WorldWideScience

Sample records for linearly increasing voltage

  1. Profiling of barrier capacitance and spreading resistance using a transient linearly increasing voltage technique.

    Gaubas, E; Ceponis, T; Kusakovskij, J

    2011-08-01

    A technique for the combined measurement of barrier capacitance and spreading resistance profiles using a linearly increasing voltage pulse is presented. The technique is based on the measurement and analysis of current transients, due to the barrier and diffusion capacitance, and the spreading resistance, between a needle probe and sample. To control the impact of deep traps in the barrier capacitance, a steady state bias illumination with infrared light was employed. Measurements of the spreading resistance and barrier capacitance profiles using a stepwise positioned probe on cross sectioned silicon pin diodes and pnp structures are presented.

  2. The use of charge extraction by linearly increasing voltage in polar organic light-emitting diodes

    Züfle, Simon; Altazin, Stéphane; Hofmann, Alexander; Jäger, Lars; Neukom, Martin T.; Schmidt, Tobias D.; Brütting, Wolfgang; Ruhstaller, Beat

    2017-05-01

    We demonstrate the application of the CELIV (charge carrier extraction by linearly increasing voltage) technique to bilayer organic light-emitting devices (OLEDs) in order to selectively determine the hole mobility in N,N0-bis(1-naphthyl)-N,N0-diphenyl-1,10-biphenyl-4,40-diamine (α-NPD). In the CELIV technique, mobile charges in the active layer are extracted by applying a negative voltage ramp, leading to a peak superimposed to the measured displacement current whose temporal position is related to the charge carrier mobility. In fully operating devices, however, bipolar carrier transport and recombination complicate the analysis of CELIV transients as well as the assignment of the extracted mobility value to one charge carrier species. This has motivated a new approach of fabricating dedicated metal-insulator-semiconductor (MIS) devices, where the extraction current contains signatures of only one charge carrier type. In this work, we show that the MIS-CELIV concept can be employed in bilayer polar OLEDs as well, which are easy to fabricate using most common electron transport layers (ETLs), like Tris-(8-hydroxyquinoline)aluminum (Alq3). Due to the macroscopic polarization of the ETL, holes are already injected into the hole transport layer below the built-in voltage and accumulate at the internal interface with the ETL. This way, by a standard CELIV experiment only holes will be extracted, allowing us to determine their mobility. The approach can be established as a powerful way of selectively measuring charge mobilities in new materials in a standard device configuration.

  3. Charge transport and recombination in bulk heterojunction solar cells studied by the photoinduced charge extraction in linearly increasing voltage technique

    Mozer, AJ; Sariciftci, NS; Osterbacka, R; Westerling, M; Juska, G; LUTSEN, Laurence; VANDERZANDE, Dirk

    2005-01-01

    Charge carrier mobility and recombination in a bulk heterojunction solar cell based on the mixture of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)-C-61 (PCBM) has been studied using the novel technique of photoinduced charge carrier extraction in a linearly increasing voltage (Photo-CELIV). In this technique, charge carriers are photogenerated by a short laser flash, and extracted under a reverse bias voltage ramp after ...

  4. Charge transport and recombination in bulk heterojunction solar cells studied by the photoinduced charge extraction in linearly increasing voltage technique

    Mozer, A. J.; Sariciftci, N. S.; Lutsen, L.; Vanderzande, D.; Österbacka, R.; Westerling, M.; Juška, G.

    2005-03-01

    Charge carrier mobility and recombination in a bulk heterojunction solar cell based on the mixture of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)-C61 (PCBM) has been studied using the novel technique of photoinduced charge carrier extraction in a linearly increasing voltage (Photo-CELIV). In this technique, charge carriers are photogenerated by a short laser flash, and extracted under a reverse bias voltage ramp after an adjustable delay time (tdel). The Photo-CELIV mobility at room temperature is found to be μ =2×10-4cm2V-1s-1, which is almost independent on charge carrier density, but slightly dependent on tdel. Furthermore, determination of charge carrier lifetime and demonstration of an electric field dependent mobility is presented.

  5. Voltage linear transformation circuit design

    Sanchez, Lucas R. W.; Jin, Moon-Seob; Scott, R. Phillip; Luder, Ryan J.; Hart, Michael

    2017-09-01

    Many engineering projects require automated control of analog voltages over a specified range. We have developed a computer interface comprising custom hardware and MATLAB code to provide real-time control of a Thorlabs adaptive optics (AO) kit. The hardware interface includes an op amp cascade to linearly shift and scale a voltage range. With easy modifications, any linear transformation can be accommodated. In AO applications, the design is suitable to drive a range of different types of deformable and fast steering mirrors (FSM's). Our original motivation and application was to control an Optics in Motion (OIM) FSM which requires the customer to devise a unique interface to supply voltages to the mirror controller to set the mirror's angular deflection. The FSM is in an optical servo loop with a wave front sensor (WFS), which controls the dynamic behavior of the mirror's deflection. The code acquires wavefront data from the WFS and fits a plane, which is subsequently converted into its corresponding angular deflection. The FSM provides +/-3° optical angular deflection for a +/-10 V voltage swing. Voltages are applied to the mirror via a National Instruments digital-to-analog converter (DAC) followed by an op amp cascade circuit. This system has been integrated into our Thorlabs AO testbed which currently runs at 11 Hz, but with planned software upgrades, the system update rate is expected to improve to 500 Hz. To show that the FSM subsystem is ready for this speed, we conducted two different PID tuning runs at different step commands. Once 500 Hz is achieved, we plan to make the code and method for our interface solution freely available to the community.

  6. Increased voltage photovoltaic cell

    Ross, B.; Bickler, D. B.; Gallagher, B. D. (Inventor)

    1985-01-01

    A photovoltaic cell, such as a solar cell, is provided which has a higher output voltage than prior cells. The improved cell includes a substrate of doped silicon, a first layer of silicon disposed on the substrate and having opposite doping, and a second layer of silicon carbide disposed on the first layer. The silicon carbide preferably has the same type of doping as the first layer.

  7. Charge carrier dynamics investigation of CuInS{sub 2} quantum dots films using injected charge extraction by linearly increasing voltage (i-CELIV): the role of ZnS Shell

    Bi, Ke; Sui, Ning; Zhang, Liquan; Wang, Yinghui, E-mail: yinghui-wang@outlook.com; Liu, Qinghui, E-mail: liuqinghui@jlu.edu.cn; Tan, Mingrui [Jilin University, Femtosecond Laser Laboratory, Key Laboratory of Physics and Technology for Advanced Batteries (Ministry of Education), College of Physics (China); Zhou, Qiang [Jilin University, Key Laboratory of Superhard Materials, College of Physics (China); Zhang, Hanzhuang, E-mail: zhanghz@jlu.edu.cn [Jilin University, Femtosecond Laser Laboratory, Key Laboratory of Physics and Technology for Advanced Batteries (Ministry of Education), College of Physics (China)

    2016-12-15

    The role of ZnS shell on the photo-physical properties within CuInS{sub 2}/ZnS quantum dots (QDs) is carefully studied in optoelectronic devices. Linearly increasing voltage technique has been employed to investigate the charge carrier dynamics of both CuInS{sub 2} and CuInS{sub 2}/ZnS QDs films. This study shows that charge carriers follow a similar behavior of monomolecular recombination in this film, with their charge transfer rate correlates to the increase of applied voltage. It turns out that the ZnS shell could affect the carrier diffusion process through depressing the trapping states and would build up a potential barrier.

  8. All-Pass Filter Based Linear Voltage Controlled Quadrature Oscillator

    Koushick Mathur

    2017-01-01

    Full Text Available A linear voltage controlled quadrature oscillator implemented from a first-order electronically tunable all-pass filter (ETAF is presented. The active element is commercially available current feedback amplifier (AD844 in conjunction with the relatively new Multiplication Mode Current Conveyor (MMCC device. Electronic tunability is obtained by the control node voltage (V of the MMCC. Effects of the device nonidealities, namely, the parasitic capacitors and the roll-off poles of the port-transfer ratios of the device, are shown to be negligible, even though the usable high-frequency ranges are constrained by these imperfections. Subsequently the filter is looped with an electronically tunable integrator (ETI to implement the quadrature oscillator (QO. Experimental responses on the voltage tunable phase of the filter and the linear-tuning law of the quadrature oscillator up to 9.9 MHz at low THD are verified by simulation and hardware tests.

  9. A new linear induction voltage adder approach to radiography

    Mazarakis, M.G.; Poukey, J.W.; Frost, C.A.; Johnson, D.L.; Shope, S.L.; Halbleib, J.A.; Prestwich, K.R.; Turman, B.N.; Smith, I.

    1992-01-01

    At present, two types of accelerators are being utilized for x-ray radiography: first a linear RF or induction accelerator with multiple accelerating gaps and beam vacuum magnetic transport systems; and second, single gap pulse-power devices with a high voltage Blumlein pulse forming line. The authors present a conceptual design of a new type of linear induction accelerator that can bridge the gap between the two devices. It can produce 30--50-kA electron currents small diameter (∼ 1 mm) and high energy (12--20-MV) beams. There is no beam drifting through the device. The voltage addition of the accelerating gaps occurs at the central self-magnetically insulated cathode electrode. The electron beam is created at the high voltage end in a single gap diode. A magnetically-immersed foilless diode can produce high quality 0.5 mm radius 30--50 kA beams. A short 100--200-kG small bore solenoidal coil is required to maintain the beam radius during transport from the cathode tips to the x-ray converter target, 50--70 cm downstream. The idea of very high impedance MITL voltage adder accelerators was first tested with RADLAC II/SMILE experiments where 12--14-MV, 50-kA 1 cm radius beams were produced with 2--3 mm annulus thickness. A 12.5 m eight-stage voltage adder was utilized, coupled to a 20 kG magnetically immersed foilless diode. In addition the magnetically-immersed foilless diodes with very thin (mm diameter) cathode tips were investigated in experiments with the IBEX accelerator. As an example of this new accelerator technology the authors present the following point design for a 16-MV, 50-kA accelerator producing 1-mm diameter electron beams. The design is based on a cavity fed MITL voltage adder which performs the series addition of the voltage pulses from 16 identical inductively-isolated cavity feed systems. Each cavity is a structure that is driven by one 14 ohm pulse-forming line, providing a 1 MV voltage pulse to the accelerating gap

  10. Low voltage RF MEMS variable capacitor with linear C-V response

    Elshurafa, Amro M.

    2012-07-23

    An RF MEMS variable capacitor, fabricated in the PolyMUMPS process and tuned electrostatically, possessing a linear capacitance-voltage response is reported. The measured quality factor of the device was 17 at 1GHz, while the tuning range was 1.2:1 and was achieved at an actuation DC voltage of 8V only. Further, the linear regression coefficient was 0.98. The variable capacitor was created such that it has both vertical and horizontal capacitances present. As the top suspended plate moves towards the bottom fixed plate, the vertical capacitance increases whereas the horizontal capacitance decreases simultaneously such that the sum of the two capacitances yields a linear capacitance-voltage relation. © 2012 The Institution of Engineering and Technology.

  11. Linear inductive voltage adders (IVA) for advanced hydrodynamic radiography

    Mazarakis, M.G.; Boyes, J.D.; Johnson, D.L.

    1998-01-01

    The electron beam which drifts through the multiple cavities of conventional induction linacs (LIA) is replaced in an IVA by a cylindrical metal conductor which extends along the entire length of the device and effectuates the addition of the accelerator cavity voltages. In the approach to radiography, the linear inductive voltage adder drives a magnetically immersed electron diode with a millimeter diameter cathode electrode and a planar anode/bremsstrahlung converter. Both anode and cathode electrodes are immersed in a strong (15--50 T) solenoidal magnetic field. The electron beam cross section is approximately of the same size as the cathode needle and generates a similar size, very intense x-ray beam when it strikes the anode converter. An IVA driven diode can produce electron beams of equal size and energy as a LIA but with much higher currents (40--50 kA versus 4--5 kA), simpler hardware and thus lower cost. The authors present here first experimental validations of the technology utilizing HERMES 3 and SABRE IVA accelerators. The electron beam voltage and current were respectively of the order of 10 MV and 40 kA. X-ray doses of up to 1 kR at sign 1 m and spot sizes as small as 1.7 mm (at 200 R doses) were measured

  12. Linear variable voltage diode capacitor and adaptive matching networks

    Larson, L.E.; De Vreede, L.C.N.

    2006-01-01

    An integrated variable voltage diode capacitor topology applied to a circuit providing a variable voltage load for controlling variable capacitance. The topology includes a first pair of anti-series varactor diodes, wherein the diode power-law exponent n for the first pair of anti-series varactor

  13. Non-linear Membrane Properties in Entorhinal Cortical Stellate Cells Reduce Modulation of Input-Output Responses by Voltage Fluctuations

    Fernandez, Fernando R.; Malerba, Paola; White, John A.

    2015-01-01

    The presence of voltage fluctuations arising from synaptic activity is a critical component in models of gain control, neuronal output gating, and spike rate coding. The degree to which individual neuronal input-output functions are modulated by voltage fluctuations, however, is not well established across different cortical areas. Additionally, the extent and mechanisms of input-output modulation through fluctuations have been explored largely in simplified models of spike generation, and with limited consideration for the role of non-linear and voltage-dependent membrane properties. To address these issues, we studied fluctuation-based modulation of input-output responses in medial entorhinal cortical (MEC) stellate cells of rats, which express strong sub-threshold non-linear membrane properties. Using in vitro recordings, dynamic clamp and modeling, we show that the modulation of input-output responses by random voltage fluctuations in stellate cells is significantly limited. In stellate cells, a voltage-dependent increase in membrane resistance at sub-threshold voltages mediated by Na+ conductance activation limits the ability of fluctuations to elicit spikes. Similarly, in exponential leaky integrate-and-fire models using a shallow voltage-dependence for the exponential term that matches stellate cell membrane properties, a low degree of fluctuation-based modulation of input-output responses can be attained. These results demonstrate that fluctuation-based modulation of input-output responses is not a universal feature of neurons and can be significantly limited by subthreshold voltage-gated conductances. PMID:25909971

  14. Modulation linearization of a frequency-modulated voltage controlled oscillator, part 3

    Honnell, M. A.

    1975-01-01

    An analysis is presented for the voltage versus frequency characteristics of a varactor modulated VHF voltage controlled oscillator in which the frequency deviation is linearized by using the nonlinear characteristics of a field effect transistor as a signal amplifier. The equations developed are used to calculate the oscillator output frequency in terms of pertinent circuit parameters. It is shown that the nonlinearity exponent of the FET has a pronounced influence on frequency deviation linearity, whereas the junction exponent of the varactor controls total frequency deviation for a given input signal. A design example for a 250 MHz frequency modulated oscillator is presented.

  15. Voltage-Sensitive Load Controllers for Voltage Regulation and Increased Load Factor in Distribution Systems

    Douglass, Philip James; Garcia-Valle, Rodrigo; Østergaard, Jacob

    2014-01-01

    This paper presents a novel controller design for controlling appliances based on local measurements of voltage. The controller finds the normalized voltage deviation accounting for the sensitivity of voltage measurements to appliance state. The controller produces a signal indicating desired pow...

  16. Development of parallel-plate-based MEMS tunable capacitors with linearized capacitance–voltage response and extended tuning range

    Shavezipur, M; Nieva, P; Khajepour, A; Hashemi, S M

    2010-01-01

    This paper presents a design technique that can be used to linearize the capacitance–voltage (C–V) response and extend the tuning range of parallel-plate-based MEMS tunable capacitors beyond that of conventional designs. The proposed technique exploits the curvature of the capacitor's moving electrode which could be induced by either manipulating the stress gradients in the plate's material or using bi-layer structures. The change in curvature generates a nonlinear structural stiffness as the moving electrode undergoes out-of-plane deformation due to the actuation voltage. If the moving plate curvature is tailored such that the capacitance increment is proportional to the voltage increment, then a linear C–V response is obtained. The larger structural resistive force at higher bias voltage also delays the pull-in and increases the maximum tunability of the capacitor. Moreover, for capacitors containing an insulation layer between the two electrodes, the proposed technique completely eliminates the pull-in effect. The experimental data obtained from different capacitors fabricated using PolyMUMPs demonstrate the advantages of this design approach where highly linear C–V responses and tunabilities as high as 1050% were recorded. The design methodology introduced in this paper could be easily extended to for example, capacitive pressure and temperature sensors or infrared detectors to enhance their response characteristics.

  17. An improved direct feedback linearization technique for transient stability enhancement and voltage regulation of power generators

    Kenne, Godpromesse [Laboratoire d' Automatique et d' Informatique Appliquee (LAIA), Departement de Genie Electrique, Universite de Dschang, B.P. 134 Bandjoun, Cameroun; Goma, Raphael; Lamnabhi-Lagarrigue, Francoise [Laboratoire des Signaux et Systemes (L2S), CNRS-SUPELEC, Universite Paris XI, 3 Rue Joliot Curie, 91192 Gif-sur-Yvette (France); Nkwawo, Homere [Departement GEII, Universite Paris XIII, IUT Villetaneuse, 99 Avenue Jean Baptiste Clement, 93430 Villetaneuse (France); Arzande, Amir; Vannier, Jean Claude [Departement Energie, Ecole Superieure d' Electricite-SUPELEC, 3 Rue Joliot Curie, 91192 Gif-sur-Yvette (France)

    2010-09-15

    In this paper, a simple improved direct feedback linearization design method for transient stability and voltage regulation of power systems is discussed. Starting with the classical direct feedback linearization technique currently applied to power systems, an adaptive nonlinear excitation control of synchronous generators is proposed, which is new and effective for engineering. The power angle and mechanical power input are not assumed to be available. The proposed method is based on a standard third-order model of a synchronous generator which requires only information about the physical available measurements of angular speed, active electric power and generator terminal voltage. Experimental results of a practical power system show that fast response, robustness, damping, steady-state and transient stability as well as voltage regulation are all achieved satisfactorily. (author)

  18. Voltage and pace-capture mapping of linear ablation lesions overestimates chronic ablation gap size.

    O'Neill, Louisa; Harrison, James; Chubb, Henry; Whitaker, John; Mukherjee, Rahul K; Bloch, Lars Ølgaard; Andersen, Niels Peter; Dam, Høgni; Jensen, Henrik K; Niederer, Steven; Wright, Matthew; O'Neill, Mark; Williams, Steven E

    2018-04-26

    Conducting gaps in lesion sets are a major reason for failure of ablation procedures. Voltage mapping and pace-capture have been proposed for intra-procedural identification of gaps. We aimed to compare gap size measured acutely and chronically post-ablation to macroscopic gap size in a porcine model. Intercaval linear ablation was performed in eight Göttingen minipigs with a deliberate gap of ∼5 mm left in the ablation line. Gap size was measured by interpolating ablation contact force values between ablation tags and thresholding at a low force cut-off of 5 g. Bipolar voltage mapping and pace-capture mapping along the length of the line were performed immediately, and at 2 months, post-ablation. Animals were euthanized and gap sizes were measured macroscopically. Voltage thresholds to define scar were determined by receiver operating characteristic analysis as voltage, pace-capture, and ablation contact force maps. All modalities overestimated chronic gap size, by 1.4 ± 2.0 mm (ablation contact force map), 5.1 ± 3.4 mm (pace-capture), and 9.5 ± 3.8 mm (voltage mapping). Error on ablation contact force map gap measurements were significantly less than for voltage mapping (P = 0.003, Tukey's multiple comparisons test). Chronically, voltage mapping and pace-capture mapping overestimated macroscopic gap size by 11.9 ± 3.7 and 9.8 ± 3.5 mm, respectively. Bipolar voltage and pace-capture mapping overestimate the size of chronic gap formation in linear ablation lesions. The most accurate estimation of chronic gap size was achieved by analysis of catheter-myocardium contact force during ablation.

  19. Low voltage RF MEMS variable capacitor with linear C-V response

    Elshurafa, Amro M.; Ho, Pak Hung; Salama, Khaled N.

    2012-01-01

    .2:1 and was achieved at an actuation DC voltage of 8V only. Further, the linear regression coefficient was 0.98. The variable capacitor was created such that it has both vertical and horizontal capacitances present. As the top suspended plate moves towards the bottom

  20. Electric field control methods for foil coils in high-voltage linear actuators

    Beek, van T.A.; Jansen, J.W.; Lomonova, E.A.

    2015-01-01

    This paper describes multiple electric field control methods for foil coils in high-voltage coreless linear actuators. The field control methods are evaluated using 2-D and 3-D boundary element methods. A comparison is presented between the field control methods and their ability to mitigate

  1. Fully Integrated, Low Drop-Out Linear Voltage Regulator in 180 nm CMOS

    Yosef-Hay, Yoni; Larsen, Dennis Øland; Llimos Muntal, Pere

    2017-01-01

    This paper presents a capacitor-free low dropout (LDO) linear regulator based on a dual loop topology. The regulator utilizes two feedback loops to satisfy the challenges of hearing aid devices, which include fast transient performance and small voltage spikes under rapid load-current changes...

  2. Enhancing Linearity of Voltage Controlled Oscillator Thermistor Signal Conditioning Circuit Using Linear Search

    Rana, K. P. S.; Kumar, Vineet; Prasad, Tapan

    2018-02-01

    Temperature to Frequency Converters (TFCs) are potential signal conditioning circuits (SCCs) usually employed in temperature measurements using thermistors. A NE/SE-566 based SCC has been recently used in several reported works as TFC. Application of NE/SE-566 based SCC requires a mechanism for finding the optimal values of SCC parameters yielding the optimal linearity and desired sensitivity performances. Two classical methods, namely, inflection point and three point have been employed for this task. In this work, the application of these two methods, on NE/SE-566 based SCC in TFC, is investigated in detail and the conditions for its effective usage are developed. Further, since these classical methods offer an approximate linearization of temperature and frequency relationship an application of a linear search based technique is proposed to further enhance the linearity. The implemented linear search method used results obtained from the above mentioned classical methods. The presented simulation studies, for three different industrial grade thermistors, revealed that the linearity enhancements of 21.7, 18.3 and 17.8% can be achieved over the inflection point method and 4.9, 4.7 and 4.7% over the three point method, for an input temperature range of 0-100 °C.

  3. Air-gap field, induced voltage and thrust in the short-stator linear induction motor

    Deleroi, W

    1980-07-15

    The description of the magnetic field in the air-gap of a short-primary linear induction motor, and the subsequent calculation of the thrust developed and the voltages induced in the stator bars can be made by using balancing waves. These balancing waves are generated at any point where the field wave that would exist in a machine of infinite length is disturbed. In the linear motor these disturbances occur at the ends of the stator iron and at discontinuities in the distribution of the stator winding, which exist in machines having stepped windings. From the points where they are generated, free balancing waves travel in two directions and determine the performance of these machines to a large extent. The voltage they induce in a stator bar can be determined from the core flux and mapped on a phasor diagram. The resulting voltage phasor follows a logarithmic spiral. The resulting voltages induced in the three phase windings form a strongly asymmetrical system which can be split-up into positive-, negative- and zerosequence components depending on the slip. The tangential forces may be calculated as the product of the magnetic flux density in the air-gap and the linear current density in either the stator or the reaction rail. As the 'magnetic tail' outside the machine also gives rise to forces in the direction of motion, both methods yield quite different force distributions, though for the resulting force the same value is found.

  4. A low-voltage fully balanced CMFF transconductor with improved linearity

    Calvo, B.; Celma, S.; Alegre, J. P.; Sanz, M. T.

    2007-05-01

    This paper presents a new low-voltage pseudo-differential continuous-time CMOS transconductor for wideband applications. The proposed cell is based on a feedforward cancellation of the input common-mode signal and keeps the input common mode voltage constant, while the transconductance is easily tunable through a continuous bias voltage. Linearity is preserved during the tuning process for a moderate range of transconductance values. Simulation results for a 0.35 μm CMOS design show a 1:2 G m tuning range with an almost constant bandwidth over 600 MHz. Total harmonic distortion figures are below -60 dB over the whole range at 10 MHz up to a 200 μA p-p differential output. The proposed cell consumes less than 1.2 mW from a single 2.0 V supply.

  5. Voltage-regulating constant-current sources in a linear induction accelerator

    Zhao Juan; Cao Kefeng; Deng Jianjun; Zhu Lijun; Yang Jia; Ye Chao; Huang Bin; Cao Ningxiang; Dong Jinxuan; Zhang Jichang; Yu Zhiguo; Chen Min

    2002-01-01

    Constant-current Sources are one of key units in a linear induction accelerator. The requirements for the sources are to supply stable direct current of high power for the induction coil, be easy to computer-control and highly stable and reliable. Applying the technique of linear current source regulating in series, the primary voltage of the power transformer is regulated through an MJYS-JL-350A type three-phase alterative voltage-regulating module. The output current variation is 300-500 A when the load variation is 0.06-0.1 Ω and the voltage drop of the regulator tube is controlled within 8 V±2V when the variation of mains voltage is in ±10%. Both the current ripple and stability meet the technical requirements. The constant-current sources are controlled through an industrial controller. For each of the constant-current sources has a smallest system comprised of 8051 which is communication-controlled through a RS-485 interface, the sources can be controlled remotely

  6. A High Performance Silicon-on-Insulator LDMOSTT Using Linearly Increasing Thickness Techniques

    Yu-Feng, Guo; Zhi-Gong, Wang; Gene, Sheu; Jian-Bing, Cheng

    2010-01-01

    We present a new technique to achieve uniform lateral electric field and maximum breakdown voltage in lateral double-diffused metal-oxide-semiconductor transistors fabricated on silicon-on-insulator substrates. A linearly increasing drift-region thickness from the source to the drain is employed to improve the electric field distribution in the devices. Compared to the lateral linear doping technique and the reduced surface field technique, two-dimensional numerical simulations show that the new device exhibits reduced specific on-resistance, maximum off- and on-state breakdown voltages, superior quasi-saturation characteristics and improved safe operating area. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  7. A Cost-effective Method for Resolution Increase of the Twostage Piecewise Linear ADC Used for Sensor Linearization

    Jovanović Jelena

    2016-02-01

    Full Text Available A cost-effective method for resolution increase of a two-stage piecewise linear analog-to-digital converter used for sensor linearization is proposed in this paper. In both conversion stages flash analog-to-digital converters are employed. Resolution increase by one bit per conversion stage is performed by introducing one additional comparator in front of each of two flash analog-to-digital converters, while the converters’ resolutions remain the same. As a result, the number of employed comparators, as well as the circuit complexity and the power consumption originating from employed comparators are for almost 50 % lower in comparison to the same parameters referring to the linearization circuit of the conventional design and of the same resolution. Since the number of employed comparators is significantly reduced according to the proposed method, special modifications of the linearization circuit are needed in order to properly adjust reference voltages of employed comparators.

  8. Power MOSFET Linearizer of a High-Voltage Power Amplifier for High-Frequency Pulse-Echo Instrumentation.

    Choi, Hojong; Woo, Park Chul; Yeom, Jung-Yeol; Yoon, Changhan

    2017-04-04

    A power MOSFET linearizer is proposed for a high-voltage power amplifier (HVPA) used in high-frequency pulse-echo instrumentation. The power MOSFET linearizer is composed of a DC bias-controlled series power MOSFET shunt with parallel inductors and capacitors. The proposed scheme is designed to improve the gain deviation characteristics of the HVPA at higher input powers. By controlling the MOSFET bias voltage in the linearizer, the gain reduction into the HVPA was compensated, thereby reducing the echo harmonic distortion components generated by the ultrasonic transducers. In order to verify the performance improvement of the HVPA implementing the power MOSFET linearizer, we measured and found that the gain deviation of the power MOSFET linearizer integrated with HVPA under 10 V DC bias voltage was reduced (-1.8 and -0.96 dB, respectively) compared to that of the HVPA without the power MOSFET linearizer (-2.95 and -3.0 dB, respectively) when 70 and 80 MHz, three-cycle, and 26 dB m input pulse waveforms are applied, respectively. The input 1-dB compression point (an index of linearity) of the HVPA with power MOSFET linearizer (24.17 and 26.19 dB m at 70 and 80 MHz, respectively) at 10 V DC bias voltage was increased compared to that of HVPA without the power MOSFET linearizer (22.03 and 22.13 dB m at 70 and 80 MHz, respectively). To further verify the reduction of the echo harmonic distortion components generated by the ultrasonic transducers, the pulse-echo responses in the pulse-echo instrumentation were compared when using HVPA with and without the power MOSFET linearizer. When three-cycle 26 dB m input power was applied, the second, third, fourth, and fifth harmonic distortion components of a 75 MHz transducer driven by the HVPA with power MOSFET linearizer (-48.34, -44.21, -48.34, and -46.56 dB, respectively) were lower than that of the HVPA without the power MOSFET linearizer (-45.61, -41.57, -45.01, and -45.51 dB, respectively). When five-cycle 20 dB m input

  9. Development of three channel linear bipolar high voltage amplifier (±2 KV) for electrostatic steerer

    Rajesh Kumar; Mukesh Kumar; Suman, S.K.; Safvan, C.P.; Mandal, A.

    2011-01-01

    Electrostatic steerers and scanners are planned for low energy ion beam facilities at IUAC to steer and scan the ion beam on target. The power supplies for electrostatic steerers are high voltage bipolar DC amplifiers and for scanners are bipolar AC amplifiers. To fulfil the requirements a common unit has been designed and assembled for AC and DC applications. It can be used with electrostatic devices in scanning, steering and sweeping of low energy ion beams at high frequencies to attain uniform implantation. The unit consist of three independent limited bandwidth high voltage, linear bipolar amplifiers (for X-axis, Y-axis and Y1-dog leg plates). The unit has been provided with both local and remote control. (author)

  10. Linearity optimizations of analog ring resonator modulators through bias voltage adjustments

    Hosseinzadeh, Arash; Middlebrook, Christopher T.

    2018-03-01

    The linearity of ring resonator modulator (RRM) in microwave photonic links is studied in terms of instantaneous bandwidth, fabrication tolerances, and operational bandwidth. A proposed bias voltage adjustment method is shown to maximize spur-free dynamic range (SFDR) at instantaneous bandwidths required by microwave photonic link (MPL) applications while also mitigating RRM fabrication tolerances effects. The proposed bias voltage adjustment method shows RRM SFDR improvement of ∼5.8 dB versus common Mach-Zehnder modulators at 500 MHz instantaneous bandwidth. Analyzing operational bandwidth effects on SFDR shows RRMs can be promising electro-optic modulators for MPL applications which require high operational frequencies while in a limited bandwidth such as radio-over-fiber 60 GHz wireless network access.

