International Nuclear Information System (INIS)
Cerquetti, Lidia; Sampaoli, Camilla; Amendola, Donatella; Bucci, Barbara; Masuelli, Laura; Marchese, Rodolfo; Misiti, Silvia; De Venanzi, Agostino; Poggi, Maurizio; Toscano, Vincenzo; Stigliano, Antonio
2011-01-01
Thiazolidinediones, specific peroxisome proliferator-activated receptor-γ (PPAR-γ) ligands, used in type-2 diabetes therapy, show favourable effects in several cancer cells. In this study we demonstrate that the growth of H295R and SW13 adrenocortical cancer cells is inhibited by rosiglitazone, a thiazolidinediones member, even though the mechanisms underlying this effect appeared to be cell-specific. Treatment with GW9662, a selective PPAR-γ-inhibitor, showed that rosiglitazone acts through both PPAR-γ-dependent and -independent mechanisms in H295R, while in SW13 cells the effect seems to be independent of PPAR-γ. H295R cells treated with rosiglitazone undergo an autophagic process, leading to morphological changes detectable by electron microscopy and an increased expression of specific proteins such as AMPKα and beclin-1. The autophagy seems to be independent of PPAR-γ activation and could be related to an increase in oxidative stress mediated by reactive oxygen species production with the disruption of the mitochondrial membrane potential, triggered by rosiglitazone. In SW13 cells, flow cytometry analysis showed an arrest in the G0/G1 phase of the cell cycle with a decrease of cyclin E and cdk2 activity, following the administration of rosiglitazone. Our data show the potential role of rosiglitazone in the therapeutic approach to adrenocortical carcinoma and indicate the molecular mechanisms at the base of its antiproliferative effects, which appear to be manifold and cell-specific in adrenocortical cancer lines.
Energy Technology Data Exchange (ETDEWEB)
Cerquetti, Lidia; Sampaoli, Camilla [Endocrinology, Department of Clinical and Molecular Medicine, Sant' Andrea Hospital, Faculty of Medicine and Psychology ' Sapienza' University of Rome, Via di Grottarossa, 1035-00189 Rome (Italy); Research Center S. Pietro Hospital, Via Cassia, 600-00189 Rome (Italy); Amendola, Donatella; Bucci, Barbara [Research Center S. Pietro Hospital, Via Cassia, 600-00189 Rome (Italy); Masuelli, Laura [Department of Experimental Medicine, ' Sapienza' University of Rome, Rome (Italy); Marchese, Rodolfo [Research Center S. Pietro Hospital, Via Cassia, 600-00189 Rome (Italy); Misiti, Silvia [Endocrinology, Department of Clinical and Molecular Medicine, Sant' Andrea Hospital, Faculty of Medicine and Psychology ' Sapienza' University of Rome, Via di Grottarossa, 1035-00189 Rome (Italy); Research Center S. Pietro Hospital, Via Cassia, 600-00189 Rome (Italy); De Venanzi, Agostino; Poggi, Maurizio; Toscano, Vincenzo [Endocrinology, Department of Clinical and Molecular Medicine, Sant' Andrea Hospital, Faculty of Medicine and Psychology ' Sapienza' University of Rome, Via di Grottarossa, 1035-00189 Rome (Italy); Stigliano, Antonio, E-mail: antonio.stigliano@uniroma1.it [Endocrinology, Department of Clinical and Molecular Medicine, Sant' Andrea Hospital, Faculty of Medicine and Psychology ' Sapienza' University of Rome, Via di Grottarossa, 1035-00189 Rome (Italy); Research Center S. Pietro Hospital, Via Cassia, 600-00189 Rome (Italy)
2011-06-10
Thiazolidinediones, specific peroxisome proliferator-activated receptor-{gamma} (PPAR-{gamma}) ligands, used in type-2 diabetes therapy, show favourable effects in several cancer cells. In this study we demonstrate that the growth of H295R and SW13 adrenocortical cancer cells is inhibited by rosiglitazone, a thiazolidinediones member, even though the mechanisms underlying this effect appeared to be cell-specific. Treatment with GW9662, a selective PPAR-{gamma}-inhibitor, showed that rosiglitazone acts through both PPAR-{gamma}-dependent and -independent mechanisms in H295R, while in SW13 cells the effect seems to be independent of PPAR-{gamma}. H295R cells treated with rosiglitazone undergo an autophagic process, leading to morphological changes detectable by electron microscopy and an increased expression of specific proteins such as AMPK{alpha} and beclin-1. The autophagy seems to be independent of PPAR-{gamma} activation and could be related to an increase in oxidative stress mediated by reactive oxygen species production with the disruption of the mitochondrial membrane potential, triggered by rosiglitazone. In SW13 cells, flow cytometry analysis showed an arrest in the G0/G1 phase of the cell cycle with a decrease of cyclin E and cdk2 activity, following the administration of rosiglitazone. Our data show the potential role of rosiglitazone in the therapeutic approach to adrenocortical carcinoma and indicate the molecular mechanisms at the base of its antiproliferative effects, which appear to be manifold and cell-specific in adrenocortical cancer lines.
Rosiglitazone, myocardial ischemic risk, and recent regulatory actions.
Bourg, Catherine A; Phillips, Beth Bryles
2012-02-01
To review the evidence surrounding rosiglitazone and ischemic cardiovascular risk and discuss the Food and Drug Administration (FDA) decision to revise safety information and restrict access to the drug. A literature search was conducted through MEDLINE (1950-January 2012), PubMed (1966-January 2012), and International Pharmaceutical Abstracts (1970-December 2011) using the search terms rosiglitazone and cardiovascular risk. Regulatory documents from the FDA and the Center for Drug Evaluation and Research, as well as reference citations from publications identified, were reviewed. All articles in English identified from the data sources were evaluated for inclusion. Literature regarding rosiglitazone and ischemic cardiovascular risk has shown inconsistent results. Meta-analyses by the FDA, GlaxoSmithKline, and several independent research groups suggest an increased risk for myocardial infarction (MI), while others have not. Long-term, controlled trials not designed to evaluate cardiovascular outcomes did not find a significant increase in cardiovascular events and had low event rates overall. The RECORD (Rosiglitazone Evaluated for Cardiovascular Outcomes in Oral Agent Combination Therapy for Type 2 Diabetes) trial is the only prospective randomized trial to date designed to evaluate cardiovascular outcomes of rosiglitazone; the results were limited because of issues with study design and event adjudication. The only direct comparisons between rosiglitazone and pioglitazone are observational studies in which pioglitazone had a more favorable MI risk profile. Data involving rosiglitazone and an association with ischemic cardiovascular risk have yielded variable results. The FDA made the decision to restrict access to rosiglitazone in September 2010 by requiring GlaxoSmithKline to submit a risk evaluation and mitigation strategy (REMS). Drug labeling was revised in February 2011, and the rosiglitazone REMS program took full effect in November 2011.
Cross, J T; Veenstra, D L; Gardner, J S; Garrison, L P
2011-03-01
Rosiglitazone was initially approved for type 2 diabetes monotherapy. We tested health-outcomes modeling as an aid to regulatory decision making by quantifying the incremental net benefit (INB) value of rosiglitazone (relative to a comparator), both at the time of first approval (1999) and at the FDA advisory committee review (2007). Using 1999 data, rosiglitazone was projected to provide an additional 0.639 years of life (0.373 quality-adjusted life years (QALYs)) relative to placebo but a loss of 0.312 years (0.173 QALYs) relative to glyburide, with uncertainty in reduction of hemoglobin A(1c) (HbA(1c)) level having the greatest impact on the benefit-risk profile. By 2007, rosiglitazone was projected to provide an additional 0.222 years (0.091 QALYs) vs. glyburide and 0.026 years vs. metformin (0.009 QALYs). Modeling suggested that the use of rosiglitazone as monotherapy was not initially warranted, given the uncertainty with regard to benefit. Despite similar net benefit (NB) as metformin shown in postmarketing data, residual cardiovascular (CV) concerns did not support the use of rosiglitazone as first-line therapy. We adapted a mathematical diabetes model to estimate NB and uncertainty of diabetes monotherapy.
The rosiglitazone decision process at FDA and EMA : What should we learn?
Pouwels, Koen B.; van Grootheest, Kees
2012-01-01
In September 2010 the EMA decided to suspend the market authorisation of rosiglitazone, while the FDA decided to restrict the use of rosiglitazone. These actions were taken approximately 10 years after the introduction of rosiglitazone, because rosiglitazone might be associated with an increased
Possible modulation of the antidiabetic effect of rosiglitazone by buspirone
Directory of Open Access Journals (Sweden)
Wafaa R. Mohamed
2012-06-01
Full Text Available Diabetes mellitus (DM is a group of metabolic disorders characterized by chronic hyperglycemia resulting from relative or absolute insulin deficiency with or without insulin resistance. As anxiolytics may have influence on glycemic control in diabetics, the present study was conducted to investigate the possible influence of buspirone in streptozotocin-induced DM and its possible interactions with rosiglitazone, an insulin sensitizer. Diabetes was induced by streptozotocin (50 mg/kg i.p.. Rats were classified into five groups namely: normal control, diabetic control, rosiglitazone (10 mg/kg p.o., buspirone (20 mg/kg i.p. or combination of both rosiglitazone and buspirone, respectively. All groups received daily treatments for 2 weeks after induction of DM including the normal group which received 1% Tween 80. There was no significant interaction between rosiglitazone and buspirone on the levels of serum glucose, insulin and C-peptide or liver glycogen content. Similarly, no interaction was observed between rosiglitazone and buspirone on oxidative stress parameters including serum malondialdehyde and blood glutathione levels or blood superoxide dismutase activity. In conclusion, the present study revealed that co-administration of buspirone with rosiglitazone does not produce serious reactions and buspirone can be safely administered as an anxiolytic in diabetic patients treated with rosiglitazone.
Rosiglitazone attenuates pulmonary fibrosis and radiation-induced intestinal damage
International Nuclear Information System (INIS)
Mangoni, M.; Gerini, C.; Sottili, M.; Cassani, S.; Stefania, G.; Biti, G.; Castiglione, F.; Vanzi, E.; Bottoncetti, A.; Pupi, A.
2011-01-01
Full text of publication follows: Purpose.-The aim of the study was to evaluate radioprotective effect of rosiglitazone (RGZ) on a murine model of late pulmonary damage and of acute intestinal damage. Methods.- Lung fibrosis: C57 mice were treated with the radiomimetic agent bleomycin, with or without rosiglitazone (5 mg/kg/day). To obtain an independent qualitative and quantitative measure for lung fibrosis we used high resolution CT, performed twice a week during the entire observation period. Hounsfield Units (HU) of section slides from the upper and lower lung region were determined. On day 31 lungs were collected for histological analysis. Acute intestinal damage: mice underwent 12 Gy total body irradiation with or without rosiglitazone. Mice were sacrificed 24 or 72 h after total body irradiation and ileum and colon were collected. Results.- Lung fibrosis: after bleomycin treatment, mice showed typical CT features of lung fibrosis, including irregular septal thickening and patchy peripheral reticular abnormalities. Accordingly, HU lung density was dramatically increased. Rosiglitazone markedly attenuated the radiological signs of fibrosis and strongly inhibited HU lung density increase (60% inhibition at the end of the observation period). Histological analysis revealed that in bleomycin-treated mice, fibrosis involved 50-55% of pulmonary parenchyma and caused an alteration of the alveolar structures in 10% of parenchyma, while in rosiglitazone-treated mice, fibrosis involved only 20-25% of pulmonary parenchyma, without alterations of the alveolar structures. Acute intestinal damage: 24 h after 12 Gy of total body irradiation intestinal mucosa showed villi shortening, mucosal thickness and crypt necrotic changes. Rosiglitazone showed a histological improvement of tissue structure, with villi and crypts normalization and oedema reduction. Conclusion.- These results demonstrate that rosiglitazone displays a protective effect on pulmonary fibrosis and radiation
Rosiglitazone attenuates pulmonary fibrosis and radiation-induced intestinal damage
Energy Technology Data Exchange (ETDEWEB)
Mangoni, M.; Gerini, C.; Sottili, M.; Cassani, S.; Stefania, G.; Biti, G. [Radiotherapy Unit, Clinical Physiopathology Department, University of Florence, Firenze (Italy); Castiglione, F. [Department of Human Pathology and Oncology, University of Florence, Firenze (Italy); Vanzi, E.; Bottoncetti, A.; Pupi, A. [Nuclear Medicine Unit, Clinical Physiopathology Department, University of Florence, Firenze (Italy)
2011-10-15
Full text of publication follows: Purpose.-The aim of the study was to evaluate radioprotective effect of rosiglitazone (RGZ) on a murine model of late pulmonary damage and of acute intestinal damage. Methods.- Lung fibrosis: C57 mice were treated with the radiomimetic agent bleomycin, with or without rosiglitazone (5 mg/kg/day). To obtain an independent qualitative and quantitative measure for lung fibrosis we used high resolution CT, performed twice a week during the entire observation period. Hounsfield Units (HU) of section slides from the upper and lower lung region were determined. On day 31 lungs were collected for histological analysis. Acute intestinal damage: mice underwent 12 Gy total body irradiation with or without rosiglitazone. Mice were sacrificed 24 or 72 h after total body irradiation and ileum and colon were collected. Results.- Lung fibrosis: after bleomycin treatment, mice showed typical CT features of lung fibrosis, including irregular septal thickening and patchy peripheral reticular abnormalities. Accordingly, HU lung density was dramatically increased. Rosiglitazone markedly attenuated the radiological signs of fibrosis and strongly inhibited HU lung density increase (60% inhibition at the end of the observation period). Histological analysis revealed that in bleomycin-treated mice, fibrosis involved 50-55% of pulmonary parenchyma and caused an alteration of the alveolar structures in 10% of parenchyma, while in rosiglitazone-treated mice, fibrosis involved only 20-25% of pulmonary parenchyma, without alterations of the alveolar structures. Acute intestinal damage: 24 h after 12 Gy of total body irradiation intestinal mucosa showed villi shortening, mucosal thickness and crypt necrotic changes. Rosiglitazone showed a histological improvement of tissue structure, with villi and crypts normalization and oedema reduction. Conclusion.- These results demonstrate that rosiglitazone displays a protective effect on pulmonary fibrosis and radiation
Budget impact of rosiglitazone in type 2 diabetes
Directory of Open Access Journals (Sweden)
Orietta Zaniolo
2007-03-01
Full Text Available BACKGROUND: in type 2 diabetes, the maintenance of non-diabetic glycaemic levels has been shown to decrease the onset of long term complications and consequently their high management costs. In order to achieve and maintain normal blood glucose levels, lifestyle interventions are highly cost/effective, but require good compliance, strong motivation and efforts by the patients. For this reason, a majority of patients needs to start pharmacological therapy shortly after diagnosis. Rosiglitazone, an insulin-sensitising drug, is indicated for subjects with inadequate glycaemic control both as monotherapy, in those contraindicated to metformin, especially if overweight, and as combination therapy with metformin, sulphanilureas or both. OBJECTIVES: rosiglitazone offers clinical advantages over the alternatives, decreasing and/or postponing the need for insulin treatment. Its high acquisition cost may therefore be totally or partially offset by the reduction in future health care resources consumption, and by short-term practical advantages, such as the decrease in the need for blood glucose monitoring and of adverse events. Aim of this study was to investigate the impact of the use of rosiglitazone in eligible diabetic patients on the National Health System budget. METHODS: for this scope an analytic model was implemented, which pathway may be summarized as follows: a estimate of the number type 2 diabetes patients living in Italy, grouped according to current therapeutic classes; b estimate of the number of patients with inadequate glycaemic control for each subgroup; c identification of patients eligible to rosiglitazone treatment; d identification of the comparator strategy for each patient sub-group; e comparison of costs for each couple of alternative options; f calculation of budget impact. RESULTS: use of rosiglitazone monotherapy instead of sulphanilurea monotherapy induces a mild costs increase. Combination treatment with rosiglitazone added
Rosiglitazone attenuates inflammation and CA3 neuronal loss following traumatic brain injury in rats
International Nuclear Information System (INIS)
Liu, Hao; Rose, Marie E.; Culver, Sherman; Ma, Xiecheng; Dixon, C. Edward; Graham, Steven H.
2016-01-01
Rosiglitazone, a potent peroxisome proliferator-activated receptor (PPAR)-γ agonist, has been shown to confer neuroprotective effects in stroke and spinal cord injury, but its role in the traumatic brain injury (TBI) is still controversial. Using a controlled cortical impact model in rats, the current study was designed to determine the effects of rosiglitazone treatment (6 mg/kg at 5 min, 6 h and 24 h post injury) upon inflammation and histological outcome at 21 d after TBI. In addition, the effects of rosiglitazone upon inflammatory cytokine transcription, vestibulomotor behavior and spatial memory function were determined at earlier time points (24 h, 1–5 d, 14–20 d post injury, respectively). Compared with the vehicle-treated group, rosiglitazone treatment suppressed production of TNFα at 24 h after TBI, attenuated activation of microglia/macrophages and increased survival of CA3 neurons but had no effect on lesion volume at 21 d after TBI. Rosiglitazone-treated animals had improved performance on beam balance testing, but there was no difference in spatial memory function as determined by Morris water maze. In summary, this study indicates that rosiglitazone treatment in the first 24 h after TBI has limited anti-inflammatory and neuroprotective effects in rat traumatic injury. Further study using an alternative dosage paradigm and more sensitive behavioral testing may be warranted. - Highlights: • Effects of rosiglitazone after CCI were evaluated using a rat TBI model. • Rosiglitazone suppressed production of TNFα at 24 h after CCI. • Rosiglitazone inhibited microglial activation at 21 d after CCI. • Rosiglitazone increased survival of CA3 neurons at 21 d after CCI. • Rosiglitazone-treated animals had improved performance in beam balance testing.
Rosiglitazone attenuates inflammation and CA3 neuronal loss following traumatic brain injury in rats
Energy Technology Data Exchange (ETDEWEB)
Liu, Hao; Rose, Marie E. [Geriatric Research Educational and Clinical Center, V.A. Pittsburgh Healthcare System, PA (United States); Department of Neurology, University of Pittsburgh School of Medicine, PA (United States); Culver, Sherman; Ma, Xiecheng; Dixon, C. Edward [Geriatric Research Educational and Clinical Center, V.A. Pittsburgh Healthcare System, PA (United States); Department of Neurosurgery, University of Pittsburgh, PA 15216 (United States); Department of Critical Care Medicine, University of Pittsburgh, PA 15216 (United States); Graham, Steven H., E-mail: Steven.Graham@va.gov [Geriatric Research Educational and Clinical Center, V.A. Pittsburgh Healthcare System, PA (United States); Department of Neurology, University of Pittsburgh School of Medicine, PA (United States)
2016-04-15
Rosiglitazone, a potent peroxisome proliferator-activated receptor (PPAR)-γ agonist, has been shown to confer neuroprotective effects in stroke and spinal cord injury, but its role in the traumatic brain injury (TBI) is still controversial. Using a controlled cortical impact model in rats, the current study was designed to determine the effects of rosiglitazone treatment (6 mg/kg at 5 min, 6 h and 24 h post injury) upon inflammation and histological outcome at 21 d after TBI. In addition, the effects of rosiglitazone upon inflammatory cytokine transcription, vestibulomotor behavior and spatial memory function were determined at earlier time points (24 h, 1–5 d, 14–20 d post injury, respectively). Compared with the vehicle-treated group, rosiglitazone treatment suppressed production of TNFα at 24 h after TBI, attenuated activation of microglia/macrophages and increased survival of CA3 neurons but had no effect on lesion volume at 21 d after TBI. Rosiglitazone-treated animals had improved performance on beam balance testing, but there was no difference in spatial memory function as determined by Morris water maze. In summary, this study indicates that rosiglitazone treatment in the first 24 h after TBI has limited anti-inflammatory and neuroprotective effects in rat traumatic injury. Further study using an alternative dosage paradigm and more sensitive behavioral testing may be warranted. - Highlights: • Effects of rosiglitazone after CCI were evaluated using a rat TBI model. • Rosiglitazone suppressed production of TNFα at 24 h after CCI. • Rosiglitazone inhibited microglial activation at 21 d after CCI. • Rosiglitazone increased survival of CA3 neurons at 21 d after CCI. • Rosiglitazone-treated animals had improved performance in beam balance testing.
Directory of Open Access Journals (Sweden)
Uttam Singh Baghel
2012-10-01
Full Text Available Objective: The aim of present work was to develop a gradient RP-HPLC method for simultaneous analysis of rosiglitazone and gliclazide, in a tablet dosage form. Method: Chromatographic system was optimized using a hypersil C18 (250mm x 4.6mm, 5毺 m column with potassium dihydrogen phosphate (pH-7.0 and acetonitrile in the ratio of 60:40, as mobile phase, at a flow rate of 1.0 ml/min. Detection was carried out at 225 nm by a SPD-20A prominence UV/Vis detector. Result: Rosiglitazone and gliclazide were eluted with retention times of 17.36 and 7.06 min, respectively. Beer’s Lambert ’s Law was obeyed over the concentration ranges of 5 to 70 毺 g/ml and 2 to 12 毺 g/ml for rosiglitazone and gliclazide, respectively. Conclusion: The high recovery and low coefficients of variation confirm the suitability of the method for simultaneous analysis of both drugs in a tablets dosage form. Statistical analysis proves that the method is sensitive and significant for the analysis of rosiglitazone and gliclazide in pure and in pharmaceutical dosage form without any interference from the excipients. The method was validated in accordance with ICH guidelines. Validation revealed the method is specific, rapid, accurate, precise, reliable, and reproducible.
Rosiglitazone evaluated for cardiovascular outcomes--an interim analysis
DEFF Research Database (Denmark)
Home, Philip D; Pocock, Stuart J; Beck-Nielsen, Henning
2007-01-01
BACKGROUND: A recent meta-analysis raised concern regarding an increased risk of myocardial infarction and death from cardiovascular causes associated with rosiglitazone treatment of type 2 diabetes. METHODS: We conducted an unplanned interim analysis of a randomized, multicenter, open...... group). The primary end point was hospitalization or death from cardiovascular causes. RESULTS: Because the mean follow-up was only 3.75 years, our interim analysis had limited statistical power to detect treatment differences. A total of 217 patients in the rosiglitazone group and 202 patients...... in the control group had the adjudicated primary end point (hazard ratio, 1.08; 95% confidence interval [CI], 0.89 to 1.31). After the inclusion of end points pending adjudication, the hazard ratio was 1.11 (95% CI, 0.93 to 1.32). There were no statistically significant differences between the rosiglitazone...
El-Din, Mohie M K Sharaf; Attia, Khalid A M; Nassar, Mohamed W I; Kaddah, Mohamed M Y
2010-10-15
Two accurate, reliable, and highly sensitive spectrofluorimetric methods were developed for simultaneous determination of binary mixture gemfibrozil and rosiglitazone in human plasma without prior separation steps. The first method is based on synchronous fluorescence spectrometry using double scans. At Δλ=27nm, gemfibrozil yields detectable signal that is independent of the presence of rosiglitazone. Similarly, at Δλ=120nm the signal of rosiglitazone is not influenced by the presence of gemfibrozil. Signals at two wavelengths, 301 (Δλ=27nm) and 368nm (Δλ=120nm) vary linearly with gemfibrozil and rosiglitazone concentrations over the range 100-700ngmL(-1) (for gemfibrozil) and 20-140ngmL(-1) (for rosiglitazone), respectively. The limits of detection (LOD) were 2.3 and 2.72ngmL(-1) for gemfibrozil and rosiglitazone, respectively. The second method is based on the technique of simultaneous equations (Vierodt's method), in which 258nm was selected as the excitation wavelength. Two equations are constructed based on the fact that at ( λ(EM)₂=302 nm of gemfibrozil) and (λ(EM)₂=369 nm of rosiglitazone) the fluorescence of the mixture is the sum of the individual fluorescence of gemfibrozil and rosiglitazone. The limits of detection (LOD) were 28.1 and 23.63ngmL(-1) for gemfibrozil and rosiglitazone, respectively. The proposed methods were successfully applied for the determination of the two compounds in synthetic mixtures and in human plasma with a good recovery. Copyright © 2010 Elsevier B.V. All rights reserved.
Rosiglitazone protects human neuroblastoma SH-SY5Y cells against acetaldehyde-induced cytotoxicity
International Nuclear Information System (INIS)
Jung, Tae Woo; Lee, Ji Young; Shim, Wan Sub; Kang, Eun Seok; Kim, Soo Kyung; Ahn, Chul Woo; Lee, Hyun Chul; Cha, Bong Soo
2006-01-01
Acetaldehyde, an inhibitor of mitochondrial function, has been widely used as a neurotoxin because it elicits a severe Parkinson's disease-like syndrome with elevation of the intracellular reactive oxygen species level and apoptosis. Rosiglitazone, a peroxisome proliferator-activated receptor-γ agonist, has been known to show various non-hypoglycemic effects, including anti-inflammatory, anti-atherogenic, and anti-apoptotic. In this study, we investigated the protective effects of rosiglitazone on acetaldehyde-induced apoptosis in human neuroblastoma SH-SY5Y cells and attempted to examine its mechanism. Acetaldehyde-induced apoptosis was moderately reversed by rosiglitazone treatment. Our results suggest that the protective effects of rosiglitazone on acetaldehyde-induced apoptosis may be ascribed to ability to induce the expression of anti-oxidant enzymes and to regulate Bcl-2 and Bax expression. These data indicate that rosiglitazone may provide a useful therapeutic strategy for the prevention of progressive neurodegenerative disease such as Parkinson's disease
Insulinotropic and anti-inflammatory effects of rosiglitazone in experimental autoimmune diabetes.
Awara, Wageh M; el-Sisi, Alaa E; el-Refaei, Mohamed; el-Naa, Mona M; el-Desoky, Karima
2005-01-01
Cytokines and nitric oxide (NO) are involved in the pathogenesis of autoimmune diabetes mellitus (DM). Rosiglitazone is an insulin-sensitizing drug that is a ligand for the nuclear receptor peroxisome proliferator-activated receptor-gamma (PPAR-gamma). The anti-inflammatory and immunomodulating properties of PPAR-gamma have been documented. The aim of this study is to investigate the effectiveness of rosiglitazone in autoimmune DM and to clarify the possible mechanism(s) involved. Autoimmune DM was induced in adult male Balb/c mice by co-administration of cyclosporin A and multiple low doses of streptozotocin. Diabetic mice were treated daily with rosiglitazone (7 mg/kg, p.o.) for 21 days. Blood glucose level (BGL), serum insulin level and pancreatic levels of tumor necrosis factor-alpha (TNF-alpha), interferon-gamma (IFN-gamma) and NO were measured. Histopathological examination and immunohistochemical determination of CD4 and CD8 T lymphocytes in the pancreatic islets were performed. In addition, analysis of pancreatic protein expression was carried out. The results showed that rosiglitazone treatment resulted in a significant decrease in the BGL and the pancreatic levels of TNF-alpha, IFN-gamma and NO compared to diabetic mice. The serum insulin level was significantly increased after rosiglitazone treatment compared to diabetic mice. The destroyed pancreatic islets were regenerated and became free from both CD4 and CD8 T cells after treatment. Furthermore, many changes in pancreatic protein expression were observed. These results suggest that rosiglitazone has a beneficial effect in the treatment of autoimmune diabetes, an effect that seemed to be a secondary consequence of its anti-inflammatory and immunomodulating properties and might be reflected at the level of protein expression.
Asp, Michelle L; Tian, Min; Kliewer, Kara L; Belury, Martha A
2011-12-01
Cachexia is characterized by severe weight loss, including adipose and muscle wasting, and occurs in a large percentage of cancer patients. Insulin resistance contributes to dysregulated metabolism in cachexia and occurs prior to weight loss in mice with colon-26 tumor-induced cachexia. Therefore, we hypothesized that the insulin sensitizer, rosiglitazone, would attenuate the loss of adipose and muscle to result in improved outcomes for mice with late-stage cachexia. Male CD2F1 mice were inoculated with colon-26 adenocarcinoma cells or vehicle. Treatments included vehicle, rosiglitazone (10 mg/kg body weight/day) or rosiglitazone plus pair-feeding to food intake of vehicle-treated mice with tumors. Rosiglitazone delayed weight loss onset by 2 d over the 16 d duration of this aggressive tumor model. This finding was associated, in part, with increased food intake. In addition, adipose mass, adipocyte cross-sectional area and inflammation were improved with rosiglitazone. However, at the time of necropsy 16 d after tumor inoculation rosiglitazone had no effect on retention of muscle mass, strength or proteolysis in late-stage cachexia. We did not measure stamina or endurance in this study. In early-stage cachexia, rosiglitazone normalized PDK4 and PPAR-delta mRNA in quadriceps muscle and rescued the decrease in insulin-stimulated glucose disappearance in mice with tumors. Rosiglitazone may delay weight loss onset by decreasing tumor-induced markers of metabolic change in early-stage cachexia. These changes predict for modest improvement in adipose, but no improvement in muscle strength in late-stage cachexia.
DEFF Research Database (Denmark)
Pedersen, G.; Brynskov, Jørn
2010-01-01
and functional activity in human colonic epithelium and explored the potential of topical treatment with rosiglitazone (a PPAR gamma ligand) in patients with ulcerative colitis. METHODS: Spontaneous and rosiglitazone-mediated PPAR gamma and adipophillin expression (a gene transcriptionally activated by PPAR...... for 14 days. RESULTS: PPAR gamma expression was fourfold reduced in epithelial cells from inflamed compared with uninflamed mucosa and controls. Adipophillin levels were decreased in parallel. Rosiglitazone induced a concentration-dependent increase in adipophillin levels and restored PPAR gamma activity...... in epithelial cells from inflamed mucosa in vitro. Rosiglitazone enema treatment was well tolerated and reduced the Mayo ulcerative colitis score from 8.9 to 4.3 (P levels in the epithelial cells of the patients, indicating PPAR...
International Nuclear Information System (INIS)
Morcos, N.Y.; Abdel-Ghaffar, A.B.; Osman, S.A.; Mohamed, M.Kh.; Arbid, M.S.; El-Eraky, W.I.
2012-01-01
Aim: The present study was designed to investigate the cardio protective effect of hesperidin and low dose γ- irradiation (LDR) against rosiglitazone cardiotoxicity. Experiment: Type 2 diabetes mellitus (T2DM) was induced in rats by single intraperitoneal injection of streptozotocin (STZ) followed by nicotinamide (NIC) (65 and 110 mg/kg b.wt, respectively). The diabetic rats were divided into 5 groups: untreated, LDR, LDR+ rosiglitazone, LDR + Hesperidin, LDR+ rosiglitazone + Hesperidin for one month, and blood and tissue samples were collected. Results: The diabetic rats showed elevated serum creatine kinase (CK-MB), lactate dehydrogenase (LDH), C-reactive protein (CRP), hyaluronidase activity, and reduced serum nitric oxide (NO) level, hematocrit % as well as final body weight, and pathological alterations in myocardial tissue. Treatment with LDR + rosiglitazone + Hesperidin ameliorated all these abnormalities approaching control levels. Conclusion: Results indicate the possible cardio protective role of hesperidin and LDR against rosiglitazone cardiotoxicity.
Rosiglitazone: a disappointing DREAM.
Nissen, Steven
2007-09-01
Dr Steven Nissen is a heart specialist and currently holds the position of chairman of cardiovascular medicine at the Cleveland Clinic, OH, USA. His work has involved the development of miniaturised ultrasound imaging devices that can be threaded into a patient's heart that allow measurement of the size and composition of plaques, which indicate early artery damage. The ability to characterize and measure the size of plaques provided a novel, effective method to evaluate the efficacy of anticholesterol medications, and for the past two decades Dr Nissen has been using these and other techniques to examine the efficacy of drugs. He has also developed a strong interest in drug safety. His work linked COX-2 inhibitors such as Celebrex and Vioxx (Merck, NJ, USA) with heart attacks, and prevented Merck's similar product, Arcoxia, from being approved. He also highlighted the serious heart attack risk associated with the experimental drug Pargluva and the drug was subsequently not approved by the US FDA. More recently, Dr Nissen's work has focused on the drug rosiglitazone, which was shown to have high cardiovascular risks and has since been given a FDA warning. Here, Dr Nissen discusses the publication of the rosiglitazone meta-analysis and why he considers work in this area to be crucially important for patients.
Directory of Open Access Journals (Sweden)
Shi-Bing Wong
Full Text Available Peroxisomal proliferator-activated receptor gamma (PPARγ is a nuclear hormone receptor whose agonist, rosiglitazone has a neuroprotective effect to hippocampal neurons in pilocarpine-induced seizures. Hippocampal slice preparations treated in Mg2+ free medium can induce ictal and interictal-like epileptiform discharges, which is regarded as an in vitro model of N-methyl-D-aspartate (NMDA receptor-mediated temporal lobe epilepsy (TLE. We applied rosiglitazone in hippocampal slices treated in Mg2+ free medium. The effects of rosiglitazone on hippocampal CA1-Schaffer collateral synaptic transmission were tested. We also examined the neuroprotective effect of rosiglitazone toward NMDA excitotoxicity on cultured hippocampal slices. Application of 10 μM rosiglitazone significantly suppressed amplitude and frequency of epileptiform discharges in CA1 neurons. Pretreatment with the PPARγ antagonist GW9662 did not block the effect of rosiglitazone on suppressing discharge frequency, but reverse the effect on suppressing discharge amplitude. Application of rosiglitazone suppressed synaptic transmission in the CA1-Schaffer collateral pathway. By miniature excitatory-potential synaptic current (mEPSC analysis, rosiglitazone significantly suppressed presynaptic neurotransmitter release. This phenomenon can be reversed by pretreating PPARγ antagonist GW9662. Also, rosiglitazone protected cultured hippocampal slices from NMDA-induced excitotoxicity. The protective effect of 10 μM rosiglitazone was partially antagonized by concomitant high dose GW9662 treatment, indicating that this effect is partially mediated by PPARγ receptors. In conclusion, rosiglitazone suppressed NMDA receptor-mediated epileptiform discharges by inhibition of presynaptic neurotransmitter release. Rosiglitazone protected hippocampal slice from NMDA excitotoxicity partially by PPARγ activation. We suggest that rosiglitazone could be a potential agent to treat patients with TLE.
Hruska, M W; Amico, J A; Langaee, T Y; Ferrell, R E; Fitzgerald, S M; Frye, R F
2005-01-01
Aims Rosiglitazone, a thiazolidinedione antidiabetic medication used in the treatment of Type 2 diabetes mellitus, is predominantly metabolized by the cytochrome P450 (CYP) enzyme CYP2C8. The anti-infective drug trimethoprim has been shown in vitro to be a selective inhibitor of CYP2C8. The purpose of this study was to evaluate the effect of trimethoprim on the CYP2C8 mediated metabolism of rosiglitazone in vivo and in vitro. Methods The effect of trimethoprim on the metabolism of rosiglitazone in vitro was assessed in pooled human liver microsomes. The effect in vivo was determined by evaluating rosiglitazone pharmacokinetics in the presence and absence of trimethoprim. Eight healthy subjects (four men and four women) completed a randomized, cross-over study. Subjects received single dose rosiglitazone (8 mg) in the presence and absence of trimethoprim 200 mg given twice daily for 5 days. Results Trimethoprim inhibited rosiglitazone metabolism both in vitro and in vivo. Inhibition of rosiglitazone para-hydroxylation by trimethoprim in vitro was found to be competitive with apparent Ki and IC50 values of 29 µm and 54.5 µm, respectively. In the presence of trimethoprim, rosiglitazone plasma AUC was increased by 31% (P = 0.01) from 2774 ± 645 µg l−1 h to 3643 ± 1051 µg l−1 h (95% confidence interval (Cl) for difference 189, 1549), and half-life was increased by 27% (P = 0.006) from 3.3 ± 0.5 to 4.2 ± 0.8 h (95% Cl for difference 0.36, 1.5). Trimethoprim reduced the para-O-sulphate rosiglitazone/rosiglitazone and the N-desmethylrosiglitazone/rosiglitazone AUC(0–24) ratios by 22% and 38%, respectively. Conclusions These results indicate that trimethoprim is a competitive inhibitor of CYP2C8-mediated rosiglitazone metabolism in vitro and that trimethoprim administration increases plasma rosiglitazone concentrations in healthy subjects. PMID:15606443
Simpson's paradox visualized: The example of the Rosiglitazone meta-analysis
Directory of Open Access Journals (Sweden)
Schumacher Martin
2008-05-01
Full Text Available Abstract Background Simpson's paradox is sometimes referred to in the areas of epidemiology and clinical research. It can also be found in meta-analysis of randomized clinical trials. However, though readers are able to recalculate examples from hypothetical as well as real data, they may have problems to easily figure where it emerges from. Method First, two kinds of plots are proposed to illustrate the phenomenon graphically, a scatter plot and a line graph. Subsequently, these can be overlaid, resulting in a overlay plot. The plots are applied to the recent large meta-analysis of adverse effects of rosiglitazone on myocardial infarction and to an example from the literature. A large set of meta-analyses is screened for further examples. Results As noted earlier by others, occurrence of Simpson's paradox in the meta-analytic setting, if present, is associated with imbalance of treatment arm size. This is well illustrated by the proposed plots. The rosiglitazone meta-analysis shows an effect reversion if all trials are pooled. In a sample of 157 meta-analyses, nine showed an effect reversion after pooling, though non-significant in all cases. Conclusion The plots give insight on how the imbalance of trial arm size works as a confounder, thus producing Simpson's paradox. Readers can see why meta-analytic methods must be used and what is wrong with simple pooling.
Pouwels, Koen; Van Grootheest, Kees
2013-01-01
The rosiglitazone decision process at FDA and EMA. What should we learn? In September 2010 the EMA decided to suspend the market authorisation of rosiglitazone while the FDA decided to restrict its use. These actions were taken because rosiglitazone had been associated with an increased risk of
International Nuclear Information System (INIS)
Escribano, Luis; Simon, Ana-Maria; Perez-Mediavilla, Alberto; Salazar-Colocho, Pablo; Rio, Joaquin Del; Frechilla, Diana
2009-01-01
Clinical trials with rosiglitazone, a potent agonist at peroxisome proliferator-activated receptor gamma (PPARγ) suggest an improvement of cognitive function in Alzheimer's disease (AD) patients. The mechanisms mediating this potential beneficial effect remain to be fully elucidated. In mice overexpressing mutant human amyloid precursor protein (hAPP), a model of AD, we found that memory impairment in the object recognition test was prevented and also reversed by chronic rosiglitazone treatment. Given the possible involvement of glucocorticoid receptors (GR) in the actions of PPARγ-ligands, we studied the effect of chronic rosiglitazone treatment on GR levels in the hippocampus of hAPP mice. An early down-regulation of GR, not related to elevated plasma corticosterone levels, was found in different hippocampal subfields of the transgenic mice and this decrease was prevented by rosiglitazone. In parallel with behavioural studies, rosiglitazone also normalized GR levels in older animals. This effect may contribute to explain the attenuation of memory decline by PPARγ activation in an AD mouse model.
Mamidi, Rao N V S; Benjamin, Biju; Ramesh, Mullangi; Srinivas, Nuggehally R
2003-09-01
To the best of our knowledge, bioanalytical methods to determine rosiglitazone in human plasma reported in literature use internal standards that are not commercially available. Our purpose was to develop a simple method for the determination of rosiglitazone in plasma employing a commercially available internal standard (IS). After the addition of celecoxib (IS), plasma (0.25 mL) samples were extracted into ethyl acetate. The residue after evaporation of the organic layer was dissolved in 750 microL of mobile phase and 50 microL was injected on to HPLC. The separation was achieved using a Hichrom KR 100, 250 x 4.6 mm C(18) with a mobile phase composition potassium dihydrogen phosphate buffer (0.01 m, pH 6.5):acetonitrile:methanol (40:50:10, v/v/v). The flow-rate of the mobile phase was set at 1 mL/min. The column eluate was monitored by fluorescence detector set at an excitation wavelength of 247 nm and emission wavelength of 367 nm. Linear relationships (r(2) > 0.99) were observed between the peak area ratio rosiglitazone to IS vs rosiglitazone concentrations across the concentration range 5-1000 ng/mL. The intra-run precision (%RSD) and accuracy (%Dev) in the measurement of rosiglitazone were 80% for both rosiglitazone and IS from human plasma. The lower limit of quantitation of the assay was 5 ng/mL. In summary, the methodology for rosiglitazone measurement in plasma was simple, sensitive and employed a commercially available IS. Copyright 2003 John Wiley & Sons, Ltd.
Sheu, Wayne H-H; Chuang, Hsiu-Chun; Cheng, Shiu-Min; Lee, Maw-Rong; Chou, Chi-Chi; Cheng, Fu-Chou
2011-03-25
Rosiglitazone is a potent synthetic peroxisome proliferator-activated receptor-gamma (PPAR-γ) agonist which improves glucose control in the plasma and reduces ischemic brain injury. However, the pharmacokinetics of rosiglitazone in the brain is still unclear. In this study, a method using liquid chromatography-mass spectrometry coupled with microdialysis and an auto-blood sampling system was developed to determine rosiglitazone and glucose concentration in the brain and blood of gerbils subjected to treatment with rosiglitazone (3.0 mg kg(-1), i.p.). The results showed the limit of detection was 0.04 μg L(-1) and the correlation coefficient was 0.9997 for the determination of rosiglitazone in the brain. The mean parameters, maximum drug concentration (C(max)) and the area under the concentration-time curve from time zero to time infinity (AUC(inf)), following rosiglitazone administration were 1.06±0.28 μg L(-1) and 296.82±44.67 μg min L(-1), respectively. The time to peak concentration (C(max) or T(max)) of rosiglitazone occurred at 105±17.10 min, and the mean elimination half-life (t(1/2)) from brain was 190.81±85.18 min after administration of rosiglitazone. The brain glucose levels decreased to 71% of the basal levels in the rosiglitazone-treated group when compared with those in the control (pblood glucose levels to 80% at 1h after pretreatment of rosiglitazone (pglucose concentrations in brain and plasma. Rosiglitazone was effective at penetrating the blood-brain barrier as evidenced by the rapid appearance of rosiglitazone in the brain, and rosiglitazone may contribute to a reduction in the extent of injuries related to cerebral ischemic stroke via its hypoglycemic effect. Copyright © 2010 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Atamer, Y. [Department of Medical Biochemistry, Faculty of Medicine, Dicle University, Diyarbakır (Turkey); Atamer, A. [Ministry of Health Haydarpaşa Numune Training and Research Hospital, Division of Gastroenterology, Department of Internal Medicine, Istanbul, Turkey, Division of Gastroenterology, Department of Internal Medicine, Ministry of Health Haydarpaşa Numune Training and Research Hospital, Istanbul (Turkey); Can, A.S. [Termal Professional School, Yalova University, Yalova (Turkey); Hekimoğlu, A. [Dicle University, Department of Pharmacology, Faculty of Medicine, Diyarbakir, Turkey, Department of Pharmacology, Faculty of Medicine, Dicle University, Diyarbakır (Turkey); Ilhan, N. [Firat University, Department of Medical Biochemistry, Faculty of Medicine, Elaziğ, Turkey, Department of Medical Biochemistry, Faculty of Medicine, Fırat University, Elazığ (Turkey); Yenice, N. [Division of Gastroenterology, Department of Internal Medicine, Faculty of Medicine, Harran University, Urfa (Turkey); Koçyiğit, Y. [Dicle University, Department of Physiology, Faculty of Medicine, Diyarbakir, Turkey, Department of Physiology, Faculty of Medicine, Dicle University, Diyarbakır (Turkey)
2013-06-25
Human serum paraoxonase contributes to the anti-atherogenic effect of high-density lipoprotein cholesterol (HDL-C) and has been shown to protect both low-density lipoprotein cholesterol (LDL-C) and HDL-C against lipid peroxidation. We investigated the effects of rosiglitazone on paraoxonase activity and metabolic parameters in patients with type 2 diabetes mellitus [50 patients (30 males, 20 females); mean±SD age: 58.7±9.2 years, body mass index: 28.2±4.1'kg/m{sup 2}], in whom glucose control could not be achieved despite treatment with metformin, sulphonylurea, and/or insulin. The patients were given 4'mg/day rosiglitazone for 3 months in addition to their usual treatment. Serum paraoxonase activity, malondialdehyde, homocysteine, and lipid profile were measured at the time of initiation and at the end of therapy with rosiglitazone. After rosiglitazone therapy, serum levels of HDL-C, apolipoprotein A-1, and paraoxonase activity increased significantly (P<0.05) and malondialdehyde, homocysteine, lipoprotein(a), and glucose levels decreased significantly (P<0.05), but no significant changes in levels of total cholesterol and apolipoprotein B were observed. Triglyceride levels also increased significantly (P<0.05). Rosiglitazone treatment led to an improvement in glycemic control and to an increase in paraoxonase activity and HDL-C levels. Although rosiglitazone showed favorable effects on oxidant/antioxidant balance and lipid profile, further studies are needed to determine the effect of rosiglitazone on cardiovascular risk factors and cardiovascular morbidity and mortality.
International Nuclear Information System (INIS)
Atamer, Y.; Atamer, A.; Can, A.S.; Hekimoğlu, A.; Ilhan, N.; Yenice, N.; Koçyiğit, Y.
2013-01-01
Human serum paraoxonase contributes to the anti-atherogenic effect of high-density lipoprotein cholesterol (HDL-C) and has been shown to protect both low-density lipoprotein cholesterol (LDL-C) and HDL-C against lipid peroxidation. We investigated the effects of rosiglitazone on paraoxonase activity and metabolic parameters in patients with type 2 diabetes mellitus [50 patients (30 males, 20 females); mean±SD age: 58.7±9.2 years, body mass index: 28.2±4.1'kg/m 2 ], in whom glucose control could not be achieved despite treatment with metformin, sulphonylurea, and/or insulin. The patients were given 4'mg/day rosiglitazone for 3 months in addition to their usual treatment. Serum paraoxonase activity, malondialdehyde, homocysteine, and lipid profile were measured at the time of initiation and at the end of therapy with rosiglitazone. After rosiglitazone therapy, serum levels of HDL-C, apolipoprotein A-1, and paraoxonase activity increased significantly (P<0.05) and malondialdehyde, homocysteine, lipoprotein(a), and glucose levels decreased significantly (P<0.05), but no significant changes in levels of total cholesterol and apolipoprotein B were observed. Triglyceride levels also increased significantly (P<0.05). Rosiglitazone treatment led to an improvement in glycemic control and to an increase in paraoxonase activity and HDL-C levels. Although rosiglitazone showed favorable effects on oxidant/antioxidant balance and lipid profile, further studies are needed to determine the effect of rosiglitazone on cardiovascular risk factors and cardiovascular morbidity and mortality
Mookkan, Jeyamurugan; De, Soumita; Shetty, Pranesha; Kulkarni, Nagaraj M; Devisingh, Vijayaraj; Jaji, Mallikarjun S; Lakshmi, Vinitha P; Chaudhary, Shilpee; Kulathingal, Jayanarayan; Rajesh, Navin B; Narayanan, Shridhar
2014-01-01
To evaluate the effect of vildagliptin alone and in combination with metformin or rosiglitazone on murine hepatic steatosis in diet-induced nonalcoholic fatty liver disease (NAFLD). Male C57BL/6 mice were fed with high fat diet (60 Kcal %) and fructose (40%) in drinking water for 60 days to induce NAFLD. After the induction period, animals were divided into different groups and treated with vildagliptin (10 mg/kg), metformin (350 mg/kg), rosiglitazone (10 mg/kg), vildagliptin (10 mg/kg) + metformin (350 mg/kg), or vildagliptin (10 mg/kg) + rosiglitazone (10 mg/kg) orally for 28 days. Following parameters were measured: body weight, food intake, plasma glucose, triglyceride (TG), total cholesterol, liver function tests, and liver TG. Liver histopathology was also examined. Oral administration of vildagliptin and rosiglitazone in combination showed a significant reduction in fasting plasma glucose, hepatic steatosis, and liver TGs. While other treatments showed less or no improvement in the measured parameters. These preliminary results demonstrate that administration of vildagliptin in combination with rosiglitazone could be a promising therapeutic strategy for the treatment of NAFLD.
International Nuclear Information System (INIS)
Wakui, Yuta; Inoue, Jun; Ueno, Yoshiyuki; Fukushima, Koji; Kondo, Yasuteru; Kakazu, Eiji; Obara, Noriyuki; Kimura, Osamu; Shimosegawa, Tooru
2010-01-01
Although chronic infection of hepatitis B virus (HBV) is currently managed with nucleot(s)ide analogues or interferon-α, the control of HBV infection still remains a clinical challenge. Peroxisome proliferator-activated receptor (PPAR) is a ligand-activated transcription factor, that plays a role in glucose and lipid metabolism, immune reactions, and inflammation. In this study, the suppressive effect of PPAR ligands on HBV replication was examined in vitro using a PPARα ligand, bezafibrate, and a PPARγ ligand, rosiglitazone. The effects were examined in HepG2 cells transfected with a plasmid containing 1.3-fold HBV genome. Whereas bezafibrate showed no effect against HBV replication, rosiglitazone reduced the amount of HBV DNA, hepatitis B surface antigen, and hepatitis B e antigen in the culture supernatant. Southern blot analysis showed that the replicative intermediates of HBV in the cells were also inhibited. It was confirmed that GW9662, an antagonist of PPARγ, reduced the suppressive effect of rosiglitazone on HBV. Moreover, rosiglitazone showed a synergistic effect on HBV replication with lamivudine or interferon-α-2b. In conclusion, this study showed that rosiglitazone inhibited the replication of HBV in vitro, and suggested that the combination therapy of rosiglitazone and nucleot(s)ide analogues or interferon could be a therapeutic option for chronic HBV infection.
Energy Technology Data Exchange (ETDEWEB)
Wakui, Yuta; Inoue, Jun [Division of Gastroenterology, Tohoku University Graduate School of Medicine, 1-1 Seiryo, Aobaku, Sendai 980-8574 (Japan); Ueno, Yoshiyuki, E-mail: yueno@mail.tains.tohoku.ac.jp [Division of Gastroenterology, Tohoku University Graduate School of Medicine, 1-1 Seiryo, Aobaku, Sendai 980-8574 (Japan); Fukushima, Koji; Kondo, Yasuteru; Kakazu, Eiji; Obara, Noriyuki; Kimura, Osamu; Shimosegawa, Tooru [Division of Gastroenterology, Tohoku University Graduate School of Medicine, 1-1 Seiryo, Aobaku, Sendai 980-8574 (Japan)
2010-05-28
Although chronic infection of hepatitis B virus (HBV) is currently managed with nucleot(s)ide analogues or interferon-{alpha}, the control of HBV infection still remains a clinical challenge. Peroxisome proliferator-activated receptor (PPAR) is a ligand-activated transcription factor, that plays a role in glucose and lipid metabolism, immune reactions, and inflammation. In this study, the suppressive effect of PPAR ligands on HBV replication was examined in vitro using a PPAR{alpha} ligand, bezafibrate, and a PPAR{gamma} ligand, rosiglitazone. The effects were examined in HepG2 cells transfected with a plasmid containing 1.3-fold HBV genome. Whereas bezafibrate showed no effect against HBV replication, rosiglitazone reduced the amount of HBV DNA, hepatitis B surface antigen, and hepatitis B e antigen in the culture supernatant. Southern blot analysis showed that the replicative intermediates of HBV in the cells were also inhibited. It was confirmed that GW9662, an antagonist of PPAR{gamma}, reduced the suppressive effect of rosiglitazone on HBV. Moreover, rosiglitazone showed a synergistic effect on HBV replication with lamivudine or interferon-{alpha}-2b. In conclusion, this study showed that rosiglitazone inhibited the replication of HBV in vitro, and suggested that the combination therapy of rosiglitazone and nucleot(s)ide analogues or interferon could be a therapeutic option for chronic HBV infection.
Prolonged effect of Rosiglitazone one year after discontinuation
DEFF Research Database (Denmark)
Gram-Kampmann, Eva-Marie; Olesen, Thomas Bastholm; Olsen, Michael Hecht
2015-01-01
: This study is a continuation of the two-year study SDDS, where 371 patients were randomized to eight groups and treated with Insulin aspart three times daily or NPH insulin once daily, metformin or placebo and Rosiglitazone or placebo, respectively. During a 12-month run-out, use of insulin was continued...... and oral antidiabetics/placebo was changed to 2000 mg of metformin a day. During the following four visits, insulin was adjusted according to a treat-to-target algoritm with avoidance of hypoglycemia. Resultater: After 12 months, there was no difference in HbA1c. As expected, in the group formerly...... receiving insulin and two times placebo, insulindose could be lowered after institution of metformin. Compared to the insulin, metformin and placebo-group, insulin dose was significantly lower in the insulin, rosiglitazone and placebo-group (56,9 IUvs 73,6IU, p =0,05) after 12 months. The Insulin...
Effect of Rosiglitazone on Radiation Damage in Bone Marrow Hemopoiesis
Benkő, Klára; Pintye, Éva; Szabó, Boglárka; Géresi, Krisztina; Megyeri, Attila; Benkő, Ilona
2008-12-01
To study radiobiological effects and drugs, which can modify radiation injury, has an importance if we would like to avoid harmful effects of radiation due to emergency situations or treat patients with malignant diseases by radiotherapy. During the long treatment schedules patients may be treated by not only anticancer but many other drugs because of accompanying diseases. These drugs may also modify radiobiological effects. Rosiglitazone pre-treatment proved to be myeloprotective and accelerated recovery of 5-fluorouracil-damaged bone marrow in our previous experiments. Our new studies are designed to evaluate whether rosiglitazone has similar beneficial effects in radiation-damaged hemopoiesis. Bone marrow damage was precipitated by total body irradiation (TBI) using single increasing doses (2-10 Gy) of γ—irradiation in groups of mice. Lethality was well correlated with damage in hemopoiesis measured by cellularity of bone marrow (LD50 values were 4.8 and 5.3 gray respectively). Rosiglitazone, an insulin-sensitizing drug, had no significant effect on bone marrow cellularity. Insulin resistance associated with obesity or diabetes mellitus type 2 is intensively growing among cancer patients requiring some kind of radiotherapy. Therefore it is important to know whether drugs used for their therapy can modify radiation effects.
Effect of Rosiglitazone on Radiation Damage in Bone Marrow Hemopoiesis
International Nuclear Information System (INIS)
Benko', Klara; Pintye, Eva; Szabo, Boglarka; Geresi, Krisztina; Megyeri, Attila; Benko, Ilona
2008-01-01
To study radiobiological effects and drugs, which can modify radiation injury, has an importance if we would like to avoid harmful effects of radiation due to emergency situations or treat patients with malignant diseases by radiotherapy. During the long treatment schedules patients may be treated by not only anticancer but many other drugs because of accompanying diseases. These drugs may also modify radiobiological effects. Rosiglitazone pre-treatment proved to be myeloprotective and accelerated recovery of 5-fluorouracil-damaged bone marrow in our previous experiments. Our new studies are designed to evaluate whether rosiglitazone has similar beneficial effects in radiation-damaged hemopoiesis. Bone marrow damage was precipitated by total body irradiation (TBI) using single increasing doses (2-10 Gy) of γ--irradiation in groups of mice. Lethality was well correlated with damage in hemopoiesis measured by cellularity of bone marrow (LD 50 values were 4.8 and 5.3 gray respectively). Rosiglitazone, an insulin-sensitizing drug, had no significant effect on bone marrow cellularity. Insulin resistance associated with obesity or diabetes mellitus type 2 is intensively growing among cancer patients requiring some kind of radiotherapy. Therefore it is important to know whether drugs used for their therapy can modify radiation effects.
Kahn, Steven E.; Lachin, John M.; Zinman, Bernard; Haffner, Steven M.; Aftring, R. Paul; Paul, Gitanjali; Kravitz, Barbara G.; Herman, William H.; Viberti, Giancarlo; Holman, Rury R.
2011-01-01
OBJECTIVE ADOPT (A Diabetes Outcome Progression Trial) demonstrated that initial monotherapy with rosiglitazone provided superior durability of glycemic control compared with metformin and glyburide in patients with recently diagnosed type 2 diabetes. Herein, we examine measures of β-cell function and insulin sensitivity from an oral glucose tolerance test (OGTT) over a 4-year period among the three treatments. RESEARCH DESIGN AND METHODS Recently diagnosed, drug-naïve patients with type 2 diabetes (4,360 total) were treated for a median of 4.0 years with rosiglitazone, metformin, or glyburide and were examined with periodic metabolic testing using an OGTT. RESULTS Measures of β-cell function and insulin sensitivity from an OGTT showed more favorable changes over time with rosiglitazone versus metformin or glyburide. Persistent improvements were seen in those who completed 4 years of monotherapy and marked deterioration of β-cell function in those who failed to maintain adequate glucose control with initial monotherapy. CONCLUSIONS The favorable combined changes in β-cell function and insulin sensitivity over time with rosiglitazone appear to be responsible for its superior glycemic durability over metformin and glyburide as initial monotherapy in type 2 diabetes. PMID:21415383
DEFF Research Database (Denmark)
Vestergaard, H; Lund, S; Pedersen, O
2001-01-01
Rosiglitazone, a thiazolidinedione (TZD), increases insulin sensitivity by reducing levels of plasma NEFA, triglycerides (TG), glucose and serum insulin. Rosiglitazone treatment decreases insulin resistance in type 2 diabetic patients, but no data exist concerning rosiglitazone treatment...
Leung, Vivien; Chiu, Ya-Lin; Kotler, Donald P.; Albu, Jeanine; Zhu, Yuan-Shan; Ham, Kirsis; Engelson, Ellen S.; Hammad, Hoda; Christos, Paul; Donovan, Daniel S.; Ginsberg, Henry N.; Glesby, Marshall J.
2016-01-01
Background/Objective In a previous report of HIV-infected patients with fat redistribution, we found that recombinant human growth hormone (rhGH) therapy reduced visceral adipose tissue (VAT) but increased insulin resistance, and that the addition of rosiglitazone reversed the negative effects of rhGH on insulin sensitivity. In this study, we sought to determine the effects of recombinant human growth hormone (rhGH) and rosiglitazone therapy on an array of inflammatory and fibrinolytic markers. Methods 72 patients with HIV-associated abdominal obesity and insulin resistance were randomized to treatment with rhGH, rosiglitazone, the combination of rhGH and rosiglitazone, or placebo for 12 weeks. Subjects with plasma and serum samples available at weeks 0 (n = 63) and 12 (n = 46-48) were assessed for adiponectin, C-reactive protein (CRP), homocysteine, interleukin-1 (IL-1), interleukin-6 (IL-6), tumor necrosis factor alpha (TNF-α), interferon gamma (IFN-γ), fibrinogen, plasminogen activator inhibitor-1 (PAI-1) antigen, and tissue plasminogen activator (tPA) antigen. Results Treatment with both rosiglitazone alone and the combination of rosiglitazone and rhGH for 12 weeks resulted in significant increases in adiponectin levels from baseline. Adiponectin levels did not change significantly in the rhGH alone arm. There were no significant changes in the other biomarkers amongst the different treatment groups. Discussion In this study of HIV-infected patients with altered fat distribution, treatment with rosiglitazone had beneficial effects on adiponectin concentrations, an effect that was also seen with combination rosiglitazone and rhGH. RhGH administration alone, however, did not demonstrate any significant impact on adiponectin levels despite reductions in VAT. PMID:27077672
Improvement in psoriasis with rosiglitazone in a diabetic and a nondiabetic patient.
Pershadsingh, Harrihar A; Benson, Steven C; Ellis, Charles N
2005-01-01
The authors conducted a prospective, open-label, pilot trial of the effects of the antidiabetic thiazolidinedione (TZD) rosiglitazone in two patients with moderate to severe plaque psoriasis. Case 1: A lean, euglycemic 43-year-old nondiabetic man with a 2-year history of plaque psoriasis presented with lesions involving 10% of his body surface (Figures 1A, 1B, 1C). He had no other chronic or acute medical problems. He had previously been managed sporadically with topical triamcinolone acetonide, an intermediate-strength glucocorticoid, and was off antipsoriatic medication for 5 months. He was started on rosiglitazone p.o., 8 mg q.d. After 10 weeks on rosiglitazone, the lesions developed increased erythema, spreading, and shedding of scale (Figures 2A, 2B, 2C). After an additional 26 weeks, the lesions had largely disappeared (Figures 3A, 3B, 3C). The patient remained euglycemic throughout the study. His liver function enzymes (alanine transferase [ALT] and aspartate transferase [AST]) remained normal throughout the study: ALT, 23 IU/L; AST, 47 IU/L before treatment; ALT, 25 IU/L; AST, 33 IU/L after treatment. There were no adverse events. Case 2: An overweight 68-year-old woman (body mass index, 29 kg/m2; with a 12-year history of type 2 diabetes and 5-year history of psoriasis presented with generalized plaque psoriasis over 20% of her body, including two large, thick, silvery plaques with the texture of leather over the lower part of the back (Figure 4A). She was given rosiglitazone p.o., 4 mg b.i.d. for 24 weeks, which resulted in significant improvement in psoriasis (Figure 4B). After an additional 26 weeks on rosiglitazone, the plaques had cleared on her back (Figure 4C) and over her entire body, including scalp, ears, and posterior forearms (not shown). Her glycemic control improved (hemoglobin A1c decreased from 7.7% to 7.2%) and liver function remained normal throughout the study (ALT, 24 IU/L; AST, 14 IU/L before treatment; and ALT, 26 IU/L; AST, 15 IU
Interactions of Rosiglitazone and Anti.Arrhythmic Drugs in Animal ...
African Journals Online (AJOL)
Interactions of Rosiglitazone and Anti.Arrhythmic Drugs in Animal Model. YM Mohammed, EI Mohammed, N Mohiuddin, SS Syeda. Abstract. Background: Diabetes increases the risk of vascular problems by two times compared with a healthy individual, with deposition of fats in blood vessel and this includes cardiovascular ...
Naderali, Mohammad M.; Itua, Imose; Abubakari, Abdul-Razak; Naderali, Ebrahim K.
2012-01-01
A number of preclinical and clinical studies have reported blood-pressure-lowering benefits of thiazolidinediones in diabetic subjects and animal models of diabetes. This study was designed to further elucidate vascular effects of rosiglitazone, on healthy nonobese, lean animals. Adult male Wistar rats were randomized and assigned to control and rosiglitazone-treated groups and were dosed daily with either vehicle or rosiglitazone (10 mg kg−1 day−1) by oral gavage for 5 days. Compared with co...
Macrophage PPARγ inhibits Gpr132 to mediate the anti-tumor effects of rosiglitazone
Cheng, Wing Yin; Huynh, HoangDinh; Chen, Peiwen; Peña-Llopis, Samuel; Wan, Yihong
2016-01-01
Tumor-associated macrophage (TAM) significantly contributes to cancer progression. Human cancer is enhanced by PPARγ loss-of-function mutations, but inhibited by PPARγ agonists such as TZD diabetes drugs including rosiglitazone. However, it remains enigmatic whether and how macrophage contributes to PPARγ tumor-suppressive functions. Here we report that macrophage PPARγ deletion in mice not only exacerbates mammary tumor development but also impairs the anti-tumor effects of rosiglitazone. Mechanistically, we identify Gpr132 as a novel direct PPARγ target in macrophage whose expression is enhanced by PPARγ loss but repressed by PPARγ activation. Functionally, macrophage Gpr132 is pro-inflammatory and pro-tumor. Genetic Gpr132 deletion not only retards inflammation and cancer growth but also abrogates the anti-tumor effects of PPARγ and rosiglitazone. Pharmacological Gpr132 inhibition significantly impedes mammary tumor malignancy. These findings uncover macrophage PPARγ and Gpr132 as critical TAM modulators, new cancer therapeutic targets, and essential mediators of TZD anti-cancer effects. DOI: http://dx.doi.org/10.7554/eLife.18501.001 PMID:27692066
Comparison of the effects of pioglitazone and rosiglitazone on macrophage foam cell formation
International Nuclear Information System (INIS)
Hirakata, Masao; Tozawa, Ryuichi; Imura, Yoshimi; Sugiyama, Yasuo
2004-01-01
In order to elucidate the antiatherogenic effects of pioglitazone (a peroxisome proliferator-activated receptor [PPAR]γ agonist with PPARα agonistic activity) and rosiglitazone (a more selective PPARγ agonist), we examined gene expression and cholesteryl ester accumulation in THP-1-derived macrophages. Pioglitazone enhanced the mRNA expression of the proatherogenic factors CD36 and adipophilin, but was approximately 10 times less potent than rosiglitazone. The potencies of the two agents appeared to correspond to their PPARγ agonistic activities in this respect. However, both agents were similarly potent in enhancing the mRNA expression of the antiatherogenic factors liver X receptor α and ATP-binding cassette-transporter A1. Furthermore, both agents enhanced cholesteryl ester hydrolase mRNA expression and inhibited acyl-CoA cholesterol acyltransferase-1 mRNA expression and cholesteryl ester accumulation in macrophages. In this respect, their potencies appeared to correspond to their PPARα agonistic activities. These results suggest that pioglitazone has an equally beneficial effect on antiatherogenic events to rosiglitazone, despite being almost 10 times less potent than a PPARγ agonist
International Nuclear Information System (INIS)
Jin, Gong Yong; Bok, Se Mi; Han, Young Min; Chung, Myung Ja; Yoon, Kwon-Ha; Kim, So Ri; Lee, Yong Chul
2012-01-01
Peroxisome proliferator-activated receptor-γ (PPARγ) agonists exhibit potent anti-fibrotic effects in the lung and other tissues. Recently, micro-computed tomography (CT) has been a useful tool for the investigation of lung diseases in small animals and is now increasingly applied to visualize and quantify the pulmonary structures. However, there is little information on the assessment for therapeutic effects of PPARγ agonists on the pulmonary fibrosis in mice using micro-CT. This study was aimed to determine the capability of micro-CT in examining the effects of rosiglitazone on pulmonary fibrosis. We used a murine model of bleomycin-induced lung fibrosis to evaluate the feasibility of micro-CT in evaluating the therapeutic potential of rosiglitazone on pulmonary fibrosis, comparing with pathologic scores. On micro-CT findings, ground glass opacity (80%) and consolidation (20%) were observed predominantly at 3 weeks after the instillation of bleomycin, and the radiologic features became more complex at 6 weeks. In bleomycin-instilled mice treated with rosiglitazone, the majority (80%) showed normal lung features on micro-CT. Radiological-pathologic correlation analyses revealed that ground glass opacity and consolidation were correlated closely with acute inflammation, while reticular opacity was well correlated with histological honeycomb appearance. These results demonstrate that rosiglitazone displays a protective effect on pulmonary fibrosis in mice and that the visualization of bleomycin-induced pulmonary fibrosis using micro-CT is satisfactory to assess the effects of rosiglitazone. It implies that micro-CT can be applied to evaluate therapeutic efficacies of a variety of candidate drugs for lung diseases.
Energy Technology Data Exchange (ETDEWEB)
Jin, Gong Yong; Bok, Se Mi; Han, Young Min [Department of Radiology, Chonbuk National University Medical School, Jeonju (Korea, Republic of); Chung, Myung Ja [Department of Pathology, Chonbuk National University Medical School, Jeonju (Korea, Republic of); Yoon, Kwon-Ha [Department of Radiology, Iksan Hospital, Iksan (Korea, Republic of); Kim, So Ri [Department of Internal Medicine and Research Center for Pulmonary Disorders, Chonbuk National University Medical School, Jeonju (Korea, Republic of); Lee, Yong Chul, E-mail: leeyc@jbnu.ac.kr [Department of Internal Medicine and Research Center for Pulmonary Disorders, Chonbuk National University Medical School, Jeonju (Korea, Republic of)
2012-08-15
Peroxisome proliferator-activated receptor-{gamma} (PPAR{gamma}) agonists exhibit potent anti-fibrotic effects in the lung and other tissues. Recently, micro-computed tomography (CT) has been a useful tool for the investigation of lung diseases in small animals and is now increasingly applied to visualize and quantify the pulmonary structures. However, there is little information on the assessment for therapeutic effects of PPAR{gamma} agonists on the pulmonary fibrosis in mice using micro-CT. This study was aimed to determine the capability of micro-CT in examining the effects of rosiglitazone on pulmonary fibrosis. We used a murine model of bleomycin-induced lung fibrosis to evaluate the feasibility of micro-CT in evaluating the therapeutic potential of rosiglitazone on pulmonary fibrosis, comparing with pathologic scores. On micro-CT findings, ground glass opacity (80%) and consolidation (20%) were observed predominantly at 3 weeks after the instillation of bleomycin, and the radiologic features became more complex at 6 weeks. In bleomycin-instilled mice treated with rosiglitazone, the majority (80%) showed normal lung features on micro-CT. Radiological-pathologic correlation analyses revealed that ground glass opacity and consolidation were correlated closely with acute inflammation, while reticular opacity was well correlated with histological honeycomb appearance. These results demonstrate that rosiglitazone displays a protective effect on pulmonary fibrosis in mice and that the visualization of bleomycin-induced pulmonary fibrosis using micro-CT is satisfactory to assess the effects of rosiglitazone. It implies that micro-CT can be applied to evaluate therapeutic efficacies of a variety of candidate drugs for lung diseases.
Rosiglitazone and Cardiovascular Risk – A Review | Isa | Bayero ...
African Journals Online (AJOL)
The thiazolidinediones (TZDs) are a class of oral drugs used for the management of type 2 diabetes mellitus and act as ligands for the transcription factor Peroxisome Proliferator-Activated Receptor gamma (PPARγ). Rosiglitazone, an example of TZD, is an anti-diabetic agent acting as a potent insulin sensitizer and is used ...
Shoghi, Kooresh I; Finck, Brian N; Schechtman, Kenneth B; Sharp, Terry; Herrero, Pilar; Gropler, Robert J; Welch, Michael J
2009-09-01
Cardiovascular disease is the leading cause of death among diabetic patients, with alteration in myocardial substrate metabolism being a likely contributor. We aimed to assess noninvasively the efficacy of metformin and rosiglitazone monotherapy in normalizing myocardial substrate metabolism in an animal model of type 2 diabetes mellitus. The study used 18 male ZDF rats (fa/fa) with 6 rats in each group: an untreated group; a group treated with metformin (16.6 mg/kg/d), and a group treated with rosiglitazone (4 mg/kg). Each rat was scanned at age 14 weeks (baseline) and subsequently at 19 weeks with small-animal positron emission tomography to estimate myocardial glucose utilization (MGU) and myocardial utilization (MFAU), oxidation (MFAO), and esterification (MFAE). Treatment lasted for 5 weeks after baseline imaging. At week 19, rats were euthanized and hearts were extracted for expression analysis of select genes encoding for GLUT transporters and fatty acid transport and oxidation genes. In addition, echocardiography measurements were obtained at weeks 13 and 18 to characterize cardiac function. Metformin had no significant effect on either MGU or MFAU and MFAO. In contrast, rosiglitazone tended to enhance MGU and significantly reduced MFAU and MFAO. Rosiglitazone-induced increase in glucose uptake correlated significantly with increased expression of GLUT4, whereas diminished MFAO correlated significantly with decreased expression of FATP-1 and MCAD. Finally, changes in fractional shortening as a measure of cardiac function were unchanged throughout the study. Treatment with rosiglitazone enhanced glucose utilization and diminished MFAO, thus reversing the metabolic phenotype of the diabetic heart.
International Nuclear Information System (INIS)
Shujaat, A.; Hussain, M.M.
2016-01-01
To evaluate the effect of pomegranate peel extract with or without rosiglitazone on plasma glucose and lipid profile in insulin resistant diabetic rats. Study Design: Randomized controlled trial. Place and Duration of Study: Department of Physiology, Army Medical College, Rawalpindi, in collaboration with National Institute of Health (N.I.H), Islamabad from 1st January 2011 to 28th May 2011. Material and Methods: Type 2 diabetes mellitus was induced in sixty healthy rats. The diabetic rats were divided into four groups, namely diabetic control group which received intraperitoneal injection of normal saline daily, pomegranate group which was treated similar to control group and also received pomegranate peel extract (200mg/kg body weight) orally once daily, rosiglitazone group which received intraperitoneal injection of rosiglitazone (5mg/kg body weight) daily and the combined group received both pomegranate extract (100 mg/kg body weight, orally) and intraperitoneal injection of rosiglitazone (2.5 mg/kg body weight) daily for 28 days. After four weeks of treatment, terminal intracardiac sampling was done to measure plasma glucose and lipid profile. Results: The plasma glucose and mean serum levels of cholesterol, triglyceride, low density lipoproteins and very low density lipoproteins was significantly reduced (p<0.001) in pomegranate, rosiglitazone and combined groups respectively as compared to the diabetic control. The mean serum levels of high density lipoproteins were significantly (p<0.001) elevated in above mentioned groups as compared to the diabetic control. Conclusion: Pomegranate peel extract is hypoglycemic and hypolipidemic agent in low doses when used alone or in combination with rosiglitazone in type 2 diabetic rats. (author)
Toyota, Yosuke; Nomura, Sayaka; Makishima, Makoto; Hashimoto, Yuichi; Ishikawa, Minoru
2017-06-15
Anti-inflammatory effects of peroxisome proliferator-activated receptor gamma (PPRAγ) ligands are thought to be largely due to PPARγ-mediated transrepression. Thus, transrepression-selective PPARγ ligands without agonistic activity or with only partial agonistic activity should exhibit anti-inflammatory properties with reduced side effects. Here, we investigated the structure-activity relationships (SARs) of PPARγ agonist rosiglitazone, focusing on transrepression activity. Alkenic analogs showed slightly more potent transrepression with reduced efficacy of transactivating agonistic activity. Removal of the alkyl group on the nitrogen atom improved selectivity for transrepression over transactivation. Among the synthesized compounds, 3l exhibited stronger transrepressional activity (IC 50 : 14μM) and weaker agonistic efficacy (11%) than rosiglitazone or pioglitazone. Copyright © 2017 Elsevier Ltd. All rights reserved.
