], who commented our recent article due to this contradiction. The present short communication is a response to the comment of Kisielowski and coworkers on our recent article, where we provide additional arguments supporting our initial findings and conclusions on the magnitude of the image contrast in HRTEM. Copyright © 2017 Elsevier B.V. All rights reserved.

  20. 實徵研究/國小教師以CREATER模式推動資訊素養創新課程之歷程/謝佩紋;林菁|The Process of Elementary School Teachers Implementing an Innovation Curriculum of Information Literacy with CREATER Model/Pei-Wen Hsieh; Lin Ching Chen

    Directory of Open Access Journals (Sweden)

    謝佩紋、林菁 Pei-Wen Hsieh; Lin Ching Chen

    2009-04-01

    Full Text Available 本研究旨在探究國小教師推動資訊素養創新課程的歷程,並以CREATER革新模式的七個階段為架構,深入瞭解教師作為創新推動者在每個階段的經歷及結果,以提供有意推動資訊素養理念或其它創新的教育工作者參考。本研究採個案研究,以南部一所國小為研究個案,研究時間歷時一年半,透過觀察、訪談、文件分析等方法進行資料的蒐集。研究結果發現,國小教師推動資訊素養課程的歷程大致與CREATER模式的七個階段相符,但「關心」、「連結」與「檢視」階段並無明顯次序,教師以組織內成員的角色推動創新,能有效地將創新理念化為行動,但行動能否持續及發揮效果,還有賴團隊組成的完整性、教師的持續更新力及組織內掌握實權者的支持與參與。The purpose of this study was to explore the change process of implementing an information literacy curriculum by elementary school teachers. Based on the CREATER model, this study investigated the teachers’ experiences as change agents in each stage of the process. The research results could provide guidelines for educators who are devoted to promote the information literacy or other innovations. The method of case study was used to design this study. The subjects of this study were the teachers who voluntarily implemented the information literacy curriculum in an elementary school in the southern part of Taiwan. The methods for collecting research data were observations, interviews, and document analyses. The research results showed that the change process of implementing the information literacy curriculum corresponded to the seven stages of the CREATER model. However, the stages of “care,” “relate,” and “examine,” did not obviously happen in sequence. As members of the organization, the teachers could transform effectively the innovative concept into an action, but whether the innovation could be persistent depended on team relationships, teachers’ self-renewal capacity, and approvals and participation of the leaders who really managed the organization.頁次:70-89

  1. Fortschritt als Fraktur im frühen Science Fiction Film. Metaphorologische Überlegungen zu Auf- und Einbrüchen in LE VOYAGE DANS LA LUNE und LE VOYAGE À TRAVERS L`IMPOSSIBLE von G. Méliès

    Directory of Open Access Journals (Sweden)

    Hartmann, Jörg

    2009-09-01

    Full Text Available Fantasies of man travelling into space form a main part of the popular movie genre ‘Science Fiction’. These celluloid visions are not only fantasies of improving transport, they also convey a meaning in a figurative sense. They can be seen as a modern adoption of one of humanities oldest metaphors, ‘life as a sea fare voyage’: the meaning, which was once expressed by this ‘nautical metaphor’, has been transferred and can nowadays be found in films, which show astro-nauts crossing the frontier from known space into the unknown space. In order to conclude on their attitude towards technological progress in the early 20th century, the two oldest space travel movies, Le Voyage dans la Lune (F 1902 and Le Voyage a Travers L’Impossible (F 1904 will be analyzed.

  2. Web Usability Policies/Standards/Guidelines Do Not Influence Practices at ARL Academic Libraries. A Review of: Chen, Yu‐Hui, Carol Anne Germain and Huahai Yang. “An Exploration into the Practices of Library Web Usability in ARL Academic Libraries.” Journal of the American Society for Information Science and Technology 60.5 (2009: 953‐68.

    Directory of Open Access Journals (Sweden)

    Shandra Protzko

    2009-12-01

    Full Text Available Objective – To survey the current status of Web usability Policies/Standards/Guidelines (PSGs found in academic libraries of the Association of Research Libraries (ARL. Researchers sought to investigate whether PSGs are in place, the levels of difficulty surrounding implementation, the impact of PSGs on design, testing, and resource allocation, and the relationship between ARL ranking and usability practice or PSGs.Design – Survey.Setting – North America.Subjects – Academic libraries of the ARL.Methods – An 18‐question survey consisting of multiple choice, Likert scale, and open‐ended questions was sent to all 113 ARL libraries in November 2007. Survey recipients were selected as the person in charge of Web site usability by visiting library Web sites and phone inquiry. The survey was concluded in January 2008 with a response rate of 74% (84 institutions. The researchers used t‐test to detect any difference in ARL library ranking between libraries with and without PSGs. Pair‐wise t‐tests were conducted to identify gaps in difficulty implementing PSGs. In addition, they used Pearson’s Correlation to investigate any significant correlations between variables such as ARL rank and resource allocation.Main Results – Of the 84 respondents, 34 (40% have general library Web PSGs and 25 (30% have specific usability PSGs; 41 (49% have at least one type of in‐library PSG. Of the 43 (51% libraries that do not have PSGs, 30 (36% are at universities with institutional Web usability PSGs; 26 (87% follow those guidelines. There was no statistically significant relationship between ARL ranking and PSG status (see Table 1. The authors asked about difficulty in implementing PSGs. Of the 32 libraries responding to a question about general library Web PSGs, most had slight or moderate difficulty. Twenty‐three libraries with specific usability PSGs identified difficulty levels; some had no difficulty, but a majority had moderate difficulty. For the 26 libraries using institutional Web usability PSGs, most had no or slight difficulty. Pair‐wise t‐tests showed that library Web usability PSGs were significantly more difficult to implement than university Web usability PSGs. Enforcement/agreement issues were reported as the primary difficulty in implementing in‐library PSGs. Technical issues and ambiguity were obstacles at the institutional level. More than half of the 84 libraries have Web advisory committees and about one third have usability committees or Web usability subcommittees. Several libraries answered that they have none of these committees, but indicated that they have some sort of ad hoc committee or user study group to address usability issues. Of the 84 respondents, 71 (85% have conducted usability testing. Sixty‐two libraries (73.8% rated usability testing as important, very important, or extremely important: the rate given for the importance of usability testing did not correlate with ARL ranking. Cited most often in open ended questioningwere the importance of iterative testing, library wide buy‐in, and staff and resource availability. Main web pages were tested most frequently. Fifty‐three libraries (74.6% tested their lower level pages at least once. OPACs were tested the least often. The amount of testing was impacted neither by the existence of library Web PSGs nor usability PSGs. The top two testing methods were in‐person observation and think aloud protocol.Of the 84 libraries, 24 (28% reported having staff dedicated to Web usability issues; twenty full‐time staff and four part‐time staff. There was a weak association between ARL ranking and hours worked by dedicated staff; no association existed for regular staff who take on Web responsibilities. Fifty‐one (60% of libraries had regular staff whose duties included Web usability; forty‐six full‐time and five part‐time. Training did not correlate to amount of testing methods used. There was a weak link between ALR ranking and availability of resources and, the authors showed, more testing was done as resources increased. In response to a query about future Web usability plans, the focus was on usability testing and site redesign, with only three libraries planning to refine or establish usability PSGs.Conclusion – The authors hypothesized that “web usability PSGs would influence usability practice within libraries and other institutions” (953. The data show that PSGs do not influence practices. The authors conclude that there is no significant relationship between PSGs and testing practices or PSGs and the availability of resources. Likewise, ARL ranking had no effect on the establishment of usability PSGs. Most libraries are conducting usability testing, and there was a weak link between ARL ranking and availability of testing resources. Highlighted in the open‐ended questions is the lack of usability expertise among stakeholders. Workload, inadequate human resources, and lack of organizational cohesion are also cited as barriers to the adoption of Web usability PSGs. The authors speculate that Web professionals likely use their own working knowledge and internalized guidelines without having formal documentation. The authors further speculate that the difficulty related to creating mental models that adequately represent library tasks may hinder the use of formal usability PSGs. Additionally, libraries may not regard the lack of usability PSGs as a liability, especially in light of the lack of government mandates or standards. The authors recommend educational efforts for key players on the value of Web usability, support for hiring dedicated staff, and formal documentation to guide design practice. The authors plan to compare the collected PSGs in an upcoming project. Future research could focus on non‐ARL libraries, the relationship between PSGs and user experience, and Content Management System (CMS usability characteristics.

  3. Effects of water stress and seed mass on germination and ...

    African Journals Online (AJOL)

    enoh

    2012-03-01

    Mar 1, 2012 ... polyvinylpyrrolidone; TCA, trichloroacetic acid; NBT, nitroblue tetrazolium; TBA ..... seeds had weaker resistances to moderate stress (-0.6. MPa) compared with .... Chen YN,Chen YP,Li WH,Zhang HF (2003). Response of ...

  4. How Many Women Are Affected by or at Risk of Preeclampsia?

    Science.gov (United States)

    ... pregnancy outcomes: Differences among 4 racial/ethnic groups. American Journal of Public Health, 95 (9), 1545–1551. Lin, H. C., Chen, S. F., Lin, H. C., & Chen, Y. H. (2010). Increased risk of adverse pregnancy outcomes ...

  5. Proceedings – Mathematical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Yanheng Chen1 2 Guiyun Chen1. School of Mathematics and Statistics, Southwest University, Chongqing 400715, People's Republic of China; School of Mathematics and Statistics, Chongqing Three Gorges University, Chongqing 404100, People's Republic of China ...

  6. Kinetic investigation on enantioselective hydrolytic resolution of ...

    African Journals Online (AJOL)

    Kinetic investigation on enantioselective hydrolytic resolution of epichlorohydrin by crude epoxide hydrolase from domestic duck liver. X Ling, D Lu, J Wang, J Chen, L Ding, J Chen, H Chai, P Ouyang ...

  7. 77 FR 11620 - Notice of Request for the Extension of a Currently Approved Information Collection

    Science.gov (United States)

    2012-02-27

    ... Reduction Act of 1995, this notice announces the intention of the Federal Transit Administration (FTA) to... INFORMATION CONTACT: Roy Chen, FTA Office of Technology, (202) 366-0462, or email: royweishun.chen@dot.gov...

  8. Reference: 291 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 291 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16244906i Chai Mao-Feng...d chloroplast protection. 4 553-64 16244906 2005 Nov Plant molecular biology An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Chen Ye-Miao|Wang Xue-Chen

  9. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Chen Bin1 Zeng Zhirong1 Wu Xiaoqin1 Chen Minhu1 Li Mei1 Gao Xiang1 Chen Baili1 Hu Pinjin1. Department of Gastroenterology, the First Affiliated Hospital, Sun Yat-sen University, 58 Zhongshan II Road, Guangzhou 510080, People's Republic of China ...

  10. Tropical Journal of Pharmaceutical Research - Vol 15, No 3 (2016)

    African Journals Online (AJOL)

    Wan Wu, Wei Chen, Qiong Jin, 447-451 ... Chung-Shih Chen, Mei-Lin Wang, Rosa Huang Liu, Shih-Pin Chen, Tsong-Ming Lu, Wei-Yu Tsai, Chien-Fu Huang, ... Yan-Qiong Li, Rui Hu, Li-Hui Zhong, Qian Sun, You-Ping Yan, 527-533.

  11. Untitled

    Indian Academy of Sciences (India)

    Beak P and Chen C W 1985 Tetrahedron Lett. 4979. Boatman R J, Whitlock B J and Whitlock H W 1977 J. An. Chen. Soc. 99 4822. Diamond S E, Szalkiewicz A and Mares F 1979 J. Ann. Chen. Soc. 101 490. Ellefson C R 1979 J. Org. Chem. 44 1533. Gschwend H W and Rodriguez H R 1979 Organic reactions 26 Chapter I.

  12. Untitled

    Indian Academy of Sciences (India)

    Smith and Carson ... Z. Physikal. Chenn., 1908, 6, 200. 13. Ephraim ... Z. anord. Chen., 190S, 58, 33S. 14. Wright ... J. Chen. Soc, 1915, 107, 1527. 15. Amadori ... Gazetta, 1922, 1, 52, 387. 16. Mori ... J. Chen. Soc., Japa), 1923, 44, 730. 17. Waradachari and Subra- Proc. Ind. Acad, Sci., 1936, 3 A, 428. Ilala. 18. Hervey and ...

  13. Three new species of the genus Gnamptogenys (Hymenoptera, Formicidae from southern China with a key to the known Chinese species

    Directory of Open Access Journals (Sweden)

    Zhilin Chen

    2017-02-01

    Full Text Available Three new species of the genus Gnamptogenys Roger, 1863 are described from southern China: Gnamptogenys dentihumera Chen, Lattke & Zhou, sp. n., Gnamptogenys nanlingensis Chen, Lattke & Zhou, sp. n. and Gnamptogenys quadrutinodules Chen, Lattke & Zhou, sp. n. A distribution map and an identification key to workers for the known species of China are provided.

  14. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Influence of free water content on the compressive mechanical behaviour of cement mortar under high strain rate · Jikai Zhou Xudong Chen Longqiang Wu Xiaowei Kan ... pp 111-117. Mechanical properties of concrete to cyclic uniaxial tensile loading using variable waveforms · YUZHI CHEN XUDONG CHEN JINGWU BU.

  15. Calycosin regulates glucocorticoid-induced apoptosis via Nrf2/ARE ...

    African Journals Online (AJOL)

    Lifeng Fu1, WeiLiang Wu2, Jian Zhu2, Shu Qiang2, Jansong Chen2* ... Results: CA reduced the apoptosis and accumulation of ROS in DEX-treated cells. ..... its downstream effectors (Figure 5 A-C). However .... Cao J, Chen Z, Zhu Y, Li Y, Guo C, Gao K, Chen L, Shi ... Hong W. Experimental study on the effect of Calycosin.

  16. Construction of full-length cDNA library of white flower Salvia ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-05-18

    May 18, 2009 ... of S. miltiorrhiza bge (Yuan et al., 1990; Wang et al.,. 1998; Huang et al., 2000). Hairy roots and ... or A. tumefaciens strains (Chen et al., 1997; Song et al.,. 1997). ..... Chen H, Yuan JP, Chen F, Zhang YL, Song JY (1997).

  17. Two new genera and three new species of Epipaschiinae Meyrick from China (Lepidoptera, Pyralidae

    Directory of Open Access Journals (Sweden)

    Mingqiang Wang

    2017-12-01

    Full Text Available Two new genera of Epipaschiinae are described. The genus Arcanusa Wang, Chen & Wu, gen. n. is established for Ar. apexiarcanusa Wang, Chen & Wu, sp. n. and Ar. sinuosa (Moore, 1888, comb. n., described in Scopocera Moore, 1888 (junior synonym of Stericta Lederer, 1863. The female genitalia of Ar. sinuosa (Moore, 1888, comb. n. are described for the first time. Androconia Wang, Chen & Wu, gen. n. is erected, including two new species, An. rallusa Wang, Chen & Wu, sp. n. and An. morulusa Wang, Chen & Wu, sp. n. Illustrations of all adults and their genitalia, and a key to the two new genera are provided.