  11. Increasing Linear Dynamic Range of a CMOS Image Sensor

    Pain, Bedabrata

    2007-01-01

    A generic design and a corresponding operating sequence have been developed for increasing the linear-response dynamic range of a complementary metal oxide/semiconductor (CMOS) image sensor. The design provides for linear calibrated dual-gain pixels that operate at high gain at a low signal level and at low gain at a signal level above a preset threshold. Unlike most prior designs for increasing dynamic range of an image sensor, this design does not entail any increase in noise (including fixed-pattern noise), decrease in responsivity or linearity, or degradation of photometric calibration. The figure is a simplified schematic diagram showing the circuit of one pixel and pertinent parts of its column readout circuitry. The conventional part of the pixel circuit includes a photodiode having a small capacitance, CD. The unconventional part includes an additional larger capacitance, CL, that can be connected to the photodiode via a transfer gate controlled in part by a latch. In the high-gain mode, the signal labeled TSR in the figure is held low through the latch, which also helps to adapt the gain on a pixel-by-pixel basis. Light must be coupled to the pixel through a microlens or by back illumination in order to obtain a high effective fill factor; this is necessary to ensure high quantum efficiency, a loss of which would minimize the efficacy of the dynamic- range-enhancement scheme. Once the level of illumination of the pixel exceeds the threshold, TSR is turned on, causing the transfer gate to conduct, thereby adding CL to the pixel capacitance. The added capacitance reduces the conversion gain, and increases the pixel electron-handling capacity, thereby providing an extension of the dynamic range. By use of an array of comparators also at the bottom of the column, photocharge voltages on sampling capacitors in each column are compared with a reference voltage to determine whether it is necessary to switch from the high-gain to the low-gain mode. Depending upon

  12. Voltage splay modes and enhanced phase locking in a modified linear Josephson array

    Harris, E. B.; Garland, J. C.

    1997-02-01

    We analyze a modified linear Josephson-junction array in which additional unbiased junctions are used to greatly enhance phase locking. This geometry exhibits strong correlated behavior, with an external magnetic field tuning the voltage splay angle between adjacent Josephson oscillators. The array displays a coherent in-phase mode for f=, where f is the magnetic frustration, while for 0tolerant of critical current disorder approaching 100%. The stability of the array has also been studied by computing Floquet exponents. These exponents are found to be negative for all array lengths, with a 1/N2 dependence, N being the number of series-connected junctions.

  13. On the modelling of linear-assisted DC-DC voltage regulators for photovoltaic solar energy systems

    Martínez-García, Herminio; García-Vílchez, Encarna

    2017-11-01

    This paper shows the modelling of linear-assisted or hybrid (linear & switching) DC/DC voltage regulators. In this kind of regulators, an auxiliary linear regulator is used, which objective is to cancel the ripple at the output voltage and provide fast responses for load variations. On the other hand, a switching DC/DC converter, connected in parallel with the linear regulator, allows to supply almost the whole output current demanded by the load. The objective of this topology is to take advantage of the suitable regulation characteristics that series linear voltage regulators have, but almost achieving the high efficiency that switching DC/DC converters provide. Linear-assisted DC/DC regulators are feedback systems with potential instability. Therefore, their modelling is mandatory in order to obtain design guidelines and assure stability of the implemented power supply system.

  14. A new linear inductive voltage adder driver for the Saturn Accelerator

    Mazarakis, M.G.; Spielman, R.B.; Struve, K.W.; Long, F.W.

    2000-01-01

    Saturn is a dual-purpose accelerator. It can be operated as a large-area flash x-ray source for simulation testing or as a Z-pinch driver especially for K-line x-ray production. In the first mode, the accelerator is fitted with three concentric-ring 2-MV electron diodes, while in the Z-pinch mode the current of all the modules is combined via a post-hole convolute arrangement and driven through a cylindrical array of very fine wires. We present here a point design for a new Saturn class driver based on a number of linear inductive voltage adders connected in parallel. A technology recently implemented at the Institute of High Current Electronics in Tomsk (Russia) is being utilized. In the present design we eliminate Marx generators and pulse-forming networks. Each inductive voltage adder cavity is directly fed by a number of fast 100-kV small-size capacitors arranged in a circular array around each accelerating gap. The number of capacitors connected in parallel to each cavity defines the total maximum current. By selecting low inductance switches, voltage pulses as short as 30-50-ns FWHM can be directly achieved. The voltage of each stage is low (100-200 kv). Many stages are required to achieve multi-megavolt accelerator output. However, since the length of each stage is very short (4-10 cm), accelerating gradients of higher than 1 MV/m can easily be obtained. The proposed new driver will be capable of delivering pulses of 15-MA, 36-TW, 1.2-MJ to the diode load, with a peak voltage of -2.2 MV and FWHM of 40-ns. And although its performance will exceed the presently utilized driver, its size and cost could be much smaller (approximately1/3). In addition, no liquid dielectrics like oil or deionized water will be required. Even elimination of ferromagnetic material (by using air-core cavities) is a possibility

  15. Voltage splay modes and enhanced phase locking in a modified linear Josephson array

    Harris, E.B.; Garland, J.C.

    1997-01-01

    We analyze a modified linear Josephson-junction array in which additional unbiased junctions are used to greatly enhance phase locking. This geometry exhibits strong correlated behavior, with an external magnetic field tuning the voltage splay angle between adjacent Josephson oscillators. The array displays a coherent in-phase mode for f=(1)/(2), where f is the magnetic frustration, while for 0 p (f)=2aV dc /Φ 0 (1-2f). The locked splay modes are found to be tolerant of critical current disorder approaching 100%. The stability of the array has also been studied by computing Floquet exponents. These exponents are found to be negative for all array lengths, with a 1/N 2 dependence, N being the number of series-connected junctions. copyright 1996 The American Physical Society

  16. Increase the threshold voltage of high voltage GaN transistors by low temperature atomic hydrogen treatment

    Erofeev, E. V., E-mail: erofeev@micran.ru [Tomsk State University of Control Systems and Radioelectronics, Research Institute of Electrical-Communication Systems (Russian Federation); Fedin, I. V.; Kutkov, I. V. [Research and Production Company “Micran” (Russian Federation); Yuryev, Yu. N. [National Research Tomsk Polytechnic University, Institute of Physics and Technology (Russian Federation)

    2017-02-15

    High-electron-mobility transistors (HEMTs) based on AlGaN/GaN epitaxial heterostructures are a promising element base for the fabrication of high voltage electronic devices of the next generation. This is caused by both the high mobility of charge carriers in the transistor channel and the high electric strength of the material, which makes it possible to attain high breakdown voltages. For use in high-power switches, normally off-mode GaN transistors operating under enhancement conditions are required. To fabricate normally off GaN transistors, one most frequently uses a subgate region based on magnesium-doped p-GaN. However, optimization of the p-GaN epitaxial-layer thickness and the doping level makes it possible to attain a threshold voltage of GaN transistors close to V{sub th} = +2 V. In this study, it is shown that the use of low temperature treatment in an atomic hydrogen flow for the p-GaN-based subgate region before the deposition of gate-metallization layers makes it possible to increase the transistor threshold voltage to V{sub th} = +3.5 V. The effects under observation can be caused by the formation of a dipole layer on the p-GaN surface induced by the effect of atomic hydrogen. The heat treatment of hydrogen-treated GaN transistors in a nitrogen environment at a temperature of T = 250°C for 12 h reveals no degradation of the transistor’s electrical parameters, which can be caused by the formation of a thermally stable dipole layer at the metal/p-GaN interface as a result of hydrogenation.

  17. Increase the threshold voltage of high voltage GaN transistors by low temperature atomic hydrogen treatment

    Erofeev, E. V.; Fedin, I. V.; Kutkov, I. V.; Yuryev, Yu. N.

    2017-01-01

    High-electron-mobility transistors (HEMTs) based on AlGaN/GaN epitaxial heterostructures are a promising element base for the fabrication of high voltage electronic devices of the next generation. This is caused by both the high mobility of charge carriers in the transistor channel and the high electric strength of the material, which makes it possible to attain high breakdown voltages. For use in high-power switches, normally off-mode GaN transistors operating under enhancement conditions are required. To fabricate normally off GaN transistors, one most frequently uses a subgate region based on magnesium-doped p-GaN. However, optimization of the p-GaN epitaxial-layer thickness and the doping level makes it possible to attain a threshold voltage of GaN transistors close to V_t_h = +2 V. In this study, it is shown that the use of low temperature treatment in an atomic hydrogen flow for the p-GaN-based subgate region before the deposition of gate-metallization layers makes it possible to increase the transistor threshold voltage to V_t_h = +3.5 V. The effects under observation can be caused by the formation of a dipole layer on the p-GaN surface induced by the effect of atomic hydrogen. The heat treatment of hydrogen-treated GaN transistors in a nitrogen environment at a temperature of T = 250°C for 12 h reveals no degradation of the transistor’s electrical parameters, which can be caused by the formation of a thermally stable dipole layer at the metal/p-GaN interface as a result of hydrogenation.

  18. New non-linear control strategy for non-isolated DC/DC converter with high voltage ratio

    Shahin, A.; Huang, B.; Martin, J.P.; Pierfederici, S.; Davat, B.

    2010-01-01

    In this paper, a non-isolated DC/DC converter with high voltage ratio is proposed to allow the interface between a low voltage power source like fuel cell and a high voltage DC bus. To take into account the low voltage-high density characteristics of power sources, a cascaded structure composed of two sub-converters has been chosen and allows obtaining a high voltage ratio. The choice of each sub-converter is based on the requirements of the source and its performances. Consequently, we have chosen a three-interleaved boost converter as the 1st sub-converter whereas the 2nd sub-converter is a three-level boost converter. The control of the whole system is realized thanks to energetic trajectories planning based on flatness properties of the system. The control of both the current and the balance of voltage across the output serial capacitors of the three-level boost converter is ensured by non-linear controllers based on a new non-linear model. Experimental results allow validating the proposed power architecture and its associated control.

  19. New non-linear control strategy for non-isolated DC/DC converter with high voltage ratio

    Shahin, A.; Huang, B.; Martin, J.P.; Pierfederici, S.; Davat, B. [Groupe de Recherche en Electronique et en Electrotechnique de Nancy - INPL - Nancy Universite, 2, Avenue de la Foret de Haye, 54516 Vandoeuvre-les-Nancy Cedex (France)

    2010-01-15

    In this paper, a non-isolated DC/DC converter with high voltage ratio is proposed to allow the interface between a low voltage power source like fuel cell and a high voltage DC bus. To take into account the low voltage-high density characteristics of power sources, a cascaded structure composed of two sub-converters has been chosen and allows obtaining a high voltage ratio. The choice of each sub-converter is based on the requirements of the source and its performances. Consequently, we have chosen a three-interleaved boost converter as the 1st sub-converter whereas the 2nd sub-converter is a three-level boost converter. The control of the whole system is realized thanks to energetic trajectories planning based on flatness properties of the system. The control of both the current and the balance of voltage across the output serial capacitors of the three-level boost converter is ensured by non-linear controllers based on a new non-linear model. Experimental results allow validating the proposed power architecture and its associated control. (author)

  20. Association Between Local Bipolar Voltage and Conduction Gap Along the Left Atrial Linear Ablation Lesion in Patients With Atrial Fibrillation.

    Masuda, Masaharu; Fujita, Masashi; Iida, Osamu; Okamoto, Shin; Ishihara, Takayuki; Nanto, Kiyonori; Kanda, Takashi; Sunaga, Akihiro; Tsujimura, Takuya; Matsuda, Yasuhiro; Mano, Toshiaki

    2017-08-01

    A bipolar voltage reflects a thick musculature where formation of a transmural lesion may be hard to achieve. The purpose of this study was to explore the association between local bipolar voltage and conduction gap in patients with persistent atrial fibrillation (AF) who underwent atrial roof or septal linear ablation. This prospective observational study included 42 and 36 consecutive patients with persistent AF who underwent roof or septal linear ablations, respectively. After pulmonary vein isolation, left atrial linear ablations were performed, and conduction gap sites were identified and ablated after first-touch radiofrequency application. Conduction gap(s) after the first-touch roof and septal linear ablation were observed in 13 (32%) and 19 patients (53%), respectively. Roof and septal area voltages were higher in patients with conduction gap(s) than in those without (roof, 1.23 ± 0.77 vs 0.73 ± 0.42 mV, p = 0.010; septal, 0.96 ± 0.43 vs 0.54 ± 0.18 mV, p = 0.001). Trisected regional analyses revealed that the voltage was higher at the region with a conduction gap than at the region without. Complete conduction block across the roof and septal lines was not achieved in 3 (7%) and 6 patients (17%), respectively. Patients in whom a linear conduction block could not be achieved demonstrated higher ablation area voltage than those with a successful conduction block (roof, 1.91 ± 0.74 vs 0.81 ± 0.51 mV, p = 0.001; septal, 1.15 ± 0.56 vs 0.69 ± 0.31 mV, p = 0.006). In conclusion, a high regional bipolar voltage predicts failure to achieve conduction block after left atrial roof or septal linear ablation. In addition, the conduction gap was located at the preserved voltage area. Copyright © 2017 Elsevier Inc. All rights reserved.

  1. Graphene-Based Linear Tandem Micro-Supercapacitors with Metal-Free Current Collectors and High-Voltage Output.

    Shi, Xiaoyu; Wu, Zhong-Shuai; Qin, Jieqiong; Zheng, Shuanghao; Wang, Sen; Zhou, Feng; Sun, Chenglin; Bao, Xinhe

    2017-11-01

    Printable supercapacitors are regarded as a promising class of microscale power source, but are facing challenges derived from conventional sandwich-like geometry. Herein, the printable fabrication of new-type planar graphene-based linear tandem micro-supercapacitors (LTMSs) on diverse substrates with symmetric and asymmetric configuration, high-voltage output, tailored capacitance, and outstanding flexibility is demonstrated. The resulting graphene-based LTMSs consisting of 10 micro-supercapacitors (MSs) present efficient high-voltage output of 8.0 V, suggestive of superior uniformity of the entire integrated device. Meanwhile, LTMSs possess remarkable flexibility without obvious capacitance degradation under different bending states. Moreover, areal capacitance of LTMSs can be sufficiently modulated by incorporating polyaniline-based pseudocapacitive nanosheets into graphene electrodes, showing enhanced capacitance of 7.6 mF cm -2 . To further improve the voltage output and energy density, asymmetric LTMSs are fabricated through controlled printing of linear-patterned graphene as negative electrodes and MnO 2 nanosheets as positive electrodes. Notably, the asymmetric LTMSs from three serially connected MSs are easily extended to 5.4 V, triple voltage output of the single cell (1.8 V), suggestive of the versatile applicability of this technique. Therefore, this work offers numerous opportunities of graphene and analogous nanosheets for one-step scalable fabrication of flexible tandem energy storage devices integrating with printed electronics on same substrate. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. Total dose induced increase in input offset voltage in JFET input operational amplifiers

    Pease, R.L.; Krieg, J.; Gehlhausen, M.; Black, J.

    1999-01-01

    Four different types of commercial JFET input operational amplifiers were irradiated with ionizing radiation under a variety of test conditions. All experienced significant increases in input offset voltage (Vos). Microprobe measurement of the electrical characteristics of the de-coupled input JFETs demonstrates that the increase in Vos is a result of the mismatch of the degraded JFETs. (authors)

  3. High-voltage integrated linear regulator with current sinking capabilities for portable ultrasound scanners

    Pausas, Guifre Vendrell; Llimos Muntal, Pere; Jørgensen, Ivan Harald Holger

    2017-01-01

    This paper presents a high-voltage integrated regulator capable of sinking current for driving pulse-triggered level shifters in drivers for ultrasound applications. The regulator utilizes a new topology with a feedback loop and a current sinking circuit to satisfy the requirements of the portable....... The proposed design has been implemented in high-voltage 0.18 μm process whithin an area of 0.11 mm2 and it is suitable for system-on-chip integration due to its low component count and the fully integrated design....

  4. One-dimensional breakdown voltage model of SOI RESURF lateral power device based on lateral linearly graded approximation

    Zhang Jun; Guo Yu-Feng; Xu Yue; Lin Hong; Yang Hui; Hong Yang; Yao Jia-Fei

    2015-01-01

    A novel one-dimensional (1D) analytical model is proposed for quantifying the breakdown voltage of a reduced surface field (RESURF) lateral power device fabricated on silicon on an insulator (SOI) substrate. We assume that the charges in the depletion region contribute to the lateral PN junctions along the diagonal of the area shared by the lateral and vertical depletion regions. Based on the assumption, the lateral PN junction behaves as a linearly graded junction, thus resulting in a reduced surface electric field and high breakdown voltage. Using the proposed model, the breakdown voltage as a function of device parameters is investigated and compared with the numerical simulation by the TCAD tools. The analytical results are shown to be in fair agreement with the numerical results. Finally, a new RESURF criterion is derived which offers a useful scheme to optimize the structure parameters. This simple 1D model provides a clear physical insight into the RESURF effect and a new explanation on the improvement in breakdown voltage in an SOI RESURF device. (paper)

  5. Submicrosecond linear pulse transformer for 800 kV voltage with modular low-inductance primary power supply

    Bykov, Yu. A.; Krastelev, E. G., E-mail: ekrastelev@yandex.ru; Popov, G. V.; Sedin, A. A.; Feduschak, V. F. [Russian Academy of Sciences, Joint Institute for High Temperatures (Russian Federation)

    2016-12-15

    A pulsed power source with voltage amplitude up to 800 kV for fast charging (350–400 ns) of the forming line of a high-current nanosecond accelerator is developed. The source includes capacitive energy storage and a linear pulse transformer. The linear transformer consists of a set of 20 inductors with circular ferromagnetic cores surrounded by primary windings inside of which a common stock adder of voltage with film-glycerol insulation is placed. The primary energy storage consists of ten modules, each of which is a low-inductance assembly of two capacitors with a capacitance of 0.35 μF and one gas switch mounted in the same frame. The total energy stored in capacitors is 5.5 kJ at the operating voltage of 40 kV. According to test results, the parameters of the equivalent circuit of the source are the following: shock capacitance = 17.5 nF, inductance = 2 μH, resistance = 3.2 Ω.

  6. A 5 V-to-3.3 V CMOS Linear Regulator with Three-Output Temperature-Independent Reference Voltages

    San-Fu Wang

    2016-01-01

    Full Text Available This paper presents a 5 V-to-3.3 V linear regulator circuit, which uses 3.3 V CMOS transistors to replace the 5 V CMOS transistors. Thus, the complexity of the manufacturing semiconductor process can be improved. The proposed linear regulator is implemented by cascode architecture, which requires three different reference voltages as the bias voltages of its circuit. Thus, the three-output temperature-independent reference voltage circuit is proposed, which provides three accurate reference voltages simultaneously. The three-output temperature-independent reference voltages also can be used in other circuits of the chip. By using the proposed temperature-independent reference voltages, the proposed linear regulator can provide an accurate output voltage, and it is suitable for low cost, small size, and highly integrated system-on-chip (SoC applications. Moreover, the proposed linear regulator uses the cascode technique, which improves both the gain performance and the isolation performance. Therefore, the proposed linear regulator has a good performance in reference voltage to output voltage isolation. The voltage variation of the linear regulator is less than 2.153% in the temperature range of −40°C–120°C, and the power supply rejection ratio (PSRR is less than −42.8 dB at 60 Hz. The regulator can support 0~200 mA output current. The core area is less than 0.16 mm2.

  7. Increasing break-down strength of the support colomn of high-voltage accelerators

    Rezvykh, K.A.; Romanov, V.A.

    1981-01-01

    Calculation results of strength of electric field of the EG-2.5 electrostatic accelerator for the support colomn with electrodes of circular and elliptical transverse cross sections are presented. Conducted is the choice of constructing the column under the condition that the dimensions of the tank, high-voltage electrode, step between the sections and internal diameter of the colomn electrodes are not changed. The potential at the high-voltage electrode equals 2.5 MV while the average longitudinal gradient of the colomn field equals 1.25 MV/m. The support insulation colomn of the high-voltage accelerator screened by rings with transverse cross section in the form of orientation oval in some accelerators promotes obtaining higher operating voltage and at the same time increase of operation reliability at the rest unchanged dimensions of the plant because the probability of break-down between the support colomn and the tank wall decreases. The latter is especially significant for most high-energy accelerators as well as for accelerators used in national economy [ru

  8. A Capacitor-Free, Fast Transient Response Linear Voltage Regulator In a 180nm CMOS

    Deleuran, Alexander N.; Lindbjerg, Nicklas; Pedersen, Martin K.

    2015-01-01

    A 1.8 V capacitor-free linear regulator with fast transient response based on a new topology with a fast and slow regulation loop is presented. The design has been laid out and simulated in a 0.18 µm CMOS process. The design has a low component count and is tailored for system-on-chip integration...

  9. Artifical Excitation of Ferro-Resonance for Testing Electrotechnical Equipment in Distribution Devices with Increased Voltage

    Ye. V. Dmitriev

    2006-01-01

    Full Text Available On the basis of the developed device for protection against of ferro-resonant and high-frequency cumulative over-voltages an algorithm for obtaining a voltage imitating ferro-resonant over-voltages is proposed in the paper. This algorithm presupposes to apply a voltage to the secondary transformer side from an extraneous source is proposed.

  10. Enhanced charge efficiency and reduced energy use in capacitive deionization by increasing the discharge voltage.

    Kim, T; Dykstra, J E; Porada, S; van der Wal, A; Yoon, J; Biesheuvel, P M

    2015-05-15

    Capacitive deionization (CDI) is an electrochemical method for water desalination using porous carbon electrodes. A key parameter in CDI is the charge efficiency, Λ, which is the ratio of salt adsorption over charge in a CDI-cycle. Values for Λ in CDI are typically around 0.5-0.8, significantly less than the theoretical maximum of unity, due to the fact that not only counterions are adsorbed into the pores of the carbon electrodes, but at the same time coions are released. To enhance Λ, ion-exchange membranes (IEMs) can be implemented. With membranes, Λ can be close to unity because the membranes only allow passage for the counterions. Enhancing the value of Λ is advantageous as this implies a lower electrical current and (at a fixed charging voltage) a reduced energy use. We demonstrate how, without the need to include IEMs, the charge efficiency can be increased to values close to the theoretical maximum of unity, by increasing the cell voltage during discharge, with only a small loss of salt adsorption capacity per cycle. In separate constant-current CDI experiments, where after some time the effluent salt concentration reaches a stable value, this value is reached earlier with increased discharge voltage. We compare the experimental results with predictions of porous electrode theory which includes an equilibrium Donnan electrical double layer model for salt adsorption in carbon micropores. Our results highlight the potential of modified operational schemes in CDI to increase charge efficiency and reduce energy use of water desalination. Copyright © 2014 Elsevier Inc. All rights reserved.

  11. Experimental Analysis of Linear Induction Motor under Variable Voltage Variable Frequency (VVVF Power Supply

    Prasenjit D. Wakode

    2016-07-01

    Full Text Available This paper presents the complete analysis of Linear Induction Motor (LIM under VVVF. The complete variation of LIM air gap flux under ‘blocked Linor’ condition and starting force is analyzed and presented when LIM is given VVVF supply. The analysis of this data is important in further understanding of the equivalent circuit parameters of LIM and to study the magnetic circuit of LIM. The variation of these parameters is important to know the LIM response at different frequencies. The simulation and application of different control strategies such as vector control thus becomes quite easy to apply and understand motor’s response under such strategy of control.

  12. Comparison of experimental and theoretical reaction rail currents, rail voltages, and airgap fields for the linear induction motor research vehicle

    Elliott, D. G.

    1977-01-01

    Measurements of reaction rail currents, reaction rail voltages, and airgap magnetic fields in tests of the Linear Induction Motor Research Vehicle (LIMRV) were compared with theoretical calculations from the mesh/matrix theory. It was found that the rail currents and magnetic fields predicted by the theory are within 20 percent of the measured currents and fields at most motor locations in most of the runs, but differ by as much as a factor of two in some cases. The most consistent difference is a higher experimental than theoretical magnetic field near the entrance of the motor and a lower experimental than theoretical magnetic field near the exit. The observed differences between the theoretical and experimental magnetic fields and currents do not account for the differences of as much as 26 percent between the theoretical and experimental thrusts.

  13. Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

    Bhowmik, R. N.; Vijayasri, G.

    2015-06-01

    We have studied current-voltage (I-V) characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (˜500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

  14. Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3} oxide

    Bhowmik, R. N., E-mail: rnbhowmik.phy@pondiuni.edu.in; Vijayasri, G. [Department of Physics, Pondicherry University, R.Venkataraman Nagar, Kalapet, Puducherry - 605 014 (India)

    2015-06-15

    We have studied current-voltage (I-V) characteristics of α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3}, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔV{sub P}) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

  15. Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

    R. N. Bhowmik

    2015-06-01

    Full Text Available We have studied current-voltage (I-V characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP 0.345(± 0.001 V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%, magnetoresistance (70-135 % and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

  16. Assessment of the setup dependence of detector response functions for mega-voltage linear accelerators

    Fox, Christopher; Simon, Tom; Simon, Bill; Dempsey, James F.; Kahler, Darren; Palta, Jatinder R.; Liu Chihray; Yan Guanghua [Sun Nuclear Inc., 425-A Pineda Court, Melbourne, Florida 32940 and Department of Radiation Oncology, University of Florida, P.O. Box 100385, Gainesville, Florida 32610-0385 (United States); NRE, 202 Nuclear Science Building, University of Florida, P.O. Box 118300, Gainesville, Florida 32611-8300 and Sun Nuclear Inc., 425-A Pineda Court, Melbourne, Florida 32940 (United States); Sun Nuclear Inc., 425-A Pineda Court, Melbourne, Florida 32940 (United States); ViewRay Inc., 2 Thermo Fisher Way, Oakwood Village, Ohio 44146 (United States); Department of Radiation Oncology, University of Florida, P.O. Box 100385, Gainesville, Florida 32610-0385 (United States)

    2010-02-15

    Purpose: Accurate modeling of beam profiles is important for precise treatment planning dosimetry. Calculated beam profiles need to precisely replicate profiles measured during machine commissioning. Finite detector size introduces perturbations into the measured profiles, which, in turn, impact the resulting modeled profiles. The authors investigate a method for extracting the unperturbed beam profiles from those measured during linear accelerator commissioning. Methods: In-plane and cross-plane data were collected for an Elekta Synergy linac at 6 MV using ionization chambers of volume 0.01, 0.04, 0.13, and 0.65 cm{sup 3} and a diode of surface area 0.64 mm{sup 2}. The detectors were orientated with the stem perpendicular to the beam and pointing away from the gantry. Profiles were measured for a 10x10 cm{sup 2} field at depths ranging from 0.8 to 25.0 cm and SSDs from 90 to 110 cm. Shaping parameters of a Gaussian response function were obtained relative to the Edge detector. The Gaussian function was deconvolved from the measured ionization chamber data. The Edge detector profile was taken as an approximation to the true profile, to which deconvolved data were compared. Data were also collected with CC13 and Edge detectors for additional fields and energies on an Elekta Synergy, Varian Trilogy, and Siemens Oncor linear accelerator and response functions obtained. Response functions were compared as a function of depth, SSD, and detector scan direction. Variations in the shaping parameter were introduced and the effect on the resulting deconvolution profiles assessed. Results: Up to 10% setup dependence in the Gaussian shaping parameter occurred, for each detector for a particular plane. This translated to less than a {+-}0.7 mm variation in the 80%-20% penumbral width. For large volume ionization chambers such as the FC65 Farmer type, where the cavity length to diameter ratio is far from 1, the scan direction produced up to a 40% difference in the shaping

  17. Assessment of the setup dependence of detector response functions for mega-voltage linear accelerators

    Fox, Christopher; Simon, Tom; Simon, Bill; Dempsey, James F.; Kahler, Darren; Palta, Jatinder R.; Liu Chihray; Yan Guanghua

    2010-01-01

    Purpose: Accurate modeling of beam profiles is important for precise treatment planning dosimetry. Calculated beam profiles need to precisely replicate profiles measured during machine commissioning. Finite detector size introduces perturbations into the measured profiles, which, in turn, impact the resulting modeled profiles. The authors investigate a method for extracting the unperturbed beam profiles from those measured during linear accelerator commissioning. Methods: In-plane and cross-plane data were collected for an Elekta Synergy linac at 6 MV using ionization chambers of volume 0.01, 0.04, 0.13, and 0.65 cm 3 and a diode of surface area 0.64 mm 2 . The detectors were orientated with the stem perpendicular to the beam and pointing away from the gantry. Profiles were measured for a 10x10 cm 2 field at depths ranging from 0.8 to 25.0 cm and SSDs from 90 to 110 cm. Shaping parameters of a Gaussian response function were obtained relative to the Edge detector. The Gaussian function was deconvolved from the measured ionization chamber data. The Edge detector profile was taken as an approximation to the true profile, to which deconvolved data were compared. Data were also collected with CC13 and Edge detectors for additional fields and energies on an Elekta Synergy, Varian Trilogy, and Siemens Oncor linear accelerator and response functions obtained. Response functions were compared as a function of depth, SSD, and detector scan direction. Variations in the shaping parameter were introduced and the effect on the resulting deconvolution profiles assessed. Results: Up to 10% setup dependence in the Gaussian shaping parameter occurred, for each detector for a particular plane. This translated to less than a ±0.7 mm variation in the 80%-20% penumbral width. For large volume ionization chambers such as the FC65 Farmer type, where the cavity length to diameter ratio is far from 1, the scan direction produced up to a 40% difference in the shaping parameter between in

  18. Cross-sectional area of the murine aorta linearly increases with increasing core body temperature.

    Crouch, A Colleen; Manders, Adam B; Cao, Amos A; Scheven, Ulrich M; Greve, Joan M

    2017-11-06

    The cardiovascular (CV) system plays a vital role in thermoregulation. To date, the response of core vasculature to increasing core temperature has not been adequately studied in vivo. Our objective was to non-invasively quantify the arterial response in murine models due to increases in body temperature, with a focus on core vessels of the torso and investigate whether responses were dependent on sex or age. Male and female, adult and aged mice were anaesthetised and underwent magnetic resonance imaging (MRI). Data were acquired from the circle of Willis (CoW), heart, infrarenal aorta and peripheral arteries at core temperatures of 35, 36, 37 and 38 °C (±0.2 °C). Vessels in the CoW did not change. Ejection fraction decreased and cardiac output (CO) increased with increasing temperature in adult female mice. Cross-sectional area of the aorta increased significantly and linearly with temperature for all groups, but at a diminished rate for aged animals (p temperature are biologically important because they may affect conductive and convective heat transfer. Leveraging non-invasive methodology to quantify sex and age dependent vascular responses due to increasing core temperature could be combined with bioheat modelling in order to improve understanding of thermoregulation.

  19. Single-Event Transient Testing of Low Dropout PNP Series Linear Voltage Regulators

    Adell, Philippe; Allen, Gregory

    2013-01-01

    As demand for high-speed, on-board, digital-processing integrated circuits on spacecraft increases (field-programmable gate arrays and digital signal processors in particular), the need for the next generation point-of-load (POL) regulator becomes a prominent design issue. Shrinking process nodes have resulted in core rails dropping to values close to 1.0 V, drastically reducing margin to standard switching converters or regulators that power digital ICs. The goal of this task is to perform SET characterization of several commercial POL converters, and provide a discussion of the impact of these results to state-of-the-art digital processing IC through laser and heavy ion testing

  20. Voltage Dependence of Supercapacitor Capacitance

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  1. Low Voltage Ride-Through of Two-Stage Grid-Connected Photovoltaic Systems Through the Inherent Linear Power-Voltage Characteristic

    Yang, Yongheng; Sangwongwanich, Ariya; Liu, Hongpeng

    2017-01-01

    In this paper, a cost-effective control scheme for two-stage grid-connected PhotoVoltaic (PV) systems in Low Voltage Ride-Through (LVRT) operation is proposed. In the case of LVRT, the active power injection by PV panels should be limited to prevent from inverter over-current and also energy...... aggregation at the dc-link, which will challenge the dc-link capacitor lifetime if remains uncontrolled. At the same time, reactive currents should be injected upon any demand imposed by the system operators. In the proposed scheme, the two objectives can be feasibly achieved. The active power is regulated...... point tracking controller without significant hardware or software modifications. In this way, the PV system will not operate at the maximum power point, whereas the inverter will not face any over-current challenge but can provide reactive power support in response to the grid voltage fault...

