WorldWideScience

Sample records for lines rosiglitazone specifically

  1. Rosiglitazone inhibits metastasis development of a murine mammary tumor cell line LMM3

    Magenta, Gabriela; Borenstein, Ximena; Rolando, Romina; Jasnis, María Adela

    2008-01-01

    Activation of peroxisome proliferator-activated receptors γ (PPARγ) induces diverse effects on cancer cells. The thiazolidinediones (TZDs), such as troglitazone and ciglitazone, are PPARγ agonists exhibiting antitumor activities; however, the underlying mechanism remains inconclusive. Rosiglitazone (RGZ), a synthetic ligand of PPARγ used in the treatment of Type 2 diabetes, inhibits growth of some tumor cells and is involved in other processes related to cancer progression. Opposing results have also been reported with different ligands on tumor cells. The purpose of this study was to determine if RGZ and 15d-PGJ 2 induce antitumor effects in vivo and in vitro on the murine mammary tumor cell line LMM3. The effect on LMM3 cell viability and nitric oxide (NO) production of different doses of RGZ, 15-dPGJ 2 , BADGE and GW9662 were determined using the MTS colorimetric assay and the Griess reaction respectively. In vivo effect of orally administration of RGZ on tumor progression was evaluated either on s.c. primary tumors as well as on experimental metastasis. Cell adhesion, migration (wound assay) and invasion in Transwells were performed. Metalloproteinase activity (MMP) was determined by zymography in conditioned media from RGZ treated tumor cells. PPARγ expression was detected by inmunohistochemistry in formalin fixed tumors and by western blot in tumor cell lysates. RGZ orally administered to tumor-bearing mice decreased the number of experimental lung metastases without affecting primary s.c. tumor growth. Tumor cell adhesion and migration, as well as metalloproteinase MMP-9 activity, decreased in the presence of 1 μM RGZ (non-cytotoxic dose). RGZ induced PPARγ protein expression in LMM3 tumors. Although metabolic activity -measured by MTS assay- diminished with 1–100 μM RGZ, 1 μM-treated cells recovered their proliferating capacity while 100 μM treated cells died. The PPARγ antagonist Biphenol A diglicydyl ether (BADGE) did not affect RGZ activity

  2. Rosiglitazone induces autophagy in H295R and cell cycle deregulation in SW13 adrenocortical cancer cells

    Cerquetti, Lidia; Sampaoli, Camilla; Amendola, Donatella; Bucci, Barbara; Masuelli, Laura; Marchese, Rodolfo; Misiti, Silvia; De Venanzi, Agostino; Poggi, Maurizio; Toscano, Vincenzo; Stigliano, Antonio

    2011-01-01

    Thiazolidinediones, specific peroxisome proliferator-activated receptor-γ (PPAR-γ) ligands, used in type-2 diabetes therapy, show favourable effects in several cancer cells. In this study we demonstrate that the growth of H295R and SW13 adrenocortical cancer cells is inhibited by rosiglitazone, a thiazolidinediones member, even though the mechanisms underlying this effect appeared to be cell-specific. Treatment with GW9662, a selective PPAR-γ-inhibitor, showed that rosiglitazone acts through both PPAR-γ-dependent and -independent mechanisms in H295R, while in SW13 cells the effect seems to be independent of PPAR-γ. H295R cells treated with rosiglitazone undergo an autophagic process, leading to morphological changes detectable by electron microscopy and an increased expression of specific proteins such as AMPKα and beclin-1. The autophagy seems to be independent of PPAR-γ activation and could be related to an increase in oxidative stress mediated by reactive oxygen species production with the disruption of the mitochondrial membrane potential, triggered by rosiglitazone. In SW13 cells, flow cytometry analysis showed an arrest in the G0/G1 phase of the cell cycle with a decrease of cyclin E and cdk2 activity, following the administration of rosiglitazone. Our data show the potential role of rosiglitazone in the therapeutic approach to adrenocortical carcinoma and indicate the molecular mechanisms at the base of its antiproliferative effects, which appear to be manifold and cell-specific in adrenocortical cancer lines.

  3. Rosiglitazone induces autophagy in H295R and cell cycle deregulation in SW13 adrenocortical cancer cells

    Cerquetti, Lidia; Sampaoli, Camilla [Endocrinology, Department of Clinical and Molecular Medicine, Sant' Andrea Hospital, Faculty of Medicine and Psychology ' Sapienza' University of Rome, Via di Grottarossa, 1035-00189 Rome (Italy); Research Center S. Pietro Hospital, Via Cassia, 600-00189 Rome (Italy); Amendola, Donatella; Bucci, Barbara [Research Center S. Pietro Hospital, Via Cassia, 600-00189 Rome (Italy); Masuelli, Laura [Department of Experimental Medicine, ' Sapienza' University of Rome, Rome (Italy); Marchese, Rodolfo [Research Center S. Pietro Hospital, Via Cassia, 600-00189 Rome (Italy); Misiti, Silvia [Endocrinology, Department of Clinical and Molecular Medicine, Sant' Andrea Hospital, Faculty of Medicine and Psychology ' Sapienza' University of Rome, Via di Grottarossa, 1035-00189 Rome (Italy); Research Center S. Pietro Hospital, Via Cassia, 600-00189 Rome (Italy); De Venanzi, Agostino; Poggi, Maurizio; Toscano, Vincenzo [Endocrinology, Department of Clinical and Molecular Medicine, Sant' Andrea Hospital, Faculty of Medicine and Psychology ' Sapienza' University of Rome, Via di Grottarossa, 1035-00189 Rome (Italy); Stigliano, Antonio, E-mail: antonio.stigliano@uniroma1.it [Endocrinology, Department of Clinical and Molecular Medicine, Sant' Andrea Hospital, Faculty of Medicine and Psychology ' Sapienza' University of Rome, Via di Grottarossa, 1035-00189 Rome (Italy); Research Center S. Pietro Hospital, Via Cassia, 600-00189 Rome (Italy)

    2011-06-10

    Thiazolidinediones, specific peroxisome proliferator-activated receptor-{gamma} (PPAR-{gamma}) ligands, used in type-2 diabetes therapy, show favourable effects in several cancer cells. In this study we demonstrate that the growth of H295R and SW13 adrenocortical cancer cells is inhibited by rosiglitazone, a thiazolidinediones member, even though the mechanisms underlying this effect appeared to be cell-specific. Treatment with GW9662, a selective PPAR-{gamma}-inhibitor, showed that rosiglitazone acts through both PPAR-{gamma}-dependent and -independent mechanisms in H295R, while in SW13 cells the effect seems to be independent of PPAR-{gamma}. H295R cells treated with rosiglitazone undergo an autophagic process, leading to morphological changes detectable by electron microscopy and an increased expression of specific proteins such as AMPK{alpha} and beclin-1. The autophagy seems to be independent of PPAR-{gamma} activation and could be related to an increase in oxidative stress mediated by reactive oxygen species production with the disruption of the mitochondrial membrane potential, triggered by rosiglitazone. In SW13 cells, flow cytometry analysis showed an arrest in the G0/G1 phase of the cell cycle with a decrease of cyclin E and cdk2 activity, following the administration of rosiglitazone. Our data show the potential role of rosiglitazone in the therapeutic approach to adrenocortical carcinoma and indicate the molecular mechanisms at the base of its antiproliferative effects, which appear to be manifold and cell-specific in adrenocortical cancer lines.

  4. Rosiglitazone: a disappointing DREAM.

    Nissen, Steven

    2007-09-01

    Dr Steven Nissen is a heart specialist and currently holds the position of chairman of cardiovascular medicine at the Cleveland Clinic, OH, USA. His work has involved the development of miniaturised ultrasound imaging devices that can be threaded into a patient's heart that allow measurement of the size and composition of plaques, which indicate early artery damage. The ability to characterize and measure the size of plaques provided a novel, effective method to evaluate the efficacy of anticholesterol medications, and for the past two decades Dr Nissen has been using these and other techniques to examine the efficacy of drugs. He has also developed a strong interest in drug safety. His work linked COX-2 inhibitors such as Celebrex and Vioxx (Merck, NJ, USA) with heart attacks, and prevented Merck's similar product, Arcoxia, from being approved. He also highlighted the serious heart attack risk associated with the experimental drug Pargluva and the drug was subsequently not approved by the US FDA. More recently, Dr Nissen's work has focused on the drug rosiglitazone, which was shown to have high cardiovascular risks and has since been given a FDA warning. Here, Dr Nissen discusses the publication of the rosiglitazone meta-analysis and why he considers work in this area to be crucially important for patients.

  5. Rosiglitazone

    ... manage your diabetes and improve your health. This therapy may also decrease your chances of having a heart attack, stroke, or other diabetes-related complications such as kidney failure, nerve damage (numb, cold legs or feet; decreased sexual ability in men and women), eye ...

  6. Can modeling of health outcomes facilitate regulatory decision making? The benefit-risk tradeoff for rosiglitazone in 1999 vs. 2007.

    Cross, J T; Veenstra, D L; Gardner, J S; Garrison, L P

    2011-03-01

    Rosiglitazone was initially approved for type 2 diabetes monotherapy. We tested health-outcomes modeling as an aid to regulatory decision making by quantifying the incremental net benefit (INB) value of rosiglitazone (relative to a comparator), both at the time of first approval (1999) and at the FDA advisory committee review (2007). Using 1999 data, rosiglitazone was projected to provide an additional 0.639 years of life (0.373 quality-adjusted life years (QALYs)) relative to placebo but a loss of 0.312 years (0.173 QALYs) relative to glyburide, with uncertainty in reduction of hemoglobin A(1c) (HbA(1c)) level having the greatest impact on the benefit-risk profile. By 2007, rosiglitazone was projected to provide an additional 0.222 years (0.091 QALYs) vs. glyburide and 0.026 years vs. metformin (0.009 QALYs). Modeling suggested that the use of rosiglitazone as monotherapy was not initially warranted, given the uncertainty with regard to benefit. Despite similar net benefit (NB) as metformin shown in postmarketing data, residual cardiovascular (CV) concerns did not support the use of rosiglitazone as first-line therapy. We adapted a mathematical diabetes model to estimate NB and uncertainty of diabetes monotherapy.

  7. Gradient HPLC method development and validation for Simultaneous estimation of Rosiglitazone and Gliclazide.

    Uttam Singh Baghel

    2012-10-01

    Full Text Available Objective: The aim of present work was to develop a gradient RP-HPLC method for simultaneous analysis of rosiglitazone and gliclazide, in a tablet dosage form. Method: Chromatographic system was optimized using a hypersil C18 (250mm x 4.6mm, 5毺 m column with potassium dihydrogen phosphate (pH-7.0 and acetonitrile in the ratio of 60:40, as mobile phase, at a flow rate of 1.0 ml/min. Detection was carried out at 225 nm by a SPD-20A prominence UV/Vis detector. Result: Rosiglitazone and gliclazide were eluted with retention times of 17.36 and 7.06 min, respectively. Beer’s Lambert ’s Law was obeyed over the concentration ranges of 5 to 70 毺 g/ml and 2 to 12 毺 g/ml for rosiglitazone and gliclazide, respectively. Conclusion: The high recovery and low coefficients of variation confirm the suitability of the method for simultaneous analysis of both drugs in a tablets dosage form. Statistical analysis proves that the method is sensitive and significant for the analysis of rosiglitazone and gliclazide in pure and in pharmaceutical dosage form without any interference from the excipients. The method was validated in accordance with ICH guidelines. Validation revealed the method is specific, rapid, accurate, precise, reliable, and reproducible.

  8. The rosiglitazone decision process at FDA and EMA : What should we learn?

    Pouwels, Koen B.; van Grootheest, Kees

    2012-01-01

    In September 2010 the EMA decided to suspend the market authorisation of rosiglitazone, while the FDA decided to restrict the use of rosiglitazone. These actions were taken approximately 10 years after the introduction of rosiglitazone, because rosiglitazone might be associated with an increased

  9. Possible modulation of the antidiabetic effect of rosiglitazone by buspirone

    Wafaa R. Mohamed

    2012-06-01

    Full Text Available Diabetes mellitus (DM is a group of metabolic disorders characterized by chronic hyperglycemia resulting from relative or absolute insulin deficiency with or without insulin resistance. As anxiolytics may have influence on glycemic control in diabetics, the present study was conducted to investigate the possible influence of buspirone in streptozotocin-induced DM and its possible interactions with rosiglitazone, an insulin sensitizer. Diabetes was induced by streptozotocin (50 mg/kg i.p.. Rats were classified into five groups namely: normal control, diabetic control, rosiglitazone (10 mg/kg p.o., buspirone (20 mg/kg i.p. or combination of both rosiglitazone and buspirone, respectively. All groups received daily treatments for 2 weeks after induction of DM including the normal group which received 1% Tween 80. There was no significant interaction between rosiglitazone and buspirone on the levels of serum glucose, insulin and C-peptide or liver glycogen content. Similarly, no interaction was observed between rosiglitazone and buspirone on oxidative stress parameters including serum malondialdehyde and blood glutathione levels or blood superoxide dismutase activity. In conclusion, the present study revealed that co-administration of buspirone with rosiglitazone does not produce serious reactions and buspirone can be safely administered as an anxiolytic in diabetic patients treated with rosiglitazone.

  10. Rosiglitazone, myocardial ischemic risk, and recent regulatory actions.

    Bourg, Catherine A; Phillips, Beth Bryles

    2012-02-01

    To review the evidence surrounding rosiglitazone and ischemic cardiovascular risk and discuss the Food and Drug Administration (FDA) decision to revise safety information and restrict access to the drug. A literature search was conducted through MEDLINE (1950-January 2012), PubMed (1966-January 2012), and International Pharmaceutical Abstracts (1970-December 2011) using the search terms rosiglitazone and cardiovascular risk. Regulatory documents from the FDA and the Center for Drug Evaluation and Research, as well as reference citations from publications identified, were reviewed. All articles in English identified from the data sources were evaluated for inclusion. Literature regarding rosiglitazone and ischemic cardiovascular risk has shown inconsistent results. Meta-analyses by the FDA, GlaxoSmithKline, and several independent research groups suggest an increased risk for myocardial infarction (MI), while others have not. Long-term, controlled trials not designed to evaluate cardiovascular outcomes did not find a significant increase in cardiovascular events and had low event rates overall. The RECORD (Rosiglitazone Evaluated for Cardiovascular Outcomes in Oral Agent Combination Therapy for Type 2 Diabetes) trial is the only prospective randomized trial to date designed to evaluate cardiovascular outcomes of rosiglitazone; the results were limited because of issues with study design and event adjudication. The only direct comparisons between rosiglitazone and pioglitazone are observational studies in which pioglitazone had a more favorable MI risk profile. Data involving rosiglitazone and an association with ischemic cardiovascular risk have yielded variable results. The FDA made the decision to restrict access to rosiglitazone in September 2010 by requiring GlaxoSmithKline to submit a risk evaluation and mitigation strategy (REMS). Drug labeling was revised in February 2011, and the rosiglitazone REMS program took full effect in November 2011.

  11. Rosiglitazone attenuates pulmonary fibrosis and radiation-induced intestinal damage

    Mangoni, M.; Gerini, C.; Sottili, M.; Cassani, S.; Stefania, G.; Biti, G.; Castiglione, F.; Vanzi, E.; Bottoncetti, A.; Pupi, A.

    2011-01-01

    Full text of publication follows: Purpose.-The aim of the study was to evaluate radioprotective effect of rosiglitazone (RGZ) on a murine model of late pulmonary damage and of acute intestinal damage. Methods.- Lung fibrosis: C57 mice were treated with the radiomimetic agent bleomycin, with or without rosiglitazone (5 mg/kg/day). To obtain an independent qualitative and quantitative measure for lung fibrosis we used high resolution CT, performed twice a week during the entire observation period. Hounsfield Units (HU) of section slides from the upper and lower lung region were determined. On day 31 lungs were collected for histological analysis. Acute intestinal damage: mice underwent 12 Gy total body irradiation with or without rosiglitazone. Mice were sacrificed 24 or 72 h after total body irradiation and ileum and colon were collected. Results.- Lung fibrosis: after bleomycin treatment, mice showed typical CT features of lung fibrosis, including irregular septal thickening and patchy peripheral reticular abnormalities. Accordingly, HU lung density was dramatically increased. Rosiglitazone markedly attenuated the radiological signs of fibrosis and strongly inhibited HU lung density increase (60% inhibition at the end of the observation period). Histological analysis revealed that in bleomycin-treated mice, fibrosis involved 50-55% of pulmonary parenchyma and caused an alteration of the alveolar structures in 10% of parenchyma, while in rosiglitazone-treated mice, fibrosis involved only 20-25% of pulmonary parenchyma, without alterations of the alveolar structures. Acute intestinal damage: 24 h after 12 Gy of total body irradiation intestinal mucosa showed villi shortening, mucosal thickness and crypt necrotic changes. Rosiglitazone showed a histological improvement of tissue structure, with villi and crypts normalization and oedema reduction. Conclusion.- These results demonstrate that rosiglitazone displays a protective effect on pulmonary fibrosis and radiation

  12. Rosiglitazone attenuates pulmonary fibrosis and radiation-induced intestinal damage

    Mangoni, M.; Gerini, C.; Sottili, M.; Cassani, S.; Stefania, G.; Biti, G. [Radiotherapy Unit, Clinical Physiopathology Department, University of Florence, Firenze (Italy); Castiglione, F. [Department of Human Pathology and Oncology, University of Florence, Firenze (Italy); Vanzi, E.; Bottoncetti, A.; Pupi, A. [Nuclear Medicine Unit, Clinical Physiopathology Department, University of Florence, Firenze (Italy)

    2011-10-15

    Full text of publication follows: Purpose.-The aim of the study was to evaluate radioprotective effect of rosiglitazone (RGZ) on a murine model of late pulmonary damage and of acute intestinal damage. Methods.- Lung fibrosis: C57 mice were treated with the radiomimetic agent bleomycin, with or without rosiglitazone (5 mg/kg/day). To obtain an independent qualitative and quantitative measure for lung fibrosis we used high resolution CT, performed twice a week during the entire observation period. Hounsfield Units (HU) of section slides from the upper and lower lung region were determined. On day 31 lungs were collected for histological analysis. Acute intestinal damage: mice underwent 12 Gy total body irradiation with or without rosiglitazone. Mice were sacrificed 24 or 72 h after total body irradiation and ileum and colon were collected. Results.- Lung fibrosis: after bleomycin treatment, mice showed typical CT features of lung fibrosis, including irregular septal thickening and patchy peripheral reticular abnormalities. Accordingly, HU lung density was dramatically increased. Rosiglitazone markedly attenuated the radiological signs of fibrosis and strongly inhibited HU lung density increase (60% inhibition at the end of the observation period). Histological analysis revealed that in bleomycin-treated mice, fibrosis involved 50-55% of pulmonary parenchyma and caused an alteration of the alveolar structures in 10% of parenchyma, while in rosiglitazone-treated mice, fibrosis involved only 20-25% of pulmonary parenchyma, without alterations of the alveolar structures. Acute intestinal damage: 24 h after 12 Gy of total body irradiation intestinal mucosa showed villi shortening, mucosal thickness and crypt necrotic changes. Rosiglitazone showed a histological improvement of tissue structure, with villi and crypts normalization and oedema reduction. Conclusion.- These results demonstrate that rosiglitazone displays a protective effect on pulmonary fibrosis and radiation

  13. Rosiglitazone evaluated for cardiovascular outcomes--an interim analysis

    Home, Philip D; Pocock, Stuart J; Beck-Nielsen, Henning

    2007-01-01

    BACKGROUND: A recent meta-analysis raised concern regarding an increased risk of myocardial infarction and death from cardiovascular causes associated with rosiglitazone treatment of type 2 diabetes. METHODS: We conducted an unplanned interim analysis of a randomized, multicenter, open...... group). The primary end point was hospitalization or death from cardiovascular causes. RESULTS: Because the mean follow-up was only 3.75 years, our interim analysis had limited statistical power to detect treatment differences. A total of 217 patients in the rosiglitazone group and 202 patients...... in the control group had the adjudicated primary end point (hazard ratio, 1.08; 95% confidence interval [CI], 0.89 to 1.31). After the inclusion of end points pending adjudication, the hazard ratio was 1.11 (95% CI, 0.93 to 1.32). There were no statistically significant differences between the rosiglitazone...

  14. Interactions of Rosiglitazone and Anti.Arrhythmic Drugs in Animal ...

    Interactions of Rosiglitazone and Anti.Arrhythmic Drugs in Animal Model. YM Mohammed, EI Mohammed, N Mohiuddin, SS Syeda. Abstract. Background: Diabetes increases the risk of vascular problems by two times compared with a healthy individual, with deposition of fats in blood vessel and this includes cardiovascular ...

  15. Rosiglitazone and Cardiovascular Risk – A Review | Isa | Bayero ...

    The thiazolidinediones (TZDs) are a class of oral drugs used for the management of type 2 diabetes mellitus and act as ligands for the transcription factor Peroxisome Proliferator-Activated Receptor gamma (PPARγ). Rosiglitazone, an example of TZD, is an anti-diabetic agent acting as a potent insulin sensitizer and is used ...

  16. Budget impact of rosiglitazone in type 2 diabetes

    Orietta Zaniolo

    2007-03-01

    Full Text Available BACKGROUND: in type 2 diabetes, the maintenance of non-diabetic glycaemic levels has been shown to decrease the onset of long term complications and consequently their high management costs. In order to achieve and maintain normal blood glucose levels, lifestyle interventions are highly cost/effective, but require good compliance, strong motivation and efforts by the patients. For this reason, a majority of patients needs to start pharmacological therapy shortly after diagnosis. Rosiglitazone, an insulin-sensitising drug, is indicated for subjects with inadequate glycaemic control both as monotherapy, in those contraindicated to metformin, especially if overweight, and as combination therapy with metformin, sulphanilureas or both. OBJECTIVES: rosiglitazone offers clinical advantages over the alternatives, decreasing and/or postponing the need for insulin treatment. Its high acquisition cost may therefore be totally or partially offset by the reduction in future health care resources consumption, and by short-term practical advantages, such as the decrease in the need for blood glucose monitoring and of adverse events. Aim of this study was to investigate the impact of the use of rosiglitazone in eligible diabetic patients on the National Health System budget. METHODS: for this scope an analytic model was implemented, which pathway may be summarized as follows: a estimate of the number type 2 diabetes patients living in Italy, grouped according to current therapeutic classes; b estimate of the number of patients with inadequate glycaemic control for each subgroup; c identification of patients eligible to rosiglitazone treatment; d identification of the comparator strategy for each patient sub-group; e comparison of costs for each couple of alternative options; f calculation of budget impact. RESULTS: use of rosiglitazone monotherapy instead of sulphanilurea monotherapy induces a mild costs increase. Combination treatment with rosiglitazone added

  17. Simpson's paradox visualized: The example of the Rosiglitazone meta-analysis

    Schumacher Martin

    2008-05-01

    Full Text Available Abstract Background Simpson's paradox is sometimes referred to in the areas of epidemiology and clinical research. It can also be found in meta-analysis of randomized clinical trials. However, though readers are able to recalculate examples from hypothetical as well as real data, they may have problems to easily figure where it emerges from. Method First, two kinds of plots are proposed to illustrate the phenomenon graphically, a scatter plot and a line graph. Subsequently, these can be overlaid, resulting in a overlay plot. The plots are applied to the recent large meta-analysis of adverse effects of rosiglitazone on myocardial infarction and to an example from the literature. A large set of meta-analyses is screened for further examples. Results As noted earlier by others, occurrence of Simpson's paradox in the meta-analytic setting, if present, is associated with imbalance of treatment arm size. This is well illustrated by the proposed plots. The rosiglitazone meta-analysis shows an effect reversion if all trials are pooled. In a sample of 157 meta-analyses, nine showed an effect reversion after pooling, though non-significant in all cases. Conclusion The plots give insight on how the imbalance of trial arm size works as a confounder, thus producing Simpson's paradox. Readers can see why meta-analytic methods must be used and what is wrong with simple pooling.

  18. Rosiglitazone treatment of patients with extreme insulin resistance and diabetes mellitus due to insulin receptor mutations has no effects on glucose and lipid metabolism

    Vestergaard, H; Lund, S; Pedersen, O

    2001-01-01

    Rosiglitazone, a thiazolidinedione (TZD), increases insulin sensitivity by reducing levels of plasma NEFA, triglycerides (TG), glucose and serum insulin. Rosiglitazone treatment decreases insulin resistance in type 2 diabetic patients, but no data exist concerning rosiglitazone treatment...

  19. Concept for Specific Lines of Business, Energy Saving Tourism

    Jilek, W.

    1998-01-01

    In the spirit of the objectives of the Energy Plan 1995 in order to make more efficient use of energy and thus to reduce energy requirements, to promote the use of renewable energies, and to attach maximum importance to the ecological compatibility of the energy systems, among other project the provincial government of Styria is pursuing the option of consulting small and medium-sized enterprises in a target manner. Three years after being launched, this Ecological Company Consulting scheme for various lines of business is now producing successful results, demonstrating that energy saving, business profit and ecology can go hand in hand by example of numerous pilot projects. Trade-specific concepts have been elaborated for foodstuffs, carpenters and car repair and sales firms, bakeries and hairdressers and, most recently, for tourist industry business /hotels, bars, restaurants, etc.). The province of Styria, represented by the Energy Commissioner and the department of waste management, is co-operating closely in the Ecological Company Consulting scheme with the Styrian Chamber of Commerce and the Economy Promotion Institute (Wirtschaftsfoerderungsinstitut). In several cases, other provinces, the Federal Ministry of Environmental, Youth and Family Affairs, and the Federal Chamber of Commerce have adopted the results of this co-operation, while in some cases subsidy schemes are linked to these trade-specific concepts. In the course of the scheme, the aim is to investigate energy requirements, saving potentials and questions of waste management. (author)

  20. Prolonged effect of Rosiglitazone one year after discontinuation

    Gram-Kampmann, Eva-Marie; Olesen, Thomas Bastholm; Olsen, Michael Hecht

    2015-01-01

    : This study is a continuation of the two-year study SDDS, where 371 patients were randomized to eight groups and treated with Insulin aspart three times daily or NPH insulin once daily, metformin or placebo and Rosiglitazone or placebo, respectively. During a 12-month run-out, use of insulin was continued...... and oral antidiabetics/placebo was changed to 2000 mg of metformin a day. During the following four visits, insulin was adjusted according to a treat-to-target algoritm with avoidance of hypoglycemia. Resultater: After 12 months, there was no difference in HbA1c. As expected, in the group formerly...... receiving insulin and two times placebo, insulindose could be lowered after institution of metformin. Compared to the insulin, metformin and placebo-group, insulin dose was significantly lower in the insulin, rosiglitazone and placebo-group (56,9 IUvs 73,6IU, p =0,05) after 12 months. The Insulin...

  1. Effect of Rosiglitazone on Radiation Damage in Bone Marrow Hemopoiesis

    Benko', Klara; Pintye, Eva; Szabo, Boglarka; Geresi, Krisztina; Megyeri, Attila; Benko, Ilona

    2008-01-01

    To study radiobiological effects and drugs, which can modify radiation injury, has an importance if we would like to avoid harmful effects of radiation due to emergency situations or treat patients with malignant diseases by radiotherapy. During the long treatment schedules patients may be treated by not only anticancer but many other drugs because of accompanying diseases. These drugs may also modify radiobiological effects. Rosiglitazone pre-treatment proved to be myeloprotective and accelerated recovery of 5-fluorouracil-damaged bone marrow in our previous experiments. Our new studies are designed to evaluate whether rosiglitazone has similar beneficial effects in radiation-damaged hemopoiesis. Bone marrow damage was precipitated by total body irradiation (TBI) using single increasing doses (2-10 Gy) of γ--irradiation in groups of mice. Lethality was well correlated with damage in hemopoiesis measured by cellularity of bone marrow (LD 50 values were 4.8 and 5.3 gray respectively). Rosiglitazone, an insulin-sensitizing drug, had no significant effect on bone marrow cellularity. Insulin resistance associated with obesity or diabetes mellitus type 2 is intensively growing among cancer patients requiring some kind of radiotherapy. Therefore it is important to know whether drugs used for their therapy can modify radiation effects.

  2. Effect of Rosiglitazone on Radiation Damage in Bone Marrow Hemopoiesis

    Benkő, Klára; Pintye, Éva; Szabó, Boglárka; Géresi, Krisztina; Megyeri, Attila; Benkő, Ilona

    2008-12-01

    To study radiobiological effects and drugs, which can modify radiation injury, has an importance if we would like to avoid harmful effects of radiation due to emergency situations or treat patients with malignant diseases by radiotherapy. During the long treatment schedules patients may be treated by not only anticancer but many other drugs because of accompanying diseases. These drugs may also modify radiobiological effects. Rosiglitazone pre-treatment proved to be myeloprotective and accelerated recovery of 5-fluorouracil-damaged bone marrow in our previous experiments. Our new studies are designed to evaluate whether rosiglitazone has similar beneficial effects in radiation-damaged hemopoiesis. Bone marrow damage was precipitated by total body irradiation (TBI) using single increasing doses (2-10 Gy) of γ—irradiation in groups of mice. Lethality was well correlated with damage in hemopoiesis measured by cellularity of bone marrow (LD50 values were 4.8 and 5.3 gray respectively). Rosiglitazone, an insulin-sensitizing drug, had no significant effect on bone marrow cellularity. Insulin resistance associated with obesity or diabetes mellitus type 2 is intensively growing among cancer patients requiring some kind of radiotherapy. Therefore it is important to know whether drugs used for their therapy can modify radiation effects.

  3. Rosiglitazone attenuates inflammation and CA3 neuronal loss following traumatic brain injury in rats

    Liu, Hao; Rose, Marie E. [Geriatric Research Educational and Clinical Center, V.A. Pittsburgh Healthcare System, PA (United States); Department of Neurology, University of Pittsburgh School of Medicine, PA (United States); Culver, Sherman; Ma, Xiecheng; Dixon, C. Edward [Geriatric Research Educational and Clinical Center, V.A. Pittsburgh Healthcare System, PA (United States); Department of Neurosurgery, University of Pittsburgh, PA 15216 (United States); Department of Critical Care Medicine, University of Pittsburgh, PA 15216 (United States); Graham, Steven H., E-mail: Steven.Graham@va.gov [Geriatric Research Educational and Clinical Center, V.A. Pittsburgh Healthcare System, PA (United States); Department of Neurology, University of Pittsburgh School of Medicine, PA (United States)

    2016-04-15

    Rosiglitazone, a potent peroxisome proliferator-activated receptor (PPAR)-γ agonist, has been shown to confer neuroprotective effects in stroke and spinal cord injury, but its role in the traumatic brain injury (TBI) is still controversial. Using a controlled cortical impact model in rats, the current study was designed to determine the effects of rosiglitazone treatment (6 mg/kg at 5 min, 6 h and 24 h post injury) upon inflammation and histological outcome at 21 d after TBI. In addition, the effects of rosiglitazone upon inflammatory cytokine transcription, vestibulomotor behavior and spatial memory function were determined at earlier time points (24 h, 1–5 d, 14–20 d post injury, respectively). Compared with the vehicle-treated group, rosiglitazone treatment suppressed production of TNFα at 24 h after TBI, attenuated activation of microglia/macrophages and increased survival of CA3 neurons but had no effect on lesion volume at 21 d after TBI. Rosiglitazone-treated animals had improved performance on beam balance testing, but there was no difference in spatial memory function as determined by Morris water maze. In summary, this study indicates that rosiglitazone treatment in the first 24 h after TBI has limited anti-inflammatory and neuroprotective effects in rat traumatic injury. Further study using an alternative dosage paradigm and more sensitive behavioral testing may be warranted. - Highlights: • Effects of rosiglitazone after CCI were evaluated using a rat TBI model. • Rosiglitazone suppressed production of TNFα at 24 h after CCI. • Rosiglitazone inhibited microglial activation at 21 d after CCI. • Rosiglitazone increased survival of CA3 neurons at 21 d after CCI. • Rosiglitazone-treated animals had improved performance in beam balance testing.

  4. Rosiglitazone attenuates inflammation and CA3 neuronal loss following traumatic brain injury in rats

    Liu, Hao; Rose, Marie E.; Culver, Sherman; Ma, Xiecheng; Dixon, C. Edward; Graham, Steven H.

    2016-01-01

    Rosiglitazone, a potent peroxisome proliferator-activated receptor (PPAR)-γ agonist, has been shown to confer neuroprotective effects in stroke and spinal cord injury, but its role in the traumatic brain injury (TBI) is still controversial. Using a controlled cortical impact model in rats, the current study was designed to determine the effects of rosiglitazone treatment (6 mg/kg at 5 min, 6 h and 24 h post injury) upon inflammation and histological outcome at 21 d after TBI. In addition, the effects of rosiglitazone upon inflammatory cytokine transcription, vestibulomotor behavior and spatial memory function were determined at earlier time points (24 h, 1–5 d, 14–20 d post injury, respectively). Compared with the vehicle-treated group, rosiglitazone treatment suppressed production of TNFα at 24 h after TBI, attenuated activation of microglia/macrophages and increased survival of CA3 neurons but had no effect on lesion volume at 21 d after TBI. Rosiglitazone-treated animals had improved performance on beam balance testing, but there was no difference in spatial memory function as determined by Morris water maze. In summary, this study indicates that rosiglitazone treatment in the first 24 h after TBI has limited anti-inflammatory and neuroprotective effects in rat traumatic injury. Further study using an alternative dosage paradigm and more sensitive behavioral testing may be warranted. - Highlights: • Effects of rosiglitazone after CCI were evaluated using a rat TBI model. • Rosiglitazone suppressed production of TNFα at 24 h after CCI. • Rosiglitazone inhibited microglial activation at 21 d after CCI. • Rosiglitazone increased survival of CA3 neurons at 21 d after CCI. • Rosiglitazone-treated animals had improved performance in beam balance testing.

  5. De besluitvorming over werkzaamheid en veiligheid van rosiglitazon bij de FDA en de EMA. Wat zijn de lessen?

    Pouwels, Koen; Van Grootheest, Kees

    2013-01-01

    The rosiglitazone decision process at FDA and EMA. What should we learn? In September 2010 the EMA decided to suspend the market authorisation of rosiglitazone while the FDA decided to restrict its use. These actions were taken because rosiglitazone had been associated with an increased risk of

  6. Hesperidin and low dose gamma irradiation alleviate rosiglitazone -induced cardiotoxicity in type 2 diabetic rats

    Morcos, N.Y.; Abdel-Ghaffar, A.B.; Osman, S.A.; Mohamed, M.Kh.; Arbid, M.S.; El-Eraky, W.I.

    2012-01-01

    Aim: The present study was designed to investigate the cardio protective effect of hesperidin and low dose γ- irradiation (LDR) against rosiglitazone cardiotoxicity. Experiment: Type 2 diabetes mellitus (T2DM) was induced in rats by single intraperitoneal injection of streptozotocin (STZ) followed by nicotinamide (NIC) (65 and 110 mg/kg b.wt, respectively). The diabetic rats were divided into 5 groups: untreated, LDR, LDR+ rosiglitazone, LDR + Hesperidin, LDR+ rosiglitazone + Hesperidin for one month, and blood and tissue samples were collected. Results: The diabetic rats showed elevated serum creatine kinase (CK-MB), lactate dehydrogenase (LDH), C-reactive protein (CRP), hyaluronidase activity, and reduced serum nitric oxide (NO) level, hematocrit % as well as final body weight, and pathological alterations in myocardial tissue. Treatment with LDR + rosiglitazone + Hesperidin ameliorated all these abnormalities approaching control levels. Conclusion: Results indicate the possible cardio protective role of hesperidin and LDR against rosiglitazone cardiotoxicity.

  7. Rosiglitazone protects human neuroblastoma SH-SY5Y cells against acetaldehyde-induced cytotoxicity

    Jung, Tae Woo; Lee, Ji Young; Shim, Wan Sub; Kang, Eun Seok; Kim, Soo Kyung; Ahn, Chul Woo; Lee, Hyun Chul; Cha, Bong Soo

    2006-01-01

    Acetaldehyde, an inhibitor of mitochondrial function, has been widely used as a neurotoxin because it elicits a severe Parkinson's disease-like syndrome with elevation of the intracellular reactive oxygen species level and apoptosis. Rosiglitazone, a peroxisome proliferator-activated receptor-γ agonist, has been known to show various non-hypoglycemic effects, including anti-inflammatory, anti-atherogenic, and anti-apoptotic. In this study, we investigated the protective effects of rosiglitazone on acetaldehyde-induced apoptosis in human neuroblastoma SH-SY5Y cells and attempted to examine its mechanism. Acetaldehyde-induced apoptosis was moderately reversed by rosiglitazone treatment. Our results suggest that the protective effects of rosiglitazone on acetaldehyde-induced apoptosis may be ascribed to ability to induce the expression of anti-oxidant enzymes and to regulate Bcl-2 and Bax expression. These data indicate that rosiglitazone may provide a useful therapeutic strategy for the prevention of progressive neurodegenerative disease such as Parkinson's disease

  8. Two different spectrofluorimetric methods for simultaneous determination of gemfibrozil and rosiglitazone in human plasma.

    El-Din, Mohie M K Sharaf; Attia, Khalid A M; Nassar, Mohamed W I; Kaddah, Mohamed M Y

    2010-10-15

    Two accurate, reliable, and highly sensitive spectrofluorimetric methods were developed for simultaneous determination of binary mixture gemfibrozil and rosiglitazone in human plasma without prior separation steps. The first method is based on synchronous fluorescence spectrometry using double scans. At Δλ=27nm, gemfibrozil yields detectable signal that is independent of the presence of rosiglitazone. Similarly, at Δλ=120nm the signal of rosiglitazone is not influenced by the presence of gemfibrozil. Signals at two wavelengths, 301 (Δλ=27nm) and 368nm (Δλ=120nm) vary linearly with gemfibrozil and rosiglitazone concentrations over the range 100-700ngmL(-1) (for gemfibrozil) and 20-140ngmL(-1) (for rosiglitazone), respectively. The limits of detection (LOD) were 2.3 and 2.72ngmL(-1) for gemfibrozil and rosiglitazone, respectively. The second method is based on the technique of simultaneous equations (Vierodt's method), in which 258nm was selected as the excitation wavelength. Two equations are constructed based on the fact that at ( λ(EM)₂=302 nm of gemfibrozil) and (λ(EM)₂=369 nm of rosiglitazone) the fluorescence of the mixture is the sum of the individual fluorescence of gemfibrozil and rosiglitazone. The limits of detection (LOD) were 28.1 and 23.63ngmL(-1) for gemfibrozil and rosiglitazone, respectively. The proposed methods were successfully applied for the determination of the two compounds in synthetic mixtures and in human plasma with a good recovery. Copyright © 2010 Elsevier B.V. All rights reserved.

  9. Future plans for the MP line (Both general and specific)

    Underwood, D.G.

    1988-01-01

    This talk consists of three sections. Topics range from suggestions of possible physics, which are presented to provoke thought and discussion about the distant future, to specific goals of E-704 for the next running period. The sections are on physics issues, possible upgrades of the beam and experimental apparatus, and goals for the next running period. 4 refs., 5 figs

  10. The effect of trimethoprim on CYP2C8 mediated rosiglitazone metabolism in human liver microsomes and healthy subjects

    Hruska, M W; Amico, J A; Langaee, T Y; Ferrell, R E; Fitzgerald, S M; Frye, R F

    2005-01-01

    Aims Rosiglitazone, a thiazolidinedione antidiabetic medication used in the treatment of Type 2 diabetes mellitus, is predominantly metabolized by the cytochrome P450 (CYP) enzyme CYP2C8. The anti-infective drug trimethoprim has been shown in vitro to be a selective inhibitor of CYP2C8. The purpose of this study was to evaluate the effect of trimethoprim on the CYP2C8 mediated metabolism of rosiglitazone in vivo and in vitro. Methods The effect of trimethoprim on the metabolism of rosiglitazone in vitro was assessed in pooled human liver microsomes. The effect in vivo was determined by evaluating rosiglitazone pharmacokinetics in the presence and absence of trimethoprim. Eight healthy subjects (four men and four women) completed a randomized, cross-over study. Subjects received single dose rosiglitazone (8 mg) in the presence and absence of trimethoprim 200 mg given twice daily for 5 days. Results Trimethoprim inhibited rosiglitazone metabolism both in vitro and in vivo. Inhibition of rosiglitazone para-hydroxylation by trimethoprim in vitro was found to be competitive with apparent Ki and IC50 values of 29 µm and 54.5 µm, respectively. In the presence of trimethoprim, rosiglitazone plasma AUC was increased by 31% (P = 0.01) from 2774 ± 645 µg l−1 h to 3643 ± 1051 µg l−1 h (95% confidence interval (Cl) for difference 189, 1549), and half-life was increased by 27% (P = 0.006) from 3.3 ± 0.5 to 4.2 ± 0.8 h (95% Cl for difference 0.36, 1.5). Trimethoprim reduced the para-O-sulphate rosiglitazone/rosiglitazone and the N-desmethylrosiglitazone/rosiglitazone AUC(0–24) ratios by 22% and 38%, respectively. Conclusions These results indicate that trimethoprim is a competitive inhibitor of CYP2C8-mediated rosiglitazone metabolism in vitro and that trimethoprim administration increases plasma rosiglitazone concentrations in healthy subjects. PMID:15606443

  11. Rosiglitazone Suppresses In Vitro Seizures in Hippocampal Slice by Inhibiting Presynaptic Glutamate Release in a Model of Temporal Lobe Epilepsy.

    Shi-Bing Wong

    Full Text Available Peroxisomal proliferator-activated receptor gamma (PPARγ is a nuclear hormone receptor whose agonist, rosiglitazone has a neuroprotective effect to hippocampal neurons in pilocarpine-induced seizures. Hippocampal slice preparations treated in Mg2+ free medium can induce ictal and interictal-like epileptiform discharges, which is regarded as an in vitro model of N-methyl-D-aspartate (NMDA receptor-mediated temporal lobe epilepsy (TLE. We applied rosiglitazone in hippocampal slices treated in Mg2+ free medium. The effects of rosiglitazone on hippocampal CA1-Schaffer collateral synaptic transmission were tested. We also examined the neuroprotective effect of rosiglitazone toward NMDA excitotoxicity on cultured hippocampal slices. Application of 10 μM rosiglitazone significantly suppressed amplitude and frequency of epileptiform discharges in CA1 neurons. Pretreatment with the PPARγ antagonist GW9662 did not block the effect of rosiglitazone on suppressing discharge frequency, but reverse the effect on suppressing discharge amplitude. Application of rosiglitazone suppressed synaptic transmission in the CA1-Schaffer collateral pathway. By miniature excitatory-potential synaptic current (mEPSC analysis, rosiglitazone significantly suppressed presynaptic neurotransmitter release. This phenomenon can be reversed by pretreating PPARγ antagonist GW9662. Also, rosiglitazone protected cultured hippocampal slices from NMDA-induced excitotoxicity. The protective effect of 10 μM rosiglitazone was partially antagonized by concomitant high dose GW9662 treatment, indicating that this effect is partially mediated by PPARγ receptors. In conclusion, rosiglitazone suppressed NMDA receptor-mediated epileptiform discharges by inhibition of presynaptic neurotransmitter release. Rosiglitazone protected hippocampal slice from NMDA excitotoxicity partially by PPARγ activation. We suggest that rosiglitazone could be a potential agent to treat patients with TLE.

  12. Rosiglitazone Inhibits Adrenocortical Cancer Cell Proliferation by Interfering with the IGF-IR Intracellular Signaling

    Luconi Michaela

    2008-07-01

    Full Text Available Rosiglitazone (RGZ, a thiazolidinedione ligand of the peroxisome proliferator-activated receptor (PPAR-γ, has been recently described as possessing antitumoral properties. We investigated RGZ effect on cell proliferation in two cell line models (SW13 and H295R of human adrenocortical carcinoma (ACC and its interaction with the signaling pathways of the activated IGF-I receptor (IGF-IR. We demonstrate a high expression of IGF-IR in the two cell lines and in ACC. Cell proliferation is stimulated by IGF-I in a dose- and time-dependent manner and is inhibited by RGZ. The analysis of the main intracellular signaling pathways downstream of the activated IGF-IR, phosphatidyl inositol 3-kinase (PI3K-Akt, and extracellular signal-regulated kinase (ERK1/2 cascades reveals that RGZ rapidly interferes with the Akt and ERK1/2 phosphorylation/activation which mediates IGF-I stimulated proliferation. In conclusion, our results suggest that RGZ exerts an inhibitory effect on human ACC cell proliferation by interfering with the PI3K/Akt and ERK1/2 signaling pathways downstream of the activated IGF-IR.

  13. Topical Rosiglitazone Treatment Improves Ulcerative Colitis by Restoring Peroxisome Proliferator-Activated Receptor-gamma Activity

    Pedersen, G.; Brynskov, Jørn

    2010-01-01

    and functional activity in human colonic epithelium and explored the potential of topical treatment with rosiglitazone (a PPAR gamma ligand) in patients with ulcerative colitis. METHODS: Spontaneous and rosiglitazone-mediated PPAR gamma and adipophillin expression (a gene transcriptionally activated by PPAR...... for 14 days. RESULTS: PPAR gamma expression was fourfold reduced in epithelial cells from inflamed compared with uninflamed mucosa and controls. Adipophillin levels were decreased in parallel. Rosiglitazone induced a concentration-dependent increase in adipophillin levels and restored PPAR gamma activity...... in epithelial cells from inflamed mucosa in vitro. Rosiglitazone enema treatment was well tolerated and reduced the Mayo ulcerative colitis score from 8.9 to 4.3 (P levels in the epithelial cells of the patients, indicating PPAR...

  14. Rosiglitazone delayed weight loss and anorexia while attenuating adipose depletion in mice with cancer cachexia.

    Asp, Michelle L; Tian, Min; Kliewer, Kara L; Belury, Martha A

    2011-12-01

    Cachexia is characterized by severe weight loss, including adipose and muscle wasting, and occurs in a large percentage of cancer patients. Insulin resistance contributes to dysregulated metabolism in cachexia and occurs prior to weight loss in mice with colon-26 tumor-induced cachexia. Therefore, we hypothesized that the insulin sensitizer, rosiglitazone, would attenuate the loss of adipose and muscle to result in improved outcomes for mice with late-stage cachexia. Male CD2F1 mice were inoculated with colon-26 adenocarcinoma cells or vehicle. Treatments included vehicle, rosiglitazone (10 mg/kg body weight/day) or rosiglitazone plus pair-feeding to food intake of vehicle-treated mice with tumors. Rosiglitazone delayed weight loss onset by 2 d over the 16 d duration of this aggressive tumor model. This finding was associated, in part, with increased food intake. In addition, adipose mass, adipocyte cross-sectional area and inflammation were improved with rosiglitazone. However, at the time of necropsy 16 d after tumor inoculation rosiglitazone had no effect on retention of muscle mass, strength or proteolysis in late-stage cachexia. We did not measure stamina or endurance in this study. In early-stage cachexia, rosiglitazone normalized PDK4 and PPAR-delta mRNA in quadriceps muscle and rescued the decrease in insulin-stimulated glucose disappearance in mice with tumors. Rosiglitazone may delay weight loss onset by decreasing tumor-induced markers of metabolic change in early-stage cachexia. These changes predict for modest improvement in adipose, but no improvement in muscle strength in late-stage cachexia.

  15. Rosiglitazone attenuates NF-κB-dependent ICAM-1 and TNF-α production caused by homocysteine via inhibiting ERK1/2/p38MAPK activation

    Bai, Yong-Ping; Liu, Yu-Hui; Chen, Jia; Song, Tao; You, Yu; Tang, Zhen-Yan; Li, Yuan-Jian; Zhang, Guo-Gang

    2007-01-01

    Previous studies demonstrated an important interaction between nuclear factor-kappaB (NF-κB) activation and homocysteine (Hcy)-induced cytokines expression in endothelial cells and vascular smooth muscle cells. However, the underlying mechanism remains illusive. In this study, we investigated the effects of Hcy on NF-κB-mediated sICAM-1, TNF-α production and the possible involvement of ERK 1/2 /p38MAPK pathway. The effects of rosiglitazone intervention were also examined. Our results show that Hcy increased the levels of sICAM-1 and TNF-α in cultured human umbilical vein endothelial cells (HUVECs) in a time- and concentration-dependent manner. This effect was significantly depressed by rosiglitazone and different inhibitors (PDTC, NF-κB inhibitor; PD98059, MEK inhibitor; SB203580, p38MAPK specific inhibitor; and staurosporine, PKC inhibitor). Next, we investigated the effect of Hcy on ERK 1/2 /p38MAPK pathway and NF-κB activity in HUVECs. The results show that Hcy activated both ERK 1/2 /p38MAPK pathway and NF-κB-DNA-binding activity. These effects were markedly inhibited by rosiglitazone as well as other inhibitors (SB203580, PD98059, and PDTC). Further, the pretreatment of staurosporine abrogated ERK 1/2 /p38MAPK phosphorylation, suggesting that Hcy-induced ERK 1/2 /p38MAPK activation is associated with PKC activity. Our results provide evidence that Hcy-induced NF-κB activation was mediated by activation of ERK 1/2 /p38MAPK pathway involving PKC activity. Rosiglitazone reduces the NF-κB-mediated sICAM-1 and TNF-α production induced by Hcy via inhibition of ERK 1/2 /p38MAPK pathway

  16. Simple method for the determination of rosiglitazone in human plasma using a commercially available internal standard.

    Mamidi, Rao N V S; Benjamin, Biju; Ramesh, Mullangi; Srinivas, Nuggehally R

    2003-09-01

    To the best of our knowledge, bioanalytical methods to determine rosiglitazone in human plasma reported in literature use internal standards that are not commercially available. Our purpose was to develop a simple method for the determination of rosiglitazone in plasma employing a commercially available internal standard (IS). After the addition of celecoxib (IS), plasma (0.25 mL) samples were extracted into ethyl acetate. The residue after evaporation of the organic layer was dissolved in 750 microL of mobile phase and 50 microL was injected on to HPLC. The separation was achieved using a Hichrom KR 100, 250 x 4.6 mm C(18) with a mobile phase composition potassium dihydrogen phosphate buffer (0.01 m, pH 6.5):acetonitrile:methanol (40:50:10, v/v/v). The flow-rate of the mobile phase was set at 1 mL/min. The column eluate was monitored by fluorescence detector set at an excitation wavelength of 247 nm and emission wavelength of 367 nm. Linear relationships (r(2) > 0.99) were observed between the peak area ratio rosiglitazone to IS vs rosiglitazone concentrations across the concentration range 5-1000 ng/mL. The intra-run precision (%RSD) and accuracy (%Dev) in the measurement of rosiglitazone were 80% for both rosiglitazone and IS from human plasma. The lower limit of quantitation of the assay was 5 ng/mL. In summary, the methodology for rosiglitazone measurement in plasma was simple, sensitive and employed a commercially available IS. Copyright 2003 John Wiley & Sons, Ltd.

  17. Pathway-specific differences between tumor cell lines and normal and tumor tissue cells

    Tozeren Aydin

    2006-11-01

    Full Text Available Abstract Background Cell lines are used in experimental investigation of cancer but their capacity to represent tumor cells has yet to be quantified. The aim of the study was to identify significant alterations in pathway usage in cell lines in comparison with normal and tumor tissue. Methods This study utilized a pathway-specific enrichment analysis of publicly accessible microarray data and quantified the gene expression differences between cell lines, tumor, and normal tissue cells for six different tissue types. KEGG pathways that are significantly different between cell lines and tumors, cell lines and normal tissues and tumor and normal tissue were identified through enrichment tests on gene lists obtained using Significance Analysis of Microarrays (SAM. Results Cellular pathways that were significantly upregulated in cell lines compared to tumor cells and normal cells of the same tissue type included ATP synthesis, cell communication, cell cycle, oxidative phosphorylation, purine, pyrimidine and pyruvate metabolism, and proteasome. Results on metabolic pathways suggested an increase in the velocity nucleotide metabolism and RNA production. Pathways that were downregulated in cell lines compared to tumor and normal tissue included cell communication, cell adhesion molecules (CAMs, and ECM-receptor interaction. Only a fraction of the significantly altered genes in tumor-to-normal comparison had similar expressions in cancer cell lines and tumor cells. These genes were tissue-specific and were distributed sparsely among multiple pathways. Conclusion Significantly altered genes in tumors compared to normal tissue were largely tissue specific. Among these genes downregulation was a major trend. In contrast, cell lines contained large sets of significantly upregulated genes that were common to multiple tissue types. Pathway upregulation in cell lines was most pronounced over metabolic pathways including cell nucleotide metabolism and oxidative

  18. Combination of vildagliptin and rosiglitazone ameliorates nonalcoholic fatty liver disease in C57BL/6 mice.

    Mookkan, Jeyamurugan; De, Soumita; Shetty, Pranesha; Kulkarni, Nagaraj M; Devisingh, Vijayaraj; Jaji, Mallikarjun S; Lakshmi, Vinitha P; Chaudhary, Shilpee; Kulathingal, Jayanarayan; Rajesh, Navin B; Narayanan, Shridhar

    2014-01-01

    To evaluate the effect of vildagliptin alone and in combination with metformin or rosiglitazone on murine hepatic steatosis in diet-induced nonalcoholic fatty liver disease (NAFLD). Male C57BL/6 mice were fed with high fat diet (60 Kcal %) and fructose (40%) in drinking water for 60 days to induce NAFLD. After the induction period, animals were divided into different groups and treated with vildagliptin (10 mg/kg), metformin (350 mg/kg), rosiglitazone (10 mg/kg), vildagliptin (10 mg/kg) + metformin (350 mg/kg), or vildagliptin (10 mg/kg) + rosiglitazone (10 mg/kg) orally for 28 days. Following parameters were measured: body weight, food intake, plasma glucose, triglyceride (TG), total cholesterol, liver function tests, and liver TG. Liver histopathology was also examined. Oral administration of vildagliptin and rosiglitazone in combination showed a significant reduction in fasting plasma glucose, hepatic steatosis, and liver TGs. While other treatments showed less or no improvement in the measured parameters. These preliminary results demonstrate that administration of vildagliptin in combination with rosiglitazone could be a promising therapeutic strategy for the treatment of NAFLD.

  19. Rosiglitazone decreases postprandial production of acylation stimulating protein in type 2 diabetics

    Tan Garry D

    2007-05-01

    Full Text Available Abstract Background We evaluated plasma ASP and its precursor C3 in type 2 diabetic men with/without rosiglitazone (ROSI treatment compared to healthy non-obese men. We tested (1 whether plasma ASP or C3 are altered postprandially in subcutaneous adipose tissue or forearm muscle effluent assessed by arteriovenous (A-V differences in healthy lean men and older obese diabetic men and (2 whether treatment with ROSI changes the arteriovenous gradient of ASP and/or C3. Methods In this ongoing placebo-controlled, crossover, double-blinded study, AV differences following a mixed meal were measured in diabetic men (n = 6 as compared to healthy men (n = 9. Results Postprandial arterial and adipose venous TG and venous NEFA were increased in diabetics vs. controls (p Conclusion Increased postprandial venous production of ASP is specific for adipose tissue (absent in forearm muscle. Increased postprandial C3 and ASP in diabetic subjects is consistent with an ASP resistant state, this state is partially normalized by treatment with ROSI.

  20. Production of prostate-specific antigen by a breast cancer cell line, Sk-Br-3

    Kamali Sarvestani, E.; Ghaderi, A.

    2002-01-01

    Prostate-specific antigen is a 33-KDa serine protease that is produced predominantly by prostate epithelium. However, it has been shown that about 30-40% of female breast tumors produce prostate-specific antigen and its production is associated with the presence of estrogen and progesterone receptors. We have now developed a new tissue culture system to study prostate-specific antigen production in breast cancer and its association with prognostic factors such as progesterone receptor and c-erbB-2. For this purpose we investigated the ability of prostate-specific antigen production in five different cell lines, including two breast cancer cell lines, Sk-Br-3 and MDA-MB-453. The prostate-specific antigen in tissue culture supernatant and cytoplasm of the Sk-Br-3 cell line was detected by western blotting and immunoperoxidase, respectively. Furthermore, we found lower expression of c-erbB-2 in Sk-Br-3 than non-prostate-specific antigen producer breast cancer cell line, MDA-MB-453. Progesterone receptor was expressed by both prostate-specific antigen-positive and -negative cell lines and only the intensity of staining and the number of positive cells in Sk-Br-3 population was higher than MDA-MB-453. According to our findings prostate-specific antigen can be considered as a good prognostic factor in breast cancer and we suggest that these two cell lines are a good in vitro model to study the relationship of different breast cancer prognostic factors and their regulations

  1. [The characters and specific features of new human embryonic stem cells lines].

    Krylova, T A; Kol'tsova, A M; Zenin, V V; Gordeeva, O F; Musorina, A S; Goriachaia, T S; Shlykova, S A; Kamenetskaia, Iu K; Pinaev, G P; Polianskaia, G G

    2009-01-01

    Four continuous human embryonic stem cell lines (SC1, SC2, SC3 and SC4), derived from the blastocysts has been described. The cell lines were cultivated on mitotically inactivated human feeder cells. The cell lines SC1 and SC2 have passed through 150 population doublings and the cell lines SC3 and SC4 -- near 120 populations doublings, which exceeds Hayflick limit sufficiently. These cell lines maintain high activity of alkaline phosphatase, expression of transcription factor OCT-4 and cell surface antigens (SSEA-4, TRA-1-60 and TRA-1-81), confirming their ESC status and human specificity. Immunofluorescent detection of antigens, characteristic of ectoderm, endoderm and mesoderm confirms the ability of these cells to retain their pluripotency under in vitro condition. PCR analysis revealed expression of six genes specific for pluripotent cells (OCT-4, NANOG, DPPA3/STELLA, TDGF/CRIPTO and LEFTYA). Correlation between the level of proliferative activity and the character of DNA-bound fluorescent staining was found. Fluorescent dyes, Hoechst 33342 and PI, produced diffuse staining of the nuclei in slowly proliferating cells of the SC1 and SC2 lines. In contrast, in actively proliferating cells of the SC3 and SC4 lines, the clear staining of the nuclei was observed. Upon changing the cultivation condition, proliferative activity of SC3 and SC4 lines decreased and became similar to that of SC1 and SC2 lines. The character of the fluorescent staining of all these lines was also shown to be similar. These results show that quality of the fluorescent staining with Hoechst 33342 and PI reflects the level of proliferation. Possible causes and mechanisms of this feature of human ESC are discussed.

  2. Insulinotropic and anti-inflammatory effects of rosiglitazone in experimental autoimmune diabetes.

    Awara, Wageh M; el-Sisi, Alaa E; el-Refaei, Mohamed; el-Naa, Mona M; el-Desoky, Karima

    2005-01-01

    Cytokines and nitric oxide (NO) are involved in the pathogenesis of autoimmune diabetes mellitus (DM). Rosiglitazone is an insulin-sensitizing drug that is a ligand for the nuclear receptor peroxisome proliferator-activated receptor-gamma (PPAR-gamma). The anti-inflammatory and immunomodulating properties of PPAR-gamma have been documented. The aim of this study is to investigate the effectiveness of rosiglitazone in autoimmune DM and to clarify the possible mechanism(s) involved. Autoimmune DM was induced in adult male Balb/c mice by co-administration of cyclosporin A and multiple low doses of streptozotocin. Diabetic mice were treated daily with rosiglitazone (7 mg/kg, p.o.) for 21 days. Blood glucose level (BGL), serum insulin level and pancreatic levels of tumor necrosis factor-alpha (TNF-alpha), interferon-gamma (IFN-gamma) and NO were measured. Histopathological examination and immunohistochemical determination of CD4 and CD8 T lymphocytes in the pancreatic islets were performed. In addition, analysis of pancreatic protein expression was carried out. The results showed that rosiglitazone treatment resulted in a significant decrease in the BGL and the pancreatic levels of TNF-alpha, IFN-gamma and NO compared to diabetic mice. The serum insulin level was significantly increased after rosiglitazone treatment compared to diabetic mice. The destroyed pancreatic islets were regenerated and became free from both CD4 and CD8 T cells after treatment. Furthermore, many changes in pancreatic protein expression were observed. These results suggest that rosiglitazone has a beneficial effect in the treatment of autoimmune diabetes, an effect that seemed to be a secondary consequence of its anti-inflammatory and immunomodulating properties and might be reflected at the level of protein expression.

  3. Characterization of alendronic- and undecylenic acid coated magnetic nanoparticles for the targeted delivery of rosiglitazone to subcutaneous adipose tissue.

    Saatchi, Katayoun; Tod, Sarah E; Leung, Donna; Nicholson, Kenton E; Andreu, Irene; Buchwalder, Christian; Schmitt, Veronika; Häfeli, Urs O; Gray, Sarah L

    2017-02-01

    Obesity is a state of positive energy balance where excess white adipose tissue accumulates to the detriment of metabolic health. Improving adipocyte function with systemic administration of thiazolidinediones (TZDs) improves metabolic outcomes in obesity, however TZD use is limited clinically due to undesirable side effects. Here we evaluate magnetic nanoparticles (MNPs) as a tool to target rosiglitazone (Rosi) specifically to adipose tissue. Results show Rosi can be adsorbed to MNPs (Rosi-MNPs) with hydrophobic coatings for which we present binding and release kinetics. Rosi adsorbed to MNPs retained the ability to induce PPARγ target gene expression in cells. Biodistribution analysis of radiolabeled Rosi-MNPs revealed a fat-implanted magnet significantly enhanced localization of Rosi to the targeted adipose tissue when administered by subcutaneous injection to obese mice. We propose MNPs for targeted delivery of anti-diabetic agents to superficially located subcutaneous adipose tissue. Copyright © 2016 Elsevier Inc. All rights reserved.

  4. Rosiglitazone Decreases Plasma Levels of Osteoprotegerin in a Randomized Clinical Trial with Type 2 Diabetes Patients

    Nybo, Mads; Preil, Simone Rørdam; Juhl, Henning Friis

    2011-01-01

    regarding cardiovascular disease. The South Danish Diabetes Study, an investigator-driven, randomized, controlled clinical trial lasting 2 years, was used to test this hypothesis in patient groups with different medication strategies (insulin aspart or NPH insulin, added either metformin...... (R = 0.29, p = 0.0002), while this correlation was poor in those not receiving rosiglitazone (R = 0.06, p = 0.48). Treatment with rosiglitazone among patients with T2DM reduces the concentration of plasma OPG. This is not seen with metformin despite similar reductions in HbA(1c) . Alteration...

  5. RNA-Mediated Gene Duplication and Retroposons: Retrogenes, LINEs, SINEs, and Sequence Specificity

    2013-01-01

    A substantial number of “retrogenes” that are derived from the mRNA of various intron-containing genes have been reported. A class of mammalian retroposons, long interspersed element-1 (LINE1, L1), has been shown to be involved in the reverse transcription of retrogenes (or processed pseudogenes) and non-autonomous short interspersed elements (SINEs). The 3′-end sequences of various SINEs originated from a corresponding LINE. As the 3′-untranslated regions of several LINEs are essential for retroposition, these LINEs presumably require “stringent” recognition of the 3′-end sequence of the RNA template. However, the 3′-ends of mammalian L1s do not exhibit any similarity to SINEs, except for the presence of 3′-poly(A) repeats. Since the 3′-poly(A) repeats of L1 and Alu SINE are critical for their retroposition, L1 probably recognizes the poly(A) repeats, thereby mobilizing not only Alu SINE but also cytosolic mRNA. Many flowering plants only harbor L1-clade LINEs and a significant number of SINEs with poly(A) repeats, but no homology to the LINEs. Moreover, processed pseudogenes have also been found in flowering plants. I propose that the ancestral L1-clade LINE in the common ancestor of green plants may have recognized a specific RNA template, with stringent recognition then becoming relaxed during the course of plant evolution. PMID:23984183

  6. Identification of genome-specific transcripts in wheat–rye translocation lines

    Tong Geon Lee

    2015-09-01

    Full Text Available Studying gene expression in wheat–rye translocation lines is complicated due to the presence of homeologs in hexaploid wheat and high levels of synteny between wheat and rye genomes (Naranjo and Fernandez-Rueda, 1991 [1]; Devos et al., 1995 [2]; Lee et al., 2010 [3]; Lee et al., 2013 [4]. To overcome limitations of current gene expression studies on wheat–rye translocation lines and identify genome-specific transcripts, we developed a custom Roche NimbleGen Gene Expression microarray that contains probes derived from the sequence of hexaploid wheat, diploid rye and diploid progenitors of hexaploid wheat genome (Lee et al., 2014. Using the array developed, we identified genome-specific transcripts in a wheat–rye translocation line (Lee et al., 2014. Expression data are deposited in the NCBI Gene Expression Omnibus (GEO under accession number GSE58678. Here we report the details of the methods used in the array workflow and data analysis.

  7. Hyper-inflammation and skin destruction mediated by rosiglitazone activation of macrophages in IL-6 deficiency

    Das, Lopa M; Rosenjack, Julie; Au, Liemin

    2015-01-01

    Injury initiates recruitment of macrophages to support tissue repair; however, excessive macrophage activity may exacerbate tissue damage causing further destruction and subsequent delay in wound repair. Here we show that the peroxisome proliferation-activated receptor-γ agonist, rosiglitazone (R...

  8. Fenofibrate and rosiglitazone improve quality of lipoproteins in patients with type 2 diabetes mellitus

    Vrablík, M.; Dobiášová, Milada; Štulc, T.; Kasalová, Z.; Doležalová, R.; Prázný, M.; Fait, T.; Češka, R.

    2008-01-01

    Roč. 29, č. 1 (2008), s. 146-150 ISSN 0172-780X R&D Projects: GA MZd(CZ) NR8328 Institutional research plan: CEZ:AV0Z50110509 Keywords : fenofibrate * rosiglitazone * type 2 diabetes mellitus Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition Impact factor: 1.359, year: 2008

  9. Effects of Rosiglitazone, Glyburide, and Metformin on β-Cell Function and Insulin Sensitivity in ADOPT

    Kahn, Steven E.; Lachin, John M.; Zinman, Bernard; Haffner, Steven M.; Aftring, R. Paul; Paul, Gitanjali; Kravitz, Barbara G.; Herman, William H.; Viberti, Giancarlo; Holman, Rury R.

    2011-01-01

    OBJECTIVE ADOPT (A Diabetes Outcome Progression Trial) demonstrated that initial monotherapy with rosiglitazone provided superior durability of glycemic control compared with metformin and glyburide in patients with recently diagnosed type 2 diabetes. Herein, we examine measures of β-cell function and insulin sensitivity from an oral glucose tolerance test (OGTT) over a 4-year period among the three treatments. RESEARCH DESIGN AND METHODS Recently diagnosed, drug-naïve patients with type 2 diabetes (4,360 total) were treated for a median of 4.0 years with rosiglitazone, metformin, or glyburide and were examined with periodic metabolic testing using an OGTT. RESULTS Measures of β-cell function and insulin sensitivity from an OGTT showed more favorable changes over time with rosiglitazone versus metformin or glyburide. Persistent improvements were seen in those who completed 4 years of monotherapy and marked deterioration of β-cell function in those who failed to maintain adequate glucose control with initial monotherapy. CONCLUSIONS The favorable combined changes in β-cell function and insulin sensitivity over time with rosiglitazone appear to be responsible for its superior glycemic durability over metformin and glyburide as initial monotherapy in type 2 diabetes. PMID:21415383

  10. Effects of Rosiglitazone on the Expression of PPAR-γ and on the ...

    Purpose: Peroxisome proliferator-activated receptor (PPAR)-γ ligand is known to repress the expression of pro-inflammatory mediators. However, it is unclear how it affects PPAR-γ expression and the inflammatory response in the human lung. We investigated the effects of rosiglitazone (synthetic PPAR-γ ligand) on the ...