  18. Meestele

    Index Scriptorium Estoniae

    1985-01-01

    Irene Truuts on suveks meestele kavandanud kombinesooni, blusooni ja püksid, sportliku ülikonna (5 moejoonist). Nr. 2, lk. 28-3: Meeste päevasest rõivastusest. Mudelite autorid Heli Kohk (6 moejoonist), Liivi Raid (5 moejoonist). Nr. 3, lk. 18-25: Meestemoest Üleliidulise Esteetikakomisjoni prognooside ja rahvusvaheliste moeajakirjade põhjal. Vaatluse all: stiilid, mantlid, joped, jakid, ülikonnad, püksid, särgid, jalatsid, peakatted, lipsud. Mudelid (6 moejoonist, 7 fotomudelit) on kavandanud Irene Truuts. Nr. 3, lk. 26-27: Kahe meeste džempri kudumise õpetus. Mudelite autorid Krista Kajandu ja Anu Stranberg. Nr. 4, lk. 30-33: Moodsad meesterõivad (7 moejoonist) kavandas kunstnik Irene Truuts.

  19. Revision of the subfamily Opiinae (Hymenoptera, Braconidae from Hunan (China, including thirty-six new species and two new genera

    Directory of Open Access Journals (Sweden)

    Li Xi-Ying

    2013-02-01

    postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915, O. ambiguus Weng & Chen, 2005 (not Wesmael, 1835 and O. mitis Chen & Weng, 2005 (not Fischer, 1963 are primary homonyms and are renamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. and O. wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005 comb. n., Diachasmimorpha longicaudata (Ashmead, 1905 and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957 comb. n. is new for China and Hunan; Xynobius maculipennis (Enderlein, 1912 comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005 comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005 comb. n., A. tracta (Weng & Chen, 2005 comb. n., Areotetes laevigatus (Weng & Chen, 2005 comb. n., Phaedrotoma dimidia (Chen & Weng, 2005 comb. n., P. improcera (Weng & Chen, 2005 comb. n., P. amputata (Weng & Chen, 2005 comb. n., P. larga (Weng & Chen, 2005 comb. n., P. osculas (Weng & Chen, 2005 comb. n., P. postuma (Chen & Weng, 2005 comb. n., P. rugulosa (Chen & Weng, 2005 comb. n., P. tabularis (Weng & Chen, 2005 comb. n., Rhogadopsis apii (Chen & Weng, 2005 comb. n., R. dimidia (Chen & Weng, 2005 comb. n., R. diutia (Chen & Weng, 2005 comb. n., R. longuria (Chen & Weng, 2005 comb. n., R. pratellae (Weng & Chen, 2005 comb. n., R. pratensis (Weng & Chen, 2005 comb. n., R. sculpta (Chen & Weng, 2005 comb. n., R. sulcifer (Fischer, 1975 comb. n., R. tabidula (Weng & Chen, 2005 comb. n., Xynobius complexus (Weng & Chen, 2005 comb. n

  20. Diabetes in Combat: Effect of Military Deployment on Diabetes Mellitus in Air Force Personnel

    Science.gov (United States)

    2017-04-01

    Irene; irene. folaron.mil@ mail.mil 916-2672 16. AUTHORSHIP AND CO-AUTHOR(S) List in the order they will appear in the manuscript. LAST NAME. FIRST...respectively, P=0.17). Likewise, subgroup analyses of gender , rank, and age showed no significant difference in A 1 C before and after deployment. ln...6.5% vs. 6.7% respectively, P=0.17). Likewise, subgroup analyses of gender , rank, and age showed no significant difference in A 1 C before and

  1. Frequency Standards and Metrology

    Science.gov (United States)

    Maleki, Lute

    2009-04-01

    over 172 KM of installed fiber / S. Crane -- pt. X. Miniature systems. Chip-scale atomic devices: precision atomic instruments based on MEMS (Invited) / J. Kitching ... [et al.]. CSAC - the chip-scale atomic clock (Invited) / R. Lutwak ... [et al.]. Reaching a few 10[symbol] stability level with a compact cold atom clock / F. X. Esnault ... [et al.]. Evaluation of Lin||Lin CPT for compact and high performance frequency standard / E. Breschi ... [et al.] -- pt. XI. Time scales. Atomic time scales TAI and TI(BIPM): present status and prospects (Invited) / G. Petit. Weight functions for biases in atomic frequency standards / J. H. Shirley -- pt. XII. Interferometers. Definition and construction of noise budget in atom interferometry (Invited) / E. D'Ambriosio. Characterization of a cold atom gyroscope (Invited) / A. Landragin ... [et al.]. A mobile atom interferometer for high precision measurements of local gravity / M. Schmidt ... [et al.]. Demonstration of atom interferometer comprised of geometric beam splitters / Hiromitsu Imai and Atsuo Morinaga -- pt. XIII. New directions. Active optical clocks (Invited) / J. Chen. Prospects for a nuclear optical frequency standard based on Thorium-229 (Invited) / E. Peik ... [et al.]. Whispering gallery mode oscillators and optical comb generators (Invited) / A. B. Matsko ... [et al.]. Frequency comparison using energy-time entangled photons / A. Stefanov -- List of participants.

  2. No gynecologist in town: the gynecological care of women in rural Taiwan

    Directory of Open Access Journals (Sweden)

    Lai LJ

    2015-07-01

    Full Text Available Li-Jung Lai,1 Chia-Lin Chou,2 H Irene Su,3 Tzeng-Ji Chen,1,4 Li-Fang Chou,5 Yueh-Ching Chou,2,6,7 Shinn-Jang Hwang,1,8 Hann-Chin Yu9,10 1Department of Family Medicine, 2Department of Pharmacy, Taipei Veterans General Hospital, Taipei, Taiwan; 3Department of Reproductive Medicine, University of California, San Diego, CA, USA; 4Institute of Hospital and Health Care Administration, School of Medicine, National Yang-Ming University, 5Department of Public Finance, National Chengchi University, 6Department and Institute of Pharmacology, National Yang-Ming University, 7College of Pharmacy, Taipei Medical University, 8Department of Family Medicine, School of Medicine, National Yang-Ming University, Taipei, Taiwan; 9Taipei Veterans General Hospital Hsinchu Branch, Hsinchu County, Taiwan; 10Department of Healthcare Management, Yuanpei University, Hsinchu, Taiwan Background: A shortage of gynecologists exists in many countries. Even within an affluent country, gynecological clinics might not be evenly distributed. The purpose of the study was to investigate the disparity in gynecological care between adult women living in towns with and without gynecologists in Taiwan.Methods: Data sources were the cohort datasets of the National Health Insurance Research Database, with claims data of 1 million beneficiaries in 2010. A woman’s residency was operationally inferred from the locations where she had most frequently visited physicians’ clinics or local community hospitals within the year.Results: In Taiwan, 145 (39.4% of 368 towns had no practicing gynecologist. Of 382,167 women with health care use in the datasets, 21,794 (5.7% lived in towns without a gynecologist. The overwhelming majority of these towns lay in sparsely populated, rural areas. During the year, 132,702 women (34.7% had sought medical help for gynecological diseases and 113,698 (29.8% had visited gynecologists for gynecological diseases. Women in towns without a gynecologist were less

  3. Short Communications

    African Journals Online (AJOL)

    NaOH treatment. P.H. Henning* and D.G. Steyn. Animal and Dairy Science Research Institute, Private Bag X2,. Irene, 1675 Republic of South Africa. Different portions (stalks, cobs, plant leaves, and cob leaves) from mature dry maize plants remaining after grain harvest were collected on two occasions, 8 weeks apart.

  4. The positioning device of beam probes for accelerator LUE-200

    International Nuclear Information System (INIS)

    Becher, Yu.; Kalmykov, A.V.; Minashkin, M.F.; Sumbaev, A.P.

    2011-01-01

    The description of a device for the positioning of sliding beam probes which is the part of the beam diagnostic system for the LUE-200 electron linac of IREN installation is presented. The device provides remote control of input-output operation of beam probes of five diagnostic stations established in an accelerating tract and in the beam transportation channel of the accelerator

  5. Cultural Affiliation Study in Support of Native American Consultation Efforts for Fort Gordon, GA: Richmond, Jefferson, McDuffie, and Columbia Counties

    Science.gov (United States)

    2008-06-01

    exchange. However, there is no evidence of intensive agriculture. Flotation samples from Middle Woodland sites lack any abundance of squash, maize...separated into the Hollywood and provisional Silver Bluff phases. Holly- wood ceramics include check stamped, Mississippi plain, burnished plain...66). Irene ceramics are dominated by filfot cross motifs and rims decorated with cane punctations and riveted nodes. Silver Bluff phase ceramics

  6. 76 FR 68803 - New York Disaster Number NY-00108

    Science.gov (United States)

    2011-11-07

    .../ 2011. Incident: Hurricane Irene. Incident Period: 08/26/2011 through 09/05/2011. DATES: Effective Date..., Processing and Disbursement Center, 14925 Kingsport Road, Fort Worth, TX 76155. FOR FURTHER INFORMATION...., Suite 6050, Washington, DC 20416. SUPPLEMENTARY INFORMATION: The notice of the President's major...

  7. 76 FR 58329 - New York Disaster Number NY-00108

    Science.gov (United States)

    2011-09-20

    .../ 2011. Incident: Hurricane Irene. Incident Period: 08/26/2011 through 09/05/2011. Effective Date: 09/08... and Disbursement Center, 14925 Kingsport Road, Fort Worth, TX 76155. FOR FURTHER INFORMATION CONTACT...., Suite 6050, Washington, DC 20416. SUPPLEMENTARY INFORMATION: The notice of the Presidential disaster...

  8. 76 FR 58328 - New York Disaster Number NY-00108

    Science.gov (United States)

    2011-09-20

    .../ 2011. Incident: Hurricane Irene. Incident Period: 08/26/2011 through 09/05/2011. Effective Date: 09/10... and Disbursement Center, 14925 Kingsport Road, Fort Worth, TX 76155. FOR FURTHER INFORMATION CONTACT...., Suite 6050, Washington, DC 20416. SUPPLEMENTARY INFORMATION: The notice of the Presidential disaster...

  9. 76 FR 62133 - Puerto Rico Disaster Number PR-00014

    Science.gov (United States)

    2011-10-06

    ...-DR), dated 08/27/2011. Incident: Hurricane Irene. Incident Period: 08/21/2011 through 08/24/2011... INFORMATION CONTACT: A. Escobar, Office of Disaster Assistance, U.S. Small Business Administration, 409 3rd Street, SW., Suite 6050, Washington, DC 20416. SUPPLEMENTARY INFORMATION: The notice of the Presidential...

  10. 76 FR 74837 - Puerto Rico Disaster Number PR-00014

    Science.gov (United States)

    2011-12-01

    ...), dated 08/ 27/2011. Incident: Hurricane Irene. Incident Period: 08/21/2011 through 08/24/2011. Effective..., Processing and Disbursement Center, 14925 Kingsport Road, Fort Worth, TX 76155. FOR FURTHER INFORMATION...., Suite 6050, Washington, DC 20416. SUPPLEMENTARY INFORMATION: The notice of the President's major...

  11. Learning from Change: Issues and Experiences in Participatory ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    Learning from Change: Issues and Experiences in Participatory Monitoring and Evaluation. Book cover Learning from Change: Issues and Experiences in Participatory Monitoring and Evaluation. Directeur(s) : Marisol Estrella, Jutta Blauert, Dindo Campilan, John Gaventa, Julian Gonsalves, Irene Guijt, Deb Johnson, and ...

  12. The influence of reproduction and lambing season of the Dohne ...

    African Journals Online (AJOL)

    The influence of reproduction and lambing season of the Dohne. Merino on different wool production traits. Ortrud Steinhagen. Animal and Dair-v Science Research Institute, Private Bag X2, Irene,. 1675 Republic of South Africa. P.J. de Wet. Department of Sheep and Wool Science, University of Stellenbosch,. Stellenbosch ...

  13. English for lawyers / Liina Soobik ; [preface: Peep Pruks

    Index Scriptorium Estoniae

    Soobik, Liina, 1955-

    2001-01-01

    Kasutatud tekstide autorid: Peep Pruks, Merit-Ene Ilja, Ilona Nurmela, Kristi Raba, Andreas Kangur, Raul Narits, Peeter Roosma, Kalle Merusk, Maret Altnurme, Jaan Ginter, Aare Tark, Norman Aas, Lasse Lehis, Hannes Veinla, Jaan Sootak, Eerik Kergandberg, Paul Varul, Jaanus Ots, Urve Liin, Irene Kull, Merle Muda, Gaabriel Tavits, Andres Vutt, Kadri Siibak, Ellen Ridaste, Heiki Pisuke, Andrus Siibak

  14. "Vesi - elu lähte mineraal" / Marju Riisikamp

    Index Scriptorium Estoniae

    Riisikamp, Marju, 1958-

    2009-01-01

    5.-7. juunini toimunud III Türi kevadfestivalist, kus leidsid aset järgmised kultuurisündmused: luuleõhtu, Raadioteatri kuuldemäng-põimik, Ööülikooli päevase osakonna loengud, fotonäitus, filmiõhtu, loodusmatkad ja kontserdid. Festivali algataja, kunstiline juht ja produtsent Iren Lill

  15. DR. MIKA MAJALE MEMORIAL LECTURE

    African Journals Online (AJOL)

    He had four children Irene Majale,. Prof. Mike Majale (Architect) Victoria Majale Ojiambo and Chris Majale. Dr. Majale died on 21st April 1978. As an orthopaedic Surgeon he worked at Kenyatta. National Hospital (KNH), Kabete Orthopaedic Unit and. Armed Forces Memorial Hospital. He did not do any private practice.

  16. Browse Title Index

    African Journals Online (AJOL)

    Items 151 - 200 of 3286 ... Vol 25, No 1 (2016), An appeal for large scale production of ... Dziedzom Komi de Souza, Irene Offei Owusu, Joseph Otchere, Michelle ... treatment of cutaneous larva migrans in an adult Ghanaian male: a case report ...

  17. Inimene tähistaeva all / Marju Riisikamp

    Index Scriptorium Estoniae

    Riisikamp, Marju, 1958-

    2011-01-01

    12. - 15. maini toimunud 5. Türi kevadfestivalist alapealkirjaga "Tähistaevas", festivali korraldaja Iren Lill. Festivali kavas olid raadio Ööülikooli salvestused, loengud, fotonäitus, animafilmi töötuba, tähetorni Orion, Mart Saare majamuuseumi külastus Hüpassaares, loodusmatkad, Urmas Sisaski autoriõhtu ja teised kontserdid

  18. 27. XI esitles Kanuti gildi saalis Mooste avatud ateljee MOKS video-, heli- ja tegevuskunstiprogrammi "Põhi silmab kagu"...