  2. Ozone synthesis improves by increasing number density of plasma channels and lower voltage in a nonthermal plasma

    Arif Malik, Muhammad; Hughes, David

    2016-04-01

    Improvements in ozone synthesis from air and oxygen by increasing the number density of plasma channels and lower voltage for the same specific input energy (SIE) were explored in a nonthermal plasma based on a sliding discharge. The number of plasma channels and energy per pulse increased in direct proportion to the increase in the effective length of the anode (the high voltage electrode). Decreasing the discharge gap increased the energy per pulse for the same length and allowed the installation of more electrode pairs in the same space. It allowed the increase of the number of plasma channels in the same space to achieve the same SIE at a lower peak voltage with less energy per plasma channel. The ozone concentration gradually increased to ~1500 ppmv (140 to 50 g kWh-1) from air and to ~6000 ppmv (400 to 200 g kWh-1) from oxygen with a gradual increase in the SIE to ~200 J L-1, irrespective of the variations in electrode geometry, applied voltage or flow rate of the feed gas. A gradual increase in SIE beyond 200 J L-1 gradually increased the ozone concentration to a certain maximum value followed by a decline, but the rate of increase and the maximum value was higher for the greater number of plasma channels and lower peak voltage combination. The maximum ozone concentration was ~5000 ppmv (~30 g kWh-1) from air and ~22 000 ppmv (~80 g kWh-1) from oxygen. The results are explained on the basis of characteristics of the plasma and ozone synthesis mechanism.

  3. Temperature and sowing date affect the linear increase of sunflower harvest index

    Bange, M.P.; Hammer, G.L.; Rickert, K.G.

    1998-01-01

    The linearity of daily linear harvest index (HI) increase can provide a simple means to predict grain growth and yield in field crops. However, the stability of the rate of increase across genotypes and environments is uncertain. Data from three field experiments were collated to investigate the phase of linear HI increase of sunflower (Helianthus annuus L.) across environments by changing genotypes, sowing time, N level, and solar irradiation level. Linear increase in HI was similar among different genotypes, N levels, and radiation treatments (mean 0.0125 d-1), but significant differences occurred between sowings. The linear increase in HI was not stable at very low temperatures (down to 9 degrees C) during grain filling, due to possible limitations to biomass accumulation and translocation (mean 0.0091 d-1). Using the linear increase in HI to predict grain yield requires predictions of the duration from an thesis to the onset of linear HI increase (lag phase) and the cessation of linear HI increase. These studies showed that the lag phase differed, and the linear HI increase ceased when 91% of the anthesis to physiological maturity period had been completed

  4. The Studies of a Vacuum Gap Breakdown after High-Current Arc Interruption with Increasing the Voltage

    Schneider, A. V.; Popov, S. A.; Batrakov, A. V.; Dubrovskaya, E. L.; Lavrinovich, V. A.

    2017-12-01

    Vacuum-gap breakdown has been studied after high-current arc interruption with a subsequent increase in the transient recovery voltage across a gap. The effects of factors, such as the rate of the rise in the transient voltage, the potential of the shield that surrounds a discharge gap, and the arc burning time, have been determined. It has been revealed that opening the contacts earlier leads to the formation of an anode spot, which is the source of electrode material vapors into the discharge gap after current zero moment. Under the conditions of increasing voltage, this fact results in the breakdown. Too late opening leads to the breakdown of a short gap due to the high electric fields.

  5. A simple method to increase effective PMT gain by amplifier circuit powered from voltage divider

    Popov, V.; Majewski, S.; Wojtsekhowski, B.; Guerin, D

    2001-01-01

    A novel concept is introduced of additional effective signal amplification by employing a dedicated circuit to process anode or dynode signals prior to sending them through a standard 50 /spl Omega/ line/cable. The circuit is entirely powered by the current flowing through the base voltage divider. Additional gain factors of 2-10 were easily achieved with preserved operation speed and rate capability up to several MHz. This additional signal boost can be used in many applications where higher gain and/or lower PMT operational voltages are desirable. For example, in the case of a PMT employed in a low input light signal (such as a Cherenkov counter), this technique will permit operation at a lower voltage and, therefore, will result in better operational PMT stability and longer PMT lifetime. At present, two experimental set-ups at Jefferson Lab are using PMT bases using this concept

  6. A structured approach to increase situational awareness in low voltage distribution grids

    Helmholt, K.A.; Groote Schaarsberg, M.; Broersma, T.; Morren, J.; Kruizinga, B.; Wouters, P.A.A.F.; Steennis, E.F.; Baldinger, F.

    2015-01-01

    Wear and tear, electrification and aging of (low voltage) distribution grids require maintenance in order to assure continuous provision of electricity. Situational awareness is required to find out when parts of the grid need maintenance and which parts should be prioritized. The paper proposes a

  7. Safety of wet welding with increased open circuit voltages up to 150 V d.c

    Schmidt, K.; Kozig, G.; Ross, J.A.S.; Green, H.L.

    1991-01-01

    An experimental test programme was performed to demonstrate that wet welding with open circuit voltages up to 150 V d.c. would not result in dangerous situations for the diver induced by electric shock. Sea water, fresh water, different types of diving suits and some worst case situations, resulting from a disregard of good working practice were considered to be test parameters. In sea water a diver will not be endangered by corresponding electric potentials if good working practice is adopted. This was demonstrated even for worst case conditions, e.g. water leakage into the dry suit, accidental positioning to the diver between torch and work piece (stretched arm) and partial removal of coating from the welding rod. The fresh water tests demonstrated higher voltages on the diver but well below accepted threshold limit values. The term 'fresh water' should be critically considered, however, the test results relate only to the water conductivity studied. (orig.) With 30 figs [de

  8. Transformer-assisted PWM zero-voltage switching pole inverter with high output bandwidth applied to linear motor drives

    Myrzik, J.M.A.; Duarte, J.L.; Haardt, de P.; Vissers, J.

    2002-01-01

    An application of the transformer-assisted PWM zero-voltage switching pole inverter (TRAP) is described in this paper. The TRAP is based on the auxiliary resonant commutated pole inverter (ARCP), but avoids its disadvantages. This paper describes the converter functionality and its applicability

  9. Voltage linearity modulation and polarity dependent conduction in metal-insulator-metal capacitors with atomic-layer-deposited Al{sub 2}O{sub 3}/ZrO{sub 2}/SiO{sub 2} nano-stacks

    Zhu, Bao; Liu, Wen-Jun; Wei, Lei; Zhang, David Wei; Jiang, Anquan; Ding, Shi-Jin, E-mail: sjding@fudan.edu.cn [State Key Laboratory of ASIC and System, School of Microelectronics, Fudan University, Shanghai 200433 (China)

    2015-07-07

    Excellent voltage linearity of metal-insulator-metal (MIM) capacitors is highly required for next generation radio frequency integration circuits. In this work, employing atomic layer deposition technique, we demonstrated how the voltage linearity of MIM capacitors was modulated by adding different thickness of SiO{sub 2} layer to the nano-stack of Al{sub 2}O{sub 3}/ZrO{sub 2}. It was found that the quadratic voltage coefficient of capacitance (α) can be effectively reduced from 1279 to −75 ppm/V{sup 2} with increasing the thickness of SiO{sub 2} from zero to 4 nm, which is more powerful than increasing the thickness of ZrO{sub 2} in the Al{sub 2}O{sub 3}/ZrO{sub 2} stack. This is attributed to counteraction between the positive α for Al{sub 2}O{sub 3}/ZrO{sub 2} and the negative one for SiO{sub 2} in the MIM capacitors with Al{sub 2}O{sub 3}/ZrO{sub 2}/SiO{sub 2} stacks. Interestingly, voltage-polarity dependent conduction behaviors in the MIM capacitors were observed. For electron bottom-injection, the addition of SiO{sub 2} obviously suppressed the leakage current; however, it abnormally increased the leakage current for electron top-injection. These are ascribed to the co-existence of shallow and deep traps in ZrO{sub 2}, and the former is in favor of the field-assisted tunnelling conduction and the latter contributes to the trap-assisted tunnelling process. The above findings will be beneficial to device design and process optimization for high performance MIM capacitors.

  10. Reducing burn-in voltage loss in polymer solar cells by increasing the polymer crystallinity

    Heumueller, Thomas

    2014-08-01

    In order to commercialize polymer solar cells, the fast initial performance losses present in many high efficiency materials will have to be managed. This burn-in degradation is caused by light-induced traps and its characteristics depend on which polymer is used. We show that the light-induced traps are in the bulk of the active layer and we find a direct correlation between their presence and the open-circuit voltage loss in devices made with amorphous polymers. Solar cells made with crystalline polymers do not show characteristic open circuit voltage losses, even though light-induced traps are also present in these devices. This indicates that crystalline materials are more resistant against the influence of traps on device performance. Recent work on crystalline materials has shown there is an energetic driving force for charge carriers to leave amorphous, mixed regions of bulk heterojunctions, and charges are dominantly transported in pure, ordered phases. This energetic landscape allows efficient charge generation as well as extraction and also may benefit the stability against light-induced traps. This journal is © the Partner Organisations 2014.

  11. Exponential increase in postprandial blood-glucose exposure with increasing carbohydrate loads using a linear carbohydrate-to-insulin ratio.

    Marran, K J; Davey, B; Lang, A; Segal, D G

    2013-04-10

    Postprandial glucose excursions contribute significantly to average blood glucose, glycaemic variability and cardiovascular risk. Carbohydrate counting is a method of insulin dosing that balances carbohydrate load to insulin dose using a fixed ratio. Many patients and current insulin pumps calculate insulin delivery for meals based on a linear carbohydrate-to-insulin relationship. It is our hypothesis that a non-linear relationship exists between the amounts of carbohydrate consumed and the insulin required to cover it. To document blood glucose exposure in response to increasing carbohydrate loads on fixed carbohydrate-to-insulin ratios. Five type 1 diabetic subjects receiving insulin pump therapy with good control were recruited. Morning basal rates and carbohydrate- to-insulin ratios were optimised. A Medtronic glucose sensor was used for 5 days to collect data for area-under-the-curve (AUC) analysis, during which standardised meals of increasing carbohydrate loads were consumed. Increasing carbohydrate loads using a fixed carbohydrate-to-insulin ratio resulted in increasing glucose AUC. The relationship was found to be exponential rather than linear. Late postprandial hypoglycaemia followed carbohydrate loads of >60 g and this was often followed by rebound hyperglycaemia that lasted >6 hours. A non-linear relationship exists between carbohydrates consumed and the insulin required to cover them. This has implications for control of postprandial blood sugars, especially when consuming large carbohydrate loads. Further studies are required to look at the optimal ratios, duration and type of insulin boluses required to cover increasing carbohydrate loads.

  12. Research on electrodischarge drilling of polycrystalline diamond with increased gap voltage

    Skoczypiec, Sebastian; Bizoń, Wojciech; Żyra, Agnieszka

    2018-05-01

    This paper presents an experimental investigation of the machining characteristics of polycrystalline diamond (PCD). Machining of PCD by conventional technologies is not an effective solution. Due to presence of cobalt this material can be machined by application of electrical discharges. On the other side, electrical conductivity of PCD is on the limit of electrodischarge machining (EDM) possibilities. Proposed paper reports experimental investigation on electrodischarge drilling of PCD samples. The test were carried out with application on of high-voltage (up to 550 V) pulse power unit for two kinds of dielectrics: carbon based (Exxsol D80) and de-ionized water. As output parameters machining accuracy (side gap), material removal rate were selected. Also, based on SEM photographs and energy dispersive X-ray spectroscopy (EDS) analysis, a qualitative evaluation of the obtained results was presented.

  13. Deposition and characterization of zirconium nitride (ZrN) thin films by reactive magnetron sputtering with linear gas ion source and bias voltage

    Kavitha, A.; Kannan, R. [Department of Physics, University College of Engineering, Anna University, Dindugal-624622 (India); Subramanian, N. Sankara [Department of Physics, Thiagarajar College of Engineering, Madurai -625015, Tamilnadu (India); Loganathan, S. [Ion Plating, Titan Industries Ltd., Hosur - 635126, Tamilnadu (India)

    2014-04-24

    Zirconium nitride thin films have been prepared on stainless steel substrate (304L grade) by reactive cylindrical magnetron sputtering method with Gas Ion Source (GIS) and bias voltage using optimized coating parameters. The structure and surface morphologies of the ZrN films were characterized using X-ray diffraction, atomic microscopy and scanning electron microscopy. The adhesion property of ZrN thin film has been increased due to the GIS. The coating exhibits better adhesion strength up to 10 N whereas the ZrN thin film with bias voltage exhibits adhesion up to 500 mN.

  14. Increasing conversion efficiency of two-step photon up-conversion solar cell with a voltage booster hetero-interface.

    Asahi, Shigeo; Kusaki, Kazuki; Harada, Yukihiro; Kita, Takashi

    2018-01-17

    Development of high-efficiency solar cells is one of the attractive challenges in renewable energy technologies. Photon up-conversion can reduce the transmission loss and is one of the promising concepts which improve conversion efficiency. Here we present an analysis of the conversion efficiency, which can be increased by up-conversion in a single-junction solar cell with a hetero-interface that boosts the output voltage. We confirm that an increase in the quasi-Fermi gap and substantial photocurrent generation result in a high conversion efficiency.

  15. Linear increases in BOLD response associated with increasing proportion of incongruent trials across time in a colour Stroop task.

    Mitchell, Rachel L C

    2010-05-01

    Selective attention is popularly assessed with colour Stroop tasks in which participants name the ink colour of colour words, whilst resisting interference from the natural tendency to read the words. Prior studies hinted that the key brain regions (dorsolateral prefrontal (dlPFC) and anterior cingulate cortex (ACC)) may vary their degree of involvement, dependent on attentional demand. This study aimed to determine whether a parametrically varied increase in attentional demand resulted in linearly increased activity in these regions, and/or whether additional regions would be recruited during high attentional demand. Twenty-eight healthy young adults underwent fMRI whilst naming the font colour of colour words. Linear increases in BOLD response were assessed with increasing percentage incongruent trials per block (0, 20, 40, 60, 80, and 100%). Whilst ACC activation increased linearly according to incongruity level, dlPFC activity appeared constant. Together with behavioural evidence of reduced Stroop interference, these data support a load-dependent conflict-related response in ACC, but not dlPFC.

  16. Increase of nonlinear signal distortions due to linear mode coupling in space division multiplexed systems

    Kutluyarov, Ruslan V.; Bagmanov, Valeriy Kh; Antonov, Vyacheslav V.

    2017-01-01

    This paper is focused on the analysis of linear and nonlinear mode coupling in space division multiplexed (SDM) optical communications over step-index fiber in few-mode regime. Linear mode coupling is caused by the fiber imperfections, while the nonlinear coupling is caused by the Kerr......-nonlinearities. Therefore, we use the system of generalized coupled nonlinear Schrödinger equations (GCNLSE) to describe the signal propagation. We analytically show that the presence of linear mode coupling may cause increasing of the nonlinear signal distortions. For the detailed study we solve GCNLSE numerically...... for the standard step index fiber at the wavelength of 850 nm in the basis of spatial modes with helical phase front (vortex modes) and for a special kind of few-mode fiber with enlarged core, providing propagation of five spatial modes at 1550 nm. Simulation results confirm that the linear mode coupling may lead...

  17. Field and polarity dependence of time-to-resistance increase in Fe–O films studied by constant voltage stress method

    Eriguchi, Koji; Wei, Zhiqiang; Takagi, Takeshi; Ohta, Hiroaki; Ono, Kouichi

    2009-01-01

    Constant voltage stress (CVS) was applied to Fe–O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (tr) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. Fro...

  18. Electromagnetic fields (UHF) increase voltage sensitivity of membrane ion channels; possible indication of cell phone effect on living cells.

    Ketabi, N; Mobasheri, H; Faraji-Dana, R

    2015-03-01

    The effects of ultra high frequency (UHF) nonionizing electromagnetic fields (EMF) on the channel activities of nanopore forming protein, OmpF porin, were investigated. The voltage clamp technique was used to study the single channel activity of the pore in an artificial bilayer in the presence and absence of the electromagnetic fields at 910 to 990 MHz in real time. Channel activity patterns were used to address the effect of EMF on the dynamic, arrangement and dielectric properties of water molecules, as well as on the hydration state and arrangements of side chains lining the channel barrel. Based on the varied voltage sensitivity of the channel at different temperatures in the presence and absence of EMF, the amount of energy transferred to nano-environments of accessible groups was estimated to address the possible thermal effects of EMF. Our results show that the effects of EMF on channel activities are frequency dependent, with a maximum effect at 930 MHz. The frequency of channel gating and the voltage sensitivity is increased when the channel is exposed to EMF, while its conductance remains unchanged at all frequencies applied. We have not identified any changes in the capacitance and permeability of membrane in the presence of EMF. The effect of the EMF irradiated by cell phones is measured by Specific Absorption Rate (SAR) in artificial model of human head, Phantom. Thus, current approach applied to biological molecules and electrolytes might be considered as complement to evaluate safety of irradiating sources on biological matter at molecular level.

  19. Block of voltage-gated potassium channels by Pacific ciguatoxin-1 contributes to increased neuronal excitability in rat sensory neurons

    Birinyi-Strachan, Liesl C.; Gunning, Simon J.; Lewis, Richard J.; Nicholson, Graham M.

    2005-01-01

    The present study investigated the actions of the polyether marine toxin Pacific ciguatoxin-1 (P-CTX-1) on neuronal excitability in rat dorsal root ganglion (DRG) neurons using patch-clamp recording techniques. Under current-clamp conditions, bath application of 2-20 nM P-CTX-1 caused a rapid, concentration-dependent depolarization of the resting membrane potential in neurons expressing tetrodotoxin (TTX)-sensitive voltage-gated sodium (Na v ) channels. This action was completely suppressed by the addition of 200 nM TTX to the external solution, indicating that this effect was mediated through TTX-sensitive Na v channels. In addition, P-CTX-1 also prolonged action potential and afterhyperpolarization (AHP) duration. In a subpopulation of neurons, P-CTX-1 also produced tonic action potential firing, an effect that was not accompanied by significant oscillation of the resting membrane potential. Conversely, in neurons expressing TTX-resistant Na v currents, P-CTX-1 failed to alter any parameter of neuronal excitability examined in this study. Under voltage-clamp conditions in rat DRG neurons, P-CTX-1 inhibited both delayed-rectifier and 'A-type' potassium currents in a dose-dependent manner, actions that occurred in the absence of alterations to the voltage dependence of activation. These actions appear to underlie the prolongation of the action potential and AHP, and contribute to repetitive firing. These data indicate that a block of potassium channels contributes to the increase in neuronal excitability, associated with a modulation of Na v channel gating, observed clinically in response to ciguatera poisoning

  20. Characteristics of MAO coating obtained on ZK60 Mg alloy under two and three steps voltage-increasing modes in dual electrolyte

    Yang, Jun; Wang, Ze-Xin; Lu, Sheng; Lv, Wei-gang; Jiang, Xi-zhi; Sun, Lei

    2017-03-01

    The micro-arc oxidation process was conducted on ZK60 Mg alloy under two and three steps voltage-increasing modes by DC pulse electrical source. The effect of each mode on current-time responses during MAO process and the coating characteristic were analysed and discussed systematically. The microstructure, thickness and corrosion resistance of MAO coatings were evaluated by scanning electron microscopy (SEM), energy disperse spectroscopy (EDS), microscope with super-depth of field and electrochemical impedance spectroscopy (EIS). The results indicate that two and three steps voltage-increasing modes can improve weak spark discharges with insufficient breakdown strength in later period during the MAO process. Due to higher value of voltage and voltage increment, the coating with maximum thickness of about 20.20μm formed under two steps voltage-increasing mode shows the best corrosion resistance. In addition, the coating fabricated under three steps voltage-increasing mode shows a smoother coating with better corrosion resistance due to the lower amplitude of voltage-increasing.

  1. Field and polarity dependence of time-to-resistance increase in Fe-O films studied by constant voltage stress method

    Eriguchi, Koji; Ohta, Hiroaki; Ono, Kouichi; Wei Zhiqiang; Takagi, Takeshi

    2009-01-01

    Constant voltage stress (CVS) was applied to Fe-O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (t r ) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. From a polarity-dependent resistance increase determined by a time-zero measurement, the voltage and polarity-dependent t r were discussed on the basis of field- and structure-enhanced thermochemical reaction mechanisms

  2. Impact of Crack on Stability of Slope with Linearly Increasing Undrained Strength

    Bing Li

    2018-01-01

    Full Text Available This paper presents a procedure for assessment of the impact of tension crack on stability of slope in clays with linearly increasing undrained strength. The procedure is based on the limit equilibrium method with variational extremization. The distribution of the normal stress over slip surface is mathematically obtained for slopes in clays with the linearly increasing undrained strength and then used to determine the tension crack for clays with zero tensile strength. The seismic effect is also included using the pseudostatic approach. Closed-form solutions to the minimum safety factor and the maximum crack depth can be derived and given in the form of chart for convenient use. The results demonstrate a significant effect of the tension crack on the stability of steep slopes, especially for strong seismic conditions. In this situation, neglecting the impact of tension crack in traditional ϕ=0 analyses may overestimate the slope safety. The most adverse location of the tension crack can be also determined and presented in the charts, which may be useful in designing reinforcements and remedial measures for slope stabilization.

  3. Voltage-stabilised elastomers with increased relative permittivity and high electrical breakdown strength by means of phase separating binary copolymer blends of silicone elastomers

    A Razak, Aliff Hisyam; Yu, Liyun; Skov, Anne Ladegaard

    2017-01-01

    Increased electrical breakdown strength and increased dielectric permittivity of silicone-based dielectric elastomers are achieved by means of the addition of so-called voltage-stabilisers prepared from PDMS–PPMS copolymers as well as PDMS–PEG copolymers in order to compensate for the negative...... effect of softness on electrical stability of silicone elastomers. The voltage-stabilised elastomer, incorporating a high-permittivity PDMS–PEG copolymer, possesses increased relative permittivity, high electrical breakdown strength, excellent network integrity and low dielectric loss and paves the way...

  4. Dielectric-wall linear accelerator with a high voltage fast rise time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators

    Caporaso, George J.; Sampayan, Stephen E.; Kirbie, Hugh C.

    1998-01-01

    A dielectric-wall linear accelerator is improved by a high-voltage, fast rise-time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators. A high voltage is placed between the electrodes sufficient to stress the voltage breakdown of the insulator on command. A light trigger, such as a laser, is focused along at least one line along the edge surface of the laminated alternating layers of isolated conductors and insulators extending between the electrodes. The laser is energized to initiate a surface breakdown by a fluence of photons, thus causing the electrical switch to close very promptly. Such insulators and lasers are incorporated in a dielectric wall linear accelerator with Blumlein modules, and phasing is controlled by adjusting the length of fiber optic cables that carry the laser light to the insulator surface.

  5. Resistors Improve Ramp Linearity

    Kleinberg, L. L.

    1982-01-01

    Simple modification to bootstrap ramp generator gives more linear output over longer sweep times. New circuit adds just two resistors, one of which is adjustable. Modification cancels nonlinearities due to variations in load on charging capacitor and due to changes in charging current as the voltage across capacitor increases.

  6. Mitigating Voltage Decay of Li-Rich Cathode Material via Increasing Ni Content for Lithium-Ion Batteries.

    Shi, Ji-Lei; Zhang, Jie-Nan; He, Min; Zhang, Xu-Dong; Yin, Ya-Xia; Li, Hong; Guo, Yu-Guo; Gu, Lin; Wan, Li-Jun

    2016-08-10

    Li-rich layered materials have been considered as the most promising cathode materials for future high-energy-density lithium-ion batteries. However, they suffer from severe voltage decay upon cycling, which hinders their further commercialization. Here, we report a Li-rich layered material 0.5Li2MnO3·0.5LiNi0.8Co0.1Mn0.1O2 with high nickel content, which exhibits much slower voltage decay during long-term cycling compared to conventional Li-rich materials. The voltage decay after 200 cycles is 201 mV. Combining in situ X-ray diffraction (XRD), ex situ XRD, ex situ X-ray photoelectron spectroscopy, and scanning transmission electron microscopy, we demonstrate that nickel ions act as stabilizing ions to inhibit the Jahn-Teller effect of active Mn(3+) ions, improving d-p hybridization and supporting the layered structure as a pillar. In addition, nickel ions can migrate between the transition-metal layer and the interlayer, thus avoiding the formation of spinel-like structures and consequently mitigating the voltage decay. Our results provide a simple and effective avenue for developing Li-rich layered materials with mitigated voltage decay and a long lifespan, thereby promoting their further application in lithium-ion batteries with high energy density.

  7. ON THE NEED TO INCREASE THE RELIABILITY OF LINEAR INSULATORS FOR DISTRIBUTION NETWORKS 10-20 KV

    Yu. N. Shumilov

    2018-02-01

    Full Text Available Introduction. In Ukraine high voltage overhead distribution lines (OL of class 6 and 10 kV are the most extended. Their total length exceeds 280,000 km. More than 95% of the lines are made on line supports from reinforced concrete racks. On all poles of the overhead line, pin insulators are installed. According to the data of operation experience, up to 60-70% of single-phase earth (SPE faults due to «insulation» occurs on VL supports due to damage to line pin insulators, mainly during the thunderstorm period. Problem. Insufficient reliability of pin insulators leads to interruptions in power supply, accidents on the line, accidents in the area of reinforced concrete poles, where in the case of insulator damages, a long process of SPE occurs. Goal. The purpose of the work is to select the design and develop requirements for new linear insulators of 10-20 kV overhead lines that provide high resistance to lightning overvoltages with direct and inductive effects of lightning. Methodology. The research methodology consists in analyzing operational experience, calculating insulator parameters and laboratory tests. Results. Using statistical data on lightning parameters and data on mechanical loads on insulators, the main dimensions of line post insulators have been determined that will ensure their reliable operation under conditions of intense thunderstorm activity and extreme ice and wind loads. Conclusions. The main technical requirements for line post insulators for 10-20 kV distribution lines were formulated. On the 10 kV OL located in areas with increased thunderstorm activity it is recommended to use line post insulators instead of pin-type ones. On the OL-20 kV it is recommended to use only line post insulators. The use of high-lightning-resistant line post insulators on OL-10-20 kV will significantly increase the electrical safety and reliability of power supply to consumers. Increased by 2-3 times the cost of line post insulators in

  8. Integrating linear optimization with structural modeling to increase HIV neutralization breadth.

    Alexander M Sevy

    2018-02-01

    Full Text Available Computational protein design has been successful in modeling fixed backbone proteins in a single conformation. However, when modeling large ensembles of flexible proteins, current methods in protein design have been insufficient. Large barriers in the energy landscape are difficult to traverse while redesigning a protein sequence, and as a result current design methods only sample a fraction of available sequence space. We propose a new computational approach that combines traditional structure-based modeling using the Rosetta software suite with machine learning and integer linear programming to overcome limitations in the Rosetta sampling methods. We demonstrate the effectiveness of this method, which we call BROAD, by benchmarking the performance on increasing predicted breadth of anti-HIV antibodies. We use this novel method to increase predicted breadth of naturally-occurring antibody VRC23 against a panel of 180 divergent HIV viral strains and achieve 100% predicted binding against the panel. In addition, we compare the performance of this method to state-of-the-art multistate design in Rosetta and show that we can outperform the existing method significantly. We further demonstrate that sequences recovered by this method recover known binding motifs of broadly neutralizing anti-HIV antibodies. Finally, our approach is general and can be extended easily to other protein systems. Although our modeled antibodies were not tested in vitro, we predict that these variants would have greatly increased breadth compared to the wild-type antibody.

  9. Integrating linear optimization with structural modeling to increase HIV neutralization breadth.

    Sevy, Alexander M; Panda, Swetasudha; Crowe, James E; Meiler, Jens; Vorobeychik, Yevgeniy

    2018-02-01

    Computational protein design has been successful in modeling fixed backbone proteins in a single conformation. However, when modeling large ensembles of flexible proteins, current methods in protein design have been insufficient. Large barriers in the energy landscape are difficult to traverse while redesigning a protein sequence, and as a result current design methods only sample a fraction of available sequence space. We propose a new computational approach that combines traditional structure-based modeling using the Rosetta software suite with machine learning and integer linear programming to overcome limitations in the Rosetta sampling methods. We demonstrate the effectiveness of this method, which we call BROAD, by benchmarking the performance on increasing predicted breadth of anti-HIV antibodies. We use this novel method to increase predicted breadth of naturally-occurring antibody VRC23 against a panel of 180 divergent HIV viral strains and achieve 100% predicted binding against the panel. In addition, we compare the performance of this method to state-of-the-art multistate design in Rosetta and show that we can outperform the existing method significantly. We further demonstrate that sequences recovered by this method recover known binding motifs of broadly neutralizing anti-HIV antibodies. Finally, our approach is general and can be extended easily to other protein systems. Although our modeled antibodies were not tested in vitro, we predict that these variants would have greatly increased breadth compared to the wild-type antibody.