  11. Identification of parental line specific effects of MLF2 on resistance to coccidiosis in chickens

    2011-01-01

    Background MLF2 was the candidate gene associated with coccidiosis resistance in chickens. Although single marker analysis supported the association between MLF2 and coccidiosis resistance, causative mutation relevant to coccidiosis was not identified yet. Thus, this study suggested segregation analysis of MLF2 haplotype and the association test of the other candidate genes using improved data transformation. Results A haplotype probably originated from one parental line was found out of 4 major haplotypes of MLF2. Frequency of this haplotype was 0.2 in parental chickens and its offspring in 12 families. Allele substitution effect of the MLF2 haplotype originated from a specific line was associated with increased body weight and fecal egg count explaining coccidiosis resistance. Nevertheless Box-Cox transformation was able to improve normality; association test did not produce obvious different results compared with analysis with log transformed phenotype. Conclusion Allele substitution effect analysis and classification of MLF2 haplotype identified the segregation of haplotype associated with coccidiosis resistance. The haplotype originated from a specific parental line was associated with improving disease resistance. Estimating effect of MLF2 haplotype on coccidiosis resistance will provide useful information for selecting animals or lines for future study. PMID:21645301

  12. Microdialysis combined blood sampling technique for the determination of rosiglitazone and glucose in brain and blood of gerbils subjected to cerebral ischemia.

    Sheu, Wayne H-H; Chuang, Hsiu-Chun; Cheng, Shiu-Min; Lee, Maw-Rong; Chou, Chi-Chi; Cheng, Fu-Chou

    2011-03-25

    Rosiglitazone is a potent synthetic peroxisome proliferator-activated receptor-gamma (PPAR-γ) agonist which improves glucose control in the plasma and reduces ischemic brain injury. However, the pharmacokinetics of rosiglitazone in the brain is still unclear. In this study, a method using liquid chromatography-mass spectrometry coupled with microdialysis and an auto-blood sampling system was developed to determine rosiglitazone and glucose concentration in the brain and blood of gerbils subjected to treatment with rosiglitazone (3.0 mg kg(-1), i.p.). The results showed the limit of detection was 0.04 μg L(-1) and the correlation coefficient was 0.9997 for the determination of rosiglitazone in the brain. The mean parameters, maximum drug concentration (C(max)) and the area under the concentration-time curve from time zero to time infinity (AUC(inf)), following rosiglitazone administration were 1.06±0.28 μg L(-1) and 296.82±44.67 μg min L(-1), respectively. The time to peak concentration (C(max) or T(max)) of rosiglitazone occurred at 105±17.10 min, and the mean elimination half-life (t(1/2)) from brain was 190.81±85.18 min after administration of rosiglitazone. The brain glucose levels decreased to 71% of the basal levels in the rosiglitazone-treated group when compared with those in the control (pblood glucose levels to 80% at 1h after pretreatment of rosiglitazone (pglucose concentrations in brain and plasma. Rosiglitazone was effective at penetrating the blood-brain barrier as evidenced by the rapid appearance of rosiglitazone in the brain, and rosiglitazone may contribute to a reduction in the extent of injuries related to cerebral ischemic stroke via its hypoglycemic effect. Copyright © 2010 Elsevier B.V. All rights reserved.

  13. Modes in Component Behavior Specification via EBP and their Application in Product Lines

    Kofroň, Jan; Plášil, František; Šerý, O.

    2009-01-01

    Roč. 51, č. 1 (2009), s. 31-41 ISSN 0950-5849 R&D Projects: GA AV ČR 1ET400300504 Grant - others:GA ČR(CZ) GA201/08/0266 Institutional research plan: CEZ:AV0Z10300504 Keywords : behavior specification * component modes * software product lines Subject RIV: JC - Computer Hardware ; Software Impact factor: 1.821, year: 2009

  14. Establishment of monoclonal HCC cell lines with organ site-specific tropisms

    Wan, Jinliang; Wen, Duo; Dong, Lili; Tang, Jun; Liu, Dongli; Liu, Yang; Tao, Zhonghua; Gao, Dongmei; Sun, Huichuan; Cao, Ya; Fan, Jia; Wu, Weizhong

    2015-01-01

    Organ site-specific metastasis is an ominous feature for most poor-prognostic hepatocellular carcinoma (HCC) patients. Cancer cell lines and animal models are indispensable for investigating the molecular mechanisms of organ specific tropism. However, till now, little is known about the drivers in HCC metastatic tropism, and also no effective way has been developed to block the process of tropistic metastasis. In this study, we established several monoclonal HCC cell lines from HCCLM3-RFP together with their xenograft models, and then analyzed their metastatic potentials and tropisms using in-vitro and in-vivo assays, and finally elucidated the driving forces of HCC tropistic metastases. Six monoclonal cell lines with different organ site-specific tropism were established successfully. SPARC, VCAM1 and ANGPTL4 were found positively correlated with the potentials of lung metastasis, while ITGA1 had a positive relation to lymph node metastasis of enterocoelia. By our powerful platforms, HCC metastatic tropisms in clinic could be easily mimicked and recapitulated for exploring the bilateral interactions between tumor and its microenvironment, elucidating the drivers of HCC metastatic tropisms, and testing anti-cancer effects of newly developed agent in pre-clinical stage. The online version of this article (doi:10.1186/s12885-015-1692-0) contains supplementary material, which is available to authorized users

  15. Chicken lines divergently selected for antibody responses to sheep red blood cells show line-specific differences in sensitivity to immunomodulation by diet. Part I: Humoral parameters

    Adriaansen-Tennekes, R.; Vries Reilingh, de G.; Nieuwland, M.G.B.; Parmentier, H.K.; Savelkoul, H.F.J.

    2009-01-01

    Individual differences in nutrient sensitivity have been suggested to be related with differences in stress sensitivity. Here we used layer hens divergently selected for high and low specific antibody responses to SRBC (i.e., low line hens and high line hens), reflecting a genetically based

  16. Progesterone-specific stimulation of triglyceride biosynthesis in a breast cancer cell line (T-47D)

    Judge, S.M.; Chatterton, R.T. Jr.

    1983-01-01

    The purpose of this study was to examine the lactogenic response of human mammary cancer cell lines to hormones in vitro. Progesterone was found to stimulate the incorporation of 14C from [14C]acetate into triglycerides (TG) and to promote accumulation of TG with a fatty acid composition similar to that of human milk fat in T-47D cells. Lipid droplets were observed in larger numbers without concomitant accumulation of casein granules in cells incubated with progesterone, but secretion of lipid into the medium did not occur. An effect of progesterone on TG accumulation was detectable after 12 hr and was maximal at 72 hr. Increasing doses of progesterone (10(-9) to 10(-5) M) caused a progressive increase in TG accumulation. The presence of cortisol and/or prolactin did not alter TG formation nor the dose response of the cells to progesterone. The growth rate of T-47D cells was not altered by the presence of progesterone in the medium. Neither of the human mammary cancer cell lines, MCF-7 and HBL-100, nor the human fibroblast cell lines, 28 and 857, responded to progesterone. The data indicate that, while the normally lactogenic hormones do not stimulate milk product biosynthesis in the cell lines tested, progesterone specifically stimulated synthesis and accumulation of TG in the T-47D cells

  17. Comparison of Two Mouse Ameloblast-like Cell Lines for Enamel-specific Gene Expression

    Juni eSarkar

    2014-07-01

    Full Text Available Ameloblasts are ectoderm-derived cells that produce an extracellular enamel matrix that mineralizes to form enamel. The development and use of immortalized cell lines, with a stable phenotype, is an important contribution to biological studies as it allows for the investigation of molecular activities without the continuous need for animals. In this study we compare the expression profiles of enamel-specific genes in two mouse derived ameloblast-like cell lines: LS8 and ALC cells. Quantitative PCR analysis indicates that, relative to each other, LS8 cells express greater mRNA levels for genes that define secretory-stage activities (Amelx, Ambn, Enam and Mmp20, while ALC express greater mRNA levels for genes that define maturation-stage activities (Odam and Klk4. Western blot analyses show that Amelx, Ambn and Odam proteins are detectable in ALC, but not LS8 cells. Unstimulated ALC cells form calcified nodules, while LS8 cells do not. These data provide greater insight as to the suitability of both cell lines to contribute to biological studies on enamel formation and biomineralization, and highlight some of the strengths and weaknesses when relying on enamel epithelial organ-derived cell lines to study molecular activities of amelogenesis.

  18. Inhibitory effect on hepatitis B virus in vitro by a peroxisome proliferator-activated receptor-γ ligand, rosiglitazone

    Wakui, Yuta; Inoue, Jun; Ueno, Yoshiyuki; Fukushima, Koji; Kondo, Yasuteru; Kakazu, Eiji; Obara, Noriyuki; Kimura, Osamu; Shimosegawa, Tooru

    2010-01-01

    Although chronic infection of hepatitis B virus (HBV) is currently managed with nucleot(s)ide analogues or interferon-α, the control of HBV infection still remains a clinical challenge. Peroxisome proliferator-activated receptor (PPAR) is a ligand-activated transcription factor, that plays a role in glucose and lipid metabolism, immune reactions, and inflammation. In this study, the suppressive effect of PPAR ligands on HBV replication was examined in vitro using a PPARα ligand, bezafibrate, and a PPARγ ligand, rosiglitazone. The effects were examined in HepG2 cells transfected with a plasmid containing 1.3-fold HBV genome. Whereas bezafibrate showed no effect against HBV replication, rosiglitazone reduced the amount of HBV DNA, hepatitis B surface antigen, and hepatitis B e antigen in the culture supernatant. Southern blot analysis showed that the replicative intermediates of HBV in the cells were also inhibited. It was confirmed that GW9662, an antagonist of PPARγ, reduced the suppressive effect of rosiglitazone on HBV. Moreover, rosiglitazone showed a synergistic effect on HBV replication with lamivudine or interferon-α-2b. In conclusion, this study showed that rosiglitazone inhibited the replication of HBV in vitro, and suggested that the combination therapy of rosiglitazone and nucleot(s)ide analogues or interferon could be a therapeutic option for chronic HBV infection.

  19. Inhibitory effect on hepatitis B virus in vitro by a peroxisome proliferator-activated receptor-{gamma} ligand, rosiglitazone

    Wakui, Yuta; Inoue, Jun [Division of Gastroenterology, Tohoku University Graduate School of Medicine, 1-1 Seiryo, Aobaku, Sendai 980-8574 (Japan); Ueno, Yoshiyuki, E-mail: yueno@mail.tains.tohoku.ac.jp [Division of Gastroenterology, Tohoku University Graduate School of Medicine, 1-1 Seiryo, Aobaku, Sendai 980-8574 (Japan); Fukushima, Koji; Kondo, Yasuteru; Kakazu, Eiji; Obara, Noriyuki; Kimura, Osamu; Shimosegawa, Tooru [Division of Gastroenterology, Tohoku University Graduate School of Medicine, 1-1 Seiryo, Aobaku, Sendai 980-8574 (Japan)

    2010-05-28

    Although chronic infection of hepatitis B virus (HBV) is currently managed with nucleot(s)ide analogues or interferon-{alpha}, the control of HBV infection still remains a clinical challenge. Peroxisome proliferator-activated receptor (PPAR) is a ligand-activated transcription factor, that plays a role in glucose and lipid metabolism, immune reactions, and inflammation. In this study, the suppressive effect of PPAR ligands on HBV replication was examined in vitro using a PPAR{alpha} ligand, bezafibrate, and a PPAR{gamma} ligand, rosiglitazone. The effects were examined in HepG2 cells transfected with a plasmid containing 1.3-fold HBV genome. Whereas bezafibrate showed no effect against HBV replication, rosiglitazone reduced the amount of HBV DNA, hepatitis B surface antigen, and hepatitis B e antigen in the culture supernatant. Southern blot analysis showed that the replicative intermediates of HBV in the cells were also inhibited. It was confirmed that GW9662, an antagonist of PPAR{gamma}, reduced the suppressive effect of rosiglitazone on HBV. Moreover, rosiglitazone showed a synergistic effect on HBV replication with lamivudine or interferon-{alpha}-2b. In conclusion, this study showed that rosiglitazone inhibited the replication of HBV in vitro, and suggested that the combination therapy of rosiglitazone and nucleot(s)ide analogues or interferon could be a therapeutic option for chronic HBV infection.

  20. Optical scatterometry system for detecting specific line edge roughness of resist gratings subjected to detector noises

    Lee, Yen-Min; Li, Jia-Han; Cheng, Hsin-Hung; Wang, Fu-Min; Shen, Yu-Tian; Tsai, Kuen-Yu; Shieh, Jason J; Chen, Alek C

    2014-01-01

    The Fourier scatterometry model was used to measure the ZEP 520A electron beam resist lines with specific line edge roughness (LER). By obtaining the pupils via an objective lens, the angle-resolved diffraction spectrum was collected efficiently without additional mechanical scanning. The concavity of the pupil was considered as the weight function in specimen recognition. A series of white noises was examined in the model, and the tolerant white noise levels for different system numerical apertures (NAs) were reported. Our numerical results show that the scatterometry model of a higher NA can identify a target with a higher white noise level. Moreover, the fabricated ZEP 520A electron beam resist gratings with LER were measured by using our model, and the fitting results were matched with scanning electron microscope measurements. (paper)

  1. Short-Term Therapy with Rosiglitazone, a PPAR-γ Agonist, Improves Metabolic Profile and Vascular Function in Nonobese Lean Wistar Rats

    Naderali, Mohammad M.; Itua, Imose; Abubakari, Abdul-Razak; Naderali, Ebrahim K.

    2012-01-01

    A number of preclinical and clinical studies have reported blood-pressure-lowering benefits of thiazolidinediones in diabetic subjects and animal models of diabetes. This study was designed to further elucidate vascular effects of rosiglitazone, on healthy nonobese, lean animals. Adult male Wistar rats were randomized and assigned to control and rosiglitazone-treated groups and were dosed daily with either vehicle or rosiglitazone (10 mg kg−1 day−1) by oral gavage for 5 days. Compared with co...

  2. Structure-activity relationships of rosiglitazone for peroxisome proliferator-activated receptor gamma transrepression.

    Toyota, Yosuke; Nomura, Sayaka; Makishima, Makoto; Hashimoto, Yuichi; Ishikawa, Minoru

    2017-06-15

    Anti-inflammatory effects of peroxisome proliferator-activated receptor gamma (PPRAγ) ligands are thought to be largely due to PPARγ-mediated transrepression. Thus, transrepression-selective PPARγ ligands without agonistic activity or with only partial agonistic activity should exhibit anti-inflammatory properties with reduced side effects. Here, we investigated the structure-activity relationships (SARs) of PPARγ agonist rosiglitazone, focusing on transrepression activity. Alkenic analogs showed slightly more potent transrepression with reduced efficacy of transactivating agonistic activity. Removal of the alkyl group on the nitrogen atom improved selectivity for transrepression over transactivation. Among the synthesized compounds, 3l exhibited stronger transrepressional activity (IC 50 : 14μM) and weaker agonistic efficacy (11%) than rosiglitazone or pioglitazone. Copyright © 2017 Elsevier Ltd. All rights reserved.

  3. Rosiglitazone Reduces Plasma Levels of Inflammatory and Hemostatic Biomarkers and Improves Global Endothelial Function in Habitual Heavy Smokers Without Diabetes Mellitus or Metabolic Syndrome

    I-Chih Chen

    2010-02-01

    Conclusion: Rosiglitazone significantly reduces plasma levels of inflammatory and hemostatic biomarkers, and restores global endothelial dysfunction, independently from insulin sensitization, in healthy smokers.

  4. Effects of rosiglitazone on metabolic parameters and large artery sclerosis in nondiabetic patients with metabolic sydrome

    Shen Zhenhai; Lu Yun; Feng Yinbo; Jin Xian

    2010-01-01

    Objective: To observe the effects of rosiglitazone on metabolic parameters, carotid intimamedia thickness (IMT), brachial-ankle pulse wave velocity (baPWV) and ankle-brachial index (ABI) in nondiabetic patients with metabolic syndrome. Methods: Seventy-nine nondiabetic patients with metabolic syndrome were randomly divided into treatment group (n = 41) and control group (n = 38). The patients in treatment group were treated with rosiglitazone on the basis of life-style intervention, those in control group were treated with life-style intervention for 9 months. All patients were followed up every 3 months. Body mass index (BMI) ,waist circumference(WC), systolic blood pressure (SBP), diastolic blood pressure(DBP), fasting blood glucose (FBG), triglyceride (TG), total cholesterol (TC), highdendity lipoprotein (HDL-C), Low-density lipoprotein (LDL), high sensitivity C-reactive protein (hsCRP), HbA 1 C, fasting insulin (FIns), HOMA-IR, IMT, baPWV and ABI were measured in both groups before treatment and at the 6th, 9th month after treatment. Results: (1) After treatment with rosiglitazone for 6 months, FPG, TG, HDL-C, hsC RP, HbA 1 C, Fins and HOMA-IR in treatment group were improved (P 1 C, Fins and HOMA-IR got further improvement at the 9th month after treatment (P 1 C, Fins and HOMA-IR were changed significantly in treatment group compared to those in control group (P 1 C and HOMA-IR was independently related to the improvement of ABI by multivarient analysis. Conclusion: In nondiabetic patients with metabolic syndrome, rosiglitazone can significantly improve insulin resistance, correct metabolic disorders, has anti-inflammatory effect and retard atherosclerosis at some extent. (authors)

  5. Rosiglitazone delayed weight loss and anorexia while attenuating adipose depletion in mice with cancer cachexia

    Asp, Michelle L.; Tian, Min; Kliewer, Kara L.; Belury, Martha A.

    2011-01-01

    Cachexia is characterized by severe weight loss, including adipose and muscle wasting, and occurs in a large percentage of cancer patients. Insulin resistance contributes to dysregulated metabolism in cachexia and occurs prior to weight loss in mice with colon-26 tumor-induced cachexia. Therefore, we hypothesized that the insulin sensitizer, rosiglitazone, would attenuate the loss of adipose and muscle to result in improved outcomes for mice with late-stage cachexia. Male CD2F1 mice were inoc...

  6. Chicken lines divergently selected for antibody responses to sheep red blood cells show line-specific differences in sensitivity to immunomodulation by diet. Part I: Humoral parameters.

    Adriaansen-Tennekes, R; de Vries Reilingh, G; Nieuwland, M G B; Parmentier, H K; Savelkoul, H F J

    2009-09-01

    Individual differences in nutrient sensitivity have been suggested to be related with differences in stress sensitivity. Here we used layer hens divergently selected for high and low specific antibody responses to SRBC (i.e., low line hens and high line hens), reflecting a genetically based differential immune competence. The parental line of these hens was randomly bred as the control line and was used as well. Recently, we showed that these selection lines differ in their stress reactivity; the low line birds show a higher hypothalamic-pituitary-adrenal (HPA) axis reactivity. To examine maternal effects and neonatal nutritional exposure on nutrient sensitivity, we studied 2 subsequent generations. This also created the opportunity to examine egg production in these birds. The 3 lines were fed 2 different nutritionally complete layer feeds for a period of 22 wk in the first generation. The second generation was fed from hatch with the experimental diets. At several time intervals, parameters reflecting humoral immunity were determined such as specific antibody to Newcastle disease and infectious bursal disease vaccines; levels of natural antibodies binding lipopolysaccharide, lipoteichoic acid, and keyhole limpet hemocyanin; and classical and alternative complement activity. The most pronounced dietary-induced effects were found in the low line birds of the first generation: specific antibody titers to Newcastle disease vaccine were significantly elevated by 1 of the 2 diets. In the second generation, significant differences were found in lipoteichoic acid natural antibodies of the control and low line hens. At the end of the observation period of egg parameters, a significant difference in egg weight was found in birds of the high line. Our results suggest that nutritional differences have immunomodulatory effects on innate and adaptive humoral immune parameters in birds with high HPA axis reactivity and affect egg production in birds with low HPA axis reactivity.

  7. Optimized gene editing technology for Drosophila melanogaster using germ line-specific Cas9.

    Ren, Xingjie; Sun, Jin; Housden, Benjamin E; Hu, Yanhui; Roesel, Charles; Lin, Shuailiang; Liu, Lu-Ping; Yang, Zhihao; Mao, Decai; Sun, Lingzhu; Wu, Qujie; Ji, Jun-Yuan; Xi, Jianzhong; Mohr, Stephanie E; Xu, Jiang; Perrimon, Norbert; Ni, Jian-Quan

    2013-11-19

    The ability to engineer genomes in a specific, systematic, and cost-effective way is critical for functional genomic studies. Recent advances using the CRISPR-associated single-guide RNA system (Cas9/sgRNA) illustrate the potential of this simple system for genome engineering in a number of organisms. Here we report an effective and inexpensive method for genome DNA editing in Drosophila melanogaster whereby plasmid DNAs encoding short sgRNAs under the control of the U6b promoter are injected into transgenic flies in which Cas9 is specifically expressed in the germ line via the nanos promoter. We evaluate the off-targets associated with the method and establish a Web-based resource, along with a searchable, genome-wide database of predicted sgRNAs appropriate for genome engineering in flies. Finally, we discuss the advantages of our method in comparison with other recently published approaches.

  8. A novel translabial platform utilizing bioexcipients from Litchi chinesis for the delivery of rosiglitazone maleate

    N.V. Satheesh Madhav

    2013-12-01

    Full Text Available The aim of this study was to formulate drug-loaded bio-lipstrips using novel bioexcipients isolated from the fruit pulp of Litchi chinesis (biomaterial L and to explore the potentiality of lip skin as a novel translabial drug delivery system. The biomaterial, prepared by a simplified economical process and purified by hot dialysis, was subjected to various physicochemical evaluations along with spectral analysis including UV, FT-IR, Mass and 1H NMR. The lipstrip formulated with the novel bioexcipients was screened for its functional properties, including filmability using a film-casting method, and bio/muco-adhesitivity using a shear-stress method, the Park and Robinson method and a rotating cylinder method. Rosiglitazone-loaded bio-lipstrips were formulated by using biomaterial L as a strip former and dextrose as a flexicizer. The formulated strips were subjected to various evaluations, including thickness, folding endurance, in-vitro release and in-vivo release. The release of rosiglitazone maleate was maintained over 24 h, which was confirmed in in-vitro and in-vivo release experiments. Our results reveal that this biopolymer possesses promising stripability as well as bio-adhesitivity. The formulated bio-lipstrips are feasible for delivering rosiglitazone maleate by translabial administration.

  9. Macrophage PPARγ inhibits Gpr132 to mediate the anti-tumor effects of rosiglitazone

    Cheng, Wing Yin; Huynh, HoangDinh; Chen, Peiwen; Peña-Llopis, Samuel; Wan, Yihong

    2016-01-01

    Tumor-associated macrophage (TAM) significantly contributes to cancer progression. Human cancer is enhanced by PPARγ loss-of-function mutations, but inhibited by PPARγ agonists such as TZD diabetes drugs including rosiglitazone. However, it remains enigmatic whether and how macrophage contributes to PPARγ tumor-suppressive functions. Here we report that macrophage PPARγ deletion in mice not only exacerbates mammary tumor development but also impairs the anti-tumor effects of rosiglitazone. Mechanistically, we identify Gpr132 as a novel direct PPARγ target in macrophage whose expression is enhanced by PPARγ loss but repressed by PPARγ activation. Functionally, macrophage Gpr132 is pro-inflammatory and pro-tumor. Genetic Gpr132 deletion not only retards inflammation and cancer growth but also abrogates the anti-tumor effects of PPARγ and rosiglitazone. Pharmacological Gpr132 inhibition significantly impedes mammary tumor malignancy. These findings uncover macrophage PPARγ and Gpr132 as critical TAM modulators, new cancer therapeutic targets, and essential mediators of TZD anti-cancer effects. DOI: http://dx.doi.org/10.7554/eLife.18501.001 PMID:27692066

  10. Comparison of the effects of pioglitazone and rosiglitazone on macrophage foam cell formation

    Hirakata, Masao; Tozawa, Ryuichi; Imura, Yoshimi; Sugiyama, Yasuo

    2004-01-01

    In order to elucidate the antiatherogenic effects of pioglitazone (a peroxisome proliferator-activated receptor [PPAR]γ agonist with PPARα agonistic activity) and rosiglitazone (a more selective PPARγ agonist), we examined gene expression and cholesteryl ester accumulation in THP-1-derived macrophages. Pioglitazone enhanced the mRNA expression of the proatherogenic factors CD36 and adipophilin, but was approximately 10 times less potent than rosiglitazone. The potencies of the two agents appeared to correspond to their PPARγ agonistic activities in this respect. However, both agents were similarly potent in enhancing the mRNA expression of the antiatherogenic factors liver X receptor α and ATP-binding cassette-transporter A1. Furthermore, both agents enhanced cholesteryl ester hydrolase mRNA expression and inhibited acyl-CoA cholesterol acyltransferase-1 mRNA expression and cholesteryl ester accumulation in macrophages. In this respect, their potencies appeared to correspond to their PPARα agonistic activities. These results suggest that pioglitazone has an equally beneficial effect on antiatherogenic events to rosiglitazone, despite being almost 10 times less potent than a PPARγ agonist

  11. Irradiation specifically sensitises solid tumour cell lines to TRAIL mediated apoptosis

    Marini, Patrizia; Schmid, Angelika; Jendrossek, Verena; Faltin, Heidrun; Daniel, Peter T; Budach, Wilfried; Belka, Claus

    2005-01-01

    TRAIL (tumor necrosis factor related apoptosis inducing ligand) is an apoptosis inducing ligand with high specificity for malignant cell systems. Combined treatment modalities using TRAIL and cytotoxic drugs revealed highly additive effects in different tumour cell lines. Little is known about the efficacy and underlying mechanistic effects of a combined therapy using TRAIL and ionising radiation in solid tumour cell systems. Additionally, little is known about the effect of TRAIL combined with radiation on normal tissues. Tumour cell systems derived from breast- (MDA MB231), lung- (NCI H460) colorectal- (Colo 205, HCT-15) and head and neck cancer (FaDu, SCC-4) were treated with a combination of TRAIL and irradiation using two different time schedules. Normal tissue cultures from breast, prostate, renal and bronchial epithelia, small muscle cells, endothelial cells, hepatocytes and fibroblasts were tested accordingly. Apoptosis was determined by fluorescence microscopy and western blot determination of PARP processing. Upregulation of death receptors was quantified by flow cytometry. The combined treatment of TRAIL with irradiation strongly increased apoptosis induction in all treated tumour cell lines compared to treatment with TRAIL or irradiation alone. The synergistic effect was most prominent after sequential application of TRAIL after irradiation. Upregulation of TRAIL receptor DR5 after irradiation was observed in four of six tumour cell lines but did not correlate to tumour cell sensitisation to TRAIL. TRAIL did not show toxicity in normal tissue cell systems. In addition, pre-irradiation did not sensitise all nine tested human normal tissue cell cultures to TRAIL. Based on the in vitro data, TRAIL represents a very promising candidate for combination with radiotherapy. Sequential application of ionising radiation followed by TRAIL is associated with an synergistic induction of cell death in a large panel of solid tumour cell lines. However, TRAIL receptor

  12. Using Regularization to Infer Cell Line Specificity in Logical Network Models of Signaling Pathways

    Sébastien De Landtsheer

    2018-05-01

    Full Text Available Understanding the functional properties of cells of different origins is a long-standing challenge of personalized medicine. Especially in cancer, the high heterogeneity observed in patients slows down the development of effective cures. The molecular differences between cell types or between healthy and diseased cellular states are usually determined by the wiring of regulatory networks. Understanding these molecular and cellular differences at the systems level would improve patient stratification and facilitate the design of rational intervention strategies. Models of cellular regulatory networks frequently make weak assumptions about the distribution of model parameters across cell types or patients. These assumptions are usually expressed in the form of regularization of the objective function of the optimization problem. We propose a new method of regularization for network models of signaling pathways based on the local density of the inferred parameter values within the parameter space. Our method reduces the complexity of models by creating groups of cell line-specific parameters which can then be optimized together. We demonstrate the use of our method by recovering the correct topology and inferring accurate values of the parameters of a small synthetic model. To show the value of our method in a realistic setting, we re-analyze a recently published phosphoproteomic dataset from a panel of 14 colon cancer cell lines. We conclude that our method efficiently reduces model complexity and helps recovering context-specific regulatory information.

  13. Effects of rosiglitazone on serum paraoxonase activity and metabolic parameters in patients with type 2 diabetes mellitus

    Atamer, Y. [Department of Medical Biochemistry, Faculty of Medicine, Dicle University, Diyarbakır (Turkey); Atamer, A. [Ministry of Health Haydarpaşa Numune Training and Research Hospital, Division of Gastroenterology, Department of Internal Medicine, Istanbul, Turkey, Division of Gastroenterology, Department of Internal Medicine, Ministry of Health Haydarpaşa Numune Training and Research Hospital, Istanbul (Turkey); Can, A.S. [Termal Professional School, Yalova University, Yalova (Turkey); Hekimoğlu, A. [Dicle University, Department of Pharmacology, Faculty of Medicine, Diyarbakir, Turkey, Department of Pharmacology, Faculty of Medicine, Dicle University, Diyarbakır (Turkey); Ilhan, N. [Firat University, Department of Medical Biochemistry, Faculty of Medicine, Elaziğ, Turkey, Department of Medical Biochemistry, Faculty of Medicine, Fırat University, Elazığ (Turkey); Yenice, N. [Division of Gastroenterology, Department of Internal Medicine, Faculty of Medicine, Harran University, Urfa (Turkey); Koçyiğit, Y. [Dicle University, Department of Physiology, Faculty of Medicine, Diyarbakir, Turkey, Department of Physiology, Faculty of Medicine, Dicle University, Diyarbakır (Turkey)

    2013-06-25

    Human serum paraoxonase contributes to the anti-atherogenic effect of high-density lipoprotein cholesterol (HDL-C) and has been shown to protect both low-density lipoprotein cholesterol (LDL-C) and HDL-C against lipid peroxidation. We investigated the effects of rosiglitazone on paraoxonase activity and metabolic parameters in patients with type 2 diabetes mellitus [50 patients (30 males, 20 females); mean±SD age: 58.7±9.2 years, body mass index: 28.2±4.1'kg/m{sup 2}], in whom glucose control could not be achieved despite treatment with metformin, sulphonylurea, and/or insulin. The patients were given 4'mg/day rosiglitazone for 3 months in addition to their usual treatment. Serum paraoxonase activity, malondialdehyde, homocysteine, and lipid profile were measured at the time of initiation and at the end of therapy with rosiglitazone. After rosiglitazone therapy, serum levels of HDL-C, apolipoprotein A-1, and paraoxonase activity increased significantly (P<0.05) and malondialdehyde, homocysteine, lipoprotein(a), and glucose levels decreased significantly (P<0.05), but no significant changes in levels of total cholesterol and apolipoprotein B were observed. Triglyceride levels also increased significantly (P<0.05). Rosiglitazone treatment led to an improvement in glycemic control and to an increase in paraoxonase activity and HDL-C levels. Although rosiglitazone showed favorable effects on oxidant/antioxidant balance and lipid profile, further studies are needed to determine the effect of rosiglitazone on cardiovascular risk factors and cardiovascular morbidity and mortality.

  14. Effects of rosiglitazone on serum paraoxonase activity and metabolic parameters in patients with type 2 diabetes mellitus

    Atamer, Y.; Atamer, A.; Can, A.S.; Hekimoğlu, A.; Ilhan, N.; Yenice, N.; Koçyiğit, Y.

    2013-01-01

    Human serum paraoxonase contributes to the anti-atherogenic effect of high-density lipoprotein cholesterol (HDL-C) and has been shown to protect both low-density lipoprotein cholesterol (LDL-C) and HDL-C against lipid peroxidation. We investigated the effects of rosiglitazone on paraoxonase activity and metabolic parameters in patients with type 2 diabetes mellitus [50 patients (30 males, 20 females); mean±SD age: 58.7±9.2 years, body mass index: 28.2±4.1'kg/m 2 ], in whom glucose control could not be achieved despite treatment with metformin, sulphonylurea, and/or insulin. The patients were given 4'mg/day rosiglitazone for 3 months in addition to their usual treatment. Serum paraoxonase activity, malondialdehyde, homocysteine, and lipid profile were measured at the time of initiation and at the end of therapy with rosiglitazone. After rosiglitazone therapy, serum levels of HDL-C, apolipoprotein A-1, and paraoxonase activity increased significantly (P<0.05) and malondialdehyde, homocysteine, lipoprotein(a), and glucose levels decreased significantly (P<0.05), but no significant changes in levels of total cholesterol and apolipoprotein B were observed. Triglyceride levels also increased significantly (P<0.05). Rosiglitazone treatment led to an improvement in glycemic control and to an increase in paraoxonase activity and HDL-C levels. Although rosiglitazone showed favorable effects on oxidant/antioxidant balance and lipid profile, further studies are needed to determine the effect of rosiglitazone on cardiovascular risk factors and cardiovascular morbidity and mortality

  15. Improvement in psoriasis with rosiglitazone in a diabetic and a nondiabetic patient.

    Pershadsingh, Harrihar A; Benson, Steven C; Ellis, Charles N

    2005-01-01

    The authors conducted a prospective, open-label, pilot trial of the effects of the antidiabetic thiazolidinedione (TZD) rosiglitazone in two patients with moderate to severe plaque psoriasis. Case 1: A lean, euglycemic 43-year-old nondiabetic man with a 2-year history of plaque psoriasis presented with lesions involving 10% of his body surface (Figures 1A, 1B, 1C). He had no other chronic or acute medical problems. He had previously been managed sporadically with topical triamcinolone acetonide, an intermediate-strength glucocorticoid, and was off antipsoriatic medication for 5 months. He was started on rosiglitazone p.o., 8 mg q.d. After 10 weeks on rosiglitazone, the lesions developed increased erythema, spreading, and shedding of scale (Figures 2A, 2B, 2C). After an additional 26 weeks, the lesions had largely disappeared (Figures 3A, 3B, 3C). The patient remained euglycemic throughout the study. His liver function enzymes (alanine transferase [ALT] and aspartate transferase [AST]) remained normal throughout the study: ALT, 23 IU/L; AST, 47 IU/L before treatment; ALT, 25 IU/L; AST, 33 IU/L after treatment. There were no adverse events. Case 2: An overweight 68-year-old woman (body mass index, 29 kg/m2; with a 12-year history of type 2 diabetes and 5-year history of psoriasis presented with generalized plaque psoriasis over 20% of her body, including two large, thick, silvery plaques with the texture of leather over the lower part of the back (Figure 4A). She was given rosiglitazone p.o., 4 mg b.i.d. for 24 weeks, which resulted in significant improvement in psoriasis (Figure 4B). After an additional 26 weeks on rosiglitazone, the plaques had cleared on her back (Figure 4C) and over her entire body, including scalp, ears, and posterior forearms (not shown). Her glycemic control improved (hemoglobin A1c decreased from 7.7% to 7.2%) and liver function remained normal throughout the study (ALT, 24 IU/L; AST, 14 IU/L before treatment; and ALT, 26 IU/L; AST, 15 IU

  16. LINES

    Minas Bakalchev

    2015-10-01

    Full Text Available The perception of elements in a system often creates their interdependence, interconditionality, and suppression. The lines from a basic geometrical element have become the model of a reductive world based on isolation according to certain criteria such as function, structure, and social organization. Their traces are experienced in the contemporary world as fragments or ruins of a system of domination of an assumed hierarchical unity. How can one release oneself from such dependence or determinism? How can the lines become less “systematic” and forms more autonomous, and less reductive? How is a form released from modernistic determinism on the new controversial ground? How can these elements or forms of representation become forms of action in the present complex world? In this paper, the meaning of lines through the ideas of Le Corbusier, Leonidov, Picasso, and Hitchcock is presented. Spatial research was made through a series of examples arising from the projects of the architectural studio “Residential Transformations”, which was a backbone for mapping the possibilities ranging from playfulness to exactness, as tactics of transformation in the different contexts of the contemporary world.

  17. Mechanism of arctigenin-mediated specific cytotoxicity against human lung adenocarcinoma cell lines.

    Susanti, Siti; Iwasaki, Hironori; Inafuku, Masashi; Taira, Naoyuki; Oku, Hirosuke

    2013-12-15

    The lignan arctigenin (ARG) from the herb Arctium lappa L. possesses anti-cancer activity, however the mechanism of action of ARG has been found to vary among tissues and types of cancer cells. The current study aims to gain insight into the ARG mediated mechanism of action involved in inhibiting proliferation and inducing apoptosis in lung adenocarcinoma cells. This study also delineates the cancer cell specificity of ARG by comparison with its effects on various normal cell lines. ARG selectively arrested the proliferation of cancer cells at the G0/G1 phase through the down-regulation of NPAT protein expression. This down-regulation occurred via the suppression of either cyclin E/CDK2 or cyclin H/CDK7, while apoptosis was induced through the modulation of the Akt-1-related signaling pathway. Furthermore, a GSH synthase inhibitor specifically enhanced the cytotoxicity of ARG against cancer cells, suggesting that the intracellular GSH content was another factor influencing the susceptibility of cancer cells to ARG. These findings suggest that specific cytotoxicity of ARG against lung cancer cells was explained by its selective modulation of the expression of NPAT, which is involved in histone biosynthesis. The cytotoxicity of ARG appeared to be dependent on the intracellular GSH level. Copyright © 2013 Elsevier GmbH. All rights reserved.

  18. ISP-50 Specifications for a Direct Vessel Injection Line Break Test with the ATLAS

    Choi, Ki Yong; Baek, Won Pil; Kim, Yeon Sik; Park, Hyun Sik; Cho, Seok; Kang, Kyoung Ho; Choi, Nam Hyun; Min, Kyoung Ho

    2009-06-01

    An OECD/NEA International Standard Problem Exercise (ISP) focussing on a DVI line break simulation result with the ATLAS was approved by the NEA Committee on the Safety of Nuclear Installation (CSNI) meeting in December 2008 and was numbered by ISP-50. The ISP-50 program will be operated by an operating agency, KAERI for three years starting from the physical year 2009. Fourteen international organizations confirmed their participation in the ISP-50, including NRC (USA), JAEA, JNES (Japan), GRS (Germany), KFKI-AEKI (Hungary), EDO Gidropress (Russia), VTT, Fortum (Finland), NRI (Czech Republic), Univ. of Pisa (Italy), KINS, KNF, KOPEC, and KAERI (Korea). In addition, KTH in Sweden and HSE in UK are considering late participation. Recently, NPIC and CIAE in China hope to join the ISP-50. As for the safety analysis codes, nine codes are expected to be used for the ISP-50: MARS-3D, RELAP5- 3D, RELAP5, TRACE, CATHARE, APROS, ATHELET, TRAP, and KORSAR. It is the first ISP exercise in Korea in which a domestic test facility is utilized by international nuclear society and this exercise will contribute to extending our physical understanding on thermal hydraulic phenomena during the DVI line break accidents and to verifying the best-estimate thermal-hydraulic safety analysis codes. This report was prepared to define technical specifications of the ISP-50 exercise according the guideline provided by OECD/CSNI. It includes general objectives, phases, deliverables to participants, parameters required for comparison and the time table

  19. Rosiglitazone reverses memory decline and hippocampal glucocorticoid receptor down-regulation in an Alzheimer's disease mouse model

    Escribano, Luis; Simon, Ana-Maria; Perez-Mediavilla, Alberto; Salazar-Colocho, Pablo; Rio, Joaquin Del; Frechilla, Diana

    2009-01-01

    Clinical trials with rosiglitazone, a potent agonist at peroxisome proliferator-activated receptor gamma (PPARγ) suggest an improvement of cognitive function in Alzheimer's disease (AD) patients. The mechanisms mediating this potential beneficial effect remain to be fully elucidated. In mice overexpressing mutant human amyloid precursor protein (hAPP), a model of AD, we found that memory impairment in the object recognition test was prevented and also reversed by chronic rosiglitazone treatment. Given the possible involvement of glucocorticoid receptors (GR) in the actions of PPARγ-ligands, we studied the effect of chronic rosiglitazone treatment on GR levels in the hippocampus of hAPP mice. An early down-regulation of GR, not related to elevated plasma corticosterone levels, was found in different hippocampal subfields of the transgenic mice and this decrease was prevented by rosiglitazone. In parallel with behavioural studies, rosiglitazone also normalized GR levels in older animals. This effect may contribute to explain the attenuation of memory decline by PPARγ activation in an AD mouse model.

  20. Serial micro-CT assessment of the therapeutic effects of rosiglitazone in a bleomycin-induced lung fibrosis mouse model

    Choi, Eun Jung; Jin, Gong Yong; Bok, Se Mi; Han, Young Min; Lee, Young Sun; Jung, Myung Ja; Kwon, Keun Sang [Research Institute of Clinical Medicine of Chonbuk National University, Biomedical Research Institute of Chonbuk National University Hospital, Institute for Medical Sciences, Jeonju (Korea, Republic of)

    2014-08-15

    The aim of this study was to assess the therapeutic effects of rosiglitazone with serial micro-CT findings before and after rosiglitazone administration in a lung fibrosis mouse model induced with bleomycin. We instilled the bleomycin solution directly into the trachea in twenty mice (female, C57BL/6 mice). After the instillation with bleomycin, mice were closely observed for 3 weeks and then all mice were scanned using micro-CT without sacrifice. At 3 weeks, the mice were treated with rosiglitazone on days 21 to 27 if they had abnormal CT findings (n = 9, 45%). For the mice treated with rosiglitazone, we performed micro-CT with mouse sacrifice 2 weeks after the rosiglitazone treatment completion. We assessed the abnormal CT findings (ground glass attenuation, consolidation, bronchiectasis, reticular opacity, and honeycombing) using a five-point scale at 3 and 6 weeks using Wilcoxon-signed ranked test. The micro-CT findings were correlated with the histopathologic results. One out of nine (11.1%) mice improved completely. In terms of consolidation, all mice (100%) showed marked decrease from 3.1 ± 1.4 at 3 weeks to 0.9 ± 0.9 at 6 weeks (p = 0.006). At 6 weeks, mild bronchiectasis (n = 6, 66.7%), mild reticular opacity (n 7, 77.8%) and mild honeycomb patterns (n = 3, 33.3%) appeared. A serial micro-CT enables the evaluation of drug effects in a lung fibrosis mouse model.

  1. On-Line Monitoring of Instrument Channel Performance: Volume 3: Applications to Nuclear Power Plant Technical Specification Instrumentation

    Davis, E.; Rasmussen, B.

    2004-01-01

    This report is a guide for a technical specification change submittal and subsequent implementation of on-line monitoring for safety-related applications. This report is the third in a three-volume set. Volume 1, ''Guidelines for Model Development and Implementation'', presents the various tasks that must be completed to prepare models for and to implement an on-line monitoring system

  2. The effects of human CYP2C8 genotype and fluvoxamine on the pharmacokinetics of rosiglitazone in healthy subjects

    Pedersen, Rasmus S; Damkier, Per; Brosen, Kim

    2006-01-01

    = 0.0066) increase in the AUC(0-infinity) of rosiglitazone, with a geometric mean ratio of 1.21 [95% confidence interval (CI) 1.06-1.39]. The elimination half-life (t(1/2)) was also significantly higher (P = 0.0203) with a geometric mean ratio of 1.38 [95% CI 1.06-1.79]. The coadministration...... of fluvoxamine had no influence on the pharmacokinetics of N-desmethylrosiglitazone. CONCLUSION: The importance of the CYP2C8*3 mutation in the in vivo metabolism of rosiglitazone could not be confirmed. Fluvoxamine increased the AUC(0-infinity) and t(1/2) of rosiglitazone moderately and hence may be a weak...

  3. Determination of glibenclamide, metformin hydrochloride and rosiglitazone maleate by reversed phase liquid chromatographic technique in tablet dosage form

    Havele Shweta S.

    2014-01-01

    Full Text Available A simple, precise and accurate high performance liquid chromatography (HPLC method was developed for the simultaneous estimation of metformin hydrochloride, rosiglitazone maleate, glibenclamide present in multicomponent dosage forms. Chromatography was performed on a 25 cm × 4.6 mm i.d., 5-μm particle, C18 column with 78:22 (v/v methanol: 20 mM potassium dihydrogen phosphate buffer as mobile phase at a flow rate of 1.0 ml/min and UV detection at 238 nm for metformin hydrochloride, rosiglitazone maleate, and glibenclamide. The total elution time was shorter than 9 min. This method was found to be precise and reproducible. This proposed method was successfully applied for the analysis of metformin hydrochloride, rosiglitazone maleate, glibenclamide as a bulk drug and in pharmaceutical formulation without any interference from the excipients.

  4. Effect of pomegranate peel alone and in combination with rosiglitazone on hyperglycemia and dyslipidemia in type 2 diabetes mellitus

    Shujaat, A.; Hussain, M.M.

    2016-01-01

    To evaluate the effect of pomegranate peel extract with or without rosiglitazone on plasma glucose and lipid profile in insulin resistant diabetic rats. Study Design: Randomized controlled trial. Place and Duration of Study: Department of Physiology, Army Medical College, Rawalpindi, in collaboration with National Institute of Health (N.I.H), Islamabad from 1st January 2011 to 28th May 2011. Material and Methods: Type 2 diabetes mellitus was induced in sixty healthy rats. The diabetic rats were divided into four groups, namely diabetic control group which received intraperitoneal injection of normal saline daily, pomegranate group which was treated similar to control group and also received pomegranate peel extract (200mg/kg body weight) orally once daily, rosiglitazone group which received intraperitoneal injection of rosiglitazone (5mg/kg body weight) daily and the combined group received both pomegranate extract (100 mg/kg body weight, orally) and intraperitoneal injection of rosiglitazone (2.5 mg/kg body weight) daily for 28 days. After four weeks of treatment, terminal intracardiac sampling was done to measure plasma glucose and lipid profile. Results: The plasma glucose and mean serum levels of cholesterol, triglyceride, low density lipoproteins and very low density lipoproteins was significantly reduced (p<0.001) in pomegranate, rosiglitazone and combined groups respectively as compared to the diabetic control. The mean serum levels of high density lipoproteins were significantly (p<0.001) elevated in above mentioned groups as compared to the diabetic control. Conclusion: Pomegranate peel extract is hypoglycemic and hypolipidemic agent in low doses when used alone or in combination with rosiglitazone in type 2 diabetic rats. (author)

  5. ON-Line Monitoring of Instrument Channel Performance: Volume 3: Applications to Nuclear Power Plant Technical Specification Instrumentation

    E Davis, B Rasmussen

    2004-12-31

    This report is a guide for a technical specification change submittal and subsequent implementation of on-line monitoring for safety-related applications. This report is the third in a three-volume set. Volume 1, ''Guidelines for Model Development and Implementation'', presents the various tasks that must be completed to prepare models for and to implement an on-line monitoring system.

  6. 2-DE analysis of breast cancer cell lines 1833 and 4175 with distinct metastatic organ-specific potentials: Comparison with parental cell line MDA-MB-231

    Selicharová, Irena; Šanda, Miloslav; Mládková, Jana; Ohri, S. S.; Vashishta, A.; Fusek, M.; Jiráček, Jiří; Vetvicka, V.

    2008-01-01

    Roč. 19, č. 5 (2008), s. 1237-1244 ISSN 1021-335X R&D Projects: GA MZd NR8323 Grant - others:NIH(US) ROI CAA082159-03 Institutional research plan: CEZ:AV0Z40550506 Keywords : breast cancer * cell line * 2-DE * organ-specific metastases Subject RIV: CE - Biochemistry Impact factor: 1.524, year: 2008

  7. Activation of PPAR by Rosiglitazone Does Not Negatively Impact Male Sex Steroid Hormones in Diabetic Rats

    Mahmoud Mansour

    2009-01-01

    Full Text Available Peroxisome proliferator-activated receptor gamma (PPAR activation decreased serum testosterone (T in women with hyperthecosis and/or polycystic ovary syndrome and reduced the conversion of androgens to estradiol (E2 in female rats. This implies modulation of female sex steroid hormones by PPAR. It is not clear if PPAR modulates sex steroid hormones in diabetic males. Because PPAR activation by thiazolidinedione increased insulin sensitivity in type 2 diabetes, understanding the long term impact of PPAR activation on steroid sex hormones in males is critical. Our objective was to determine the effect of PPAR activation on serum and intratesticular T, luteinizing hormone (LH, follicle stimulating hormone (FSH and E2 concentrations in male Zucker diabetic fatty (ZDF rats treated with the PPAR agonist rosiglitazone (a thiazolidinedione. Treatment for eight weeks increased PPAR mRNA and protein in the testis and elevated serum adiponectin, an adipokine marker for PPAR activation. PPAR activation did not alter serum or intratesticular T concentrations. In contrast, serum T level but not intratesticular T was reduced by diabetes. Neither diabetes nor PPAR activation altered serum E2 or gonadotropins FSH and LH concentrations. The results suggest that activation of PPAR by rosiglitazone has no negative impact on sex hormones in male ZDF rats.

  8. Flux line lattice melting transition in YBa2Cu3O6.94 observed in specific heat experiments

    Roulin, M.; Junod, A.; Walker, E.

    1996-01-01

    When a magnetic field penetrates a type II superconductor, it forms a lattice of thin quantized filaments called magnetic vortices. Resistance, magnetization, and neutron diffraction experiments have shown that the vortex lattice of high-temperature superconductors can melt along a line in the field-temperature plane. The calorimetric signature of melting on this line was observed in a high-accuracy adiabatic specific heat experiment performed on YBa 2 Cu 3 O 6.94 . The specific heat of the vortex liquid was greater than that of the vortex solid. 17 refs., 3 figs

  9. Testing for myositis specific autoantibodies: Comparison between line blot and immunoprecipitation assays in 57 myositis sera.

    Cavazzana, Ilaria; Fredi, Micaela; Ceribelli, Angela; Mordenti, Cristina; Ferrari, Fabio; Carabellese, Nice; Tincani, Angela; Satoh, Minoru; Franceschini, Franco

    2016-06-01

    To analyze the performance of a line blot assay for the identification of autoantibodies in sera of patients affected by myositis, compared with immunoprecipitation (IP) as gold standard. 66 sera of patients with myositis (23 polymyositis, 8 anti-synthetase syndromes, 29 dermatomyositis and 6 overlap syndromes) were tested by commercial LB (Euroimmun, Lubeck, Germany); 57 sera were analyzed also by IP of K562 cell extract radiolabeled with (35)S-methionine. Inter-rater agreement was calculated with Cohen's k coefficient. Myositis-specific antibodies (MSA) were detected in 36/57 sera (63%) by IP and in 39/66 sera (59%) by LB. The most frequent MSA found by LB were anti-Jo1 and anti-Mi2 found in 15% (10/66) of sera, followed by anti-NXP2 and anti-SRP detected in 106% (7/66) of sera. Anti-TIF1gamma and anti-MDA5 were found in 6 (9%) and 5 sera (7.6%), respectively. A good agreement between methods was found only for anti-TIF1γ, anti-MDA5 and anti-NXP-2 antibodies, while a moderate agreement was estimated for anti-Mi2 and anti-EJ. By contrast, a high discordance rate for the detection of anti-Jo1 antibodies was evident (k: 0.3). Multiple positivity for MSA were found in 11/66 (17%) by LB and 0/57 by IP (p: 0001). Comparing the clinical features of these 11 sera, we found total discrepancies between assays in 3 sera (27.3%), a relative discrepancy due to the occurrence of one discordant autoantibody (not confirmed by IP) in 5 cases (45.5%) and a total discrepancy between LB and IP results, but with a relative concordance with clinical features were found in other 3 sera (27.3%). The semiquantitative results do not support the interpretation of the data. The use of LB assay allowed the detection of new MSA, such as anti-MDA5, anti-MJ and anti-TIF1gamma antibodies, previously not found with routine methods. However, the high prevalence of multiple positivities and the high discondant rate of anti-Jo1 antibodies could create some misinterpretation of the results from the

  10. Effectiveness of rosiglitazone on bleomycin-induced lung fibrosis: Assessed by micro-computed tomography and pathologic scores

    Jin, Gong Yong; Bok, Se Mi; Han, Young Min; Chung, Myung Ja; Yoon, Kwon-Ha; Kim, So Ri; Lee, Yong Chul

    2012-01-01

    Peroxisome proliferator-activated receptor-γ (PPARγ) agonists exhibit potent anti-fibrotic effects in the lung and other tissues. Recently, micro-computed tomography (CT) has been a useful tool for the investigation of lung diseases in small animals and is now increasingly applied to visualize and quantify the pulmonary structures. However, there is little information on the assessment for therapeutic effects of PPARγ agonists on the pulmonary fibrosis in mice using micro-CT. This study was aimed to determine the capability of micro-CT in examining the effects of rosiglitazone on pulmonary fibrosis. We used a murine model of bleomycin-induced lung fibrosis to evaluate the feasibility of micro-CT in evaluating the therapeutic potential of rosiglitazone on pulmonary fibrosis, comparing with pathologic scores. On micro-CT findings, ground glass opacity (80%) and consolidation (20%) were observed predominantly at 3 weeks after the instillation of bleomycin, and the radiologic features became more complex at 6 weeks. In bleomycin-instilled mice treated with rosiglitazone, the majority (80%) showed normal lung features on micro-CT. Radiological-pathologic correlation analyses revealed that ground glass opacity and consolidation were correlated closely with acute inflammation, while reticular opacity was well correlated with histological honeycomb appearance. These results demonstrate that rosiglitazone displays a protective effect on pulmonary fibrosis in mice and that the visualization of bleomycin-induced pulmonary fibrosis using micro-CT is satisfactory to assess the effects of rosiglitazone. It implies that micro-CT can be applied to evaluate therapeutic efficacies of a variety of candidate drugs for lung diseases.

  11. Repurposing rosiglitazone, a PPAR-γ agonist and oral antidiabetic, as an inhaled formulation, for the treatment of PAH.

    Rashid, Jahidur; Alobaida, Ahmad; Al-Hilal, Taslim A; Hammouda, Samia; McMurtry, Ivan F; Nozik-Grayck, Eva; Stenmark, Kurt R; Ahsan, Fakhrul

    2018-06-28

    Peroxisome-proliferator-activated-receptor-gamma (PPAR-γ) is implicated, in some capacity, in the pathogenesis of pulmonary arterial hypertension (PAH). Rosiglitazone, an oral antidiabetic and PPAR-γ agonist, has the potential to dilate pulmonary arteries and to attenuate arterial remodeling in PAH. Here, we sought to test the hypothesis that rosiglitazone can be repurposed as inhaled formulation for the treatment of PAH. We have tested this conjecture by preparing and optimizing poly(lactic-co-glycolic) acid (PLGA) based particles of rosiglitazone, assessing the drug particles for pulmonary absorption, investigating the efficacy of the plain versus particulate drug formulation in improving the respiratory hemodynamics in PAH animals, and finally studying the effect of the drug in regulating the molecular markers associated with PAH pathogenesis. The optimized particles were slightly porous and spherical, and released 87.9% ± 6.7% of the drug in 24 h. The elimination half-life of the drug formulated in PLGA particles was 2.5-fold greater than that of the plain drug administered via the same route at the same dose. The optimized formulation, given via the pulmonary route, produced pulmonary selective vasodilation in PAH animals, but oral rosiglitazone had no effect in pulmonary hemodynamics. Rosiglitazone ameliorates the pathogenesis of PAH by balancing the molecular regulators involved in the vasoconstriction and vasodilation of human pulmonary arterial smooth muscle cells. All in all, data generated using intact animal and cellular models point to the conclusion that PLGA particles of an antidiabetic drug can be used for the treatment of a different disease, PAH. Copyright © 2018 Elsevier B.V. All rights reserved.

  12. In vivo metabolic phenotyping of myocardial substrate metabolism in rodents: differential efficacy of metformin and rosiglitazone monotherapy.

    Shoghi, Kooresh I; Finck, Brian N; Schechtman, Kenneth B; Sharp, Terry; Herrero, Pilar; Gropler, Robert J; Welch, Michael J

    2009-09-01

    Cardiovascular disease is the leading cause of death among diabetic patients, with alteration in myocardial substrate metabolism being a likely contributor. We aimed to assess noninvasively the efficacy of metformin and rosiglitazone monotherapy in normalizing myocardial substrate metabolism in an animal model of type 2 diabetes mellitus. The study used 18 male ZDF rats (fa/fa) with 6 rats in each group: an untreated group; a group treated with metformin (16.6 mg/kg/d), and a group treated with rosiglitazone (4 mg/kg). Each rat was scanned at age 14 weeks (baseline) and subsequently at 19 weeks with small-animal positron emission tomography to estimate myocardial glucose utilization (MGU) and myocardial utilization (MFAU), oxidation (MFAO), and esterification (MFAE). Treatment lasted for 5 weeks after baseline imaging. At week 19, rats were euthanized and hearts were extracted for expression analysis of select genes encoding for GLUT transporters and fatty acid transport and oxidation genes. In addition, echocardiography measurements were obtained at weeks 13 and 18 to characterize cardiac function. Metformin had no significant effect on either MGU or MFAU and MFAO. In contrast, rosiglitazone tended to enhance MGU and significantly reduced MFAU and MFAO. Rosiglitazone-induced increase in glucose uptake correlated significantly with increased expression of GLUT4, whereas diminished MFAO correlated significantly with decreased expression of FATP-1 and MCAD. Finally, changes in fractional shortening as a measure of cardiac function were unchanged throughout the study. Treatment with rosiglitazone enhanced glucose utilization and diminished MFAO, thus reversing the metabolic phenotype of the diabetic heart.

  13. Effectiveness of rosiglitazone on bleomycin-induced lung fibrosis: Assessed by micro-computed tomography and pathologic scores

    Jin, Gong Yong; Bok, Se Mi; Han, Young Min [Department of Radiology, Chonbuk National University Medical School, Jeonju (Korea, Republic of); Chung, Myung Ja [Department of Pathology, Chonbuk National University Medical School, Jeonju (Korea, Republic of); Yoon, Kwon-Ha [Department of Radiology, Iksan Hospital, Iksan (Korea, Republic of); Kim, So Ri [Department of Internal Medicine and Research Center for Pulmonary Disorders, Chonbuk National University Medical School, Jeonju (Korea, Republic of); Lee, Yong Chul, E-mail: leeyc@jbnu.ac.kr [Department of Internal Medicine and Research Center for Pulmonary Disorders, Chonbuk National University Medical School, Jeonju (Korea, Republic of)

    2012-08-15

    Peroxisome proliferator-activated receptor-{gamma} (PPAR{gamma}) agonists exhibit potent anti-fibrotic effects in the lung and other tissues. Recently, micro-computed tomography (CT) has been a useful tool for the investigation of lung diseases in small animals and is now increasingly applied to visualize and quantify the pulmonary structures. However, there is little information on the assessment for therapeutic effects of PPAR{gamma} agonists on the pulmonary fibrosis in mice using micro-CT. This study was aimed to determine the capability of micro-CT in examining the effects of rosiglitazone on pulmonary fibrosis. We used a murine model of bleomycin-induced lung fibrosis to evaluate the feasibility of micro-CT in evaluating the therapeutic potential of rosiglitazone on pulmonary fibrosis, comparing with pathologic scores. On micro-CT findings, ground glass opacity (80%) and consolidation (20%) were observed predominantly at 3 weeks after the instillation of bleomycin, and the radiologic features became more complex at 6 weeks. In bleomycin-instilled mice treated with rosiglitazone, the majority (80%) showed normal lung features on micro-CT. Radiological-pathologic correlation analyses revealed that ground glass opacity and consolidation were correlated closely with acute inflammation, while reticular opacity was well correlated with histological honeycomb appearance. These results demonstrate that rosiglitazone displays a protective effect on pulmonary fibrosis in mice and that the visualization of bleomycin-induced pulmonary fibrosis using micro-CT is satisfactory to assess the effects of rosiglitazone. It implies that micro-CT can be applied to evaluate therapeutic efficacies of a variety of candidate drugs for lung diseases.

  14. Development of an On-Line Surgeon-Specific Operating Room Time Prediction System (Experience with the Michigan Surgical Monitors)

    Brown, Allan C.D.; Schmidt, Nancy M.

    1984-01-01

    The development of a micro-computer application for the on-line prediction of surgeon-specific operating room time using an IBM - PCXT is described. The reasons leading to the project, together with an assessment of the Condor 20 relational database management system as the basis for the application are discussed.

  15. 7 CFR 1755.397 - RUS performance specification for line concentrators.

    2010-01-01

    ... part 51. Copies of these standards are available for inspection during normal business hours at RUS.... (ii) There should be provisions for such types of lines as ground start, loop start, regular... surface of the protectors. Means for easy identification of pairs shall be provided. (v) Protectors shall...

  16. The account of sagging of wires at definition of specific potential factors of air High-Voltage Power Transmission Lines

    Suslov V.M.

    2005-12-01

    Full Text Available The opportunity approached is shown, but more exact as it is usually accepted, the account of sagging of wires at definition of specific potential factors air High-Voltage Power Transmission Lines. The technique of reception of analytical expressions is resulted. For an opportunity of comparison traditional expressions for specific potential factors are resulted also. Communication of the offered and traditional analytical expressions is shown. Offered analytical expressions are not difficult for programming on a personal computer of any class and besides they allow to make an estimation of an error of traditional expressions by means of parallel definition of specific potential factors by both ways.

  17. Rosiglitazone evaluated for cardiovascular outcomes in oral agent combination therapy for type 2 diabetes (RECORD): a multicentre, randomised, open-label trial

    Home, Philip D; Pocock, Stuart J; Beck-Nielsen, Henning

    2009-01-01

    .80-1.63) for myocardial infarction, and 0.72 (0.49-1.06) for stroke. Heart failure causing admission to hospital or death occurred in 61 people in the rosiglitazone group and 29 in the active control group (HR 2.10, 1.35-3.27, risk difference per 1000 person-years 2.6, 1.1-4.1). Upper and distal lower limb fracture rates...... failure and of some fractures, mainly in women. Although the data are inconclusive about any possible effect on myocardial infarction, rosiglitazone does not increase the risk of overall cardiovascular morbidity or mortality compared with standard glucose-lowering drugs. FUNDING: GlaxoSmithKline plc, UK.......BACKGROUND: Rosiglitazone is an insulin sensitiser used in combination with metformin, a sulfonylurea, or both, for lowering blood glucose in people with type 2 diabetes. We assessed cardiovascular outcomes after addition of rosiglitazone to either metformin or sulfonylurea compared...

  18. Effect of the addition of rosiglitazone to metformin or sulfonylureas versus metformin/sulfonylurea combination therapy on ambulatory blood pressure in people with type 2 diabetes

    Komajda, Michel; Curtis, Paula; Hanefeld, Markolf

    2008-01-01

    BACKGROUND: Hypertension and type 2 diabetes are common co-morbidities. Preliminary studies suggest that thiazolidinediones reduce blood pressure (BP). We therefore used ambulatory BP to quantify BP lowering at 6-12 months with rosiglitazone used in combination with metformin or sulfonylureas...... compared to metformin and sulfonylureas in people with type 2 diabetes. METHODS: Participants (n = 759) in the multicentre RECORD study were studied. Those taking metformin were randomized (open label) to add-on rosiglitazone or sulfonylureas, and those on sulfonylurea to add-on rosiglitazone or metformin....... RESULTS: 24-Hour ambulatory BP was measured at baseline, 6 months and 12 months. At 6 and 12 months, reductions in 24-hour ambulatory systolic BP (sBP) were greater with rosiglitazone versus metformin (difference at 6 months 2.7 [95% CI 0.5-4.9] mmHg, p = 0.015; 12 months 2.5 [95% CI 0.2-4.8] mmHg, p = 0...

  19. Development of one control and one tumor-specific induced pluripotent stem cell line from laryngeal carcinoma patient

    Yamin Zhang

    2017-12-01

    Full Text Available Skin fibroblasts and tumor fibroblasts were extracted from a 64-year old male patient clinically diagnosed with laryngeal carcinoma. Control and tumor specific induced pluripotent stem cells were reprogrammed with 5 reprogramming factors, Klf-4, c-Myc, Oct-4, Sox-2, and Lin-28, using the messenger RNA reprogramming system. The transgene-free iPSC lines showed pluripotency, confirmed by immunofluorescence staining. The iPSC lines also showed normal karyotype, and could form embryoid bodies in vitro and differentiate into the 3 germ layers in vivo. This in vitro cellular model can be used to study the oncogenesis and pathogenesis of laryngeal carcinoma.

  20. Effects of metformin, rosiglitazone and insulin on bone metabolism in patients with type 2 diabetes

    Stage, Tore Bjerregaard; Christensen, Mette-Marie Hougaard; Jørgensen, Niklas Rye

    2018-01-01

    BACKGROUND: Fracture risk is increased in individuals with type 2 diabetes (T2D). The pathophysiological mechanisms accentuating fracture risk in T2D are convoluted, incorporating factors such as hyperglycaemia, insulinopenia, and antidiabetic drugs. The objectives of this study were to assess...... treatment in 371 T2D patients. Participants were randomized to short or long-acting human insulin (non-blinded) and then further randomized to metformin + placebo, rosiglitazone + placebo, metformin + rosiglitazone or placebo + placebo (blinded). Fasting bone turnover markers (BTM) representing bone......-up of the trial were analysed in mixed-effects models that included adjustments for age, gender, BMI, renal function and repeated measures of HbA1c. RESULTS: BTMs increased from baseline to month 12 and remained higher at month 24, with CTX and PINP increasing 28.5% and 23.0% (all: p 

  1. Effect of Recombinant Human Growth Hormone and Rosiglitazone for HIV-Associated Abdominal Fat Accumulation on Adiponectin and other Markers of Inflammation

    Leung, Vivien; Chiu, Ya-Lin; Kotler, Donald P.; Albu, Jeanine; Zhu, Yuan-Shan; Ham, Kirsis; Engelson, Ellen S.; Hammad, Hoda; Christos, Paul; Donovan, Daniel S.; Ginsberg, Henry N.; Glesby, Marshall J.