    Index Scriptorium Estoniae

    2003-01-01

    Esinesid MOKSiga seotud kunstnikud ja rühmitused: John Grzinich, OPA: Slobodanka Stevceska, Denis Saraginovski (Obsessive Possessive Aggression, Makedoonia), Kaarel Vulla, Irene Roos, Jane Remm, OMP: maalikunstnikud Maris Palgi, Eva Orav ja ajakirjanik Maia Möller, Pink Punk: Kristin Kalamees, Margus Tamm, Sandra Jõgeva

  19. Учебные программы: новости и мифы / Юлия Тоцкая

    Index Scriptorium Estoniae

    Тоцкая, Юлия

    2010-01-01

    Narvas toimunud briifingul selgitas Haridus- ja Teadusministeeriumi üldharidusosakonna juhataja Irene Käosaar uuendusi õppekavades ja uut põhikooli- ning gümnaasiumiseadust, sealhulgas ka vene õppekeelega koolide eestikeelsele õppele ülemineku küsimusi

  20. Standardinng initial cooling of sheep semen before freezing

    African Journals Online (AJOL)

    sheep semen before freezing. C. Kemp. Animal and Dairy Science Research Institute, Private Bag X2,. Irene, 1675 Republic of South Africa. Received 6 June 1985. A practical and repeatable method for the cooling, during the processing phase, of sheep semen, with the aim of minimizing inter-experiment variation is ...

  1. Hydrologic and water-quality response of forested and agricultural lands during the 1999 extreme weather conditions in Eastern North Carolina

    Science.gov (United States)

    J.D. Shelby; G.M. Chescheir; R.W. Skaggs; D.M. Amatya

    2006-01-01

    This study evaluated hydrologic and water-quality data collected on a coastal-plain research watershed during a series of hurricanes and tropical storms that hit coastal North Carolina in 1999, including hurricanes Dennis, Floyd, and Irene. DU ring September and October 1999, the research watershed received approximately 555 mm of rainfall associated with hurricanes....

  2. Byzantine Hymns in Churches of Constantinople - An Archaeological Soundscape

    DEFF Research Database (Denmark)

    Troelsgård, Christian; Rindel, Jens Holger

    2010-01-01

    Ved hjælp af digitale 3D-modeller genskabes de gamle kirkerums akustik. Under det EU-støttede projekt CAHRISMA (2000-2003), hvori Ørsted-DTU deltog, blev opbygget modeller af de tre justinianske kirker, Hagia Sophia, Hagia Irene, og Sergios og Bacchos. De stilles her til rådighed af firmaet ODEON...

  3. Tagasisidet peab töötajale vahendama ülemus / Mait Raava

    Index Scriptorium Estoniae

    Raava, Mait

    2004-01-01

    Autor teeb lühiülevaate 360ʻ ja teiste tagasiside meetodite rakendamisest maailmas alates 1950ndatest aastatest ning juhib tähelepanu vigadele, mida meetodi rakendamisel on tehtud. Kommenteerib Irene Metsis. Skeem: Juht saab tagasiside nelja kanali kaudu. Vt. samas: Rollist tulenevalt on tagasiside erinev

  4. Creative Artist 2

    African Journals Online (AJOL)

    Precious

    The profile of Irene Salami, a new Nigerian female academic and dramatist is ... in the kingdom. Paraphrasing Brimstone, one sees in Emotan's .... What the play does is to try to carve a direction for Nona, ... Spousal support for career tracking and political ambition ... excluded or included in the scheme of things, men cannot.

  5. Go4Life

    Medline Plus

    Full Text Available ... Go4Life exercises to improve your strength! Stronger muscles can make it easier to do everyday things like ... 513 views Trainer Sandy shows Irene that you can do Go4Life exercises anywhere, even the kitchen! CC ...

  6. 1.8. Brand*, HA Badenhorst, FK 8iebrits and EH Kemm JP Hayes et ...

    African Journals Online (AJOL)

    Brand*, H.A. Badenhorst, F.K. 8iebrits and E.H. Kemm. Animal and Dairy Science Research Institute, Private Bag X2, Irene 1675, Republic of South Africa. J.P. Hayes. Department of Poultry Science, University of Stellenbosch, Stellenbosch 7600, Republic of South Africa. The experiment was conducted to compare the ...

  7. Vulture News

    African Journals Online (AJOL)

    ... underutilized samples for detecting organophosphorus and carbamate pesticide poisoning in raptors · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Ngaio Richards, Irene Zorrilla, Joseph Lalah, Peter Otieno, Isabel Fernandez, Monica Calvino, Joaquin Garcia ...

  8. Vulture News - Vol 72 (2017)

    African Journals Online (AJOL)

    ... but underutilized samples for detecting organophosphorus and carbamate pesticide poisoning in raptors · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Ngaio Richards, Irene Zorrilla, Joseph Lalah, Peter Otieno, Isabel Fernandez, Monica Calvino, Joaquin Garcia ...

  9. Browse Title Index

    African Journals Online (AJOL)

    Items 1 - 50 of 154 ... Vol 68, No 1 (2015), A preliminary assessment of the palate and tongue for detecting organophosphorus and carbamate pesticide exposure in the degraded carcasses of vultures and other animals, Abstract PDF PDF. Ngaio L Richards, Irene Zorilla, Isabel Fernandez, Monica Calvino, Joaquin Garcia, ...

  10. Law and Power in the Middle Ages

    DEFF Research Database (Denmark)

    International konferenceantologi med bidrag fra Gerd Althoff, Dominique Bauer, Bruce C Brasington, Charlotte Christensen-Nugues, Michael H Gelting, John Gillingham, Eldbjørg Haug, John Hudson, Brigitte Meijns, Hans Jacob Orning, Anne Irene Riisøy, Matthew Strickland, Jo Rune Ugulen, og Sally N Va...

  11. Journal of the Cameroon Academy of Sciences - Vol 1, No 1 (2001)

    African Journals Online (AJOL)

    Utilisation du papier filtre dans la gestion de programme de lute contre le SIDA au Cameroun, EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. Marie-Claire Okomo Assoumou, Dieudonné Adiogo, Irene Yatabene Bobcokono, Peter Ndumbe, 9-13 ...

  12. Author Details

    African Journals Online (AJOL)

    Bobcokono, Irene Yatabene. Vol 1, No 1 (2001) - Articles Utilisation du papier filtre dans la gestion de programme de lute contre le SIDA au Cameroun Details PDF · AJOL African Journals Online. HOW TO USE AJOL... for Researchers · for Librarians · for Authors · FAQ's · More about AJOL · AJOL's Partners · Terms and ...

  13. Bereavement Care Provision in Europe

    DEFF Research Database (Denmark)

    Guldin, Mai-Britt; Murphy, Irene; Keegan, Orla

    2015-01-01

    The Bereavement Care Taskforce of the EAPC has conducted a survey on bereavement care service provision in Europe. Mai-Britt Guldin, Irene Murphy, Orla Keegan, Barbara Monroe, Maria Antonia Lacasta Reverte and Inger Benkel report on the results. One of the key findings is that not all palliative...

  14. Solid medical waste management in Africa

    African Journals Online (AJOL)

    user

    databases searched using the same search terms included Web of. Science, Embase, Scopus, Proquest and African ..... Shannon, Taubman Library, University of Michigan, Ann. Arbor, USA, Ms. Irene Rattenborg, ..... Healthcare waste management in clinics in a rural health district in. KwaZulu-Natal. South Afr J Epidemiol ...

  15. Kõige olulisemate Prantsuse kirjandusauhindade väljakuulutamine langeb novembri algusele / Lauri Eesmaa

    Index Scriptorium Estoniae

    Eesmaa, Lauri

    2004-01-01

    Académie Franȧise'i romaanipreemia sai Bernard du Boucheron romaani "Court serpent" ("Lühike madu") eest. Goncourt'i preemia sai Laurent Gaudé romaani "La soleil des Scorta" ("Scortade päike" eest). Redaunot' preemia määrati postuumselt Irene Némirovsky romaanile "Suite Franȧise"

  16. Ballet as Somatic Practice: A Case Study Exploring the Integration of Somatic Practices in Ballet Pedagogy

    Science.gov (United States)

    Berg, Tanya

    2017-01-01

    This case study explores one teacher's integration of Alexander Technique and the work of neuromuscular retrainer Irene Dowd in ballet pedagogy to establish a somatic approach to teaching, learning, and performing ballet technique. This case study highlights the teacher's unique teaching method called IMAGE TECH for dancers (ITD) and offers…

  17. Negotiations: Experienced vs. Inexperienced Negotiators

    Science.gov (United States)

    1990-12-01

    Alange , Shauna E., "Ethics in Government Procurement? Edition I1," Briefing Papers, No 87-8, July 1987. 176 12. Guimera, Irene, "Small Business and the...Exercises, and Cases, Preface by Roy J. Lewicki and Joseph Litterer, Homewood, Illinois: Irwin, 1985, pp. 156-164. Johnson, W. Stanfield, and Alange

  18. Feed intake, live mass-gain, body composition and protein ...

    African Journals Online (AJOL)

    Feed intake, live mass-gain, body composition and protein deposition in pigs fed three protein levels. E.H. Kemm,* F.K. Siebrits, M.N. Ras and H.A. Badenhorst. Animal and Dairy Science Research Institute, Private Bag X2, Irene 1675, Republic of South Africa. A group of 82 genetically lean and 90 obese Landrace pigs was ...

  19. Enrico Fermi – The Complete Physicist

    Indian Academy of Sciences (India)

    ias

    bridge in 1932 by bombarding beryllium with α-particles. In Paris, Irene Curie ... the experiments with a very simple arrangement. First ..... Pu production and the design of a Pu bomb. ..... relatively short life span of 53 years as much as Enrico.

  20. Ocean Circulation and Dynamics on the West Antarctic Peninsula Continental Shelf

    Science.gov (United States)

    2007-09-01

    Pena-Molino, Stephanie Waterman, Ted Durland, Leif Tomas, Irene Garcia, Fiamma Straneo, Luc Rainville, Mary-Louise 6 Timmermans, Malcolm Scully, Dave...R., Atkinson, A., Korb, A., Whitehouse, M., Ward, P., Rodhouse, P., Enderlein, P., Hirst, A., Martin, A., Hill, S., Staniland, I., Pond, D., Briggs

  1. Growth, carcase and meat characteristics of stress susceptible and ...

    African Journals Online (AJOL)

    Growth, carcase and meat characteristics of stress susceptible and stress resistant. South African Landrace gilts. P.H. Heinze*. Animal and Dairy Science Research Institute, Private Bag X2, Irene, 1675Republic of South Africa. G. Mitchell. Department of Physiology, Medical School, University of the Witwatersrand, York ...

  2. Diseño y evaluación de un programa de habilidades para la salud en niños en comunidades rurales /

    OpenAIRE

    Anaya González, Cecilia Irene sustentante.

    2009-01-01

     tesis que para obtener el grado de Doctor en Psicología, presenta Cecilia Irene Anaya González ; asesor Susan Pick Steiner. 197 páginas : ilustraciones. Doctorado en Psicología UNAM, Facultad de Psicología, 2009

  3. 76 FR 61374 - Massachusetts; Emergency and Related Determinations

    Science.gov (United States)

    2011-10-04

    ... Hurricane Irene beginning on August 26, 2011, and continuing, are of sufficient severity and magnitude to... Commonwealth of Massachusetts have been designated as adversely affected by this declared emergency: Emergency... Unemployment Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing Assistance to...

  4. 76 FR 60849 - Vermont; Emergency and Related Determinations

    Science.gov (United States)

    2011-09-30

    ... from Hurricane Irene beginning on August 26, 2011, and continuing, are of sufficient severity and... State of Vermont have been designated as adversely affected by this declared emergency: The entire State... Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing Assistance to...

  5. 76 FR 60513 - Puerto Rico; Emergency and Related Determinations

    Science.gov (United States)

    2011-09-29

    ... resulting from Hurricane Irene beginning on August 21, 2011, and continuing, are of sufficient severity and... adversely affected by this declared emergency: All 78 municipalities in the Commonwealth of Puerto Rico for... Unemployment Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing Assistance to...

  6. 76 FR 60850 - Delaware; Emergency and Related Determinations

    Science.gov (United States)

    2011-09-30

    ... determined that the emergency conditions in the State of Delaware resulting from Hurricane Irene beginning on... have been designated as adversely affected by this declared emergency: The entire State of Delaware for... Management Assistance Grant; 97.048, Disaster Housing Assistance to Individuals and Households in...

  7. 76 FR 64959 - District of Columbia; Major Disaster and Related Determinations

    Science.gov (United States)

    2011-10-19

    ... of Columbia resulting from Hurricane Irene during the period of August 26 to September 1, 2011, is of... following areas of the District of Columbia have been designated as adversely affected by this major... Unemployment Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing Assistance to...

  8. 76 FR 61372 - New Hampshire; Emergency and Related Determinations

    Science.gov (United States)

    2011-10-04

    ... Hurricane Irene beginning on August 26, 2011, and continuing, are of sufficient severity and magnitude to... following areas of the State of New Hampshire have been designated as adversely affected by this declared... Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing Assistance to...

  9. 76 FR 60512 - Virginia; Emergency and Related Determinations

    Science.gov (United States)

    2011-09-29

    ... Hurricane Irene beginning on August 26, 2011, and continuing, are of sufficient severity and magnitude to... Commonwealth of Virginia have been designated as adversely affected by this declared emergency: Accomack..., Disaster Housing Assistance to Individuals and Households in Presidentially Declared Disaster Areas; 97.049...

  10. 76 FR 61726 - North Carolina; Emergency and Related Determinations

    Science.gov (United States)

    2011-10-05

    ... Hurricane Irene beginning on August 25, 2011, and continuing, are of sufficient severity and magnitude to... State of North Carolina have been designated as adversely affected by this declared emergency: Carteret... Grant; 97.048, Disaster Housing Assistance to Individuals and Households in Presidentially Declared...

  11. 76 FR 61373 - Connecticut; Emergency and Related Determinations

    Science.gov (United States)

    2011-10-04

    ... determined that the emergency conditions in the State of Connecticut resulting from Hurricane Irene beginning... designated as adversely affected by this declared emergency: All eight counties in the State of Connecticut... Management Assistance Grant; 97.048, Disaster Housing Assistance to Individuals and Households In...

  12. 76 FR 64959 - Delaware; Major Disaster and Related Determinations

    Science.gov (United States)

    2011-10-19

    ... resulting from Hurricane Irene during the period of August 25-31, 2011, is of sufficient severity and... State of Delaware have been designated as adversely affected by this major disaster: Kent and Sussex... Unemployment Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing Assistance to...

  13. 76 FR 60512 - New York; Emergency and Related Determinations

    Science.gov (United States)

    2011-09-29

    ... from Hurricane Irene beginning on August 25, 2011, and continuing, are of sufficient severity and... as adversely affected by this declared emergency: Bronx, Kings, New York, Queens, Richmond, Nassau..., Disaster Housing Assistance to Individuals and Households In Presidentially Declared Disaster Areas; 97.049...