DEFF Research Database (Denmark)
Pedersen, Rasmus S; Damkier, Per; Brosen, Kim
2006-01-01
= 0.0066) increase in the AUC(0-infinity) of rosiglitazone, with a geometric mean ratio of 1.21 [95% confidence interval (CI) 1.06-1.39]. The elimination half-life (t(1/2)) was also significantly higher (P = 0.0203) with a geometric mean ratio of 1.38 [95% CI 1.06-1.79]. The coadministration...... of fluvoxamine had no influence on the pharmacokinetics of N-desmethylrosiglitazone. CONCLUSION: The importance of the CYP2C8*3 mutation in the in vivo metabolism of rosiglitazone could not be confirmed. Fluvoxamine increased the AUC(0-infinity) and t(1/2) of rosiglitazone moderately and hence may be a weak...
Energy Technology Data Exchange (ETDEWEB)
Choi, Eun Jung; Jin, Gong Yong; Bok, Se Mi; Han, Young Min; Lee, Young Sun; Jung, Myung Ja; Kwon, Keun Sang [Research Institute of Clinical Medicine of Chonbuk National University, Biomedical Research Institute of Chonbuk National University Hospital, Institute for Medical Sciences, Jeonju (Korea, Republic of)
2014-08-15
The aim of this study was to assess the therapeutic effects of rosiglitazone with serial micro-CT findings before and after rosiglitazone administration in a lung fibrosis mouse model induced with bleomycin. We instilled the bleomycin solution directly into the trachea in twenty mice (female, C57BL/6 mice). After the instillation with bleomycin, mice were closely observed for 3 weeks and then all mice were scanned using micro-CT without sacrifice. At 3 weeks, the mice were treated with rosiglitazone on days 21 to 27 if they had abnormal CT findings (n = 9, 45%). For the mice treated with rosiglitazone, we performed micro-CT with mouse sacrifice 2 weeks after the rosiglitazone treatment completion. We assessed the abnormal CT findings (ground glass attenuation, consolidation, bronchiectasis, reticular opacity, and honeycombing) using a five-point scale at 3 and 6 weeks using Wilcoxon-signed ranked test. The micro-CT findings were correlated with the histopathologic results. One out of nine (11.1%) mice improved completely. In terms of consolidation, all mice (100%) showed marked decrease from 3.1 ± 1.4 at 3 weeks to 0.9 ± 0.9 at 6 weeks (p = 0.006). At 6 weeks, mild bronchiectasis (n = 6, 66.7%), mild reticular opacity (n 7, 77.8%) and mild honeycomb patterns (n = 3, 33.3%) appeared. A serial micro-CT enables the evaluation of drug effects in a lung fibrosis mouse model.
Zhang, Yun-Fang; Zou, Xun-Liang; Wu, Jun; Yu, Xue-Qing; Yang, Xiao
2015-12-01
We assessed the anti-inflammatory effect of peroxisome proliferator-activated receptor (PPAR)-γ agonist, rosiglitazone, in a lipopolysaccharide (LPS)-induced peritonitis rat model. LPS was intraperitoneally injected into rats to establish peritonitis model. Male Sprague-Dawley (SD) rats were assigned to normal saline (the solvent of LPS), LPS, rosiglitazone plus LPS, and rosiglitazone alone. A simple peritoneal equilibrium test was performed with 20 ml 4.25 % peritoneal dialysis fluid. We measured the leukocyte count in dialysate and ultrafiltration volume. Peritoneal membrane histochemical staining was performed, and peritoneal thickness was assessed. CD40 and intercellular adhesion molecule-1 messenger RNA (ICAM-1 mRNA) levels in rat visceral peritoneum were detected by reverse transcription (RT)-PCR. IL-6 in rat peritoneal dialysis effluent was measured using enzyme-linked immunosorbent assay. The phosphorylation of NF-κB-p65 and IκBα was analyzed by Western blot. LPS administration resulted in increased peritoneal thickness and decreased ultrafiltration volume. Rosiglitazone pretreatment significantly decreased peritoneal thickness. In addition to CD40 and ICAM-1 mRNA expression, the IL-6, p-p65, and p-IκBα protein expressions were enhanced in LPS-administered animals. Rosiglitazone pretreatment significantly decreased ICAM-1 mRNA upregulation, secretion of IL-6 protein, and phosphorylation of NF-κB-p65 and IκBα without decreasing CD40 mRNA expression. Rosiglitazone has a protective effect in peritonitis, simultaneously decreasing NF-κB phosphorylation, suggesting that NF-κB signaling pathway mediated peritoneal inflammation induced by LPS. PPAR-γ might be considered a potential therapeutic target against peritonitis.
Sharma, S K; Verma, S H
2016-09-01
To study the complete fasting lipid profile and other parameters (weight, body mass index, HbA1c, fasting blood sugar and postprandial blood sugar)in Type 2 diabetes mellitus patients on OHA/insulin, to study the effect of addition of pioglitazone on lipid profile and other parameters in Type 2 diabetes mellitus patients on OHA/insulin, to study the effect of addition of rosiglitazone on lipid profile and other parameters in Type 2 diabetes mellitus patients on OHA/insulin and to compare the effect of pioglitazone and rosiglitazone on lipid profile and other parameters in Type 2 diabetes mellitus patients on OHA/insulin. In the study, 100 Type 2 diabetes cases on oral hypoglycemic agent/insulin with deranged lipid profile were chosen and divided into 2 groups 50 and 50 in group A and group B respectively.Pioglitazone was given initially 15mg/day then if required increasing upto 45mg/day in group A for period of 18 weeks and rosiglitazone was given initially 2 mg/day then if required increasing upto 8 mg/day in group B for period of 18 weeks. Detailed clinical history was obtained and thorough physical examination was done and following parameters were established-Age, Height, Weight, Body mass index, Fasting and Postprandial blood sugar, HbA1c levels and fasting complete lipid profile done at 0 and 18 weeks. Each patient itself served as a control for this study. Maximum no. of patients were in sixth decade (53.30%) and minimum patients were in seventh decade (6.6%). Males were 63.3% and females were 36.8%. Fasting blood sugar levels decreased by 23% with pioglitazone in group A and 14.07% with rosiglitazone in group B. The postprandial blood sugar levels decreased by 29.9% with pioglitazone in group A and 20.17% with rosiglitazone in group B.The mean HbA1c decreased by 2.13 % pioglitazone in group A and 3.8% with rosiglitazone in group B after 18 weeks of therapy. The effects of both drugs on BMI and weight were not significant. In group A the total cholesterol
Rosiglitazone inhibits metastasis development of a murine mammary tumor cell line LMM3
International Nuclear Information System (INIS)
Magenta, Gabriela; Borenstein, Ximena; Rolando, Romina; Jasnis, María Adela
2008-01-01
Activation of peroxisome proliferator-activated receptors γ (PPARγ) induces diverse effects on cancer cells. The thiazolidinediones (TZDs), such as troglitazone and ciglitazone, are PPARγ agonists exhibiting antitumor activities; however, the underlying mechanism remains inconclusive. Rosiglitazone (RGZ), a synthetic ligand of PPARγ used in the treatment of Type 2 diabetes, inhibits growth of some tumor cells and is involved in other processes related to cancer progression. Opposing results have also been reported with different ligands on tumor cells. The purpose of this study was to determine if RGZ and 15d-PGJ 2 induce antitumor effects in vivo and in vitro on the murine mammary tumor cell line LMM3. The effect on LMM3 cell viability and nitric oxide (NO) production of different doses of RGZ, 15-dPGJ 2 , BADGE and GW9662 were determined using the MTS colorimetric assay and the Griess reaction respectively. In vivo effect of orally administration of RGZ on tumor progression was evaluated either on s.c. primary tumors as well as on experimental metastasis. Cell adhesion, migration (wound assay) and invasion in Transwells were performed. Metalloproteinase activity (MMP) was determined by zymography in conditioned media from RGZ treated tumor cells. PPARγ expression was detected by inmunohistochemistry in formalin fixed tumors and by western blot in tumor cell lysates. RGZ orally administered to tumor-bearing mice decreased the number of experimental lung metastases without affecting primary s.c. tumor growth. Tumor cell adhesion and migration, as well as metalloproteinase MMP-9 activity, decreased in the presence of 1 μM RGZ (non-cytotoxic dose). RGZ induced PPARγ protein expression in LMM3 tumors. Although metabolic activity -measured by MTS assay- diminished with 1–100 μM RGZ, 1 μM-treated cells recovered their proliferating capacity while 100 μM treated cells died. The PPARγ antagonist Biphenol A diglicydyl ether (BADGE) did not affect RGZ activity
DEFF Research Database (Denmark)
Home, Philip D; Pocock, Stuart J; Beck-Nielsen, Henning
2009-01-01
.80-1.63) for myocardial infarction, and 0.72 (0.49-1.06) for stroke. Heart failure causing admission to hospital or death occurred in 61 people in the rosiglitazone group and 29 in the active control group (HR 2.10, 1.35-3.27, risk difference per 1000 person-years 2.6, 1.1-4.1). Upper and distal lower limb fracture rates...... failure and of some fractures, mainly in women. Although the data are inconclusive about any possible effect on myocardial infarction, rosiglitazone does not increase the risk of overall cardiovascular morbidity or mortality compared with standard glucose-lowering drugs. FUNDING: GlaxoSmithKline plc, UK.......BACKGROUND: Rosiglitazone is an insulin sensitiser used in combination with metformin, a sulfonylurea, or both, for lowering blood glucose in people with type 2 diabetes. We assessed cardiovascular outcomes after addition of rosiglitazone to either metformin or sulfonylurea compared...
Rashid, Jahidur; Alobaida, Ahmad; Al-Hilal, Taslim A; Hammouda, Samia; McMurtry, Ivan F; Nozik-Grayck, Eva; Stenmark, Kurt R; Ahsan, Fakhrul
2018-06-28
Peroxisome-proliferator-activated-receptor-gamma (PPAR-γ) is implicated, in some capacity, in the pathogenesis of pulmonary arterial hypertension (PAH). Rosiglitazone, an oral antidiabetic and PPAR-γ agonist, has the potential to dilate pulmonary arteries and to attenuate arterial remodeling in PAH. Here, we sought to test the hypothesis that rosiglitazone can be repurposed as inhaled formulation for the treatment of PAH. We have tested this conjecture by preparing and optimizing poly(lactic-co-glycolic) acid (PLGA) based particles of rosiglitazone, assessing the drug particles for pulmonary absorption, investigating the efficacy of the plain versus particulate drug formulation in improving the respiratory hemodynamics in PAH animals, and finally studying the effect of the drug in regulating the molecular markers associated with PAH pathogenesis. The optimized particles were slightly porous and spherical, and released 87.9% ± 6.7% of the drug in 24 h. The elimination half-life of the drug formulated in PLGA particles was 2.5-fold greater than that of the plain drug administered via the same route at the same dose. The optimized formulation, given via the pulmonary route, produced pulmonary selective vasodilation in PAH animals, but oral rosiglitazone had no effect in pulmonary hemodynamics. Rosiglitazone ameliorates the pathogenesis of PAH by balancing the molecular regulators involved in the vasoconstriction and vasodilation of human pulmonary arterial smooth muscle cells. All in all, data generated using intact animal and cellular models point to the conclusion that PLGA particles of an antidiabetic drug can be used for the treatment of a different disease, PAH. Copyright © 2018 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Havele Shweta S.
2014-01-01
Full Text Available A simple, precise and accurate high performance liquid chromatography (HPLC method was developed for the simultaneous estimation of metformin hydrochloride, rosiglitazone maleate, glibenclamide present in multicomponent dosage forms. Chromatography was performed on a 25 cm × 4.6 mm i.d., 5-μm particle, C18 column with 78:22 (v/v methanol: 20 mM potassium dihydrogen phosphate buffer as mobile phase at a flow rate of 1.0 ml/min and UV detection at 238 nm for metformin hydrochloride, rosiglitazone maleate, and glibenclamide. The total elution time was shorter than 9 min. This method was found to be precise and reproducible. This proposed method was successfully applied for the analysis of metformin hydrochloride, rosiglitazone maleate, glibenclamide as a bulk drug and in pharmaceutical formulation without any interference from the excipients.
DEFF Research Database (Denmark)
Nybo, Mads; Preil, Simone Rørdam; Juhl, Henning Friis
2011-01-01
regarding cardiovascular disease. The South Danish Diabetes Study, an investigator-driven, randomized, controlled clinical trial lasting 2 years, was used to test this hypothesis in patient groups with different medication strategies (insulin aspart or NPH insulin, added either metformin...... (R = 0.29, p = 0.0002), while this correlation was poor in those not receiving rosiglitazone (R = 0.06, p = 0.48). Treatment with rosiglitazone among patients with T2DM reduces the concentration of plasma OPG. This is not seen with metformin despite similar reductions in HbA(1c) . Alteration...
International Nuclear Information System (INIS)
Bai, Yong-Ping; Liu, Yu-Hui; Chen, Jia; Song, Tao; You, Yu; Tang, Zhen-Yan; Li, Yuan-Jian; Zhang, Guo-Gang
2007-01-01
Previous studies demonstrated an important interaction between nuclear factor-kappaB (NF-κB) activation and homocysteine (Hcy)-induced cytokines expression in endothelial cells and vascular smooth muscle cells. However, the underlying mechanism remains illusive. In this study, we investigated the effects of Hcy on NF-κB-mediated sICAM-1, TNF-α production and the possible involvement of ERK 1/2 /p38MAPK pathway. The effects of rosiglitazone intervention were also examined. Our results show that Hcy increased the levels of sICAM-1 and TNF-α in cultured human umbilical vein endothelial cells (HUVECs) in a time- and concentration-dependent manner. This effect was significantly depressed by rosiglitazone and different inhibitors (PDTC, NF-κB inhibitor; PD98059, MEK inhibitor; SB203580, p38MAPK specific inhibitor; and staurosporine, PKC inhibitor). Next, we investigated the effect of Hcy on ERK 1/2 /p38MAPK pathway and NF-κB activity in HUVECs. The results show that Hcy activated both ERK 1/2 /p38MAPK pathway and NF-κB-DNA-binding activity. These effects were markedly inhibited by rosiglitazone as well as other inhibitors (SB203580, PD98059, and PDTC). Further, the pretreatment of staurosporine abrogated ERK 1/2 /p38MAPK phosphorylation, suggesting that Hcy-induced ERK 1/2 /p38MAPK activation is associated with PKC activity. Our results provide evidence that Hcy-induced NF-κB activation was mediated by activation of ERK 1/2 /p38MAPK pathway involving PKC activity. Rosiglitazone reduces the NF-κB-mediated sICAM-1 and TNF-α production induced by Hcy via inhibition of ERK 1/2 /p38MAPK pathway
International Nuclear Information System (INIS)
Shen Zhenhai; Lu Yun; Feng Yinbo; Jin Xian
2010-01-01
Objective: To observe the effects of rosiglitazone on metabolic parameters, carotid intimamedia thickness (IMT), brachial-ankle pulse wave velocity (baPWV) and ankle-brachial index (ABI) in nondiabetic patients with metabolic syndrome. Methods: Seventy-nine nondiabetic patients with metabolic syndrome were randomly divided into treatment group (n = 41) and control group (n = 38). The patients in treatment group were treated with rosiglitazone on the basis of life-style intervention, those in control group were treated with life-style intervention for 9 months. All patients were followed up every 3 months. Body mass index (BMI) ,waist circumference(WC), systolic blood pressure (SBP), diastolic blood pressure(DBP), fasting blood glucose (FBG), triglyceride (TG), total cholesterol (TC), highdendity lipoprotein (HDL-C), Low-density lipoprotein (LDL), high sensitivity C-reactive protein (hsCRP), HbA 1 C, fasting insulin (FIns), HOMA-IR, IMT, baPWV and ABI were measured in both groups before treatment and at the 6th, 9th month after treatment. Results: (1) After treatment with rosiglitazone for 6 months, FPG, TG, HDL-C, hsC RP, HbA 1 C, Fins and HOMA-IR in treatment group were improved (P 1 C, Fins and HOMA-IR got further improvement at the 9th month after treatment (P 1 C, Fins and HOMA-IR were changed significantly in treatment group compared to those in control group (P 1 C and HOMA-IR was independently related to the improvement of ABI by multivarient analysis. Conclusion: In nondiabetic patients with metabolic syndrome, rosiglitazone can significantly improve insulin resistance, correct metabolic disorders, has anti-inflammatory effect and retard atherosclerosis at some extent. (authors)
Directory of Open Access Journals (Sweden)
N.V. Satheesh Madhav
2013-12-01
Full Text Available The aim of this study was to formulate drug-loaded bio-lipstrips using novel bioexcipients isolated from the fruit pulp of Litchi chinesis (biomaterial L and to explore the potentiality of lip skin as a novel translabial drug delivery system. The biomaterial, prepared by a simplified economical process and purified by hot dialysis, was subjected to various physicochemical evaluations along with spectral analysis including UV, FT-IR, Mass and 1H NMR. The lipstrip formulated with the novel bioexcipients was screened for its functional properties, including filmability using a film-casting method, and bio/muco-adhesitivity using a shear-stress method, the Park and Robinson method and a rotating cylinder method. Rosiglitazone-loaded bio-lipstrips were formulated by using biomaterial L as a strip former and dextrose as a flexicizer. The formulated strips were subjected to various evaluations, including thickness, folding endurance, in-vitro release and in-vivo release. The release of rosiglitazone maleate was maintained over 24 h, which was confirmed in in-vitro and in-vivo release experiments. Our results reveal that this biopolymer possesses promising stripability as well as bio-adhesitivity. The formulated bio-lipstrips are feasible for delivering rosiglitazone maleate by translabial administration.
Effects of Rosiglitazone on the Expression of PPAR-γ and on the ...
African Journals Online (AJOL)
Purpose: Peroxisome proliferator-activated receptor (PPAR)-γ ligand is known to repress the expression of pro-inflammatory mediators. However, it is unclear how it affects PPAR-γ expression and the inflammatory response in the human lung. We investigated the effects of rosiglitazone (synthetic PPAR-γ ligand) on the ...
Directory of Open Access Journals (Sweden)
Luconi Michaela
2008-07-01
Full Text Available Rosiglitazone (RGZ, a thiazolidinedione ligand of the peroxisome proliferator-activated receptor (PPAR-γ, has been recently described as possessing antitumoral properties. We investigated RGZ effect on cell proliferation in two cell line models (SW13 and H295R of human adrenocortical carcinoma (ACC and its interaction with the signaling pathways of the activated IGF-I receptor (IGF-IR. We demonstrate a high expression of IGF-IR in the two cell lines and in ACC. Cell proliferation is stimulated by IGF-I in a dose- and time-dependent manner and is inhibited by RGZ. The analysis of the main intracellular signaling pathways downstream of the activated IGF-IR, phosphatidyl inositol 3-kinase (PI3K-Akt, and extracellular signal-regulated kinase (ERK1/2 cascades reveals that RGZ rapidly interferes with the Akt and ERK1/2 phosphorylation/activation which mediates IGF-I stimulated proliferation. In conclusion, our results suggest that RGZ exerts an inhibitory effect on human ACC cell proliferation by interfering with the PI3K/Akt and ERK1/2 signaling pathways downstream of the activated IGF-IR.
DEFF Research Database (Denmark)
Komajda, Michel; Curtis, Paula; Hanefeld, Markolf
2008-01-01
BACKGROUND: Hypertension and type 2 diabetes are common co-morbidities. Preliminary studies suggest that thiazolidinediones reduce blood pressure (BP). We therefore used ambulatory BP to quantify BP lowering at 6-12 months with rosiglitazone used in combination with metformin or sulfonylureas...... compared to metformin and sulfonylureas in people with type 2 diabetes. METHODS: Participants (n = 759) in the multicentre RECORD study were studied. Those taking metformin were randomized (open label) to add-on rosiglitazone or sulfonylureas, and those on sulfonylurea to add-on rosiglitazone or metformin....... RESULTS: 24-Hour ambulatory BP was measured at baseline, 6 months and 12 months. At 6 and 12 months, reductions in 24-hour ambulatory systolic BP (sBP) were greater with rosiglitazone versus metformin (difference at 6 months 2.7 [95% CI 0.5-4.9] mmHg, p = 0.015; 12 months 2.5 [95% CI 0.2-4.8] mmHg, p = 0...
Directory of Open Access Journals (Sweden)
Hongying Ye
Full Text Available OBJECTIVE: This study was designed to (1 investigate the expression profiles of resistin in db/db mice and its dynamic association with metabolic parameters; and (2 evaluate the effects of Rosiglitazone on production of resistin. METHODS: Db/db mice and their lean litter mates were used for this study. Epididymal fat tissue was excised from mice of different age (from 5 to 12 weeks for ex vivo incubation. Resistin,along with adiponectin,in serum and conditioned culture medium of epididymal fat pads were measured with immunoassays. The gene expression of resistin was determined by real-time PCR. Rosiglitazone or the vehicle (PBS was administered into db/db mice by daily intra-gastric gavage. Differentiated 3T3-L1 adipocytes were used for in vitro evaluation. RESULTS: The secretion of resistin from the fat pads in db/db mice was significantly lower than that in lean mice (P<0.01. The mRNA expression of the resistin gene in fat tissue of db/db mice at the age of 5 weeks was decreased by 60.5% compared to lean controls (p<0.05. Serum levels of resistin were comparable between the obese and lean groups, perhaps due to the increased total fat mass in db/db mice. Correlation analysis showed that serum resistin levels were positively correlated to resistin secretion from fat pads(r = 0.844,P = 0.000, while negatively associated with the body weight (r = -0.515, P = 0.000 and fasting glucose level (r = -0.357, P = 0.002. Notably, treatment with rosiglitazone increased the serum resistin levels by 66.4%(P<0.05in db/db mice. In 3T3-L1 adipocytes, Rosiglitazone (10 uM markedly enhanced the secretion of resistin by 120% (P<0.01 and its gene expression by 78.1% (P<0.05. CONCLUSION: Both resistin gene expression and its secretion from the epididymal adipose tissue were decreased in db/db obese mice, while the insulin-sensitizing drug rosiglitazone increased resistin production. Our results do not support the role of resistin as an
International Nuclear Information System (INIS)
Morcos, N.Y.; Abdel-Ghaffar, A.B.; Osman, S.A.; Mohamed, M.Kh.; Arbid, M.S.; El-Eraky, W.I.
2012-01-01
The present study was designed to investigate the possible ameliorative effect of hesperidin and low dose fÁ-irradiation (LDR) in combination with rosiglitazone in an experimental model of insulin resistance. Type 2 diabetes mellitus (T2DM) was induced in rats by single intraperitoneal injection of streptozotocin (STZ) followed by nicotinamide (NIC) (65 and 110 mg/kg b.wt; i.p respectively). After verifying T2DM in rats, they were subjected to LDR (50 cGy) and then treated with rosiglitazone (4 mg/kg b.wt; p.o) and hesperidin (100 mg/kg b.wt; p.o) for 30 days. Results showed that STZ injection significantly elevated blood glucose, glycosylated hemoglobin (HbA1c), insulin, homeostasis model assessment of insulin resistance (HOMA-IR), lipid peroxides (TBARS; MDA) accompanied with a reduction in adiponectin plasma level, reduced glutathione (GSH) and superoxide dismutase (SOD) serum level. Treatment of diabetic rats with rosiglitazone, hesperidin and LDR significantly reduced blood glucose, HbA1c, insulin, HOMA-IR and MDA levels. Whereas, plasma adiponectin, SOD in serum and GSH plasma level were significantly elevated. Therefore, our data suggest that hesperidin and LDR might be useful adjuvants with rosiglitazone and attenuate insulin resistance and oxidative stress in T2DM.
Ratner, Robert E; Cannon, Christopher P; Gerstein, Hertzel C; Nesto, Richard W; Serruys, Patrick W; Van Es, Gerrit-Anne; Kolatkar, Nikheel S; Kravitz, Barbara G; Zalewski, Andrew; Fitzgerald, Peter J
2008-12-01
Rosiglitazone, a thiazolidinedione, has effects on insulin sensitivity and cardiovascular risk factors that may favorably impact the progression of coronary atherosclerosis. APPROACH is a double-blind randomized clinical trial comparing the effects of the insulin sensitizer rosiglitazone with the insulin secretagogue glipizide on the progression of coronary atherosclerosis. Patients with type 2 diabetes and coronary artery disease undergoing clinically indicated coronary angiography or percutaneous coronary intervention are randomized to receive rosiglitazone or glipizide for 18 months using a titration algorithm designed to provide comparable glycemic control between treatment groups. The primary end point is change in percent atheroma volume from baseline to study completion in a nonintervened coronary artery, as measured by intravascular ultrasound. Cardiovascular events are adjudicated by an end point committee. A total of 672 patients were randomized. The mean age was 61 years, hemoglobin A(1c) (HbA(1c)) 7.2%, body mass index 29.5 kg/m(2), and median duration of diabetes 4.8 years. At baseline, approximately half of the participants were receiving oral antidiabetic monotherapy (53.9%) with 27.5% receiving dual combination therapy and 17.9% treated with diet and exercise alone. Approximately two thirds of the participants (68%) had dyslipidemia, 79.9% hypertension, and 24% prior myocardial infarction. APPROACH has fully enrolled a high-risk patient population and will compare the glucose-independent effects of rosiglitazone and glipizide on the progression of coronary atherosclerosis, as well as provide additional data on the cardiovascular safety of rosiglitazone in patients with type 2 diabetes and coronary artery disease.
Directory of Open Access Journals (Sweden)
Marshall J Glesby
Full Text Available Recombinant human growth hormone (rhGH reduces visceral adipose tissue (VAT volume in HIV-infected patients but can worsen glucose homeostasis and lipoatrophy. We aimed to determine if adding rosiglitazone to rhGH would abrogate the adverse effects of rhGH on insulin sensitivity (SI and subcutaneous adipose tissue (SAT volume.Randomized, double-blind, placebo-controlled, multicenter trial using a 2×2 factorial design in which HIV-infected subjects with abdominal obesity and insulin resistance were randomized to rhGH 3 mg daily, rosiglitazone 4 mg twice daily, combination rhGH + rosiglitazone, or double placebo (control for 12 weeks. The primary endpoint was change in SI by frequently sampled intravenous glucose tolerance test from entry to week 12. Body composition was assessed by whole body magnetic resonance imaging (MRI and dual Xray absorptiometry (DEXA. Seventy-seven subjects were randomized of whom 72 initiated study drugs. Change in SI from entry to week 12 differed across the 4 arms by 1-way ANCOVA (P = 0.02; by pair-wise comparisons, only rhGH (decreasing SI; P = 0.03 differed significantly from control. Changes from entry to week 12 in fasting glucose and glucose area under the curve on 2-hour oral glucose tolerance test differed across arms (1-way ANCOVA P = 0.004, increasing in the rhGH arm relative to control. VAT decreased significantly in the rhGH arms (-17.5% in rhGH/rosiglitazone and -22.7% in rhGH but not in the rosiglitazone alone (-2.5% or control arms (-1.9%. SAT did not change significantly in any arm. DEXA results were consistent with the MRI data. There was no significant rhGH x rosiglitazone interaction for any body composition parameter.The addition of rosiglitazone abrogated the adverse effects of rhGH on insulin sensitivity and glucose tolerance while not significantly modifying the lowering effect of rhGH on VAT.Clinicaltrials.gov NCT00130286.
Glesby, Marshall J; Albu, Jeanine; Chiu, Ya-Lin; Ham, Kirsis; Engelson, Ellen; He, Qing; Muthukrishnan, Varalakshmi; Ginsberg, Henry N; Donovan, Daniel; Ernst, Jerry; Lesser, Martin; Kotler, Donald P
2013-01-01
Recombinant human growth hormone (rhGH) reduces visceral adipose tissue (VAT) volume in HIV-infected patients but can worsen glucose homeostasis and lipoatrophy. We aimed to determine if adding rosiglitazone to rhGH would abrogate the adverse effects of rhGH on insulin sensitivity (SI) and subcutaneous adipose tissue (SAT) volume. Randomized, double-blind, placebo-controlled, multicenter trial using a 2×2 factorial design in which HIV-infected subjects with abdominal obesity and insulin resistance were randomized to rhGH 3 mg daily, rosiglitazone 4 mg twice daily, combination rhGH + rosiglitazone, or double placebo (control) for 12 weeks. The primary endpoint was change in SI by frequently sampled intravenous glucose tolerance test from entry to week 12. Body composition was assessed by whole body magnetic resonance imaging (MRI) and dual Xray absorptiometry (DEXA). Seventy-seven subjects were randomized of whom 72 initiated study drugs. Change in SI from entry to week 12 differed across the 4 arms by 1-way ANCOVA (P = 0.02); by pair-wise comparisons, only rhGH (decreasing SI; P = 0.03) differed significantly from control. Changes from entry to week 12 in fasting glucose and glucose area under the curve on 2-hour oral glucose tolerance test differed across arms (1-way ANCOVA P = 0.004), increasing in the rhGH arm relative to control. VAT decreased significantly in the rhGH arms (-17.5% in rhGH/rosiglitazone and -22.7% in rhGH) but not in the rosiglitazone alone (-2.5%) or control arms (-1.9%). SAT did not change significantly in any arm. DEXA results were consistent with the MRI data. There was no significant rhGH x rosiglitazone interaction for any body composition parameter. The addition of rosiglitazone abrogated the adverse effects of rhGH on insulin sensitivity and glucose tolerance while not significantly modifying the lowering effect of rhGH on VAT. Clinicaltrials.gov NCT00130286.
Tfayli, Hala; Ulnach, Julia Warren; Lee, SoJung; Sutton-Tyrrell, Kim; Arslanian, Silva
2011-05-01
Adolescents with polycystic ovary syndrome (PCOS) have insulin resistance and higher rates of the metabolic syndrome. Our objective was to compare the effects of 6 months treatment with drospirenone/ethinyl estradiol (EE) (3 mg/30 μg) vs. rosiglitazone (4 mg) daily on the hormonal and cardiometabolic profiles of overweight/obese adolescents with PCOS. We conducted a randomized, double-blinded, parallel clinical trial in an academic hospital, with n = 46 patients. The primary outcome measure was insulin sensitivity, hepatic with [6,6-(2)H(2)]glucose and peripheral with a 3-h hyperinsulinemic-euglycemic clamp. Other outcome measures included plasma androgen profile and response to ACTH stimulation, glucose and insulin response to oral glucose tolerance test, insulin secretion with a 2-h hyperglycemic clamp, fasting lipid profile, inflammatory markers, intima media thickness, aortic pulse wave velocity, body composition by dual-energy x-ray absorptiometry, and abdominal adiposity by computed tomography scan. Drospirenone/EE resulted in greater reductions in androgenemia. Neither treatment led to change in weight or body mass index, but rosiglitazone led to a significant decrease in visceral adiposity. Compared with drospirenone/EE, treatment with rosiglitazone improved hepatic and peripheral insulin sensitivity and lowered fasting and stimulated insulin levels during the oral glucose tolerance test. Treatment with drospirenone/EE was associated with elevations in total cholesterol, high-sensitivity C-reactive protein and leptin concentrations, whereas treatment with rosiglitazone led to lower triglycerides and higher adiponectin concentrations. Neither treatment affected intima media thickness or pulse wave velocity. In overweight/obese adolescents with PCOS, 6 months treatment with rosiglitazone was superior to drospirenone/EE in improving the cardiometabolic risk profile, and effective but inferior in attenuating hyperandrogenemia. Additional studies are needed to
Bundhun, Pravesh Kumar; Janoo, Girish; Teeluck, Abhishek Rishikesh; Huang, Feng
2017-10-23
Vildagliptin and pioglitazone/rosiglitazone are emerging Oral Hypoglycemic Agents (OHAs) which are used to treat patients suffering from Type 2 Diabetes Mellitus (T2DM). In this analysis, we aimed to systematically compare the adverse drug events which were observed with the use of vildagliptin versus pioglitazone or rosiglitazone respectively. Online databases were searched for studies comparing vildagliptin with pioglitazone/rosiglitazone. Adverse drug events were considered as the clinical endpoints in this analysis. We calculated Odds Ratios (OR) with 95% Confidence Intervals (CIs) using the RevMan 5.3 software. All the authors had full access to the data which were used and approved the final version of the manuscript. A total number of 2396 patients were analyzed (1486 and 910 patients were treated with vildagliptin and pioglitazone/rosiglitazone respectively). Vildagliptin and pioglitazone/rosiglitazone were both associated with similar overall adverse drug events (OR: 1.00, 95% CI: 0.81-1.24; P = 1.00). Headache (OR: 0.88, 95% CI: 0.60-1.27; P = 0.49) and upper respiratory tract infection (OR: 0.95, 95% CI: 0.71-1.27; P = 0.75) were similarly observed. However, dizziness was significantly lower with pioglitazone/rosiglitazone (OR: 0.63, 95% CI: 0.43-0.92; P = 0.02). Back pain, diarrhea and nausea were insignificantly lower with pioglitazone/rosiglitazone (OR: 0.81, 95% CI: 0.49-1.33; P = 0.40), (OR: 0.83, 95% CI: 0.48-1.44; P = 0.52) and (OR: 0.52, 95% CI: 0.25-1.05; P = 0.07) respectively, whereas peripheral edema and weight gain were insignificantly higher (OR: 1.21, 95% CI: 0.56-2.62; P = 0.63) and (OR: 2.29, 95% CI: 0.51-10.34; P = 0.28) respectively. Nevertheless, when pioglitazone and rosiglitazone were separately compared with vildagliptin, peripheral edema and weight gain were significantly higher with rosiglitazone (OR: 2.36, 95% CI: 1.40-3.99; P = 0.001) and (OR: 5.20, 95% CI: 2.47-10.92; P = 0.0001) respectively. Both
DEFF Research Database (Denmark)
Das, Lopa M; Rosenjack, Julie; Au, Liemin
2015-01-01
Injury initiates recruitment of macrophages to support tissue repair; however, excessive macrophage activity may exacerbate tissue damage causing further destruction and subsequent delay in wound repair. Here we show that the peroxisome proliferation-activated receptor-γ agonist, rosiglitazone (R...
Czech Academy of Sciences Publication Activity Database
Vrablík, M.; Dobiášová, Milada; Štulc, T.; Kasalová, Z.; Doležalová, R.; Prázný, M.; Fait, T.; Češka, R.
2008-01-01
Roč. 29, č. 1 (2008), s. 146-150 ISSN 0172-780X R&D Projects: GA MZd(CZ) NR8328 Institutional research plan: CEZ:AV0Z50110509 Keywords : fenofibrate * rosiglitazone * type 2 diabetes mellitus Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition Impact factor: 1.359, year: 2008
Minge, Cadence E; Bennett, Brenton D; Norman, Robert J; Robker, Rebecca L
2008-05-01
Obesity and its physiological consequences are increasingly prevalent among women of reproductive age and are associated with infertility. To investigate, female mice were fed a high-fat diet until the onset of insulin resistance, followed by assessments of ovarian gene expression, ovulation, fertilization, and oocyte developmental competence. We report defects to ovarian function associated with diet-induced obesity (DIO) that result in poor oocyte quality, subsequently reduced blastocyst survival rates, and abnormal embryonic cellular differentiation. To identify critical cellular mediators of ovarian responses to obesity induced insulin resistance, DIO females were treated for 4 d before mating with an insulin-sensitizing pharmaceutical: glucose and lipid-lowering AMP kinase activator, 5-aminoimidazole 4-carboxamide-riboside, 30 mg/kg.d; sodium salicylate, IkappaK inhibitor that reverses insulin resistance, 50 mg/kg.d; or peroxisome proliferator activated receptor-gamma agonist rosiglitazone, 10 mg/kg.d. 5-aminoimidazole 4-carboxamide-riboside or sodium salicylate treatment did not have significant effects on the reproductive parameters examined. However, embryonic development to the blastocyst stage was significantly improved when DIO mice were treated with rosiglitazone, effectively repairing development rates. Rosiglitazone also normalized DIO-associated abnormal blastomere allocation to the inner cell mass. Such improvements to oocyte quality were coupled with weight loss, improved glucose metabolism, and changes in ovarian mRNA expression of peroxisome proliferator activated receptor-regulated genes, Cd36, Scarb1, and Fabp4 cholesterol transporters. These studies demonstrate that peri-conception treatment with select insulin-sensitizing pharmaceuticals can directly influence ovarian functions and ultimately exert positive effects on oocyte developmental competence. Improved blastocyst quality in obese females treated with rosiglitazone before mating
Belli, Susana H; Graffigna, Mabel N; Oneto, Adriana; Otero, Patricia; Schurman, Leon; Levalle, Oscar A
2004-03-01
To evaluate the effects of rosiglitazone on insulin resistance, growth factors, and reproductive disturbances in women with polycystic ovary syndrome (PCOS). Prospective study. Women with PCOS attending as outpatients of the Endocrine Division, Hospital Durand, Buenos Aires. Twenty-four insulin-resistant women with PCOS. Hormonal evaluations and a standardized oral glucose tolerance test before and after a 3-month trial of 4 mg of rosiglitazone daily. Serum LH, FSH, T, IGF-1, IGFBP-1, IGFBP-3, leptin, 17alpha-hydroxyprogesterone, insulin, and glucose concentrations. The area under insulin curve (AUC-insulin), the HOMA index (insulin resistance), the QUICKI index (insulin sensitivity), and the beta-cell function were calculated. Body mass index (BMI) and the waist/hip ratio were evaluated. A significant decrease was observed in serum fasting insulin, AUC insulin, HOMA index, beta-cell function, IGF-1, LH, and waist/hip ratio. The QUICKI index and IGFBP-1 increased significantly. Serum sex hormone-binding globulin, androgens, leptin, IGFBP-3, and BMI remained unchanged. Twenty-two of 23 females had their menses restored, and three patients became pregnant. One patient was excluded because she became pregnant at the second month. Associated with the decrease in LH, rosiglitazone improved insulin-resistance parameters and normalized the menstrual cycle, which suggests that this drug could improve the endocrine-reproductive condition in insulin-resistant women with PCOS.
Lie, Shervi; Hui, Melisa; McMillen, I Caroline; Muhlhausler, Beverly S; Posterino, Giuseppe S; Dunn, Stacey L; Wang, Kimberley C; Botting, Kimberley J; Morrison, Janna L
2014-03-15
It is unknown whether cardiomyocyte hypertrophy and the transition to fatty acid oxidation as the main source of energy after birth is dependent on the maturation of the cardiomyocytes' metabolic system, or on the limitation of substrate availability before birth. This study aimed to investigate whether intrafetal administration of a peroxisome proliferator-activated receptor-γ (PPAR-γ) agonist, rosiglitazone, during late gestation can stimulate the expression of factors regulating cardiac growth and metabolism in preparation for birth, and the consequences of cardiac contractility in the fetal sheep at ∼140 days gestation. The mRNA expression and protein abundance of key factors regulating growth and metabolism were quantified using quantitative RT-PCR and Western blot analysis, respectively. Cardiac contractility was determined by measuring the Ca(2+) sensitivity and maximum Ca(2+)-activated force of skinned cardiomyocyte bundles. Rosiglitazone-treated fetuses had a lower cardiac abundance of insulin-signaling molecules, including insulin receptor-β, insulin receptor substrate-1 (IRS-1), phospho-IRS-1 (Tyr-895), phosphatidylinositol 3-kinase (PI3K) regulatory subunit p85, PI3K catalytic subunit p110α, phospho-3-phosphoinositide-dependent protein kinase 1 (Ser-241), protein kinase B (Akt-1), phospho-Akt (Ser-273), PKCζ, phospho-PKCζ(Thr-410), Akt substrate 160 kDa (AS160), phospho-AS160 (Thr-642), and glucose transporter type-4. Additionally, cardiac abundance of regulators of fatty acid β-oxidation, including adiponectin receptor 1, AMPKα, phospho-AMPKα (Thr-172), phospho-acetyl CoA carboxylase (Ser-79), carnitine palmitoyltransferase-1, and PGC-1α was lower in the rosiglitazone-treated group. Rosiglitazone administration also resulted in a decrease in cardiomyocyte size. Rosiglitazone administration in the late-gestation sheep fetus resulted in a decreased abundance of factors regulating cardiac glucose uptake, fatty acid β-oxidation, and
DEFF Research Database (Denmark)
Skov, Vibe; Cangemi, Claudia; Gram, Jeppe
2013-01-01
ObjectiveThe extracellular matrix protein fibulin-1 is upregulated in the arterial wall in type 2 diabetes and circulates in increased concentrations in diabetes. Metformin is an anti-diabetic drug with beneficial CVD effects in diabetes. We hypothesized that metformin would influence the increased...... level of plasma fibulin-1 in diabetes.Research Design and MethodsAfter a four-week run-in period, 371 eligible patients with type 2 diabetes were randomized to treatment groups in a factorial design including insulin alone (control), +metformin, +rosiglitazone, or +both metformin and rosiglitazone...
Dart, Caroline
2012-01-01
Rosiglitazone, the thiazolidinedione class anti-diabetic withdrawn from Europe in 2010 amid reports of adverse cardiovascular effects, is revealed by Yu et al. in this issue of the British Journal of Pharmacology to be a selective blocker of ATP-sensitive potassium (KATP) channels. This seems little cause for excitement given that the closure of pancreatic KATP channels is integral to insulin secretion; and sulphonylureas, which inhibit KATP channels, are widely used to treat type II diabetes. However, rosiglitazone, whose primary targets are nuclear transcription factors that regulate genes involved in lipid metabolism, blocks KATP channels by a novel mechanism different to that of the sulphonylureas and has a worrying preference for blood flow–regulating vascular KATP channels. Identification of a new molecule that modulates KATP channel gating will not only tell us more about how these complex metabolic sensors work but also raises questions as to whether rosiglitazone suppresses the cardiovascular system's ability to cope with metabolic stress – a claim that has dogged the sulphonylureas for many years. LINKED ARTICLE This article is a commentary on Yu et al., pp. 26–36 of this issue. To view this paper visit http://dx.doi.org/10.1111/j.1476-5381.2012.01934.x PMID:22506686
Ye, Hongying; Zhang, Herbert J; Xu, Aimin; Hoo, Ruby L C
2013-01-01
This study was designed to (1) investigate the expression profiles of resistin in db/db mice and its dynamic association with metabolic parameters; and (2) evaluate the effects of Rosiglitazone on production of resistin. Db/db mice and their lean litter mates were used for this study. Epididymal fat tissue was excised from mice of different age (from 5 to 12 weeks) for ex vivo incubation. Resistin,along with adiponectin,in serum and conditioned culture medium of epididymal fat pads were measured with immunoassays. The gene expression of resistin was determined by real-time PCR. Rosiglitazone or the vehicle (PBS) was administered into db/db mice by daily intra-gastric gavage. Differentiated 3T3-L1 adipocytes were used for in vitro evaluation. The secretion of resistin from the fat pads in db/db mice was significantly lower than that in lean mice (Plean controls (plean groups, perhaps due to the increased total fat mass in db/db mice. Correlation analysis showed that serum resistin levels were positively correlated to resistin secretion from fat pads(r = 0.844,P = 0.000), while negatively associated with the body weight (r = -0.515, P = 0.000) and fasting glucose level (r = -0.357, P = 0.002). Notably, treatment with rosiglitazone increased the serum resistin levels by 66.4%(Pproduction. Our results do not support the role of resistin as an etiological link between obesity and diabetes.
Home, P D; Kahn, S E; Jones, N P; Noronha, D; Beck-Nielsen, H; Viberti, G
2010-09-01
Observational and mechanistic studies have suggested a possible relationship between treatment with metformin and decreased incidence of cancer in participants with type 2 diabetes. We extracted data for malignancies from the ADOPT (A Diabetes Outcome Progression Trial) and RECORD (Rosiglitazone Evaluated for Cardiovascular Outcomes and Regulation of Glycaemia in Diabetes) randomised controlled clinical trials, in which the efficacy and/or safety of metformin was assessed in comparison with sulfonylureas and rosiglitazone. Neoplasm occurrences were collected as adverse events in these studies. We reviewed and re-analysed the individual participant data in both studies for serious adverse events, malignancies reported as adverse events and related neoplasms of special interest. In ADOPT, 50 participants (3.4%) on metformin and 55 (3.8%) on each of rosiglitazone and glibenclamide (known as glyburide in the USA and Canada) developed serious adverse event malignancies (excluding non-melanoma skin cancers). This corresponds to 1.03, 1.12 and 1.31 per 100 person-years, giving hazard ratios for metformin of 0.92 (95% CI 0.63-1.35) vs rosiglitazone and 0.78 (0.53-1.14) vs glibenclamide. In RECORD, on a background of sulfonylurea, 69 (6.1%) participants developed malignant neoplasms in the metformin group, compared with 56 (5.1%) in the rosiglitazone group (HR 1.22 [0.86-1.74]). On a background of metformin, 74 (6.7%) participants in the sulfonylurea group developed malignant neoplasms, compared with 57 (5.1%) in the rosiglitazone group (HR 1.33 [0.94-1.88]). The malignancy rates in these two randomised controlled clinical trials do not support a view that metformin offers any particular protection against malignancy compared with rosiglitazone. However, they do not refute the possibility of a difference compared with sulfonylureas.
Rosiglitazone decreases postprandial production of acylation stimulating protein in type 2 diabetics
Directory of Open Access Journals (Sweden)
Tan Garry D
2007-05-01
Full Text Available Abstract Background We evaluated plasma ASP and its precursor C3 in type 2 diabetic men with/without rosiglitazone (ROSI treatment compared to healthy non-obese men. We tested (1 whether plasma ASP or C3 are altered postprandially in subcutaneous adipose tissue or forearm muscle effluent assessed by arteriovenous (A-V differences in healthy lean men and older obese diabetic men and (2 whether treatment with ROSI changes the arteriovenous gradient of ASP and/or C3. Methods In this ongoing placebo-controlled, crossover, double-blinded study, AV differences following a mixed meal were measured in diabetic men (n = 6 as compared to healthy men (n = 9. Results Postprandial arterial and adipose venous TG and venous NEFA were increased in diabetics vs. controls (p Conclusion Increased postprandial venous production of ASP is specific for adipose tissue (absent in forearm muscle. Increased postprandial C3 and ASP in diabetic subjects is consistent with an ASP resistant state, this state is partially normalized by treatment with ROSI.
Directory of Open Access Journals (Sweden)
Hou G
2015-04-01
Full Text Available Gang Hou, Yan Yin, Dan Han, Qiu-yue Wang, Jian Kang Department of Respiratory Medicine, the First Hospital of China Medical University, Shenyang, People’s Republic of China Objective: We investigated how rosiglitazone attenuated cigarette smoke (CS-induced emphysema in a rat model. In particular, we focused on its possible effects on the imbalance between metalloprotease (MMP and anti-MMP activity, mitogen-activated protein kinase (MAPK phosphorylation, and nuclear factor kappa-light-chain-enhancer of activated B cell (NFκB signaling pathway over-activation.Methods: A total of 36 Wistar rats were divided into three groups (n=12 each: animals were exposed to CS for 12 weeks in the absence (the CS group or presence of 30 mg/kg rosiglitazone (the rosiglitazone-CS [RCS] group; a control group was treated with the rosiglitazone vehicle only, without any CS exposure. Histopathology of lung tissue in all groups was evaluated to grade severity of the disease. Expression levels of peroxisome proliferator-activated receptor γ (PPARγ, MMP2, and MMP9 in lung tissue were determined and compared using Western blotting and immunohistochemistry. Activation of MAPKs, NFκB, and the nuclear factor of kappa light polypeptide gene enhancer in B-cell inhibitor, alpha (IκBα phosphorylation in lung tissue was examined by Western blotting.Results: Emphysema-related pathology, based on inter-alveolar wall distance and alveolar density, was less severe in the RCS group than in the CS group. Compared with the CS group, levels of PPARγ were higher in the RCS group, and levels of MMP2 and MMP9 proteins were lower in the RCS rats. Levels of activated MAPKs and NFκB were also lower, while the IκBαphosphorylation was increased in the lung tissue of RCS rats.Conclusion: Our findings suggest that oral administration of rosiglitazone attenuates the metalloprotease activity induced by CS, and the underlying mechanism might involve the activation of signaling pathways
Directory of Open Access Journals (Sweden)
I-Chih Chen
2010-02-01
Conclusion: Rosiglitazone significantly reduces plasma levels of inflammatory and hemostatic biomarkers, and restores global endothelial dysfunction, independently from insulin sensitization, in healthy smokers.
Asp, Michelle L.; Tian, Min; Kliewer, Kara L.; Belury, Martha A.
2011-01-01
Cachexia is characterized by severe weight loss, including adipose and muscle wasting, and occurs in a large percentage of cancer patients. Insulin resistance contributes to dysregulated metabolism in cachexia and occurs prior to weight loss in mice with colon-26 tumor-induced cachexia. Therefore, we hypothesized that the insulin sensitizer, rosiglitazone, would attenuate the loss of adipose and muscle to result in improved outcomes for mice with late-stage cachexia. Male CD2F1 mice were inoc...
Directory of Open Access Journals (Sweden)
Mahmoud Mansour
2009-01-01
Full Text Available Peroxisome proliferator-activated receptor gamma (PPAR activation decreased serum testosterone (T in women with hyperthecosis and/or polycystic ovary syndrome and reduced the conversion of androgens to estradiol (E2 in female rats. This implies modulation of female sex steroid hormones by PPAR. It is not clear if PPAR modulates sex steroid hormones in diabetic males. Because PPAR activation by thiazolidinedione increased insulin sensitivity in type 2 diabetes, understanding the long term impact of PPAR activation on steroid sex hormones in males is critical. Our objective was to determine the effect of PPAR activation on serum and intratesticular T, luteinizing hormone (LH, follicle stimulating hormone (FSH and E2 concentrations in male Zucker diabetic fatty (ZDF rats treated with the PPAR agonist rosiglitazone (a thiazolidinedione. Treatment for eight weeks increased PPAR mRNA and protein in the testis and elevated serum adiponectin, an adipokine marker for PPAR activation. PPAR activation did not alter serum or intratesticular T concentrations. In contrast, serum T level but not intratesticular T was reduced by diabetes. Neither diabetes nor PPAR activation altered serum E2 or gonadotropins FSH and LH concentrations. The results suggest that activation of PPAR by rosiglitazone has no negative impact on sex hormones in male ZDF rats.
Peers, P.V.; Semple, J.; Lai, R.Y.K.; Smith, G.R.; Altman, J.; Risner, M.; Riedel, W.J.
2006-01-01
Background: Rosiglitazone (a PPARg agonist) has shown beneficial effects on memory and executive function tasks in Alzheimer’s disease (AD)[1] Objective(s): To examine the use of standard clinical measures (e.g ADAS-cog) and experimental measures of simple and choice reaction time (examining
Directory of Open Access Journals (Sweden)
Kun Ho Yoon
2011-02-01
Full Text Available BackgroundAlthough many anti-diabetic drugs have been used to control hyperglycemia for decades, the efficacy of commonly-used oral glucose-lowering agents in Korean type 2 diabetic patients has yet to be clearly demonstrated.MethodsWe evaluated the efficacy of glimepiride, metformin, and rosiglitazone as initial treatment for drug-naïve type 2 diabetes mellitus patients in a 48-week, double-blind, randomized controlled study that included 349 Korean patients. Our primary goal was to determine the change in HbA1c levels from baseline to end point. Our secondary goal was to evaluate changes in fasting plasma glucose (FPG levels, body weight, frequency of adverse events, and the proportion of participants achieving target HbA1c levels.ResultsHbA1c levels decreased from 7.8% to 6.9% in the glimepiride group (P<0.001, from 7.9% to 7.0% in the metformin group (P<0.001, and from 7.8% to 7.0% (P<0.001 in the rosiglitazone group. Glimepiride and rosiglitazone significantly increased body weight and metformin reduced body weight during the study period. Symptomatic hypoglycemia was more frequent in the glimepiride group and diarrhea was more frequent in the metformin group.ConclusionThe efficacy of glimepiride, metformin, and rosiglitazone as antidiabetic monotherapies in drug-naïve Korean type 2 diabetic patients was similar in the three groups, with no statistical difference. This study is the first randomized controlled trial to evaluate the efficacy of commonly-used oral hypoglycemic agents in Korean type 2 diabetic patients. An additional subgroup analysis is recommended to obtain more detailed information.
Saatchi, Katayoun; Tod, Sarah E; Leung, Donna; Nicholson, Kenton E; Andreu, Irene; Buchwalder, Christian; Schmitt, Veronika; Häfeli, Urs O; Gray, Sarah L
2017-02-01
Obesity is a state of positive energy balance where excess white adipose tissue accumulates to the detriment of metabolic health. Improving adipocyte function with systemic administration of thiazolidinediones (TZDs) improves metabolic outcomes in obesity, however TZD use is limited clinically due to undesirable side effects. Here we evaluate magnetic nanoparticles (MNPs) as a tool to target rosiglitazone (Rosi) specifically to adipose tissue. Results show Rosi can be adsorbed to MNPs (Rosi-MNPs) with hydrophobic coatings for which we present binding and release kinetics. Rosi adsorbed to MNPs retained the ability to induce PPARγ target gene expression in cells. Biodistribution analysis of radiolabeled Rosi-MNPs revealed a fat-implanted magnet significantly enhanced localization of Rosi to the targeted adipose tissue when administered by subcutaneous injection to obese mice. We propose MNPs for targeted delivery of anti-diabetic agents to superficially located subcutaneous adipose tissue. Copyright © 2016 Elsevier Inc. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Kuda, Ondřej; Jílková, Zuzana; Rossmeisl, Martin; Flachs, Pavel; Ogston, N. C.; Mohamed-Ali, V.; Cinti, S.; Kopecký, Jan
2007-01-01
Roč. 50, Suppl.1 (2007), S260-S260 ISSN 0012-186X. [Annual Meeting of the European Association for the Study of Diabetes /43./. 18.09.2007-21.09.2007, Amsterdam] R&D Projects: GA ČR(CZ) GD303/03/H065 Institutional research plan: CEZ:AV0Z50110509 Keywords : cpo1 * insulin * rosiglitazone * PUFA Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition
Energy Technology Data Exchange (ETDEWEB)
Kim, Ki Young; Kim, Joo Young; Sung, Yoon-Young; Jung, Won Hoon; Kim, Hee-Youn; Park, Ji Seon; Cheon, Hyae Gyeong [Medicinal Science Division, Korea Research Institute of Chemical Technology, 100 Jang-dong, Yuseong, 305-600 Daejon (Korea, Republic of); Rhee, Sang Dal, E-mail: sdrhee@krict.re.kr [Medicinal Science Division, Korea Research Institute of Chemical Technology, 100 Jang-dong, Yuseong, 305-600 Daejon (Korea, Republic of)
2011-03-25
Research highlights: {yields} In this study, we investigated the effects of leptin on adipocyte differentiation prepared from subcutaneous fat of TallyHo mice. {yields} Leptin inhibited the adipocytes differentiation at physiological concentration via inhibition of PPAR{gamma} expression. {yields} Inhibitors of ERK and STAT1 restored the leptin's inhibitory activity both in vitro and in vivo. -- Abstract: The effects of leptin on rosiglitazone-induced adipocyte differentiation were investigated in the primary adipocytes prepared from subcutaneous fat of TallyHO/Jng (TallyHO) mouse, a recently developed model animal for type 2 diabetes mellitus (T2DM). The treatment of leptin inhibited the rosiglitazone-induced adipocyte differentiation with a decreased expression of peroxisome proliferator-activated receptor {gamma} (PPAR{gamma}) a key adipogenic transcription factor, both in mRNA and protein levels. Leptin (10 nM) was sufficient to inhibit the adipocyte differentiation, which seemed to come from increased expression of leptin receptor genes in the fat of TallyHO mice. The inhibition of adipogenesis by leptin was restored by the treatment of inhibitors for extracellular-signal-regulated kinase (ERK) (PD98059) and signal transducer and activator of transcription-1 (STAT1) (fludarabine). Furthermore, in vivo intraperitoneal administration of PD98059 and fludarabine increased the PPAR{gamma} expression in the subcutaneous fat of TallyHO mice. These data suggest that leptin could inhibit the PPAR{gamma} expression and adipocyte differentiation in its physiological concentration in TallyHO mice.
Potenza, Maria A; Marasciulo, Flora L; Tarquinio, Mariela; Quon, Michael J; Montagnani, Monica
2006-12-01
Spontaneously hypertensive rats (SHRs) exhibit endothelial dysfunction and insulin resistance. Reciprocal relationships between endothelial dysfunction and insulin resistance may contribute to hypertension by causing imbalanced regulation of endothelial-derived vasodilators (e.g., nitric oxide) and vasoconstrictors (e.g., endothelin-1 [ET-1]). Treatment of SHRs with rosiglitazone (insulin sensitizer) and/or enalapril (ACE inhibitor) may simultaneously improve hypertension, insulin resistance, and endothelial dysfunction by rebalancing insulin-stimulated production of vasoactive mediators. When compared with WKY control rats, 12-week-old vehicle-treated SHRs were hypertensive, overweight, and insulin resistant, with elevated fasting levels of insulin and ET-1 and reduced serum adiponectin levels. In mesenteric vascular beds (MVBs) isolated from vehicle-treated SHRs and preconstricted with norepinephrine (NE) ex vivo, vasodilator responses to insulin were significantly impaired, whereas the ability of insulin to oppose vasoconstrictor actions of NE was absent (versus WKY controls). Three-week treatment of SHRs with rosiglitazone and/or enalapril significantly reduced blood pressure, insulin resistance, fasting insulin, and ET-1 levels and increased adiponectin levels to values comparable with those observed in vehicle-treated WKY controls. By restoring phosphatidylinositol 3-kinase-dependent effects, rosiglitazone and/or enalapril therapy of SHRs also significantly improved vasodilator responses to insulin in MVB preconstricted with NE ex vivo. Taken together, our data provide strong support for the existence of reciprocal relationships between endothelial dysfunction and insulin resistance that may be relevant for developing novel therapeutic strategies for the metabolic syndrome.
Yanik, Susan C.; Baker, Amelia H.; Mann, Koren K.; Schlezinger, Jennifer J.
2011-01-01
Adipocyte differentiation in bone marrow is potentially deleterious to both bone integrity and lymphopoiesis. Here, we examine the hypothesis that organotins, common environmental contaminants that are dual ligands for peroxisome proliferator–activated receptor (PPAR) γ and its heterodimerization partner retinoid X receptor (RXR), are potent activators of bone marrow adipogenesis. A C57Bl/6-derived bone marrow multipotent mesenchymal stromal cell (MSC) line, BMS2, was treated with rosiglitazone, a PPARγ agonist, bexarotene, an RXR agonist, or a series of organotins. Rosiglitazone and bexarotene potently activated adipocyte differentiation; however, bexarotene had a maximal efficacy of only 20% of that induced by rosiglitazone. Organotins (tributyltin [TBT], triphenyltin, and dibutyltin) also stimulated adipocyte differentiation (EC50 of 10–20nM) but with submaximal, structure-dependent efficacy. In coexposures, both bexarotene and TBT enhanced rosiglitazone-induced adipogenesis. To investigate the contribution of PPARγ to TBT-induced adipogenesis, we examined expression of PPARγ2, as well as its transcriptional target FABP4. TBT-induced PPARγ2 and FABP4 protein expression with an efficacy intermediate between rosiglitazone and bexarotene, similar to lipid accumulation. A PPARγ antagonist and PPARγ-specific small hairpin RNA suppressed TBT-induced differentiation, although to a lesser extent than rosiglitazone-induced differentiation, suggesting that TBT may engage alternate pathways. TBT and bexarotene, but not rosiglitazone, also induced the expression of TGM2 (an RXR target) and ABCA1 (a liver X receptor target). The results show that an environmental contaminant, acting with the same potency as a therapeutic drug, induces PPARγ-dependent adipocyte differentiation in bone marrow MSCs. Activation of multiple nuclear receptor pathways by organotins may have significant implications for bone physiology. PMID:21622945
Directory of Open Access Journals (Sweden)
Olga Horakova
Full Text Available Insulin resistance, the key defect in type 2 diabetes (T2D, is associated with a low capacity to adapt fuel oxidation to fuel availability, i.e., metabolic inflexibility. This, in turn, contributes to a further damage of insulin signaling. Effectiveness of T2D treatment depends in large part on the improvement of insulin sensitivity and metabolic adaptability of the muscle, the main site of whole-body glucose utilization. We have shown previously in mice fed an obesogenic high-fat diet that a combined use of n-3 long-chain polyunsaturated fatty acids (n-3 LC-PUFA and thiazolidinediones (TZDs, anti-diabetic drugs, preserved metabolic health and synergistically improved muscle insulin sensitivity. We investigated here whether n-3 LC-PUFA could elicit additive beneficial effects on metabolic flexibility when combined with a TZD drug rosiglitazone. Adult male C57BL/6N mice were fed an obesogenic corn oil-based high-fat diet (cHF for 8 weeks, or randomly assigned to various interventions: cHF with n-3 LC-PUFA concentrate replacing 15% of dietary lipids (cHF+F, cHF with 10 mg rosiglitazone/kg diet (cHF+ROSI, cHF+F+ROSI, or chow-fed. Indirect calorimetry demonstrated superior preservation of metabolic flexibility to carbohydrates in response to the combined intervention. Metabolomic and gene expression analyses in the muscle suggested distinct and complementary effects of the interventions, with n-3 LC-PUFA supporting complete oxidation of fatty acids in mitochondria and the combination with n-3 LC-PUFA and rosiglitazone augmenting insulin sensitivity by the modulation of branched-chain amino acid metabolism. These beneficial metabolic effects were associated with the activation of the switch between glycolytic and oxidative muscle fibers, especially in the cHF+F+ROSI mice. Our results further support the idea that the combined use of n-3 LC-PUFA and TZDs could improve the efficacy of the therapy of obese and diabetic patients.
International Nuclear Information System (INIS)
Prawitt, Janne; Niemeier, Andreas; Kassem, Moustapha; Beisiegel, Ulrike; Heeren, Joerg
2008-01-01
There is a great demand for cell models to study human adipocyte function. Here we describe the adipogenic differentiation of a telomerase-immortalized human mesenchymal stem cell line (hMSC-Tert) that maintains numerous features of terminally differentiated adipocytes even after prolonged withdrawal of the peroxisome proliferator activated receptor γ (PPARγ) agonist rosiglitazone. Differentiated hMSC-Tert developed the characteristic monolocular phenotype of mature adipocytes. The expression of adipocyte specific markers was highly increased during differentiation. Most importantly, the presence of the PPARγ agonist rosiglitazone was not required for the stable expression of lipoprotein lipase, adipocyte fatty acid binding protein and perilipin on mRNA and protein levels. Adiponectin expression was post-transcriptionally down-regulated in the absence of rosiglitazone. Insulin sensitivity as measured by insulin-induced phosphorylation of Akt and S6 ribosomal protein was also independent of rosiglitazone. In addition to commonly used adipogenic markers, we investigated further PPARγ-stimulated proteins with a role in lipid metabolism. We observed an increase of lipoprotein receptor (VLDLR, LRP1) and apolipoprotein E expression during differentiation. Despite this increased expression, the receptor-mediated endocytosis of lipoproteins was decreased in differentiated adipocytes, suggesting that these proteins may have an additional function in adipose tissue beyond lipoprotein uptake
Production of prostate-specific antigen by a breast cancer cell line, Sk-Br-3
International Nuclear Information System (INIS)
Kamali Sarvestani, E.; Ghaderi, A.
2002-01-01
Prostate-specific antigen is a 33-KDa serine protease that is produced predominantly by prostate epithelium. However, it has been shown that about 30-40% of female breast tumors produce prostate-specific antigen and its production is associated with the presence of estrogen and progesterone receptors. We have now developed a new tissue culture system to study prostate-specific antigen production in breast cancer and its association with prognostic factors such as progesterone receptor and c-erbB-2. For this purpose we investigated the ability of prostate-specific antigen production in five different cell lines, including two breast cancer cell lines, Sk-Br-3 and MDA-MB-453. The prostate-specific antigen in tissue culture supernatant and cytoplasm of the Sk-Br-3 cell line was detected by western blotting and immunoperoxidase, respectively. Furthermore, we found lower expression of c-erbB-2 in Sk-Br-3 than non-prostate-specific antigen producer breast cancer cell line, MDA-MB-453. Progesterone receptor was expressed by both prostate-specific antigen-positive and -negative cell lines and only the intensity of staining and the number of positive cells in Sk-Br-3 population was higher than MDA-MB-453. According to our findings prostate-specific antigen can be considered as a good prognostic factor in breast cancer and we suggest that these two cell lines are a good in vitro model to study the relationship of different breast cancer prognostic factors and their regulations
Identification of genome-specific transcripts in wheat–rye translocation lines
Directory of Open Access Journals (Sweden)
Tong Geon Lee
2015-09-01
Full Text Available Studying gene expression in wheat–rye translocation lines is complicated due to the presence of homeologs in hexaploid wheat and high levels of synteny between wheat and rye genomes (Naranjo and Fernandez-Rueda, 1991 [1]; Devos et al., 1995 [2]; Lee et al., 2010 [3]; Lee et al., 2013 [4]. To overcome limitations of current gene expression studies on wheat–rye translocation lines and identify genome-specific transcripts, we developed a custom Roche NimbleGen Gene Expression microarray that contains probes derived from the sequence of hexaploid wheat, diploid rye and diploid progenitors of hexaploid wheat genome (Lee et al., 2014. Using the array developed, we identified genome-specific transcripts in a wheat–rye translocation line (Lee et al., 2014. Expression data are deposited in the NCBI Gene Expression Omnibus (GEO under accession number GSE58678. Here we report the details of the methods used in the array workflow and data analysis.
Czech Academy of Sciences Publication Activity Database
Kuda, Ondřej; Jeleník, Tomáš; Jílková, Zuzana; Flachs, Pavel; Rossmeisl, Martin; Hensler, Michal; Kazdová, L.; Ogston, N.; Baranowski, M.; Gorski, J.; Janovská, Petra; Kůs, Vladimír; Polák, J.; Mohamed-Ali, V.; Burcelin, R.; Cinti, S.; Bryhn, M.; Kopecký, Jan
2009-01-01
Roč. 52, č. 5 (2009), s. 941-951 ISSN 0012-186X R&D Projects: GA ČR(CZ) GA303/08/0664; GA MŠk(CZ) 1M0520; GA MŠk(CZ) OC08007 Grant - others:EC(XE) LSMH-CT-2004005272 Institutional research plan: CEZ:AV0Z50110509 Keywords : fish oil * rosiglitazone * obesity Subject RIV: FB - Endocrinology, Diabetology, Metabolism, Nutrition Impact factor: 6.551, year: 2009
Directory of Open Access Journals (Sweden)
Rashmi Choudhary
2010-03-01
Full Text Available Work from our laboratory and others has demonstrated that activation of the nuclear receptor peroxisome proliferator-activated receptor-γ (PPARγ inhibits transformed growth of non-small cell lung cancer (NSCLC cell lines in vitro and in vivo. We have demonstrated that activation of PPARγ promotes epithelial differentiation of NSCLC by increasing expression of E-cadherin, as well as inhibiting expression of COX-2 and nuclear factor-κB. The Snail family of transcription factors, which includes Snail (Snail1, Slug (Snail2, and ZEB1, is an important regulator of epithelial-mesenchymal transition, as well as cell survival. The goal of this study was to determine whether the biological responses to rosiglitazone, a member of the thiazolidinedione family of PPARγ activators, are mediated through the regulation of Snail family members. Our results indicate that, in two independent NSCLC cell lines, rosiglitazone specifically decreased expression of Snail, with no significant effect on either Slug or ZEB1. Suppression of Snail using short hairpin RNA silencing mimicked the effects of PPARγ activation, in inhibiting anchorage-independent growth, promoting acinar formation in three-dimensional culture, and inhibiting invasiveness. This was associated with the increased expression of E-cadherin and decreased expression of COX-2 and matrix metaloproteinases. Conversely, overexpression of Snail blocked the biological responses to rosiglitazone, increasing anchorage-independent growth, invasiveness, and promoting epithelial-mesenchymal transition. The suppression of Snail expression by rosiglitazone seemed to be independent of GSK-3 signaling but was rather mediated through suppression of extracellular signal-regulated kinase activity. These findings suggest that selective regulation of Snail may be critical in mediating the antitumorigenic effects of PPARγ activators.
Effects of metformin, rosiglitazone and insulin on bone metabolism in patients with type 2 diabetes
DEFF Research Database (Denmark)
Stage, Tore Bjerregaard; Christensen, Mette-Marie Hougaard; Jørgensen, Niklas Rye
2018-01-01
BACKGROUND: Fracture risk is increased in individuals with type 2 diabetes (T2D). The pathophysiological mechanisms accentuating fracture risk in T2D are convoluted, incorporating factors such as hyperglycaemia, insulinopenia, and antidiabetic drugs. The objectives of this study were to assess...... treatment in 371 T2D patients. Participants were randomized to short or long-acting human insulin (non-blinded) and then further randomized to metformin + placebo, rosiglitazone + placebo, metformin + rosiglitazone or placebo + placebo (blinded). Fasting bone turnover markers (BTM) representing bone......-up of the trial were analysed in mixed-effects models that included adjustments for age, gender, BMI, renal function and repeated measures of HbA1c. RESULTS: BTMs increased from baseline to month 12 and remained higher at month 24, with CTX and PINP increasing 28.5% and 23.0% (all: p
Directory of Open Access Journals (Sweden)
Charlotte Rietbergen
2018-02-01
Full Text Available The current system of harm assessment of medicines has been criticized for relying on intuitive expert judgment. There is a call for more quantitative approaches and transparency in decision-making. Illustrated with the case of cardiovascular safety concerns for rosiglitazone, we aimed to explore a structured procedure for the collection, quality assessment, and statistical modeling of safety data from observational and randomized studies. We distinguished five stages in the synthesis process. In Stage I, the general research question, population and outcome, and general inclusion and exclusion criteria are defined and a systematic search is performed. Stage II focusses on the identification of sub-questions examined in the included studies and the classification of the studies into the different categories of sub-questions. In Stage III, the quality of the identified studies is assessed. Coding and data extraction are performed in Stage IV. Finally, meta-analyses on the study results per sub-question are performed in Stage V. A Pubmed search identified 30 randomized and 14 observational studies meeting our search criteria. From these studies, we identified 4 higher level sub-questions and 4 lower level sub-questions. We were able to categorize 29 individual treatment comparisons into one or more of the sub-question categories, and selected study duration as an important covariate. We extracted covariate, outcome, and sample size information at the treatment arm level of the studies. We extracted absolute numbers of myocardial infarctions from the randomized study, and adjusted risk estimates with 95% confidence intervals from the observational studies. Overall, few events were observed in the randomized studies that were frequently of relatively short duration. The large observational studies provided more information since these were often of longer duration. A Bayesian random effects meta-analysis on these data showed no significant increase
Pathway-specific differences between tumor cell lines and normal and tumor tissue cells
Directory of Open Access Journals (Sweden)
Tozeren Aydin
2006-11-01
Full Text Available Abstract Background Cell lines are used in experimental investigation of cancer but their capacity to represent tumor cells has yet to be quantified. The aim of the study was to identify significant alterations in pathway usage in cell lines in comparison with normal and tumor tissue. Methods This study utilized a pathway-specific enrichment analysis of publicly accessible microarray data and quantified the gene expression differences between cell lines, tumor, and normal tissue cells for six different tissue types. KEGG pathways that are significantly different between cell lines and tumors, cell lines and normal tissues and tumor and normal tissue were identified through enrichment tests on gene lists obtained using Significance Analysis of Microarrays (SAM. Results Cellular pathways that were significantly upregulated in cell lines compared to tumor cells and normal cells of the same tissue type included ATP synthesis, cell communication, cell cycle, oxidative phosphorylation, purine, pyrimidine and pyruvate metabolism, and proteasome. Results on metabolic pathways suggested an increase in the velocity nucleotide metabolism and RNA production. Pathways that were downregulated in cell lines compared to tumor and normal tissue included cell communication, cell adhesion molecules (CAMs, and ECM-receptor interaction. Only a fraction of the significantly altered genes in tumor-to-normal comparison had similar expressions in cancer cell lines and tumor cells. These genes were tissue-specific and were distributed sparsely among multiple pathways. Conclusion Significantly altered genes in tumors compared to normal tissue were largely tissue specific. Among these genes downregulation was a major trend. In contrast, cell lines contained large sets of significantly upregulated genes that were common to multiple tissue types. Pathway upregulation in cell lines was most pronounced over metabolic pathways including cell nucleotide metabolism and oxidative
[The characters and specific features of new human embryonic stem cells lines].
Krylova, T A; Kol'tsova, A M; Zenin, V V; Gordeeva, O F; Musorina, A S; Goriachaia, T S; Shlykova, S A; Kamenetskaia, Iu K; Pinaev, G P; Polianskaia, G G
2009-01-01
Four continuous human embryonic stem cell lines (SC1, SC2, SC3 and SC4), derived from the blastocysts has been described. The cell lines were cultivated on mitotically inactivated human feeder cells. The cell lines SC1 and SC2 have passed through 150 population doublings and the cell lines SC3 and SC4 -- near 120 populations doublings, which exceeds Hayflick limit sufficiently. These cell lines maintain high activity of alkaline phosphatase, expression of transcription factor OCT-4 and cell surface antigens (SSEA-4, TRA-1-60 and TRA-1-81), confirming their ESC status and human specificity. Immunofluorescent detection of antigens, characteristic of ectoderm, endoderm and mesoderm confirms the ability of these cells to retain their pluripotency under in vitro condition. PCR analysis revealed expression of six genes specific for pluripotent cells (OCT-4, NANOG, DPPA3/STELLA, TDGF/CRIPTO and LEFTYA). Correlation between the level of proliferative activity and the character of DNA-bound fluorescent staining was found. Fluorescent dyes, Hoechst 33342 and PI, produced diffuse staining of the nuclei in slowly proliferating cells of the SC1 and SC2 lines. In contrast, in actively proliferating cells of the SC3 and SC4 lines, the clear staining of the nuclei was observed. Upon changing the cultivation condition, proliferative activity of SC3 and SC4 lines decreased and became similar to that of SC1 and SC2 lines. The character of the fluorescent staining of all these lines was also shown to be similar. These results show that quality of the fluorescent staining with Hoechst 33342 and PI reflects the level of proliferation. Possible causes and mechanisms of this feature of human ESC are discussed.