    2016-01-01

    Background/Objective In a previous report of HIV-infected patients with fat redistribution, we found that recombinant human growth hormone (rhGH) therapy reduced visceral adipose tissue (VAT) but increased insulin resistance, and that the addition of rosiglitazone reversed the negative effects of rhGH on insulin sensitivity. In this study, we sought to determine the effects of recombinant human growth hormone (rhGH) and rosiglitazone therapy on an array of inflammatory and fibrinolytic markers. Methods 72 patients with HIV-associated abdominal obesity and insulin resistance were randomized to treatment with rhGH, rosiglitazone, the combination of rhGH and rosiglitazone, or placebo for 12 weeks. Subjects with plasma and serum samples available at weeks 0 (n = 63) and 12 (n = 46-48) were assessed for adiponectin, C-reactive protein (CRP), homocysteine, interleukin-1 (IL-1), interleukin-6 (IL-6), tumor necrosis factor alpha (TNF-α), interferon gamma (IFN-γ), fibrinogen, plasminogen activator inhibitor-1 (PAI-1) antigen, and tissue plasminogen activator (tPA) antigen. Results Treatment with both rosiglitazone alone and the combination of rosiglitazone and rhGH for 12 weeks resulted in significant increases in adiponectin levels from baseline. Adiponectin levels did not change significantly in the rhGH alone arm. There were no significant changes in the other biomarkers amongst the different treatment groups. Discussion In this study of HIV-infected patients with altered fat distribution, treatment with rosiglitazone had beneficial effects on adiponectin concentrations, an effect that was also seen with combination rosiglitazone and rhGH. RhGH administration alone, however, did not demonstrate any significant impact on adiponectin levels despite reductions in VAT. PMID:27077672

  2. Serum-free media formulations are cell line-specific and require optimization for microcarrier culture.

    Tan, Kah Yong; Teo, Kim Leng; Lim, Jessica F Y; Chen, Allen K L; Choolani, Mahesh; Reuveny, Shaul; Chan, Jerry; Oh, Steve Kw

    2015-08-01

    Mesenchymal stromal cells (MSCs) are being investigated as potential cell therapies for many different indications. Current methods of production rely on traditional monolayer culture on tissue-culture plastic, usually with the use of serum-supplemented growth media. However, the monolayer culturing system has scale-up limitations and may not meet the projected hundreds of billions to trillions batches of cells needed for therapy. Furthermore, serum-free medium offers several advantages over serum-supplemented medium, which may have supply and contaminant issues, leading to many serum-free medium formulations being developed. We cultured seven MSC lines in six different serum-free media and compared their growth between monolayer and microcarrier culture. We show that (i) expansion levels of MSCs in serum-free monolayer cultures may not correlate with expansion in serum-containing media; (ii) optimal culture conditions (serum-free media for monolayer or microcarrier culture) differ for each cell line; (iii) growth in static microcarrier culture does not correlate with growth in stirred spinner culture; (iv) and that early cell attachment and spreading onto microcarriers does not necessarily predict efficiency of cell expansion in agitated microcarrier culture. Current serum-free media developed for monolayer cultures of MSCs may not support MSC proliferation in microcarrier cultures. Further optimization in medium composition will be required for microcarrier suspension culture for each cell line. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.

  3. Screening and Establishment of Human Lung Cancer Cell Lines 
with Organ-specific Metastasis Potential

    Qinghua ZHOU

    2014-03-01

    Full Text Available Background and objective Cancer metastasis is not only the malignant marker and characteristics, but also the main cause of failure to cure and lose their life in the patients with lung cancer. Lung cancer metastasis has organ-specific characteristics. The most common sites of lung cancer metastasis are mediastinal lymph node, brain, bone, liver and adrenal gland. The aim of this study is to screen and establish lung cancer cell model with organ-specific metastasis potential with human high-metastatic large cell lung cancer cell line L9981 established by our laboratory previously, and to provide cell models for studying the mechanisms and signal regulation of organ-specific metastasis of lung cancer. Materials and methods The parent lung cancer cell line, L9981-Luc, was inoculated in the armpit of nude mice. The live animal imaging system, IVIS-200, was used to detect the lung cancer organ-specific metastasis every week. When the organ-specific metastasis were established, the nude mices bearing the lung cancer were sacrificed when they became moribund. Under sterile conditions, the organs (mediastinal lymph nodes, lung, spinal column and brain with lung cancer organ-specific metastasis were removed and the metastasized nodules were dissected free of connective tissue and blood clots, and rinsed twice with medium. The metastasized nodules were finely minced using sterile scalpel blades in medium, and the cells were seeded in tissue culture dishes. Then, the cells with organ-specific metastasis potential were reinoculated into the armpit of nude mice, respectively. This processes were repeated to establish the organ-specific metastatic sublines of L9981-Luc cell line more than 10 times. Finally, the organ-specific metastasis sublines of L9981-Luc were screened and established, which the four cell lines have the characteristics only metastasized to brian, lung, bone and mediastinal lymph node. Results A group of organ-specific metastasis cell

  4. A Study of Effects of Pioglitazone and Rosiglitazone on Various Parameters in Patients of Type-2 Diabetes Mellitus with Special Reference to Lipid Profile.

    Sharma, S K; Verma, S H

    2016-09-01

    To study the complete fasting lipid profile and other parameters (weight, body mass index, HbA1c, fasting blood sugar and postprandial blood sugar)in Type 2 diabetes mellitus patients on OHA/insulin, to study the effect of addition of pioglitazone on lipid profile and other parameters in Type 2 diabetes mellitus patients on OHA/insulin, to study the effect of addition of rosiglitazone on lipid profile and other parameters in Type 2 diabetes mellitus patients on OHA/insulin and to compare the effect of pioglitazone and rosiglitazone on lipid profile and other parameters in Type 2 diabetes mellitus patients on OHA/insulin. In the study, 100 Type 2 diabetes cases on oral hypoglycemic agent/insulin with deranged lipid profile were chosen and divided into 2 groups 50 and 50 in group A and group B respectively.Pioglitazone was given initially 15mg/day then if required increasing upto 45mg/day in group A for period of 18 weeks and rosiglitazone was given initially 2 mg/day then if required increasing upto 8 mg/day in group B for period of 18 weeks. Detailed clinical history was obtained and thorough physical examination was done and following parameters were established-Age, Height, Weight, Body mass index, Fasting and Postprandial blood sugar, HbA1c levels and fasting complete lipid profile done at 0 and 18 weeks. Each patient itself served as a control for this study. Maximum no. of patients were in sixth decade (53.30%) and minimum patients were in seventh decade (6.6%). Males were 63.3% and females were 36.8%. Fasting blood sugar levels decreased by 23% with pioglitazone in group A and 14.07% with rosiglitazone in group B. The postprandial blood sugar levels decreased by 29.9% with pioglitazone in group A and 20.17% with rosiglitazone in group B.The mean HbA1c decreased by 2.13 % pioglitazone in group A and 3.8% with rosiglitazone in group B after 18 weeks of therapy. The effects of both drugs on BMI and weight were not significant. In group A the total cholesterol

  5. work specification for the construction of 33kv overhead lines across

    HOD

    obtained using the standard mathematical equations and the specifications for Aluminium Conductor Steel Reinforce ... systems. The choice of conductor depends on the cost and efficiency. ... Support structure requirements, limitations.

  6. Standardized orthotopic xenografts in zebrafish reveal glioma cell-line-specific characteristics and tumor cell heterogeneity

    Alessandra M. Welker

    2016-02-01

    Full Text Available Glioblastoma (GBM is a deadly brain cancer, for which few effective drug treatments are available. Several studies have used zebrafish models to study GBM, but a standardized approach to modeling GBM in zebrafish was lacking to date, preventing comparison of data across studies. Here, we describe a new, standardized orthotopic xenotransplant model of GBM in zebrafish. Dose-response survival assays were used to define the optimal number of cells for tumor formation. Techniques to measure tumor burden and cell spread within the brain over real time were optimized using mouse neural stem cells as control transplants. Applying this standardized approach, we transplanted two patient-derived GBM cell lines, serum-grown adherent cells and neurospheres, into the midbrain region of embryonic zebrafish and analyzed transplanted larvae over time. Progressive brain tumor growth and premature larval death were observed using both cell lines; however, fewer transplanted neurosphere cells were needed for tumor growth and lethality. Tumors were heterogeneous, containing both cells expressing stem cell markers and cells expressing markers of differentiation. A small proportion of transplanted neurosphere cells expressed glial fibrillary acidic protein (GFAP or vimentin, markers of more differentiated cells, but this number increased significantly during tumor growth, indicating that these cells undergo differentiation in vivo. By contrast, most serum-grown adherent cells expressed GFAP and vimentin at the earliest times examined post-transplant. Both cell types produced brain tumors that contained Sox2+ cells, indicative of tumor stem cells. Transplanted larvae were treated with currently used GBM therapeutics, temozolomide or bortezomib, and this resulted in a reduction in tumor volume in vivo and an increase in survival. The standardized model reported here facilitates robust and reproducible analysis of glioblastoma tumor cells in real time and provides a

  7. Synergic effect of n-3 polyunsaturated fatty acids and rosiglitazone in the amelioration of insulin resistance and adipose tissue inflammatinon

    Kuda, Ondřej; Jílková, Zuzana; Rossmeisl, Martin; Flachs, Pavel; Ogston, N. C.; Mohamed-Ali, V.; Cinti, S.; Kopecký, Jan

    2007-01-01

    Roč. 50, Suppl.1 (2007), S260-S260 ISSN 0012-186X. [Annual Meeting of the European Association for the Study of Diabetes /43./. 18.09.2007-21.09.2007, Amsterdam] R&D Projects: GA ČR(CZ) GD303/03/H065 Institutional research plan: CEZ:AV0Z50110509 Keywords : cpo1 * insulin * rosiglitazone * PUFA Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition

  8. Specific sensitivity of small cell lung cancer cell lines to the snake venom toxin taipoxin

    Poulsen, Thomas T; Pedersen, Nina; Perin, Mark S

    2005-01-01

    and relatively specifically expressed in SCLC, consistent with the neuroendocrine features of this cancer. Normally, NPR is exclusively expressed in neurons, where it associates with the homologous proteins neuronal pentraxins 1 and 2 (NP1 and NP2) in complexes capable of binding the snake venom neurotoxin...

  9. Generation of an inducible colon-specific Cre enzyme mouse line for colon cancer research

    Tetteh, Paul W.; Kretzschmar, Kai; Begthel, Harry; Van Den Born, Maaike; Korving, Jeroen; Morsink, Folkert; Farin, Henner; Van Es, Johan H.; Offerhaus, G. Johan A; Clevers, Hans

    2016-01-01

    Current mouse models for colorectal cancer often differ significantly from human colon cancer, being largely restricted to the small intestine. Here, we aim to develop a colon-specific inducible mouse model that can faithfully recapitulate human colon cancer initiation and progression. Carbonic

  10. Selective block of KATP channels: why the anti-diabetic sulphonylureas and rosiglitazone have more in common than we thought

    Dart, Caroline

    2012-01-01

    Rosiglitazone, the thiazolidinedione class anti-diabetic withdrawn from Europe in 2010 amid reports of adverse cardiovascular effects, is revealed by Yu et al. in this issue of the British Journal of Pharmacology to be a selective blocker of ATP-sensitive potassium (KATP) channels. This seems little cause for excitement given that the closure of pancreatic KATP channels is integral to insulin secretion; and sulphonylureas, which inhibit KATP channels, are widely used to treat type II diabetes. However, rosiglitazone, whose primary targets are nuclear transcription factors that regulate genes involved in lipid metabolism, blocks KATP channels by a novel mechanism different to that of the sulphonylureas and has a worrying preference for blood flow–regulating vascular KATP channels. Identification of a new molecule that modulates KATP channel gating will not only tell us more about how these complex metabolic sensors work but also raises questions as to whether rosiglitazone suppresses the cardiovascular system's ability to cope with metabolic stress – a claim that has dogged the sulphonylureas for many years. LINKED ARTICLE This article is a commentary on Yu et al., pp. 26–36 of this issue. To view this paper visit http://dx.doi.org/10.1111/j.1476-5381.2012.01934.x PMID:22506686

  11. Effect of rosiglitazone on insulin resistance, growth factors, and reproductive disturbances in women with polycystic ovary syndrome.

    Belli, Susana H; Graffigna, Mabel N; Oneto, Adriana; Otero, Patricia; Schurman, Leon; Levalle, Oscar A

    2004-03-01

    To evaluate the effects of rosiglitazone on insulin resistance, growth factors, and reproductive disturbances in women with polycystic ovary syndrome (PCOS). Prospective study. Women with PCOS attending as outpatients of the Endocrine Division, Hospital Durand, Buenos Aires. Twenty-four insulin-resistant women with PCOS. Hormonal evaluations and a standardized oral glucose tolerance test before and after a 3-month trial of 4 mg of rosiglitazone daily. Serum LH, FSH, T, IGF-1, IGFBP-1, IGFBP-3, leptin, 17alpha-hydroxyprogesterone, insulin, and glucose concentrations. The area under insulin curve (AUC-insulin), the HOMA index (insulin resistance), the QUICKI index (insulin sensitivity), and the beta-cell function were calculated. Body mass index (BMI) and the waist/hip ratio were evaluated. A significant decrease was observed in serum fasting insulin, AUC insulin, HOMA index, beta-cell function, IGF-1, LH, and waist/hip ratio. The QUICKI index and IGFBP-1 increased significantly. Serum sex hormone-binding globulin, androgens, leptin, IGFBP-3, and BMI remained unchanged. Twenty-two of 23 females had their menses restored, and three patients became pregnant. One patient was excluded because she became pregnant at the second month. Associated with the decrease in LH, rosiglitazone improved insulin-resistance parameters and normalized the menstrual cycle, which suggests that this drug could improve the endocrine-reproductive condition in insulin-resistant women with PCOS.

  12. A Tetrameric Peptide Derived from Bovine Lactoferricin Exhibits Specific Cytotoxic Effects against Oral Squamous-Cell Carcinoma Cell Lines

    Víctor A. Solarte

    2015-01-01

    Full Text Available Several short linear peptides derived from cyclic bovine lactoferricin were synthesized and tested for their cytotoxic effect against the oral cavity squamous-cell carcinoma (OSCC cell lines CAL27 and SCC15. As a control, an immortalized and nontumorigenic cell line, Het-1A, was used. Linear peptides based on the RRWQWR core sequence showed a moderate cytotoxic effect and specificity towards tumorigenic cells. A tetrameric peptide, LfcinB(20–254, containing the RRWQWR motif, exhibited greater cytotoxic activity (>90% in both OSCC cell lines compared to the linear lactoferricin peptide or the lactoferrin protein. Additionally, this tetrameric peptide showed the highest specificity towards tumorigenic cells among the tested peptides. Interestingly, this effect was very fast, with cell shrinkage, severe damage to cell membrane permeability, and lysis within one hour of treatment. Our results are consistent with a necrotic effect rather than an apoptotic one and suggest that this tetrameric peptide could be considered as a new candidate for the therapeutic treatment of OSCC.

  13. A Tetrameric Peptide Derived from Bovine Lactoferricin Exhibits Specific Cytotoxic Effects against Oral Squamous-Cell Carcinoma Cell Lines.

    Solarte, Víctor A; Rosas, Jaiver E; Rivera, Zuly J; Arango-Rodríguez, Martha L; García, Javier E; Vernot, Jean-Paul

    2015-01-01

    Several short linear peptides derived from cyclic bovine lactoferricin were synthesized and tested for their cytotoxic effect against the oral cavity squamous-cell carcinoma (OSCC) cell lines CAL27 and SCC15. As a control, an immortalized and nontumorigenic cell line, Het-1A, was used. Linear peptides based on the RRWQWR core sequence showed a moderate cytotoxic effect and specificity towards tumorigenic cells. A tetrameric peptide, LfcinB(20-25)4, containing the RRWQWR motif, exhibited greater cytotoxic activity (>90%) in both OSCC cell lines compared to the linear lactoferricin peptide or the lactoferrin protein. Additionally, this tetrameric peptide showed the highest specificity towards tumorigenic cells among the tested peptides. Interestingly, this effect was very fast, with cell shrinkage, severe damage to cell membrane permeability, and lysis within one hour of treatment. Our results are consistent with a necrotic effect rather than an apoptotic one and suggest that this tetrameric peptide could be considered as a new candidate for the therapeutic treatment of OSCC.

  14. SATB1 regulates SPARC expression in K562 cell line through binding to a specific sequence in the third intron

    Li, K.; Cai, R.; Dai, B.B.; Zhang, X.Q.; Wang, H.J.; Ge, S.F.; Xu, W.R.; Lu, J.

    2007-01-01

    Special AT-rich binding protein 1 (SATB1), a cell type-specific nuclear matrix attachment region (MAR) DNA-binding protein, tethers to a specific DNA sequence and regulates gene expression through chromatin remodeling and HDAC (histone deacetylase complex) recruitment. In this study, a SATB1 eukaryotic expression plasmid was transfected into the human erythroleukemia K562 cell line and individual clones that stably over-expressed the SATB1 protein were isolated. Microarray analysis revealed that hundreds of genes were either up- or down-regulated in the SATB1 over-expressing K562 cell lines. One of these was the extra-cellular matrix glycoprotein, SPARC (human secreted protein acidic and rich in cysteine). siRNA knock-down of SATB1 also reduced SPARC expression, which was consistent with elevated SPARC levels in the SATB1 over-expressing cell line. Bioinformatics software Mat-inspector showed that a 17 bp DNA sequence in the third intron of SPARC possessed a high potential for SATB1 binding; a finding confirmed by Chromatin immunoprecipitation (ChIP) with anti-SATB1 antibody. Our results show for the first time that forced-expression of SATB1 in K562 cells triggers SPARC up-regulation by binding to a 17 bp DNA sequence in the third intron

  15. Generation and functional analysis of T cell lines and clones specific for schistosomula released products (SRP-A).

    Damonneville, M; Velge, F; Verwaerde, C; Pestel, J; Auriault, C; Capron, A

    1987-01-01

    Antigens present in the products released by the larval stage of schistosome (SRP-A) were shown to induce a strong cytotoxic and protective IgE response both in the rat and the monkey. T cell lines and clones specific for SRP-A or 26 kD antigens which are the main target of the cytotoxic IgE have been derived. The passive transfer of SRP-A specific T lymphocytes into infected rats led to an increase of the IgE response, conferring a significant level of protection to the rats. In coculture assays in vitro, these cell lines significantly enhanced the production of IgE by SRP-A sensitized rat spleen cells. This helper effect on the IgE response was confirmed with 26 kD T cell clone supernatants. Moreover, supernatants obtained after stimulation with phorbol myristate acetate were able to enhance the IgE production of a hybridoma B cell line (B48-14) producing a monoclonal IgE antibody, cytotoxic for the schistosomula. PMID:3498590

  16. Generation and functional analysis of T cell lines and clones specific for schistosomula released products (SRP-A).

    Damonneville, M; Velge, F; Verwaerde, C; Pestel, J; Auriault, C; Capron, A

    1987-08-01

    Antigens present in the products released by the larval stage of schistosome (SRP-A) were shown to induce a strong cytotoxic and protective IgE response both in the rat and the monkey. T cell lines and clones specific for SRP-A or 26 kD antigens which are the main target of the cytotoxic IgE have been derived. The passive transfer of SRP-A specific T lymphocytes into infected rats led to an increase of the IgE response, conferring a significant level of protection to the rats. In coculture assays in vitro, these cell lines significantly enhanced the production of IgE by SRP-A sensitized rat spleen cells. This helper effect on the IgE response was confirmed with 26 kD T cell clone supernatants. Moreover, supernatants obtained after stimulation with phorbol myristate acetate were able to enhance the IgE production of a hybridoma B cell line (B48-14) producing a monoclonal IgE antibody, cytotoxic for the schistosomula.

  17. Generation of an inducible colon-specific Cre enzyme mouse line for colon cancer research.

    Tetteh, Paul W; Kretzschmar, Kai; Begthel, Harry; van den Born, Maaike; Korving, Jeroen; Morsink, Folkert; Farin, Henner; van Es, Johan H; Offerhaus, G Johan A; Clevers, Hans

    2016-10-18

    Current mouse models for colorectal cancer often differ significantly from human colon cancer, being largely restricted to the small intestine. Here, we aim to develop a colon-specific inducible mouse model that can faithfully recapitulate human colon cancer initiation and progression. Carbonic anhydrase I (Car1) is a gene expressed uniquely in colonic epithelial cells. We generated a colon-specific inducible Car1 CreER knock-in (KI) mouse with broad Cre activity in epithelial cells of the proximal colon and cecum. Deletion of the tumor suppressor gene Apc using the Car1 CreER KI caused tumor formation in the cecum but did not yield adenomas in the proximal colon. Mutation of both Apc and Kras yielded microadenomas in both the cecum and the proximal colon, which progressed to macroadenomas with significant morbidity. Aggressive carcinomas with some invasion into lymph nodes developed upon combined induction of oncogenic mutations of Apc, Kras, p53, and Smad4 Importantly, no adenomas were observed in the small intestine. Additionally, we observed tumors from differentiated Car1-expressing cells with Apc/Kras mutations, suggesting that a top-down model of intestinal tumorigenesis can occur with multiple mutations. Our results establish the Car1 CreER KI as a valuable mouse model to study colon-specific tumorigenesis and metastasis as well as cancer-cell-of-origin questions.

  18. Position-specific isotope analysis by on-line pyrolysis coupled to IRMS

    Gilbert, A.; Suda, K.; Yamada, K.; Ueno, Y.; Yoshida, N.

    2016-12-01

    Position-specific isotopic analyses (PSIA) provide unique information regarding the sources, sinks and processes related to natural molecules. For instance, PSIA of short-chain hydrocarbons could lead to temperature of formation and maturity of natural gas reservoirs [1][2]. In the last decade, quantitative Nuclear Magnetic Resonance (NMR) specrometry has been used for PSIA of organic molecules such as glucose or n-alkanes [3][4]. However, due to its low sensitivity, application to low amount geochemical samples remains challenging. In 1997, Corso & Brenna proposed to adapt a pyrolysis furnace to an isotope ratio mass spectrometer, making it possible the thermal degradation of the target molecule and the subsequent analysis of the d13C values of the fragments formed [5]. Starting from fatty acid methyl esters they demonstrated the absence of rearrangement during pyrolytic degradation and could determine the d13C value of carboxyl C-atom position. We adapted the system for the full characterization of position-specific isotope composition of small molecules (ethanol, acetic acid, alanine, propane). Nanomole amount of sample can be analyzed with a precision on intramolecular d13C values of 1‰ or lower [2]. We recently analyzed abiotic and thermogenic propane samples both from the field and from lab simulations. PSIA of propane shows systematic differences of position-specific isotope composition between thermogenic and abiotic samples. While the former show 13C-depletion on the terminal C-atom position - consistent with thermal cracking kinetic models [6] - abiotic samples show little or no preference for terminal or central 13C-isotopomer. These results emphasize the potential of PSIA to trace the the processes associated with organic molecules production. [1] Piasecki et al. 2016 GCA 188, 58 [2] Gilbert et al. 2016 GCA 177, 205 [3] Gilbert et al. 2012 PNAS, 109, 18204 [4] Gilbert et al. 2013 Org. Geochem, 62, 56 [5] Corso & Brenna 1997 PNAS, 94, 1049 [6] Tang et

  19. Evidence Synthesis in Harm Assessment of Medicines Using the Example of Rosiglitazone and Myocardial Infarction

    Charlotte Rietbergen

    2018-02-01

    Full Text Available The current system of harm assessment of medicines has been criticized for relying on intuitive expert judgment. There is a call for more quantitative approaches and transparency in decision-making. Illustrated with the case of cardiovascular safety concerns for rosiglitazone, we aimed to explore a structured procedure for the collection, quality assessment, and statistical modeling of safety data from observational and randomized studies. We distinguished five stages in the synthesis process. In Stage I, the general research question, population and outcome, and general inclusion and exclusion criteria are defined and a systematic search is performed. Stage II focusses on the identification of sub-questions examined in the included studies and the classification of the studies into the different categories of sub-questions. In Stage III, the quality of the identified studies is assessed. Coding and data extraction are performed in Stage IV. Finally, meta-analyses on the study results per sub-question are performed in Stage V. A Pubmed search identified 30 randomized and 14 observational studies meeting our search criteria. From these studies, we identified 4 higher level sub-questions and 4 lower level sub-questions. We were able to categorize 29 individual treatment comparisons into one or more of the sub-question categories, and selected study duration as an important covariate. We extracted covariate, outcome, and sample size information at the treatment arm level of the studies. We extracted absolute numbers of myocardial infarctions from the randomized study, and adjusted risk estimates with 95% confidence intervals from the observational studies. Overall, few events were observed in the randomized studies that were frequently of relatively short duration. The large observational studies provided more information since these were often of longer duration. A Bayesian random effects meta-analysis on these data showed no significant increase

  20. Resistin production from adipose tissue is decreased in db/db obese mice, and is reversed by rosiglitazone.

    Hongying Ye

    Full Text Available OBJECTIVE: This study was designed to (1 investigate the expression profiles of resistin in db/db mice and its dynamic association with metabolic parameters; and (2 evaluate the effects of Rosiglitazone on production of resistin. METHODS: Db/db mice and their lean litter mates were used for this study. Epididymal fat tissue was excised from mice of different age (from 5 to 12 weeks for ex vivo incubation. Resistin,along with adiponectin,in serum and conditioned culture medium of epididymal fat pads were measured with immunoassays. The gene expression of resistin was determined by real-time PCR. Rosiglitazone or the vehicle (PBS was administered into db/db mice by daily intra-gastric gavage. Differentiated 3T3-L1 adipocytes were used for in vitro evaluation. RESULTS: The secretion of resistin from the fat pads in db/db mice was significantly lower than that in lean mice (P<0.01. The mRNA expression of the resistin gene in fat tissue of db/db mice at the age of 5 weeks was decreased by 60.5% compared to lean controls (p<0.05. Serum levels of resistin were comparable between the obese and lean groups, perhaps due to the increased total fat mass in db/db mice. Correlation analysis showed that serum resistin levels were positively correlated to resistin secretion from fat pads(r = 0.844,P = 0.000, while negatively associated with the body weight (r = -0.515, P = 0.000 and fasting glucose level (r = -0.357, P = 0.002. Notably, treatment with rosiglitazone increased the serum resistin levels by 66.4%(P<0.05in db/db mice. In 3T3-L1 adipocytes, Rosiglitazone (10 uM markedly enhanced the secretion of resistin by 120% (P<0.01 and its gene expression by 78.1% (P<0.05. CONCLUSION: Both resistin gene expression and its secretion from the epididymal adipose tissue were decreased in db/db obese mice, while the insulin-sensitizing drug rosiglitazone increased resistin production. Our results do not support the role of resistin as an

  1. Isolation of oogenesis-specific genes transcribed in the germ-line of Calliphora erythrocephala and Drosophila melanogaster

    Tucker, M.A.

    1988-01-01

    Poly(A) + RNA from early or mid-stage ovarian follicles of C. erythrocephala was used to generate radiolabelled oogenesis-specific cDNA probes for screening the phage libraries. A cDNA probe made from mid-stage embryo poly(A) + RNA was used as the differential screening probe. Thus plaques hybridizing to the two oogenesis-specific probes but not the mid-stage embryo probe were selected as potentially containing oogenesis-specific genes. Two further rounds of screening were used to eliminate false positives and, after plaque purification, restriction digests of the remaining clones were screened by Southern blot hybridization to identify DNA fragments transcribed in an oogenesis-specific manner. In situ hybridization to sections of ovarian follicles has been used to determine the cell types within the follicles in which the various genes are expressed. Radiolabelled RNA probes for four of the C. erythrocephala oogenesis-specific clones and the two D. melanogaster clones have been hybridized to ovarian follicles. Further studies have been concentrated on the two germ-line transcribed, oogenesis-specific clones isolated from the D. melanogaster clone library. Detailed genetic mapping of the DA clone and of these mutations was performed to determine which mutations might represent the DA gene. cDNA clones have been isolated for the transcribed region of clone DA and have been used to further define the transcription unit from this region of the D. melanogaster genome

  2. Cell-type-specific responses of RT4 neural cell lines to dibutyryl-cAMP: branch determination versus maturation

    Droms, K.; Sueoka, N.

    1987-01-01

    This report describes the induction of cell-type-specific maturation, by dibutyryl-cAMP and testololactone, of neuronal and glial properties in a family of cell lines derived from a rat peripheral neurotumor, RT4. This maturation allows further understanding of the process of determination because of the close lineage relationship between the cell types of the RT4 family. The RT4 family is characterized by the spontaneous conversion of one of the cell types, RT4-AC (stem-cell type), to any of three derivative cell types, RT4-B, RT4-D, or RT4-E, with a frequency of about 10(-5). The RT4-AC cells express some properties characteristic of both neuronal and glial cells. Of these neural properties expressed by RT4-AC cells, only the neuronal properties are expressed by the RT4-B and RT4-E cells, and only the glial properties are expressed by the RT4-D cells. This in vitro cell-type conversion of RT4-AC to three derivative cell types is a branch point for the coordinate regulation of several properties and seems to resemble determination in vivo. In our standard culture conditions, several other neuronal and glial properties are not expressed by these cell types. However, addition of dibutyryl-cAMP induces expression of additional properties, in a cell-type-specific manner: formation of long cellular processes in the RT4-B8 and RT4-E5 cell lines and expression of high-affinity uptake of gamma-aminobutyric acid, by a glial-cell-specific mechanism, in the RT4-D6-2 cell line. These new properties are maximally expressed 2-3 days after addition of dibutyryl-cAMP

  3. Influence Of Specific Mechanical Energy On Cornmeal Viscosity Measured By An On-line System During Twin-screw Extrusion

    Chang Y.K.; Martinez-Bustos F.; Park T.S.; Kokini J.L.

    1999-01-01

    The influence of specific mechanical energy (SME) on cornmeal viscosity during the twin-screw extrusion at feed moisture contents of 25 and 30% and screw speeds in the range from 100 to 500 rpm was measured. Cornmeal was extruded in a co-rotating, intermeshing twin-screw coupled to a slit die rheometer. One approach to the on-line rheological measurement is to use a slit die with the extruder. In the present work it was show that shear viscosity decreased as a function of SME. The viscosity o...

  4. The Effect of Rosiglitazone on Bone Quality in a Rat Model of Insulin Resistance and Osteoporosis

    Sardone, Laura Donata

    Rosiglitazone (RSG) is an insulin-sensitizing drug used to treat Type 2 Diabetes Mellitus (T2DM). Clinical trials show that women taking RSG experience more limb fractures than patients taking other T2DM drugs. The purpose of this study is to understand how RSG (3mg/kg/day and 10mg/kg/day) and the bisphosphonate alendronate (0.7mg/kg/week) alter bone quality in the male, female and female ovariectomized (OVX) Zucker fatty rat model over a 12 week period. Bone quality was evaluated by mechanical testing of cortical and trabecular bone. Microarchitecture, bone mineral density (BMD), cortical bone porosity, bone formation/resorption and mineralization were also measured. Female OVX RSG10mg/kg rats had significantly lower vertebral BMD and compromised trabecular architecture versus OVX controls. Increased cortical porosity and decreased mechanical properties occurred in these rats. ALN treatment prevented these negative effects in the OVX RSG model. Evidence of reduced bone formation and excess bone resorption was detected in female RSG-treated rats.

  5. Electroacupuncture Reduces Weight Gain Induced by Rosiglitazone through PPARγ and Leptin Receptor in CNS

    Xinyue Jing

    2016-01-01

    Full Text Available We investigate the effect of electroacupuncture (EA on protecting the weight gain side effect of rosiglitazone (RSG in type 2 diabetes mellitus (T2DM rats and its possible mechanism in central nervous system (CNS. Our study showed that RSG (5 mg/kg significantly increased the body weight and food intake of the T2DM rats. After six-week treatment with RSG combined with EA, body weight, food intake, and the ratio of IWAT to body weight decreased significantly, whereas the ratio of BAT to body weight increased markedly. HE staining indicated that the T2DM-RSG rats had increased size of adipocytes in their IWAT, but EA treatment reduced the size of adipocytes. EA effectively reduced the lipid contents without affecting the antidiabetic effect of RSG. Furthermore, we noticed that the expression of PPARγ gene in hypothalamus was reduced by EA, while the expressions of leptin receptor and signal transducer and activator of transcription 3 (STAT3 were increased. Our results suggest that EA is an effective approach for inhibiting weight gain in T2DM rats treated by RSG. The possible mechanism might be through increased levels of leptin receptor and STAT3 and decreased PPARγ expression, by which food intake of the rats was reduced and RSG-induced weight gain was inhibited.

  6. Rosiglitazone, a Peroxisome Proliferator-Activated Receptor (PPAR)-γ Agonist, Attenuates Inflammation Via NF-κB Inhibition in Lipopolysaccharide-Induced Peritonitis.

    Zhang, Yun-Fang; Zou, Xun-Liang; Wu, Jun; Yu, Xue-Qing; Yang, Xiao

    2015-12-01

    We assessed the anti-inflammatory effect of peroxisome proliferator-activated receptor (PPAR)-γ agonist, rosiglitazone, in a lipopolysaccharide (LPS)-induced peritonitis rat model. LPS was intraperitoneally injected into rats to establish peritonitis model. Male Sprague-Dawley (SD) rats were assigned to normal saline (the solvent of LPS), LPS, rosiglitazone plus LPS, and rosiglitazone alone. A simple peritoneal equilibrium test was performed with 20 ml 4.25 % peritoneal dialysis fluid. We measured the leukocyte count in dialysate and ultrafiltration volume. Peritoneal membrane histochemical staining was performed, and peritoneal thickness was assessed. CD40 and intercellular adhesion molecule-1 messenger RNA (ICAM-1 mRNA) levels in rat visceral peritoneum were detected by reverse transcription (RT)-PCR. IL-6 in rat peritoneal dialysis effluent was measured using enzyme-linked immunosorbent assay. The phosphorylation of NF-κB-p65 and IκBα was analyzed by Western blot. LPS administration resulted in increased peritoneal thickness and decreased ultrafiltration volume. Rosiglitazone pretreatment significantly decreased peritoneal thickness. In addition to CD40 and ICAM-1 mRNA expression, the IL-6, p-p65, and p-IκBα protein expressions were enhanced in LPS-administered animals. Rosiglitazone pretreatment significantly decreased ICAM-1 mRNA upregulation, secretion of IL-6 protein, and phosphorylation of NF-κB-p65 and IκBα without decreasing CD40 mRNA expression. Rosiglitazone has a protective effect in peritonitis, simultaneously decreasing NF-κB phosphorylation, suggesting that NF-κB signaling pathway mediated peritoneal inflammation induced by LPS. PPAR-γ might be considered a potential therapeutic target against peritonitis.

  7. Characterization of a human cell line stably over-expressing the candidate oncogene, dual specificity phosphatase 12.

    Erica L Cain

    2011-04-01

    Full Text Available Analysis of chromosomal rearrangements within primary tumors has been influential in the identification of novel oncogenes. Identification of the "driver" gene(s within cancer-derived amplicons is, however, hampered by the fact that most amplicons contain many gene products. Amplification of 1q21-1q23 is strongly associated with liposarcomas and microarray-based comparative genomic hybridization narrowed down the likely candidate oncogenes to two: the activating transcription factor 6 (atf6 and the dual specificity phosphatase 12 (dusp12. While atf6 is an established transcriptional regulator of the unfolded protein response, the potential role of dusp12 in cancer remains uncharacterized.To evaluate the oncogenic potential of dusp12, we established stable cell lines that ectopically over-express dusp12 in isolation and determined whether this cell line acquired properties frequently associated with transformed cells. Here, we demonstrate that cells over-expressing dusp12 display increased cell motility and resistance to apoptosis. Additionally, over-expression of dusp12 promoted increased expression of the c-met proto-oncogene and the collagen and laminin receptor intergrin alpha 1 (itga1 which is implicated in metastasis.Collectively, these results suggest that dusp12 is oncologically relevant and exposes a potential association between dusp12 and established oncogenes that could be therapeutically targeted.

  8. Resistin production from adipose tissue is decreased in db/db obese mice, and is reversed by rosiglitazone.

    Ye, Hongying; Zhang, Herbert J; Xu, Aimin; Hoo, Ruby L C

    2013-01-01

    This study was designed to (1) investigate the expression profiles of resistin in db/db mice and its dynamic association with metabolic parameters; and (2) evaluate the effects of Rosiglitazone on production of resistin. Db/db mice and their lean litter mates were used for this study. Epididymal fat tissue was excised from mice of different age (from 5 to 12 weeks) for ex vivo incubation. Resistin,along with adiponectin,in serum and conditioned culture medium of epididymal fat pads were measured with immunoassays. The gene expression of resistin was determined by real-time PCR. Rosiglitazone or the vehicle (PBS) was administered into db/db mice by daily intra-gastric gavage. Differentiated 3T3-L1 adipocytes were used for in vitro evaluation. The secretion of resistin from the fat pads in db/db mice was significantly lower than that in lean mice (Plean controls (plean groups, perhaps due to the increased total fat mass in db/db mice. Correlation analysis showed that serum resistin levels were positively correlated to resistin secretion from fat pads(r = 0.844,P = 0.000), while negatively associated with the body weight (r = -0.515, P = 0.000) and fasting glucose level (r = -0.357, P = 0.002). Notably, treatment with rosiglitazone increased the serum resistin levels by 66.4%(Pproduction. Our results do not support the role of resistin as an etiological link between obesity and diabetes.

  9. Upregulation of meiosis-specific genes in lymphoma cell lines following genotoxic insult and induction of mitotic catastrophe

    Kalejs, Martins; Ivanov, Andrey; Plakhins, Gregory; Cragg, Mark S; Emzinsh, Dzintars; Illidge, Timothy M; Erenpreisa, Jekaterina

    2006-01-01

    We have previously reported that p53 mutated radioresistant lymphoma cell lines undergo mitotic catastrophe after irradiation, resulting in metaphase arrest and the generation of endopolyploid cells. A proportion of these endopolyploid cells then undergo a process of de-polyploidisation, stages of which are partially reminiscent of meiotic prophase. Furthermore, expression of meiosis-specific proteins of the cancer/testis antigens group of genes has previously been reported in tumours. We therefore investigated whether expression of meiosis-specific genes was associated with the polyploidy response in our tumour model. Three lymphoma cell lines, Namalwa, WI-L2-NS and TK6, of varying p53 status were exposed to a single 10 Gy dose of gamma radiation and their responses assessed over an extended time course. DNA flow cytometry and mitotic counts were used to assess the kinetics and extent of polyploidisation and mitotic progression. Expression of meiotic genes was analysed using RT-PCR and western blotting. In addition, localisation of the meiotic cohesin REC8 and its relation to centromeres was analysed by immunofluorescence. The principal meiotic regulator MOS was found to be significantly post-transcriptionally up-regulated after irradiation in p53 mutated but not p53 wild-type lymphoma cells. The maximum expression of MOS coincided with the maximal fraction of metaphase arrested cells and was directly proportional to both the extent of the arrest and the number of endopolyploid cells that subsequently emerged. The meiotic cohesin REC8 was also found to be up-regulated after irradiation, linking sister chromatid centromeres in the metaphase-arrested and subsequent giant cells. Finally, RT-PCR revealed expression of the meiosis-prophase genes, DMC1, STAG3, SYCP3 and SYCP1. We conclude that multiple meiotic genes are aberrantly activated during mitotic catastrophe in p53 mutated lymphoma cells after irradiation. Furthermore, we suggest that the coordinated expression

  10. Metformin, but not rosiglitazone, attenuates the increasing plasma levels of a new cardiovascular marker, fibulin-1, in patients with type 2 diabetes

    Skov, Vibe; Cangemi, Claudia; Gram, Jeppe

    2013-01-01

    ObjectiveThe extracellular matrix protein fibulin-1 is upregulated in the arterial wall in type 2 diabetes and circulates in increased concentrations in diabetes. Metformin is an anti-diabetic drug with beneficial CVD effects in diabetes. We hypothesized that metformin would influence the increased...... level of plasma fibulin-1 in diabetes.Research Design and MethodsAfter a four-week run-in period, 371 eligible patients with type 2 diabetes were randomized to treatment groups in a factorial design including insulin alone (control), +metformin, +rosiglitazone, or +both metformin and rosiglitazone...

  11. Plasmodium falciparum parasites expressing pregnancy-specific variant surface antigens adhere strongly to the choriocarcinoma cell line BeWo

    Haase, Rikke N; Megnekou, Rosette; Lundquist, Maja

    2006-01-01

    Placenta-sequestering Plasmodium falciparum parasites causing pregnancy-associated malaria express pregnancy-specific variant surface antigens (VSA(PAM)). We report here that VSA(PAM)-expressing patient isolates adhere strongly to the choriocarcinoma cell line BeWo and that the BeWo line can...... be used to efficiently select for VSA(PAM) expression in vitro....

  12. Rosiglitazone Improves Survival and Hastens Recovery from Pancreatic Inflammation in Obese Mice

    Pini, Maria; Rhodes, Davina H.; Castellanos, Karla J.; Cabay, Robert J.; Grady, Eileen F.; Fantuzzi, Giamila

    2012-01-01

    Obesity increases severity of acute pancreatitis (AP) by unclear mechanisms. We investigated the effect of the PPAR-gamma agonist rosiglitazone (RGZ, 0.01% in the diet) on severity of AP induced by administration of IL-12+ IL-18 in male C57BL6 mice fed a low fat (LFD) or high fat diet (HFD), under the hypothesis that RGZ would reduce disease severity in HFD-fed obese animals. In both LFD and HFD mice without AP, RGZ significantly increased body weight and % fat mass, with significant upregulation of adiponectin and suppression of erythropoiesis. In HFD mice with AP, RGZ significantly increased survival and hastened recovery from pancreatic inflammation, as evaluated by significantly improved pancreatic histology, reduced saponification of visceral adipose tissue and less severe suppression of erythropoiesis at Day 7 post-AP. This was associated with significantly lower circulating and pancreas-associated levels of IL-6, Galectin-3, osteopontin and TIMP-1 in HFD + RGZ mice, particularly at Day 7 post-AP. In LFD mice with AP, RGZ significantly worsened the degree of intrapancreatic acinar and fat necrosis as well as visceral fat saponification, without affecting other parameters of disease severity or inflammation. Induction of AP lead to major suppression of adiponectin levels at Day 7 in both HFD and HFD + RGZ mice. In conclusion, RGZ prevents development of severe AP in obese mice even though it significantly increases adiposity, indicating that obesity can be dissociated from AP severity by improving the metabolic and inflammatory milieu. However, RGZ worsens selective parameters of AP severity in LFD mice. PMID:22815875

  13. Prolonged decrease of adipocyte size after rosiglitazone treatment in high- and low-fat-fed rats.

    Johnson, Julia A; Trasino, Steven E; Ferrante, Anthony W; Vasselli, Joseph R

    2007-11-01

    The anti-diabetic thiazolidinediones (TZDs) stimulate adipocyte differentiation and decrease mean adipocyte size. However, whether these smaller, more insulin-sensitive adipocytes maintain their size after TZD therapy is discontinued has not been studied. Adult female Sprague-Dawley rats were fed a low-fat (10% fat) diet or, to elevate body weight (BW), a high-fat (HF) diet (45% fat) for 6 weeks. Rats were initially randomized to groups (n = 12) fed either low-fat or HF diets, with or without the TZD rosiglitazone (ROSI; 5 mg/kg per day), for 6 weeks. ROSI was then discontinued, and all animals were fed HF for another 6 weeks before sacrifice. Retroperitoneal (RP) adipose tissue morphology was determined from tissue collected by serial biopsies before and after 6 weeks of ROSI treatment and at sacrifice. Measures of BW and adiposity did not differ among groups 6 weeks after stopping ROSI treatment. However, during treatment, ROSI in both diets significantly decreased RP adipocyte size and increased RP DNA content, and these effects continued to be observed after discontinuing treatment. ROSI administration also decreased circulating insulin, leptin, and triglycerides and increased circulating adiponectin levels; however, these effects were reversed on stopping treatment. These results demonstrated that TZD-induced effects on adipocyte size and number were maintained after discontinuing treatment, even with consumption of an obesigenic diet. However, additional studies are needed to determine whether TZD-treated animals eventually achieve an adipocyte size similar to that of untreated animals at the expense of a higher BW.

  14. New Method for Simultaneous Species-Specific Identification of Equine Strongyles (Nematoda, Strongylida) by Reverse Line Blot Hybridization▿

    Traversa, Donato; Iorio, Raffaella; Klei, Thomas R.; Kharchenko, Vitaliy A.; Gawor, Jakub; Otranto, Domenico; Sparagano, Olivier A. E.

    2007-01-01

    The ability of a reverse line blot (RLB) assay to identify 13 common species of equine small strongyles (cyathostomins) and to discriminate them from three Strongylus spp. (large strongyles) was demonstrated. The assay relied on the specific hybridization of PCR-amplified intergenic spacer DNA fragments of the nuclear ribosomal DNA to membrane-bound species-specific probes. All cyathostomins examined were unequivocally identified and simultaneously discriminated from each other and from three large strongyles (Strongylus edentatus, Strongylus equinus, and Strongylus vulgaris). This assay will enable the accurate and rapid identification of equine cyathostomins irrespective of their life cycle stage, opening important avenues for a better understanding of their biology and epidemiology and of the pathogenesis of cyathostomin-associated disease. In particular, this RLB method promises to be a powerful diagnostic tool to determine the roles of individual species in the pathogenesis of mixed infections and to elucidate some aspects of cyathostominosis. Also, it could represent a basic step toward the development of a rapid and simple molecular test for the early detection of drug-resistant genotypes of horse strongyle species. PMID:17626168

  15. On-line analysis of biosignals for the automation of total and specific sleep deprivation in the rat

    ENNIO A VIVALDI

    2008-12-01

    Full Text Available A computer-based system that automates sleep studies, including sleep deprivation paradigms, is described. The system allows for total or REM-specific sleep deprivation and is based on a reliable, fast-responding, on-line state detection algorithm linked to a dependable intervention device. Behavioral state detection is achieved by dimensión reduction of short-term EEG power spectrum. Interventions are made by serial outputs to servomotors that move a cage with different patterns and variable intensity. The system can adapt itself to individual characteristics and to changes in recording conditions. Customized protocols can be designed by defining the states or stages to be deprived, including scheduling temporal patterns. A detailed analysis of the relevant signáis during and after deprivation is readily available. Data is presented from two experimental designs in rats. One consisted of specific REM-sleep short-term deprivation and the other of 10-hour total sleep deprivation. An outline of conceptual and practical considerations involved in the automation of laboratory set-ups oriented to biosignal analysis is provided. Careful monitoring of sleep EEG variables during sleep deprivation suggests peculiarities of brain functioning in that condition. A corollary is that sleep deprivation should not be considered to be merely a forced prolonged wakefulness.

  16. Tissue-specific expression of transfected human insulin genes in pluripotent clonal rat insulinoma lines induced during passage in vivo

    Madsen, O.D.; Andersen, L.C.; Michelsen, B.; Owerbach, D.; Larsson, L.I.; Lernmark, A.; Steiner, D.F. (Hagedorn Research Laboratory, Gentofte (Denmark))

    1988-09-01

    The pluripotent rat islet tumor cell line MSL-G2 expresses primarily glucagon or cholecystokinin and not insulin in vitro but changes phenotype completely after prolonged in vivo cultivation to yield small-sized hypoglycemic tumors composed almost entirely of insulin-producing beta cells. When a genomic DNA fragment containing the coding and upstream regulatory regions of the human insulin gene was stably transfected into MSL-G2 cells no measurable amounts of insulin or insulin mRNA were detected in vitro. However, successive transplantation of two transfected clones resulted in hypoglycemic tumors that efficiently coexpressed human and rat insulin as determined by human C-peptide-specific immunoreagents. These results demonstrate that cis-acting tissue-specific insulin gene enhancer elements are conserved between rat and human insulin genes. The authors propose that the in vivo differentiation of MSL-G2 cells and transfected subclones into insulin-producing cells reflects processes of natural beta-cell ontogeny leading to insulin gene expression.

  17. Tissue-specific expression of transfected human insulin genes in pluripotent clonal rat insulinoma lines induced during passage in vivo

    Madsen, O.D.; Andersen, L.C.; Michelsen, B.; Owerbach, D.; Larsson, L.I.; Lernmark, A.; Steiner, D.F.

    1988-01-01

    The pluripotent rat islet tumor cell line MSL-G2 expresses primarily glucagon or cholecystokinin and not insulin in vitro but changes phenotype completely after prolonged in vivo cultivation to yield small-sized hypoglycemic tumors composed almost entirely of insulin-producing beta cells. When a genomic DNA fragment containing the coding and upstream regulatory regions of the human insulin gene was stably transfected into MSL-G2 cells no measurable amounts of insulin or insulin mRNA were detected in vitro. However, successive transplantation of two transfected clones resulted in hypoglycemic tumors that efficiently coexpressed human and rat insulin as determined by human C-peptide-specific immunoreagents. These results demonstrate that cis-acting tissue-specific insulin gene enhancer elements are conserved between rat and human insulin genes. The authors propose that the in vivo differentiation of MSL-G2 cells and transfected subclones into insulin-producing cells reflects processes of natural beta-cell ontogeny leading to insulin gene expression

  18. Melting of the flux line lattice observed by specific heat experiments in YBa2Cu3O7-δ

    Roulin, M.; Junod, A.; Erb, A.; Walker, E.

    1996-01-01

    High resolution adiabatic specific heat experiments on YBa 2 Cu 3 O 7-δ (0≤δ≤0.05) are performed in magnetic fields from 0 to 14 T (B parallel c and B perpendicular c). In a 0.3 gram, twinned crystal with strong pinning, a step is consistently observed at the melting temperature T m of the vortex solid up to a critical point that depends on δ. The field B m and step temperature T m obey the relation B m =B m0 (δ)(1-T m /T c ) ∼4/3 . The anisotropy of B m and that of the upper critical field B c2 are found to be equal. Alternatively, in a 18 mg, twinned crystal of high purity with low pinning, first-order-like specific heat peaks are observed on the melting line from 8 to 14 T. The entropy under these peaks is ∼0.5 k B /vortex/bilayer. These characteristic features are attributed to the melting of a vortex glass in the former case and that of a vortex lattice in the latter case

  19. Generation and characterization of peptide-specific, MHC-restricted cytotoxic T lymphocyte (CTL) and helper T cell lines from unprimed T cells under microculture conditions.

    Sambhara, S R; Upadhya, A G; Miller, R G

    1990-06-12

    We describe a microculture system for the generation of CTL and T helper cells against peptides. Tryptic digest and cyanogen bromide fragments of chicken ovalbumin and synthetic peptides of ovalbumin (323-339) and influenza virus (NP 365-380) were used to generate CTL and T helper lines from unprimed T cells. These lines were both peptide-specific and MHC-restricted. The relative ease of generating peptide-specific, MHC-restricted CTL and helper T cell lines with as few as 10(6) unprimed lymphocytes can be an efficient method of detecting potential immunogenic determinants of an antigen.

  20. Epithelial cell specific properties and genetic complementation in a delta F508 cystic fibrosis nasal polyp cell line.

    Kunzelmann, K; Lei, D C; Eng, K; Escobar, L C; Koslowsky, T; Gruenert, D C

    1995-09-01

    Analysis of vectorial ion transport and protein trafficking in transformed cystic fibrosis (CF) epithelial cells has been limited because the cells tend to lose their tight junctions with multiple subcultures. To elucidate ion transport and protein trafficking in CF epithelial cells, a polar cell line with apical and basolateral compartments will facilitate analysis of the efficacy of different gene therapy strategies in a "tight epithelium" in vitro. This study investigates the genotypic and phenotypic properties of a CF nasal polyp epithelial, delta F508 homozygote, cell line that has tight junctions pre-crisis. The cells (sigma CFNPE14o-) were transformed with an origin-of-replication defective SV40 plasmid. They develop transepithelial resistance in Ussing chambers and are defective in cAMP-dependent Cl- transport as measured by efflux of radioactive Cl-, short circuit current (Isc), or whole-cell patch clamp. Stimulation of the cells by bradykinin, histamine, or ATP seems to activate both K(+)- and Ca(+2)-dependent Cl- transport. Measurement of 36Cl- efflux following stimulation with A23187 and ionomycin indicate a Ca(+2)-dependent Cl- transport. Volume regulatory capacity of the cells is indicated by cell swelling conductance. Expression of the CF transmembrane conductance regulator mRNA was indicated by RT-PCR amplification. When cells are grown at 26 degrees C for 48 h there is no indication of cAMP-dependent Cl- as has been previously indicated in heterologous expression systems. Antibodies specific for secretory cell antigens indicate the presence of antigens found in goblet, serous, and mucous cells; in goblet and serous cells; or in goblet and mucous cells; but not antigens found exclusively in mucous or serous cells.(ABSTRACT TRUNCATED AT 250 WORDS)

  1. Specific receptors for epidermal growth factor in human bone tumour cells and its effect on synthesis of prostaglandin E2 by cultured osteosarcoma cell line

    Hirata, Y.; Uchihashi, M.; Nakashima, H.; Fujita, T.; Matsukura, S.; Matsui, K.

    1984-01-01

    Using tumour cell lines derived from human bone tumours, specific binding sites for epidermal growth factor (EGF), a potent growth stimulator in many tissues, and its effect on synthesis of prostaglandin (PG) E 2 , a potent bone-resorbing factor, by cultured osteosarcoma cell line were studied. Three tumour cell lines, one osteosarcoma (HOSO) and two giant cell tumours of the bone (G-1 and G-2), all possessed specific binding sites for 125 I-labelled EGF: the apparent dissociation constant was approximately 4-10 x 10 -10 M and the maximal binding capacity was 50 000-80 000 sites/cell. EGF had no mitogenic effect in these cell lines. However, these cell lines did not have specific binding sites for 125 I-labelled parathyroid hormone (PTH) or calcitonin. HOSO line produced and secreted PGE 2 into medium, while no significant amount of PGE 2 was demonstrated in G-1 or G-2 line. EGF significantly stimulated PGE 2 production in HOSO line in a dose-dependent manner (0.5-50 ng/ml); its stimulatory effect was completely abolished by indomethacin, an inhibitor of PG biosynthesis. Exogenous PGE 1 significantly stimulated cyclic AMP formation in HOSO line, whereas PGFsub(2α) PTH, calcitonin, or EGF had no effect. None of these calcium-regulating hormones affected cyclic AMP generation in either G-1 of G-2 line. These data indicate that human bone tumour cells have specific EGF receptors unrelated to cell growth, and suggest that EGF may be involved in bone resorption through a PGE 2 -mediated process in human osseous tissues. (author)

  2. Assessment of General and Specific Combining Ability and Heterosis of Some Cucumber (Cucumis sativus L. Lines for Vegetative Traits

    Fatemeh Moradipour

    2017-10-01

    Full Text Available Introduction: Cucumber (Cucumis sativus L. is one of the most widely cultivated vegetables. Plant length is a quantitative trait is controlled by many genes. These traits are difficult to study due to the complex nature of their inheritance. The combining ability estimation is useful in determining the breeding value of cucumber lines by suggesting the appropriate use in a breeding program. In studying combining ability, the most commonly utilized experimental approach is the diallel design. General combining ability is a measure of additive genetic action; and specific combining ability (SCA is deviation from additivity. General combining ability is a main effect and SCA is an interaction. The aim is to determine the breeding value of the cross. Heterosis has been utilized to exploit dominance variance through production of hybrids. There are reports on positive and negative heterosis in cucumber however, there are differences between reports. This research was conducted to estimate general and specific combining ability and heterosis in cucumber inbred lines and hybrids to produce hybrids with high yield and quality. Material and Methods: In the spring of 2014, the seven parental lines and their 21 F1 hybrid were planted at the University of Guilan, in loamy sand field. Three replications were arranged in a randomized complete block design. The sandy loam soil was prepared by plowing and disking and formed into raised beds by plowed and harrow prior to plant establishment. Rows were on 1 m centers and plants were about 25 cm apart in the row. Prior to planting 150 kg·ha-1 of nitrogen from urea and 100 kg·ha-1 of phosphorous from triple superphosphate and 80 kg·ha-1 of potassium sulfate was applied. Side dressing with the same amount of nitrogen and phosphorus occurred at 50% flowering stage. Irrigation with 250 m3·ha-1, three times weekly, was begun at plant first flowering. In each replication, 12 individuals of each line or hybrid were

  3. Inhibitory effect of leptin on rosiglitazone-induced differentiation of primary adipocytes prepared from TallyHO/Jng mice

    Kim, Ki Young; Kim, Joo Young; Sung, Yoon-Young; Jung, Won Hoon; Kim, Hee-Youn; Park, Ji Seon; Cheon, Hyae Gyeong [Medicinal Science Division, Korea Research Institute of Chemical Technology, 100 Jang-dong, Yuseong, 305-600 Daejon (Korea, Republic of); Rhee, Sang Dal, E-mail: sdrhee@krict.re.kr [Medicinal Science Division, Korea Research Institute of Chemical Technology, 100 Jang-dong, Yuseong, 305-600 Daejon (Korea, Republic of)

    2011-03-25

    Research highlights: {yields} In this study, we investigated the effects of leptin on adipocyte differentiation prepared from subcutaneous fat of TallyHo mice. {yields} Leptin inhibited the adipocytes differentiation at physiological concentration via inhibition of PPAR{gamma} expression. {yields} Inhibitors of ERK and STAT1 restored the leptin's inhibitory activity both in vitro and in vivo. -- Abstract: The effects of leptin on rosiglitazone-induced adipocyte differentiation were investigated in the primary adipocytes prepared from subcutaneous fat of TallyHO/Jng (TallyHO) mouse, a recently developed model animal for type 2 diabetes mellitus (T2DM). The treatment of leptin inhibited the rosiglitazone-induced adipocyte differentiation with a decreased expression of peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) a key adipogenic transcription factor, both in mRNA and protein levels. Leptin (10 nM) was sufficient to inhibit the adipocyte differentiation, which seemed to come from increased expression of leptin receptor genes in the fat of TallyHO mice. The inhibition of adipogenesis by leptin was restored by the treatment of inhibitors for extracellular-signal-regulated kinase (ERK) (PD98059) and signal transducer and activator of transcription-1 (STAT1) (fludarabine). Furthermore, in vivo intraperitoneal administration of PD98059 and fludarabine increased the PPAR{gamma} expression in the subcutaneous fat of TallyHO mice. These data suggest that leptin could inhibit the PPAR{gamma} expression and adipocyte differentiation in its physiological concentration in TallyHO mice.

  4. Generation of a Tph2 Conditional Knockout Mouse Line for Time- and Tissue-Specific Depletion of Brain Serotonin

    Migliarini, Sara; Pacini, Giulia; Pasqualetti, Massimo

    2015-01-01

    Serotonin has been gaining increasing attention during the last two decades due to the dual function of this monoamine as key regulator during critical developmental events and as neurotransmitter. Importantly, unbalanced serotonergic levels during critical temporal phases might contribute to the onset of neuropsychiatric disorders, such as schizophrenia and autism. Despite increasing evidences from both animal models and human genetic studies have underpinned the importance of serotonin homeostasis maintenance during central nervous system development and adulthood, the precise role of this molecule in time-specific activities is only beginning to be elucidated. Serotonin synthesis is a 2-step process, the first step of which is mediated by the rate-limiting activity of Tph enzymes, belonging to the family of aromatic amino acid hydroxylases and existing in two isoforms, Tph1 and Tph2, responsible for the production of peripheral and brain serotonin, respectively. In the present study, we generated and validated a conditional knockout mouse line, Tph2 flox/flox, in which brain serotonin can be effectively ablated with time specificity. We demonstrated that the Cre-mediated excision of the third exon of Tph2 gene results in the production of a Tph2 null allele in which we observed the near-complete loss of brain serotonin, as well as the growth defects and perinatal lethality observed in serotonin conventional knockouts. We also revealed that in mice harbouring the Tph2 null allele, but not in wild-types, two distinct Tph2 mRNA isoforms are present, namely Tph2Δ3 and Tph2Δ3Δ4, with the latter showing an in-frame deletion of amino acids 84–178 and coding a protein that could potentially retain non-negligible enzymatic activity. As we could not detect Tph1 expression in the raphe, we made the hypothesis that the Tph2Δ3Δ4 isoform can be at the origin of the residual, sub-threshold amount of serotonin detected in the brain of Tph2 null/null mice. Finally, we set

  5. Insulin Sensitizing and Antioxidant Effects of Hesperidin and Low Dose Gamma Irradiation in Combination with Rosiglitazone in Type 2 Diabetic Rats

    Morcos, N.Y.; Abdel-Ghaffar, A.B.; Osman, S.A.; Mohamed, M.Kh.; Arbid, M.S.; El-Eraky, W.I.

    2012-01-01

    The present study was designed to investigate the possible ameliorative effect of hesperidin and low dose fÁ-irradiation (LDR) in combination with rosiglitazone in an experimental model of insulin resistance. Type 2 diabetes mellitus (T2DM) was induced in rats by single intraperitoneal injection of streptozotocin (STZ) followed by nicotinamide (NIC) (65 and 110 mg/kg b.wt; i.p respectively). After verifying T2DM in rats, they were subjected to LDR (50 cGy) and then treated with rosiglitazone (4 mg/kg b.wt; p.o) and hesperidin (100 mg/kg b.wt; p.o) for 30 days. Results showed that STZ injection significantly elevated blood glucose, glycosylated hemoglobin (HbA1c), insulin, homeostasis model assessment of insulin resistance (HOMA-IR), lipid peroxides (TBARS; MDA) accompanied with a reduction in adiponectin plasma level, reduced glutathione (GSH) and superoxide dismutase (SOD) serum level. Treatment of diabetic rats with rosiglitazone, hesperidin and LDR significantly reduced blood glucose, HbA1c, insulin, HOMA-IR and MDA levels. Whereas, plasma adiponectin, SOD in serum and GSH plasma level were significantly elevated. Therefore, our data suggest that hesperidin and LDR might be useful adjuvants with rosiglitazone and attenuate insulin resistance and oxidative stress in T2DM.

  6. A pilot study investigating the effects of rosiglitazone on performance in neuropsychological tests in patients with mild-to-moderate Alzheimer's disease

    Peers, P.V.; Semple, J.; Lai, R.Y.K.; Smith, G.R.; Altman, J.; Risner, M.; Riedel, W.J.

    2006-01-01

    Background: Rosiglitazone (a PPARg agonist) has shown beneficial effects on memory and executive function tasks in Alzheimer’s disease (AD)[1] Objective(s): To examine the use of standard clinical measures (e.g ADAS-cog) and experimental measures of simple and choice reaction time (examining

  7. Recombinant human growth hormone and rosiglitazone for abdominal fat accumulation in HIV-infected patients with insulin resistance: a randomized, double-blind, placebo-controlled, factorial trial.

    Marshall J Glesby

    Full Text Available Recombinant human growth hormone (rhGH reduces visceral adipose tissue (VAT volume in HIV-infected patients but can worsen glucose homeostasis and lipoatrophy. We aimed to determine if adding rosiglitazone to rhGH would abrogate the adverse effects of rhGH on insulin sensitivity (SI and subcutaneous adipose tissue (SAT volume.Randomized, double-blind, placebo-controlled, multicenter trial using a 2×2 factorial design in which HIV-infected subjects with abdominal obesity and insulin resistance were randomized to rhGH 3 mg daily, rosiglitazone 4 mg twice daily, combination rhGH + rosiglitazone, or double placebo (control for 12 weeks. The primary endpoint was change in SI by frequently sampled intravenous glucose tolerance test from entry to week 12. Body composition was assessed by whole body magnetic resonance imaging (MRI and dual Xray absorptiometry (DEXA. Seventy-seven subjects were randomized of whom 72 initiated study drugs. Change in SI from entry to week 12 differed across the 4 arms by 1-way ANCOVA (P = 0.02; by pair-wise comparisons, only rhGH (decreasing SI; P = 0.03 differed significantly from control. Changes from entry to week 12 in fasting glucose and glucose area under the curve on 2-hour oral glucose tolerance test differed across arms (1-way ANCOVA P = 0.004, increasing in the rhGH arm relative to control. VAT decreased significantly in the rhGH arms (-17.5% in rhGH/rosiglitazone and -22.7% in rhGH but not in the rosiglitazone alone (-2.5% or control arms (-1.9%. SAT did not change significantly in any arm. DEXA results were consistent with the MRI data. There was no significant rhGH x rosiglitazone interaction for any body composition parameter.The addition of rosiglitazone abrogated the adverse effects of rhGH on insulin sensitivity and glucose tolerance while not significantly modifying the lowering effect of rhGH on VAT.Clinicaltrials.gov NCT00130286.

  8. Recombinant human growth hormone and rosiglitazone for abdominal fat accumulation in HIV-infected patients with insulin resistance: a randomized, double-blind, placebo-controlled, factorial trial.

    Glesby, Marshall J; Albu, Jeanine; Chiu, Ya-Lin; Ham, Kirsis; Engelson, Ellen; He, Qing; Muthukrishnan, Varalakshmi; Ginsberg, Henry N; Donovan, Daniel; Ernst, Jerry; Lesser, Martin; Kotler, Donald P

    2013-01-01

    Recombinant human growth hormone (rhGH) reduces visceral adipose tissue (VAT) volume in HIV-infected patients but can worsen glucose homeostasis and lipoatrophy. We aimed to determine if adding rosiglitazone to rhGH would abrogate the adverse effects of rhGH on insulin sensitivity (SI) and subcutaneous adipose tissue (SAT) volume. Randomized, double-blind, placebo-controlled, multicenter trial using a 2×2 factorial design in which HIV-infected subjects with abdominal obesity and insulin resistance were randomized to rhGH 3 mg daily, rosiglitazone 4 mg twice daily, combination rhGH + rosiglitazone, or double placebo (control) for 12 weeks. The primary endpoint was change in SI by frequently sampled intravenous glucose tolerance test from entry to week 12. Body composition was assessed by whole body magnetic resonance imaging (MRI) and dual Xray absorptiometry (DEXA). Seventy-seven subjects were randomized of whom 72 initiated study drugs. Change in SI from entry to week 12 differed across the 4 arms by 1-way ANCOVA (P = 0.02); by pair-wise comparisons, only rhGH (decreasing SI; P = 0.03) differed significantly from control. Changes from entry to week 12 in fasting glucose and glucose area under the curve on 2-hour oral glucose tolerance test differed across arms (1-way ANCOVA P = 0.004), increasing in the rhGH arm relative to control. VAT decreased significantly in the rhGH arms (-17.5% in rhGH/rosiglitazone and -22.7% in rhGH) but not in the rosiglitazone alone (-2.5%) or control arms (-1.9%). SAT did not change significantly in any arm. DEXA results were consistent with the MRI data. There was no significant rhGH x rosiglitazone interaction for any body composition parameter. The addition of rosiglitazone abrogated the adverse effects of rhGH on insulin sensitivity and glucose tolerance while not significantly modifying the lowering effect of rhGH on VAT. Clinicaltrials.gov NCT00130286.

  9. Assessment on the Prevention of Progression by Rosiglitazone on Atherosclerosis in diabetes patients with Cardiovascular History (APPROACH): study design and baseline characteristics.

    Ratner, Robert E; Cannon, Christopher P; Gerstein, Hertzel C; Nesto, Richard W; Serruys, Patrick W; Van Es, Gerrit-Anne; Kolatkar, Nikheel S; Kravitz, Barbara G; Zalewski, Andrew; Fitzgerald, Peter J

    2008-12-01

    Rosiglitazone, a thiazolidinedione, has effects on insulin sensitivity and cardiovascular risk factors that may favorably impact the progression of coronary atherosclerosis. APPROACH is a double-blind randomized clinical trial comparing the effects of the insulin sensitizer rosiglitazone with the insulin secretagogue glipizide on the progression of coronary atherosclerosis. Patients with type 2 diabetes and coronary artery disease undergoing clinically indicated coronary angiography or percutaneous coronary intervention are randomized to receive rosiglitazone or glipizide for 18 months using a titration algorithm designed to provide comparable glycemic control between treatment groups. The primary end point is change in percent atheroma volume from baseline to study completion in a nonintervened coronary artery, as measured by intravascular ultrasound. Cardiovascular events are adjudicated by an end point committee. A total of 672 patients were randomized. The mean age was 61 years, hemoglobin A(1c) (HbA(1c)) 7.2%, body mass index 29.5 kg/m(2), and median duration of diabetes 4.8 years. At baseline, approximately half of the participants were receiving oral antidiabetic monotherapy (53.9%) with 27.5% receiving dual combination therapy and 17.9% treated with diet and exercise alone. Approximately two thirds of the participants (68%) had dyslipidemia, 79.9% hypertension, and 24% prior myocardial infarction. APPROACH has fully enrolled a high-risk patient population and will compare the glucose-independent effects of rosiglitazone and glipizide on the progression of coronary atherosclerosis, as well as provide additional data on the cardiovascular safety of rosiglitazone in patients with type 2 diabetes and coronary artery disease.