  14. 76 FR 61728 - Pennsylvania; Major Disaster and Related Determinations

    Science.gov (United States)

    2011-10-05

    ... Commonwealth of Pennsylvania resulting from Hurricane Irene during the period of August 26-30, 2011, is of... Commonwealth of Pennsylvania have been designated as adversely affected by this major disaster: Chester... Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing Assistance to...

  15. 76 FR 60850 - Rhode Island; Emergency and Related Determinations

    Science.gov (United States)

    2011-09-30

    ... Hurricane Irene beginning on August 26, 2011, and continuing, are of sufficient severity and magnitude to... State of Rhode Island have been designated as adversely affected by this declared emergency: Providence..., Disaster Unemployment Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing...

  16. 76 FR 61372 - Pennsylvania; Emergency and Related Determinations

    Science.gov (United States)

    2011-10-04

    ... resulting from Hurricane Irene beginning on August 26, 2011, and continuing, are of sufficient severity and... following areas of the Commonwealth of Pennsylvania have been designated as adversely affected by this..., Disaster Housing Assistance to Individuals and Households in Presidentially Declared Disaster Areas; 97.049...

  17. 76 FR 60516 - Virginia; Major Disaster and Related Determinations

    Science.gov (United States)

    2011-09-29

    ... resulting from Hurricane Irene during the period of August 26-28, 2011, is of sufficient severity and... of the Commonwealth of Virginia have been designated as adversely affected by this major disaster... Unemployment Assistance (DUA); 97.046, Fire Management Assistance Grant; 97.048, Disaster Housing Assistance to...

  18. Let Lakatos Be! A Commentary on "Would the Real Lakatos Please Stand Up"

    Science.gov (United States)

    Sriraman, Bharath

    2008-01-01

    In this commentary, some remarks are offered on David Pimm, Mary Beisiegel, and Irene Meglis' article "Would the Real Lakatos Please Stand up." The commentary focuses on relatively recent developments in the philosophy of mathematics based on the work of Lakatos; on theory development in mathematics education; and offers critique on whether…

  19. THE MICROBIOLOGY OF SOUTH AFRICAN DRIED SAUSAGE

    African Journals Online (AJOL)

    THE MICROBIOLOGY OF SOUTH AFRICAN DRIED SAUSAGE. W.H. Holzapfel and A.N. Hail. Receipt of MS s.3.76. Department of Microbiology and Plant Pathology, University of hetoria and. Animol and Dairv Science Reseorch Institute, Irene. OPSOMMING: DIE MIKROBIOLOGIE VAN SUID.AFRIKAANSE DROiWORS.

  20. Browse Title Index

    African Journals Online (AJOL)

    Items 51 - 100 of 1309 ... Li-Long Liu, Kai Xu, Lu-Mei Kang, Shu-Ping Jiang, Qing-Hua Wang, ... CR Sewani-Rusike, JE Iputo, EJ Ndebia, M Gondwe, DR Kamadyaapa ... K-M Man, W-C Chen, H-M Wang, H-Y Chen, J-L Shen, L-D Chen, F-J Tsai, ...

  1. Soil Behavior Under Blast Loading

    Science.gov (United States)

    2010-12-01

    in detail (Lade 2005, Prevost and Popescu 1996, Chen and Baladi 1985). Models that are appropriate to be implemented into finite element programs...Chen and Baladi 1985). As the soil strain hardens, both the cone and the end cap expand. This concept of cap envelope was a major step forward...hardening cap model (Chen and Baladi 1985) 17 The modified Cam-clay model was developed at Cambridge University by Roscoe et al. (1963). This

  2. Reference: 418 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available 418 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u4ria224u16856986i Chai Mao-Feng...cid responses in Arabidopsis. 5 665-74 16856986 2006 Sep The Plant journal An Rui|Chai Mao-Feng|Chen Jia|Chen Qi-Jun|Wang Xue-Chen|Wei Peng-Cheng|Yang Shuhua

  3. Taiwan in 2004: Elections, Referenda, and Other Democratic Challenges

    National Research Council Canada - National Science Library

    Dumbaugh, Kerry

    2005-01-01

    .... In both the presidential and legislative election campaigns, Chen emphasized gaining a separate international identity for Taiwan -- an emphasis to which Beijing strenuously objected as dangerously...

  4. 77 FR 28880 - Ocean Transportation Intermediary License Applicants

    Science.gov (United States)

    2012-05-16

    ... (NVO & OFF), 332 Hindry Avenue, Inglewood, CA 90301, Officers: Edison Chen, Manager (Qualifying..., Schiller Park, IL 60176, Officers: Scott A. Case, Vice President (Qualifying Individual), Thomas C. Case...

  5. Journal of Biosciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Biosciences. Chen Fang. Articles written in Journal of Biosciences. Volume 30 Issue 3 June 2005 pp 351-357 Articles. Expression of a ribosome inactivating protein (curcin 2) in Jatropha curcas is induced by stress · Wei Qin Huang Ming-Xing Xu Ying Zhang Xin-Shen Chen Fang · More Details ...

  6. Evaluation of effectiveness in a novel wound healing ointment ...

    African Journals Online (AJOL)

    Evaluation of effectiveness in a novel wound healing ointment-crocodile oil burn ointment. Hua-Liang Li, Yi-Tao Deng, Zi-Ran Zhang, Qi-Rui Fu, Ya-Hui Zheng, Xing-Mei Cao, Jing Nie, Li-Wen Fu, Li-Ping Chen, You-Xiong Xiong, Dong-Yan Shen, Qing-Xi Chen ...

  7. Enhanced Thermal Transport of Surfaces with Superhydrophobic Coatings

    Science.gov (United States)

    2015-07-01

    resistance conferred by superhydrophobic fluorinated polyacrylate-silica composite coatings on cold-rolled steel. Journal of Applied Polymer Science... thiolates on metals as a form of nanotechnology. ChemInform. 2005:36. doi: 10.1002/chin.200532281. 9. Chen C-H, Cai Q, Tsai C, Chen C-L, Xiong G

  8. Advances in SCA and RF-DNA Fingerprinting Through Enhanced Linear Regression Attacks and Application of Random Forest Classifiers

    Science.gov (United States)

    2014-09-18

    22:477– 505 , 2007. [21] Bushnell, Michael L. and Vishwani Agrawal. Essentials of Electronic Testing for Digital, Memory, and Mixed-Signal VLSI...Investigation”. Knowledge and information systems, 10(4):453–472, 2006. [68] Liang, Nia -Chiang, Ping-Chieh Chen, Tony Sun, Guang Yang, Ling-Jyh Chen

  9. A comparative study assessing a new tool for occluding ...

    African Journals Online (AJOL)

    0.630, p=0.068 and p=0.047, respectively) (Table 2). A comparative study assessing a new tool for occluding parenchymal blood flow during liver resection for hepatocellular carcinoma. S Zhou, X-J Xue, R-R Li, D-F Chen, W-Y Chen, G-X Liu, ...

  10. (DEPSCOR FY 09) Obfuscation and Deobfuscation of Intent of Computer Programs

    Science.gov (United States)

    2012-12-21

    increased as the malware distribution mechanism has moved to the web through infected sites. In this use a site is hacked so as to distribute malware to...Simpósio Brasileiro em Segurança da Informaçao e de Sistemas Computacionais (2009). (Chen et al., 2012) Jundong Chen, Matthias R. Brust, Vir V. Phoha

  11. The roles of electronic books in the transformation of learning and instruction

    NARCIS (Netherlands)

    Huang, Ronghuai; Chen, Nian-Shing; Kang, Myunghee; McKenney, Susan; Churchill, Daniel

    2014-01-01

    Huang, R., Chen, N., Kang, M. McKenney, S. & Churchill, D. (2013). The roles of electronic books in the transformation of learning and instruction. In N. Chen, R. Huang, Kinshuk, Y. Li, D. G. Sampson (Eds.) Proceedings of the IEEE 13th International Conference on Advanced Learning Technologies

  12. African Journal of Biotechnology - Vol 10, No 60 (2011)

    African Journals Online (AJOL)

    Microsatellite variability reveals significant genetic differentiation of giant pandas (Ailuropoda melanoleuca) in the Minshan A habitat · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Yang, R Hou, F Shen, X Yang, L Zhang, L Chen, W Chen, W Zhang, Q Zhu, Z Zhang ...

  13. Trend analysis and change point detection of annual and seasonal ...

    Indian Academy of Sciences (India)

    elevation ranges from 0 m in the coastal areas of the. Persian Gulf to over ... been explained by Kang and Yusof (2012); Dhorde ...... J L 2004 Detection of statistically significant trends in ... Sun H, Chen Y, Li W, Li F, Chen Y, Hao X and Yang Y.

  14. The effects of growth time on the quality of graphene synthesized by ...

    Indian Academy of Sciences (India)

    by LPCVD. A JAFARI, R ALIPOUR∗ and M GHORANNEVISS ..... Li T, Hass J, Marchenkoy A N, Conrad E H, First P N and de ... Ni Z H, Chen W, Fan X F, Kuo J L, Yu T, Wee A T S ... Chen S, Cai W, Piner R D, Suk J W, Wu Y, Ren Y, Kang Y.

  15. Genome-Wide Chromosomal Targets of Oncogenic Transcription Factors

    Science.gov (United States)

    2008-04-01

    Altman, W.E., Attiya, S., Bader, J.S., Bemben, L.A., Berka , J., Braverman, M.S., Chen, Y.J., Chen, Z., et al. 2005. Genome sequencing in microfabricated...software after filtering to exclude bad spots. qPCR validation. Primer pairs used in Figure 1 were designed to cover three peaks and three troughs in

  16. The Response of Small Scale Rigid Targets to Shallow Buried Explosive Detonations

    Science.gov (United States)

    2011-09-01

    properties as applied in this work was based on some of the standard defini- tions of soil constitutive properties as found in, e.g., Chen and Baladi [18...Technology Corporation; 2007. [18] Chen WF, Baladi GY. Soil plasticity: theory and implementation. New York: Elsevier Science; 1985. [19] Zimmerman

  17. Application of an Arbitrary Lagrangian Eulerian Method to Describe High Velocity Gas-Particle Flow Behavior

    Science.gov (United States)

    2011-09-01

    applied in this work was based on some of the standard definitions of soil constitutive properties as found in, e.g., Chen and Baladi [20], and...Livermore, CA. [20] Chen, W. F., and Baladi , G. Y., 1985. Soil Plasticity: Theory and Implementation. Elsevier Science, New York. [21] Zimmerman, H.D

  18. Untitled

    Indian Academy of Sciences (India)

    20. Nevill GA and Cook D 1969 Can. J. Chen. 47 743. 21. Glasel GA 1969 Org. Magn. Reson. 1481. 22. Soundarajan S 1958 Trans. Faraday Soc. 54147. 23. Rein R 1971 Int. J. Quant. Chem., Symp, 4341. 24. Woet D 1972.J. Am. Chen, Soc. 94.8213. 25. Bideau.JP, Huong PV and Toure S 1976 Acta Crystallogr. B32481.

  19. Mechanisms of all-trans retinoic acid-induced differentiation of acute ...

    Indian Academy of Sciences (India)

    Author Affiliations. Ji-Wang Zhang1 Jian Gu1 Zhen-Yi Wang1 Sai-Juan Chen1 Zhu Chen1. Shanghai Institute of Hematology, Ruijin Hospital Affiliated to Shanghai Second Medical University, 197 Ruijin Road II, Shanghai 200025, People's Republic of China ...

  20. A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBand EFHC2gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN SONG YULAI ...

  1. WAIS-IV and WISC-IV Structural Validity: Alternate Methods, Alternate Results. Commentary on Weiss et al. (2013a) and Weiss et al. (2013b)

    Science.gov (United States)

    Canivez, Gary L.; Kush, Joseph C.

    2013-01-01

    Weiss, Keith, Zhu, and Chen (2013a) and Weiss, Keith, Zhu, and Chen (2013b), this issue, report examinations of the factor structure of the Wechsler Adult Intelligence Scale-Fourth Edition (WAIS-IV) and Wechsler Intelligence Scale for Children-Fourth Edition (WISC-IV), respectively; comparing Wechsler Hierarchical Model (W-HM) and…

  2. A reviewof the pharmacologicalmechanism of traditional Chinese ...

    African Journals Online (AJOL)

    A reviewof the pharmacologicalmechanism of traditional Chinese medicine in the intervention of coronary heart disease and stroke. W Zhang, K Gao, K Gao, J Liu, J Liu, H Zhao, H Zhao, J Wang, J Wang, Y Li, Y Li, G Murtaza, G Murtaza, J Chen, J Chen, W Wang, W Wang ...

  3. African Journal of Traditional, Complementary and Alternative ...

    African Journals Online (AJOL)

    Anti-tumour effects of polysaccharides isolated from Artemisia Annua L by inducing cell apoptosis and immunomodulatory anti-hepatoma effects of polysaccharides · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. J Chen, J Chen, X Wang, C Liu, 15-22.

  4. Journal of Genetics | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    ... Refresher Courses · Symposia · Live Streaming. Home; Journals; Journal of Genetics; Volume 95; Issue 1. Novel NPHS1 gene mutations in a Chinese family with congenital nephrotic syndrome. Fengjie Yang Yaxian Chen Yu Zhang Liru Qiu Yu Chen Jianhua Zhou. Research Note Volume 95 Issue 1 March 2016 pp 161- ...

  5. Impacts of DNAPL Source Treatment: Experimental and Modeling Assessment of the Benefits of Partial DNAPL Source Removal

    Science.gov (United States)

    2009-09-01

    this project: A. Noman M. Ahsanuzzaman, Steve Acree, Nandita Basu, Sten Berglund, Carol Bratt, Gordon Brown, Xaisong Chen, Jaehyun Cho, Pat Clark...A.S.C. Chen (eds). Chapelle, F.H., J.S. Widdowson, J.S. Bruner, E. Mendez , and C.C. Casey (2003). Methodology for Estimating Times of Remediation

  6. Enhancement of Radiation Therapy in Prostate Cancer by DNA-PKcs Inhibitor

    Science.gov (United States)

    2015-09-01

    Center, Urology Habib , Amyn; UTSouthwestern Medical Center, Neurology & Neurotherapeutics Chen, Benjamin; UTSouthwestern Medical Center, Radiation...Tsong Hsieh 3,5,7 , Amyn A. Habib 4,5,6 , Benjamin Chen 1,4 and Debabrata Saha 1,4 1 Department of Radiation Oncology, 3 Department of Urology, 4

  7. A novel contiguous deletion involving NDP, MAOB and EFHC2 gene ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 96; Issue 6. A novel contiguous deletion involving NDP, MAOBitalic> and EFHC2italic> gene in a patient with familial Norrie disease: bilateral blindness and leucocoria without other deficits. BEI JIA LIPING HUANG YAOYU CHEN SIPING LIU CUIHUA CHEN KE XIONG LANLIN ...

  8. Browse Title Index

    African Journals Online (AJOL)

    Vol 9, No 1 (2006), Splenectomy in a rural surgical practice, Abstract PDF. E Alufohai, OO Odusanya. Vol 20, No 9 (2017), Spontaneous Retropharyngeal Emphysema: A Case Report, Abstract PDF. T-H Chi, C-C Hung, R-F Chen, C-H Yuan, J-C Chen. Vol 5, No 2 (2002), Spontaneous Rupture Of A Massive Hydrocephalus ...