Establishment of monoclonal HCC cell lines with organ site-specific tropisms
International Nuclear Information System (INIS)
Wan, Jinliang; Wen, Duo; Dong, Lili; Tang, Jun; Liu, Dongli; Liu, Yang; Tao, Zhonghua; Gao, Dongmei; Sun, Huichuan; Cao, Ya; Fan, Jia; Wu, Weizhong
2015-01-01
Organ site-specific metastasis is an ominous feature for most poor-prognostic hepatocellular carcinoma (HCC) patients. Cancer cell lines and animal models are indispensable for investigating the molecular mechanisms of organ specific tropism. However, till now, little is known about the drivers in HCC metastatic tropism, and also no effective way has been developed to block the process of tropistic metastasis. In this study, we established several monoclonal HCC cell lines from HCCLM3-RFP together with their xenograft models, and then analyzed their metastatic potentials and tropisms using in-vitro and in-vivo assays, and finally elucidated the driving forces of HCC tropistic metastases. Six monoclonal cell lines with different organ site-specific tropism were established successfully. SPARC, VCAM1 and ANGPTL4 were found positively correlated with the potentials of lung metastasis, while ITGA1 had a positive relation to lymph node metastasis of enterocoelia. By our powerful platforms, HCC metastatic tropisms in clinic could be easily mimicked and recapitulated for exploring the bilateral interactions between tumor and its microenvironment, elucidating the drivers of HCC metastatic tropisms, and testing anti-cancer effects of newly developed agent in pre-clinical stage. The online version of this article (doi:10.1186/s12885-015-1692-0) contains supplementary material, which is available to authorized users
Fitzpatrick, Lorraine A.; Bilezikian, John P.; Wooddell, Margaret; Paul, Gitanjali; Kolatkar, Nikheel S.; Nino, Antonio J.; Miller, Colin G.; Bogado, Cesar E.; Arnaud, Claude D.; Cobitz, Alexander R.
2012-01-01
Objectives Post-hoc analyses have shown an increase incidence of fractures among type 2 diabetes (T2DM) patients treated with thiazolidinediones (TZDs). The mechanisms by which TZDs may be associated with increased fracture risk is not well understood. This article describes the study design and baseline characteristics for a prospective, randomized, double-blind, active-controlled trial to evaluate the effects of rosiglitazone on changes in measures of skeletal structure, surrogates of bone strength and metabolism. Methods Postmenopausal women without osteoporosis and diagnosed with T2DM were randomized in a double-blind design to either rosiglitazone or metformin for 52 weeks, then all subjects received open-label metformin for 24 weeks. Study endpoints included changes in bone mineral density (BMD), quantitative computed tomography (QCT), digitized hip radiography (HXR) and high resolution magnetic resonance imaging (hrMRI). Serum markers of bone metabolism and indices of glycemic control were assessed within and between treatment groups. Results A total of 226 subjects were randomized. Baseline characteristics included: age 63.8 ± 6.5 years; years postmenopausal 16.9 ± 8.4; duration of diabetes 3.5 (1.8–7.8) years; body mass index (BMI) 31.4 ± 5.9 kg/m2; and glycated hemoglobin (HbA1c) 6.4 ± 0.65%. At baseline, mean T-scores were −0.95 ± 0.91 at the femoral neck, −0.02 ± 0.97 at the total hip and −0.55 ± 1.25 at the total spine. Since there are no well recognized techniques to determine bone mass and structure at the distal limbs (cortical bone sites where fractures were reported in RSG subjects), using the femoral neck as a surrogate for these areas may be a potential limitation of the study. Conclusion This is the first randomized trial utilizing multiple techniques to evaluate bone mass, structure, serum markers of bone remodeling, and potential reversibility of changes after discontinuation of rosiglitazone. This
Energy Technology Data Exchange (ETDEWEB)
Lee, Jeong Eun [Department of Pharmacology, College of Medicine, Hanyang University, Seoul (Korea, Republic of); Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Park, Jae Hyeon; Jang, Sea Jeong [Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Graduate School of Biomedical Science and Engineering, Hanyang University, Seoul (Korea, Republic of); Koh, Hyun Chul, E-mail: hckoh@hanyang.ac.kr [Department of Pharmacology, College of Medicine, Hanyang University, Seoul (Korea, Republic of); Hanyang Biomedical Research Institute, Seoul (Korea, Republic of); Graduate School of Biomedical Science and Engineering, Hanyang University, Seoul (Korea, Republic of)
2014-07-15
Oxidative stress can lead to expression of inflammatory transcription factors, which are important regulatory elements in the induction of inflammatory responses. One of the transcription factors, nuclear transcription factor kappa-B (NF-κB) plays a significant role in the inflammation regulatory process. Inflammatory cell death has been implicated in neuronal cell death in some neurodegenerative disorders such as Parkinson's disease (PD). In this study, we investigated the molecular mechanisms underlying apoptosis initiated by chlorpyrifos (CPF)-mediated oxidative stress. Based on the cytotoxic mechanism of CPF, we examined the neuroprotective effects of rosiglitazone (RGZ), a peroxisome proliferator-activated receptor gamma (PPAR-γ) agonist, against CPF-induced neuronal cell death. The treatment of SH-SY5Y cells with CPF induced oxidative stress. In addition, CPF activated the p38, JNK and ERK mitogen-activated protein kinases (MAPKs), and induced increases in the inflammatory genes such as COX-2 and TNF-α. CPF also induced nuclear translocation of NF-κB and inhibitors of NF-κB abolished the CPF-induced COX-2 expression. Pretreatment with RGZ significantly reduced ROS generation and enhanced HO-1 expression in CPF-exposed cells. RGZ blocked the activation of both p38 and JNK signaling, while ERK activation was strengthened. RGZ also attenuated CPF-induced cell death through the reduction of NF-κB-mediated proinflammatory factors. Results from this study suggest that RGZ may exert an anti-apoptotic effect against CPF-induced cytotoxicity by attenuation of oxidative stress as well as inhibition of the inflammatory cascade via inactivation of signaling by p38 and JNK, and NF-κB. - Highlights: • CPF induces apoptotic cell death in SH-SY5Y cells • ROS involved in CPF-mediated apoptotic cell death • Inflammation involved in CPF-mediated apoptotic cell death • Rosiglitazone modulates ROS and inflammatory response in CPF-treated cells.
International Nuclear Information System (INIS)
Kim, Hyo-Sup; Noh, Jung-Hyun; Hong, Seung-Hyun; Hwang, You-Cheol; Yang, Tae-Young; Lee, Myung-Shik; Kim, Kwang-Won; Lee, Moon-Kyu
2008-01-01
Peroxisome proliferator-activated receptor (PPAR)-γ is a member of the nuclear receptor superfamily, and its ligands, the thiazolidinediones, might directly stimulate insulin release and insulin synthesis in pancreatic β-cells. In the present study, we examined the effects of rosiglitazone (RGZ) on insulin release and synthesis in pancreatic β-cell (INS-1). Insulin release and synthesis were stimulated by treatment with RGZ for 24 h. RGZ upregulated the expressions of GLUT-2 and glucokinase (GCK). Moreover, it was found that RGZ increased the expression of BETA2/NeuroD gene which could regulate insulin gene expression. These results suggest that RGZ could stimulate the release and synthesis of insulin through the upregulation of GLUT-2, GCK, and BETA2/NeuroD gene expression
Screening and Establishment of Human Lung Cancer Cell Lines with Organ-specific Metastasis Potential
Directory of Open Access Journals (Sweden)
Qinghua ZHOU
2014-03-01
Full Text Available Background and objective Cancer metastasis is not only the malignant marker and characteristics, but also the main cause of failure to cure and lose their life in the patients with lung cancer. Lung cancer metastasis has organ-specific characteristics. The most common sites of lung cancer metastasis are mediastinal lymph node, brain, bone, liver and adrenal gland. The aim of this study is to screen and establish lung cancer cell model with organ-specific metastasis potential with human high-metastatic large cell lung cancer cell line L9981 established by our laboratory previously, and to provide cell models for studying the mechanisms and signal regulation of organ-specific metastasis of lung cancer. Materials and methods The parent lung cancer cell line, L9981-Luc, was inoculated in the armpit of nude mice. The live animal imaging system, IVIS-200, was used to detect the lung cancer organ-specific metastasis every week. When the organ-specific metastasis were established, the nude mices bearing the lung cancer were sacrificed when they became moribund. Under sterile conditions, the organs (mediastinal lymph nodes, lung, spinal column and brain with lung cancer organ-specific metastasis were removed and the metastasized nodules were dissected free of connective tissue and blood clots, and rinsed twice with medium. The metastasized nodules were finely minced using sterile scalpel blades in medium, and the cells were seeded in tissue culture dishes. Then, the cells with organ-specific metastasis potential were reinoculated into the armpit of nude mice, respectively. This processes were repeated to establish the organ-specific metastatic sublines of L9981-Luc cell line more than 10 times. Finally, the organ-specific metastasis sublines of L9981-Luc were screened and established, which the four cell lines have the characteristics only metastasized to brian, lung, bone and mediastinal lymph node. Results A group of organ-specific metastasis cell
The Effect of Rosiglitazone on Bone Quality in a Rat Model of Insulin Resistance and Osteoporosis
Sardone, Laura Donata
Rosiglitazone (RSG) is an insulin-sensitizing drug used to treat Type 2 Diabetes Mellitus (T2DM). Clinical trials show that women taking RSG experience more limb fractures than patients taking other T2DM drugs. The purpose of this study is to understand how RSG (3mg/kg/day and 10mg/kg/day) and the bisphosphonate alendronate (0.7mg/kg/week) alter bone quality in the male, female and female ovariectomized (OVX) Zucker fatty rat model over a 12 week period. Bone quality was evaluated by mechanical testing of cortical and trabecular bone. Microarchitecture, bone mineral density (BMD), cortical bone porosity, bone formation/resorption and mineralization were also measured. Female OVX RSG10mg/kg rats had significantly lower vertebral BMD and compromised trabecular architecture versus OVX controls. Increased cortical porosity and decreased mechanical properties occurred in these rats. ALN treatment prevented these negative effects in the OVX RSG model. Evidence of reduced bone formation and excess bone resorption was detected in female RSG-treated rats.
Adriaansen-Tennekes, R; de Vries Reilingh, G; Nieuwland, M G B; Parmentier, H K; Savelkoul, H F J
2009-09-01
Individual differences in nutrient sensitivity have been suggested to be related with differences in stress sensitivity. Here we used layer hens divergently selected for high and low specific antibody responses to SRBC (i.e., low line hens and high line hens), reflecting a genetically based differential immune competence. The parental line of these hens was randomly bred as the control line and was used as well. Recently, we showed that these selection lines differ in their stress reactivity; the low line birds show a higher hypothalamic-pituitary-adrenal (HPA) axis reactivity. To examine maternal effects and neonatal nutritional exposure on nutrient sensitivity, we studied 2 subsequent generations. This also created the opportunity to examine egg production in these birds. The 3 lines were fed 2 different nutritionally complete layer feeds for a period of 22 wk in the first generation. The second generation was fed from hatch with the experimental diets. At several time intervals, parameters reflecting humoral immunity were determined such as specific antibody to Newcastle disease and infectious bursal disease vaccines; levels of natural antibodies binding lipopolysaccharide, lipoteichoic acid, and keyhole limpet hemocyanin; and classical and alternative complement activity. The most pronounced dietary-induced effects were found in the low line birds of the first generation: specific antibody titers to Newcastle disease vaccine were significantly elevated by 1 of the 2 diets. In the second generation, significant differences were found in lipoteichoic acid natural antibodies of the control and low line hens. At the end of the observation period of egg parameters, a significant difference in egg weight was found in birds of the high line. Our results suggest that nutritional differences have immunomodulatory effects on innate and adaptive humoral immune parameters in birds with high HPA axis reactivity and affect egg production in birds with low HPA axis reactivity.
RNA-Mediated Gene Duplication and Retroposons: Retrogenes, LINEs, SINEs, and Sequence Specificity
2013-01-01
A substantial number of “retrogenes” that are derived from the mRNA of various intron-containing genes have been reported. A class of mammalian retroposons, long interspersed element-1 (LINE1, L1), has been shown to be involved in the reverse transcription of retrogenes (or processed pseudogenes) and non-autonomous short interspersed elements (SINEs). The 3′-end sequences of various SINEs originated from a corresponding LINE. As the 3′-untranslated regions of several LINEs are essential for retroposition, these LINEs presumably require “stringent” recognition of the 3′-end sequence of the RNA template. However, the 3′-ends of mammalian L1s do not exhibit any similarity to SINEs, except for the presence of 3′-poly(A) repeats. Since the 3′-poly(A) repeats of L1 and Alu SINE are critical for their retroposition, L1 probably recognizes the poly(A) repeats, thereby mobilizing not only Alu SINE but also cytosolic mRNA. Many flowering plants only harbor L1-clade LINEs and a significant number of SINEs with poly(A) repeats, but no homology to the LINEs. Moreover, processed pseudogenes have also been found in flowering plants. I propose that the ancestral L1-clade LINE in the common ancestor of green plants may have recognized a specific RNA template, with stringent recognition then becoming relaxed during the course of plant evolution. PMID:23984183
DEFF Research Database (Denmark)
Stage, Tore B; Christensen, Mette M H; Feddersen, Søren
2013-01-01
OBJECTIVE: The aim of this study was to examine the effect of single nucleotide polymorphisms in CYP2C8, LPIN1, PPARGC1A and PPARγ on rosiglitazone's (i) trough steady-state plasma concentration (C(ss,min)), (ii) on glycosylated haemoglobin A1c (HbA1c) and (iii) the risk of developing adverse eve...
Rosiglitazone Improves Survival and Hastens Recovery from Pancreatic Inflammation in Obese Mice
Pini, Maria; Rhodes, Davina H.; Castellanos, Karla J.; Cabay, Robert J.; Grady, Eileen F.; Fantuzzi, Giamila
2012-01-01
Obesity increases severity of acute pancreatitis (AP) by unclear mechanisms. We investigated the effect of the PPAR-gamma agonist rosiglitazone (RGZ, 0.01% in the diet) on severity of AP induced by administration of IL-12+ IL-18 in male C57BL6 mice fed a low fat (LFD) or high fat diet (HFD), under the hypothesis that RGZ would reduce disease severity in HFD-fed obese animals. In both LFD and HFD mice without AP, RGZ significantly increased body weight and % fat mass, with significant upregulation of adiponectin and suppression of erythropoiesis. In HFD mice with AP, RGZ significantly increased survival and hastened recovery from pancreatic inflammation, as evaluated by significantly improved pancreatic histology, reduced saponification of visceral adipose tissue and less severe suppression of erythropoiesis at Day 7 post-AP. This was associated with significantly lower circulating and pancreas-associated levels of IL-6, Galectin-3, osteopontin and TIMP-1 in HFD + RGZ mice, particularly at Day 7 post-AP. In LFD mice with AP, RGZ significantly worsened the degree of intrapancreatic acinar and fat necrosis as well as visceral fat saponification, without affecting other parameters of disease severity or inflammation. Induction of AP lead to major suppression of adiponectin levels at Day 7 in both HFD and HFD + RGZ mice. In conclusion, RGZ prevents development of severe AP in obese mice even though it significantly increases adiposity, indicating that obesity can be dissociated from AP severity by improving the metabolic and inflammatory milieu. However, RGZ worsens selective parameters of AP severity in LFD mice. PMID:22815875
Directory of Open Access Journals (Sweden)
Xinyue Jing
2016-01-01
Full Text Available We investigate the effect of electroacupuncture (EA on protecting the weight gain side effect of rosiglitazone (RSG in type 2 diabetes mellitus (T2DM rats and its possible mechanism in central nervous system (CNS. Our study showed that RSG (5 mg/kg significantly increased the body weight and food intake of the T2DM rats. After six-week treatment with RSG combined with EA, body weight, food intake, and the ratio of IWAT to body weight decreased significantly, whereas the ratio of BAT to body weight increased markedly. HE staining indicated that the T2DM-RSG rats had increased size of adipocytes in their IWAT, but EA treatment reduced the size of adipocytes. EA effectively reduced the lipid contents without affecting the antidiabetic effect of RSG. Furthermore, we noticed that the expression of PPARγ gene in hypothalamus was reduced by EA, while the expressions of leptin receptor and signal transducer and activator of transcription 3 (STAT3 were increased. Our results suggest that EA is an effective approach for inhibiting weight gain in T2DM rats treated by RSG. The possible mechanism might be through increased levels of leptin receptor and STAT3 and decreased PPARγ expression, by which food intake of the rats was reduced and RSG-induced weight gain was inhibited.
Adriaansen-Tennekes, R.; Vries Reilingh, de G.; Nieuwland, M.G.B.; Parmentier, H.K.; Savelkoul, H.F.J.
2009-01-01
Individual differences in nutrient sensitivity have been suggested to be related with differences in stress sensitivity. Here we used layer hens divergently selected for high and low specific antibody responses to SRBC (i.e., low line hens and high line hens), reflecting a genetically based
Identification of parental line specific effects of MLF2 on resistance to coccidiosis in chickens
2011-01-01
Background MLF2 was the candidate gene associated with coccidiosis resistance in chickens. Although single marker analysis supported the association between MLF2 and coccidiosis resistance, causative mutation relevant to coccidiosis was not identified yet. Thus, this study suggested segregation analysis of MLF2 haplotype and the association test of the other candidate genes using improved data transformation. Results A haplotype probably originated from one parental line was found out of 4 major haplotypes of MLF2. Frequency of this haplotype was 0.2 in parental chickens and its offspring in 12 families. Allele substitution effect of the MLF2 haplotype originated from a specific line was associated with increased body weight and fecal egg count explaining coccidiosis resistance. Nevertheless Box-Cox transformation was able to improve normality; association test did not produce obvious different results compared with analysis with log transformed phenotype. Conclusion Allele substitution effect analysis and classification of MLF2 haplotype identified the segregation of haplotype associated with coccidiosis resistance. The haplotype originated from a specific parental line was associated with improving disease resistance. Estimating effect of MLF2 haplotype on coccidiosis resistance will provide useful information for selecting animals or lines for future study. PMID:21645301
Modes in Component Behavior Specification via EBP and their Application in Product Lines
Czech Academy of Sciences Publication Activity Database
Kofroň, Jan; Plášil, František; Šerý, O.
2009-01-01
Roč. 51, č. 1 (2009), s. 31-41 ISSN 0950-5849 R&D Projects: GA AV ČR 1ET400300504 Grant - others:GA ČR(CZ) GA201/08/0266 Institutional research plan: CEZ:AV0Z10300504 Keywords : behavior specification * component modes * software product lines Subject RIV: JC - Computer Hardware ; Software Impact factor: 1.821, year: 2009
Comparison of Two Mouse Ameloblast-like Cell Lines for Enamel-specific Gene Expression
Directory of Open Access Journals (Sweden)
Juni eSarkar
2014-07-01
Full Text Available Ameloblasts are ectoderm-derived cells that produce an extracellular enamel matrix that mineralizes to form enamel. The development and use of immortalized cell lines, with a stable phenotype, is an important contribution to biological studies as it allows for the investigation of molecular activities without the continuous need for animals. In this study we compare the expression profiles of enamel-specific genes in two mouse derived ameloblast-like cell lines: LS8 and ALC cells. Quantitative PCR analysis indicates that, relative to each other, LS8 cells express greater mRNA levels for genes that define secretory-stage activities (Amelx, Ambn, Enam and Mmp20, while ALC express greater mRNA levels for genes that define maturation-stage activities (Odam and Klk4. Western blot analyses show that Amelx, Ambn and Odam proteins are detectable in ALC, but not LS8 cells. Unstimulated ALC cells form calcified nodules, while LS8 cells do not. These data provide greater insight as to the suitability of both cell lines to contribute to biological studies on enamel formation and biomineralization, and highlight some of the strengths and weaknesses when relying on enamel epithelial organ-derived cell lines to study molecular activities of amelogenesis.
International Nuclear Information System (INIS)
Davis, E.; Rasmussen, B.
2004-01-01
This report is a guide for a technical specification change submittal and subsequent implementation of on-line monitoring for safety-related applications. This report is the third in a three-volume set. Volume 1, ''Guidelines for Model Development and Implementation'', presents the various tasks that must be completed to prepare models for and to implement an on-line monitoring system
Flux line lattice melting transition in YBa2Cu3O6.94 observed in specific heat experiments
International Nuclear Information System (INIS)
Roulin, M.; Junod, A.; Walker, E.
1996-01-01
When a magnetic field penetrates a type II superconductor, it forms a lattice of thin quantized filaments called magnetic vortices. Resistance, magnetization, and neutron diffraction experiments have shown that the vortex lattice of high-temperature superconductors can melt along a line in the field-temperature plane. The calorimetric signature of melting on this line was observed in a high-accuracy adiabatic specific heat experiment performed on YBa 2 Cu 3 O 6.94 . The specific heat of the vortex liquid was greater than that of the vortex solid. 17 refs., 3 figs
Energy Technology Data Exchange (ETDEWEB)
E Davis, B Rasmussen
2004-12-31
This report is a guide for a technical specification change submittal and subsequent implementation of on-line monitoring for safety-related applications. This report is the third in a three-volume set. Volume 1, ''Guidelines for Model Development and Implementation'', presents the various tasks that must be completed to prepare models for and to implement an on-line monitoring system.
Damonneville, M; Velge, F; Verwaerde, C; Pestel, J; Auriault, C; Capron, A
1987-08-01
Antigens present in the products released by the larval stage of schistosome (SRP-A) were shown to induce a strong cytotoxic and protective IgE response both in the rat and the monkey. T cell lines and clones specific for SRP-A or 26 kD antigens which are the main target of the cytotoxic IgE have been derived. The passive transfer of SRP-A specific T lymphocytes into infected rats led to an increase of the IgE response, conferring a significant level of protection to the rats. In coculture assays in vitro, these cell lines significantly enhanced the production of IgE by SRP-A sensitized rat spleen cells. This helper effect on the IgE response was confirmed with 26 kD T cell clone supernatants. Moreover, supernatants obtained after stimulation with phorbol myristate acetate were able to enhance the IgE production of a hybridoma B cell line (B48-14) producing a monoclonal IgE antibody, cytotoxic for the schistosomula.
Directory of Open Access Journals (Sweden)
Cekić Vlada
2011-01-01
Full Text Available Introduction. In the recent years, herbal preparations have been more used to treat diabetes. Dietetic supplement based on barley and beer yeast enriched with chromium (BBCr is registered in Serbia as a supplement in the treatment of type 2 diabetes. Objective. To investigate the effect of the preparation based on barley and brewer’s yeast with chromium (BBCr, rosiglitazone (R and their combination (BBCr+R on fasting glycaemia and glycaemia in mice after glucose, adrenalin and alloxan application. Methods. The animals were divided into three groups: glucose 500 mg/kg (I; adrenalin 0.2 mg/kg (II; and alloxan 100 mg/kg (III and into subgroups according to the substance they received (BBCr: 750 mg/kg, R: 0.75 mg/kg and BBCr+R. Each animal was its own control in respect of glycaemia before and after the treatment with test substances, except for group III which contained a placebo subgroup. Results. BBCr caused a significant decrease of fasting glycaemia and significant reduction of glycaemia after glucose load compared to the values before treatment (7.4±0.6 mmol/l vs 9.2±0.6 mmol/l; p=0.01. R and BBCr+R significantly decreased glycaemia after adrenalin load (R: 8.6±1.8 mmol/l vs 15.4±3.2 mmol/l; p=0.004; BBCr+R: 9.6±2.4 mmol/l vs 15.0±4.4 mmol/l; p=0.04. After alloxan application the glycaemia was significantly lower in the subgroups treated with BBCr, R and BBCr+R compared to placebo subgroup (10.1±8.0 mmol/l vs 6.8±2.7 mmol/l vs 13.5±9.7 mmol/l vs 24.5±4.7 mmol/l; p=0.001. Conclusion. Pretreatment with BBCr caused a significant reduction of fasting glycaemia and glycaemia after glucose load. Rosiglitazone and BBCr+R caused a significant reduction of glycaemia after adrenalin load. Pretreatment with BBCr, R and BBCr+R prevented the onset of experimental diabetes caused by alloxan, which was confirmed by histological analysis of pancreas tissue.
Irradiation specifically sensitises solid tumour cell lines to TRAIL mediated apoptosis
International Nuclear Information System (INIS)
Marini, Patrizia; Schmid, Angelika; Jendrossek, Verena; Faltin, Heidrun; Daniel, Peter T; Budach, Wilfried; Belka, Claus
2005-01-01
TRAIL (tumor necrosis factor related apoptosis inducing ligand) is an apoptosis inducing ligand with high specificity for malignant cell systems. Combined treatment modalities using TRAIL and cytotoxic drugs revealed highly additive effects in different tumour cell lines. Little is known about the efficacy and underlying mechanistic effects of a combined therapy using TRAIL and ionising radiation in solid tumour cell systems. Additionally, little is known about the effect of TRAIL combined with radiation on normal tissues. Tumour cell systems derived from breast- (MDA MB231), lung- (NCI H460) colorectal- (Colo 205, HCT-15) and head and neck cancer (FaDu, SCC-4) were treated with a combination of TRAIL and irradiation using two different time schedules. Normal tissue cultures from breast, prostate, renal and bronchial epithelia, small muscle cells, endothelial cells, hepatocytes and fibroblasts were tested accordingly. Apoptosis was determined by fluorescence microscopy and western blot determination of PARP processing. Upregulation of death receptors was quantified by flow cytometry. The combined treatment of TRAIL with irradiation strongly increased apoptosis induction in all treated tumour cell lines compared to treatment with TRAIL or irradiation alone. The synergistic effect was most prominent after sequential application of TRAIL after irradiation. Upregulation of TRAIL receptor DR5 after irradiation was observed in four of six tumour cell lines but did not correlate to tumour cell sensitisation to TRAIL. TRAIL did not show toxicity in normal tissue cell systems. In addition, pre-irradiation did not sensitise all nine tested human normal tissue cell cultures to TRAIL. Based on the in vitro data, TRAIL represents a very promising candidate for combination with radiotherapy. Sequential application of ionising radiation followed by TRAIL is associated with an synergistic induction of cell death in a large panel of solid tumour cell lines. However, TRAIL receptor
Damonneville, M; Velge, F; Verwaerde, C; Pestel, J; Auriault, C; Capron, A
1987-01-01
Antigens present in the products released by the larval stage of schistosome (SRP-A) were shown to induce a strong cytotoxic and protective IgE response both in the rat and the monkey. T cell lines and clones specific for SRP-A or 26 kD antigens which are the main target of the cytotoxic IgE have been derived. The passive transfer of SRP-A specific T lymphocytes into infected rats led to an increase of the IgE response, conferring a significant level of protection to the rats. In coculture assays in vitro, these cell lines significantly enhanced the production of IgE by SRP-A sensitized rat spleen cells. This helper effect on the IgE response was confirmed with 26 kD T cell clone supernatants. Moreover, supernatants obtained after stimulation with phorbol myristate acetate were able to enhance the IgE production of a hybridoma B cell line (B48-14) producing a monoclonal IgE antibody, cytotoxic for the schistosomula. PMID:3498590
International Nuclear Information System (INIS)
Tai, Cheng-Jeng; Lee, Horng-Mo; Deng, Win-Ping; Wu, Alexander TH; Chiou, Jeng-Feng; Jan, Hsun-Jin; Wei, Hon-Jian; Hsu, Chung-Huei; Lin, Che-Tong; Chiu, Wen-Ta; Wu, Cheng-Wen
2010-01-01
Invasiveness and metastasis are the most common characteristics of non small cell lung cancer (NSCLC) and causes of tumour-related morbidity and mortality. Mitogen-activated protein kinases (MAPKs) signalling pathways have been shown to play critical roles in tumorigenesis. However, the precise pathological role(s) of mitogen-activated protein kinase phosphatase-1 (MKP-1) in different cancers has been controversial such that the up-regulation of MKP-1 in different cancers does not always correlate to a better prognosis. In this study, we showed that the induction of MKP-1 lead to a significant retardation of proliferation and metastasis in NSCLC cells. We also established that rosiglitazone (a PPARγ agonist) elevated MKP-1 expression level in NSCLC cells and inhibited tumour metastasis. Both wildtype and dominant negative forms of MKP-1 were constitutively expressed in NSCLC cell line H441GL. The migration and invasion abilities of these cells were examined in vitro. MKP-1 modulating agents such as rosiglitazone and triptolide were used to demonstrate MKP-1's role in tumorigenesis. Bioluminescent imaging was utilized to study tumorigenesis of MKP-1 over-expressing H441GL cells and anti-metastatic effect of rosiglitazone. Over-expression of MKP-1 reduced NSCLC cell proliferation rate as well as cell invasive and migratory abilities, evident by the reduced expression levels of MMP-2 and CXCR4. Mice inoculated with MKP-1 over-expressing H441 cells did not develop NSCLC while their control wildtype H441 inoculated littermates developed NSCLC and bone metastasis. Pharmacologically, rosiglitazone, a peroxisome proliferator activated receptor-γ (PPARγ) agonist appeared to induce MKP-1 expression while reduce MMP-2 and CXCR4 expression. H441GL-inoculated mice receiving daily oral rosiglitazone treatment demonstrated a significant inhibition of bone metastasis when compared to mice receiving sham treatment. We found that rosiglitazone treatment impeded the ability
Directory of Open Access Journals (Sweden)
Michelangela Barbieri
Full Text Available Understanding the molecular regulatory mechanisms controlling for myocardial lipid metabolism is of critical importance for the development of new therapeutic strategies for heart diseases. The role of PPARγ and thiazolidinediones in regulation of myocardial lipid metabolism is controversial. The aim of our study was to assess the role of PPARγ on myocardial lipid metabolism and function and differentiate local/from systemic actions of PPARs agonists using cardiomyocyte-specific PPARγ -knockout (CM-PGKO mice. To this aim, the effect of PPARγ, PPARγ/PPARα and PPARα agonists on cardiac function, intra-myocyte lipid accumulation and myocardial expression profile of genes and proteins, affecting lipid oxidation, uptake, synthesis, and storage (CD36, CPT1MIIA, AOX, FAS, SREBP1-c and ADPR was evaluated in cardiomyocyte-specific PPARγ-knockout (CM-PGKO and littermate control mice undergoing standard and high fat diet (HFD. At baseline, protein levels and mRNA expression of genes involved in lipid uptake, oxidation, synthesis, and accumulation of CM-PGKO mice were not significantly different from those of their littermate controls. At baseline, no difference in myocardial lipid content was found between CM-PGKO and littermate controls. In standard condition, pioglitazone and rosiglitazone do not affect myocardial metabolism while, fenofibrate treatment significantly increased CD36 and CPT1MIIA gene expression. In both CM-PGKO and control mice submitted to HFD, six weeks of treatment with rosiglitazone, fenofibrate and pioglitazone lowered myocardial lipid accumulation shifting myocardial substrate utilization towards greater contribution of glucose. In conclusion, at baseline, PPARγ does not play a crucial role in regulating cardiac metabolism in mice, probably due to its low myocardial expression. PPARs agonists, indirectly protect myocardium from lipotoxic damage likely reducing fatty acids delivery to the heart through the actions on adipose
Concept for Specific Lines of Business, Energy Saving Tourism
International Nuclear Information System (INIS)
Jilek, W.
1998-01-01
In the spirit of the objectives of the Energy Plan 1995 in order to make more efficient use of energy and thus to reduce energy requirements, to promote the use of renewable energies, and to attach maximum importance to the ecological compatibility of the energy systems, among other project the provincial government of Styria is pursuing the option of consulting small and medium-sized enterprises in a target manner. Three years after being launched, this Ecological Company Consulting scheme for various lines of business is now producing successful results, demonstrating that energy saving, business profit and ecology can go hand in hand by example of numerous pilot projects. Trade-specific concepts have been elaborated for foodstuffs, carpenters and car repair and sales firms, bakeries and hairdressers and, most recently, for tourist industry business /hotels, bars, restaurants, etc.). The province of Styria, represented by the Energy Commissioner and the department of waste management, is co-operating closely in the Ecological Company Consulting scheme with the Styrian Chamber of Commerce and the Economy Promotion Institute (Wirtschaftsfoerderungsinstitut). In several cases, other provinces, the Federal Ministry of Environmental, Youth and Family Affairs, and the Federal Chamber of Commerce have adopted the results of this co-operation, while in some cases subsidy schemes are linked to these trade-specific concepts. In the course of the scheme, the aim is to investigate energy requirements, saving potentials and questions of waste management. (author)
Yuan, Hong; Weng, Chunyan; Yang, Youbo; Huang, Lihua; Xing, Xiaowei
2013-12-01
The metabolic syndrome (MS) is a cluster of metabolic disorders arising from insulin resistance, characterized by the presence of central obesity, impaired fasting glucose level, dyslipidemia and hypertension. As the first-line medication, metformin is commonly used for MS to reduce insulin resistance. Comparing with rosiglitazone, metformin does not increase cardiovascular mortality risk in patients with MS. However, metformin is not good enough in improving insulin sensitivity. Its molecular mechanism is still not clear. Recent studies have demonstrated that resistin, an adipokine, could induce IR by both AMPK-dependent and AMPK-independent pathways. Though there were conflicting findings of resistin in metabolic syndrome or type 2 diabetes mellitus in different studies, resistin was significant decreased in the rosiglitazone treated patients than in the metformin-treated patients in most of studies. Here, we hypothesized that resistin, an adipokine, may affect the improvement of insulin sensitivity in the metabolic syndrome patient treated with metformin. This hypothesis could explain why rosiglitazone is superior to metformin in enhancement of insulin sensitivity. Copyright © 2013. Published by Elsevier Ltd.
Solarte, Víctor A; Rosas, Jaiver E; Rivera, Zuly J; Arango-Rodríguez, Martha L; García, Javier E; Vernot, Jean-Paul
2015-01-01
Several short linear peptides derived from cyclic bovine lactoferricin were synthesized and tested for their cytotoxic effect against the oral cavity squamous-cell carcinoma (OSCC) cell lines CAL27 and SCC15. As a control, an immortalized and nontumorigenic cell line, Het-1A, was used. Linear peptides based on the RRWQWR core sequence showed a moderate cytotoxic effect and specificity towards tumorigenic cells. A tetrameric peptide, LfcinB(20-25)4, containing the RRWQWR motif, exhibited greater cytotoxic activity (>90%) in both OSCC cell lines compared to the linear lactoferricin peptide or the lactoferrin protein. Additionally, this tetrameric peptide showed the highest specificity towards tumorigenic cells among the tested peptides. Interestingly, this effect was very fast, with cell shrinkage, severe damage to cell membrane permeability, and lysis within one hour of treatment. Our results are consistent with a necrotic effect rather than an apoptotic one and suggest that this tetrameric peptide could be considered as a new candidate for the therapeutic treatment of OSCC.
Prolonged decrease of adipocyte size after rosiglitazone treatment in high- and low-fat-fed rats.
Johnson, Julia A; Trasino, Steven E; Ferrante, Anthony W; Vasselli, Joseph R
2007-11-01
The anti-diabetic thiazolidinediones (TZDs) stimulate adipocyte differentiation and decrease mean adipocyte size. However, whether these smaller, more insulin-sensitive adipocytes maintain their size after TZD therapy is discontinued has not been studied. Adult female Sprague-Dawley rats were fed a low-fat (10% fat) diet or, to elevate body weight (BW), a high-fat (HF) diet (45% fat) for 6 weeks. Rats were initially randomized to groups (n = 12) fed either low-fat or HF diets, with or without the TZD rosiglitazone (ROSI; 5 mg/kg per day), for 6 weeks. ROSI was then discontinued, and all animals were fed HF for another 6 weeks before sacrifice. Retroperitoneal (RP) adipose tissue morphology was determined from tissue collected by serial biopsies before and after 6 weeks of ROSI treatment and at sacrifice. Measures of BW and adiposity did not differ among groups 6 weeks after stopping ROSI treatment. However, during treatment, ROSI in both diets significantly decreased RP adipocyte size and increased RP DNA content, and these effects continued to be observed after discontinuing treatment. ROSI administration also decreased circulating insulin, leptin, and triglycerides and increased circulating adiponectin levels; however, these effects were reversed on stopping treatment. These results demonstrated that TZD-induced effects on adipocyte size and number were maintained after discontinuing treatment, even with consumption of an obesigenic diet. However, additional studies are needed to determine whether TZD-treated animals eventually achieve an adipocyte size similar to that of untreated animals at the expense of a higher BW.
International Nuclear Information System (INIS)
Hirata, Y.; Uchihashi, M.; Nakashima, H.; Fujita, T.; Matsukura, S.; Matsui, K.
1984-01-01
Using tumour cell lines derived from human bone tumours, specific binding sites for epidermal growth factor (EGF), a potent growth stimulator in many tissues, and its effect on synthesis of prostaglandin (PG) E 2 , a potent bone-resorbing factor, by cultured osteosarcoma cell line were studied. Three tumour cell lines, one osteosarcoma (HOSO) and two giant cell tumours of the bone (G-1 and G-2), all possessed specific binding sites for 125 I-labelled EGF: the apparent dissociation constant was approximately 4-10 x 10 -10 M and the maximal binding capacity was 50 000-80 000 sites/cell. EGF had no mitogenic effect in these cell lines. However, these cell lines did not have specific binding sites for 125 I-labelled parathyroid hormone (PTH) or calcitonin. HOSO line produced and secreted PGE 2 into medium, while no significant amount of PGE 2 was demonstrated in G-1 or G-2 line. EGF significantly stimulated PGE 2 production in HOSO line in a dose-dependent manner (0.5-50 ng/ml); its stimulatory effect was completely abolished by indomethacin, an inhibitor of PG biosynthesis. Exogenous PGE 1 significantly stimulated cyclic AMP formation in HOSO line, whereas PGFsub(2α) PTH, calcitonin, or EGF had no effect. None of these calcium-regulating hormones affected cyclic AMP generation in either G-1 of G-2 line. These data indicate that human bone tumour cells have specific EGF receptors unrelated to cell growth, and suggest that EGF may be involved in bone resorption through a PGE 2 -mediated process in human osseous tissues. (author)
International Nuclear Information System (INIS)
Hays, W.H.
1998-01-01
This Specific Test and Evaluation Plan (STEP) defines the test and evaluation activities encompassing the installation of the SN-635 transfer line for the W-314 Project. The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made by the addition of the SN-635 transfer line and the tie in of SN-633 to the AY-02A pit by the W-314 Project. The STEP develops the outline for test procedures that verify the system's performance to the established Project design criteria. The STEP is a lower tier document based on the W-314 Test and Evaluation Plan (TEP)
Directory of Open Access Journals (Sweden)
Víctor A. Solarte
2015-01-01
Full Text Available Several short linear peptides derived from cyclic bovine lactoferricin were synthesized and tested for their cytotoxic effect against the oral cavity squamous-cell carcinoma (OSCC cell lines CAL27 and SCC15. As a control, an immortalized and nontumorigenic cell line, Het-1A, was used. Linear peptides based on the RRWQWR core sequence showed a moderate cytotoxic effect and specificity towards tumorigenic cells. A tetrameric peptide, LfcinB(20–254, containing the RRWQWR motif, exhibited greater cytotoxic activity (>90% in both OSCC cell lines compared to the linear lactoferricin peptide or the lactoferrin protein. Additionally, this tetrameric peptide showed the highest specificity towards tumorigenic cells among the tested peptides. Interestingly, this effect was very fast, with cell shrinkage, severe damage to cell membrane permeability, and lysis within one hour of treatment. Our results are consistent with a necrotic effect rather than an apoptotic one and suggest that this tetrameric peptide could be considered as a new candidate for the therapeutic treatment of OSCC.
DEFF Research Database (Denmark)
Haase, Rikke N; Megnekou, Rosette; Lundquist, Maja
2006-01-01
Placenta-sequestering Plasmodium falciparum parasites causing pregnancy-associated malaria express pregnancy-specific variant surface antigens (VSA(PAM)). We report here that VSA(PAM)-expressing patient isolates adhere strongly to the choriocarcinoma cell line BeWo and that the BeWo line can...... be used to efficiently select for VSA(PAM) expression in vitro....
Mechanism of arctigenin-mediated specific cytotoxicity against human lung adenocarcinoma cell lines.
Susanti, Siti; Iwasaki, Hironori; Inafuku, Masashi; Taira, Naoyuki; Oku, Hirosuke
2013-12-15
The lignan arctigenin (ARG) from the herb Arctium lappa L. possesses anti-cancer activity, however the mechanism of action of ARG has been found to vary among tissues and types of cancer cells. The current study aims to gain insight into the ARG mediated mechanism of action involved in inhibiting proliferation and inducing apoptosis in lung adenocarcinoma cells. This study also delineates the cancer cell specificity of ARG by comparison with its effects on various normal cell lines. ARG selectively arrested the proliferation of cancer cells at the G0/G1 phase through the down-regulation of NPAT protein expression. This down-regulation occurred via the suppression of either cyclin E/CDK2 or cyclin H/CDK7, while apoptosis was induced through the modulation of the Akt-1-related signaling pathway. Furthermore, a GSH synthase inhibitor specifically enhanced the cytotoxicity of ARG against cancer cells, suggesting that the intracellular GSH content was another factor influencing the susceptibility of cancer cells to ARG. These findings suggest that specific cytotoxicity of ARG against lung cancer cells was explained by its selective modulation of the expression of NPAT, which is involved in histone biosynthesis. The cytotoxicity of ARG appeared to be dependent on the intracellular GSH level. Copyright © 2013 Elsevier GmbH. All rights reserved.
Czech Academy of Sciences Publication Activity Database
Selicharová, Irena; Šanda, Miloslav; Mládková, Jana; Ohri, S. S.; Vashishta, A.; Fusek, M.; Jiráček, Jiří; Vetvicka, V.
2008-01-01
Roč. 19, č. 5 (2008), s. 1237-1244 ISSN 1021-335X R&D Projects: GA MZd NR8323 Grant - others:NIH(US) ROI CAA082159-03 Institutional research plan: CEZ:AV0Z40550506 Keywords : breast cancer * cell line * 2-DE * organ-specific metastases Subject RIV: CE - Biochemistry Impact factor: 1.524, year: 2008
Optimized gene editing technology for Drosophila melanogaster using germ line-specific Cas9.
Ren, Xingjie; Sun, Jin; Housden, Benjamin E; Hu, Yanhui; Roesel, Charles; Lin, Shuailiang; Liu, Lu-Ping; Yang, Zhihao; Mao, Decai; Sun, Lingzhu; Wu, Qujie; Ji, Jun-Yuan; Xi, Jianzhong; Mohr, Stephanie E; Xu, Jiang; Perrimon, Norbert; Ni, Jian-Quan
2013-11-19
The ability to engineer genomes in a specific, systematic, and cost-effective way is critical for functional genomic studies. Recent advances using the CRISPR-associated single-guide RNA system (Cas9/sgRNA) illustrate the potential of this simple system for genome engineering in a number of organisms. Here we report an effective and inexpensive method for genome DNA editing in Drosophila melanogaster whereby plasmid DNAs encoding short sgRNAs under the control of the U6b promoter are injected into transgenic flies in which Cas9 is specifically expressed in the germ line via the nanos promoter. We evaluate the off-targets associated with the method and establish a Web-based resource, along with a searchable, genome-wide database of predicted sgRNAs appropriate for genome engineering in flies. Finally, we discuss the advantages of our method in comparison with other recently published approaches.
Progesterone-specific stimulation of triglyceride biosynthesis in a breast cancer cell line (T-47D)
International Nuclear Information System (INIS)
Judge, S.M.; Chatterton, R.T. Jr.
1983-01-01
The purpose of this study was to examine the lactogenic response of human mammary cancer cell lines to hormones in vitro. Progesterone was found to stimulate the incorporation of 14C from [14C]acetate into triglycerides (TG) and to promote accumulation of TG with a fatty acid composition similar to that of human milk fat in T-47D cells. Lipid droplets were observed in larger numbers without concomitant accumulation of casein granules in cells incubated with progesterone, but secretion of lipid into the medium did not occur. An effect of progesterone on TG accumulation was detectable after 12 hr and was maximal at 72 hr. Increasing doses of progesterone (10(-9) to 10(-5) M) caused a progressive increase in TG accumulation. The presence of cortisol and/or prolactin did not alter TG formation nor the dose response of the cells to progesterone. The growth rate of T-47D cells was not altered by the presence of progesterone in the medium. Neither of the human mammary cancer cell lines, MCF-7 and HBL-100, nor the human fibroblast cell lines, 28 and 857, responded to progesterone. The data indicate that, while the normally lactogenic hormones do not stimulate milk product biosynthesis in the cell lines tested, progesterone specifically stimulated synthesis and accumulation of TG in the T-47D cells
Project W-314 specific test and evaluation plan for SN-633 transfer line (241-AX-B to 241-AY-02A)
International Nuclear Information System (INIS)
Hays, W.H.
1998-01-01
The purpose of this Specific Test and Evaluation Plan (STEP) is to provide a detailed written plan for the systematic testing of modifications made by the addition of the SN-633 transfer line by the W-314 Project. The STEP develops the outline for test procedures that verify the system's performance to the established Project design criteria. The STEP is a lower tier document based on the W-314 Test and Evaluation Plan (TEP). This STEP encompasses all testing activities required to demonstrate compliance to the project design criteria as it relates to the addition of transfer line SN-633. The Project Design Specifications (PDS) identify the specific testing activities required for the Project. Testing includes Validations and Verifications (e.g., Commercial Grade Item Dedication activities), Factory Acceptance Tests (FATs), installation tests and inspections, Construction Acceptance Tests (CATs), Acceptance Test Procedures (ATPs), Pre-Operational Test Procedures (POTPs), and Operational Test Procedures (OTPs). It should be noted that POTPs are not required for testing of the transfer line addition. The STEP will be utilized in conjunction with the TEP for verification and validation
Using Regularization to Infer Cell Line Specificity in Logical Network Models of Signaling Pathways
Directory of Open Access Journals (Sweden)
Sébastien De Landtsheer
2018-05-01
Full Text Available Understanding the functional properties of cells of different origins is a long-standing challenge of personalized medicine. Especially in cancer, the high heterogeneity observed in patients slows down the development of effective cures. The molecular differences between cell types or between healthy and diseased cellular states are usually determined by the wiring of regulatory networks. Understanding these molecular and cellular differences at the systems level would improve patient stratification and facilitate the design of rational intervention strategies. Models of cellular regulatory networks frequently make weak assumptions about the distribution of model parameters across cell types or patients. These assumptions are usually expressed in the form of regularization of the objective function of the optimization problem. We propose a new method of regularization for network models of signaling pathways based on the local density of the inferred parameter values within the parameter space. Our method reduces the complexity of models by creating groups of cell line-specific parameters which can then be optimized together. We demonstrate the use of our method by recovering the correct topology and inferring accurate values of the parameters of a small synthetic model. To show the value of our method in a realistic setting, we re-analyze a recently published phosphoproteomic dataset from a panel of 14 colon cancer cell lines. We conclude that our method efficiently reduces model complexity and helps recovering context-specific regulatory information.
Directory of Open Access Journals (Sweden)
Yamin Zhang
2017-12-01
Full Text Available Skin fibroblasts and tumor fibroblasts were extracted from a 64-year old male patient clinically diagnosed with laryngeal carcinoma. Control and tumor specific induced pluripotent stem cells were reprogrammed with 5 reprogramming factors, Klf-4, c-Myc, Oct-4, Sox-2, and Lin-28, using the messenger RNA reprogramming system. The transgene-free iPSC lines showed pluripotency, confirmed by immunofluorescence staining. The iPSC lines also showed normal karyotype, and could form embryoid bodies in vitro and differentiate into the 3 germ layers in vivo. This in vitro cellular model can be used to study the oncogenesis and pathogenesis of laryngeal carcinoma.
Sambhara, S R; Upadhya, A G; Miller, R G
1990-06-12
We describe a microculture system for the generation of CTL and T helper cells against peptides. Tryptic digest and cyanogen bromide fragments of chicken ovalbumin and synthetic peptides of ovalbumin (323-339) and influenza virus (NP 365-380) were used to generate CTL and T helper lines from unprimed T cells. These lines were both peptide-specific and MHC-restricted. The relative ease of generating peptide-specific, MHC-restricted CTL and helper T cell lines with as few as 10(6) unprimed lymphocytes can be an efficient method of detecting potential immunogenic determinants of an antigen.
Directory of Open Access Journals (Sweden)
Boris Betz
2012-01-01
Full Text Available Background. Nitric oxide (NO-signal transduction plays an important role in renal ischemia/reperfusion (I/R injury. NO produced by endothelial NO-synthase (eNOS has protective functions whereas NO from inducible NO-synthase (iNOS induces impairment. Rosiglitazone (RGZ, a peroxisome proliferator-activated receptor (PPAR-γ agonist exerted beneficial effects after renal I/R injury, so we investigated whether this might be causally linked with NOS imbalance. Methods. RGZ (5 mg/kg was administered i.p. to SD-rats (f subjected to bilateral renal ischemia (60 min. Following 24 h of reperfusion, inulin- and PAH-clearance as well as PAH-net secretion were determined. Morphological alterations were graded by histopathological scoring. Plasma NOx-production was measured. eNOS and iNOS expression was analyzed by qPCR. Cleaved caspase 3 (CC3 was determined as an apoptosis indicator and ED1 as a marker of macrophage infiltration in renal tissue. Results. RGZ improves renal function after renal I/R injury (PAH-/inulin-clearance, PAH-net secretion and reduces histomorphological injury. Additionally, RGZ reduces NOx plasma levels, ED-1 positive cell infiltration and CC3 expression. iNOS-mRNA is reduced whereas eNOS-mRNA is increased by RGZ. Conclusion. RGZ has protective properties after severe renal I/R injury. Alterations of the NO pathway regarding eNOS and iNOS could be an explanation of the underlying mechanism of RGZ protection in renal I/R injury.
An Asian poverty line? Issues and options
Klasen, Stephan
2016-01-01
Given Asia's record of rapid economic growth and the conceptual and empirical problems of the current international income poverty line ('dollar-a-day'), this paper discusses whether there is merit to develop an Asia-specific poverty line that addresses some of the shortcomings of the dollar-a-day line and additionally considers Asia's particular economic situation. We consider various ways of creating an Asia-specific poverty line, including an Asia-specific international income poverty line...
Directory of Open Access Journals (Sweden)
Pilar eAlberdi
2016-02-01
Full Text Available Anaplasma phagocytophilum are transmitted by Ixodes spp. ticks and have become one of the most common and relevant tick-borne pathogens due to their impact on human and animal health. Recent results have increased our understanding of the molecular interactions between Ixodes scapularis and A. phagocytophilum through the demonstration of tissue-specific molecular pathways that ensure pathogen infection, development and transmission by ticks. However, little is known about the Ixodes ricinus genes and proteins involved in the response to A. phagocytophilum infection. The tick species I. scapularis and I. ricinus are evolutionarily closely related and therefore similar responses are expected in A. phagocytophilum-infected cells. However, differences may exist between I. scapularis ISE6 and I. ricinus IRE/CTVM20 tick cells associated with tissue-specific signatures of these cell lines. To address this hypothesis, the transcriptional response to A. phagocytophilum infection was characterized by RNA sequencing and compared between I. scapularis ISE6 and I. ricinus IRE/CTVM20 tick cell lines. The transcriptional response to infection of I. scapularis ISE6 cells resembled that of tick hemocytes while the response in I. ricinus IRE/CTVM20 cells was more closely related to that reported previously in infected tick midguts. The inhibition of cell apoptosis by A. phagocytophilum appears to be a key adaptation mechanism to facilitate infection of both vertebrate and tick cells and was used to investigate further the tissue-specific response of tick cell lines to pathogen infection. The results supported a role for the intrinsic pathway in the inhibition of cell apoptosis by A. phagocytophilum infection of I. scapularis ISE6 cells. In contrast, the results in I. ricinus IRE/CTVM20 cells were similar to those obtained in tick midguts and suggested a role for the JAK/STAT pathway in the inhibition of apoptosis in tick cells infected with A. phagocytophilum
International Nuclear Information System (INIS)
Galton, J.E.; Xue, B.; Hochwald, G.M.; Thorbecke, G.J.
1982-01-01
Transplantable 7,12-dimethylbenz[a]anthracene-induced SC chicken fibrosarcoma (CHCT-NYU) lines were studied for their ability to grow in internal organs after iv injection (artificial metastases) into 1- to 3-week-old chickens. Some tumor lines were recently derived, whereas others were studied after many serial subcutaneous transplantations. Artificial metastases were seen in the stomach, pancreas, lungs, heart, and muscle, and occasionally in the kidneys and liver. Agammaglobulinemic recipients showed more extensive organ involvement than normal recipients of the same age. Whole-body ν-irradiation enhanced the incidence of artificial metastases, particularly in lungs. Antibody from the serum of a primary tumor-bearing host reduced the growth of the corresponding tumor in many organs. The metastatic pattern of line CHCT-NYU4 was a relatively stable property. However, intravenous transplantation of tumor cells from line CHCT-NYU4 taken from the liver, lungs, and pancreas of a single recipient established sublines with changes in organ specificity. After a few such serial transplants of liver-derived tumor, a line was derived that grew virtually in the liver alone. A subline with preference for growth in lungs was also obtained, but its ability to grow in the pancreas persisted. A pancreas-derived tumor line also grew in the liver and lungs. Subcutaneous transplants of tissue fragments of the lung-derived tumor line caused the appearance of spontaneous metastases in lungs. The incidence of spontaneous metastases with the lung-derived line was much greater than that with the liver-derived line or with the original CHCT-NYU4 line
Zhao, Menglin; Wang, Jiaxian; Luo, Manyu; Luo, Han; Zhao, Meiqi; Han, Lei; Zhang, Mengxiao; Yang, Hui; Xie, Yueqing; Jiang, Hua; Feng, Lei; Lu, Huili; Zhu, Jianwei
2018-07-01
Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.
International Nuclear Information System (INIS)
Lee, Yen-Min; Li, Jia-Han; Cheng, Hsin-Hung; Wang, Fu-Min; Shen, Yu-Tian; Tsai, Kuen-Yu; Shieh, Jason J; Chen, Alek C
2014-01-01
The Fourier scatterometry model was used to measure the ZEP 520A electron beam resist lines with specific line edge roughness (LER). By obtaining the pupils via an objective lens, the angle-resolved diffraction spectrum was collected efficiently without additional mechanical scanning. The concavity of the pupil was considered as the weight function in specimen recognition. A series of white noises was examined in the model, and the tolerant white noise levels for different system numerical apertures (NAs) were reported. Our numerical results show that the scatterometry model of a higher NA can identify a target with a higher white noise level. Moreover, the fabricated ZEP 520A electron beam resist gratings with LER were measured by using our model, and the fitting results were matched with scanning electron microscope measurements. (paper)
Brown, Allan C.D.; Schmidt, Nancy M.
1984-01-01
The development of a micro-computer application for the on-line prediction of surgeon-specific operating room time using an IBM - PCXT is described. The reasons leading to the project, together with an assessment of the Condor 20 relational database management system as the basis for the application are discussed.
Beneficial effects of co-enzyme Q10 and rosiglitazone in fructose-induced metabolic syndrome in rats
Directory of Open Access Journals (Sweden)
Suzan M. Mansour
2013-06-01
Full Text Available Increased fructose consumption is strongly associated with metabolic syndrome (MS. This study was performed to elucidate the role of co-enzyme Q10 (CoQ and/or rosiglitazone (Rosi in fructose induced MS. Four groups of rats (n = 8–10 were fed on fructose-enriched diet (FED for 16 weeks. One served as FED-control while the remaining groups were treated with CoQ (10 mg/kg/day, Rosi (4 mg/kg/day or their combination during the last 6 weeks. Another group was fed on normal laboratory chow (normal control. At the end of the experiment, blood samples were collected for estimation of markers related to MS. In addition, histological examination of liver, kidney and pancreas samples was done. Induction of the MS was associated with increased body weight gain (34% coupled with elevated levels of blood glucose (48%, insulin (86%, insulin resistance (270%, uric acid (69%, urea (155%, creatinine (129% and blood lipids with different degrees. Fructose-induced MS also reduced plasma catalase (62% and glutathione peroxidase (89% activities parallel to increased serum leptin and tumor necrosis factor-alpha (TNF-α levels. These changes were coupled by marked histological changes in the examined tissues. Treatment with CoQ or Rosi attenuated most of MS-induced changes. Besides, the combination of both agents further reduced blood glucose, total cholesterol, triglycerides and urea levels, as well as, normalized serum levels of leptin and TNF-α. In addition, combined therapy of both agents elevated HDL-cholesterol level and glutathione peroxidase activity. In conclusion, the present study proves the benefits of co-supplementation of CoQ and Rosi in a fructose-induced model of insulin resistance.
International Nuclear Information System (INIS)
Droms, K.; Sueoka, N.
1987-01-01
This report describes the induction of cell-type-specific maturation, by dibutyryl-cAMP and testololactone, of neuronal and glial properties in a family of cell lines derived from a rat peripheral neurotumor, RT4. This maturation allows further understanding of the process of determination because of the close lineage relationship between the cell types of the RT4 family. The RT4 family is characterized by the spontaneous conversion of one of the cell types, RT4-AC (stem-cell type), to any of three derivative cell types, RT4-B, RT4-D, or RT4-E, with a frequency of about 10(-5). The RT4-AC cells express some properties characteristic of both neuronal and glial cells. Of these neural properties expressed by RT4-AC cells, only the neuronal properties are expressed by the RT4-B and RT4-E cells, and only the glial properties are expressed by the RT4-D cells. This in vitro cell-type conversion of RT4-AC to three derivative cell types is a branch point for the coordinate regulation of several properties and seems to resemble determination in vivo. In our standard culture conditions, several other neuronal and glial properties are not expressed by these cell types. However, addition of dibutyryl-cAMP induces expression of additional properties, in a cell-type-specific manner: formation of long cellular processes in the RT4-B8 and RT4-E5 cell lines and expression of high-affinity uptake of gamma-aminobutyric acid, by a glial-cell-specific mechanism, in the RT4-D6-2 cell line. These new properties are maximally expressed 2-3 days after addition of dibutyryl-cAMP
Meyer, P; Heidmann, I
1994-05-25
We analysed de novo DNA methylation occurring in plants obtained from the transgenic petunia line R101-17. This line contains one copy of the maize A1 gene that leads to the production of brick-red pelargonidin pigment in the flowers. Due to its integration into an unmethylated genomic region the A1 transgene is hypomethylated and transcriptionally active. Several epigenetic variants of line 17 were selected that exhibit characteristic and somatically stable pigmentation patterns, displaying fully coloured, marbled or colourless flowers. Analysis of the DNA methylation patterns revealed that the decrease in pigmentation among the epigenetic variants was correlated with an increase in methylation, specifically of the transgene DNA. No change in methylation of the hypomethylated integration region could be detected. A similar increase in methylation, specifically in the transgene region, was also observed among progeny of R101-17del, a deletion derivative of R101-17 that no longer produces pelargonidin pigments due to a deletion in the A1 coding region. Again de novo methylation is specifically directed to the transgene, while the hypomethylated character of neighbouring regions is not affected. Possible mechanisms for transgene-specific methylation and its consequences for long-term use of transgenic material are discussed.
Effects of Na/K-ATPase and its ligands on bone marrow stromal cell differentiation
Directory of Open Access Journals (Sweden)
Moustafa Sayed
2014-07-01
Full Text Available Endogenous ligands of Na/K-ATPase have been demonstrated to increase in kidney dysfunction and heart failure. It is also reported that Na/K-ATPase signaling function effects stem cell differentiation. This study evaluated whether Na/K-ATPase activation through its ligands and associated signaling functions affect bone marrow stromal cells (BMSCs, also known as bone marrow-derived mesenchymal stem cells differentiation capacity. BMSCs were isolated from male Sprague–Dawley rats and cultured in minimal essential medium alpha (MEM-α supplemented with 15% Fetal Bovine serum (FBS. The results showed that marinobufagenin (MBG, a specific Na/K-ATPase ligand, potentiated rosiglitazone-induced adipogenesis in these BMSCs. Meanwhile, it attenuated BMSC osteogenesis. Mechanistically, MBG increased CCAAT/enhancer binding protein alpha (C/EBPα protein expression through activation of an extracellular regulated kinase (ERK signaling pathway, which leads to enhanced rosiglitazone-induced adipogenesis. Inhibition of ERK activation by U0126 blocks the effect of MBG on C/EBPα expression and on rosiglitazone-induced adipogenesis. Reciprocally, MBG reduced runt-related transcription factor 2 (RunX2 expression, which resulted in the inhibition of osteogenesis induced by β-glycerophosphate/ascorbic acid. MBG also potentiated rosiglitazone-induced adipogenesis in 3T3-L1 cells and in mouse BMSCs. These results suggest that Na/K-ATPase and its signaling functions are involved in the regulation of BMSCs differentiation.
Pan, Huei-Ju; Lin, Yiming; Chen, Yuqing E; Vance, Dennis E; Leiter, Edward H
2006-07-01
Given the heterogeneous nature of metabolic dysfunctions associated with insulin resistance and type 2 diabetes (T2D), a single pharmaceutical cannot be expected to provide complication-free therapy in all patients. Thiazolidinediones (TZD) increase insulin sensitivity, reduce blood glucose and improve cardiovascular parameters. However, in addition to increasing fat mass, TZD have the potential in certain individuals to exacerbate underlying hepatosteatosis and diabetic cardiomyopathy. Pharmacogenetics should allow patient selection to maximize therapy and minimize risk. To this end, we have combined two genetically diverse inbred strains, NON/Lt and NZO/Lt, to produce a "negative heterosis" increasing the frequency of T2D in F1 males. As in humans with T2D, treatment of diabetic and hyperlipemic F1 males with rosiglitazone (Rosi), an agonist of peroxisome proliferator-activated gamma receptor (PPARgamma), reverses these disease phenotypes. However, the hybrid genome perturbed both major pathways for phosphatidylcholine (PC) biosynthesis in the liver, and effected remarkable alterations in the composition of cardiolipin in heart mitochondria. These metabolic defects severely exacerbated an underlying hepatosteatosis and increased levels of the adipokine, plasminogen activator inhibitor-1 (PAI-1), a risk factor for cardiovascular events. This model system demonstrates how the power of mouse genetics can be used to identify the metabolic signatures of individuals who may be prone to drug side effects.
Directory of Open Access Journals (Sweden)
Rong-Tsung Lin
2013-01-01
Full Text Available Aims. To evaluate the efficacy of rosiglitazone (TZD and electroacupuncture (EA combined therapy as a treatment for type 2 diabetes mellitus (T2DM patients by randomized single-blind placebo controlled clinical trial. Methods. A total of 31 newly diagnostic T2DM patients, who fulfilled the study's eligibility criteria, were recruited. The individuals were randomly assigned into two groups, the control group (TZD, N=15 and the experimental group (TZD + EA, N=16. Changes in their plasma free fatty acid (FFA, glucose, and insulin levels, together with their homeostasis model assessment (HOMA indices, were statistically compared before and after treatment. Hypoglycemic activity (% was also compared between these two groups. Results. There was no significant difference in hypoglycemic activity between the TZD and TZD + EA group. The effectiveness of the combined therapy seems to derive from an improvement in insulin resistance and a significant lowering of the secreted insulin rather than the effect of TZD alone on T2DM. The combined treatment had no significant adverse effects. A lower plasma FFA concentration is likely to be the mechanism that causes this effect. Conclusion. This combined therapy seems to suppress endogenous insulin secretion by improving insulin resistance via a mechanism involving a reduction in plasma FFA. This trial is registered with ClinicalTrials.gov NCT01577095.
Directory of Open Access Journals (Sweden)
Suslov V.M.
2005-12-01
Full Text Available The opportunity approached is shown, but more exact as it is usually accepted, the account of sagging of wires at definition of specific potential factors air High-Voltage Power Transmission Lines. The technique of reception of analytical expressions is resulted. For an opportunity of comparison traditional expressions for specific potential factors are resulted also. Communication of the offered and traditional analytical expressions is shown. Offered analytical expressions are not difficult for programming on a personal computer of any class and besides they allow to make an estimation of an error of traditional expressions by means of parallel definition of specific potential factors by both ways.
International Nuclear Information System (INIS)
Li, K.; Cai, R.; Dai, B.B.; Zhang, X.Q.; Wang, H.J.; Ge, S.F.; Xu, W.R.; Lu, J.
2007-01-01
Special AT-rich binding protein 1 (SATB1), a cell type-specific nuclear matrix attachment region (MAR) DNA-binding protein, tethers to a specific DNA sequence and regulates gene expression through chromatin remodeling and HDAC (histone deacetylase complex) recruitment. In this study, a SATB1 eukaryotic expression plasmid was transfected into the human erythroleukemia K562 cell line and individual clones that stably over-expressed the SATB1 protein were isolated. Microarray analysis revealed that hundreds of genes were either up- or down-regulated in the SATB1 over-expressing K562 cell lines. One of these was the extra-cellular matrix glycoprotein, SPARC (human secreted protein acidic and rich in cysteine). siRNA knock-down of SATB1 also reduced SPARC expression, which was consistent with elevated SPARC levels in the SATB1 over-expressing cell line. Bioinformatics software Mat-inspector showed that a 17 bp DNA sequence in the third intron of SPARC possessed a high potential for SATB1 binding; a finding confirmed by Chromatin immunoprecipitation (ChIP) with anti-SATB1 antibody. Our results show for the first time that forced-expression of SATB1 in K562 cells triggers SPARC up-regulation by binding to a 17 bp DNA sequence in the third intron
International Nuclear Information System (INIS)
Tucker, M.A.
1988-01-01
Poly(A) + RNA from early or mid-stage ovarian follicles of C. erythrocephala was used to generate radiolabelled oogenesis-specific cDNA probes for screening the phage libraries. A cDNA probe made from mid-stage embryo poly(A) + RNA was used as the differential screening probe. Thus plaques hybridizing to the two oogenesis-specific probes but not the mid-stage embryo probe were selected as potentially containing oogenesis-specific genes. Two further rounds of screening were used to eliminate false positives and, after plaque purification, restriction digests of the remaining clones were screened by Southern blot hybridization to identify DNA fragments transcribed in an oogenesis-specific manner. In situ hybridization to sections of ovarian follicles has been used to determine the cell types within the follicles in which the various genes are expressed. Radiolabelled RNA probes for four of the C. erythrocephala oogenesis-specific clones and the two D. melanogaster clones have been hybridized to ovarian follicles. Further studies have been concentrated on the two germ-line transcribed, oogenesis-specific clones isolated from the D. melanogaster clone library. Detailed genetic mapping of the DA clone and of these mutations was performed to determine which mutations might represent the DA gene. cDNA clones have been isolated for the transcribed region of clone DA and have been used to further define the transcription unit from this region of the D. melanogaster genome
International Nuclear Information System (INIS)
Chang, Young-Chae; Cho, Hyun-Ji
2012-01-01
Highlights: ► Ascofuranone increases expression of adiponectin and PPARγ. ► Inhibitors for MEK and JNK increased the expression of adiponectin and PPARγ. ► Ascofuranone significantly suppressed phosho-ERK, while increasing phospho-p38. -- Abstract: Ascofuranone, an isoprenoid antibiotic, was originally isolated as a hypolipidemic substance from a culture broth of the phytopathogenic fungus, Ascochyta visiae. Adiponectin is mainly synthesized by adipocytes. It relieves insulin resistance by decreasing the plasma triglycerides and improving glucose uptake, and has anti-atherogenic properties. Here, we found that ascofuranone increases expression of adiponectin and PPARγ, a major transcription factor for adiponectin, in 3T3-L1, murine pre-adipocytes cell line, without promoting accumulation of lipid droplets. Ascofuranone induced expression of adiponectin, and increases the promoter activity of adiponectin and PPRE, PPAR response element, as comparably as a PPARγ agonist, rosiglitazone, that stimulates lipid accumulation in the preadipocyte cell line. Moreover, inhibitors for MEK and JNK, like ascofuranone, considerably increased the expression of adiponectin and PPARγ, while a p38 inhibitor significantly suppressed. Ascofuranone significantly suppressed ERK phosphorylation, while increasing p38 phosphorylation, during adipocyte differentiation program. These results suggest that ascofuranone regulates the expression of adiponectin and PPARγ through the modulation of MAP kinase family members.
International Nuclear Information System (INIS)
Crescioli, Clara; Squecco, Roberta; Cosmi, Lorenzo; Sottili, Mariangela; Gelmini, Stefania; Borgogni, Elisa; Sarchielli, Erica; Scolletta, Sabino; Francini, Fabio; Annunziato, Francesco; Vannelli, Gabriella Barbara; Serio, Mario
2008-01-01
CXCL10-CXCR3 axis plays a pivotal role in cardiac allograft rejection, so that targeting CXCL10 without inducing generalized immunosuppression may be of therapeutic significance in allotransplantation. Since the role of resident cells in cardiac rejection is still unclear, we aimed to establish reliable human cardiomyocyte cultures to investigate Th1 cytokine-mediated response in allograft rejection. We used human fetal cardiomyocytes (Hfcm) isolated from fetal hearts, obtained after legal abortions. Hfcm expressed specific cardiac lineage markers, specific cardiac structural proteins, typical cardiac currents and generated ventricular action potentials. Thus, Hfcm represent a reliable in vitro tool for allograft rejection research, since they resemble the features of mature cells. Hfcm secreted CXCL10 in response to IFNγ and TNFαα; this effect was magnified by cytokine combination. Cytokine synergy was associated to a significant TNFα-induced up-regulation of IFNγR. The response of Hfcm to some currently used immunosuppressive drugs compared to rosiglitazone, a peroxisome proliferator-activated receptor γ agonist and Th1-mediated response inhibitor, was also evaluated. Only micophenolic acid and rosiglitazone halved CXCL10 secretion by Hfcm. Given the pivotal role of IFNγ-induced chemokines in Th1-mediated allograft rejection, these preliminary results suggest that the combined effects of immunosuppressive agents and rosiglitazone could be potentially beneficial to patients receiving heart transplants
Energy Technology Data Exchange (ETDEWEB)
Bevanger, Kjetil
2011-02-15
To achieve European-level policy goals on climate change challenges, as well securing the electricity supply within Norway, it will be necessary to increase power line construction efforts significantly, as well as to upgrade the existing grid. Statnett have estimated an approximately 40 billion NOK investment over the next 10 years will be required for the central grid. Although this is a huge investment, the length of the new transmission lines constructed will only comprise a small part of the Norwegian grid. Of approximately 193 000 km of overhead power lines in Norway the distribution grid (i.e. up to 24 kV) comprises 85%. In this report we discuss the ornithological challenges connected to the different elements of the Norwegian grid. All overhead wires pose a potential risk to flying birds; however, the risk increases with the number of lines and wire length per unit of land area. The central and regional grid, in general, represents no electrocution threat, as the distances between the phase conductors and/or the distance between a phase conductor and an earthed device is rather wide. Thus the electrocution problem is a distribution grid specific problem. Both the collision and the electrocution risk are highly species specific problems. Over the last years several research projects have collected data enabling an identification of the bird species and bird species groups facing a particular risk. However, there is still a lack of know-ledge in several respects, for example why the number of collisions is not evenly distributed along a power line section, but is frequently concentrated at a few spots. This type of knowledge is crucial to contribute to the selection of as environmentally friendly power line routing as possible when new power lines are constructed. This is also stressed in the new Energy Act of 2009. With respect to both upgrading, and to new power line constructions, underground cabling should be used to a much greater extent. This will
Directory of Open Access Journals (Sweden)
Soo Jin Yang
Full Text Available BACKGROUND: Sirt6 has been implicated in the regulation of hepatic lipid metabolism and the development of hepatic steatosis. The aim of this study was to address the potential role of Sirt6 in the protective effects of rosiglitazone (RGZ on hepatic steatosis. METHODS: To investigate the effect of RGZ on hepatic steatosis, rats were treated with RGZ (4 mg·kg⁻¹·day⁻¹ by stomach gavage for 6 weeks. The involvement of Sirt6 in the RGZ's regulation was evaluated by Sirt6 knockdown in AML12 mouse hepatocytes. RESULTS: RGZ treatment ameliorated hepatic lipid accumulation and increased expression of Sirt6, peroxisome proliferator-activated receptor gamma coactivtor-1-α (Ppargc1a/PGC1-α and Forkhead box O1 (Foxo1 in rat livers. AMP-activated protein kinase (AMPK phosphorylation was also increased by RGZ, accompanied by alterations in phosphorylation of LKB1. Interestingly, in free fatty acid-treated cells, Sirt6 knockdown increased hepatocyte lipid accumulation measured as increased triglyceride contents (p = 0.035, suggesting that Sirt6 may be beneficial in reducing hepatic fat accumulation. In addition, Sirt6 knockdown abolished the effects of RGZ on hepatocyte fat accumulation, mRNA and protein expression of Ppargc1a/PGC1-α and Foxo1, and phosphorylation levels of LKB1 and AMPK, suggesting that Sirt6 is involved in RGZ-mediated metabolic effects. CONCLUSION: Our results demonstrate that RGZ significantly decreased hepatic lipid accumulation, and that this process appeared to be mediated by the activation of the Sirt6-AMPK pathway. We propose Sirt6 as a possible therapeutic target for hepatic steatosis.