  10. Drospirenone/ethinyl estradiol versus rosiglitazone treatment in overweight adolescents with polycystic ovary syndrome: comparison of metabolic, hormonal, and cardiovascular risk factors.

    Tfayli, Hala; Ulnach, Julia Warren; Lee, SoJung; Sutton-Tyrrell, Kim; Arslanian, Silva

    2011-05-01

    Adolescents with polycystic ovary syndrome (PCOS) have insulin resistance and higher rates of the metabolic syndrome. Our objective was to compare the effects of 6 months treatment with drospirenone/ethinyl estradiol (EE) (3 mg/30 μg) vs. rosiglitazone (4 mg) daily on the hormonal and cardiometabolic profiles of overweight/obese adolescents with PCOS. We conducted a randomized, double-blinded, parallel clinical trial in an academic hospital, with n = 46 patients. The primary outcome measure was insulin sensitivity, hepatic with [6,6-(2)H(2)]glucose and peripheral with a 3-h hyperinsulinemic-euglycemic clamp. Other outcome measures included plasma androgen profile and response to ACTH stimulation, glucose and insulin response to oral glucose tolerance test, insulin secretion with a 2-h hyperglycemic clamp, fasting lipid profile, inflammatory markers, intima media thickness, aortic pulse wave velocity, body composition by dual-energy x-ray absorptiometry, and abdominal adiposity by computed tomography scan. Drospirenone/EE resulted in greater reductions in androgenemia. Neither treatment led to change in weight or body mass index, but rosiglitazone led to a significant decrease in visceral adiposity. Compared with drospirenone/EE, treatment with rosiglitazone improved hepatic and peripheral insulin sensitivity and lowered fasting and stimulated insulin levels during the oral glucose tolerance test. Treatment with drospirenone/EE was associated with elevations in total cholesterol, high-sensitivity C-reactive protein and leptin concentrations, whereas treatment with rosiglitazone led to lower triglycerides and higher adiponectin concentrations. Neither treatment affected intima media thickness or pulse wave velocity. In overweight/obese adolescents with PCOS, 6 months treatment with rosiglitazone was superior to drospirenone/EE in improving the cardiometabolic risk profile, and effective but inferior in attenuating hyperandrogenemia. Additional studies are needed to

  11. Rosiglitazone stimulates the release and synthesis of insulin by enhancing GLUT-2, glucokinase and BETA2/NeuroD expression

    Kim, Hyo-Sup; Noh, Jung-Hyun; Hong, Seung-Hyun; Hwang, You-Cheol; Yang, Tae-Young; Lee, Myung-Shik; Kim, Kwang-Won; Lee, Moon-Kyu

    2008-01-01

    Peroxisome proliferator-activated receptor (PPAR)-γ is a member of the nuclear receptor superfamily, and its ligands, the thiazolidinediones, might directly stimulate insulin release and insulin synthesis in pancreatic β-cells. In the present study, we examined the effects of rosiglitazone (RGZ) on insulin release and synthesis in pancreatic β-cell (INS-1). Insulin release and synthesis were stimulated by treatment with RGZ for 24 h. RGZ upregulated the expressions of GLUT-2 and glucokinase (GCK). Moreover, it was found that RGZ increased the expression of BETA2/NeuroD gene which could regulate insulin gene expression. These results suggest that RGZ could stimulate the release and synthesis of insulin through the upregulation of GLUT-2, GCK, and BETA2/NeuroD gene expression

  12. Derivation of transplantable 7,12-dimethylbenz[a]anthracene-induced chicken fibrosarcoma lines: differences in metastasizing properties and organ specificity

    Galton, J.E.; Xue, B.; Hochwald, G.M.; Thorbecke, G.J.

    1982-01-01

    Transplantable 7,12-dimethylbenz[a]anthracene-induced SC chicken fibrosarcoma (CHCT-NYU) lines were studied for their ability to grow in internal organs after iv injection (artificial metastases) into 1- to 3-week-old chickens. Some tumor lines were recently derived, whereas others were studied after many serial subcutaneous transplantations. Artificial metastases were seen in the stomach, pancreas, lungs, heart, and muscle, and occasionally in the kidneys and liver. Agammaglobulinemic recipients showed more extensive organ involvement than normal recipients of the same age. Whole-body ν-irradiation enhanced the incidence of artificial metastases, particularly in lungs. Antibody from the serum of a primary tumor-bearing host reduced the growth of the corresponding tumor in many organs. The metastatic pattern of line CHCT-NYU4 was a relatively stable property. However, intravenous transplantation of tumor cells from line CHCT-NYU4 taken from the liver, lungs, and pancreas of a single recipient established sublines with changes in organ specificity. After a few such serial transplants of liver-derived tumor, a line was derived that grew virtually in the liver alone. A subline with preference for growth in lungs was also obtained, but its ability to grow in the pancreas persisted. A pancreas-derived tumor line also grew in the liver and lungs. Subcutaneous transplants of tissue fragments of the lung-derived tumor line caused the appearance of spontaneous metastases in lungs. The incidence of spontaneous metastases with the lung-derived line was much greater than that with the liver-derived line or with the original CHCT-NYU4 line

  13. Exposure to rosiglitazone, a PPAR-γ agonist, in late gestation reduces the abundance of factors regulating cardiac metabolism and cardiomyocyte size in the sheep fetus.

    Lie, Shervi; Hui, Melisa; McMillen, I Caroline; Muhlhausler, Beverly S; Posterino, Giuseppe S; Dunn, Stacey L; Wang, Kimberley C; Botting, Kimberley J; Morrison, Janna L

    2014-03-15

    It is unknown whether cardiomyocyte hypertrophy and the transition to fatty acid oxidation as the main source of energy after birth is dependent on the maturation of the cardiomyocytes' metabolic system, or on the limitation of substrate availability before birth. This study aimed to investigate whether intrafetal administration of a peroxisome proliferator-activated receptor-γ (PPAR-γ) agonist, rosiglitazone, during late gestation can stimulate the expression of factors regulating cardiac growth and metabolism in preparation for birth, and the consequences of cardiac contractility in the fetal sheep at ∼140 days gestation. The mRNA expression and protein abundance of key factors regulating growth and metabolism were quantified using quantitative RT-PCR and Western blot analysis, respectively. Cardiac contractility was determined by measuring the Ca(2+) sensitivity and maximum Ca(2+)-activated force of skinned cardiomyocyte bundles. Rosiglitazone-treated fetuses had a lower cardiac abundance of insulin-signaling molecules, including insulin receptor-β, insulin receptor substrate-1 (IRS-1), phospho-IRS-1 (Tyr-895), phosphatidylinositol 3-kinase (PI3K) regulatory subunit p85, PI3K catalytic subunit p110α, phospho-3-phosphoinositide-dependent protein kinase 1 (Ser-241), protein kinase B (Akt-1), phospho-Akt (Ser-273), PKCζ, phospho-PKCζ(Thr-410), Akt substrate 160 kDa (AS160), phospho-AS160 (Thr-642), and glucose transporter type-4. Additionally, cardiac abundance of regulators of fatty acid β-oxidation, including adiponectin receptor 1, AMPKα, phospho-AMPKα (Thr-172), phospho-acetyl CoA carboxylase (Ser-79), carnitine palmitoyltransferase-1, and PGC-1α was lower in the rosiglitazone-treated group. Rosiglitazone administration also resulted in a decrease in cardiomyocyte size. Rosiglitazone administration in the late-gestation sheep fetus resulted in a decreased abundance of factors regulating cardiac glucose uptake, fatty acid β-oxidation, and

  14. Rapid development of stable transgene CHO cell lines by CRISPR/Cas9-mediated site-specific integration into C12orf35.

    Zhao, Menglin; Wang, Jiaxian; Luo, Manyu; Luo, Han; Zhao, Meiqi; Han, Lei; Zhang, Mengxiao; Yang, Hui; Xie, Yueqing; Jiang, Hua; Feng, Lei; Lu, Huili; Zhu, Jianwei

    2018-07-01

    Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.

  15. Homotypic aggregation of human cell lines by HLA class II-, class Ia- and HLA-G-specific monoclonal antibodies

    Odum, Niels; Ledbetter, J A; Martin, P

    1991-01-01

    Major histocompatibility complex (MHC) class II molecules have been implicated in cell adhesion in two ways. In addition to the well-established role of class II antigens in low-affinity adhesion provided by interactions between class II and CD4, recent data indicated that class II may also induce...... adhesion between T and B cells by activating the CD18/CD11a (LFA-1) adhesion pathway. Here we report that monoclonal antibodies (mAb) against HLA-DR (L243, p4.1, HB10a, VI15) and certain broad class II reacting mAb (TU35, TU39), but not anti-DQ (TU22, Leu-10) mAb, induced homotypic aggregation of human...... class II-positive monocytic (I937) and T leukemic (HUT78) tumor cell lines and Epstein-Barr virus (EBV) transformed B-lymphoid cell lines (EBV-LCL). Class II-negative cell lines (U-937 and the EBV-LCL mutant line 616) were not induced to aggregate. An HLA-G-transfected EBV-LCL, 221-AGN...

  16. Project W-314 specific test and evaluation plan for SN-635 transfer line (241-AY-01A to 241-AY-02A) and SN-633 transfer line tie in

    Hays, W.H.

    1998-01-01

    This Specific Test and Evaluation Plan (STEP) defines the test and evaluation activities encompassing the installation of the SN-635 transfer line for the W-314 Project. The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made by the addition of the SN-635 transfer line and the tie in of SN-633 to the AY-02A pit by the W-314 Project. The STEP develops the outline for test procedures that verify the system's performance to the established Project design criteria. The STEP is a lower tier document based on the W-314 Test and Evaluation Plan (TEP)

  17. Adverse drug effects observed with vildagliptin versus pioglitazone or rosiglitazone in the treatment of patients with type 2 diabetes mellitus: a systematic review and meta-analysis of randomized controlled trials.

    Bundhun, Pravesh Kumar; Janoo, Girish; Teeluck, Abhishek Rishikesh; Huang, Feng

    2017-10-23

    Vildagliptin and pioglitazone/rosiglitazone are emerging Oral Hypoglycemic Agents (OHAs) which are used to treat patients suffering from Type 2 Diabetes Mellitus (T2DM). In this analysis, we aimed to systematically compare the adverse drug events which were observed with the use of vildagliptin versus pioglitazone or rosiglitazone respectively. Online databases were searched for studies comparing vildagliptin with pioglitazone/rosiglitazone. Adverse drug events were considered as the clinical endpoints in this analysis. We calculated Odds Ratios (OR) with 95% Confidence Intervals (CIs) using the RevMan 5.3 software. All the authors had full access to the data which were used and approved the final version of the manuscript. A total number of 2396 patients were analyzed (1486 and 910 patients were treated with vildagliptin and pioglitazone/rosiglitazone respectively). Vildagliptin and pioglitazone/rosiglitazone were both associated with similar overall adverse drug events (OR: 1.00, 95% CI: 0.81-1.24; P = 1.00). Headache (OR: 0.88, 95% CI: 0.60-1.27; P = 0.49) and upper respiratory tract infection (OR: 0.95, 95% CI: 0.71-1.27; P = 0.75) were similarly observed. However, dizziness was significantly lower with pioglitazone/rosiglitazone (OR: 0.63, 95% CI: 0.43-0.92; P = 0.02). Back pain, diarrhea and nausea were insignificantly lower with pioglitazone/rosiglitazone (OR: 0.81, 95% CI: 0.49-1.33; P = 0.40), (OR: 0.83, 95% CI: 0.48-1.44; P = 0.52) and (OR: 0.52, 95% CI: 0.25-1.05; P = 0.07) respectively, whereas peripheral edema and weight gain were insignificantly higher (OR: 1.21, 95% CI: 0.56-2.62; P = 0.63) and (OR: 2.29, 95% CI: 0.51-10.34; P = 0.28) respectively. Nevertheless, when pioglitazone and rosiglitazone were separately compared with vildagliptin, peripheral edema and weight gain were significantly higher with rosiglitazone (OR: 2.36, 95% CI: 1.40-3.99; P = 0.001) and (OR: 5.20, 95% CI: 2.47-10.92; P = 0.0001) respectively. Both

  18. n-3 Fatty acids and rosiglitazone improve insulin sensitivity through additive stimulatory effects on muscle glycogen synthesis in mice fed a high-fat diet

    Kuda, Ondřej; Jeleník, Tomáš; Jílková, Zuzana; Flachs, Pavel; Rossmeisl, Martin; Hensler, Michal; Kazdová, L.; Ogston, N.; Baranowski, M.; Gorski, J.; Janovská, Petra; Kůs, Vladimír; Polák, J.; Mohamed-Ali, V.; Burcelin, R.; Cinti, S.; Bryhn, M.; Kopecký, Jan

    2009-01-01

    Roč. 52, č. 5 (2009), s. 941-951 ISSN 0012-186X R&D Projects: GA ČR(CZ) GA303/08/0664; GA MŠk(CZ) 1M0520; GA MŠk(CZ) OC08007 Grant - others:EC(XE) LSMH-CT-2004005272 Institutional research plan: CEZ:AV0Z50110509 Keywords : fish oil * rosiglitazone * obesity Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition Impact factor: 6.551, year: 2009

  19. Peroxisome proliferator-activated receptor-gamma agonist rosiglitazone reverses the adverse effects of diet-induced obesity on oocyte quality.

    Minge, Cadence E; Bennett, Brenton D; Norman, Robert J; Robker, Rebecca L

    2008-05-01

    Obesity and its physiological consequences are increasingly prevalent among women of reproductive age and are associated with infertility. To investigate, female mice were fed a high-fat diet until the onset of insulin resistance, followed by assessments of ovarian gene expression, ovulation, fertilization, and oocyte developmental competence. We report defects to ovarian function associated with diet-induced obesity (DIO) that result in poor oocyte quality, subsequently reduced blastocyst survival rates, and abnormal embryonic cellular differentiation. To identify critical cellular mediators of ovarian responses to obesity induced insulin resistance, DIO females were treated for 4 d before mating with an insulin-sensitizing pharmaceutical: glucose and lipid-lowering AMP kinase activator, 5-aminoimidazole 4-carboxamide-riboside, 30 mg/kg.d; sodium salicylate, IkappaK inhibitor that reverses insulin resistance, 50 mg/kg.d; or peroxisome proliferator activated receptor-gamma agonist rosiglitazone, 10 mg/kg.d. 5-aminoimidazole 4-carboxamide-riboside or sodium salicylate treatment did not have significant effects on the reproductive parameters examined. However, embryonic development to the blastocyst stage was significantly improved when DIO mice were treated with rosiglitazone, effectively repairing development rates. Rosiglitazone also normalized DIO-associated abnormal blastomere allocation to the inner cell mass. Such improvements to oocyte quality were coupled with weight loss, improved glucose metabolism, and changes in ovarian mRNA expression of peroxisome proliferator activated receptor-regulated genes, Cd36, Scarb1, and Fabp4 cholesterol transporters. These studies demonstrate that peri-conception treatment with select insulin-sensitizing pharmaceuticals can directly influence ovarian functions and ultimately exert positive effects on oocyte developmental competence. Improved blastocyst quality in obese females treated with rosiglitazone before mating

  20. Comparison of the Efficacy of Glimepiride, Metformin, and Rosiglitazone Monotherapy in Korean Drug-Naïve Type 2 Diabetic Patients: The Practical Evidence of Antidiabetic Monotherapy Study

    Kun Ho Yoon

    2011-02-01

    Full Text Available BackgroundAlthough many anti-diabetic drugs have been used to control hyperglycemia for decades, the efficacy of commonly-used oral glucose-lowering agents in Korean type 2 diabetic patients has yet to be clearly demonstrated.MethodsWe evaluated the efficacy of glimepiride, metformin, and rosiglitazone as initial treatment for drug-naïve type 2 diabetes mellitus patients in a 48-week, double-blind, randomized controlled study that included 349 Korean patients. Our primary goal was to determine the change in HbA1c levels from baseline to end point. Our secondary goal was to evaluate changes in fasting plasma glucose (FPG levels, body weight, frequency of adverse events, and the proportion of participants achieving target HbA1c levels.ResultsHbA1c levels decreased from 7.8% to 6.9% in the glimepiride group (P<0.001, from 7.9% to 7.0% in the metformin group (P<0.001, and from 7.8% to 7.0% (P<0.001 in the rosiglitazone group. Glimepiride and rosiglitazone significantly increased body weight and metformin reduced body weight during the study period. Symptomatic hypoglycemia was more frequent in the glimepiride group and diarrhea was more frequent in the metformin group.ConclusionThe efficacy of glimepiride, metformin, and rosiglitazone as antidiabetic monotherapies in drug-naïve Korean type 2 diabetic patients was similar in the three groups, with no statistical difference. This study is the first randomized controlled trial to evaluate the efficacy of commonly-used oral hypoglycemic agents in Korean type 2 diabetic patients. An additional subgroup analysis is recommended to obtain more detailed information.

  1. Treatment of spontaneously hypertensive rats with rosiglitazone and/or enalapril restores balance between vasodilator and vasoconstrictor actions of insulin with simultaneous improvement in hypertension and insulin resistance.

    Potenza, Maria A; Marasciulo, Flora L; Tarquinio, Mariela; Quon, Michael J; Montagnani, Monica

    2006-12-01

    Spontaneously hypertensive rats (SHRs) exhibit endothelial dysfunction and insulin resistance. Reciprocal relationships between endothelial dysfunction and insulin resistance may contribute to hypertension by causing imbalanced regulation of endothelial-derived vasodilators (e.g., nitric oxide) and vasoconstrictors (e.g., endothelin-1 [ET-1]). Treatment of SHRs with rosiglitazone (insulin sensitizer) and/or enalapril (ACE inhibitor) may simultaneously improve hypertension, insulin resistance, and endothelial dysfunction by rebalancing insulin-stimulated production of vasoactive mediators. When compared with WKY control rats, 12-week-old vehicle-treated SHRs were hypertensive, overweight, and insulin resistant, with elevated fasting levels of insulin and ET-1 and reduced serum adiponectin levels. In mesenteric vascular beds (MVBs) isolated from vehicle-treated SHRs and preconstricted with norepinephrine (NE) ex vivo, vasodilator responses to insulin were significantly impaired, whereas the ability of insulin to oppose vasoconstrictor actions of NE was absent (versus WKY controls). Three-week treatment of SHRs with rosiglitazone and/or enalapril significantly reduced blood pressure, insulin resistance, fasting insulin, and ET-1 levels and increased adiponectin levels to values comparable with those observed in vehicle-treated WKY controls. By restoring phosphatidylinositol 3-kinase-dependent effects, rosiglitazone and/or enalapril therapy of SHRs also significantly improved vasodilator responses to insulin in MVB preconstricted with NE ex vivo. Taken together, our data provide strong support for the existence of reciprocal relationships between endothelial dysfunction and insulin resistance that may be relevant for developing novel therapeutic strategies for the metabolic syndrome.

  2. Epigenetic variants of a transgenic petunia line show hypermethylation in transgene DNA: an indication for specific recognition of foreign DNA in transgenic plants.

    Meyer, P; Heidmann, I

    1994-05-25

    We analysed de novo DNA methylation occurring in plants obtained from the transgenic petunia line R101-17. This line contains one copy of the maize A1 gene that leads to the production of brick-red pelargonidin pigment in the flowers. Due to its integration into an unmethylated genomic region the A1 transgene is hypomethylated and transcriptionally active. Several epigenetic variants of line 17 were selected that exhibit characteristic and somatically stable pigmentation patterns, displaying fully coloured, marbled or colourless flowers. Analysis of the DNA methylation patterns revealed that the decrease in pigmentation among the epigenetic variants was correlated with an increase in methylation, specifically of the transgene DNA. No change in methylation of the hypomethylated integration region could be detected. A similar increase in methylation, specifically in the transgene region, was also observed among progeny of R101-17del, a deletion derivative of R101-17 that no longer produces pelargonidin pigments due to a deletion in the A1 coding region. Again de novo methylation is specifically directed to the transgene, while the hypomethylated character of neighbouring regions is not affected. Possible mechanisms for transgene-specific methylation and its consequences for long-term use of transgenic material are discussed.

  3. Experience of malignancies with oral glucose-lowering drugs in the randomised controlled ADOPT (A Diabetes Outcome Progression Trial) and RECORD (Rosiglitazone Evaluated for Cardiovascular Outcomes and Regulation of Glycaemia in Diabetes) clinical trials.

    Home, P D; Kahn, S E; Jones, N P; Noronha, D; Beck-Nielsen, H; Viberti, G

    2010-09-01

    Observational and mechanistic studies have suggested a possible relationship between treatment with metformin and decreased incidence of cancer in participants with type 2 diabetes. We extracted data for malignancies from the ADOPT (A Diabetes Outcome Progression Trial) and RECORD (Rosiglitazone Evaluated for Cardiovascular Outcomes and Regulation of Glycaemia in Diabetes) randomised controlled clinical trials, in which the efficacy and/or safety of metformin was assessed in comparison with sulfonylureas and rosiglitazone. Neoplasm occurrences were collected as adverse events in these studies. We reviewed and re-analysed the individual participant data in both studies for serious adverse events, malignancies reported as adverse events and related neoplasms of special interest. In ADOPT, 50 participants (3.4%) on metformin and 55 (3.8%) on each of rosiglitazone and glibenclamide (known as glyburide in the USA and Canada) developed serious adverse event malignancies (excluding non-melanoma skin cancers). This corresponds to 1.03, 1.12 and 1.31 per 100 person-years, giving hazard ratios for metformin of 0.92 (95% CI 0.63-1.35) vs rosiglitazone and 0.78 (0.53-1.14) vs glibenclamide. In RECORD, on a background of sulfonylurea, 69 (6.1%) participants developed malignant neoplasms in the metformin group, compared with 56 (5.1%) in the rosiglitazone group (HR 1.22 [0.86-1.74]). On a background of metformin, 74 (6.7%) participants in the sulfonylurea group developed malignant neoplasms, compared with 57 (5.1%) in the rosiglitazone group (HR 1.33 [0.94-1.88]). The malignancy rates in these two randomised controlled clinical trials do not support a view that metformin offers any particular protection against malignancy compared with rosiglitazone. However, they do not refute the possibility of a difference compared with sulfonylureas.

  4. Different Expression and Localization of Phosphoinositide Specific Phospholipases C in Human Osteoblasts, Osteosarcoma Cell Lines, Ewing Sarcoma and Synovial Sarcoma

    V.Vasco

    2017-06-01

    Full Text Available Background: Bone hardness and strength depends on mineralization, which involves a complex process in which calcium phosphate, produced by bone-forming cells, was shed around the fibrous matrix. This process is strictly regulated, and a number of signal transduction systems were interested in calcium metabolism, such as the phosphoinositide (PI pathway and related phospholipase C (PLC enzymes. Objectives: Our aim was to search for common patterns of expression in osteoblasts, as well as in ES and SS. Methods: We analysed the PLC enzymes in human osteoblasts and osteosarcoma cell lines MG-63 and SaOS-2. We compared the obtained results to the expression of PLCs in samples of patients affected with Ewing sarcoma (ES and synovial sarcoma (SS. Results: In osteoblasts, MG-63 cells and SaOS-2 significant differences were identified in the expression of PLC δ4 and PLC η subfamily isoforms. Differences were also identified regarding the expression of PLCs in ES and SS. Most ES and SS did not express PLCB1, which was expressed in most osteoblasts, MG-63 and SaOS-2 cells. Conversely, PLCB2, unexpressed in the cell lines, was expressed in some ES and SS. However, PLCH1 was expressed in SaOS-2 and inconstantly expressed in osteoblasts, while it was expressed in ES and unexpressed in SS. The most relevant difference observed in ES compared to SS regarded PLC ε and PLC η isoforms. Conclusion: MG-63 and SaOS-2 osteosarcoma cell lines might represent an inappropriate experimental model for studies about the analysis of signal transduction in osteoblasts

  5. Gene expression-signature of belinostat in cell lines is specific for histone deacetylase inhibitor treatment, with a corresponding signature in xenografts

    Monks, A.; Hose, C.D.; Pezzoli, P.

    2009-01-01

    gene modulation were significantly correlated. A belinostat-gene profile was specific for HDACi in three cell lines when compared with equipotent concentrations of four mechanistically different chemotherapeutic agents: 5-fluorouracil, cisplatin, paclitaxel, and thiotepa. Belinostat- and trichostatin...... in a drug-sensitive tumor than a more resistant model. We have demonstrated a gene signature that is selectively regulated by HDACi when compared with other clinical agents allowing us to distinguish HDACi responses from those related to other mechanisms Udgivelsesdato: 2009/9...

  6. TGF-b and a specific TGF-b inhibitor regulate pericentrin B and MYH9 in glioma cell lines

    Óscar Álzate

    2006-01-01

    Full Text Available Malignant gliomas are heterogeneous, highly invasive vascular tumours. The multifunctional cytokine, transforming growth factor-beta (TGF-P, is expressed by grade III/IV gliomas and promotes tumour angiogenesis, invasión and immune escape. It has been shown previously that a small TGF-P receptor type I (TGF-(3-RI molecule inhibitor (SB-431542 blocks TGF-(3-mediated signal transduction, induction of angiogenic factor expression and cellular motility. As glioma cell lines display differential sensitivity to TGF-P, it was expected that they would also be differentially impacted by disruption of TGF-P signalling. Differential in gel expression (DIGE analysis and mass spectrometry was used in this work for determining protein regulation effects of both TGF-P and SB-431542 on human glioma cell lines. It was found that pericentrin B and non muscle myosin were differentially expressed in fragments which likely resulted from protease activation by the tumour growth mechanism. These results suggest that both pericentrin B and non-muscle myosin might be potential glioma biomarkers. Key words: DIGE, proteomics, glioma, TGF-P, mass spectrometry, non muscle myosin, pericentrin B.

  7. Rosiglitazone attenuates the metalloprotease/anti-metalloprotease imbalance in emphysema induced by cigarette smoke: involvement of extracellular signal-regulated kinase and NFκB signaling

    Hou G

    2015-04-01

    Full Text Available Gang Hou, Yan Yin, Dan Han, Qiu-yue Wang, Jian Kang Department of Respiratory Medicine, the First Hospital of China Medical University, Shenyang, People’s Republic of China Objective: We investigated how rosiglitazone attenuated cigarette smoke (CS-induced emphysema in a rat model. In particular, we focused on its possible effects on the imbalance between metalloprotease (MMP and anti-MMP activity, mitogen-activated protein kinase (MAPK phosphorylation, and nuclear factor kappa-light-chain-enhancer of activated B cell (NFκB signaling pathway over-activation.Methods: A total of 36 Wistar rats were divided into three groups (n=12 each: animals were exposed to CS for 12 weeks in the absence (the CS group or presence of 30 mg/kg rosiglitazone (the rosiglitazone-CS [RCS] group; a control group was treated with the rosiglitazone vehicle only, without any CS exposure. Histopathology of lung tissue in all groups was evaluated to grade severity of the disease. Expression levels of peroxisome proliferator-activated receptor γ (PPARγ, MMP2, and MMP9 in lung tissue were determined and compared using Western blotting and immunohistochemistry. Activation of MAPKs, NFκB, and the nuclear factor of kappa light polypeptide gene enhancer in B-cell inhibitor, alpha (IκBα phosphorylation in lung tissue was examined by Western blotting.Results: Emphysema-related pathology, based on inter-alveolar wall distance and alveolar density, was less severe in the RCS group than in the CS group. Compared with the CS group, levels of PPARγ were higher in the RCS group, and levels of MMP2 and MMP9 proteins were lower in the RCS rats. Levels of activated MAPKs and NFκB were also lower, while the IκBαphosphorylation was increased in the lung tissue of RCS rats.Conclusion: Our findings suggest that oral administration of rosiglitazone attenuates the metalloprotease activity induced by CS, and the underlying mechanism might involve the activation of signaling pathways

  8. Power lines and birds. A summary of general and grid-specific issues; Kraftledninger og fugl. Oppsummering av generelle og nettspesifikke prob-lemstillinger

    Bevanger, Kjetil

    2011-02-15

    To achieve European-level policy goals on climate change challenges, as well securing the electricity supply within Norway, it will be necessary to increase power line construction efforts significantly, as well as to upgrade the existing grid. Statnett have estimated an approximately 40 billion NOK investment over the next 10 years will be required for the central grid. Although this is a huge investment, the length of the new transmission lines constructed will only comprise a small part of the Norwegian grid. Of approximately 193 000 km of overhead power lines in Norway the distribution grid (i.e. up to 24 kV) comprises 85%. In this report we discuss the ornithological challenges connected to the different elements of the Norwegian grid. All overhead wires pose a potential risk to flying birds; however, the risk increases with the number of lines and wire length per unit of land area. The central and regional grid, in general, represents no electrocution threat, as the distances between the phase conductors and/or the distance between a phase conductor and an earthed device is rather wide. Thus the electrocution problem is a distribution grid specific problem. Both the collision and the electrocution risk are highly species specific problems. Over the last years several research projects have collected data enabling an identification of the bird species and bird species groups facing a particular risk. However, there is still a lack of know-ledge in several respects, for example why the number of collisions is not evenly distributed along a power line section, but is frequently concentrated at a few spots. This type of knowledge is crucial to contribute to the selection of as environmentally friendly power line routing as possible when new power lines are constructed. This is also stressed in the new Energy Act of 2009. With respect to both upgrading, and to new power line constructions, underground cabling should be used to a much greater extent. This will

  9. Project W-314 specific test and evaluation plan for SN-633 transfer line (241-AX-B to 241-AY-02A)

    Hays, W.H.

    1998-01-01

    The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made by the addition of the SN-633 transfer line by the W-314 Project. The STEP develops the outline for test procedures that verify the system's performance to the established Project design criteria. The STEP is a lower tier document based on the W-314 Test and Evaluation Plan (TEP). This STEP encompasses all testing activities required to demonstrate compliance to the project design criteria as it relates to the addition of transfer line SN-633. The Project Design Specifications (PDS) identify the specific testing activities required for the Project. Testing includes Validations and Verifications (e.g., Commercial Grade Item Dedication activities), Factory Acceptance Tests (FATs), installation tests and inspections, Construction Acceptance Tests (CATs), Acceptance Test Procedures (ATPs), Pre-Operational Test Procedures (POTPs), and Operational Test Procedures (OTPs). It should be noted that POTPs are not required for testing of the transfer line addition. The STEP will be utilized in conjunction with the TEP for verification and validation

  10. First line treatment of advanced non-small-cell lung cancer – specific focus on albumin bound paclitaxel

    Gupta N

    2013-12-01

    Full Text Available Neha Gupta, Hassan Hatoum, Grace K DyDepartment of Medicine, Roswell Park Cancer Institute, Buffalo, NY, USAAbstract: Lung cancer is the leading cause of cancer mortality worldwide in both men and women. Non-small-cell lung cancer (NSCLC is the most common type of lung cancer, accounting for more than 80% of cases. Paclitaxel has a broad spectrum of activity against various malignancies, including NSCLC. Paclitaxel is poorly soluble in water and thus, until recently, its commercially available preparations contained a non-ionic solvent Cremophor EL®. Cremophor EL® improves the solubility of paclitaxel and allows its intravenous administration. However, certain side-effects associated with paclitaxel, such as hypersensitivity reactions, myelosuppression, and peripheral neuropathy, are known to be worsened by Cremophor®. Nanoparticle albumin-bound paclitaxel ([nab-paclitaxel] ABRAXANE® ABI-007 is a new generation formulation of paclitaxel that obviates the need for Cremophor®, resulting in a safer and faster infusion without requiring the use of premedications to avoid hypersensitivity. Albumin-binding receptor-mediated delivery and lack of sequestering Cremophor® micelles allow higher intratumoral concentration of pharmacologically active paclitaxel. Multiple clinical trials have demonstrated a superior tolerability profile of nab-paclitaxel in comparison to solvent-bound paclitaxel (sb-paclitaxel. A recent Phase III trial compared the effects of weekly nab-paclitaxel in combination with carboplatin versus sb-paclitaxel in combination with carboplatin given every 3 weeks for first line treatment of NSCLC. This trial highlights the weekly nab-paclitaxel combination as an alternate treatment option for NSCLC, with higher response rate in squamous cell NSCLC and longer survival in elderly patients. This review will focus on the properties of nab-paclitaxel and its use in the first line treatment of NSCLC.Keywords: ABI-007, Abraxane, nab

  11. Fidaxomicin versus Vancomycin as a First-Line Treatment for Clostridium difficile-Associated Diarrhea in Specific Patient Populations: A Pharmacoeconomic Evaluation.

    Reveles, Kelly R; Backo, Jennifer L; Corvino, Frank A; Zivkovic, Marko; Broderick, Kelly C

    2017-12-01

    The reduction in recurrent Clostridium difficile-associated diarrhea (CDAD) with fidaxomicin therapy may reduce hospital readmissions and lead to lower overall CDAD costs. However, studies assessing the cost-effectiveness of fidaxomicin as first-line therapy from the U.S. hospital perspective are lacking. This study evaluated the costs associated with utilizing fidaxomicin or vancomycin as a first-line therapy for CDAD in specific patient populations from a U.S. hospital perspective. A decision-analytic model was developed to estimate total costs (hospitalization and drug costs) associated with using fidaxomicin or vancomycin as first-line therapy for a first episode and up to two recurrences of CDAD in five patient populations: general population, elderly, patients receiving concomitant antibiotics, and patients with renal impairment or cancer. The total cost of CDAD treatment using fidaxomicin first line in the general population was $14,442 per patient versus $14,179 per patient with vancomycin first line. In subgroup analyses, fidaxomicin use resulted in total hospital cost savings of $616 per patient in patients with cancer and $312 in patients with concomitant antibiotic use; vancomycin use was associated with total hospital cost savings of $243 per patient in the elderly and $371 in patients with renal impairment. Fidaxomicin as first-line CDAD therapy is associated with similar total costs as compounded vancomycin oral solution in the general population. In elderly and renally impaired patients, slight increases in hospital cost were observed with fidaxomicin therapy, and in patients with cancer or concomitant antibiotic use, hospital cost savings were observed. © 2017 Pharmacotherapy Publications, Inc.

  12. Extracellular concentration of homocysteine in human cell lines is influenced by specific inhibitors of cyst(e)ine transport.

    Hultberg, Björn

    2004-04-01

    Despite the growing evidence that plasma homocysteine is a cardiovascular risk factor, the mechanism behind the vascular injuries is still unknown. Studies of the cellular uptake systems for homocysteine are scarce, but membrane transporters of cyst(e)ine seem to be involved. In the present study the cellular uptake of extracellular homocysteine in HeLa and hepatoma cell lines is investigated by using several different transport inhibitors for cellular uptake of cyst(e)ine. It is shown that systems A and Xc- are the main transport systems for homocysteine uptake in HeLa cells. It is also confirmed that the magnitude of homocysteine uptake in hepatoma cells is lower than in HeLa cells. However, in the presence of high amounts of extracellular homocysteine both cell types exhibited a high elimination of homocysteine, which was inhibited by the presence of inhibitors of systems A or Xc-. It is possible that there is normally a high turnover of homocysteine in cell cultures, which is not detected by occasional determinations of homocysteine concentrations. The complex pattern of homocysteine production, release, uptake and distribution between different cells in the body is important to examine further in order to possibly be able to modulate the elimination of homocysteine from circulation and thereby lower the risk of cardiovascular disease.

  13. Tissue-specific signatures in the transcriptional response to Anaplasma phagocytophilum infection of Ixodes scapularis and Ixodes ricinus tick cell lines

    Pilar eAlberdi

    2016-02-01

    Full Text Available Anaplasma phagocytophilum are transmitted by Ixodes spp. ticks and have become one of the most common and relevant tick-borne pathogens due to their impact on human and animal health. Recent results have increased our understanding of the molecular interactions between Ixodes scapularis and A. phagocytophilum through the demonstration of tissue-specific molecular pathways that ensure pathogen infection, development and transmission by ticks. However, little is known about the Ixodes ricinus genes and proteins involved in the response to A. phagocytophilum infection. The tick species I. scapularis and I. ricinus are evolutionarily closely related and therefore similar responses are expected in A. phagocytophilum-infected cells. However, differences may exist between I. scapularis ISE6 and I. ricinus IRE/CTVM20 tick cells associated with tissue-specific signatures of these cell lines. To address this hypothesis, the transcriptional response to A. phagocytophilum infection was characterized by RNA sequencing and compared between I. scapularis ISE6 and I. ricinus IRE/CTVM20 tick cell lines. The transcriptional response to infection of I. scapularis ISE6 cells resembled that of tick hemocytes while the response in I. ricinus IRE/CTVM20 cells was more closely related to that reported previously in infected tick midguts. The inhibition of cell apoptosis by A. phagocytophilum appears to be a key adaptation mechanism to facilitate infection of both vertebrate and tick cells and was used to investigate further the tissue-specific response of tick cell lines to pathogen infection. The results supported a role for the intrinsic pathway in the inhibition of cell apoptosis by A. phagocytophilum infection of I. scapularis ISE6 cells. In contrast, the results in I. ricinus IRE/CTVM20 cells were similar to those obtained in tick midguts and suggested a role for the JAK/STAT pathway in the inhibition of apoptosis in tick cells infected with A. phagocytophilum

  14. Effects of Rosiglitazone on the Expression of PPAR-γ and the ...

    Erah

    2011-03-15

    Mar 15, 2011 ... and the Production of IL-6 and IL-8 in Acute Lung. Injury Model ... pathophysiology of ALI [2,3]. Peroxisome .... view in the pathophysiologic mechanism of. ALI is that it is a ... DNA synthesis in breast cancer-derived cell lines.

  15. The influence of specific mechanical energy on cornmeal viscosity measured by an on-line system during twin-screw extrusion

    CHANG, Y. K.; MARTINEZ-BUSTOS, F.; PARK, T. S.; KOKINI, J .L.

    1999-01-01

    The influence of specific mechanical energy (SME) on cornmeal viscosity during the twin-screw extrusion at feed moisture contents of 25 and 30% and screw speeds in the range from 100 to 500 rpm was measured. Cornmeal was extruded in a co-rotating, intermeshing twin-screw coupled to a slit die rheometer. One approach to the on-line rheological measurement is to use a slit die with the extruder. In the present work it was show that shear viscosity decreased as a function of SME. The viscosity o...

  16. Two new routes to make blood: Hematopoietic specification from pluripotent cell lines versus reprogramming of somatic cells.

    Singbrant, Sofie; van Galen, Peter; Lucas, Daniel; Challen, Grant; Rossi, Derrick J; Daley, George Q

    2015-09-01

    Transplantation of hematopoietic stem cells (HSCs) to treat hematologic disorders is routinely used in the clinic. However, HSC therapy is hindered by the requirements of finding human leukocyte antigen (HLA)-matched donors and attaining sufficient numbers of long-term HSCs in the graft. Therefore, ex vivo expansion of transplantable HSCs remains one of the "holy grails" of hematology. Without the ability to maintain and expand human HSCs in vitro, two complementary approaches involving cellular reprogramming to generate transplantable HSCs have emerged. Reprogrammed HSCs represent a potentially inexhaustible supply of autologous tissue. On March 18th, 2015, Dr. George Q. Daley and Dr. Derrick J. Rossi, two pioneers in the field, presented and discussed their most recent research on these topics in a webinar organized by the International Society for Experimental Hematology (ISEH). Here, we summarize these seminars and discuss the possibilities and challenges in the field of hematopoietic specification. Copyright © 2015 ISEH - International Society for Experimental Hematology. Published by Elsevier Inc. All rights reserved.

  17. Assembled genomic and tissue-specific transcriptomic data resources for two genetically distinct lines of Cowpea ( Vigna unguiculata (L.) Walp).

    Spriggs, Andrew; Henderson, Steven T; Hand, Melanie L; Johnson, Susan D; Taylor, Jennifer M; Koltunow, Anna

    2018-02-09

    Cowpea ( Vigna unguiculata (L.) Walp) is an important legume crop for food security in areas of low-input and smallholder farming throughout Africa and Asia. Genetic improvements are required to increase yield and resilience to biotic and abiotic stress and to enhance cowpea crop performance. An integrated cowpea genomic and gene expression data resource has the potential to greatly accelerate breeding and the delivery of novel genetic traits for cowpea. Extensive genomic resources for cowpea have been absent from the public domain; however, a recent early release reference genome for IT97K-499-35 ( Vigna unguiculata  v1.0, NSF, UCR, USAID, DOE-JGI, http://phytozome.jgi.doe.gov/) has now been established in a collaboration between the Joint Genome Institute (JGI) and University California (UC) Riverside. Here we release supporting genomic and transcriptomic data for IT97K-499-35 and a second transformable cowpea variety, IT86D-1010. The transcriptome resource includes six tissue-specific datasets for each variety, with particular emphasis on reproductive tissues that extend and support the V. unguiculata v1.0 reference. Annotations have been included in our resource to allow direct mapping to the v1.0 cowpea reference. Access to this resource provided here is supported by raw and assembled data downloads.

  18. Experiment Operating Specification for the Semiscale MOD-2C feedwater and steam line break experiment series. Appendix S-FS-6 and 7

    Boucher, T.J.; Owca, W.A.

    1985-05-01

    This document is the Semiscale MOD-2C feedwater and steam line break experiment series Experiment Operating Specification Appendix for tests S-FS-6 and S-FS-7. Test S-FS-6 is the third test in the series and simulates a 100% break in a steam generator bottom feedwater line downstream of the check valve accompanied by compounding factors (such as check valve failure, loss-of-offsite power at SIS and SIS delayed until low steam generator pressure signal). The test is terminated after plant stabilization and recovery procedures including unaffected loop steam and feed, pressurizer heater operation, pressurizer auxiliary spray operation, and normal charging/letdown operation. Test S-FS-7 is the fourth test in the series and simulates a 14.3% break in a steam generator bottom feedwater line downstream of the check valve, accompanied by compounding factors. The test is terminated after plant stabilization procedures including unaffected loop steam and feed, pressurizer heater operation, and normal charging/letdown operation. The test was followed by an affected loop secondary refill after isolating the break. The Appendix contains information on the major fluid systems, initial experiment conditions, experiment boundary conditions, and sequence of experiment events. Also included is a discussion of the scaling criteria and philosophy used to develop the experiment initial and boundary conditions and system configuration

  19. Cancer-specific SNPs originate from low-level heteroplasmic variants in human mitochondrial genomes of a matched cell line pair.

    Hedberg, Annica; Knutsen, Erik; Løvhaugen, Anne Silje; Jørgensen, Tor Erik; Perander, Maria; Johansen, Steinar D

    2018-04-19

    Low-level mitochondrial heteroplasmy is a common phenomenon in both normal and cancer cells. Here, we investigate the link between low-level heteroplasmy and mitogenome mutations in a human breast cancer matched cell line by high-throughput sequencing. We identified 23 heteroplasmic sites, of which 15 were common between normal cells (Hs578Bst) and cancer cells (Hs578T). Most sites were clustered within the highly conserved Complex IV and ribosomal RNA genes. Two heteroplasmic variants in normal cells were found as fixed mutations in cancer cells. This indicates a positive selection of these variants in cancer cells. RNA-Seq analysis identified upregulated L-strand specific transcripts in cancer cells, which include three mitochondrial long non-coding RNA molecules. We hypothesize that this is due to two cancer cell-specific mutations in the control region.

  20. Beneficial effects of co-enzyme Q10 and rosiglitazone in fructose-induced metabolic syndrome in rats

    Suzan M. Mansour

    2013-06-01

    Full Text Available Increased fructose consumption is strongly associated with metabolic syndrome (MS. This study was performed to elucidate the role of co-enzyme Q10 (CoQ and/or rosiglitazone (Rosi in fructose induced MS. Four groups of rats (n = 8–10 were fed on fructose-enriched diet (FED for 16 weeks. One served as FED-control while the remaining groups were treated with CoQ (10 mg/kg/day, Rosi (4 mg/kg/day or their combination during the last 6 weeks. Another group was fed on normal laboratory chow (normal control. At the end of the experiment, blood samples were collected for estimation of markers related to MS. In addition, histological examination of liver, kidney and pancreas samples was done. Induction of the MS was associated with increased body weight gain (34% coupled with elevated levels of blood glucose (48%, insulin (86%, insulin resistance (270%, uric acid (69%, urea (155%, creatinine (129% and blood lipids with different degrees. Fructose-induced MS also reduced plasma catalase (62% and glutathione peroxidase (89% activities parallel to increased serum leptin and tumor necrosis factor-alpha (TNF-α levels. These changes were coupled by marked histological changes in the examined tissues. Treatment with CoQ or Rosi attenuated most of MS-induced changes. Besides, the combination of both agents further reduced blood glucose, total cholesterol, triglycerides and urea levels, as well as, normalized serum levels of leptin and TNF-α. In addition, combined therapy of both agents elevated HDL-cholesterol level and glutathione peroxidase activity. In conclusion, the present study proves the benefits of co-supplementation of CoQ and Rosi in a fructose-induced model of insulin resistance.

  1. Rosiglitazone Affects Nitric Oxide Synthases and Improves Renal Outcome in a Rat Model of Severe Ischemia/Reperfusion Injury

    Boris Betz

    2012-01-01

    Full Text Available Background. Nitric oxide (NO-signal transduction plays an important role in renal ischemia/reperfusion (I/R injury. NO produced by endothelial NO-synthase (eNOS has protective functions whereas NO from inducible NO-synthase (iNOS induces impairment. Rosiglitazone (RGZ, a peroxisome proliferator-activated receptor (PPAR-γ agonist exerted beneficial effects after renal I/R injury, so we investigated whether this might be causally linked with NOS imbalance. Methods. RGZ (5 mg/kg was administered i.p. to SD-rats (f subjected to bilateral renal ischemia (60 min. Following 24 h of reperfusion, inulin- and PAH-clearance as well as PAH-net secretion were determined. Morphological alterations were graded by histopathological scoring. Plasma NOx-production was measured. eNOS and iNOS expression was analyzed by qPCR. Cleaved caspase 3 (CC3 was determined as an apoptosis indicator and ED1 as a marker of macrophage infiltration in renal tissue. Results. RGZ improves renal function after renal I/R injury (PAH-/inulin-clearance, PAH-net secretion and reduces histomorphological injury. Additionally, RGZ reduces NOx plasma levels, ED-1 positive cell infiltration and CC3 expression. iNOS-mRNA is reduced whereas eNOS-mRNA is increased by RGZ. Conclusion. RGZ has protective properties after severe renal I/R injury. Alterations of the NO pathway regarding eNOS and iNOS could be an explanation of the underlying mechanism of RGZ protection in renal I/R injury.

  2. Activation of peroxisome proliferator-activated receptor gamma by rosiglitazone increases sirt6 expression and ameliorates hepatic steatosis in rats.

    Soo Jin Yang

    Full Text Available BACKGROUND: Sirt6 has been implicated in the regulation of hepatic lipid metabolism and the development of hepatic steatosis. The aim of this study was to address the potential role of Sirt6 in the protective effects of rosiglitazone (RGZ on hepatic steatosis. METHODS: To investigate the effect of RGZ on hepatic steatosis, rats were treated with RGZ (4 mg·kg⁻¹·day⁻¹ by stomach gavage for 6 weeks. The involvement of Sirt6 in the RGZ's regulation was evaluated by Sirt6 knockdown in AML12 mouse hepatocytes. RESULTS: RGZ treatment ameliorated hepatic lipid accumulation and increased expression of Sirt6, peroxisome proliferator-activated receptor gamma coactivtor-1-α (Ppargc1a/PGC1-α and Forkhead box O1 (Foxo1 in rat livers. AMP-activated protein kinase (AMPK phosphorylation was also increased by RGZ, accompanied by alterations in phosphorylation of LKB1. Interestingly, in free fatty acid-treated cells, Sirt6 knockdown increased hepatocyte lipid accumulation measured as increased triglyceride contents (p = 0.035, suggesting that Sirt6 may be beneficial in reducing hepatic fat accumulation. In addition, Sirt6 knockdown abolished the effects of RGZ on hepatocyte fat accumulation, mRNA and protein expression of Ppargc1a/PGC1-α and Foxo1, and phosphorylation levels of LKB1 and AMPK, suggesting that Sirt6 is involved in RGZ-mediated metabolic effects. CONCLUSION: Our results demonstrate that RGZ significantly decreased hepatic lipid accumulation, and that this process appeared to be mediated by the activation of the Sirt6-AMPK pathway. We propose Sirt6 as a possible therapeutic target for hepatic steatosis.

  3. Improvement of the design and generation of highly specific plant knockdown lines using primary synthetic microRNAs (pri-smiRNAs

    Alves Leonardo

    2010-03-01

    Full Text Available Abstract Background microRNAs (miRNAs are endogenous small non-coding RNAs that post-transcriptionally regulate gene expression. In plants, they typically show high complementarity to a single sequence motif within their target mRNAs and act by catalyzing specific mRNA cleavage and degradation. miRNAs are processed from much longer primary transcripts via precursor miRNAs containing fold-back structures. Leaving these secondary structures intact, miRNAs can be re-designed experimentally to target mRNAs of choice. Results We designed primary synthetic miRNAs (pri-smiRNAs on the basis of the primary transcript of the Arabidopsis MIR159A gene by replacing the original miR159a and the corresponding miR159a* with novel sequences, keeping the overall secondary structure as predicted by the program RNAfold. We used the program RNAhybrid to optimize smiRNA design and to screen the complete Arabidopsis transcriptome for potential off-targets. To improve the molecular cloning of the pri-smiRNA we inserted restriction sites in the original MIR159A primary transcript to easily accommodate the smiRNA/smiRNA* DNA fragment. As a proof-of-concept, we targeted the single gene encoding chalcone synthase (CHS in Arabidopsis. We demonstrate smiRNA(CHS expression and CHS mRNA cleavage in different transgenic lines. Phenotypic changes in these lines were observed for seed color and flavonol derivatives, and quantified with respect to anthocyanin content. We also tested the effect of mismatches and excess G:U base pairs on knockdown efficiency. Conclusions RNAhybrid-assisted design of smiRNAs and generation of pri-smiRNAs using a novel vector containing restriction sites greatly improves specificity and speed of the generation of stable knockdown lines for functional analyses in plants.

  4. Pan-cancer stratification of solid human epithelial tumors and cancer cell lines reveals commonalities and tissue-specific features of the CpG island methylator phenotype.

    Sánchez-Vega, Francisco; Gotea, Valer; Margolin, Gennady; Elnitski, Laura

    2015-01-01

    The term CpG island methylator phenotype (CIMP) has been used to describe widespread DNA hypermethylation at CpG-rich genomic regions affecting clinically distinct subsets of cancer patients. Even though there have been numerous studies of CIMP in individual cancer types, a uniform analysis across tissues is still lacking. We analyze genome-wide patterns of CpG island hypermethylation in 5,253 solid epithelial tumors from 15 cancer types from TCGA and 23 cancer cell lines from ENCODE. We identify differentially methylated loci that define CIMP+ and CIMP- samples, and we use unsupervised clustering to provide a robust molecular stratification of tumor methylomes for 12 cancer types and all cancer cell lines. With a minimal set of 89 discriminative loci, we demonstrate accurate pan-cancer separation of the 12 CIMP+/- subpopulations, based on their average levels of methylation. Tumor samples in different CIMP subclasses show distinctive correlations with gene expression profiles and recurrence of somatic mutations, copy number variations, and epigenetic silencing. Enrichment analyses indicate shared canonical pathways and upstream regulators for CIMP-targeted regions across cancer types. Furthermore, genomic alterations showing consistent associations with CIMP+/- status include genes involved in DNA repair, chromatin remodeling genes, and several histone methyltransferases. Associations of CIMP status with specific clinical features, including overall survival in several cancer types, highlight the importance of the CIMP+/- designation for individual tumor evaluation and personalized medicine. We present a comprehensive computational study of CIMP that reveals pan-cancer commonalities and tissue-specific differences underlying concurrent hypermethylation of CpG islands across tumors. Our stratification of solid tumors and cancer cell lines based on CIMP status is data-driven and agnostic to tumor type by design, which protects against known biases that have hindered

  5. Tissue- and Cell-Specific Cytokinin Activity in Populus × canescens Monitored by ARR5::GUS Reporter Lines in Summer and Winter.

    Paul, Shanty; Wildhagen, Henning; Janz, Dennis; Teichmann, Thomas; Hänsch, Robert; Polle, Andrea

    2016-01-01

    Cytokinins play an important role in vascular development. But knowledge on the cellular localization of this growth hormone in the stem and other organs of woody plants is lacking. The main focus of this study was to investigate the occurrence and cellular localization of active cytokinins in leaves, roots, and along the stem of Populus × canescens and to find out how the pattern is changed between summer and winter. An ARR5::GUS reporter construct was used to monitor distribution of active cytokinins in different tissues of transgenic poplar lines. Three transgenic lines tested under outdoor conditions showed no influence of ARR5::GUS reporter construct on the growth performance compared with the wild-type, but one line lost the reporter activity. ARR5::GUS activity indicated changes in the tissue- and cell type-specific pattern of cytokinin activity during dormancy compared with the growth phase. ARR5::GUS activity, which was present in the root tips in the growing season, disappeared in winter. In the stem apex ground tissue, ARR5::GUS activity was higher in winter than in summer. Immature leaves from tissue-culture grown plants showed inducible ARR5::GUS activity. Leaf primordia in summer showed ARR5::GUS activity, but not the expanded leaves of outdoor plants or leaf primordia in winter. In stem cross sections, the most prominent ARR5::GUS activity was detected in the cortex region and in the rays of bark in summer and in winter. In the cambial zone the ARR5::GUS activity was more pronounced in the dormant than in growth phase. The pith and the ray cells adjacent to the vessels also displayed ARR5::GUS activity. In silico analyses of the tissue-specific expression patterns of the whole PtRR type-A family of poplar showed that PtRR10, the closest ortholog to the Arabidopsis ARR5 gene, was usually the most highly expressed gene in all tissues. In conclusion, gene expression and tissue-localization indicate high activity of cytokinins not only in summer, but

  6. Icotinib, a potent and specific EGFR tyrosine kinase inhibitor, inhibits growth of squamous cell carcinoma cell line A431 through negatively regulating AKT signaling.

    Gao, Zhenzhen; Chen, Wei; Zhang, Xiaohua; Cai, Peifen; Fang, Xianying; Xu, Qiang; Sun, Yang; Gu, Yanhong

    2013-06-01

    Icotinib is a potent and specific epidermal growth factor receptor tyrosine kinase inhibitor. In this study, we reported that icotinib had the antitumor activity on human squamous cell carcinoma cell line A431 in vitro. Meanwhile, adhesion to fibronectin and expression of integrin α3 and β1 were significantly reduced in a dose-dependent manner after the treatment of icotinib. Moreover, icotinib induced cell cycle arrested and affected expression of various cell cycle related proteins in squamous cancer cell line A431, whereas it did not cause apoptosis. Furthermore, icotinib remarkably down-regulated phosphorylation of protein kinase B (AKT) though blocking the interaction between 3-phosphoinositide-dependent protein kinase-1 (PDK1) and AKT in A431 cells. Taken together, it is shown that the small molecular compound, icotinib, has an anti-squamous cell carcinoma activity in vitro and its antitumor mechanism is associated with the blockage of the interaction between PDK1 and AKT. These results provide a novel strategy for anti-squamous cell carcinoma therapy. Copyright © 2013 Elsevier Masson SAS. All rights reserved.

  7. Mitochondrial Alterations by PARKIN in Dopaminergic Neurons Using PARK2 Patient-Specific and PARK2 Knockout Isogenic iPSC Lines

    Atossa Shaltouki

    2015-05-01

    Full Text Available In this study, we used patient-specific and isogenic PARK2-induced pluripotent stem cells (iPSCs to show that mutations in PARK2 alter neuronal proliferation. The percentage of TH+ neurons was decreased in Parkinson’s disease (PD patient-derived neurons carrying various mutations in PARK2 compared with an age-matched control subject. This reduction was accompanied by alterations in mitochondrial:cell volume fraction (mitochondrial volume fraction. The same phenotype was confirmed in isogenic PARK2 null lines. The mitochondrial phenotype was also seen in non-midbrain neurons differentiated from the PARK2 null line, as was the functional phenotype of reduced proliferation in culture. Whole genome expression profiling at various stages of differentiation confirmed the mitochondrial phenotype and identified pathways altered by PARK2 dysfunction that include PD-related genes. Our results are consistent with current model of PARK2 function where damaged mitochondria are targeted for degradation via a PARK2/PINK1-mediated mechanism.

  8. Inheritance of resistance to watermelon mosaic virus in the cucumber line TMG-1: tissue-specific expression and relationship to zucchini yellow mosaic virus resistance.

    Wai, T; Grumet, R

    1995-09-01

    The inbred cucumber (Cucumis sativus L.) line TMG-1 is resistant to three potyviruses:zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus (WMV), and the watermelon strain of papaya ringspot virus (PRSV-W). The genetics of resistance to WMV and the relationship of WMV resistance to ZYMV resistance were examined. TMG-1 was crossed with WI-2757, a susceptible inbred line. F1, F2 and backcross progeny populations were screened for resistance to WMV and/or ZYMV. Two independently assorting factors conferred resistance to WMV. One resistance was conferred by a single recessive gene from TMG-1 (wmv-2). The second resistance was conferred by an epistatic interaction between a second recessive gene from TMG-1 (wmv-3) and either a dominant gene from WI-2757 (Wmv-4) or a third recessive gene from TMG-1 (wmv-4) located 20-30 cM from wmv-3. The two resistances exhibited tissue-specific expression. Resistance conferred by wmv-2 was expressed in the cotyledons and throughout the plant. Resistance conferred by wmv-3 + Wmv-4 (or wmv-4) was expressed only in true leaves. The gene conferring resistance to ZYMV appeared to be the same as, or tightly linked to one of the WMV resistance genes, wmv-3.

  9. Study of verification and validation of standard welding procedure specifications guidelines for API 5L X-70 grade line pipe welding

    Qazi H. A. A.

    2017-12-01

    Full Text Available Verification and validation of welding procedure specifications for X-70 grade line pipe welding was performed as per clause 8.2, Annexure B and D of API 5L, 45th Edition to check weld integrity in its future application conditions. Hot rolled coils were imported from China, de-coiling, strip edge milling, three roller bending to from pipe, inside and outside submerged arc welding of pipe, online ultrasonic testing of weld, HAZ and pipe body, cutting at fixed random length of pipe, visual inspection of pipe, Fluoroscopic inspection of pipe, welding procedure qualification test pieces marking at weld portion of the pipe, tensile testing, guided bend testing, CVN Impact testing were performed. Detailed study was conducted to explore possible explanations and variation in mechanical properties, WPS is examined and qualified as per API 5L 45th Edition.

  10. Application of a Reverse Line Blot hybridisation assay for the species-specific identification of cyathostomins (Nematoda, Strongylida) from benzimidazole-treated horses in the Slovak Republic.

    Cernanská, Dana; Paoletti, Barbara; Králová-Hromadová, Ivica; Iorio, Raffaella; Cudeková, Patrícia; Milillo, Piermarino; Traversa, Donato

    2009-03-09

    Five horse farms located in eastern Slovakia were investigated for the presence of benzimidazole-resistant strongyles by faecal egg count reduction test and egg hatch assay. Coprocultures were prepared for each farm from faecal samples taken pre- and post-treatment and harvested larvae were molecularly examined with a Reverse Line Blot assay. Faecal egg count reduction values ranged from 0 to 52.5% and all farms were positive for benzimidazole-resistant cyathostomins. Seven benzimidazole-resistant cyathostomin species were molecularly identified on farms before and also after treatment. These data demonstrate that resistance to benzimidazoles is well established in cyathostomin populations from horse farms in the Slovak Republic and that the molecular assay was able to determine the species-specific distribution of resistant cyathostomins under field conditions.

  11. The role of genetic variants in CYP2C8, LPIN1, PPARGC1A and PPARγ on the trough steady-state plasma concentrations of rosiglitazone and on glycosylated haemoglobin A1c in type 2 diabetes

    Stage, Tore B; Christensen, Mette M H; Feddersen, Søren

    2013-01-01

    OBJECTIVE: The aim of this study was to examine the effect of single nucleotide polymorphisms in CYP2C8, LPIN1, PPARGC1A and PPARγ on rosiglitazone's (i) trough steady-state plasma concentration (C(ss,min)), (ii) on glycosylated haemoglobin A1c (HbA1c) and (iii) the risk of developing adverse eve...

  12. Park Facilities, Boundaries were determined from parcel mapping lines & site specific items, such as shelter locations, were obtained by field GPS observation, Published in 2010, Not Applicable scale, Chippewa County Government.

    NSGIC Local Govt | GIS Inventory — Park Facilities dataset current as of 2010. Boundaries were determined from parcel mapping lines & site specific items, such as shelter locations, were obtained...

  13. Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

    Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

    2016-01-01

    In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

  14. The effects of estrogen receptors α- and β-specific agonists and antagonists on cell proliferation and energy metabolism in human bone cell line.

    Somjen, D; Katzburg, S; Sharon, O; Grafi-Cohen, M; Knoll, E; Stern, N

    2011-02-01

    In cultured human osteoblasts estradiol-17β (E2) modulated DNA synthesis, the specific activity of creatine kinase BB (CK), 12 and 15 lipoxygenase (LO) mRNA expression and formation of 12- and 15-hydroxyeicosatetraenoic acid (HETE). We now investigate the response of human bone cell line (SaOS2) to phytoestrogens and estrogen receptors (ER)-specific agonists and antagonists. Treatment of SaSO2 with E2, 2,3-bis (4-hydroxyphenyl)-propionitrile (DPN; ERβ-specific agonist), 4,4',4″-[4-propyl-(1H)-pyrazol-1,3,5-triyl] tris-phenol (PPT; ERα-specific agonist), biochainin A (BA), daidzein (D), genistein (G) and raloxifene (Ral) showed increased DNA synthesis and CK. Ral inhibited completely all stimulations except DPN and to some extent D. The ERα-specific antagonist methyl-piperidino-pyrazole (MPP) and the ERβ-specific antagonist 4-[2-phenyl-5,7-bis (tri-fluoro-methyl) pyrazolo [1,5-a]pyrimidin-3-yl] phenol (PTHPP) inhibited DNA synthesis, CK and reactive oxygen species (ROS) formation induced by estrogens according to their receptors affinity. The LO inhibitor baicaleine inhibited only E2, DPN and G's effects. E2 and Ral unlike all other compounds had no effect on ERα mRNA expression, while ERβ mRNA expression was stimulated by all compounds. All compounds modulated the expression of 12LO and 15LO mRNA, except E2, PPT and Ral for 12LO, and 12- and 15-HETE productions and stimulated ROS formation which was inhibited by NADPH oxidase inhibitors diphenyleneiodonium chloride (DPI) and N-acetyl cysteine and the estrogen inhibitor ICI. DPI did not affect hormonal-induced DNA and CK. In conclusion, we provide evidence for the separation of mediation via ERα and ERβ pathways in the effects of estrogenic compounds on osteoblasts, but the role of LO/HETE/ROS is unclear. Copyright © 2010 Wiley-Liss, Inc.

  15. Sequence-specific inhibition of microRNA-130a gene by CRISPR/Cas9 system in breast cancer cell line

    Ainina Abdollah, Nur; Das Kumitaa, Theva; Yusof Narazah, Mohd; Razak, Siti Razila Abdul

    2017-05-01

    MicroRNAs (miRNAs) are short stranded noncoding RNA that play important roles in apoptosis, cell survival, development and cell proliferation. However, gene expression control via small regulatory RNA, particularly miRNA in breast cancer is still less explored. Therefore, this project aims to develop an approach to target microRNA-130a using the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system in MCF7, breast cancer cell line. The 20 bp sequences target at stem loop, 3ʹ and 5ʹ end of miR130a were cloned into pSpCas9(BB)-2A-GFP (PX458) plasmid, and the positive clones were confirmed by sequencing. A total of 5 μg of PX458-miR130a was transfected to MCF7 using Lipofectamine® 3000 according to manufacturer’s protocol. The transfected cells were maintained in the incubator at 37 °C under humidified 5% CO2. After 48 hours, cells were harvested and total RNA was extracted using miRNeasy Mini Kit (Qiagen). cDNAs were synthesised specific to miR-130a using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems). Then, qRT-PCR was carried out using TaqMan Universal Master Mix (Applied Biosystems) to quantify the knockdown level of mature miRNAs in the cells. Result showed that miR-130a-5p was significantly downregulated in MCF7 cell line. However, no significant changes were observed for sequences targeting miR-130a-3p and stem loop. Thus, this study showed that the expression of miR-130a-5p was successfully down-regulated using CRISPR silencing system. This technique may be useful to manipulate the level of miRNA in various cell types to answer clinical questions at the molecular level.

  16. Folic acid induces cell type-specific changes in the transcriptome of breast cancer cell lines: a proof-of-concept study.

    Price, R Jordan; Lillycrop, Karen A; Burdge, Graham C

    2016-01-01

    The effect of folic acid (FA) on breast cancer (BC) risk is uncertain. We hypothesised that this uncertainty may be due, in part, to differential effects of FA between BC cells with different phenotypes. To test this we investigated the effect of treatment with FA concentrations within the range of unmetabolised FA reported in humans on the expression of the transcriptome of non-transformed (MCF10A) and cancerous (MCF7 and Hs578T) BC cells. The total number of transcripts altered was: MCF10A, seventy-five (seventy up-regulated); MCF7, twenty-four (fourteen up-regulated); and Hs578T, 328 (156 up-regulated). Only the cancer-associated gene TAGLN was altered by FA in all three cell lines. In MCF10A and Hs578T cells, FA treatment decreased pathways associated with apoptosis, cell death and senescence, but increased those associated with cell proliferation. The folate transporters SLC19A1, SLC46A1 and FOLR1 were differentially expressed between cell lines tested. However, the level of expression was not altered by FA treatment. These findings suggest that physiological concentrations of FA can induce cell type-specific changes in gene regulation in a manner that is consistent with proliferative phenotype. This has implications for understanding the role of FA in BC risk. In addition, these findings support the suggestion that differences in gene expression induced by FA may involve differential activities of folate transporters. Together these findings indicate the need for further studies of the effect of FA on BC.

  17. Mechanism of action study to evaluate the effect of rosiglitazone on bone in postmenopausal women with type 2 diabetes mellitus: rationale, study design and baseline characteristics

    Fitzpatrick, Lorraine A.; Bilezikian, John P.; Wooddell, Margaret; Paul, Gitanjali; Kolatkar, Nikheel S.; Nino, Antonio J.; Miller, Colin G.; Bogado, Cesar E.; Arnaud, Claude D.; Cobitz, Alexander R.