  10. Non-linear increase of respiratory diseases and their costs under severe air pollution.

    Shen, Ying; Wu, Yiyun; Chen, Guangdi; Van Grinsven, Hans J M; Wang, Xiaofeng; Gu, Baojing; Lou, Xiaoming

    2017-05-01

    China is experiencing severe and persistent air pollution, with concentrations of fine particulate matters (PM 2.5 ) reaching unprecedentedly high levels in many cities. Quantifying the detrimental effects on health and their costs derived from high PM 2.5 levels is crucial because of the unsolved challenges to mitigate air pollution in the following decades. Using the daily monitoring data on PM 2.5 concentrations and clinic visits, we found a non-linear increase of respiratory diseases, but not for other diseases (e.g., digestive diseases) under severe air pollution. We found an increase of respiratory diseases by 1% for each 10 μg m -3 increase in PM 2.5 when the annual average daily PM 2.5 concentration was less than 50 μg m -3 ; while this ratio was doubled (around 2%) with the daily PM 2.5 concentration larger than 50 μg m -3 . Under severe air pollution (PM 2.5 concentration >150 μg m -3 ), the respiratory diseases increased by over 50% compared to that in clean days. Children are more sensitive to the severe air pollution. The increase of clinic visits, especially for adults, was observed mainly in bigger (>500 beds) hospitals. Re-allocating medical resources (e.g., doctors) from big hospitals to community hospitals can benefit the respiratory patients due to air pollution. The total medical cost of clinic visits of respiratory diseases derived from PM 2.5 pollution was estimated at 17.2-57.0 billion Yuan in 2014 in China, accounting for 0.5-1.6% of national total health expenditure. Because these medical costs only represent a small part of total health cost derived from air pollution, the reduction of associated health costs would be an important co-benefit of implementation of air pollution preventive strategies. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. High-output microwave detector using voltage-induced ferromagnetic resonance

    Shiota, Yoichi; Suzuki, Yoshishige; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Yuasa, Shinji

    2014-01-01

    We investigated the voltage-induced ferromagnetic resonance (FMR) with various DC bias voltage and input RF power in magnetic tunnel junctions. We found that the DC bias monotonically increases the homodyne detection voltage due to the nonlinear FMR originating in an asymmetric magnetization-potential in the free layer. In addition, the linear increase of an output voltage to the input RF power in the voltage-induced FMR is more robust than that in spin-torque FMR. These characteristics enable us to obtain an output voltage more than ten times than that of microwave detectors using spin-transfer torque

  12. Algorithm оf Computer Model Realization оf High-Frequency Processes in Switchgears Containing Non-Linear Over-Voltage Limiters

    Ye. V. Dmitriev

    2007-01-01

    Full Text Available Analysis of the Over-Voltage Limiter (OVL influence on electromagnetic high-frequency over-voltages at commutations with isolators of unloaded sections of wires and possibility of application of a frequency-dependent resistor in case of necessity to facilitate OVL operation conditions is provided in the paper.It is shown that it is necessary to take into account characteristics of OVL by IEEE circuit and its modifications at computer modeling of high-frequency over-voltages.

  13. Increase in speed of Wilkinson-type ADC and improvement of differential non-linearity

    Kinbara, S [Japan Atomic Energy Research Inst., Tokai, Ibaraki. Tokai Research Establishment

    1977-06-01

    It is shown that the differential non-linearity of a Wilkinson-type analog-to-digital converter (ADC) is dominated by the unbalance of even-numbered periods caused by the action of interference resulting from operation of a channel scaler. To improve this situation, new methods were tested which allow such action of interference to be dispersed. Measurements show that a differential non-linearity value of +- 0.043% is attainable for a clock rate of 300 MHz.

  14. Controlled Conjugated Backbone Twisting for an Increased Open-Circuit Voltage while Having a High Short-Circuit Current in Poly(hexylthiophene) Derivatives

    Ko, Sangwon

    2012-03-21

    Conjugated polymers with nearly planar backbones have been the most commonly investigated materials for organic-based electronic devices. More twisted polymer backbones have been shown to achieve larger open-circuit voltages in solar cells, though with decreased short-circuit current densities. We systematically impose twists within a family of poly(hexylthiophene)s and examine their influence on the performance of polymer:fullerene bulk heterojunction (BHJ) solar cells. A simple chemical modification concerning the number and placement of alkyl side chains along the conjugated backbone is used to control the degree of backbone twisting. Density functional theory calculations were carried out on a series of oligothiophene structures to provide insights on how the sterically induced twisting influences the geometric, electronic, and optical properties. Grazing incidence X-ray scattering measurements were performed to investigate how the thin-film packing structure was affected. The open-circuit voltage and charge-transfer state energy of the polymer:fullerene BHJ solar cells increased substantially with the degree of twist induced within the conjugated backbone-due to an increase in the polymer ionization potential-while the short-circuit current decreased as a result of a larger optical gap and lower hole mobility. A controlled, moderate degree of twist along the poly(3,4-dihexyl-2,2′:5′,2′′- terthiophene) (PDHTT) conjugated backbone led to a 19% enhancement in the open-circuit voltage (0.735 V) vs poly(3-hexylthiophene)-based devices, while similar short-circuit current densities, fill factors, and hole-carrier mobilities were maintained. These factors resulted in a power conversion efficiency of 4.2% for a PDHTT:[6,6]-phenyl-C 71-butyric acid methyl ester (PC 71BM) blend solar cell without thermal annealing. This simple approach reveals a molecular design avenue to increase open-circuit voltage while retaining the short-circuit current. © 2012 American

  15. Controlled conjugated backbone twisting for an increased open-circuit voltage while having a high short-circuit current in poly(hexylthiophene) derivatives.

    Ko, Sangwon; Hoke, Eric T; Pandey, Laxman; Hong, Sanghyun; Mondal, Rajib; Risko, Chad; Yi, Yuanping; Noriega, Rodrigo; McGehee, Michael D; Brédas, Jean-Luc; Salleo, Alberto; Bao, Zhenan

    2012-03-21

    Conjugated polymers with nearly planar backbones have been the most commonly investigated materials for organic-based electronic devices. More twisted polymer backbones have been shown to achieve larger open-circuit voltages in solar cells, though with decreased short-circuit current densities. We systematically impose twists within a family of poly(hexylthiophene)s and examine their influence on the performance of polymer:fullerene bulk heterojunction (BHJ) solar cells. A simple chemical modification concerning the number and placement of alkyl side chains along the conjugated backbone is used to control the degree of backbone twisting. Density functional theory calculations were carried out on a series of oligothiophene structures to provide insights on how the sterically induced twisting influences the geometric, electronic, and optical properties. Grazing incidence X-ray scattering measurements were performed to investigate how the thin-film packing structure was affected. The open-circuit voltage and charge-transfer state energy of the polymer:fullerene BHJ solar cells increased substantially with the degree of twist induced within the conjugated backbone--due to an increase in the polymer ionization potential--while the short-circuit current decreased as a result of a larger optical gap and lower hole mobility. A controlled, moderate degree of twist along the poly(3,4-dihexyl-2,2':5',2''-terthiophene) (PDHTT) conjugated backbone led to a 19% enhancement in the open-circuit voltage (0.735 V) vs poly(3-hexylthiophene)-based devices, while similar short-circuit current densities, fill factors, and hole-carrier mobilities were maintained. These factors resulted in a power conversion efficiency of 4.2% for a PDHTT:[6,6]-phenyl-C(71)-butyric acid methyl ester (PC(71)BM) blend solar cell without thermal annealing. This simple approach reveals a molecular design avenue to increase open-circuit voltage while retaining the short-circuit current.

  16. Sigma-1 receptor agonist increases axon outgrowth of hippocampal neurons via voltage-gated calcium ions channels.

    Li, Dong; Zhang, Shu-Zhuo; Yao, Yu-Hong; Xiang, Yun; Ma, Xiao-Yun; Wei, Xiao-Li; Yan, Hai-Tao; Liu, Xiao-Yan

    2017-12-01

    Sigma-1 receptors (Sig-1Rs) are unique endoplasmic reticulum proteins that have been implicated in both neurodegenerative and ischemic diseases, such as Alzheimer's disease and stroke. Accumulating evidence has suggested that Sig-1R plays a role in neuroprotection and axon outgrowth. The underlying mechanisms of Sig-1R-mediated neuroprotection have been well elucidated. However, the mechanisms underlying the effects of Sig-1R on axon outgrowth are not fully understood. To clarify this issue, we utilized immunofluorescence to compare the axon lengths of cultured naïve hippocampal neurons before and after the application of the Sig-1R agonist, SA4503. Then, electrophysiology and immunofluorescence were used to examine voltage-gated calcium ion channel (VGCCs) currents in the cell membranes and growth cones. We found that Sig-1R activation dramatically enhanced the axonal length of the naïve hippocampal neurons. Application of the Sig-1R antagonist NE100 and gene knockdown techniques both demonstrated the effects of Sig-1R. The growth-promoting effect of SA4503 was accompanied by the inhibition of voltage-gated Ca 2+ influx and was recapitulated by incubating the neurons with the L-type, N-type, and P/Q-type VGCC blockers, nimodipine, MVIIA and ω-agatoxin IVA, respectively. This effect was unrelated to glial cells. The application of SA4503 transformed the growth cone morphologies from complicated to simple, which favored axon outgrowth. Sig-1R activation can enhance axon outgrowth and may have a substantial influence on neurogenesis and neurodegenerative diseases. © 2017 John Wiley & Sons Ltd.

  17. Aspects on increase and decrease within a national economy as eigenvalue problem of linear homogeneous equations

    Mueller, E.

    2007-01-01

    The paper presents an approach which treats topics of macroeconomics by methods familiar in physics and technology, especially in nuclear reactor technology and in quantum mechanics. Such methods are applied to simplified models for the money flows within a national economy, their variation in time and thereby for the annual national growth rate. As usual, money flows stand for economic activities. The money flows between the economic groups are described by a set of difference equations or by a set of approximative differential equations or eventually by a set of linear algebraic equations. Thus this paper especially deals with the time behaviour of model economies which are under the influence of imbalances and of delay processes, thereby dealing also with economic growth and recession rates. These differential equations are solved by a completely numerical Runge-Kutta algorithm. Case studies are presented for cases with 12 groups only and are to show the capability of the methods which have been worked out. (orig.)

  18. Aspects on increase and decrease within a national economy as eigenvalue problem of linear homogeneous equations

    Mueller, E.

    2007-12-15

    The paper presents an approach which treats topics of macroeconomics by methods familiar in physics and technology, especially in nuclear reactor technology and in quantum mechanics. Such methods are applied to simplified models for the money flows within a national economy, their variation in time and thereby for the annual national growth rate. As usual, money flows stand for economic activities. The money flows between the economic groups are described by a set of difference equations or by a set of approximative differential equations or eventually by a set of linear algebraic equations. Thus this paper especially deals with the time behaviour of model economies which are under the influence of imbalances and of delay processes, thereby dealing also with economic growth and recession rates. These differential equations are solved by a completely numerical Runge-Kutta algorithm. Case studies are presented for cases with 12 groups only and are to show the capability of the methods which have been worked out. (orig.)

  19. Stray voltage mitigation

    Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies

    2008-04-09

    This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.

  20. Voltage Quench Dynamics of a Kondo System.

    Antipov, Andrey E; Dong, Qiaoyuan; Gull, Emanuel

    2016-01-22

    We examine the dynamics of a correlated quantum dot in the mixed valence regime. We perform numerically exact calculations of the current after a quantum quench from equilibrium by rapidly applying a bias voltage in a wide range of initial temperatures. The current exhibits short equilibration times and saturates upon the decrease of temperature at all times, indicating Kondo behavior both in the transient regime and in the steady state. The time-dependent current saturation temperature connects the equilibrium Kondo temperature to a substantially increased value at voltages outside of the linear response. These signatures are directly observable by experiments in the time domain.

  1. GABA(A) Increases Calcium in Subventricular Zone Astrocyte-Like Cells Through L- and T-Type Voltage-Gated Calcium Channels

    Young, Stephanie Z; Platel, Jean-Claude; Nielsen, Jakob V

    2010-01-01

    In the adult neurogenic subventricular zone (SVZ), the behavior of astrocyte-like cells and some of their functions depend on changes in intracellular Ca(2+) levels and tonic GABA(A) receptor activation. However, it is unknown whether, and if so how, GABA(A) receptor activity regulates...... intracellular Ca(2+) dynamics in SVZ astrocytes. To monitor Ca(2+) activity selectively in astrocyte-like cells, we used two lines of transgenic mice expressing either GFP fused to a Gq-coupled receptor or DsRed under the human glial fibrillary acidic protein (hGFAP) promoter. GABA(A) receptor activation...... induced Ca(2+) increases in 40-50% of SVZ astrocytes. GABA(A)-induced Ca(2+) increases were prevented with nifedipine and mibefradil, blockers of L- and T-type voltage-gated calcium channels (VGCC). The L-type Ca(2+) channel activator BayK 8644 increased the percentage of GABA(A)-responding astrocyte...

  2. Increased linear bone growth by GH in the absence of SOCS2 is independent of IGF-1.

    Dobie, Ross; Ahmed, Syed F; Staines, Katherine A; Pass, Chloe; Jasim, Seema; MacRae, Vicky E; Farquharson, Colin

    2015-11-01

    Growth hormone (GH) signaling is essential for postnatal linear bone growth, but the relative importance of GHs actions on the liver and/or growth plate cartilage remains unclear. The importance of liver derived insulin like-growth factor-1 (IGF-1) for endochondral growth has recently been challenged. Here, we investigate linear growth in Suppressor of Cytokine Signaling-2 (SOCS2) knockout mice, which have enhanced growth despite normal systemic GH/IGF-1 levels. Wild-type embryonic ex vivo metatarsals failed to exhibit increased linear growth in response to GH, but displayed increased Socs2 transcript levels (P growth over a 12 day period. Despite this increase, IGF-1 transcript and protein levels were not increased in response to GH. In accordance with these data, IGF-1 levels were unchanged in GH-challenged postnatal Socs2(-/-) conditioned medium despite metatarsals showing enhanced linear growth. Growth-plate Igf1 mRNA levels were not elevated in juvenile Socs2(-/-) mice. GH did however elevate IGF-binding protein 3 levels in conditioned medium from GH challenged metatarsals and this was more apparent in Socs2(-/-) metatarsals. GH did not enhance the growth of Socs2(-/-) metatarsals when the IGF receptor was inhibited, suggesting that IGF receptor mediated mechanisms are required. IGF-2 may be responsible as IGF-2 promoted metatarsal growth and Igf2 expression was elevated in Socs2(-/-) (but not WT) metatarsals in response to GH. These studies emphasise the critical importance of SOCS2 in regulating GHs ability to promote bone growth. Also, GH appears to act directly on the metatarsals of Socs2(-/-) mice, promoting growth via a mechanism that is independent of IGF-1. © 2014 The Authors. Journal of Cellular Physiology Published by Wiley Periodicals, Inc.

  3. Near-linear cost increase to reduce climate-change risk

    Schaeffer, M. [Environmental Systems Analysis Group, Wageningen University and Research Centre, P.O. Box 47, 6700 AA Wageningen (Netherlands); Kram, T.; Van Vuuren, D.P. [Climate and Global Sustainability Group, Netherlands Environmental Assessment Agency, P.O. Box 303, 3720 AH Bilthoven (Netherlands); Meinshausen, M.; Hare, W.L. [Potsdam Institute for Climate Impact Research, P.O. Box 60 12 03, 14412 Potsdam (Germany); Schneider, S.H. (ed.) [Stanford University, Stanford, CA (United States)

    2008-12-30

    One approach in climate-change policy is to set normative long-term targets first and then infer the implied emissions pathways. An important example of a normative target is to limit the global-mean temperature change to a certain maximum. In general, reported cost estimates for limiting global warming often rise rapidly, even exponentially, as the scale of emission reductions from a reference level increases. This rapid rise may suggest that more ambitious policies may be prohibitively expensive. Here, we propose a probabilistic perspective, focused on the relationship between mitigation costs and the likelihood of achieving a climate target. We investigate the qualitative, functional relationship between the likelihood of achieving a normative target and the costs of climate-change mitigation. In contrast to the example of exponentially rising costs for lowering concentration levels, we show that the mitigation costs rise proportionally to the likelihood of meeting a temperature target, across a range of concentration levels. In economic terms investing in climate mitigation to increase the probability of achieving climate targets yields 'constant returns to scale', because of a counterbalancing rapid rise in the probabilities of meeting a temperature target as concentration is lowered.

  4. Definition of Static Voltage Characteristics of the Motor Load for the Purpose of Increase in Energy Efficiency of Coal Mines of Kuzbass

    Nepsha, Fedor; Efremenko, Vladimir

    2017-11-01

    The task of determining the static load characteristics is one of the most important tasks, the solution of which is necessary for the correct development of measures to increase the energy efficiency of the Kuzbass coal mines. At present, the influence of electric receivers on the level of consumption of active and reactive power is not taken into account, therefore, the proposed measures to increase the energy efficiency are not optimal. The article analyzes the L-shaped and T-shaped circuit for the replacement of an asynchronous motor (AM), according to the results of which it is determined that the T-shaped replacement scheme is the most accurate for determination of static load characteristics. The authors proposed and implemented in the MATLAB Simulink environment an algorithm for determining the static voltage characteristics of the motor load.

  5. Activation of CRH receptor type 1 expressed on glutamatergic neurons increases excitability of CA1 pyramidal neurons by the modulation of voltage-gated ion channels

    Stephan eKratzer

    2013-07-01

    Full Text Available Corticotropin-releasing hormone (CRH plays an important role in a substantial number of patients with stress-related mental disorders, such as anxiety disorders and depression. CRH has been shown to increase neuronal excitability in the hippocampus, but the underlying mechanisms are poorly understood. The effects of CRH on neuronal excitability were investigated in acute hippocampal brain slices. Population spikes (PS and field excitatory postsynaptic potentials (fEPSP were evoked by stimulating Schaffer-collaterals and recorded simultaneously from the somatic and dendritic region of CA1 pyramidal neurons. CRH was found to increase PS amplitudes (mean  Standard error of the mean; 231.8  31.2% of control; n=10 while neither affecting fEPSPs (104.3 ± 4.2%; n=10 nor long-term potentiation (LTP. However, when Schaffer-collaterals were excited via action potentials (APs generated by stimulation of CA3 pyramidal neurons, CRH increased fEPSP amplitudes (119.8 ± 3.6%; n=8 and the magnitude of LTP in the CA1 region. Experiments in slices from transgenic mice revealed that the effect on PS amplitude is mediated exclusively by CRH receptor 1 (CRHR1 expressed on glutamatergic neurons. The effects of CRH on PS were dependent on phosphatase-2B, L- and T-type calcium channels and voltage-gated potassium channels but independent on intracellular Ca2+-elevation. In patch-clamp experiments, CRH increased the frequency and decay times of APs and decreased currents through A-type and delayed-rectifier potassium channels. These results suggest that CRH does not affect synaptic transmission per se, but modulates voltage-gated ion currents important for the generation of APs and hence elevates by this route overall neuronal activity.

  6. based dynamic voltage restorer

    HOD

    operation due to presence of increased use of nonlinear loads (computers, microcontrollers ... simulations of a dynamic voltage restorer (DVR) was achieved using MATLAB/Simulink. ..... using Discrete PWM generator, then the IGBT inverter.

  7. Benchmarking of Voltage Sag Generators

    Yang, Yongheng; Blaabjerg, Frede; Zou, Zhixiang

    2012-01-01

    The increased penetration of renewable energy systems, like photovoltaic and wind power systems, rises the concern about the power quality and stability of the utility grid. Some regulations for Low Voltage Ride-Through (LVRT) for medium voltage or high voltage applications, are coming into force...

  8. Linear response of mutans streptococci to increasing frequency of xylitol chewing gum use: a randomized controlled trial [ISRCTN43479664

    Yamaguchi David K

    2006-03-01

    Full Text Available Abstract Background Xylitol is a naturally occurring sugar substitute that has been shown to reduce the level of mutans streptococci in plaque and saliva and to reduce tooth decay. It has been suggested that the degree of reduction is dependent on both the amount and the frequency of xylitol consumption. For xylitol to be successfully and cost-effectively used in public health prevention strategies dosing and frequency guidelines should be established. This study determined the reduction in mutans streptococci levels in plaque and unstimulated saliva to increasing frequency of xylitol gum use at a fixed total daily dose of 10.32 g over five weeks. Methods Participants (n = 132 were randomized to either active groups (10.32 g xylitol/day or a placebo control (9.828 g sorbitol and 0.7 g maltitol/day. All groups chewed 12 pieces of gum per day. The control group chewed 4 times/day and active groups chewed xylitol gum at a frequency of 2 times/day, 3 times/day, or 4 times/day. The 12 gum pieces were evenly divided into the frequency assigned to each group. Plaque and unstimulated saliva samples were taken at baseline and five-weeks and were cultured on modified Mitis Salivarius agar for mutans streptococci enumeration. Results There were no significant differences in mutans streptococci level among the groups at baseline. At five-weeks, mutans streptococci levels in plaque and unstimulated saliva showed a linear reduction with increasing frequency of xylitol chewing gum use at the constant daily dose. Although the difference observed for the group that chewed xylitol 2 times/day was consistent with the linear model, the difference was not significant. Conclusion There was a linear reduction in mutans streptococci levels in plaque and saliva with increasing frequency of xylitol gum use at a constant daily dose. Reduction at a consumption frequency of 2 times per day was small and consistent with the linear-response line but was not statistically

  9. A CACNA1C variant associated with reduced voltage-dependent inactivation, increased CaV1.2 channel window current, and arrhythmogenesis.

    Jessica A Hennessey

    Full Text Available Mutations in CACNA1C that increase current through the CaV1.2 L-type Ca2+ channel underlie rare forms of long QT syndrome (LQTS, and Timothy syndrome (TS. We identified a variant in CACNA1C in a male child of Filipino descent with arrhythmias and extracardiac features by candidate gene sequencing and performed functional expression studies to electrophysiologically characterize the effects of the variant on CaV1.2 channels. As a baby, the subject developed seizures and displayed developmental delays at 30 months of age. At age 5 years, he displayed a QTc of 520 ms and experienced recurrent VT. Physical exam at 17 years of age was notable for microcephaly, short stature, lower extremity weakness and atrophy with hyperreflexia, spastic diplegia, multiple dental caries and episodes of rhabdomyolysis. Candidate gene sequencing identified a G>C transversion at position 5731 of CACNA1C (rs374528680 predicting a glycine>arginine substitution at residue 1911 (p.G1911R of CaV1.2. The allele frequency of this variant is 0.01 in Malays, but absent in 984 Caucasian alleles and in the 1000 genomes project. In electrophysiological analyses, the variant decreased voltage-dependent inactivation, thus causing a gain of function of CaV1.2. We also observed a negative shift of V1/2 of activation and positive shift of V1/2 of channel inactivation, resulting in an increase of the window current. Together, these suggest a gain-of-function effect on CaV1.2 and suggest increased susceptibility for arrhythmias in certain clinical settings. The p.G1911R variant was also identified in a case of sudden unexplained infant death (SUID, for which an increasing number of clinical observations have demonstrated can be associated with arrhythmogenic mutations in cardiac ion channels. In summary, the combined effects of the CACNA1C variant to diminish voltage-dependent inactivation of CaV1.2 and increase window current expand our appreciation of mechanisms by which a gain of

  10. Energy response of imaging plates to radiation beams from standard beta sources, ortho-voltage and cobalt-60 units and linear accelerators

    Gonzalez, Albin Leonel

    The response to different types of radiation beams of commercial imaging plates used for diagnostic computed radiography has been investigated in this work. Imaging plates are designed with a phosphor layer which after been irradiated; information is stored in the form of photostimulable luminescence (PSL) centers. Initial measurements of the dose distribution of a radioactive stent with the imaging plates showed similar results to those with radiochromic films, but with much shorter exposure time due to their higher sensitivity. In order to investigate further their response, the imaging plates were irradiated with calibrated beams from: standard beta sources, orthovoltage and Co-60 units and therapy linear accelerator. Initially it was found that the energy to create the storage centers (generation efficiency) when irradiated with the three standard beta sources (225 keV to 2.28 MeV) was the same. For the rest of the calibrated beams an in house reader system was built in order to perform the bleaching of the plates with a He-Ne laser (632.8 nm) and to measure the absolute number of the emitted PSL photons (storage centers produced). Bleaching curves were then obtained for different exposure times for each beam. From the graph of the calculated area under the bleaching curves (total number of storage center) versus the absorbed dose to the phosphor layer it was possible to calculate the energy to create the storage centers (generation efficiency) for photon and electron beams. The dose to the phosphor layer was calculated in the case of the electron beams following a scaling procedure, while in the case of the photon beams Monte Carlo simulations were performed. For the photons beams the measurement of the generation efficiency energy of 126 +/- 8% eV per PSL storage center, coincide with measurements using a different approach (˜148 eV) by previous investigators. The generation efficiency for the electron beam was 807 +/- 3% eV, no reference was found in the

  11. Systemic blockade of dopamine D2-like receptors increases high-voltage spindles in the globus pallidus and motor cortex of freely moving rats.

    Yang, Chen; Ge, Shun-Nan; Zhang, Jia-Rui; Chen, Lei; Yan, Zhi-Qiang; Heng, Li-Jun; Zhao, Tian-Zhi; Li, Wei-Xin; Jia, Dong; Zhu, Jun-Ling; Gao, Guo-Dong

    2013-01-01

    High-voltage spindles (HVSs) have been reported to appear spontaneously and widely in the cortical-basal ganglia networks of rats. Our previous study showed that dopamine depletion can significantly increase the power and coherence of HVSs in the globus pallidus (GP) and motor cortex of freely moving rats. However, it is unclear whether dopamine regulates HVS activity by acting on dopamine D₁-like receptors or D₂-like receptors. We employed local-field potential and electrocorticogram methods to simultaneously record the oscillatory activities in the GP and primary motor cortex (M1) in freely moving rats following systemic administration of dopamine receptor antagonists or saline. The results showed that the dopamine D₂-like receptor antagonists, raclopride and haloperidol, significantly increased the number and duration of HVSs, and the relative power associated with HVS activity in the GP and M1 cortex. Coherence values for HVS activity between the GP and M1 cortex area were also significantly increased by dopamine D₂-like receptor antagonists. On the contrary, the selective dopamine D₁-like receptor antagonist, SCH23390, had no significant effect on the number, duration, or relative power of HVSs, or HVS-related coherence between M1 and GP. In conclusion, dopamine D₂-like receptors, but not D₁-like receptors, were involved in HVS regulation. This supports the important role of dopamine D₂-like receptors in the regulation of HVSs. An siRNA knock-down experiment on the striatum confirmed our conclusion.

  12. Aplicación de modelos de regresión lineal para determinar las armónicas de tensión y corriente; Application of linear regression models to determine the current and voltage harmonics

    Juan Miguel Astorga Gómez

    2015-04-01

    Full Text Available En este artículo se evalúan las armónicas individuales de tensión como función de las armónicas individuales de corriente usando los análisis estadísticos de regresión lineal simple, regresión polinomial y regresión lineal múltiple. Para la selección del modelo, se usan el coeficiente de determinación R2 y el criterio de información de Akaike (AIC. Se utiliza como caso de estudio un sistema eléctrico de un proceso minero ubicado en la región de Atacama Copiapó Chile,  que ocupa la técnica de electro obtención de cobre como parte principal de su proceso productivo. Se muestran y comparan los resultados para los distintos modelos estadísticos y se discute la información de éstos para el estudio de calidad de energía. Finalmente, usando el modelo que mejor se ajusta a las mediciones de armónicas de tensión y corriente, se muestran algunas predicciones para la componente armónica dominante de tensión. This paper assesses the individual voltage harmonics as a function of the individual current harmonics using the statistical analyses of simple linear regression, polynomial regression and multiple linear regression. For model choice, the coefficient of determination R2 and Akaike information criterion (AIC are used. A mining process electrical system located in the Atacama Copiapó Chile, is used as a case study. This uses the technique copper electrowining as the main part of its production process.  The results for different statistical models are shown and their information discussed for the power quality study. Finally, using the model that better fits to the measurements of voltage and current harmonics, some predictions for the dominant voltage harmonic are shown.

  13. Simultaneous Increase in Open-Circuit Voltage and Efficiency of Fullerene-Free Solar Cells through Chlorinated Thieno[3,4- b ]thiophene Polymer Donor

    Wang, Huan [Department; Chao, Pengjie [Department; Chen, Hui [Department; Mu, Zhao [Department; Chen, Wei [Materials; Institute; He, Feng [Department

    2017-08-09

    The chlorinated polymer, PBTCl, has been found to be an efficient donor in nonfullerene polymer solar cells (PSCs), which showed a blue-shifted absorbance compared to that of its fluorine analogue (PTB7-th) and resulted in more complementary light absorption with a nonfullerene acceptor, such as ITIC. Meanwhile, chlorine substitution lowered the HOMO level of PBTCl, which increased the open-circuit voltage of the corresponding polymer-based devices. The 2D GIWAXS analysis illustrated that the PBTCl/ITIC blend film exhibited a “face-on” orientation and scattering features of both PBTCl and ITIC, suggesting that the blend of PBTCl and ITIC was phase-separated and formed individual crystalline domains of the donor and acceptor, which promoted charge transfer in the bicontinuous film and eventually elevated the solar energy conversion efficiency. The PBTCl-based nonfullerene PSC exhibited a maximum PCE of 7.57% with a Voc of 0.91 V, which was an approximately 13% increasing in the PCE compared to that of the fluorine-analogue-based device.

  14. Microbial respiration, but not biomass, responded linearly to increasing light fraction organic matter input: Consequences for carbon sequestration.

    Rui, Yichao; Murphy, Daniel V; Wang, Xiaoli; Hoyle, Frances C

    2016-10-18

    Rebuilding 'lost' soil carbon (C) is a priority in mitigating climate change and underpinning key soil functions that support ecosystem services. Microorganisms determine if fresh C input is converted into stable soil organic matter (SOM) or lost as CO 2 . Here we quantified if microbial biomass and respiration responded positively to addition of light fraction organic matter (LFOM, representing recent inputs of plant residue) in an infertile semi-arid agricultural soil. Field trial soil with different historical plant residue inputs [soil C content: control (tilled) = 9.6 t C ha -1 versus tilled + plant residue treatment (tilled + OM) = 18.0 t C ha -1 ] were incubated in the laboratory with a gradient of LFOM equivalent to 0 to 3.8 t C ha -1 (0 to 500% LFOM). Microbial biomass C significantly declined under increased rates of LFOM addition while microbial respiration increased linearly, leading to a decrease in the microbial C use efficiency. We hypothesise this was due to insufficient nutrients to form new microbial biomass as LFOM input increased the ratio of C to nitrogen, phosphorus and sulphur of soil. Increased CO 2 efflux but constrained microbial growth in response to LFOM input demonstrated the difficulty for C storage in this environment.

  15. DUF1220 copy number is linearly associated with increased cognitive function as measured by total IQ and mathematical aptitude scores

    Davis, Jonathon M.; Searles, Veronica B.; Anderson, Nathan; Keeney, Jonathon; Raznahan, Armin; Horwood, L. John; Fergusson, David M.; Kennedy, Martin A.; Giedd, Jay

    2014-01-01

    DUF1220 protein domains exhibit the greatest human lineage-specific copy number expansion of any protein-coding sequence in the genome, and variation in DUF1220 copy number has been linked to both brain size in humans and brain evolution among primates. Given these findings, we examined associations between DUF1220 subtypes CON1 and CON2 and cognitive aptitude. We identified a linear association between CON2 copy number and cognitive function in two independent populations of European descent. In North American males, an increase in CON2 copy number corresponded with an increase in WISC IQ (R2 = 0.13, p = 0.02), which may be driven by males aged 6–11 (R2 = 0.42, p = 0.003). We utilized ddPCR in a subset as a confirmatory measurement. This group had 26–33 copies of CON2 with a mean of 29, and each copy increase of CON2 was associated with a 3.3-point increase in WISC IQ (R2 = 0.22, p = 0.045). In individuals from New Zealand, an increase in CON2 copy number was associated with an increase in math aptitude ability (R2 = 0.10 p = 0.018). These were not confounded by brain size. To our knowledge, this is the first study to report a replicated association between copy number of a gene coding sequence and cognitive aptitude. Remarkably, dosage variations involving DUF1220 sequences have now been linked to human brain expansion, autism severity and cognitive aptitude, suggesting that such processes may be genetically and mechanistically inter-related. The findings presented here warrant expanded investigations in larger, well-characterized cohorts. PMID:25287832

  16. Moderately nonlinear diffuse-charge dynamics under an ac voltage.

    Stout, Robert F; Khair, Aditya S

    2015-09-01

    The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of V_{o}/(k_{B}T/e), where V_{o} is the amplitude of the driving voltage and k_{B}T/e is the thermal voltage with k_{B} as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D/λ_{D}L, where D is the ion diffusivity, λ_{D} is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O(V_{o}^{3}) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in V_{o}. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing V_{o}. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

  17. Moderately nonlinear diffuse-charge dynamics under an ac voltage

    Stout, Robert F.; Khair, Aditya S.