  9. 75 FR 7358 - Addition of Certain Persons to the Entity List: Addition of Persons Acting Contrary to the...

    Science.gov (United States)

    2010-02-19

    ... Company Ltd., 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan; and (4) Yi-Lan Chen, a.k.a., Kevin Chen, 13/F, Number 181, Sec 1, Datong Rd., Sijhih City, Taipei, Taiwan, and 7th Floor, Number 17... the requirements of the Paperwork Reduction Act of 1995 (44 U.S.C. 3501 et seq.) (PRA), unless that...

  10. 75 FR 4509 - Uniform Criteria for State Observational Surveys of Seat Belt Use

    Science.gov (United States)

    2010-01-28

    ... statistical issues: Ms. Chou-Lin Chen, Chief, Mathematical Analysis Division, National Center for Statistics..., Washington, DC 20590. Telephone number: 202-366-1048; E- mail: Chou-Lin.Chen@dot.gov . For legal issues: Ms..., and reduce burden. E. Paperwork Reduction Act Under the Paperwork Reduction Act of 1995, a person is...

  11. The effects of reciprocal cross on inheritance of DNA methylation in ...

    African Journals Online (AJOL)

    enoh

    2012-03-20

    Mar 20, 2012 ... DNA methylation plays an important role for regulation of gene expression. To study ... genes, and newly acquired epigenetic states of trans- ... GACTGCGTACCAATTCAGA(E6). ATCATGAGTCCTGCTCGGTAC(H6). GACTGCGTACCAATTCAGT(E7) ..... Chen XQ, Ma Y, Chen F, Song WQ, Zhang L (2009).

  12. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    YUZHI CHEN1 2 XUDONG CHEN2 JINGWU BU3. Architectural Engineering Institute, Jinling Institute of Technology, Nanjing 211169, China; College of Civil and Transportation Engineering, Hobai University, Nanjing 210098, China; College of Water Conservancy and Hydropower Engineering, Hohai University, Nanjing ...

  13. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Chemical Sciences. Chen Chai. Articles written in Journal of Chemical Sciences. Volume 126 Issue 3 May 2014 pp 813-820 Regular Articles. First total synthesis of Boehmenan · Yamu Xia Xiaoli Dai Haixin Liu Chen Chai · More Details Abstract Fulltext PDF. The first total synthesis of dilignan ...

  14. Three novel antioxidants from Cinnamomum plants | Cheng | African ...

    African Journals Online (AJOL)

    Three novel antioxidants from Cinnamomum plants. K-C Cheng, H-A Chen, P-F Wu, W-L Yang, H-M Wang, C-Y Chen. Abstract. In this study, we identified three novel antioxidants, subamolide C (1), subamolide E (2) and isokotomolide A (3) from the constitutes of Cinnamomum subavenium and Cinnamomum kotoense.

  15. The validity and accuracy in foot-to-foot bioelectrical impedance ...

    African Journals Online (AJOL)

    The validity and accuracy in foot-to-foot bioelectrical impedance analysis measuring models referenced by dual-energy X-ray absorptiometry in body composition in standing position. KC Hsieh, HK Lu, CH Chen, TR Jang, YY Chen, MF Kao ...

  16. High School Students' Topic Preferences and Oral Development in an English-Only Short-Term Intensive Language Program

    Science.gov (United States)

    Hsieh, Hui-Chen

    2016-01-01

    Developing the ability to speak English is a daunting task that has long been omitted in a test-driven pedagogy context (Chang, 2011; Li, 2012a, 2012b; Chen & Tsai, 2012; Katchen, 1989, 1995). Since speaking is not tested for school admissions, most students are not motivated to learn it (Chang, 2011; Chen & Tsai, 2012). Now, globalization…

  17. Sadhana | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Home; Journals; Sadhana. B Chen. Articles written in Sadhana. Volume 38 Issue 4 August 2013 pp 557-569. Flexibility-based structural damage identification using Gauss–Newton method · B Chen S Nagarajaiah · More Details Abstract Fulltext PDF. Structural damage will change the dynamic characteristics, including ...

  18. New St-chromosome-specific molecular markers for identifying ...

    Indian Academy of Sciences (India)

    et al. 1994) or JJsSt (Chen et al. 1998) was widely used in wheat breeding programme (Chen .... Japan). Table 1. The features of primers used in this study. Homologous ..... Redinbaugh M. G., Jones T. A. and Zhang Y. T. 2000 Ubiquity of.

  19. Materia extraña

    CERN Document Server

    Gómez Cadenas, J J

    2008-01-01

    Enero, 1999. Unas extrañas burbujas se han colocado en el acelerador de particulas del CERN (Ginebra). Ante el riesgo de que esto desencadene una catástrofe a escala mundial, el centro ordena detener el experimento. Años después, Irene, una joven y promotedora científica, es contratada en la división de Física Teórica del CERN. Allí coincide con el mayor Espinosa, destinado a la sede suiza de la ONU para trabajar en un proyecto contra la proliferación de armas nucleares. La misión de Espinosa resulta ser mucho más arriesgada de lo que parecía. Irene ambiciosa y rebelde, toma una decisión de efectos imprevisibles.

  20. O gênero Strangalia Audinet-Serville no Norte e Centro-Oeste do Brasil (Coleoptera, Cerambycidae, Lepturinae The genus Strangalia Audinet-Serville in northern and central Brazil (Coleoptera, Cerambycidae, Lepturinae

    Directory of Open Access Journals (Sweden)

    Marcela L. Monné

    2005-06-01

    Full Text Available As espécies do gênero Strangalia Audinet-Serville do Norte e Centro-Oeste do Brasil são revistas. Strangalia xanthomelaena sp. nov. é descrita de Rondônia e Mato Grosso, Brasil. Dois novos sinônimos são propostos: Ophistomis irene Gounelle, 1911 = Euryptera albicollis Pascoe, 1860; O. paraensis Bates, 1870 = O. bivittatus Bates, 1870. São fornecidas ilustrações e chave para identificação das espécies.The species of the genus Strangalia from northern and central Brazil are revised. Strangalia xanthomelaena sp. nov. is described from Rondônia and Mato Grosso, Brazil. Two new synonyms are proposed: Ophistomis irene Gounelle, 1911 = Euryptera albicollis Pascoe, 1860; O. paraensis Bates, 1870 = O. bivittatus Bates, 1870. Illustrations and key for identification are provided.

  1. 50 years with nuclear fission, April 25-28, 1989. A prelude to fission: France

    International Nuclear Information System (INIS)

    Savic, P.

    1989-01-01

    A personal account of the events leading to the 1938 discovery, by Irene Joliot-Curie and the author, of the unidentified element R 3.5h will be presented, as well as the experimental methods proving the R 3.5h had chemical properties similar to lanthanum which in turn led Hahn and Strassmann to the discovery of fission in 1939. The author points out that Irene Curie's intuition indicated the path towards the solution of the problem of uranium irradiated by neutrons, which made possible the discovery of fission by Hahn and Strassmann. Further applications of fission became possible by tremendous efforts and excellent contributions of scientists in the USA

  2. Women at CERN: Once upon a time…

    CERN Multimedia

    Antonella Del Rosso

    2015-01-01

    In 1995, a working group was set up to address the gender imbalance at CERN. Twenty years later, the people involved in the endeavour celebrated the long series of achievements recorded by today’s Diversity Office.     Situation in 1995: 14% women/total employees. Categories requiring university-level education = 5% women/total.     Top: The working group that submitted a report to the Management with recommendations to increase the number of women working at CERN (1995). From left to right: Maria Fidecaro, Sudeshna Datta-Cockerill, Irene Seis, Eva-Maria Gröniger-Voss, Linda Griffiths. Bottom: In 2015, the working group celebrates the achievements of the Diversity policy together with the various people who have been involved in its implementation. From left to right: Maria Fidecaro, Geneviève Guinot, Eva-Maria Gröniger-Voss, Sudeshna Datta-Cockerill, Irene Seis, Josi Schinzel, Doris Chromek-Burckhart. &nbs...

  3. Short communication: selective cytotoxicity of curcumin on osteosarcoma cells compared to healthy osteoblasts

    Directory of Open Access Journals (Sweden)

    Chang R

    2014-01-01

    Full Text Available Run Chang,1 Linlin Sun,1 Thomas J Webster1,21Department of Chemical Engineering, Northeastern University, Boston, MA, USA; 2Center of Excellence for Advanced Materials Research, King Abdulaziz University, Jeddah, Saudi ArabiaAbstract: Curcumin is a natural phenolic compound extracted from the plant Curcuma longa L. In previous studies, curcumin has been shown to have anticancer, antioxidant, and anti-inflammatory effects. In this study, the cytotoxicity of different concentrations (5, 10, 25, 50, 75, and 100 µM of curcumin dissolved in dimethyl sulfoxide was compared between MG-63 osteosarcoma and healthy human osteoblast cells. Consequently, the viability of osteosarcoma cells was less than 50% at a concentration of 10 µM compared to the control sample without curcumin, but healthy osteoblast cells had at least 80% viability throughout all the concentrations tested. The results demonstrated that MG-63 osteosarcoma cells were much more sensitive in terms of cytotoxicity to curcumin, while the healthy human osteoblasts exhibited a higher healthy viability after 24 hours of curcumin treatment. Therefore, this study showed that at the right concentrations (5 µM to 25 µM, curcumin, along with a proper nanoparticle drug delivery carrier, may selectively kill bone cancer cells over healthy bone cells.Keywords: curcumin, osteosarcoma, human osteoblast, viability, bone cancer

  4. Graphene oxide-modified ZnO particles: synthesis, characterization, and antibacterial properties

    Directory of Open Access Journals (Sweden)

    Zhong LL

    2015-08-01

    Full Text Available Linlin Zhong, Kyusik Yun Department of Bionanotechnology, Gachon University, Gyeonggi-do, Republic of Korea Abstract: Nanosized ZnO particles with diameters of 15 nm were prepared with a solution precipitation method at low cost and high yield. The synthesis of the particles was functionalized by the organic solvent dimethylformamide, and the particles were covalently bonded to the surface of graphene oxide. The morphology of the graphene oxide sheets and ZnO particles was confirmed with field emission scanning electron microscopy and biological atomic force microscopy. Fourier transform infrared spectroscopy and X-ray diffraction were used to analyze the physical and chemical properties of the ZnO/graphene oxide composites that differed from those of the individual components. Enhanced electrochemical properties were detected with cyclic voltammetry, with a redox peak of the composites at 0.025 mV. Excellent antibacterial activity of ZnO/graphene oxide composites was observed with a microdilution method in which minimum inhibitory concentrations of 6.25 µg/mL for Escherichia coli and Salmonella typhimurium, 12.5 µg/mL for Bacillus subtilis, and 25 µg/mL for Enterococcus faecalis. After further study of the antibacterial mechanism, we concluded that a vast number of reactive oxygen species formed on the surface of composites, improving antibacterial properties. Keywords: graphene oxide, ZnO, characterization, antibacterial property

  5. Carbon nanotube-incorporated collagen hydrogels improve cell alignment and the performance of cardiac constructs

    Directory of Open Access Journals (Sweden)

    Sun HY

    2017-04-01

    Full Text Available Hongyu Sun,* Jing Zhou,* Zhu Huang,* Linlin Qu,* Ning Lin,* Chengxiao Liang, Ruiwu Dai, Lijun Tang, Fuzhou Tian General Surgery Center, Chengdu Military General Hospital, Chengdu, China *These authors contributed equally to this work Abstract: Carbon nanotubes (CNTs provide an essential 2-D microenvironment for cardiomyocyte growth and function. However, it remains to be elucidated whether CNT nanostructures can promote cell–cell integrity and facilitate the formation of functional tissues in 3-D hydrogels. Here, single-walled CNTs were incorporated into collagen hydrogels to fabricate (CNT/Col hydrogels, which improved mechanical and electrical properties. The incorporation of CNTs (up to 1 wt% exhibited no toxicity to cardiomyocytes and enhanced cell adhesion and elongation. Through the use of immunohistochemical staining, transmission electron microscopy, and intracellular calcium-transient measurement, the incorporation of CNTs was found to improve cell alignment and assembly remarkably, which led to the formation of engineered cardiac tissues with stronger contraction potential. Importantly, cardiac tissues based on CNT/Col hydrogels were noted to have better functionality. Collectively, the incorporation of CNTs into the Col hydrogels improved cell alignment and the performance of cardiac constructs. Our study suggests that CNT/Col hydrogels offer a promising tissue scaffold for cardiac constructs, and might serve as injectable biomaterials to deliver cell or drug molecules for cardiac regeneration following myocardial infarction in the near future. Keywords: carbon nanotubes, collagen hydrogel, cardiac constructs, cell alignment, tissue functionality

  6. Gold nanoparticles enlighten the future of cancer theranostics

    Directory of Open Access Journals (Sweden)

    Guo J

    2017-08-01

    Full Text Available Jianfeng Guo,1 Kamil Rahme,2–4 Yan He,1 Lin-Lin Li,5 Justin D Holmes,3,4 Caitriona M O’Driscoll6 1School of Pharmaceutical Sciences, Jilin University, Changchun, China; 2Department of Sciences, Faculty of Natural and Applied Science, Notre Dame University (Louaize, Zouk Mosbeh, Lebanon; 3Department of Chemistry, Tyndall National Institute, University College Cork, Cork, 4AMBER@CRANN, Trinity College Dublin, Dublin, Ireland; 5The First Hospital of Jilin University, Changchun, China; 6Pharmacodelivery Group, School of Pharmacy, University College Cork, Cork, Ireland Abstract: Development of multifunctional nanomaterials, one of the most interesting and advanced research areas in the field of nanotechnology, is anticipated to revolutionize cancer diagnosis and treatment. Gold nanoparticles (AuNPs are now being widely utilized in bioimaging and phototherapy due to their tunable and highly sensitive optical and electronic properties (the surface plasmon resonance. As a new concept, termed “theranostics,” multifunctional AuNPs may contain diagnostic and therapeutic functions that can be integrated into one system, thereby simultaneously facilitating diagnosis and therapy and monitoring therapeutic responses. In this review, the important properties of AuNPs relevant to diagnostic and phototherapeutic applications such as structure, shape, optics, and surface chemistry are described. Barriers for translational development of theranostic AuNPs and recent advances in the application of AuNPs for cancer diagnosis, photothermal, and photodynamic therapy are discussed. Keywords: multifunctional gold nanoparticles, cancer bioimaging, cancer photothermal and photodynamic therapy

  7. Farmer perceptions of climate change risk and associated on-farm management strategies in Vermont, northeastern United States

    OpenAIRE

    Schattman, Rachel E.; Conner, David; Méndez, V. Ernesto

    2016-01-01

    Abstract Little research has been conducted on how agricultural producers in the northeastern United States conceptualize climate-related risk and how these farmers address risk through on-farm management strategies. Two years following Tropical Storm Irene, our team interviewed 15 farmers in order to investigate their perceptions of climate-related risk and how their decision-making was influenced by these perceptions. Our results show that Vermont farmers are concerned with both ecological ...