    2012-01-01

    Objectives Post-hoc analyses have shown an increase incidence of fractures among type 2 diabetes (T2DM) patients treated with thiazolidinediones (TZDs). The mechanisms by which TZDs may be associated with increased fracture risk is not well understood. This article describes the study design and baseline characteristics for a prospective, randomized, double-blind, active-controlled trial to evaluate the effects of rosiglitazone on changes in measures of skeletal structure, surrogates of bone strength and metabolism. Methods Postmenopausal women without osteoporosis and diagnosed with T2DM were randomized in a double-blind design to either rosiglitazone or metformin for 52 weeks, then all subjects received open-label metformin for 24 weeks. Study endpoints included changes in bone mineral density (BMD), quantitative computed tomography (QCT), digitized hip radiography (HXR) and high resolution magnetic resonance imaging (hrMRI). Serum markers of bone metabolism and indices of glycemic control were assessed within and between treatment groups. Results A total of 226 subjects were randomized. Baseline characteristics included: age 63.8 ± 6.5 years; years postmenopausal 16.9 ± 8.4; duration of diabetes 3.5 (1.8–7.8) years; body mass index (BMI) 31.4 ± 5.9 kg/m2; and glycated hemoglobin (HbA1c) 6.4 ± 0.65%. At baseline, mean T-scores were −0.95 ± 0.91 at the femoral neck, −0.02 ± 0.97 at the total hip and −0.55 ± 1.25 at the total spine. Since there are no well recognized techniques to determine bone mass and structure at the distal limbs (cortical bone sites where fractures were reported in RSG subjects), using the femoral neck as a surrogate for these areas may be a potential limitation of the study. Conclusion This is the first randomized trial utilizing multiple techniques to evaluate bone mass, structure, serum markers of bone remodeling, and potential reversibility of changes after discontinuation of rosiglitazone. This

  18. Preservation of metabolic flexibility in skeletal muscle by a combined use of n-3 PUFA and rosiglitazone in dietary obese mice.

    Olga Horakova

    Full Text Available Insulin resistance, the key defect in type 2 diabetes (T2D, is associated with a low capacity to adapt fuel oxidation to fuel availability, i.e., metabolic inflexibility. This, in turn, contributes to a further damage of insulin signaling. Effectiveness of T2D treatment depends in large part on the improvement of insulin sensitivity and metabolic adaptability of the muscle, the main site of whole-body glucose utilization. We have shown previously in mice fed an obesogenic high-fat diet that a combined use of n-3 long-chain polyunsaturated fatty acids (n-3 LC-PUFA and thiazolidinediones (TZDs, anti-diabetic drugs, preserved metabolic health and synergistically improved muscle insulin sensitivity. We investigated here whether n-3 LC-PUFA could elicit additive beneficial effects on metabolic flexibility when combined with a TZD drug rosiglitazone. Adult male C57BL/6N mice were fed an obesogenic corn oil-based high-fat diet (cHF for 8 weeks, or randomly assigned to various interventions: cHF with n-3 LC-PUFA concentrate replacing 15% of dietary lipids (cHF+F, cHF with 10 mg rosiglitazone/kg diet (cHF+ROSI, cHF+F+ROSI, or chow-fed. Indirect calorimetry demonstrated superior preservation of metabolic flexibility to carbohydrates in response to the combined intervention. Metabolomic and gene expression analyses in the muscle suggested distinct and complementary effects of the interventions, with n-3 LC-PUFA supporting complete oxidation of fatty acids in mitochondria and the combination with n-3 LC-PUFA and rosiglitazone augmenting insulin sensitivity by the modulation of branched-chain amino acid metabolism. These beneficial metabolic effects were associated with the activation of the switch between glycolytic and oxidative muscle fibers, especially in the cHF+F+ROSI mice. Our results further support the idea that the combined use of n-3 LC-PUFA and TZDs could improve the efficacy of the therapy of obese and diabetic patients.

  19. The influence of specific mechanical energy on cornmeal viscosity measured by an on-line system during twin-screw extrusion

    Y. K. CHANG

    1999-09-01

    Full Text Available The influence of specific mechanical energy (SME on cornmeal viscosity during the twin-screw extrusion at feed moisture contents of 25 and 30% and screw speeds in the range from 100 to 500 rpm was measured. Cornmeal was extruded in a co-rotating, intermeshing twin-screw coupled to a slit die rheometer. One approach to the on-line rheological measurement is to use a slit die with the extruder. In the present work it was show that shear viscosity decreased as a function of SME. The viscosity of cornmeal at the exit die was influenced by screw speed, rate of total mass flow, mass temperature inside the extruder and SME. An increase in screw speed resulted in an increase in SME and a decrease in viscosity. A reduction in slit die height and an increase in screw speed and mass temperature led to a remarkable macromolecular degradation of the starch, as evidenced by the decrease in viscosity.

  20. Cloning of a Recombinant Plasmid Encoding Thiol-Specific Antioxidant Antigen (TSA) Gene of Leishmania majorand Expression in the Chinese Hamster Ovary Cell Line.

    Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi

    2012-01-01

    TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.

  1. Isolate-specific effects of patulin, penicillic Acid and EDTA on biofilm formation and growth of dental unit water line biofilm isolates.

    Liaqat, Iram; Bachmann, Robert Thomas; Sabri, Anjum Nasim; Edyvean, Robert G J

    2010-08-01

    Dental unit water line (DUWL) contamination by opportunistic pathogens has its significance in nosocomial infection of patients, health care workers, and life-threatening infections to immunocompromized persons. Recently, the quorum sensing (QS) system of DUWL isolates has been found to affect their biofilm-forming ability, making it an attractive target for antimicrobial therapy. In this study, the effect of two quorum-sensing inhibitory compounds (patulin; PAT, penicillic acid; PA) and EDTA on planktonic growth, AI-2 signalling and in vitro biofilm formation of Pseudomonas aeruginosa, Achromobacter xylosoxidans and Achromobacter sp. was monitored. Vibrio harveyi BB170 bioassay and crystal violet staining methods were used to detect the AI-2 monitoring and biofilm formation in DUWL isolates, respectively. The V. harveyi BB170 bioassay failed to induce bioluminescence in A. xylosoxidans and Achromobacter sp., while P. aeruginosa showed AI-2 like activity suggesting the need of some pretreatments prior to bioassay. All strains were found to form biofilms within 72 h of incubation. The QSIs/EDTA combination have isolate-specific effects on biofilm formation and in some cases it stimulated biofilm formation as often as it was inhibited. However, detailed information about the anti-biofilm effect of these compounds is still lacking.

  2. Rosiglitazone inhibits chlorpyrifos-induced apoptosis via modulation of the oxidative stress and inflammatory response in SH-SY5Y cells

    Lee, Jeong Eun [Department of Pharmacology, College of Medicine, Hanyang University, Seoul (Korea, Republic of); Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Park, Jae Hyeon; Jang, Sea Jeong [Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Graduate School of Biomedical Science and Engineering, Hanyang University, Seoul (Korea, Republic of); Koh, Hyun Chul, E-mail: hckoh@hanyang.ac.kr [Department of Pharmacology, College of Medicine, Hanyang University, Seoul (Korea, Republic of); Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Graduate School of Biomedical Science and Engineering, Hanyang University, Seoul (Korea, Republic of)

    2014-07-15

    Oxidative stress can lead to expression of inflammatory transcription factors, which are important regulatory elements in the induction of inflammatory responses. One of the transcription factors, nuclear transcription factor kappa-B (NF-κB) plays a significant role in the inflammation regulatory process. Inflammatory cell death has been implicated in neuronal cell death in some neurodegenerative disorders such as Parkinson's disease (PD). In this study, we investigated the molecular mechanisms underlying apoptosis initiated by chlorpyrifos (CPF)-mediated oxidative stress. Based on the cytotoxic mechanism of CPF, we examined the neuroprotective effects of rosiglitazone (RGZ), a peroxisome proliferator-activated receptor gamma (PPAR-γ) agonist, against CPF-induced neuronal cell death. The treatment of SH-SY5Y cells with CPF induced oxidative stress. In addition, CPF activated the p38, JNK and ERK mitogen-activated protein kinases (MAPKs), and induced increases in the inflammatory genes such as COX-2 and TNF-α. CPF also induced nuclear translocation of NF-κB and inhibitors of NF-κB abolished the CPF-induced COX-2 expression. Pretreatment with RGZ significantly reduced ROS generation and enhanced HO-1 expression in CPF-exposed cells. RGZ blocked the activation of both p38 and JNK signaling, while ERK activation was strengthened. RGZ also attenuated CPF-induced cell death through the reduction of NF-κB-mediated proinflammatory factors. Results from this study suggest that RGZ may exert an anti-apoptotic effect against CPF-induced cytotoxicity by attenuation of oxidative stress as well as inhibition of the inflammatory cascade via inactivation of signaling by p38 and JNK, and NF-κB. - Highlights: • CPF induces apoptotic cell death in SH-SY5Y cells • ROS involved in CPF-mediated apoptotic cell death • Inflammation involved in CPF-mediated apoptotic cell death • Rosiglitazone modulates ROS and inflammatory response in CPF-treated cells.

  3. In vitro cytotoxicity of {sup 211}At-labeled trastuzumab in human breast cancer cell lines: effect of specific activity and HER2 receptor heterogeneity on survival fraction

    Akabani, Gamal [Department of Radiology, Duke University Medical Center, P.O. Box 3808, Durham, NC 27710 (United States); Carlin, Sean [Department of Radiology, Duke University Medical Center, P.O. Box 3808, Durham, NC 27710 (United States); Welsh, Phil [Department of Radiology, Duke University Medical Center, P.O. Box 3808, Durham, NC 27710 (United States); Zalutsky, Michael R. [Department of Radiology, Duke University Medical Center, P.O. Box 3808, Durham, NC 27710 (United States)]. E-mail: zalut001@mc.duke.edu

    2006-04-15

    Introduction: Radioimmunotherapy with anti-HER2 monoclonal antibodies (mAbs) such as trastuzumab is a promising strategy for treating HER2-positive breast and ovarian carcinoma patients. The objective of this study was to determine the cytotoxic effectiveness of trastuzumab labeled with the 7.2-h half-life {alpha}-particle emitter {sup 211}At. Methods: Experiments were performed on SKBr-3, BT-474 and the transfected MCF7/HER2-18 human breast carcinoma cell lines. Intrinsic radiosensitivity was determined after exposure to external beam irradiation. The cytotoxicity of {sup 211}At-labeled trastuzumab was measured by clonogenic assays. The distribution of HER2 receptor expression on the cell lines was measured using fluorescence-activated cell sorting. A pharmacokinetic (PK)/microdosimetric model was established to assess the effects of specific activity (SA), HER2 receptor expression and absorbed dose on survival fraction (SF). Results: With external beam irradiation, the 2-Gy SF for BT-474, SKBr-3 and MCF7/HER2-18 cells was 0.78, 0.53 and 0.64 Gy, respectively. Heterogeneous HER2 expression was observed, with a subpopulation of cells lacking measurable receptor (14.5%, SKBr-3; 0.34%, MCF-7/HER2; 1.73%, BT-474). When plotted as a function of activity concentration, SF curves were biphasic and inversely proportional to SA; however, when the model was applied and absorbed doses calculated, the SF curve was monoexponential independent of SA. Thus, the PK model was able to demonstrate the effects of competition between cold and labeled mAb. These studies showed that the relative biological effectiveness of {sup 211}At-labeled trastuzaumab was about 10 times higher than that of external beam therapy. Conclusion: These in vitro studies showed that {sup 211}At-labeled trastuzumab mAb is an effective cytotoxic agent for the treatment of HER2-positive tumor cells. The SA of the labeled mAb and the homogeneity of HER2 receptor expression are important variables influencing

  4. The Spectral Energy Distributions of z ~ 8 Galaxies from the IRAC Ultra Deep Fields: Emission Lines, Stellar Masses, and Specific Star Formation Rates at 650 Myr

    Labbé, I.; Oesch, P. A.; Bouwens, R. J.; Illingworth, G. D.; Magee, D.; González, V.; Carollo, C. M.; Franx, M.; Trenti, M.; van Dokkum, P. G.; Stiavelli, M.

    2013-11-01

    Using new ultradeep Spitzer/InfraRed Array Camera (IRAC) photometry from the IRAC Ultra Deep Field program, we investigate the stellar populations of a sample of 63 Y-dropout galaxy candidates at z ~ 8, only 650 Myr after the big bang. The sources are selected from HST/ACS+WFC3/IR data over the Hubble Ultra Deep Field (HUDF), two HUDF parallel fields, and wide area data over the CANDELS/GOODS-South. The new Spitzer/IRAC data increase the coverage in [3.6] and [4.5] to ~120h over the HUDF reaching depths of ~28 (AB,1σ). The improved depth and inclusion of brighter candidates result in direct >=3σ InfraRed Array Camera (IRAC) detections of 20/63 sources, of which 11/63 are detected at >=5σ. The average [3.6]-[4.5] colors of IRAC detected galaxies at z ~ 8 are markedly redder than those at z ~ 7, observed only 130 Myr later. The simplest explanation is that we witness strong rest-frame optical emission lines (in particular [O III] λλ4959, 5007 + Hβ) moving through the IRAC bandpasses with redshift. Assuming that the average rest-frame spectrum is the same at both z ~ 7 and z ~ 8 we estimate a rest-frame equivalent width of {W}_{[O\\,\\scriptsize{III}]\\ \\lambda \\lambda 4959,5007+H\\beta }=670^{+260}_{-170} Å contributing 0.56^{+0.16}_{-0.11} mag to the [4.5] filter at z ~ 8. The corresponding {W}_{H\\alpha }=430^{+160}_{-110} Å implies an average specific star formation rate of sSFR=11_{-5}^{+11} Gyr-1 and a stellar population age of 100_{-50}^{+100} Myr. Correcting the spectral energy distribution for the contribution of emission lines lowers the average best-fit stellar masses and mass-to-light ratios by ~3 ×, decreasing the integrated stellar mass density to \\rho ^*(z=8,M_{\\rm{UV}}Universities for Research in Astronomy, Inc., under NASA contract NAS 5-26555. These observations are associated with programs #11563, 9797. Based on observations with the Spitzer Space Telescope, which is operated by the Jet Propulsion Laboratory, California Institute of

  5. THE SPECTRAL ENERGY DISTRIBUTIONS OF z ∼ 8 GALAXIES FROM THE IRAC ULTRA DEEP FIELDS: EMISSION LINES, STELLAR MASSES, AND SPECIFIC STAR FORMATION RATES AT 650 MYR

    Labbé, I.; Bouwens, R. J.; Franx, M. [Leiden Observatory, Leiden University, NL-2300 RA Leiden (Netherlands); Oesch, P. A.; Illingworth, G. D.; Magee, D.; González, V. [UCO/Lick Observatory, University of California, Santa Cruz, CA 95064 (United States); Carollo, C. M. [Institute for Astronomy, ETH Zurich, 8092 Zurich (Switzerland); Trenti, M. [Kavli Institute for Cosmology and Institute of Astronomy, University of Cambridge, Cambridge (United Kingdom); Van Dokkum, P. G. [Department of Astronomy, Yale University, New Haven, CT 06520 (United States); Stiavelli, M. [Space Telescope Science Institute, Baltimore, MD 21218 (United States)

    2013-11-10

    Using new ultradeep Spitzer/InfraRed Array Camera (IRAC) photometry from the IRAC Ultra Deep Field program, we investigate the stellar populations of a sample of 63 Y-dropout galaxy candidates at z ∼ 8, only 650 Myr after the big bang. The sources are selected from HST/ACS+WFC3/IR data over the Hubble Ultra Deep Field (HUDF), two HUDF parallel fields, and wide area data over the CANDELS/GOODS-South. The new Spitzer/IRAC data increase the coverage in [3.6] and [4.5] to ∼120h over the HUDF reaching depths of ∼28 (AB,1σ). The improved depth and inclusion of brighter candidates result in direct ≥3σ InfraRed Array Camera (IRAC) detections of 20/63 sources, of which 11/63 are detected at ≥5σ. The average [3.6]-[4.5] colors of IRAC detected galaxies at z ∼ 8 are markedly redder than those at z ∼ 7, observed only 130 Myr later. The simplest explanation is that we witness strong rest-frame optical emission lines (in particular [O III] λλ4959, 5007 + Hβ) moving through the IRAC bandpasses with redshift. Assuming that the average rest-frame spectrum is the same at both z ∼ 7 and z ∼ 8 we estimate a rest-frame equivalent width of contributing 0.56{sup +0.16}{sub -0.11} mag to the [4.5] filter at z ∼ 8. The corresponding W{sub Hα}=430{sup +160}{sub -110} Å implies an average specific star formation rate of sSFR=11{sub -5}{sup +11} Gyr{sup –1} and a stellar population age of 100{sub -50}{sup +100} Myr. Correcting the spectral energy distribution for the contribution of emission lines lowers the average best-fit stellar masses and mass-to-light ratios by ∼3 ×, decreasing the integrated stellar mass density to ρ{sup *}(z=8,M{sub UV}<-18)=0.6{sup +0.4}{sub -0.3}×10{sup 6} M{sub sun} Mpc{sup –3}.

  6. Mapping Mammalian Cell-type-specific Transcriptional Regulatory Networks Using KD-CAGE and ChIP-seq Data in the TC-YIK Cell Line

    Lizio, Marina; Ishizu, Yuri; Itoh, Masayoshi; Lassmann, Timo; Hasegawa, Akira; Kubosaki, Atsutaka; Severin, Jessica; Kawaji, Hideya; Nakamura, Yukio; Suzuki, Harukazu; Hayashizaki, Yoshihide; Carninci, Piero; Forrest, Alistair R. R.

    2015-01-01

    Mammals are composed of hundreds of different cell types with specialized functions. Each of these cellular phenotypes are controlled by different combinations of transcription factors. Using a human non islet cell insulinoma cell line (TC-YIK) which expresses insulin and the majority of known pancreatic beta cell specific genes as an example, we describe a general approach to identify key cell-type-specific transcription factors (TFs) and their direct and indirect targets. By ranking all human TFs by their level of enriched expression in TC-YIK relative to a broad collection of samples (FANTOM5), we confirmed known key regulators of pancreatic function and development. Systematic siRNA mediated perturbation of these TFs followed by qRT-PCR revealed their interconnections with NEUROD1 at the top of the regulation hierarchy and its depletion drastically reducing insulin levels. For 15 of the TF knock-downs (KD), we then used Cap Analysis of Gene Expression (CAGE) to identify thousands of their targets genome-wide (KD-CAGE). The data confirm NEUROD1 as a key positive regulator in the transcriptional regulatory network (TRN), and ISL1, and PROX1 as antagonists. As a complimentary approach we used ChIP-seq on four of these factors to identify NEUROD1, LMX1A, PAX6, and RFX6 binding sites in the human genome. Examining the overlap between genes perturbed in the KD-CAGE experiments and genes with a ChIP-seq peak within 50 kb of their promoter, we identified direct transcriptional targets of these TFs. Integration of KD-CAGE and ChIP-seq data shows that both NEUROD1 and LMX1A work as the main transcriptional activators. In the core TRN (i.e., TF-TF only), NEUROD1 directly transcriptionally activates the pancreatic TFs HSF4, INSM1, MLXIPL, MYT1, NKX6-3, ONECUT2, PAX4, PROX1, RFX6, ST18, DACH1, and SHOX2, while LMX1A directly transcriptionally activates DACH1, SHOX2, PAX6, and PDX1. Analysis of these complementary datasets suggests the need for caution in interpreting Ch

  7. Development of a convenient in vivo hepatotoxin assay using a transgenic zebrafish line with liver-specific DsRed expression.

    Xiaoyan Zhang

    Full Text Available Previously we have developed a transgenic zebrafish line (LiPan with liver-specific red fluorescent protein (DsRed expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine] caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics and chlorphenamine (pain killer did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry

  8. Development of a Convenient In Vivo Hepatotoxin Assay Using a Transgenic Zebrafish Line with Liver-Specific DsRed Expression

    Zhang, Xiaoyan; Li, Caixia; Gong, Zhiyuan

    2014-01-01

    Previously we have developed a transgenic zebrafish line (LiPan) with liver-specific red fluorescent protein (DsRed) expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone) in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate) behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine]) caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics) and chlorphenamine (pain killer) did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry provide a rapid

  9. The effects of human TSH receptor gene transfection on iodide uptake and thyroid-specific gene expression in poorly differentiated thyroid carcinoma cell line

    Hou Shasha; Wang Hui; Feng Fang; Lin Ning; Fu Hongliang; Du Xueliang; Wu Jingchuan

    2011-01-01

    Objective: To investigate the changes of iodide uptake and the expression of thyroid-specific genes in poorly differentiated follicular thyroid carcinoma (FTC) cells after transfection of human TSH receptor (hTSHR) gene in vitro. Methods: The recombinant eukaryotic expression plasmid PcDNA3.1/hTSHR-cDNA was transformed into DH 5a bacterial for amplification and then the recombinant plasmid was extracted. The recombinant was identified with PCR amplifying, restriction enzyme digestion analysis and DNA sequencing. The recombinant plasmid pcDNA3.1/hTSHR was transfected into FTC-133 cell line by lipofectin method in vitro. Immunofluorescence, iodide uptake studies and real time-PCR were applied to detect target protein expression. Statistical analysis was performed with t-test using SPSS 13.0 software. Results: Kpn I and Xba I restriction enzyme digestion, PCR amplifying and DNA sequencing confirmed that pcDNA3.1/hTSHR was successfully constructed. After transfection of the recombinant plasmid pcDNA3.1/hTSHR-cDNA and the stimulation of hTSH, the tumor cells displayed the expression of hTSHR protein at cell surface and cytoplasm. The iodine uptake in pcDNA3.1/hTSHR transfected cells was 2.9 times higher than that of control(pcDNA3.1(+) transfected cells) group(t = 28.63, P<0.01). The expression of TSHR, NIS, TPO and Tg (mRNA levels) in pcDNA3.1/hTSHR transfected cells were also significantly elevated by 1.74 (t =5.959, P<0.01), 7.2 (t =3.807, P<0.05), 2.88 (t=4.769, P<0.01) and 2.67 times (t=6.388, P<0.01) respectively compared to those of the control group. Conclusion: The study demonstrates that iodide uptake may be reactivated by hTSHR receptor gene transfection in poorly differentiated FTC cell. (authors)

  10. Ag85A-specific CD4+ T cell lines derived after boosting BCG-vaccinated cattle with Ad5-85A possess both mycobacterial growth inhibition and anti-inflammatory properties.

    Metcalfe, Hannah J; Biffar, Lucia; Steinbach, Sabine; Guzman, Efrain; Connelley, Tim; Morrison, Ivan; Vordermeier, H Martin; Villarreal-Ramos, Bernardo

    2018-05-11

    There is a need to improve the efficacy of the BCG vaccine against human and bovine tuberculosis. Previous data showed that boosting bacilli Calmette-Guerin (BCG)-vaccinated cattle with a recombinant attenuated human type 5 adenovirally vectored subunit vaccine (Ad5-85A) increased BCG protection and was associated with increased frequency of Ag85A-specific CD4 + T cells post-boosting. Here, the capacity of Ag85A-specific CD4 + T cell lines - derived before and after viral boosting - to interact with BCG-infected macrophages was evaluated. No difference before and after boosting was found in the capacity of these Ag85A-specific CD4 + T cell lines to restrict mycobacterial growth, but the secretion of IL-10 in vitro post-boost increased significantly. Furthermore, cell lines derived post-boost had no statistically significant difference in the secretion of pro-inflammatory cytokines (IL-1β, IL-12, IFNγ or TNFα) compared to pre-boost lines. In conclusion, the protection associated with the increased number of Ag85A-specific CD4 + T cells restricting mycobacterial growth may be associated with anti-inflammatory properties to limit immune-pathology. Copyright © 2018 Department for Environment Food and Rural Affairs. Published by Elsevier Ltd.. All rights reserved.

  11. Specific pesticide-dependent increases in α-synuclein levels in human neuroblastoma (SH-SY5Y) and melanoma (SK-MEL-2) cell lines.

    Chorfa, Areski; Bétemps, Dominique; Morignat, Eric; Lazizzera, Corinne; Hogeveen, Kevin; Andrieu, Thibault; Baron, Thierry

    2013-06-01

    Epidemiological studies indicate a role of genetic and environmental factors in Parkinson's disease involving alterations of the neuronal α-synuclein (α-syn) protein. In particular, a relationship between Parkinson's disease and occupational exposure to pesticides has been repeatedly suggested. Our objective was to precisely assess changes in α-syn levels in human neuroblastoma (SH-SY5Y) and melanoma (SK-MEL-2) cell lines following acute exposure to pesticides (rotenone, paraquat, maneb, and glyphosate) using Western blot and flow cytometry. These human cell lines express α-syn endogenously, and overexpression of α-syn (wild type or mutated A53T) can be obtained following recombinant adenoviral transduction. We found that endogenous α-syn levels in the SH-SY5Y neuroblastoma cell line were markedly increased by paraquat, and to a lesser extent by rotenone and maneb, but not by glyphosate. Rotenone also clearly increased endogenous α-syn levels in the SK-MEL-2 melanoma cell line. In the SH-SY5Y cell line, similar differences were observed in the α-syn adenovirus-transduced cells, with a higher increase of the A53T mutated protein. Paraquat markedly increased α-syn in the SK-MEL-2 adenovirus-transduced cell line, similarly for the wild-type or A53T proteins. The observed differences in the propensities of pesticides to increase α-syn levels are in agreement with numerous reports that indicate a potential role of exposure to certain pesticides in the development of Parkinson's disease. Our data support the hypothesis that pesticides can trigger some molecular events involved in this disease and also in malignant melanoma that consistently shows a significant but still unexplained association with Parkinson's disease.

  12. Specific down-regulation of XIAP with RNA interference enhances the sensitivity of canine tumor cell-lines to TRAIL and doxorubicin

    Rothuizen Jan

    2006-09-01

    Full Text Available Abstract Background Apoptosis resistance occurs in various tumors. The anti-apoptotic XIAP protein is responsible for inhibiting apoptosis by reducing caspase-3 activation. Our aim is to evaluate whether RNA inhibition against XIAP increases the sensitivity of canine cell-lines for chemotherapeutics such as TRAIL and doxorubicin. We used small interfering RNA's (siRNA directed against XIAP in three cell-lines derived from bile-duct epithelia (BDE, mammary carcinoma (P114, and osteosarcoma (D17. These cell-lines represent frequently occurring canine cancers and are highly comparable to their human counterparts. XIAP down-regulation was measured by means of quantitative PCR (Q-PCR and Western blotting. The XIAP depleted cells were treated with a serial dilution of TRAIL or doxorubicin and compared to mock- and nonsense-treated controls. Viability was measured with a MTT assay. Results All XIAP siRNA treated cell-lines showed a mRNA down-regulation over 80 percent. Western blot analysis confirmed mRNA measurements. No compensatory effect of IAP family members was seen in XIAP depleted cells. The sensitivity of XIAP depleted cells for TRAIL was highest in BDE cells with an increase in the ED50 of 14-fold, compared to mock- and nonsense-treated controls. The sensitivity of P114 and D17 cell-lines increased six- and five-fold, respectively. Doxorubicin treatment in XIAP depleted cells increased sensitivity in BDE cells more than eight-fold, whereas P114 and D17 cell-lines showed an increase in sensitivity of three- and five-fold, respectively. Conclusion XIAP directed siRNA's have a strong sensitizing effect on TRAIL-reduced cell-viability and a smaller but significant effect with the DNA damaging drug doxorubicin. The increase in efficacy of chemotherapeutics with XIAP depletion provides the rationale for the use of XIAP siRNA's in insensitive canine tumors.

  13. Specific degradation of 3' regions of GUS mRNA in posttranscriptionally silenced tobacco lines may be related to 5'-3' spreading of silencing

    Braunstein, Thomas Hartig; Moury, Benoit; Johannessen, Marina

    2002-01-01

    background, we have performed detailed analyses of target regions in three spontaneously beta-glucuronidase (GUS) silencing tobacco lines of different origin. From quantitative cosuppression experiments, we show that the main target region in all three tobacco lines is found within the 3' half of the GUS...... VIGS. Surprisingly, only evidence for spreading of the target region in the 5'-3' direction was obtained. This finding may help explain why the majority of target regions examined to date lie within the 3' region of transgenes....

  14. Generation of a human induced pluripotent stem cell line via CRISPR-Cas9 mediated integration of a site-specific homozygous mutation in CHMP2B

    Yu Zhang

    2016-07-01

    Full Text Available Frontotemporal dementia (FTD is an early onset neurodegenerative disease. Mutations in several genes cause familial FTD and one of them is charged multivesicular body protein 2B (CHMP2B on chromosome 3 (FTD3, a component of the endosomal sorting complex required for transport III (ESCRT-III. We have generated an induced pluripotent stem cell (iPSC line of a healthy individual and inserted the CHMP2B IVS5AS G-C gene mutation into both alleles, resulting in aberrant splicing. This human iPSC line provides an ideal model to study CHMP2B-dependent phenotypes of FTD3.

  15. Effect of chromium enriched fermentation product of barley and brewer’s yeast and its combination with rosiglitazone on experimentally induced hyperglycaemia in mice

    Cekić Vlada

    2011-01-01

    Full Text Available Introduction. In the recent years, herbal preparations have been more used to treat diabetes. Dietetic supplement based on barley and beer yeast enriched with chromium (BBCr is registered in Serbia as a supplement in the treatment of type 2 diabetes. Objective. To investigate the effect of the preparation based on barley and brewer’s yeast with chromium (BBCr, rosiglitazone (R and their combination (BBCr+R on fasting glycaemia and glycaemia in mice after glucose, adrenalin and alloxan application. Methods. The animals were divided into three groups: glucose 500 mg/kg (I; adrenalin 0.2 mg/kg (II; and alloxan 100 mg/kg (III and into subgroups according to the substance they received (BBCr: 750 mg/kg, R: 0.75 mg/kg and BBCr+R. Each animal was its own control in respect of glycaemia before and after the treatment with test substances, except for group III which contained a placebo subgroup. Results. BBCr caused a significant decrease of fasting glycaemia and significant reduction of glycaemia after glucose load compared to the values before treatment (7.4±0.6 mmol/l vs 9.2±0.6 mmol/l; p=0.01. R and BBCr+R significantly decreased glycaemia after adrenalin load (R: 8.6±1.8 mmol/l vs 15.4±3.2 mmol/l; p=0.004; BBCr+R: 9.6±2.4 mmol/l vs 15.0±4.4 mmol/l; p=0.04. After alloxan application the glycaemia was significantly lower in the subgroups treated with BBCr, R and BBCr+R compared to placebo subgroup (10.1±8.0 mmol/l vs 6.8±2.7 mmol/l vs 13.5±9.7 mmol/l vs 24.5±4.7 mmol/l; p=0.001. Conclusion. Pretreatment with BBCr caused a significant reduction of fasting glycaemia and glycaemia after glucose load. Rosiglitazone and BBCr+R caused a significant reduction of glycaemia after adrenalin load. Pretreatment with BBCr, R and BBCr+R prevented the onset of experimental diabetes caused by alloxan, which was confirmed by histological analysis of pancreas tissue.

  16. Correlated effects of selection for immunity in White Leghorn chicken lines on natural antibodies and specific antibody responses to KLH and M. butyricum

    Minozzi, G.; Parmentier, H.K.; Mignon-Grasteau, S.; Nieuwland, M.G.B.; Bed'hom, B.; Gourichon, D.; Minvielle, F.; Pinard-van der Laan, M.H.

    2008-01-01

    Background - The effect of selection for three general immune response traits on primary antibody responses (Ab) to Mycobacterium butyricum or keyhole limpet hemocyanin (KLH) was studied in four experimental lines of White Leghorn chicken. Birds underwent 12 generations of selection for one of three

  17. Lessons from the use of genetically modified Drosophila melanogaster in ecological studies: Hsf mutant lines show highly trait-specific performance in field and laboratory thermal assays

    Sørensen, Jesper Givskov; Loeschcke, Volker; Kristensen, Torsten Nygård

    2009-01-01

    . 2.  We have tested the importance of inducible heat shock proteins (Hsps) under different thermal conditions using two heat shock factor (Hsf) mutant lines (either able (Hsf+) or unable (Hsf0) to mount a heat stress response) and an outbred laboratory adapted wild-type line of Drosophila......1.  Laboratory studies on genetically modified strains may reveal important information on mechanisms involved in coping with thermal stress. However, to address the evolutionary significance of specific genes or physiological mechanisms, ecologically relevant field tests should also be performed...

  18. Phosphorus Partitioning of Soybean Lines Containing Different Mutant Alleles of Two Soybean Seed-Specific Adenosine Triphosphate-Binding Cassette Phytic Acid Transporter Paralogs

    Jason D. Gillman

    2013-03-01

    Full Text Available Seed phytate is a repository of P and minerals in soybean [ (L. Merr.] seeds that limits P and mineral bioavailability for monogastric animals (e.g., humans, swine [], and poultry [especially chicken, ] due to insufficient digestive tract phytase activity. We previously identified epistatic recessive mutations affecting two paralogous adenosine triphosphate-binding cassette phytic acid transporter genes (one a nonsense mutation in and the other a missense mutation in as the molecular genetic basis in the ethyl methanesulfonate (EMS-induced mutant low phytate soybean line M153. An additional mutant low phytate line, M766, contained one single nucleotide polymorphism within the ninth intron of the locus as well as a nonsense mutation in . The objectives of this research were to clarify the genetics underlying the low phytate phenotype in line M766 and to determine P partitioning in new combinations of mutant alleles from M766 and M153. Inheritance of nonsense alleles affecting both ( genes (one from M153 and one from M766 led to the production of viable seeds that contained transgressive reductions in total seed phytate and significantly higher levels of inorganic phosphate than has been reported for nontransgenic soybean material and will allow efficient molecular selection of soybeans with even greater reductions of phytate for improved quality soybean meal.

  19. Adverse hepatic and cardiac responses to rosiglitazone in a new mouse model of type 2 diabetes: relation to dysregulated phosphatidylcholine metabolism.

    Pan, Huei-Ju; Lin, Yiming; Chen, Yuqing E; Vance, Dennis E; Leiter, Edward H

    2006-07-01

    Given the heterogeneous nature of metabolic dysfunctions associated with insulin resistance and type 2 diabetes (T2D), a single pharmaceutical cannot be expected to provide complication-free therapy in all patients. Thiazolidinediones (TZD) increase insulin sensitivity, reduce blood glucose and improve cardiovascular parameters. However, in addition to increasing fat mass, TZD have the potential in certain individuals to exacerbate underlying hepatosteatosis and diabetic cardiomyopathy. Pharmacogenetics should allow patient selection to maximize therapy and minimize risk. To this end, we have combined two genetically diverse inbred strains, NON/Lt and NZO/Lt, to produce a "negative heterosis" increasing the frequency of T2D in F1 males. As in humans with T2D, treatment of diabetic and hyperlipemic F1 males with rosiglitazone (Rosi), an agonist of peroxisome proliferator-activated gamma receptor (PPARgamma), reverses these disease phenotypes. However, the hybrid genome perturbed both major pathways for phosphatidylcholine (PC) biosynthesis in the liver, and effected remarkable alterations in the composition of cardiolipin in heart mitochondria. These metabolic defects severely exacerbated an underlying hepatosteatosis and increased levels of the adipokine, plasminogen activator inhibitor-1 (PAI-1), a risk factor for cardiovascular events. This model system demonstrates how the power of mouse genetics can be used to identify the metabolic signatures of individuals who may be prone to drug side effects.

  20. Coordinate Transcriptomic and Metabolomic Effects of the Insulin Sensitizer Rosiglitazone on Fundamental Metabolic Pathways in Liver, Soleus Muscle, and Adipose Tissue in Diabetic db/db Mice

    Sabrina Le Bouter

    2010-01-01

    Full Text Available Rosiglitazone (RSG, developed for the treatment of type 2 diabetes mellitus, is known to have potent effects on carbohydrate and lipid metabolism leading to the improvement of insulin sensitivity in target tissues. To further assess the capacity of RSG to normalize gene expression in insulin-sensitive tissues, we compared groups of 18-day-treated db/db mice with increasing oral doses of RSG (10, 30, and 100 mg/kg/d with untreated non-diabetic littermates (db/+. For this aim, transcriptional changes were measured in liver, inguinal adipose tissue (IAT and soleus muscle using microarrays and real-time PCR. In parallel, targeted metabolomic assessment of lipids (triglycerides (TGs and free fatty acids (FFAs in plasma and tissues was performed by UPLC-MS methods. Multivariate analyses revealed a relationship between the differential gene expressions in liver and liver trioleate content and between blood glucose levels and a combination of differentially expressed genes measured in liver, IAT, and muscle. In summary, we have integrated gene expression and targeted metabolomic data to present a comprehensive overview of RSG-induced changes in a diabetes mouse model and improved the molecular understanding of how RSG ameliorates diabetes through its effect on the major insulin-sensitive tissues.

  1. Electroacupuncture and Rosiglitazone Combined Therapy as a Means of Treating Insulin Resistance and Type 2 Diabetes Mellitus: A Randomized Controlled Trial

    Rong-Tsung Lin

    2013-01-01

    Full Text Available Aims. To evaluate the efficacy of rosiglitazone (TZD and electroacupuncture (EA combined therapy as a treatment for type 2 diabetes mellitus (T2DM patients by randomized single-blind placebo controlled clinical trial. Methods. A total of 31 newly diagnostic T2DM patients, who fulfilled the study's eligibility criteria, were recruited. The individuals were randomly assigned into two groups, the control group (TZD, N=15 and the experimental group (TZD + EA, N=16. Changes in their plasma free fatty acid (FFA, glucose, and insulin levels, together with their homeostasis model assessment (HOMA indices, were statistically compared before and after treatment. Hypoglycemic activity (% was also compared between these two groups. Results. There was no significant difference in hypoglycemic activity between the TZD and TZD + EA group. The effectiveness of the combined therapy seems to derive from an improvement in insulin resistance and a significant lowering of the secreted insulin rather than the effect of TZD alone on T2DM. The combined treatment had no significant adverse effects. A lower plasma FFA concentration is likely to be the mechanism that causes this effect. Conclusion. This combined therapy seems to suppress endogenous insulin secretion by improving insulin resistance via a mechanism involving a reduction in plasma FFA. This trial is registered with ClinicalTrials.gov NCT01577095.

  2. Improvement of specific growth rate of Pichia pastoris for effective porcine interferon-α production with an on-line model-based glycerol feeding strategy.

    Gao, Min-Jie; Zheng, Zhi-Yong; Wu, Jian-Rong; Dong, Shi-Juan; Li, Zhen; Jin, Hu; Zhan, Xiao-Bei; Lin, Chi-Chung

    2012-02-01

    Effective expression of porcine interferon-α (pIFN-α) with recombinant Pichia pastoris was conducted in a bench-scale fermentor. The influence of the glycerol feeding strategy on the specific growth rate and protein production was investigated. The traditional DO-stat feeding strategy led to very low cell growth rate resulting in low dry cell weight (DCW) of about 90 g/L during the subsequent induction phase. The previously reported Artificial Neural Network Pattern Recognition (ANNPR) model-based glycerol feeding strategy improved the cell density to 120 g DCW/L, while the specific growth rate decreased from 0.15 to 0.18 to 0.03-0.08 h(-1) during the last 10 h of the glycerol feeding stage leading to a variation of the porcine interferon-α production, as the glycerol feeding scheme had a significant effect on the induction phase. This problem was resolved by an improved ANNPR model-based feeding strategy to maintain the specific growth rate above 0.11 h(-1). With this feeding strategy, the pIFN-α concentration reached a level of 1.43 g/L, more than 1.5-fold higher than that obtained with the previously adopted feeding strategy. Our results showed that increasing the specific growth rate favored the target protein production and the glycerol feeding methods directly influenced the induction stage. Consequently, higher cell density and specific growth rate as well as effective porcine interferon-α production have been achieved by our novel glycerol feeding strategy.

  3. Abscisic acid synergizes with rosiglitazone to improve glucose tolerance, down-modulate macrophage accumulation in adipose tissue: possible action of the cAMP/PKA/PPAR γ axis

    Guri, Amir J; Hontecillas, Raquel; Bassaganya-Riera, Josep

    2010-01-01

    Background & Aims Abscisic acid (ABA) is effective in preventing insulin resistance and obesity-related inflammation through a PPAR γ-dependent mechanism. The objective of this study was to assess the efficacy ABA in improving glucose homeostasis and suppress inflammation when administered in combination with rosiglitazone (Ros) and to determine whether PPAR γ activation by ABA is initiated via cAMP/protein kinase A (PKA) signaling. Methods Obese db/db mice were fed high-fat diets containing 0, 10, or 70 mg/kg Ros with and without racemic ABA (100 mg/kg) for 60 days. Glucose tolerance and fasting insulin levels were assessed at 6 and 8 weeks, respectively, and adipose tissue macrophage (ATM) infiltration was examined by flow cytometry. Gene expression was examined on white adipose tissue (WAT) and stromal vascular cells (SVCs) cultured with ABA, Ros, or an ABA/Ros combination. Results Both Ros and ABA improved glucose tolerance, and ABA decreased plasma insulin levels while having no effect on Ros-induced weight gain. ABA in combination with low-dose Ros (10 mg/kg; Roslo) synergistically inhibited ATM infiltration. Treatment of SVCs with Ros, ABA or ABA/Ros suppressed expression of the M1 marker CCL17. ABA and Ros synergistically increased PPAR γ activity and pretreatment with a cAMP-inhibitor or a PKA-inhibitor abrogated ABA-induced PPAR γ activation. Conclusions ABA and Ros act synergistically to modulate PPAR γ activity and macrophage accumulation in WAT and ABA enhances PPAR γ activity through a membrane-initiated mechanism dependent on cAMP/PKA signaling. PMID:20207056

  4. Multi-objective optimization strategy based on desirability functions used for electrophoratic separation and quantification of rosiglitazone and glimepiride in plasma and formulations.

    Hefnawy, Mohamed M; Sultan, Maha A; Al-Johar, Haya I; Kassem, Mohamed G; Aboul-Enein, Hassan Y

    2012-01-01

    Multiple response simultaneous optimization employing Derringer's desirability function was used for the development of a capillary electrophoresis method for the simultaneous determination of rosiglitazone (RSG) and glimepiride (GLM) in plasma and formulations. Twenty experiments, taking the two resolutions, the analysis time, and the capillary current as the responses with three important factors--buffer morality, volte and column temperature--were used to design mathematical models. The experimental responses were fitted into a second order polynomial and the six responses were simultaneously optimized to predict the optimum conditions for the effective separation of the studied compounds. The separation was carried out by using capillary zone electrophoresis (CZE) with a silica capillary column and diode array detector at 210 nm. The optimum assay conditions were 52 mmol l⁻¹ phosphate buffer, pH 7, and voltage of 22 kV at 29 °C. The method showed good agreement between the experimental data and predictive value throughout the studied parameter space. The assay limit of detection was 0.02 µg ml⁻¹ and the effective working range at relative standard deviation (RSD) of ≤ 5% was 0.05-16 µg ml⁻¹ (r = 0.999) for both drugs. Analytical recoveries of the studied drugs from spiked plasma were 97.2-101.9 ± 0.31-3.0%. The precision of the assay was satisfactory; RSD was 1.07 and 1.14 for intra- and inter-assay precision, respectively. The proposed method has a great value in routine analysis of RSG and GLM for its therapeutic monitoring and pharmacokinetic studies. Copyright © 2011 John Wiley & Sons, Ltd.

  5. The effect of recombinant human growth hormone with or without rosiglitazone on hepatic fat content in HIV-1-infected individuals: a randomized clinical trial.

    Kotler, Donald P; He, Qing; Engelson, Ellen S; Albu, Jeanine B; Glesby, Marshall J

    2016-01-01

    Hepatic fat is related to insulin resistance (IR) and visceral adipose tissue (VAT) in HIV+ and uninfected individuals. Growth hormone (GH) reduces VAT but increases IR. We evaluated the effects of recombinant human GH (rhGH) and rosiglitazone (Rosi) on hepatic fat in a substudy of a randomized controlled trial. HIV+ subjects with abdominal obesity and IR (QUICKI≤0.33) were randomized to rhGH 3 mg daily, Rosi 4 mg twice daily, the combination or double placebo. Hepatic fat was measured by magnetic resonance spectroscopy, visceral fat by MRI and IR by frequently sampled intravenous glucose tolerance tests at baseline and week 12. 31 subjects were studied at both time points. Significant correlations between hepatic fat and VAT (r=0.41; P=0.02) and QUICKI (r=0.39; P<0.05) were seen at baseline. IR rose with rhGH but not Rosi. When rhGH treatment groups were combined, hepatic fat expressed as percentage change decreased significantly (P<0.05) but did not change in Rosi (P=0.71). There were no correlations between changes in hepatic fat and VAT (P=0.4) or QUICKI (P=0.6). In a substudy of 21 subjects, a trend was noticed between changes in hepatic fat and serum insulin-like growth factor-1 (IGF-1; P=0.09). Hepatic fat correlates significantly with both VAT and IR, but changes in hepatic fat do not correlate with changes in VAT and glucose metabolism. Hepatic fat content is reduced by rhGH but Rosi has no effect. These results suggest an independent effect of GH or IGF-1 on hepatic fat. The study was registered at Clinicaltrials.gov (NCT00130286).

  6. The effect of recombinant human growth hormone with or without rosiglitazone on hepatic fat content in HIV-1 infected individuals; a randomized clinical trial

    Kotler, Donald P; He, Qing; Engelson, Ellen S; Albu, Jeanine B; Glesby, Marshall J

    2016-01-01

    Background Hepatic fat is related to insulin resistance (IR) and visceral adipose tissue (VAT) in HIV+ and uninfected individuals. Growth hormone (GH) reduces VAT but increases IR. We evaluated the effects of recombinant human GH (rhGH) and rosiglitazone (Rosi) on hepatic fat in a substudy of a randomized controlled trial. Methods HIV+ subjects with abdominal obesity and IR (QUICKI ≤ 0.33) were randomized to rhGH 3 mg daily, Rosi 4 mg twice daily, the combination, or double placebo. Hepatic fat was measured by magnetic resonance spectroscopy (MRS), visceral fat by MRI, and IR by frequently sampled IV glucose tolerance tests at baseline and week 12. Results 31 subjects were studied at both time points. Significant correlations between hepatic fat and VAT (r = 0.41, p=0.02) and QUICKI (r = 0.39, p<0.05) were seen at baseline. Insulin resistance rose with rhGH but not Rosi. When rhGH treatment groups were combined, hepatic fat expressed as percent change decreased significantly (p<0.05) but did not change in Rosi (p=0.71). There were no correlations between changes in hepatic fat and VAT (p=0.4) or QUICKI (p=0.6). In a substudy of 21 subjects, a trend was noticed between changes in hepatic fat and serum IGF-1 (p=0.09). Conclusions Hepatic fat correlates significantly with both VAT and IR, but changes in hepatic fat do not correlate with changes in VAT and glucose metabolism. Hepatic fat content is reduced by rhGH but Rosi has no effect. These results suggest an independent effect of growth hormone or IGF-1 on hepatic fat. The study was registered at Clinicaltrials.gov (NCT00130286). PMID:25536669

  7. Comparison of mucosal lining fluid sampling methods and influenza-specific IgA detection assays for use in human studies of influenza immunity.

    de Silva, Thushan I; Gould, Victoria; Mohammed, Nuredin I; Cope, Alethea; Meijer, Adam; Zutt, Ilse; Reimerink, Johan; Kampmann, Beate; Hoschler, Katja; Zambon, Maria; Tregoning, John S

    2017-10-01

    We need greater understanding of the mechanisms underlying protection against influenza virus to develop more effective vaccines. To do this, we need better, more reproducible methods of sampling the nasal mucosa. The aim of the current study was to compare levels of influenza virus A subtype-specific IgA collected using three different methods of nasal sampling. Samples were collected from healthy adult volunteers before and after LAIV immunization by nasal wash, flocked swabs and Synthetic Absorptive Matrix (SAM) strips. Influenza A virus subtype-specific IgA levels were measured by haemagglutinin binding ELISA or haemagglutinin binding microarray and the functional response was assessed by microneutralization. Nasosorption using SAM strips lead to the recovery of a more concentrated sample of material, with a significantly higher level of total and influenza H1-specific IgA. However, an equivalent percentage of specific IgA was observed with all sampling methods when normalized to the total IgA. Responses measured using a recently developed antibody microarray platform, which allows evaluation of binding to multiple influenza strains simultaneously with small sample volumes, were compared to ELISA. There was a good correlation between ELISA and microarray values. Material recovered from SAM strips was weakly neutralizing when used in an in vitro assay, with a modest correlation between the level of IgA measured by ELISA and neutralization, but a greater correlation between microarray-measured IgA and neutralizing activity. In conclusion we have tested three different methods of nasal sampling and show that flocked swabs and novel SAM strips are appropriate alternatives to traditional nasal washes for assessment of mucosal influenza humoral immunity. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. NF-kappaB specifically activates BMP-2 gene expression in growth plate chondrocytes in vivo and in a chondrocyte cell line in vitro.

    Feng, Jian Q; Xing, Lianping; Zhang, Jiang-Hong; Zhao, Ming; Horn, Diane; Chan, Jeannie; Boyce, Brendan F; Harris, Stephen E; Mundy, Gregory R; Chen, Di

    2003-08-01

    Bone morphogenetic protein-2 (BMP-2) regulates growth plate chondrogenesis during development and postnatal bone growth, but the control mechanisms of BMP-2 expression in growth plate chondrocytes are unknown. Here we have used both in vitro and in vivo approaches to demonstrate that transcription factor, NF-kappaB, regulates BMP-2 gene expression in chondrocytes. Two putative NF-kappaB response elements were found in the -2712/+165 region of the BMP-2 gene. Cotransfection of mutant I-kappaBalpha expression plasmids with BMP-2 promoter-luciferase reporters into TMC-23 chondrocyte cell line suppressed BMP-2 transcription. Mutations in NF-kappaB response elements in the BMP-2 gene lead to decreases in BMP-2 promoter activity. Electrophoretic mobility shift assay using nuclear extracts from TMC-23 chondrocytic cells revealed that the NF-kappaB subunits p50 and p65 bound to the NF-kappaB response elements of the BMP-2 gene. Thus, NF-kappaB may positively regulate BMP-2 gene transcription. Consistent with these findings, expression of BMP-2 mRNA was significantly reduced in growth plate chondrocytes in NF-kappaB p50/p52 dKO mice, which associated with decreased numbers of 5-bromo-2'-deoxyuridine (BrdUrd)-positive cells in the proliferating zone of growth plate in these mice. Therefore, in postnatal growth plate chondrocytes, expression of BMP-2 is regulated by NF-kappaB, which may play an important role in chondrogenesis.

  9. p,p'-Dichlorodiphenyltrichloroethane (p,p'-DDT) and p,p'-dichlorodiphenyldichloroethylene (p,p'-DDE) repress prostate specific antigen levels in human prostate cancer cell lines.

    Wong, Lilian I L; Labrecque, Mark P; Ibuki, Naokazu; Cox, Michael E; Elliott, John E; Beischlag, Timothy V

    2015-03-25

    Despite stringent restrictions on their use by many countries since the 1970s, the endocrine disrupting chemicals, DDT and DDE are still ubiquitous in the environment. However, little attention has been directed to p,p'-DDT and the anti-androgen, p,p'-DDE on androgen receptor (AR) target gene transcription in human cells. Inhibitors of androgenic activity may have a deleterious clinical outcome in prostate cancer screens and progression, therefore we determined whether environmentally relevant concentrations of p,p'-DDT and p,p'-DDE negatively impact AR-regulated expression of prostate-specific antigen (PSA), and other AR target genes in human LNCaP and VCaP prostate cancer cells. Quantitative real-time PCR and immuno-blotting techniques were used to measure intracellular PSA, PSMA and AR mRNA and protein levels. We have shown for the first time that p,p'-DDT and p,p'-DDE repressed R1881-inducible PSA mRNA and protein levels in a dose-dependent manner. Additionally, we used the fully automated COBAS PSA detection system to determine that extracellular PSA levels were also significantly repressed. These chemicals achieve this by blocking the recruitment of AR to the PSA promoter region at 10 μM, as demonstrated by the chromatin immunoprecipitation (ChIP) in LNCaP cells. Both p,p'-DDT and p,p'-DDE repressed R1881-inducible AR protein accumulation at 10 μM. Thus, we conclude that men who have been exposed to either DDT or DDE may produce a false-negative PSA test when screening for prostate cancer, resulting in an inaccurate clinical diagnosis. More importantly, prolonged exposure to these anti-androgens may mimic androgen ablation therapy in individuals with prostate cancer, thus exacerbating the condition by inadvertently forcing adaptation to this stress early in the disease. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

  10. Human chromosome-specific changes in a human-hamster hybrid cell line (AL) assessed by fluorescent in situ hybridization (fish)

    Geard, Charles R.; Jenkins, Gloria

    1995-01-01

    Purpose: To quantitatively assess all gamma-ray induced chromosomal changes confined to one human chromosome using fluorescence microscopy and in situ hybridization with a fluorescently labeled human chromosome specific nucleic acid probe. Methods and Materials: Synchronized human-hamster hybrid cells containing human chromosome 11 were obtained by a modified mitotic shake-off procedure. G1 phase cells (> 95%) were irradiated with 137 Cs gamma rays (0, 0.5, 1.0, 1.5, 2.0, 4.0, 6.0, 8.0, and 10.0 Gy) at a dose rate of 1.1 Gy/min and mitotic cells collected 16-20 h later; chromosomal spreads were prepared, denatured, and hybridized with a fluorescein-tagged nucleic acid probe against total human DNA. Chromosomes were examined by fluorescence microscopy and all categories of change involving the human chromosome 11 as target, recorded. Results: Overall, of the 3104 human-hamster hybrid cells examined, 82.1% were euploid, of which 88.6% contained one copy of human chromosome 11, 6.2% contained two copies, and 5.2% contained 0 copies. This is compatible with mitotic nondisjunction in a small fraction of cells. Of the remaining 17.9% of cells, 85.2% were tetraploid cells with two copies of human chromosome 11. For all aberrations involving human chromosome 11 there was a linear relationship between yield and absorbed dose of 0.1 aberrations per chromosome per Gy. The yield of dicentrics, translocations, and terminal deletions that involve one lesion on the human chromosome was linear, while the yield of interstitial deletions that arise from two interacting lesions on the human chromosome was curvilinear. The frequencies of dicentrics and translocations were about equal, while there was a high (40-60%) incidence of incomplete exchanges between human and hamster chromosomes. Conclusions: Fluorescent in situ hybridization (FISH) procedures allow for the efficient detection of a broad range of induced changes in target chromosomes. Symmetrical exchanges induced in G1

  11. A new look at auranofin, dextromethorphan and rosiglitazone for reduction of glia-mediated inflammation in neurodegenerative diseases

    Jocelyn M Madeira

    2015-01-01

    Full Text Available Neurodegenerative disorders including Alzheimer′s disease are characterized by chronic inflammation in the central nervous system. The two main glial types involved in inflammatory reactions are microglia and astrocytes. While these cells normally protect neurons by providing nutrients and growth factors, disease specific stimuli can induce glial secretion of neurotoxins. It has been hypothesized that reducing glia-mediated inflammation could diminish neuronal loss. This hypothesis is supported by observations that chronic use of non-steroidal anti-inflammatory drugs (NSAIDs is linked with lower incidences of neurodegenerative disease. It is possible that the NSAIDs are not potent enough to appreciably reduce chronic neuroinflammation after disease processes are fully established. Gold thiol compounds, including auranofin, comprise another class of medications effective at reducing peripheral inflammation. We have demonstrated that auranofin inhibits human microglia- and astrocyte-mediated neurotoxicity. Other drugs which are currently used to treat peripheral inflammatory conditions could be helpful in neurodegenerative disease. Three different classes of anti-inflammatory compounds, which have a potential to inhibit neuroinflammation are highlighted below.

  12. High Line

    Kiib, Hans

    2015-01-01

    At just over 10 meters above street level, the High Line extends three kilometers through three districts of Southwestern Manhattan in New York. It consists of simple steel construction, and previously served as an elevated rail line connection between Penn Station on 34th Street and the many....... The High Line project has been carried out as part of an open conversion strategy. The result is a remarkable urban architectural project, which works as a catalyst for the urban development of Western Manhattan. The greater project includes the restoration and reuse of many old industrial buildings...

  13. An Asian poverty line? Issues and options

    Klasen, Stephan

    2016-01-01

    Given Asia's record of rapid economic growth and the conceptual and empirical problems of the current international income poverty line ('dollar-a-day'), this paper discusses whether there is merit to develop an Asia-specific poverty line that addresses some of the shortcomings of the dollar-a-day line and additionally considers Asia's particular economic situation. We consider various ways of creating an Asia-specific poverty line, including an Asia-specific international income poverty line...

  14. World lines.

    Waser Jürgen; Fuchs Raphael; Ribicic Hrvoje; Schindler Benjamin; Blöschl Günther; Gröller Eduard

    2010-01-01

    In this paper we present World Lines as a novel interactive visualization that provides complete control over multiple heterogeneous simulation runs. In many application areas decisions can only be made by exploring alternative scenarios. The goal of the suggested approach is to support users in this decision making process. In this setting the data domain is extended to a set of alternative worlds where only one outcome will actually happen. World Lines integrate simulation visualization and...

  15. Break Lines, This data was produced for the USGS according to specific project requirements. The Lidar derived breaklines cover Somerset County and the Western portion of Wicomico County, Maryland. Inland streams, rivers, lakes, ponds and tidal features are present., Published in 2012, Not Applicable scale, Eastern Shore Regional GIS Cooperative.

    NSGIC Regional | GIS Inventory — Break Lines dataset current as of 2012. This data was produced for the USGS according to specific project requirements. The Lidar derived breaklines cover Somerset...

  16. Box-Behnken design for optimum extraction of biogenetic chemicals from P. lanceolata with an energy audit (thermal × microwave × acoustic): a case study of HPTLC determination with additional specificity using on-line/off-line coupling with DAD/NIR/ESI-MS.

    Srivastava, Pooja; Ajayakumar, P V; Shanker, Karuna

    2014-01-01

    The genus Pluchea comprises about 80 species distributed worldwide, out of them, only Pluchea lanceolata (DC.) Oliv. & Hiern, is used extensively in the traditional system of India. No chromatographic method is available for its quality. To perform the energy audit for the extraction of biogenetic pentacyclic triterpene, its acetate and sterol from P. lanceolata utilising organic and four alternative solvents. Additionally to resolve the uncertainty of TLC determination, on-line/off-line coupling with a diode-array detector (DAD), and near-infrared (NIR) and electrospray ionisation (ESI) MS was introduced. The extraction of taraxasterol (Tx), taraxasterol acetate (TxAc) and stigmasterol (St) from P. lanceolata was performed using three energy modes. The effects of different operating parameters were studied for optimum extraction yield using the design of experiments, that is, the central composite design and Box-Behnken design. In addition to the retention factor (Rf ) and visible spectral matching, two additional optical spectroscopic techniques, that is, NIR and ESI-MS, were applied for extended specificity. The method was developed for Tx, TxAc and St determination using HPTLC at 645 nm. The optimum extraction yield of targeted compounds was found to be higher with organic solvents than eco-friendly surfactants. The pulse ultrasonic assisted extraction (PUAE) has resulted in optimum extraction of compounds comparable to hot extraction. Both NIR and ESI-MS provided extended specificity in determination. The 5/1-PUAE was determined to be effective, reproducible, simple and energy efficient for the determination of Tx, TxAc and St in P. lanceolata. The offline coupling of NIR and ESI-MS with HPTLC led to considerable improvement in specificity. Copyright © 2014 John Wiley & Sons, Ltd.

  17. Insulin-sensitising drugs (metformin, rosiglitazone, pioglitazone, D-chiro-inositol) for women with polycystic ovary syndrome, oligo amenorrhoea and subfertility.

    Morley, Lara C; Tang, Thomas; Yasmin, Ephia; Norman, Robert J; Balen, Adam H

    2017-11-29

    Polycystic ovary syndrome (PCOS) is characterised by infrequent or absent ovulation, and high levels of androgens and insulin (hyperinsulinaemia). Hyperinsulinaemia occurs secondary to insulin resistance and is associated with increased risk of cardiovascular disease and diabetes mellitus. Insulin-sensitising agents such as metformin may be effective in treating PCOS-related anovulation. To evaluate the effectiveness and safety of insulin-sensitising drugs in improving reproductive and metabolic outcomes for women with PCOS undergoing ovulation induction. We searched the following databases from inception to January 2017: Cochrane Gynaecology and Fertility Group Specialised Register, CENTRAL, MEDLINE, Embase, PsycINFO and CINAHL. We searched registers of ongoing trials and reference lists from relevant studies. We included randomised controlled trials of insulin-sensitising drugs compared with placebo, no treatment, or an ovulation-induction agent for women with oligo and anovulatory PCOS. Two review authors independently assessed studies for eligibility and bias. Primary outcomes were live birth rate and gastrointestinal adverse effects. Secondary outcomes included other pregnancy outcomes, menstrual frequency and metabolic effects. We combined data to calculate pooled odds ratios (ORs) and 95% confidence intervals (CIs). We assessed statistical heterogeneity using the I 2 statistic and reported quality of the evidence for primary outcomes using GRADE methodology. We assessed the interventions metformin, clomiphene citrate, metformin plus clomiphene citrate, D-chiro-inositol, rosiglitazone and pioglitazone. We compared these with each other, placebo or no treatment. We included 48 studies (4451 women), 42 of which investigated metformin (4024 women). Evidence quality ranged from very low to moderate. Limitations were risk of bias (poor reporting of methodology and incomplete outcome data), imprecision and inconsistency. Metformin versus placebo or no treatment

  18. Silver linings.

    Bultas, Margaret W; Pohlman, Shawn

    2014-01-01

    The purpose of this interpretive phenomenological study was to gain a better understanding of the experiences of 11 mothers of preschool children with autism spectrum disorder (ASD). Mothers were interviewed three times over a 6 week period. Interviews were analyzed using interpretive methods. This manuscript highlights one particular theme-a positive perspective mothers described as the "silver lining." This "silver lining" represents optimism despite the adversities associated with parenting a child with ASD. A deeper understanding of this side of mothering children with ASD may help health care providers improve rapport, communication, and result in more authentic family centered care. Copyright © 2014 Elsevier Inc. All rights reserved.

  19. Building with a Line

    Hubbert, Beth

    2011-01-01

    Architecture is a versatile, multifaceted area to study in the artroom with multiple age levels. It can easily stimulate a study of basic line, shape, and various other art elements and principles. It can then be extended into a more extensive study of architectural elements, styles, specific architects, architecture of different cultures, and…

  20. Transmission line capital costs

    Hughes, K.R.; Brown, D.R.

    1995-05-01

    The displacement or deferral of conventional AC transmission line installation is a key benefit associated with several technologies being developed with the support of the U.S. Department of Energy's Office of Energy Management (OEM). Previous benefits assessments conducted within OEM have been based on significantly different assumptions for the average cost per mile of AC transmission line. In response to this uncertainty, an investigation of transmission line capital cost data was initiated. The objective of this study was to develop a database for preparing preliminary estimates of transmission line costs. An extensive search of potential data sources identified databases maintained by the Bonneville Power Administration (BPA) and the Western Area Power Administration (WAPA) as superior sources of transmission line cost data. The BPA and WAPA data were adjusted to a common basis and combined together. The composite database covers voltage levels from 13.8 to 765 W, with cost estimates for a given voltage level varying depending on conductor size, tower material type, tower frame type, and number of circuits. Reported transmission line costs vary significantly, even for a given voltage level. This can usually be explained by variation in the design factors noted above and variation in environmental and land (right-of-way) costs, which are extremely site-specific. Cost estimates prepared from the composite database were compared to cost data collected by the Federal Energy Regulatory Commission (FERC) for investor-owned utilities from across the United States. The comparison was hampered because the only design specifications included with the FERC data were voltage level and line length. Working within this limitation, the FERC data were not found to differ significantly from the composite database. Therefore, the composite database was judged to be a reasonable proxy for estimating national average costs

  1. Termometria infravermelha na fenotipagem para resistência à seca de linhagens inter e intraespecíficas de arroz Infrared thermometry for drought phenotyping of inter and intra specific upland rice lines

    Cleber M. Guimarães

    2010-02-01

    Full Text Available Propôs-se avaliar, no presente estudo, a técnica da termometria ao infravermelho na caracterização de linhagens interespecíficas (Oryza glaberrima x Oryza sativa cv Caiapó e intraespecíficas de arroz para tolerância a seca. O experimento, conduzido em Porangatu, GO, foi submetido a condições adequadas de umidade no solo até 30 dias após a emergência, quando então foi implantado um tratamento com deficiência hídrica moderada (aproximadamente 50% da irrigação aplicada em uma parcela testemunha, com condições adequadas de umidade no solo. Verificou-se que as linhagens mais produtivas em condições de deficiência hídrica apresentaram plantas mais altas, com panículas mais densas e com grãos mais bem formados, com menor esterilidade de espiguetas. Observou-se, também, que a temperatura das folhas se correlacionou positivamente com a esterilidade de espiguetas e negativamente com a massa de 100 grãos, altura das plantas, fertilidade de perfilhos e produtividade. Exceto a fertilidade de perfilhos, os demais componentes se correlacionaram com a produtividade de grãos, sendo que com a esterilidade de espiguetas a correlação foi negativa. Concluiu-se que a O. glaberrima confere, às suas progênies, maior rusticidade à deficiência hídrica e que a termometria ao infravermelho é uma técnica auxiliar importante na fenotipagem para tolerância a seca.The purpose of the present study was to evaluate the use of infrared thermometry in the characterization of inter specific (Oryza glaberrima x Oryza sativa cv Caiapó and intra specific upland rice lines for drought tolerance. The experiment, carried out at Porangatu in the State of Goiás, was submitted to adequate soil moisture for up to 30 days following emergence when a moderate water stress treatment was imposed (about 50% of the applied irrigation in a control plot in which adequate conditions of soil moisture were maintained. It has been observed that lines with higher

  2. Isolation of monocytes from leukapheretic products for large-scale GMP-grade generation of cytomegalovirus-specific T-cell lines by means of an automated elutriation device.

    Perseghin, Paolo; D'Amico, Giovanna; Dander, Erica; Gaipa, Giuseppe; Dassi, Maria; Biagi, Ettore; Biondi, Andrea

    2008-08-01

    Dendritic cells (DC) act as antigen-presenting cells in immune response-mediated mechanisms against malignant cells and/or viral or fungal pathogens. CD14+ monocytes have been so far isolated by techniques of plastic adherence or by using immunomagnetic methods. Here the effectiveness of a commercially available cell separation system (Elutra, Gambro BCT) in the separation of monocytes and the large-scale production of cytomegalovirus (CMV)-specific T-cell lines were investigated. Six mononuclear cell (MNC) collections were processed with the Elutra system. Monocyte-enriched fraction was differentiated into DCs by addition of granulocyte-macrophage-colony-stimulating factor and interleukin (IL)-4. After 6 days of culture, DCs were matured in the presence of interferon (IFN)-gamma, IFN-alpha, IL-1beta, tumor necrosis factor-alpha, and poly(I:C) and pulsed with a pool of 48 MHC Class I and II-binding CMV peptides. Lymphocytes were then stimulated with mature autologous CMV peptide-pulsed DCs. After elutriation, the mean monocyte yield was 0.89 x 10(9) +/- 0.65 x 10(9), with a 51.0 +/- 31.6 percent recovery and a 51.1 +/- 35.4 percent purity. A significant correlation was observed when basal monocyte content was related to the postelutriation recovery (p < 0.0116). More than 60 percent of plated monocytes were differentiated into DCs, which after pulsing with CMV peptides, were able to stimulate a robust enrichment in CMV antigen-specific T cells in all tested samples (mean percentage of pentamer-positive CD8+ cells, 35% compared to the initial 2%). Our findings might be helpful for an appropriate MNC collection, to maximize the efficiency of the elutriation system and subsequently obtain an optimal monocyte-enriched yield for further DC generation and T-cell stimulation.

  3. production lines

    Jingshan Li

    2000-01-01

    Full Text Available In this work, serial production lines with finished goods buffers operating in the pull regime are considered. The machines are assumed to obey Bernoulli reliability model. The problem of satisfying customers demand is addressed. The level of demand satisfaction is quantified by the due-time performance (DTP, which is defined as the probability to ship to the customer a required number of parts during a fixed time interval. Within this scenario, the definitions of DTP bottlenecks are introduced and a method for their identification is developed.