    2015-09-01

    The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of Vo/(kBT /e ) , where Vo is the amplitude of the driving voltage and kBT /e is the thermal voltage with kB as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D /λDL , where D is the ion diffusivity, λD is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O (Vo3) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in Vo. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing Vo. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

  18. Systemic blockade of dopamine D2-like receptors increases high-voltage spindles in the globus pallidus and motor cortex of freely moving rats.

    Chen Yang

    Full Text Available High-voltage spindles (HVSs have been reported to appear spontaneously and widely in the cortical-basal ganglia networks of rats. Our previous study showed that dopamine depletion can significantly increase the power and coherence of HVSs in the globus pallidus (GP and motor cortex of freely moving rats. However, it is unclear whether dopamine regulates HVS activity by acting on dopamine D₁-like receptors or D₂-like receptors. We employed local-field potential and electrocorticogram methods to simultaneously record the oscillatory activities in the GP and primary motor cortex (M1 in freely moving rats following systemic administration of dopamine receptor antagonists or saline. The results showed that the dopamine D₂-like receptor antagonists, raclopride and haloperidol, significantly increased the number and duration of HVSs, and the relative power associated with HVS activity in the GP and M1 cortex. Coherence values for HVS activity between the GP and M1 cortex area were also significantly increased by dopamine D₂-like receptor antagonists. On the contrary, the selective dopamine D₁-like receptor antagonist, SCH23390, had no significant effect on the number, duration, or relative power of HVSs, or HVS-related coherence between M1 and GP. In conclusion, dopamine D₂-like receptors, but not D₁-like receptors, were involved in HVS regulation. This supports the important role of dopamine D₂-like receptors in the regulation of HVSs. An siRNA knock-down experiment on the striatum confirmed our conclusion.

  19. Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

    William J.B. Heffernan

    2014-12-01

    Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

  20. Current-voltage characteristics of C70 solid near Meyer-Neldel temperature

    Onishi, Koichi; Sezaimaru, Kouki; Nakashima, Fumihiro; Sun, Yong; Kirimoto, Kenta; Sakaino, Masamichi; Kanemitsu, Shigeru

    2017-06-01

    The current-voltage characteristics of the C70 solid with hexagonal closed-packed structures were measured in the temperature range of 250-450 K. The current-voltage characteristics can be described as a temporary expedient by a cubic polynomial of the voltage, i = a v 3 + b v 2 + c v + d . Moreover, the Meyer-Neldel temperature of the C70 solid was confirmed to be 310 K, at which a linear relationship between the current and voltage was observed. Also, at temperatures below the Meyer-Neldel temperature, the current increases with increasing voltage. On the other hand, at temperatures above the Meyer-Neldel temperature a negative differential conductivity effect was observed at high voltage side. The negative differential conductivity was related to the electric field and temperature effects on the mobility of charge carrier, which involve two variations in the carrier concentration and the activation energy for carrier hopping transport.

  1. Low-voltage gyrotrons

    Glyavin, M. Yu.; Zavolskiy, N. A.; Sedov, A. S.; Nusinovich, G. S.

    2013-01-01

    For a long time, the gyrotrons were primarily developed for electron cyclotron heating and current drive of plasmas in controlled fusion reactors where a multi-megawatt, quasi-continuous millimeter-wave power is required. In addition to this important application, there are other applications (and their number increases with time) which do not require a very high power level, but such issues as the ability to operate at low voltages and have compact devices are very important. For example, gyrotrons are of interest for a dynamic nuclear polarization, which improves the sensitivity of the nuclear magnetic resonance spectroscopy. In this paper, some issues important for operation of gyrotrons driven by low-voltage electron beams are analyzed. An emphasis is made on the efficiency of low-voltage gyrotron operation at the fundamental and higher cyclotron harmonics. These efficiencies calculated with the account for ohmic losses were, first, determined in the framework of the generalized gyrotron theory based on the cold-cavity approximation. Then, more accurate, self-consistent calculations for the fundamental and second harmonic low-voltage sub-THz gyrotron designs were carried out. Results of these calculations are presented and discussed. It is shown that operation of the fundamental and second harmonic gyrotrons with noticeable efficiencies is possible even at voltages as low as 5–10 kV. Even the third harmonic gyrotrons can operate at voltages about 15 kV, albeit with rather low efficiency (1%–2% in the submillimeter wavelength region).

  2. Dopamine depletion increases the power and coherence of high-voltage spindles in the globus pallidus and motor cortex of freely moving rats.

    Ge, Shunnan; Yang, Chen; Li, Min; Li, Jiang; Chang, Xiaozan; Fu, Jian; Chen, Lei; Chang, Chongwang; Wang, Xuelian; Zhu, Junling; Gao, Guodong

    2012-07-17

    Studies on patients with Parkinson's disease and in animal models have observed enhanced synchronization of oscillations in several frequency bands within and between the cortical-basal ganglia (BG) structures. Recent research has also shown that synchronization of high-voltage spindles (HVSs) in the cortex, striatum and substantia nigra pars reticulate is increased by dopamine depletion. However, more evidence is needed to determine whether HVS activity in the whole cortex-BG network represents homologous alteration following dopamine depletion. As the globus pallidus (GP) is in a central position to propagate and synchronize oscillations in the cortical-BG circuits, we employed local-field potentials and electrocorticogram to simultaneously record oscillations in the GP and primary (M1) and secondary (M2) motor cortices on freely moving 6-hydroxydopamine (6-OHDA) lesioned and control rats. Results showed that HVS episodes recorded from GP, and M2 and M1 cortex areas were more numerous and longer in 6-OHDA lesioned rats compared to controls. Relative power associated with HVS activity in the GP, and M2 and M1 cortices of 6-OHDA lesioned rats was significantly greater than that for control rats. Coherence values for HVS activity between the GP, and M2 and M1 cortex areas were significantly increased by dopamine depletion. Time lag between the M1 cortex HVS and GP HVS was significantly shorter for dopamine depleted than normal rats. Findings indicate a crucial rule for dopamine in the regulation of HVS activity in the whole cortical-BG circuit, and suggest a close relationship between abnormally synchronized HVS oscillations in the cortex-BG network and Parkinson's disease. Copyright © 2012 Elsevier B.V. All rights reserved.

  3. Mobility of holes and polarons in polyaniline films assessed by frequency-dependent impedance and charge extraction by linearly increasing voltage

    Toušek, J.; Toušková, J.; Chomutová, R.; Křivka, I.; Hajná, Milena; Stejskal, Jaroslav

    2017-01-01

    Roč. 234, December (2017), s. 161-165 ISSN 0379-6779 R&D Projects: GA ČR(CZ) GA16-02787S Institutional support: RVO:61389013 Keywords : polyaniline * impedance spectroscopy * CELIV Subject RIV: CD - Macromolecular Chemistry OBOR OECD: Polymer science Impact factor: 2.435, year: 2016

  4. High frequency breakdown voltage

    Chu, Thanh Duy.

    1992-03-01

    This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance

  5. Impact of cell-voltage on energy and power performance of supercapacitors with single-walled carbon nanotube electrodes

    Izadi-Najafabadi, Ali; Yamada, Takeo; Futaba, Don N.; Iijima, Sumio [Nanotube Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hatori, Hiroaki [Project Headquarters, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hata, Kenji [Japan Science and Technology Agency JST, Kawaguchi (Japan)

    2010-12-15

    We report the energy and power voltage-dependencies of supercapacitors using single-walled carbon nanotube electrodes. The energy density was dependent on the cell-voltage cubed (up to 4 V: E = 1.43 x V{sup 3}). The cubic relationship was attributed to the linear increase of the capacitance as a function of voltage, enabled by electrochemical doping. Furthermore, while up to 3.5 V, the maximum power rating of the nanotube electrodes increased as a function of the cell-voltage squared, beyond 3.5 V, a decline in power was observed as a result of depletion of the electrolyte's ions. (author)

  6. Design and Implementation of a High-Voltage Generator with Output Voltage Control for Vehicle ER Shock-Absorber Applications

    Chih-Lung Shen

    2013-01-01

    Full Text Available A self-oscillating high-voltage generator is proposed to supply voltage for a suspension system in order to control the damping force of an electrorheological (ER fluid shock absorber. By controlling the output voltage level of the generator, the damping force in the ER fluid shock absorber can be adjusted immediately. The shock absorber is part of the suspension system. The high-voltage generator drives a power transistor based on self-excited oscillation, which converts dc to ac. A high-frequency transformer with high turns ratio is used to increase the voltage. In addition, the system uses the car battery as dc power supply. By regulating the duty cycle of the main switch in the buck converter, the output voltage of the buck converter can be linearly adjusted so as to obtain a specific high voltage for ER. The driving system is self-excited; that is, no additional external driving circuit is required. Thus, it reduces cost and simplifies system structure. A prototype version of the actual product is studied to measure and evaluate the key waveforms. The feasibility of the proposed system is verified based on experimental results.

  7. Pancreatic beta cell function increases in a linear dose-response manner following exercise training in adults with prediabetes

    Malin, Steven K; Solomon, Thomas; Blaszczak, Alecia

    2013-01-01

    While some studies suggest that a linear dose-response relationship exists between exercise and insulin sensitivity, the exercise dose required to enhance pancreatic beta-cell function is unknown. Thirty-five older, obese adults with prediabetes underwent a progressive 12-week supervised exercise...

  8. Manipulating the voltage dependence of tunneling spin torques

    Manchon, Aurelien

    2012-01-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

  9. Voltage-Controlled Floating Resistor Using DDCC

    M. Kumngern

    2011-04-01

    Full Text Available This paper presents a new simple configuration to realize the voltage-controlled floating resistor, which is suitable for integrated circuit implementation. The proposed resistor is composed of three main components: MOS transistor operating in the non-saturation region, DDCC, and MOS voltage divider. The MOS transistor operating in the non-saturation region is used to configure a floating linear resistor. The DDCC and the MOS transistor voltage divider are used for canceling the nonlinear component term of MOS transistor in the non-saturation region to obtain a linear current/voltage relationship. The DDCC is employed to provide a simple summer of the circuit. This circuit offers an ease for realizing the voltage divider circuit and the temperature effect that includes in term of threshold voltage can be compensated. The proposed configuration employs only 16 MOS transistors. The performances of the proposed circuit are simulated with PSPICE to confirm the presented theory.

  10. Insulation Resistance and Leakage Currents in Low-Voltage Ceramic Capacitors with Cracks

    Teverovsky, Alexander A.

    2016-01-01

    Measurement of insulation resistance (IR) in multilayer ceramic capacitors (MLCCs) is considered a screening technique that ensures the dielectric is defect-free. This work analyzes the effectiveness of this technique for revealing cracks in ceramic capacitors. It is shown that absorption currents prevail over the intrinsic leakage currents during standard IR measurements at room temperature. Absorption currents, and consequently IR, have a weak temperature dependence, increase linearly with voltage (before saturation), and are not sensitive to the presence of mechanical defects. In contrary, intrinsic leakage currents increase super-linearly with voltage and exponentially with temperature (activation energy is in the range from 0.6 eV to 1.1 eV). Leakage currents associated with the presence of cracks have a weaker dependence on temperature and voltage compared to the intrinsic leakage currents. For this reason, intrinsic leakage currents prevail at high temperatures and voltages, thus masking the presence of defects.

  11. Mixed Linear/Square-Root Encoded Single Slope Ramp Provides a Fast, Low Noise Analog to Digital Converter with Very High Linearity for Focal Plane Arrays

    Wrigley, Christopher James (Inventor); Hancock, Bruce R. (Inventor); Newton, Kenneth W. (Inventor); Cunningham, Thomas J. (Inventor)

    2014-01-01

    An analog-to-digital converter (ADC) converts pixel voltages from a CMOS image into a digital output. A voltage ramp generator generates a voltage ramp that has a linear first portion and a non-linear second portion. A digital output generator generates a digital output based on the voltage ramp, the pixel voltages, and comparator output from an array of comparators that compare the voltage ramp to the pixel voltages. A return lookup table linearizes the digital output values.

  12. Current—voltage characteristics of lead zirconate titanate/nickel bilayered hollow cylindrical magnetoelectric composites

    De-An, Pan; Shen-Gen, Zhang; Jian-Jun, Tian; Li-Jie, Qiao; Jun-Sai, Sun; Volinsky, Alex A.

    2010-01-01

    Current–voltage measurements obtained from lead zirconate titanate/nickel bilayered hollow cylindrical magnetoelectric composite showed that a sinusoidal current applied to the copper coil wrapped around the hollow cylinder circumference induces voltage across the lead zirconate titanate layer thickness. The current–voltage coefficient and the maximum induced voltage in lead zirconate titanate at 1 kHz and resonance (60.1 kHz) frequencies increased linearly with the number of the coil turns and the applied current. The resonance frequency corresponds to the electromechanical resonance frequency. The current–voltage coefficient can be significantly improved by optimizing the magnetoelectric structure geometry and/or increasing the number of coil turns. Hollow cylindrical lead zirconate titanate/nickel structures can be potentially used as current sensors. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  13. Distributed Monitoring of Voltage Collapse Sensitivity Indices

    Simpson-Porco, John W.; Bullo, Francesco

    2016-01-01

    The assessment of voltage stability margins is a promising direction for wide-area monitoring systems. Accurate monitoring architectures for long-term voltage instability are typically centralized and lack scalability, while completely decentralized approaches relying on local measurements tend towards inaccuracy. Here we present distributed linear algorithms for the online computation of voltage collapse sensitivity indices. The computations are collectively performed by processors embedded ...

  14. Ultra-Low-Dropout Linear Regulator

    Thornton, Trevor; Lepkowski, William; Wilk, Seth

    2011-01-01

    A radiation-tolerant, ultra-low-dropout linear regulator can operate between -150 and 150 C. Prototype components were demonstrated to be performing well after a total ionizing dose of 1 Mrad (Si). Unlike existing components, the linear regulator developed during this activity is unconditionally stable over all operating regimes without the need for an external compensation capacitor. The absence of an external capacitor reduces overall system mass/volume, increases reliability, and lowers cost. Linear regulators generate a precisely controlled voltage for electronic circuits regardless of fluctuations in the load current that the circuit draws from the regulator.

  15. Voltage regulating circuit

    2005-01-01

    A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional

  16. The Increase in Animal Mortality Risk following Exposure to Sparsely Ionizing Radiation Is Not Linear Quadratic with Dose.

    Benjamin M Haley

    Full Text Available The US government regulates allowable radiation exposures relying, in large part, on the seventh report from the committee to estimate the Biological Effect of Ionizing Radiation (BEIR VII, which estimated that most contemporary exposures- protracted or low-dose, carry 1.5 fold less risk of carcinogenesis and mortality per Gy than acute exposures of atomic bomb survivors. This correction is known as the dose and dose rate effectiveness factor for the life span study of atomic bomb survivors (DDREFLSS. It was calculated by applying a linear-quadratic dose response model to data from Japanese atomic bomb survivors and a limited number of animal studies.We argue that the linear-quadratic model does not provide appropriate support to estimate the risk of contemporary exposures. In this work, we re-estimated DDREFLSS using 15 animal studies that were not included in BEIR VII's original analysis. Acute exposure data led to a DDREFLSS estimate from 0.9 to 3.0. By contrast, data that included both acute and protracted exposures led to a DDREFLSS estimate from 4.8 to infinity. These two estimates are significantly different, violating the assumptions of the linear-quadratic model, which predicts that DDREFLSS values calculated in either way should be the same.Therefore, we propose that future estimates of the risk of protracted exposures should be based on direct comparisons of data from acute and protracted exposures, rather than from extrapolations from a linear-quadratic model. The risk of low dose exposures may be extrapolated from these protracted estimates, though we encourage ongoing debate as to whether this is the most valid approach. We also encourage efforts to enlarge the datasets used to estimate the risk of protracted exposures by including both human and animal data, carcinogenesis outcomes, a wider range of exposures, and by making more radiobiology data publicly accessible. We believe that these steps will contribute to better estimates

  17. Voltage Controlled Dynamic Demand Response

    Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...

  18. Impurity effects on electrical conductivity of doped bilayer graphene in the presence of a bias voltage

    Lotfi, E; Rezania, H; Arghavaninia, B; Yarmohammadi, M

    2016-01-01

    We address the electrical conductivity of bilayer graphene as a function of temperature, impurity concentration, and scattering strength in the presence of a finite bias voltage at finite doping, beginning with a description of the tight-binding model using the linear response theory and Green’s function approach. Our results show a linear behavior at high doping for the case of high bias voltage. The effects of electron doping on the electrical conductivity have been studied via changing the electronic chemical potential. We also discuss and analyze how the bias voltage affects the temperature behavior of the electrical conductivity. Finally, we study the behavior of the electrical conductivity as a function of the impurity concentration and scattering strength for different bias voltages and chemical potentials respectively. The electrical conductivity is found to be monotonically decreasing with impurity scattering strength due to the increased scattering among electrons at higher impurity scattering strength. (paper)

  19. Characterization of a low-voltage electron beam

    Berejka, A.J.

    2004-01-01

    Growing interests in low-voltage electron beam (EB) processing in areas that may require regulatory compliance, such as the curing of inks and coatings for food packaging materials and in the surface disinfection of medicinal and food containers, lead to the characterization of a low-voltage EB by two methods: a widely used thin radiochromic film and a film strip made on a continuous basis with an alanine coating. Using a laboratory unit, beam currents and voltages were varied and then optical density and alanine/matrix ratios were, respectively, determined. No inferences as to 'dose' were made. The radiochromic film was found to be insensitive to slight changes at low beam currents and to show considerable divergence and a broadening in response as current was increased across a meaningful range at the three applied beam voltages of 80, 100 and 120 kV. The electron paramagnetic resonance (EPR) increase in response of the alanine coated film taken as a ratio to an internal reference material within the test instrument itself was shown to have a linear response with respect to beam current and no divergence as current increased. The use of an alanine coating of thickness greater than that of the extrapolated range of the electron penetration offers a method for the characterization of the output of such very low-voltage beams

  20. Increase in the number of distributed power generation installations in electricity distribution grids - Simulation in a 16 kV medium-voltage network; Zunahme der dezentralen Energieerzeugungsanlagen in elektrischen Verteilnetzen: Simulationen im 16 kV Mittelspannungsnetz des AEW

    Hoeckel, M.; Luechinger, P.

    2003-07-01

    This is the seventh part of a ten-part final report for the Swiss Federal Office of Energy (SFOE) on a project that looked into potential problems relating to the Swiss electricity distribution grid with respect to the increasing number of distributed power generation facilities being put into service. The identification of special conditions for the grid's operation and future development that take increasing decentralised power production into account are discussed. The results of the project activities encompass the analysis and evaluation of various problem areas associated with planning and management of the grid during normal operation and periods of malfunction, as well as required modifications to safety systems and grid configurations. This sixth appendix to the main report presents and discusses the results of simulations made on the basis of the real-life 16 kV medium-voltage distribution network operated by the Aargovian electricity utility AEW. This appendix describes the simulation methods used and the basic characteristics of medium-voltage networks and distributed generation facilities. Different types of load profiles, including domestic and industrial loads, are discussed. The results of the simulations are presented in graphical form and provide profiles of voltage and current, active and reactive power and further mains characteristics for varying load conditions. Also, daily profiles for situations with and without distributed generation are presented and short-circuit simulations and grid dynamics are discussed.

  1. Increase in the number of distributed power generation installations in electricity distribution grids - Simulation in a 400 V low-voltage network; Zunahme der dezentralen Energieerzeugungsanlagen in elektrischen Verteilnetzen: Simulationen im 400 V Niederspannungsnetz des ewz

    Hoeckel, M.; Luechinger, P.

    2003-07-01

    This is the sixth part of a ten-part final report for the Swiss Federal Office of Energy (SFOE) on a project that looked into potential problems relating to the Swiss electricity distribution grid with respect to the increasing number of distributed power generation facilities being put into service. The identification of special conditions for the grid's operation and future development that take increasing decentralised power production into account are discussed. The results of the project activities encompass the analysis and evaluation of various problem areas associated with planning and management of the grid during normal operation and periods of malfunction, as well as required modifications to safety systems and grid configurations. This fifth appendix to the main report presents and discusses the results of simulations made on the basis of the real-life 400 V low-voltage distribution network operated by the public utilities of the City of Zurich, Switzerland. This comprehensive appendix describes the simulation methods used and the basic characteristics of low-voltage networks and distributed generation facilities. The 6 simulation variants used are also described. The results of the simulations are presented in graphical form and provide profiles of voltage and current, active and reactive power and further mains characteristics for varying load conditions. Also, short-circuit simulations and harmonics analysis are discussed.

  2. Extending the Linear Modulation Range to the Full Base Speed Using a Single DC-Link Multilevel Inverter With Capacitor-Fed H-Bridges for IM Drives

    Rahul, Arun; Pramanick, Sumit; Kaarthik, R. Sudharshan

    2017-01-01

    In this paper, a new space vector pulse width modulation method to extend the linear modulation range of a cascaded five level inverter topology with a single dc supply is presented. Using this method, the inverter can be controlled linearly and the peak phase fundamental output voltage of the in......In this paper, a new space vector pulse width modulation method to extend the linear modulation range of a cascaded five level inverter topology with a single dc supply is presented. Using this method, the inverter can be controlled linearly and the peak phase fundamental output voltage...... of the inverter can be increased from 0.577 to 0.637Vdc without increasing the dc bus voltage and without exceeding the induction motor voltage rating. This new technique makes use of cascaded inverter pole voltage redundancy and property of the space vector structure for its operation. Using this, the induction...

  3. LINEAR ACCELERATOR

    Christofilos, N.C.; Polk, I.J.

    1959-02-17

    Improvements in linear particle accelerators are described. A drift tube system for a linear ion accelerator reduces gap capacity between adjacent drift tube ends. This is accomplished by reducing the ratio of the diameter of the drift tube to the diameter of the resonant cavity. Concentration of magnetic field intensity at the longitudinal midpoint of the external sunface of each drift tube is reduced by increasing the external drift tube diameter at the longitudinal center region.

  4. Elimination of indigenous linear plasmids in Streptomyces hygroscopicus var. jinggangensis and Streptomyces sp. FR008 to increase validamycin A and candicidin productivities.

    Lu, Chenyang; Wu, Hang; Su, Xiurong; Bai, Linquan

    2017-05-01

    Giant linear plasmids, which replicate independently of the chromosomes, widely exist in actinobacteria. Previous studies mostly focused on the replication and evolution of the linear plasmids or the secondary metabolite gene clusters and the resistance gene clusters therein. However, the relationships of the linear plasmids to the productivities of secondary metabolites have not been studied. In this work, we developed a method to eliminate the indigenous linear plasmid pSHJG1 in Streptomyces hygroscopicus var. jinggangensis, and validamycin A titer increased by 12.5% (from 19.16 ± 1.93 to 21.56 ± 2.25 g/L) in the high-yielding strain TL01 and 43.7% (from 4.67 ± 0.05 to 6.71 ± 0.21 g/L) in the wild-type strain 5008, whereas the cellular growth of the plasmid-cured mutant was reduced. Subsequently, the plasmid-cured mutant was complemented with three structure genes involved in cellular growth in pSHJG1 under the control of a strong PvalA promoter. Among them, the complementation of genes pSHJG1.069 and pSHJG1.072, encoding a putative hydrolase and putative P-loop ATPase, respectively, resulted in the restoration of cellular growth and validamycin A titer. Furthermore, the elimination of indigenous linear plasmid pHZ228 in the candicidin producer Streptomyces sp. FR008 also led to enhanced candicidin production and reduced cellular growth. Because of the wide distribution of indigenous linear plasmids in actinobacteria, the engineering strategy described here could be implemented in a variety of strains for the overproduction of various natural products.

  5. Research into the Effect of Supercapacitor Terminal Voltage on Regenerative Suspension Energy-Regeneration and Dynamic Performance

    Ruochen Wang

    2017-01-01

    Full Text Available To study the effect of supercapacitor initial terminal voltage on the regenerative and semiactive suspension energy-regeneration and dynamic performance, firstly, the relationship between supercapacitor terminal voltage and linear motor electromagnetic damping force and that between supercapacitor terminal voltage and recycled energy by the supercapacitor in one single switching period were both analyzed. The result shows that the linear motor electromagnetic damping force is irrelevant to the supercapacitor terminal voltage, and the recycled energy by the supercapacitor reaches the maximum when initial terminal voltage of the supercapacitor equals output terminal voltage of the linear motor. Then, performances of system dynamics and energy-regeneration were studied as the supercapacitor initial terminal voltage varied in situations of B level and C level road. The result showed that recycled energy by the supercapacitor increased at first and then decreased while the dynamic performance had no obvious change. On the basis of previous study, a mode-switching control strategy of supercapacitor for the regenerative and semiactive suspension system was proposed, and the mode-switching rule was built. According to simulation and experiment results, the system energy-regeneration efficiency can be increased by utilizing the control strategy without influencing suspension dynamic performance, which is highly valuable to practical engineering.

  6. Analog Amplitude Modulation of a High Voltage, Solid State Inductive Adder, Pulse Generator Using MOSFETS

    Gower, E J; Sullivan, J S

    2002-01-01

    High voltage, solid state, inductive adder, pulse generators have found increasing application as fast kicker pulse modulators for charged particle beams. The solid state, inductive adder, pulse generator is similar in operation to the linear induction accelerator. The main difference is that the solid state, adder couples energy by transformer action from multiple primaries to a voltage summing stalk, instead of an electron beam. Ideally, the inductive adder produces a rectangular voltage pulse at the load. In reality, there is usually some voltage variation at the load due to droop on primary circuit storage capacitors, or, temporal variations in the load impedance. Power MOSFET circuits have been developed to provide analog modulation of the output voltage amplitude of a solid state, inductive adder, pulse generator. The modulation is achieved by including MOSFET based, variable subtraction circuits in the multiple primary stack. The subtraction circuits can be used to compensate for voltage droop, or, to tailor the output pulse amplitude to provide a desired effect in the load. Power MOSFET subtraction circuits have been developed to modulate short, temporal (60-400 ns), voltage and current pulses. MOSFET devices have been tested up to 20 amps and 800 Volts with a band pass of 50 MHz. An analog modulation cell has been tested in a five cell high, voltage adder stack

  7. High voltage systems

    Martin, M.

    1991-01-01

    Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance

  8. Controlled Conjugated Backbone Twisting for an Increased Open-Circuit Voltage while Having a High Short-Circuit Current in Poly(hexylthiophene) Derivatives

    Ko, Sangwon; Hoke, Eric T.; Pandey, Laxman; Hong, Sanghyun; Mondal, Rajib; Risko, Chad; Yi, Yuanping; Noriega, Rodrigo; McGehee, Michael D.; Bré das, Jean-Luc; Salleo, Alberto; Bao, Zhenan

    2012-01-01

    and charge-transfer state energy of the polymer:fullerene BHJ solar cells increased substantially with the degree of twist induced within the conjugated backbone-due to an increase in the polymer ionization potential-while the short-circuit current decreased

  9. Acoustically determined linear piezoelectric response of lithium niobate up to 1100 V

    Patel, N. [Sandia National Laboratories, Albuquerque, New Mexico 87185 (United States); Department of Electrical and Computer Engineering, University of New Mexico, Albuquerque, New Mexico 87106 (United States); Branch, D. W.; Cular, S. [Sandia National Laboratories, Albuquerque, New Mexico 87185 (United States); Schamiloglu, E. [Department of Electrical and Computer Engineering, University of New Mexico, Albuquerque, New Mexico 87106 (United States)

    2014-04-21

    We present a method to measure high voltages using the piezoelectric crystal lithium niobate without using voltage dividers. A 36° Y-X cut lithium niobate crystal was coupled to two acoustic transducers, where direct current voltages were applied from 128–1100 V. The time-of-flight through the crystal was determined to be linearly dependent on the applied voltage. A model was developed to predict the time-delay in response to the applied voltage. The results show a sensitivity of 17 fs/V with a measurement error of 1 fs/V was achievable using this method. The sensitivity of this method can be increased by measuring the acoustic wave after multiple passes through the crystal. This method has many advantages over traditional techniques such as: favorable scalability for larger voltages, ease of use, cost effectiveness, and compactness.

  10. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  11. Ways for improvement of the LIU-5/5000 linear induction accelerator parameters

    Bobylev, V.I.; Kapchinskij, I.M.; Lapitskij, Yu.Ya.; Plotnikov, V.K.; Chuvilo, I.V.

    1987-01-01

    The reasons of limitaions to increase the beam current and improve the quality of beam in the electron linear induction accelerator LIU-5/5000 are studied. The necessity to increase the voltage in the gaps of the electron gun, increase the diameter of the cathode and aperture of the drift tube, accuracy of axial symmetry electron gun current-carrying elements and accuracy of gun fabrication are shown. Stabilization of beam parameters require a new high voltage modulators. Different versions of the linac modernization with the use of transformers with cores of 430 and 600 mm are studied. Technical possibilities at several versions of high voltage modulators are discussed

  12. Voltage regulator for generator

    Naoi, K

    1989-01-17

    It is an object of this invention to provide a voltage regulator for a generator charging a battery, wherein even if the ambient temperature at the voltage regulator rises abnormally high, possible thermal breakage of the semiconductor elements constituting the voltage regulator can be avoided. A feature of this invention is that the semiconductor elements can be protected from thermal breakage, even at an abnormal ambient temperature rise at the voltage regulator for the battery charging generator, by controlling a maximum conduction ratio of a power transistor in the voltage regulator in accordance with the temperature at the voltage regulator. This is achieved through a switching device connected in series to the field coil of the generator and adapted to be controlled in accordance with an output voltage of the generator and the ambient temperature at the voltage regulator. 6 figs.

  13. A matter of quantum voltages

    Sellner, Bernhard; Kathmann, Shawn M., E-mail: Shawn.Kathmann@pnnl.gov [Physical Sciences Division, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)

    2014-11-14

    Voltages inside matter are relevant to crystallization, materials science, biology, catalysis, and aqueous chemistry. The variation of voltages in matter can be measured by experiment, however, modern supercomputers allow the calculation of accurate quantum voltages with spatial resolutions of bulk systems well beyond what can currently be measured provided a sufficient level of theory is employed. Of particular interest is the Mean Inner Potential (V{sub o}) – the spatial average of these quantum voltages referenced to the vacuum. Here we establish a protocol to reliably evaluate V{sub o} from quantum calculations. Voltages are very sensitive to the distribution of electrons and provide metrics to understand interactions in condensed phases. In the present study, we find excellent agreement with measurements of V{sub o} for vitrified water and salt crystals and demonstrate the impact of covalent and ionic bonding as well as intermolecular/atomic interactions. Certain aspects in this regard are highlighted making use of simple model systems/approximations. Furthermore, we predict V{sub o} as well as the fluctuations of these voltages in aqueous NaCl electrolytes and characterize the changes in their behavior as the resolution increases below the size of atoms.