  8. Sealpool nukkude orgu asub pop-voodoo / Aleksander Tsapov

    Index Scriptorium Estoniae

    Tsapov, Aleksander

    2006-01-01

    Ekstsentrilisest disainist. Raffaele Ianello ja Irene van Gesteli noa- ja hambaorgihoidjad, Philippe Starcki ja Critz Campbelli tugitool-valgustid, August de Martinville'i papist jahitrofee, Sebastian E. partlamp, Isabelle Leijni keraamilised kiivrid, Harry Alleni hoiupõrsas jm. High-tech kodusisustuse näiteid: Jackie Shapiro disainitud taldrikud, Frank Gehry sofa, Ingo Maureri Campari Soda lamp, Sonya Chow siilvalgusti, Mathias Bengtssoni (sünd. 1971) alumiiniumtool, Piet Houtenbosi õlilambid jm.

  9. Infrastructure Innovation: Case Study of the Gautrain

    CSIR Research Space (South Africa)

    van der Merwe, J

    2017-10-01

    Full Text Available ROODEPOORT NALEDI COSMO RUIMSIG BLUE HILLS SAMRAND LAKEVIEW RHODESFIELD BOKSBURG RANDBURG HONEYDEW EAST RAND MALL OR TAMBO LANSERIA K: Additional Rolling Stock (The Future) Capacity Constraints – Gautrain Project Background Need... RHODESFIELD O.R. TAMBO SAMRAND IRENE TSHWANE EAST HAZELDEAN MAMELODI OLIEVENHOUTSBOSCH SUNNINGHILL FOURWAYS COSMO LITTLE FALLS ROODEPOORT JABULANI RANDBURG LANSERIA EAST RAND MALL BOKSBURG SANDTON 2 LEGEND North – South Commuter East...

  10. Role of rasagiline in treating Parkinson’s disease: effect on disease progression

    OpenAIRE

    Fernandez, Hubert; Malaty,

    2009-01-01

    Irene A Malaty, Hubert H FernandezUniversity of Florida Movement Disorders Center, Gainesville, FL, USAAbstract: Rasagiline is a second generation, selective, irreversible monoamine oxidase type B (MAO-B) inhibitor. It has demonstrated efficacy in monotherapy for early Parkinson’s disease (PD) patients in one large randomized, placebo-controlled trial (TVP-1012 in Early Monotherapy for Parkinson’s Disease Outpatients), and has shown ability to reduce off time in more advan...

  11. The Comparative Organizational Inequality Network: Toward an Economic Sociology of Inequality

    OpenAIRE

    Tomaskovic-Devey , Donald; Godechot, Olivier

    2017-01-01

    The international Comparative Organizational Inequality Network (COIN) asks: • What factors drive overall income inequality within and between workplaces? • How do workplaces exacerbate or mitigate the impact of individual distinctions, such as education level, gender, or immigrant status? • How do inequality-generating mechanisms vary as a function of institutional context? List of authors: Donald Tomaskovic-Devey with Nina Bandelj, Irene Boeckmann, István Boza, David Co...

  12. Possibility of some radionuclides production using high energy electron Bremsstrahlung

    International Nuclear Information System (INIS)

    Balzhinnyam, N.; Belov, A.G.; Gehrbish, Sh; Maslov, O.D.; Shvetsov, V.N.; Ganbold, G.

    2008-01-01

    The method of some radionuclides production using high energy Bremsstrahlung of electron accelerators and determination of photonuclear reaction yield and specific activities for some radionuclides is described. Photonuclear reaction yield and specific activities for some radionuclides are determined for 117m Sn, 111 In and 195m Pt. Based on the experimental data obtained at low energy (E e- e- = 75 MeV) of the IREN facility (FLNR, JINR) at irradiation of high purity platinum and tin metals

  13. Nuclear energy in Switzerland

    International Nuclear Information System (INIS)

    Aegerter, I.

    1988-01-01

    Dr.phil.nat. Irene Aegerter gave this presentation in the ATS monthly meeting in November 1988. In the presentation she gives an introduction to the Swiss energy management and policy. But above all, she explains the peculiar Swiss way to vote or arrange referendum several times a year, and clarifies the development of the public opinion according to these votes during the last ten years

  14. A Randomized Phase 2 Trial of 177Lu Radiolabeled Anti-PSMA Monoclonal Antibody J591 in Patients with High-Risk Castrate, Biochemically Relapsed Prostate Cancer

    Science.gov (United States)

    2014-09-01

    Irene Karpenko Lauren Tyrell Olivera Calukovic Gillian Hodes June Greenberg Jessica Campbell PATIENTS AND THEIR FAMILIES Biostatistics...myelosuppression or need for >2 platelet (plt) transfusions, febrile neutropenia , or grade >2 non-heme toxicity following 177Lu- J591. PSA was assessed prior to...toxicity • Grade 4 neutropenia or thrombocytopenia > 14 days • Need for > 2 platelet transfusions or hemorrhage • Febrile neutropenia • > 3 week delay for

  15. Aasia Reini ääres / Kaire Nurk

    Index Scriptorium Estoniae

    Nurk, Kaire, 1960-

    2002-01-01

    Näitusest CHINaRT" Duisburgis Küppersmühle muuseumis. Eksponeeritud 40 hiina kunstniku peamiselt 2002. a. valminud teosed. Kuraatorid Walter Smerling, Fan Di. Oberhauseni lossis näitus "Hiina - traditsioon ja modernsus", kus on väljas tööd Kölni kunstikogujate Peter ja Irene Ludwigi kogust, Hiina rahvusmuuseumist Pekingis, Uli Siggi erakogust Luzernist jm

  16. Two Japanese scientists and the Curie family, Nobuo Yamada and Toshiko Yuasa

    International Nuclear Information System (INIS)

    Kawashima, Keiko

    2012-01-01

    This article presents two Japanese scientists, a man and a woman, who worked with Pierre and Marie Curie, and with Irene and Pierre Joliot-Curie. Nobuo Yamada (1896-1927) was the first Japanese researcher at the French Radium Institute; he was a specialist of researches on helium. Toshiko Yuasa was the first Japanese scientist to obtain a permanent appointment in France. Her researches were a contribution to the investigation of the continuous spectrum of beta radiation emitted by artificial radioactive bodies

  17. Cloning and Expressing Recombinant Protective Antigen Domains of B. anthracis

    Science.gov (United States)

    2011-09-01

    future predictive modeling toolkits. 1 1. Introduction The use of Bacillus anthracis as a bio - weapon in the United States in 2001 affirmed the need...for improved sensing and detection of biological weapons of mass destruction (WMD). Protective Antigen (PA) protein of Bacillus anthracis is the...Cloning and Expressing Recombinant Protective Antigen Domains of B. anthracis by Deborah A. Sarkes, Joshua M. Kogot, Irene Val-Addo

  18. Livres | Page 24 | CRDI - Centre de recherches pour le ...

    International Development Research Centre (IDRC) Digital Library (Canada)

    L'Évaluation et le suivi participatifs présente une vue d'ensemble des thèmes et expériences communs aux approches participatives du suivi et de l'évaluation de divers secteurs et institutio. Directeur(s) : Marisol Estrella, with Jutta Blauert, Dindo Campilan, John Gaventa, Julian Gonsalves, Irene Guijt, Deb Johnson et ...

  19. Mis võiks olla ühist Johan Laidoneril ja Ingmar Bergmanil / Tiiu Laks

    Index Scriptorium Estoniae

    Laks, Tiiu, 1984-

    2008-01-01

    Laretei, Käbi. Kuhu kadus kõik see armastus? : Ingmari kirjad Käbile / tõlge rootsi keelest Anu Saluäär. Tallinn : SE&JS, 2008 ; Laidoner, Johan. Ühtekuuluvuse teel : Johan Laidoneri kirjad abikaasale / koostanud [ja toimetanud] Irene Lään ja Toomas Hiio ; vene keelest tõlkinud Jüri Ojamaa. Tallinn : Varrak, 2008

  20. Maritime Geo-Fence Letter Report

    Science.gov (United States)

    2016-07-01

    1 Classification | CG-926 RDC | author | audience | month year Maritime Geo-Fence Letter Report Authors: Irene Gonin and Gregory...Johnson   Distribution Statement A: Approved for public release; distribution is unlimited. July 2016 Report No. CG-D-10-16 Maritime Geo-Fence...United States Coast Guard Research & Development Center 1 Chelsea Street New London, CT 06320 Maritime Geo-Fence Letter Report 1

  1. Consistency Properties for Growth Model Parameters Under an Infill Asymptotics Domain

    Science.gov (United States)

    2010-09-01

    Gompertz in 1825 [15], was initially used for actuarial projections. Winsor’s 1932 reparameterization of the Gompertz curve in [38] is given by f(t;K, a, b...these assumptions it is possible to construct a pathological example which, while mathematically interesting, is of no practical use to a practitioner...Abramowitz, Milton and Irene A. Stegun. Handbook of Mathematical Functions . Washington D.C.: National Bureau of Standards, 1972. [2] Allgower, E. L

  2. Piigaste pansionaadimõis / Helju Koger

    Index Scriptorium Estoniae

    Koger, Helju, 1943-

    2007-01-01

    Põlvamaal Piigaste mõisa endises häärberis avatud pansionist. Sisekujundaja Irene Sepping, kelle jooniste järgi tegi osa elutubade mööblist Wako Värkstuba. Pargi korrastamise plaanist. Kordategemist ootavad muinsuskaitse all olevad puukuur, sammastega ait-kuivati ja tall-tõllakuur. Lühidalt mõisa ajaloost. Kommenteerivad I. Sepping ja pansioni juhataja Kerti Seeme. 10 vaadet

  3. ANALISIS PENGARUH CAPITAL ADEQUACY RATIO (CAR) DAN NON PERFORMING LOAN (NPL) TERHADAP LOAN TO DEPOSIT RATIO (LDR) PADA BANK BUMN PERSERO DI INDONESIA

    OpenAIRE

    TANGKO, IRENE LASTRY FARDANI

    2012-01-01

    Non Performing Loan (NPL)Analisis Pengaruh Capital Adequacy Ratio (CAR) dan Non Performing Loan (NPL) Terhadap Loan to Deposit Ratio (LDR) Pada Bank BUMN Persero Di Indonesia Analysis ofEffect ofCapitalAdequacy Ratio (CAR) and theNon-PerformingLoan(NPL) AgainstLoanto DepositRatio (LDR) Thestate-owned bankinIndonesiaPersero Irene Lastry Fardani Tangko Otto R. Payangan Maat pono Penelitian ini bertujuan untuk menganalisis pengaruh Capital Adequacy Ratio (CAR) dan Non Performin...

  4. Rita Bottoms: Polyartist Librarian

    OpenAIRE

    Bottoms, Rita; Reti, Irene; Regional History Project, UCSC Library

    2005-01-01

    Project Director Irene Reti conducted fourteen hours of interviews with Rita Bottoms, Head of Special Collections at the University Library, UC Santa Cruz, shortly before her retirement in March 2003. This oral history provides a vivid and intimate look at thirty-seven years behind the scenes in the library's Special Collections. For thirty-seven years Bottoms dedicated herself to collecting work by some of the most eminent writers and photographers of the twentieth century, includin...

  5. Assessing Conventional Army Demands and Requirements for Ultra-Light Tactical Mobility

    Science.gov (United States)

    2015-01-01

    hour Enemy or adversary actions Population Decision points Reserve Fires Engineer PMO AMD CBRN Intelligence R&S Avn Bde M o ve m en t an d m an eu ve...LDMove on Route Irish Seize on OBJ Irene 2nd BCT Cross LDMove on Route Longstreet Seize on OBJ Rose 3rd BCT FPOL with 1st BCT Airdrop resupply AMD Avn Bde

  6. Historien om Judasevangeliet

    DEFF Research Database (Denmark)

    Pedersen, Nils Arne

    2008-01-01

    Gennem en detaljeret historisk-filologisk argumentation viser artiklen dels, at det nyligt publicerede koptiske Judasevangelium næppe kan være en oversættelse af det Judasevangelium, som Irenæus nævner, dels at det forudsætter kendskab til en ældre, skriftlig evangelielitteratur. På denne baggrun...

  7. Hurricane Havoc - Mapping the Mayhem with NOAA's National Water Model

    Science.gov (United States)

    Aggett, G. R.; Stone, M.

    2017-12-01

    With Hurricane Irene as an example, this work demonstrates the versatility of NOAA's new National Water Model (NWM) as a tool for analyzing hydrologic hazards before, during, and after events. Hurricane Irene made landfall on the coast of North Carolina on August 27, 2011, and made its way up the East Coast over the next 3 days. This storm caused widespread flooding across the Northeast, where rain totals over 20" and wind speeds of 100mph were recorded, causing loss of life and significant damage to infrastructure. Large portions of New York and Vermont were some of the hardest hit areas. This poster will present a suite of post-processed products, derived from NWM output, that are currently being developed at NOAA's National Water Center in Tuscaloosa, AL. The National Water Model is allowing NOAA to expand its water prediction services to the approximately 2.7 million stream reaches across the U.S. The series of forecasted and real-time analysis products presented in this poster will demonstrate the strides NOAA is taking to increase preparedness and aid response to severe hydrologic events, like Hurricane Irene.

  8. Data denial experiments for extratropical transition

    Directory of Open Access Journals (Sweden)

    Doris Anwender

    2012-11-01

    Full Text Available Data denial experiments using the European Centre for Medium-Range Weather Forecasts (ECMWF model are designed to investigate the value of targeted observations for historical extratropical transition (ET cases over the Atlantic. The impact of removing data from specified locations linked to the ET development is therefore examined. It is shown that the impact of denying data in the near tropical cyclone (TC environment is, on average, as important as denying data in mid-latitude sensitive regions determined using extratropical singular vectors (SV. The impact of data denial over TC regions propagates downstream from the Atlantic towards Europe, with a maximum degradation at day 4. This degradation is mainly attributed to the data denial at the TC stage, i.e. before ET is completed. When data are denied on mid-latitude sensitive regions, the largest degradation is found around day 2 and also after the day 4 forecast. In general, the loss of information content is larger when data are denied in mid-latitude sensitive areas because these identify dynamically active regions. In both denial experiments, aircraft and satellite radiance data are the most influential observations. For the selected case of Hurricane Irene, the largest degradations are found for forecasts initialised while Irene reached its peak intensity. If observations are denied in the near storm environment, the TC mostly disappears from the analysis and the subsequent forecast. This allows the impact of Irene on the formation of the downstream cut-off low to be investigated.