Illustrative Line Styles for Flow Visualization
Everts, Maarten H.; Bekker, Hendrik; Roerdink, Jos B. T. M.; Isenberg, Tobias
2011-01-01
We present a flexible illustrative line style model for the visualization of streamline data. Our model partitions view-oriented line strips into parallel bands whose basic visual properties can be controlled independently. We thus extend previous line stylization techniques specifically for
Flow Visualization using Illustrative Line Styles
Everts, Maarten H.; Bekker, Hendrik; Roerdink, Jos B. T. M.; Isenberg, Tobias; Bekker, Paulus
2011-01-01
We present a flexible illustrative line style model for the visualization of streamline data. Our model partitions view- oriented line strips into parallel bands whose basic visual properties can be controlled independently. We thus extend previous line stylization techniques specifically for
... manage your diabetes and improve your health. This therapy may also decrease your chances of having a heart attack, stroke, or other diabetes-related complications such as kidney failure, nerve damage (numb, cold legs or feet; decreased sexual ability in men and women), eye ...
Reveles, Kelly R; Backo, Jennifer L; Corvino, Frank A; Zivkovic, Marko; Broderick, Kelly C
2017-12-01
The reduction in recurrent Clostridium difficile-associated diarrhea (CDAD) with fidaxomicin therapy may reduce hospital readmissions and lead to lower overall CDAD costs. However, studies assessing the cost-effectiveness of fidaxomicin as first-line therapy from the U.S. hospital perspective are lacking. This study evaluated the costs associated with utilizing fidaxomicin or vancomycin as a first-line therapy for CDAD in specific patient populations from a U.S. hospital perspective. A decision-analytic model was developed to estimate total costs (hospitalization and drug costs) associated with using fidaxomicin or vancomycin as first-line therapy for a first episode and up to two recurrences of CDAD in five patient populations: general population, elderly, patients receiving concomitant antibiotics, and patients with renal impairment or cancer. The total cost of CDAD treatment using fidaxomicin first line in the general population was $14,442 per patient versus $14,179 per patient with vancomycin first line. In subgroup analyses, fidaxomicin use resulted in total hospital cost savings of $616 per patient in patients with cancer and $312 in patients with concomitant antibiotic use; vancomycin use was associated with total hospital cost savings of $243 per patient in the elderly and $371 in patients with renal impairment. Fidaxomicin as first-line CDAD therapy is associated with similar total costs as compounded vancomycin oral solution in the general population. In elderly and renally impaired patients, slight increases in hospital cost were observed with fidaxomicin therapy, and in patients with cancer or concomitant antibiotic use, hospital cost savings were observed. © 2017 Pharmacotherapy Publications, Inc.
Similarity law for Widom lines and coexistence lines.
Banuti, D T; Raju, M; Ihme, M
2017-05-01
The coexistence line of a fluid separates liquid and gaseous states at subcritical pressures, ending at the critical point. Only recently, it became clear that the supercritical state space can likewise be divided into regions with liquidlike and gaslike properties, separated by an extension to the coexistence line. This crossover line is commonly referred to as the Widom line, and is characterized by large changes in density or enthalpy, manifesting as maxima in the thermodynamic response functions. Thus, a reliable representation of the coexistence line and the Widom line is important for sub- and supercritical applications that depend on an accurate prediction of fluid properties. While it is known for subcritical pressures that nondimensionalization with the respective species critical pressures p_{cr} and temperatures T_{cr} only collapses coexistence line data for simple fluids, this approach is used for Widom lines of all fluids. However, we show here that the Widom line does not adhere to the corresponding states principle, but instead to the extended corresponding states principle. We resolve this problem in two steps. First, we propose a Widom line functional based on the Clapeyron equation and derive an analytical, species specific expression for the only parameter from the Soave-Redlich-Kwong equation of state. This parameter is a function of the acentric factor ω and compares well with experimental data. Second, we introduce the scaled reduced pressure p_{r}^{*} to replace the previously used reduced pressure p_{r}=p/p_{cr}. We show that p_{r}^{*} is a function of the acentric factor only and can thus be readily determined from fluid property tables. It collapses both subcritical coexistence line and supercritical Widom line data over a wide range of species with acentric factors ranging from -0.38 (helium) to 0.34 (water), including alkanes up to n-hexane. By using p_{r}^{*}, the extended corresponding states principle can be applied within
Metcalfe, Hannah J; Biffar, Lucia; Steinbach, Sabine; Guzman, Efrain; Connelley, Tim; Morrison, Ivan; Vordermeier, H Martin; Villarreal-Ramos, Bernardo
2018-05-11
There is a need to improve the efficacy of the BCG vaccine against human and bovine tuberculosis. Previous data showed that boosting bacilli Calmette-Guerin (BCG)-vaccinated cattle with a recombinant attenuated human type 5 adenovirally vectored subunit vaccine (Ad5-85A) increased BCG protection and was associated with increased frequency of Ag85A-specific CD4 + T cells post-boosting. Here, the capacity of Ag85A-specific CD4 + T cell lines - derived before and after viral boosting - to interact with BCG-infected macrophages was evaluated. No difference before and after boosting was found in the capacity of these Ag85A-specific CD4 + T cell lines to restrict mycobacterial growth, but the secretion of IL-10 in vitro post-boost increased significantly. Furthermore, cell lines derived post-boost had no statistically significant difference in the secretion of pro-inflammatory cytokines (IL-1β, IL-12, IFNγ or TNFα) compared to pre-boost lines. In conclusion, the protection associated with the increased number of Ag85A-specific CD4 + T cells restricting mycobacterial growth may be associated with anti-inflammatory properties to limit immune-pathology. Copyright © 2018 Department for Environment Food and Rural Affairs. Published by Elsevier Ltd.. All rights reserved.
Efficient algorithm for generating spectra using line-by-line methods
International Nuclear Information System (INIS)
Sonnad, V.; Iglesias, C.A.
2011-01-01
A method is presented for efficient generation of spectra using line-by-line approaches. The only approximation is replacing the line shape function with an interpolation procedure, which makes the method independent of the line profile functional form. The resulting computational savings for large number of lines is proportional to the number of frequency points in the spectral range. Therefore, for large-scale problems the method can provide speedups of two orders of magnitude or more. A method was presented to generate line-by-line spectra efficiently. The first step was to replace the explicit calculation of the profile by the Newton divided-differences interpolating polynomial. The second step is to accumulate the lines effectively reducing their number to the number of frequency points. The final step is recognizing the resulting expression as a convolution and amenable to FFT methods. The reduction in computational effort for a configuration-to-configuration transition array with large number of lines is proportional to the number of frequency points. The method involves no approximations except for replacing the explicit profile evaluation by interpolation. Specifically, the line accumulation and convolution are exact given the interpolation procedure. Furthermore, the interpolation makes the method independent of the line profile functional form contrary to other schemes using FFT methods to generate line-by-line spectra but relying on the analytic form of the profile Fourier transform. Finally, the method relies on a uniform frequency mesh. For non-uniform frequency meshes, however, the method can be applied by using a suitable temporary uniform mesh and the results interpolated onto the final mesh with little additional cost.
7 CFR 1755.397 - RUS performance specification for line concentrators.
2010-01-01
... part 51. Copies of these standards are available for inspection during normal business hours at RUS.... (ii) There should be provisions for such types of lines as ground start, loop start, regular... surface of the protectors. Means for easy identification of pairs shall be provided. (v) Protectors shall...
ISP-50 Specifications for a Direct Vessel Injection Line Break Test with the ATLAS
International Nuclear Information System (INIS)
Choi, Ki Yong; Baek, Won Pil; Kim, Yeon Sik; Park, Hyun Sik; Cho, Seok; Kang, Kyoung Ho; Choi, Nam Hyun; Min, Kyoung Ho
2009-06-01
An OECD/NEA International Standard Problem Exercise (ISP) focussing on a DVI line break simulation result with the ATLAS was approved by the NEA Committee on the Safety of Nuclear Installation (CSNI) meeting in December 2008 and was numbered by ISP-50. The ISP-50 program will be operated by an operating agency, KAERI for three years starting from the physical year 2009. Fourteen international organizations confirmed their participation in the ISP-50, including NRC (USA), JAEA, JNES (Japan), GRS (Germany), KFKI-AEKI (Hungary), EDO Gidropress (Russia), VTT, Fortum (Finland), NRI (Czech Republic), Univ. of Pisa (Italy), KINS, KNF, KOPEC, and KAERI (Korea). In addition, KTH in Sweden and HSE in UK are considering late participation. Recently, NPIC and CIAE in China hope to join the ISP-50. As for the safety analysis codes, nine codes are expected to be used for the ISP-50: MARS-3D, RELAP5- 3D, RELAP5, TRACE, CATHARE, APROS, ATHELET, TRAP, and KORSAR. It is the first ISP exercise in Korea in which a domestic test facility is utilized by international nuclear society and this exercise will contribute to extending our physical understanding on thermal hydraulic phenomena during the DVI line break accidents and to verifying the best-estimate thermal-hydraulic safety analysis codes. This report was prepared to define technical specifications of the ISP-50 exercise according the guideline provided by OECD/CSNI. It includes general objectives, phases, deliverables to participants, parameters required for comparison and the time table
Standardization of beam line representations
International Nuclear Information System (INIS)
Carey, David C.
1998-01-01
Standardization of beam line representations means that a single set of data can be used in many situations to represent a beam line. This set of data should be the same no matter what the program to be run or the calculation to be made. We have concerned ourselves with three types of standardization: (1) The same set of data should be usable by different programs. (2) The inclusion of other items in the data, such as calculations to be done, units to be used, or preliminary specifications, should be in a notation similar to the lattice specification. (3) A single set of data should be used to represent a given beam line, no matter what is being modified or calculated. The specifics of what is to be modified or calculated can be edited into the data as part of the calculation. These three requirements all have aspects not previously discussed in a public forum. Implementations into TRANSPORT will be discussed
Standardization of beam line representations
International Nuclear Information System (INIS)
Carey, David C.
1999-01-01
Standardization of beam line representations means that a single set of data can be used in many situations to represent a beam line. This set of data should be the same no matter what the program to be run or the calculation to be made. We have concerned ourselves with three types of standardization: (1) The same set of data should be usable by different programs. (2) The inclusion of other items in the data, such as calculations to be done, units to be used, or preliminary specifications, should be in a notation similar to the lattice specification. (3) A single set of data should be used to represent a given beam line, no matter what is being modified or calculated. The specifics of what is to be modified or calculated can be edited into the data as part of the calculation. These three requirements all have aspects not previously discussed in a public forum. Implementations into TRANSPORT will be discussed
Directory of Open Access Journals (Sweden)
Sabrina Le Bouter
2010-01-01
Full Text Available Rosiglitazone (RSG, developed for the treatment of type 2 diabetes mellitus, is known to have potent effects on carbohydrate and lipid metabolism leading to the improvement of insulin sensitivity in target tissues. To further assess the capacity of RSG to normalize gene expression in insulin-sensitive tissues, we compared groups of 18-day-treated db/db mice with increasing oral doses of RSG (10, 30, and 100 mg/kg/d with untreated non-diabetic littermates (db/+. For this aim, transcriptional changes were measured in liver, inguinal adipose tissue (IAT and soleus muscle using microarrays and real-time PCR. In parallel, targeted metabolomic assessment of lipids (triglycerides (TGs and free fatty acids (FFAs in plasma and tissues was performed by UPLC-MS methods. Multivariate analyses revealed a relationship between the differential gene expressions in liver and liver trioleate content and between blood glucose levels and a combination of differentially expressed genes measured in liver, IAT, and muscle. In summary, we have integrated gene expression and targeted metabolomic data to present a comprehensive overview of RSG-induced changes in a diabetes mouse model and improved the molecular understanding of how RSG ameliorates diabetes through its effect on the major insulin-sensitive tissues.
Directory of Open Access Journals (Sweden)
Erica L Cain
2011-04-01
Full Text Available Analysis of chromosomal rearrangements within primary tumors has been influential in the identification of novel oncogenes. Identification of the "driver" gene(s within cancer-derived amplicons is, however, hampered by the fact that most amplicons contain many gene products. Amplification of 1q21-1q23 is strongly associated with liposarcomas and microarray-based comparative genomic hybridization narrowed down the likely candidate oncogenes to two: the activating transcription factor 6 (atf6 and the dual specificity phosphatase 12 (dusp12. While atf6 is an established transcriptional regulator of the unfolded protein response, the potential role of dusp12 in cancer remains uncharacterized.To evaluate the oncogenic potential of dusp12, we established stable cell lines that ectopically over-express dusp12 in isolation and determined whether this cell line acquired properties frequently associated with transformed cells. Here, we demonstrate that cells over-expressing dusp12 display increased cell motility and resistance to apoptosis. Additionally, over-expression of dusp12 promoted increased expression of the c-met proto-oncogene and the collagen and laminin receptor intergrin alpha 1 (itga1 which is implicated in metastasis.Collectively, these results suggest that dusp12 is oncologically relevant and exposes a potential association between dusp12 and established oncogenes that could be therapeutically targeted.
Chang Y.K.; Martinez-Bustos F.; Park T.S.; Kokini J.L.
1999-01-01
The influence of specific mechanical energy (SME) on cornmeal viscosity during the twin-screw extrusion at feed moisture contents of 25 and 30% and screw speeds in the range from 100 to 500 rpm was measured. Cornmeal was extruded in a co-rotating, intermeshing twin-screw coupled to a slit die rheometer. One approach to the on-line rheological measurement is to use a slit die with the extruder. In the present work it was show that shear viscosity decreased as a function of SME. The viscosity o...
Energy Technology Data Exchange (ETDEWEB)
Chang, Young-Chae, E-mail: ycchang@cu.ac.kr [Research Institute of Biomedical Engineering and Department of Medicine, Catholic University of Daegu School of Medicine, Daegu 705-718 (Korea, Republic of); Cho, Hyun-Ji, E-mail: hjcho.dr@gmail.com [Research Institute of Biomedical Engineering and Department of Medicine, Catholic University of Daegu School of Medicine, Daegu 705-718 (Korea, Republic of)
2012-06-08
Highlights: Black-Right-Pointing-Pointer Ascofuranone increases expression of adiponectin and PPAR{gamma}. Black-Right-Pointing-Pointer Inhibitors for MEK and JNK increased the expression of adiponectin and PPAR{gamma}. Black-Right-Pointing-Pointer Ascofuranone significantly suppressed phosho-ERK, while increasing phospho-p38. -- Abstract: Ascofuranone, an isoprenoid antibiotic, was originally isolated as a hypolipidemic substance from a culture broth of the phytopathogenic fungus, Ascochyta visiae. Adiponectin is mainly synthesized by adipocytes. It relieves insulin resistance by decreasing the plasma triglycerides and improving glucose uptake, and has anti-atherogenic properties. Here, we found that ascofuranone increases expression of adiponectin and PPAR{gamma}, a major transcription factor for adiponectin, in 3T3-L1, murine pre-adipocytes cell line, without promoting accumulation of lipid droplets. Ascofuranone induced expression of adiponectin, and increases the promoter activity of adiponectin and PPRE, PPAR response element, as comparably as a PPAR{gamma} agonist, rosiglitazone, that stimulates lipid accumulation in the preadipocyte cell line. Moreover, inhibitors for MEK and JNK, like ascofuranone, considerably increased the expression of adiponectin and PPAR{gamma}, while a p38 inhibitor significantly suppressed. Ascofuranone significantly suppressed ERK phosphorylation, while increasing p38 phosphorylation, during adipocyte differentiation program. These results suggest that ascofuranone regulates the expression of adiponectin and PPAR{gamma} through the modulation of MAP kinase family members.
Hefnawy, Mohamed M; Sultan, Maha A; Al-Johar, Haya I; Kassem, Mohamed G; Aboul-Enein, Hassan Y
2012-01-01
Multiple response simultaneous optimization employing Derringer's desirability function was used for the development of a capillary electrophoresis method for the simultaneous determination of rosiglitazone (RSG) and glimepiride (GLM) in plasma and formulations. Twenty experiments, taking the two resolutions, the analysis time, and the capillary current as the responses with three important factors--buffer morality, volte and column temperature--were used to design mathematical models. The experimental responses were fitted into a second order polynomial and the six responses were simultaneously optimized to predict the optimum conditions for the effective separation of the studied compounds. The separation was carried out by using capillary zone electrophoresis (CZE) with a silica capillary column and diode array detector at 210 nm. The optimum assay conditions were 52 mmol l⁻¹ phosphate buffer, pH 7, and voltage of 22 kV at 29 °C. The method showed good agreement between the experimental data and predictive value throughout the studied parameter space. The assay limit of detection was 0.02 µg ml⁻¹ and the effective working range at relative standard deviation (RSD) of ≤ 5% was 0.05-16 µg ml⁻¹ (r = 0.999) for both drugs. Analytical recoveries of the studied drugs from spiked plasma were 97.2-101.9 ± 0.31-3.0%. The precision of the assay was satisfactory; RSD was 1.07 and 1.14 for intra- and inter-assay precision, respectively. The proposed method has a great value in routine analysis of RSG and GLM for its therapeutic monitoring and pharmacokinetic studies. Copyright © 2011 John Wiley & Sons, Ltd.
The effect of PPAR-γ agonist on 18F-FDG uptake in tumor and macrophages and tumor cells
International Nuclear Information System (INIS)
Kim, Se-Lim; Kim, Eun-Mi; Cheong, Su-Jin; Lee, Chang-Moon; Kim, Dong Wook; Jeong, Hwan-Jeong; Lim, Seok Tae; Sohn, Myung-Hee; Yim, Chang Yeol
2009-01-01
Purpose: The peroxisome proliferator-activated receptor-γ (PPAR-γ) is a member of the nuclear receptor superfamily of ligand-dependent transcription factors, and its role in adipogenesis and glucose metabolism has been well established. PPAR-γ agonists have been shown to inhibit many cytokines and to have anti-inflammatory effects. In pathologic conditions, enhanced fluoro-2-deoxy-D-glucose (FDG) uptake is observed not only in malignant tumors but also in inflammatory lesions, and this uptake occurs through the glucose transporter in these cells. Thus, the present study was undertaken to investigate the potential of using PPAR-γ's glucose uptake ability as a diagnostic tool to differentiate between macrophage and tumor cells. Materials and Methods: Cellular uptake studies were carried out on macrophage and two tumor cell lines for comparison by using 18 F-FDG. Western blot analysis was performed to determine the expression levels of both the glucose transporter and hexokinase protein. To confirm the possibility of differentiation between tumor and inflammatory lesions using rosiglitazone based on in vitro studies, 18 F-FDG (3.7x10 6 Bq) uptake in A549 and RAW 264.7 xenograft mice was compared. Results: The cellular uptake study findings were quite different for macrophages and tumor cells. 18 F-FDG uptakes by macrophages decreased by about 60% but was increased twofold in tumor cells after rosiglitazone treatment. Moreover, the expressions of proteins related to glucose uptake correlated well with cellular glucose accumulation in both cell types. Higher tumor uptake was observed after the injection of rosiglitazone in A549 xenograft mice (1.58±0.55 to 4.66±1.16), but no significant change of 18 F-FDG uptake was shown in RAW 264.7 xenograft mice (4.04±1.16 to 4.00±0.14). Conclusion: The present study demonstrates the roles of PPAR-γ agonist on FDG uptake in macrophages and tumor cells in vitro and in vivo. Our findings suggest that rosiglitazone has the
Product Line Rivalry with Brand Differentiation
Gilbert, Richard J.; Matutes, Carmen
1989-01-01
Competition with product rivalry is examined in a model where products are differentiated by both quality and brand name. With no commitment, firms produce a full product line. When firms can commit to restrict their product offerings, firms specialize if the degree of brand-specific differentiation is small and they produce a full product line if brand-specific differentiation is large relative to intrafirm differentiation. Firms may crowd a product space when all competitors would be better...
Diverse coactivator recruitment through differential PPARγ nuclear receptor agonism
Directory of Open Access Journals (Sweden)
Fernando Lizcano
2013-01-01
Full Text Available The PPARγ nuclear receptor regulates the expression of genes involved in lipid and carbohydrate metabolism, and it has protective effects in some patients with type 2 diabetes. Nevertheless, the therapeutic value of the PPARγ nuclear receptor protein is limited due to the secondary effects of some PPARγ ligands. Because the downstream effects of PPARγ are determined by the binding of specific cofactors that are mediated by ligand-induced conformational changes, we evaluated the differential effects of various ligands on the binding of certain cofactors associated with PPARγ. The ligands used were rosiglitazone for treating type 2 diabetes and telmisartan for treating arterial hypertension. Functional, phenotypic, and molecular studies were conducted on pre-adipocyte 3T3-L1 and functional studies in U2OS cells. The moderating influence of various cofactor families was evaluated using transient transfection assays. Our findings confirm that telmisartan has a partial modulating effect on PPARγ activity compared to rosiglitazone. The cofactors SRC1 and GRIP1 mediate the activity of telmisartan and rosiglitazone and partially determine the difference in their effects. Studying the modulating activity of these cofactors can provide interesting insights for developing new therapeutic approaches for certain metabolic diseases.
Transmission line capital costs
International Nuclear Information System (INIS)
Hughes, K.R.; Brown, D.R.
1995-05-01
The displacement or deferral of conventional AC transmission line installation is a key benefit associated with several technologies being developed with the support of the U.S. Department of Energy's Office of Energy Management (OEM). Previous benefits assessments conducted within OEM have been based on significantly different assumptions for the average cost per mile of AC transmission line. In response to this uncertainty, an investigation of transmission line capital cost data was initiated. The objective of this study was to develop a database for preparing preliminary estimates of transmission line costs. An extensive search of potential data sources identified databases maintained by the Bonneville Power Administration (BPA) and the Western Area Power Administration (WAPA) as superior sources of transmission line cost data. The BPA and WAPA data were adjusted to a common basis and combined together. The composite database covers voltage levels from 13.8 to 765 W, with cost estimates for a given voltage level varying depending on conductor size, tower material type, tower frame type, and number of circuits. Reported transmission line costs vary significantly, even for a given voltage level. This can usually be explained by variation in the design factors noted above and variation in environmental and land (right-of-way) costs, which are extremely site-specific. Cost estimates prepared from the composite database were compared to cost data collected by the Federal Energy Regulatory Commission (FERC) for investor-owned utilities from across the United States. The comparison was hampered because the only design specifications included with the FERC data were voltage level and line length. Working within this limitation, the FERC data were not found to differ significantly from the composite database. Therefore, the composite database was judged to be a reasonable proxy for estimating national average costs
Directory of Open Access Journals (Sweden)
Alves Leonardo
2010-03-01
Full Text Available Abstract Background microRNAs (miRNAs are endogenous small non-coding RNAs that post-transcriptionally regulate gene expression. In plants, they typically show high complementarity to a single sequence motif within their target mRNAs and act by catalyzing specific mRNA cleavage and degradation. miRNAs are processed from much longer primary transcripts via precursor miRNAs containing fold-back structures. Leaving these secondary structures intact, miRNAs can be re-designed experimentally to target mRNAs of choice. Results We designed primary synthetic miRNAs (pri-smiRNAs on the basis of the primary transcript of the Arabidopsis MIR159A gene by replacing the original miR159a and the corresponding miR159a* with novel sequences, keeping the overall secondary structure as predicted by the program RNAfold. We used the program RNAhybrid to optimize smiRNA design and to screen the complete Arabidopsis transcriptome for potential off-targets. To improve the molecular cloning of the pri-smiRNA we inserted restriction sites in the original MIR159A primary transcript to easily accommodate the smiRNA/smiRNA* DNA fragment. As a proof-of-concept, we targeted the single gene encoding chalcone synthase (CHS in Arabidopsis. We demonstrate smiRNA(CHS expression and CHS mRNA cleavage in different transgenic lines. Phenotypic changes in these lines were observed for seed color and flavonol derivatives, and quantified with respect to anthocyanin content. We also tested the effect of mismatches and excess G:U base pairs on knockdown efficiency. Conclusions RNAhybrid-assisted design of smiRNAs and generation of pri-smiRNAs using a novel vector containing restriction sites greatly improves specificity and speed of the generation of stable knockdown lines for functional analyses in plants.
Effects of Rosiglitazone on the Expression of PPAR-γ and the ...
African Journals Online (AJOL)
Erah
2011-03-15
Mar 15, 2011 ... and the Production of IL-6 and IL-8 in Acute Lung. Injury Model ... pathophysiology of ALI [2,3]. Peroxisome .... view in the pathophysiologic mechanism of. ALI is that it is a ... DNA synthesis in breast cancer-derived cell lines.
Traversa, Donato; Iorio, Raffaella; Klei, Thomas R.; Kharchenko, Vitaliy A.; Gawor, Jakub; Otranto, Domenico; Sparagano, Olivier A. E.
2007-01-01
The ability of a reverse line blot (RLB) assay to identify 13 common species of equine small strongyles (cyathostomins) and to discriminate them from three Strongylus spp. (large strongyles) was demonstrated. The assay relied on the specific hybridization of PCR-amplified intergenic spacer DNA fragments of the nuclear ribosomal DNA to membrane-bound species-specific probes. All cyathostomins examined were unequivocally identified and simultaneously discriminated from each other and from three large strongyles (Strongylus edentatus, Strongylus equinus, and Strongylus vulgaris). This assay will enable the accurate and rapid identification of equine cyathostomins irrespective of their life cycle stage, opening important avenues for a better understanding of their biology and epidemiology and of the pathogenesis of cyathostomin-associated disease. In particular, this RLB method promises to be a powerful diagnostic tool to determine the roles of individual species in the pathogenesis of mixed infections and to elucidate some aspects of cyathostominosis. Also, it could represent a basic step toward the development of a rapid and simple molecular test for the early detection of drug-resistant genotypes of horse strongyle species. PMID:17626168
CHANG, Y. K.; MARTINEZ-BUSTOS, F.; PARK, T. S.; KOKINI, J .L.
1999-01-01
The influence of specific mechanical energy (SME) on cornmeal viscosity during the twin-screw extrusion at feed moisture contents of 25 and 30% and screw speeds in the range from 100 to 500 rpm was measured. Cornmeal was extruded in a co-rotating, intermeshing twin-screw coupled to a slit die rheometer. One approach to the on-line rheological measurement is to use a slit die with the extruder. In the present work it was show that shear viscosity decreased as a function of SME. The viscosity o...
Hedberg, Annica; Knutsen, Erik; Løvhaugen, Anne Silje; Jørgensen, Tor Erik; Perander, Maria; Johansen, Steinar D
2018-04-19
Low-level mitochondrial heteroplasmy is a common phenomenon in both normal and cancer cells. Here, we investigate the link between low-level heteroplasmy and mitogenome mutations in a human breast cancer matched cell line by high-throughput sequencing. We identified 23 heteroplasmic sites, of which 15 were common between normal cells (Hs578Bst) and cancer cells (Hs578T). Most sites were clustered within the highly conserved Complex IV and ribosomal RNA genes. Two heteroplasmic variants in normal cells were found as fixed mutations in cancer cells. This indicates a positive selection of these variants in cancer cells. RNA-Seq analysis identified upregulated L-strand specific transcripts in cancer cells, which include three mitochondrial long non-coding RNA molecules. We hypothesize that this is due to two cancer cell-specific mutations in the control region.
Directory of Open Access Journals (Sweden)
Atossa Shaltouki
2015-05-01
Full Text Available In this study, we used patient-specific and isogenic PARK2-induced pluripotent stem cells (iPSCs to show that mutations in PARK2 alter neuronal proliferation. The percentage of TH+ neurons was decreased in Parkinson’s disease (PD patient-derived neurons carrying various mutations in PARK2 compared with an age-matched control subject. This reduction was accompanied by alterations in mitochondrial:cell volume fraction (mitochondrial volume fraction. The same phenotype was confirmed in isogenic PARK2 null lines. The mitochondrial phenotype was also seen in non-midbrain neurons differentiated from the PARK2 null line, as was the functional phenotype of reduced proliferation in culture. Whole genome expression profiling at various stages of differentiation confirmed the mitochondrial phenotype and identified pathways altered by PARK2 dysfunction that include PD-related genes. Our results are consistent with current model of PARK2 function where damaged mitochondria are targeted for degradation via a PARK2/PINK1-mediated mechanism.
Hsieh, Wen-Chuan; Lan, Bau-Shin; Chen, Yi-Ling; Chang, Yao; Chuang, Huai-Chia; Su, Ih-Jen
2010-01-01
Virus-associated haemophagocytic syndrome (VAHS) is a fatal complication of viral infections, such as Epstein-Barr virus and H5N1 influenza, that results from macrophage activation and pro inflammatory cytokine injuries. The high comorbidity and mortality of current therapy urgently demands an ideal agent based on VAHS pathogenesis. Peroxisome proliferator activated receptor (PPAR) agonists, regulators of metabolic syndrome, can exhibit immunomodulatory effects on macrophage activation and cytokine secretion. In this study, we adopted rosiglitazone, a PPAR-gamma agonist, for VAHS control in a Herpesvirus papio (HVP)-infected rabbit model. Various doses of rosiglitazone were orally administered to rabbits on day 7 or day 20 after intravenous challenge with 5 x 10(7) copies of HVP. The rabbits that received 4 mg/day rosiglitazone had significantly increased survival when treated at an early stage of infection (P<0.01), whereas a higher dose (8 mg/day) was required at the advanced stage of the disease (P<0.05). All rosiglitazone-treated rabbits had significantly improved laboratory parameters and plasma tumour necrosis factor-alpha levels. Importantly, rosiglitazone could also inhibit viral replication in vitro and in vivo. PPAR agonists could represent a potentially new agent for the therapy of VAHS.
Reconstruction of railway energy lines; Rekonstruktion von Bahnenergieleitungen
Energy Technology Data Exchange (ETDEWEB)
Rothe, Matthias [DB Energie Gmbh, Berlin (Germany); Wahlen, Manfred [DB Energie Gmbh, Koeln (Germany)
2013-06-15
As is the case for other overhead lines, 110 kV railway energy lines are assumed to have a service life of 80 years. When this service life ends or the lines are adapted to the state of the art as necessary, all components of the overhead line are renewed. For the reconstruction of railway energy lines, the specifications laid down in planning and environmental laws, operational management aspects and the local ambient and development situation are decisive project planning parameters. (orig.)
International Nuclear Information System (INIS)
Kalejs, Martins; Ivanov, Andrey; Plakhins, Gregory; Cragg, Mark S; Emzinsh, Dzintars; Illidge, Timothy M; Erenpreisa, Jekaterina
2006-01-01
We have previously reported that p53 mutated radioresistant lymphoma cell lines undergo mitotic catastrophe after irradiation, resulting in metaphase arrest and the generation of endopolyploid cells. A proportion of these endopolyploid cells then undergo a process of de-polyploidisation, stages of which are partially reminiscent of meiotic prophase. Furthermore, expression of meiosis-specific proteins of the cancer/testis antigens group of genes has previously been reported in tumours. We therefore investigated whether expression of meiosis-specific genes was associated with the polyploidy response in our tumour model. Three lymphoma cell lines, Namalwa, WI-L2-NS and TK6, of varying p53 status were exposed to a single 10 Gy dose of gamma radiation and their responses assessed over an extended time course. DNA flow cytometry and mitotic counts were used to assess the kinetics and extent of polyploidisation and mitotic progression. Expression of meiotic genes was analysed using RT-PCR and western blotting. In addition, localisation of the meiotic cohesin REC8 and its relation to centromeres was analysed by immunofluorescence. The principal meiotic regulator MOS was found to be significantly post-transcriptionally up-regulated after irradiation in p53 mutated but not p53 wild-type lymphoma cells. The maximum expression of MOS coincided with the maximal fraction of metaphase arrested cells and was directly proportional to both the extent of the arrest and the number of endopolyploid cells that subsequently emerged. The meiotic cohesin REC8 was also found to be up-regulated after irradiation, linking sister chromatid centromeres in the metaphase-arrested and subsequent giant cells. Finally, RT-PCR revealed expression of the meiosis-prophase genes, DMC1, STAG3, SYCP3 and SYCP1. We conclude that multiple meiotic genes are aberrantly activated during mitotic catastrophe in p53 mutated lymphoma cells after irradiation. Furthermore, we suggest that the coordinated expression
Energy Technology Data Exchange (ETDEWEB)
Madsen, O.D.; Andersen, L.C.; Michelsen, B.; Owerbach, D.; Larsson, L.I.; Lernmark, A.; Steiner, D.F. (Hagedorn Research Laboratory, Gentofte (Denmark))
1988-09-01
The pluripotent rat islet tumor cell line MSL-G2 expresses primarily glucagon or cholecystokinin and not insulin in vitro but changes phenotype completely after prolonged in vivo cultivation to yield small-sized hypoglycemic tumors composed almost entirely of insulin-producing beta cells. When a genomic DNA fragment containing the coding and upstream regulatory regions of the human insulin gene was stably transfected into MSL-G2 cells no measurable amounts of insulin or insulin mRNA were detected in vitro. However, successive transplantation of two transfected clones resulted in hypoglycemic tumors that efficiently coexpressed human and rat insulin as determined by human C-peptide-specific immunoreagents. These results demonstrate that cis-acting tissue-specific insulin gene enhancer elements are conserved between rat and human insulin genes. The authors propose that the in vivo differentiation of MSL-G2 cells and transfected subclones into insulin-producing cells reflects processes of natural beta-cell ontogeny leading to insulin gene expression.
International Nuclear Information System (INIS)
Madsen, O.D.; Andersen, L.C.; Michelsen, B.; Owerbach, D.; Larsson, L.I.; Lernmark, A.; Steiner, D.F.
1988-01-01
The pluripotent rat islet tumor cell line MSL-G2 expresses primarily glucagon or cholecystokinin and not insulin in vitro but changes phenotype completely after prolonged in vivo cultivation to yield small-sized hypoglycemic tumors composed almost entirely of insulin-producing beta cells. When a genomic DNA fragment containing the coding and upstream regulatory regions of the human insulin gene was stably transfected into MSL-G2 cells no measurable amounts of insulin or insulin mRNA were detected in vitro. However, successive transplantation of two transfected clones resulted in hypoglycemic tumors that efficiently coexpressed human and rat insulin as determined by human C-peptide-specific immunoreagents. These results demonstrate that cis-acting tissue-specific insulin gene enhancer elements are conserved between rat and human insulin genes. The authors propose that the in vivo differentiation of MSL-G2 cells and transfected subclones into insulin-producing cells reflects processes of natural beta-cell ontogeny leading to insulin gene expression
Line radiative transfer and statistical equilibrium*
Directory of Open Access Journals (Sweden)
Kamp Inga
2015-01-01
Full Text Available Atomic and molecular line emission from protoplanetary disks contains key information of their detailed physical and chemical structures. To unravel those structures, we need to understand line radiative transfer in dusty media and the statistical equilibrium, especially of molecules. I describe here the basic principles of statistical equilibrium and illustrate them through the two-level atom. In a second part, the fundamentals of line radiative transfer are introduced along with the various broadening mechanisms. I explain general solution methods with their drawbacks and also specific difficulties encountered in solving the line radiative transfer equation in disks (e.g. velocity gradients. I am closing with a few special cases of line emission from disks: Radiative pumping, masers and resonance scattering.
DEFF Research Database (Denmark)
Monks, A.; Hose, C.D.; Pezzoli, P.
2009-01-01
gene modulation were significantly correlated. A belinostat-gene profile was specific for HDACi in three cell lines when compared with equipotent concentrations of four mechanistically different chemotherapeutic agents: 5-fluorouracil, cisplatin, paclitaxel, and thiotepa. Belinostat- and trichostatin...... in a drug-sensitive tumor than a more resistant model. We have demonstrated a gene signature that is selectively regulated by HDACi when compared with other clinical agents allowing us to distinguish HDACi responses from those related to other mechanisms Udgivelsesdato: 2009/9...
A Retrospective Review of Thiazolidinediones with Development of a Troglitazone Conversion Protocol
Directory of Open Access Journals (Sweden)
Cameron Lindsey
2003-01-01
Full Text Available The objective of this paper was (1 to assess compliance with the National Veterans Affairs Guidelines for the use of troglitazone and rosiglitazone and (2 to develop and implement a conversion protocol that allows effective management of patients receiving troglitazone. A retrospective chart review was conducted to assess adherence to guidelines for all patients receiving troglitazone and rosiglitazone at the medical center. Appropriateness of therapy through indication evaluation, safety through alanine aminotransferase (ALT monitoring compliance, and efficacy through hemoglobin A1c (HbA1c changes were used to assess adherence. According to National Veterans Affairs (VA Guidelines, 68% of troglitazone and 63% of rosiglitazone patients had an appropriate indication for the use of these agents. Baseline ALT levels were obtained in 40% of troglitazone and 71% of rosiglitazone patients. Full compliance with continual ALT monitoring was seen in 6 and 54% of patients, respectively. Goal HbA1c was achieved in 57 and 29% of patients, respectively. Of the 33 patients receiving troglitazone, 19 were converted to rosiglitazone therapy; 11 were maintained on current regimens without troglitazone, and 3 were lost to follow up. Adherence to guidelines needs to be reinforced, in particular, compliance with ALT monitoring. However, there were no reported cases of hepatotoxicity in the patients reviewed. Many patients did not achieve a HbA1c
On-line analysis of biosignals for the automation of total and specific sleep deprivation in the rat
Directory of Open Access Journals (Sweden)
ENNIO A VIVALDI
2008-12-01
Full Text Available A computer-based system that automates sleep studies, including sleep deprivation paradigms, is described. The system allows for total or REM-specific sleep deprivation and is based on a reliable, fast-responding, on-line state detection algorithm linked to a dependable intervention device. Behavioral state detection is achieved by dimensión reduction of short-term EEG power spectrum. Interventions are made by serial outputs to servomotors that move a cage with different patterns and variable intensity. The system can adapt itself to individual characteristics and to changes in recording conditions. Customized protocols can be designed by defining the states or stages to be deprived, including scheduling temporal patterns. A detailed analysis of the relevant signáis during and after deprivation is readily available. Data is presented from two experimental designs in rats. One consisted of specific REM-sleep short-term deprivation and the other of 10-hour total sleep deprivation. An outline of conceptual and practical considerations involved in the automation of laboratory set-ups oriented to biosignal analysis is provided. Careful monitoring of sleep EEG variables during sleep deprivation suggests peculiarities of brain functioning in that condition. A corollary is that sleep deprivation should not be considered to be merely a forced prolonged wakefulness.
Corral-Vázquez, C; Aguilar-Quesada, R; Catalina, P; Lucena-Aguilar, G; Ligero, G; Miranda, B; Carrillo-Ávila, J A
2017-06-01
Establishment of continuous cell lines from human normal and tumor tissues is an extended and useful methodology for molecular characterization of cancer pathophysiology and drug development in research laboratories. The exchange of these cell lines between different labs is a common practice that can compromise assays reliability due to contamination with microorganism such as mycoplasma or cells from different flasks that compromise experiment reproducibility and reliability. Great proportions of cell lines are contaminated with mycoplasma and/or are replaced by cells derived for a different origin during processing or distribution process. The scientific community has underestimated this problem and thousand of research experiment has been done with cell lines that are incorrectly identified and wrong scientific conclusions have been published. Regular contamination and authentication tests are necessary in order to avoid negative consequences of widespread misidentified and contaminated cell lines. Cell banks generate, store and distribute cell lines for research, being mandatory a consistent and continuous quality program. Methods implementation for guaranteeing both, the absence of mycoplasma and authentication in the supplied cell lines, has been performed in the Andalusian Health System Biobank. Specifically, precise results were obtained using real time PCR detection for mycoplasma and 10 STRs identification by capillary electrophoresis for cell line authentication. Advantages and disadvantages of these protocols are discussed.
Paul, Shanty; Wildhagen, Henning; Janz, Dennis; Teichmann, Thomas; Hänsch, Robert; Polle, Andrea
2016-01-01
Cytokinins play an important role in vascular development. But knowledge on the cellular localization of this growth hormone in the stem and other organs of woody plants is lacking. The main focus of this study was to investigate the occurrence and cellular localization of active cytokinins in leaves, roots, and along the stem of Populus × canescens and to find out how the pattern is changed between summer and winter. An ARR5::GUS reporter construct was used to monitor distribution of active cytokinins in different tissues of transgenic poplar lines. Three transgenic lines tested under outdoor conditions showed no influence of ARR5::GUS reporter construct on the growth performance compared with the wild-type, but one line lost the reporter activity. ARR5::GUS activity indicated changes in the tissue- and cell type-specific pattern of cytokinin activity during dormancy compared with the growth phase. ARR5::GUS activity, which was present in the root tips in the growing season, disappeared in winter. In the stem apex ground tissue, ARR5::GUS activity was higher in winter than in summer. Immature leaves from tissue-culture grown plants showed inducible ARR5::GUS activity. Leaf primordia in summer showed ARR5::GUS activity, but not the expanded leaves of outdoor plants or leaf primordia in winter. In stem cross sections, the most prominent ARR5::GUS activity was detected in the cortex region and in the rays of bark in summer and in winter. In the cambial zone the ARR5::GUS activity was more pronounced in the dormant than in growth phase. The pith and the ray cells adjacent to the vessels also displayed ARR5::GUS activity. In silico analyses of the tissue-specific expression patterns of the whole PtRR type-A family of poplar showed that PtRR10, the closest ortholog to the Arabidopsis ARR5 gene, was usually the most highly expressed gene in all tissues. In conclusion, gene expression and tissue-localization indicate high activity of cytokinins not only in summer, but
Ground-based transmission line conductor motion sensor
International Nuclear Information System (INIS)
Jacobs, M.L.; Milano, U.
1988-01-01
A ground-based-conductor motion-sensing apparatus is provided for remotely sensing movement of electric-power transmission lines, particularly as would occur during the wind-induced condition known as galloping. The apparatus is comprised of a motion sensor and signal-generating means which are placed underneath a transmission line and will sense changes in the electric field around the line due to excessive line motion. The detector then signals a remote station when a conditioning of galloping is sensed. The apparatus of the present invention is advantageous over the line-mounted sensors of the prior art in that it is easier and less hazardous to install. The system can also be modified so that a signal will only be given when particular conditions, such as specific temperature range, large-amplitude line motion, or excessive duration of the line motion, are occurring
On-line Learning of Prototypes and Principal Components
Biehl, M.; Freking, A.; Hölzer, M.; Reents, G.; Schlösser, E.; Saad, David
1998-01-01
We review our recent investigation of on-line unsupervised learning from high-dimensional structured data. First, on-line competitive learning is studied as a method for the identification of prototype vectors from overlapping clusters of examples. Specifically, we analyse the dynamics of the
Kotler, Donald P; He, Qing; Engelson, Ellen S; Albu, Jeanine B; Glesby, Marshall J
2016-01-01
Hepatic fat is related to insulin resistance (IR) and visceral adipose tissue (VAT) in HIV+ and uninfected individuals. Growth hormone (GH) reduces VAT but increases IR. We evaluated the effects of recombinant human GH (rhGH) and rosiglitazone (Rosi) on hepatic fat in a substudy of a randomized controlled trial. HIV+ subjects with abdominal obesity and IR (QUICKI≤0.33) were randomized to rhGH 3 mg daily, Rosi 4 mg twice daily, the combination or double placebo. Hepatic fat was measured by magnetic resonance spectroscopy, visceral fat by MRI and IR by frequently sampled intravenous glucose tolerance tests at baseline and week 12. 31 subjects were studied at both time points. Significant correlations between hepatic fat and VAT (r=0.41; P=0.02) and QUICKI (r=0.39; P<0.05) were seen at baseline. IR rose with rhGH but not Rosi. When rhGH treatment groups were combined, hepatic fat expressed as percentage change decreased significantly (P<0.05) but did not change in Rosi (P=0.71). There were no correlations between changes in hepatic fat and VAT (P=0.4) or QUICKI (P=0.6). In a substudy of 21 subjects, a trend was noticed between changes in hepatic fat and serum insulin-like growth factor-1 (IGF-1; P=0.09). Hepatic fat correlates significantly with both VAT and IR, but changes in hepatic fat do not correlate with changes in VAT and glucose metabolism. Hepatic fat content is reduced by rhGH but Rosi has no effect. These results suggest an independent effect of GH or IGF-1 on hepatic fat. The study was registered at Clinicaltrials.gov (NCT00130286).
The effect of bright lines in environmental risk communication
International Nuclear Information System (INIS)
Wilson, K.N.; Desvousges, W.H.; Smith, K.V.; Payne, J.
1993-01-01
Bright lines in environmental risk communication refer to the specific levels at which an environmental risk becomes a serious health threat and action should be taken to mitigate its effects. This study examined the effect of ''bright lines'' in risk communication by emphasizing the radon exposure threshold level of 4 picocuries per liter. Specifically, the authors developed a computer-assisted interview containing bright-line versions of risk information. The bright-line version contained a range of possible radon levels, the corresponding number of estimated lung cancer cases, the relative health risk from radon compared to other health risks, and the EPA guidelines for mitigating levels above 4 picocuries in the home. The non-bright line version was identical to the bright-line version, except it did not include the EPA's mitigation recommendations. Effect measures included respondents' change in perceived risk after reading their materials, intended testing behavior, and advice to their neighbor for a specified radon level either above or below the 4 picocury threshold level. This paper discusses broader policy implications for designing effective risk communication programs
DEFF Research Database (Denmark)
Kongsted, Per; Svane, Inge M; Lindberg, Henriette
2016-01-01
To compare treatment outcomes in patients with metastatic castration-resistant prostate cancer treated with cabazitaxel (CA) as second-line or third-line therapy in the everyday clinical setting. Charts from 94 patients treated with CA as second-line (n=28) or third-line therapy (n=66) were...... evaluated. Common Terminology Criteria for Adverse Events were used to register grade 3-4 nonhematological toxicity during treatment with CA. Baseline metastatic castration-resistant prostate cancer-related prognostic factors, duration of therapy, and maximum prostate-specific antigen (PSA) percentage...... change were registered during treatment with CA and previous/subsequent novel androgen receptor targeting therapies. Progression-free survival (PFS) and overall survival (OS) were calculated using the Kaplan-Meier method. A median of 6 versus 5 treatment cycles was administered in patients treated...
Hepatocyte specific expression of human cloned genes
Energy Technology Data Exchange (ETDEWEB)
Cortese, R
1986-01-01
A large number of proteins are specifically synthesized in the hepatocyte. Only the adult liver expresses the complete repertoire of functions which are required at various stages during development. There is therefore a complex series of regulatory mechanisms responsible for the maintenance of the differentiated state and for the developmental and physiological variations in the pattern of gene expression. Human hepatoma cell lines HepG2 and Hep3B display a pattern of gene expression similar to adult and fetal liver, respectively; in contrast, cultured fibroblasts or HeLa cells do not express most of the liver specific genes. They have used these cell lines for transfection experiments with cloned human liver specific genes. DNA segments coding for alpha1-antitrypsin and retinol binding protein (two proteins synthesized both in fetal and adult liver) are expressed in the hepatoma cell lines HepG2 and Hep3B, but not in HeLa cells or fibroblasts. A DNA segment coding for haptoglobin (a protein synthesized only after birth) is only expressed in the hepatoma cell line HepG2 but not in Hep3B nor in non hepatic cell lines. The information for tissue specific expression is located in the 5' flanking region of all three genes. In vivo competition experiments show that these DNA segments bind to a common, apparently limiting, transacting factor. Conventional techniques (Bal deletions, site directed mutagenesis, etc.) have been used to precisely identify the DNA sequences responsible for these effects. The emerging picture is complex: they have identified multiple, separate transcriptional signals, essential for maximal promoter activation and tissue specific expression. Some of these signals show a negative effect on transcription in fibroblast cell lines.
Optimal Reinsertion of Cancelled Train Lines
DEFF Research Database (Denmark)
Groth, Julie Jespersen; Clausen, Jens
2006-01-01
One recovery strategy in case of a major disruption in rail network is to cancel all trains on a specific line of the network. When the disturbance has ended, the cancelled line must be reinserted as soon as possible. In this article we present a mixed integer programming (MIP) model for calculat....... The model finds the optimal solution in an average of 0.5 CPU seconds in each test case....
Directory of Open Access Journals (Sweden)
Fatemeh Moradipour
2017-10-01
Full Text Available Introduction: Cucumber (Cucumis sativus L. is one of the most widely cultivated vegetables. Plant length is a quantitative trait is controlled by many genes. These traits are difficult to study due to the complex nature of their inheritance. The combining ability estimation is useful in determining the breeding value of cucumber lines by suggesting the appropriate use in a breeding program. In studying combining ability, the most commonly utilized experimental approach is the diallel design. General combining ability is a measure of additive genetic action; and specific combining ability (SCA is deviation from additivity. General combining ability is a main effect and SCA is an interaction. The aim is to determine the breeding value of the cross. Heterosis has been utilized to exploit dominance variance through production of hybrids. There are reports on positive and negative heterosis in cucumber however, there are differences between reports. This research was conducted to estimate general and specific combining ability and heterosis in cucumber inbred lines and hybrids to produce hybrids with high yield and quality. Material and Methods: In the spring of 2014, the seven parental lines and their 21 F1 hybrid were planted at the University of Guilan, in loamy sand field. Three replications were arranged in a randomized complete block design. The sandy loam soil was prepared by plowing and disking and formed into raised beds by plowed and harrow prior to plant establishment. Rows were on 1 m centers and plants were about 25 cm apart in the row. Prior to planting 150 kg·ha-1 of nitrogen from urea and 100 kg·ha-1 of phosphorous from triple superphosphate and 80 kg·ha-1 of potassium sulfate was applied. Side dressing with the same amount of nitrogen and phosphorus occurred at 50% flowering stage. Irrigation with 250 m3·ha-1, three times weekly, was begun at plant first flowering. In each replication, 12 individuals of each line or hybrid were
DEFF Research Database (Denmark)
Sørensen, Jesper Givskov; Loeschcke, Volker; Kristensen, Torsten Nygård
2009-01-01
. 2. We have tested the importance of inducible heat shock proteins (Hsps) under different thermal conditions using two heat shock factor (Hsf) mutant lines (either able (Hsf+) or unable (Hsf0) to mount a heat stress response) and an outbred laboratory adapted wild-type line of Drosophila......1. Laboratory studies on genetically modified strains may reveal important information on mechanisms involved in coping with thermal stress. However, to address the evolutionary significance of specific genes or physiological mechanisms, ecologically relevant field tests should also be performed...
Guri, Amir J; Hontecillas, Raquel; Bassaganya-Riera, Josep
2010-01-01
Background & Aims Abscisic acid (ABA) is effective in preventing insulin resistance and obesity-related inflammation through a PPAR γ-dependent mechanism. The objective of this study was to assess the efficacy ABA in improving glucose homeostasis and suppress inflammation when administered in combination with rosiglitazone (Ros) and to determine whether PPAR γ activation by ABA is initiated via cAMP/protein kinase A (PKA) signaling. Methods Obese db/db mice were fed high-fat diets containing 0, 10, or 70 mg/kg Ros with and without racemic ABA (100 mg/kg) for 60 days. Glucose tolerance and fasting insulin levels were assessed at 6 and 8 weeks, respectively, and adipose tissue macrophage (ATM) infiltration was examined by flow cytometry. Gene expression was examined on white adipose tissue (WAT) and stromal vascular cells (SVCs) cultured with ABA, Ros, or an ABA/Ros combination. Results Both Ros and ABA improved glucose tolerance, and ABA decreased plasma insulin levels while having no effect on Ros-induced weight gain. ABA in combination with low-dose Ros (10 mg/kg; Roslo) synergistically inhibited ATM infiltration. Treatment of SVCs with Ros, ABA or ABA/Ros suppressed expression of the M1 marker CCL17. ABA and Ros synergistically increased PPAR γ activity and pretreatment with a cAMP-inhibitor or a PKA-inhibitor abrogated ABA-induced PPAR γ activation. Conclusions ABA and Ros act synergistically to modulate PPAR γ activity and macrophage accumulation in WAT and ABA enhances PPAR γ activity through a membrane-initiated mechanism dependent on cAMP/PKA signaling. PMID:20207056
Harnessing natural product assembly lines: structure, promiscuity, and engineering.
Ladner, Christopher C; Williams, Gavin J
2016-03-01
Many therapeutically relevant natural products are biosynthesized by the action of giant mega-enzyme assembly lines. By leveraging the specificity, promiscuity, and modularity of assembly lines, a variety of strategies has been developed that enables the biosynthesis of modified natural products. This review briefly summarizes recent structural advances related to natural product assembly lines, discusses chemical approaches to probing assembly line structures in the absence of traditional biophysical data, and surveys efforts that harness the inherent or engineered promiscuity of assembly lines for the synthesis of non-natural polyketides and non-ribosomal peptide analogues.
Energy Technology Data Exchange (ETDEWEB)
Suzuki, Shunichi, E-mail: shunsuzu@affrc.go.jp [Transgenic Pig Research Unit, National Institute of Agrobiological Sciences, 2 Ikenodai, Tsukuba, Ibaraki 305-0901 (Japan); Suzuki, Misae; Sembon, Shoichiro; Fuchimoto, Daiichiro; Onishi, Akira [Transgenic Pig Research Unit, National Institute of Agrobiological Sciences, 2 Ikenodai, Tsukuba, Ibaraki 305-0901 (Japan)
2013-03-01
Highlights: ► Octanoate regulated gene expressions in a way distinct from rosiglitasone. ► Octanoate upregulatedPPRE and LXRE reporter activities. ► Octanoate may act on some PPARγ-target genes competitively with other ligands. - Abstract: Octanoate is used to induce adipogenic differentiation and/or lipid accumulation in preadipocytes of domestic animals. However, information on detailed actions of octanoate and the characteristics of octanoate-induced adipocytes is limited. The aim of this study was to examine these issues by comparing the outcomes of the effects of octanoate with those of rosiglitazone, which is a well-defined activator of peroxisome proliferator-activated receptor (PPAR)-γ. The adipocytes that were differentiated with 5 mM of octanoate had dispersed and diversely sized lipid droplets compared to those that were differentiated with 1 μM of rosiglitazone. The gene expression levels of adiponectin, glycerol-3-phosphate dehydrogenase, perilipin 1, and perilipin 4 were much higher in the adipocytes that were differentiated with rosiglitazone than in those differentiated with octanoate, while the gene expression levels of lipoprotein lipase and perilipin 2 were decreased in rosiglitazone-differentiated adipocytes compared to octanoate-differentiated adipocytes. However, the expressions of aP2 and CD36 genes were comparably induced. Luciferase reporter assays revealed that PPAR and liver-X-receptor activities were upregulated by octanoate more effectively than by rosiglitazone. Overall, these results suggested that the action of octanoate was complicated and may be dependent on the targeted genes and cellular status.
Human rhabdomyosarcoma cell lines for rhabdomyosarcoma research: Utility and pitfalls
Directory of Open Access Journals (Sweden)
Ashley R.P. Hinson
2013-07-01
Full Text Available Rhabdomyosarcoma (RMS is the most common soft tissue sarcoma of childhood and adolescence. Despite intergroup clinical trials conducted in Europe and North America, outcomes for high risk patients with this disease have not significantly improved in the last several decades, and survival of metastatic or relapsed disease remains extremely poor. Accrual into new clinical trials is slow and difficult, so in vitro cell line research and in vivo xenograft models present an attractive alternative for preclinical research for this cancer type. Currently, 30 commonly used human RMS cell lines exist, with differing origins, karyotypes, histologies, and methods of validation. Selecting an appropriate cell line for RMS research has important implications for outcomes. There are also potential pitfalls in using certain cell lines including contamination with murine stromal cells, cross-contamination between cell lines, discordance between the cell line and its associated original tumor, imposter cell lines, and nomenclature errors that result in the circulation of two or more presumed unique cell lines that are actually from the same origin. These pitfalls can be avoided by testing for species-specific isoenzymes, microarray analysis, assays for subtype-specific fusion products, and short tandem repeat analysis.
Human Rhabdomyosarcoma Cell Lines for Rhabdomyosarcoma Research: Utility and Pitfalls
Hinson, Ashley R. P.; Jones, Rosanne; Crose, Lisa E. S.; Belyea, Brian C.; Barr, Frederic G.; Linardic, Corinne M.
2013-01-01
Rhabdomyosarcoma (RMS) is the most common soft tissue sarcoma of childhood and adolescence. Despite intergroup clinical trials conducted in Europe and North America, outcomes for high risk patients with this disease have not significantly improved in the last several decades, and survival of metastatic or relapsed disease remains extremely poor. Accrual into new clinical trials is slow and difficult, so in vitro cell-line research and in vivo xenograft models present an attractive alternative for preclinical research for this cancer type. Currently, 30 commonly used human RMS cell lines exist, with differing origins, karyotypes, histologies, and methods of validation. Selecting an appropriate cell line for RMS research has important implications for outcomes. There are also potential pitfalls in using certain cell lines including contamination with murine stromal cells, cross-contamination between cell lines, discordance between the cell line and its associated original tumor, imposter cell lines, and nomenclature errors that result in the circulation of two or more presumed unique cell lines that are actually from the same origin. These pitfalls can be avoided by testing for species-specific isoenzymes, microarray analysis, assays for subtype-specific fusion products, and short tandem repeat analysis. PMID:23882450
On-line maintenance PSA support at NPP Krsko
International Nuclear Information System (INIS)
Prosen, R.; Vrbanic, I.; Kastelan, M.
2000-01-01
In 1997 Krsko NPP initiated the on-line maintenance (OLM) practice. On-line maintenance constitutes of corrective activities, preventive activities, surveillance activities, tests and inspections, as well as calibrations and modifications, taking place during the normal power operations. The on-line maintenance is a multidisciplinary process consisting of activity specification, planning, and preparation and performing of the OLM activity of interest. The primary role of the PSA group is to assess from the r isk perspective , using the plant-specific NEK PSA model, system unavailability and the impact to the plant operational risk. The intent is to support planning of the on-line maintenance activities from the risk perspective. The risk evaluation of the OLM activities is based on the probability of core damage evaluation for the defined discrete plant configuration states, determined by the OLM activities. Within this application, the optimized, plant-specific PSA model is used on Risk Spectrum platform. To perform the risk assessment of the on-line maintenance activities, first the systems to be affected are defined based on the planned OLM activities. The next important step is the assessment of the planned work schedule. To define the final schedule, the co-ordination and optimizing the planned OLM activities needs activation of all participating departments, supported also from PSA group. The P3 (i.e. Primavera) planning tool system windows are defined for different systems and groups of systems, and the activities are sorted in particular weeks according to these windows. (author)
Safety in the design of production lines
DEFF Research Database (Denmark)
Dyhrberg, Mette Bang; Broberg, Ole; Jacobsen, Peter
2006-01-01
This paper is a case study report on how safety considerations were handled in the process of redesigning a production line. The design process was characterized as a specification and negotiation process between engineers from the company and the supplier organization. The new production line...... in the specification material nor in their face-to-face meetings with the supplier. Safety aspects were not part of their work practice. On this basis, it was suggested that formal guidelines or procedures for integrating safety in the design of production lines would have no effect. Instead, the researchers set up...... became safer, but not as a result of any intentional plan to integrate safety aspects into the design process. Instead, the supplier’s design of a new piece of equipment had a higher built-in safety level. The engineering team in the company was aware of the importance of safety aspects neither...
Safety in the redesigning of production lines
DEFF Research Database (Denmark)
Dyhrberg, Mette Bang; Broberg, Ole; Jacobsen, Peter
2006-01-01
This paper is a case study report on how safety considerations were handled in the process of redesigning a production line. The design process was characterized as a specification and negotiation process between engineers from the company and the supplier organization. The new production line...... became safer, but not as a result of any intentional plan to integrate safety aspects into the design process. Instead, the supplier’s design of a new piece of equipment had a higher built-in safety level. The engineering team in the company was aware of the importance of safety aspects neither...... in the specification material nor in their face-to-face meetings with the supplier. Safety aspects were not part of their work practice. On this basis, it was suggested that formal guidelines or procedures for integrating safety in the design of production lines would have no effect. Instead, the researchers set up...
Hubbert, Beth
2011-01-01
Architecture is a versatile, multifaceted area to study in the artroom with multiple age levels. It can easily stimulate a study of basic line, shape, and various other art elements and principles. It can then be extended into a more extensive study of architectural elements, styles, specific architects, architecture of different cultures, and…
International Nuclear Information System (INIS)
Boucher, T.J.; Owca, W.A.
1985-05-01
This document is the Semiscale MOD-2C feedwater and steam line break experiment series Experiment Operating Specification Appendix for tests S-FS-6 and S-FS-7. Test S-FS-6 is the third test in the series and simulates a 100% break in a steam generator bottom feedwater line downstream of the check valve accompanied by compounding factors (such as check valve failure, loss-of-offsite power at SIS and SIS delayed until low steam generator pressure signal). The test is terminated after plant stabilization and recovery procedures including unaffected loop steam and feed, pressurizer heater operation, pressurizer auxiliary spray operation, and normal charging/letdown operation. Test S-FS-7 is the fourth test in the series and simulates a 14.3% break in a steam generator bottom feedwater line downstream of the check valve, accompanied by compounding factors. The test is terminated after plant stabilization procedures including unaffected loop steam and feed, pressurizer heater operation, and normal charging/letdown operation. The test was followed by an affected loop secondary refill after isolating the break. The Appendix contains information on the major fluid systems, initial experiment conditions, experiment boundary conditions, and sequence of experiment events. Also included is a discussion of the scaling criteria and philosophy used to develop the experiment initial and boundary conditions and system configuration
30 CFR 75.705-1 - Work on high-voltage lines.
2010-07-01
... 30 Mineral Resources 1 2010-07-01 2010-07-01 false Work on high-voltage lines. 75.705-1 Section 75... AND HEALTH MANDATORY SAFETY STANDARDS-UNDERGROUND COAL MINES Grounding § 75.705-1 Work on high-voltage lines. (a) Section 75.705 specifically prohibits work on energized high-voltage lines underground; (b...
NSGIC Local Govt | GIS Inventory — Park Facilities dataset current as of 2010. Boundaries were determined from parcel mapping lines & site specific items, such as shelter locations, were obtained...
Kotler, Donald P; He, Qing; Engelson, Ellen S; Albu, Jeanine B; Glesby, Marshall J
2016-01-01
Background Hepatic fat is related to insulin resistance (IR) and visceral adipose tissue (VAT) in HIV+ and uninfected individuals. Growth hormone (GH) reduces VAT but increases IR. We evaluated the effects of recombinant human GH (rhGH) and rosiglitazone (Rosi) on hepatic fat in a substudy of a randomized controlled trial. Methods HIV+ subjects with abdominal obesity and IR (QUICKI ≤ 0.33) were randomized to rhGH 3 mg daily, Rosi 4 mg twice daily, the combination, or double placebo. Hepatic fat was measured by magnetic resonance spectroscopy (MRS), visceral fat by MRI, and IR by frequently sampled IV glucose tolerance tests at baseline and week 12. Results 31 subjects were studied at both time points. Significant correlations between hepatic fat and VAT (r = 0.41, p=0.02) and QUICKI (r = 0.39, p<0.05) were seen at baseline. Insulin resistance rose with rhGH but not Rosi. When rhGH treatment groups were combined, hepatic fat expressed as percent change decreased significantly (p<0.05) but did not change in Rosi (p=0.71). There were no correlations between changes in hepatic fat and VAT (p=0.4) or QUICKI (p=0.6). In a substudy of 21 subjects, a trend was noticed between changes in hepatic fat and serum IGF-1 (p=0.09). Conclusions Hepatic fat correlates significantly with both VAT and IR, but changes in hepatic fat do not correlate with changes in VAT and glucose metabolism. Hepatic fat content is reduced by rhGH but Rosi has no effect. These results suggest an independent effect of growth hormone or IGF-1 on hepatic fat. The study was registered at Clinicaltrials.gov (NCT00130286). PMID:25536669
Melting of the flux line lattice observed by specific heat experiments in YBa2Cu3O7-δ
International Nuclear Information System (INIS)
Roulin, M.; Junod, A.; Erb, A.; Walker, E.
1996-01-01
High resolution adiabatic specific heat experiments on YBa 2 Cu 3 O 7-δ (0≤δ≤0.05) are performed in magnetic fields from 0 to 14 T (B parallel c and B perpendicular c). In a 0.3 gram, twinned crystal with strong pinning, a step is consistently observed at the melting temperature T m of the vortex solid up to a critical point that depends on δ. The field B m and step temperature T m obey the relation B m =B m0 (δ)(1-T m /T c ) ∼4/3 . The anisotropy of B m and that of the upper critical field B c2 are found to be equal. Alternatively, in a 18 mg, twinned crystal of high purity with low pinning, first-order-like specific heat peaks are observed on the melting line from 8 to 14 T. The entropy under these peaks is ∼0.5 k B /vortex/bilayer. These characteristic features are attributed to the melting of a vortex glass in the former case and that of a vortex lattice in the latter case
Handbook of spectral lines in diamond
Dischler, Bernhard
2012-01-01
This handbook is a breakthrough in the understanding of the large number of spectral lines in diamond. Data on more than 2000 lines and bands are presented in 200 tables, including many unpublished results. With a novel organization scheme, the search for a specific line is greatly simplified as a benefit for researchers and students. In order to meet the interest in the understanding of the spectra, structure assignments for 80 % of the lines are given, of which 15 % only were published before. The majority of the structures for the 300 centers is explained in most cases for the first time. A key instrument in the interpretation is the analysis by donor-acceptor pair transitions. In a special chapter 95 such centers are listed and discussed, of which only two have been published before, the first one by the present author in 1994.
Establishment and characterization of rat portal myofibroblast cell lines.
Directory of Open Access Journals (Sweden)
Michel Fausther
Full Text Available The major sources of scar-forming myofibroblasts during liver fibrosis are activated hepatic stellate cells (HSC and portal fibroblasts (PF. In contrast to well-characterized HSC, PF remain understudied and poorly defined. This is largely due to the facts that isolation of rodent PF for functional studies is technically challenging and that PF cell lines had not been established. To address this, we have generated two polyclonal portal myofibroblast cell lines, RGF and RGF-N2. RGF and RGF-N2 were established from primary PF isolated from adult rat livers that underwent culture activation and subsequent SV40-mediated immortalization. Specifically, Ntpdase2/Cd39l1-sorted primary PF were used to generate the RGF-N2 cell line. Both cell lines were functionally characterized by RT-PCR, immunofluorescence, immunoblot and bromodeoxyuridine-based proliferation assay. First, immortalized RGF and RGF-N2 cells are positive for phenotypic myofibroblast markers alpha smooth muscle actin, type I collagen alpha-1, tissue inhibitor of metalloproteinases-1, PF-specific markers elastin, type XV collagen alpha-1 and Ntpdase2/Cd39l1, and mesenchymal cell marker ecto-5'-nucleotidase/Cd73, while negative for HSC-specific markers desmin and lecithin retinol acyltransferase. Second, both RGF and RGF-N2 cell lines are readily transfectable using standard methods. Finally, RGF and RGF-N2 cells attenuate the growth of Mz-ChA-1 cholangiocarcinoma cells in co-culture, as previously demonstrated for primary PF. Immortalized rat portal myofibroblast RGF and RGF-N2 cell lines express typical markers of activated PF-derived myofibroblasts, are suitable for DNA transfection, and can effectively inhibit cholangiocyte proliferation. Both RGF and RGF-N2 cell lines represent novel in vitro cellular models for the functional studies of portal (myofibroblasts and their contribution to the progression of liver fibrosis.
International Nuclear Information System (INIS)
Medina, D.; Oborn, C.J.; Li, M.L.; Bissell, M.J.
1987-01-01
The COMMA-D mammary cell line exhibits mammary-specific functional differentiation under appropriate conditions in cell culture. The cytologically heterogeneous COMMA-D parental line and the clonal lines DB-1, TA-5, and FA-1 derived from the COMMA-D parent were examined for similar properties of functional differentiation. In monolayer cell culture, the cell lines DB-1, TA-5, FA-1, and MA-4 were examined for expression of mammary-specific and epithelial-specific proteins by an indirect immunofluorescence assay. The clonal cell lines were relatively homogeneous in their respective staining properties and seemed to represent three subpopulations found in the heterogeneous parental COMMA-D lines. None of the four clonal lines appeared to represent myoepithelial cells. The cell lines were examined for expression of β-casein mRNA in the presence or absence of prolactin. The inducibility of β-casein in the COMMA-D cell line was further enhanced by a reconstituted basement membrane preparation enriched in laminin, collagen IV, and proteoglycans. These results support the hypothesis that the functional response of inducible mammary cell populations is a result of interaction among hormones, multiple extracellular matrix components, and specific cell types
Proximity effects of high voltage electric power transmission lines on ...
African Journals Online (AJOL)
Yomi
2010-08-18
Aug 18, 2010 ... transmission lines on ornamental plant growth. Zeki Demir ... The effects of proximity to power-line on specific leaf area and seedling dbh were tested .... during vegetation season is about 72% and common wind blow.
Xiong, Guoxin; Xiong, Leilei; Li, Xinzhong
2016-09-01
To investigate the effects of low intensity semiconductor laser acupoint irradiation on inhibiting islet beta-cell apoptosis in rats with type 2 diabetes, a method using a high-fat diet and low-dose intraperitoneal injections of streptozotocin established a type 2 diabetes mellitus rat model. Model rats were randomly divided into a laser acupoint irradiation group, rosiglitazone control group, and placebo group; each group had 10 rats. In addition, 10 normal male rats were selected for the normal control group. The Housanli, Neiting and Yishu acupoints of the rats in the laser acupoint irradiation group were irradiated with a 10 mW semiconductor laser; each point was irradiated for 15 min, once every 2 d over 28 d, for a total of 14 episodes of irradiation. The rosiglitazone group rats were given rosiglitazone (0.2 mg kg-1) intragastrically; the placebo group rats were given 0.9% brine (0.2 mg kg-1) intragastrically, once daily, for four consecutive weeks. The change of fasting blood glucose was determined before and after each treatment. The islet beta-cell apoptosis was determined. The islet beta-cell apoptosis rates of the laser acupoint irradiation group and the rosiglitazone group were significantly lower than the rate of the placebo group. Even though the rate was lower in the laser acupoint irradiation group than in the rosiglitazone group, there was no significant difference between them. It is shown that acupoint irradiation with a semiconductor laser can effectively inhibit islet beta-cell apoptosis in rats with type 2 diabetes.
Modeling operational behavior of a disassembly line
Kizilkaya, Elif A.; Gupta, Surendra M.
2004-12-01
In this paper we present a dynamic kanban (pull) system specifically developed for disassembly lines. This type of kanban system is much more complex than the traditional kanban system used in assembly lines. For instance, unlike the assembly line where the external demand occurs only at the last station, the demands in the disassembly case also occur at any of the intermittent stations. The reason is that as a product moves on the disassembly line, various parts are disassembled at every station and accumulated at that station. Therefore, there are as many demand sources as there are number of parts. We consider a case example involving the end-of-life products. Based on the precedence relationships and other criteria such as hazardous properties of the parts, we balance the disassembly line. The results of the disassembly line-balancing problem (DLBP) are used as input to the proposed dynamic kanban system for disassembly line (DKSDL). We compare the performance of the DKSDL to the modified kanban system for disassembly line (MKSDL), which was previously introduced by the authors. We show, via simulation, that the DKSDL is far superior to MKSDL considered.
International Nuclear Information System (INIS)
Leibhard, S.; Smida, J.
1996-01-01
Repetitive DNA sequences of the LINE-family (long interspersed elements) that are widely distributed among the mammalian genome can be activated or altered by the exposure to ionizing radiation [1]. By the integration at new sites in the genome alterations in the expression of genes that are involved in cell transformation and/or carcinogenesis may occur [2, 3]. A new technique -the inter-LINE PCR - has been developed in order to detect and analyse such genomic rearrangements in radiation-transformed cell lines. From the sites of transformation- or tumour-specific changes in the genome it might be possible to develop new tumour markers for diagnostic purpose. (orig.) [de
Collisionless reconnection: magnetic field line interaction
Directory of Open Access Journals (Sweden)
R. A. Treumann
2012-10-01
Full Text Available Magnetic field lines are quantum objects carrying one quantum Φ0 = 2πh/e of magnetic flux and have finite radius λm. Here we argue that they possess a very specific dynamical interaction. Parallel field lines reject each other. When confined to a certain area they form two-dimensional lattices of hexagonal structure. We estimate the filling factor of such an area. Anti-parallel field lines, on the other hand, attract each other. We identify the physical mechanism as being due to the action of the gauge potential field, which we determine quantum mechanically for two parallel and two anti-parallel field lines. The distortion of the quantum electrodynamic vacuum causes a cloud of virtual pairs. We calculate the virtual pair production rate from quantum electrodynamics and estimate the virtual pair cloud density, pair current and Lorentz force density acting on the field lines via the pair cloud. These properties of field line dynamics become important in collisionless reconnection, consistently explaining why and how reconnection can spontaneously set on in the field-free centre of a current sheet below the electron-inertial scale.
Children's cognitive representation of the mathematical number line.