  14. Videometrics-based Detection of Vibration Linearity in MEMS Gyroscope

    Yong Zhou

    2011-05-01

    Full Text Available MEMS gyroscope performs as a sort of sensor to detect angular velocity, with diverse applications in engineering including vehicle and intelligent traffic etc. A balanced vibration of driving module excited by electrostatic driving signal is the base MEMS gyroscope's performance. In order to analyze the linear property of vibration in MEMS Gyroscope, a method of computer vision measuring is applied with the help of high-speed vidicon to obtain video of linear vibration of driving module in gyroscope, under the driving voltage signal of inherent frequency and amplitude linearly increasing. By means of image processing, target identifying, and motion parameter extracting from the obtained video, vibration curve with time variation is acquired. And then, linearity of this vibration system can be analyzed by focusing on the amplitude value of vibration responding to the amplitude variation of driving voltage signal.

  15. Automatic voltage imbalance detector

    Bobbett, Ronald E.; McCormick, J. Byron; Kerwin, William J.

    1984-01-01

    A device for indicating and preventing damage to voltage cells such as galvanic cells and fuel cells connected in series by detecting sequential voltages and comparing these voltages to adjacent voltage cells. The device is implemented by using operational amplifiers and switching circuitry is provided by transistors. The device can be utilized in battery powered electric vehicles to prevent galvanic cell damage and also in series connected fuel cells to prevent fuel cell damage.

  16. High voltage investigations for ITER coils

    Fink, S.; Fietz, W.H.

    2006-01-01

    The superconducting ITER magnets will be excited with high voltage during operation and fast discharge. Because the coils are complex systems the internal voltage distribution can differ to a large extent from the ideal linear voltage distribution. In case of fast excitations internal voltages between conductor and radial plate of a TF coil can be even higher than the terminal voltage of 3.5 kV to ground which appears during a fast discharge without a fault. Hence the determination of the transient voltage distribution is important for a proper insulation co-ordination and will provide a necessary basis for the verification of the individual insulation design and the choice of test voltages and waveforms. Especially the extent of internal overvoltages in case of failures, e. g. malfunction of discharge units and / or arcing is of special interest. Transient calculations for the ITER TF coil system have been performed for fast discharge and fault scenarios to define test voltages for ITER TF. The conductor and radial plate insulation of the ITER TF Model Coil were exposed at room temperature to test voltages derived from the results from these calculations. Breakdown appeared during the highest AC voltage step. A fault scenario for the TF fast discharge system is presented where one fault triggers a second fault, leading to considerable voltage stress. In addition a FEM model of Poloidal Field Coil 3 for the determination of the parameters of a detailed network model is presented in order to prepare detailed investigations of the transient voltage behaviour of the PF coils. (author)

  17. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  18. Thickness independent reduced forming voltage in oxygen engineered HfO{sub 2} based resistive switching memories

    Sharath, S. U., E-mail: sharath@oxide.tu-darmstadt.de; Kurian, J.; Komissinskiy, P.; Hildebrandt, E.; Alff, L. [Institute of Materials Science, Technische Universität Darmstadt, 64287 Darmstadt (Germany); Bertaud, T.; Walczyk, C.; Calka, P. [IHP, Im Technologiepark 25, 15236 Frankfurt Oder (Germany); Schroeder, T. [IHP, Im Technologiepark 25, 15236 Frankfurt Oder (Germany); Brandenburgische Technische Universität, Konrad-Zuse-Strasse 1, 03046 Cottbus (Germany)

    2014-08-18

    The conducting filament forming voltage of stoichiometric hafnium oxide based resistive switching layers increases linearly with layer thickness. Using strongly reduced oxygen deficient hafnium oxide thin films grown on polycrystalline TiN/Si(001) substrates, the thickness dependence of the forming voltage is strongly suppressed. Instead, an almost constant forming voltage of about 3 V is observed up to 200 nm layer thickness. This effect suggests that filament formation and switching occurs for all samples in an oxidized HfO{sub 2} surface layer of a few nanometer thickness while the highly oxygen deficient thin film itself merely serves as a oxygen vacancy reservoir.

  19. High-voltage transistor converter for pulsed x-ray sources

    Krasil'nikov, S.B.; Kristalinskii, A.L.; Lozovoi, L.N.; Markov, S.N.; Sindalovskii, E.I.

    1986-01-01

    A 24-V/12-kV converter for MIRA-2D and NORA pulsed x-ray sources is described. When the low-voltage supply varies within 20-26 V, the frequency stability of the x-ray pulses is higher by a factor of 3 ≅ 3 than when the PRIMA converter is used. For 14-24 V, the average output power of the converter is independent of the load impedance and increases linearly with an increase in supply voltage. The efficiency of the converter reaches 60%. The converter operates in the temperature range of -40 to +60 0 C

  20. Technological Aspects: High Voltage

    Faircloth, D C

    2013-01-01

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)

  1. Technological Aspects: High Voltage

    Faircloth, D.C.

    2013-12-16

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

  2. High voltage engineering

    Rizk, Farouk AM

    2014-01-01

    Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec

  3. High voltage test techniques

    Kind, Dieter

    2001-01-01

    The second edition of High Voltage Test Techniques has been completely revised. The present revision takes into account the latest international developments in High Voltage and Measurement technology, making it an essential reference for engineers in the testing field.High Voltage Technology belongs to the traditional area of Electrical Engineering. However, this is not to say that the area has stood still. New insulating materials, computing methods and voltage levels repeatedly pose new problems or open up methods of solution; electromagnetic compatibility (EMC) or components and systems al

  4. Voltage dependency of transmission probability of aperiodic DNA molecule

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  5. Linear growth increased in young children in an urban slum of Haiti: a randomized controlled trial of a lipid-based nutrient supplement.

    Iannotti, Lora L; Dulience, Sherlie Jean Louis; Green, Jamie; Joseph, Saminetha; François, Judith; Anténor, Marie-Lucie; Lesorogol, Carolyn; Mounce, Jacqueline; Nickerson, Nathan M

    2014-01-01

    Haiti has experienced rapid urbanization that has exacerbated poverty and undernutrition in large slum areas. Stunting affects 1 in 5 young children. We aimed to test the efficacy of a daily lipid-based nutrient supplement (LNS) for increased linear growth in young children. Healthy, singleton infants aged 6-11 mo (n = 589) were recruited from an urban slum of Cap Haitien and randomly assigned to receive: 1) a control; 2) a 3-mo LNS; or 3) a 6-mo LNS. The LNS provided 108 kcal and other nutrients including vitamin A, vitamin B-12, iron, and zinc at ≥80% of the recommended amounts. Infants were followed monthly on growth, morbidity, and developmental outcomes over a 6-mo intervention period and at one additional time point 6 mo postintervention to assess sustained effects. The Bonferroni multiple comparisons test was applied, and generalized least-squares (GLS) regressions with mixed effects was used to examine impacts longitudinally. Baseline characteristics did not differ by trial arm except for a higher mean age in the 6-mo LNS group. GLS modeling showed LNS supplementation for 6 mo significantly increased the length-for-age z score (±SE) by 0.13 ± 0.05 and the weight-for-age z score by 0.12 ± 0.02 compared with in the control group after adjustment for child age (P < 0.001). The effects were sustained 6 mo postintervention. Morbidity and developmental outcomes did not differ by trial arm. A low-energy, fortified product improved the linear growth of young children in this urban setting. The trial was registered at clinicaltrials.gov as NCT01552512.

  6. Hysteretic current-voltage characteristics in RF-sputtered nanocrystalline TiO2 thin films

    Villafuerte, Manuel; Juarez, Gabriel; Heluani, Silvia P. de; Comedi, David

    2007-01-01

    We have measured the current-voltage characteristics at room temperature of a nanocrystalline TiO 2 thin film fabricated by reactive RF-sputtering deposition and sandwiched between ITO (indium-tin-oxide)-buffered glass substrate and an indium top electrode. The I-V characteristics are ohmic for low voltages and become non-linear, hysteretic and asymmetric as the voltage is increased. The system is shown to be well represented by two distinct resistance states in the non-ohmic region. Current transient evolutions were also measured for constant voltage excitations. The resistance is stable in time for voltages in the ohmic regime. In contrast, for voltages in the non-ohmic regime, the resistance has a small variation for a short period of time (order of tens seconds) and then increases with time. For those transients, long characteristic times (on the order of tens of minutes up to hours) were found. The behavior of the system is discussed on the basis of experimental results reported in the literature for similar systems and existing models for electric-field induced resistive switching

  7. Linear induction accelerator

    Buttram, M.T.; Ginn, J.W.

    1988-06-21

    A linear induction accelerator includes a plurality of adder cavities arranged in a series and provided in a structure which is evacuated so that a vacuum inductance is provided between each adder cavity and the structure. An energy storage system for the adder cavities includes a pulsed current source and a respective plurality of bipolar converting networks connected thereto. The bipolar high-voltage, high-repetition-rate square pulse train sets and resets the cavities. 4 figs.

  8. Maximum permissible voltage of YBCO coated conductors

    Wen, J.; Lin, B.; Sheng, J.; Xu, J.; Jin, Z. [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Hong, Z., E-mail: zhiyong.hong@sjtu.edu.cn [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Wang, D.; Zhou, H.; Shen, X.; Shen, C. [Qingpu Power Supply Company, State Grid Shanghai Municipal Electric Power Company, Shanghai (China)

    2014-06-15

    Highlights: • We examine three kinds of tapes’ maximum permissible voltage. • We examine the relationship between quenching duration and maximum permissible voltage. • Continuous I{sub c} degradations under repetitive quenching where tapes reaching maximum permissible voltage. • The relationship between maximum permissible voltage and resistance, temperature. - Abstract: Superconducting fault current limiter (SFCL) could reduce short circuit currents in electrical power system. One of the most important thing in developing SFCL is to find out the maximum permissible voltage of each limiting element. The maximum permissible voltage is defined as the maximum voltage per unit length at which the YBCO coated conductors (CC) do not suffer from critical current (I{sub c}) degradation or burnout. In this research, the time of quenching process is changed and voltage is raised until the I{sub c} degradation or burnout happens. YBCO coated conductors test in the experiment are from American superconductor (AMSC) and Shanghai Jiao Tong University (SJTU). Along with the quenching duration increasing, the maximum permissible voltage of CC decreases. When quenching duration is 100 ms, the maximum permissible of SJTU CC, 12 mm AMSC CC and 4 mm AMSC CC are 0.72 V/cm, 0.52 V/cm and 1.2 V/cm respectively. Based on the results of samples, the whole length of CCs used in the design of a SFCL can be determined.

  9. Control and Testing of a Dynamic Voltage Restorer (DVR) at Medium Voltage Level

    Nielsen, John Godsk; Newman, Michael; Nielsen, Hans Ove

    2004-01-01

    power sensitive loads from voltage sags. This paper reports practical test results obtained on a medium voltage (10 kV) level using a DVR at a Distribution test facility in Kyndby, Denmark. The DVR was designed to protect a 400-kVA load from a 0.5-p.u. maximum voltage sag. The reported DVR verifies......The dynamic voltage restorer (DVR) has become popular as a cost effective solution for the protection of sensitive loads from voltage sags. Implementations of the DVR have been proposed at both a low voltage (LV) level, as well as a medium voltage (MV) level; and give an opportunity to protect high...... the use of a feed-forward and feed-back technique of the controller and it obtains both good transient and steady state responses. The effect of the DVR on the system is experimentally investigated under both faulted and non-faulted system states, for a variety of linear and non-linear loads. Variable...

  10. Design of shielded voltage divider for impulse voltage measurement

    Kato, Shohei; Kouno, Teruya; Maruyama, Yoshio; Kikuchi, Koji.

    1976-01-01

    The dividers used for the study of the insulation and electric discharge phenomena in high voltage equipments have the problems of the change of response characteristics owing to adjacent bodies and of induced noise. To improve the characteristics, the enclosed type divider shielded with metal has been investigated, and the divider of excellent response has been obtained by adopting the frequency-separating divider system, which is divided into two parts, resistance divider (lower frequency region) and capacitance divider (higher frequency region), for avoiding to degrade the response. Theoretical analysis was carried out in the cases that residual inductance can be neglected or can not be neglected in the small capacitance divider, and that the connecting wires are added. Next, the structure of the divider and the design of the electric field for the divider manufactured on the basis of the theory are described. The response characteristics were measured. The results show that 1 MV impulse voltage can be measured within the response time of 10 ns. Though this divider aims at the impulse voltage, the duration time of which is about that of standard lightning impulse, in view of the heat capacity because of the input resistance of 10.5 kΩ, it is expected that the divider can be applied to the voltage of longer duration time by increasing the input resistance in future. (Wakatsuki, Y.)

  11. Square pulse linear transformer driver

    A. A. Kim

    2012-04-01

    Full Text Available The linear transformer driver (LTD technological approach can result in relatively compact devices that can deliver fast, high current, and high-voltage pulses straight out of the LTD cavity without any complicated pulse forming and pulse compression network. Through multistage inductively insulated voltage adders, the output pulse, increased in voltage amplitude, can be applied directly to the load. The usual LTD architecture [A. A. Kim, M. G. Mazarakis, V. A. Sinebryukhov, B. M. Kovalchuk, V. A. Vizir, S. N Volkov, F. Bayol, A. N. Bastrikov, V. G. Durakov, S. V. Frolov, V. M. Alexeenko, D. H. McDaniel, W. E. Fowler, K. LeCheen, C. Olson, W. A. Stygar, K. W. Struve, J. Porter, and R. M. Gilgenbach, Phys. Rev. ST Accel. Beams 12, 050402 (2009PRABFM1098-440210.1103/PhysRevSTAB.12.050402; M. G. Mazarakis, W. E. Fowler, A. A. Kim, V. A. Sinebryukhov, S. T. Rogowski, R. A. Sharpe, D. H. McDaniel, C. L. Olson, J. L. Porter, K. W. Struve, W. A. Stygar, and J. R. Woodworth, Phys. Rev. ST Accel. Beams 12, 050401 (2009PRABFM1098-440210.1103/PhysRevSTAB.12.050401] provides sine shaped output pulses that may not be well suited for some applications like z-pinch drivers, flash radiography, high power microwaves, etc. A more suitable power pulse would have a flat or trapezoidal (rising or falling top. In this paper, we present the design and first test results of an LTD cavity that generates such a type of output pulse by including within its circular array a number of third harmonic bricks in addition to the main bricks. A voltage adder made out of a square pulse cavity linear array will produce the same shape output pulses provided that the timing of each cavity is synchronized with the propagation of the electromagnetic pulse.

  12. Nonlinear electrokinetics at large voltages

    Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu

    2009-07-15

    The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.

  13. Characteristics of output voltage and current of integrated nanogenerators

    Yang, Rusen; Qin, Yong; Li, Cheng; Dai, Liming; Wang, Zhong Lin

    2009-01-01

    three criteria: Schottky behavior test, switching-polarity tests, and linear superposition of current and voltage tests. The 11 tests can effectively rule out the system artifacts, whose sign does not change with the switching measurement polarity

  14. Linear algebra

    Shilov, Georgi E

    1977-01-01

    Covers determinants, linear spaces, systems of linear equations, linear functions of a vector argument, coordinate transformations, the canonical form of the matrix of a linear operator, bilinear and quadratic forms, Euclidean spaces, unitary spaces, quadratic forms in Euclidean and unitary spaces, finite-dimensional space. Problems with hints and answers.

  15. Photovoltaic Small Molecules of TPA(FxBT-T-Cz)3: Tuning Open-Circuit Voltage over 1.0 V for Their Organic Solar Cells by Increasing Fluorine Substitution.

    Wang, Qiong; Duan, Linrui; Tao, Qiang; Peng, Wenhong; Chen, Jianhua; Tan, Hua; Yang, Renqiang; Zhu, Weiguo

    2016-11-09

    To simultaneously improve both open-circuit voltage (V oc ) and short-circuit current density (J sc ) for organic solar cells, a novel D(A-π-Ar) 3 type of photovoltaic small molecules of TPA(F x BT-T-3Cz) 3 was designed and synthesized, which contain central triphenylamine (TPA), terminal carbazole (Cz), armed fluorine-substituted benzothiadiazole (F x BT, where x = 1 or 2), and bridged thiophene (T) units. A narrowed ultraviolet-visible absorption and a decreasing highest occupied molecular orbital energy level were observed from TPA(F 1 BT-T-3Cz) 3 to TPA(F 2 BT-T-3Cz) 3 with increasing fluorine substitution. However, the TPA(F 2 BT-T-3Cz) 3 /PC 71 BM-based solar devices showed a rising V oc of 1.01 V and an enhanced J sc of 10.84 mA cm -2 as well as a comparable power conversion efficiency of 4.81% in comparison to the TPA(F 1 BT-T-3Cz) 3 /PC 71 BM-based devices. Furthermore, in comparison to the parent TPA(BT-T-3Cz) 3 molecule without fluorine substitution, the fluorine-substituted TPA(F x BT-T-3Cz) 3 molecules exhibited significantly incremental V oc and J sc values in their bulk heterojunction organic solar cells, owing to fluorine incorporation in the electron-deficient benzothiadiazole unit.

  16. High voltage engineering fundamentals

    Kuffel, E; Hammond, P

    1984-01-01

    Provides a comprehensive treatment of high voltage engineering fundamentals at the introductory and intermediate levels. It covers: techniques used for generation and measurement of high direct, alternating and surge voltages for general application in industrial testing and selected special examples found in basic research; analytical and numerical calculation of electrostatic fields in simple practical insulation system; basic ionisation and decay processes in gases and breakdown mechanisms of gaseous, liquid and solid dielectrics; partial discharges and modern discharge detectors; and over

  17. Reduced Voltage Scaling in Clock Distribution Networks

    Khader Mohammad

    2009-01-01

    Full Text Available We propose a novel circuit technique to generate a reduced voltage swing (RVS signals for active power reduction on main buses and clocks. This is achieved without performance degradation, without extra power supply requirement, and with minimum area overhead. The technique stops the discharge path on the net that is swinging low at a certain voltage value. It reduces active power on the target net by as much as 33% compared to traditional full swing signaling. The logic 0 voltage value is programmable through control bits. If desired, the reduced-swing mode can also be disabled. The approach assumes that the logic 0 voltage value is always less than the threshold voltage of the nMOS receivers, which eliminate the need of the low to high voltage translation. The reduced noise margin and the increased leakage on the receiver transistors using this approach have been addressed through the selective usage of multithreshold voltage (MTV devices and the programmability of the low voltage value.

  18. Prediction of breakdown voltages in novel gases for high voltage insulation

    Koch, M.

    2015-07-01

    This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF{sub 6}) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF{sub 6} is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF{sub 6} in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF{sub 6} based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media.

  19. Prediction of breakdown voltages in novel gases for high voltage insulation

    Koch, M.

    2015-01-01

    This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF_6) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF_6 is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF_6 in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF_6 based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media

  20. Optimal condition of memristance enhancement circuit using external voltage source

    Hiroya Tanaka

    2014-05-01

    Full Text Available Memristor provides nonlinear response in the current-voltage characteristic and the memristance is modulated using an external voltage source. We point out by solving nonlinear equations that an optimal condition of the external voltage source exists for maximizing the memristance in such modulation scheme. We introduce a linear function to describe the nonlinear time response and derive an important design guideline; a constant ratio of the frequency to the amplitude of the external voltage source maximizes the memristance. The analysis completely accounts for the memristance behavior.

  1. Device for monitoring cell voltage

    Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE

    2012-08-21

    A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.

  2. Low-Voltage Consumption Coordination for Loss Minimization and Voltage Control

    Juelsgaard, Morten; Sloth, Christoffer; Wisniewski, Rafal

    2014-01-01

    This work presents a strategy for minimizing active power losses in low-voltage grids, by coordinating the consumption of electric vehicles and power generation from solar panels. We show that minimizing losses, also reduces voltage variations, and illustrate how this may be employed for increasing...

  3. Voltage generators of high voltage high power accelerators

    Svinin, M.P.

    1981-01-01

    High voltage electron accelerators are widely used in modern radiation installations for industrial purposes. In the near future further increasing of their power may be effected, which enables to raise the efficiency of the radiation processes known and to master new power-consuming production in industry. Improvement of HV generators by increasing their power and efficiency is one of many scientific and engineering aspects the successful solution of which provides further development of these accelerators and their technical parameters. The subject is discussed in detail. (author)

  4. Irradiation of intense characteristic x-rays from weakly ionized linear molybdenum plasma

    Sato, Eiichi; Hayasi, Yasuomi

    2003-01-01

    In the plasma flash x-ray generator, a high-voltage main condenser of approximately 200 nF is charged up to 55 kV by a power supply, and electric charges in the condenser are discharged to an x-ray tube after triggering the cathode electrode. The flash x-rays are then produced. The x-ray tube is a demountable triode that is connected to a turbo molecular pump with a pressure of approximately 1 mPa. As electron flows from the cathode electrode are roughly converged to a rod molybdenum target of 2.0 mm in diameter by the electric field in the x-ray tube, weakly ionized linear plasma, which consists of molybdenum ions and electrons, forms by target evaporation. At a charging voltage of 55 kV, the maximum tube voltage was almost equal to the charging voltage of the main condenser, and the peak current was about 20 kA. When the charging voltage was increased, the linear plasma formed, and the K-series characteristic x-ray intensities increased. The K lines were quite sharp and intense, and hardly any bremsstrahlung rays were detected. The x-ray pulse widths were approximately 700 ns, and the time-integrated x-ray intensity had a value of approximately 35 μC/kg at 1.0 m from the x-ray source with a charging voltage of 50 kV. (author)

  5. A dynamic voltage restorer (DVR) with selective harmonic compensation at medium voltage level

    Newman, M.J.; Holmes, D.G.; Nielsen, J.G.

    2005-01-01

    Dynamic voltage restorers (DVRs) are now becoming more established in industry to reduce the impact of voltage sags to sensitive loads. However, DVRs spend most of their time in standby mode, since voltage sags occur very infrequently, and hence their utilization is low. In principle, it would...... be advantageous if the series-connected inverter of a DVR could also be used to compensate for any steady-state load voltage harmonics, since this would increase the power quality "value-added" benefits to the grid system. However, before this can be done, consideration must be given to the control of steady......-state power through the DVR, the increased losses, and the low modulation depths at which the scheme must operate to achieve acceptable harmonic compensation performance. This paper presents a selective harmonic feedback control strategy that can be easily added to medium-voltage DVR systems to provide...

  6. An optical fiber Bragg grating and piezoelectric ceramic voltage sensor

    Yang, Qing; He, Yanxiao; Sun, Shangpeng; Luo, Mandan; Han, Rui

    2017-10-01

    Voltage measurement is essential in many fields like power grids, telecommunications, metallurgy, railways, and oil production. A voltage-sensing unit, consisting of fiber Bragg gratings (FBGs) and piezoelectric ceramics, based on which an optical over-voltage sensor was proposed and fabricated in this paper. No demodulation devices like spectrometer or Fabry-Perot filter were needed to gain the voltage signal, and a relatively large sensing frequency range was acquired in this paper; thus, the cost of the sensing system is more acceptable in engineering application. The voltage to be measured was directly applied to the piezoelectric ceramic, and deformation of the ceramics and the grating would be caused because of the inverse piezoelectric effect. With a reference grating, the output light intensity change will be caused by the FBG center wavelength change; thus, the relationship between the applied voltage and the output light intensity was established. Validation of the sensor was accomplished in the frequency range from 50 Hz to 20 kHz and switching impulse waves with a test platform; good linearity of the input-output characteristic was achieved. A temperature validation test was completed, showing that the sensor maintains good temperature stability. Experimental results show that the optical over-voltage sensor can be used for voltage monitoring, and if applied with a voltage divider, the sensor can be used to measure high voltage.

  7. An optical fiber Bragg grating and piezoelectric ceramic voltage sensor.

    Yang, Qing; He, Yanxiao; Sun, Shangpeng; Luo, Mandan; Han, Rui

    2017-10-01

    Voltage measurement is essential in many fields like power grids, telecommunications, metallurgy, railways, and oil production. A voltage-sensing unit, consisting of fiber Bragg gratings (FBGs) and piezoelectric ceramics, based on which an optical over-voltage sensor was proposed and fabricated in this paper. No demodulation devices like spectrometer or Fabry-Perot filter were needed to gain the voltage signal, and a relatively large sensing frequency range was acquired in this paper; thus, the cost of the sensing system is more acceptable in engineering application. The voltage to be measured was directly applied to the piezoelectric ceramic, and deformation of the ceramics and the grating would be caused because of the inverse piezoelectric effect. With a reference grating, the output light intensity change will be caused by the FBG center wavelength change; thus, the relationship between the applied voltage and the output light intensity was established. Validation of the sensor was accomplished in the frequency range from 50 Hz to 20 kHz and switching impulse waves with a test platform; good linearity of the input-output characteristic was achieved. A temperature validation test was completed, showing that the sensor maintains good temperature stability. Experimental results show that the optical over-voltage sensor can be used for voltage monitoring, and if applied with a voltage divider, the sensor can be used to measure high voltage.

  8. Digital voltage discriminator

    Zhou Zhicheng

    1992-01-01

    A digital voltage discriminator is described, which is synthesized by digital comparator and ADC. The threshold is program controllable with high stability. Digital region of confusion is approximately equal to 1.5 LSB. This discriminator has a single channel analyzer function model with channel width of 1.5 LSB

  9. High-voltage picoamperemeter

    Bugl, Andrea; Ball, Markus; Boehmer, Michael; Doerheim, Sverre; Hoenle, Andreas; Konorov, Igor [Technische Universitaet Muenchen, Garching (Germany); Ketzer, Bernhard [Technische Universitaet Muenchen, Garching (Germany); Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany)

    2014-07-01

    Current measurements in the nano- and picoampere region on high voltage are an important tool to understand charge transfer processes in micropattern gas detectors like the Gas Electron Multiplier (GEM). They are currently used to e.g. optimize the field configuration in a multi-GEM stack to be used in the ALICE TPC after the upgrade of the experiment during the 2nd long shutdown of the LHC. Devices which allow measurements down to 1pA at high voltage up to 6 kV have been developed at TU Muenchen. They are based on analog current measurements via the voltage drop over a switchable shunt. A microcontroller collects 128 digital ADC values and calculates their mean and standard deviation. This information is sent with a wireless transmitting unit to a computer and stored in a root file. A nearly unlimited number of devices can be operated simultaneously and read out by a single receiver. The results can also be displayed on a LCD directly at the device. Battery operation and the wireless readout are important to protect the user from any contact to high voltage. The principle of the device is explained, and systematic studies of their properties are shown.

  10. Geomagnetism and Induced Voltage

    Abdul-Razzaq, W.; Biller, R. D.

    2010-01-01

    Introductory physics laboratories have seen an influx of "conceptual integrated science" over time in their classrooms with elements of other sciences such as chemistry, biology, Earth science, and astronomy. We describe a laboratory to introduce this development, as it attracts attention to the voltage induced in the human brain as it…

  11. Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

  12. Linear gate

    Suwono.

    1978-01-01

    A linear gate providing a variable gate duration from 0,40μsec to 4μsec was developed. The electronic circuity consists of a linear circuit and an enable circuit. The input signal can be either unipolar or bipolar. If the input signal is bipolar, the negative portion will be filtered. The operation of the linear gate is controlled by the application of a positive enable pulse. (author)

  13. Linear Accelerators

    Vretenar, M

    2014-01-01

    The main features of radio-frequency linear accelerators are introduced, reviewing the different types of accelerating structures and presenting the main characteristics aspects of linac beam dynamics

  14. Application of pentacene thin-film transistors with controlled threshold voltages to enhancement/depletion inverters

    Takahashi, Hajime; Hanafusa, Yuki; Kimura, Yoshinari; Kitamura, Masatoshi

    2018-03-01

    Oxygen plasma treatment has been carried out to control the threshold voltage in organic thin-film transistors (TFTs) having a SiO2 gate dielectric prepared by rf sputtering. The threshold voltage linearly changed in the range of -3.7 to 3.1 V with the increase in plasma treatment time. Although the amount of change is smaller than that for organic TFTs having thermally grown SiO2, the tendency of the change was similar to that for thermally grown SiO2. To realize different plasma treatment times on the same substrate, a certain region on the SiO2 surface was selected using a shadow mask, and was treated with oxygen plasma. Using the process, organic TFTs with negative threshold voltages and those with positive threshold voltages were fabricated on the same substrate. As a result, enhancement/depletion inverters consisting of the organic TFTs operated at supply voltages of 5 to 15 V.

  15. Voltage-dependent gating of hERG potassium channels

    Yen May eCheng

    2012-05-01

    Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.

  16. Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...

  17. Capturing power at higher voltages from arrays of microbial fuel cells without voltage reversal

    Kim, Younggy

    2011-01-01

    Voltages produced by microbial fuel cells (MFCs) cannot be sustainably increased by linking them in series due to voltage reversal, which substantially reduces stack voltages. It was shown here that MFC voltages can be increased with continuous power production using an electronic circuit containing two sets of multiple capacitors that were alternately charged and discharged (every one second). Capacitors were charged in parallel by the MFCs, but linked in series while discharging to the circuit load (resistor). The parallel charging of the capacitors avoided voltage reversal, while discharging the capacitors in series produced up to 2.5 V with four capacitors. There were negligible energy losses in the circuit compared to 20-40% losses typically obtained with MFCs using DC-DC converters to increase voltage. Coulombic efficiencies were 67% when power was generated via four capacitors, compared to only 38% when individual MFCs were operated with a fixed resistance of 250 Ω. The maximum power produced using the capacitors was not adversely affected by variable performance of the MFCs, showing that power generation can be maintained even if individual MFCs perform differently. Longer capacitor charging and discharging cycles of up to 4 min maintained the average power but increased peak power by up to 2.6 times. These results show that capacitors can be used to easily obtain higher voltages from MFCs, allowing for more useful capture of energy from arrays of MFCs. © 2011 The Royal Society of Chemistry.

  18. Linearization Method and Linear Complexity

    Tanaka, Hidema

    We focus on the relationship between the linearization method and linear complexity and show that the linearization method is another effective technique for calculating linear complexity. We analyze its effectiveness by comparing with the logic circuit method. We compare the relevant conditions and necessary computational cost with those of the Berlekamp-Massey algorithm and the Games-Chan algorithm. The significant property of a linearization method is that it needs no output sequence from a pseudo-random number generator (PRNG) because it calculates linear complexity using the algebraic expression of its algorithm. When a PRNG has n [bit] stages (registers or internal states), the necessary computational cost is smaller than O(2n). On the other hand, the Berlekamp-Massey algorithm needs O(N2) where N(≅2n) denotes period. Since existing methods calculate using the output sequence, an initial value of PRNG influences a resultant value of linear complexity. Therefore, a linear complexity is generally given as an estimate value. On the other hand, a linearization method calculates from an algorithm of PRNG, it can determine the lower bound of linear complexity.