  9. Revision of the subfamily Opiinae (Hymenoptera, Braconidae) from Hunan (China), including thirty-six new species and two new genera

    Science.gov (United States)

    Li, Xi-Ying; van Achterberg, Cornelis; Tan, Ji-Cai

    2013-01-01

    van Achterberg & Li, gen. n. (type species: Areotetes carinuliferus sp. n.) and Coleopioides van Achterberg & Li, gen. n. (type species: Coleopioides postpectalis sp. n. are described. All species are illustrated and keyed. In total 30 species of Opiinae are sequenced and the cladograms are presented. Neopius Gahan, 1917, Opiognathus Fischer, 1972, Opiostomus Fischer, 1972, and Rhogadopsis Brèthes, 1913, are treated as a valid genera based on molecular and morphological differences. Opius vittata Chen & Weng, 2005 (not Opius vittatus Ruschka, 1915), Opius ambiguus Weng & Chen, 2005 (not Wesmael, 1835) and Opius mitis Chen & Weng, 2005 (not Fischer, 1963) are primary homonymsandarerenamed into Phaedrotoma depressa Li & van Achterberg, nom. n., Opius cheni Li & van Achterberg, nom. n. andOpius wengi Li & van Achterberg, nom. n., respectively. Phaedrotoma terga (Chen & Weng, 2005) comb. n.,Diachasmimorpha longicaudata (Ashmead, 1905) and Biosteres pavitita Chen & Weng, 2005, are reported new for Hunan, Opiostomus aureliae (Fischer, 1957) comb. n. is new for China and Hunan; Xynobius maculipennis(Enderlein, 1912) comb. n. is new for Hunan and continental China and Rhogadopsis longuria (Chen & Weng, 2005) comb. n. is new for Hunan. The following new combinations are given: Apodesmia puncta (Weng & Chen, 2005) comb. n., Apodesmia tracta (Weng & Chen, 2005) comb. n., Areotetes laevigatus (Weng & Chen, 2005) comb. n., Phaedrotoma dimidia (Chen & Weng, 2005) comb. n., Phaedrotoma improcera (Weng & Chen, 2005) comb. n., Phaedrotoma amputata (Weng & Chen, 2005) comb. n., Phaedrotoma larga (Weng & Chen, 2005) comb. n., Phaedrotoma osculas (Weng & Chen, 2005) comb. n., Phaedrotoma postuma (Chen & Weng, 2005) comb. n., Phaedrotoma rugulosa (Chen & Weng, 2005) comb. n., Phaedrotoma tabularis (Weng & Chen, 2005) comb. n., Rhogadopsis apii (Chen & Weng, 2005) comb. n., Rhogadopsis dimidia (Chen & Weng, 2005) comb. n., Rhogadopsis diutia (Chen & Weng, 2005) comb. n., Rhogadopsis

  10. Seven new species of Begonia (Begoniaceae) in Northern Vietnam and Southern China

    Science.gov (United States)

    Chen, Wen-Hong; Radbouchoom, Sirilak; Nguyen, Hieu Quang; Nguyen, Hiep Tien; Nguyen4, Khang Sinh; Shui, Yu-Min

    2018-01-01

    Abstract Since 2016, KIB (Kunming Institute of Botany) and CPC (Centre for Plant Conservation of Vietnam) have conducted several surveys in the transboundary karst regions in Northern Vietnam and Southern China and seven new species in the genus Begonia Linn. (Begoniaceae) are firstly described. Amongst them, two species, Begonia albopunctata Y.M. Shui, W.H. Chen & H.Q. Nguyen and B. erectocarpa H.Q. Nguyen, Y.M. Shui & W.H. Chen, respectively belong to section Sphenanthera with berry fruits and section Leprosae with clavate berry fruits; four species, B. gulongshanensis Y.M. Shui & W. H. Chen, B. minissima H.Q. Nguyen, Y.M. Shui & W.H. Chen, B. mollissima Y.M. Shui, H.Q. Nguyen & W.H. Chen, B. rhytidophylla Y.M. Shui & W.H. Chen, belong to section Coelocentrum with parietal placentation; one species, Begonia bambusetorum H.Q. Nguyen, Y.M. Shui & W.H. Chen, belongs to section Diploclinium with 3-loculed ovary and capsules. The diagnostic characters of these species are described and illustrated in the text and photographs. PMID:29416422

  11. Wide Band Gap Semiconductors Symposium Held in Boston, Massachusetts on 2-6 December 1991. Materials Research Society Symposium Proceedings. Volume 242

    Science.gov (United States)

    1992-01-01

    AND PROPERTIES OF WIDE BAND-GAP Il-VI STRAINED- LAYER SUPERLATTICE 227 Hailong Wang. Jie Cui. Aidong Shen. Liang Xu, Yunliang Chen. and Yuhua Shen IN...WANG JIE CUI AIDONG SHEN LIANG XU YUNLIANG CHEN AND YUHUA SHEN Shanghai Institute of Optics and Fine Mechanics, Academia Sinica P.O.Box 800-216 Shanghai...He Zujou, Cao Huazhe, Su Wuda, Chen Zhongcai, Zhon Feng and Wang Erguang, Thin Solid Films, 139,261(1986). 22) Xin Li and T.L.Tansley, J.AppI.Phys

  12. Pitfalls in VAR based return decompositions: A clarification

    DEFF Research Database (Denmark)

    Engsted, Tom; Pedersen, Thomas Quistgaard; Tanggaard, Carsten

    in their analysis is not "cashflow news" but "inter- est rate news" which should not be zero. Consequently, in contrast to what Chen and Zhao claim, their decomposition does not serve as a valid caution against VAR based decompositions. Second, we point out that in order for VAR based decompositions to be valid......Based on Chen and Zhao's (2009) criticism of VAR based return de- compositions, we explain in detail the various limitations and pitfalls involved in such decompositions. First, we show that Chen and Zhao's interpretation of their excess bond return decomposition is wrong: the residual component...

  13. THREE NEW SPECIES OF CRAMBINAE(LEPIDOPTERA : PYRALIDAE) IN CHINA

    Institute of Scientific and Technical Information of China (English)

    CHENTie-mei; SONGShi-mei; YUANDe-cheng

    2003-01-01

    Three new species of Crambinae from China, Eschata truncata Song & Chen, sp. nov., Eschata tricornia Song & Chen, sp. nov., Pseudargyria acuta Song & Chen, sp. nov. and the female of Girdharia tau-romma Kapur are described, with figures and illustrations of genitalia provided. E. truncata resembles E.smithi Bleszynski, but valva with one short truncated process in costa; E. tricornia differed from all recorded species by valva with a triangular process on dorsum; P. acuta resembles P. marginepunctalis (Hampson), but with cucullus rapidly pointed and aedeagus with one group of cornuti. E. bleszynskiella Minet is proposed as a junior synonym of E. shanghaiensis Wang & Sung.

  14. The genus Bryoerythrophyllum (Musci, Pottiaceae in Antarctica

    Directory of Open Access Journals (Sweden)

    Sollman Philip

    2015-07-01

    Full Text Available Antarctic material of the genus Bryoerythrophyllum P. C. Chen was studied from all specimens present in KRAM. Bryoerythrophyllum recurvirostrum (Hedw. P. C. Chen var. antarcticum L. I. Savicz & Smirnova is treated as a distinct species: B. antarcticum (L. I. Savicz & Smirnova P. Sollman, stat. nov. Three species are now known in the Antarctic region: B. antarcticum, B. recurvirostrum and B. rubrum (Jur. ex Geh. P. C. Chen. Bryoerythrophyllum rubrum is reported for the first time from the Antarctic. It is a bipolar species. A key to the taxa is given. These species are described and briefly discussed, with notes on illustrations, reproduction, habitat, world range, distribution and elevation in Antarctica.

  15. LDL Particle Testing

    Science.gov (United States)

    ... P. Caulfield, Jay Wohlgemuth, Zhizong Chen, Robert Superko, Charles M. Rowland, Robert J. Glynn, Paul M. Ridker, ... See Less Ask a Laboratory Scientist Your questions will be answered by a laboratory scientist as part ...

  16. 77 FR 52311 - Wooden Bedroom Furniture From the People's Republic of China: Partial Rescission of Antidumping...

    Science.gov (United States)

    2012-08-29

    ... Furniture Co., Ltd. Zhangjiagang Zheng Yan Decoration Co., Ltd. Zhangjiang Sunwin Arts & Crafts Co., Ltd.... Trendex Industries Limited Wan Bao Chen Group Hong Kong Co., Ltd. World Design International Co., Ltd...

  17. On synchronization of three chaotic systems

    International Nuclear Information System (INIS)

    Yan Jianping; Li Changpin

    2005-01-01

    In this paper, a simple but efficient method is applied to the synchronization of three chaotic systems, i.e., the chaotic Lorenz, Chua, and Chen systems. Numerical simulations show this method works very well

  18. ONE WAY ANOVA RANDOMIZED COMPLETE BLOCKS

    African Journals Online (AJOL)

    ******

    2012-04-24

    Apr 24, 2012 ... Key words: Grey mullet, growth, foreign DNA, genetically modified. INTRODUCTION ... ration, food quality and preservation (Shears et al., 1991;. Chen et al. ... fish eggs (Khoo et al., 1992) and 4) direct injection of foreign DNA ...

  19. Hybrid Chaos Synchronization of Four-Scroll Systems via Active Control

    Science.gov (United States)

    Karthikeyan, Rajagopal; Sundarapandian, Vaidyanathan

    2014-03-01

    This paper investigates the hybrid chaos synchronization of identical Wang four-scroll systems (Wang, 2009), identical Liu-Chen four-scroll systems (Liu and Chen, 2004) and non-identical Wang and Liu-Chen four-scroll systems. Active control method is the method adopted to achieve the hybrid chaos synchronization of the four-scroll chaotic systems addressed in this paper and our synchronization results are established using Lyapunov stability theory. Since the Lyapunov exponents are not required for these calculations, the active control method is effective and convenient to hybrid synchronize identical and different Wang and Liu-Chen four-scroll chaotic systems. Numerical simulations are also shown to illustrate and validate the hybrid synchronization results derived in this paper.

  20. Fulltext PDF

    Indian Academy of Sciences (India)

    Journal of Earth System Science wishes to place on record the valuable ... Chen Xun-Hong, University of Nebraska-Lincoln, Nebraska, United States ... Dasgupta Somnath, Indian Institute of Science Education and Research, Kolkata.

  1. The Application of First‑Trimester Volumetry in Predicting Pregnancy ...

    African Journals Online (AJOL)

    Rawal MY, Malhotra N. Ultrasonography in Early Intrauterine pregnancy. ... Leung KY, Ma Teresa, Lau BY, Chen M. First trimester ultrasound volumetry: .... Ghosh A, Tang MH, Lam YH, Fung E, Chan V. Ultrasound measurement of placental ...

  2. Appiah-Adjei et al

    African Journals Online (AJOL)

    PUBLICATIONS1

    ing, sale of automobile spare parts, and metal fabrication. Some of these activities generate huge ... Keywords: Groundwater quality, pollution, waste disposal, Suame, Ghana ... of fertilizers (Chen et al., 2007; Parris, 2011;. Shen et al., 2011), ...

  3. Genetics Home Reference: isobutyryl-CoA dehydrogenase deficiency

    Science.gov (United States)

    ... An Y, Weavil SD, Chaing SH, Bali D, McDonald MT, Kishnani PS, Chen YT, Millington DS. Rare ... 10 All Bulletins Features What is direct-to-consumer genetic testing? What are genome editing and CRISPR- ...

  4. Genetics Home Reference: short-chain acyl-CoA dehydrogenase deficiency

    Science.gov (United States)

    ... An Y, Weavil SD, Chaing SH, Bali D, McDonald MT, Kishnani PS, Chen YT, Millington DS. Rare ... 10 All Bulletins Features What is direct-to-consumer genetic testing? What are genome editing and CRISPR- ...

  5. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... Counseling Blog About Media Donate Spinal Cord Injury Medical Expert Videos Topics menu Topics Spinal Cord Injury ... Jennifer Piatt, PhD David Chen, MD Read Bio Medical Director, Spinal Cord Injury Rehabilitation Program, Rehabilitation Institute ...

  6. Journal of Chemical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Fang Dong1 Jiang Chenning1 Zhu Ting1 Yang Jinming1. Department of Pharmaceutical Engineering, School of Chemistry and Chemical Engineering, Yancheng Teachers University, 50 Kai Fang Da Dao, Yancheng 224002, Jiangsu, P. R. China ...

  7. Probability to produce animal vaccines in insect baculovirus ...

    African Journals Online (AJOL)

    Administrator

    2011-09-07

    Sep 7, 2011 ... The insect baculovirus expression system is a valuable tool for the production of vaccine. .... vaccine expression/delivery vehicle (Yu-Chen et al., ... baculoviruses are applied in cell-based assays for drug ... Intramuscular.

  8. Extraction and Purification of Flavonoids from Radix Puerariae

    African Journals Online (AJOL)

    and preparations are now on sale. ... significant for optimization of extraction, resin selection and ... and flavonoids as indexes, optimize the proper density. ..... system. Sep Purif Technol. 2008; 62: 590-595. 12. Chen JH, Liau BC, Jong TT.

  9. ACKNOWLEDGEMENTS

    Indian Academy of Sciences (India)

    Chen Xingyuan Lorraine, University of California, Berkeley, United States ... Das Kaushik, Bengal Engineering and Science University, Kolkata de Boyer ..... Samborska Katarzyna, Institute for Ecology of Industrial Areas, Katowice, Poland.

  10. 1,6-Diaminoperylene bisimide with a highly twisted perylene core

    Indian Academy of Sciences (India)

    ... KEW-YU CHEN. ∗. Department of Chemical Engineering, Feng Chia University, 40724 Taichung, Taiwan, Republic of China ... chromic materials,6 and organic field-effect transis- ..... Wasielewski M R 2012 Competition between singlet fis-.

  11. Phenotype-gene: 396 [Arabidopsis Phenome Database[Archive

    Lifescience Database Archive (English)

    Full Text Available ciency in organ named stomatal complex during process named stomatal movement for AT5G13680 Chen Zhizhong et...943431i increased efficiency in organ named stomatal complex during process named stomatal movement

  12. Screening a heterogeneous elderly South African population for ...

    African Journals Online (AJOL)

    Age and race influenced performance on the MMSE, SIS and SMRS. Conclusion: Different types .... Depression Scale (GDS)34 employing a cut-off score of >11. ...... Society for Academic Emergency Medicine 2008;15(7):613-6. 42. Chen MR ...

  13. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Injury Medical Expert Videos Topics menu Topics Preventing Pressure Sores Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to Home ...

  14. Afrika Statistika ISSN 2316-090X Network estimation in State Space ...

    African Journals Online (AJOL)

    continuous, stochastic differential equation model (Chen et al., 2005; ... a large number of model parameters and are not well suited to deal with noisy data ... and selection in regression analysis that incorporates an L1 regularization constraint.

  15. Isolation and identification of two galangin metabolites from rat urine ...

    African Journals Online (AJOL)

    Isolation and identification of two galangin metabolites from rat urine and determination of their in vitro hypolipidemic activity. Xuguang Zhang, Shouqian Cheng, Hailong Li, Xiaopo Zhang, Feng Chen, Youbin Li, Junqing Zhang, Yinfeng Tan ...