Rouder, Jeffrey N; Geary, David C
2014-07-01
Learning of the mathematical number line has been hypothesized to be dependent on an inherent sense of approximate quantity. Children's number line placements are predicted to conform to the underlying properties of this system; specifically, placements are exaggerated for small numerals and compressed for larger ones. Alternative hypotheses are based on proportional reasoning; specifically, numerals are placed relative to set anchors such as end points on the line. Traditional testing of these alternatives involves fitting group medians to corresponding regression models which assumes homogenous residuals and thus does not capture useful information from between- and within-child variation in placements across the number line. To more fully assess differential predictions, we developed a novel set of hierarchical statistical models that enable the simultaneous estimation of mean levels of and variation in performance, as well as developmental transitions. Using these techniques we fitted the number line placements of 224 children longitudinally assessed from first to fifth grade, inclusive. The compression pattern was evident in mean performance in first grade, but was the best fit for only 20% of first graders when the full range of variation in the data are modeled. Most first graders' placements suggested use of end points, consistent with proportional reasoning. Developmental transition involved incorporation of a mid-point anchor, consistent with a modified proportional reasoning strategy. The methodology introduced here enables a more nuanced assessment of children's number line representation and learning than any previous approaches and indicates that developmental improvement largely results from midpoint segmentation of the line. © 2014 John Wiley & Sons Ltd.
AAVS1-Targeted Plasmid Integration in AAV Producer Cell Lines.
Luo, Yuxia; Frederick, Amy; Martin, John M; Scaria, Abraham; Cheng, Seng H; Armentano, Donna; Wadsworth, Samuel C; Vincent, Karen A
2017-06-01
Adeno-associated virus (AAV) producer cell lines are created via transfection of HeLaS3 cells with a single plasmid containing three components (the vector sequence, the AAV rep and cap genes, and a selectable marker gene). As this plasmid contains both the cis (Rep binding sites) and trans (Rep protein encoded by the rep gene) elements required for site-specific integration, it was predicted that plasmid integration might occur within the AAVS1 locus on human chromosome 19 (chr19). The objective of this study was to investigate whether integration in AAVS1 might be correlated with vector yield. Plasmid integration sites within several independent cell lines were assessed via Southern, fluorescence in situ hybridization (FISH) and PCR analyses. In the Southern analyses, the presence of fragments detected by both rep- and AAVS1-specific probes suggested that for several mid- and high-producing lines, plasmid DNA had integrated into the AAVS1 locus. Analysis with puroR and AAVS1-specific probes suggested that integration in AAVS1 was a more widespread phenomenon. High-producing AAV2-secreted alkaline phosphatase (SEAP) lines (masterwell 82 [MW82] and MW278) were evaluated via FISH using probes specific for the plasmid, AAVS1, and a chr19 marker. FISH analysis detected two plasmid integration sites in MW278 (neither in AAVS1), while a total of three sites were identified in MW82 (two in AAVS1). An inverse PCR assay confirmed integration within AAVS1 for several mid- and high-producing lines. In summary, the FISH, Southern, and PCR data provide evidence of site-specific integration of the plasmid within AAVS1 in several AAV producer cell lines. The data also suggest that integration in AAVS1 is a general phenomenon that is not necessarily restricted to high producers. The results also suggest that plasmid integration within the AAVS1 locus is not an absolute requirement for a high vector yield.
International Nuclear Information System (INIS)
Zhu Cuiying; Zhou Huan; Han Yuan; Ling Liqun; Huang Gang
2008-01-01
The aim of this study was to find and establish the serum marker which can reflect the degree of intrahepatic lipid infiltration in Type 2 diabetes patients and assess the therapeutic effect. It helps us to observe the improvement of intrahepatic lipid deposit under controlled serum glucose metabolism. Twenty-three Type 2 diabetes patients with obvious intrahepatic lipid infiltration diagnosed by CT scan were divided into two groups, one group took rosiglitazone orally (male: female 5:6), and the combined treatment group took rosiglitazone and metformin simultaneously (male: female 6:6), in daily therapeutic dose of 4 mg rosiglitazone and 2 g metformin for 24 weeks. Before and after treatment, we measured fasting serum glucose, glycated hemoglobin (GHb), insulin, insulin resistant index, plasma adiponectin, leptin, tumor necrotic factor α (TNF-α), ferrtin respectively. After the treatment, fasting serum glucose and GHb decreased obvious, especially the combined treatment group. Intrahepatic lipid content percent decreased, too, in both groups (the rosiglitazone group: 43.3±25.8 vs 29.1±18.7, P<0.01, the combined group: 43.4±21.8 vs 22.0±16.7, P<0.01). Plasma adiponectin and TNF-α had correlation to intrahepatic lipid contend percent change. Plasma adiponectin and TNF-α was obviously improved in the rosiglitazone group and the combined treatment group (Adiponectin: 11.96±7.3 vs 20.61±12.0 ng/mL, 12.76±6.7 vs 25.81±12.8 ng/mL; TNFα: 6.92±2.5 vs 5.89±1.9 pg/mL, 6.81±2.14 vs 5.45±2.0 pg/mL; P<0.01). In addition, serum ferrtin concentration decreased obviously, especially the combined treatment group (rosiglitazone group: 345±116 vs 288±71ng/mL, P<0.05, combined treatment group: 362±194 vs 258±109 ng/mL, P<0.01). It can be concluded that 1) rosiglitazone and metformin controls serum glucose metabolism and improves intrahepatic lipid infiltration by especially the combined treatment, 2) plasma adiponectic and TNF-α are effective markers to reflect
The relationship of metabolic burden to productivity levels in CHO cell lines.
Zou, Wu; Edros, Raihana; Al-Rubeai, Mohamed
2018-03-01
The growing demand for recombinant therapeutics has driven biotechnologists to develop new production strategies. One such strategy for increasing the expression of heterologous proteins has focused on enhancing cell-specific productivity through environmental perturbations. In this work, the effects of hypothermia, hyperosmolarity, high shear stress, and sodium butyrate treatment on growth and productivity were studied using three (low, medium, and high producing) CHO cell lines that differed in their specific productivities of monoclonal antibody. In all three cell lines, the inhibitory effect of these parameters on proliferation was demonstrated. Additionally, compared to the control, specific productivity was enhanced under all conditions and exhibited a consistent cell line specific pattern, with maximum increases (50-290%) in the low producer, and minimum increases (7-20%) in the high producer. Thus, the high-producing cell line was less responsive to environmental perturbations than the low-producing cell line. We hypothesize that this difference is most likely due to the bottleneck associated with a higher metabolic burden caused by higher antibody expression. Increased recombinant mRNA levels and pyruvate carboxylase activities due to low temperature and hyperosmotic stress were found to be positively associated with the metabolic burden. © 2017 International Union of Biochemistry and Molecular Biology, Inc.
The U-line line balancing problem
Miltenburg, G.J.; Wijngaard, J.
1994-01-01
The traditional line balancing (LB) problem considers a production line in which stations are arranged consecutively in a line. A balance is determined by grouping tasks into stations while moving forward (or backward) through a precedence network. Recently many production lines are being arranged
50 CFR 648.200 - Specifications.
2010-10-01
..., unless an OY that exceeds MSY in a specific year is consistent with a control rule that ensures the... northerly along the Hague Line to the U.S.-Canadian border, to include state and Federal waters adjacent to...., northeasterly to the Hague Line at 42°53′14″ N. lat., 67°44′35″ W. long. [72 FR 11277, Mar. 12, 2007, as amended...
Tan, Kah Yong; Teo, Kim Leng; Lim, Jessica F Y; Chen, Allen K L; Choolani, Mahesh; Reuveny, Shaul; Chan, Jerry; Oh, Steve Kw
2015-08-01
Mesenchymal stromal cells (MSCs) are being investigated as potential cell therapies for many different indications. Current methods of production rely on traditional monolayer culture on tissue-culture plastic, usually with the use of serum-supplemented growth media. However, the monolayer culturing system has scale-up limitations and may not meet the projected hundreds of billions to trillions batches of cells needed for therapy. Furthermore, serum-free medium offers several advantages over serum-supplemented medium, which may have supply and contaminant issues, leading to many serum-free medium formulations being developed. We cultured seven MSC lines in six different serum-free media and compared their growth between monolayer and microcarrier culture. We show that (i) expansion levels of MSCs in serum-free monolayer cultures may not correlate with expansion in serum-containing media; (ii) optimal culture conditions (serum-free media for monolayer or microcarrier culture) differ for each cell line; (iii) growth in static microcarrier culture does not correlate with growth in stirred spinner culture; (iv) and that early cell attachment and spreading onto microcarriers does not necessarily predict efficiency of cell expansion in agitated microcarrier culture. Current serum-free media developed for monolayer cultures of MSCs may not support MSC proliferation in microcarrier cultures. Further optimization in medium composition will be required for microcarrier suspension culture for each cell line. Copyright © 2015 International Society for Cellular Therapy. Published by Elsevier Inc. All rights reserved.
Evaluation of the combining ability of mutant maize lines
Directory of Open Access Journals (Sweden)
V. Valkova
2016-09-01
Full Text Available Abstract. The study shows the results of a preliminary evaluation of the combining ability for grain yield of 17 mutant maize lines. For the purpose the top cross method for early testing and the mathematical model of Savchenko for analysis of the general and the specific combining ability were used. The lines were tested on three testers with high general combining ability that belong to two genetic groups: K 46 52 and XM 552 from SSS and N 192 – Lancaster. For the purposes of evaluation of the productive abilities of the received top cross two preliminary varietal experiments were carried out at the experimental field of Maize Research Institute, Knezha As a result of the conducted experimental work and the analysis it was found that the highest general combining ability have lines XM 11 6 and XM 12 1. These lines can be included as components of high-yielding synthetics or as testers in analyzing crosses to determine general combining ability in early stages of the selection process. The above lines with high specific combining ability – XM 11 13 and XM 11 46 are suitable for inclusion in combinations to develop high-yielding hybrids. Three of the tested lines XM 11 7 11 XM 10 and XM 11 11 have both high GCA and SCA. These lines can be used in corresponding breeding in the selection programs.
Generalized emittance measurements in a beam transport line
International Nuclear Information System (INIS)
Skelly, J.; Gardner, C.; Luccio, A.; Kponou, A.; Reece, K.
1991-01-01
Motivated by the need to commission 3 beam transport lines for the new AGS Booster project, we have developed a generalized emittance-measurement program; beam line specifics are entirely resident in data tables, not in program code. For instrumentation, the program requires one or more multi-wire profile monitors; one or multiple profiles are acquired from each monitor, corresponding to one or multiple tunes of the transport line. Emittances and Twiss parameters are calculated using generalized algorithms. The required matix descriptions of the beam optics are constructed by an on-line general beam modeling program. Design of the program, its algorithms, and initial experience with it will be described. 4 refs., 2 figs., 1 tab
Evolutionary history of LINE-1 in the major clades of placental mammals.
Directory of Open Access Journals (Sweden)
Paul D Waters
2007-01-01
Full Text Available LINE-1 constitutes an important component of mammalian genomes. It has a dynamic evolutionary history characterized by the rise, fall and replacement of subfamilies. Most data concerning LINE-1 biology and evolution are derived from the human and mouse genomes and are often assumed to hold for all placentals.To examine LINE-1 relationships, sequences from the 3' region of the reverse transcriptase from 21 species (representing 13 orders across Afrotheria, Xenarthra, Supraprimates and Laurasiatheria were obtained from whole genome sequence assemblies, or by PCR with degenerate primers. These sequences were aligned and analysed.Our analysis reflects accepted placental relationships suggesting mostly lineage-specific LINE-1 families. The data provide clear support for several clades including Glires, Supraprimates, Laurasiatheria, Boreoeutheria, Xenarthra and Afrotheria. Within the afrotherian LINE-1 (AfroLINE clade, our tree supports Paenungulata, Afroinsectivora and Afroinsectiphillia. Xenarthran LINE-1 (XenaLINE falls sister to AfroLINE, providing some support for the Atlantogenata (Xenarthra+Afrotheria hypothesis.LINEs and SINEs make up approximately half of all placental genomes, so understanding their dynamics is an essential aspect of comparative genomics. Importantly, a tree of LINE-1 offers a different view of the root, as long edges (branches such as that to marsupials are shortened and/or broken up. Additionally, a robust phylogeny of diverse LINE-1 is essential in testing that site-specific LINE-1 insertions, often regarded as homoplasy-free phylogenetic markers, are indeed unique and not convergent.
Design process and modeling studies of SSRL beam line wunder
International Nuclear Information System (INIS)
Bachrach, R.Z.; Bringans, R.D.
1984-01-01
SSRL Beam Line Wunder will be the first soft X-ray energy range synchrotron radiation beam line specifically designed to exploit the unique aspects of periodic insertion devices in the wiggler-undulator (wunder) regime. Aspects of the development of this beam line are described in this paper and in particular, we discuss the design methodology adopted and emphasize the joint optical, thermal and mechanical optimization studies that were required. (orig.)
Guri, Amir J; Hontecillas, Raquel; Bassaganya-Riera, Josep
2010-10-01
Abscisic acid (ABA) is effective in preventing insulin resistance and obesity-related inflammation through a PPAR γ-dependent mechanism. The objective of this study was to assess the efficacy ABA in improving glucose homeostasis and suppress inflammation when administered in combination with rosiglitazone (Ros) and to determine whether PPAR γ activation by ABA is initiated via cAMP/protein kinase A (PKA) signaling. Obese db/db mice were fed high-fat diets containing 0, 10, or 70 mg/kg Ros with and without racemic ABA (100 mg/kg) for 60 days. Glucose tolerance and fasting insulin levels were assessed at 6 and 8 weeks, respectively, and adipose tissue macrophage (ATM) infiltration was examined by flow cytometry. Gene expression was examined on white adipose tissue (WAT) and stromal vascular cells (SVCs) cultured with ABA, Ros, or an ABA/Ros combination. Both Ros and ABA improved glucose tolerance, and ABA decreased plasma insulin levels while having no effect on Ros-induced weight gain. ABA in combination with low-dose Ros (10 mg/kg; Roslo) synergistically inhibited ATM infiltration. Treatment of SVCs with Ros, ABA or ABA/Ros suppressed expression of the M1 marker CCL17. ABA and Ros synergistically increased PPAR γ activity and pretreatment with a cAMP-inhibitor or a PKA-inhibitor abrogated ABA-induced PPAR γ activation. ABA and Ros act synergistically to modulate PPAR γ activity and macrophage accumulation in WAT and ABA enhances PPAR γ activity through a membrane-initiated mechanism dependent on cAMP/PKA signaling. Copyright © 2010 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.
Menzel, R.; Paynter, D.; Jones, A. L.
2017-12-01
Due to their relatively low computational cost, radiative transfer models in global climate models (GCMs) run on traditional CPU architectures generally consist of shortwave and longwave parameterizations over a small number of wavelength bands. With the rise of newer GPU and MIC architectures, however, the performance of high resolution line-by-line radiative transfer models may soon approach those of the physical parameterizations currently employed in GCMs. Here we present an analysis of the current performance of a new line-by-line radiative transfer model currently under development at GFDL. Although originally designed to specifically exploit GPU architectures through the use of CUDA, the radiative transfer model has recently been extended to include OpenMP in an effort to also effectively target MIC architectures such as Intel's Xeon Phi. Using input data provided by the upcoming Radiative Forcing Model Intercomparison Project (RFMIP, as part of CMIP 6), we compare model results and performance data for various model configurations and spectral resolutions run on both GPU and Intel Knights Landing architectures to analogous runs of the standard Oxford Reference Forward Model on traditional CPUs.
Identification and characterization of mobile genetic elements LINEs from Brassica genome.
Nouroz, Faisal; Noreen, Shumaila; Khan, Muhammad Fiaz; Ahmed, Shehzad; Heslop-Harrison, J S Pat
2017-09-05
Among transposable elements (TEs), the LTR retrotransposons are abundant followed by non-LTR retrotransposons in plant genomes, the lateral being represented by LINEs and SINEs. Computational and molecular approaches were used for the characterization of Brassica LINEs, their diversity and phylogenetic relationships. Four autonomous and four non-autonomous LINE families were identified and characterized from Brassica. Most of the autonomous LINEs displayed two open reading frames, ORF1 and ORF2, where ORF1 is a gag protein domain, while ORF2 encodes endonuclease (EN) and a reverse transcriptase (RT). Three of four families encoded an additional RNase H (RH) domain in pol gene common to 'R' and 'I' type of LINEs. The PCR analyses based on LINEs RT fragments indicate their high diversity and widespread occurrence in tested 40 Brassica cultivars. Database searches revealed the homology in LINE sequences in closely related genera Arabidopsis indicating their origin from common ancestors predating their separation. The alignment of 58 LINEs RT sequences from Brassica, Arabidopsis and other plants depicted 4 conserved domains (domain II-V) showing similarity to previously detected domains. Based on RT alignment of Brassica and 3 known LINEs from monocots, Brassicaceae LINEs clustered in separate clade, further resolving 4 Brassica-Arabidopsis specific families in 2 sub-clades. High similarities were observed in RT sequences in the members of same family, while low homology was detected in members across the families. The investigation led to the characterization of Brassica specific LINE families and their diversity across Brassica species and their cultivars. Copyright © 2017 Elsevier B.V. All rights reserved.
ExoCross: Spectra from molecular line lists
Yurchenko, Sergei N.; Al-Refaie, Ahmed; Tennyson, Jonathan
2018-03-01
ExoCross generates spectra and thermodynamic properties from molecular line lists in ExoMol, HITRAN, or several other formats. The code is parallelized and also shows a high degree of vectorization; it works with line profiles such as Doppler, Lorentzian and Voigt and supports several broadening schemes. ExoCross is also capable of working with the recently proposed method of super-lines. It supports calculations of lifetimes, cooling functions, specific heats and other properties. ExoCross converts between different formats, such as HITRAN, ExoMol and Phoenix, and simulates non-LTE spectra using a simple two-temperature approach. Different electronic, vibronic or vibrational bands can be simulated separately using an efficient filtering scheme based on the quantum numbers.
Thiazolidinediones inhibit TNFα induction of PAI-1 independent of PPARγ activation
International Nuclear Information System (INIS)
Liu, H.B.; Hu, Y.S.; Medcalf, R.L.; Simpson, R.W.; Dear, A.E.
2005-01-01
Increased plasminogen activator inhibitor type 1 (PAI-1) levels are observed in endothelial cells stimulated by tumour necrosis factor α (TNFα). Thiazolidinediones (TZDs) may inhibit elevated endothelial cell PAI-1 accounting, in part, for the putative atheroprotective effects of TZDs. In an endothelial cell line, Rosiglitazone (RG) and Pioglitazone (PG) inhibited induction of PAI-1 by TNFα. The specific peroxisome proliferator-activated receptor γ (PPARγ) inhibitor, SR-202, failed to modulate this effect. RG also inhibited the effect of TNFα on a reporter gene construct harbouring the proximal PAI-1 promoter and PAI-1 mRNA in cells co-transfected with a dominant-negative PPARγ construct. RG and PG attenuated TNFα-mediated induction of trans-acting factor(s) Nur77/Nurr1 and binding of nuclear proteins (NP) to the cis-acting element (NBRE). SR-202 failed to modulate these effects. The observations suggest TZDs inhibit TNFα-mediated PAI-1 induction independent of inducible PPARγ activation and this may involve in the modulation of Nur77/Nurr1 expression and NP binding to the PAI-1 NBRE
Table of laser lines in gases and vapors
Energy Technology Data Exchange (ETDEWEB)
Beck, R; Englisch, W; Guers, K
1980-01-01
Numerous applications of lasers require use of specific wavelengths (gas analysis including remote sensing, Raman spectroscopy, optical pumping, laser chemistry and isotope separation). Scientists active in these fields have been compelled to search, in addition to the available, mostly obsolete, laser-line tables, the entire recent literature in order to find suitable laser transitions. Over 6100 laser transitions are presented. An additional list of the lines arranged in order of wavelength should greatly facilitate the search for a laser material that generates a specific wavelength. Further information has also been supplied by listing the pump transition for each of the FIR lines obtained with the optically pumped organic vapors. In addition to the laser lines, the operating conditions under which emission has been achieved are briefly specified at the top of the list for each active medium. The order in which the atomic laser media are listed is based on the periodic system, beginning with the noble gases, continuing with hydrogen and the alkalies to the halogens and the rare earths. The molecular laser media are arranged in order of chemical composition, beginning with the compounds of noble gases (the excimers), then other diatomic molecules, triatomic molecules, and ending with the more complex molecules of organic vapors. (WHK).
Kunzelmann, K; Lei, D C; Eng, K; Escobar, L C; Koslowsky, T; Gruenert, D C
1995-09-01
Analysis of vectorial ion transport and protein trafficking in transformed cystic fibrosis (CF) epithelial cells has been limited because the cells tend to lose their tight junctions with multiple subcultures. To elucidate ion transport and protein trafficking in CF epithelial cells, a polar cell line with apical and basolateral compartments will facilitate analysis of the efficacy of different gene therapy strategies in a "tight epithelium" in vitro. This study investigates the genotypic and phenotypic properties of a CF nasal polyp epithelial, delta F508 homozygote, cell line that has tight junctions pre-crisis. The cells (sigma CFNPE14o-) were transformed with an origin-of-replication defective SV40 plasmid. They develop transepithelial resistance in Ussing chambers and are defective in cAMP-dependent Cl- transport as measured by efflux of radioactive Cl-, short circuit current (Isc), or whole-cell patch clamp. Stimulation of the cells by bradykinin, histamine, or ATP seems to activate both K(+)- and Ca(+2)-dependent Cl- transport. Measurement of 36Cl- efflux following stimulation with A23187 and ionomycin indicate a Ca(+2)-dependent Cl- transport. Volume regulatory capacity of the cells is indicated by cell swelling conductance. Expression of the CF transmembrane conductance regulator mRNA was indicated by RT-PCR amplification. When cells are grown at 26 degrees C for 48 h there is no indication of cAMP-dependent Cl- as has been previously indicated in heterologous expression systems. Antibodies specific for secretory cell antigens indicate the presence of antigens found in goblet, serous, and mucous cells; in goblet and serous cells; or in goblet and mucous cells; but not antigens found exclusively in mucous or serous cells.(ABSTRACT TRUNCATED AT 250 WORDS)
Directory of Open Access Journals (Sweden)
Mohamad Hoda E
2011-03-01
Full Text Available Abstract Background Diabetes mellitus (DM and hypertension (HTN are accused of being responsible for the development of the cardiac fibrosis due to severe cardiomyopathy. Methods Blood glucose (BG test was carried out, lipid concentrations, tumor necrosis factor alpha (TNF-α, transforming growth factor beta (TGF-β, matrix metalloproteinase (MMP-2, collagen-I and collagen-III were measured in male Albino rats weighing 179-219 g. The rats were divided into five groups, kept on either control diet or high fat diet (HFD, and simultaneously treated with rosiglitazone (PPAR-gamma only for one group with 3 mg/kg/day via oral route for 30 days, and with rosiglitazone and felodipine combination for another group with 3 mg/kg/day and 5 mg/kg/day, respectively via oral route for 30 days. Results Diabetic hypertensive (DH rats which fed on a HFD, injected with streptozotocin (STZ (i.p. and obstruction for its right kidney was occurred develop hyperglycemia, hypertension, cardiac fibrosis, hypertriglyceridemia, hypercholesterolemia, increased TNF-α, increased TGF-β, decreased MMP-2, increased collagen-I and increased collagen-III, when compared to rats fed on control diet. Treating the DH rats with rosiglitazone only causes a significant decrease for BG levels by 52.79%, triglycerides (TGs by 24.05%, total cholesterol (T-Chol by 30.23%, low density lipoprotein cholesterol (LDL-C by 40.53%, TNF-α by 20.81%, TGF-β by 46.54%, collagen-I by 48.11% and collagen-III by 53.85% but causes a significant increase for MMP-2 by 272.73%. Moreover, Treating the DH rats with rosiglitazone and felodipine combination causes a significant decrease for BG levels by 61.08%, blood pressure (BP by 16.78%, TGs by 23.80%, T-Chol by 33.27%, LDL-C by 45.18%, TNF-α by 22.82%, TGF-β by 49.31%, collagen-I by 64.15% and collagen-III by 53.85% but causes a significant increase for MMP-2 by 290.91%. Rosiglitazone alone failed to decrease the BP in DH rats in the current dosage and
Presence of dopamine D-2 receptors in human tumoral cell lines
Energy Technology Data Exchange (ETDEWEB)
Sokoloff, P.; Riou, J.F.; Martres, M.P.; Schwartz, J.C. (Centre Paul Broca, Paris (France))
1989-07-31
({sup 125}I) Iodosulpride binding was examined on eight human cell lines derived from lung, breast and digestive tract carcinomas, neuroblastomas and leukemia. Specific binding was detected in five of these cell lines. In the richest cell line N417, derived from small cell lung carcinoma, ({sup 125}I) iodosulpride bound with a high affinity (Kd = 1.3 nM) to an apparently homogeneous population of binding site (Bmax = 1,606 sites per cell). These sites displayed a typical D-2 specificity, established with several dopaminergic agonists and antagonists selective of either D-1 or D-2 receptor subtypes. In addition, dopamine, apomorphine and RU 24926 distinguished high- and low-affinity sites, suggesting that the binding sites are associated with a G-protein. The biological significance and the possible diagnostic implication of the presence of D-2 receptors on these cell lines are discussed.
Establishment of cell lines with rat spermatogonial stem cell characteristics
van Pelt, Ans M. M.; Roepers-Gajadien, Hermien L.; Gademan, Iris S.; Creemers, Laura B.; de Rooij, Dirk G.; van Dissel-Emiliani, Federica M. F.
2002-01-01
Spermatogonial cell lines were established by transfecting a mixed population of purified rat A(s) (stem cells), A(pr) and A(al) spermatogonia with SV40 large T antigen. Two cell lines were characterized and found to express Hsp90alpha and oct-4, specific markers for germ cells and A spermatogonia,
Selenium-regulated hierarchy of human selenoproteome in cancerous and immortalized cells lines.
Touat-Hamici, Zahia; Bulteau, Anne-Laure; Bianga, Juliusz; Jean-Jacques, Hélène; Szpunar, Joanna; Lobinski, Ryszard; Chavatte, Laurent
2018-04-13
Selenoproteins (25 genes in human) co-translationally incorporate selenocysteine using a UGA codon, normally used as a stop signal. The human selenoproteome is primarily regulated by selenium bioavailability with a tissue-specific hierarchy. We investigated the hierarchy of selenoprotein expression in response to selenium concentration variation in four cell lines originating from kidney (HEK293, immortalized), prostate (LNCaP, cancer), skin (HaCaT, immortalized) and liver (HepG2, cancer), using complementary analytical methods. We performed (i) enzymatic activity, (ii) RT-qPCR, (iii) immuno-detection, (iv) selenium-specific mass spectrometric detection after non-radioactive 76 Se labeling of selenoproteins, and (v) luciferase-based reporter constructs in various cell extracts. We characterized cell-line specific alterations of the selenoproteome in response to selenium variation that, in most of the cases, resulted from a translational control of gene expression. We established that UGA-selenocysteine recoding efficiency, which depends on the nature of the SECIS element, dictates the response to selenium variation. We characterized that selenoprotein hierarchy is cell-line specific with conserved features. This analysis should be done prior to any experiments in a novel cell line. We reported a strategy based on complementary methods to evaluate selenoproteome regulation in human cells in culture. Copyright © 2018 Elsevier B.V. All rights reserved.
Introducing Product Lines through Open Source Tools
Haugen, Øystein
2008-01-01
We present an approach to introducing product lines to companies that lower their initial risk by applying open source tools and a smooth learning curve into the use and creation of domain specific modeling combined with standardized variability modeling.
DEFF Research Database (Denmark)
Lybeck, Kari; Sjurseth, Siri K.; Al-Touama, Zainab
The aim of the study was to establish a protocol for generation of MAP-specific T-cell lines and to use these lines for evaluation of a peptide vaccine. A protocol for culturing T-cell lines from peripheral blood of goats naturally infected with MAP was established. CD4+ T cells were positively...... selected using an anti CD4 mAb and Dynabeads. Sorted CD4+ cells were cultivated with purified protein derivative from MAP (PPDj) or E. coli sonicate, IL-2, and IL-15. After two cultivation cycles, T cells were tested for recall responses in a proliferative T-cell assay. T-cell line responses were...... in average 92 % for PPDj, and -3 % for E. coli sonicate. CD4+ T-cell lines stimulated with PPDj showed a 6 fold increase in IFN- γ production compared to controls. These results indicated that the T-cell lines were MAP-specific. The protocol was subsequently used to evaluate MAP-specific peptides as vaccine...
Directory of Open Access Journals (Sweden)
Y. K. CHANG
1999-09-01
Full Text Available The influence of specific mechanical energy (SME on cornmeal viscosity during the twin-screw extrusion at feed moisture contents of 25 and 30% and screw speeds in the range from 100 to 500 rpm was measured. Cornmeal was extruded in a co-rotating, intermeshing twin-screw coupled to a slit die rheometer. One approach to the on-line rheological measurement is to use a slit die with the extruder. In the present work it was show that shear viscosity decreased as a function of SME. The viscosity of cornmeal at the exit die was influenced by screw speed, rate of total mass flow, mass temperature inside the extruder and SME. An increase in screw speed resulted in an increase in SME and a decrease in viscosity. A reduction in slit die height and an increase in screw speed and mass temperature led to a remarkable macromolecular degradation of the starch, as evidenced by the decrease in viscosity.
Polymer encapsulated dopaminergic cell lines as "alternative neural grafts".
Jaeger, C B; Greene, L A; Tresco, P A; Winn, S R; Aebischer, P
1990-01-01
Our preliminary findings (Jaeger et al., 1988; Aebischer et al., 1989; Tresco et al., 1989) and the studies in progress show that encapsulated dopaminergic cell lines survive enclosure within a semi-permeable membrane. The encapsulated cells remained viable for extended time periods when maintained in vitro. Moreover, encapsulated PC12 and T28 cells have the potential to survive following their implantation into the forebrain of rats. Cell lines are essentially "immortal" because they continue to divide indefinitely. This property allows perpetual "self-renewal" of a given cell population. However, the capacity of continuous uncontrolled cell division may also lead to tumor formation. This in fact is the case for unencapsulated PC12 cell implants placed into the brain of young Sprague Dawley rats (Jaeger, 1985). Cell line encapsulation has the potential to prevent tumor growth (Jaeger et al., 1988). Survival for 6 months in vitro suggests that encapsulation does not preclude long-term maintenance of an homogeneous cell line like PC12 cells. The presence of mitotic figures in the capsules further supports the likelihood of propagation and self renewal of the encapsulated population. Another significant property of cell lines is that they consist of a single, genetically homogeneous cell type. They do not require specific synaptic interactions for their survival. In the case of PC12 and T28 lines, the cells synthesize and release neurotransmitters. Our data show that PC12 and T28 cells continue to release dopamine spontaneously and to express specific transmitters and enzymes following encapsulation. Thus, cell lines such as these may constitute relatively simple "neural implants" exerting their function via humoral release.(ABSTRACT TRUNCATED AT 250 WORDS)
Gao, Zhenzhen; Chen, Wei; Zhang, Xiaohua; Cai, Peifen; Fang, Xianying; Xu, Qiang; Sun, Yang; Gu, Yanhong
2013-06-01
Icotinib is a potent and specific epidermal growth factor receptor tyrosine kinase inhibitor. In this study, we reported that icotinib had the antitumor activity on human squamous cell carcinoma cell line A431 in vitro. Meanwhile, adhesion to fibronectin and expression of integrin α3 and β1 were significantly reduced in a dose-dependent manner after the treatment of icotinib. Moreover, icotinib induced cell cycle arrested and affected expression of various cell cycle related proteins in squamous cancer cell line A431, whereas it did not cause apoptosis. Furthermore, icotinib remarkably down-regulated phosphorylation of protein kinase B (AKT) though blocking the interaction between 3-phosphoinositide-dependent protein kinase-1 (PDK1) and AKT in A431 cells. Taken together, it is shown that the small molecular compound, icotinib, has an anti-squamous cell carcinoma activity in vitro and its antitumor mechanism is associated with the blockage of the interaction between PDK1 and AKT. These results provide a novel strategy for anti-squamous cell carcinoma therapy. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
On-line monitoring for calibration reduction
International Nuclear Information System (INIS)
Hoffmann, Mario; Gran, Frauke Schmitt; Thunem, Harald P-J.
2004-04-01
On-Line Monitoring (OLM) of a channel's calibration state evaluates instrument channel performance by assessing its consistency with other plant indications. Industry and experience at several plants has shown this overall approach to be very effective in identifying instrument channels that are exhibiting degrading or inconsistent performance characteristics. The Halden Reactor Project has developed the signal validation system PEANO, which can be used to assist with the tasks of OLM. To further enhance the PEANO System for use as a calibration reduction tool, the following two additional modules have been developed; HRP Prox, which performs pre-processing and statistical analysis of signal data, Batch Monitoring Module (BMM), which is an off-line batch monitoring and reporting suite. The purpose and functionality of the HRP Prox and BMM modules are discussed in this report, as well as the improvements made to the PEANO Server to support these new modules. The Halden Reactor Project has established a Halden On-Line Monitoring User Group (HOLMUG), devoted to the discussion and implementation of on-line monitoring techniques in power plants. It is formed by utilities, vendors, regulatory bodies and research institutes that meet regularly to discuss implementation aspects of on-line monitoring, technical specification changes, cost-benefit analysis and regulatory issues. (Author)
Truncation correction for oblique filtering lines
International Nuclear Information System (INIS)
Hoppe, Stefan; Hornegger, Joachim; Lauritsch, Guenter; Dennerlein, Frank; Noo, Frederic
2008-01-01
State-of-the-art filtered backprojection (FBP) algorithms often define the filtering operation to be performed along oblique filtering lines in the detector. A limited scan field of view leads to the truncation of those filtering lines, which causes artifacts in the final reconstructed volume. In contrast to the case where filtering is performed solely along the detector rows, no methods are available for the case of oblique filtering lines. In this work, the authors present two novel truncation correction methods which effectively handle data truncation in this case. Method 1 (basic approach) handles data truncation in two successive preprocessing steps by applying a hybrid data extrapolation method, which is a combination of a water cylinder extrapolation and a Gaussian extrapolation. It is independent of any specific reconstruction algorithm. Method 2 (kink approach) uses similar concepts for data extrapolation as the basic approach but needs to be integrated into the reconstruction algorithm. Experiments are presented from simulated data of the FORBILD head phantom, acquired along a partial-circle-plus-arc trajectory. The theoretically exact M-line algorithm is used for reconstruction. Although the discussion is focused on theoretically exact algorithms, the proposed truncation correction methods can be applied to any FBP algorithm that exposes oblique filtering lines.
Butterfly valve of all rubber lining type
International Nuclear Information System (INIS)
Shimada, Shosaku; Nakatsuma, Sumiya; Sasaki, Iwao; Aoki, Naoshi.
1982-01-01
The valves used for the circulating water pipes for condensers in nuclear and thermal power stations have become large with the increase of power output, and their specifications have become strict. The materials for the valves change from cast iron to steel plate construction. To cope with sea water corrosion, rubber lining has been applied to the internal surfaces of valve boxes, and the build-up welding of stainless steel has been made on the edges of valves. However, recently it is desired to develop butterfly valves, of which the whole valve disks are lined with hard rubber. For the purpose of confirming the performance of large bore valves, a 2600 mm bore butterfly valve of all rubber lining type was used, and the opening and closing test of 1100 times was carried out by applying thermal cycle and pressure difference and using artifical sea water. Also the bending test of hard rubber lining was performed with test pieces. Thus, it was confirmed that the butterfly valves of all rubber lining type have the performance exceeding that of the valves with build-up welding. The course of development of the valves of all rubber lining type, the construction and the items of confirmation by tests of these valves, and the tests of the valve and the hard rubber lining described above are reported. (Kako, I.)
Combined echo offset (Dixon) and line volume chemical shift imaging as a clinical imaging protocol
International Nuclear Information System (INIS)
Listerud, J.; Chan, T.; Lenkinski, R.E.; Kressel, H.Y.; Chao, P.W.
1989-01-01
The authors have studied the sensitivity and specificity of the line-volume chemical-shift imaging (CSI) method as compared with the Dixon method they have recently implemented on a Signa, which supports a variety of options. Potential sources or error for the Dixon method include line broadening due to susceptibility, field inhomogeneity, and errors form olefinic resonances associated with fat, which behave like water in the Dixon regime. The authors investigate whether a combined Dixon/line-volume CSI method could be used to improve the placement of the line volume and to provide higher sensitivity and specificity than does the Dixon method alone
Interior Design's Role in Educational Specifications.
Keller, Mary Ann
1986-01-01
An experienced interior designer, equipped with a well-written educational specification, will specify the best materials and coordinate colors, materials, and furnishings in line with the district's budget. (MLF)
DEFF Research Database (Denmark)
Odum, Niels; Ledbetter, J A; Martin, P
1991-01-01
Major histocompatibility complex (MHC) class II molecules have been implicated in cell adhesion in two ways. In addition to the well-established role of class II antigens in low-affinity adhesion provided by interactions between class II and CD4, recent data indicated that class II may also induce...... adhesion between T and B cells by activating the CD18/CD11a (LFA-1) adhesion pathway. Here we report that monoclonal antibodies (mAb) against HLA-DR (L243, p4.1, HB10a, VI15) and certain broad class II reacting mAb (TU35, TU39), but not anti-DQ (TU22, Leu-10) mAb, induced homotypic aggregation of human...... class II-positive monocytic (I937) and T leukemic (HUT78) tumor cell lines and Epstein-Barr virus (EBV) transformed B-lymphoid cell lines (EBV-LCL). Class II-negative cell lines (U-937 and the EBV-LCL mutant line 616) were not induced to aggregate. An HLA-G-transfected EBV-LCL, 221-AGN...
DEFF Research Database (Denmark)
Felip, E; Gridelli, C; Baas, P
2011-01-01
the conference, the expert panel prepared clinically relevant questions concerning five areas: early and locally advanced non-small-cell lung cancer (NSCLC), first-line metastatic NSCLC, second-/third-line NSCLC, NSCLC pathology and molecular testing, and small-cell lung cancer to be addressed through discussion......The 1st ESMO Consensus Conference on lung cancer was held in Lugano, Switzerland on 21 and 22 May 2010 with the participation of a multidisciplinary panel of leading professionals in pathology and molecular diagnostics, medical oncology, surgical oncology and radiation oncology. Before...... at the Consensus Conference. All relevant scientific literature for each question was reviewed in advance. During the Consensus Conference, the panel developed recommendations for each specific question. The consensus agreement on three of these areas: NSCLC pathology and molecular testing, the treatment of first-line...
International Nuclear Information System (INIS)
Choi, K.C.; Ryu, O.H.; Lee, K.W.; Kim, H.Y.; Seo, J.A.; Kim, S.G.; Kim, N.H.; Choi, D.S.; Baik, S.H.; Choi, K.M.
2005-01-01
A variety of adipocytokines and peptides secreted from adipocytes have been considered to play a crucial role in obesity, insulin resistance, and type 2 diabetes. Recently, visfatin, a new adipocytokine, known as a pre-B cell colony-enhancing factor, has been isolated from visceral fat deposits. It has been shown to activate insulin receptors in a manner different from insulin. To understand the role of adipocytokines in improving insulin sensitivity via activation of the nuclear receptor peroxisome proliferator-activated receptor-α (PPAR-α) and -γ (PPAR-γ), we examined the expression of visfatin, adiponectin, and TNF-α in visceral fat depots of Otsuka Long-Evans Tokushima fatty (OLETF) rats from early to advanced diabetic stage (from 28 to 40 weeks of age). Serum glucose and insulin concentrations significantly (P < 0.05) decreased in rosiglitazone or fenofibrate-treated OLETF rats compared to untreated OLETF rats. Rosiglitazone significantly increased serum adiponectin concentration from 20 to 40 weeks of age (P < 0.05), whereas fenofibrate reduced TNF-α concentration. The expression of visfatin and adiponectin mRNA in visceral fat deposits was elevated by rosiglitazone or fenofibrate treatments when compared to untreated OLETF rats (P < 0.05), whereas, TNF-α mRNA was down-regulated by these drugs (P < 0.05). These results suggest that rosiglitazone and fenofibrate may prevent type 2 diabetes by regulating adipocytokines including visfatin, adiponectin, and TNF-α
Directory of Open Access Journals (Sweden)
Guang-xing Shui
2017-01-01
Full Text Available Objectives. The effects of the traditional formula Dahuang Fuzi Decoction (DFD on chronic aristolochic acid nephropathy (AAN in mice and its underlying mechanisms were studied. Methods. Mice were randomly divided into the following six groups: the control group, the model group (AAN, the saline-treated group (AAN + vehicle, the normal dose DFD-treated group (AAN + NDFD, the high dose DFD-treated group (AAN + HDFD, and the rosiglitazone treated group (AAN + Rosi. After treating for 8 weeks, 24 h urine and blood samples were collected and the mice sacrificed to study the biochemical parameters associated with renal function. The samples were analyzed for renal fibrosis and mitochondrial dysfunction (MtD markers. To achieve that, collagen III, collagen I, mitochondrial DNA copy numbers (mtDNA, mitochondrial membrane potential (MMP, ATP content, and ROS production were evaluated. Results. Our results showed that proteinuria, kidney function, and the renal pathological characteristics were improved by DFD and rosiglitazone. The expression of collagen III and collagen I decreased after treating with either DFD or rosiglitazone. Mitochondrial dysfunction based on the increase in ROS production, decrease in mitochondrial DNA copy numbers, and reduction of MMP and ATP content was improved by DFD and rosiglitazone. Conclusions. DFD could protect against renal impairments and ameliorate mitochondrial dysfunction in chronic AAN mice.
Sánchez-Vega, Francisco; Gotea, Valer; Margolin, Gennady; Elnitski, Laura
2015-01-01
The term CpG island methylator phenotype (CIMP) has been used to describe widespread DNA hypermethylation at CpG-rich genomic regions affecting clinically distinct subsets of cancer patients. Even though there have been numerous studies of CIMP in individual cancer types, a uniform analysis across tissues is still lacking. We analyze genome-wide patterns of CpG island hypermethylation in 5,253 solid epithelial tumors from 15 cancer types from TCGA and 23 cancer cell lines from ENCODE. We identify differentially methylated loci that define CIMP+ and CIMP- samples, and we use unsupervised clustering to provide a robust molecular stratification of tumor methylomes for 12 cancer types and all cancer cell lines. With a minimal set of 89 discriminative loci, we demonstrate accurate pan-cancer separation of the 12 CIMP+/- subpopulations, based on their average levels of methylation. Tumor samples in different CIMP subclasses show distinctive correlations with gene expression profiles and recurrence of somatic mutations, copy number variations, and epigenetic silencing. Enrichment analyses indicate shared canonical pathways and upstream regulators for CIMP-targeted regions across cancer types. Furthermore, genomic alterations showing consistent associations with CIMP+/- status include genes involved in DNA repair, chromatin remodeling genes, and several histone methyltransferases. Associations of CIMP status with specific clinical features, including overall survival in several cancer types, highlight the importance of the CIMP+/- designation for individual tumor evaluation and personalized medicine. We present a comprehensive computational study of CIMP that reveals pan-cancer commonalities and tissue-specific differences underlying concurrent hypermethylation of CpG islands across tumors. Our stratification of solid tumors and cancer cell lines based on CIMP status is data-driven and agnostic to tumor type by design, which protects against known biases that have hindered
Impact if hyperprolific line of litter size in multiplication herd
Directory of Open Access Journals (Sweden)
Zdeněk Tvrdoň
2009-01-01
Full Text Available The hyperprolific line is considered to be maximally effective in pursuit of progress in sow’s reproduction. Hyperprolific line efficiency is commonly evaluated in regard of breeding herd progress. We decided to study how effective it is with respect to increasing of litter size in multiplication herd. Our study is specific by using the data from practice, concretely it is based on the information about the ancestor of sows in multiplication herd. The ancestors could be the member either hyperprolific line or normal line. The information about performances of sows breed in multiplication herd was known. The mixed linear models in SAS for Windows 9.1.2. were conducted to statistical analysis. Our results indicated that no significant effect on litter size was achieved by selection criteria used in the hyperprolific line creation. In studied population no differences between TNB, NBA or NW were found on the 1st as well as on the 1st–5th litters. As we have mentioned above, the study is specific by using the data from practice. Therefore the studied population size is limited. It is necessary to take into consideration when the results are applied. Nevertheless, the results shown that other studies with larger population should be done to reevaluate the selection criteria.
Thermographic Sensing For On-Line Industrial Control
Holmsten, Dag
1986-10-01
It is today's emergence of thermoelectrically cooled, highly accurate infrared linescanners and imaging systems that has definitely made on-line Infraread Thermography (IRT) possible. Specifically designed for continuous use, these scanners are equipped with dedicated software capable of monitoring and controlling highly complex thermodynamic situations. This paper will outline some possible implications of using IRT on-line by describing some uses of this technology in the steel-making (hot rolling) and automotive industries (machine-vision). A warning is also expressed that IRT technology not originally designed for automated applications e.g. high resolution, imaging systems, should not be directly applied to an on-line measurement situation without having its measurement resolution, accuracy and especially its repeatability, reliably proven. Some suitable testing procedures are briefly outlined at the end of the paper.
Price, R Jordan; Lillycrop, Karen A; Burdge, Graham C
2016-01-01
The effect of folic acid (FA) on breast cancer (BC) risk is uncertain. We hypothesised that this uncertainty may be due, in part, to differential effects of FA between BC cells with different phenotypes. To test this we investigated the effect of treatment with FA concentrations within the range of unmetabolised FA reported in humans on the expression of the transcriptome of non-transformed (MCF10A) and cancerous (MCF7 and Hs578T) BC cells. The total number of transcripts altered was: MCF10A, seventy-five (seventy up-regulated); MCF7, twenty-four (fourteen up-regulated); and Hs578T, 328 (156 up-regulated). Only the cancer-associated gene TAGLN was altered by FA in all three cell lines. In MCF10A and Hs578T cells, FA treatment decreased pathways associated with apoptosis, cell death and senescence, but increased those associated with cell proliferation. The folate transporters SLC19A1, SLC46A1 and FOLR1 were differentially expressed between cell lines tested. However, the level of expression was not altered by FA treatment. These findings suggest that physiological concentrations of FA can induce cell type-specific changes in gene regulation in a manner that is consistent with proliferative phenotype. This has implications for understanding the role of FA in BC risk. In addition, these findings support the suggestion that differences in gene expression induced by FA may involve differential activities of folate transporters. Together these findings indicate the need for further studies of the effect of FA on BC.
Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing
2016-01-01
In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.
International Nuclear Information System (INIS)
1998-08-01
This book deals with line facilities. The contents of this book are outline line of wire telecommunication ; development of line, classification of section of line and theory of transmission of line, cable line ; structure of line, line of cable in town, line out of town, domestic cable and other lines, Optical communication ; line of optical cable, transmission method, measurement of optical communication and cable of the sea bottom, Equipment of telecommunication line ; telecommunication line facilities and telecommunication of public works, construction of cable line and maintenance and Regulation of line equipment ; regulation on technique, construction and maintenance.
Risk-based equipment removal guide for on-line maintenance at PSE ampersand G
International Nuclear Information System (INIS)
Knoll, A.; Smith, C.; Pollock, J.
1995-01-01
On-line maintenance plays an important role in achieving safe and reliable power generation in a nuclear power plant. However, maintenance, if not properly planned and performed, may also be an important contributor to plant risk. Therefore, plant-specific procedures are needed for equipment removal from service to enhance the benefits of on-line maintenance and minimize the risks involved. The problem is to identify and implement the most effective on-line maintenance policy in the form of a proceduralized guide to assure plant safety under various operation and maintenance constraints. This paper presents a methodology to develop plant-specific on-line maintenance strategies and acceptance criteria using a multivariate safety approach based on risk assessment. Based on plant-specific data as modeled in the individual plant evaluation (IPE) and the updated probabilistic safety assessment (PSA), the risk-based methodology is currently being applied to the development of proceduralized equipment removal guides at Hope Creek and Salem units 1 and 2 of Public Service Electric and Gas Company (PSE ampersand G)
Future plans for the MP line (Both general and specific)
International Nuclear Information System (INIS)
Underwood, D.G.
1988-01-01
This talk consists of three sections. Topics range from suggestions of possible physics, which are presented to provoke thought and discussion about the distant future, to specific goals of E-704 for the next running period. The sections are on physics issues, possible upgrades of the beam and experimental apparatus, and goals for the next running period. 4 refs., 5 figs
Linac4 chopper line commissioning strategy
Bellodi, G; Lombardi, A M; Posocco, P A; Sargsyan, E
2010-01-01
The report outlines the strategy for beam-based commissioning of the Linac4 3 MeV chopper line as currently scheduled to start in the second half of 2011 in the Test Stand Area. A dedicated temporary diagnostics test bench will complement the measurement devices foreseen for permanent installation in the chopper line. A commissioning procedure is set out as a series of consecutive phases, each one supposed to meet a well- defined milestone in the path to fully characterise the beam-line. Specific set-ups for each stage are defined in terms of beam characteristics, machine settings and diagnostics used. Operational guidelines are given and expected results at the relative points of measurements are shown for simulated scenarios (on the basis of multi-particle tracking studies carried out with the codes PATH and TRACEWin). These are then interpreted in the light of the resolution limits of the available diagnostics instruments to assess the precision reach on individual measurements and the feasibility of techn...
Genetic variability among advanced lines of brassica
International Nuclear Information System (INIS)
Ullah, N.; Farhatullah, A.; Rahman, H.U.; Fayyaz, L.
2015-01-01
Genetic variability for morphological and biochemical traits among six advanced lines (F10:11) of brassica was studied at The University of Agriculture Peshawar during crop season of 2012-13. These lines were developed through interspecific hybridization. Significant differences at (p=0.01) for plant height, main, pods main raceme-1, pod length, seed yield plant-1 and protein content at (p=0.05) for 100-seed weight, oil content were recorded. The advanced line, AUP-05 produced the maximum seed yield plant-1 (19.73 g), protein content (24.56%), 100-seed weight (0.64 g). Advanced line AUP-04 had the highest erucic acid (50.31%), linolenic acid (10.60%) and was late maturing (179.33). Advanced line AUP-06 produced the high oil content (48.82%). Advanced line AUP-03 produced comparatively longer main raceme (69.32 cm). Environmental variance was smaller than genotypic variance for majority of the traits. Genotypic and phenotypic coefficients of variation ranged from 2.45 to 25.67% and 2.50 to 27.68%, respectively. Heritability was high for majority of the traits. The maximum heritability was recorded for plant height (0.61), main raceme length (0.81), pods main raceme-1 (0.74), seed yield plant-1 (0.86) and protein content (0.77). Moderate heritability was observed for oil (0.58) contents. Heritability for 100-seed weight (0.30) was the lowest. These lines may be released as new improved varieties for specific parameters. (author)
Power Line Communications for Smart Grid Applications
Directory of Open Access Journals (Sweden)
Lars Torsten Berger
2013-01-01
Full Text Available Power line communication, that is, using the electricity infrastructure for data transmission, is experiencing a renaissance in the context of Smart Grid. Smart Grid objectives include the integration of intermittent renewable energy sources into the electricity supply chain, securing reliable electricity delivery, and using the existing electrical infrastructure more efficiently. This paper surveys power line communications (PLCs in the context of Smart Grid. The specifications G3-PLC, PRIME, HomePlug Green PHY, and HomePlug AV2, and the standards IEEE 1901/1901.2 and ITU-T G.hn/G.hnem are discussed.
Linux Command Line and Shell Scripting Bible
Blum, Richard
2011-01-01
The authoritative guide to Linux command line and shell scripting?completely updated and revised [it's not a guide to Linux as a whole ? just to scripting] The Linux command line allows you to type specific Linux commands directly to the system so that you can easily manipulate files and query system resources, thereby permitting you to automate commonly used functions and even schedule those programs to run automatically. This new edition is packed with new and revised content, reflecting the many changes to new Linux versions, including coverage of alternative shells to the default bash shel
Galaxy emission line classification using three-dimensional line ratio diagrams
Energy Technology Data Exchange (ETDEWEB)
Vogt, Frédéric P. A.; Dopita, Michael A.; Kewley, Lisa J.; Sutherland, Ralph S. [Research School of Astronomy and Astrophysics, Australian National University, Canberra, ACT 2611 (Australia); Scharwächter, Julia [Observatoire de Paris, LERMA (CNRS: UMR8112), 61 Av. de l' Observatoire, F-75014 Paris (France); Basurah, Hassan M.; Ali, Alaa; Amer, Morsi A., E-mail: frederic.vogt@anu.edu.au [Astronomy Department, King Abdulaziz University, P.O. Box 80203, Jeddah (Saudi Arabia)
2014-10-01
Two-dimensional (2D) line ratio diagnostic diagrams have become a key tool in understanding the excitation mechanisms of galaxies. The curves used to separate the different regions—H II-like or excited by an active galactic nucleus (AGN)—have been refined over time but the core technique has not evolved significantly. However, the classification of galaxies based on their emission line ratios really is a multi-dimensional problem. Here we exploit recent software developments to explore the potential of three-dimensional (3D) line ratio diagnostic diagrams. We introduce the ZQE diagrams, which are a specific set of 3D diagrams that separate the oxygen abundance and the ionization parameter of H II region-like spectra and also enable us to probe the excitation mechanism of the gas. By examining these new 3D spaces interactively, we define the ZE diagnostics, a new set of 2D diagnostics that can provide the metallicity of objects excited by hot young stars and that cleanly separate H II region-like objects from the different classes of AGNs. We show that these ZE diagnostics are consistent with the key log [N II]/Hα versus log [O III]/Hβ diagnostic currently used by the community. They also have the advantage of attaching a probability that a given object belongs to one class or the other. Finally, we discuss briefly why ZQE diagrams can provide a new way to differentiate and study the different classes of AGNs in anticipation of a dedicated follow-up study.
Absorption of aluminium X-ray lines in a laser created gold plasma
International Nuclear Information System (INIS)
Combis, P.; Busquet, M.; Louis-Jacquet, M.
1986-04-01
We have studied the absorption of aluminium X-ray lines through a gold plasma by focusing a high intensity laser-beam onto a specific target. Absorption in the wavelength range of 5 to 7 A has been evidenced and measured for Aluminium resonance lines
Evaluation of Hose in Hose Transfer Line Service Life for Hanford's Interim Stabilization Program
International Nuclear Information System (INIS)
TORRES, T.D.
2000-01-01
RPP-6153, Engineering Task Plan for Hose-in-Hose Transfer System for the Interim Stabilization Program, defines the programmatic goals, functional requirements, and technical criteria for the development and subsequent installation of transfer line equipment to support Hanford's Interim Stabilization Program. RPP-6028, Specification for Hose in Hose Transfer Lines for Hanford's Interim Stabilization Program, has been issued to define the specific requirements for the design, manufacture, and verification of transfer line assemblies for specific waste transfer applications. Included in RPP-6028 are tables defining the chemical constituents of concern to which transfer lines will be exposed. Current Interim Stabilization Program planning forecasts that the at-grade transfer lines will be required to convey pumpable waste for as much as three years after commissioning. Prudent engineering dictates that the equipment placed in service have a working life in excess of this forecasted time period, with some margin to allow for future adjustments to the planned schedule. This document evaluates the effective service life of the Hose-in-Hose Transfer Lines, based on information submitted by the manufacturer and published literature. The effective service life of transfer line assemblies is a function of several factors. Foremost among these are process fluid characteristics, ambient environmental conditions, and the manufacturer's stated shelf life. This evaluation examines the manufacturer's certification of shelf life, the manufacturer's certifications of chemical compatibility with waste, and published literature on the effects of exposure to ionizing radiation on the mechanical properties of elastomeric materials to evaluate transfer line service life
work specification for the construction of 33kv overhead lines across
African Journals Online (AJOL)
HOD
obtained using the standard mathematical equations and the specifications for Aluminium Conductor Steel Reinforce ... systems. The choice of conductor depends on the cost and efficiency. ... Support structure requirements, limitations.
Sequence-specific inhibition of microRNA-130a gene by CRISPR/Cas9 system in breast cancer cell line
Ainina Abdollah, Nur; Das Kumitaa, Theva; Yusof Narazah, Mohd; Razak, Siti Razila Abdul
2017-05-01
MicroRNAs (miRNAs) are short stranded noncoding RNA that play important roles in apoptosis, cell survival, development and cell proliferation. However, gene expression control via small regulatory RNA, particularly miRNA in breast cancer is still less explored. Therefore, this project aims to develop an approach to target microRNA-130a using the Clustered Regularly Interspaced Short Palindromic Repeat (CRISPR)/Cas9 system in MCF7, breast cancer cell line. The 20 bp sequences target at stem loop, 3ʹ and 5ʹ end of miR130a were cloned into pSpCas9(BB)-2A-GFP (PX458) plasmid, and the positive clones were confirmed by sequencing. A total of 5 μg of PX458-miR130a was transfected to MCF7 using Lipofectamine® 3000 according to manufacturer’s protocol. The transfected cells were maintained in the incubator at 37 °C under humidified 5% CO2. After 48 hours, cells were harvested and total RNA was extracted using miRNeasy Mini Kit (Qiagen). cDNAs were synthesised specific to miR-130a using TaqMan MicroRNA Reverse Transcription Kit (Applied Biosystems). Then, qRT-PCR was carried out using TaqMan Universal Master Mix (Applied Biosystems) to quantify the knockdown level of mature miRNAs in the cells. Result showed that miR-130a-5p was significantly downregulated in MCF7 cell line. However, no significant changes were observed for sequences targeting miR-130a-3p and stem loop. Thus, this study showed that the expression of miR-130a-5p was successfully down-regulated using CRISPR silencing system. This technique may be useful to manipulate the level of miRNA in various cell types to answer clinical questions at the molecular level.
Somjen, D; Katzburg, S; Sharon, O; Grafi-Cohen, M; Knoll, E; Stern, N
2011-02-01
In cultured human osteoblasts estradiol-17β (E2) modulated DNA synthesis, the specific activity of creatine kinase BB (CK), 12 and 15 lipoxygenase (LO) mRNA expression and formation of 12- and 15-hydroxyeicosatetraenoic acid (HETE). We now investigate the response of human bone cell line (SaOS2) to phytoestrogens and estrogen receptors (ER)-specific agonists and antagonists. Treatment of SaSO2 with E2, 2,3-bis (4-hydroxyphenyl)-propionitrile (DPN; ERβ-specific agonist), 4,4',4″-[4-propyl-(1H)-pyrazol-1,3,5-triyl] tris-phenol (PPT; ERα-specific agonist), biochainin A (BA), daidzein (D), genistein (G) and raloxifene (Ral) showed increased DNA synthesis and CK. Ral inhibited completely all stimulations except DPN and to some extent D. The ERα-specific antagonist methyl-piperidino-pyrazole (MPP) and the ERβ-specific antagonist 4-[2-phenyl-5,7-bis (tri-fluoro-methyl) pyrazolo [1,5-a]pyrimidin-3-yl] phenol (PTHPP) inhibited DNA synthesis, CK and reactive oxygen species (ROS) formation induced by estrogens according to their receptors affinity. The LO inhibitor baicaleine inhibited only E2, DPN and G's effects. E2 and Ral unlike all other compounds had no effect on ERα mRNA expression, while ERβ mRNA expression was stimulated by all compounds. All compounds modulated the expression of 12LO and 15LO mRNA, except E2, PPT and Ral for 12LO, and 12- and 15-HETE productions and stimulated ROS formation which was inhibited by NADPH oxidase inhibitors diphenyleneiodonium chloride (DPI) and N-acetyl cysteine and the estrogen inhibitor ICI. DPI did not affect hormonal-induced DNA and CK. In conclusion, we provide evidence for the separation of mediation via ERα and ERβ pathways in the effects of estrogenic compounds on osteoblasts, but the role of LO/HETE/ROS is unclear. Copyright © 2010 Wiley-Liss, Inc.
Directory of Open Access Journals (Sweden)
Qazi H. A. A.
2017-12-01
Full Text Available Verification and validation of welding procedure specifications for X-70 grade line pipe welding was performed as per clause 8.2, Annexure B and D of API 5L, 45th Edition to check weld integrity in its future application conditions. Hot rolled coils were imported from China, de-coiling, strip edge milling, three roller bending to from pipe, inside and outside submerged arc welding of pipe, online ultrasonic testing of weld, HAZ and pipe body, cutting at fixed random length of pipe, visual inspection of pipe, Fluoroscopic inspection of pipe, welding procedure qualification test pieces marking at weld portion of the pipe, tensile testing, guided bend testing, CVN Impact testing were performed. Detailed study was conducted to explore possible explanations and variation in mechanical properties, WPS is examined and qualified as per API 5L 45th Edition.
Migliarini, Sara; Pacini, Giulia; Pasqualetti, Massimo
2015-01-01
Serotonin has been gaining increasing attention during the last two decades due to the dual function of this monoamine as key regulator during critical developmental events and as neurotransmitter. Importantly, unbalanced serotonergic levels during critical temporal phases might contribute to the onset of neuropsychiatric disorders, such as schizophrenia and autism. Despite increasing evidences from both animal models and human genetic studies have underpinned the importance of serotonin homeostasis maintenance during central nervous system development and adulthood, the precise role of this molecule in time-specific activities is only beginning to be elucidated. Serotonin synthesis is a 2-step process, the first step of which is mediated by the rate-limiting activity of Tph enzymes, belonging to the family of aromatic amino acid hydroxylases and existing in two isoforms, Tph1 and Tph2, responsible for the production of peripheral and brain serotonin, respectively. In the present study, we generated and validated a conditional knockout mouse line, Tph2 flox/flox, in which brain serotonin can be effectively ablated with time specificity. We demonstrated that the Cre-mediated excision of the third exon of Tph2 gene results in the production of a Tph2 null allele in which we observed the near-complete loss of brain serotonin, as well as the growth defects and perinatal lethality observed in serotonin conventional knockouts. We also revealed that in mice harbouring the Tph2 null allele, but not in wild-types, two distinct Tph2 mRNA isoforms are present, namely Tph2Δ3 and Tph2Δ3Δ4, with the latter showing an in-frame deletion of amino acids 84–178 and coding a protein that could potentially retain non-negligible enzymatic activity. As we could not detect Tph1 expression in the raphe, we made the hypothesis that the Tph2Δ3Δ4 isoform can be at the origin of the residual, sub-threshold amount of serotonin detected in the brain of Tph2 null/null mice. Finally, we set
In-line estimation of sulfur and nitrogen contents during hydrotreating of middle distillates
Directory of Open Access Journals (Sweden)
M. E. Pacheco
2009-12-01
Full Text Available The main objective of this work is analyzing whether it is possible to develop an empirical correlation for in-line estimation of the sulfur and nitrogen contents of the middle distillates Hydrotreating (HDT products for control purposes. Correlations are based only on readily available in-line information of specific gravity variation between feedstock and products, without considering any piece of information about the kinetic behavior of the catalyst. Experimental data were obtained in pilot plants under operating conditions that are representative of refinery operations. Results indicate that the removal of nitrogen and sulfur compounds during middle distillates HDT can be monitored in-line in real time, based on the available measurements of specific gravity. This allows for development and implementation of advanced in-line procedures for monitoring and control of the HDT process in real time.
Utz, S.; Matzat, U.; Snijders, C.C.P.
2009-01-01
Previous research on reputation systems primarily focused on their trust-building function. The present research addresses their trust-rebuilding function-specifically, the role of the short text comments given in reaction to negative feedback. Rebuilding trust is often necessary because on-line
A new electrostatic on-line collection-system
International Nuclear Information System (INIS)
Dufour, J.P.; Del Moral, R.; Fleury, A.
1981-06-01
The working conditions of a new on-line electrostatic collection system are presented. The main charactersitics are high efficiency (reaching 20%) and short delay time (down to the millisecond). The salient features of specific devices for measurements of absolute cross sections, recoil range distributions and angular distributions are given
Srivastava, Pooja; Ajayakumar, P V; Shanker, Karuna
2014-01-01
The genus Pluchea comprises about 80 species distributed worldwide, out of them, only Pluchea lanceolata (DC.) Oliv. & Hiern, is used extensively in the traditional system of India. No chromatographic method is available for its quality. To perform the energy audit for the extraction of biogenetic pentacyclic triterpene, its acetate and sterol from P. lanceolata utilising organic and four alternative solvents. Additionally to resolve the uncertainty of TLC determination, on-line/off-line coupling with a diode-array detector (DAD), and near-infrared (NIR) and electrospray ionisation (ESI) MS was introduced. The extraction of taraxasterol (Tx), taraxasterol acetate (TxAc) and stigmasterol (St) from P. lanceolata was performed using three energy modes. The effects of different operating parameters were studied for optimum extraction yield using the design of experiments, that is, the central composite design and Box-Behnken design. In addition to the retention factor (Rf ) and visible spectral matching, two additional optical spectroscopic techniques, that is, NIR and ESI-MS, were applied for extended specificity. The method was developed for Tx, TxAc and St determination using HPTLC at 645 nm. The optimum extraction yield of targeted compounds was found to be higher with organic solvents than eco-friendly surfactants. The pulse ultrasonic assisted extraction (PUAE) has resulted in optimum extraction of compounds comparable to hot extraction. Both NIR and ESI-MS provided extended specificity in determination. The 5/1-PUAE was determined to be effective, reproducible, simple and energy efficient for the determination of Tx, TxAc and St in P. lanceolata. The offline coupling of NIR and ESI-MS with HPTLC led to considerable improvement in specificity. Copyright © 2014 John Wiley & Sons, Ltd.
Script-independent text line segmentation in freestyle handwritten documents.
Li, Yi; Zheng, Yefeng; Doermann, David; Jaeger, Stefan; Li, Yi
2008-08-01
Text line segmentation in freestyle handwritten documents remains an open document analysis problem. Curvilinear text lines and small gaps between neighboring text lines present a challenge to algorithms developed for machine printed or hand-printed documents. In this paper, we propose a novel approach based on density estimation and a state-of-the-art image segmentation technique, the level set method. From an input document image, we estimate a probability map, where each element represents the probability that the underlying pixel belongs to a text line. The level set method is then exploited to determine the boundary of neighboring text lines by evolving an initial estimate. Unlike connected component based methods ( [1], [2] for example), the proposed algorithm does not use any script-specific knowledge. Extensive quantitative experiments on freestyle handwritten documents with diverse scripts, such as Arabic, Chinese, Korean, and Hindi, demonstrate that our algorithm consistently outperforms previous methods [1]-[3]. Further experiments show the proposed algorithm is robust to scale change, rotation, and noise.
A new mathematical formulation of the line-by-line method in case of weak line overlapping
Ishov, Alexander G.; Krymova, Natalie V.
1994-01-01
A rigorous mathematical proof is presented for multiline representation on the equivalent width of a molecular band which consists in the general case of n overlapping spectral lines. The multiline representation includes a principal term and terms of minor significance. The principal term is the equivalent width of the molecular band consisting of the same n nonoverlapping spectral lines. The terms of minor significance take into consideration the overlapping of two, three and more spectral lines. They are small in case of the weak overlapping of spectral lines in the molecular band. The multiline representation can be easily generalized for optically inhomogeneous gas media and holds true for combinations of molecular bands. If the band lines overlap weakly the standard formulation of line-by-line method becomes too labor-consuming. In this case the multiline representation permits line-by-line calculations to be performed more effectively. Other useful properties of the multiline representation are pointed out.
Generation of genome-modified Drosophila cell lines using SwAP.
Franz, Alexandra; Brunner, Erich; Basler, Konrad
2017-10-02
The ease of generating genetically modified animals and cell lines has been markedly increased by the recent development of the versatile CRISPR/Cas9 tool. However, while the isolation of isogenic cell populations is usually straightforward for mammalian cell lines, the generation of clonal Drosophila cell lines has remained a longstanding challenge, hampered by the difficulty of getting Drosophila cells to grow at low densities. Here, we describe a highly efficient workflow to generate clonal Cas9-engineered Drosophila cell lines using a combination of cell pools, limiting dilution in conditioned medium and PCR with allele-specific primers, enabling the efficient selection of a clonal cell line with a suitable mutation profile. We validate the protocol by documenting the isolation, selection and verification of eight independently Cas9-edited armadillo mutant Drosophila cell lines. Our method provides a powerful and simple workflow that improves the utility of Drosophila cells for genetic studies with CRISPR/Cas9.
Abnormal A-type lamin organization in a human lung carcinoma cell line
Machiels, BM; Broers, JL; Raymond, Y; de Leij, Louis; Kuijpers, HJH; Caberg, NEH; Ramaekers, Frans C. S.
We have studied the expression of lamins A and C (A-type lamins) in a lung carcinoma cell line using type-specific monoclonal antibodies, Using immunofluorescence and immunoblotting studies it was noted that several irregularities in lamin expression exist in the cell line GLC-A1, derived from an
On-line optimal control improves gas processing
International Nuclear Information System (INIS)
Berkowitz, P.N.; Papadopoulos, M.N.
1992-01-01
This paper reports that the authors' companies jointly funded the first phase of a gas processing liquids optimization project that has the specific purposes to: Improve the return of processing natural gas liquids, Develop sets of control algorithms, Make available a low-cost solution suitable for small to medium-sized gas processing plants, Test and demonstrate the feasibility of line control. The ARCO Willard CO 2 gas recovery processing plant was chosen as the initial test site to demonstrate the application of multivariable on-line optimal control. One objective of this project is to support an R ampersand D effort to provide a standardized solution to the various types of gas processing plants in the U.S. Processes involved in these gas plants include cryogenic separations, demethanization, lean oil absorption, fractionation and gas treating. Next, the proposed solutions had to be simple yet comprehensive enough to allow an operator to maintain product specifications while operating over a wide range of gas input flow and composition. This had to be a supervisors system that remained on-line more than 95% of the time, and achieved reduced plant operating variability and improved variable cost control. It took more than a year to study various gas processes and to develop a control approach before a real application was finally exercised. An initial process for C 2 and CO 2 recoveries was chosen
2011-08-18
... FEDERAL MARITIME COMMISSION [Docket No. 11-12] China Shipping Container Lines Co., Ltd.; COSCO Container Lines Company Limited; Evergreen Line A Joint Service Agreement; Hanjin Shipping Co., Ltd... Maritime Commission (Commission) by China Shipping Container Lines Co., Ltd.; COSCO Container Lines Company...
A new electrostatic on-line collection-system
International Nuclear Information System (INIS)
Dufour, J.P.; Del Moral, R.; Fleury, A.; Hubert, F.; Llabador, Y.; Mauhourat, M.B.; Bimbot, R.; Gardes, D.; Rivet, M.F.
1981-01-01
The working conditions of a new on-line electrostatic collection system are presented. The main characteristics are high efficiency (reaching 20%) and short delay time (down to the millisecond). The salient features of specific devices for measurements of absolute cross sections, recoil range distributions and angular distributions are given. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Taub, Mary, E-mail: biochtau@buffalo.edu
2016-03-11
Troglitazone has been used to suppress the growth of a number of tumors through apoptosis and autophagy. However, previous in vitro studies have employed very high concentrations of troglitazone (≥10{sup −5} M) in order to elicit growth inhibitory effects. In this report, when employing lower concentrations of troglitazone in defined medium, troglitazone was observed to stimulate the growth of primary renal proximal tubule (RPT) cells. Rosiglitazone, like troglitazone, is a thiazolidinedione (TZD) that is known to activate Peroxisome Proliferator Activated Receptor Υ (PPARΥ). Notably, rosiglitazone also stimulates RPT cell growth, as does Υ-linolenic acids, another PPARΥ agonist. The PPARΥ antagonist GW9662 inhibited the growth stimulatory effect of troglitazone. In addition, troglitazone stimulated transcription by a PPAR Response Element/Luciferase construct. These results are consistent with the involvement of PPARΥ as a mediator of the growth stimulatory effect of troglitazone. In a number of tumor cells, the expression of hypoxia inducible factor (HIF) is increased, promoting the expression of HIF inducible genes, and vascularization. Troglitazone was observed to stimulate transcription by a HIF/luciferase construct. These observations indicate that troglitazone not only promotes growth, also the survival of RPT cells under conditions of hypoxia. - Highlights: • Troglitazone and rosiglitazone stimulate renal proximal tubule cell growth. • Troglitazone and linolenic acid stimulate growth via PPARϒ. • Linolenic acid stimulates growth in the presence of fatty acid free serum albumin. • Rosiglitazone stimulates transcription by a HRE luciferase construct.
International Nuclear Information System (INIS)
Taub, Mary
2016-01-01
Troglitazone has been used to suppress the growth of a number of tumors through apoptosis and autophagy. However, previous in vitro studies have employed very high concentrations of troglitazone (≥10"−"5 M) in order to elicit growth inhibitory effects. In this report, when employing lower concentrations of troglitazone in defined medium, troglitazone was observed to stimulate the growth of primary renal proximal tubule (RPT) cells. Rosiglitazone, like troglitazone, is a thiazolidinedione (TZD) that is known to activate Peroxisome Proliferator Activated Receptor Υ (PPARΥ). Notably, rosiglitazone also stimulates RPT cell growth, as does Υ-linolenic acids, another PPARΥ agonist. The PPARΥ antagonist GW9662 inhibited the growth stimulatory effect of troglitazone. In addition, troglitazone stimulated transcription by a PPAR Response Element/Luciferase construct. These results are consistent with the involvement of PPARΥ as a mediator of the growth stimulatory effect of troglitazone. In a number of tumor cells, the expression of hypoxia inducible factor (HIF) is increased, promoting the expression of HIF inducible genes, and vascularization. Troglitazone was observed to stimulate transcription by a HIF/luciferase construct. These observations indicate that troglitazone not only promotes growth, also the survival of RPT cells under conditions of hypoxia. - Highlights: • Troglitazone and rosiglitazone stimulate renal proximal tubule cell growth. • Troglitazone and linolenic acid stimulate growth via PPARϒ. • Linolenic acid stimulates growth in the presence of fatty acid free serum albumin. • Rosiglitazone stimulates transcription by a HRE luciferase construct.
International Nuclear Information System (INIS)
Nuttall, K.R.; Gardner, P.R.