  4. Line facilities outline

    1998-08-01

    This book deals with line facilities. The contents of this book are outline line of wire telecommunication ; development of line, classification of section of line and theory of transmission of line, cable line ; structure of line, line of cable in town, line out of town, domestic cable and other lines, Optical communication ; line of optical cable, transmission method, measurement of optical communication and cable of the sea bottom, Equipment of telecommunication line ; telecommunication line facilities and telecommunication of public works, construction of cable line and maintenance and Regulation of line equipment ; regulation on technique, construction and maintenance.

  5. Parallel Lines

    James G. Worner

    2017-05-01

    Full Text Available James Worner is an Australian-based writer and scholar currently pursuing a PhD at the University of Technology Sydney. His research seeks to expose masculinities lost in the shadow of Australia’s Anzac hegemony while exploring new opportunities for contemporary historiography. He is the recipient of the Doctoral Scholarship in Historical Consciousness at the university’s Australian Centre of Public History and will be hosted by the University of Bologna during 2017 on a doctoral research writing scholarship.   ‘Parallel Lines’ is one of a collection of stories, The Shapes of Us, exploring liminal spaces of modern life: class, gender, sexuality, race, religion and education. It looks at lives, like lines, that do not meet but which travel in proximity, simultaneously attracted and repelled. James’ short stories have been published in various journals and anthologies.

  6. Red Maca (Lepidium meyenii) did not affect cell viability despite increased androgen receptor and prostate-specific antigen gene expression in the human prostate cancer cell line LNCaP.

    Díaz, P; Cardenas, H; Orihuela, P A

    2016-10-01

    We examined whether aqueous extract of Lepidium meyenii (red Maca) could inhibit growth, potentiate apoptotic activity of two anticancer drugs Taxol and 2-methoxyestradiol (2ME) or change mRNA expression for the androgen target genes, androgen receptor (Ar) and prostate-specific antigen (Psa) in the human prostate cancer cell line LNCaP. Red Maca aqueous extract at 0, 10, 20, 40 or 80 μg/ml was added to LNCaP cells, and viability was evaluated by the MTS assay at 24 or 48 hr after treatment. Furthermore, LNCaP cells were treated with 80 μg/ml of red Maca plus Taxol or 2ME 5 μM and viability was assessed 48 hr later. Finally, LNCaP cells were treated with red Maca 0, 20, 40 or 80 μg/ml, and 12 hr later, mRNA level for Ar or Psa was assessed by real-time PCR. Treatment with red Maca did not affect viability of LNCaP cells. Apoptotic activity induced by Taxol and 2ME in LNCaP cells was not altered with red Maca treatment. Relative expression of the mRNA for Ar and Psa increased with red Maca 20 and 40 μg/ml, but not at 80 μg/ml. We conclude that red Maca aqueous extract does not have toxic effects, but stimulates androgen signalling in LNCaP cells. © 2016 Blackwell Verlag GmbH.

  7. A novel genotoxin-specific qPCR array based on the metabolically competent human HepaRG™ cell line as a rapid and reliable tool for improved in vitro hazard assessment.

    Ates, Gamze; Mertens, Birgit; Heymans, Anja; Verschaeve, Luc; Milushev, Dimiter; Vanparys, Philippe; Roosens, Nancy H C; De Keersmaecker, Sigrid C J; Rogiers, Vera; Doktorova, Tatyana Y

    2018-04-01

    Although the value of the regulatory accepted batteries for in vitro genotoxicity testing is recognized, they result in a high number of false positives. This has a major impact on society and industries developing novel compounds for pharmaceutical, chemical, and consumer products, as afflicted compounds have to be (prematurely) abandoned or further tested on animals. Using the metabolically competent human HepaRG ™ cell line and toxicogenomics approaches, we have developed an upgraded, innovative, and proprietary gene classifier. This gene classifier is based on transcriptomic changes induced by 12 genotoxic and 12 non-genotoxic reference compounds tested at sub-cytotoxic concentrations, i.e., IC10 concentrations as determined by the 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The resulting gene classifier was translated into an easy-to-handle qPCR array that, as shown by pathway analysis, covers several different cellular processes related to genotoxicity. To further assess the predictivity of the tool, a set of 5 known positive and 5 known negative test compounds for genotoxicity was evaluated. In addition, 2 compounds with debatable genotoxicity data were tested to explore how the qPCR array would classify these. With an accuracy of 100%, when equivocal results were considered positive, the results showed that combining HepaRG ™ cells with a genotoxin-specific qPCR array can improve (geno)toxicological hazard assessment. In addition, the developed qPCR array was able to provide additional information on compounds for which so far debatable genotoxicity data are available. The results indicate that the new in vitro tool can improve human safety assessment of chemicals in general by basing predictions on mechanistic toxicogenomics information.

  8. VT Digital Line Graph Miscellaneous Transmission Lines

    Vermont Center for Geographic Information — (Link to Metadata) This datalayer is comprised of Miscellaineous Transmission Lines. Digital line graph (DLG) data are digital representations of cartographic...

  9. The U-line line balancing problem

    Miltenburg, G.J.; Wijngaard, J.

    1994-01-01

    The traditional line balancing (LB) problem considers a production line in which stations are arranged consecutively in a line. A balance is determined by grouping tasks into stations while moving forward (or backward) through a precedence network. Recently many production lines are being arranged

  10. Specific degradation of 3[prime prime or minute] regions of GUS mRNA in posttranscriptionally silenced tobacco lines may be related to 5[prime prime or minute]-3[prime prime or minute] spreading of silencing

    Braunstein, T.H.; Moury, B.; Johannessen, M.M.

    2002-01-01

    background, we have performed detailed analyses of target regions in three spontaneously beta-glucuronidase (GUS) silencing tobacco lines of different origin. From quantitative cosuppression experiments, we show that the main target region in all three tobacco lines is found within the 3' half of the GUS...... VIGS. Surprisingly, only evidence for spreading of the target region in the 5'-3' direction was obtained. This finding may help explain why the majority of target regions examined to date lie within the 3' region of transgenes....

  11. Epstein-Barr virus (EBV) provides survival factors to EBV+ diffuse large B-cell lymphoma (DLBCL) lines and modulates cytokine induced specific chemotaxis in EBV+  DLBCL.

    Wu, Liang; Ehlin-Henriksson, Barbro; Zhou, Xiaoying; Zhu, Hong; Ernberg, Ingemar; Kis, Lorand L; Klein, George

    2017-12-01

    Diffuse large B-cell lymphoma (DLBCL), the most common type of malignant lymphoma, accounts for 30% of adult non-Hodgkin lymphomas. Epstein-Barr virus (EBV) -positive DLBCL of the elderly is a newly recognized subtype that accounts for 8-10% of DLBCLs in Asian countries, but is less common in Western populations. Five DLBCL-derived cell lines were employed to characterize patterns of EBV latent gene expression, as well as response to cytokines and chemotaxis. Interleukin-4 and interleukin-21 modified LMP1, EBNA1 and EBNA2 expression depending on cell phenotype and type of EBV latent programme (type I, II or III). These cytokines also affected CXCR4- or CCR7-mediated chemotaxis in two of the cell lines, Farage (type III) and Val (type II). Further, we investigated the effect of EBV by using dominant-negative EBV nuclear antigen 1(dnEBNA1) to eliminate EBV genomes. This resulted in decreased chemotaxis. By employing an alternative way to eliminate EBV genomes, Roscovitine, we show an increase of apoptosis in the EBV-positive lines. These results show that EBV plays an important role in EBV-positive DLBCL lines with regard to survival and chemotactic response. Our findings provide evidence for the impact of microenvironment on EBV-carrying DLBCL cells and might have therapeutic implications. © 2017 John Wiley & Sons Ltd.

  12. Illustrative Line Styles for Flow Visualization

    Everts, Maarten H.; Bekker, Hendrik; Roerdink, Jos B. T. M.; Isenberg, Tobias

    2011-01-01

    We present a flexible illustrative line style model for the visualization of streamline data. Our model partitions view-oriented line strips into parallel bands whose basic visual properties can be controlled independently. We thus extend previous line stylization techniques specifically for

  13. Flow Visualization using Illustrative Line Styles

    Everts, Maarten H.; Bekker, Hendrik; Roerdink, Jos B. T. M.; Isenberg, Tobias; Bekker, Paulus

    2011-01-01

    We present a flexible illustrative line style model for the visualization of streamline data. Our model partitions view- oriented line strips into parallel bands whose basic visual properties can be controlled independently. We thus extend previous line stylization techniques specifically for

  14. Standardization of beam line representations

    Carey, David C.

    1998-01-01

    Standardization of beam line representations means that a single set of data can be used in many situations to represent a beam line. This set of data should be the same no matter what the program to be run or the calculation to be made. We have concerned ourselves with three types of standardization: (1) The same set of data should be usable by different programs. (2) The inclusion of other items in the data, such as calculations to be done, units to be used, or preliminary specifications, should be in a notation similar to the lattice specification. (3) A single set of data should be used to represent a given beam line, no matter what is being modified or calculated. The specifics of what is to be modified or calculated can be edited into the data as part of the calculation. These three requirements all have aspects not previously discussed in a public forum. Implementations into TRANSPORT will be discussed

  15. Standardization of beam line representations

    Carey, David C.

    1999-01-01

    Standardization of beam line representations means that a single set of data can be used in many situations to represent a beam line. This set of data should be the same no matter what the program to be run or the calculation to be made. We have concerned ourselves with three types of standardization: (1) The same set of data should be usable by different programs. (2) The inclusion of other items in the data, such as calculations to be done, units to be used, or preliminary specifications, should be in a notation similar to the lattice specification. (3) A single set of data should be used to represent a given beam line, no matter what is being modified or calculated. The specifics of what is to be modified or calculated can be edited into the data as part of the calculation. These three requirements all have aspects not previously discussed in a public forum. Implementations into TRANSPORT will be discussed

  16. PROJECT-SPECIFIC TYPE A VERIFICATION FOR THE HIGH FLUX BEAM REACTOR UNDERGROUND UTILITIES REMOVAL PHASE 2 D/F WASTE LINE REMOVAL, BROOKHAVEN NATIONAL LABORATORY UPTON, NEW YORK

    Weaver, P.C.

    2010-01-01

    Oak Ridge Institute for Science and Education (ORISE) has reviewed the project documentation and data for the High Flux Beam Reactor (HFBR) Underground Utilities removal Phase 2; the D/F Waste Line removal at Brookhaven National Laboratory (BNL) in Upton, New York. The Brookhaven Survey Group (BSG) has completed removal and performed the final status survey (FSS) of the D/F Waste Line that provided the conduit for pumping waste from Building 750 to Building 801. Sample results have been submitted as required to demonstrate that the cleanup goals of 15 mrem/yr above background to a resident in 50 years have been met. Four rounds of sampling, from pre-excavation to final status survey (FSS), were performed as specified in the Field Sampling Plan (FSP) (BNL 2010a). It is the policy of the US Departmental of Energy (DOE) to perform independent verifications of decontamination and decomissioning activities conducted at DOE facilities. ORISE has been designated as the organization responsible for this task at the HFBR. ORISE together with DOE determined that a Type A verification of the D/F Waste Line was appropriate based on its method of construction and upon the minimal potential for residual radioactivity in the area. The removal of underground utilities is being performed in three stages in the process to decommission the HFBR facility and support structures. Phase 2 of this project included the grouting and removal of 1100 feet of 2-inch pipe and 640 feet of 4-inch pipe that served as the D/F Waste Line. Based on the pre-excavation sample results of the soil overburden, the potential for contamination of the soil surrounding the pipe is minimal (BNL 2010a). ORISE reviewed the BNL FSP and identified comments for consideration (ORISE 2010). BNL prepared a revised FSP that addressed each ORISE comment adequately (BNL 2010a). ORISE referred to the revised Phase 2 D/F Waste Line removal FSP FSS data to conduct the Type A verification and determine whether the intent odf

  17. Abscisic acid synergizes with rosiglitazone to improve glucose tolerance and down-modulate macrophage accumulation in adipose tissue: possible action of the cAMP/PKA/PPAR γ axis.

    Guri, Amir J; Hontecillas, Raquel; Bassaganya-Riera, Josep

    2010-10-01

    Abscisic acid (ABA) is effective in preventing insulin resistance and obesity-related inflammation through a PPAR γ-dependent mechanism. The objective of this study was to assess the efficacy ABA in improving glucose homeostasis and suppress inflammation when administered in combination with rosiglitazone (Ros) and to determine whether PPAR γ activation by ABA is initiated via cAMP/protein kinase A (PKA) signaling. Obese db/db mice were fed high-fat diets containing 0, 10, or 70 mg/kg Ros with and without racemic ABA (100 mg/kg) for 60 days. Glucose tolerance and fasting insulin levels were assessed at 6 and 8 weeks, respectively, and adipose tissue macrophage (ATM) infiltration was examined by flow cytometry. Gene expression was examined on white adipose tissue (WAT) and stromal vascular cells (SVCs) cultured with ABA, Ros, or an ABA/Ros combination. Both Ros and ABA improved glucose tolerance, and ABA decreased plasma insulin levels while having no effect on Ros-induced weight gain. ABA in combination with low-dose Ros (10 mg/kg; Roslo) synergistically inhibited ATM infiltration. Treatment of SVCs with Ros, ABA or ABA/Ros suppressed expression of the M1 marker CCL17. ABA and Ros synergistically increased PPAR γ activity and pretreatment with a cAMP-inhibitor or a PKA-inhibitor abrogated ABA-induced PPAR γ activation. ABA and Ros act synergistically to modulate PPAR γ activity and macrophage accumulation in WAT and ABA enhances PPAR γ activity through a membrane-initiated mechanism dependent on cAMP/PKA signaling. Copyright © 2010 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

  18. Quercetin, ascorbic acid, caffeine and ellagic acid are more efficient than rosiglitazone, metformin and glimepiride in interfering with pathways leading to the development of neurological complications associated with diabetes: A comparative in-vitro study

    Vineet Mehta

    2017-06-01

    Full Text Available Neuropathy is the least understood and most devastating complication associated with diabetes. Diabetic neuropathy develops in patients despite of regular therapy, indicating that marketed drugs has minimal effect on pathways leading to the development and progression of these complications. Present study was aimed to evaluate natural compounds for their ability to interfere with pathways leading to the development of diabetes mediated neurological complications and compare their efficacy with marketed anti-diabetic drugs. Anti-diabetic potential of ascorbic acid, gallic acid, quercetin, ellagic acid, cinnamic acid, caffeine and piperine was predicted by evaluating in-silico interaction energy (kcal/mol of these compounds with insulin receptor, peroxisome proliferator-activated receptor gamma-γ and dipeptidyl peptidase-4 proteins. Ascorbic acid, gallic acid, quercetin and ellagic acid showed excellent in-vitro antioxidant activity in DPPH radical scavenging and inhibition of lipid peroxidation assay, which was 1.5–3 folds better than the marketed drugs. Quercetin, gallic acid, cinnamic acid, piperine and caffeine efficiently prevented H2O2 induced genotoxicity, which commercial drugs failed to prevent. Further, quercetin, ellagic acid, caffeine and ascorbic acid were 3–4.7 folds better than marketed drugs in inhibiting α-amylase activity. Herbal molecules and rosiglitazone showed comparable results for glucose uptake, which may be attributed to enhanced GLUT4 translocation into primary neuronal culture under hyperglycemic conditions. In conclusion, currently available marketed anti-diabetic drugs have minimal effect on the pathways leading to diabetic neuropathy and supplementing diabetic therapeutics with quercetin, ascorbic acid, caffeine and ellagic acid may be better suited to counter diabetic neuropathy through inhibiting oxidative stress, genotoxicity and improving neuronal glucose utilization.

  19. Remote mechanical C line

    Nuttall, K.R.; Gardner, P.R.

    1991-01-01

    Westinghouse Hanford Company is developing a desk-top simulation based training program on the operation of the Remote Mechanical C (RMC) Line process in the Plutonium Finishing Plant on the Hanford site, Richland, Washington. Simulations display aod contioually update current values of system parameters on computer graphics of RMC line equipment. Students are able to operate a variety of controllers to maintain proper system status. Programmed faults, selectable by the course instructor, can be used to test student responses to off-normal events. Prior to operation of the simulation, students are given computer-based tutorials on the function, processes, operation, and error conditions associated with individual components. By including the capability of operating each individual component - valves, heaters, agitators, etc. - the computer-based training (CBT) lessons become an interactive training manual. From one perspective RMC represents one step in the diffusion of the well-known and well-documented simulator training activities for nuclear reactor operators to other training programs, equally critical, perhaps, but less well scrutinized in the past. Because of the slowly responding nature of the actual process, RMC can retain many of the capabilities of practice and testing in a simulated work environment while avoiding the cost of a full scale simulator and the exposure and waste developed by practice runs of the RMC line. From another perspective RMC suggests training advances even beyond the most faithful simulators. For example, by integrating CBT lessons with the simulation, RMC permits students to focus in on specific processes occurring inside chosen components. In effect, the interactive training manual is available on-line with the simulation itself. Cost are also discussed

  20. Similarity law for Widom lines and coexistence lines.

    Banuti, D T; Raju, M; Ihme, M

    2017-05-01

    The coexistence line of a fluid separates liquid and gaseous states at subcritical pressures, ending at the critical point. Only recently, it became clear that the supercritical state space can likewise be divided into regions with liquidlike and gaslike properties, separated by an extension to the coexistence line. This crossover line is commonly referred to as the Widom line, and is characterized by large changes in density or enthalpy, manifesting as maxima in the thermodynamic response functions. Thus, a reliable representation of the coexistence line and the Widom line is important for sub- and supercritical applications that depend on an accurate prediction of fluid properties. While it is known for subcritical pressures that nondimensionalization with the respective species critical pressures p_{cr} and temperatures T_{cr} only collapses coexistence line data for simple fluids, this approach is used for Widom lines of all fluids. However, we show here that the Widom line does not adhere to the corresponding states principle, but instead to the extended corresponding states principle. We resolve this problem in two steps. First, we propose a Widom line functional based on the Clapeyron equation and derive an analytical, species specific expression for the only parameter from the Soave-Redlich-Kwong equation of state. This parameter is a function of the acentric factor ω and compares well with experimental data. Second, we introduce the scaled reduced pressure p_{r}^{*} to replace the previously used reduced pressure p_{r}=p/p_{cr}. We show that p_{r}^{*} is a function of the acentric factor only and can thus be readily determined from fluid property tables. It collapses both subcritical coexistence line and supercritical Widom line data over a wide range of species with acentric factors ranging from -0.38 (helium) to 0.34 (water), including alkanes up to n-hexane. By using p_{r}^{*}, the extended corresponding states principle can be applied within

  1. Radiation resistant lining material

    Ouchi, Koki; Okagawa, Seigo; Tamaki, Hidehiro.

    1990-01-01

    Rigidity, viscoelasticity, flexibility, radiation resistance, leaching resistance, rust-proofness, endurance, etc. are required for the lining materials to wall surfaces and floor surfaces of facilities used under the effect of radiation rays and for the inner surface protection of vessels for radioactive wastes. The present invention provides radiation resistant lining material capable of satisfying such various requirements in a well-balanced manner. That is, the material contains (A) 100 parts by weight of rapidly curing cement, (B) 50 to 300 % by weight of aggregate, and (C) 80 to 120 parts by weight of polymer emulsion. As the specific example, the ingredient (A) is commercially available under the trade name of Jet Cement. The aggregate of the ingredient (B) has preferably from about 0.6 to 0.2 mm of size and is made of material, preferably, silicon or iron grains. As the ingredient (C), acrylic resin emulsion is preferred. As a result of example, these ingredient constitutions can satisfy each of the required performance described above. (I.S.)

  2. Cable line engineering

    Jang, Hak Sin; Kim, Sin Yeong

    1998-02-01

    This book is about cable line engineering. It is comprised of nine chapters, which deals with summary of cable communication such as way, process of cable communication and optical communication, Line constant of transmission on primary constant, reflection and crosstalk, communication cable line of types like flat cable, coaxial cable and loaded cable, Install of communication line with types and facility of aerial line, construction method of communication line facility, Measurement of communication line, Carrier communication of summary, PCM communication with Introduction, regeneration relay system sampling and quantization and Electric communication service and general information network with mobile communication technique and satellite communication system.

  3. Organotins Are Potent Activators of PPARγ and Adipocyte Differentiation in Bone Marrow Multipotent Mesenchymal Stromal Cells

    Yanik, Susan C.; Baker, Amelia H.; Mann, Koren K.; Schlezinger, Jennifer J.

    2011-01-01

    Adipocyte differentiation in bone marrow is potentially deleterious to both bone integrity and lymphopoiesis. Here, we examine the hypothesis that organotins, common environmental contaminants that are dual ligands for peroxisome proliferator–activated receptor (PPAR) γ and its heterodimerization partner retinoid X receptor (RXR), are potent activators of bone marrow adipogenesis. A C57Bl/6-derived bone marrow multipotent mesenchymal stromal cell (MSC) line, BMS2, was treated with rosiglitazone, a PPARγ agonist, bexarotene, an RXR agonist, or a series of organotins. Rosiglitazone and bexarotene potently activated adipocyte differentiation; however, bexarotene had a maximal efficacy of only 20% of that induced by rosiglitazone. Organotins (tributyltin [TBT], triphenyltin, and dibutyltin) also stimulated adipocyte differentiation (EC50 of 10–20nM) but with submaximal, structure-dependent efficacy. In coexposures, both bexarotene and TBT enhanced rosiglitazone-induced adipogenesis. To investigate the contribution of PPARγ to TBT-induced adipogenesis, we examined expression of PPARγ2, as well as its transcriptional target FABP4. TBT-induced PPARγ2 and FABP4 protein expression with an efficacy intermediate between rosiglitazone and bexarotene, similar to lipid accumulation. A PPARγ antagonist and PPARγ-specific small hairpin RNA suppressed TBT-induced differentiation, although to a lesser extent than rosiglitazone-induced differentiation, suggesting that TBT may engage alternate pathways. TBT and bexarotene, but not rosiglitazone, also induced the expression of TGM2 (an RXR target) and ABCA1 (a liver X receptor target). The results show that an environmental contaminant, acting with the same potency as a therapeutic drug, induces PPARγ-dependent adipocyte differentiation in bone marrow MSCs. Activation of multiple nuclear receptor pathways by organotins may have significant implications for bone physiology. PMID:21622945

  4. VT Electric Transmission Line Corridors - corridor lines

    Vermont Center for Geographic Information — (Link to Metadata) The ELTRN layer depicts electric transmission line corridors in Vermont. Various methods have been used to digitize features. The data layer...

  5. Introducing Product Lines through Open Source Tools

    Haugen, Øystein

    2008-01-01

    We present an approach to introducing product lines to companies that lower their initial risk by applying open source tools and a smooth learning curve into the use and creation of domain specific modeling combined with standardized variability modeling.

  6. Homotopic Polygonal Line Simplification

    Deleuran, Lasse Kosetski

    This thesis presents three contributions to the area of polygonal line simplification, or simply line simplification. A polygonal path, or simply a path is a list of points with line segments between the points. A path can be simplified by morphing it in order to minimize some objective function...

  7. Product Line Rivalry with Brand Differentiation

    Gilbert, Richard J.; Matutes, Carmen

    1989-01-01

    Competition with product rivalry is examined in a model where products are differentiated by both quality and brand name. With no commitment, firms produce a full product line. When firms can commit to restrict their product offerings, firms specialize if the degree of brand-specific differentiation is small and they produce a full product line if brand-specific differentiation is large relative to intrafirm differentiation. Firms may crowd a product space when all competitors would be better...

  8. Proximity effects of high voltage electric power transmission lines on ...

    Yomi

    2010-08-18

    Aug 18, 2010 ... transmission lines on ornamental plant growth. Zeki Demir ... The effects of proximity to power-line on specific leaf area and seedling dbh were tested .... during vegetation season is about 72% and common wind blow.

  9. Effects of PPARs agonists on cardiac metabolism in littermate and cardiomyocyte-specific PPAR-γ-knockout (CM-PGKO mice.

    Michelangela Barbieri

    Full Text Available Understanding the molecular regulatory mechanisms controlling for myocardial lipid metabolism is of critical importance for the development of new therapeutic strategies for heart diseases. The role of PPARγ and thiazolidinediones in regulation of myocardial lipid metabolism is controversial. The aim of our study was to assess the role of PPARγ on myocardial lipid metabolism and function and differentiate local/from systemic actions of PPARs agonists using cardiomyocyte-specific PPARγ -knockout (CM-PGKO mice. To this aim, the effect of PPARγ, PPARγ/PPARα and PPARα agonists on cardiac function, intra-myocyte lipid accumulation and myocardial expression profile of genes and proteins, affecting lipid oxidation, uptake, synthesis, and storage (CD36, CPT1MIIA, AOX, FAS, SREBP1-c and ADPR was evaluated in cardiomyocyte-specific PPARγ-knockout (CM-PGKO and littermate control mice undergoing standard and high fat diet (HFD. At baseline, protein levels and mRNA expression of genes involved in lipid uptake, oxidation, synthesis, and accumulation of CM-PGKO mice were not significantly different from those of their littermate controls. At baseline, no difference in myocardial lipid content was found between CM-PGKO and littermate controls. In standard condition, pioglitazone and rosiglitazone do not affect myocardial metabolism while, fenofibrate treatment significantly increased CD36 and CPT1MIIA gene expression. In both CM-PGKO and control mice submitted to HFD, six weeks of treatment with rosiglitazone, fenofibrate and pioglitazone lowered myocardial lipid accumulation shifting myocardial substrate utilization towards greater contribution of glucose. In conclusion, at baseline, PPARγ does not play a crucial role in regulating cardiac metabolism in mice, probably due to its low myocardial expression. PPARs agonists, indirectly protect myocardium from lipotoxic damage likely reducing fatty acids delivery to the heart through the actions on adipose

  10. Reconstruction of railway energy lines; Rekonstruktion von Bahnenergieleitungen

    Rothe, Matthias [DB Energie Gmbh, Berlin (Germany); Wahlen, Manfred [DB Energie Gmbh, Koeln (Germany)

    2013-06-15

    As is the case for other overhead lines, 110 kV railway energy lines are assumed to have a service life of 80 years. When this service life ends or the lines are adapted to the state of the art as necessary, all components of the overhead line are renewed. For the reconstruction of railway energy lines, the specifications laid down in planning and environmental laws, operational management aspects and the local ambient and development situation are decisive project planning parameters. (orig.)

  11. Towards Coleoptera-specific high-throughput screening systems for compounds with ecdysone activity: development of EcR reporter assays using weevil (Anthonomus grandis)-derived cell lines and in silico analysis of ligand binding to A. grandis EcR ligand-binding pocket.

    Soin, Thomas; Iga, Masatoshi; Swevers, Luc; Rougé, Pierre; Janssen, Colin R; Smagghe, Guy

    2009-08-01

    Molting in insects is regulated by ecdysteroids and juvenile hormones. Several synthetic non-steroidal ecdysone agonists are on the market as insecticides. These ecdysone agonists are dibenzoylhydrazine (DBH) analogue compounds that manifest their toxicity via interaction with the ecdysone receptor (EcR). Of the four commercial available ecdysone agonists, three (tebufenozide, methoxyfenozide and chromafenozide) are highly lepidopteran specific, one (halofenozide) is used to control coleopteran and lepidopteran insects in turf and ornamentals. However, compared to the very high binding affinity of these DBH analogues to lepidopteran EcRs, halofenozide has a low binding affinity for coleopteran EcRs. For the discovery of ecdysone agonists that target non-lepidopteran insect groups, efficient screening systems that are based on the activation of the EcR are needed. We report here the development and evaluation of two coleopteran-specific reporter-based screening systems to discover and evaluate ecdysone agonists. The screening systems are based on the cell lines BRL-AG-3A and BRL-AG-3C that are derived from the weevil Anthonomus grandis, which can be efficiently transduced with an EcR reporter cassette for evaluation of induction of reporter activity by ecdysone agonists. We also cloned the almost full length coding sequence of EcR expressed in the cell line BRL-AG-3C and used it to make an initial in silico 3D-model of its ligand-binding pocket docked with ponasterone A and tebufenozide.

  12. Directed line liquids

    Kamien, R.D.

    1992-01-01

    This thesis is devoted to the study of ensembles of dense directed lines. These lines are principally to be thought of as polymers, though they also have the morphology of flux lines in high temperature superconductors, strings of colloidal spheres in electrorheological fluids and the world lines of quantum mechanical bosons. The authors discuss how directed polymer melts, string-like formations in electrorheological and ferro-fluids, flux lines in high temperature superconductors and the world lines of quantum mechanical bosons all share similar descriptions. They study a continuous transition in all of these systems, and then study the critical mixing properties of binary mixtures of directed polymers through the renormalization group. They predict the exponents for a directed polymer blend consolute point and a novel two-phase superfluid liquid-gas critical point

  13. Series Transmission Line Transformer

    Buckles, Robert A.; Booth, Rex; Yen, Boris T.

    2004-06-29

    A series transmission line transformer is set forth which includes two or more of impedance matched sets of at least two transmissions lines such as shielded cables, connected in parallel at one end ans series at the other in a cascading fashion. The cables are wound about a magnetic core. The series transmission line transformer (STLT) which can provide for higher impedance ratios and bandwidths, which is scalable, and which is of simpler design and construction.

  14. Covariant electromagnetic field lines

    Hadad, Y.; Cohen, E.; Kaminer, I.; Elitzur, A. C.

    2017-08-01

    Faraday introduced electric field lines as a powerful tool for understanding the electric force, and these field lines are still used today in classrooms and textbooks teaching the basics of electromagnetism within the electrostatic limit. However, despite attempts at generalizing this concept beyond the electrostatic limit, such a fully relativistic field line theory still appears to be missing. In this work, we propose such a theory and define covariant electromagnetic field lines that naturally extend electric field lines to relativistic systems and general electromagnetic fields. We derive a closed-form formula for the field lines curvature in the vicinity of a charge, and show that it is related to the world line of the charge. This demonstrates how the kinematics of a charge can be derived from the geometry of the electromagnetic field lines. Such a theory may also provide new tools in modeling and analyzing electromagnetic phenomena, and may entail new insights regarding long-standing problems such as radiation-reaction and self-force. In particular, the electromagnetic field lines curvature has the attractive property of being non-singular everywhere, thus eliminating all self-field singularities without using renormalization techniques.

  15. Minnesota County Boundaries - lines

    Minnesota Department of Natural Resources — Minnesota county boundaries derived from a combination of 1:24,000 scale PLS lines, 1:100,000 scale TIGER, 1:100,000 scale DLG, and 1:24,000 scale hydrography lines....

  16. Database of emission lines

    Binette, L.; Ortiz, P.; Joguet, B.; Rola, C.

    1998-11-01

    A widely accessible data bank (available through Netscape) and consiting of all (or most) of the emission lines reported in the litterature is being built. It will comprise objects as diverse as HII regions, PN, AGN, HHO. One of its use will be to define/refine existing diagnostic emission line diagrams.

  17. Line radiative transfer and statistical equilibrium*

    Kamp Inga

    2015-01-01

    Full Text Available Atomic and molecular line emission from protoplanetary disks contains key information of their detailed physical and chemical structures. To unravel those structures, we need to understand line radiative transfer in dusty media and the statistical equilibrium, especially of molecules. I describe here the basic principles of statistical equilibrium and illustrate them through the two-level atom. In a second part, the fundamentals of line radiative transfer are introduced along with the various broadening mechanisms. I explain general solution methods with their drawbacks and also specific difficulties encountered in solving the line radiative transfer equation in disks (e.g. velocity gradients. I am closing with a few special cases of line emission from disks: Radiative pumping, masers and resonance scattering.

  18. Specifying Specification.

    Paulo, Norbert

    2016-03-01

    This paper tackles the accusation that applied ethics is no serious academic enterprise because it lacks theoretical bracing. It does so in two steps. In the first step I introduce and discuss a highly acclaimed method to guarantee stability in ethical theories: Henry Richardson's specification. The discussion shows how seriously ethicists take the stability of the connection between the foundational parts of their theories and their further development as well as their "application" to particular problems or cases. A detailed scrutiny of specification leads to the second step, where I use insights from legal theory to inform the debate around stability from that point of view. This view reveals some of specification's limitations. I suggest that, once specification is sufficiently specified, it appears astonishingly similar to deduction as used in legal theory. Legal theory also provides valuable insight into the functional range of deduction and its relation to other forms of reasoning. This leads to a richer understanding of stability in normative theories and to a smart division of labor between deduction and other forms of reasoning. The comparison to legal theory thereby provides a framework for how different methods such as specification, deduction, balancing, and analogy relate to one another.

  19. Wood pole overhead lines

    Wareing, Brian

    2005-01-01

    This new book concentrates on the mechanical aspects of distribution wood pole lines, including live line working, environmental influences, climate change and international standards. Other topics include statutory requirements, safety, profiling, traditional and probabilistic design, weather loads, bare and covered conductors, different types of overhead systems, conductor choice, construction and maintenance. A section has also been devoted to the topic of lightning, which is one of the major sources of faults on overhead lines. The book focuses on the effects of this problem and the strate

  20. Optimal Reinsertion of Cancelled Train Lines

    Groth, Julie Jespersen; Clausen, Jens

    2006-01-01

    One recovery strategy in case of a major disruption in rail network is to cancel all trains on a specific line of the network. When the disturbance has ended, the cancelled line must be reinserted as soon as possible. In this article we present a mixed integer programming (MIP) model for calculat....... The model finds the optimal solution in an average of 0.5 CPU seconds in each test case....

  1. The appearance of beam lines

    Carey, D.C.

    1993-05-01

    The combination of an existing graphics package with a large program like TRANSPORT has often resulted in considerable modification to the large program. Use of other graphics package has resulted in essentially having to repeat the work. This difficulty has been avoided in a modification of TRANSPORT which produce layouts of beam lines. Drawings of the reference trajectory and three-dimensional images of all magnets are made by the graphics package TOP DRAWER. Nothing specific to TOP DRAWER or any other graphics has been incorporated into TRANSPORT. If a user is with a different graphics package he or she can then begin usage of this alternate package essentially immediately

  2. Veterans Crisis Line

    Department of Veterans Affairs — The caring responders at the Veterans Crisis Line are specially trained and experienced in helping Veterans of all ages and circumstances. Some of the responders are...

  3. Product line design

    Anderson, S. P.; Celik, Levent

    2015-01-01

    Roč. 157, May (2015), s. 517-526 ISSN 0022-0531 Institutional support: RVO:67985998 Keywords : product line design * product differentiation * second-degree price discrimination Subject RIV: AH - Economics Impact factor: 1.097, year: 2015

  4. Kansas Electric Transmission Lines

    Kansas Data Access and Support Center — This data set is a digital representation of the EletcircTransmission lines for the State of Kansas as maintained by the Kansas Corporation Commission. Data is...

  5. Electric Power Transmission Lines

    Department of Homeland Security — Transmission Lines are the system of structures, wires, insulators and associated hardware that carry electric energy from one point to another in an electric power...

  6. Probe specificity

    Laget, J.M.

    1986-11-01

    Specificity and complementarity of hadron and electron probes must be systematically developed to answer three questions currently asked in intermediate energy nuclear physics: what is nucleus structure at short distances, what is nature of short range correlations, what is three body force nature [fr

  7. SAF line powder operations

    Frederickson, J.R.; Horgos, R.M.

    1983-10-01

    An automated nuclear fuel fabrication line is being designed for installation in the Fuels and Materials Examination Facility (FMEF) near Richland, Washington. The fabrication line will consist of seven major process systems: Receiving and Powder Preparation; Powder Conditioning; Pressing and Boat Loading; Debinding, Sintering, and Property Adjustment; Boat Transport; Pellet Inspection and Finishing; and Pin Operations. Fuel powder processing through pellet pressing will be discussed in this paper

  8. Capital Improvements Business Line

    2012-08-08

    NAVFAC Southwest Dan Waid Program & Business Mgmt NAVFAC SW Capital Improvements Business Line NAVFAC SW 8 August 2012 1 Report...REPORT TYPE 3. DATES COVERED 00-00-2012 to 00-00-2012 4. TITLE AND SUBTITLE Capital Improvements Business Line 5a. CONTRACT NUMBER 5b. GRANT...AVAILABILITY STATEMENT Approved for public release; distribution unlimited 13. SUPPLEMENTARY NOTES Presented at the 2012 Navy Gold Coast Small Business

  9. Nasca Lines, Peru

    2001-01-01

    The Nasca Lines are located in the Pampa region of Peru, the desolate plain of the Peruvian coast 400 km south of Lima. The Lines were first spotted when commercial airlines began flying across the Peruvian desert in the 1920's. Passengers reported seeing 'primitive landing strips' on the ground below. The Lines were made by removing the iron-oxide coated pebbles which cover the surface of the desert. When the gravel is removed, they contrast with the light color underneath. In this way the lines were drawn as furrows of a lighter color. On the pampa, south of the Nasca Lines, archaeologists have now uncovered the lost city of the line-builders, Cahuachi. It was built nearly two thousand years ago and was mysteriously abandoned 500 years later. This ASTER sub-image covers an area of 14 x 18 km, was acquired on December 22, 2000, and is located at 14.7 degrees south latitude and 75.1 degrees west longitude. The U.S. science team is located at NASA's Jet Propulsion Laboratory, Pasadena, Calif. The Terra mission is part of NASA's Science Mission Directorate.

  10. Modeling operational behavior of a disassembly line

    Kizilkaya, Elif A.; Gupta, Surendra M.

    2004-12-01

    In this paper we present a dynamic kanban (pull) system specifically developed for disassembly lines. This type of kanban system is much more complex than the traditional kanban system used in assembly lines. For instance, unlike the assembly line where the external demand occurs only at the last station, the demands in the disassembly case also occur at any of the intermittent stations. The reason is that as a product moves on the disassembly line, various parts are disassembled at every station and accumulated at that station. Therefore, there are as many demand sources as there are number of parts. We consider a case example involving the end-of-life products. Based on the precedence relationships and other criteria such as hazardous properties of the parts, we balance the disassembly line. The results of the disassembly line-balancing problem (DLBP) are used as input to the proposed dynamic kanban system for disassembly line (DKSDL). We compare the performance of the DKSDL to the modified kanban system for disassembly line (MKSDL), which was previously introduced by the authors. We show, via simulation, that the DKSDL is far superior to MKSDL considered.

  11. Efficient algorithm for generating spectra using line-by-line methods

    Sonnad, V.; Iglesias, C.A.

    2011-01-01

    A method is presented for efficient generation of spectra using line-by-line approaches. The only approximation is replacing the line shape function with an interpolation procedure, which makes the method independent of the line profile functional form. The resulting computational savings for large number of lines is proportional to the number of frequency points in the spectral range. Therefore, for large-scale problems the method can provide speedups of two orders of magnitude or more. A method was presented to generate line-by-line spectra efficiently. The first step was to replace the explicit calculation of the profile by the Newton divided-differences interpolating polynomial. The second step is to accumulate the lines effectively reducing their number to the number of frequency points. The final step is recognizing the resulting expression as a convolution and amenable to FFT methods. The reduction in computational effort for a configuration-to-configuration transition array with large number of lines is proportional to the number of frequency points. The method involves no approximations except for replacing the explicit profile evaluation by interpolation. Specifically, the line accumulation and convolution are exact given the interpolation procedure. Furthermore, the interpolation makes the method independent of the line profile functional form contrary to other schemes using FFT methods to generate line-by-line spectra but relying on the analytic form of the profile Fourier transform. Finally, the method relies on a uniform frequency mesh. For non-uniform frequency meshes, however, the method can be applied by using a suitable temporary uniform mesh and the results interpolated onto the final mesh with little additional cost.

  12. Along the line

    Dinesen, Cort Ross

    2011-01-01

    Embarking on a work of art constitutes a reduction of information – because we grasp the diversity and plurality of the manifestations we encounter by abstracting them and transforming them into manageable concepts; as we do when we draw contour lines on the landscape – they are imaginary...... and invisible but an abstraction essential for noting a difference or marking a place on a map. In the same way, a stroke in a sketch or a line in the sand is a manifestation of our ability to draw a boundary that both includes and excludes information. Where the line makes the birth of an idea visible......, it expresses through movement our tendency to mark a difference by drawing attention to and enclosing a whole series of relations that confront our preconceived notions. It is in the process of transformation in which we reduce the complexity of how we work, and rethink our ideas anew by refining the very same...

  13. Spectral Line Shapes. Proceedings

    Zoppi, M.; Ulivi, L.

    1997-01-01

    These proceedings represent papers presented at the 13th International Conference on Spectral Line Shapes which was held in Firenze,Italy from June 16-21, 1996. The topics covered a wide range of subjects emphasizing the physical processes associated with the formation of line profiles: high and low density plasma; atoms and molecules in strong laser fields, Dopple-free and ultra-fine spectroscopy; the line shapes generated by the interaction of neutrals, atoms and molecules, where the relavant quantities are single particle properties, and the interaction-induced spectroscopy. There were 131 papers presented at the conference, out of these, 6 have been abstracted for the Energy Science and Technology database

  14. Stokes line width

    Nikiskov, A.I.; Ritus, V.I.

    1993-01-01

    The concept of Stokes line width is introduced for the asymptotic expansions of functions near an essential singularity. Explicit expressions are found for functions (switching functions) that switch on the exponentially small terms for the Dawson integral, Airy function, and the gamma function. A different, more natural representation of a function, not associated with expansion in an asymptotic series, in the form of dominant and recessive terms is obtained by a special division of the contour integral which represents the function into contributions of higher and lower saddle points. This division leads to a narrower, natural Stokes line width and a switching function of an argument that depends on the topology of the lines of steepest descent from the saddle point

  15. VT Digital Line Graph Railroads

    Vermont Center for Geographic Information — (Link to Metadata) This datalayer is comprised of major railroad lines for the state of Vermont. These railroad lines line up well along quadrangle boundaries, but...

  16. Sprayed concrete linings

    Hindle, D.

    1999-12-01

    Sprayed concrete, or shotcrete, was invented in the 1920s for preserving dinosaur skeletons and was used underground initially in coalmines for the preservation and fine proofing of timber supports. Its use as a support lining in rock tunnelling was developed in the 1950s and 60s. The article surveys equipment available from major manufacturers and suppliers of concrete spraying equipment (Aliva, Cifa, GIA, Industri, Ingersoll Rand, etc.), specialist cement and additive manufacturers (Castle, Cement, Moria Carbotech). manufacturers of lattice girders and fibre reinforcement, and manufacturers of instrumentation for tunnel linings. 5 tabs., 9 photos.

  17. Butterfly valve of all rubber lining type

    Shimada, Shosaku; Nakatsuma, Sumiya; Sasaki, Iwao; Aoki, Naoshi.

    1982-01-01

    The valves used for the circulating water pipes for condensers in nuclear and thermal power stations have become large with the increase of power output, and their specifications have become strict. The materials for the valves change from cast iron to steel plate construction. To cope with sea water corrosion, rubber lining has been applied to the internal surfaces of valve boxes, and the build-up welding of stainless steel has been made on the edges of valves. However, recently it is desired to develop butterfly valves, of which the whole valve disks are lined with hard rubber. For the purpose of confirming the performance of large bore valves, a 2600 mm bore butterfly valve of all rubber lining type was used, and the opening and closing test of 1100 times was carried out by applying thermal cycle and pressure difference and using artifical sea water. Also the bending test of hard rubber lining was performed with test pieces. Thus, it was confirmed that the butterfly valves of all rubber lining type have the performance exceeding that of the valves with build-up welding. The course of development of the valves of all rubber lining type, the construction and the items of confirmation by tests of these valves, and the tests of the valve and the hard rubber lining described above are reported. (Kako, I.)

  18. HRT Specification

    Möller, M

    1996-01-01

    In the context of the AIS Project (Advanced Informatics Systems for administration and management) a study has been conducted that resulted in the definition of a high level information systems model. Thirteen proposed systems were defined for detailed analysis. The Finance, Foundation, Human Resources, Logistics and Purchasing areas have been studied in detail. These studies have lead to the purchase and implementation of the ORIAC and SIRIAC packages, the Foundation database, the Oracle HR package, the Triton package and EDH and BHT. This specification describes the Human Resources Toolkit (HRT) intended to be used for accessing data in the HR and Foundation systems. This toolkit should help the divisions carry out their Human Resource management, planning and follow-up. It will have extensive report generation capabilities and offer a variety of standard graphs. It should have an easy-to-use graphical user interface and run on the CERN standard desktop platforms.

  19. Handbook of spectral lines in diamond

    Dischler, Bernhard

    2012-01-01

    This handbook is a breakthrough in the understanding of the large number of spectral lines in diamond. Data on more than 2000 lines and bands are presented in 200 tables, including many unpublished results. With a novel organization scheme, the search for a specific line is greatly simplified as a benefit for researchers and students. In order to meet the interest in the understanding of the spectra, structure assignments for 80 % of the lines are given, of which 15 % only were published before. The majority of the structures for the 300 centers is explained in most cases for the first time. A key instrument in the interpretation is the analysis by donor-acceptor pair transitions. In a special chapter 95 such centers are listed and discussed, of which only two have been published before, the first one by the present author in 1994.

  20. Glue-paste linings

    Fuster-López, Laura; Andersen, Cecil Krarup; Bouillon, Nicolas

    2017-01-01

    Glue-paste linings of (Western) canvas paintings have been performed with a variety of materials throughout history and are present in a very significant amount of artworks in collections in Europe and elsewhere. Cereal flours and animal glues were usually the main ingredients because they were r...

  1. Product line design

    Anderson, S. P.; Celik, Levent

    2015-01-01

    Roč. 157, May (2015), s. 517-526 ISSN 0022-0531 R&D Projects: GA ČR(CZ) GA15-22540S Institutional support: PRVOUK-P23 Keywords : product line design * product differentiation * second-degree price discrimination Subject RIV: AH - Economics Impact factor: 1.097, year: 2015

  2. K-line photometry

    Henry, R.C.

    1979-01-01

    A brief review is given of more than a decade of work involving measurement of the strength of the K line of calcium in A-type stars. The effects of interstellar reddening are reexamined, and an improved estimate for the range in calcium abundance among field stars is obtained. (Auth.)

  3. SAF line pellet gaging

    Jedlovec, D.R.; Bowen, W.W.; Brown, R.L.

    1983-10-01

    Automated and remotely controlled pellet inspection operations will be utilized in the Secure Automated Fabrication (SAF) line. A prototypic pellet gage was designed and tested to verify conformance to the functions and requirements for measurement of diameter, surface flaws and weight-per-unit length

  4. Bike Map Lines

    Town of Chapel Hill, North Carolina — Chapel Hill Bike Map Lines from KMZ file.This data came from the wiki comment board for the public, not an “official map” showing the Town of Chapel Hill's plans or...

  5. Drawing the Line

    Holm, Isak Winkel

    2016-01-01

    of judgement that distinguishes between the inside and outside of a political community, between citizens and zombies. Second, the chapter focuses on the rhetorics applied to draw the line between rights-bearers and the rightless. ‘Prophetic’ speech, echoing the language of the Old Testament prophets, is vital...

  6. Developing Green Line Products

    Muñoz-Marin, Ana Maria; Lassen, Astrid Heidemann; Poulsen, Søren Bolvig

    2011-01-01

    This publication is based on the Master thesis “User-driven ecoinnovation process: Towards the implementation of the Green product line at JELD-WEN” written by Ana Maria Muñoz-Marin as her Graduation Project for the MSc. Global Innovation Management degree. The company-based experiment was carried...

  7. Magnetic field line Hamiltonian

    Boozer, A.H.

    1984-03-01

    The magnetic field line Hamiltonian and the associated canonical form for the magnetic field are important concepts both for understanding toroidal plasma physics and for practical calculations. A number of important properties of the canonical or Hamiltonian representation are derived and their importance is explained

  8. Mixed Lubricated Line Contacts

    Faraon, I.C.

    2005-01-01

    The present work deals with friction in mixed lubricated line contacts. Components in systems are becoming smaller and due to, for instance power transmitted, partial contact may occur. In industrial applications, friction between the moving contacting surfaces cannot be avoided, therefore it is

  9. Lined canvas paintings

    Krarup Andersen, Cecil

    2013-01-01

    at 50% RH but increased the stress level severely in dry conditions and offered no support to the painting at 70-80 % RH. This means that the traditional glue-paste lining techniques and the wax-resin technique in high RH seem to limit the advisable RH fluctuation in a cultural institution. Conversely...

  10. LEAR: antiproton extraction lines

    Photographic Service

    1992-01-01

    Antiprotons, decelerated in LEAR to a momentum of 100 MeV/c (kinetic energy of 5.3 MeV), were delivered to the experiments in an "Ultra-Slow Extraction", dispensing some 1E9 antiprotons over times counted in hours. Beam-splitters and a multitude of beam-lines allowed several users to be supplied simultaneously.

  11. Labelling subway lines

    Garrido, M.A.; Iturriaga, C.; Márquez, A.; Portillo, J.R.; Reyes, P.; Wolff, A.; Eades, P.; Takaoka, T.

    2001-01-01

    Graphical features on map, charts, diagrams and graph drawings usually must be annotated with text labels in order to convey their meaning. In this paper we focus on a problem that arises when labeling schematized maps, e.g. for subway networks. We present algorithms for labeling points on a line

  12. Subjective poverty line definitions

    J. Flik; B.M.S. van Praag (Bernard)

    1991-01-01

    textabstractIn this paper we will deal with definitions of subjective poverty lines. To measure a poverty threshold value in terms of household income, which separates the poor from the non-poor, we take into account the opinions of all people in society. Three subjective methods will be discussed

  13. Biosynthesis: Reprogramming assembly lines

    Menon, Binuraj R. K.; Jenner, Matthew

    2018-03-01

    Rational engineering of biosynthetic assembly lines for production of new compounds is an attractive prospect, yet it presents many challenges. Learning from biology, some of the rules for expanding the chemical diversity of non-ribosomal peptides have been uncovered in two recent studies.

  14. Magnetic field line Hamiltonian

    Boozer, A.H.

    1985-02-01

    The basic properties of the Hamiltonian representation of magnetic fields in canonical form are reviewed. The theory of canonical magnetic perturbation theory is then developed and applied to the time evolution of a magnetic field embedded in a toroidal plasma. Finally, the extension of the energy principle to tearing modes, utilizing the magnetic field line Hamiltonian, is outlined

  15. Defining line replaceable units

    Parada Puig, J. E.; Basten, R. J I

    2015-01-01

    Defective capital assets may be quickly restored to their operational condition by replacing the item that has failed. The item that is replaced is called the Line Replaceable Unit (LRU), and the so-called LRU definition problem is the problem of deciding on which item to replace upon each type of

  16. Safety in the design of production lines

    Dyhrberg, Mette Bang; Broberg, Ole; Jacobsen, Peter

    2006-01-01

    This paper is a case study report on how safety considerations were handled in the process of redesigning a production line. The design process was characterized as a specification and negotiation process between engineers from the company and the supplier organization. The new production line...... in the specification material nor in their face-to-face meetings with the supplier. Safety aspects were not part of their work practice. On this basis, it was suggested that formal guidelines or procedures for integrating safety in the design of production lines would have no effect. Instead, the researchers set up...... became safer, but not as a result of any intentional plan to integrate safety aspects into the design process. Instead, the supplier’s design of a new piece of equipment had a higher built-in safety level. The engineering team in the company was aware of the importance of safety aspects neither...

  17. Safety in the redesigning of production lines

    Dyhrberg, Mette Bang; Broberg, Ole; Jacobsen, Peter

    2006-01-01

    This paper is a case study report on how safety considerations were handled in the process of redesigning a production line. The design process was characterized as a specification and negotiation process between engineers from the company and the supplier organization. The new production line...... became safer, but not as a result of any intentional plan to integrate safety aspects into the design process. Instead, the supplier’s design of a new piece of equipment had a higher built-in safety level. The engineering team in the company was aware of the importance of safety aspects neither...... in the specification material nor in their face-to-face meetings with the supplier. Safety aspects were not part of their work practice. On this basis, it was suggested that formal guidelines or procedures for integrating safety in the design of production lines would have no effect. Instead, the researchers set up...

  18. Ascofuranone stimulates expression of adiponectin and peroxisome proliferator activated receptor through the modulation of mitogen activated protein kinase family members in 3T3-L1, murine pre-adipocyte cell line

    Chang, Young-Chae, E-mail: ycchang@cu.ac.kr [Research Institute of Biomedical Engineering and Department of Medicine, Catholic University of Daegu School of Medicine, Daegu 705-718 (Korea, Republic of); Cho, Hyun-Ji, E-mail: hjcho.dr@gmail.com [Research Institute of Biomedical Engineering and Department of Medicine, Catholic University of Daegu School of Medicine, Daegu 705-718 (Korea, Republic of)

    2012-06-08

    Highlights: Black-Right-Pointing-Pointer Ascofuranone increases expression of adiponectin and PPAR{gamma}. Black-Right-Pointing-Pointer Inhibitors for MEK and JNK increased the expression of adiponectin and PPAR{gamma}. Black-Right-Pointing-Pointer Ascofuranone significantly suppressed phosho-ERK, while increasing phospho-p38. -- Abstract: Ascofuranone, an isoprenoid antibiotic, was originally isolated as a hypolipidemic substance from a culture broth of the phytopathogenic fungus, Ascochyta visiae. Adiponectin is mainly synthesized by adipocytes. It relieves insulin resistance by decreasing the plasma triglycerides and improving glucose uptake, and has anti-atherogenic properties. Here, we found that ascofuranone increases expression of adiponectin and PPAR{gamma}, a major transcription factor for adiponectin, in 3T3-L1, murine pre-adipocytes cell line, without promoting accumulation of lipid droplets. Ascofuranone induced expression of adiponectin, and increases the promoter activity of adiponectin and PPRE, PPAR response element, as comparably as a PPAR{gamma} agonist, rosiglitazone, that stimulates lipid accumulation in the preadipocyte cell line. Moreover, inhibitors for MEK and JNK, like ascofuranone, considerably increased the expression of adiponectin and PPAR{gamma}, while a p38 inhibitor significantly suppressed. Ascofuranone significantly suppressed ERK phosphorylation, while increasing p38 phosphorylation, during adipocyte differentiation program. These results suggest that ascofuranone regulates the expression of adiponectin and PPAR{gamma} through the modulation of MAP kinase family members.

  19. Ascofuranone stimulates expression of adiponectin and peroxisome proliferator activated receptor through the modulation of mitogen activated protein kinase family members in 3T3-L1, murine pre-adipocyte cell line

    Chang, Young-Chae; Cho, Hyun-Ji

    2012-01-01

    Highlights: ► Ascofuranone increases expression of adiponectin and PPARγ. ► Inhibitors for MEK and JNK increased the expression of adiponectin and PPARγ. ► Ascofuranone significantly suppressed phosho-ERK, while increasing phospho-p38. -- Abstract: Ascofuranone, an isoprenoid antibiotic, was originally isolated as a hypolipidemic substance from a culture broth of the phytopathogenic fungus, Ascochyta visiae. Adiponectin is mainly synthesized by adipocytes. It relieves insulin resistance by decreasing the plasma triglycerides and improving glucose uptake, and has anti-atherogenic properties. Here, we found that ascofuranone increases expression of adiponectin and PPARγ, a major transcription factor for adiponectin, in 3T3-L1, murine pre-adipocytes cell line, without promoting accumulation of lipid droplets. Ascofuranone induced expression of adiponectin, and increases the promoter activity of adiponectin and PPRE, PPAR response element, as comparably as a PPARγ agonist, rosiglitazone, that stimulates lipid accumulation in the preadipocyte cell line. Moreover, inhibitors for MEK and JNK, like ascofuranone, considerably increased the expression of adiponectin and PPARγ, while a p38 inhibitor significantly suppressed. Ascofuranone significantly suppressed ERK phosphorylation, while increasing p38 phosphorylation, during adipocyte differentiation program. These results suggest that ascofuranone regulates the expression of adiponectin and PPARγ through the modulation of MAP kinase family members.

  20. Harnessing natural product assembly lines: structure, promiscuity, and engineering.

    Ladner, Christopher C; Williams, Gavin J

    2016-03-01

    Many therapeutically relevant natural products are biosynthesized by the action of giant mega-enzyme assembly lines. By leveraging the specificity, promiscuity, and modularity of assembly lines, a variety of strategies has been developed that enables the biosynthesis of modified natural products. This review briefly summarizes recent structural advances related to natural product assembly lines, discusses chemical approaches to probing assembly line structures in the absence of traditional biophysical data, and surveys efforts that harness the inherent or engineered promiscuity of assembly lines for the synthesis of non-natural polyketides and non-ribosomal peptide analogues.

  1. Multiple Lines of Evidence

    Amidan, Brett G. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Venzin, Alexander M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States); Bramer, Lisa M. [Pacific Northwest National Lab. (PNNL), Richland, WA (United States)

    2015-06-03

    This paper discusses the process of identifying factors that influence the contamination level of a given decision area and then determining the likelihood that the area remains unacceptable. This process is referred to as lines of evidence. These lines of evidence then serve as inputs for the stratified compliance sampling (SCS) method, which requires a decision area to be divided into strata based upon contamination expectations. This is done in order to focus sampling efforts more within stratum where contamination is more likely and to use the domain knowledge about these likelihoods of the stratum remaining unacceptable to buy down the number of samples necessary, if possible. Two different building scenarios were considered as an example (see Table 3.1). SME expertise was elicited concerning four lines of evidence factors (see Table 3.2): 1) amount of contamination that was seen before decontamination, 2) post-decontamination air sampling information, 3) the applied decontaminant information, and 4) the surface material. Statistical experimental design and logistic regression modelling were used to help determine the likelihood that example stratum remained unacceptable for a given example scenario. The number of samples necessary for clearance was calculated by applying the SCS method to the example scenario, using the estimated likelihood of each stratum remaining unacceptable as was determined using the lines of evidence approach. The commonly used simple random sampling (SRS) method was also used to calculate the number of samples necessary for clearance for comparison purposes. The lines of evidence with SCS approach resulted in a 19% to 43% reduction in total number of samples necessary for clearance (see Table 3.6). The reduction depended upon the building scenario, as well as the level of percent clean criteria. A sensitivity analysis was also performed showing how changing the estimated likelihoods of stratum remaining unacceptable affect the number

  2. The last line effect explained

    Beller, M. (Moritz); Zaidman, A. (Andy); Karpov, A. (Andrey); R.A. Zwaan (Rolf)

    2017-01-01

    textabstractMicro-clones are tiny duplicated pieces of code; they typically comprise only few statements or lines. In this paper, we study the “Last Line Effect,” the phenomenon that the last line or statement in a micro-clone is much more likely to contain an error than the previous lines or

  3. The last line effect explained

    Beller, M.M.; Zaidman, A.E.; Karpov, Andrey; Zwaan, Rolf A.

    Micro-clones are tiny duplicated pieces of code; they typically comprise only few statements or lines. In this paper, we study the “Last Line Effect,” the phenomenon that the last line or statement in a micro-clone is much more likely to contain an error than the previous lines or statements. We do

  4. Contact Line Dynamics

    Kreiss, Gunilla; Holmgren, Hanna; Kronbichler, Martin; Ge, Anthony; Brant, Luca

    2017-11-01

    The conventional no-slip boundary condition leads to a non-integrable stress singularity at a moving contact line. This makes numerical simulations of two-phase flow challenging, especially when capillarity of the contact point is essential for the dynamics of the flow. We will describe a modeling methodology, which is suitable for numerical simulations, and present results from numerical computations. The methodology is based on combining a relation between the apparent contact angle and the contact line velocity, with the similarity solution for Stokes flow at a planar interface. The relation between angle and velocity can be determined by theoretical arguments, or from simulations using a more detailed model. In our approach we have used results from phase field simulations in a small domain, but using a molecular dynamics model should also be possible. In both cases more physics is included and the stress singularity is removed.

  5. Adaptive method of lines

    Saucez, Ph

    2001-01-01

    The general Method of Lines (MOL) procedure provides a flexible format for the solution of all the major classes of partial differential equations (PDEs) and is particularly well suited to evolutionary, nonlinear wave PDEs. Despite its utility, however, there are relatively few texts that explore it at a more advanced level and reflect the method''s current state of development.Written by distinguished researchers in the field, Adaptive Method of Lines reflects the diversity of techniques and applications related to the MOL. Most of its chapters focus on a particular application but also provide a discussion of underlying philosophy and technique. Particular attention is paid to the concept of both temporal and spatial adaptivity in solving time-dependent PDEs. Many important ideas and methods are introduced, including moving grids and grid refinement, static and dynamic gridding, the equidistribution principle and the concept of a monitor function, the minimization of a functional, and the moving finite elem...

  6. Limit lines for risk

    Cox, D.C.; Baybutt, P.

    1982-01-01

    Approaches to the regulation of risk from technological systems, such as nuclear power plants or chemical process plants, in which potential accidents may result in a broad range of adverse consequences must take into account several different aspects of risk. These include overall or average risk, accidents posing high relative risks, the rate at which accident probability decreases with increasing accident consequences, and the impact of high frequency, low consequence accidents. A hypothetical complementary cumulative distribution function (CCDF), with appropriately chosen parametric form, meets all these requirements. The Farmer limit line, by contrast, places limits on the risks due to individual accident sequences, and cannot adequately account for overall risk. This reduces its usefulness as a regulatory tool. In practice, the CCDF is used in the Canadian nuclear licensing process, while the Farmer limit line approach, supplemented by separate qualitative limits on overall risk, is employed in the United Kingdom

  7. Draw the Line!

    present proceedings from the UPGEM conference "Draw the Line!" in Copenhagen May 2008. The proceedings include contributions by UPGEM researchers, conference speeches by other researchers, politicians and gender equality officers in which they relate their work and research with the research done in UPGEM......Draw the Line! International Conference, Copenhagen 2008 Papers, proceedings and recommendations is the second publication of the international three year long project "Understanding Puzzles in the Gendered European Map" (UPGEM), which is financed by the European Commission. In this publication we....... The UPGEM research has previously been published in national reports from each of the partner countries (Denmark, Estonia, Finland, Italy and Poland). In these individual national reports of universities as workplaces for male and female researchers we discuss scientific cultures in physics embedded...

  8. SLIA beam line design

    Petillo, J.; Chernin, D.; Kostas, C.; Mondelli, A.

    1990-01-01

    The Spiral Line Induction Accelerator (SLIA) is a multi-kiloampere compact electron accelerator. It uses linear induction accelerator modules on the straight sections of a racetrack spiral, with strong-focusing bends to recirculate the electrons. The strong focusing is provided by stellarator windings on the bends. Stellarator coils are used to provide the strong focusing on the bends. The matching of the electron beam from a diode through a series of accelerator modules and stellarator bends is a major issue in the design of this accelerator. The beam line design for a proof-of-concept SLIA experiment (10 kA, 7 MeV) to be carried out at Pulse Sciences, Inc. will be presented. The design will demonstrate beam matching from element to element in the focusing system, the design of an achromatic bend, and the requirements for avoiding collective instabilities

  9. Pink-line syndrome

    Ravindran J.; Raghukumar, C.; Manikandan, B.

    , a physiological crisis in the scleractinian coral Porites lutea. Marine biology 149: 347-356 7. Ravindran J, Raghukumar C (2006a) Histological observations on the scleractinian coral Porites lutea affected by pink-line syndrome. Current science... handbook: guidelines for assessment and monitoring. Currie Communications, Melbourne, Australia, 94p+App 10. Vargas-Angel B, Wheeler B (2009) Coral health and disease assessment in the US Pacific territories and affiliated states. Proc. 11th Coral Reef...

  10. New support line for members

    AGU has recently established a new customer "support line"—solutions@agu.org—as the point of contact on AGU's staff for members and other individual constituents who have not been able to resolve issues or get questions answered promptly or to their satisfaction through customary channels.Over the past year, there have been many changes at AGU. Unfortunately—and perhaps as a result of these changes—communication with members and individual constituents has suffered. Some individuals report, for example, that e-mail messages are not answered to their satisfaction, or in a timely manner. Instructions on AGU's Web site are unclear in some areas. Problems related specifically to the transition to electronic publishing are cropping up.

  11. Line managers as marketers.

    Rynne, T J

    1986-09-01

    Many hospital administrators and boards of directors, having overcome their initial opposition to advertising and hired a marketing professional, are wondering why their marketing programs have not accomplished all that they had hoped. The answer lies in their perception of who is responsible for marketing. Marketing is not a specialty separate from the disciplines of management--it is a basic management skill. Its goal is to satisfy the customer by providing products and services that meet the customer's needs, wants, and preferences. Line managers must understand the hospital's customers and make the critical day-to-day differences in satisfying them. They are the hospital's front-line marketers, and the marketing department's role is to support them in this function. The marketing department should develop the line managers' marketing skills by furnishing them with the appropriate tools: formats, models, examples, and instructions. In addition, the marketing staff should provide such specialized services as marketing research, ad agency management, and development of communications.

  12. Technical specification use and application

    Williamson, D.; Hoffman, D.R.

    1991-01-01

    Since early 1988 intensive efforts have been under way to produce a new and improved Standard Technical Specification. The program involves a coordinated effort between utility personnel representing each of the four nuclear steam supply system (NSSS) product lines, the NSSS vendors, and the US Nuclear Regulatory Commission (NRC). This intensive work period is actually the culmination of a decade of rhetoric about shortcomings of the existing technical specifications. Work on the improved technical specifications provided a unique forum for intense philosophical discussions between the users and enforcers of technical specifications, the outcome of which could have an impact on all licensees. Some of the more intriguing difficulties in the use and application of existing technical specifications, as well as discussions of the resolutions being applied in the improved technical specifications and the dilemmas remaining to be resolved are discussed in the paper

  13. Cell lines authentication and mycoplasma detection as minimun quality control of cell lines in biobanking.

    Corral-Vázquez, C; Aguilar-Quesada, R; Catalina, P; Lucena-Aguilar, G; Ligero, G; Miranda, B; Carrillo-Ávila, J A

    2017-06-01

    Establishment of continuous cell lines from human normal and tumor tissues is an extended and useful methodology for molecular characterization of cancer pathophysiology and drug development in research laboratories. The exchange of these cell lines between different labs is a common practice that can compromise assays reliability due to contamination with microorganism such as mycoplasma or cells from different flasks that compromise experiment reproducibility and reliability. Great proportions of cell lines are contaminated with mycoplasma and/or are replaced by cells derived for a different origin during processing or distribution process. The scientific community has underestimated this problem and thousand of research experiment has been done with cell lines that are incorrectly identified and wrong scientific conclusions have been published. Regular contamination and authentication tests are necessary in order to avoid negative consequences of widespread misidentified and contaminated cell lines. Cell banks generate, store and distribute cell lines for research, being mandatory a consistent and continuous quality program. Methods implementation for guaranteeing both, the absence of mycoplasma and authentication in the supplied cell lines, has been performed in the Andalusian Health System Biobank. Specifically, precise results were obtained using real time PCR detection for mycoplasma and 10 STRs identification by capillary electrophoresis for cell line authentication. Advantages and disadvantages of these protocols are discussed.