  19. Linear induction accelerators

    Briggs, R.J.

    1986-06-01

    The development of linear induction accelerators has been motivated by applications requiring high-pulsed currents of charged particles at voltages exceeding the capability of single-stage, diode-type accelerators and at currents too high for rf accelerators. In principle, one can accelerate charged particles to arbitrarily high voltages using a multi-stage induction machine, but the 50-MeV, 10-kA Advanced Test Accelerator (ATA) at LLNL is the highest voltage machine in existence at this time. The advent of magnetic pulse power systems makes sustained operation at high-repetition rates practical, and this capability for high-average power is very likely to open up many new applications of induction machines in the future. This paper surveys the US induction linac technology with primary emphasis on electron machines. A simplified description of how induction machines couple energy to the electron beam is given, to illustrate many of the general issues that bound the design space of induction linacs

  20. Frequency pulling in a low-voltage medium-power gyrotron

    Luo, Li; Du, Chao-Hai; Huang, Ming-Guang; Liu, Pu-Kun

    2018-04-01

    Many recent biomedical applications use medium-power frequency-tunable terahertz (THz) sources, such as sensitivity-enhanced nuclear magnetic resonance, THz imaging, and biomedical treatment. As a promising candidate, a low-voltage gyrotron can generate watt-level, continuous THz-wave radiation. In particular, the frequency-pulling effect in a gyrotron, namely, the effect of the electron beam parameters on the oscillation frequency, can be used to tune the operating frequency. Most previous investigations used complicated and time-consuming gyrotron nonlinear theory to study the influence of many beam parameters on the interaction performance. While gyrotron linear theory investigation demonstrates the advantages of rapidly and clearly revealing the physical influence of individual key beam parameters on the overall system performance, this paper demonstrates systematically the use of gyrotron linear theory to study the frequency-pulling effect in a low-voltage gyrotron with either a Gaussian or a sinusoidal axial-field profile. Furthermore, simulations of a gyrotron operating in the first axial mode are carried out in the framework of nonlinear theory as a contrast. Close agreement is achieved between the two theories. Besides, some interesting results are obtained. In a low-current sinusoidal-profile cavity, the ranges of frequency variation for different axial modes are isolated from each other, and the frequency tuning bandwidth for each axial mode increases by increasing either the beam voltage or pitch factor. Lowering the voltage, the total tuning ranges are squeezed and become concentrated. However, the isolated frequency regions of each axial mode cannot be linked up unless the beam current is increased, meaning that higher current operation is the key to achieving a wider and continuous tuning frequency range. The results presented in this paper can provide a reference for designing a broadband low-voltage gyrotron.

  1. An Improved Droop Control Method for DC Microgrids Based on Low Bandwidth Communication with DC Bus Voltage Restoration and Enhanced Current Sharing Accuracy

    Lu, Xiaonan; Guerrero, Josep M.; Sun, Kai

    2014-01-01

    Droop control is the basic control method for load current sharing in dc microgrid applications. The conventional dc droop control method is realized by linearly reducing the dc output voltage as the output current increases. This method has two limitations. First, with the consideration of line...... resistance in a droop-controlled dc microgrid, since the output voltage of each converter cannot be exactly the same, the output current sharing accuracy is degraded. Second, the DC bus voltage deviation increases with the load due to the droop action. In this paper, in order to improve the performance......, and the LBC system is only used for changing the values of the dc voltage and current. Hence, a decentralized control scheme is accomplished. The simulation test based on Matlab/Simulink and the experimental validation based on a 2×2.2 kW prototype were implemented to demonstrate the proposed approach....

  2. Linear algebra

    Said-Houari, Belkacem

    2017-01-01

    This self-contained, clearly written textbook on linear algebra is easily accessible for students. It begins with the simple linear equation and generalizes several notions from this equation for the system of linear equations and introduces the main ideas using matrices. It then offers a detailed chapter on determinants and introduces the main ideas with detailed proofs. The third chapter introduces the Euclidean spaces using very simple geometric ideas and discusses various major inequalities and identities. These ideas offer a solid basis for understanding general Hilbert spaces in functional analysis. The following two chapters address general vector spaces, including some rigorous proofs to all the main results, and linear transformation: areas that are ignored or are poorly explained in many textbooks. Chapter 6 introduces the idea of matrices using linear transformation, which is easier to understand than the usual theory of matrices approach. The final two chapters are more advanced, introducing t...

  3. High Voltage Charge Pump

    Emira, Ahmed A.; Abdelghany, Mohamed A.; Elsayed, Mohannad Yomn; Elshurafa, Amro M; Salama, Khaled N.

    2014-01-01

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  4. High Voltage Charge Pump

    Emira, Ahmed A.

    2014-10-09

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  5. Voltage effect in PTCR ceramics: Calculation by the method of tilted energy band

    Fang Chao; Zhou Dongxiang; Gong Shuping

    2010-01-01

    A numerical model for the calculation of the electrical characteristics of donor-doped BaTiO 3 semiconducting ceramics is suggested. This paper established a differential equation about electron level on the base of Poisson equation, and solved the equation with Runge-Kutta method. Under extra electric field, electrical characteristics have been calculated by the method of tilted energy band. We have quantitatively computed the positive temperature coefficient of resistivity (PTCR) behavior of donor-doped BaTiO 3 semiconducting ceramics and its voltage effect, and further obtained non-linear current-voltage characteristics with different grain sizes at different temperature. The results pointed out that the resistance jumping is reduced with increasing electric field applied; current and voltage relation follows Ohm's law below Curie temperature, and exhibits strong non-linear above Curie temperature; the non-linear coefficient shows a maximum value at temperature the resistivity reaches maximum and with grain size closed to depletion region width. The results are compared with experimental data.

  6. High Voltage Seismic Generator

    Bogacz, Adrian; Pala, Damian; Knafel, Marcin

    2015-04-01

    This contribution describes the preliminary result of annual cooperation of three student research groups from AGH UST in Krakow, Poland. The aim of this cooperation was to develop and construct a high voltage seismic wave generator. Constructed device uses a high-energy electrical discharge to generate seismic wave in ground. This type of device can be applied in several different methods of seismic measurement, but because of its limited power it is mainly dedicated for engineering geophysics. The source operates on a basic physical principles. The energy is stored in capacitor bank, which is charged by two stage low to high voltage converter. Stored energy is then released in very short time through high voltage thyristor in spark gap. The whole appliance is powered from li-ion battery and controlled by ATmega microcontroller. It is possible to construct larger and more powerful device. In this contribution the structure of device with technical specifications is resented. As a part of the investigation the prototype was built and series of experiments conducted. System parameter was measured, on this basis specification of elements for the final device were chosen. First stage of the project was successful. It was possible to efficiently generate seismic waves with constructed device. Then the field test was conducted. Spark gap wasplaced in shallowborehole(0.5 m) filled with salt water. Geophones were placed on the ground in straight line. The comparison of signal registered with hammer source and sparker source was made. The results of the test measurements are presented and discussed. Analysis of the collected data shows that characteristic of generated seismic signal is very promising, thus confirms possibility of practical application of the new high voltage generator. The biggest advantage of presented device after signal characteristics is its size which is 0.5 x 0.25 x 0.2 m and weight approximately 7 kg. This features with small li-ion battery makes

  7. Linear algebra

    Stoll, R R

    1968-01-01

    Linear Algebra is intended to be used as a text for a one-semester course in linear algebra at the undergraduate level. The treatment of the subject will be both useful to students of mathematics and those interested primarily in applications of the theory. The major prerequisite for mastering the material is the readiness of the student to reason abstractly. Specifically, this calls for an understanding of the fact that axioms are assumptions and that theorems are logical consequences of one or more axioms. Familiarity with calculus and linear differential equations is required for understand

  8. Voltage-Dependent Gating of hERG Potassium Channels

    Cheng, Yen May; Claydon, Tom W.

    2012-01-01

    The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397

  9. Do non-targeted effects increase or decrease low dose risk in relation to the linear-non-threshold (LNT) model?

    Little, M.P.

    2010-01-01

    In this paper we review the evidence for departure from linearity for malignant and non-malignant disease and in the light of this assess likely mechanisms, and in particular the potential role for non-targeted effects. Excess cancer risks observed in the Japanese atomic bomb survivors and in many medically and occupationally exposed groups exposed at low or moderate doses are generally statistically compatible. For most cancer sites the dose-response in these groups is compatible with linearity over the range observed. The available data on biological mechanisms do not provide general support for the idea of a low dose threshold or hormesis. This large body of evidence does not suggest, indeed is not statistically compatible with, any very large threshold in dose for cancer, or with possible hormetic effects, and there is little evidence of the sorts of non-linearity in response implied by non-DNA-targeted effects. There are also excess risks of various types of non-malignant disease in the Japanese atomic bomb survivors and in other groups. In particular, elevated risks of cardiovascular disease, respiratory disease and digestive disease are observed in the A-bomb data. In contrast with cancer, there is much less consistency in the patterns of risk between the various exposed groups; for example, radiation-associated respiratory and digestive diseases have not been seen in these other (non-A-bomb) groups. Cardiovascular risks have been seen in many exposed populations, particularly in medically exposed groups, but in contrast with cancer there is much less consistency in risk between studies: risks per unit dose in epidemiological studies vary over at least two orders of magnitude, possibly a result of confounding and effect modification by well known (but unobserved) risk factors. In the absence of a convincing mechanistic explanation of epidemiological evidence that is, at present, less than persuasive, a cause-and-effect interpretation of the reported

  10. Rectangular waveform linear transformer driver module design

    Zhao Yue; Xie Weiping; Zhou Liangji; Chen Lin

    2014-01-01

    Linear Transformer Driver is a novel pulsed power technology, its main merits include a parallel LC discharge array and Inductive Voltage Adder. The parallel LC discharge array lowers the whole circuit equivalent inductance and the Inductive Voltage Adder unites the modules in series in order to create a high electric field grads, meanwhile, restricts the high voltage in a small space. The lower inductance in favor of LTD output a fast waveform and IVA confine high voltage in secondary cavity. In recently, some LTD-based pulsed power system has been development yet. The usual LTD architecture provides damped sine shaped output pulses that may not be suitable in flash radiography, high power microwave production, z-pinch drivers, and certain other applications. A more suitable driver output pulse would have a flat or inclined top (slightly rising or falling). In this paper, we present the design of an LTD cavity that generates this type of the output pulse by including within its circular array some number of the harmonic bricks in addition to the standard bricks according to Fourier progression theory. The parallel LC discharge array circuit formula is introduced by Kirchhoff Law, and the sum of harmonic is proofed as an analytic result, meanwhile, rationality of design is proved by simulation. Varying gas spark discharge dynamic resistance with harmonic order and switches jitter are analyzed. The results are as following: The more harmonic order is an approach to the ideal rectangular waveform, but lead to more system complexity. The capacity decreases as harmonic order increase, and gas spark discharge dynamic resistance rises with the capacity. The rising time protracts and flat is decay or even vanishes and the shot to shot reproducibility is degenerate as the switches jitter is high. (authors)

  11. Suppressing voltage transients in high voltage power supplies

    Lickel, K.F.; Stonebank, R.

    1979-01-01

    A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)

  12. Linear programming

    Solow, Daniel

    2014-01-01

    This text covers the basic theory and computation for a first course in linear programming, including substantial material on mathematical proof techniques and sophisticated computation methods. Includes Appendix on using Excel. 1984 edition.

  13. Linear algebra

    Liesen, Jörg

    2015-01-01

    This self-contained textbook takes a matrix-oriented approach to linear algebra and presents a complete theory, including all details and proofs, culminating in the Jordan canonical form and its proof. Throughout the development, the applicability of the results is highlighted. Additionally, the book presents special topics from applied linear algebra including matrix functions, the singular value decomposition, the Kronecker product and linear matrix equations. The matrix-oriented approach to linear algebra leads to a better intuition and a deeper understanding of the abstract concepts, and therefore simplifies their use in real world applications. Some of these applications are presented in detailed examples. In several ‘MATLAB-Minutes’ students can comprehend the concepts and results using computational experiments. Necessary basics for the use of MATLAB are presented in a short introduction. Students can also actively work with the material and practice their mathematical skills in more than 300 exerc...

  14. Linear algebra

    Berberian, Sterling K

    2014-01-01

    Introductory treatment covers basic theory of vector spaces and linear maps - dimension, determinants, eigenvalues, and eigenvectors - plus more advanced topics such as the study of canonical forms for matrices. 1992 edition.

  15. Linear Models

    Searle, Shayle R

    2012-01-01

    This 1971 classic on linear models is once again available--as a Wiley Classics Library Edition. It features material that can be understood by any statistician who understands matrix algebra and basic statistical methods.

  16. Charge-pump voltage converter

    Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

    2009-11-03

    A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

  17. Observability of Low Voltage grids

    Martin-Loeches, Ruben Sánchez; Iov, Florin; Kemal, Mohammed Seifu

    2017-01-01

    Low Voltage (LV) distribution power grids are experiencing a transformation from a passive to a more active role due to the increasing penetration of distributed generation, heat pumps and electrical vehicles. The first step towards a smarter operation of LV electrical systems is to provide grid ...... an updated state of the art on DSSE-AMI based, adaptive data collection techniques and database management system types. Moreover, the ongoing Danish RemoteGRID project is presented as a realistic case study.......Low Voltage (LV) distribution power grids are experiencing a transformation from a passive to a more active role due to the increasing penetration of distributed generation, heat pumps and electrical vehicles. The first step towards a smarter operation of LV electrical systems is to provide grid....... It becomes unrealistic to provide near real time full observability of the LV grid by applying Distribution System State Estimation (DSSE) utilizing the classical data collection and storage/preprocessing techniques. This paper investigates up-todate the observability problem in LV grids by providing...

  18. Transient voltage sharing in series-coupled high voltage switches

    Editorial Office

    1992-07-01

    Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analy­sis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus oc­curs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.

  19. Coordinated Voltage Control of Distributed PV Inverters for Voltage Regulation in Low Voltage Distribution Networks

    Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna

    2017-01-01

    This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...

  20. Low cost photomultiplier high-voltage readout system

    Oxoby, G.J.; Kunz, P.F.

    1976-10-01

    The Large Aperture Solenoid Spectrometer (LASS) at Stanford Linear Accelerator Center (SLAC) requires monitoring over 300 voltages. This data is recorded on magnetic tapes along with the event data. It must also be displayed so that operators can easily monitor and adjust the voltages. A low-cost high-voltage readout system has been implemented to offer stand-alone digital readout capability as well as fast data transfer to a host computer. The system is flexible enough to permit use of a DVM or ADC and commercially available analogue multiplexers

  1. Artificial intelligence techniques for voltage control

    Ekwue, A.; Cheng, D.T.Y.; Macqueen, J.F.

    1997-12-31

    In electric power systems, the advantages of reactive power dispatching or optimisation include improved utilisation of reactive power sources and hence reduction in reactive power flows and real losses of the system; unloading of the system and equipment as a result of reactive flow reduction; the power factors of generation are improved and system security is enhanced; reduced voltage gradients and somewhat higher voltages which result across the system from improved operation; deferred capital investment is new reactive power sources as a result of improved utilisation of existing equipment; and for the National Grid Company plc (NGC), the main advantage is reduced out-of-merit operation. The problem of reactive power control has been studied and widely reported in the literature. Non-linear programming methods as well as linear programming techniques for constraint dispatch have been described. Static optimisation of reactive power sources by the use of sensitivity analysis was described by Kishore and Hill. Long range optimum var planning has been considered and the optimum amount and location of network reactive compensation so as to maintain the system voltage within the desired limits, while operating under normal and various insecurity states, have also been studied using several methods. The objective of this chapter is therefore to review conventional methods as well as AI techniques for reactive power control. (Author)

  2. Sensing voltage across lipid membranes

    Swartz, Kenton J.

    2009-01-01

    The detection of electrical potentials across lipid bilayers by specialized membrane proteins is required for many fundamental cellular processes such as the generation and propagation of nerve impulses. These membrane proteins possess modular voltage-sensing domains, a notable example being the S1-S4 domains of voltage-activated ion channels. Ground-breaking structural studies on these domains explain how voltage sensors are designed and reveal important interactions with the surrounding lipid membrane. Although further structures are needed to fully understand the conformational changes that occur during voltage sensing, the available data help to frame several key concepts that are fundamental to the mechanism of voltage sensing. PMID:19092925

  3. Genetically encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics.

    Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

    2012-07-15

    A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.

  4. Genetically-encoded fluorescent voltage sensors using the voltage-sensing domain of Nematostella and Danio phosphatases exhibit fast kinetics

    Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent

    2012-01-01

    A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212

  5. Linear regression

    Olive, David J

    2017-01-01

    This text covers both multiple linear regression and some experimental design models. The text uses the response plot to visualize the model and to detect outliers, does not assume that the error distribution has a known parametric distribution, develops prediction intervals that work when the error distribution is unknown, suggests bootstrap hypothesis tests that may be useful for inference after variable selection, and develops prediction regions and large sample theory for the multivariate linear regression model that has m response variables. A relationship between multivariate prediction regions and confidence regions provides a simple way to bootstrap confidence regions. These confidence regions often provide a practical method for testing hypotheses. There is also a chapter on generalized linear models and generalized additive models. There are many R functions to produce response and residual plots, to simulate prediction intervals and hypothesis tests, to detect outliers, and to choose response trans...

  6. Linear Colliders

    Alcaraz, J.

    2001-01-01

    After several years of study e''+ e''- linear colliders in the TeV range have emerged as the major and optimal high-energy physics projects for the post-LHC era. These notes summarize the present status form the main accelerator and detector features to their physics potential. The LHC era. These notes summarize the present status, from the main accelerator and detector features to their physics potential. The LHC is expected to provide first discoveries in the new energy domain, whereas an e''+ e''- linear collider in the 500 GeV-1 TeV will be able to complement it to an unprecedented level of precision in any possible areas: Higgs, signals beyond the SM and electroweak measurements. It is evident that the Linear Collider program will constitute a major step in the understanding of the nature of the new physics beyond the Standard Model. (Author) 22 refs

  7. Linear algebra

    Edwards, Harold M

    1995-01-01

    In his new undergraduate textbook, Harold M Edwards proposes a radically new and thoroughly algorithmic approach to linear algebra Originally inspired by the constructive philosophy of mathematics championed in the 19th century by Leopold Kronecker, the approach is well suited to students in the computer-dominated late 20th century Each proof is an algorithm described in English that can be translated into the computer language the class is using and put to work solving problems and generating new examples, making the study of linear algebra a truly interactive experience Designed for a one-semester course, this text adopts an algorithmic approach to linear algebra giving the student many examples to work through and copious exercises to test their skills and extend their knowledge of the subject Students at all levels will find much interactive instruction in this text while teachers will find stimulating examples and methods of approach to the subject

  8. Maximum penetration level of distributed generation without violating voltage limits

    Morren, J.; Haan, de S.W.H.

    2009-01-01

    Connection of Distributed Generation (DG) units to a distribution network will result in a local voltage increase. As there will be a maximum on the allowable voltage increase, this will limit the maximum allowable penetration level of DG. By reactive power compensation (by the DG unit itself) a

  9. Voltage scheduling for low power/energy

    Manzak, Ali

    2001-07-01

    Power considerations have become an increasingly dominant factor in the design of both portable and desk-top systems. An effective way to reduce power consumption is to lower the supply voltage since voltage is quadratically related to power. This dissertation considers the problem of lowering the supply voltage at (i) the system level and at (ii) the behavioral level. At the system level, the voltage of the variable voltage processor is dynamically changed with the work load. Processors with limited sized buffers as well as those with very large buffers are considered. Given the task arrival times, deadline times, execution times, periods and switching activities, task scheduling algorithms that minimize energy or peak power are developed for the processors equipped with very large buffers. A relation between the operating voltages of the tasks for minimum energy/power is determined using the Lagrange multiplier method, and an iterative algorithm that utilizes this relation is developed. Experimental results show that the voltage assignment obtained by the proposed algorithm is very close (0.1% error) to that of the optimal energy assignment and the optimal peak power (1% error) assignment. Next, on-line and off-fine minimum energy task scheduling algorithms are developed for processors with limited sized buffers. These algorithms have polynomial time complexity and present optimal (off-line) and close-to-optimal (on-line) solutions. A procedure to calculate the minimum buffer size given information about the size of the task (maximum, minimum), execution time (best case, worst case) and deadlines is also presented. At the behavioral level, resources operating at multiple voltages are used to minimize power while maintaining the throughput. Such a scheme has the advantage of allowing modules on the critical paths to be assigned to the highest voltage levels (thus meeting the required timing constraints) while allowing modules on non-critical paths to be assigned

  10. A high-voltage equipment (high voltage supply, high voltage pulse generators, resonant charging inductance, synchro-instruments for gyrotron frequency measurements) for plasma applications

    Spassov, Velin

    1996-01-01

    This document reports my activities as visitor-professor at the Gyrotron Project - INPE Plasma Laboratory. The main objective of my activities was designing, construction and testing a suitable high-voltage pulse generator for plasma applications, and efforts were concentrated on the following points: Design of high-voltage resonant power supply with tunable output (0 - 50 kV) for line-type high voltage pulse generator; design of line-type pulse generator (4 microseconds pulse duration, 0 - 25 kV tunable voltage) for non linear loads such as a gyrotron and P III reactor; design of resonant charging inductance for resonant line-type pulse generator, and design of high resolution synchro instrument for gyrotron frequency measurement. (author)

  11. Effect of Anode Floating Voltage and its Applications in Characterizing Silicon Drift Detectors

    Guang-Guo, Wu; Hong-Ri, Li; Kun, Liang; Ru, Yang; De-Jun, Han; Xue-Lei, Cao; Huan-Yu, Wang; Jun-Ming, An; Xiong-Wei, Hu

    2009-01-01

    Anode Boating voltage is predicted and investigated for silicon drift detectors (SDDs) with an active area of 5 mm 2 fabricated by a double-side parallel technology. It is demonstrated that the anode Boating voltage increases with the increasing inner ring voltage, and is almost unchanged with the external ring voltage. The anode Boating voltage will not be affected by the back electrode biased voltage until it reaches the full-depleted voltage (−50 V) of the SDD. Theoretical analysis and experimental results show that the anode Boating voltage is equal to the sum of the inner ring voltage and the built-in potential between the p + inner ring and the n + anode. A fast checking method before detector encapsulation is proposed by employing the anode Boating voltage along with checking the leakage current, potential distribution and drift properties

  12. Increasing Teachers' Workloads in the Form of Quantitative Expansion in Extracurricular Activities: Aggregated Data Analysis of Past Working Hours Using a General Linear Model

    Kanbayashi, Toshiyuki

    2016-01-01

    In recent years, teachers' increased workloads have become an issue for policy, and have been multiply pointed out, deriving as they do from peripheral duties such as paperwork, in academic research as well. However, these mentions have not been based on sufficiently solid proof. Here, this paper compares teacher working hours surveys extant from…

  13. Passive longitudinal phase space linearizer

    P. Craievich

    2010-03-01

    Full Text Available We report on the possibility to passively linearize the bunch compression process in electron linacs for the next generation x-ray free electron lasers. This can be done by using the monopole wakefields in a dielectric-lined waveguide. The optimum longitudinal voltage loss over the length of the bunch is calculated in order to compensate both the second-order rf time curvature and the second-order momentum compaction terms. Thus, the longitudinal phase space after the compression process is linearized up to a fourth-order term introduced by the convolution between the bunch and the monopole wake function.

  14. Radiation effects on residual voltage of polyethylene films

    Kyokane, Jun; Park, Dae-Hee; Yoshino, Katsumi.

    1986-01-01

    It has recently been pointed out that diagnosis of deterioration in insulating materials for electric cables used in nuclear power plants and outer space (communications satellite in particular) can be effectively performed based on measurements of residual voltage. In the present study, polyethylene films are irradiated with γ-rays or electron beam to examine the changes in residual voltage characteristics. Irradiation of electron beam and γ-rays are carried out to a dose of 0 - 90 Mrad and 0 - 100 Mrad, respectively. Measurements are made of the dependence of residual voltage on applied voltage, electron beam and γ-ray irradiation, annealing temperature and annealing time. Results show that carriers, which are once trapped after being released from the electrode, move within the material after the opening of the circuit to produce resiual voltage. The residual voltage increases with increasing dose of electron beam or γ-ray and levels off at high dose. Residual voltage is increased about several times by either electron beam or γ-rays, but electron beam tends to cause greater residual voltage than γ-ray. Polyethylene films irradiated with electron beam can recover upon annealing. It is concluded from observations made that residual voltage has close relations with defects in molecular structures caused by radiations, particularly the breaking of backbone chains and alteration in superstructures. (Nogami, K.)

  15. Evaluation of the Voltage Support Strategies for the Low Voltage Grid Connected PV

    Demirok, Erhan; Sera, Dezso; Teodorescu, Remus

    2010-01-01

    Admissible range of grid voltage is one of the strictest constraints for the penetration of distributed photovoltaic (PV) generators especially connection to low voltage (LV) public networks. Voltage limits are usually fulfilled either by network reinforcements or limiting of power injections from...... PVs. In order to increase PV penetration level further, new voltage support control functions for individual inverters are required. This paper investigates distributed reactive power regulation and active power curtailment strategies regarding the development of PV connection capacity by evaluation...... of reactive power efforts and requirement of minimum active power curtailment. Furthermore, a small scale experimental setup is built to reflect real grid interaction in the laboratory by achieving critical types of grid (weak and sufficiently stiff)....

  16. A high linearity current mode second IF CMOS mixer for a DRM/DAB receiver

    Xu Jian; Zhou Zheng; Wu Yiqiang; Wang Zhigong; Chen Jianping

    2015-01-01

    A passive current switch mixer was designed for the second IF down-conversion in a DRM/DAB receiver. The circuit consists of an input transconductance stage, a passive current switching stage, and a current amplifier stage. The input transconductance stage employs a self-biasing current reusing technique, with a resistor shunt feedback to increase the gain and output impedance. A dynamic bias technique is used in the switching stage to ensure the stability of the overdrive voltage versus the PVT variations. A current shunt feedback is introduced to the conventional low-voltage second-generation fully balanced multi-output current converter (FBMOCCII), which provides very low input impedance and high output impedance. With the circuit working in current mode, the linearity is effectively improved with low supply voltages. Especially, the transimpedance stage can be removed, which simplifies the design considerably. The design is verified with a SMIC 0.18 μm RF CMOS process. The measurement results show that the voltage conversation gain is 1.407 dB, the NF is 16.22 dB, and the IIP3 is 4.5 dBm, respectively. The current consumption is 9.30 mA with a supply voltage of 1.8 V. This exhibits a good compromise among the gain, noise, and linearity for the second IF mixer in DRM/DAB receivers. (paper)

  17. Cooperative Control with Virtual Selective Harmonic Capacitance for Harmonic Voltage Compensation in Islanded MicroGrids

    Micallef, A.; Apap, M.; Spitero-Stanies, C.

    2012-01-01

    This paper focuses on the islanded operation of microgrids. In this mode of operation, the microsources are required to cooperate autonomously to regulate the local grid voltage and frequency. Droop control is typically used to achieve this autonomous voltage and frequency regulation. Inverters...... having LCL output filters would cause voltage distortion to be present at the PCC of the local load when non-linear current is supplied to the load due to the voltage drop across the grid side inductor. Techniques to reduce the output voltage distortion typically consist of installing either passive...

  18. High voltage isolation transformer

    Clatterbuck, C. H.; Ruitberg, A. P. (Inventor)

    1985-01-01

    A high voltage isolation transformer is provided with primary and secondary coils separated by discrete electrostatic shields from the surfaces of insulating spools on which the coils are wound. The electrostatic shields are formed by coatings of a compound with a low electrical conductivity which completely encase the coils and adhere to the surfaces of the insulating spools adjacent to the coils. Coatings of the compound also line axial bores of the spools, thereby forming electrostatic shields separating the spools from legs of a ferromagnetic core extending through the bores. The transformer is able to isolate a high constant potential applied to one of its coils, without the occurrence of sparking or corona, by coupling the coatings, lining the axial bores to the ferromagnetic core and by coupling one terminal of each coil to the respective coating encasing the coil.

  19. Linear particle accelerator

    Richards, J.A.

    1977-01-01

    A linear particle accelerator which provides a pulsed beam of charged particles of uniform energy is described. The accelerator is in the form of an evacuated dielectric tube, inside of which a particle source is located at one end of the tube, with a target or window located at the other end of the dielectric tube. Along the length of the tube are externally located pairs of metal plates, each insulated from each other in an insulated housing. Each of the plates of a pair are connected to an electrical source of voltage of opposed polarity, with the polarity of the voltage of the plates oriented so that the plate of a pair, nearer to the particle source, is of the opposed polarity to the charge of the particle emitted by the source. Thus, a first plate about the tube located nearest the particle source, attracts a particle which as it passes through the tube past the first plate is then repelled by the reverse polarity of the second plate of the pair to continue moving towards the target

  20. A two-layer linear piezoelectric micromotor.

    Li, Xiaotian; Ci, Penghong; Liu, Guoxi; Dong, Shuxiang

    2015-03-01

    A first bending (B1) mode two-layer piezoelectric ultrasonic linear micromotor has been developed for microoptics driving applications. The piezo-vibrator of the micromotor was composed of two small Pb(Zr,Ti)O3 (PZT-5) plates, with overall dimensions and mass of only 2.0 × 2.0 × 5.0 mm(3) and 0.2 g, respectively. The proposed micromotor could operate either in single-phase voltage (standing wave) mode or two-phase voltage (traveling wave) mode to drive a slider via friction force to provide bidirectional linear motion. A large thrust of up to 0.30 N, which corresponds to a high unit volume direct driving force of 15 mN/mm(3), and a linear movement velocity of up to 230 mm/s were obtained under an applied voltage of 80 Vpp at the B1 mode resonance frequency of 174 kHz.

  1. Optimal dynamic voltage scaling for wireless sensor nodes with real-time constraints

    Cassandras, Christos G.; Zhuang, Shixin

    2005-11-01

    Sensors are increasingly embedded in manufacturing systems and wirelessly networked to monitor and manage operations ranging from process and inventory control to tracking equipment and even post-manufacturing product monitoring. In building such sensor networks, a critical issue is the limited and hard to replenish energy in the devices involved. Dynamic voltage scaling is a technique that controls the operating voltage of a processor to provide desired performance while conserving energy and prolonging the overall network's lifetime. We consider such power-limited devices processing time-critical tasks which are non-preemptive, aperiodic and have uncertain arrival times. We treat voltage scaling as a dynamic optimization problem whose objective is to minimize energy consumption subject to hard or soft real-time execution constraints. In the case of hard constraints, we build on prior work (which engages a voltage scaling controller at task completion times) by developing an intra-task controller that acts at all arrival times of incoming tasks. We show that this optimization problem can be decomposed into two simpler ones whose solution leads to an algorithm that does not actually require solving any nonlinear programming problems. In the case of soft constraints, this decomposition must be partly relaxed, but it still leads to a scalable (linear in the number of tasks) algorithm. Simulation results are provided to illustrate performance improvements in systems with intra-task controllers compared to uncontrolled systems or those using inter-task control.