1991-01-01
Westinghouse Hanford Company is developing a desk-top simulation based training program on the operation of the Remote Mechanical C (RMC) Line process in the Plutonium Finishing Plant on the Hanford site, Richland, Washington. Simulations display aod contioually update current values of system parameters on computer graphics of RMC line equipment. Students are able to operate a variety of controllers to maintain proper system status. Programmed faults, selectable by the course instructor, can be used to test student responses to off-normal events. Prior to operation of the simulation, students are given computer-based tutorials on the function, processes, operation, and error conditions associated with individual components. By including the capability of operating each individual component - valves, heaters, agitators, etc. - the computer-based training (CBT) lessons become an interactive training manual. From one perspective RMC represents one step in the diffusion of the well-known and well-documented simulator training activities for nuclear reactor operators to other training programs, equally critical, perhaps, but less well scrutinized in the past. Because of the slowly responding nature of the actual process, RMC can retain many of the capabilities of practice and testing in a simulated work environment while avoiding the cost of a full scale simulator and the exposure and waste developed by practice runs of the RMC line. From another perspective RMC suggests training advances even beyond the most faithful simulators. For example, by integrating CBT lessons with the simulation, RMC permits students to focus in on specific processes occurring inside chosen components. In effect, the interactive training manual is available on-line with the simulation itself. Cost are also discussed
Methylation Status of miR-182 Promoter in Lung Cancer Cell Lines
Directory of Open Access Journals (Sweden)
Yongwen LI
2015-05-01
Full Text Available Background and objective It has been proven that the abnormal expression of miR-182 was related to the occurrence and development of tumors. The aim of this study is to explore the relationship between the methylation of miR-182 promoter and its expression in lung cancer cell lines. Methods Real-time quantitative PCR and methylation-specific PCR were used to detect the expression level of miR-182 and its promoter methylation status in five lung cancer cell lines (A549, L9981, NL9980, 95C and 95D. DNA sequencing was used to confirm the methylation results. Results The level of miR-182 expression significantly differs among these lung cancer cell lines. The highly metastatic human lung cancer cell lines, namely, A549 and L9981, demonstrate a relatively lower expression level of miR-182 compared with the lowly metastatic human lung cancer cell line 95C. Methylation-specific PCR and DNA sequencing assay results indicate that these lung cancer cell lines present different levels of miR-182 promoter methylation, and the highest methylation level is observed in A549 cells. Furthermore, the expression of miR-182 in these cell lines significantly increases when treated with 10 μM 5’-Aza-dC. Conclusion DNA methylation occurs in the miR-182 promoter region in lung cancer cell lines. This methylation can regulate the expression level of miR-182. Further study must be conducted to explore the function of miR-182 promoter methylation in lung cancer occurrence and development.
Technical specification use and application
International Nuclear Information System (INIS)
Williamson, D.; Hoffman, D.R.
1991-01-01
Since early 1988 intensive efforts have been under way to produce a new and improved Standard Technical Specification. The program involves a coordinated effort between utility personnel representing each of the four nuclear steam supply system (NSSS) product lines, the NSSS vendors, and the US Nuclear Regulatory Commission (NRC). This intensive work period is actually the culmination of a decade of rhetoric about shortcomings of the existing technical specifications. Work on the improved technical specifications provided a unique forum for intense philosophical discussions between the users and enforcers of technical specifications, the outcome of which could have an impact on all licensees. Some of the more intriguing difficulties in the use and application of existing technical specifications, as well as discussions of the resolutions being applied in the improved technical specifications and the dilemmas remaining to be resolved are discussed in the paper
LINE BROADENING AND THE SOLAR OPACITY PROBLEM
Energy Technology Data Exchange (ETDEWEB)
Krief, M.; Feigel, A.; Gazit, D., E-mail: menahem.krief@mail.huji.ac.il [The Racah Institute of Physics, The Hebrew University, 91904 Jerusalem (Israel)
2016-06-20
The calculation of line widths constitutes theoretical and computational challenges in the calculation of opacities of hot, dense plasmas. Opacity models use line broadening approximations that are untested at stellar interior conditions. Moreover, calculations of atomic spectra of the Sun indicate a large discrepancy in the K-shell line widths between several atomic codes and the Opacity-Project (OP). In this work, the atomic code STAR is used to study the sensitivity of solar opacities to line broadening. Variations in the solar opacity profile due to an increase of the Stark widths resulting from discrepancies with OP, are compared, in light of the solar opacity problem, with the required opacity variations of the present day Sun, as imposed by helioseismic and neutrino observations. The resulting variation profile is much larger than the discrepancy between different atomic codes, agrees qualitatively with the missing opacity profile, recovers about half of the missing opacity nearby the convection boundary, and has a little effect in the internal regions. Since it is hard to estimate quantitatively the uncertainty in the Stark widths, we show that an increase of all line widths by a factor of about ∼100 recovers quantitatively the missing opacity. These results emphasize the possibility that photoexcitation processes are not modeled properly, and more specifically, highlight the need for a better theoretical characterization of the line broadening phenomena at stellar interior conditions, and of the uncertainty due to the way it is implemented by atomic codes.
Harmony Search for Balancing Two-sided Assembly Lines
Directory of Open Access Journals (Sweden)
Hindriyanto Dwi Purnomo
2012-01-01
Full Text Available Two-sided assembly lines balancing problems are important problem for large-sized products such as cars and buses, in which, tasks operations can be performed in the two sides of the line. In this paper, Harmony Search algorithm is proposed to solve two-sided assembly lines balancing problems type-I (TALBP-I. The proposed method adopts the COMSOAL heuristic and specific features of TALBP in the Harmony operators – the harmony memory consideration, random selection and pitch adjustment – in order to maintain the local and global search. The proposed method is evaluated based on 6 benchmark problems that are commonly used in TALBP. The experiment results show that the proposed method work well and produces better solution than the heuristic method and genetic algorithm.
Simulating the Beam-line at CERN's ISOLDE Experiment
McGrath, Casey
2013-01-01
Maximizing the optical matching along portions of the ISOLDE beam-line and automating this procedure will make it easier for scientists to determine what the strengths of the electrical elds of each beam-line element should be in order to reduce particle loss. Simulations are run using a program called MAD-X, however, certain issues were discovered that hindered an immediate success of the simulations. Specifically, the transfer matrices for electrostatic components like the switchyards, kickers, and electric quadrupoles were missing from the original coding. The primary aim of this project was to design these components using AutoCAD and then extract the transfer matrices using SIMION. Future work will then implement these transfer matrices into the MAD-X code to make the simulations of the beam-line more accurate.
Investigating the Temperature Problem in Narrow Line Emitting AGN
Jenkins, Sam; Richardson, Chris T.
2018-06-01
Our research investigates the physical conditions in gas clouds around the narrow line region of AGN. Specifically, we explore the necessary conditions for anomalously high electron temperatures, Te, in those clouds. Our 321 galaxy data set was acquired from SDSS DR14 after requiring S/N > 5.0 in [OIII] 4363 and S/N > 3.0 in all BPT diagram emission lines, to ensure both accurate Te and galaxy classification, with 0.04 study the effects these conditions have on gas cloud Te.
Energy Technology Data Exchange (ETDEWEB)
Leibhard, S.; Smida, J. [Muenchen Univ. (Germany). Strahlenbiologisches Inst.; Eckardt-Schupp, F.; Hieber, L. [GSF-Inst. fuer Strahlenbiologie, Oberschleissheim (Germany)
1996-12-31
Repetitive DNA sequences of the LINE-family (long interspersed elements) that are widely distributed among the mammalian genome can be activated or altered by the exposure to ionizing radiation [1]. By the integration at new sites in the genome alterations in the expression of genes that are involved in cell transformation and/or carcinogenesis may occur [2, 3]. A new technique - the inter-LINE PCR - has been developed in order to detect and analyse such genomic rearrangements in radiation-transformed cell lines. From the sites of transformation- or tumour-specific changes in the genome it might be possible to develop new tumour markers for diagnostic purpose. (orig.) [Deutsch] Repetitive DNA-Sequenzen der LINE-Familie, die weit verbreitet im Genom von Saeugerzellen vorkommen, koennen durch Exposition mit ionisierender Strahlung aktiviert und veraendert werden [1]. Durch eine Neu- bzw. Reintegration an anderen Positionen im Genom kann es zu bedeutenden Veraenderungen im Genom der Zelle kommen. Die Expression von Genen, die bei den Prozessen der Zelltransformation bzw. der Karzinogenese beteiligt sind, kann dadurch veraendert werden [2, 3]. Mithilfe der von uns entwickelten Inter-LINE PCR und der anschliessenden Analyse der veraenderten Produktmuster nach gelelektrophoretischer Auftrennung koennen solche `genomic rearrangements` unter Beteiligung von LINE-Elementen untersucht und naeher charakterisiert werden. Durch Klonierung und Sequenzierung transformations- bzw. tumorspezifischer PCR-Produkte sollte es moeglich sein Tumormarker fuer diagnostische Zwecke zu entwickeln. Die Methode wurde fuer die Analyse von Zellen des Syrischen Hamster aufgebaut, sie ist jedoch universell fuer alle Saeuger anwendbar. (orig.)
Health impact assessment of the Atlanta BeltLine.
Ross, Catherine L; Leone de Nie, Karen; Dannenberg, Andrew L; Beck, Laurie F; Marcus, Michelle J; Barringer, Jason
2012-03-01
Although a health impact assessment (HIA) is a tool that can provide decision makers with recommendations to promote positive health impacts and mitigate adverse health impacts of proposed projects and policies, it is not routinely conducted on most major projects or policies. To make health a decision criterion for the Atlanta BeltLine, a multibillion-dollar transit, trails, parks, and redevelopment project. An HIA was conducted in 2005-2007 to anticipate and influence the BeltLine's effect on health determinants. Changes in access and equity, environmental quality, safety, social capital, and physical activity were forecast, and steps to maximize health benefits and reduce negative effects were recommended. Key recommendations included giving priority to the construction of trails and greenspace rather than residential and retail construction, making health an explicit goal in project priority setting, adding a public health professional to decision-making boards, increasing the connectivity between the BeltLine and civic spaces, and ensuring that affordable housing is built. BeltLine project decision makers have incorporated most of the HIA recommendations into the planning process. The HIA was cited in the awarding of additional funds of $7,000,000 for brownfield clean-up and greenspace development. The project is expected to promote the health of local residents more than in the absence of the HIA. This report is one of the first HIAs to tie specific assessment findings to specific recommendations and to identifiable impacts from those recommendations. The lessons learned from this project may help others engaged in similar efforts. Copyright © 2012. Published by Elsevier Inc.
Creation and evaluation of best cotton mutant lines
International Nuclear Information System (INIS)
Rastegari, S. J.; Hosseini, Z.
2001-01-01
During (1997-1999) a study was carried out to recognize the best mutant lines, which were already obtained from a mutation breeding project. A Triple Rectangular Latis Design (8 7) in form of randomized complete blocks (RCB) with fifty- six treatments and three replications, were used in Estahban, Kordkouy and Varamin, under different ecological conditions, rainfall (Kordkouy) desert (Varamin) hot and dry (Estahban). During growing season some important morphological characteristics were recorded. Some lines had specific characters, for example: line 3191 (Chirpan 150 gray) had a low leaf number per plant, line 3169 (Bakhtegan 200 gray) plants were clustered. The results of the data in Varamin station showed that Bakhtegan irradiated with 150 gray line 3485 and Tashkand with 300 gray line 3451 compared to check (Varamin with 4373 kg/ha) had highest yield with 4942 kg/ha, and 4871 kg/ha respectively. In view of boll weight line 3405 of Sahel irradiated with 200 gray had highest boll weight (6.5 g/boll). In Kordkouy station the best mutant line was Chirpan irradiated with 250 gray, line 3208, with 20% yield increase compared to Sahel and 30% yield increase compared to original Chirpan. In respect to irradiation effect on lint percentage and fiber quality, the results showed; there was a positive effect on lint percentage of all varieties, especially in Tashkant, Bakhtegan and Chirpan which are inherently weak in lint percentage. As a whole gamma radiation did not have any negative effect on fiber quality. Even in Estahban 1.6 to 2.4 mm fiber increase were observed in some Chirpan irradiated material (C150-3516) and (C200-3523)
From Off-line to On-line Handwriting Recognition
Lallican, P.; Viard-Gaudin, C.; Knerr, S.
2004-01-01
On-line handwriting includes more information on time order of the writing signal and on the dynamics of the writing process than off-line handwriting. Therefore, on-line recognition systems achieve higher recognition rates. This can be concluded from results reported in the literature, and has been
VT Digital Line Graph Miscellaneous Transmission Lines
Vermont Center for Geographic Information — (Link to Metadata) This datalayer is comprised of Miscellaineous Transmission Lines. Digital line graph (DLG) data are digital representations of cartographic...
Wai, T; Grumet, R
1995-09-01
The inbred cucumber (Cucumis sativus L.) line TMG-1 is resistant to three potyviruses:zucchini yellow mosaic virus (ZYMV), watermelon mosaic virus (WMV), and the watermelon strain of papaya ringspot virus (PRSV-W). The genetics of resistance to WMV and the relationship of WMV resistance to ZYMV resistance were examined. TMG-1 was crossed with WI-2757, a susceptible inbred line. F1, F2 and backcross progeny populations were screened for resistance to WMV and/or ZYMV. Two independently assorting factors conferred resistance to WMV. One resistance was conferred by a single recessive gene from TMG-1 (wmv-2). The second resistance was conferred by an epistatic interaction between a second recessive gene from TMG-1 (wmv-3) and either a dominant gene from WI-2757 (Wmv-4) or a third recessive gene from TMG-1 (wmv-4) located 20-30 cM from wmv-3. The two resistances exhibited tissue-specific expression. Resistance conferred by wmv-2 was expressed in the cotyledons and throughout the plant. Resistance conferred by wmv-3 + Wmv-4 (or wmv-4) was expressed only in true leaves. The gene conferring resistance to ZYMV appeared to be the same as, or tightly linked to one of the WMV resistance genes, wmv-3.
CaMV-35S promoter sequence-specific DNA methylation in lettuce.
Okumura, Azusa; Shimada, Asahi; Yamasaki, Satoshi; Horino, Takuya; Iwata, Yuji; Koizumi, Nozomu; Nishihara, Masahiro; Mishiba, Kei-ichiro
2016-01-01
We found 35S promoter sequence-specific DNA methylation in lettuce. Additionally, transgenic lettuce plants having a modified 35S promoter lost methylation, suggesting the modified sequence is subjected to the methylation machinery. We previously reported that cauliflower mosaic virus 35S promoter-specific DNA methylation in transgenic gentian (Gentiana triflora × G. scabra) plants occurs irrespective of the copy number and the genomic location of T-DNA, and causes strong gene silencing. To confirm whether 35S-specific methylation can occur in other plant species, transgenic lettuce (Lactuca sativa L.) plants with a single copy of the 35S promoter-driven sGFP gene were produced and analyzed. Among 10 lines of transgenic plants, 3, 4, and 3 lines showed strong, weak, and no expression of sGFP mRNA, respectively. Bisulfite genomic sequencing of the 35S promoter region showed hypermethylation at CpG and CpWpG (where W is A or T) sites in 9 of 10 lines. Gentian-type de novo methylation pattern, consisting of methylated cytosines at CpHpH (where H is A, C, or T) sites, was also observed in the transgenic lettuce lines, suggesting that lettuce and gentian share similar methylation machinery. Four of five transgenic lettuce lines having a single copy of a modified 35S promoter, which was modified in the proposed core target of de novo methylation in gentian, exhibited 35S hypomethylation, indicating that the modified sequence may be the target of the 35S-specific methylation machinery.
On field line resonances of hydromagnetic Alfven waves in dipole magnetic field
International Nuclear Information System (INIS)
Chen, Liu; Cowley, S.C.
1989-07-01
Using the dipole magnetic field model, we have developed the theory of field line resonances of hydromagnetic Alfven waves in general magnetic field geometries. In this model, the Alfven speed thus varies both perpendicular and parallel to the magnetic field. Specifically, it is found that field line resonances do persist in the dipole model. The corresponding singular solutions near the resonant field lines as well as the natural definition of standing shear Alfven eigenfunctions have also been systematically derived. 11 refs
Some Results On The Modelling Of TSS Manufacturing Lines
Directory of Open Access Journals (Sweden)
Viorel MÎNZU
2000-12-01
Full Text Available This paper deals with the modelling of a particular class of manufacturing lines, governed by a decentralised control strategy so that they balance themselves. Such lines are known as “bucket brigades” and also as “TSS lines”, after their first implementation, at Toyota, in the 70’s. A first study of their behaviour was based upon modelling as stochastic dynamic systems, which emphasised, in the frame of the so-called “Normative Model”, a sufficient condition for self-balancing, that means for autonomous functioning at a steady production rate (stationary behaviour. Under some particular conditions, a simulation analysis of TSS lines could be made on non-linear block diagrams, showing that the state trajectories are piecewise continuous in between occurrences of certain discrete events, which determine their discontinuity. TSS lines may therefore be modelled as hybrid dynamic systems, more specific, with autonomous switching and autonomous impulses (jumps. A stability analysis of such manufacturing lines is allowed by modelling them as hybrid dynamic systems with discontinuous motions.
Utilizing adequate intake line curtain air quantities to maintain respirable dust compliance
Energy Technology Data Exchange (ETDEWEB)
Schultz, M.J.; Tomko, D.M.; Rumbaugh, V.E. [United States Dept. of Labor, Mine Safety and Health Administration, Pittsburgh, PA (United States). Safety and Health Technical Center
2010-07-01
Mine operators are obligated to ensure the effectiveness of their dust controls and implement practices to minimize the generation of dust in their mines. The 2 main types of face ventilation are blowing and exhaust ventilation. With blowing face ventilation, intake air is directed behind a line curtain or through ventilation tubing and then discharged from the end of the line curtain toward the working face. This paper presented specific information for mine operators regarding where and when exhausting or blowing ventilation will be used. Mine operators should establish the line curtain for directing the face ventilating air as a specific distance from the point of deepest penetration of the face. The location of curtains where roof bolting is being performed should also be specified. The distance from the face is important to the effectiveness of ventilation. 4 refs., 3 tabs., 2 figs.
Radiation resistant lining material
International Nuclear Information System (INIS)
Ouchi, Koki; Okagawa, Seigo; Tamaki, Hidehiro.
1990-01-01
Rigidity, viscoelasticity, flexibility, radiation resistance, leaching resistance, rust-proofness, endurance, etc. are required for the lining materials to wall surfaces and floor surfaces of facilities used under the effect of radiation rays and for the inner surface protection of vessels for radioactive wastes. The present invention provides radiation resistant lining material capable of satisfying such various requirements in a well-balanced manner. That is, the material contains (A) 100 parts by weight of rapidly curing cement, (B) 50 to 300 % by weight of aggregate, and (C) 80 to 120 parts by weight of polymer emulsion. As the specific example, the ingredient (A) is commercially available under the trade name of Jet Cement. The aggregate of the ingredient (B) has preferably from about 0.6 to 0.2 mm of size and is made of material, preferably, silicon or iron grains. As the ingredient (C), acrylic resin emulsion is preferred. As a result of example, these ingredient constitutions can satisfy each of the required performance described above. (I.S.)
Calculation of stresses in a rock mass and lining in stagewise face drivage
Seryakov, VM; Zhamalova, BR
2018-03-01
Using the method of calculating mechanical state of a rock mass for the conditions of stagewise drivage of a production face in large cross-section excavations, the specific features of stress redistribution in lining of excavations are found. The zones of tensile stresses in the lining are detected. The authors discuss the influence of the initial stress state of rocks on the tension stress zones induced in the lining in course of the heading advance
Control of single-phase islanded PV/battery minigrids based on power-line signaling
DEFF Research Database (Denmark)
Quintana, Pablo; Guerrero, Josep M.; Dragicevic, Tomislav
2014-01-01
should be utilized as efficiently as possible. This paper proposes a coordinated control strategy based on power-line signaling (PLS), instead of common communications, for a single-phase minigrid in which each unit can operate in different operation modes taking into account the resource limitation...... types of renewable energy sources (RES) and energy storage systems (ESS). Specifically, the recharging process of secondary battery, the most prominent ESS, should be done in a specific manner to preserve its life-time, microgrid line voltage must be kept within the bounds and the energy offered by RES...
Yuan, Naichang; He, Jianguo; Yao, Demiao; Dai, Qin; Lin, Weigan
1995-06-01
Two types of coplanar transmission lines, rectangular microshield coplanar coupled lines (RMCCL) and coplanar coupled rectangular microshield lines (CCRML), are proposed for MMIC applications. These are developed from coplanar coupled lines (CCL) and coplanar coupled strip lines (CCS). Analytic formulas are presented for calculating the quasistatic TEM parameters of these coupled lines by means of exact conformal mapping techniques. Numerical results are also presented to illustrate the properties of these coplanar transmission lines.
Heterotic line bundle models on elliptically fibered Calabi-Yau three-folds
Braun, Andreas P.; Brodie, Callum R.; Lukas, Andre
2018-04-01
We analyze heterotic line bundle models on elliptically fibered Calabi-Yau three-folds over weak Fano bases. In order to facilitate Wilson line breaking to the standard model group, we focus on elliptically fibered three-folds with a second section and a freely-acting involution. Specifically, we consider toric weak Fano surfaces as base manifolds and identify six such manifolds with the required properties. The requisite mathematical tools for the construction of line bundle models on these spaces, including the calculation of line bundle cohomology, are developed. A computer scan leads to more than 400 line bundle models with the right number of families and an SU(5) GUT group which could descend to standard-like models after taking the ℤ2 quotient. A common and surprising feature of these models is the presence of a large number of vector-like states.
Peginterferon Alfa-2b Injection (Sylatron)
... Naprosyn), ondansetron (Zofran), paroxetine (Paxil, Pexeva), phenytoin (Dilantin), piroxicam (Feldene), propafenone (Rhythmol), risperidone (Risperdal), rosiglitazone (Avandia), sulfamethoxazole ( ...
Evaluation of Hose in Hose Transfer Line Service Life for Hanford's Interim Stabilization Program
Energy Technology Data Exchange (ETDEWEB)
TORRES, T.D.
2000-08-24
RPP-6153, Engineering Task Plan for Hose-in-Hose Transfer System for the Interim Stabilization Program, defines the programmatic goals, functional requirements, and technical criteria for the development and subsequent installation of transfer line equipment to support Hanford's Interim Stabilization Program. RPP-6028, Specification for Hose in Hose Transfer Lines for Hanford's Interim Stabilization Program, has been issued to define the specific requirements for the design, manufacture, and verification of transfer line assemblies for specific waste transfer applications. Included in RPP-6028 are tables defining the chemical constituents of concern to which transfer lines will be exposed. Current Interim Stabilization Program planning forecasts that the at-grade transfer lines will be required to convey pumpable waste for as much as three years after commissioning. Prudent engineering dictates that the equipment placed in service have a working life in excess of this forecasted time period, with some margin to allow for future adjustments to the planned schedule. This document evaluates the effective service life of the Hose-in-Hose Transfer Lines, based on information submitted by the manufacturer and published literature. The effective service life of transfer line assemblies is a function of several factors. Foremost among these are process fluid characteristics, ambient environmental conditions, and the manufacturer's stated shelf life. This evaluation examines the manufacturer's certification of shelf life, the manufacturer's certifications of chemical compatibility with waste, and published literature on the effects of exposure to ionizing radiation on the mechanical properties of elastomeric materials to evaluate transfer line service life.
Vermeulen, CJ; Bijlsma, R
The specific genetic basis of inbreeding depression is poorly understood. To address this question, two conditionally expressed lethal effects that were found to cause line-specific life span reductions in two separate inbred lines of Drosophila melanogaster. were characterized phenotypically and
Jang, Jiho; Yoo, Jeong-Eun; Lee, Jeong-Ah; Lee, Dongjin R; Kim, Ji Young; Huh, Yong Jun; Kim, Dae-Sung; Park, Chul-Yong; Hwang, Dong-Youn; Kim, Han-Soo; Kang, Hoon-Chul; Kim, Dong-Wook
2012-03-31
The generation of disease-specific induced pluripotent stem cell (iPSC) lines from patients with incurable diseases is a promising approach for studying disease mechanisms and drug screening. Such innovation enables to obtain autologous cell sources in regenerative medicine. Herein, we report the generation and characterization of iPSCs from fibroblasts of patients with sporadic or familial diseases, including Parkinson's disease (PD), Alzheimer's disease (AD), juvenile-onset, type I diabetes mellitus (JDM), and Duchenne type muscular dystrophy (DMD), as well as from normal human fibroblasts (WT). As an example to modeling disease using disease-specific iPSCs, we also discuss the previously established childhood cerebral adrenoleukodystrophy (CCALD)- and adrenomyeloneuropathy (AMN)-iPSCs by our group. Through DNA fingerprinting analysis, the origins of generated disease-specific iPSC lines were identified. Each iPSC line exhibited an intense alkaline phosphatase activity, expression of pluripotent markers, and the potential to differentiate into all three embryonic germ layers: the ectoderm, endoderm, and mesoderm. Expression of endogenous pluripotent markers and downregulation of retrovirus-delivered transgenes [OCT4 (POU5F1), SOX2, KLF4, and c-MYC] were observed in the generated iPSCs. Collectively, our results demonstrated that disease-specific iPSC lines characteristically resembled hESC lines. Furthermore, we were able to differentiate PD-iPSCs, one of the disease-specific-iPSC lines we generated, into dopaminergic (DA) neurons, the cell type mostly affected by PD. These PD-specific DA neurons along with other examples of cell models derived from disease-specific iPSCs would provide a powerful platform for examining the pathophysiology of relevant diseases at the cellular and molecular levels and for developing new drugs and therapeutic regimens.
Extreme Ultraviolet Emission Lines of Iron Fe XI-XIII
Lepson, Jaan; Beiersdorfer, P.; Brown, G. V.; Liedahl, D. A.; Brickhouse, N. S.; Dupree, A. K.
2013-04-01
The extreme ultraviolet (EUV) spectral region (ca. 20--300 Å) is rich in emission lines from low- to mid-Z ions, particularly from the middle charge states of iron. Many of these emission lines are important diagnostics for astrophysical plasmas, providing information on properties such as elemental abundance, temperature, density, and even magnetic field strength. In recent years, strides have been made to understand the complexity of the atomic levels of the ions that emit the lines that contribute to the richness of the EUV region. Laboratory measurements have been made to verify and benchmark the lines. Here, we present laboratory measurements of Fe XI, Fe XII, and Fe XIII between 40-140 Å. The measurements were made at the Lawrence Livermore electron beam ion trap (EBIT) facility, which has been optimized for laboratory astrophysics, and which allows us to select specific charge states of iron to help line identification. We also present new calculations by the Hebrew University - Lawrence Livermore Atomic Code (HULLAC), which we also utilized for line identification. We found that HULLAC does a creditable job of reproducing the forest of lines we observed in the EBIT spectra, although line positions are in need of adjustment, and line intensities often differed from those observed. We identify or confirm a number of new lines for these charge states. This work was supported by the NASA Solar and Heliospheric Program under Contract NNH10AN31I and the DOE General Plasma Science program. Work was performed in part under the auspices of the Department of Energy by Lawrence Livermore National Laboratory under Contract DEAC52-07NA27344.
Li, Xueying; Wang, Yan; Guo, Jiazhong; Zhong, Tao; Li, Li; Zhang, Hongping; Wang, Linjie
2018-02-15
Adipokines are secreted by adipose tissue and play an important role in the regulation of lipid metabolism. However, the information regarding adipokines in goats is limited. PPARγ is a key gene in adipocyte differentiation and activates adipokine genes. Rosiglitazone is a PPARγ agonist and can promote the expression of PPARγ to increase the expression of lipogenesis-related genes. Therefore, investigation of the relationship between rosiglitazone and adipokines will help us to better understand the function of PPARγ in lipid metabolism in Tibetan goats. In this study, we cloned the resistin (RETN), apelin (APLN), fibroblast growth factor 21 (FGF21), and visfatin (NAMPT) genes from non-pregnant female Tibetan goat adipose tissue. APLN and NAMPT were predominantly expressed in the kidney, and FGF21 was expressed at the highest levels in the liver in vivo. In fat tissues, the highest expression levels of FGF21 and RETN were detected in omental fat, whereas their expression in perirenal and subcutaneous fat was extremely weak. APLN and NAMPT were abundantly expressed in omental and subcutaneous fat in vivo. In addition, the four adipokines had different expression profiles during goat adipocyte differentiation in vitro. Oil red O staining showed that rosiglitazone could promote adipocyte differentiation and lipid droplet formation. In addition, rosiglitazone significantly increased the expression of FGF21 and RETN (pgoat adipocyte differentiation. And PPARγ could regulate the expression of the four adipokines, but the detailed regulatory mechanism still needs to be elucidated. Copyright © 2017 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Rothuizen Jan
2006-09-01
Full Text Available Abstract Background Apoptosis resistance occurs in various tumors. The anti-apoptotic XIAP protein is responsible for inhibiting apoptosis by reducing caspase-3 activation. Our aim is to evaluate whether RNA inhibition against XIAP increases the sensitivity of canine cell-lines for chemotherapeutics such as TRAIL and doxorubicin. We used small interfering RNA's (siRNA directed against XIAP in three cell-lines derived from bile-duct epithelia (BDE, mammary carcinoma (P114, and osteosarcoma (D17. These cell-lines represent frequently occurring canine cancers and are highly comparable to their human counterparts. XIAP down-regulation was measured by means of quantitative PCR (Q-PCR and Western blotting. The XIAP depleted cells were treated with a serial dilution of TRAIL or doxorubicin and compared to mock- and nonsense-treated controls. Viability was measured with a MTT assay. Results All XIAP siRNA treated cell-lines showed a mRNA down-regulation over 80 percent. Western blot analysis confirmed mRNA measurements. No compensatory effect of IAP family members was seen in XIAP depleted cells. The sensitivity of XIAP depleted cells for TRAIL was highest in BDE cells with an increase in the ED50 of 14-fold, compared to mock- and nonsense-treated controls. The sensitivity of P114 and D17 cell-lines increased six- and five-fold, respectively. Doxorubicin treatment in XIAP depleted cells increased sensitivity in BDE cells more than eight-fold, whereas P114 and D17 cell-lines showed an increase in sensitivity of three- and five-fold, respectively. Conclusion XIAP directed siRNA's have a strong sensitizing effect on TRAIL-reduced cell-viability and a smaller but significant effect with the DNA damaging drug doxorubicin. The increase in efficacy of chemotherapeutics with XIAP depletion provides the rationale for the use of XIAP siRNA's in insensitive canine tumors.
Recombinant protein production from stable mammalian cell lines and pools.
Hacker, David L; Balasubramanian, Sowmya
2016-06-01
We highlight recent developments for the production of recombinant proteins from suspension-adapted mammalian cell lines. We discuss the generation of stable cell lines using transposons and lentivirus vectors (non-targeted transgene integration) and site-specific recombinases (targeted transgene integration). Each of these methods results in the generation of cell lines with protein yields that are generally superior to those achievable through classical plasmid transfection that depends on the integration of the transfected DNA by non-homologous DNA end-joining. This is the main reason why these techniques can also be used for the generation of stable cell pools, heterogenous populations of recombinant cells generated by gene delivery and genetic selection without resorting to single cell cloning. This allows the time line from gene transfer to protein production to be reduced. Copyright © 2016 Elsevier Ltd. All rights reserved.
Determination of line edge roughness in low-dose top-down scanning electron microscopy images
Verduin, T.; Kruit, P.; Hagen, C.W.
2014-01-01
We investigated the off-line metrology for line edge roughness (LER) determination by using the discrete power spectral density (PSD). The study specifically addresses low-dose scanning electron microscopy (SEM) images in order to reduce the acquisition time and the risk of resist shrinkage. The
A transgenic mouse line for molecular genetic analysis of excitatory glutamatergic neurons
DEFF Research Database (Denmark)
Borgius, Lotta; Restrepo, C. Ernesto; Leao, Richardson N.
2010-01-01
Excitatory glutamatergic neurons are part of most of the neuronal circuits in the mammalian nervous system. We have used BAC-technology to generate a BAC-Vglut2::Cre mouse line where Cre expression is driven by the vesicular glutamate transporter 2 (Vglut2) promotor. This BAC-Vglut2::Cre mouse line...... showed specific expression of Cre in Vglut2 positive cells in the spinal cord with no ectopic expression in GABAergic or glycinergic neurons. This mouse line also showed specific Cre expression in Vglut2 positive structures in the brain such as thalamus, hypothalamus, superior colliculi, inferior...... colliculi and deep cerebellar nuclei together with nuclei in the midbrain and hindbrain. Cre-mediated recombination was restricted to Cre expressing cells in the spinal cord and brain and occurred as early as E 12.5. Known Vglut2 positive neurons showed normal electrophysiological properties in the BAC...
Optimization of line configuration and balancing for flexible machining lines
Liu, Xuemei; Li, Aiping; Chen, Zurui
2016-05-01
Line configuration and balancing is to select the type of line and allot a given set of operations as well as machines to a sequence of workstations to realize high-efficiency production. Most of the current researches for machining line configuration and balancing problems are related to dedicated transfer lines with dedicated machine workstations. With growing trends towards great product variety and fluctuations in market demand, dedicated transfer lines are being replaced with flexible machining line composed of identical CNC machines. This paper deals with the line configuration and balancing problem for flexible machining lines. The objective is to assign operations to workstations and find the sequence of execution, specify the number of machines in each workstation while minimizing the line cycle time and total number of machines. This problem is subject to precedence, clustering, accessibility and capacity constraints among the features, operations, setups and workstations. The mathematical model and heuristic algorithm based on feature group strategy and polychromatic sets theory are presented to find an optimal solution. The feature group strategy and polychromatic sets theory are used to establish constraint model. A heuristic operations sequencing and assignment algorithm is given. An industrial case study is carried out, and multiple optimal solutions in different line configurations are obtained. The case studying results show that the solutions with shorter cycle time and higher line balancing rate demonstrate the feasibility and effectiveness of the proposed algorithm. This research proposes a heuristic line configuration and balancing algorithm based on feature group strategy and polychromatic sets theory which is able to provide better solutions while achieving an improvement in computing time.
International Nuclear Information System (INIS)
Valentiner, Ursula; Carlsson, Margarita; Erttmann, Rudolf; Hildebrandt, Herbert; Schumacher, Udo
2005-01-01
The thiazolidinedione (TZD) or glitazone class of peroxisome proliferator-activated-γ (PPAR-γ) ligands not only induce adipocyte differentiation and increase insulin sensitivity, but also exert growth inhibitory effects on several carcinoma cell lines in vitro as well as in vivo. In the current study the in vitro effect of four PPAR-γ agonists (ciglitazone, pioglitazone, troglitazone, rosiglitazone) on the cell growth of seven human neuroblastoma cell lines (Kelly, LAN-1, LAN-5, LS, IMR-32, SK-N-SH, SH-SY5Y) was investigated. Growth rates were assessed by a colorimetric XTT-based assay kit. Expression of PPAR-γ protein was examined by immunohistochemistry and Western blot analysis. All glitazones inhibited in vitro growth and viability of the human neuroblastoma cell lines in a dose-dependent manner showing considerable effects only at high concentrations (10 μM and 100 μM). Effectiveness of the glitazones on neuroblastoma cell growth differed depending on the cell line and the agent. The presence of PPAR-γ protein was demonstrated in all cell lines. Our findings indicate that ligands for PPAR-γ may be useful therapeutic agents for the treatment of neuroblastoma. Thus the effect of glitazones on the growth of neuroblastoma should now be investigated in an in vivo animal model
LINE FUSION GENES: a database of LINE expression in human genes
Directory of Open Access Journals (Sweden)
Park Hong-Seog
2006-06-01
Full Text Available Abstract Background Long Interspersed Nuclear Elements (LINEs are the most abundant retrotransposons in humans. About 79% of human genes are estimated to contain at least one segment of LINE per transcription unit. Recent studies have shown that LINE elements can affect protein sequences, splicing patterns and expression of human genes. Description We have developed a database, LINE FUSION GENES, for elucidating LINE expression throughout the human gene database. We searched the 28,171 genes listed in the NCBI database for LINE elements and analyzed their structures and expression patterns. The results show that the mRNA sequences of 1,329 genes were affected by LINE expression. The LINE expression types were classified on the basis of LINEs in the 5' UTR, exon or 3' UTR sequences of the mRNAs. Our database provides further information, such as the tissue distribution and chromosomal location of the genes, and the domain structure that is changed by LINE integration. We have linked all the accession numbers to the NCBI data bank to provide mRNA sequences for subsequent users. Conclusion We believe that our work will interest genome scientists and might help them to gain insight into the implications of LINE expression for human evolution and disease. Availability http://www.primate.or.kr/line
Directory of Open Access Journals (Sweden)
Eric M Walton
Full Text Available Transgenic labeling of innate immune cell lineages within the larval zebrafish allows for real-time, in vivo analyses of microbial pathogenesis within a vertebrate host. To date, labeling of zebrafish macrophages has been relatively limited, with the most specific expression coming from the mpeg1 promoter. However, mpeg1 transcription at both endogenous and transgenic loci becomes attenuated in the presence of intracellular pathogens, including Salmonella typhimurium and Mycobacterium marinum. Here, we describe mfap4 as a macrophage-specific promoter capable of producing transgenic lines in which transgene expression within larval macrophages remains stable throughout several days of infection. Additionally, we have developed a novel macrophage-specific Cre transgenic line under the control of mfap4, enabling macrophage-specific expression using existing floxed transgenic lines. These tools enrich the repertoire of transgenic lines and promoters available for studying zebrafish macrophage dynamics during infection and inflammation and add flexibility to the design of future macrophage-specific transgenic lines.
International Nuclear Information System (INIS)
Jang, Hak Sin; Kim, Sin Yeong
1998-02-01
This book is about cable line engineering. It is comprised of nine chapters, which deals with summary of cable communication such as way, process of cable communication and optical communication, Line constant of transmission on primary constant, reflection and crosstalk, communication cable line of types like flat cable, coaxial cable and loaded cable, Install of communication line with types and facility of aerial line, construction method of communication line facility, Measurement of communication line, Carrier communication of summary, PCM communication with Introduction, regeneration relay system sampling and quantization and Electric communication service and general information network with mobile communication technique and satellite communication system.
New Trends in on-line Marketing
Palkovič, Lukáš
2011-01-01
This bachelor thesis deals with new trend of internet marketing, it focuses especially on viral marketing. The theoretical part charasterizes the process of viral campaigns, furthermore deals with the components and aspects of on-line environment. Another separated chapter presents social networks, their place in viral marketing and at last but not least the viral video making process. The practical part contains different analyses of specific viral campaigns. The next and equally the last pa...
Self-Leadership and Creativity Differences in Line and Supervisory Defense Acquisition Employees
National Research Council Canada - National Science Library
DiLiello, Trudy C; Houghton, Jeffery D
2007-01-01
.... More specifically, the study examined differences in self-leadership, creativity, and perceived organizational support for creativity between line and supervisory defense acquisition employees...
Position-specific isotope analysis by on-line pyrolysis coupled to IRMS
Gilbert, A.; Suda, K.; Yamada, K.; Ueno, Y.; Yoshida, N.
2016-12-01
Position-specific isotopic analyses (PSIA) provide unique information regarding the sources, sinks and processes related to natural molecules. For instance, PSIA of short-chain hydrocarbons could lead to temperature of formation and maturity of natural gas reservoirs [1][2]. In the last decade, quantitative Nuclear Magnetic Resonance (NMR) specrometry has been used for PSIA of organic molecules such as glucose or n-alkanes [3][4]. However, due to its low sensitivity, application to low amount geochemical samples remains challenging. In 1997, Corso & Brenna proposed to adapt a pyrolysis furnace to an isotope ratio mass spectrometer, making it possible the thermal degradation of the target molecule and the subsequent analysis of the d13C values of the fragments formed [5]. Starting from fatty acid methyl esters they demonstrated the absence of rearrangement during pyrolytic degradation and could determine the d13C value of carboxyl C-atom position. We adapted the system for the full characterization of position-specific isotope composition of small molecules (ethanol, acetic acid, alanine, propane). Nanomole amount of sample can be analyzed with a precision on intramolecular d13C values of 1‰ or lower [2]. We recently analyzed abiotic and thermogenic propane samples both from the field and from lab simulations. PSIA of propane shows systematic differences of position-specific isotope composition between thermogenic and abiotic samples. While the former show 13C-depletion on the terminal C-atom position - consistent with thermal cracking kinetic models [6] - abiotic samples show little or no preference for terminal or central 13C-isotopomer. These results emphasize the potential of PSIA to trace the the processes associated with organic molecules production. [1] Piasecki et al. 2016 GCA 188, 58 [2] Gilbert et al. 2016 GCA 177, 205 [3] Gilbert et al. 2012 PNAS, 109, 18204 [4] Gilbert et al. 2013 Org. Geochem, 62, 56 [5] Corso & Brenna 1997 PNAS, 94, 1049 [6] Tang et
Neutron beam-line shield design for the protein crystallography instrument at the Lujan Center
International Nuclear Information System (INIS)
Russell, G.J.; Pitcher, E.J.; Muhrer, G.; Ferguson, P.D.
2001-01-01
We have developed a very useful methodology for calculating absolute total (neutron plus gamma-ray) dose equivalent rates for use in the design of neutron beam line shields at a spallation neutron source. We have applied this technique to the design of beam line shields for several new materials science instruments being built at the Manuel Lujan Jr. Neutron Scattering Center. These instruments have a variety of collimation systems and different beam line shielding issues. We show here some specific beam line shield designs for the Protein Crystallography Instrument. (author)
Directory of Open Access Journals (Sweden)
Changbin Sun
Full Text Available Human embryonic stem cells (hESCs have the potential to form any cell type in the body, making them attractive cell sources in drug screening, regenerative medicine, disease and developmental processes modeling. However, not all hESC lines have the equal potency to generate desired cell types in vitro. Significant variations have been observed for the differentiation efficiency of various human ESC lines. The precise underpinning molecular mechanisms are still unclear. In this work, we compared transcriptome variations of four hESC lines H7, HUES1, HUES8 and HUES9. We found that hESC lines have different gene expression profiles, and these differentially expressed genes (DEGs are significantly enriched in developmental processes, such as ectodermal, mesodermal and endodermal development. The enrichment difference between hESC lines was consistent with its lineage bias. Among these DEGs, some pluripotency factors and genes involved in signaling transduction showed great variations as well. The pleiotropic functions of these genes in controlling hESC identity and early lineage specification, implicated that different hESC lines may utilize distinct balance mechanisms to maintain pluripotent state. When the balance is broken in a certain environment, gene expression variation between them could impact on their different lineage specification behavior.
Universal FFM Hydrogen Spectral Line Shapes Applied to Ions and Electrons
Mossé, C.; Calisti, A.; Ferri, S.; Talin, B.; Bureyeva, L. A.; Lisitsa, V. S.
2008-10-01
We present a method for the calculation of hydrogen spectral line shapes based on two combined approaches: Universal Model and FFM procedure. We start with the analytical functions for the intensities of the Stark components of radiative transitions between highly excited atomic states with large values of principal quantum numbers n,n'γ1, with Δn = n-n'≪n for the specific cases of Hn-α line (Δn = 1) and Hn-β line (Δn = 2). The FFM line shape is obtained by averaging on the electric field of the Hooper's field distribution for ion and electron perturber dynamics and by mixing the Stark components with a jumping frequency rate ve (vi) where v = N1/3u (N is electron density and u is the ion or electron thermal velocity). Finally, the total line shape is given by convolution of ion and electron line shapes. Hydrogen line shape calculations for Balmer Hα and Hβ lines are compared to experimental results in low density plasma (Ne˜1016-1017cm-3) and low electron temperature in order of 10 000K. This method relying on analytic expressions permits fast calculation of Hn-α and Hn-β lines of hydrogen and could be used in the study of the Stark broadening of radio recombination lines for high principal quantum number.
Calling line managers in employee continuous professional development in South East Asia
Directory of Open Access Journals (Sweden)
Anubama Ramachandra
2011-11-01
Full Text Available Purpose: The paper aims to study the relationship of Line Managers’ (LMs Human Resource (HR role and its facets within employee’s Continuous Professional Development (CPD.Design/methodology/approach: A quantitative approach using 100 questionnaires were distributed to line managers in a South East Asia with a response rate of 87%.Findings: Results depict that LMs are actively involved in Strategic Partner, Employee Champion, and Change Agent roles. Study also shows that these three HR roles correlate with employee CPD. LMs’ are neither involved in Administrative Expert role, nor it correlates with employee Continuous Professional Development.Research limitations: Inability of the line managers to be fully involved with the four HR roles constraints the process of line manager deployment of HR roles specifically to employee CPD.Practical implications: Argues that the importance of strategic partner, employee champion, and change agent roles are the most important barrier and enabler of employee CPD, thus indirectly promoting organizational success and productivity.Social implications: Highlights the difficulties of managing organisations by getting the line managers directly involve in the development of employee CPD. Many line managers have to be made and given opportunities to develop their capabilities on this platform. Contends that HR can help an organization to succeed, provided that all line managers understand their roles, work together and take responsibility for their contribution. In addition is the adoption of the HR roles for the smooth delivery of HR functions which aligns with the overall organizational success.Originality/value: Specific HR roles are significant importance to the development of employee CPD within the setting of this South East Asian organization.
In vitro cytotoxicity of alpha conjugates for human pancreatic cancer cell lines
International Nuclear Information System (INIS)
Qu, C.; Li, Y.; Rizvi, M.A.; Allen, B.; Samra, J.; Smith, R.
2003-01-01
Targeted Alpha therapy (TAT) can inhibit the growth of micrometastases by selectively killing isolated and preangiogenic clusters of cancer cells. The aim of this study is to demonstrate the cytotoxicity of different alpha conjugates in vitro to human metastatic pancreatic cancer cell lines (CAPAN-1, CFPAN-1 and PANC-1). We are labeling the C595 and J591 (non-specific controls) monoclonal antibodies (Mabs) with 213 Bi were performed according to the standard methods in our laboratory. 213 Bi-C595 is specifically cytotoxic to CAPAN-1, CFPAN-1 and PANC-1cell lines in a concentration-dependent fashion. While non-specific alpha conjugates only killed very small fractions of pancreatic cancer cells. These alpha conjugates might be useful agents for the treatment of micro-metastases in pancreatic cancer patients with over-expression of the targeted receptors
On-Line Path Generation and Tracking for High-Speed Wheeled Autonomous Vehicles
2006-02-17
On-Line Path Generation and Tracking for High-Speed Wheeled Autonomous Vehicles Report Title ABSTRACT In this work we proposed two semi-analytic...298-102 Enclosure 1 On-Line Path Generation and Tracking for High-Speed Wheeled Autonomous Vehicles by...Specifically, the following problems will be addressed during this project: 2.1 Challenges The problem of trajectory planning for high-speed autonomous vehicles is
Line Manager Involvement in Work-Life Balance and Career Development: Can't Manage, Won't Manage?
Dick, Penny; Hyde, Rosie
2006-01-01
Line manager involvement in HRM is an increasing trend across Europe. With the numbers of employees taking advantage of work-life balance policies also on the increase, line manager responsibility for this specific policy area is likely to become more marked. In this paper, we argue that line managers have a critical role to play in the career…
A review on high-resolution CMOS delay lines: towards sub-picosecond jitter performance.
Abdulrazzaq, Bilal I; Abdul Halin, Izhal; Kawahito, Shoji; Sidek, Roslina M; Shafie, Suhaidi; Yunus, Nurul Amziah Md
2016-01-01
A review on CMOS delay lines with a focus on the most frequently used techniques for high-resolution delay step is presented. The primary types, specifications, delay circuits, and operating principles are presented. The delay circuits reported in this paper are used for delaying digital inputs and clock signals. The most common analog and digitally-controlled delay elements topologies are presented, focusing on the main delay-tuning strategies. IC variables, namely, process, supply voltage, temperature, and noise sources that affect delay resolution through timing jitter are discussed. The design specifications of these delay elements are also discussed and compared for the common delay line circuits. As a result, the main findings of this paper are highlighting and discussing the followings: the most efficient high-resolution delay line techniques, the trade-off challenge found between CMOS delay lines designed using either analog or digitally-controlled delay elements, the trade-off challenge between delay resolution and delay range and the proposed solutions for this challenge, and how CMOS technology scaling can affect the performance of CMOS delay lines. Moreover, the current trends and efforts used in order to generate output delayed signal with low jitter in the sub-picosecond range are presented.
Specification and Verification of Communication Protocols in AFFIRM Using State Transition Models.
1981-03-01
NewQueueOfftcket; theorem Pendnglnvariant, Remove(Pending(s)) = NewQueueOfPacket; Since the implementation is in keeping with the specification, its salp ...another communication line. The communication lines are unreliable; messages traveling in either direction can be lost, reordered, corrupted, or
Application of superconductors to motors, generators, and transmission lines
International Nuclear Information System (INIS)
Kirtley, J.L.
1989-01-01
Superconductors are of interest to the designers of electric power equipment because they can carry current without loss, currents that are large enough to make very intense magnetic fields. This means that superconductors, used in suitable applications, can make electric power equipment smaller, lighter, more efficient, and perhaps with better dynamic response. Two specific applications are considered here: electric machinery (motors and generators) and transmission lines. The so-called high-T c superconductors will have beneficial impact on motors, generators, and transmission lines only if conductors with sufficient mechanical properties and current-carrying capabilities can be developed
Energy Technology Data Exchange (ETDEWEB)
Wagt, R. van der; Vos, F. de [Skalar Analytical (Netherlands); Babichenko, S.; Poryvkina, L. [Institute of Ecology, Tallinn (Estonia)
1999-08-01
In many environmental applications decomposing the mixture of substances in the water into its various chemical ingredients, for subsequent analysis, is a very complicated task. The most productive approach to on-line diagnosis is to treat the object as an integral spectroscopic sample, characterized by certain specific Spectral Fluorescent Signatures (SFS). The SFS are recorded as a matrix of fluorescent intensity of organic compounds in water, in co-ordinates of excitation and emission spectra, providing a three-dimensional spectrum. Spectral windows of SFS are defined by fluorescent characteristics of basic groups of organic substances in the water sample. The novel Skalar Fluo Imager, based on this principle, is intended for the analysis of organic compounds in natural, domestic, and technological waters in an on-line mode. (orig.) [German] In vielen Umweltschutzanwendungen stellt die Auftrennung eines Substanzgemisches zum Zweck der Analyse eine sehr komplizierte Aufgabe dar. Ein erfolgversprechender Ansatz fuer eine on-line-Diagnostik besteht darin, das Objekt als integrale Spektroskopieprobe zu betrachten, die durch bestimmte spezifische Spektral-Fluoreszenz-Signaturen (SFS) charakterisiert wird. Diese werden als Fluoreszenz-Intensitaets-Matrix organischer Verbindungen in Wasser dargestellt, mit Anregungs- und Emissionsspektren als weiteren Koordinaten, wodurch ein dreidimensionales Spektrum entsteht. Spektrale Fenster der SFS sind definiert als Fluoreszenzcharakteristika von Funktionsgruppen organischer Substanzen in der Wasserprobe. Der auf diesem Prinzip basierende Skalar Fluo Imager ist fuer die on-line-Analyse organischer Bestandteile in natuerlichen, Haus- und technischen Waessern gedacht. (orig.)
Characterization of a human antigen specific helper factor
International Nuclear Information System (INIS)
Richardson, B.
1986-01-01
While antigen (Ag) specific helper factors have been characterized in mice, similar molecules have not been identified in humans. To characterize human antigen specific helper molecules, an IL-2 dependent tetanus toxoid (T.T.) reactive T cell line was fused with a 6-thioguanine resistant CEM line, and hybrids selected in medium containing hypoxanthine and azaserine. Hybrids were screened by culturing the cells with 35 S-Met then reacting the supernatants with T.T. or hepatitis vaccine immobilized on nitrocellulose. One hybrid, TT6BA-O, was identified which secreted a Met-containing molecule which bound T.T. but not hepatitis vaccine. Supernatants from TT6BA-O, but not the parent CEM line, when added to autologous peripheral blood mononuclear cells (PBMC's) stimulated secretion of T.T. specific antibodies (Abs). Specificity controls demonstrated that TT6BA-O supernatant did not induce antibodies to diphtheria toxoid, hepatitis vaccine or pneumococcal polysaccharide, and total immunoglobulin (lg) synthesis was minimally increased. In contrast, pokeweed mitogen stimulated significant lg synthesis as well as Ab's to pneumococcal polysaccharide and T.T. TT6BA-O supernatant induced anti-T.T.Ab's in autologous PBMC's but not PBMC's from 3 unrelated donors, suggesting that the activity of the helper factor is restricted, possibly by the MHC. The molecular weight of the helper factor was estimated at 100,000-150,000 by Sephacryl S-300 chromatography. Finally, the helper factor could be demonstrated to bind and elute from sephorose-immobilized T.T. and anti-DR antisera, but not anti-lg antisera or the T40/25 monoclonal antibody, which binds a nonpolymorphic determinant on the human T cell receptor. These results demonstrate that human Ag specific helper factors exist, bind antigen and bear class II MHC determinants
Third-line therapy in recurrent glioblastoma: is it another chance for bevacizumab?
Franceschi, Enrico; Lamberti, Giuseppe; Paccapelo, Alexandro; Di Battista, Monica; Genestreti, Giovenzio; Minichillo, Santino; Mura, Antonella; Bartolini, Stefania; Agati, Raffaele; Brandes, Alba A
2018-04-18
Standard glioblastoma therapy is long-lasting. Among second-line therapy, choices could be bevacizumab and nitrosoureas depending on National Agencies approval. There is no consensus on 3rd line therapy or clinical trials specifically designed for this setting. We reviewed our institutional database on all consecutive patients who received 3rd line therapy for glioblastoma. Data on 168 out of 1337 (12.6%) glioblastoma patients who underwent 3rd line therapy treatment were collected. Third line treatments were bevacizumab or chemotherapy (nitrosourea, temozolomide or carboplatin plus etoposide). Median progression free survival was 2.9 months and median survival time was 6.6 months from the start of 3rd line therapy. Bevacizumab significantly improved progression-free survival (4.7 vs. 2.6 months, p = .020) and survival from 3rd line start (8.0 vs. 6.0 months, p = .014) in respect to chemotherapy. Toxicity of grade ≥ 3 occurred in 13.7% of patients. In multivariate analysis, survival in 3rd line treatment depends on MGMT methylation (p = .006) and treatment with Bevacizumab (p = .011). Third line therapy in selected glioblastoma patients may be feasible and well tolerated. Bevacizumab improved outcome in 3rd line in respect to chemotherapy.
Cotter, P.F.; Ayoub, J.; Parmentier, H.K.
2005-01-01
Agglutination data from generations 8 through 19 indicate that bidirectional selection for specific SRBC antibody responses was successful in a line cross of ISA × Warren medium heavy layers. After 11 generations titers of the high SRBC selected line (H line) were nearly 1:32,000; those of the low
Configuration-specific kinetic theory applied to an ideal binary gas mixture.
Wiseman, Floyd L
2006-10-05
This paper is the second in a two-part series dealing with the configuration-specific analyses for molecular collision events of hard, spherical molecules at thermal equilibrium. The first paper analyzed a single-component system, and the reader is referred to it for the fundamental concepts. In this paper, the expressions for the configuration-specific collision frequencies and the average line-of-centers collision angles and speeds are derived for an ideal binary gas mixture. The analyses show that the average line-of-centers quantities are all dependent upon the ratio of the masses of the two components, but not upon molecular size. Of course, the configuration-specific collision frequencies do depend on molecular size. The expression for the overall binary collision frequency is a simple sum of the configuration-specific collision frequencies and is identical to the conventional expression.
Morley, Lara C; Tang, Thomas; Yasmin, Ephia; Norman, Robert J; Balen, Adam H
2017-11-29
Polycystic ovary syndrome (PCOS) is characterised by infrequent or absent ovulation, and high levels of androgens and insulin (hyperinsulinaemia). Hyperinsulinaemia occurs secondary to insulin resistance and is associated with increased risk of cardiovascular disease and diabetes mellitus. Insulin-sensitising agents such as metformin may be effective in treating PCOS-related anovulation. To evaluate the effectiveness and safety of insulin-sensitising drugs in improving reproductive and metabolic outcomes for women with PCOS undergoing ovulation induction. We searched the following databases from inception to January 2017: Cochrane Gynaecology and Fertility Group Specialised Register, CENTRAL, MEDLINE, Embase, PsycINFO and CINAHL. We searched registers of ongoing trials and reference lists from relevant studies. We included randomised controlled trials of insulin-sensitising drugs compared with placebo, no treatment, or an ovulation-induction agent for women with oligo and anovulatory PCOS. Two review authors independently assessed studies for eligibility and bias. Primary outcomes were live birth rate and gastrointestinal adverse effects. Secondary outcomes included other pregnancy outcomes, menstrual frequency and metabolic effects. We combined data to calculate pooled odds ratios (ORs) and 95% confidence intervals (CIs). We assessed statistical heterogeneity using the I 2 statistic and reported quality of the evidence for primary outcomes using GRADE methodology. We assessed the interventions metformin, clomiphene citrate, metformin plus clomiphene citrate, D-chiro-inositol, rosiglitazone and pioglitazone. We compared these with each other, placebo or no treatment. We included 48 studies (4451 women), 42 of which investigated metformin (4024 women). Evidence quality ranged from very low to moderate. Limitations were risk of bias (poor reporting of methodology and incomplete outcome data), imprecision and inconsistency. Metformin versus placebo or no treatment
Establishment and culture optimization of a new type of pituitary immortalized cell line
Energy Technology Data Exchange (ETDEWEB)
Kokubu, Yuko [Graduate School of Life and Environmental Sciences, The University of Tsukuba, Tsukuba, Ibaraki 305-8562 (Japan); Asashima, Makoto [Graduate School of Life and Environmental Sciences, The University of Tsukuba, Tsukuba, Ibaraki 305-8562 (Japan); Life Science Center of TARA, The University of Tsukuba, Ibaraki-ken 305-8577 (Japan); Kurisaki, Akira, E-mail: akikuri@hotmail.com [Graduate School of Life and Environmental Sciences, The University of Tsukuba, Tsukuba, Ibaraki 305-8562 (Japan); Biotechnology Research Institute for Drug Discovery, National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba, Ibaraki 305-8562 (Japan)
2015-08-07
The pituitary gland is a center of the endocrine system that controls homeostasis in an organism by secreting various hormones. The glandular anterior pituitary consists of five different cell types, each expressing specific hormones. However, their regulation and the appropriate conditions for their in vitro culture are not well defined. Here, we report the immortalization of mouse pituitary cells by introducing TERT, E6, and E7 transgenes. The immortalized cell lines mainly expressed a thyrotroph-specific thyroid stimulating hormone beta (Tshb). After optimization of the culture conditions, these immortalized cells proliferated and maintained morphological characteristics similar to those of primary pituitary cells under sphere culture conditions in DMEM/F12 medium supplemented with N2, B27, basic FGF, and EGF. These cell lines responded to PKA or PKC pathway activators and induced the expression of Tshb mRNA. Moreover, transplantation of the immortalized cell line into subcutaneous regions and kidney capsules of mice further increased Tshb expression. These results suggest that immortalization of pituitary cells with TERT, E6, and E7 transgenes is a useful method for generating proliferating cells for the in vitro analysis of pituitary regulatory mechanisms. - Highlights: • Mouse pituitary cell lines were immortalized by introducing TERT, E6, and E7. • The immortalized cell lines mainly expressed thyroid stimulating hormone beta. • The cell lines responded to PKA or PKC pathway activators, and induced Tshb.
Cernanská, Dana; Paoletti, Barbara; Králová-Hromadová, Ivica; Iorio, Raffaella; Cudeková, Patrícia; Milillo, Piermarino; Traversa, Donato
2009-03-09
Five horse farms located in eastern Slovakia were investigated for the presence of benzimidazole-resistant strongyles by faecal egg count reduction test and egg hatch assay. Coprocultures were prepared for each farm from faecal samples taken pre- and post-treatment and harvested larvae were molecularly examined with a Reverse Line Blot assay. Faecal egg count reduction values ranged from 0 to 52.5% and all farms were positive for benzimidazole-resistant cyathostomins. Seven benzimidazole-resistant cyathostomin species were molecularly identified on farms before and also after treatment. These data demonstrate that resistance to benzimidazoles is well established in cyathostomin populations from horse farms in the Slovak Republic and that the molecular assay was able to determine the species-specific distribution of resistant cyathostomins under field conditions.
Integrated Circuit Interconnect Lines on Lossy Silicon Substrate with Finite Element Method
Sarhan M. Musa,; Matthew N. O. Sadiku
2014-01-01
The silicon substrate has a significant effect on the inductance parameter of a lossy interconnect line on integrated circuit. It is essential to take this into account in determining the transmission line electrical parameters. In this paper, a new quasi-TEM capacitance and inductance analysis of multiconductor multilayer interconnects is successfully demonstrated using finite element method (FEM). We specifically illustrate the electrostatic modeling of single and coupled in...
SPHERE DAQ and off-line systems: implementation based on the qdpb system
International Nuclear Information System (INIS)
Isupov, A.Yu.
2003-01-01
Design of the on-line data acquisition (DAQ) system for the SPHERE setup (LHE, JINR) is described. SPHERE DAQ is based on the qdpb (Data Processing with Branchpoints) system and configurable experimental data and CAMAC hardware representations. Implementation of the DAQ and off-line program code, depending on the SPHERE setup's hardware layout and experimental data contents, is explained as well as software modules specific for such implementation
Monitoring cell line identity in collections of human induced pluripotent stem cells
Directory of Open Access Journals (Sweden)
Raquel Sarafian
2018-04-01
Full Text Available The ability to reprogram somatic cells into induced pluripotent stem cells (hiPSCs has led to the generation of large collections of cell lines from thousands of individuals with specific phenotypes, many of which will be shared among different research groups as invaluable tools for biomedical research. As hiPSC-based research involves extensive culture of many cell lines, the issue periodic cell line identification is particularly important to ensure that cell line identity remains accurate. Here we analyzed the different commercially available genotyping methods considering ease of in-house genotyping, cost and informativeness, and applied one of them in our workflow for hiPSC generation. We show that the chosen STR method was able to establish a unique DNA profile for each of the 35 individuals/hiPSC lines at the examined sites, as well as identify two discrepancies resulting from inadvertently exchanged samples. Our results highlight the importance of hiPSC line genotyping by an in-house method that allows periodic cell line identification and demonstrate that STR is a useful approach to supplement less frequent karyotyping and epigenetic evaluations. Keywords: Induced pluripotent stem cells, Genotyping, Cell line identification, Short tandem repeats, Quality control
FIMS Wavelength Calibration via Airglow Line Observations
Directory of Open Access Journals (Sweden)
Dae-Hee Lee
2004-12-01
Full Text Available Far-ultraviolet Imaging Spectrograph (FIMS is the main payload of the Korea's first scientific micro satellite STSAT-1, which was launched at Sep. 27 2003 successfully. Major objective of FIMS is observing hot gas in the Galaxy in FUV bands to diagnose the energy flow models of the interstellar medium. Supernova remnants, molecular clouds, and Aurora emission in the geomagnetic pole regions are specific targets for pointing observation. Although the whole system was calibrated before launch, it is essential to perform on-orbit calibration for data analysis. For spectral calibration, we observed airglow lines in the atmosphere since they provide good spectral references. We identify and compare the observed airglow lines with model calculations, and correct the spectral distortion appeared in the detector system to improve the spectral resolution of the system.
Exercise Regulation of Marrow Adipose Tissue
Directory of Open Access Journals (Sweden)
Gabriel M Pagnotti
2016-07-01
Full Text Available Despite association with low bone density and skeletal fractures, marrow adipose tissue (MAT remains poorly understood. The marrow adipocyte originates from the mesenchymal stem cell pool (MSC that gives rise also to osteoblasts, chondrocytes, and myocytes among other cell types. To date, the presence of MAT has been attributed to preferential biasing of MSC into the adipocyte rather than osteoblast lineage, thus negatively impacting bone formation. Here we focus on understanding the physiology of MAT in the setting of exercise, dietary interventions and pharmacologic agents that alter fat metabolism. The beneficial effect of exercise on musculoskeletal strength is known: exercise induces bone formation, encourages growth of skeletally-supportive tissues, inhibits bone resorption and alters skeletal architecture through direct and indirect effects on a multiplicity of cells involved in skeletal adaptation. MAT is less well studied due to the lack of reproducible quantification techniques. In recent work, osmium-based 3D quantification shows a robust response of MAT to both dietary and exercise intervention in that MAT is elevated in response to high fat diet and can be suppressed following daily exercise. Exercise-induced bone formation correlates with suppression of MAT, such that exercise effects might be due to either calorie expenditure from this depot, or from mechanical biasing of MSC lineage away from fat and toward bone, or a combination thereof. Following treatment with the anti-diabetes drug rosiglitazone - a PPARγ-agonist known to increase MAT and fracture risk - mice demonstrate a 5-fold higher femur MAT volume compared to the controls. In addition to preventing MAT accumulation in control mice, exercise intervention significantly lowers MAT accumulation in rosiglitazone-treated mice. Importantly, exercise induction of trabecular bone volume is unhindered by rosiglitazone. Thus, despite rosiglitazone augmentation of MAT, exercise
Directory of Open Access Journals (Sweden)
Kyoung Min Kim
2017-09-01
Full Text Available BackgroundBone strength is impaired in patients with type 2 diabetes mellitus despite an increase in bone mineral density (BMD. Thiazolidinedione (TZD, a peroxisome proliferator activated receptor γ agonist, promotes adipogenesis, and suppresses osteoblastogenesis. Therefore, its use is associated with an increased risk of fracture. The aim of this study was to examine the in vitro and in vivo effects of lobeglitazone, a new TZD, on bone.MethodsMC3T3E1 and C3H10T1/2 cells were cultured in osteogenic medium and exposed to lobeglitazone (0.1 or 1 µM, rosiglitazone (0.4 µM, or pioglitazone (1 µM for 10 to 14 days. Alkaline phosphatase (ALP activity, Alizarin red staining, and osteoblast marker gene expression were analyzed. For in vivo experiments, 6-month-old C57BL/6 mice were treated with vehicle, one of two doses of lobeglitazone, rosiglitazone, or pioglitazone. BMD was assessed using a PIXImus2 instrument at the baseline and after 12 weeks of treatment.ResultsAs expected, in vitro experiments showed that ALP activity was suppressed and the mRNA expression of osteoblast marker genes RUNX2 (runt-related transcription factor 2 and osteocalcin was significantly attenuated after rosiglitazone treatment. By contrast, lobeglitazone at either dose did not inhibit these variables. Rosiglitazone-treated mice showed significantly accelerated bone loss for the whole bone and femur, but BMD did not differ significantly between the lobeglitazone-treated and vehicle-treated mice.ConclusionThese findings suggest that lobeglitazone has no detrimental effects on osteoblast biology and might not induce side effects in the skeletal system.
Bragdon, Beth; Burns, Robert; Baker, Amelia H; Belkina, Anna C; Morgan, Elise F; Denis, Gerald V; Gerstenfeld, Louis C; Schlezinger, Jennifer J
2015-02-01
Bone formation and aging are sexually dimorphic. Yet, definition of the intrinsic molecular differences between male and female multipotent mesenchymal stromal cells (MSCs) in bone is lacking. This study assessed sex-linked differences in MSC differentiation in 3-, 6-, and 9-month-old C57BL/6J mice. Analysis of tibiae showed that female mice had lower bone volume fraction and higher adipocyte content in the bone marrow compared to age-matched males. While both males and females lost bone mass in early aging, the rate of loss was higher in males. Similar expression of bone- and adipocyte-related genes was seen in males and females at 3 and 9 months, while at 6 months, females exhibited a twofold greater expression of these genes. Under osteogenic culture conditions, bone marrow MSCs from female 3- and 6-month-old mice expressed similar levels of bone-related genes, but significantly greater levels of adipocyte-related genes, than male MSCs. Female MSCs also responded to rosiglitazone-induced suppression of osteogenesis at a 5-fold lower (10 nM) concentration than male MSCs. Female MSCs grown in estrogen-stripped medium showed similar responses to rosiglitazone as MSCs grown in serum containing estrogen. MSCs from female mice that had undergone ovariectomy before sexual maturity also were sensitive to rosiglitazone-induced effects on osteogenesis. These results suggest that female MSCs are more sensitive to modulation of differentiation by PPARγ and that these differences are intrinsic to the sex of the animal from which the MSCs came. These results also may explain the sensitivity of women to the deleterious effects of rosiglitazone on bone. © 2014 Wiley Periodicals, Inc.
International Nuclear Information System (INIS)
Crosswell, Hal E; Dasgupta, Anindya; Alvarado, Carlos S; Watt, Tanya; Christensen, James G; De, Pradip; Durden, Donald L; Findley, Harry W
2009-01-01
c-Met is a tyrosine kinase receptor for hepatocyte growth factor/scatter factor (HGF/SF), and both c-Met and its ligand are expressed in a variety of tissues. C-Met/HGF/SF signaling is essential for normal embryogenesis, organogenesis, and tissue regeneration. Abnormal c-Met/HGF/SF signaling has been demonstrated in different tumors and linked to aggressive and metastatic tumor phenotypes. In vitro and in vivo studies have demonstrated inhibition of c-Met/HGF/SF signaling by the small-molecule inhibitor PHA665752. This study investigated c-Met and HGF expression in two neuroblastoma (NBL) cell lines and tumor tissue from patients with NBL, as well as the effects of PHA665752 on growth and motility of NBL cell lines. The effect of the tumor suppressor protein PTEN on migration and proliferation of tumor cells treated with PHA665752 was also evaluated. Expression of c-Met and HGF in NBL cell lines SH-EP and SH-SY5Y and primary tumor tissue was assessed by immunohistochemistry and quantitative RT-PCR. The effect of PHA665752 on c-Met/HGF signaling involved in NBL cell proliferation and migration was evaluated in c-Met-positive cells and c-Met-transfected cells. The transwell chemotaxis assay and the MTT assay were used to measure migration and proliferation/cell-survival of tumor cells, respectively. The PPAR-γ agonist rosiglitazone was used to assess the effect of PTEN on PHA665752-induced inhibition of NBL cell proliferation/cell-survival and migration High c-Met expression was detected in SH-EP cells and primary tumors from patients with advanced-stage disease. C-Met/HGF signaling induced both migration and proliferation of SH-EP cells. Migration and proliferation/cell-survival were inhibited by PHA665752 in a dose-dependent manner. We also found that induced overexpression of PTEN following treatment with rosiglitazone significantly enhanced the inhibitory effect of PHA665752 on NBL-cell migration and proliferation. c-Met is highly expressed in most tumors from
Directory of Open Access Journals (Sweden)
Laura W. Engstrom
2010-01-01
Full Text Available The kinetics of metabolic and inflammatory parameters associated with obesity were evaluated in a murine diet-induced obesity (DIO model using a diet high in fat and cholesterol. Cellular infiltration and mediator production were assessed and shown to be therapeutically modulated by the PPARgamma agonist rosiglitazone. C57BL/6 mice were maintained on a 45% fat/0.12% cholesterol (HF/CH or Chow diet for 3, 6, 16, or 27 weeks. Flow cytometry was employed to monitor peripheral blood monocytes and adipose tissue macrophages (ATM. Gene expression and protein analysis methods were used to evaluate mediator production from total epididymal fat (EF, stromal vascular fraction (SVF, and sorted SVF cells. To investigate therapeutic intervention, mice were fed a HF/CH diet for 12 weeks and then a diet formulated with rosiglitazone (5 mg/kg for an additional 6 weeks. A HF/CH diet correlated with obesity and a dramatic proinflammatory state. Therapeutic intervention with rosiglitazone attenuated the HF/CH induced inflammation. In addition, a novel population was found that expressed the highest levels of the pro-inflammatory mediators CCL2 and IL-6.
Energy Technology Data Exchange (ETDEWEB)
Bhattarai, Bishnu P.; Gentle, Jake P.; Hill, Porter; McJunkin, Tim; Myers, Kurt S.; Abbound, Alex; Renwick, Rodger; Hengst, David
2017-07-01
Abstract—Overhead transmission lines (TLs) are conventionally given seasonal ratings based on conservative environmental assumptions. Such an approach often results in underutilization of the line ampacity as the worst conditions prevail only for a short period over a year/season. We presents dynamic line rating (DLR) as an enabling smart grid technology that adaptively computes ratings of TLs based on local weather conditions to utilize additional headroom of existing lines. In particular, general line ampacity state solver utilizes measured weather data for computing the real-time thermal rating of the TLs. The performance of the presented method is demonstrated from a field study of DLR technology implementation on four TL segments at AltaLink, Canada. The performance is evaluated and quantified by comparing the existing static and proposed dynamic line ratings, and the potential benefits of DLR for enhanced transmission assets utilization. For the given line segments, the proposed DLR results in real-time ratings above the seasonal static ratings for most of the time; up to 95.1% of the time, with a mean increase of 72% over static rating.