  14. Collisionless reconnection: magnetic field line interaction

    R. A. Treumann

    2012-10-01

    Full Text Available Magnetic field lines are quantum objects carrying one quantum Φ0 = 2πh/e of magnetic flux and have finite radius λm. Here we argue that they possess a very specific dynamical interaction. Parallel field lines reject each other. When confined to a certain area they form two-dimensional lattices of hexagonal structure. We estimate the filling factor of such an area. Anti-parallel field lines, on the other hand, attract each other. We identify the physical mechanism as being due to the action of the gauge potential field, which we determine quantum mechanically for two parallel and two anti-parallel field lines. The distortion of the quantum electrodynamic vacuum causes a cloud of virtual pairs. We calculate the virtual pair production rate from quantum electrodynamics and estimate the virtual pair cloud density, pair current and Lorentz force density acting on the field lines via the pair cloud. These properties of field line dynamics become important in collisionless reconnection, consistently explaining why and how reconnection can spontaneously set on in the field-free centre of a current sheet below the electron-inertial scale.

  15. LINE BROADENING AND THE SOLAR OPACITY PROBLEM

    Krief, M.; Feigel, A.; Gazit, D., E-mail: menahem.krief@mail.huji.ac.il [The Racah Institute of Physics, The Hebrew University, 91904 Jerusalem (Israel)

    2016-06-20

    The calculation of line widths constitutes theoretical and computational challenges in the calculation of opacities of hot, dense plasmas. Opacity models use line broadening approximations that are untested at stellar interior conditions. Moreover, calculations of atomic spectra of the Sun indicate a large discrepancy in the K-shell line widths between several atomic codes and the Opacity-Project (OP). In this work, the atomic code STAR is used to study the sensitivity of solar opacities to line broadening. Variations in the solar opacity profile due to an increase of the Stark widths resulting from discrepancies with OP, are compared, in light of the solar opacity problem, with the required opacity variations of the present day Sun, as imposed by helioseismic and neutrino observations. The resulting variation profile is much larger than the discrepancy between different atomic codes, agrees qualitatively with the missing opacity profile, recovers about half of the missing opacity nearby the convection boundary, and has a little effect in the internal regions. Since it is hard to estimate quantitatively the uncertainty in the Stark widths, we show that an increase of all line widths by a factor of about ∼100 recovers quantitatively the missing opacity. These results emphasize the possibility that photoexcitation processes are not modeled properly, and more specifically, highlight the need for a better theoretical characterization of the line broadening phenomena at stellar interior conditions, and of the uncertainty due to the way it is implemented by atomic codes.

  16. Interior Design's Role in Educational Specifications.

    Keller, Mary Ann

    1986-01-01

    An experienced interior designer, equipped with a well-written educational specification, will specify the best materials and coordinate colors, materials, and furnishings in line with the district's budget. (MLF)

  17. Power Line Communications for Smart Grid Applications

    Lars Torsten Berger

    2013-01-01

    Full Text Available Power line communication, that is, using the electricity infrastructure for data transmission, is experiencing a renaissance in the context of Smart Grid. Smart Grid objectives include the integration of intermittent renewable energy sources into the electricity supply chain, securing reliable electricity delivery, and using the existing electrical infrastructure more efficiently. This paper surveys power line communications (PLCs in the context of Smart Grid. The specifications G3-PLC, PRIME, HomePlug Green PHY, and HomePlug AV2, and the standards IEEE 1901/1901.2 and ITU-T G.hn/G.hnem are discussed.

  18. Linux Command Line and Shell Scripting Bible

    Blum, Richard

    2011-01-01

    The authoritative guide to Linux command line and shell scripting?completely updated and revised [it's not a guide to Linux as a whole ? just to scripting] The Linux command line allows you to type specific Linux commands directly to the system so that you can easily manipulate files and query system resources, thereby permitting you to automate commonly used functions and even schedule those programs to run automatically. This new edition is packed with new and revised content, reflecting the many changes to new Linux versions, including coverage of alternative shells to the default bash shel

  19. Characterization of lipid metabolism in insulin-sensitive adipocytes differentiated from immortalized human mesenchymal stem cells

    Prawitt, Janne; Niemeier, Andreas; Kassem, Moustapha; Beisiegel, Ulrike; Heeren, Joerg

    2008-01-01

    There is a great demand for cell models to study human adipocyte function. Here we describe the adipogenic differentiation of a telomerase-immortalized human mesenchymal stem cell line (hMSC-Tert) that maintains numerous features of terminally differentiated adipocytes even after prolonged withdrawal of the peroxisome proliferator activated receptor γ (PPARγ) agonist rosiglitazone. Differentiated hMSC-Tert developed the characteristic monolocular phenotype of mature adipocytes. The expression of adipocyte specific markers was highly increased during differentiation. Most importantly, the presence of the PPARγ agonist rosiglitazone was not required for the stable expression of lipoprotein lipase, adipocyte fatty acid binding protein and perilipin on mRNA and protein levels. Adiponectin expression was post-transcriptionally down-regulated in the absence of rosiglitazone. Insulin sensitivity as measured by insulin-induced phosphorylation of Akt and S6 ribosomal protein was also independent of rosiglitazone. In addition to commonly used adipogenic markers, we investigated further PPARγ-stimulated proteins with a role in lipid metabolism. We observed an increase of lipoprotein receptor (VLDLR, LRP1) and apolipoprotein E expression during differentiation. Despite this increased expression, the receptor-mediated endocytosis of lipoproteins was decreased in differentiated adipocytes, suggesting that these proteins may have an additional function in adipose tissue beyond lipoprotein uptake

  20. Coaxial transmission line - Equalization

    Bonnerue, J.L.; Fremont, Jacques; Haubtmann, Jack; Pillon, Gerard.

    1981-09-01

    The transmission of electrical signal through a coaxial line is not perfect and signal distortions are increased as much as the frequency spectrum is extended. We have designed and achieved passive filters (named equalizers) with transfer functions which are inverse of coaxial transfer functions. Doing so our attempt is to avoid definitive loss of information in the recorded data. The main feature of our equalization method lies in the fact it could be either an electrical or a numerical correction or both of them. Some examples in the use of this technique are also proposed [fr

  1. α-line systematics

    Caurier, E.; Zuker, A.P.

    1991-01-01

    A study of the α-line, defined as a set of differences (D α ) characterized binding energies of (N,Z) nuclei, is presented. The 2p2n-separation energies for even-even nuclei, odd-odd nuclei, even(Z)-odd(N) nuclei, odd(Z)-even(N) nuclei are presented. Trends and details in even-even nuclei, magic numbers of even-even and odd-odd nuclei are discussed. (G.P.) 1 ref.; 8 figs

  2. Design process and modeling studies of SSRL beam line wunder

    Bachrach, R.Z.; Bringans, R.D.

    1984-01-01

    SSRL Beam Line Wunder will be the first soft X-ray energy range synchrotron radiation beam line specifically designed to exploit the unique aspects of periodic insertion devices in the wiggler-undulator (wunder) regime. Aspects of the development of this beam line are described in this paper and in particular, we discuss the design methodology adopted and emphasize the joint optical, thermal and mechanical optimization studies that were required. (orig.)

  3. Ground-based transmission line conductor motion sensor

    Jacobs, M.L.; Milano, U.

    1988-01-01

    A ground-based-conductor motion-sensing apparatus is provided for remotely sensing movement of electric-power transmission lines, particularly as would occur during the wind-induced condition known as galloping. The apparatus is comprised of a motion sensor and signal-generating means which are placed underneath a transmission line and will sense changes in the electric field around the line due to excessive line motion. The detector then signals a remote station when a conditioning of galloping is sensed. The apparatus of the present invention is advantageous over the line-mounted sensors of the prior art in that it is easier and less hazardous to install. The system can also be modified so that a signal will only be given when particular conditions, such as specific temperature range, large-amplitude line motion, or excessive duration of the line motion, are occurring

  4. From Off-line to On-line Handwriting Recognition

    Lallican, P.; Viard-Gaudin, C.; Knerr, S.

    2004-01-01

    On-line handwriting includes more information on time order of the writing signal and on the dynamics of the writing process than off-line handwriting. Therefore, on-line recognition systems achieve higher recognition rates. This can be concluded from results reported in the literature, and has been

  5. The innominate line

    Whelan, M.A.; Myung, K.H.; Bergeron, R.T.

    1984-01-01

    The innominate line continues to be of value in evaluating the integrity of the sphenoid bone since plain skull radiographs remain a primary screening tool for metastatic disease, seizure disorder and headache. The detection of lesions involving the sphenoid bone can be difficult. The accuracy of the radionulcide scan is reduced because of confusion caused by uptake in the adjacent nasal and sinus mucosa. On computed tomography, the sections through the base of the skull and orbit can contain many artifictual densities caused by a combination of bone, soft tissue and sinus air interfaces. In addition, routine settings of window width and level on CT scan are designed to best demonstrate the soft tissues, and bony lesions can easily be missed. Thus, disruption of the ''integrity'' of this line on plain films, particularly the Caldwell projection, can be a sensitive first indicator of disease involving the sphenoid bone. Such a determination on plain film leads to more accurate CT scanning, in that attention will be given to the skull base and scans will be imaged with both soft tissue and bone windows. (orig./MG)

  6. Strategic production line synchronisation

    Hattingh, Teresa

    2016-08-01

    Full Text Available A study was conducted at the sole global producer of suspension struts for a particular vehicle manufacturer. This supplier is currently able to meet customer demand. However, it does so because of a large finished goods and work-in-progress (WIP inventory. The plant operates two production processes that are separated by a large buffer of WIP, which essentially decouples the production processes. This study aimed to reduce this WIP buffer; this would require the processes to become synchronised, bearing in mind that the reliability of delivery should not decrease. A tool that considers time, quality, and machine capacity was developed to assess the impact of line synchronisation on company performance figures. It was found that line synchronisation produced several benefits for the supplier, including batch size reduction, lower inventory levels, and associated shorter lead times. This further allowed the supplier to improve flow in the plant by introducing a pull system. Improved visual oversight could lead to further improved problem-solving and innovation.

  7. Establishment of cell lines with rat spermatogonial stem cell characteristics

    van Pelt, Ans M. M.; Roepers-Gajadien, Hermien L.; Gademan, Iris S.; Creemers, Laura B.; de Rooij, Dirk G.; van Dissel-Emiliani, Federica M. F.

    2002-01-01

    Spermatogonial cell lines were established by transfecting a mixed population of purified rat A(s) (stem cells), A(pr) and A(al) spermatogonia with SV40 large T antigen. Two cell lines were characterized and found to express Hsp90alpha and oct-4, specific markers for germ cells and A spermatogonia,

  8. On-line Learning of Prototypes and Principal Components

    Biehl, M.; Freking, A.; Hölzer, M.; Reents, G.; Schlösser, E.; Saad, David

    1998-01-01

    We review our recent investigation of on-line unsupervised learning from high-dimensional structured data. First, on-line competitive learning is studied as a method for the identification of prototype vectors from overlapping clusters of examples. Specifically, we analyse the dynamics of the

  9. China's Bilateral Currency Swap Lines

    Zhitao, Lin; Wenjie, Zhan; Cheung, Yin-Wong

    2016-01-01

    We study the determinants of China’s bilateral local currency swap lines that were established since the recent global finance crisis. It is found that economic factors, political considerations, and institutional characteristics including trade intensity, economic size, strategic partnership, free trade agreement, corruption, and stability affect the decision of signing a swap line agreement. Once a swap line agreement decision is made, the size of the swap line is then mainly affected by tr...

  10. Mjollnir Rotational Line Scan Diagnostics.

    1981-05-19

    using long cavity. M8 Removable Pellicle Beam Splitter for He-Ne Lineup Beam. Removed before HF or DF laser is turned on. 27 A 27 * A r of the chopper...three probe laser lines, however three lines were sequentially measured to verify the diagnostic equipment. Two of the three lines have been monitored

  11. CLO : The cell line ontology

    Sarntivijai, Sirarat; Lin, Yu; Xiang, Zuoshuang; Meehan, Terrence F.; Diehl, Alexander D.; Vempati, Uma D.; Schuerer, Stephan C.; Pang, Chao; Malone, James; Parkinson, Helen; Liu, Yue; Takatsuki, Terue; Saijo, Kaoru; Masuya, Hiroshi; Nakamura, Yukio; Brush, Matthew H.; Haendel, Melissa A.; Zheng, Jie; Stoeckert, Christian J.; Peters, Bjoern; Mungall, Christopher J.; Carey, Thomas E.; States, David J.; Athey, Brian D.; He, Yongqun

    2014-01-01

    Background: Cell lines have been widely used in biomedical research. The community-based Cell Line Ontology (CLO) is a member of the OBO Foundry library that covers the domain of cell lines. Since its publication two years ago, significant updates have been made, including new groups joining the CLO

  12. Parallel plate transmission line transformer

    Voeten, S.J.; Brussaard, G.J.H.; Pemen, A.J.M.

    2011-01-01

    A Transmission Line Transformer (TLT) can be used to transform high-voltage nanosecond pulses. These transformers rely on the fact that the length of the pulse is shorter than the transmission lines used. This allows connecting the transmission lines in parallel at the input and in series at the

  13. Topological Acoustic Delay Line

    Zhang, Zhiwang; Tian, Ye; Cheng, Ying; Wei, Qi; Liu, Xiaojun; Christensen, Johan

    2018-03-01

    Topological protected wave engineering in artificially structured media is at the frontier of ongoing metamaterials research that is inspired by quantum mechanics. Acoustic analogues of electronic topological insulators have recently led to a wealth of new opportunities in manipulating sound propagation with strikingly unconventional acoustic edge modes immune to backscattering. Earlier fabrications of topological insulators are characterized by an unreconfigurable geometry and a very narrow frequency response, which severely hinders the exploration and design of useful devices. Here we establish topologically protected sound in reconfigurable phononic crystals that can be switched on and off simply by rotating its three-legged "atoms" without altering the lattice structure. In particular, we engineer robust phase delay defects that take advantage of the ultrabroadband reflection-free sound propagation. Such topological delay lines serve as a paradigm in compact acoustic devices, interconnects, and electroacoustic integrated circuits.

  14. Line broadening by focusing

    Brito, A.L. de; Jabs, A.

    1983-01-01

    It is pointed out that the spectral width of a quasi-monochromatic light beam broadens when the beam is focused. A quantitative formula for this broadening is derived from classical wave theory. The effect is shown to explain some experiments on laser beams done by E. Panarella which that author has explained under the ad-hoc hypothesis that the frequency of the photons changes along with the intensity of the light beam. The line broadening by focusing might also contribute to gas ionization by incident light when the ionization potential is well above the mean photon energy. Some remarks are made on some direct applications of the Heisenberg relations in comparison with our treatment. (Author) [pt

  15. Genetic variability among advanced lines of brassica

    Ullah, N.; Farhatullah, A.; Rahman, H.U.; Fayyaz, L.

    2015-01-01

    Genetic variability for morphological and biochemical traits among six advanced lines (F10:11) of brassica was studied at The University of Agriculture Peshawar during crop season of 2012-13. These lines were developed through interspecific hybridization. Significant differences at (p=0.01) for plant height, main, pods main raceme-1, pod length, seed yield plant-1 and protein content at (p=0.05) for 100-seed weight, oil content were recorded. The advanced line, AUP-05 produced the maximum seed yield plant-1 (19.73 g), protein content (24.56%), 100-seed weight (0.64 g). Advanced line AUP-04 had the highest erucic acid (50.31%), linolenic acid (10.60%) and was late maturing (179.33). Advanced line AUP-06 produced the high oil content (48.82%). Advanced line AUP-03 produced comparatively longer main raceme (69.32 cm). Environmental variance was smaller than genotypic variance for majority of the traits. Genotypic and phenotypic coefficients of variation ranged from 2.45 to 25.67% and 2.50 to 27.68%, respectively. Heritability was high for majority of the traits. The maximum heritability was recorded for plant height (0.61), main raceme length (0.81), pods main raceme-1 (0.74), seed yield plant-1 (0.86) and protein content (0.77). Moderate heritability was observed for oil (0.58) contents. Heritability for 100-seed weight (0.30) was the lowest. These lines may be released as new improved varieties for specific parameters. (author)

  16. On-line monitoring for calibration reduction

    Hoffmann, Mario; Gran, Frauke Schmitt; Thunem, Harald P-J.

    2004-04-01

    On-Line Monitoring (OLM) of a channel's calibration state evaluates instrument channel performance by assessing its consistency with other plant indications. Industry and experience at several plants has shown this overall approach to be very effective in identifying instrument channels that are exhibiting degrading or inconsistent performance characteristics. The Halden Reactor Project has developed the signal validation system PEANO, which can be used to assist with the tasks of OLM. To further enhance the PEANO System for use as a calibration reduction tool, the following two additional modules have been developed; HRP Prox, which performs pre-processing and statistical analysis of signal data, Batch Monitoring Module (BMM), which is an off-line batch monitoring and reporting suite. The purpose and functionality of the HRP Prox and BMM modules are discussed in this report, as well as the improvements made to the PEANO Server to support these new modules. The Halden Reactor Project has established a Halden On-Line Monitoring User Group (HOLMUG), devoted to the discussion and implementation of on-line monitoring techniques in power plants. It is formed by utilities, vendors, regulatory bodies and research institutes that meet regularly to discuss implementation aspects of on-line monitoring, technical specification changes, cost-benefit analysis and regulatory issues. (Author)

  17. Truncation correction for oblique filtering lines

    Hoppe, Stefan; Hornegger, Joachim; Lauritsch, Guenter; Dennerlein, Frank; Noo, Frederic

    2008-01-01

    State-of-the-art filtered backprojection (FBP) algorithms often define the filtering operation to be performed along oblique filtering lines in the detector. A limited scan field of view leads to the truncation of those filtering lines, which causes artifacts in the final reconstructed volume. In contrast to the case where filtering is performed solely along the detector rows, no methods are available for the case of oblique filtering lines. In this work, the authors present two novel truncation correction methods which effectively handle data truncation in this case. Method 1 (basic approach) handles data truncation in two successive preprocessing steps by applying a hybrid data extrapolation method, which is a combination of a water cylinder extrapolation and a Gaussian extrapolation. It is independent of any specific reconstruction algorithm. Method 2 (kink approach) uses similar concepts for data extrapolation as the basic approach but needs to be integrated into the reconstruction algorithm. Experiments are presented from simulated data of the FORBILD head phantom, acquired along a partial-circle-plus-arc trajectory. The theoretically exact M-line algorithm is used for reconstruction. Although the discussion is focused on theoretically exact algorithms, the proposed truncation correction methods can be applied to any FBP algorithm that exposes oblique filtering lines.

  18. Introduction to transfer lines and circular machines

    Bryant, P.J.

    1984-01-01

    This course was given in the 1983-84 Academic Training Programme. It is designed as an elementary introduction to both the theory and the hardware for transfer lines and circular machines. The course is limited to linear problems and treates the topics of single particle motion in the transverse and longitudinal planes, emittance ellipses, parameterisation, optical properties of some specific modules, stabilities in the transverse and longitudinal planes, field and gradient errors, and scattering in thin windows. (orig.)

  19. New Trends in on-line Marketing

    Palkovič, Lukáš

    2011-01-01

    This bachelor thesis deals with new trend of internet marketing, it focuses especially on viral marketing. The theoretical part charasterizes the process of viral campaigns, furthermore deals with the components and aspects of on-line environment. Another separated chapter presents social networks, their place in viral marketing and at last but not least the viral video making process. The practical part contains different analyses of specific viral campaigns. The next and equally the last pa...

  20. Radiosensitivity of mesothelioma cell lines

    Haekkinen, A.M.; Laasonen, A.; Linnainmaa, K.; Mattson, K.; Pyrhoenen, S.

    1996-01-01

    The present study was carried out in order to examine the radiosensitivity of malignant pleural mesothelioma cell lines. Cell kinetics, radiation-induced delay of the cell cycle and DNA ploidy of the cell lines were also determined. For comparison an HeLa and a human foetal fibroblast cell line were simultaneously explored. Six previously cytogenetically and histologically characterized mesothelioma tumor cell lines were applied. A rapid tiazolyl blue microtiter (MTT) assay was used to analyze radiosensitivity and cell kinetics and DNA ploidy of the cultured cells were determined by flow cytometry. The survival fraction after a dose of 2 Gy (SF2), parameters α and β of the linear quadratic model (LQ-model) and mean inactivation dose (D MID ) were also estimated. The DNA index of four cell lines equaled 1.0 and two cell lines equaled 1.5 and 1.6. Different mesothelioma cell lines showed a great variation in radiosensitivity. Mean survival fraction after a radiation dose of 2 Gy (SF2) was 0.60 and ranged from 0.36 to 0.81 and mean α value was 0.26 (range 0.48-0.083). The SF2 of the most sensitive diploid mesothelioma cell line was 0.36: Less than that of the foetal fibroblast cell line (0.49). The survival fractions (0.81 and 0.74) of the two most resistant cell lines, which also were aneuploid, were equal to that of the HeLa cell line (0.78). The α/β ratios of the most sensitive cell lines were almost an order of magnitude greater than those of the two most resistant cell lines. Radiation-induced delay of the most resistant aneuploid cell line was similar to that of HeLa cells but in the most sensitive (diploid cells) there was practically no entry into the G1 phase following the 2 Gy radiation dose during 36 h. (orig.)

  1. Bipolar pulse forming line

    Rhodes, Mark A.

    2008-10-21

    A bipolar pulse forming transmission line module for linear induction accelerators having first, second, third, fourth, and fifth planar conductors which form an interleaved stack with dielectric layers between the conductors. Each conductor has a first end, and a second end adjacent an acceleration axis. The first and second planar conductors are connected to each other at the second ends, the fourth and fifth planar conductors are connected to each other at the second ends, and the first and fifth planar conductors are connected to each other at the first ends via a shorting plate adjacent the first ends. The third planar conductor is electrically connectable to a high voltage source, and an internal switch functions to short a high voltage from the first end of the third planar conductor to the first end of the fourth planar conductor to produce a bipolar pulse at the acceleration axis with a zero net time integral. Improved access to the switch is enabled by an aperture through the shorting plate and the proximity of the aperture to the switch.

  2. On-line filtering

    Verkerk, C.

    1978-01-01

    Present day electronic detectors used in high energy physics make it possible to obtain high event rates and it is likely that future experiments will face even higher data rates than at present. The complexity of the apparatus increases very rapidly with time and also the criteria for selecting desired events become more and more complex. So complex in fact that the fast trigger system cannot be designed to fully cope with it. The interesting events become thus contaminated with multitudes of uninteresting ones. To distinguish the 'good' events from the often overwhelming background of other events one has to resort to computing techniques. Normally this selection is made in the first part of the analysis of the events, analysis normally performed on a powerful scientific computer. This implies however that many uninteresting or background events have to be recorded during the experiment for subsequent analysis. A number of undesired consequences result; and these constitute a sufficient reason for trying to perform the selection at an earlier stage, in fact ideally before the events are recorded on magnetic tape. This early selection is called 'on-line filtering' and it is the topic of the present lectures. (Auth.)

  3. PEARS Emission Line Galaxies

    Pirzkal, Nor; Rothberg, Barry; Ly, Chun; Rhoads, James E.; Malhotra, Sangeeta; Grogin, Norman A.; Dahlen, Tomas; Meurer, Gerhardt R.; Walsh, Jeremy; Hathi, Nimish P.; hide

    2012-01-01

    We present a full analysis of the Probing Evolution And Reionization Spectroscopically (PEARS) slitless grism spectroscopic data obtained vl'ith the Advanced Camera for Surveys on HST. PEARS covers fields within both the Great Observatories Origins Deep Survey (GOODS) North and South fields, making it ideal as a random surveY of galaxies, as well as the availability of a wide variety of ancillary observations to support the spectroscopic results. Using the PEARS data we are able to identify star forming galaxies within the redshift volume 0 galaxies down to a limiting flux of approx 10 - 18 erg/s/sq cm . The ELRs have also been compared to the properties of the host galaxy, including morphology, luminosity, and mass. From this analysis we find three key results: 1) The computed line luminosities show evidence of a flattening in the luminosity function with increasing redshift; 2) The star forming systems show evidence of disturbed morphologies, with star formation occurring predominantly within one effective (half-light) radius. However, the morphologies show no correlation with host stellar mass; and 3) The number density of star forming galaxies with M(*) >= 10(exp 9) Solar M decreases by an order of magnitude at z<=0.5 relative to the number at 0.5 < z < 0.9 in support of the argument for galaxy downsizing.

  4. Optimization of line configuration and balancing for flexible machining lines

    Liu, Xuemei; Li, Aiping; Chen, Zurui

    2016-05-01

    Line configuration and balancing is to select the type of line and allot a given set of operations as well as machines to a sequence of workstations to realize high-efficiency production. Most of the current researches for machining line configuration and balancing problems are related to dedicated transfer lines with dedicated machine workstations. With growing trends towards great product variety and fluctuations in market demand, dedicated transfer lines are being replaced with flexible machining line composed of identical CNC machines. This paper deals with the line configuration and balancing problem for flexible machining lines. The objective is to assign operations to workstations and find the sequence of execution, specify the number of machines in each workstation while minimizing the line cycle time and total number of machines. This problem is subject to precedence, clustering, accessibility and capacity constraints among the features, operations, setups and workstations. The mathematical model and heuristic algorithm based on feature group strategy and polychromatic sets theory are presented to find an optimal solution. The feature group strategy and polychromatic sets theory are used to establish constraint model. A heuristic operations sequencing and assignment algorithm is given. An industrial case study is carried out, and multiple optimal solutions in different line configurations are obtained. The case studying results show that the solutions with shorter cycle time and higher line balancing rate demonstrate the feasibility and effectiveness of the proposed algorithm. This research proposes a heuristic line configuration and balancing algorithm based on feature group strategy and polychromatic sets theory which is able to provide better solutions while achieving an improvement in computing time.

  5. Alternate Double Single Track Lines

    Moraga Contreras, P.; Grande Andrade, Z.; Castillo Ron, E.

    2016-07-01

    The paper discusses the advantages and shortcomings of alternate double single track (ADST) lines with respect to double track lines for high speed lines. ADST lines consists of sequences of double and single track segments optimally selected in order to reduce the construction and maintenance costs of railway lines and to optimize the timetables used to satisfy a given demand. The single tracks are selected to coincide with expensive segments (tunnels and viaducts) and the double tracks are chosen to coincide with flat areas and only where they are necessary. At the same time, departure times are adjusted for trains to cross at the cheap double track segments. This alternative can be used for new lines and also for existing conventional lines where some new tracks are to be constructed to reduce travel time (increase speed). The ADST proposal is illustrated with some examples of both types (new lines and where conventional lines exist), including the Palencia-Santander, the Santiago-Valparaíso-Viña del Mar and the Dublin-Belfast lines, where very important reductions (90 %) are obtained, especially where a railway infrastructure already exist. (Author)

  6. On-line data display

    Lang, Sherman Y. T.; Brooks, Martin; Gauthier, Marc; Wein, Marceli

    1993-05-01

    A data display system for embedded realtime systems has been developed for use as an operator's user interface and debugging tool. The motivation for development of the On-Line Data Display (ODD) have come from several sources. In particular the design reflects the needs of researchers developing an experimental mobile robot within our laboratory. A proliferation of specialized user interfaces revealed a need for a flexible communications and graphical data display system. At the same time the system had to be readily extensible for arbitrary graphical display formats which would be required for data visualization needs of the researchers. The system defines a communication protocol transmitting 'datagrams' between tasks executing on the realtime system and virtual devices displaying the data in a meaningful way on a graphical workstation. The communication protocol multiplexes logical channels on a single data stream. The current implementation consists of a server for the Harmony realtime operating system and an application written for the Macintosh computer. Flexibility requirements resulted in a highly modular server design, and a layered modular object- oriented design for the Macintosh part of the system. Users assign data types to specific channels at run time. Then devices are instantiated by the user and connected to channels to receive datagrams. The current suite of device types do not provide enough functionality for most users' specialized needs. Instead the system design allows the creation of new device types with modest programming effort. The protocol, design and use of the system are discussed.

  7. On line portal imaging

    Munro, Peter

    1997-01-01

    Purpose/Objective: The purpose of this presentation is to examine the various imaging devices that have been developed for portal imaging, describe some of the image registration methods that have been developed to determine geometric errors quantitatively, and discuss how portal imaging has been incorporated into clinical practice. Discussion: Verification of patient positioning has always been an important aspect of external beam radiation therapy. Over the past decade many portal imaging devices have been developed by individual investigators and most accelerator manufacturers now offer 'on-line' portal imaging systems. The commercial devices include T.V. camera-based systems, liquid ionisation chamber systems, and shortly, flat panel systems. The characteristics of these imaging systems will be discussed. In addition, other approaches such as the use of kilovoltage x-ray sources, video monitoring, and ultrasound have been proposed for improving patient positioning. Some of the advantages of these approaches will be discussed. One of the major advantages of on-line portal imaging is that many quantitative techniques have been developed to detect errors in patient positioning. The general approach is to register anatomic structures on a portal image with the same structures on a digitized simulator film. Once the anatomic structures have been registered, any discrepancies in the position of the patient can be identified. One problem is finding a common frame of reference for the simulator and portal images, since the location of the radiation field within the pixel matrix may differ for the two images. As a result, a common frame of reference has to be established before the anatomic structures in the images can be registered - generally by registering radiation field edges identified in the simulator and portal images. In addition, distortions in patient geometry or rotations out of the image plane can confound the image registration techniques. Despite the

  8. On line portal imaging

    Munro, Peter

    1996-01-01

    Purpose/Objective: The purpose of this presentation is to examine the various imaging devices that have been developed for portal imaging; describe some of the image registration methods that have been developed to determine geometric errors quantitatively; discuss some of the ways that portal imaging has been incorporated into routine clinical practice; describe quality assurance procedures for these devices, and discuss the use of portal imaging devices for dosimetry applications. Discussion: Verification of patient positioning has always been an important aspect of external beam radiation therapy. Over the past decade many portal imaging devices have been developed by individual investigators and most accelerator manufacturers now offer 'on-line' portal imaging systems. The commercial devices can be classified into three categories: T.V. camera-based systems, liquid ionisation chamber systems, and amorphous silicon systems. Many factors influence the quality of images generated by these portal imaging systems. These include factors which are unavoidable (e.g., low subject contrast), factors which depend upon the individual imaging device forming the image (e.g., dose utilisation, spatial resolution) as well as factors which depend upon the characteristics of the linear accelerator irradiating the imaging system (x-ray source size, image magnification). The characteristics of individual imaging systems, such as spatial resolution, temporal response, and quantum utilisation will be discussed. One of the major advantages of on-line portal imaging is that many quantitative techniques have been developed to detect errors in patient positioning. The general approach is to register anatomic structures on a portal image with the same structures on a digitized simulator film. Once the anatomic structures have been registered, any discrepancies in the position of the patient can be identified. However, the task is not nearly as straight-forward as it sounds. One problem

  9. Rapid line scan MR angiography

    Frahm, J.; Merboldt, K.D.; Hanicke, W.; Bruhn, H.

    1987-01-01

    Direct MR angiography may be performed using line scan imaging techniques combined with presaturation of stationary spins. Thus, a single line scan echo yields a projection of vessels due to the signal from reflowing unsaturated spins. Reconstruction of an angiographic image is performed line by line at slightly incremented positions. In particular, line scan angiography is direct and fast without a sensitivity to artifacts even for high flow rates. Image resolution and field of view may be chosen without restrictions, and zoom images using enhanced gradients may be recorded without aliasing artifacts. The method is robust with respect to eddy currents and pulsatile flow. Line scan MR angiograms of phantoms, animals, and human volunteers have been recorded using 90 0 radio frequency pulses and gradient-recalled echoes

  10. Design of LEIR Transfer Lines

    Carli, Ch; Hemery, J-Y

    2002-01-01

    The LEIR transfer lines are designed to transport the ion beam from the Linac 3 to LEIR and, after accumulation and acceleration from LEIR to the PS. A part of the transfer line is used for both, injection and extraction. Thus, it is natural to design injection and extraction optics in common. Beside optics constraints, the geometry of the existing machines (Linac 3, LEIR and PS) and transfer tunnels have to be respected. A new proposal for the LEIR transfer lines is presented.

  11. A Fe K Line in GRB 970508

    Protassov, R.; van Dyk, D.; Connors, A.; Kashyap, V.; Siemiginowska, A.

    2000-12-01

    We examine the x-ray spectrum of the afterglow of GRB 970508, analyzed for Fe line emission by Piro et al (1999, ApJL, 514, L73). This is a difficult and extremely important measurement: the detection of x-ray afterglows from γ -ray bursts is at best a tricky business, relying on near-real satellite time response to unpredictable events; and a great deal of luck in catching a burst bright enough for a useful spectral analysis. Detecting a clear atomic (or cyclotron) line in the generally smooth and featureless afterglow (or burst) emission not only gives one of the few very specific keys to the physics local to the emission region, but also provides clues or confirmation of its distance (via redshift). Unfortunately, neither the likelihood ratio test or the related F-statistic commonly used to detect spectral lines adhere to their nominal Chi square and F-distributions. Thus we begin by calibrating the F-statistic used in Piro et al (1999, ApJL, 514, L73) via a simulation study. The simulation study relies on a completely specified source model, i.e. we do Monte Carlo simulations with all model parameters fixed (so--called ``parametric bootstrapping''). Second, we employ the method of posterior predictive p-values to calibrate a LRT statistic while accounting for the uncertainty in the parameters of the source model. Our analysis reveals evidence for the Fe K line.

  12. 50 CFR 648.200 - Specifications.

    2010-10-01

    ..., unless an OY that exceeds MSY in a specific year is consistent with a control rule that ensures the... northerly along the Hague Line to the U.S.-Canadian border, to include state and Federal waters adjacent to...., northeasterly to the Hague Line at 42°53′14″ N. lat., 67°44′35″ W. long. [72 FR 11277, Mar. 12, 2007, as amended...

  13. On line portal imaging

    Munro, Peter

    1995-01-01

    Purpose/Objective: The purpose of this presentation is to review the physics of imaging with high energy x-ray beams; examine the various imaging devices that have been developed for portal imaging; describe some of the image registration methods that have been developed to determine errors in patient positioning quantitatively; and discuss some of the ways that portal imaging has been incorporated into routine clinical practice. Verification of patient positioning has always been an important aspect of external beam radiation therapy. Checks of patient positioning have generally been done with film, however, film suffers from a number of drawbacks, such as poor image display and delays due to film development. Over the past decade many portal imaging devices have been developed by individual investigators and most accelerator manufacturers now offer 'on-line' portal imaging systems, which are intended to overcome the limitations of portal films. The commercial devices can be classified into three categories: T.V. camera-based systems, liquid ionisation chamber systems, and amorphous silicon systems. Many factors influence the quality of images generated by these portal imaging systems. These include factors which are unavoidable (e.g., low subject contrast), factors which depend upon the individual imaging device forming the image (e.g., dose utilisation, spatial resolution) as well as factors which depend upon the characteristics of the linear accelerator irradiating the imaging system (x-ray source size, image magnification). The fundamental factors which limit image quality and the characteristics of individual imaging systems, such as spatial resolution, temporal response, and quantum utilisation will be discussed. One of the major advantages of on-line portal imaging is that many quantitative techniques have been developed to detect errors in patient positioning. The general approach is to register anatomic structures on a portal image with the same

  14. Human rhabdomyosarcoma cell lines for rhabdomyosarcoma research: Utility and pitfalls

    Ashley R.P. Hinson

    2013-07-01

    Full Text Available Rhabdomyosarcoma (RMS is the most common soft tissue sarcoma of childhood and adolescence. Despite intergroup clinical trials conducted in Europe and North America, outcomes for high risk patients with this disease have not significantly improved in the last several decades, and survival of metastatic or relapsed disease remains extremely poor. Accrual into new clinical trials is slow and difficult, so in vitro cell line research and in vivo xenograft models present an attractive alternative for preclinical research for this cancer type. Currently, 30 commonly used human RMS cell lines exist, with differing origins, karyotypes, histologies, and methods of validation. Selecting an appropriate cell line for RMS research has important implications for outcomes. There are also potential pitfalls in using certain cell lines including contamination with murine stromal cells, cross-contamination between cell lines, discordance between the cell line and its associated original tumor, imposter cell lines, and nomenclature errors that result in the circulation of two or more presumed unique cell lines that are actually from the same origin. These pitfalls can be avoided by testing for species-specific isoenzymes, microarray analysis, assays for subtype-specific fusion products, and short tandem repeat analysis.

  15. Human Rhabdomyosarcoma Cell Lines for Rhabdomyosarcoma Research: Utility and Pitfalls

    Hinson, Ashley R. P.; Jones, Rosanne; Crose, Lisa E. S.; Belyea, Brian C.; Barr, Frederic G.; Linardic, Corinne M.

    2013-01-01

    Rhabdomyosarcoma (RMS) is the most common soft tissue sarcoma of childhood and adolescence. Despite intergroup clinical trials conducted in Europe and North America, outcomes for high risk patients with this disease have not significantly improved in the last several decades, and survival of metastatic or relapsed disease remains extremely poor. Accrual into new clinical trials is slow and difficult, so in vitro cell-line research and in vivo xenograft models present an attractive alternative for preclinical research for this cancer type. Currently, 30 commonly used human RMS cell lines exist, with differing origins, karyotypes, histologies, and methods of validation. Selecting an appropriate cell line for RMS research has important implications for outcomes. There are also potential pitfalls in using certain cell lines including contamination with murine stromal cells, cross-contamination between cell lines, discordance between the cell line and its associated original tumor, imposter cell lines, and nomenclature errors that result in the circulation of two or more presumed unique cell lines that are actually from the same origin. These pitfalls can be avoided by testing for species-specific isoenzymes, microarray analysis, assays for subtype-specific fusion products, and short tandem repeat analysis. PMID:23882450

  16. Self-Leadership and Creativity Differences in Line and Supervisory Defense Acquisition Employees

    DiLiello, Trudy C; Houghton, Jeffery D

    2007-01-01

    .... More specifically, the study examined differences in self-leadership, creativity, and perceived organizational support for creativity between line and supervisory defense acquisition employees...

  17. Fractions, Number Lines, Third Graders

    Cramer, Kathleen; Ahrendt, Sue; Monson, Debra; Wyberg, Terry; Colum, Karen

    2017-01-01

    The Common Core State Standards for Mathematics (CCSSM) (CCSSI 2010) outlines ambitious goals for fraction learning, starting in third grade, that include the use of the number line model. Understanding and constructing fractions on a number line are particularly complex tasks. The current work of the authors centers on ways to successfully…

  18. Mechanical Behaviour of Lined Pipe

    Hilberink, A.

    2011-01-01

    Installing lined pipe by means of the reeling installation method seems to be an attractive combination, because it provides the opportunity of eliminating the demanding welds from the critical time offshore and instead preparing them onshore. However, reeling of lined pipe is not yet proven

  19. Marine line fish research programme

    SANCOR

    1979-04-01

    Full Text Available This report outlines the framework for a marine line fish programme under the aegis of the South African National Committee for Oceanographic Research (SANCOR). An attempt is made to assess the state of knowledge about South African marine line...

  20. A tangent subsolar merging line

    Crooker, N.U.; Siscoe, G.L.; Toffoletto, F.R.

    1990-01-01

    The authors describe a global magnetospheric model with a single subsolar merging line whose position is determined neither locally by the relative orientations and strengths of the merging fields nor globally by the orientation of a separator line--the governing parameters of most previous models--but by the condition of tangential contact between the external field and the magnetopause. As in previous models, the tilt of the merging line varies with IMF orientation, but here it also depends upon the ratio of Earth's magnetic flux that leaks out of the magnetopause to IMF flux that penetrates in. In the limiting case treated by Alekseyev and Belen'kaya, with no leakage of Earth's field and total IMF penetration, the merging line forms a great circle around a spherical magnetosphere where undeviated IMF lines lie tangent to its surface. This tangent merging line lies perpendicular to the IMF. They extend their work to the case of finite leakage and partial penetration, which distort the IMF into a draped pattern, thus changing the locus of tangency to the sphere. In the special case where the penetrating IMF flux is balanced by an equal amount of Earth flux leakage, the tangent merging line bisects the angle between the IMF and Earth's northward subsolar field. This result is identical to the local merging line model result for merging fields with equal magnitude. Here a global flux balance condition replaces the local equal magnitude condition

  1. Radiosensitivity of mesothelioma cell lines

    Haekkinen, A.M. [Dept. of Oncology, Univ. Central Hospital, Helsinki (Finland); Laasonen, A. [Dept. of Pathology, Central Hospital of Etelae-Pohjanmaa, Seinaejoki (Finland); Linnainmaa, K. [Dept. of Industrial Hygiene and Toxicology, Inst. of Occupational Health, Helsinki (Finland); Mattson, K. [Dept. Pulmonary Medicine, Univ. Central Hospital, Helsinki (Finland); Pyrhoenen, S. [Dept. of Oncology, Univ. Central Hospital, Helsinki (Finland)

    1996-10-01

    The present study was carried out in order to examine the radiosensitivity of malignant pleural mesothelioma cell lines. Cell kinetics, radiation-induced delay of the cell cycle and DNA ploidy of the cell lines were also determined. For comparison an HeLa and a human foetal fibroblast cell line were simultaneously explored. Six previously cytogenetically and histologically characterized mesothelioma tumor cell lines were applied. A rapid tiazolyl blue microtiter (MTT) assay was used to analyze radiosensitivity and cell kinetics and DNA ploidy of the cultured cells were determined by flow cytometry. The survival fraction after a dose of 2 Gy (SF2), parameters {alpha} and {beta} of the linear quadratic model (LQ-model) and mean inactivation dose (D{sub MID}) were also estimated. The DNA index of four cell lines equaled 1.0 and two cell lines equaled 1.5 and 1.6. Different mesothelioma cell lines showed a great variation in radiosensitivity. Mean survival fraction after a radiation dose of 2 Gy (SF2) was 0.60 and ranged from 0.36 to 0.81 and mean {alpha} value was 0.26 (range 0.48-0.083). The SF2 of the most sensitive diploid mesothelioma cell line was 0.36: Less than that of the foetal fibroblast cell line (0.49). The survival fractions (0.81 and 0.74) of the two most resistant cell lines, which also were aneuploid, were equal to that of the HeLa cell line (0.78). The {alpha}/{beta} ratios of the most sensitive cell lines were almost an order of magnitude greater than those of the two most resistant cell lines. Radiation-induced delay of the most resistant aneuploid cell line was similar to that of HeLa cells but in the most sensitive (diploid cells) there was practically no entry into the G1 phase following the 2 Gy radiation dose during 36 h. (orig.).

  2. FIMS Wavelength Calibration via Airglow Line Observations

    Dae-Hee Lee

    2004-12-01

    Full Text Available Far-ultraviolet Imaging Spectrograph (FIMS is the main payload of the Korea's first scientific micro satellite STSAT-1, which was launched at Sep. 27 2003 successfully. Major objective of FIMS is observing hot gas in the Galaxy in FUV bands to diagnose the energy flow models of the interstellar medium. Supernova remnants, molecular clouds, and Aurora emission in the geomagnetic pole regions are specific targets for pointing observation. Although the whole system was calibrated before launch, it is essential to perform on-orbit calibration for data analysis. For spectral calibration, we observed airglow lines in the atmosphere since they provide good spectral references. We identify and compare the observed airglow lines with model calculations, and correct the spectral distortion appeared in the detector system to improve the spectral resolution of the system.

  3. Data specifications for INSPIRE

    Portele, Clemens; Woolf, Andrew; Cox, Simon

    2010-05-01

    approved by the INSPIRE Committee. After they enter into force they become part of the legal framework and European Member States have to implement these rules. The next step is the development of the remaining 25 spatial data themes, which include many themes of interest for the Earth Sciences including geology, meteorological and oceanographic geographic features, atmospheric conditions, habitats and biotopes, species distribution, environmental monitoring facilities, and land cover to name a few. The process will follow in general the same steps as for the first themes and the working groups are expected to start their work in March/April 2010. The first draft specifications for public comment are expected at the end of 2010 and the work is scheduled to be completed in 2012. At the same time, other initiatives like GMES (Global Monitoring for Environment and Security) and GEOSS (Global Earth Observation System of Systems) are also dealing with spatial data from the themes covered by INSPIRE. With the EU-funded project GIGAS, a support action, a step has been made towards architectural coherence between these initiatives. Recommendations to improve the coherence of the information architectures across the initiatives have been discussed in January 2010 with stakeholders from all initiatives, the standards organisations and EU-funded research projects. Based on the general agreements achieved in these discussions, the next step will be to start working towards the implementation of these recommendations, which are in line with the approach taken by the INSPIRE data specifications.

  4. Teaching Braille Line Tracking Using Stimulus Fading

    Scheithauer, Mindy C.; Tiger, Jeffrey H.

    2014-01-01

    Line tracking is a prerequisite skill for braille literacy that involves moving one's finger horizontally across a line of braille text and identifying when a line ends so the reader may reset his or her finger on the subsequent line. Current procedures for teaching line tracking are incomplete, because they focus on tracking lines with only…

  5. Myositis specific autoantibodies; specificity and clinical applications.

    Hengstman, G.J.D.

    2005-01-01

    The sera of about half of the patients with myositis contain autoantibodies that are specific for this group of diseases compared to other inflammatory connective tissue disorders. In a recent study we showed that these myositis specific autoantibodies (MSAs) are also specific for myositis as

  6. 30 CFR 75.705-1 - Work on high-voltage lines.

    2010-07-01

    ... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Work on high-voltage lines. 75.705-1 Section 75... AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Grounding § 75.705-1 Work on high-voltage lines. (a) Section 75.705 specifically prohibits work on energized high-voltage lines underground; (b...

  7. Atlas transmission line breakdown analysis

    Nielsen, K E; Ballard, E O; Elizondo, J M; Gribble, R F; McCuistian, B T; Parsons, W M

    1999-01-01

    The Atlas facility will use 24 radially converging, vertically oriented and tapered, oil insulated, triplate transmission lines between the Marx generators and the central load region. Among the requirements of the transmission lines are low inductance and high reliability. The inter-conductor gap is nominally 2 cm and the lines taper from a height of 1.75 m at the Marx end to 0.32 m at the output end. The aluminum conductors, held together by 20 insulating spacers, are assembled and inserted as a unit into radial oil-filled steel tanks. The negative, high-voltage, center conductor is 2.54-cm thick and the outer ground conductors are 1.59-cm thick. All 24 triplate transmission lines connect to a transition section at near 1 m radius that couples the transmission lines to a disk/conical solid- dielectric-insulated power flow channel transmission line terminating at the load. Peak operating voltage on the lines can be as high as 240 kV with an effective stress time of 0.8 mu s. Testing of small sections of the ...

  8. rf reference line for PEP

    Schwarz, H.D.; Weaver, J.N.

    1979-03-01

    A rf phase reference line in 6 segments around the 2200 meter circumference PEP storage ring is described. Each segment of the reference line is phase stabilized by its own independent feedback system, which uses an amplitude modulated reflection from the end of each line. The modulation is kept small and decoupled from the next segment to avoid crosstalk and significant modulation of the rf drive signal. An error evaluation of the system is made. The technical implementation and prototype performance are described. Prototype tests indicate that the phase error around the ring can be held below 1 degree with this relatively simple system

  9. rf reference line for PEP

    Schwarz, H.D.; Weaver, J.N.

    1979-03-01

    A rf phase reference line in 6 segments around the 2200 meter circumference PEP storage ring is described. Each segment of the reference line is phase stabilized by its own independent feedback system, which uses an amplitude modulated reflection from the end of each line. The modulation is kept small and decoupled from the next segment to avoid crosstalk and significant modulation of the rf drive signal. An error evaluation of the system is made. The technical implementation and prototype performance are described. Prototype tests indicate that the phase error around the ring can be held below 1 degree with this relatively simple system.

  10. Status of ACCULINNA beam line

    Rodin, A M; Bogdanov, D D; Golovkov, M S; Fomichev, A S; Sidorchuk, S I; Slepnev, R S; Wolski, R; Ter-Akopian, G M; Oganessian, Yu T; Yukhimchuk, A A; Perevozchikov, V V; Vinogradov, Yu I; Grishenchkin, S K; Demin, A M; Zlatoustovskii, S V; Kuryakin, A V; Filchagin, S V; Ilkaev, R I

    2003-01-01

    The separator ACCULINNA was upgraded to achieve new experimental requirements. The beam line was extended by new ion-optical elements beyond the cyclotron hall. The new arrangements yield much better background conditions. The intensities of sup 6 He and sup 8 He radioactive beams produced in fragmentation of 35 A MeV sup 1 sup 1 B ions were increased up to a factor of 10. The upgraded beam line was used in experiments to study the sup 5 H resonance states populated in the t+t reaction. A cryogenic liquid tritium target was designed and installed at the separator beam line.

  11. Analysis of some coplanar transmission lines: coplanar coupled lines, coplanar coupled striplines, and coplanar coupled lines with rectangular microshield

    Yuan, Naichang; He, Jianguo; Yao, Demiao; Dai, Qin; Lin, Weigan

    1995-06-01

    Two types of coplanar transmission lines, rectangular microshield coplanar coupled lines (RMCCL) and coplanar coupled rectangular microshield lines (CCRML), are proposed for MMIC applications. These are developed from coplanar coupled lines (CCL) and coplanar coupled strip lines (CCS). Analytic formulas are presented for calculating the quasistatic TEM parameters of these coupled lines by means of exact conformal mapping techniques. Numerical results are also presented to illustrate the properties of these coplanar transmission lines.

  12. PSpice for filters and transmission lines

    Tobin, Paul

    2007-01-01

    In this book, PSpice for Filters and Transmission Lines, we examine a range of active and passive filters where each design is simulated using the latest Cadence Orcad V10.5 PSpice capture software. These filters cannot match the very high order digital signal processing (DSP) filters considered in PSpice for Digital Signal Processing, but nevertheless these filters have many uses. The active filters considered were designed using Butterworth and Chebychev approximation loss functions rather than using the 'cookbook approach' so that the final design will meet a given specification in an exact

  13. Acoustic power balance in lined ducts

    Eversman, W.

    1979-01-01

    It is shown that the two common definitions of acoustic energy density and intensity in uniform unlined ducts carrying uniform flow are compatible to the extent that both energy densities can be used in an appropriate variational principle to derive the convected wave equation. When the duct walls are lined both energy densities must be modified to account for the wall energy density. This results in a new energy conservation equation which utilizes a modified definition of axial power and accounts for wall dissipation. Computations in specific cases demonstrate the validity of the modified acoustic energy relation.

  14. Evaluation of the combining ability of mutant maize lines

    V. Valkova

    2016-09-01

    Full Text Available Abstract. The study shows the results of a preliminary evaluation of the combining ability for grain yield of 17 mutant maize lines. For the purpose the top cross method for early testing and the mathematical model of Savchenko for analysis of the general and the specific combining ability were used. The lines were tested on three testers with high general combining ability that belong to two genetic groups: K 46 52 and XM 552 from SSS and N 192 – Lancaster. For the purposes of evaluation of the productive abilities of the received top cross two preliminary varietal experiments were carried out at the experimental field of Maize Research Institute, Knezha As a result of the conducted experimental work and the analysis it was found that the highest general combining ability have lines XM 11 6 and XM 12 1. These lines can be included as components of high-yielding synthetics or as testers in analyzing crosses to determine general combining ability in early stages of the selection process. The above lines with high specific combining ability – XM 11 13 and XM 11 46 are suitable for inclusion in combinations to develop high-yielding hybrids. Three of the tested lines XM 11 7 11 XM 10 and XM 11 11 have both high GCA and SCA. These lines can be used in corresponding breeding in the selection programs.

  15. Hepatocyte specific expression of human cloned genes

    Cortese, R

    1986-01-01

    A large number of proteins are specifically synthesized in the hepatocyte. Only the adult liver expresses the complete repertoire of functions which are required at various stages during development. There is therefore a complex series of regulatory mechanisms responsible for the maintenance of the differentiated state and for the developmental and physiological variations in the pattern of gene expression. Human hepatoma cell lines HepG2 and Hep3B display a pattern of gene expression similar to adult and fetal liver, respectively; in contrast, cultured fibroblasts or HeLa cells do not express most of the liver specific genes. They have used these cell lines for transfection experiments with cloned human liver specific genes. DNA segments coding for alpha1-antitrypsin and retinol binding protein (two proteins synthesized both in fetal and adult liver) are expressed in the hepatoma cell lines HepG2 and Hep3B, but not in HeLa cells or fibroblasts. A DNA segment coding for haptoglobin (a protein synthesized only after birth) is only expressed in the hepatoma cell line HepG2 but not in Hep3B nor in non hepatic cell lines. The information for tissue specific expression is located in the 5' flanking region of all three genes. In vivo competition experiments show that these DNA segments bind to a common, apparently limiting, transacting factor. Conventional techniques (Bal deletions, site directed mutagenesis, etc.) have been used to precisely identify the DNA sequences responsible for these effects. The emerging picture is complex: they have identified multiple, separate transcriptional signals, essential for maximal promoter activation and tissue specific expression. Some of these signals show a negative effect on transcription in fibroblast cell lines.

  16. Animated construction of line drawings

    Fu, Hongbo; Zhou, Shizhe; Liu, Ligang; Mitra, Niloy J.

    2011-01-01

    Revealing the sketching sequence of a line drawing can be visually intriguing and used for video-based storytelling. Typically this is enabled based on tedious recording of artists' drawing process. We demonstrate that it is often possible

  17. Animated construction of line drawings

    Fu, Hongbo; Zhou, Shizhe; Liu, Ligang; Mitra, Niloy J.

    2011-01-01

    system produces plausible animated constructions of input line drawings, with no or little user intervention. We test our algorithm on a range of input sketches, with varying degree of complexity and structure, and evaluate the results via a user study

  18. Composite Materials in Overhead Lines

    Sørensen, Thomas Kjærsgaard; Holbøll, Joachim

    2009-01-01

    towers and recently conductors based on composite materials are available at transmission levels. In this paper it is investigated which composite based solutions are available in connection with complete overhead line systems including insulators, towers and conductors. The components are reviewed......The use of composite materials, e.g. fibreglass materials, in overhead transmission line systems is nothing new. Composite based insulators have been applied to transmission lines for over 30 years, mainly as suspension and post insulators and often as an option for special applications. Also...... with respect to solved and persisting known failures/problems of both mechanical and electrical nature. Major challenges related to extensive use of composite materials in an overhead line system are identified, as are possible benefits - both when using standard as well as customised composite components, e...

  19. Louisiana ESI: ROADS (Road Lines)

    National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains the state maintained primary and secondary road network of Louisiana. Vector lines in the data set represent Interstates, U.S. Highways, and...

  20. Control Point Generated PLS - lines

    Minnesota Department of Natural Resources — The Control Point Generated PLS layer contains line and polygon features to the 1/4 of 1/4 PLS section (approximately 40 acres) and government lot level. The layer...

  1. Railroad Lines, US, 2015, NAVTEQ

    U.S. Environmental Protection Agency — NAVTEQ Railroads for the United States. The Railroads layer contains Railroad features published as lines and polylines. Attributes for this layer include the name...

  2. Base Flood Elevation (BFE) Lines

    Department of Homeland Security — The Base Flood Elevation (BFE) table is required for any digital data where BFE lines will be shown on the corresponding Flood Insurance Rate Map (FIRM). Normally if...

  3. Program of telluric lines monitoring

    Vince I.

    2006-01-01

    Full Text Available A new observational program of telluric lines monitoring was introduced at Belgrade Astronomical Observatory. The ultimate goal of this program is to investigate the properties of Earth’s atmosphere through modeling the observed profiles of telluric lines. The program is intend to observe infrared molecular oxygen lines that were selected according to spectral sensitivity of the available CCD camera. In this paper we give the initial and the final selection criteria for spectral lines included in the program the description of equipment and procedures used for observations and reduction, a review of preliminary observational results with the estimated precision, and a short discussion on the comparison of the theoretical predictions and the measurements.

  4. Radio and line transmission 2

    Roddy, Dermot

    2013-01-01

    Radio and Line Transmission, Volume 2 gives a detailed treatment of the subject as well as an introduction to additional advanced subject matter. Organized into 14 chapters, this book begins by explaining the radio wave propagation, signal frequencies, and bandwidth. Subsequent chapters describe the transmission lines and cables; the aerials; tuned and coupled circuits; bipolar transistor amplifiers; field-effect transistors and circuits; thermionic valve amplifiers; LC oscillators; the diode detectors and modulators; and the superheterodyne receiver. Other chapters explore noise and interfere

  5. SAF line analytical chemistry system

    Gerber, E.W.; Sherrell, D.L.

    1983-10-01

    An analytical chemistry system dedicated to supporting the Secure Automated Fabrication (SAF) line is discussed. Several analyses are required prior to the fuel pellets being loaded into cladding tubes to assure certification requirements will be met. These analyses, which will take less than 15 minutes, are described. The automated sample transport system which will be used to move pellets from the fabriction line to the chemistry area is also described

  6. QSOs with narrow emission lines

    Baldwin, J.A.; Mcmahon, R.; Hazard, C.; Williams, R.E.

    1988-01-01

    Observations of two new high-redshift, narrow-lined QSOs (NLQSOs) are presented and discussed together with observations of similar objects reported in the literature. Gravitational lensing is ruled out as a possible means of amplifying the luminosity for one of these objects. It is found that the NLQSOs have broad bases on their emission lines as well as the prominent narrow cores which define this class. Thus, these are not pole-on QSOs. The FWHM of the emission lines fits onto the smoothly falling tail of the lower end of the line-width distribution for complete QSO samples. The equivalent widths of the combined broad and narrow components of the lines are normal for QSOs of the luminosity range under study. However, the NLQSOs do show ionization differences from broader-lined QSOs; most significant, the semiforbidden C III/C IV intensity ratio is unusually low. The N/C abundance ratio in these objects is found to be normal; the Al/C abundance ratio may be quite high. 38 references

  7. Polarization of Coronal Forbidden Lines

    Li, Hao; Qu, Zhongquan [Yunnan Observatories, Chinese Academy of Sciences, Kunming, Yunnan 650011 (China); Landi Degl’Innocenti, Egidio, E-mail: sayahoro@ynao.ac.cn [Dipartimento di Astronomia e Scienza dello Spazio, Università di Firenze, Largo E. Fermi 2, I-50125 Firenze (Italy)

    2017-03-20

    Since the magnetic field is responsible for most manifestations of solar activity, one of the most challenging problems in solar physics is the diagnostics of solar magnetic fields, particularly in the outer atmosphere. To this end, it is important to develop rigorous diagnostic tools to interpret polarimetric observations in suitable spectral lines. This paper is devoted to analyzing the diagnostic content of linear polarization imaging observations in coronal forbidden lines. Although this technique is restricted to off-limb observations, it represents a significant tool to diagnose the magnetic field structure in the solar corona, where the magnetic field is intrinsically weak and still poorly known. We adopt the quantum theory of polarized line formation developed in the framework of the density matrix formalism, and synthesize images of the emergent linear polarization signal in coronal forbidden lines using potential-field source-surface magnetic field models. The influence of electronic collisions, active regions, and Thomson scattering on the linear polarization of coronal forbidden lines is also examined. It is found that active regions and Thomson scattering are capable of conspicuously influencing the orientation of the linear polarization. These effects have to be carefully taken into account to increase the accuracy of the field diagnostics. We also found that linear polarization observation in suitable lines can give valuable information on the long-term evolution of the magnetic field in the solar corona.

  8. Application of the inter-line PCR for the analyse of genomic rearrangements in radiation-transformed mammalian cell lines

    Leibhard, S.; Smida, J.

    1996-01-01

    Repetitive DNA sequences of the LINE-family (long interspersed elements) that are widely distributed among the mammalian genome can be activated or altered by the exposure to ionizing radiation [1]. By the integration at new sites in the genome alterations in the expression of genes that are involved in cell transformation and/or carcinogenesis may occur [2, 3]. A new technique -the inter-LINE PCR - has been developed in order to detect and analyse such genomic rearrangements in radiation-transformed cell lines. From the sites of transformation- or tumour-specific changes in the genome it might be possible to develop new tumour markers for diagnostic purpose. (orig.) [de

  9. Linac4 chopper line commissioning strategy

    Bellodi, G; Lombardi, A M; Posocco, P A; Sargsyan, E

    2010-01-01

    The report outlines the strategy for beam-based commissioning of the Linac4 3 MeV chopper line as currently scheduled to start in the second half of 2011 in the Test Stand Area. A dedicated temporary diagnostics test bench will complement the measurement devices foreseen for permanent installation in the chopper line. A commissioning procedure is set out as a series of consecutive phases, each one supposed to meet a well- defined milestone in the path to fully characterise the beam-line. Specific set-ups for each stage are defined in terms of beam characteristics, machine settings and diagnostics used. Operational guidelines are given and expected results at the relative points of measurements are shown for simulated scenarios (on the basis of multi-particle tracking studies carried out with the codes PATH and TRACEWin). These are then interpreted in the light of the resolution limits of the available diagnostics instruments to assess the precision reach on individual measurements and the feasibility of techn...

  10. 76 FR 51367 - China Shipping Container Lines Co., Ltd.; COSCO Container Lines Company Limited; Evergreen Line A...

    2011-08-18

    ... FEDERAL MARITIME COMMISSION [Docket No. 11-12] China Shipping Container Lines Co., Ltd.; COSCO Container Lines Company Limited; Evergreen Line A Joint Service Agreement; Hanjin Shipping Co., Ltd... Maritime Commission (Commission) by China Shipping Container Lines Co., Ltd.; COSCO Container Lines Company...

  11. Building Bridges One Line at a Time

    Grigsby, Cathy Murray

    2012-01-01

    In this article, first-grade students were taught the different kinds of lines that were part of the construction of various bridges--the curved lines of the arches of stone bridges, straight lines connecting the cables of a suspension bridge, vertical lines, horizontal lines, and so on. They gained practice in drawing structures and in fine brush…

  12. Evolutionary history of LINE-1 in the major clades of placental mammals.

    Paul D Waters

    2007-01-01

    Full Text Available LINE-1 constitutes an important component of mammalian genomes. It has a dynamic evolutionary history characterized by the rise, fall and replacement of subfamilies. Most data concerning LINE-1 biology and evolution are derived from the human and mouse genomes and are often assumed to hold for all placentals.To examine LINE-1 relationships, sequences from the 3' region of the reverse transcriptase from 21 species (representing 13 orders across Afrotheria, Xenarthra, Supraprimates and Laurasiatheria were obtained from whole genome sequence assemblies, or by PCR with degenerate primers. These sequences were aligned and analysed.Our analysis reflects accepted placental relationships suggesting mostly lineage-specific LINE-1 families. The data provide clear support for several clades including Glires, Supraprimates, Laurasiatheria, Boreoeutheria, Xenarthra and Afrotheria. Within the afrotherian LINE-1 (AfroLINE clade, our tree supports Paenungulata, Afroinsectivora and Afroinsectiphillia. Xenarthran LINE-1 (XenaLINE falls sister to AfroLINE, providing some support for the Atlantogenata (Xenarthra+Afrotheria hypothesis.LINEs and SINEs make up approximately half of all placental genomes, so understanding their dynamics is an essential aspect of comparative genomics. Importantly, a tree of LINE-1 offers a different view of the root, as long edges (branches such as that to marsupials are shortened and/or broken up. Additionally, a robust phylogeny of diverse LINE-1 is essential in testing that site-specific LINE-1 insertions, often regarded as homoplasy-free phylogenetic markers, are indeed unique and not convergent.

  13. Linear morphoea follows Blaschko's lines.

    Weibel, L; Harper, J I

    2008-07-01

    The aetiology of morphoea (or localized scleroderma) remains unknown. It has previously been suggested that lesions of linear morphoea may follow Blaschko's lines and thus reflect an embryological development. However, the distribution of linear morphoea has never been accurately evaluated. We aimed to identify common patterns of clinical presentation in children with linear morphoea and to establish whether linear morphoea follows the lines of Blaschko. A retrospective chart review of 65 children with linear morphoea was performed. According to clinical photographs the skin lesions of these patients were plotted on to standardized head and body charts. With the aid of Adobe Illustrator a final figure was produced including an overlay of all individual lesions which was used for comparison with the published lines of Blaschko. Thirty-four (53%) patients had the en coup de sabre subtype, 27 (41%) presented with linear morphoea on the trunk and/or limbs and four (6%) children had a combination of the two. In 55 (85%) children the skin lesions were confined to one side of the body, showing no preference for either left or right side. On comparing the overlays of all body and head lesions with the original lines of Blaschko there was an excellent correlation. Our data indicate that linear morphoea follows the lines of Blaschko. We hypothesize that in patients with linear morphoea susceptible cells are present in a mosaic state and that exposure to some trigger factor may result in the development of this condition.

  14. Linear rotary optical delay lines

    Guerboukha, Hichem; Qu, Hang; Skorobogatiy, Maksim

    2016-03-01

    We present a semi-analytical solution for the design of a high-speed rotary optical delay line that use a combination of two rotating curvilinear reflectors. We demonstrate that it is possible to design an infinite variety of the optical delay lines featuring linear dependence of the optical delay on the rotation angle. This is achieved via shape optimization of the rotating reflector surfaces. Moreover, a convenient spatial separation of the incoming and outgoing beams is possible. For the sake of example, we present blades that fit into a circle of 10cm diameter. Finally, a prototype of a rotary delay line is fabricated using CNC machining, and its optical properties are characterized.

  15. Spent Pot Lining Characterization Framework

    Ospina, Gustavo; Hassan, Mohamed I.

    2017-09-01

    Spent pot lining (SPL) management represents a major concern for aluminum smelters. There are two key elements for spent pot lining management: recycling and safe storage. Spent pot lining waste can potentially have beneficial uses in co-firing in cement plants. Also, safe storage of SPL is of utmost importance. Gas generation of SPL reaction with water and ignition sensitivity must be studied. However, determining the feasibility of SPL co-firing and developing the required procedures for safe storage rely on determining experimentally all the necessary SPL properties along with the appropriate test methods, recognized by emissions standards and fire safety design codes. The applicable regulations and relevant SPL properties for this purpose are presented along with the corresponding test methods.

  16. Animated construction of line drawings

    Fu, Hongbo

    2011-12-01

    Revealing the sketching sequence of a line drawing can be visually intriguing and used for video-based storytelling. Typically this is enabled based on tedious recording of artists\\' drawing process. We demonstrate that it is often possible to estimate a reasonable drawing order from a static line drawing with clearly defined shape geometry, which looks plausible to a human viewer. We map the key principles of drawing order from drawing cognition to computational procedures in our framework. Our system produces plausible animated constructions of input line drawings, with no or little user intervention. We test our algorithm on a range of input sketches, with varying degree of complexity and structure, and evaluate the results via a user study. We also present applications to gesture drawing synthesis and drawing animation creation especially in the context of video scribing.

  17. Animated construction of line drawings

    Fu, Hongbo

    2011-12-01

    Revealing the sketching sequence of a line drawing can be visually intriguing and used for video-based storytelling. Typically this is enabled based on tedious recording of artists\\' drawing process. We demonstrate that it is often possible to estimate a reasonable drawing order from a static line drawing with clearly defined shape geometry, which looks plausible to a human viewer. We map the key principles of drawing order from drawing cognition to computational procedures in our framework. Our system produces plausible animated constructions of input line drawings, with no or little user intervention. We test our algorithm on a range of input sketches, with varying degree of complexity and structure, and evaluate the results via a user study. We also present applications to gesture drawing synthesis and drawing animation creation especially in the context of video scribing. © 2011 ACM.

  18. AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.

    Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A

    2017-06-01

    Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.

  19. Extreme Ultraviolet Emission Lines of Iron Fe XI-XIII

    Lepson, Jaan; Beiersdorfer, P.; Brown, G. V.; Liedahl, D. A.; Brickhouse, N. S.; Dupree, A. K.