  16. Fulltext PDF

    Indian Academy of Sciences (India)

    The newly synthesized molecules were characterized by spectral analysis and subjected to antioxidant and ... membered heterocyclic compounds with oxygen and nitrogen atoms. ...... Yen G C and Chen H Y 1995 J. Agric. Food Chem. 43. 27.

  17. Proceedings – Mathematical Sciences | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    dimensional stochastic Navier–Stokes equations in the presence of delays. The results extend some of the existing results. Author Affiliations. Huabin Chen1. Department of Mathematics, School of Science, Nanchang University, Nanchang 330031, ...

  18. Genetics Home Reference: type 2 diabetes

    Science.gov (United States)

    ... Chen H, Huyghe JR, van de Bunt M, Pearson RD, Kumar A, Müller-Nurasyid M, Grarup N, ... Accessibility FOIA Viewers & Players U.S. Department of Health & Human Services National Institutes of Health National Library of ...

  19. hispidulin and other constituents of scoparia dulcis linn

    African Journals Online (AJOL)

    Administrator

    HIV. INTRODUCTION. Scoparia dulcis Linn. (Scrophulariaceae) has been extensively studied for its flavone and terpene constituents (Ahmed et al., 1990, Ah- san et al., 2003, Chen et al., 1976, Hayashi et al., 1987, 1987b, 1988, 1990, 1991, ...

  20. Wahab et al (14)

    African Journals Online (AJOL)

    DELL

    food chain via cereals, vegetables, fishes and meat. (Abdulqawi, 2011). ... different functional groups which are involved in metal binding, and .... Penicillium species. A phylogenetic tree was ..... Chemistry and Ecology, 29(4),. 320–328. Chen ...

  1. Synthesis, characterization and photocatalytic reactions of ...

    Indian Academy of Sciences (India)

    The methods used usually include various surface modifi- cations. Several ... In recent years, innovative solid catalysts have been prepared ... post-treatment with phosphoric acid (Clesla et al 1996; Chen .... The ammonia adsorption was ca-.

  2. Hong et al., Afr J Tradit Complement Altern Med. (2013) 10(4):66-69 ...

    African Journals Online (AJOL)

    AJTCAM

    inflammation, annex inflammation, uterine prolapse, and neurasthenia. .... Research progress on pharmacological effects of Bidens bipinnata L. China Pharmacy. ... Clinic. 24 (3): 147-149. 8. Wang, Q., Zhang Y.N., Chen F.H. (2009). Research ...

  3. Sex and Fertility After SCI

    Medline Plus

    Full Text Available ... Topic Resources Peer Counseling Blog About Media Donate Spinal Cord Injury Medical Expert Videos Topics menu Topics Sex and Fertility After Spinal Cord Injury Adult Injuries Spinal Cord Injury 101 David Chen, ...

  4. THE AGINCOURT FIELD SITE - EVOLUTION AND CURRENT ...

    African Journals Online (AJOL)

    teaching, research and practice since C C Chen's impressive efforts at the ... HSDU tended to emphasise human resource development, for example ... innovative subdistrict and health centre programmes could be ... Agincourt Study Area. Fig.

  5. “Use salt and foods high in salt sparingly”: a food-based dietary ...

    African Journals Online (AJOL)

    2013-04-12

    Apr 12, 2013 ... effect on blood pressure, a high sodium intake has also been associated with ... promotion of healthy eating habits from an early age is important. Chen and ..... help consumers make informed purchasing decisions. However ...

  6. Moskva kunstibiennaal reaktsiooni teenistuses? / Johannes Saar

    Index Scriptorium Estoniae

    Saar, Johannes, 1965-

    2007-01-01

    Moskva II rahvusvahelisest nüüdiskunsti biennaalist. Näitustest "Sotsart. Poliitiline kunst Venemaal" (kuraator Andrei Jerofejev), "Sotsart. Poliitiline kunst Hiinas" (kuraator Xin Don Chen), "Mõtlev realism" (kuraator Jekaterina Djegot) ja "Mina usun" (kuraator Oleg Kulik)

  7. Online Resources Microsatellites development, cross-amplification ...

    Indian Academy of Sciences (India)

    unknown

    1Guangdong Provincial Key Laboratory of Applied Botany, South China ... In south China, urban development is another threat to A. sinensis. ..... Chen G., Liu C. and Sun W. 2016 Pollination and seed dispersal of Aquilaria sinensis (Lour.) ...

  8. A lanthanum pyromellitate coordination polymer with three ...

    Indian Academy of Sciences (India)

    Framework Solids Laboratory, Chemistry and Physics of Materials Unit, Jawaharlal Nehru Centre for. Advanced Scientific ... bases, though the quality of the single crystals ob- tained using ..... Chen J S and Wang S N 2003 Inorg. Chem. 42 944.

  9. Nanocomposite Membrane via Magnetite Nanoparticle Assembly

    KAUST Repository

    Xie, Yihui

    2012-01-01

    discussions and suggestions. I also want to extend my gratitude to the staff from the KAUST Core Lab for Advanced Nanofabrication, Imaging and Characterization, especially Dr. Ali Reza Behzad, Dr. Rachid Sougrat, and Dr. Long Chen, for their assistance

  10. Bulletin of Materials Science | Indian Academy of Sciences

    Indian Academy of Sciences (India)

    Author Affiliations. Xiaoming Liao1 Hongyang Zhu1 Guangfu Yin1 Zhongbing Huang1 Yadong Yao1 Xianchun Chen1. College of Materials Science and Engineering, Sichuan University, Chengdu 610064, P.R. of China ...

  11. ocular findings in children with cerebral palsy attending a tertiary

    African Journals Online (AJOL)

    ocular abnormalities among children with cerebral palsy that attended the neurology clinic of University of. Ilorin Teaching ... recognize faces or hand-held toys (Chen, Weinberg and Catalano ... palsy that is also blind/visually impaired pose a.

  12. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... RN Pediatric Injuries Pediatric Spinal Cord Injury 101 Lawrence Vogel, MD The Basics of Pediatric SCI Rehabilitation ... Rogers, PT Recreational Therapy after Spinal Cord Injury Jennifer Piatt, PhD David Chen, MD Read Bio Medical ...

  13. Effect of demographic variables on public attitudes towards ...

    African Journals Online (AJOL)

    Jane

    2011-09-30

    Sep 30, 2011 ... 5Faculty of Social Sciences and Humanities, Universiti Kebangsaan Malaysia, 43600 UKM, Bangi, ..... race formulates a cultural/social network. .... Macer D, Chen Ng MA (2000). Changing Attitudes to Biotechnology in. Japan.

  14. Galactosemia

    Science.gov (United States)

    ... and Rector's The Kidney. 10th ed. Philadelphia, PA: Elsevier; 2016:chap 45. Broomfield A, Brain C, Grunewald S. ... Neurology in Clinical Practice. 7th ed. Philadelphia, PA: Elsevier; 2016:chap 91. Kishnani PS, Chen Y-T. ...

  15. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... Medical Experts People Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...

  16. Basics of SCI Rehabilitation

    Medline Plus

    Full Text Available ... Medical Experts People Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...

  17. Sex and Fertility After SCI

    Medline Plus

    Full Text Available ... Medical Experts People Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...

  18. TMX magnet system, present and future

    International Nuclear Information System (INIS)

    Wong, R.L.; Pedrotti, L.R.; Leavitt, G.A.; Waugh, A.F.; Chargin, A.K.; Calderon, M.O.

    1979-01-01

    The magnetic field design and the mechanical design of the TMX magnet system were previously reported by Chen and Hinkle. This paper is a summary of the work that has been accomplished in the two years since then

  19. On bounds in Poisson approximation for distributions of independent negative-binomial distributed random variables.

    Science.gov (United States)

    Hung, Tran Loc; Giang, Le Truong

    2016-01-01

    Using the Stein-Chen method some upper bounds in Poisson approximation for distributions of row-wise triangular arrays of independent negative-binomial distributed random variables are established in this note.

  20. Download this PDF file

    African Journals Online (AJOL)

    Andries du Toit

    11 Chen, et al Mainstreaming informal Employment and Gender (2004). 12 Svendsen Work (2008) at 3. ...... In the workplace, other than changes in ..... Philip K Second economy strategy: addressing inequality and economic marginalisation.

  1. Novel alleles of 31-bp VNTR polymorphism in the human ...

    Indian Academy of Sciences (India)

    Author Affiliations. Yik-Yuen Gan1 Chuan-Fei Chen1. Natural Sciences and Science Education, National Institute of Education, Nanyang Technological University, 1 Nanyang Walk, Singapore 637616, Republic of Singapore ...

  2. Tourism and microcredit for sustainable community development in Sub-Saharan Africa

    NARCIS (Netherlands)

    Hoeve ten, Marieke

    2009-01-01

    Poverty reduction is one of the main Millennium Development Goals (United Nations, 2000). Sub-Saharan Africa is the region with the highest prevalence of poverty. Almost half the population lives in extreme poverty (Chen & Ravillion, 2004; UN, 2005). Pove

  3. Recognition of Pitman shorthand text using tangent feature values at ...

    Indian Academy of Sciences (India)

    R. Narasimhan (Krishtel eMaging) 1461 1996 Oct 15 13:05:22

    a prerequisite for directional code measurement (Chen & Lee 1992). The handwritten PSL ... shows the directional code and an example to illustrate the coding method for a word formed by the concatenation .... Primitive selection. 5.1 Corner ...

  4. Sex and Fertility After SCI

    Medline Plus

    Full Text Available ... Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from ... Rosenberg, PsyD Understanding SCI Rehabilitation Donald Peck Leslie, MD Adjusting to Social Life in a Wheelchair Lisa ...

  5. Basics of SCI Rehabilitation

    Medline Plus

    Full Text Available ... Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from ... Rosenberg, PsyD Understanding SCI Rehabilitation Donald Peck Leslie, MD Adjusting to Social Life in a Wheelchair Lisa ...

  6. Preventing Pressure Sores

    Medline Plus

    Full Text Available ... Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from ... Rosenberg, PsyD Understanding SCI Rehabilitation Donald Peck Leslie, MD Adjusting to Social Life in a Wheelchair Lisa ...

  7. 76 FR 72850 - Adjustment of Monetary Threshold for Reporting Rail Equipment Accidents/Incidents for Calendar...

    Science.gov (United States)

    2011-11-28

    ... 2010. DATES: This regulation is effective January 1, 2012. FOR FURTHER INFORMATION CONTACT: Kebo Chen... of 1995 Pursuant to Section 201 of the Unfunded Mandates Reform Act of 1995 (Pub. L. 104-4, 2 U.S.C...

  8. 77 FR 13393 - Endangered and Threatened Wildlife and Plants; Revised Endangered Status, Revised Critical...

    Science.gov (United States)

    2012-03-06

    ..., 1995). Chance or stochastic events have occurred in the range of M. viminea, and may continue to make M.... 2010; Chen et al. 2011). Scientists are projecting possible impacts and responses of ecological systems...

  9. 77 FR 71354 - Adjustment of Monetary Threshold for Reporting Rail Equipment Accidents/Incidents for Calendar...

    Science.gov (United States)

    2012-11-30

    ... 2011. DATES: This regulation is effective January 1, 2013. FOR FURTHER INFORMATION CONTACT: Kebo Chen... of 1995 Pursuant to Section 201 of the Unfunded Mandates Reform Act of 1995 (Pub. L. 104-4, 2 U.S.C...

  10. T'ai Chi

    Science.gov (United States)

    ... are different styles of t'ai chi, including: Chen style Hao (or Wu Shi) style Hu Lei ... medical advice, diagnoses, and treatment, consult your doctor. © 1995- The Nemours Foundation. All rights reserved. Images provided ...

  11. LDRD 2013 Annual Report: Laboratory Directed Research and Development Program Activities

    Energy Technology Data Exchange (ETDEWEB)

    Bookless, W. [Brookhaven National Lab. (BNL), Upton, NY (United States)

    2013-12-31

    This LDRD project establishes a research program led by Jingguang Chen, who has started a new position as a Joint Appointee between BNL and Columbia University as of FY2013. Under this project, Dr. Chen will establish a new program in catalysis science at BNL and Columbia University. The LDRD program will provide initial research funding to start research at both BNL and Columbia. At BNL, Dr. Chen will initiate laboratory research, including hiring research staff, and will collaborate with the existing BNL catalysis and electrocatalysis research groups. At Columbia, a subcontract to Dr. Chen will provide startup funding for his laboratory research, including initial graduate student costs. The research efforts will be linked under a common Catalysis Program in Sustainable Fuels. The overall impact of this project will be to strengthen the BNL catalysis science program through new linked research thrusts and the addition of an internationally distinguished catalysis scientist.

  12. Comparative mapping reveals similar linkage of functional genes to ...

    Indian Academy of Sciences (India)

    related traits between Brassica napus and Oryza sativa. Fupeng Li, Chaozhi Ma, Qingfang Chen, Touming Liu, Jinxiong Shen, Jinxing Tu, Yongzhong Xing and Tingdong Fu. J. Genet. 91, 163–170. Length of. Position of. Position of. Expect.

  13. Treatment responses in adult depressive patients treated with ...

    African Journals Online (AJOL)

    with dexamethasone/corticotrophin-releasing hormone. Lina Zhang1*, Yanbo Chen2, ... Keywords: stress, depressive patients, hormonal response, hormonal dysregulation, sertraline, ..... interactions in depression: will cause inform cure. Mol.

  14. Growth assessments of Nicotianatabaccumcv.Xanthitransformed ...

    African Journals Online (AJOL)

    Jane

    2011-08-10

    Aug 10, 2011 ... transgenic plants were grown; T1 and the succeeding T2 transgenic plants were obtained. Subsequently, ..... evaluation of T2 plants for salt tolerance, seeds from .... Chen C, Wanduragala S, Becker DF, Dickman MB (2006).

  15. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... Living with SCI Personal Experiences by Topic Resources Peer ... Adult Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...

  16. Sex and Fertility After SCI

    Medline Plus

    Full Text Available ... Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...

  17. Basics of SCI Rehabilitation

    Medline Plus

    Full Text Available ... Living with SCI Personal Experiences by Topic Resources Peer ... Injuries Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ...

  18. Spinal Cord Injury 101

    Medline Plus

    Full Text Available ... Spinal Cord Injury 101 David Chen, MD Preventing Pressure Sores Mary Zeigler, MS Transition from Hospital to ... a spinal cord injury? play_arrow Why are high-dose steroids often used right after an injury? ...

  19. Truncus arteriosus

    Science.gov (United States)

    ... through the middle Truncus arteriosus References Fraser CD, Kane LC. Congenital heart disease. In: Townsend CM Jr, ... 62. Review Date 10/17/2017 Updated by: Michael A. Chen, MD, PhD, Associate Professor of Medicine, ...

  20. Total anomalous pulmonary venous return

    Science.gov (United States)

    ... pulmonary venous return, x-ray References Fraser CD, Kane LC. Congenital heart disease. In: Townsend CM Jr, ... 62. Review Date 10/17/2017 Updated by: Michael A. Chen, MD, PhD, Associate Professor of Medicine, ...