Cell type-specific roles of Jak3 in IL-2-induced proliferative signal transduction
International Nuclear Information System (INIS)
Fujii, Hodaka
2007-01-01
Binding of interleukin-2 (IL-2) to its specific receptor induces activation of two members of Jak family protein tyrosine kinases, Jak1 and Jak3. An IL-2 receptor (IL-2R)-reconstituted NIH 3T3 fibroblast cell line proliferates in response to IL-2 only when hematopoietic lineage-specific Jak3 is ectopically expressed. However, the mechanism of Jak3-dependent proliferation in the fibroblast cell line is not known. Here, I showed that Jak3 expression is dispensable for IL-2-induced activation of Jak1 and Stat proteins and expression of nuclear proto-oncogenes in the IL-2R-reconstituted fibroblast cell line. Jak3 expression markedly enhanced these IL-2-induced signaling events. In contrast, Jak3 expression was essential for induction of cyclin genes involved in the G1-S transition. These data suggest a critical role of Jak3 in IL-2 signaling in the fibroblast cell line and may provide further insight into the cell type-specific mechanism of cytokine signaling
Cell type-specific roles of Jak3 in IL-2-induced proliferative signal transduction
Fujii, Hodaka
2007-01-01
Binding of IL-2 to its specific receptor induces activation of two members of Jak family protein tyrosine kinases, Jak1 and Jak3. An IL-2R-reconstituted NIH 3T3 fibroblast cell line proliferates in response to IL-2 only when hematopoietic lineage-specific Jak3 is ectopically expressed. However, the mechanism of Jak3-dependent proliferation in the fibroblast cell line is not known. Here, I showed that Jak3 expression is dispensable for IL-2-induced activation of Jak1 and Stat proteins and expression of nuclear proto-oncogenes in the IL-2R-reconstituted fibroblast cell line. However, Jak3 expression markedly enhanced these IL-2-induced signaling events. In contrast, Jak3 expression was essential for induction of cyclin genes involved in the G1-S transition. These data suggest a critical role of Jak3 in IL-2 signaling in the fibroblast cell line and may provide further insight into the cell type-specific mechanism of cytokine signaling. PMID:17266928
Precise ion optical description of strip-line pulsed magnetic lenses
International Nuclear Information System (INIS)
Varentsov, D.; Spiller, P.; Eickhoff, H.; Hoffmann, D.H.H.
2002-01-01
A specific computer code has been developed to investigate ion optical properties of a new generation of pulsed strip-line high current magnets. The code is based on a modern 'Differential Algebra' computational technique and it is able to calculate transfer matrices of pulsed strip-line magnets up to arbitrary order. The realistic three-dimensional distribution of the magnetic field in pulsed lenses as well as all the fringing field effects are taken into account in the simulations. We have demonstrated, that for precise description of such magnets one cannot use the existing ion optical codes where ideal multipole field distributions and fringing fields, typical for conventional iron-dominated magnets are assumed. The transfer matrix elements of pulsed strip-line lenses differ significantly from those of conventional magnets, especially in higher orders
Electric and magnetic field reduction by alternative transmission line options
Energy Technology Data Exchange (ETDEWEB)
Stewart, J.R. (Power Technologies, Inc., Schenectady, NY (United States)); Dale, S.J. (Oak Ridge National Lab., TN (United States)); Klein, K.W. (Energetics, Inc., Columbia, MD (United States))
1991-01-01
Ground level electric, and more recently magnetic, fields from overhead power transmission lines are increasingly important considerations in right of way specification, with states setting or planning to set edge of right of way limits. Research has been conducted in high phase order power transmission wherein six of twelve phases are used to transmit power in less physical space and with reduced electrical environmental effects than conventional designs. The first magnetic field testing, as reported in this paper, has verified predictive methods for determination of magnetic fields from high phase order lines. Based on these analytical methods, field profiles have been determined for lines of different phase order of comparable power capacity. Potential advantages of high phase order as a means of field mitigation are discussed. 10 refs., 12 figs., 3 tabs.
International Nuclear Information System (INIS)
Kamien, R.D.
1992-01-01
This thesis is devoted to the study of ensembles of dense directed lines. These lines are principally to be thought of as polymers, though they also have the morphology of flux lines in high temperature superconductors, strings of colloidal spheres in electrorheological fluids and the world lines of quantum mechanical bosons. The authors discuss how directed polymer melts, string-like formations in electrorheological and ferro-fluids, flux lines in high temperature superconductors and the world lines of quantum mechanical bosons all share similar descriptions. They study a continuous transition in all of these systems, and then study the critical mixing properties of binary mixtures of directed polymers through the renormalization group. They predict the exponents for a directed polymer blend consolute point and a novel two-phase superfluid liquid-gas critical point
Cook Inlet and Kenai Peninsula, Alaska ESI: RIPS (Rip Current Lines)
National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains locations of rip currents in Cook Inlet, Alaska. Vector lines in the data set represent rip zone locations. Location-specific type and source...
Cook Inlet and Kenai Peninsula, Alaska ESI: ICE (Ice Extent Lines)
National Oceanic and Atmospheric Administration, Department of Commerce — This data set contains locations of ice extent in Cook Inlet, Alaska. Vector lines in the data set represent 50 percent ice coverage. Location-specific type and...
Wp specific methylation of highly proliferated LCLs
International Nuclear Information System (INIS)
Park, Jung-Hoon; Jeon, Jae-Pil; Shim, Sung-Mi; Nam, Hye-Young; Kim, Joon-Woo; Han, Bok-Ghee; Lee, Suman
2007-01-01
The epigenetic regulation of viral genes may be important for the life cycle of EBV. We determined the methylation status of three viral promoters (Wp, Cp, Qp) from EBV B-lymphoblastoid cell lines (LCLs) by pyrosequencing. Our pyrosequencing data showed that the CpG region of Wp was methylated, but the others were not. Interestingly, Wp methylation was increased with proliferation of LCLs. Wp methylation was as high as 74.9% in late-passage LCLs, but 25.6% in early-passage LCLs. From two Burkitt's lymphoma cell lines, Wp specific hypermethylation was also found (>80%). Interestingly, the expression of EBNA2 gene which located directly next to Wp was associated with its methylation. Our data suggested that Wp specific methylation may be important for the indicator of the proliferation status of LCLs, and the epigenetic viral gene regulation of EBNA2 gene by Wp should be further defined possibly with other biological processes
Directory of Open Access Journals (Sweden)
Marcos R H Estécio
2007-05-01
Full Text Available Alterations in DNA methylation in cancer include global hypomethylation and gene-specific hypermethylation. It is not clear whether these two epigenetic errors are mechanistically linked or occur independently. This study was performed to determine the relationship between DNA hypomethylation, hypermethylation and microsatellite instability in cancer.We examined 61 cancer cell lines and 60 colorectal carcinomas and their adjacent tissues using LINE-1 bisulfite-PCR as a surrogate for global demethylation. Colorectal carcinomas with sporadic microsatellite instability (MSI, most of which are due to a CpG island methylation phenotype (CIMP and associated MLH1 promoter methylation, showed in average no difference in LINE-1 methylation between normal adjacent and cancer tissues. Interestingly, some tumor samples in this group showed increase in LINE-1 methylation. In contrast, MSI-showed a significant decrease in LINE-1 methylation between normal adjacent and cancer tissues (P<0.001. Microarray analysis of repetitive element methylation confirmed this observation and showed a high degree of variability in hypomethylation between samples. Additionally, unsupervised hierarchical clustering identified a group of highly hypomethylated tumors, composed mostly of tumors without microsatellite instability. We extended LINE-1 analysis to cancer cell lines from different tissues and found that 50/61 were hypomethylated compared to peripheral blood lymphocytes and normal colon mucosa. Interestingly, these cancer cell lines also exhibited a large variation in demethylation, which was tissue-specific and thus unlikely to be resultant from a stochastic process.Global hypomethylation is partially reversed in cancers with microsatellite instability and also shows high variability in cancer, which may reflect alternative progression pathways in cancer.
Warth, Benedikt; Rajkai, György; Mandenius, Carl-Fredrik
2010-05-03
Software sensors for monitoring and on-line estimation of critical bioprocess variables have mainly been used with standard bioreactor sensors, such as electrodes and gas analyzers, where algorithms in the software model have generated the desired state variables. In this article we propose that other on-line instruments, such as NIR probes and on-line HPLC, should be used to make more reliable and flexible software sensors. Five software sensor architectures were compared and evaluated: (1) biomass concentration from an on-line NIR probe, (2) biomass concentration from titrant addition, (3) specific growth rate from titrant addition, (4) specific growth rate from the NIR probe, and (5) specific substrate uptake rate and by-product rate from on-line HPLC and NIR probe signals. The software sensors were demonstrated on an Escherichia coli cultivation expressing a recombinant protein, green fluorescent protein (GFP), but the results could be extrapolated to other production organisms and product proteins. We conclude that well-maintained on-line instrumentation (hardware sensors) can increase the potential of software sensors. This would also strongly support the intentions with process analytical technology and quality-by-design concepts. 2010 Elsevier B.V. All rights reserved.
Identifying anti-growth factors for human cancer cell lines through genome-scale metabolic modeling
DEFF Research Database (Denmark)
Ghaffari, Pouyan; Mardinoglu, Adil; Asplund, Anna
2015-01-01
Human cancer cell lines are used as important model systems to study molecular mechanisms associated with tumor growth, hereunder how genomic and biological heterogeneity found in primary tumors affect cellular phenotypes. We reconstructed Genome scale metabolic models (GEMs) for eleven cell lines...... based on RNA-Seq data and validated the functionality of these models with data from metabolite profiling. We used cell line-specific GEMs to analyze the differences in the metabolism of cancer cell lines, and to explore the heterogeneous expression of the metabolic subsystems. Furthermore, we predicted...... for inhibition of cell growth may provide leads for the development of efficient cancer treatment strategies....
Directory of Open Access Journals (Sweden)
van Esbroeck Marjan
2010-07-01
Full Text Available Abstract Background Most malaria rapid diagnostic tests (RDTs detect Plasmodium falciparum and an antigen common to the four species. Plasmodium vivax-specific RDTs target P. vivax-specific parasite lactate dehydrogenase (Pv-pLDH. Previous observations of false positive Pv-pLDH test lines in P. falciparum samples incited to the present study, which assessed P. vivax-specific RDTs for the occurrence of false positive Pv-pLDH lines in P. falciparum samples. Methods Nine P. vivax-specific RDTs were tested with 85 P. falciparum samples of high (≥2% parasite density. Mixed P. falciparum/P. vivax infections were ruled out by real-time PCR. The RDTs included two-band (detecting Pv-pLDH, three-band (detecting P. falciparum-antigen and Pv-pLDH and four-band RDTs (detecting P. falciparum, Pv-pLDH and pan-pLDH. Results False positive Pv-pLDH lines were observed in 6/9 RDTs (including two- three- and four-band RDTs. They occurred in the individual RDT brands at frequencies ranging from 8.2% to 29.1%. For 19/85 samples, at least two RDT brands generated a false positive Pv-pLDH line. Sixteen of 85 (18.8% false positive lines were of medium or strong line intensity. There was no significant relation between false positive results and parasite density or geographic origin of the samples. Conclusion False positive Pv-pLDH lines in P. falciparum samples with high parasite density occurred in 6/9 P. vivax-specific RDTs. This is of concern as P. falciparum and P. vivax are co-circulating in many regions. The diagnosis of life-threatening P. falciparum malaria may be missed (two-band Pv-pLDH RDT, or the patient may be treated incorrectly with primaquine (three- or four-band RDTs.
Straight-Line Target Tracking for Unmanned Surface Vehicles
Directory of Open Access Journals (Sweden)
Morten Breivik
2008-10-01
Full Text Available This paper considers the subject of straight-line target tracking for unmanned surface vehicles (USVs. Target-tracking represents motion control scenarios where no information about the target behavior is known in advance, i.e., the path that the target traverses is not defined apriori. Specifically, this work presents the design of a motion control system which enables an underactuated USV to track a target that moves in a straight line at high speed. The motion control system employs a guidance principle originally developed for interceptor missiles, as well as a novel velocity controller inspired by maneuverability and agility concepts found in fighter aircraft literature. The performance of the suggested design is illustrated through full-scale USV experiments in the Trondheimsfjord.
Modular production line optimization: The exPLORE architecture
Directory of Open Access Journals (Sweden)
Spinellis Diomidis D.
2000-01-01
Full Text Available The general design problem in serial production lines concerns the allocation of resources such as the number of servers, their service rates, and buffers given production-specific constraints, associated costs, and revenue projections. We describe the design of exPLOre: a modular, object-oriented, production line optimization software architecture. An abstract optimization module can be instantiated using a variety of stochastic optimization methods such as simulated annealing and genetic algorithms. Its search space is constrained by a constraint checker while its search direction is guided by a cost analyser which combines the output of a throughput evaluator with the business model. The throughput evaluator can be instantiated using Markovian, generalised queueing network methods, a decomposition, or an expansion method algorithm.
Emission line galaxies and active galactic nuclei in WINGS clusters
Marziani, P.; D'Onofrio, M.; Bettoni, D.; Poggianti, B. M.; Moretti, A.; Fasano, G.; Fritz, J.; Cava, A.; Varela, J.; Omizzolo, A.
2017-03-01
We present the analysis of the emission line galaxies members of 46 low-redshift (0.04 employing diagnostic diagrams. We examined the emission line properties and frequencies of star-forming galaxies, transition objects, and active galactic nuclei (AGNs: LINERs and Seyferts), unclassified galaxies with emission lines, and quiescent galaxies with no detectable line emission. A deficit of emission line galaxies in the cluster environment is indicated by both a lower frequency, and a systematically lower Balmer emission line equivalent width and luminosity with respect to control samples; this implies a lower amount of ionized gas per unit mass and a lower star formation rate if the source is classified as Hii region. A sizable population of transition objects and of low-luminosity LINERs (≈ 10-20% of all emission line galaxies) are detected among WINGS cluster galaxies. These sources are a factor of ≈1.5 more frequent, or at least as frequent, as in control samples with respect to Hii sources. Transition objects and LINERs in clusters are most affected in terms ofline equivalent width by the environment and appear predominantly consistent with so-called retired galaxies. Shock heating can be a possible gas excitation mechanism that is able to account for observed line ratios. Specific to the cluster environment, we suggest interaction between atomic and molecular gas and the intracluster medium as a possible physical cause of line-emitting shocks. The data whose description is provided in Table B.1, and emission line catalog of the WINGS database are only available at the CDS via anonymous ftp to http://cdsarc.u-strasbg.fr (http://130.79.128.5) or via http://cdsarc.u-strasbg.fr/viz-bin/qcat?J/A+A/599/A83
Several key issues on implementing delay line based TDCs using FPGAs
International Nuclear Information System (INIS)
Wu, Jinyuan
2009-01-01
Several topics in FPGA delay line based TDCs are discussed in this document. First, FPGA specific issues such as considerations on the delay line choice in different FPGA families, Wave Union Launchers, 'bubble proof' encoding logic, etc. are examined. Next, common problems for both FPGA TDCs and ASIC TDCs such as schemes of coarse time counter implementation, bin-by-bin calibration and noise issues due to single ended signals are discussed. Several resource/power saving design approaches for various processing stages are described in the document.
Thiazolidinediones abrogate cervical cancer growth
Energy Technology Data Exchange (ETDEWEB)
Wuertz, Beverly R., E-mail: knier003@umn.edu; Darrah, Lindsay, E-mail: ldarrah@obgynmn.com; Wudel, Justin, E-mail: drwudel@drwudel.com; Ondrey, Frank G., E-mail: ondre002@umn.edu
2017-04-15
Peroxisome proliferator-activated receptor gamma (PPAR γ) is activated by thiazolidinedione drugs (TZDs) and can promote anti-cancer properties. We used three TZDs (pioglitazone, rosiglitazone, and ciglitazone) to target cervical cancer cell lines and a nude mouse animal model. Each agent increased activation of PPAR γ, as judged by a luciferase reporter gene assay in three HPV-associated cell lines (CaSki, SiHa, and HeLa cells) while decreasing cellular proliferation in a dose-dependent manner. They also promoted Oil Red O accumulation in treated cell lines and upregulated the lipid differentiation marker adipsin. Interestingly, xenograft HeLa tumors in nude mice treated with 100 mg/kg/day pioglitazone exhibited decreased growth compared to control mice or mice treated with standard cervical chemotherapy. In conclusion, TZDs slow tumor cell growth in vitro and in vivo with decreases in cell proliferation and increases in PPAR γ and adipsin. These agents may be interesting treatments or treatment adjuncts for HPV-associated cancers or perhaps even precancerous conditions. - Highlights: • Thiazolidinediones decreases cervical cancer proliferation. • Pioglitazone increases cervical cancer differentiation. • Pioglitazone decreases tumor growth in mice. • Pioglitazone may be a useful treatment adjunct.
PPARγ-independent induction of growth arrest and apoptosis in prostate and bladder carcinoma
International Nuclear Information System (INIS)
Chaffer, Christine L; Thomas, David M; Thompson, Erik W; Williams, Elizabeth D
2006-01-01
Although PPARγ antagonists have shown considerable pre-clinical efficacy, recent studies suggest PPARγ ligands induce PPARγ-independent effects. There is a need to better define such effects to permit rational utilization of these agents. We have studied the effects of a range of endogenous and synthetic PPARγ ligands on proliferation, growth arrest (FACS analysis) and apoptosis (caspase-3/7 activation and DNA fragmentation) in multiple prostate carcinoma cell lines (DU145, PC-3 and LNCaP) and in a series of cell lines modelling metastatic transitional cell carcinoma of the bladder (TSU-Pr1, TSU-Pr1-B1 and TSU-Pr1-B2). 15-deoxy-prostaglandin J 2 (15dPGJ2), troglitazone (TGZ) and to a lesser extent ciglitazone exhibited inhibitory effects on cell number; the selective PPARγ antagonist GW9662 did not reverse these effects. Rosiglitazone and pioglitazone had no effect on proliferation. In addition, TGZ induced G0/G1 growth arrest whilst 15dPGJ2 induced apoptosis. Troglitazone and 15dPGJ2 inhibit growth of prostate and bladder carcinoma cell lines through different mechanisms and the effects of both agents are PPARγ-independent
The Local Helium Compound Transfer Lines for the Large Hadron Collider Cryogenic System
Parente, C; Munday, A; Wiggins, P
2006-01-01
The cryogenic system for the Large Hadron Collider (LHC) under construction at CERN will include twelve new local helium transfer lines distributed among five LHC points in underground caverns. These lines, being manufactured and installed by industry, will connect the cold boxes of the 4.5-K refrigerators and the 1.8-K refrigeration units to the cryogenic interconnection boxes. The lines have a maximum of 30-m length and may possess either small or large re-distribution units to allow connection to the interface ports. Due to space restrictions the lines may have complex routings and require several elbowed sections. The lines consist of a vacuum jacket, a thermal shield and either three or four helium process pipes. Specific internal and external supporting and compensation systems were designed for each line to allow for thermal contraction of the process pipes (or vacuum jacket, in case of a break in the insulation vacuum) and to minimise the forces applied to the interface equipment. Whenever possible, f...
On Estimation of Contamination from Hydrogen Cyanide in Carbon Monoxide Line-intensity Mapping
Energy Technology Data Exchange (ETDEWEB)
Chung, Dongwoo T.; Li, Tony Y.; Viero, Marco P.; Church, Sarah E.; Wechsler, Risa H., E-mail: dongwooc@stanford.edu [Kavli Institute for Particle Astrophysics and Cosmology, Physics Department, Stanford University, Stanford, CA 94305 (United States)
2017-09-01
Line-intensity mapping surveys probe large-scale structure through spatial variations in molecular line emission from a population of unresolved cosmological sources. Future such surveys of carbon monoxide line emission, specifically the CO(1-0) line, face potential contamination from a disjointed population of sources emitting in a hydrogen cyanide emission line, HCN(1-0). This paper explores the potential range of the strength of HCN emission and its effect on the CO auto power spectrum, using simulations with an empirical model of the CO/HCN–halo connection. We find that effects on the observed CO power spectrum depend on modeling assumptions but are very small for our fiducial model, which is based on current understanding of the galaxy–halo connection. Given the fiducial model, we expect the bias in overall CO detection significance due to HCN to be less than 1%.
Directory of Open Access Journals (Sweden)
Vineet Mehta
2017-06-01
Full Text Available Neuropathy is the least understood and most devastating complication associated with diabetes. Diabetic neuropathy develops in patients despite of regular therapy, indicating that marketed drugs has minimal effect on pathways leading to the development and progression of these complications. Present study was aimed to evaluate natural compounds for their ability to interfere with pathways leading to the development of diabetes mediated neurological complications and compare their efficacy with marketed anti-diabetic drugs. Anti-diabetic potential of ascorbic acid, gallic acid, quercetin, ellagic acid, cinnamic acid, caffeine and piperine was predicted by evaluating in-silico interaction energy (kcal/mol of these compounds with insulin receptor, peroxisome proliferator-activated receptor gamma-γ and dipeptidyl peptidase-4 proteins. Ascorbic acid, gallic acid, quercetin and ellagic acid showed excellent in-vitro antioxidant activity in DPPH radical scavenging and inhibition of lipid peroxidation assay, which was 1.5–3 folds better than the marketed drugs. Quercetin, gallic acid, cinnamic acid, piperine and caffeine efficiently prevented H2O2 induced genotoxicity, which commercial drugs failed to prevent. Further, quercetin, ellagic acid, caffeine and ascorbic acid were 3–4.7 folds better than marketed drugs in inhibiting α-amylase activity. Herbal molecules and rosiglitazone showed comparable results for glucose uptake, which may be attributed to enhanced GLUT4 translocation into primary neuronal culture under hyperglycemic conditions. In conclusion, currently available marketed anti-diabetic drugs have minimal effect on the pathways leading to diabetic neuropathy and supplementing diabetic therapeutics with quercetin, ascorbic acid, caffeine and ellagic acid may be better suited to counter diabetic neuropathy through inhibiting oxidative stress, genotoxicity and improving neuronal glucose utilization.
Membrane-associated signaling in human B-lymphoma lines
Energy Technology Data Exchange (ETDEWEB)
Tauzin, Sebastien; Ding, Heidrun; Burdevet, Dimitri [Department of Pathology and Immunology, Centre medical universitaire, 1, rue Michel-Servet, 1211 Geneva 11 (Switzerland); Borisch, Bettina [Department of Social and Preventive Medicine, Centre medical universitaire, 1, rue Michel-Servet, 1211 Geneva 11 (Switzerland); Hoessli, Daniel C., E-mail: danielhoessli@gmail.com [Department of Pathology and Immunology, Centre medical universitaire, 1, rue Michel-Servet, 1211 Geneva 11 (Switzerland)
2011-01-15
In B-non-Hodgkin lymphomas, Lyn and Cbp/PAG constitute the core of an oncogenic signalosome that captures the Phosphatidylinositol-3-kinase, the Spleen tyrosine kinase and the Signal transducer and activator of transcription-3 to generate pro-survival and proliferative signals. Lymphoma lines corresponding to follicular, mantle-cell and Burkitt-derived lymphomas display type-specific signalosome organizations that differentially activate PI3K, Syk and STAT3. In the follicular lymphoma line, PI3K, Syk and STAT3 were optimally activated upon association with the Lyn-Cbp/PAG signalosome, while in the Burkitt lymphoma-derived line, the association with Cbp/PAG and activation of PI3K were interfered with by the latent membrane proteins encoded by the Epstein-Barr virus. In the Jeko-1 mantle-cell line, a weak association of Syk with the Lyn-Cbp/PAG signalosome resulted in poor activation of Syk, but in those cells, as in the follicular and Burkitt-derived lines, efficient apoptosis induction by the Syk inhibitor R406 indicated that Syk is nonetheless an important prosurvival element and therefore a valuable therapeutic target. In all configurations described herein is the Lyn-Cbp/PAG signalosome independent of external signals and provides efficient means of activation for its associated lipid and protein kinases. In follicular and Burkitt-derived lines, Syk appears to be activated following binding to Cbp/PAG and no longer requires B-cell receptor-associated activation motifs for activation. Assessment of the different modalities of Lyn-Cbp/PAG signalosome organization could help in selecting the appropriate combination of kinase inhibitors to eliminate a particular type of lymphoma cells.
HB-Line Plutonium Oxide Data Collection Strategy
Energy Technology Data Exchange (ETDEWEB)
Watkins, R. [Savannah River Nuclear Solutions; Varble, J. [Savannah River Nuclear Solutions; Jordan, J. [Savannah River Nuclear Solutions
2015-05-26
identifies the required facility procedures, DCS print outs, and laboratory results needed to assemble a final data package for each HB-Line plutonium oxide interim oxide can. The data traveler may identify the specific values (data) required to be extracted from the collected facility procedures and DCS print outs. The data traveler may also identify associated criteria to be checked. Inevitably there will be procedure anomalies during the course of the HB-Line plutonium oxide campaign that will have to be addressed in a timely manner.
Ao, Lu; Guo, You; Song, Xuekun; Guan, Qingzhou; Zheng, Weicheng; Zhang, Jiahui; Huang, Haiyan; Zou, Yi; Guo, Zheng; Wang, Xianlong
2017-11-01
Concerns are raised about the representativeness of cell lines for tumours due to the culture environment and misidentification. Liver is a major metastatic destination of many cancers, which might further confuse the origin of hepatocellular carcinoma cell lines. Therefore, it is of crucial importance to understand how well they can represent hepatocellular carcinoma. The HCC-specific gene pairs with highly stable relative expression orderings in more than 99% of hepatocellular carcinoma but with reversed relative expression orderings in at least 99% of one of the six types of cancer, colorectal carcinoma, breast carcinoma, non-small-cell lung cancer, gastric carcinoma, pancreatic carcinoma and ovarian carcinoma, were identified. With the simple majority rule, the HCC-specific relative expression orderings from comparisons with colorectal carcinoma and breast carcinoma could exactly discriminate primary hepatocellular carcinoma samples from both primary colorectal carcinoma and breast carcinoma samples. Especially, they correctly classified more than 90% of liver metastatic samples from colorectal carcinoma and breast carcinoma to their original tumours. Finally, using these HCC-specific relative expression orderings from comparisons with six cancer types, we identified eight of 24 hepatocellular carcinoma cell lines in the Cancer Cell Line Encyclopedia (Huh-7, Huh-1, HepG2, Hep3B, JHH-5, JHH-7, C3A and Alexander cells) that are highly representative of hepatocellular carcinoma. Evaluated with a REOs-based prognostic signature for hepatocellular carcinoma, all these eight cell lines showed the same metastatic properties of the high-risk metastatic hepatocellular carcinoma tissues. Caution should be taken for using hepatocellular carcinoma cell lines. Our results should be helpful to select proper hepatocellular carcinoma cell lines for biological experiments. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Numerical study of whisker field lines in the periphery of the Large Helical Device
International Nuclear Information System (INIS)
Akao, Hideki
1990-01-01
The behavior of periphery magnetic field lines in the standard Large-Helical Device (l=2 heliotron/torsatron type) configuration is studied numerically. Three different types of behavior are found, corresponding to three different regions: the stochastic region near the outermost magnetic surface, the whisker region, and the inter-whisker region outside the stochastic region. The behavior of whisker and inter-whisker field lines is specifically analyzed. It is found that whisker field lines exhibit both regular and irregular types of behavior, whereas inter-whisker field lines exhibit only regular behavior. The connection lengths for the whisker field lines are usually as long as several tens of toroidal pitches, whereas those for the inter-whisker field lines are usually less than ten toroidal pitch lengths. Whisker field lines are characterized by three fundamental processes; stretching, folding, and nesting associated with the motion of a residual X-point of the separatrix. Simple modeling is performed to reproduce these three fundamental processes. (author)
Prostate-Specific Natural Health Products (Dietary Supplements) Radiosensitize Normal Prostate Cells
International Nuclear Information System (INIS)
Hasan, Yasmin; Schoenherr, Diane; Martinez, Alvaro A.; Wilson, George D.; Marples, Brian
2010-01-01
Purpose: Prostate-specific health products (dietary supplements) are taken by cancer patients to alleviate the symptoms linked with poor prostate health. However, the effect of these agents on evidence-based radiotherapy practice is poorly understood. The present study aimed to determine whether dietary supplements radiosensitized normal prostate or prostate cancer cell lines. Methods and Materials: Three well-known prostate-specific dietary supplements were purchased from commercial sources available to patients (Trinovin, Provelex, and Prostate Rx). The cells used in the study included normal prostate lines (RWPE-1 and PWR-1E), prostate tumor lines (PC3, DU145, and LNCaP), and a normal nonprostate line (HaCaT). Supplement toxicity was assessed using cell proliferation assays [3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyl tetrazolium bromide] and cellular radiosensitivity using conventional clonogenic assays (0.5-4Gy). Cell cycle kinetics were assessed using the bromodeoxyuridine/propidium iodide pulse-labeling technique, apoptosis by scoring caspase-3 activation, and DNA repair by assessing γH2AX. Results: The cell growth and radiosensitivity of the malignant PC3, DU145, and LNcaP cells were not affected by any of the dietary prostate supplements (Provelex [2μg/mL], Trinovin [10μg/mL], and Prostate Rx [50 μg/mL]). However, both Trinovin (10μg/mL) and Prostate Rx (6μg/mL) inhibited the growth rate of the normal prostate cell lines. Prostate Rx increased cellular radiosensitivity of RWPE-1 cells through the inhibition of DNA repair. Conclusion: The use of prostate-specific dietary supplements should be discouraged during radiotherapy owing to the preferential radiosensitization of normal prostate cells.
A photoionization model for the optical line emission from cooling flows
Donahue, Megan; Voit, G. M.
1991-01-01
The detailed predictions of a photoionization model previously outlined in Voit and Donahue (1990) to explain the optical line emission associated with cooling flows in X-ray emitting clusters of galaxies are presented. In this model, EUV/soft X-ray radiation from condensing gas photoionizes clouds that have already cooled. The energetics and specific consequences of such a model, as compared to other models put forth in the literature is discussed. Also discussed are the consequences of magnetic fields and cloud-cloud shielding. The results illustrate how varying the individual column densities of the ionized clouds can reproduce the range of line ratios observed and strongly suggest that the emission-line nebulae are self-irradiated condensing regions at the centers of cooling flows.
DEFF Research Database (Denmark)
Theilade, M D; Gram, G J; Jensen, P B
1999-01-01
Multidrug resistance (MDR) remains a major problem in the successful treatment of small cell lung cancer (SCLC). New treatment strategies are needed, such as gene therapy specifically targeting the MDR cells in the tumor. Retroviral LacZ gene-containing vectors that were either pseudotyped...... for the gibbon ape leukemia virus (GALV-1) receptor or had specificity for the amphotropic murine leukemia virus (MLV-A) receptor were used for transduction of five SCLC cell lines differing by a range of MDR mechanisms. Transduction efficiencies in these cell lines were compared by calculating the percentage...... of blue colonies after X-Gal staining of the cells grown in soft agar. All examined SCLC cell lines were transducible with either vector. Transduction efficiencies varied from 5.7% to 33.5% independent of the presence of MDR. These results indicate that MDR does not severely impair transduction of SCLC...
Amdel on-line analyser at Rooiberg Tin Limited
International Nuclear Information System (INIS)
Owen, T.V.
1987-01-01
An Amdel on line analysis system was installed on the 'A' mine tin flotation plant at Rooiberg in April 1984. The motivation for the installation was made on account of the large variations in the feed grade to the plant and the resulting need for rapid operational adjustments to control concentrate grades thereby maximising the financial returns. An 'on-line' analyser system presented itself as a suitable alternative to the existing control method of smaller laboratory x-ray fluorescence analysers. On the system as installed at Rooiberg, two probes were fitted in each analysis zone, viz a density probe using high energy gamma radiation from a Cesium 127 source and a specific element absorption probe using low energy gamma radiation from a Americium 241 source. The signals as received from the probes are fed to a line receiver unit in the control room where a micro computer is doing the processing and prints out the information as required. Several advantages of this type of installation were gained at Rooiberg Tin Limited
Protassov, R.; van Dyk, D.; Connors, A.; Kashyap, V.; Siemiginowska, A.
2000-12-01
We examine the x-ray spectrum of the afterglow of GRB 970508, analyzed for Fe line emission by Piro et al (1999, ApJL, 514, L73). This is a difficult and extremely important measurement: the detection of x-ray afterglows from γ -ray bursts is at best a tricky business, relying on near-real satellite time response to unpredictable events; and a great deal of luck in catching a burst bright enough for a useful spectral analysis. Detecting a clear atomic (or cyclotron) line in the generally smooth and featureless afterglow (or burst) emission not only gives one of the few very specific keys to the physics local to the emission region, but also provides clues or confirmation of its distance (via redshift). Unfortunately, neither the likelihood ratio test or the related F-statistic commonly used to detect spectral lines adhere to their nominal Chi square and F-distributions. Thus we begin by calibrating the F-statistic used in Piro et al (1999, ApJL, 514, L73) via a simulation study. The simulation study relies on a completely specified source model, i.e. we do Monte Carlo simulations with all model parameters fixed (so--called ``parametric bootstrapping''). Second, we employ the method of posterior predictive p-values to calibrate a LRT statistic while accounting for the uncertainty in the parameters of the source model. Our analysis reveals evidence for the Fe K line.
Chorfa, Areski; Bétemps, Dominique; Morignat, Eric; Lazizzera, Corinne; Hogeveen, Kevin; Andrieu, Thibault; Baron, Thierry
2013-06-01
Epidemiological studies indicate a role of genetic and environmental factors in Parkinson's disease involving alterations of the neuronal α-synuclein (α-syn) protein. In particular, a relationship between Parkinson's disease and occupational exposure to pesticides has been repeatedly suggested. Our objective was to precisely assess changes in α-syn levels in human neuroblastoma (SH-SY5Y) and melanoma (SK-MEL-2) cell lines following acute exposure to pesticides (rotenone, paraquat, maneb, and glyphosate) using Western blot and flow cytometry. These human cell lines express α-syn endogenously, and overexpression of α-syn (wild type or mutated A53T) can be obtained following recombinant adenoviral transduction. We found that endogenous α-syn levels in the SH-SY5Y neuroblastoma cell line were markedly increased by paraquat, and to a lesser extent by rotenone and maneb, but not by glyphosate. Rotenone also clearly increased endogenous α-syn levels in the SK-MEL-2 melanoma cell line. In the SH-SY5Y cell line, similar differences were observed in the α-syn adenovirus-transduced cells, with a higher increase of the A53T mutated protein. Paraquat markedly increased α-syn in the SK-MEL-2 adenovirus-transduced cell line, similarly for the wild-type or A53T proteins. The observed differences in the propensities of pesticides to increase α-syn levels are in agreement with numerous reports that indicate a potential role of exposure to certain pesticides in the development of Parkinson's disease. Our data support the hypothesis that pesticides can trigger some molecular events involved in this disease and also in malignant melanoma that consistently shows a significant but still unexplained association with Parkinson's disease.
Angiocrine functions of organ-specific endothelial cells
Rafii, Shahin; Butler, Jason M; Ding, Bi-Sen
2016-01-01
Preface Endothelial cells lining blood vessel capillaries are not just passive conduits for delivering blood. Tissue-specific endothelium establish specialized vascular niches that deploy specific sets of growth factors, known as angiocrine factors, which actively participate in inducing, specifying, patterning, and guiding organ regeneration and maintaining homeostasis and metabolism. Angiocrine factors upregulated in response to injury orchestrates self-renewal and differentiation of tissue-specific repopulating resident stem and progenitor cells into functional organs. Uncovering the precise mechanisms whereby physiological-levels of angiocrine factors are spatially and temporally produced, and distributed by organotypic endothelium to repopulating cells, will lay the foundation for driving organ repair without scarring. PMID:26791722
Improved patient specific seizure detection during pre-surgical evaluation.
LENUS (Irish Health Repository)
Chua, Eric C-P
2011-04-01
There is considerable interest in improved off-line automated seizure detection methods that will decrease the workload of EEG monitoring units. Subject-specific approaches have been demonstrated to perform better than subject-independent ones. However, for pre-surgical diagnostics, the traditional method of obtaining a priori data to train subject-specific classifiers is not practical. We present an alternative method that works by adapting the threshold of a subject-independent to a specific subject based on feedback from the user.
Product Lines for Service Oriented Applications - PL for SOA
Directory of Open Access Journals (Sweden)
Maurice H. ter Beek
2011-08-01
Full Text Available PL for SOA proposes, formally, a software engineering methodology, development techniques and support tools for the provision of service product lines. We propose rigorous modeling techniques for the specification and verification of formal notations and languages for service computing with inclinations of variability. Through these cutting-edge technologies, increased levels of flexibility and adaptivity can be achieved. This will involve developing semantics of variability over behavioural models of services. Such tools will assist organizations to plan, optimize and control the quality of software service provision, both at design and at run time by making it possible to develop flexible and cost-effective software systems that support high levels of reuse. We tackle this challenge from two levels. We use feature modeling from product line engineering and, from a services point of view, the orchestration language Orc. We introduce the Smart Grid as the service product line to apply the techniques to.
Cyber Risk Assessment of Transmission Lines in Smart Grids
Directory of Open Access Journals (Sweden)
Xuan Liu
2015-12-01
Full Text Available The increasing use of information technologies in power systems has increased the risk of power systems to cyber-attacks. In this paper, we assess the risk of transmission lines being overloaded due to cyber-based false data injection attacks. The cyber risk assessment is formulated as bilevel optimization problems that determine the maximum line flows under false data injection attacks. We propose efficient techniques to reduce the computation complexity of solving the bilevel problems. Specifically, primary and secondary filtering techniques are employed to identify the lines whose flows will never exceed their limits, which can significantly reduce computation burden. A special feasibility cut-based acceleration technique is introduced to further reduce the computation burden. The simulation results on the IEEE 30-bus, IEEE 118-bus, IEEE 300-bus and IEEE 2383-bus systems verify the proposed risk assessment model and the effectiveness of the proposed filtering and acceleration techniques.
LS1 Report: The cryogenic line goes through the scanner
CERN Bulletin
2013-01-01
In spite of the complexity of LS1, with many different activities taking place in parallel and sometimes overlapping, the dashboard shows that work is progressing on schedule. This week, teams have started X-raying the cryogenic line to examine its condition in minute detail. The LS1 schedule is pretty unfathomable for those who don't work in the tunnels or installations, but if you look down all the columns and stop at the line indicating today’s date, you can see that all of the priority and critical items are bang on time, like a Swiss watch. More specifically: the SMACC project in the LHC is on schedule, with a new testing phase for the interconnections which have already been consolidated; preparations are under way for the cable replacement campaign at Point 1 of the SPS (about 20% of the cables will not be replaced as they are completely unused); and the demineralised water distribution line is back in service, as are the electrical substations for the 400 and 66 kV line...
Antibacterial effects of cavity lining: a systematic review and network meta-analysis.
Schwendicke, Falk; Tu, Yu-Kang; Hsu, Le-Yin; Göstemeyer, Gerd
2015-11-01
Cavity liners are frequently used prior placing a restoration, with one main aim being to reduce the number of remaining bacteria. We systematically appraised studies comparing antibacterial effects of different liners against each other or no liner. reporting the number of sterile cavities before/after lining or sealing, or the reduction in bacterial numbers (colony-forming-units) in two or more treatment groups were included. Treatments were categorized as: no/placebo liner, calcium hydroxide, mineral trioxide aggregate, antibiotic/disinfectant, calcium phosphates, zinc oxide eugenol, black copper cement, and glass ionomer cement liners. Pairwise and network meta-analyses were performed. From 113 identified studies, 14 (500 treated lesions) were included. Risk of bias was high or unclear. Based on 11 studies, network meta-analysis found mineral trioxide lining to yield the greatest probability of achieving sterile cavities after a lining/sealing period (73%), followed by antibiotic/disinfectant (8%) and zinc oxide eugenol (7%). Only six studies assessed bacterial reduction after lining/sealing, and zinc oxide eugenol was found to have the highest probability of achieving a bacterial reduction. In both analyses, not providing any lining was found to have low antibacterial effects. Within the limitations of this review and the included studies, certain liners seem more suitable to achieve sterile cavities or reduce bacterial numbers than others. Given the paucity of data and the unclear impact of remaining bacteria on clinical outcomes, further recommendations for specific cavity treatments prior a restoration are not possible. There is insufficient evidence to generally recommend cavity lining or the use of any specific liner based on their antibacterial effects. Dentists might continue to use liners, but should be aware that such use is not strongly supported by clinical studies. Copyright © 2015 Elsevier Ltd. All rights reserved.
DNA fingerprinting of glioma cell lines and considerations on similarity measurements.
Bady, Pierre; Diserens, Annie-Claire; Castella, Vincent; Kalt, Stefanie; Heinimann, Karl; Hamou, Marie-France; Delorenzi, Mauro; Hegi, Monika E
2012-06-01
Glioma cell lines are an important tool for research in basic and translational neuro-oncology. Documentation of their genetic identity has become a requirement for scientific journals and grant applications to exclude cross-contamination and misidentification that lead to misinterpretation of results. Here, we report the standard 16 marker short tandem repeat (STR) DNA fingerprints for a panel of 39 widely used glioma cell lines as reference. Comparison of the fingerprints among themselves and with the large DSMZ database comprising 9 marker STRs for 2278 cell lines uncovered 3 misidentified cell lines and confirmed previously known cross-contaminations. Furthermore, 2 glioma cell lines exhibited identity scores of 0.8, which is proposed as the cutoff for detecting cross-contamination. Additional characteristics, comprising lack of a B-raf mutation in one line and a similarity score of 1 with the original tumor tissue in the other, excluded a cross-contamination. Subsequent simulation procedures suggested that, when using DNA fingerprints comprising only 9 STR markers, the commonly used similarity score of 0.8 is not sufficiently stringent to unambiguously differentiate the origin. DNA fingerprints are confounded by frequent genetic alterations in cancer cell lines, particularly loss of heterozygosity, that reduce the informativeness of STR markers and, thereby, the overall power for distinction. The similarity score depends on the number of markers measured; thus, more markers or additional cell line characteristics, such as information on specific mutations, may be necessary to clarify the origin.
Nodal line optimization and its application to violin top plate design
Yu, Yonggyun; Jang, In Gwun; Kim, In Kyum; Kwak, Byung Man
2010-10-01
In the literature, most problems of structural vibration have been formulated to adjust a specific natural frequency: for example, to maximize the first natural frequency. In musical instruments like a violin; however, mode shapes are equally important because they are related to sound quality in the way that natural frequencies are related to the octave. The shapes of nodal lines, which represent the natural mode shapes, are generally known to have a unique feature for good violins. Among the few studies on mode shape optimization, one typical study addresses the optimization of nodal point location for reducing vibration in a one-dimensional beam structure. However, nodal line optimization, which is required in violin plate design, has not yet been considered. In this paper, the central idea of controlling the shape of the nodal lines is proposed and then applied to violin top plate design. Finite element model for a violin top plate was constructed using shell elements. Then, optimization was performed to minimize the square sum of the displacement of selected nodes located along the target nodal lines by varying the thicknesses of the top plate. We conducted nodal line optimization for the second and the fifth modes together at the same time, and the results showed that the nodal lines obtained match well with the target nodal lines. The information on plate thickness distribution from nodal line optimization would be valuable for tailored trimming of a violin top plate for the given performances.
Acute physiological responses to recreational in-line skating in young adults.
Orepic, Paula; Mikulic, Pavle; Soric, Maroje; Ruzic, Lana; Markovic, Goran
2014-01-01
We examined the physiological responses to in-line skating exercise at self-selected paces in recreationally trained adults. Seven men and 10 women performed in-line skating exercise during which oxygen uptake (VO2) and heart rate (HR) were recorded continuously. Ratings of perceived exertion (RPE) and blood lactate concentration were also obtained at the end of exercise. Furthermore, subjects' peak VO2, peak HR, RPE and gas-exchange thresholds were determined in laboratory settings. The average exercise intensity during in-line skating was 90% of peak HR, 67% of peak VO2, 84% of HR reserve and 64% of VO2 reserve. When expressed as RPE and as metabolic equivalents (METs), the average exercise intensity was 13.1 RPE and 9.4 METs. Overall, these indicators of exercise intensity categorise in-line skating at self-selected paces as a vigorous physical activity. Notably, at similar VO2 values, significantly higher HR (174 ± 16 vs. 156 ± 6 bpm; pskating compared with treadmill running. We conclude that 1. recreational in-line skating induces physiological responses that are sufficient for improving and maintaining cardiovascular fitness in healthy adults, 2. HR- and RPE-based methods for quantifying the exercise intensity during in-line skating may overestimate the actual metabolic load and 3. the derivation of exercise prescriptions for in-line skating should be preferably based on specific (i.e. in-line skating) graded exhaustive exercise test.
Protein profile of human hepatocarcinoma cell line SMMC-7721: Identification and functional analysis
Feng, Yi; Tian, Zhong-Min; Wan, Ming-Xi; Zheng, Zhao-Bin
2007-01-01
AIM: To investigate the protein profile of human hepatocarcinoma cell line SMMC-7721, to analyze the specific functions of abundant expressed proteins in the processes of hepatocarcinoma genesis, growth and metastasis, to identify the hepatocarcinoma-specific biomarkers for the early prediction in diagnosis, and to explore the new drug targets for liver cancer therapy.
MICROLENSING OF QUASAR BROAD EMISSION LINES: CONSTRAINTS ON BROAD LINE REGION SIZE
Energy Technology Data Exchange (ETDEWEB)
Guerras, E.; Mediavilla, E. [Instituto de Astrofisica de Canarias, Via Lactea S/N, La Laguna E-38200, Tenerife (Spain); Jimenez-Vicente, J. [Departamento de Fisica Teorica y del Cosmos, Universidad de Granada, Campus de Fuentenueva, E-18071 Granada (Spain); Kochanek, C. S. [Department of Astronomy and the Center for Cosmology and Astroparticle Physics, The Ohio State University, 4055 McPherson Lab, 140 West 18th Avenue, Columbus, OH 43221 (United States); Munoz, J. A. [Departamento de Astronomia y Astrofisica, Universidad de Valencia, E-46100 Burjassot, Valencia (Spain); Falco, E. [Center for Astrophysics, 60 Garden Street, Cambridge, MA 02138 (United States); Motta, V. [Departamento de Fisica y Astronomia, Universidad de Valparaiso, Avda. Gran Bretana 1111, Valparaiso (Chile)
2013-02-20
We measure the differential microlensing of the broad emission lines between 18 quasar image pairs in 16 gravitational lenses. We find that the broad emission lines are in general weakly microlensed. The results show, at a modest level of confidence (1.8{sigma}), that high ionization lines such as C IV are more strongly microlensed than low ionization lines such as H{beta}, indicating that the high ionization line emission regions are more compact. If we statistically model the distribution of microlensing magnifications, we obtain estimates for the broad line region size of r{sub s} = 24{sup +22} {sub -15} and r{sub s} = 55{sup +150} {sub -35} lt-day (90% confidence) for the high and low ionization lines, respectively. When the samples are divided into higher and lower luminosity quasars, we find that the line emission regions of more luminous quasars are larger, with a slope consistent with the expected scaling from photoionization models. Our estimates also agree well with the results from local reveberation mapping studies.
Lining seam elimination algorithm and surface crack detection in concrete tunnel lining
Qu, Zhong; Bai, Ling; An, Shi-Quan; Ju, Fang-Rong; Liu, Ling
2016-11-01
Due to the particularity of the surface of concrete tunnel lining and the diversity of detection environments such as uneven illumination, smudges, localized rock falls, water leakage, and the inherent seams of the lining structure, existing crack detection algorithms cannot detect real cracks accurately. This paper proposed an algorithm that combines lining seam elimination with the improved percolation detection algorithm based on grid cell analysis for surface crack detection in concrete tunnel lining. First, check the characteristics of pixels within the overlapping grid to remove the background noise and generate the percolation seed map (PSM). Second, cracks are detected based on the PSM by the accelerated percolation algorithm so that the fracture unit areas can be scanned and connected. Finally, the real surface cracks in concrete tunnel lining can be obtained by removing the lining seam and performing percolation denoising. Experimental results show that the proposed algorithm can accurately, quickly, and effectively detect the real surface cracks. Furthermore, it can fill the gap in the existing concrete tunnel lining surface crack detection by removing the lining seam.
Constrained Convolutional Sparse Coding for Parametric Based Reconstruction of Line Drawings
Shaheen, Sara
2017-12-25
Convolutional sparse coding (CSC) plays an essential role in many computer vision applications ranging from image compression to deep learning. In this work, we spot the light on a new application where CSC can effectively serve, namely line drawing analysis. The process of drawing a line drawing can be approximated as the sparse spatial localization of a number of typical basic strokes, which in turn can be cast as a non-standard CSC model that considers the line drawing formation process from parametric curves. These curves are learned to optimize the fit between the model and a specific set of line drawings. Parametric representation of sketches is vital in enabling automatic sketch analysis, synthesis and manipulation. A couple of sketch manipulation examples are demonstrated in this work. Consequently, our novel method is expected to provide a reliable and automatic method for parametric sketch description. Through experiments, we empirically validate the convergence of our method to a feasible solution.
Simulation of a Narrowband Power Line Communications System over Medium Voltage
Directory of Open Access Journals (Sweden)
Nikolaos Chiotellis
2016-03-01
Full Text Available Narrowband Power Line Communications (NB-PLCs are investigated as an alternative option for transferring low rate smart grid (SG data via Medium Voltage (MV power lines. In this framework, two variants of orthogonal frequency division multiplexing are examined, namely Filtered-OFDM (F-OFDM and Wavelet-OFDM (W-OFDM, in an attempt to determine which of them is capable of transmitting low rate SG data to greater distances over non-branched MV power lines. The reach of NB-PLC signals via MV power lines is estimated, taking into account the transfer function of the relevant PLC channels and noise mechanisms as well as the specific features of the two modulation options under consideration. Simulations show that NB-PLC transmission constitutes a technically feasible and economically affordable option for exchanging low rate data with remote SG nodes dispersed over the MV grid. Moreover, simulations show that F-OFDM allows low rate data transmission to considerably greater distances compared to W-OFDM.
Beam-line considerations for experiments with highly-charged ions
International Nuclear Information System (INIS)
Johnson, B.M.
1990-01-01
The APS offers exciting possibilities for a bright future in x-ray research. For example, measurements on the inner-shell photoionization of ions will be feasible using stored ions in ions traps or ion beams from an electron-cyclotron-resonance ion source, or perhaps even a heavy-ion storage ring. Such experiments with ionic targets are the focus for the discussion given here on the optimization of photon flux on a generic beamline at the APS. The performance of beam lines X26C, X26A, and X17 on the x-ray ring of the National Synchrotron Light Source will be discussed as specific examples of beam-line design considerations
Beam-line considerations for experiments with highly-charged ions
Energy Technology Data Exchange (ETDEWEB)
Johnson, B.M.
1990-01-01
The APS offers exciting possibilities for a bright future in x-ray research. For example, measurements on the inner-shell photoionization of ions will be feasible using stored ions in ions traps or ion beams from an electron-cyclotron-resonance ion source, or perhaps even a heavy-ion storage ring. Such experiments with ionic targets are the focus for the discussion given here on the optimization of photon flux on a generic beamline at the APS. The performance of beam lines X26C, X26A, and X17 on the x-ray ring of the National Synchrotron Light Source will be discussed as specific examples of beam-line design considerations.
PSpice for filters and transmission lines
Tobin, Paul
2007-01-01
In this book, PSpice for Filters and Transmission Lines, we examine a range of active and passive filters where each design is simulated using the latest Cadence Orcad V10.5 PSpice capture software. These filters cannot match the very high order digital signal processing (DSP) filters considered in PSpice for Digital Signal Processing, but nevertheless these filters have many uses. The active filters considered were designed using Butterworth and Chebychev approximation loss functions rather than using the 'cookbook approach' so that the final design will meet a given specification in an exact
Introduction to transfer lines and circular machines
International Nuclear Information System (INIS)
Bryant, P.J.
1984-01-01
This course was given in the 1983-84 Academic Training Programme. It is designed as an elementary introduction to both the theory and the hardware for transfer lines and circular machines. The course is limited to linear problems and treates the topics of single particle motion in the transverse and longitudinal planes, emittance ellipses, parameterisation, optical properties of some specific modules, stabilities in the transverse and longitudinal planes, field and gradient errors, and scattering in thin windows. (orig.)
Tabassum, Arshia; Zaidi, Syeda Nuzhat Fatima; Yasmeen, Kausar; Mahboob, Tabassum
2018-07-15
Electrolytes and trace elements dysregulation play an important role in the progression of obesity and diabetes complications. The present study was designed to evaluate the insulin sensitizing effects of peroxisomes proliferators activated receptor gamma (PPAR-γ) agonist on trace elements in obesity induced type 2 diabetes mellitus and correlate with serum visfatin. Wistar rats were categorized into five groups. Group I served as control; Group II fed on high fat diet (HFD); Group III fed on HFD and treated with rosiglitazone (3 mg/kg) for 7 days; Group IV were T2DM rats induce by HFD and low dose of streptozotocin (i.p. 35 mg/kg); Group V was T2DM rats treated with rosiglitazone (3 mg/kg) for 7 days. Serum and tissues electrolytes levels and renal, hepatic and cardiac tissues trace elements were estimated by flame photometer and atomic absorption spectroscopy. Serum visfatin was estimated by ELISA. Pearson correlations were analyzed among fasting blood glucose (FBG), serum visfatin and tissues trace elements. Results of the current study showed hyponatremia, hyperkalemia, hypomagnesemia and hypercalcemia in HFD and T2DM groups. HFD and T2DM also showed elevated copper and iron levels; however, zinc and selenium levels were decreased. Rosiglitazone treatment increased the insulin sensitization and altered these changes. A Strong association was observed among FBG, serum visfatin and trace elements levels of HFD and T2DM. Obesity and diabetes mellitus disturbed visfatin, electrolytes and trace elements homeostasis. Rosiglitazone treatment restored these changes. The results of the study could serve as a basis for further studies for the prevention of diabetic complications. Copyright © 2018 Elsevier Inc. All rights reserved.
On-line soft sensing in upstream bioprocessing.
Randek, Judit; Mandenius, Carl-Fredrik
2018-02-01
This review provides an overview and a critical discussion of novel possibilities of applying soft sensors for on-line monitoring and control of industrial bioprocesses. Focus is on bio-product formation in the upstream process but also the integration with other parts of the process is addressed. The term soft sensor is used for the combination of analytical hardware data (from sensors, analytical devices, instruments and actuators) with mathematical models that create new real-time information about the process. In particular, the review assesses these possibilities from an industrial perspective, including sensor performance, information value and production economy. The capabilities of existing analytical on-line techniques are scrutinized in view of their usefulness in soft sensor setups and in relation to typical needs in bioprocessing in general. The review concludes with specific recommendations for further development of soft sensors for the monitoring and control of upstream bioprocessing.
Type 2 diabetes mellitus and heart failure
DEFF Research Database (Denmark)
Seferović, Petar M; Petrie, Mark C; Filippatos, Gerasimos S
2018-01-01
, has been associated with a higher risk of HF hospitalization. Thiazolidinediones (pioglitazone and rosiglitazone) are contraindicated in patients with (or at risk of) HF. In recent trials, sodium-glucose co-transporter-2 (SGLT2) inhibitors, empagliflozin and canagliflozin, have both shown...... a significant reduction in HF hospitalization in patients with established CV disease or at risk of CV disease. Several ongoing trials should provide an insight into the effectiveness of SGLT2 inhibitors in patients with HFrEF and HFpEF in the absence of T2DM........ Sulphonylureas and insulin have been the traditional second- and third-line therapies although their safety in HF is equivocal. Neither glucagon-like preptide-1 (GLP-1) receptor agonists, nor dipeptidyl peptidase-4 (DPP4) inhibitors reduce the risk for HF hospitalization. Indeed, a DPP4 inhibitor, saxagliptin...
DEFF Research Database (Denmark)
Kiib, Hans
2015-01-01
At just over 10 meters above street level, the High Line extends three kilometers through three districts of Southwestern Manhattan in New York. It consists of simple steel construction, and previously served as an elevated rail line connection between Penn Station on 34th Street and the many....... The High Line project has been carried out as part of an open conversion strategy. The result is a remarkable urban architectural project, which works as a catalyst for the urban development of Western Manhattan. The greater project includes the restoration and reuse of many old industrial buildings...
Virus specific antigens in mammalian cells infected with herpes simplex virus
Watson, D. H.; Shedden, W. I. H.; Elliot, A.; Tetsuka, T.; Wildy, P.; Bourgaux-Ramoisy, D.; Gold, E.
1966-01-01
Antisera to specific proteins in herpes simplex infected cells were produced by immunization of rabbits with infected rabbit kidney cells. These antisera were highly virus specific and produced up to twelve lines in immunodiffusion tests against infected cell extracts. Acrylamide electrophoresis and immunoelectrophoresis revealed up to ten virus specific proteins of varying size. ImagesFIG. 1FIG. 2FIG. 3FIG. 4FIG. 5 PMID:4288648
International Nuclear Information System (INIS)
Carey, D.C.
1993-05-01
The combination of an existing graphics package with a large program like TRANSPORT has often resulted in considerable modification to the large program. Use of other graphics package has resulted in essentially having to repeat the work. This difficulty has been avoided in a modification of TRANSPORT which produce layouts of beam lines. Drawings of the reference trajectory and three-dimensional images of all magnets are made by the graphics package TOP DRAWER. Nothing specific to TOP DRAWER or any other graphics has been incorporated into TRANSPORT. If a user is with a different graphics package he or she can then begin usage of this alternate package essentially immediately
An ultrafast line-by-line algorithm for calculating spectral transmittance and radiance
International Nuclear Information System (INIS)
Tan, X.
2013-01-01
An ultrafast line-by-line algorithm for calculating spectral transmittance and radiance of gases is presented. The algorithm is based on fast convolution of the Voigt line profile using Fourier transform and a binning technique. The algorithm breaks a radiative transfer calculation into two steps: a one-time pre-computation step in which a set of pressure independent coefficients are computed using the spectral line information; a normal calculation step in which the Fourier transform coefficients of the optical depth are calculated using the line of sight information and the coefficients pre-computed in the first step, the optical depth is then calculated using an inverse Fourier transform and the spectral transmittance and radiance are calculated. The algorithm is significantly faster than line-by-line algorithms that do not employ special speedup techniques by a factor of 10 3 –10 6 . A case study of the 2.7 μm band of H 2 O vapor is presented. -- Highlights: •An ultrafast line-by-line model based on FFT and a binning technique is presented. •Computationally expensive calculations are factored out into a pre-computation step. •It is 10 3 –10 8 times faster than LBL algorithms that do not employ speedup techniques. •Good agreement with experimental data for the 2.7 μm band of H 2 O
International Nuclear Information System (INIS)
Uno, Shigeyuki; Endo, Kaori; Ishida, Yuji; Tateno, Chise; Makishima, Makoto; Yoshizato, Katsutoshi; Nebert, Daniel W.
2009-01-01
Human and rodent cytochrome P450 (CYP) enzymes sometimes exhibit striking species-specific differences in substrate preference and rate of metabolism. Human risk assessment of CYP substrates might therefore best be evaluated in the intact mouse by replacing mouse Cyp genes with human CYP orthologs; however, how 'human-like' can human gene expression be expected in mouse tissues? Previously a bacterial-artificial-chromosome-transgenic mouse, carrying the human CYP1A1 C YP1A2 locus and lacking the mouse Cyp1a1 and Cyp1a2 orthologs, was shown to express robustly human dioxin-inducible CYP1A1 and basal versus inducible CYP1A2 (mRNAs, proteins, enzyme activities) in each of nine mouse tissues examined. Chimeric mice carrying humanized liver have also been generated, by transplanting human hepatocytes into a urokinase-type plasminogen activator(+/+) s evere-combined-immunodeficiency (uPA/SCID) line with most of its mouse hepatocytes ablated. Herein we compare basal and dioxin-induced CYP1A mRNA copy numbers, protein levels, and four enzymes (benzo[a]pyrene hydroxylase, ethoxyresorufin O-deethylase, acetanilide 4-hydroxylase, methoxyresorufin O-demethylase) in liver of these two humanized mouse lines versus wild-type mice; we also compare these same parameters in mouse Hepa-1c1c7 and human HepG2 hepatoma-derived established cell lines. Most strikingly, mouse liver CYP1A1-specific enzyme activities are between 38- and 170-fold higher than human CYP1A1-specific enzyme activities (per unit of mRNA), whereas mouse versus human CYP1A2 enzyme activities (per unit of mRNA) are within 2.5-fold of one another. Moreover, both the mouse and human hepatoma cell lines exhibit striking differences in CYP1A mRNA levels and enzyme activities. These findings are relevant to risk assessment involving human CYP1A1 and CYP1A2 substrates, when administered to mice as environmental toxicants or drugs.
SPECTRAL OPTICAL MONITORING OF THE NARROW-LINE SEYFERT 1 GALAXY Ark 564
International Nuclear Information System (INIS)
Shapovalova, A. I.; Burenkov, A. N.; Popović, L. Č.; Kovačević, J.; Chavushyan, V. H.; Valdes, J. R.; Torrealba, J.; Carrasco, L.; Ilić, D.; Kovačević, A.; Kollatschny, W.; Bochkarev, N. G.; León-Tavares, J.; Mercado, A.; Benítez, E.; Dultzin, D.; De la Fuente, E.
2012-01-01
We present the results of a long-term (1999-2010) spectral optical monitoring campaign of the active galactic nucleus (AGN) Ark 564, which shows a strong Fe II line emission in the optical. This AGN is a narrow-line Seyfert 1 (NLS1) galaxy, a group of AGNs with specific spectral characteristics. We analyze the light curves of the permitted Hα, Hβ, optical Fe II line fluxes, and the continuum flux in order to search for a time lag between them. Additionally, in order to estimate the contribution of iron lines from different multiplets, we fit the Hβ and Fe II lines with a sum of Gaussian components. We find that during the monitoring period the spectral variation (F max /F min ) of Ark 564 is between 1.5 for Hα and 1.8 for the Fe II lines. The correlation between the Fe II and Hβ flux variations is of higher significance than that of Hα and Hβ (whose correlation is almost absent). The permitted-line profiles are Lorentzian-like and do not change shape during the monitoring period. We investigate, in detail, the optical Fe II emission and find different degrees of correlation between the Fe II emission arising from different spectral multiplets and the continuum flux. The relatively weak and different degrees of correlations between permitted lines and continuum fluxes indicate a rather complex source of ionization of the broad-line emission region.
SPECTRAL OPTICAL MONITORING OF THE NARROW-LINE SEYFERT 1 GALAXY Ark 564
Energy Technology Data Exchange (ETDEWEB)
Shapovalova, A. I.; Burenkov, A. N. [Special Astrophysical Observatory of the Russian AS, Nizhnij Arkhyz, Karachaevo-Cherkesia 369167 (Russian Federation); Popovic, L. C.; Kovacevic, J. [Astronomical Observatory, Volgina 7, 11160 Belgrade 74 (Serbia); Chavushyan, V. H.; Valdes, J. R.; Torrealba, J.; Carrasco, L. [Instituto Nacional de Astrofisica, Optica y Electronica, Apartado Postal 51-216, 72000 Puebla (Mexico); Ilic, D.; Kovacevic, A. [Isaac Newton Institute of Chile, Yugoslavia Branch, Belgrade (Serbia); Kollatschny, W. [Institut fuer Astrophysik, Georg-August-Universitaet, Goettingen (Germany); Bochkarev, N. G. [Sternberg Astronomical Institute, Moscow (Russian Federation); Leon-Tavares, J. [Aalto University Metsaehovi Radio Observatory, Metsaehovintie 114, FIN-02540 Kylmaelae (Finland); Mercado, A. [Universidad Politecnica de Baja California, Av. de la Industria 291, 21010 Mexicali, B.C. (Mexico); Benitez, E.; Dultzin, D. [Instituto de Astronomia, Universidad Nacional Autonoma de Mexico, Apartado Postal 70-264, Mexico, D.F. 04510 (Mexico); De la Fuente, E., E-mail: ashap@sao.ru [Instituto de Astronomia y Meteorologia, Dpto. de Fisica CUCEI, Universidad de Guadalajara, Av. Vallarta 2602, 44130 Guadalajara, Jalisco (Mexico)
2012-09-15
We present the results of a long-term (1999-2010) spectral optical monitoring campaign of the active galactic nucleus (AGN) Ark 564, which shows a strong Fe II line emission in the optical. This AGN is a narrow-line Seyfert 1 (NLS1) galaxy, a group of AGNs with specific spectral characteristics. We analyze the light curves of the permitted H{alpha}, H{beta}, optical Fe II line fluxes, and the continuum flux in order to search for a time lag between them. Additionally, in order to estimate the contribution of iron lines from different multiplets, we fit the H{beta} and Fe II lines with a sum of Gaussian components. We find that during the monitoring period the spectral variation (F{sub max}/F{sub min}) of Ark 564 is between 1.5 for H{alpha} and 1.8 for the Fe II lines. The correlation between the Fe II and H{beta} flux variations is of higher significance than that of H{alpha} and H{beta} (whose correlation is almost absent). The permitted-line profiles are Lorentzian-like and do not change shape during the monitoring period. We investigate, in detail, the optical Fe II emission and find different degrees of correlation between the Fe II emission arising from different spectral multiplets and the continuum flux. The relatively weak and different degrees of correlations between permitted lines and continuum fluxes indicate a rather complex source of ionization of the broad-line emission region.
Covariant electromagnetic field lines
Hadad, Y.; Cohen, E.; Kaminer, I.; Elitzur, A. C.
2017-08-01
Faraday introduced electric field lines as a powerful tool for understanding the electric force, and these field lines are still used today in classrooms and textbooks teaching the basics of electromagnetism within the electrostatic limit. However, despite attempts at generalizing this concept beyond the electrostatic limit, such a fully relativistic field line theory still appears to be missing. In this work, we propose such a theory and define covariant electromagnetic field lines that naturally extend electric field lines to relativistic systems and general electromagnetic fields. We derive a closed-form formula for the field lines curvature in the vicinity of a charge, and show that it is related to the world line of the charge. This demonstrates how the kinematics of a charge can be derived from the geometry of the electromagnetic field lines. Such a theory may also provide new tools in modeling and analyzing electromagnetic phenomena, and may entail new insights regarding long-standing problems such as radiation-reaction and self-force. In particular, the electromagnetic field lines curvature has the attractive property of being non-singular everywhere, thus eliminating all self-field singularities without using renormalization techniques.
Uveal Melanoma Cell Lines: Where do they come from? (An American Ophthalmological Society Thesis).
Jager, Martine J; Magner, J Antonio Bermudez; Ksander, Bruce R; Dubovy, Sander R
2016-08-01
To determine whether some of the most often used uveal melanoma cell lines resemble their original tumor. Analysis of the literature, patient charts, histopathology, mutations, chromosome status, HLA type, and expression of melanocyte markers on cell lines and their primary tumors. We examined five cell lines and the primary tumors from which they were derived. Four of the five examined primary tumors were unusual: one occupied the orbit, two were recurrences after prior irradiation, and one developed in an eye with a nevus of Ota. One cell line did not contain the GNA11 mutation, but it was present in the primary tumor. Three of the primary tumors had monosomy 3 (two of these lacked BAP1 expression); however, all five cell lines showed disomy 3 and BAP1 expression. All of the cell lines had gain of 8q. Two cell lines lacked expression of melanocyte markers, although these were present in the corresponding primary tumor. All cell lines could be traced back to their original uveal melanoma. Four of the five primary tumors were unusual. Cell lines often differed from their primary tumor in chromosome status and melanocyte markers. However, their specific chromosome aberrations and capacity to continue proliferation characterize them as uveal melanoma cell lines.
Cheng, Wei; Li, He-Ping; Zhang, Jing-Bo; Du, Hong-Jie; Wei, Qi-Yong; Huang, Tao; Yang, Peng; Kong, Xian-Wei; Liao, Yu-Cai
2015-06-01
Fusarium head blight (FHB) in wheat and other small grain cereals is a globally devastating disease caused by toxigenic Fusarium pathogens. Controlling FHB is a challenge because germplasm that is naturally resistant against these pathogens is inadequate. Current control measures rely on fungicides. Here, an antibody fusion comprised of the Fusarium spp.-specific recombinant antibody gene CWP2 derived from chicken, and the endochitinase gene Ech42 from the biocontrol fungus Trichoderma atroviride was introduced into the elite wheat cultivar Zhengmai9023 by particle bombardment. Expression of this fusion gene was regulated by the lemma/palea-specific promoter Lem2 derived from barley; its expression was confirmed as lemma/palea-specific in transgenic wheat. Single-floret inoculation of independent transgenic wheat lines of the T3 to T6 generations revealed significant resistance (type II) to fungal spreading, and natural infection assays in the field showed significant resistance (type I) to initial infection. Gas chromatography-mass spectrometry analysis revealed marked reduction of mycotoxins in the grains of the transgenic wheat lines. Progenies of crosses between the transgenic lines and the FHB-susceptible cultivar Huamai13 also showed significantly enhanced FHB resistance. Quantitative real-time PCR analysis revealed that the tissue-specific expression of the antibody fusion was induced by salicylic acid drenching and induced to a greater extent by F. graminearum infection. Histochemical analysis showed substantial restriction of mycelial growth in the lemma tissues of the transgenic plants. Thus, the combined tissue-specific and pathogen-inducible expression of this Fusarium-specific antibody fusion can effectively protect wheat against Fusarium pathogens and reduce mycotoxin content in grain. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
J. Wang
2013-10-01
Full Text Available Psathyrostachys huashanica Keng is an endangered species that is endemic to China, which provides an important gene pool for wheat improvement. We developed a quick and reliable PCR-based diagnostic assay to accurately and efficiently detect P. huashanica DNA sequences from introgression lines, which was based on a species-specific marker derived from genomic DNA. The 900-bp PCR-amplified band used as a P. huashanica-specific RAPD marker was tested with 21 different plant species and was converted into a sequence-characterized amplified region (SCAR marker by cloning and sequencing the selected fragments (pHs11. This SCAR marker, which was designated as RHS23, could clearly distinguish the presence of P. huashanica DNA repetitive sequences in wheat-P. huashanica derivative lines. The specificity of the marker was validated using 21 different plant species and a complete set of wheat-P. huashanica disomic addition lines (1Ns–7Ns, 2n=44=22II. This specific sequence targeted the Ns genome of P. huashanica and it was present in all the seven P. huashanica chromosomes. Therefore, this SCAR marker is specific for P. huashanica chromosomes and may be used in the identification of alien repetitive sequences in large gene pools. This diagnostic PCR assay for screening the target genetic material may play a key role in marker-assisted selective breeding programs.
The End of the Lines for OX 169: No Binary Broad-Line Region
Halpern, J. P.; Eracleous, M.
2000-03-01
We show that unusual Balmer emission-line profiles of the quasar OX 169, frequently described as either self-absorbed or double peaked, are actually neither. The effect is an illusion resulting from two coincidences. First, the forbidden lines are quite strong and broad. Consequently, the [N II] λ6583 line and the associated narrow-line component of Hα present the appearance of twin Hα peaks. Second, the redshift of 0.2110 brings Hβ into coincidence with Na I D at zero redshift, and ISM absorption in Na I D divides the Hβ emission line. In spectra obtained over the past decade, we see no substantial change in the character of the line profiles and no indication of intrinsic double-peaked structure. The Hγ, Mg II, and Lyα emission lines are single peaked, and all of the emission-line redshifts are consistent once they are correctly attributed to their permitted and forbidden-line identifications. A systematic shift of up to 700 km s-1 between broad and narrow lines is seen, but such differences are common and could be due to gravitational and transverse redshift in a low-inclination disk. Stockton & Farnham had called attention to an apparent tidal tail in the host galaxy of OX 169 and speculated that a recent merger had supplied the nucleus with a coalescing pair of black holes that was now revealing its existence in the form of two physically distinct broad-line regions. Although there is no longer any evidence for two broad emission-line regions in OX 169, binary black holes should form frequently in galaxy mergers, and it is still worthwhile to monitor the radial velocities of emission lines that could supply evidence of their existence in certain objects.
Pressure control of a pneumatic control system with a long transmission line
International Nuclear Information System (INIS)
Jang, Ji Seong; Lee, Kwang Kuk; Choi, Myung Soo
2003-01-01
In this study, a robust controller to control pressure in a pneumatic pressure vessel with a long transmission line is proposed. Frequency response of transmission line using compressible fluid is changed by the flowing state of the fluid. So, if a fixed gain controller designed based on a model supposed the flowing state to a specific state, the performance of the control system could be degraded because of the modelling error. The controller designed in this study is composed of two parts. One is a feedback controller to improve a feedback characteristics and to compensate the influence of the variation of transfer characteristics of a transmission line owing to the change of flowing state and the other is a feed forward controller to regulate command following performance. The experimental results with the designed controller show that the robustness of the control system is achieved regardless of the change of the model of the transmission line. Therefore, the designed controller can be utilized for the performance improvement of a pressure control system with a long transmission line using compressible fluid
International Nuclear Information System (INIS)
Mei, Q.; Zhou, X.; Liu, C.