    2013-04-01

    The extreme ultraviolet (EUV) spectral region (ca. 20--300 Å) is rich in emission lines from low- to mid-Z ions, particularly from the middle charge states of iron. Many of these emission lines are important diagnostics for astrophysical plasmas, providing information on properties such as elemental abundance, temperature, density, and even magnetic field strength. In recent years, strides have been made to understand the complexity of the atomic levels of the ions that emit the lines that contribute to the richness of the EUV region. Laboratory measurements have been made to verify and benchmark the lines. Here, we present laboratory measurements of Fe XI, Fe XII, and Fe XIII between 40-140 Å. The measurements were made at the Lawrence Livermore electron beam ion trap (EBIT) facility, which has been optimized for laboratory astrophysics, and which allows us to select specific charge states of iron to help line identification. We also present new calculations by the Hebrew University - Lawrence Livermore Atomic Code (HULLAC), which we also utilized for line identification. We found that HULLAC does a creditable job of reproducing the forest of lines we observed in the EBIT spectra, although line positions are in need of adjustment, and line intensities often differed from those observed. We identify or confirm a number of new lines for these charge states. This work was supported by the NASA Solar and Heliospheric Program under Contract NNH10AN31I and the DOE General Plasma Science program. Work was performed in part under the auspices of the Department of Energy by Lawrence Livermore National Laboratory under Contract DEAC52-07NA27344.

  20. Emission line galaxies and active galactic nuclei in WINGS clusters

    Marziani, P.; D'Onofrio, M.; Bettoni, D.; Poggianti, B. M.; Moretti, A.; Fasano, G.; Fritz, J.; Cava, A.; Varela, J.; Omizzolo, A.

    2017-03-01

    We present the analysis of the emission line galaxies members of 46 low-redshift (0.04 employing diagnostic diagrams. We examined the emission line properties and frequencies of star-forming galaxies, transition objects, and active galactic nuclei (AGNs: LINERs and Seyferts), unclassified galaxies with emission lines, and quiescent galaxies with no detectable line emission. A deficit of emission line galaxies in the cluster environment is indicated by both a lower frequency, and a systematically lower Balmer emission line equivalent width and luminosity with respect to control samples; this implies a lower amount of ionized gas per unit mass and a lower star formation rate if the source is classified as Hii region. A sizable population of transition objects and of low-luminosity LINERs (≈ 10-20% of all emission line galaxies) are detected among WINGS cluster galaxies. These sources are a factor of ≈1.5 more frequent, or at least as frequent, as in control samples with respect to Hii sources. Transition objects and LINERs in clusters are most affected in terms ofline equivalent width by the environment and appear predominantly consistent with so-called retired galaxies. Shock heating can be a possible gas excitation mechanism that is able to account for observed line ratios. Specific to the cluster environment, we suggest interaction between atomic and molecular gas and the intracluster medium as a possible physical cause of line-emitting shocks. The data whose description is provided in Table B.1, and emission line catalog of the WINGS database are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/599/A83

  1. The effect of bright lines in environmental risk communication

    Wilson, K.N.; Desvousges, W.H.; Smith, K.V.; Payne, J.

    1993-01-01

    Bright lines in environmental risk communication refer to the specific levels at which an environmental risk becomes a serious health threat and action should be taken to mitigate its effects. This study examined the effect of ''bright lines'' in risk communication by emphasizing the radon exposure threshold level of 4 picocuries per liter. Specifically, the authors developed a computer-assisted interview containing bright-line versions of risk information. The bright-line version contained a range of possible radon levels, the corresponding number of estimated lung cancer cases, the relative health risk from radon compared to other health risks, and the EPA guidelines for mitigating levels above 4 picocuries in the home. The non-bright line version was identical to the bright-line version, except it did not include the EPA's mitigation recommendations. Effect measures included respondents' change in perceived risk after reading their materials, intended testing behavior, and advice to their neighbor for a specified radon level either above or below the 4 picocury threshold level. This paper discusses broader policy implications for designing effective risk communication programs

  2. Helium transfer line installation details.

    G. Perinic

    2007-01-01

    A particularity of the 32 m long four in one helium transfer line in between the cold box in USC55 and the cavern UX5 is the fact that the transfer line passes through a hole in the crane rail support beam. In order to ensure the alignment of the suspension rail in the interconnecting tunnel with the hole in the rail support as well as the connection points at both ends required precise measurements of the given geometries as well as the installation of a temporary target for the verification of the theoretical predictions.

  3. Reconnection of magnetic field lines

    Heyn, M.F.; Gratton, F.T.; Gnavi, G.; Heindler, M.

    1990-01-01

    Magnetic field line diffusion in a plasma is studied on the basis of the non-linear boundary layer equations of dissipative, incompressible magnetohydrodynamics. Non-linear steady state solutions for a class of plasma parameters have been obtained which are consistent with the boundary conditions appropriate for reconnection. The solutions are self-consistent in connecting a stagnation point flow of a plasma with reconnecting magnetic field lines. The range of the validity of the solutions, their relation to other fluid models of reconnection, and their possible applications to space plasma configurations are pointed out. (Author)

  4. Assembly line performance and modeling

    Rane, Arun B.; Sunnapwar, Vivek K.

    2017-09-01

    Automobile sector forms the backbone of manufacturing sector. Vehicle assembly line is important section in automobile plant where repetitive tasks are performed one after another at different workstations. In this thesis, a methodology is proposed to reduce cycle time and time loss due to important factors like equipment failure, shortage of inventory, absenteeism, set-up, material handling, rejection and fatigue to improve output within given cost constraints. Various relationships between these factors, corresponding cost and output are established by scientific approach. This methodology is validated in three different vehicle assembly plants. Proposed methodology may help practitioners to optimize the assembly line using lean techniques.

  5. On-line maintenance PSA support at NPP Krsko

    Prosen, R.; Vrbanic, I.; Kastelan, M.

    2000-01-01

    In 1997 Krsko NPP initiated the on-line maintenance (OLM) practice. On-line maintenance constitutes of corrective activities, preventive activities, surveillance activities, tests and inspections, as well as calibrations and modifications, taking place during the normal power operations. The on-line maintenance is a multidisciplinary process consisting of activity specification, planning, and preparation and performing of the OLM activity of interest. The primary role of the PSA group is to assess from the r isk perspective , using the plant-specific NEK PSA model, system unavailability and the impact to the plant operational risk. The intent is to support planning of the on-line maintenance activities from the risk perspective. The risk evaluation of the OLM activities is based on the probability of core damage evaluation for the defined discrete plant configuration states, determined by the OLM activities. Within this application, the optimized, plant-specific PSA model is used on Risk Spectrum platform. To perform the risk assessment of the on-line maintenance activities, first the systems to be affected are defined based on the planned OLM activities. The next important step is the assessment of the planned work schedule. To define the final schedule, the co-ordination and optimizing the planned OLM activities needs activation of all participating departments, supported also from PSA group. The P3 (i.e. Primavera) planning tool system windows are defined for different systems and groups of systems, and the activities are sorted in particular weeks according to these windows. (author)

  6. Generalized emittance measurements in a beam transport line

    Skelly, J.; Gardner, C.; Luccio, A.; Kponou, A.; Reece, K.

    1991-01-01

    Motivated by the need to commission 3 beam transport lines for the new AGS Booster project, we have developed a generalized emittance-measurement program; beam line specifics are entirely resident in data tables, not in program code. For instrumentation, the program requires one or more multi-wire profile monitors; one or multiple profiles are acquired from each monitor, corresponding to one or multiple tunes of the transport line. Emittances and Twiss parameters are calculated using generalized algorithms. The required matix descriptions of the beam optics are constructed by an on-line general beam modeling program. Design of the program, its algorithms, and initial experience with it will be described. 4 refs., 2 figs., 1 tab

  7. Recombinant protein production from stable mammalian cell lines and pools.

    Hacker, David L; Balasubramanian, Sowmya

    2016-06-01

    We highlight recent developments for the production of recombinant proteins from suspension-adapted mammalian cell lines. We discuss the generation of stable cell lines using transposons and lentivirus vectors (non-targeted transgene integration) and site-specific recombinases (targeted transgene integration). Each of these methods results in the generation of cell lines with protein yields that are generally superior to those achievable through classical plasmid transfection that depends on the integration of the transfected DNA by non-homologous DNA end-joining. This is the main reason why these techniques can also be used for the generation of stable cell pools, heterogenous populations of recombinant cells generated by gene delivery and genetic selection without resorting to single cell cloning. This allows the time line from gene transfer to protein production to be reduced. Copyright © 2016 Elsevier Ltd. All rights reserved.

  8. Coiled transmission line pulse generators

    McDonald, Kenneth Fox

    2010-11-09

    Methods and apparatus are provided for fabricating and constructing solid dielectric "Coiled Transmission Line" pulse generators in radial or axial coiled geometries. The pour and cure fabrication process enables a wide variety of geometries and form factors. The volume between the conductors is filled with liquid blends of monomers, polymers, oligomers, and/or cross-linkers and dielectric powders; and then cured to form high field strength and high dielectric constant solid dielectric transmission lines that intrinsically produce ideal rectangular high voltage pulses when charged and switched into matched impedance loads. Voltage levels may be increased by Marx and/or Blumlein principles incorporating spark gap or, preferentially, solid state switches (such as optically triggered thyristors) which produce reliable, high repetition rate operation. Moreover, these Marxed pulse generators can be DC charged and do not require additional pulse forming circuitry, pulse forming lines, transformers, or an a high voltage spark gap output switch. The apparatus accommodates a wide range of voltages, impedances, pulse durations, pulse repetition rates, and duty cycles. The resulting mobile or flight platform friendly cylindrical geometric configuration is much more compact, light-weight, and robust than conventional linear geometries, or pulse generators constructed from conventional components. Installing additional circuitry may accommodate optional pulse shape improvements. The Coiled Transmission Lines can also be connected in parallel to decrease the impedance, or in series to increase the pulse length.

  9. Reconnections of Wave Vortex Lines

    Berry, M. V.; Dennis, M. R.

    2012-01-01

    When wave vortices, that is nodal lines of a complex scalar wavefunction in space, approach transversely, their typical crossing and reconnection is a two-stage process incorporating two well-understood elementary events in which locally coplanar hyperbolas switch branches. The explicit description of this reconnection is a pedagogically useful…

  10. Priming the Mental Time Line

    Di Bono, Maria Grazia; Casarotti, Marco; Priftis, Konstantinos; Gava, Lucia; Umilta, Carlo; Zorzi, Marco

    2012-01-01

    Growing experimental evidence suggests that temporal events are represented on a mental time line, spatially oriented from left to right. Support for the spatial representation of time comes mostly from studies that have used spatially organized responses. Moreover, many of these studies did not avoid possible confounds attributable to target…

  11. Picosecond resolution programmable delay line

    Suchenek, Mariusz

    2009-01-01

    The note presents implementation of a programmable delay line for digital signals. The tested circuit has a subnanosecond delay range programmable with a resolution of picoseconds. Implementation of the circuit was based on low-cost components, easily available on the market. (technical design note)

  12. Managing first-line failure.

    Cooper, David A

    2014-01-01

    WHO standard of care for failure of a first regimen, usually 2N(t)RTI's and an NNRTI, consists of a ritonavir-boosted protease inhibitor with a change in N(t)RTI's. Until recently, there was no evidence to support these recommendations which were based on expert opinion. Two large randomized clinical trials, SECOND LINE and EARNEST both showed excellent response rates (>80%) for the WHO standard of care and indicated that a novel regimen of a boosted protease inhibitor with an integrase inhibitor had equal efficacy with no difference in toxicity. In EARNEST, a third arm consisting of induction with the combined protease and integrase inhibitor followed by protease inhibitor monotherapy maintenance was inferior and led to substantial (20%) protease inhibitor resistance. These studies confirm the validity of the current recommendations of WHO and point to a novel public health approach of using two new classes for second line when standard first-line therapy has failed, which avoids resistance genotyping. Notwithstanding, adherence must be stressed in those failing first-line treatments. Protease inhibitor monotherapy is not suitable for a public health approach in low- and middle-income countries.

  13. Measurements of weak conversion lines

    Feoktistov, A.I.; Frantsev, Yu.E.

    1979-01-01

    Described is a new methods for measuring weak conversion lines with the help of the β spectrometer of the π √ 2 type which permits to increase the reliability of the results obtained. According to this method the measurements were carried out by short series with the storage of the information obtained on the punched tape. The spectrometer magnetic field was stabilized during the measuring of the conversion spectra with the help of three nmr recorders. Instead of the dependence of the pulse calculation rate on the magnetic field value was measured the dependence of the calculation rate on the value of the voltage applied between the source and the spectrometer chamber. A short description of the automatic set-up for measuring conversion lines according to the method proposed is given. The main set-up elements are the voltage multiplexer timer, printer, scaler and the pulse analyzer. With the help of the above methods obtained is the K 1035, 8 keV 182 Ta line. It is obtained as a result of the composition of 96 measurement series. Each measurement time constitutes 640 s 12 points are taken on the line

  14. CERN Video News on line

    2003-01-01

    The latest CERN video news is on line. In this issue : an interview with the Director General and reports on the new home for the DELPHI barrel and the CERN firemen's spectacular training programme. There's also a vintage video news clip from 1954. See: www.cern.ch/video or Bulletin web page

  15. Establishment and characterization of rat portal myofibroblast cell lines.

    Michel Fausther

    Full Text Available The major sources of scar-forming myofibroblasts during liver fibrosis are activated hepatic stellate cells (HSC and portal fibroblasts (PF. In contrast to well-characterized HSC, PF remain understudied and poorly defined. This is largely due to the facts that isolation of rodent PF for functional studies is technically challenging and that PF cell lines had not been established. To address this, we have generated two polyclonal portal myofibroblast cell lines, RGF and RGF-N2. RGF and RGF-N2 were established from primary PF isolated from adult rat livers that underwent culture activation and subsequent SV40-mediated immortalization. Specifically, Ntpdase2/Cd39l1-sorted primary PF were used to generate the RGF-N2 cell line. Both cell lines were functionally characterized by RT-PCR, immunofluorescence, immunoblot and bromodeoxyuridine-based proliferation assay. First, immortalized RGF and RGF-N2 cells are positive for phenotypic myofibroblast markers alpha smooth muscle actin, type I collagen alpha-1, tissue inhibitor of metalloproteinases-1, PF-specific markers elastin, type XV collagen alpha-1 and Ntpdase2/Cd39l1, and mesenchymal cell marker ecto-5'-nucleotidase/Cd73, while negative for HSC-specific markers desmin and lecithin retinol acyltransferase. Second, both RGF and RGF-N2 cell lines are readily transfectable using standard methods. Finally, RGF and RGF-N2 cells attenuate the growth of Mz-ChA-1 cholangiocarcinoma cells in co-culture, as previously demonstrated for primary PF. Immortalized rat portal myofibroblast RGF and RGF-N2 cell lines express typical markers of activated PF-derived myofibroblasts, are suitable for DNA transfection, and can effectively inhibit cholangiocyte proliferation. Both RGF and RGF-N2 cell lines represent novel in vitro cellular models for the functional studies of portal (myofibroblasts and their contribution to the progression of liver fibrosis.

  16. Cabazitaxel as second-line or third-line therapy in patients with metastatic castration-resistant prostate cancer

    Kongsted, Per; Svane, Inge M; Lindberg, Henriette

    2016-01-01

    To compare treatment outcomes in patients with metastatic castration-resistant prostate cancer treated with cabazitaxel (CA) as second-line or third-line therapy in the everyday clinical setting. Charts from 94 patients treated with CA as second-line (n=28) or third-line therapy (n=66) were...... evaluated. Common Terminology Criteria for Adverse Events were used to register grade 3-4 nonhematological toxicity during treatment with CA. Baseline metastatic castration-resistant prostate cancer-related prognostic factors, duration of therapy, and maximum prostate-specific antigen (PSA) percentage...... change were registered during treatment with CA and previous/subsequent novel androgen receptor targeting therapies. Progression-free survival (PFS) and overall survival (OS) were calculated using the Kaplan-Meier method. A median of 6 versus 5 treatment cycles was administered in patients treated...

  17. A new electrostatic on-line collection-system

    Dufour, J.P.; Del Moral, R.; Fleury, A.; Hubert, F.; Llabador, Y.; Mauhourat, M.B.; Bimbot, R.; Gardes, D.; Rivet, M.F.

    1981-01-01

    The working conditions of a new on-line electrostatic collection system are presented. The main characteristics are high efficiency (reaching 20%) and short delay time (down to the millisecond). The salient features of specific devices for measurements of absolute cross sections, recoil range distributions and angular distributions are given. (orig.)

  18. A new electrostatic on-line collection-system

    Dufour, J.P.; Del Moral, R.; Fleury, A.

    1981-06-01

    The working conditions of a new on-line electrostatic collection system are presented. The main charactersitics are high efficiency (reaching 20%) and short delay time (down to the millisecond). The salient features of specific devices for measurements of absolute cross sections, recoil range distributions and angular distributions are given

  19. How specific is specific self-efficacy?

    Nielsen, Tine; Makransky, Guido; Vang, Maria Louison

    2017-01-01

    academic learning self-efficacy (SAL-SE) and specific academic exam self-efficacy (SAE-SE), each scale being measurement invariant relative to age, Gender, admission method and specific course targeted. Furthermore, significant and relevant differences between the SAL-SE and SAE-SE scores dependent......Self-efficacy is an important and much used construct in psychology and social science studies. The validity of the measurements used is not always sufficiently evaluated. The aim was to evaluate the psychometric properties of the Danish translation of the self-efficacy subscale of The Motivated...... Strategies for Learning Questionnaire (MSLQ-SE) within a higher education context. Rasch measurement models were employed focusing on measurement invariance and dimensionality. Results with one students sample showed the MSLQ-SE to be not one, but two separate unidimensional subscales, measuring specific...

  20. US line-ups outperform UK line-ups

    Seale-Carlisle, Travis M.; Mickes, Laura

    2016-01-01

    In the USA and the UK, many thousands of police suspects are identified by eyewitnesses every year. Unfortunately, many of those suspects are innocent, which becomes evident when they are exonerated by DNA testing, often after having been imprisoned for years. It is, therefore, imperative to use identification procedures that best enable eyewitnesses to discriminate innocent from guilty suspects. Although police investigators in both countries often administer line-up procedures, the details ...

  1. Peroxisome Proliferator-Activated Receptor-γ Inhibits Transformed Growth of Non-Small Cell Lung Cancer Cells through Selective Suppression of Snail

    Rashmi Choudhary

    2010-03-01

    Full Text Available Work from our laboratory and others has demonstrated that activation of the nuclear receptor peroxisome proliferator-activated receptor-γ (PPARγ inhibits transformed growth of non-small cell lung cancer (NSCLC cell lines in vitro and in vivo. We have demonstrated that activation of PPARγ promotes epithelial differentiation of NSCLC by increasing expression of E-cadherin, as well as inhibiting expression of COX-2 and nuclear factor-κB. The Snail family of transcription factors, which includes Snail (Snail1, Slug (Snail2, and ZEB1, is an important regulator of epithelial-mesenchymal transition, as well as cell survival. The goal of this study was to determine whether the biological responses to rosiglitazone, a member of the thiazolidinedione family of PPARγ activators, are mediated through the regulation of Snail family members. Our results indicate that, in two independent NSCLC cell lines, rosiglitazone specifically decreased expression of Snail, with no significant effect on either Slug or ZEB1. Suppression of Snail using short hairpin RNA silencing mimicked the effects of PPARγ activation, in inhibiting anchorage-independent growth, promoting acinar formation in three-dimensional culture, and inhibiting invasiveness. This was associated with the increased expression of E-cadherin and decreased expression of COX-2 and matrix metaloproteinases. Conversely, overexpression of Snail blocked the biological responses to rosiglitazone, increasing anchorage-independent growth, invasiveness, and promoting epithelial-mesenchymal transition. The suppression of Snail expression by rosiglitazone seemed to be independent of GSK-3 signaling but was rather mediated through suppression of extracellular signal-regulated kinase activity. These findings suggest that selective regulation of Snail may be critical in mediating the antitumorigenic effects of PPARγ activators.

  2. Creation and evaluation of best cotton mutant lines

    Rastegari, S. J.; Hosseini, Z.

    2001-01-01

    During (1997-1999) a study was carried out to recognize the best mutant lines, which were already obtained from a mutation breeding project. A Triple Rectangular Latis Design (8 7) in form of randomized complete blocks (RCB) with fifty- six treatments and three replications, were used in Estahban, Kordkouy and Varamin, under different ecological conditions, rainfall (Kordkouy) desert (Varamin) hot and dry (Estahban). During growing season some important morphological characteristics were recorded. Some lines had specific characters, for example: line 3191 (Chirpan 150 gray) had a low leaf number per plant, line 3169 (Bakhtegan 200 gray) plants were clustered. The results of the data in Varamin station showed that Bakhtegan irradiated with 150 gray line 3485 and Tashkand with 300 gray line 3451 compared to check (Varamin with 4373 kg/ha) had highest yield with 4942 kg/ha, and 4871 kg/ha respectively. In view of boll weight line 3405 of Sahel irradiated with 200 gray had highest boll weight (6.5 g/boll). In Kordkouy station the best mutant line was Chirpan irradiated with 250 gray, line 3208, with 20% yield increase compared to Sahel and 30% yield increase compared to original Chirpan. In respect to irradiation effect on lint percentage and fiber quality, the results showed; there was a positive effect on lint percentage of all varieties, especially in Tashkant, Bakhtegan and Chirpan which are inherently weak in lint percentage. As a whole gamma radiation did not have any negative effect on fiber quality. Even in Estahban 1.6 to 2.4 mm fiber increase were observed in some Chirpan irradiated material (C150-3516) and (C200-3523)

  3. Combined echo offset (Dixon) and line volume chemical shift imaging as a clinical imaging protocol

    Listerud, J.; Chan, T.; Lenkinski, R.E.; Kressel, H.Y.; Chao, P.W.

    1989-01-01

    The authors have studied the sensitivity and specificity of the line-volume chemical-shift imaging (CSI) method as compared with the Dixon method they have recently implemented on a Signa, which supports a variety of options. Potential sources or error for the Dixon method include line broadening due to susceptibility, field inhomogeneity, and errors form olefinic resonances associated with fat, which behave like water in the Dixon regime. The authors investigate whether a combined Dixon/line-volume CSI method could be used to improve the placement of the line volume and to provide higher sensitivity and specificity than does the Dixon method alone

  4. TGF-b y un inhibidor específico de TGF-b regulan pericentrina B y MYH9 en células de glioma TGF-b and a specific TGF-b inhibitor regulate pericentrin B and MYH9 in glioma cell lines

    Rich Jeremy N.

    2006-07-01

    Full Text Available Malignant gliomas are heterogeneous, highly invasive vascular tumours. The multifunctional cytokine, transforming growth factor-beta (TGF-P, is expressed by grade III/IV gliomas and promotes tumour angiogenesis, invasión and immune escape. It has been shown previously that a small TGF-P receptor type I (TGF-(3-RI molecule inhibitor (SB-431542 blocks TGF-(3-mediated signal transduction, induction of angiogenic factor expression and cellular motility. As glioma cell lines display differential sensitivity to TGF-P, it was expected that they would also be differentially impacted by disruption of TGF-P signalling. Differential in gel expression (DIGE analysis and mass spectrometry was used in this work for determining protein regulation effects of both TGF-P and SB-431542 on human glioma cell lines. It was found that pericentrin B and non muscle myosin were differentially expressed in fragments which likely resulted from protease activation by the tumour growth mechanism. These results suggest that both pericentrin B and non-muscle myosin might be potential glioma biomarkers. Key words: DIGE, proteomics, glioma, TGF-P, mass spectrometry, non muscle myosin, pericentrin B.Los gliomas malignos son tumores vasculares heterogéneos altamente invasivos. El factor de transformación de creci­miento P (TGF-P es una citoquina multifuncional que es expresada por gliomas de grado III /IV y promueve angiogenesis de tumores, invasión y escape inmunológico. Recientemente se demostró que una pequeña molécula inhibidora (SB-431542 del receptor de TGF-P tipo I (TGF-P-RI, bloquea la señal de transducción mediada por TGF-P, la inducción del factor angiogénico de expresión y la movilidad celular. Ya que las líneas celulares de gliomas mues­tran sensitividad diferencial a TGF-P, se esperaba que también mostrarían impacto diferencial por el bloqueo de la señal de TGF-p. En el presente trabajo se usó un análisis diferencial en gel (DIGE, por sus

  5. Interactions of Rosiglitazone and Anti‑Arrhythmic Drugs in Animal ...

    Background: Diabetes increases the risk of vascular problems by two times compared with a healthy ... Aim: The aim of the study is to compare the influence of Mexiletine and ... analyze mean change in blood glucose between treatments with body weight as co‑variable ... increased the reliability of the results (P < 0.001).

  6. Rosiglitazone attenuates transplant arteriosclerosis after allogeneic aorta transplantation in rats

    Onuta, Geanina; Rienstra, Heleen; de Boer, Jan Freark; Boer, Mark Walther; Roks, Anton J. M.; Klatter, Flip A.; Uges, Donald R. A.; Navis, Gerjan; Rozing, Jan; Hillebrands, Jan-Luuk

    2007-01-01

    Background. Transplant arteriosclerosis is a leading cause of chronic transplant dysfunction and is characterized by occlusive neointima formation in intragraft arteries. Development of transplant arteriosclerosis is refractory to conventional immunosuppressive drugs and adequate therapy is not

  7. Eccentric vision : adverse interactions between line segments

    Andriessen, J.J.; Bouma, H.

    1976-01-01

    The paper deals with adverse interactions between line stimuli ineccentric vision. Bothcontrast thresholdandjust noticeable difference of slanthave been measured for a test line as a function of the distance from a number of surrounding lines. Test lines were either parallel or perpendicular to the

  8. Urine specific gravity test

    ... medlineplus.gov/ency/article/003587.htm Urine specific gravity test To use the sharing features on this page, please enable JavaScript. Urine specific gravity is a laboratory test that shows the concentration ...

  9. The petroleum industry improving the bottom line

    Benner, R.I.

    1992-01-01

    The oil and gas exploration and production business environment has presented many challenges over the last decade, notably price volatility and rising costs. Managing the margin and changing a company's cost structure to improve the bottom line is a major issue with company executives. The experiences of Oryx Energy Company since its spinoff from Sun Company in 1988 are used as an example of a company makeover. A generalized exploration and production income statement is employed to present industry cost/portfolio relationships and strategies for improving the bottom line. At Oryx, three major strategies were set in place to enhance shareholder value: an increased emphasis on applied technology, including horizontal drilling, advanced 3-dimensional seismic prospecting, and intensive use of interactive computer workstations; international expansion; and an emphasis on the U.S. Gulf of Mexico, deemphasizing the onshore U.S. and the gas processing business. Specific strategies are outlined in the areas of increasing revenues, reducing production cost and exploration expense, and controlling general and administrative expenses. 8 refs., 18 figs., 2 tabs

  10. Circuit for Communication Over Power Lines

    Krasowski, Michael J.; Prokop, Normal F.; Greer, Lawrence C., III; Nappier, Jennifer

    2011-01-01

    Many distributed systems share common sensors and instruments along with a common power line supplying current to the system. A communication technique and circuit has been developed that allows for the simple inclusion of an instrument, sensor, or actuator node within any system containing a common power bus. Wherever power is available, a node can be added, which can then draw power for itself, its associated sensors, and actuators from the power bus all while communicating with other nodes on the power bus. The technique modulates a DC power bus through capacitive coupling using on-off keying (OOK), and receives and demodulates the signal from the DC power bus through the same capacitive coupling. The circuit acts as serial modem for the physical power line communication. The circuit and technique can be made of commercially available components or included in an application specific integrated circuit (ASIC) design, which allows for the circuit to be included in current designs with additional circuitry or embedded into new designs. This device and technique moves computational, sensing, and actuation abilities closer to the source, and allows for the networking of multiple similar nodes to each other and to a central processor. This technique also allows for reconfigurable systems by adding or removing nodes at any time. It can do so using nothing more than the in situ power wiring of the system.

  11. Minimization over randomly selected lines

    Ismet Sahin

    2013-07-01

    Full Text Available This paper presents a population-based evolutionary optimization method for minimizing a given cost function. The mutation operator of this method selects randomly oriented lines in the cost function domain, constructs quadratic functions interpolating the cost function at three different points over each line, and uses extrema of the quadratics as mutated points. The crossover operator modifies each mutated point based on components of two points in population, instead of one point as is usually performed in other evolutionary algorithms. The stopping criterion of this method depends on the number of almost degenerate quadratics. We demonstrate that the proposed method with these mutation and crossover operations achieves faster and more robust convergence than the well-known Differential Evolution and Particle Swarm algorithms.

  12. On-line moisture analysis

    Cutmore, N G

    2002-01-01

    Measurement of the moisture content of iron ore has become a key issue for controlling moisture additions for dust suppression. In most cases moisture content is still determined by manual or automatic sampling of the ore stream, followed by conventional laboratory analysis by oven drying. Although this procedure enables the moisture content to be routinely monitored, it is too slow for control purposes. This has generated renewed interest in on-line techniques for the accurate and rapid measurement of moisture in iron ore on conveyors. Microwave transmission techniques have emerged over the past 40 years as the dominant technology for on-line measurement of moisture in bulk materials, including iron ores. Alternative technologies have their limitations. Infra-red analysers are used in a variety of process industries, but rely on the measurement of absorption by moisture in a very thin surface layer. Consequently such probes may be compromised by particle size effects and biased presentation of the bulk mater...

  13. Avoided intersections of nodal lines

    Monastra, Alejandro G; Smilansky, Uzy; Gnutzmann, Sven

    2003-01-01

    We consider real eigenfunctions of the Schroedinger operator in 2D. The nodal lines of separable systems form a regular grid, and the number of nodal crossings equals the number of nodal domains. In contrast, for wavefunctions of non-integrable systems nodal intersections are rare, and for random waves, the expected number of intersections in any finite area vanishes. However, nodal lines display characteristic avoided crossings which we study in this work. We define a measure for the avoidance range and compute its distribution for the random wave ensemble. We show that the avoidance range distribution of wavefunctions of chaotic systems follows the expected random wave distributions, whereas for wavefunctions of classically integrable but quantum non-separable systems, the distribution is quite different. Thus, the study of the avoidance distribution provides more support to the conjecture that nodal structures of chaotic systems are reproduced by the predictions of the random wave ensemble

  14. Line Creep in Paper Peeling

    Rosti J.

    2010-06-01

    Full Text Available We have studied experimentally the dynamics of the separation of a sheet of paper into two halves in a peeling configuration. The experimental setup consists of a peeling device, where a fracture front is driven along the plane of the paper, with a constant force. The theoretical picture is how an elastic line interacts with a random landscape of fracture toughness. We compare the results with theoretical simulations in several aspects. One recent finding concerns the autocorrelation function of the average front position. The data from the experiments produces so-called cusps or singularities in the correlation function, as predicted by the functional renormalization group theory for elastic lines. Comparisons with simulations with either a short range or a long range elastic kernel demonstrate that the latter agrees with the experimental observations, as expected.

  15. Efficient line matching with homography

    Shen, Yan; Dai, Yuxing; Zhu, Zhiliang

    2018-03-01

    In this paper, we propose a novel approach to line matching based on homography. The basic idea is to use cheaply obtainable matched points to boost the similarity between two images. Two types of homography method, which are estimated by direct linear transformation, transform images and extract their similar parts, laying a foundation for the use of optical flow tracking. The merit of the similarity is that rapid matching can be achieved by regionalizing line segments and local searching. For multiple homography estimation that can perform better than one global homography, we introduced the rank-one modification method of singular value decomposition to reduce the computation cost. The proposed approach results in point-to-point matches, which can be utilized with state-of-the-art point-match-based structures from motion (SfM) frameworks seamlessly. The outstanding performance and feasible robustness of our approach are demonstrated in this paper.

  16. Line strengths in WN stars

    Leep, E.M.

    1982-01-01

    The author has analyzed high-dispersion spectra of over 100 WN stars in the Galaxy and the Large Magellenic Cloud (LMC). Most of the spectra were obtained through 4-m telescopes (Conti, Leep, and Perry 1981). The measured strengths of the WN classification lines N III lambdalambda4634-41, N IV lambda4057, N V lambda4604 (Smith 1968) for stars on WN subtypes 2.5-8 are shown. The assignments of WN subtypes are based on visual estimates of ratios of line strengths according to the scheme of Smith (1968), except that stars appearing to be earlier than WN3 are classified as WN2 or WN2.5 as explained by van der Hucht et al. (1981) and by Conti, Leep and Perry (1981). (Auth.)

  17. Transversal Lines of the Debates

    Yolanda Onghena

    1998-12-01

    Full Text Available The Transversal Lines of the Debates gathers for publication the presentations of the scholars invited to the seminar. In the papers, Yolanda Onghena observes that the evolution from the cultural to the inter-cultural travels along four axes: the relations between cultureand society; the processes of change within identity-based dynamics; the representations of the Other; and, interculturality. Throughout the presentations and subsequent debates, whenever the different participants referred to aspects of the cultural identity problematic--”angst”, “obsession”, “deficit”, manipulation”, and others, these same participants in the Transversal Lines of the Debates also showed that, in certain areas, an optimistic viewpoint is not out of the question.

  18. Signal Transmission on Power Lines

    Dalby, Arne Brejning

    1997-01-01

    In the analysis of power-line networks over a large frequency span, the time-domain method used in programs like EMTP (Electromagnetic Time domain Program) can not be used. A more rigorous analysis method must be employed. The correct analysis method (assuming TEM-mode propagation) for multiple....... An approximate analysis method must be usedIn this paper it is shown that an eigenvectormatrix, that is the propagation modes, can be chosen almost arbitrarily if the frequency interval of interest lies below the frequency, where the line length is about 1/3 times the wavelength for the propagation mode...... with the lowest phase velocity. The propagation constants corresponding to the chosen eigenvector matrix (the quasi modes) are found iteratively, which is a much simpler procedure than finding the eigenvalues....

  19. Line integral on engineering mathematics

    Wiryanto, L. H.

    2018-01-01

    Definite integral is a basic material in studying mathematics. At the level of calculus, calculating of definite integral is based on fundamental theorem of calculus, related to anti-derivative, as the inverse operation of derivative. At the higher level such as engineering mathematics, the definite integral is used as one of the calculating tools of line integral. the purpose of this is to identify if there is a question related to line integral, we can use definite integral as one of the calculating experience. The conclusion of this research says that the teaching experience in introducing the relation between both integrals through the engineer way of thinking can motivate and improve students in understanding the material.

  20. On real quadric line complexes

    Krasnov, Vyacheslav A

    2010-01-01

    We describe the topological types of the real parts of the Kummer surfaces associated with real three-dimensional quadric line complexes. The topological type of the real part of such a surface is shown to depend on the number of real singular points: it is determined by the number of such points if any exist, and otherwise the real part of the Kummer surface is either empty or consists of one or two tori.

  1. About cosmic gamma ray lines

    Diehl, Roland

    2017-06-01

    Gamma ray lines from cosmic sources convey the action of nuclear reactions in cosmic sites and their impacts on astrophysical objects. Gamma rays at characteristic energies result from nuclear transitions following radioactive decays or high-energy collisions with excitation of nuclei. The gamma-ray line from the annihilation of positrons at 511 keV falls into the same energy window, although of different origin. We present here the concepts of cosmic gamma ray spectrometry and the corresponding instruments and missions, followed by a discussion of recent results and the challenges and open issues for the future. Among the lessons learned are the diffuse radioactive afterglow of massive-star nucleosynthesis in 26Al and 60Fe gamma rays, which is now being exploited towards the cycle of matter driven by massive stars and their supernovae; large interstellar cavities and superbubbles have been recognised to be of key importance here. Also, constraints on the complex processes making stars explode as either thermonuclear or core-collapse supernovae are being illuminated by gamma-ray lines, in this case from shortlived radioactivities from 56Ni and 44Ti decays. In particular, the three-dimensionality and asphericities that have recently been recognised as important are enlightened in different ways through such gamma-ray line spectroscopy. Finally, the distribution of positron annihilation gamma ray emission with its puzzling bulge-dominated intensity disctribution is measured through spatially-resolved spectra, which indicate that annihilation conditions may differ in different parts of our Galaxy. But it is now understood that a variety of sources may feed positrons into the interstellar medium, and their characteristics largely get lost during slowing down and propagation of positrons before annihilation; a recent microquasar flare was caught as an opportunity to see positrons annihilate at a source.

  2. Rapid reconnection of flux lines

    Samain, A.

    1982-01-01

    The rapid reconnection of flux lines in an incompressible fluid through a singular layer of the current density is discussed. It is shown that the liberated magnetic energy must partially appear in the form of plasma kinetic energy. A laminar structure of the flow is possible, but Alfven velocity must be achieved in eddies of growing size at the ends of the layer. The gross structure of the flow and the magnetic configuration may be obtained from variational principles. (author)

  3. Assembly delay line pulse generators

    CERN PhotoLab

    1971-01-01

    Assembly of six of the ten delay line pulse generators that will power the ten kicker magnet modules. One modulator part contains two pulse generators. Capacitors, inductances, and voltage dividers are in the oil tank on the left. Triggered high-pressure spark gap switches are on the platforms on the right. High voltage pulse cables to the kicker magnet emerge under the spark gaps. In the centre background are the assembled master gaps.

  4. Varied line-space gratings and applications

    McKinney, W.R.

    1991-01-01

    This paper presents a straightforward analytical and numerical method for the design of a specific type of varied line-space grating system. The mathematical development will assume plane or nearly-plane spherical gratings which are illuminated by convergent light, which covers many interesting cases for synchrotron radiation. The gratings discussed will have straight grooves whose spacing varies across the principal plane of the grating. Focal relationships and formulae for the optical grating-pole-to-exist-slit distance and grating radius previously presented by other authors will be derived with a symbolic algebra system. It is intended to provide the optical designer with the tools necessary to design such a system properly. Finally, some possible advantages and disadvantages for application to synchrotron to synchrotron radiation beamlines will be discussed

  5. A universal mammalian vaccine cell line substrate.

    Jackelyn Murray

    Full Text Available Using genome-wide small interfering RNA (siRNA screens for poliovirus, influenza A virus and rotavirus, we validated the top 6 gene hits PV, RV or IAV to search for host genes that when knocked-down (KD enhanced virus permissiveness and replication over wild type Vero cells or HEp-2 cells. The enhanced virus replication was tested for 12 viruses and ranged from 2-fold to >1000-fold. There were variations in virus-specific replication (strain differences across the cell lines examined. Some host genes (CNTD2, COQ9, GCGR, NDUFA9, NEU2, PYCR1, SEC16G, SVOPL, ZFYVE9, and ZNF205 showed that KD resulted in enhanced virus replication. These findings advance platform-enabling vaccine technology, the creation of diagnostic cells substrates, and are informative about the host mechanisms that affect virus replication in mammalian cells.

  6. Autoshuttle: Concept and Commercial Example Line

    Andreas Steingrover

    2003-05-01

    Full Text Available The transport system AUTOSHUTTLE integrates roadand track guided traffic using and combining the specific advantagesof each of these means of transportation. Conventionalroad vehicles are transported including their passengersand freight in individual cabins. The operational concept ofA UTOSHUTTLE provides operation of the cabins without intermediatestops at almost constant travelling speed. During thejourney convoys with low aerodynamic drag are formed in orderto lower the energy consumption and increase traffic capacity.Approaching a station only those cabins that have reachedtheir destination leave the convoy on a passive switch and decelerateon a brake track, while other cabins close the gap in theconvoy and travel on at the usual cruising speed. This paper describesthe planning and economical aspects of a proposedcommercia/line along the motorway A3 in Germany betweenthe cities of Duisburg and Cologne as a typical example formany other applications.

  7. Inductive line energy storage generator

    Choi, P [Ecole Polytechnique, Palaiseau (France). Laboratoire de Physique des Milieux Ionises

    1997-12-31

    The inductive energy storage (IES) generator has long been considered to be the most efficient system for energy usage in large pulsed power system at the MA level. A number of parameters govern the efficiency of energy transfer between the storage capacitors and the load, and the level of current deliverable to the load. For high power system, the energy storage capacitors are arranged as a Marx generator. The primary constraints are the inductances in the various parts of the circuit, in particular, the upstream inductance between the Marx and the POS, and the downstream inductance between the POS and the load. This paper deals with the effect of replacing part of the upstream inductance with a transmission line and introduces the new concept of an inductive line for energy storage (ILES). Extensive parametric scans were carried out on circuit simulations to investigate the effect of this upstream transmission line. A model was developed to explain the operation of the ILES design based on the data obtained. Comparison with an existing IES generator shows that the ILES design offers a significant improvement in the maximum current and hence energy delivered to an inductive load. (author). 5 figs., 1 ref.

  8. The laser integration line (LIL)

    Roussel, A.

    2006-01-01

    The laser integration line (LIL) was originally built to validate the technological choices made for the Megajoule laser that is being built nearby. The LIL is made up of a single line composed of 8 laser beams. Each laser beam consists of 4 main modules: 1) the impulse generator that delivers a 40 mm * 40 mm square cross section infrared laser beam (λ = 1053 nm); 2) the amplification module that involves 2 steps in power amplifying, the output signal is a laser impulse of 5 ns of time duration carrying an energy of 20.10 3 Joule at a wavelength of 1053 nm; 3) the transport line that leads 4 elementary laser beams through a system of 6 mirrors; and 4) the optical block of the focusing and frequency conversion system (SCF). The purpose of SCF is twofold, first to turn the 4 infrared elementary beams into 4 ultraviolet (λ = 351 nm) beams thanks to 2 KDP (potassium di-hydrogeno-phosphate) crystals, and secondly to merge and focus the 4 elementary beams on a unique spot of the target thanks to diffraction gratings with curved slits. (A.C.)

  9. Workshop on Radio Recombination Lines

    1980-01-01

    Since their first detection 15 years ago, radio recombination lines from several elements have been observed in a wide variety of objects including HII regions, planetary nebulae, molecular clouds, the diffuse interstellar medium, and recently, other galaxies. The observations span almost the entire range from 0.1 to 100 GHz, and employ both single­ djsh and aperture synthesis techniques. The theory of radio recombination lines has also advanced strongly, to the point where it is perhaps one of the best-understood in astro­ physics. In a parallel development, it has become possible over the last decade to study these same highly-excited atoms in the laboratory; this work provides further confirmation of the theoretical framework. However there has been continuing controversy over the astrophysical interpre­ tation of radio recombination line observations, especially regarding the role of stimulated emission. A workshop was held in Ottawa on 24-25 August, 1979, bringing together many of the active scientist...

  10. Casein gene expression in mouse mammary epithelial cell lines: Dependence upon extracellular matrix and cell type

    Medina, D.; Oborn, C.J.; Li, M.L.; Bissell, M.J.

    1987-01-01

    The COMMA-D mammary cell line exhibits mammary-specific functional differentiation under appropriate conditions in cell culture. The cytologically heterogeneous COMMA-D parental line and the clonal lines DB-1, TA-5, and FA-1 derived from the COMMA-D parent were examined for similar properties of functional differentiation. In monolayer cell culture, the cell lines DB-1, TA-5, FA-1, and MA-4 were examined for expression of mammary-specific and epithelial-specific proteins by an indirect immunofluorescence assay. The clonal cell lines were relatively homogeneous in their respective staining properties and seemed to represent three subpopulations found in the heterogeneous parental COMMA-D lines. None of the four clonal lines appeared to represent myoepithelial cells. The cell lines were examined for expression of β-casein mRNA in the presence or absence of prolactin. The inducibility of β-casein in the COMMA-D cell line was further enhanced by a reconstituted basement membrane preparation enriched in laminin, collagen IV, and proteoglycans. These results support the hypothesis that the functional response of inducible mammary cell populations is a result of interaction among hormones, multiple extracellular matrix components, and specific cell types

  11. Impact if hyperprolific line of litter size in multiplication herd

    Zdeněk Tvrdoň

    2009-01-01

    Full Text Available The hyperprolific line is considered to be maximally effective in pursuit of progress in sow’s reproduction. Hyperprolific line efficiency is commonly evaluated in regard of breeding herd progress. We decided to study how effective it is with respect to increasing of litter size in multiplication herd. Our study is specific by using the data from practice, concretely it is based on the information about the ancestor of sows in multiplication herd. The ancestors could be the member either hyperprolific line or normal line. The information about performances of sows breed in multiplication herd was known. The mixed linear models in SAS for Windows 9.1.2. were conducted to statistical analysis. Our results indicated that no significant effect on litter size was achieved by selection criteria used in the hyperprolific line creation. In studied population no differences between TNB, NBA or NW were found on the 1st as well as on the 1st–5th litters. As we have mentioned above, the study is specific by using the data from practice. Therefore the studied population size is limited. It is necessary to take into consideration when the results are applied. Nevertheless, the results shown that other studies with larger population should be done to reevaluate the selection criteria.

  12. A new mathematical formulation of the line-by-line method in case of weak line overlapping

    Ishov, Alexander G.; Krymova, Natalie V.

    1994-01-01

    A rigorous mathematical proof is presented for multiline representation on the equivalent width of a molecular band which consists in the general case of n overlapping spectral lines. The multiline representation includes a principal term and terms of minor significance. The principal term is the equivalent width of the molecular band consisting of the same n nonoverlapping spectral lines. The terms of minor significance take into consideration the overlapping of two, three and more spectral lines. They are small in case of the weak overlapping of spectral lines in the molecular band. The multiline representation can be easily generalized for optically inhomogeneous gas media and holds true for combinations of molecular bands. If the band lines overlap weakly the standard formulation of line-by-line method becomes too labor-consuming. In this case the multiline representation permits line-by-line calculations to be performed more effectively. Other useful properties of the multiline representation are pointed out.

  13. Real-time specifications

    David, A.; Larsen, K.G.; Legay, A.

    2015-01-01

    A specification theory combines notions of specifications and implementations with a satisfaction relation, a refinement relation, and a set of operators supporting stepwise design. We develop a specification framework for real-time systems using Timed I/O Automata as the specification formalism......, with the semantics expressed in terms of Timed I/O Transition Systems. We provide constructs for refinement, consistency checking, logical and structural composition, and quotient of specifications-all indispensable ingredients of a compositional design methodology. The theory is implemented in the new tool Ecdar...

  14. Children's cognitive representation of the mathematical number line.

    Rouder, Jeffrey N; Geary, David C

    2014-07-01

    Learning of the mathematical number line has been hypothesized to be dependent on an inherent sense of approximate quantity. Children's number line placements are predicted to conform to the underlying properties of this system; specifically, placements are exaggerated for small numerals and compressed for larger ones. Alternative hypotheses are based on proportional reasoning; specifically, numerals are placed relative to set anchors such as end points on the line. Traditional testing of these alternatives involves fitting group medians to corresponding regression models which assumes homogenous residuals and thus does not capture useful information from between- and within-child variation in placements across the number line. To more fully assess differential predictions, we developed a novel set of hierarchical statistical models that enable the simultaneous estimation of mean levels of and variation in performance, as well as developmental transitions. Using these techniques we fitted the number line placements of 224 children longitudinally assessed from first to fifth grade, inclusive. The compression pattern was evident in mean performance in first grade, but was the best fit for only 20% of first graders when the full range of variation in the data are modeled. Most first graders' placements suggested use of end points, consistent with proportional reasoning. Developmental transition involved incorporation of a mid-point anchor, consistent with a modified proportional reasoning strategy. The methodology introduced here enables a more nuanced assessment of children's number line representation and learning than any previous approaches and indicates that developmental improvement largely results from midpoint segmentation of the line. © 2014 John Wiley & Sons Ltd.

  15. Polymer encapsulated dopaminergic cell lines as "alternative neural grafts".

    Jaeger, C B; Greene, L A; Tresco, P A; Winn, S R; Aebischer, P

    1990-01-01

    Our preliminary findings (Jaeger et al., 1988; Aebischer et al., 1989; Tresco et al., 1989) and the studies in progress show that encapsulated dopaminergic cell lines survive enclosure within a semi-permeable membrane. The encapsulated cells remained viable for extended time periods when maintained in vitro. Moreover, encapsulated PC12 and T28 cells have the potential to survive following their implantation into the forebrain of rats. Cell lines are essentially "immortal" because they continue to divide indefinitely. This property allows perpetual "self-renewal" of a given cell population. However, the capacity of continuous uncontrolled cell division may also lead to tumor formation. This in fact is the case for unencapsulated PC12 cell implants placed into the brain of young Sprague Dawley rats (Jaeger, 1985). Cell line encapsulation has the potential to prevent tumor growth (Jaeger et al., 1988). Survival for 6 months in vitro suggests that encapsulation does not preclude long-term maintenance of an homogeneous cell line like PC12 cells. The presence of mitotic figures in the capsules further supports the likelihood of propagation and self renewal of the encapsulated population. Another significant property of cell lines is that they consist of a single, genetically homogeneous cell type. They do not require specific synaptic interactions for their survival. In the case of PC12 and T28 lines, the cells synthesize and release neurotransmitters. Our data show that PC12 and T28 cells continue to release dopamine spontaneously and to express specific transmitters and enzymes following encapsulation. Thus, cell lines such as these may constitute relatively simple "neural implants" exerting their function via humoral release.(ABSTRACT TRUNCATED AT 250 WORDS)

  16. Investigating the Temperature Problem in Narrow Line Emitting AGN

    Jenkins, Sam; Richardson, Chris T.

    2018-06-01

    Our research investigates the physical conditions in gas clouds around the narrow line region of AGN. Specifically, we explore the necessary conditions for anomalously high electron temperatures, Te, in those clouds. Our 321 galaxy data set was acquired from SDSS DR14 after requiring S/N > 5.0 in [OIII] 4363 and S/N > 3.0 in all BPT diagram emission lines, to ensure both accurate Te and galaxy classification, with 0.04 study the effects these conditions have on gas cloud Te.

  17. Application of superconductors to motors, generators, and transmission lines

    Kirtley, J.L.

    1989-01-01

    Superconductors are of interest to the designers of electric power equipment because they can carry current without loss, currents that are large enough to make very intense magnetic fields. This means that superconductors, used in suitable applications, can make electric power equipment smaller, lighter, more efficient, and perhaps with better dynamic response. Two specific applications are considered here: electric machinery (motors and generators) and transmission lines. The so-called high-T c superconductors will have beneficial impact on motors, generators, and transmission lines only if conductors with sufficient mechanical properties and current-carrying capabilities can be developed

  18. Line Manager Involvement in Work-Life Balance and Career Development: Can't Manage, Won't Manage?

    Dick, Penny; Hyde, Rosie

    2006-01-01

    Line manager involvement in HRM is an increasing trend across Europe. With the numbers of employees taking advantage of work-life balance policies also on the increase, line manager responsibility for this specific policy area is likely to become more marked. In this paper, we argue that line managers have a critical role to play in the career…

  19. Wp specific methylation of highly proliferated LCLs

    Park, Jung-Hoon; Jeon, Jae-Pil; Shim, Sung-Mi; Nam, Hye-Young; Kim, Joon-Woo; Han, Bok-Ghee; Lee, Suman

    2007-01-01

    The epigenetic regulation of viral genes may be important for the life cycle of EBV. We determined the methylation status of three viral promoters (Wp, Cp, Qp) from EBV B-lymphoblastoid cell lines (LCLs) by pyrosequencing. Our pyrosequencing data showed that the CpG region of Wp was methylated, but the others were not. Interestingly, Wp methylation was increased with proliferation of LCLs. Wp methylation was as high as 74.9% in late-passage LCLs, but 25.6% in early-passage LCLs. From two Burkitt's lymphoma cell lines, Wp specific hypermethylation was also found (>80%). Interestingly, the expression of EBNA2 gene which located directly next to Wp was associated with its methylation. Our data suggested that Wp specific methylation may be important for the indicator of the proliferation status of LCLs, and the epigenetic viral gene regulation of EBNA2 gene by Wp should be further defined possibly with other biological processes

  20. Difference in membrane repair capacity between cancer cell lines and a normal cell line

    Frandsen, Stine Krog; McNeil, Anna K.; Novak, Ivana

    2016-01-01

    repair was investigated by disrupting the plasma membrane using laser followed by monitoring fluorescent dye entry over time in seven cancer cell lines, an immortalized cell line, and a normal primary cell line. The kinetics of repair in living cells can be directly recorded using this technique...... cancer cell lines (p immortalized cell line (p

  1. On line ultrasonic integrated backscatter

    Landini, L.; Picano, E.; Mazzarisi, A.; Santarelli, F.; Benassi, A.; De Pieri, G.

    1988-01-01

    A new equipment for on-line evaluation of index based on two-dimensional integrated backscatter from ultrasonic images is described. The new equipment is fully integrated into a B-mode ultrasonic apparatus which provides a simultaneous display of conventional information together with parameters of tissue characterization. The system has been tested with a backscattering model of microbubbles in polysaccharide solution, characterized by a physiological exponential time decay. An exponential fitting to the experimental data was performed which yielded r=0.95

  2. Integrated Glass Coating Manufacturing Line

    Brophy, Brenor [Enki Technology Inc., San Jose, CA (United States)

    2015-09-30

    This project aims to enable US module manufacturers to coat glass with Enki’s state of the art tunable functionalized AR coatings at the lowest possible cost and highest possible performance by encapsulating Enki’s coating process in an integrated tool that facilitates effective process improvement through metrology and data analysis for greater quality and performance while reducing footprint, operating and capital costs. The Phase 1 objective was a fully designed manufacturing line, including fully specified equipment ready for issue of purchase requisitions; a detailed economic justification based on market prices at the end of Phase 1 and projected manufacturing costs and a detailed deployment plan for the equipment.

  3. A contrario line segment detection

    von Gioi, Rafael Grompone

    2014-01-01

    The reliable detection of low-level image structures is an old and still challenging problem in computer vision. This?book leads a detailed tour through the LSD algorithm, a line segment detector designed to be fully automatic. Based on the a contrario framework, the algorithm works efficiently without the need of any parameter tuning. The design criteria are thoroughly explained and the algorithm's good and bad results are illustrated on real and synthetic images. The issues involved, as well as the strategies used, are common to many geometrical structure detection problems and some possible

  4. Radiative transfer in molecular lines

    Asensio Ramos, A.; Trujillo Bueno, J.; Cernicharo, J.

    2001-07-01

    The highly convergent iterative methods developed by Trujillo Bueno and Fabiani Bendicho (1995) for radiative transfer (RT) applications are generalized to spherical symmetry with velocity fields. These RT methods are based on Jacobi, Gauss-Seidel (GS), and SOR iteration and they form the basis of a new NLTE multilevel transfer code for atomic and molecular lines. The benchmark tests carried out so far are presented and discussed. The main aim is to develop a number of powerful RT tools for the theoretical interpretation of molecular spectra.

  5. Understanding broadband over power line

    Held, Gilbert

    2006-01-01

    Understanding Broadband over Power Line explores all aspects of the emerging technology that enables electric utilities to provide support for high-speed data communications via their power infrastructure. This book examines the two methods used to connect consumers and businesses to the Internet through the utility infrastructure: the existing electrical wiring of a home or office; and a wireless local area network (WLAN) access point.Written in a practical style that can be understood by network engineers and non-technologists alike, this volume offers tutorials on electric utility infrastru

  6. On-line nuclear orientation

    Krane, K.S.

    1990-01-01

    This grant has as its overall goal the pursuit of on-line nuclear orientation experiments for the purpose of eliciting details of nuclear structure from the decays of neutron-deficient nuclei, such as those produced by the Holifield Heavy-Ion Research Facility at Oak Ridge and extracted by the UNISOR Isotope Separator. This paper discusses: refrigerator development; the decay of 184 Au; the decay of 191 Hg to 191 Au; the decay of 189 Pt to 189 Ir; the decays of 109,111 Pd; the decay of 172 Er; and solid angle corrections

  7. On the relict recombination lines

    Bershtejn, I.N.; Bernshtejn, D.N.; Dubrovich, V.K.

    1977-01-01

    Accurate numerical calculation of intensities and profiles of hydrogen recombination lines of cosmological origin is made. Relie radiation distortions stipulated by recombination quantum release at the irrevocable recombination are investigated. Mean number calculation is given for guantums educing for one irrevocably-lost electron. The account is taken of the educed quantums interraction with matter. The main quantum-matter interrraction mechanisms are considered: electronic blow broadening; free-free, free-bound, bound-bound absorptions Recombination dynamics is investigated depending on hydrogen density and total density of all the matter kinds in the Universe

  8. Recent interstellar molecular line work

    Winnewisser, G.

    1975-01-01

    A summary of recent interstellar molecular line work is presented. Transitions of the following molecules have been detected in Sgr B2: Vinylcyanide, H 2 C 2 HCN, formic acid, HCOOH, dimethyl ether (CH 3 ) 2 O and isotopically labelled cyanoacetylene- 13 C,HC 13 CCN and HCC 13 CN. The data on cyanoacetylene give an upper limit to the abundance ratio 12 C/ 13 C of 36 +- 5. A short discussion of the interstellar chemistry leads to the conclusion that hydrocarbons such as acetylene, HCCH, ethylen, H 2 CCH 2 and ethane H 3 CCH 3 should be present in interstellar clouds. 13 refs

  9. Transient formation of forbidden lines

    Rosmej, F.B.; Rosmej, O.N.

    1996-01-01

    An explanation of anomalously long time scales in the transient formation of forbidden lines is proposed. The concept is based on a collisionally induced density dependence of the relaxation times of metastable level populations in transient plasma. Generalization leads to an incorporation of diffusion phenomena. We demonstrate this new concept for the simplest atomic system: the He-like isoelectronic sequence. A new interpretation of the observed long duration and anomalously high intensity of spin-forbidden emission in hot plasmas is given. (author)

  10. Walking at the drip line

    Bonaccorso, Angela

    2015-01-01

    Among exotic nuclei those at the drip line which are unstable against neutron emission are particularly interesting because they convey information on the nuclear force in the most extreme situations. Strictly speaking they are not ''nuclei'' but they exist thanks to long living resonances between a neutron and a bound ''core'' nucleus. Adding one more neutron they become bound and are called ''borromean''. Being particularly exotic they have attracted much attention in past years. One very challenging example is 13 Be whose level ordering has been discussed in a large number of papers in which it has been studied by transfer and fragmentation experiments, or it has been discussed theoretically. Although projectile fragmentation spectra show evident similarities, the interpretations of data all differ from each other. In this paper we argue that a way trough the problem could be to try to establish first, or at the same time, the quite elusive ''nature'' of the second s-state in the Beryllium isotopes with A=9-14. On the other hand there are other recent neutron removal experiments leading to nuclei unstable by one or more proton emissions, and thus somewhat mirror to borromean nuclei, performed with nuclei close to the proton drip line. It has been shown that by taking in coincidence all (charged) particles but the removed neutron, reconstructing the invariant mass and gating on the ground state peak, it is possible to obtain the longitudinal momentum distribution of the unbound ''core''. One can link it to the original wave function of the bound orbital and thus determine the initial neutron angular momentum from the shape of the distribution and the initial occupation probability from the absolute removal cross section. Then it is clear that modern experiments and theories are able to study unstable nuclei with the same degree of accuracy as stable nuclei. Such a

  11. Transient formation of forbidden lines

    Rosmej, F.B. [Bochum Univ., Ruhr (Germany). Inst. fuer Experimentalphysik V; Rosmej, O.N. [VNIIFTRI, Moscow Region (Russian Federation). MISDC

    1996-05-14

    An explanation of anomalously long time scales in the transient formation of forbidden lines is proposed. The concept is based on a collisionally induced density dependence of the relaxation times of metastable level populations in transient plasma. Generalization leads to an incorporation of diffusion phenomena. We demonstrate this new concept for the simplest atomic system: the He-like isoelectronic sequence. A new interpretation of the observed long duration and anomalously high intensity of spin-forbidden emission in hot plasmas is given. (author).

  12. On field line resonances of hydromagnetic Alfven waves in dipole magnetic field

    Chen, Liu; Cowley, S.C.

    1989-07-01

    Using the dipole magnetic field model, we have developed the theory of field line resonances of hydromagnetic Alfven waves in general magnetic field geometries. In this model, the Alfven speed thus varies both perpendicular and parallel to the magnetic field. Specifically, it is found that field line resonances do persist in the dipole model. The corresponding singular solutions near the resonant field lines as well as the natural definition of standing shear Alfven eigenfunctions have also been systematically derived. 11 refs

  13. Calculation of stresses in a rock mass and lining in stagewise face drivage

    Seryakov, VM; Zhamalova, BR

    2018-03-01

    Using the method of calculating mechanical state of a rock mass for the conditions of stagewise drivage of a production face in large cross-section excavations, the specific features of stress redistribution in lining of excavations are found. The zones of tensile stresses in the lining are detected. The authors discuss the influence of the initial stress state of rocks on the tension stress zones induced in the lining in course of the heading advance

  14. CORRECTION OF FAULTY LINES IN MUSCLE MODEL, TO BE USED IN 3D BUILDING NETWORK CONSTRUCTION

    I. R. Karas

    2012-07-01

    Full Text Available This paper describes the usage of MUSCLE (Multidirectional Scanning for Line Extraction Model for automatic generation of 3D networks in CityGML format (from raster floor plans. MUSCLE (Multidirectional Scanning for Line Extraction Model is a conversion method which was developed to vectorize the straight lines through the raster images including floor plans, maps for GIS, architectural drawings, and machine plans. The model allows user to define specific criteria which are crucial for acquiring the vectorization process. Unlike traditional vectorization process, this model generates straight lines based on a line thinning algorithm, without performing line following-chain coding and vector reduction stages. In this method the nearly vertical lines were obtained by scanning the images horizontally, while the nearly horizontal lines were obtained by scanning the images vertically. In a case where two or more consecutive lines are nearly horizontal or nearly vertical, raster data become unmanageable and the process generates wrongly vectorized lines. In this situation, to obtain the precise lines, the image with the wrongly vectorized lines is diagonally scanned. By using MUSCLE model, the network models are topologically structured in CityGML format. After the generation process, it is possible to perform 3D network analysis based on these models. Then, by using the software that was designed based on the generated models, a geodatabase of the models could be established. This paper presents the correction application in MUSCLE and explains 3D network construction in detail.

  15. Experiences with effects specifications

    Simonsen, Jesper; Hertzum, Morten; Barlach, Anders

    2011-01-01

    We describe the effects-specification process from a project that was conducted during the fall 2010 and spring of 2011 in this chapter. The project configured and implemented an electronic patient record system at a maternity ward at a hospital located in a European region. The process comprised...... workshops with effects specification with management and end-users and an agile development process including prototypes configured from the effects specifications. We describe the project and the effects-specification process through which effects were related to the system design and instruments...... for measuring effects were designed. The project is analyzed and lessons learned are discussed....

  16. service line analytics in the new era.

    Spence, Jay; Seargeant, Dan

    2015-08-01

    To succeed under the value-based business model, hospitals and health systems require effective service line analytics that combine inpatient and outpatient data and that incorporate quality metrics for evaluating clinical operations. When developing a framework for collection, analysis, and dissemination of service line data, healthcare organizations should focus on five key aspects of effective service line analytics: Updated service line definitions. Ability to analyze and trend service line net patient revenues by payment source. Access to accurate service line cost information across multiple dimensions with drill-through capabilities. Ability to redesign key reports based on changing requirements. Clear assignment of accountability.

  17. Identification of a novel rhabdovirus in Spodoptera frugiperda cell lines.

    Ma, Hailun; Galvin, Teresa A; Glasner, Dustin R; Shaheduzzaman, Syed; Khan, Arifa S

    2014-06-01

    The Sf9 cell line, derived from Spodoptera frugiperda, is used as a cell substrate for biological products, and no viruses have been reported in this cell line after extensive testing. We used degenerate PCR assays and massively parallel sequencing (MPS) to identify a novel RNA virus belonging to the order Mononegavirales in Sf9 cells. Sequence analysis of the assembled virus genome showed the presence of five open reading frames (ORFs) corresponding to the genes for the N, P, M, G, and L proteins in other rhabdoviruses and an unknown ORF of 111 amino acids located between the G- and L-protein genes. BLAST searches indicated that the S. frugiperda rhabdovirus (Sf-rhabdovirus) was related in a limited region of the L-protein gene to Taastrup virus, a newly discovered member of the Mononegavirales from a leafhopper (Hemiptera), and also to plant rhabdoviruses, particularly in the genus Cytorhabdovirus. Phylogenetic analysis of sequences in the L-protein gene indicated that Sf-rhabdovirus is a novel virus that branched with Taastrup virus. Rhabdovirus morphology was confirmed by transmission electron microscopy of filtered supernatant samples from Sf9 cells. Infectivity studies indicated potential transient infection by Sf-rhabdovirus in other insect cell lines, but there was no evidence of entry or virus replication in human cell lines. Sf-rhabdovirus sequences were also found in the Sf21 parental cell line of Sf9 cells but not in other insect cell lines, such as BT1-TN-5B1-4 (Tn5; High Five) cells and Schneider's Drosophila line 2 [D.Mel.(2); SL2] cells, indicating a species-specific infection. The results indicate that conventional methods may be complemented by state-of-the-art technologies with extensive bioinformatics analysis for identification of novel viruses. The Spodoptera frugiperda Sf9 cell line is used as a cell substrate for the development and manufacture of biological products. Extensive testing has not previously identified any viruses in this cell

  18. Directional Selection for Specific Sheep Cell Antibody Responses Affects Natural Rabbit Agglutinins of Chickens

    Cotter, P.F.; Ayoub, J.; Parmentier, H.K.

    2005-01-01

    Agglutination data from generations 8 through 19 indicate that bidirectional selection for specific SRBC antibody responses was successful in a line cross of ISA × Warren medium heavy layers. After 11 generations titers of the high SRBC selected line (H line) were nearly 1:32,000; those of the low

  19. Line selection in celestial masers

    Middleton, M.S.

    1978-09-01

    The primary themes of this work concern the applicability of the Cook (1975) filter mechanism to line selection in hydroxyl masers, and the question of whether interstellar hydroxyl, water, and silicon monoxide masers are saturated. Whether the Cook filter is operative in celestial masers has not thus far been decided, even though it has been shown that such an effect might be occurring. The theory in its present form does not account for line broadening, nor have its consequences with regard to microwave maser emission from excited states of hydroxyl been explored. Both these topics are discussed and the findings are compared with the observations of NGC 6334A, a source which is interesting because of the strong evidence for Zeeman splitting which can be seen in some of its observed spectra. The question of whether interstellar masers are saturated has been much discussed, but a simple method for determining the state of saturation of observed masers does not exist. In particular, the importance of background radiation and of different cloud geometries on the state of saturation of interstellar masers up to now has not been fully appreciated. Both these topics are discussed. (author)

  20. Isotopic meteoric line for Colombia

    Rodriguez N, Cesar O

    2004-01-01

    Isotope analyses from representative rainfall samples taken from different areas in Colombia were processed to yield the meteoric line. Stable isotope composition in precipitation reflects the effects of temperature, altitude and of the continental site, being affected by different sources of atmospheric humidity over the Colombian territory. There is a seasonal variation in isotopic composition of precipitation with grater σ deviation during the rainy season and lower values in the dry season. In coastal areas the variation is smaller and is more pronounced than at continental stations. Correlation between altitude and isotope content led to equations, which indicate, on a regional level, a change in isotopic composition with altitude, of about 0.5 σ units per 200 m, for O 18 and 4 σ units per 200 m for H 2 . Such equations may be used to identify the original altitude of precipitation water, in hydrological surface and groundwater studies. Meteoric line and the concepts derived from the resulting equations presented in this paper may be applied to the interpretation of isotope analysis in future hydrological studies, particularly in areas without available data