2011-01-01
Twelve different Cytoplasmic Male-Sterile (CMS) lines were crossed with 18 rice varieties. From the hybrid with japonica rice Nongken 58, twelve homokaryotic-heteroplasmic male sterile lines were developed in B7F1 after successive back crossing and selection for stable male sterility and desirable agronomic traits such as flowering habit and high out crossing rate. The experimental results demonstrated that expression of the CMS factors were influenced by the corresponding nuclear genes. Three pollen abortion types, including the typical, the spherical and the stained abortion, were observed in the homokaryotic-heteroplasmic male sterile lines. Formation of the aborted pollen grains was influenced by the interaction among specific cytoplasmic and the corresponding nuclear genes. As the CMS carriers, these homokaryotic-heteroplasmic lines will have significant impact on the utilization of multiple types of CMS in hybrid rice breeding. What is more important is that these CMS lines are the invaluable materials for the investigation of the molecular mechanism of CMS formation in rice. (author)
Directory of Open Access Journals (Sweden)
Alessandra M. Welker
2016-02-01
Full Text Available Glioblastoma (GBM is a deadly brain cancer, for which few effective drug treatments are available. Several studies have used zebrafish models to study GBM, but a standardized approach to modeling GBM in zebrafish was lacking to date, preventing comparison of data across studies. Here, we describe a new, standardized orthotopic xenotransplant model of GBM in zebrafish. Dose-response survival assays were used to define the optimal number of cells for tumor formation. Techniques to measure tumor burden and cell spread within the brain over real time were optimized using mouse neural stem cells as control transplants. Applying this standardized approach, we transplanted two patient-derived GBM cell lines, serum-grown adherent cells and neurospheres, into the midbrain region of embryonic zebrafish and analyzed transplanted larvae over time. Progressive brain tumor growth and premature larval death were observed using both cell lines; however, fewer transplanted neurosphere cells were needed for tumor growth and lethality. Tumors were heterogeneous, containing both cells expressing stem cell markers and cells expressing markers of differentiation. A small proportion of transplanted neurosphere cells expressed glial fibrillary acidic protein (GFAP or vimentin, markers of more differentiated cells, but this number increased significantly during tumor growth, indicating that these cells undergo differentiation in vivo. By contrast, most serum-grown adherent cells expressed GFAP and vimentin at the earliest times examined post-transplant. Both cell types produced brain tumors that contained Sox2+ cells, indicative of tumor stem cells. Transplanted larvae were treated with currently used GBM therapeutics, temozolomide or bortezomib, and this resulted in a reduction in tumor volume in vivo and an increase in survival. The standardized model reported here facilitates robust and reproducible analysis of glioblastoma tumor cells in real time and provides a
2001-01-01
The Nasca Lines are located in the Pampa region of Peru, the desolate plain of the Peruvian coast 400 km south of Lima. The Lines were first spotted when commercial airlines began flying across the Peruvian desert in the 1920's. Passengers reported seeing 'primitive landing strips' on the ground below. The Lines were made by removing the iron-oxide coated pebbles which cover the surface of the desert. When the gravel is removed, they contrast with the light color underneath. In this way the lines were drawn as furrows of a lighter color. On the pampa, south of the Nasca Lines, archaeologists have now uncovered the lost city of the line-builders, Cahuachi. It was built nearly two thousand years ago and was mysteriously abandoned 500 years later. This ASTER sub-image covers an area of 14 x 18 km, was acquired on December 22, 2000, and is located at 14.7 degrees south latitude and 75.1 degrees west longitude. The U.S. science team is located at NASA's Jet Propulsion Laboratory, Pasadena, Calif. The Terra mission is part of NASA's Science Mission Directorate.
Understanding Mammalian Germ Line Development with In Vitro Models.
Martínez-Arroyo, Ana M; Míguez-Forján, Jose M; Remohí, Jose; Pellicer, Antonio; Medrano, Jose V
2015-09-15
Germ line development is crucial in organisms with sexual reproduction to complete their life cycle. In mammals, knowledge about germ line development is based mainly on the mouse model, in which genetic and epigenetic events are well described. However, little is known about how germ line development is orchestrated in humans, especially in the earliest stages. New findings derived from human in vitro models to obtain germ cells can shed light on these questions. This comprehensive review summarizes the current knowledge about mammalian germ line development, emphasizing the state of the art obtained from in vitro models for germ cell-like cell derivation. Current knowledge of the pluripotency cycle and germ cell specification has allowed different in vitro strategies to obtain germ cells with proven functionality in mouse models. Several reports during the last 10 years show that in vitro germ cell derivation with proven functionality to generate a healthy offspring is possible in mice. However, differences in the embryo development and pluripotency potential between human and mouse make it difficult to extrapolate these results. Further efforts on both human and mouse in vitro models to obtain germ cells from pluripotent stem cells may help to elucidate how human physiological events take place; therefore, therapeutic strategies can also be considered.
Gene expression profiling in chemoresistant variants of three cell lines of different origin
DEFF Research Database (Denmark)
Johnsson, Anders; Vallon-Christensson, Johan; Strand, Carina
2005-01-01
lines (K562 leukemia, MCF-7 breast cancer and S1 colon cancer) with acquired resistance against five cytostatic drugs; daunorubicin (DNR), doxorubicin (DOX), vincristine (VCR), etoposide (VP) and mitoxantrone (MX). RESULTS: The resistant cell lines clustered together based on their type of origin...... was also seen in, e.g., GSTs, topoisomerases, caveolins, annexins and CD44. CONCLUSION: These results will constitute a platform for further studies on specific pathways and biological processes involved in chemotherapy resistance....
Directory of Open Access Journals (Sweden)
Serkan Altuntaş
2010-01-01
Full Text Available Occasionally certain tasks in an assembly line balancing problem are required to be kept together due to some specific reasons. These tasks are attained to the same work stations. Such problems are called as 'Assembly Line Balancing Problem with Task Related Constraints (ALBTRC'. Certain situations like awkward product construction, simultaneous operations or specific requirements leading to zoning and positional constraints like utilization of common resources as tools, jigs and fixtures are implemented thanks to these supplementary constraints. Additionally, materials handling and tooling costs, distances, set-up and lead times are also reduced. Literature on ALBTRC seems quite rare compared to Classical Line Balancing papers, although ALBTRC is one of the common real life balancing problems. This study aimed to develop and implement a novel line balancing method for a manufacturing concern where known methods are impractical to employ due to some specific positional constraints. 'Largest Candidate Method' known as a simple but effective tool is modified for this purpose first. Then a thorough 'method and time study' is conducted to get the necessary data to utilize that method. As a result, more efficient alternatives are generated and presented to decision maker.
Cancer antigens are expressed in a carcinogen-transformed Bloom syndrome B-lymphoblastoid cell line
International Nuclear Information System (INIS)
Shiraishi, Yukimasa; Soma, Hiroaki
1988-01-01
The authors have cloned malignant cells carrying specific antigens associated with ovarian cancer (OVC) and malignant lymphoma (ML) from BS-SHI-4M cells, a line derived from a 1-methyl-3-nitro-1-nitrosoguanidine-treated B-lymphoblastoid cell line isolated from a patient with Bloom syndrome. Since BS-SHI-4M cells react with sera from various individual cancer patients at relatively low frequencies (2-9%), as detected by an indirect immunofluorescence technique, cell clones that specifically react with sera from patients with OVC and ML were separated by the panning method in which polystyrene dishes were coated with sera from OVC and ML patients and cells with the corresponding antigens bound to the dishes. Subsequent cloning by limiting dilution provided cell clones highly enriched for OVC- and ML-associated antigens. Karyotype analyses revealed that cell clones with OVC and ML antigens had common marker chromosomes. Interestingly, in cell clones with a strong OVC antigen response, the distal part of the Y chromosome (Yq11) was missing in 100% of the cells. Therefore the cell line BS-SHI-4M appears to be a reservoir of cell clones each of which carries a specific tumor antigen and thus provides a potential tool for rapid serological diagnosis of cancer
Investigation of Cytocidal Activity of Bacillus Thuringiensis Parasporal Toxin on CCRF-CEM Cell Line
Directory of Open Access Journals (Sweden)
Elham Moazamian
2013-03-01
Full Text Available Background & Objective: Parasporin is a parasporal protein of Bacillus thuringiensis and exhibits special cytocidal activity against human cancer cells. Similar to other insecticidal Bacillus thuringiensis crystal toxins, parasporin shows target specificity and damages the cellular membrane. In this study, different strains of Bacillus thuringiensis isolated from various regions of Iran and their cytocidal activity against CCRF-CEM cell line and human erythrocyte were investigated. Materials & Methods: Fifty soil samples were collected from different Iranian provinces, and characterization was performed based on protein crystal morphology by phase-contrast microscope and variations of Cry protein toxin using SDS-PAGE. After parasporin was processed with proteinase K, the active form was produced and protein activity on the cell line was evaluated. Results: Parasporal inclusion proteins showed different cytotoxicity against acute lymphoblastic leukemia cells (ALL, but not against normal lymphocyte. Isolated parasporin demonstrated no hemolytic activity against human erythrocyte. It appears that these proteins have the ability to differentiate between normal lymphocytes and leukemia cells and have specific receptors on specific cancer cell lines. Conclusion: Our results provide evidence that the parasporin-producing organism is a common member in Bacillus thuringiensis populations occurring in the natural environments of Iran.
An OCD perspective of line edge and line width roughness metrology
Bonam, Ravi; Muthinti, Raja; Breton, Mary; Liu, Chi-Chun; Sieg, Stuart; Seshadri, Indira; Saulnier, Nicole; Shearer, Jeffrey; Patlolla, Raghuveer; Huang, Huai
2017-03-01
Metrology of nanoscale patterns poses multiple challenges that range from measurement noise, metrology errors, probe size etc. Optical Metrology has gained a lot of significance in the semiconductor industry due to its fast turn around and reliable accuracy, particularly to monitor in-line process variations. Apart from monitoring critical dimension, thickness of films, there are multiple parameters that can be extracted from Optical Metrology models3. Sidewall angles, material compositions etc., can also be modeled to acceptable accuracy. Line edge and Line Width roughness are much sought of metrology following critical dimension and its uniformity, although there has not been much development in them with optical metrology. Scanning Electron Microscopy is still used as a standard metrology technique for assessment of Line Edge and Line Width roughness. In this work we present an assessment of Optical Metrology and its ability to model roughness from a set of structures with intentional jogs to simulate both Line edge and Line width roughness at multiple amplitudes and frequencies. We also present multiple models to represent roughness and extract relevant parameters from Optical metrology. Another critical aspect of optical metrology setup is correlation of measurement to a complementary technique to calibrate models. In this work, we also present comparison of roughness parameters extracted and measured with variation of image processing conditions on a commercially available CD-SEM tool.
Generation of six multiple sclerosis patient-derived induced pluripotent stem cell lines.
Miquel-Serra, L; Duarri, A; Muñoz, Y; Kuebler, B; Aran, B; Costa, C; Martí, M; Comabella, M; Malhotra, S; Montalban, X; Veiga, A; Raya, A
2017-10-01
Multiple sclerosis (MS) is considered a chronic autoimmune disease of the central nervous system that leads to gliosis, demyelination, axonal damage and neuronal death. The MS disease aetiology is unknown, though a polymorphism of the TNFRSF1A gene, rs1800693, is known to confer an increased risk for MS. Using retroviral delivery of reprogramming transgenes, we generated six MS patient-specific iPSC lines with two distinct genotypes, CC or TT, of the polymorphism rs1800693. iPSC lines had normal karyotype, expressed pluripotency genes and differentiated into the three germ layers. These lines offer a good tool to study MS pathomechanisms and for drug testing. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Initial analyses of surface spectral radiance between observations and Line-By-Line calculations
Energy Technology Data Exchange (ETDEWEB)
Brown, P.D.; Clough, S.A. [Atmospheric and Environmental Research, Inc., Cambridge, MA (United States); Miller, N.E.; Shippert, T.R.; Turner, D.D. [Pacific Northwest Lab., Richland, WA (United States)] [and others
1996-04-01
The evaluation an improvement of radiative transfer calculations are essential to attain improved performance of general circulation models (GCMs) for climate change applications. A Quality Measurement Experiment (QME) is being conducted to analyze the spectral residuals between the downwelling longwave radiance measured by the University of Wisconsin Atmospheric Emitted Radiance Interferometer (AERI) and spectral radiance calculated by the Line-By-Line Radiative Transfer Model (LBLRTM). The three critical components of this study are (1) the assessment of the quality of the high resolution AERI measurements, (2) the assessment of the ability to define the atmospheric state in the radiating column, and (3) the evaluation of the capability of LBLRTM. Validations have been performed on spectral radiance data, obtained from April 1994 through July 1994, through the analysis of the spectral interval and physical process. The results are archived as a function of time, enabling the retrieval of specific data and facilitating investigations and diurnal effects, seasonal effects, and longer-term trends. While the initial focus is restricted to clear-sky analyses, efforts are under way to include the effects of clouds and aerosols. Plans are well formulated for the extension of the current approach to the shortwave. An overview of the concept of the QME is described by Miller et al. (1994), and a detailed description of this study is provided by Clough et al. (1994).
Modification of the U-line of the RHIC injection line
International Nuclear Information System (INIS)
Xu, Jianming.
1991-09-01
The parameters of the U-line of the RHIC injection line with low β waist are described. In that lattice, the location of SA is not dispersion free and 14 quadrupoles are needed. This line has been modified to move SA to a dispersion free region (after the 8-degree bend), the length and maximum gradient of quadrupoles have been adjusted to fit the existing quadrupole parameters and the number of quadrupoles is reduced to 12. 2 refs., 3 tabs
Novel strong tissue specific promoter for gene expression in human germ cells
Directory of Open Access Journals (Sweden)
Kuzmin Denis
2010-08-01
Full Text Available Abstract Background Tissue specific promoters may be utilized for a variety of applications, including programmed gene expression in cell types, tissues and organs of interest, for developing different cell culture models or for use in gene therapy. We report a novel, tissue-specific promoter that was identified and engineered from the native upstream regulatory region of the human gene NDUFV1 containing an endogenous retroviral sequence. Results Among seven established human cell lines and five primary cultures, this modified NDUFV1 upstream sequence (mNUS was active only in human undifferentiated germ-derived cells (lines Tera-1 and EP2102, where it demonstrated high promoter activity (~twice greater than that of the SV40 early promoter, and comparable to the routinely used cytomegaloviral promoter. To investigate the potential applicability of the mNUS promoter for biotechnological needs, a construct carrying a recombinant cytosine deaminase (RCD suicide gene under the control of mNUS was tested in cell lines of different tissue origin. High cytotoxic effect of RCD with a cell-death rate ~60% was observed only in germ-derived cells (Tera-1, whereas no effect was seen in a somatic, kidney-derived control cell line (HEK293. In further experiments, we tested mNUS-driven expression of a hyperactive Sleeping Beauty transposase (SB100X. The mNUS-SB100X construct mediated stable transgene insertions exclusively in germ-derived cells, thereby providing further evidence of tissue-specificity of the mNUS promoter. Conclusions We conclude that mNUS may be used as an efficient promoter for tissue-specific gene expression in human germ-derived cells in many applications. Our data also suggest that the 91 bp-long sequence located exactly upstream NDUFV1 transcriptional start site plays a crucial role in the activity of this gene promoter in vitro in the majority of tested cell types (10/12, and an important role - in the rest two cell lines.
Difference in membrane repair capacity between cancer cell lines and a normal cell line
DEFF Research Database (Denmark)
Frandsen, Stine Krog; McNeil, Anna K.; Novak, Ivana
2016-01-01
repair was investigated by disrupting the plasma membrane using laser followed by monitoring fluorescent dye entry over time in seven cancer cell lines, an immortalized cell line, and a normal primary cell line. The kinetics of repair in living cells can be directly recorded using this technique...... cancer cell lines (p immortalized cell line (p
Directory of Open Access Journals (Sweden)
K. Lakota
2018-01-01
Full Text Available Background. RA patients have a higher incidence of cardiovascular diseases compared to the general population. Serum amyloid A (SAA is an acute-phase protein, upregulated in sera of RA patients. Aim. To determine the effects of medications on SAA-stimulated human coronary artery endothelial cells (HCAEC. Methods. HCAEC were preincubated for 2 h with medications from sterile ampules (dexamethasone, methotrexate, certolizumab pegol, and etanercept, dissolved in medium (captopril or DMSO (etoricoxib, rosiglitazone, meloxicam, fluvastatin, and diclofenac. Human recombinant apo-SAA was used to stimulate HCAEC at a final 1000 nM concentration for 24 hours. IL-6, IL-8, sVCAM-1, and PAI-1 were measured by ELISA. The number of viable cells was determined colorimetrically. Results. SAA-stimulated levels of released IL-6, IL-8, and sVCAM-1 from HCAEC were significantly attenuated by methotrexate, fluvastatin, and etoricoxib. Both certolizumab pegol and etanercept significantly decreased PAI-1 by an average of 43%. Rosiglitazone significantly inhibited sVCAM-1 by 58%. Conclusion. We observed marked influence of fluvastatin on lowering cytokine production in SAA-activated HCAEC. Methotrexate showed strong beneficial effects for lowering released Il-6, IL-8, and sVCAM-1. Interesting duality was observed for NSAIDs, with meloxicam exhibiting opposite-trend effects from diclofenac and etoricoxib. This represents unique insight into specific responsiveness of inflammatory-driven HCAEC relevant to atherosclerosis.
Action Intentions: Action Influences Both On-Line Perception and Off-Line Representation
Directory of Open Access Journals (Sweden)
C Kirtley
2014-08-01
Full Text Available Given that one role of vision is to gather information for upcoming tasks, previous studies have investigated whether the preparation for action affects visual behaviour. The current studies aimed to determine if such influences on visual selection would also influence the formation of subsequent memory representations. Two experiments were conducted- in the first, participants' action intentions towards a scene were manipulated by the performance of different grasping postures as they observed the scene. This was followed by a memory test for the objects presented. Participants' eye movements were affected by their action intention, so that performing a power grip led to significantly longer fixation durations on power grip compatible objects. In contrast, memory for the objects and their properties was not affected by the action. Our second study required participants to make the action posture during the recall phase. No effect on eye movements was found, but recall was affected, with a particular advantage for recall of the position of grip-compatible objects. Previous studies have shown that action intentions can affect the on-line perception of objects. The current study suggests this may not extend to off-line representations if they are accessed after the action has been completed or abandoned. However, the recall of information may be affected if gestures are formed during retrieval. Memory representations may not be tailored specifically to an action, but actions can still affect the recall of information.
Isolation of a primate embryonic stem cell line.
Thomson, J A; Kalishman, J; Golos, T G; Durning, M; Harris, C P; Becker, R A; Hearn, J P
1995-01-01
Embryonic stem cells have the ability to remain undifferentiated and proliferate indefinitely in vitro while maintaining the potential to differentiate into derivatives of all three embryonic germ layers. Here we report the derivation of a cloned cell line (R278.5) from a rhesus monkey blastocyst that remains undifferentiated in continuous passage for > 1 year, maintains a normal XY karyotype, and expresses the cell surface markers (alkaline phosphatase, stage-specific embryonic antigen 3, st...
Tunable zero-line modes via magnetic field in bilayer graphene
Wang, Ke; Qiao, Zhenhua
Zero-line modes appear in bilayer graphene at the internal boundary between two opposite vertical electrostatic confinements. These one-dimensional modes are metallic along the boundary and exhibit quantized conductance in the absence of inter-valley scattering. However, experimental results show that the conductance is around 0.5 e2/h rather than quantized. This observation can be explained from our numerical results, which suggest that the scattering between zero-line mode and bound states and the presence of atomic scale disorders that provide inter-valley scattering can effectively reduce the conductance to about 0.5 e2/h. We further find that out-of-plane magnetic field can strongly suppress these scattering mechanisms and gives rise to nearly quantized conductance. On one hand, the presence of magnetic field makes bound states become Landau levels, which reduces the scattering between zero-line mode and bound states. On the other hand, the wave function distributions of oppositely propagating zero-line modes at different valleys are spatially separated, which can strongly suppress the inter-valley scattering. Specifically speaking, the conductance can be increased to 3.2 e2/h at 8 T even when the atomic Anderson type disorders are considered.
Loads specification and embedded plate definition for the ITER cryoline system
Badgujar, S.; Benkheira, L.; Chalifour, M.; Forgeas, A.; Shah, N.; Vaghela, H.; Sarkar, B.
2015-12-01
ITER cryolines (CLs) are complex network of vacuum-insulated multi and single process pipe lines, distributed in three different areas at ITER site. The CLs will support different operating loads during the machine life-time; either considered as nominal, occasional or exceptional. The major loads, which form the design basis are inertial, pressure, temperature, assembly, magnetic, snow, wind, enforced relative displacement and are put together in loads specification. Based on the defined load combinations, conceptual estimation of reaction loads have been carried out for the lines located inside the Tokamak building. Adequate numbers of embedded plates (EPs) per line have been defined and integrated in the building design. The finalization of building EPs to support the lines, before the detailed design, is one of the major design challenges as the usual logic of the design may alter. At the ITER project level, it was important to finalize EPs to allow adequate design and timely availability of the Tokamak building. The paper describes the single loads, load combinations considered in load specification and the approach for conceptual load estimation and selection of EPs for Toroidal Field (TF) Cryoline as an example by converting the load combinations in two main load categories; pressure and seismic.
Liaqat, Iram; Bachmann, Robert Thomas; Sabri, Anjum Nasim; Edyvean, Robert G J
2010-08-01
Dental unit water line (DUWL) contamination by opportunistic pathogens has its significance in nosocomial infection of patients, health care workers, and life-threatening infections to immunocompromized persons. Recently, the quorum sensing (QS) system of DUWL isolates has been found to affect their biofilm-forming ability, making it an attractive target for antimicrobial therapy. In this study, the effect of two quorum-sensing inhibitory compounds (patulin; PAT, penicillic acid; PA) and EDTA on planktonic growth, AI-2 signalling and in vitro biofilm formation of Pseudomonas aeruginosa, Achromobacter xylosoxidans and Achromobacter sp. was monitored. Vibrio harveyi BB170 bioassay and crystal violet staining methods were used to detect the AI-2 monitoring and biofilm formation in DUWL isolates, respectively. The V. harveyi BB170 bioassay failed to induce bioluminescence in A. xylosoxidans and Achromobacter sp., while P. aeruginosa showed AI-2 like activity suggesting the need of some pretreatments prior to bioassay. All strains were found to form biofilms within 72 h of incubation. The QSIs/EDTA combination have isolate-specific effects on biofilm formation and in some cases it stimulated biofilm formation as often as it was inhibited. However, detailed information about the anti-biofilm effect of these compounds is still lacking.
Acoustic power balance in lined ducts
Eversman, W.
1979-01-01
It is shown that the two common definitions of acoustic energy density and intensity in uniform unlined ducts carrying uniform flow are compatible to the extent that both energy densities can be used in an appropriate variational principle to derive the convected wave equation. When the duct walls are lined both energy densities must be modified to account for the wall energy density. This results in a new energy conservation equation which utilizes a modified definition of axial power and accounts for wall dissipation. Computations in specific cases demonstrate the validity of the modified acoustic energy relation.
High voltage transmission lines studies with the use of artificial intelligence
Energy Technology Data Exchange (ETDEWEB)
Ekonomou, L. [A.S.PE.T.E. - School of Pedagogical and Technological Education, Department of Electrical Engineering Educators, N. Heraklion, 141 21 Athens (Greece)
2009-12-15
The paper presents an alternative approach for the studies of high voltage transmission lines based on artificial intelligence and more specifically artificial neural networks (ANNs). In contrast to the existing conventional-analytical techniques and simulations which are using in the calculations empirical and/or approximating equations, this approach is based only on actual field data and actual measurements. The proposed approach is applied on high voltage transmission lines in order to calculate the lightning outages, on grounding systems in order to assess the grounding resistance and on high voltage transmission lines' polluted insulators in order to estimate the critical flashover voltage. The obtained results are very close to the actual ones for all three case studies, something which clearly implies that the ANN approach is well working and has an acceptable accuracy, constituting an additional tool of electric engineers. (author)
Evolution of chemical specifications following the working group of international inter-comparison
International Nuclear Information System (INIS)
Leduc-Brunet, Murielle; Gressier, F.; Mole, D.; Massias, O.; Marescot, O.; Bretelle, Jean Luc
2012-09-01
As part of a continuous improvement process and the inclusion of Experience Feedback, EDF has launched a working group to analyse its reference of Chemical Specifications with regard to the guidelines of EPRI and VGB.. As a result of the analysis of over 1000 lines of specifications, a large number of recommendations were issued, referring either to control of new chemical parameters or to an enhancement of measurement frequencies. These recommendations are to be developed by preliminary studies which will provide supporting evidence for future decisions. To implement these recommendations, EDF launched a dedicated project in 2011, whose main objectives were to: - raise the requirements of chemical specifications in line with international standards and compare the technical basis of the different international standards, - strengthen monitoring and anticipation of corrective actions in the field of plant chemistry with a view to extending nuclear plant lifetime to 60 years. This project, scheduled for 2011 to 2016, covers the following activities: - studies on the technical background of the specifications (2011-14), - study of the possibility of adopting an 'Actions Levels' approach in EDF's own specifications (2012-14), - new propositions evolution of the specifications (2015-16). (authors)
Definition of a matrix of the generalized parameters asymmetrical multiphase transmission lines
Directory of Open Access Journals (Sweden)
Suslov V.M.
2005-12-01
Full Text Available Idle time, without introduction of wave characteristics, algorithm of definition of a matrix of the generalized parameters asymmetrical multiphase transmission lines is offered. Definition of a matrix of parameters is based on a matrix primary specific of parameters of line and simple iterative procedure. The amount of iterations of iterative procedure is determined by a set error of performance of the resulted matrix ratio between separate blocks of a determined matrix. The given error is connected by close image of with a margin error determined matrix.
Specific Ion Effects in Cholesterol Monolayers
Directory of Open Access Journals (Sweden)
Teresa Del Castillo-Santaella
2016-05-01
Full Text Available The interaction of ions with interfaces and, in particular, the high specificity of these interactions to the particular ions considered, are central questions in the field of surface forces. Here we study the effect of different salts (NaI, NaCl, CaCl2 and MgCl2 on monolayers made of cholesterol molecules, both experimentally (surface area vs. lateral pressure isotherms measured by a Langmuir Film Balance and theoretically (molecular dynamics (MD all-atomic simulations. We found that surface isotherms depend, both quantitatively and qualitatively, on the nature of the ions by altering the shape and features of the isotherm. In line with the experiments, MD simulations show clear evidences of specific ionic effects and also provide molecular level details on ion specific interactions with cholesterol. More importantly, MD simulations show that the interaction of a particular ion with the surface depends strongly on its counterion, a feature ignored so far in most theories of specific ionic effects in surface forces.
Impact of patient suicide on front-line staff in Ireland.
LENUS (Irish Health Repository)
Gaffney, Paul
2009-08-01
Research and anecdotal evidence suggests that coming to terms with the suicide of a patient can be extremely distressing for front-line professionals. Some research also suggests that exposure to such situations can undermine professionals\\' functioning and feelings of competence, cause them to question their professional standing and ultimately contribute to burnout. A survey of 447 front-line professionals\\' experiences of patient suicide was undertaken to further explore these issues. Thematic analysis of open-ended questionnaire items revealed that concerns for the bereaved family, feelings of responsibility for the death and having a close therapeutic relationship with the client are key factors that influence the adjustment and coping of a health professional in the aftermath of the death of a client by suicide. The results are discussed with a focus on the impact of suicide on front-line staff, the need for ongoing support and training and the development of specific post-suicide protocols.
Global Conservation of Protein Status between Cell Lines and Xenografts
Directory of Open Access Journals (Sweden)
Julian Biau
2016-08-01
Full Text Available Common preclinical models for testing anticancer treatment include cultured human tumor cell lines in monolayer, and xenografts derived from these cell lines in immunodeficient mice. Our goal was to determine how similar the xenografts are compared with their original cell line and to determine whether it is possible to predict the stability of a xenograft model beforehand. We studied a selection of 89 protein markers of interest in 14 human cell cultures and respective subcutaneous xenografts using the reverse-phase protein array technology. We specifically focused on proteins and posttranslational modifications involved in DNA repair, PI3K pathway, apoptosis, tyrosine kinase signaling, stress, cell cycle, MAPK/ERK signaling, SAPK/JNK signaling, NFκB signaling, and adhesion/cytoskeleton. Using hierarchical clustering, most cell culture-xenograft pairs cluster together, suggesting a global conservation of protein signature. Particularly, Akt, NFkB, EGFR, and Vimentin showed very stable protein expression and phosphorylation levels highlighting that 4 of 10 pathways were highly correlated whatever the model. Other proteins were heterogeneously conserved depending on the cell line. Finally, cell line models with low Akt pathway activation and low levels of Vimentin gave rise to more reliable xenograft models. These results may be useful for the extrapolation of cell culture experiments to in vivo models in novel targeted drug discovery.
AGU has recently established a new customer "support line"—solutions@agu.org—as the point of contact on AGU's staff for members and other individual constituents who have not been able to resolve issues or get questions answered promptly or to their satisfaction through customary channels.Over the past year, there have been many changes at AGU. Unfortunately—and perhaps as a result of these changes—communication with members and individual constituents has suffered. Some individuals report, for example, that e-mail messages are not answered to their satisfaction, or in a timely manner. Instructions on AGU's Web site are unclear in some areas. Problems related specifically to the transition to electronic publishing are cropping up.
Gao, Jun; Che, Dongsheng; Zheng, Vincent W; Zhu, Ruixin; Liu, Qi
2012-07-31
The Hedgehog Signaling Pathway is one of signaling pathways that are very important to embryonic development. The participation of inhibitors in the Hedgehog Signal Pathway can control cell growth and death, and searching novel inhibitors to the functioning of the pathway are in a great demand. As the matter of fact, effective inhibitors could provide efficient therapies for a wide range of malignancies, and targeting such pathway in cells represents a promising new paradigm for cell growth and death control. Current research mainly focuses on the syntheses of the inhibitors of cyclopamine derivatives, which bind specifically to the Smo protein, and can be used for cancer therapy. While quantitatively structure-activity relationship (QSAR) studies have been performed for these compounds among different cell lines, none of them have achieved acceptable results in the prediction of activity values of new compounds. In this study, we proposed a novel collaborative QSAR model for inhibitors of the Hedgehog Signaling Pathway by integration the information from multiple cell lines. Such a model is expected to substantially improve the QSAR ability from single cell lines, and provide useful clues in developing clinically effective inhibitors and modifications of parent lead compounds for target on the Hedgehog Signaling Pathway. In this study, we have presented: (1) a collaborative QSAR model, which is used to integrate information among multiple cell lines to boost the QSAR results, rather than only a single cell line QSAR modeling. Our experiments have shown that the performance of our model is significantly better than single cell line QSAR methods; and (2) an efficient feature selection strategy under such collaborative environment, which can derive the commonly important features related to the entire given cell lines, while simultaneously showing their specific contributions to a specific cell-line. Based on feature selection results, we have proposed several
Marketing klubu HC Olomouc zaměřený na on-line komunikaci
Kramář, Josef
2015-01-01
The theoretical part of this Bachelor Thesis on the topic "Marketing of Ice-hockey club Olomouc focusing on on-line communication" has got the aim of introducing general marketing, internet marketing, social sites on the internet and also the specifics of sports marketing. The practical part then introduces the Ice-hockey club Olomouc, assesses the current state of its on-line marketing communication and shows a comparison with its competitors on social sites. There will be also a questionnai...
Purity, adulteration and price of drugs bought on-line versus off-line in the Netherlands.
van der Gouwe, Daan; Brunt, Tibor M; van Laar, Margriet; van der Pol, Peggy
2017-04-01
On-line drug markets flourish and consumers have high expectations of on-line quality and drug value. The aim of this study was to (i) describe on-line drug purchases and (ii) compare on-line with off-line purchased drugs regarding purity, adulteration and price. Comparison of laboratory analyses of 32 663 drug consumer samples (stimulants and hallucinogens) purchased between January 2013 and January 2016, 928 of which were bought on-line. The Netherlands. Primary outcome measures were (i) the percentage of samples purchased on-line and (ii) the chemical purity of powders (or dosage per tablet); adulteration; and the price per gram, blotter or tablet of drugs bought on-line compared with drugs bought off-line. The proportion of drug samples purchased on-line increased from 1.4% in 2013 to 4.1% in 2015. The frequency varied widely, from a maximum of 6% for controlled, traditional substances [ecstasy tablets, 3,4-methylenedioxy-methamphetamine (MDMA) powder, amphetamine powder, cocaine powder, 4-bromo-2,5-dimethoxyphenethylamine (2C-B) and lysergic acid diethylamide (LSD)] to more than a third for new psychoactive substances (NPS) [4-fluoroamphetamine (4-FA), 5/6-(2-aminopropyl)benzofuran (5/6-APB) and methoxetamine (MXE)]. There were no large differences in drug purity, yet small but statistically significant differences were found for 4-FA (on-line 59% versus off-line 52% purity for 4-FA on average, P = 0.001), MDMA powders (45 versus 61% purity for MDMA, P = 0.02), 2C-B tablets (21 versus 10 mg 2C-B/tablet dosage, P = 0.49) and ecstasy tablets (131 versus 121 mg MDMA/tablet dosage, P = 0.05). The proportion of adulterated samples purchased on-line and off-line did not differ, except for 4-FA powder, being less adulterated on-line (χ 2 = 8.3; P < 0.02). Drug prices were mainly higher on-line, ranging for various drugs from 10 to 23% higher than that of drugs purchased off-line (six of 10 substances: P < 0.05). Dutch drug users increasingly
Quantum Walks on the Line with Phase Parameters
Villagra, Marcos; Nakanishi, Masaki; Yamashita, Shigeru; Nakashima, Yasuhiko
In this paper, a study on discrete-time coined quantum walks on the line is presented. Clear mathematical foundations are still lacking for this quantum walk model. As a step toward this objective, the following question is being addressed: Given a graph, what is the probability that a quantum walk arrives at a given vertex after some number of steps? This is a very natural question, and for random walks it can be answered by several different combinatorial arguments. For quantum walks this is a highly non-trivial task. Furthermore, this was only achieved before for one specific coin operator (Hadamard operator) for walks on the line. Even considering only walks on lines, generalizing these computations to a general SU(2) coin operator is a complex task. The main contribution is a closed-form formula for the amplitudes of the state of the walk (which includes the question above) for a general symmetric SU(2) operator for walks on the line. To this end, a coin operator with parameters that alters the phase of the state of the walk is defined. Then, closed-form solutions are computed by means of Fourier analysis and asymptotic approximation methods. We also present some basic properties of the walk which can be deducted using weak convergence theorems for quantum walks. In particular, the support of the induced probability distribution of the walk is calculated. Then, it is shown how changing the parameters in the coin operator affects the resulting probability distribution.
Service Line Management: A New Paradigm in Health Care System
Directory of Open Access Journals (Sweden)
Rafat Rezapour Nasrabad
2016-12-01
Full Text Available Health care organizations are required to implement modern management practices and approaches due to the importance of improving quality and increasing efficiency of health care services. Service line management of healthcare services is one of the new approaches that managers of health sectors are interested in. The “service line” approach will organize the management of inpatient and outpatient in clinical services focusing on patient diagnostic clusters. Services specific in each patient diagnostic cluster will be offered by a multidisciplinary team including nurses, physicians, and so no. Accordingly, the present study aims to evaluate the features, process and benefits of service line management approach in the provision of health services. In this descriptive study, internal and external scientific database have been reviewed and the necessary data have been extracted from the latest research projects and related scientific documents. The results showed that the new management approach is based on a paradigm shift from traditional health care system management to healthcare service line management with a focus on managers’ competencies. Four specific manager’s competencies in this new management model are: conceptual, collaborative, interpersonal, and leadership competencies. Theses competencies should be developed in health system managers so as to lead to organizational excellency and improvement of health service quality. The health sector managers should strengthen these four key competencies and act on them. Then they will become effective leaders and managers in the health system.
Feary, Marc; Racher, Andrew J; Young, Robert J; Smales, C Mark
2017-01-01
In Lonza Biologics' GS Gene Expression System™, recombinant protein-producing GS-CHOK1SV cell lines are generated by transfection with an expression vector encoding both GS and the protein product genes followed by selection in MSX and glutamine-free medium. MSX is required to inhibit endogenous CHOK1SV GS, and in effect create a glutamine auxotrophy in the host that can be complemented by the expression vector encoded GS in selected cell lines. However, MSX is not a specific inhibitor of GS as it also inhibits the activity of GCL (a key enzyme in the glutathione biosynthesis pathway) to a similar extent. Glutathione species (GSH and GSSG) have been shown to provide both oxidizing and reducing equivalents to ER-resident oxidoreductases, raising the possibility that selection for transfectants with increased GCL expression could result in the isolation of GS-CHOKISV cell lines with improved capacity for recombinant protein production. In this study we have begun to address the relationship between MSX supplementation, the amount of intracellular GCL subunit and mAb production from a panel of GS-CHOK1SV cell lines. We then evaluated the influence of reduced GCL activity on batch culture of an industrially relevant mAb-producing GS-CHOK1SV cell line. To the best of our knowledge, this paper describes for the first time the change in expression of GCL subunits and recombinant mAb production in these cell lines with the degree of MSX supplementation in routine subculture. Our data also shows that partial inhibition of GCL activity in medium containing 75 µM MSX increases mAb productivity, and its more specific inhibitor BSO used at a concentration of 80 µM in medium increases the specific rate of mAb production eight-fold and the concentration in harvest medium by two-fold. These findings support a link between the inhibition of glutathione biosynthesis and recombinant protein production in industrially relevant systems and provide a process-driven method for
Subtype and pathway specific responses to anticancer compounds in breast cancer.
Heiser, Laura M; Sadanandam, Anguraj; Kuo, Wen-Lin; Benz, Stephen C; Goldstein, Theodore C; Ng, Sam; Gibb, William J; Wang, Nicholas J; Ziyad, Safiyyah; Tong, Frances; Bayani, Nora; Hu, Zhi; Billig, Jessica I; Dueregger, Andrea; Lewis, Sophia; Jakkula, Lakshmi; Korkola, James E; Durinck, Steffen; Pepin, François; Guan, Yinghui; Purdom, Elizabeth; Neuvial, Pierre; Bengtsson, Henrik; Wood, Kenneth W; Smith, Peter G; Vassilev, Lyubomir T; Hennessy, Bryan T; Greshock, Joel; Bachman, Kurtis E; Hardwicke, Mary Ann; Park, John W; Marton, Laurence J; Wolf, Denise M; Collisson, Eric A; Neve, Richard M; Mills, Gordon B; Speed, Terence P; Feiler, Heidi S; Wooster, Richard F; Haussler, David; Stuart, Joshua M; Gray, Joe W; Spellman, Paul T
2012-02-21
Breast cancers are comprised of molecularly distinct subtypes that may respond differently to pathway-targeted therapies now under development. Collections of breast cancer cell lines mirror many of the molecular subtypes and pathways found in tumors, suggesting that treatment of cell lines with candidate therapeutic compounds can guide identification of associations between molecular subtypes, pathways, and drug response. In a test of 77 therapeutic compounds, nearly all drugs showed differential responses across these cell lines, and approximately one third showed subtype-, pathway-, and/or genomic aberration-specific responses. These observations suggest mechanisms of response and resistance and may inform efforts to develop molecular assays that predict clinical response.
Crossing the LINE toward genomic instability: LINE-1 retrotransposition in cancer
Kemp, Jacqueline; Longworth, Michelle
2015-12-01
Retrotransposons are repetitive DNA sequences that are positioned throughout the human genome. Retrotransposons are capable of copying themselves and mobilizing new copies to novel genomic locations in a process called retrotransposition. While most retrotransposon sequences in the human genome are incomplete and incapable of mobilization, the LINE-1 retrotransposon, which comprises approximately 17% of the human genome, remains active. The disruption of cellular mechanisms that suppress retrotransposon activity is linked to the generation of aneuploidy, a potential driver of tumor development. When retrotransposons insert into a novel genomic region, they have the potential to disrupt the coding sequence of endogenous genes and alter gene expression, which can lead to deleterious consequences for the organism. Additionally, increased LINE-1 copy numbers provide more chances for recombination events to occur between retrotransposons, which can lead to chromosomal breaks and rearrangements. LINE-1 activity is increased in various cancer cell lines and in patient tissues resected from primary tumors. LINE-1 activity also correlates with increased cancer metastasis. This review aims to give a brief overview of the connections between LINE-1 retrotransposition and the loss of genome stability. We will also discuss the mechanisms that repress retrotransposition in human cells and their links to cancer.
Molecular characterization of breast cancer cell lines through multiple omic approaches.
Smith, Shari E; Mellor, Paul; Ward, Alison K; Kendall, Stephanie; McDonald, Megan; Vizeacoumar, Frederick S; Vizeacoumar, Franco J; Napper, Scott; Anderson, Deborah H
2017-06-05
Breast cancer cell lines are frequently used as model systems to study the cellular properties and biology of breast cancer. Our objective was to characterize a large, commonly employed panel of breast cancer cell lines obtained from the American Type Culture Collection (ATCC 30-4500 K) to enable researchers to make more informed decisions in selecting cell lines for specific studies. Information about these cell lines was obtained from a wide variety of sources. In addition, new information about cellular pathways that are activated within each cell line was generated. We determined key protein expression data using immunoblot analyses. In addition, two analyses on serum-starved cells were carried out to identify cellular proteins and pathways that are activated in these cells. These analyses were performed using a commercial PathScan array and a novel and more extensive phosphopeptide-based kinome analysis that queries 1290 phosphorylation events in major signaling pathways. Data about this panel of breast cancer cell lines was also accessed from several online sources, compiled and summarized for the following areas: molecular classification, mRNA expression, mutational status of key proteins and other possible cancer-associated mutations, and the tumorigenic and metastatic capacity in mouse xenograft models of breast cancer. The cell lines that were characterized included 10 estrogen receptor (ER)-positive, 12 human epidermal growth factor receptor 2 (HER2)-amplified and 18 triple negative breast cancer cell lines, in addition to 4 non-tumorigenic breast cell lines. Within each subtype, there was significant genetic heterogeneity that could impact both the selection of model cell lines and the interpretation of the results obtained. To capture the net activation of key signaling pathways as a result of these mutational combinations, profiled pathway activation status was examined. This provided further clarity for which cell lines were particularly deregulated
Line Balancing Using Largest Candidate Rule Algorithm In A Garment Industry: A Case Study
Directory of Open Access Journals (Sweden)
V. P.Jaganathan
2014-12-01
Full Text Available The emergence of fast changes in fashion has given rise to the need to shorten production cycle times in the garment industry. As effective usage of resources has a significant effect on the productivity and efficiency of production operations, garment manufacturers are urged to utilize their resources effectively in order to meet dynamic customer demand. This paper focuses specifically on line balancing and layout modification. The aim of assembly line balance in sewing lines is to assign tasks to the workstations, so that the machines of the workstation can perform the assigned tasks with a balanced loading. Largest Candidate Rule Algorithm (LCR has been deployed in this paper.
Derivation of novel genetically diverse human embryonic stem cell lines.
Stefanova, Valentina T; Grifo, James A; Hansis, Christoph
2012-06-10
Human embryonic stem cells (hESCs) have the potential to revolutionize many biomedical fields ranging from basic research to disease modeling, regenerative medicine, drug discovery, and toxicity testing. A multitude of hESC lines have been derived worldwide since the first 5 lines by Thomson et al. 13 years ago, but many of these are poorly characterized, unavailable, or do not represent desired traits, thus making them unsuitable for application purposes. In order to provide the scientific community with better options, we have derived 12 new hESC lines at New York University from discarded genetically normal and abnormal embryos using the latest techniques. We examined the genetic status of the NYUES lines in detail as well as their molecular and cellular features and DNA fingerprinting profile. Furthermore, we differentiated our hESCs into the tissues most affected by a specific condition or into clinically desired cell types. To our knowledge, a number of characteristics of our hESCs have not been previously reported, for example, mutation for alpha thalassemia X-linked mental retardation syndrome, linkage to conditions with a genetic component such as asthma or poor sperm morphology, and novel combinations of ethnic backgrounds. Importantly, all of our undifferentiated euploid female lines tested to date did not show X chromosome inactivation, believed to result in superior potency. We continue to derive new hESC lines and add them to the NIH registry and other registries. This should facilitate the use of our hESCs and lead to advancements for patient-benefitting applications.
Theoretical Atomic Physics code development IV: LINES, A code for computing atomic line spectra
International Nuclear Information System (INIS)
Abdallah, J. Jr.; Clark, R.E.H.
1988-12-01
A new computer program, LINES, has been developed for simulating atomic line emission and absorption spectra using the accurate fine structure energy levels and transition strengths calculated by the (CATS) Cowan Atomic Structure code. Population distributions for the ion stages are obtained in LINES by using the Local Thermodynamic Equilibrium (LTE) model. LINES is also useful for displaying the pertinent atomic data generated by CATS. This report describes the use of LINES. Both CATS and LINES are part of the Theoretical Atomic PhysicS (TAPS) code development effort at Los Alamos. 11 refs., 9 figs., 1 tab
Proceedings of the 9. international symposium on power-line communications and its applications
Energy Technology Data Exchange (ETDEWEB)
Lampe, L. (comp.) [British Columbia Univ., Vancouver, BC (Canada). Dept. of Electrical and Computer Engineering
2005-07-01
The 2005 International Symposium on Power Line Communications and Its Applications (ISPLC 2005) is the leading international scientific conference on technology and applications for communication over power lines. The conference addresses the latest technological advances in power-line communications and current and future applications of power-line communication systems including broadband Internet access, indoor home networking, power-line based communications in vehicles, power-line control networks, and automatic meter reading systems. Specific conference papers included measurements, channel characterization and modeling; standards and regulations; electromagnetic compatibility; information and communication theory; modulation and error-control coding techniques; single carrier, OFDM, and spread spectrum techniques; detection, estimation, and iterative processing techniques; signal processing algorithms and devices; multiple-access techniques; modem and LSI design; networks and protocols; system architectures; automatic meter reading systems; applications and services; and, experimental systems and field trials. A total of 90 papers were featured and organized into 14 regular sessions and one poster session. Seven of these presentations have been catalogued separately for inclusion in this database. In addition to the technical program, 3 keynotes speeches and 2 panel discussions were presented and chaired by distinguished speakers and moderators. tabs., figs.
Liu, Huitao; Cui, Peng; Zhan, Kehui; Lin, Qiang; Zhuo, Guoyin; Guo, Xiaoli; Ding, Feng; Yang, Wenlong; Liu, Dongcheng; Hu, Songnian; Yu, Jun; Zhang, Aimin
2011-03-29
Plant mitochondria, semiautonomous organelles that function as manufacturers of cellular ATP, have their own genome that has a slow rate of evolution and rapid rearrangement. Cytoplasmic male sterility (CMS), a common phenotype in higher plants, is closely associated with rearrangements in mitochondrial DNA (mtDNA), and is widely used to produce F1 hybrid seeds in a variety of valuable crop species. Novel chimeric genes deduced from mtDNA rearrangements causing CMS have been identified in several plants, such as rice, sunflower, pepper, and rapeseed, but there are very few reports about mtDNA rearrangements in wheat. In the present work, we describe the mitochondrial genome of a wheat K-type CMS line and compare it with its maintainer line. The complete mtDNA sequence of a wheat K-type (with cytoplasm of Aegilops kotschyi) CMS line, Ks3, was assembled into a master circle (MC) molecule of 647,559 bp and found to harbor 34 known protein-coding genes, three rRNAs (18 S, 26 S, and 5 S rRNAs), and 16 different tRNAs. Compared to our previously published sequence of a K-type maintainer line, Km3, we detected Ks3-specific mtDNA (> 100 bp, 11.38%) and repeats (> 100 bp, 29 units) as well as genes that are unique to each line: rpl5 was missing in Ks3 and trnH was absent from Km3. We also defined 32 single nucleotide polymorphisms (SNPs) in 13 protein-coding, albeit functionally irrelevant, genes, and predicted 22 unique ORFs in Ks3, representing potential candidates for K-type CMS. All these sequence variations are candidates for involvement in CMS. A comparative analysis of the mtDNA of several angiosperms, including those from Ks3, Km3, rice, maize, Arabidopsis thaliana, and rapeseed, showed that non-coding sequences of higher plants had mostly divergent multiple reorganizations during the mtDNA evolution of higher plants. The complete mitochondrial genome of the wheat K-type CMS line Ks3 is very different from that of its maintainer line Km3, especially in non
Directory of Open Access Journals (Sweden)
Liu Dongcheng
2011-03-01
Full Text Available Abstract Background Plant mitochondria, semiautonomous organelles that function as manufacturers of cellular ATP, have their own genome that has a slow rate of evolution and rapid rearrangement. Cytoplasmic male sterility (CMS, a common phenotype in higher plants, is closely associated with rearrangements in mitochondrial DNA (mtDNA, and is widely used to produce F1 hybrid seeds in a variety of valuable crop species. Novel chimeric genes deduced from mtDNA rearrangements causing CMS have been identified in several plants, such as rice, sunflower, pepper, and rapeseed, but there are very few reports about mtDNA rearrangements in wheat. In the present work, we describe the mitochondrial genome of a wheat K-type CMS line and compare it with its maintainer line. Results The complete mtDNA sequence of a wheat K-type (with cytoplasm of Aegilops kotschyi CMS line, Ks3, was assembled into a master circle (MC molecule of 647,559 bp and found to harbor 34 known protein-coding genes, three rRNAs (18 S, 26 S, and 5 S rRNAs, and 16 different tRNAs. Compared to our previously published sequence of a K-type maintainer line, Km3, we detected Ks3-specific mtDNA (> 100 bp, 11.38% and repeats (> 100 bp, 29 units as well as genes that are unique to each line: rpl5 was missing in Ks3 and trnH was absent from Km3. We also defined 32 single nucleotide polymorphisms (SNPs in 13 protein-coding, albeit functionally irrelevant, genes, and predicted 22 unique ORFs in Ks3, representing potential candidates for K-type CMS. All these sequence variations are candidates for involvement in CMS. A comparative analysis of the mtDNA of several angiosperms, including those from Ks3, Km3, rice, maize, Arabidopsis thaliana, and rapeseed, showed that non-coding sequences of higher plants had mostly divergent multiple reorganizations during the mtDNA evolution of higher plants. Conclusion The complete mitochondrial genome of the wheat K-type CMS line Ks3 is very different from that of
Recommendation for a set of solar EUV lines to be monitored for aeronomy applications
Directory of Open Access Journals (Sweden)
J. Lilensten
2007-06-01
Full Text Available In two recent studies, Dudok de Wit et al. (2005 and Kretzschmar et al. (2006 have shown that the solar Ultra-Violet spectrum between 25 and 195 nm can be reconstructed from the observation of a set of 6 to 10 carefully chosen spectral lines. The best set of lines, however, is application dependent. In this study, we demonstrate that a good candidate for aeronomy applications consists of the following 6 lines: H I at 102.572 nm, C III at 97.702 nm, O V at 62.973 nm, He I at 58.433 nm, Fe XV at 28.415 nm and He II at 30.378 nm. The TRANSCAR model is used to quantify the impact of each individual line on the density, temperature and velocity profiles. Using a multidimensional scaling technique, we show how to select from this the best set of lines. Although this selection is motivated by the specification of the ionosphere, our set of lines is also found to be appropriate for reconstructing the variability of the solar spectrum between 25 and 195 nm.
Modal Transition Systems as the Basis for Interface Theories and Product Lines
DEFF Research Database (Denmark)
Nyman, Ulrik
and a subset of modal transition systems is proved. The developed interface theory, which can describe liveness properties, is also applied as a behavioral variability theory for product line development. The two last papers of the thesis concern themselves with modal and mixed transition systems. The first....... It also proves PSPACE-hardness for consistency of mixed specifications and establishes a number of reductions between the different decision problems. Keywords: Modeling, Software Product Lines, Embedded Software, Modal Refinement, Labeled Transition Systems, Modal Transition Systems, Mixed Transition......This thesis presents research taking its outset in component-based software development, interface theory and software product lines, as well as modeling formalisms for describing component based software systems and their interfaces. The main part of the thesis consists of five papers. The first...
Second-line failure and first experience with third-line antiretroviral therapy in Mumbai, India
Directory of Open Access Journals (Sweden)
Samsuddin Khan
2014-07-01
Full Text Available Background: There are limited data on the failure of second-line antiretroviral therapy (ART and the use of third-line ART in people living with HIV in resource-limited settings. Since 2011, the Médecins Sans Frontières (MSF HIV/tuberculosis programme in Mumbai, India, has been providing third-line ART to patients in care. Objective: To describe the experiences and programmatic challenges during management of suspected second-line ART failure and third-line ART therapy for patients living with HIV, including the use of HIV viral load (VL testing. Design: This was a retrospective, observational cohort study of patients with suspected second-line ART treatment failure, who were followed for at least 12 months between January 2011 and March 2014. Results: A total of 47 patients with suspected second-line failure met the inclusion criteria during the study period. Twenty-nine of them (62% responded to enhanced adherence support, had a subsequent undetectable VL after a median duration of 3 months and remained on second-line ART. The other 18 patients had to be initiated on a third-line ART regimen, which consisted of darunavir–ritonavir, raltegravir, and one or more appropriate nucleoside or nucleotide reverse transcriptase inhibitors, based on the results of HIV genotype testing. Of the 13 patients for whom follow-up VL results were available, 11 achieved virological suppression after a median duration of 3 months on third-line ART (interquartile range: 2.5–3.0. No serious treatment-related adverse events were recorded. Conclusions: With intensive counselling and adherence support in those suspected of failing second-line ART, unnecessary switching to more expensive third-line ART can be averted in the majority of cases. However, there is an increasing need for access to third-line ART medications such as darunavir and raltegravir, for which national ART programmes should be prepared. The cost of such medications and inadequate access to VL
International Nuclear Information System (INIS)
Yan, D.; Birkner, M.; Nuesslin, F.; Wong, J.; Martinez, A.
2001-01-01
Purpose: To test the capability of dose escalation in the IMRT process where the organ/patient temporal geometric variation, measured using either off-line or on-line treatment CT and portal images, are adapted for the optimal design of intensity modulated beam. Materials and Methods: Retrospective study was performed on five prostate cancer patients with multiple CT scans (14∼17/patient) and daily portal images obtained during the treatment course. These images were used to determine the displacements of each subvolume in the organs of interest caused by the daily patient setup and internal organ motion/deformation. The temporal geometric information was processed in order of treatment time and fed into an inverse planning system. The inverse planning engine was specifically implemented to adapt the design of intensity modulated beam to the temporal subvolume displacement and patient internal density changes. Three image feedback strategies were applied to each patient and evaluated with respect to the capability of safe dose escalation. The first one is off-line image feedback, which designs the beam intensity based on the patient images measured within the first week of treatment. The second is an on-line 'the target of the day' strategy, which designs the beam intensity in daily bases by using 'the image of the day' alone. The last one is also the on-line based. However, it designs the instantaneous beam intensity based on also dose distribution in each organ of interest received prior to the current treatment. For each of the treatment strategies, the minimum dose delivered to the CTV was determined by applying the identical normal tissue constraints of partial dose/volumes. This minimum dose was used to represent the treatment dose for each patient. Results: The off-line strategy appears feasible after 5 days of image feedback. The average treatment dose among the patients can be 10% higher than the one in the conventional IMRT treatment where the inverse
Survey of transmission line corridors. [Data on delays in transmission line construction
Energy Technology Data Exchange (ETDEWEB)
1979-01-05
The intent of this study is to determine the extent of delays experienced in planning and constructing transmission lines in the continental United States. The reasons for the delays are identified for each line studied and their effect on the total electrical system is sought. Data was collected for 136 different lines either recently built or currently under study. Statistics were developed for each line in several categories and comparisons of lines delayed were made by company, area served and generation capacity. From the study presented here it was found that: right-of-way acquisition procedures including condemnation and easement negotiation practices delay more projects than local, state and federal regulatory requirements combined; load growth reductions particularly in the east have reduced the impact of regulatory delays; the south, southeast and southwestern areas of the country experience fewer delays in constructing transmission lines than the more populated states, and the cost for corridor delays was responded to for only 17 of the 142 projects surveyed. By far the most costly delay is the expense of condemning land for transmission right-of-way.
Directory of Open Access Journals (Sweden)
Minas Bakalchev
2015-10-01
Full Text Available The perception of elements in a system often creates their interdependence, interconditionality, and suppression. The lines from a basic geometrical element have become the model of a reductive world based on isolation according to certain criteria such as function, structure, and social organization. Their traces are experienced in the contemporary world as fragments or ruins of a system of domination of an assumed hierarchical unity. How can one release oneself from such dependence or determinism? How can the lines become less “systematic” and forms more autonomous, and less reductive? How is a form released from modernistic determinism on the new controversial ground? How can these elements or forms of representation become forms of action in the present complex world? In this paper, the meaning of lines through the ideas of Le Corbusier, Leonidov, Picasso, and Hitchcock is presented. Spatial research was made through a series of examples arising from the projects of the architectural studio “Residential Transformations”, which was a backbone for mapping the possibilities ranging from playfulness to exactness, as tactics of transformation in the different contexts of the contemporary world.
Debowski, Katharina; Drummer, Charis; Lentes, Jana; Cors, Maren; Dressel, Ralf; Lingner, Thomas; Salinas-Riester, Gabriela; Fuchs, Sigrid; Sasaki, Erika; Behr, Rüdiger
2016-07-07
Embryonic stem cells (ESCs) are useful for the study of embryonic development. However, since research on naturally conceived human embryos is limited, non-human primate (NHP) embryos and NHP ESCs represent an excellent alternative to the corresponding human entities. Though, ESC lines derived from naturally conceived NHP embryos are still very rare. Here, we report the generation and characterization of four novel ESC lines derived from natural preimplantation embryos of the common marmoset monkey (Callithrix jacchus). For the first time we document derivation of NHP ESCs derived from morula stages. We show that quantitative chromosome-wise transcriptome analyses precisely reflect trisomies present in both morula-derived ESC lines. We also demonstrate that the female ESC lines exhibit different states of X-inactivation which is impressively reflected by the abundance of the lncRNA X inactive-specific transcript (XIST). The novel marmoset ESC lines will promote basic primate embryo and ESC studies as well as preclinical testing of ESC-based regenerative approaches in NHP.
Directory of Open Access Journals (Sweden)
Jun-Bean Park
Full Text Available The role and underlying mechanisms of rosiglitazone, a peroxisome proliferator-activated receptor-gamma (PPAR-γ agonist, on myocardial infarction are poorly understood. We investigated the effects of this PPAR-γ agonist on the expression of tissue factor (TF, a primary molecule for thrombosis, and elucidated its underlying mechanisms. The PPAR-γ agonist inhibited TF expression in response to TNF-α in human umbilical vein endothelial cells, human monocytic leukemia cell line, and human umbilical arterial smooth muscle cells. The overexpression of TF was mediated by increased phosphorylation of mitogen-activated protein kinase (MAPK, which was blocked by the PPAR-γ agonist. The effective MAPK differed depending on each cell type. Luciferase and ChIP assays showed that transcription factor, activator protein-1 (AP-1, was a pivotal target of the PPAR-γ agonist to lower TF transcription. Intriguingly, two main drugs for drug-eluting stent, paclitaxel or rapamycin, significantly exaggerated thrombin-induced TF expression, which was also effectively blocked by the PPAR-γ agonist in all cell types. This PPAR-γ agonist did not impair TF pathway inhibitor (TFPI in three cell types. In rat balloon injury model (Sprague-Dawley rats, n = 10/group with continuous paclitaxel infusion, the PPAR-γ agonist attenuated TF expression by 70±5% (n = 4; P<0.0001 in injured vasculature. Taken together, rosiglitazone reduced TF expression in three critical cell types involved in vascular thrombus formation via MAPK and AP-1 inhibitions. Also, this PPAR-γ agonist reversed the paclitaxel-induced aggravation of TF expression, which suggests a possibility that the benefits might outweigh its risks in a group of patients with paclitaxel-eluting stent implanted.
Sun, Changhong; Fan, Yu; Li, Juan; Wang, Gancheng; Zhang, Hanshuo; Xi, Jianzhong Jeff
2015-02-01
Transcription activator-like effectors (TALEs) are becoming powerful DNA-targeting tools in a variety of mammalian cells and model organisms. However, generating a stable cell line with specific gene mutations in a simple and rapid manner remains a challenging task. Here, we report a new method to efficiently produce monoclonal cells using integrated TALE nuclease technology and a series of high-throughput cell cloning approaches. Following this method, we obtained three mTOR mutant 293T cell lines within 2 months, which included one homozygous mutant line. © 2014 Society for Laboratory Automation and Screening.
Witten, Ilana B; Steinberg, Elizabeth E; Lee, Soo Yeun; Davidson, Thomas J; Zalocusky, Kelly A; Brodsky, Matthew; Yizhar, Ofer; Cho, Saemi L; Gong, Shiaoching; Ramakrishnan, Charu; Stuber, Garret D; Tye, Kay M; Janak, Patricia H; Deisseroth, Karl
2011-12-08
Currently there is no general approach for achieving specific optogenetic control of genetically defined cell types in rats, which provide a powerful experimental system for numerous established neurophysiological and behavioral paradigms. To overcome this challenge we have generated genetically restricted recombinase-driver rat lines suitable for driving gene expression in specific cell types, expressing Cre recombinase under the control of large genomic regulatory regions (200-300 kb). Multiple tyrosine hydroxylase (Th)::Cre and choline acetyltransferase (Chat)::Cre lines were produced that exhibited specific opsin expression in targeted cell types. We additionally developed methods for utilizing optogenetic tools in freely moving rats and leveraged these technologies to clarify the causal relationship between dopamine (DA) neuron firing and positive reinforcement, observing that optical stimulation of DA neurons in the ventral tegmental area (VTA) of Th::Cre rats is sufficient to support vigorous intracranial self-stimulation (ICSS). These studies complement existing targeting approaches by extending the generalizability of optogenetics to traditionally non-genetically-tractable but vital animal models. Copyright © 2011 Elsevier Inc. All rights reserved.
Reengineering a PC-based System into the Mobile Device Product Line
DEFF Research Database (Denmark)
Zhang, Weishan; Jarzabek, Stanislaw; Loughran, Neil
2003-01-01
There is a growing demand to port existing PC-based software systems to mobile device platforms. Systems running on mobile devices share basic characteristics with their PC-based counterparts, but differ from them in details of user interfaces, application models, etc. Systems running on mobile...... devices must also perform well using less memory than PC-based systems. Mobile devices themselves are different from each other in many ways, too. We describe how we made an existing PC-based City Guide System available on a wide range of mobile devices, in a cost-effective way. We applied "reengineering...... into a product line architecture" approach to achieve the goal. Our product line architecture facilitates reuse via generation. We generate specific City Guide Systems for target platforms including PC, Pocket PC and other mobile devices, from generic meta-components that form the City Guide System product line...
Development of a Gastroretentive Drug Delivery System based on ...
African Journals Online (AJOL)
Erah
Degradation kinetics showed that chitosan superporous hydrogels had good water retention ... polymer chain, it dissolves in acidic solution and forms a gel with ... Rosiglitazone, an anti-diabetic agent, improves ... EXPERIMENTAL. Materials.
Transmission Lines or Poles, Electric - VOLUSIA COUNTY MAJOR POWER LINES (Arcs)
NSGIC Local Govt | GIS Inventory — Volusia County Power Line data was aggregated by using parcel data and visual inspection of 2005 aerial photography to determine centerline of Power Lines Right of...
A longitudinally-pumped laser (specifically, pulse-pumped lasers)
Energy Technology Data Exchange (ETDEWEB)
Wojtkowiak, J
1979-10-15
A laser is proposed that employs travelling-wave pumping, for which no less than four electrodes, interconnected with coaxial transmission lines with a feed network, are placed at specific distances from each other in a discharge channel filled with an active medium. An expression is given for determining the length of the coaxial sections.
[Mucous retention cysts of the minor salivary glands. A specific type of mucocele].
Kakarantza-Angelopoulou, E; Triantaphyllou, A
1989-08-01
The mucous retention cyst of the minor salivary glands represent a specific type of oral mucocele which is lined by epithelium. It is caused probably from partial or complete obstruction of a duct. It affects older patients (over 40 years of age) most commonly women and it is located in different sites than the ordinary mucocele. In this paper we studied the histologic and histochemical features of four cases. The lining epithelium varied from cuboidal to columnar or flattened. Among the cells of the lining epithelium oncocytes were observed.
Energy Technology Data Exchange (ETDEWEB)
Serodio, Conrado Jose Morbach [GDK Engenharia, Salvador, BA (Brazil)
2003-07-01
The construction of the natural gas flow lines and export lines system of the Sabalo field, in the far South of Bolivia is an unique job in the pipeline construction area. Its execution is a turning point in terms of engineering and construction technology in this industry. Among the Aguarague Cordillera (mountains), it runs across rocky canyons for more than 5 km, a 2.100 mt long narrow tunnel to overcome the mountains and steep hills along all the ROW length, with a total extension of 70 km, in line pipes ranging from 10'' and 12'' for the flow lines, 28'' for the gas export line and 8' for the condensate line. An integrated construction work plan was settled in order to face and overcome the complex construction situations found in every feet of the pipeline. Four simultaneous work sites were mobilized, 8 independent work fronts, 700 professionals and more than 150 pieces of heavy construction equipment, brought from 3 different countries. Special techniques were adopted also to handle the challenging detail engineering . All in all, the correct conjunction of a sound engineering work, planning, human resources and equipment and the managing flexibility to create alternatives and solutions at the fast pace required by a dynamic work schedule were essential to succeed, in a job with no room for mistakes. The successfully job completion open new possibilities to other challenging projects alike.(author)
Alternate Double Single Track Lines
Energy Technology Data Exchange (ETDEWEB)
Moraga Contreras, P.; Grande Andrade, Z.; Castillo Ron, E.
2016-07-01
The paper discusses the advantages and shortcomings of alternate double single track (ADST) lines with respect to double track lines for high speed lines. ADST lines consists of sequences of double and single track segments optimally selected in order to reduce the construction and maintenance costs of railway lines and to optimize the timetables used to satisfy a given demand. The single tracks are selected to coincide with expensive segments (tunnels and viaducts) and the double tracks are chosen to coincide with flat areas and only where they are necessary. At the same time, departure times are adjusted for trains to cross at the cheap double track segments. This alternative can be used for new lines and also for existing conventional lines where some new tracks are to be constructed to reduce travel time (increase speed). The ADST proposal is illustrated with some examples of both types (new lines and where conventional lines exist), including the Palencia-Santander, the Santiago-Valparaíso-Viña del Mar and the Dublin-Belfast lines, where very important reductions (90 %) are obtained, especially where a railway infrastructure already exist. (Author)
A novel RNA sequencing data analysis method for cell line authentication.
Directory of Open Access Journals (Sweden)
Erik Fasterius
Full Text Available We have developed a novel analysis method that can interrogate the authenticity of biological samples used for generation of transcriptome profiles in public data repositories. The method uses RNA sequencing information to reveal mutations in expressed transcripts and subsequently confirms the identity of analysed cells by comparison with publicly available cell-specific mutational profiles. Cell lines constitute key model systems widely used within cancer research, but their identity needs to be confirmed in order to minimise the influence of cell contaminations and genetic drift on the analysis. Using both public and novel data, we demonstrate the use of RNA-sequencing data analysis for cell line authentication by examining the validity of COLO205, DLD1, HCT15, HCT116, HKE3, HT29 and RKO colorectal cancer cell lines. We successfully authenticate the studied cell lines and validate previous reports indicating that DLD1 and HCT15 are synonymous. We also show that the analysed HKE3 cells harbour an unexpected KRAS-G13D mutation and confirm that this cell line is a genuine KRAS dosage mutant, rather than a true isogenic derivative of HCT116 expressing only the wild type KRAS. This authentication method could be used to revisit the numerous cell line based RNA sequencing experiments available in public data repositories, analyse new experiments where whole genome sequencing is not available, as well as facilitate comparisons of data from different experiments, platforms and laboratories.
TGF-b and a specific TGF-b inhibitor regulate pericentrin B and MYH9 in glioma cell lines
Directory of Open Access Journals (Sweden)
Óscar Álzate
2006-01-01
Full Text Available Malignant gliomas are heterogeneous, highly invasive vascular tumours. The multifunctional cytokine, transforming growth factor-beta (TGF-P, is expressed by grade III/IV gliomas and promotes tumour angiogenesis, invasión and immune escape. It has been shown previously that a small TGF-P receptor type I (TGF-(3-RI molecule inhibitor (SB-431542 blocks TGF-(3-mediated signal transduction, induction of angiogenic factor expression and cellular motility. As glioma cell lines display differential sensitivity to TGF-P, it was expected that they would also be differentially impacted by disruption of TGF-P signalling. Differential in gel expression (DIGE analysis and mass spectrometry was used in this work for determining protein regulation effects of both TGF-P and SB-431542 on human glioma cell lines. It was found that pericentrin B and non muscle myosin were differentially expressed in fragments which likely resulted from protease activation by the tumour growth mechanism. These results suggest that both pericentrin B and non-muscle myosin might be potential glioma biomarkers. Key words: DIGE, proteomics, glioma, TGF-P, mass spectrometry, non muscle myosin, pericentrin B.
DEFF Research Database (Denmark)
Desmonde, Sophie; Eboua, François T; Malateste, Karen
2015-01-01
BACKGROUND: We described reasons for switching to second-line antiretroviral treatment (ART) and time to switch in HIV-infected children failing first-line ART in West Africa. METHODS: We included all children aged 15 years or less, starting ART (at least three drugs) in the paediatric Ie...... post-ART initiation, 188 (7%) had switched to second-line. The most frequent reasons were drug stock outs (20%), toxicity (18%), treatment failure (16%) and poor adherence (8%). Over the 24-month follow-up period, 322 (12%) children failed first-line ART after a median time of 7 months...... rare and switches after an immunological failure were insufficient. These gaps reveal that it is crucial to advocate for both sustainable access to first-line and alternative regimens to provide adequate roll-out of paediatric ART programmes....
Automatic selective feature retention in patient specific elastic surface registration
CSIR Research Space (South Africa)
Jansen van Rensburg, GJ
2011-01-01
Full Text Available The accuracy with which a recent elastic surface registration algorithm deforms the complex geometry of a skull is examined. This algorithm is then coupled to a line based algorithm as is frequently used in patient specific feature registration...
Generation of an inducible colon-specific Cre enzyme mouse line for colon cancer research.
Tetteh, Paul W; Kretzschmar, Kai; Begthel, Harry; van den Born, Maaike; Korving, Jeroen; Morsink, Folkert; Farin, Henner; van Es, Johan H; Offerhaus, G Johan A; Clevers, Hans
2016-10-18
Current mouse models for colorectal cancer often differ significantly from human colon cancer, being largely restricted to the small intestine. Here, we aim to develop a colon-specific inducible mouse model that can faithfully recapitulate human colon cancer initiation and progression. Carbonic anhydrase I (Car1) is a gene expressed uniquely in colonic epithelial cells. We generated a colon-specific inducible Car1 CreER knock-in (KI) mouse with broad Cre activity in epithelial cells of the proximal colon and cecum. Deletion of the tumor suppressor gene Apc using the Car1 CreER KI caused tumor formation in the cecum but did not yield adenomas in the proximal colon. Mutation of both Apc and Kras yielded microadenomas in both the cecum and the proximal colon, which progressed to macroadenomas with significant morbidity. Aggressive carcinomas with some invasion into lymph nodes developed upon combined induction of oncogenic mutations of Apc, Kras, p53, and Smad4 Importantly, no adenomas were observed in the small intestine. Additionally, we observed tumors from differentiated Car1-expressing cells with Apc/Kras mutations, suggesting that a top-down model of intestinal tumorigenesis can occur with multiple mutations. Our results establish the Car1 CreER KI as a valuable mouse model to study colon-specific tumorigenesis and metastasis as well as cancer-cell-of-origin questions.
Mouse DRG Cell Line with Properties of Nociceptors.
Doran, Ciara; Chetrit, Jonathan; Holley, Matthew C; Grundy, David; Nassar, Mohammed A
2015-01-01
In vitro cell lines from DRG neurons aid drug discovery because they can be used for early stage, high-throughput screens for drugs targeting pain pathways, with minimal dependence on animals. We have established a conditionally immortal DRG cell line from the Immortomouse. Using immunocytochemistry, RT-PCR and calcium microfluorimetry, we demonstrate that the cell line MED17.11 expresses markers of cells committed to the sensory neuron lineage. Within a few hours under differentiating conditions, MED17.11 cells extend processes and following seven days of differentiation, express markers of more mature DRG neurons, such as NaV1.7 and Piezo2. However, at least at this time-point, the nociceptive marker NaV1.8 is not expressed, but the cells respond to compounds known to excite nociceptors, including the TRPV1 agonist capsaicin, the purinergic receptor agonist ATP and the voltage gated sodium channel agonist, veratridine. Robust calcium transients are observed in the presence of the inflammatory mediators bradykinin, histamine and norepinephrine. MED17.11 cells have the potential to replace or reduce the use of primary DRG culture in sensory, pain and developmental research by providing a simple model to study acute nociception, neurite outgrowth and the developmental specification of DRG neurons.
Homotopic Polygonal Line Simplification
DEFF Research Database (Denmark)
Deleuran, Lasse Kosetski
This thesis presents three contributions to the area of polygonal line simplification, or simply line simplification. A polygonal path, or simply a path is a list of points with line segments between the points. A path can be simplified by morphing it in order to minimize some objective function...
Directory of Open Access Journals (Sweden)
Ricardo C. Calhelha
2014-01-01
Full Text Available With a complex chemical composition rich in phenolic compounds, propolis (resinous substance collected by Apis mellifera from various tree buds exhibits a broad spectrum of biological activities. Recently, in vitro and in vivo data suggest that propolis has anticancer properties, but is the cytoxicity of propolis specific for tumor cells? To answer this question, the cytotoxicity of phenolic extracts from Portuguese propolis of different origins was evaluated using human tumor cell lines (MCF7—breast adenocarcinoma, NCI-H460—non-small cell lung carcinoma, HCT15—colon carcinoma, HeLa—cervical carcinoma, and HepG2—hepatocellular carcinoma, and non-tumor primary cells (PLP2. The studied propolis presented high cytotoxic potential for human tumor cell lines, mostly for HCT15. Nevertheless, excluding HCT15 cell line, the extracts at the GI50 obtained for tumor cell lines showed, in general, cytotoxicity for normal cells (PLP2. Propolis phenolic extracts comprise phytochemicals that should be further studied for their bioactive properties against human colon carcinoma. In the other cases, the proximity of the in vitro cytotoxic doses for tumor and normal cell lines should be confirmed by in vivo tests and may highlight the need for selection of specific compounds within the propolis extract.