  2. High voltage switches having one or more floating conductor layers

    Werne, Roger W.; Sampayan, Stephen; Harris, John Richardson

    2015-11-24

    This patent document discloses high voltage switches that include one or more electrically floating conductor layers that are isolated from one another in the dielectric medium between the top and bottom switch electrodes. The presence of the one or more electrically floating conductor layers between the top and bottom switch electrodes allow the dielectric medium between the top and bottom switch electrodes to exhibit a higher breakdown voltage than the breakdown voltage when the one or more electrically floating conductor layers are not present between the top and bottom switch electrodes. This increased breakdown voltage in the presence of one or more electrically floating conductor layers in a dielectric medium enables the switch to supply a higher voltage for various high voltage circuits and electric systems.

  3. Linear programming

    Karloff, Howard

    1991-01-01

    To this reviewer’s knowledge, this is the first book accessible to the upper division undergraduate or beginning graduate student that surveys linear programming from the Simplex Method…via the Ellipsoid algorithm to Karmarkar’s algorithm. Moreover, its point of view is algorithmic and thus it provides both a history and a case history of work in complexity theory. The presentation is admirable; Karloff's style is informal (even humorous at times) without sacrificing anything necessary for understanding. Diagrams (including horizontal brackets that group terms) aid in providing clarity. The end-of-chapter notes are helpful...Recommended highly for acquisition, since it is not only a textbook, but can also be used for independent reading and study. —Choice Reviews The reader will be well served by reading the monograph from cover to cover. The author succeeds in providing a concise, readable, understandable introduction to modern linear programming. —Mathematics of Computing This is a textbook intend...

  4. Wide Operating Voltage Range Fuel Cell Battery Charger

    Hernandez Botella, Juan Carlos; Mira Albert, Maria del Carmen; Sen, Gokhan

    2014-01-01

    DC-DC converters for fuel cell applications require wide voltage range operation due to the unique fuel cell characteristic curve. Primary parallel isolated boost converter (PPIBC) is a boost derived topology for low voltage high current applications reaching an efficiency figure up to 98...... by two the converter input-to-output voltage gain. This allows covering the conditions when the fuel cell stack operates in the activation region (maximum output voltage) and increases the degrees of freedom for converter optimization. The transition between operating modes is studied because represents...

  5. Performance improvement of a slip energy recovery drive system by a voltage-controlled technique

    Tunyasrirut, Satean [Department of Instrumentation Engineering, Faculty of Engineering, Pathumwan Institute of Technology, 833 Rama1 Road, Pathumwan, Bangkok 10330 (Thailand); Kinnares, Vijit [Department of Electrical Engineering, Faculty of Engineering, King Mongkut' s Institute of Technology Ladkrabang, Bangkok 10520 (Thailand); Ngamwiwit, Jongkol [Department of Control Engineering, Faculty of Engineering, King Mongkut' s Institute of Technology Ladkrabang, Bangkok 10520 (Thailand)

    2010-10-15

    This paper introduces the performance improvement of a slip energy recovery drive system for the speed control of a wound rotor induction motor by a voltage-controlled technique. The slip energy occurred in the rotor circuit is transferred back to ac mains supply through a reactor instead of a step up transformer. The objective of the voltage-controlled technique is to increase power factor of the system and to reduce low order harmonics of the input line current. The drive system is designed and implemented using a voltage source inverter in conjunction with a boost chopper for DC link voltage, instead of a conventional drive using a 6 pulse converter or a Scherbius system. The slip power is recovered by the help of a voltage source inverter (VSI) based on a space vector pulse width modulation (SVPWM) technique. In order to keep the speed of the wound rotor induction motor constant over a certain range of operating conditions, the servo state feedback controller designed by a linear quadratic regulator (LQR) is also introduced in this paper. The overall control system is implemented on DSP, DS1104'TMS320F240 controller board. The performance improvement of the proposed system is tested in comparison with the conventional Scherbius system and the modified conventional Scherbius system by a 12 pulse converter in conjunction with a chopper at steady state and at dynamic conditions. A 220 W wound motor is employed for testing. It is found that the motor speed can be controlled to be constant in the operating range of 450-1200 rpm at no load and full load. It is also found that the efficiency of the proposed system is remarkably increased since the harmonics of the input ac line current is reduced while the ac line input power factor is increased. (author)

  6. Pulse-voltage fast generator

    Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.

    1988-01-01

    The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns

  7. Recursive Algorithm For Linear Regression

    Varanasi, S. V.

    1988-01-01

    Order of model determined easily. Linear-regression algorithhm includes recursive equations for coefficients of model of increased order. Algorithm eliminates duplicative calculations, facilitates search for minimum order of linear-regression model fitting set of data satisfactory.

  8. Temporary over voltages in the high voltage networks

    Vukelja, Petar; Naumov, Radomir; Mrvic, Jovan; Minovski, Risto

    2001-01-01

    The paper treats the temporary over voltages that may arise in the high voltage networks as a result of: ground faults, loss of load, loss of one or two phases and switching operation. Based on the analysis, the measures for their limitation are proposed. (Original)

  9. Energy Storage Characteristic Analysis of Voltage Sags Compensation for UPQC Based on MMC for Medium Voltage Distribution System

    Yongchun Yang

    2018-04-01

    Full Text Available The modular multilevel converter (MMC, as a new type of voltage source converter, is increasingly used because it is a distributed storage system. There are many advantages of using the topological structure of the MMC on a unified power quality controller (UPQC, and voltage sag mitigation is an important use of the MMC energy storage system for the power quality compensation process. In this paper, based on the analysis of the topology of the MMC, the essence of energy conversion in a UPQC of voltage sag compensation is analyzed; then, the energy storage characteristics are calculated and analyzed to determine the performance index of voltage sag compensation; in addition, the simulation method is used to verify the voltage sag compensation characteristics of the UPQC; finally, an industrial prototype of the UPQC based on an MMC for 10 kV of medium voltage distribution network has been developed, and the basic functions of UPQC have been tested.

  10. DC-Voltage Fluctuation Elimination Through a DC-Capacitor Current Control for DFIG Converters Under Unbalanced Grid Voltage Conditions

    Liu, Changjin; Xu, Dehong; Zhu, Nan

    2013-01-01

    Unbalanced grid voltage causes a large second-order harmonic current in the dc-link capacitors as well as dc-voltage fluctuation, which potentially will degrade the lifespan and reliability of the capacitors in voltage source converters. This paper proposes a novel dc-capacitor current control...... method for a grid-side converter (GSC) to eliminate the negative impact of unbalanced grid voltage on the dc-capacitors. In this method, a dc-capacitor current control loop, where a negative-sequence resonant controller is used to increase the loop gain, is added to the conventional GSC current control...... loop. The rejection capability to the unbalanced grid voltage and the stability of the proposed control system are discussed. The second-order harmonic current in the dc capacitor as well as dc-voltage fluctuation is very well eliminated. Hence, the dc capacitors will be more reliable under unbalanced...

  11. Flying capacitor resonant pole inverter applying five voltage levels

    Settels, S.J.

    2017-01-01

    Industrial applications, e.g. semiconductor manufacturing equipment, require power amplifiers providing high power with high precision and bandwidth. Due to limitations in system infrastructure, increasing voltage is favorable to increasing current to generate more output power. This research

  12. The Design and Characterization of a Prototype Wideband Voltage Sensor Based on a Resistive Divider.

    Garnacho, Fernando; Khamlichi, Abderrahim; Rovira, Jorge

    2017-11-17

    The most important advantage of voltage dividers over traditional voltage transformers is that voltage dividers do not have an iron core with non-linear hysteresis characteristics. The voltage dividers have a linear behavior with respect to over-voltages and a flat frequency response larger frequency range. The weak point of a voltage divider is the influence of external high-voltage (HV) and earth parts in its vicinity. Electrical fields arising from high voltages in neighboring phases and from ground conductors and structures are one of their main sources for systematic measurement errors. This paper describes a shielding voltage divider for a 24 kV medium voltage network insulated in SF6 composed of two resistive-capacitive dividers, one integrated within the other, achieving a flat frequency response up to 10 kHz for ratio error and up to 5 kHz for phase displacement error. The metal shielding improves its immunity against electric and magnetic fields. The characterization performed on the built-in voltage sensor shows an accuracy class of 0.2 for a frequency range from 20 Hz to 5 kHz and a class of 0.5 for 1 Hz up to 20 Hz. A low temperature effect is also achieved for operation conditions of MV power grids.

  13. Harmonic current interaction at a low voltage customer's installations

    Bhattacharyya, S.; Myrzik, J.M.A.; Kling, W.L.; Cobben, J.F.G.; Casteren, van J.

    2009-01-01

    The increased uses of power electronics and switching devices in the electricity network have changed the operational environment of the power system. These devices have nonlinear voltage-current characteristics and produce harmonic currents, and consequently distort the voltage waveform. A low

  14. High Efficiency Power Converter for Low Voltage High Power Applications

    Nymand, Morten

    The topic of this thesis is the design of high efficiency power electronic dc-to-dc converters for high-power, low-input-voltage to high-output-voltage applications. These converters are increasingly required for emerging sustainable energy systems such as fuel cell, battery or photo voltaic based...

  15. Variation of microchannel plate resistance with temperature and applied voltage

    Pearson, J.F.; Fraser, G.W.; Whiteley, M.J.

    1987-01-01

    The resistance of microchannel plate electron multiplier is well known to be a function of both applied voltage and detector temperature. We show that the apparent variation of resistance with bias voltage is simply due to plate temperature increases resulting from resistive heating. (orig.)

  16. Ceramic capacitor insulation resistance failures accelerated by low voltage

    Brennan, T. F.

    1978-01-01

    Ceramic capacitors failed insulation resistance testing at less than one-tenth their rated voltage. Many failures recovered as the voltage was increased. Comprehensive failure analysis techniques, some of which are unprecedented, were used to examine these failures. It was determined that there was more than one failure mechanism, and the results indicate a need for special additional screening.

  17. Loss Minimization and Voltage Control in Smart Distribution Grid

    Juelsgaard, Morten; Sloth, Christoffer; Wisniewski, Rafal

    2014-01-01

    This work presents a strategy for increasing the installation of electric vehicles and solar panels in low-voltage grids, while obeying voltage variation constraints. Our approach employs minimization of active power losses for coordinating consumption and generation of power, as well as reactive...

  18. On the Response of Interleaved Transformer Windings to Surge Voltages

    Pedersen, A.

    1963-01-01

    The high series capacitance theory for the response of interleaved transformer windings to surge voltages is criticized from the point of view that an increased series capacitance as a result of interleaving is incompatible with the concept of a pure capacitive initial voltage distribution. A new...

  19. Dual voltage source inverter topology extending machine operating range

    Gerrits, T.; Wijnands, C.G.E.; Paulides, J.J.H.; Duarte, J.L.

    2012-01-01

    Field weakening operation of an electrical machine is a conventional method to extend the angular velocity range of a system above the peak output voltage of the inverter. A downside, however, is that an increased reactive current is required that creates losses but no output torque. A dual voltage

  20. A voltage to frequency converter for astronomical photometry

    Dunham, E.; Elliot, J. L.

    1978-01-01

    A voltage to frequency converter (VFC) for general use with photomultipliers is described. For high light levels, when the dead-time corrections for a photon counter would be excessive, the VFC maintains a linear response and allows the recording of data at high time resolution. Results of laboratory tests are given for the signal-to-noise characteristics, linearity, stability, and transient response of the VFC when used in conjunction with EMI 9658 and RCA C31034 photomultipliers.

  1. New method for determining avalanche breakdown voltage of silicon photomultipliers

    Chirikov-Zorin, I.

    2017-01-01

    The avalanche breakdown and Geiger mode of the silicon p-n junction is considered. A precise physically motivated method is proposed for determining the avalanche breakdown voltage of silicon photomultipliers (SiPM). The method is based on measuring the dependence of the relative photon detection efficiency (PDE rel ) on the bias voltage when one type of carriers (electron or hole) is injected into the avalanche multiplication zone of the p-n junction. The injection of electrons or holes from the base region of the SiPM semiconductor structure is performed using short-wave or long-wave light. At a low overvoltage (1-2 V) the detection efficiency is linearly dependent on the bias voltage; therefore, extrapolation to zero PDE rel value determines the SiPM avalanche breakdown voltage with an accuracy within a few millivolts. [ru

  2. Voltage-carrying states in superconducting microstrips

    Stuivinga, M.E.C.

    1983-01-01

    When the critical current is exceeded in a superconducting microstrip, voltage-carrying states with a resistance significantly below the normal state resistance can occur. Phase-slip centers (PSC) appear at about the critical temperature. These are successive local voltage units which manifest themselves as strip-like increments in voltage in the I-V characteristic. For temperatures off the critical temperature the PSC regime degenerates into a region of normal material, a so-called hot spot. These two phenomena, PSC and hot spots, form the subject of this thesis. To gain a better understanding of the phase-slip center process, an experiment was designed to measure local values of the quasi-particle and pair potential. The results of local potential and gap measurements at a PSC in aluminium are presented and discussed. Special attention is paid to pair-breaking interactions which can shorten the relaxation time. A non-linear differential equation is derived which describes the development of a PSC into a normal hot spot under the influence of Joule heating. It incorporates the temperature rise due to the dissipative processes occurring in the charge imbalance tails. Numerical solutions are presented for a set of parameters, including those for aluminium and tin. Subsequently, they are compared with experiments. (Auth.)

  3. Effects of Linear Falling Ramp Reset Pulse on Addressing Operation in AC PDP

    Liu Zujun; Liang Zhihu; Liu Chunliang; Meng Lingguo

    2006-01-01

    The effects of linear falling ramp reset pulse related to addressing operation in an alternating current plasma display panel (AC PDP) were studied. The wall charge waveforms were measured by the electrode balance method in a 12-inch coplanar AC PDP. The wall charge waveforms show the relationship between the slope ratio of the falling ramp reset pulse and the wall charges at the end of the falling ramp reset pulse which influences the addressing stability. Then the effects of the slope ratio of the linear falling ramp reset pulse on the addressing voltage and addressing time were investigated. The experimental results show that the minimum addressing voltage increases with the increase of the slope ratio of the falling ramp reset pulse, and so does the minimum addressing time. Based on the experimental results, the optimization of the addressing time and the slope ratio of the falling ramp pulse is discussed

  4. Small Distributed Renewable Energy Generation for Low Voltage Distribution Networks

    Chindris M.

    2016-08-01

    Full Text Available Driven by the existing energy policies, the use of renewable energy has increased considerably all over the world in order to respond to the increasing energy consumption and to reduce the environmental impact of the electricity generation. Although most policy makers and companies are focusing on large applications, the use of cheap small generation units, based on local renewable resources, has become increasingly attractive for the general public, small farms and remote communities. The paper presents several results of a research project aiming to identify the power quality issues and the impact of RES based distributed generation (DG or other non-linear loads on low voltage (LV distribution networks in Romania; the final goal is to develop a Universal Power Quality Conditioner (UPQC able to diminish the existing disturbances. Basically, the work analyses the existing DG technologies and identifies possible solutions for their integration in Romania; taking into account the existent state of the art, the attention was paid on small systems, using wind and solar energy, and on possibility to integrate them into suburban and rural LV distribution networks. The presence of DG units at distribution voltage level means the transition from traditional passive to active distribution networks. In general, the relatively low penetration levels of DG does not produce problems; however, the nowadays massive increase of local power generation have led to new integration challenges in order to ensure the reliability and quality of the power supply. Power quality issues are identified and their assessment is the key element in the design of measures aiming to diminish all existing disturbances.

  5. Computer controlled high voltage system

    Kunov, B; Georgiev, G; Dimitrov, L [and others

    1996-12-31

    A multichannel computer controlled high-voltage power supply system is developed. The basic technical parameters of the system are: output voltage -100-3000 V, output current - 0-3 mA, maximum number of channels in one crate - 78. 3 refs.

  6. A Voltage Quality Detection Method

    Chen, Zhe; Wei, Mu

    2008-01-01

    This paper presents a voltage quality detection method based on a phase-locked loop (PLL) technique. The technique can detect the voltage magnitude and phase angle of each individual phase under both normal and fault power system conditions. The proposed method has the potential to evaluate various...

  7. Linearity correction device for a scintillation camera

    Lange, Kai

    1978-06-16

    This invention concerns the scintillation cameras still called gamma ray camera. The invention particularly covers the improvement in the resolution and the uniformity of these cameras. Briefly, in the linearity correction device of the invention, the sum is made of the voltage signals of different amplitudes produced by the preamplifiers of all the photomultiplier tubes and the signal obtained is employed to generate bias voltages which represent predetermined percentages of the sum signal. In one design mode, pairs of transistors are blocked when the output signal of the corresponding preamplifier is under a certain point on its gain curve. When the summation of the energies of a given scintillation exceeds this level which corresponds to a first percentage of the total signal, the first transistor of each pair of each line is unblocked, thereby modifying the gain and curve slop. When the total energy of an event exceeds the next preset level, the second transistor is unblocked to alter the shape again, so much so that the curve shows two break points. If needs be, the device can be designed so as to obtain more break points for the increasingly higher levels of energy. Once the signals have been processed as described above, they may be used for calculating the co-ordinates of the scintillation by one of the conventional methods.

  8. Dual voltage power supply with 48 volt

    Froeschl, Joachim; Proebstle, Hartmut; Sirch, Ottmar [BMW Group, Muenchen (Germany)

    2012-11-01

    Automotive electrics/electronics have just reached a period of tremendous change. High voltage systems for Hybrid, Plug-In Hybrid or Battery Electric Vehicles with high power electric motors, high energy accumulators and electric climate compressors will be introduced in order to achieve the challenging targets for CO{sub 2} emissions and energy efficiency and to anticipate the mobility of the future. Additionally, innovations and the continuous increase of functionality for comfort, safety, driver assistance and infotainment systems require more and more electrical power of the vehicle power supply at all. On the one hand side electrified vehicles will certainly achieve a significant market share, on the other hand side they will increase the pressure to conventional vehicles with combustion engines for fuel consumption and CO{sub 2} emissions. These vehicles will be enabled to keep their competitiveness by new functions and the optimization of their electric systems. A dual voltage power supply with 48 Volt and 12 Volt will be one of the key technologies to realize these requirements. The power capability of the existing 12 Volt power supply has reached its limits. Further potentials can only be admitted by the introduction of 48 Volt. For this reason the car manufacturers Audi, BMW, Daimler, Porsche and Volkswagen started very early on this item and developed a common specification of the new voltage range. Now, it is necessary to identify the probable systems at this voltage range and to start the developments. (orig.)

  9. Transient voltage oscillations in coils

    Chowdhuri, P.

    1985-01-01

    Magnet coils may be excited into internal voltage oscillations by transient voltages. Such oscillations may electrically stress the magnet's dielectric components to many times its normal stress. This may precipitate a dielectric failure, and the attendant prolonged loss of service and costly repair work. Therefore, it is important to know the natural frequencies of oscillations of a magnet during the design stage, and to determine whether the expected switching transient voltages can excite the magnet into high-voltage internal oscillations. The series capacitance of a winding significantly affects its natural frequencies. However, the series capacitance is difficult to calculate, because it may comprise complex capacitance network, consisting of intra- and inter-coil turn-to-turn capacitances of the coil sections. A method of calculating the series capacitance of a winding is proposed. This method is rigorous but simple to execute. The time-varying transient voltages along the winding are also calculated

  10. Experimental research for vacuum gap breakdown in high voltage multi-pulse

    Huang Ziping; He Jialong; Chen Sifu; Deng Jianjun; Wang Liping

    2008-01-01

    Base on the breakdown theory of vacuum gaps, experiments have been done to find out the breakdown electric field intensities in high voltage single-and triple-pulse for 26 vacuum gaps with different shapes. The experimental results match up to the theory and confirm the effect of the pulse-number increase on the breakdown electric field intensity. The key point to decide the macroscopical breakdown electric field intensity of a vacuum gap has been pointed out with some advises about the design of a multi-pulse linear inductive accelerator's accelerate gap. (authors)

  11. Reduction of Linear Programming to Linear Approximation

    Vaserstein, Leonid N.

    2006-01-01

    It is well known that every Chebyshev linear approximation problem can be reduced to a linear program. In this paper we show that conversely every linear program can be reduced to a Chebyshev linear approximation problem.

  12. Bio-Inspired Carbon Monoxide Sensors with Voltage-Activated Sensitivity

    Savagatrup, Suchol; Schroeder, Vera; He, Xin; Lin, Sibo; He, Maggie; Yassine, Omar; Salama, Khaled N.; Zhang, Xixiang; Swager, Timothy M.

    2017-01-01

    voltage offers a predicted extra dimension for sensing. Specifically, the sensors show a significant increase in sensitivity toward CO when negative gate voltage is applied. The dosimetric sensors are selective to ppm levels of CO and functional in air. UV

  13. Direct model-based predictive control scheme without cost function for voltage source inverters with reduced common-mode voltage

    Kim, Jae-Chang; Moon, Sung-Ki; Kwak, Sangshin

    2018-04-01

    This paper presents a direct model-based predictive control scheme for voltage source inverters (VSIs) with reduced common-mode voltages (CMVs). The developed method directly finds optimal vectors without using repetitive calculation of a cost function. To adjust output currents with the CMVs in the range of -Vdc/6 to +Vdc/6, the developed method uses voltage vectors, as finite control resources, excluding zero voltage vectors which produce the CMVs in the VSI within ±Vdc/2. In a model-based predictive control (MPC), not using zero voltage vectors increases the output current ripples and the current errors. To alleviate these problems, the developed method uses two non-zero voltage vectors in one sampling step. In addition, the voltage vectors scheduled to be used are directly selected at every sampling step once the developed method calculates the future reference voltage vector, saving the efforts of repeatedly calculating the cost function. And the two non-zero voltage vectors are optimally allocated to make the output current approach the reference current as close as possible. Thus, low CMV, rapid current-following capability and sufficient output current ripple performance are attained by the developed method. The results of a simulation and an experiment verify the effectiveness of the developed method.

  14. Non-linear thermal fluctuations in a diode

    Kampen, N.G. van

    As an example of non-linear noise the fluctuations in a circuit consisting of a diode and a condenser C are studied. From the master equation for this system the following results are derived. 1. (i) The equilibrium distribution of the voltage is rigorously Gaussian, the average voltage being

  15. Linear ubiquitination in immunity.

    Shimizu, Yutaka; Taraborrelli, Lucia; Walczak, Henning

    2015-07-01

    Linear ubiquitination is a post-translational protein modification recently discovered to be crucial for innate and adaptive immune signaling. The function of linear ubiquitin chains is regulated at multiple levels: generation, recognition, and removal. These chains are generated by the linear ubiquitin chain assembly complex (LUBAC), the only known ubiquitin E3 capable of forming the linear ubiquitin linkage de novo. LUBAC is not only relevant for activation of nuclear factor-κB (NF-κB) and mitogen-activated protein kinases (MAPKs) in various signaling pathways, but importantly, it also regulates cell death downstream of immune receptors capable of inducing this response. Recognition of the linear ubiquitin linkage is specifically mediated by certain ubiquitin receptors, which is crucial for translation into the intended signaling outputs. LUBAC deficiency results in attenuated gene activation and increased cell death, causing pathologic conditions in both, mice, and humans. Removal of ubiquitin chains is mediated by deubiquitinases (DUBs). Two of them, OTULIN and CYLD, are constitutively associated with LUBAC. Here, we review the current knowledge on linear ubiquitination in immune signaling pathways and the biochemical mechanisms as to how linear polyubiquitin exerts its functions distinctly from those of other ubiquitin linkage types. © 2015 The Authors. Immunological Reviews Published by John Wiley & Sons Ltd.

  16. Modification of Modulating Anode Voltage Supply of Klystron for PEFP 20 MeV Linac

    Kim, Dae Il; Kwon, Hyeok Jung; Kim, Han Sung; Cho, Yong Sub

    2011-01-01

    The klystron (TH2089F, THALES) for PEFP 20MeV proton linear accelerator has a triode type electron gun and the modulating anode voltage should be supplied. The klystron has gone through some modification in the modulating anode voltage supply circuit. Formerly, the mod-anode voltage was supplied by using the tetrode-controlled voltage divider. This system requires addition power supply for the tetrode and the grid control circuit. Recently we modified the mod-anode supply from the tetrode-controlled voltage divider to a resistive voltage divider. The resistors for the previous voltage divider were installed at a supporter with high voltage bushing structure next to the klystron. In the previous system, the resistors were exposed to the air and their size was very bulky, length of which was about 1m long. To reduce the space occupied by the voltage divider and to improve the electrical insulation performance, the voltage dividing resistors were moved into the oil tank of the klystron. During the operation of the 20 MeV linac, the klystron parameters were measured. In this paper, the modification of the voltage divider and the operational characteristics of the klystron with modified voltage divider circuit are presented

  17. High-temperature performance of MoS{sub 2} thin-film transistors: Direct current and pulse current-voltage characteristics

    Jiang, C.; Samnakay, R.; Balandin, A. A., E-mail: balandin@ee.ucr.edu [Nano-Device Laboratory (NDL), Department of Electrical Engineering, Bourns College of Engineering, University of California—Riverside, Riverside, California 92521 (United States); Phonon Optimized Engineered Materials (POEM) Center, Materials Science and Engineering Program, University of California—Riverside, Riverside, California 92521 (United States); Rumyantsev, S. L. [Department of Electrical, Computer, and Systems Engineering, Center for Integrated Electronics, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States); Ioffe Physical-Technical Institute, St. Petersburg 194021 (Russian Federation); Shur, M. S. [Department of Electrical, Computer, and Systems Engineering, Center for Integrated Electronics, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States)

    2015-02-14

    We report on fabrication of MoS{sub 2} thin-film transistors (TFTs) and experimental investigations of their high-temperature current-voltage characteristics. The measurements show that MoS{sub 2} devices remain functional to temperatures of at least as high as 500 K. The temperature increase results in decreased threshold voltage and mobility. The comparison of the direct current (DC) and pulse measurements shows that the direct current sub-linear and super-linear output characteristics of MoS{sub 2} thin-films devices result from the Joule heating and the interplay of the threshold voltage and mobility temperature dependences. At temperatures above 450 K, a kink in the drain current occurs at zero gate voltage irrespective of the threshold voltage value. This intriguing phenomenon, referred to as a “memory step,” was attributed to the slow relaxation processes in thin films similar to those in graphene and electron glasses. The fabricated MoS{sub 2} thin-film transistors demonstrated stable operation after two months of aging. The obtained results suggest new applications for MoS{sub 2} thin-film transistors in extreme-temperature electronics and sensors.

  18. Equilibrium fluctuation relations for voltage coupling in membrane proteins.

    Kim, Ilsoo; Warshel, Arieh

    2015-11-01

    A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free

  19. Templates for Linear Algebra Problems

    Bai, Z.; Day, D.; Demmel, J.; Dongarra, J.; Gu, M.; Ruhe, A.; Vorst, H.A. van der

    1995-01-01

    The increasing availability of advanced-architecture computers is having a very signicant eect on all spheres of scientic computation, including algorithm research and software development in numerical linear algebra. Linear algebra {in particular, the solution of linear systems of equations and

  20. Illumination and Voltage Dependence of Electrical Characteristics of Au/0.03 Graphene-Doped PVA/n-Si Structures via Capacitance/Conductance-Voltage Measurements

    Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu

    2015-01-01

    Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)

  1. A Hybrid Optimization Method for Reactive Power and Voltage Control Considering Power Loss Minimization

    Liu, Chengxi; Qin, Nan; Bak, Claus Leth

    2015-01-01

    This paper proposes a hybrid optimization method to optimally control the voltage and reactive power with minimum power loss in transmission grid. This approach is used for the Danish automatic voltage control (AVC) system which is typically a non-linear non-convex problem mixed with both...

  2. Computation of Steady State Nodal Voltages for Fast Security Assessment in Power Systems

    Møller, Jakob Glarbo; Jóhannsson, Hjörtur; Østergaard, Jacob

    2014-01-01

    Development of a method for real-time assess-ment of post-contingency nodal voltages is introduced. Linear network theory is applied in an algorithm that utilizes Thevenin equivalent representation of power systems as seen from every voltage-controlled node in a network. The method is evaluated b...

  3. Nonlinear Parasitic Capacitance Modelling of High Voltage Power MOSFETs in Partial SOI Process

    Fan, Lin; Knott, Arnold; Jørgensen, Ivan Harald Holger

    2016-01-01

    : off-state, sub-threshold region, and on-state in the linear region. A high voltage power MOSFET is designed in a partial Silicon on Insulator (SOI) process, with the bulk as a separate terminal. 3D plots and contour plots of the capacitances versus bias voltages for the transistor summarize...

  4. High voltage pulse generator. [Patent application

    Fasching, G.E.

    1975-06-12

    An improved high-voltage pulse generator is described which is especially useful in ultrasonic testing of rock core samples. An N number of capacitors are charged in parallel to V volts and at the proper instance are coupled in series to produce a high-voltage pulse of N times V volts. Rapid switching of the capacitors from the paralleled charging configuration to the series discharging configuration is accomplished by using silicon-controlled rectifiers which are chain self-triggered following the initial triggering of the first rectifier connected between the first and second capacitors. A timing and triggering circuit is provided to properly synchronize triggering pulses to the first SCR at a time when the charging voltage is not being applied to the parallel-connected charging capacitors. The output voltage can be readily increased by adding additional charging networks. The circuit allows the peak level of the output to be easily varied over a wide range by using a variable autotransformer in the charging circuit.

  5. LOFT voltage insertion calibaration program

    Tillitt, D.N.; Miyasaki, F.S.

    1975-08-01

    The Loss-of-Fluid Test (LOFT) Facility is an experimental facility built around a ''scaled'' version of a large pressurized water reactor (LPWR). Part of this facility is the Data Acquisition and Visual Display System (DAVDS) as defined by the LOFT System Design Document SDD 1.4.2C. The DAVDS has a 702 data channel recording capability of which 548 are recorded digitally. The DAVDS also contains a Voltage Insertion Calibration Subsystem used to inject precise and known voltage steps into the recording systems. The computer program that controls the Voltage Insertion Calibration Subsystem is presented. 7 references. (auth)

  6. Power-MOSFET Voltage Regulator

    Miller, W. N.; Gray, O. E.

    1982-01-01

    Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.

  7. Non-sparking anodization process of AZ91D magnesium alloy under low AC voltage

    Li, Weiping; Li, Wen; Zhu, Liqun; Liu, Huicong; Wang, Xiaofang

    2013-01-01

    Highlights: ► Four different processes appear on magnesium alloys with applied voltage increase. ► Non-sparking film formation process occurred in the range of 6–10 V AC. ► The film was composed of Mg 2 SiO 4 with a stable growth rate in 30 min. ► Film growth was a balance of electrochemical dissolution and chemical deposition. -- Abstract: Anodization is widely recognized as one of the most important surface treatments for magnesium alloys. However, since high voltage oxidation films are limited in some applications due to porosity and brittleness, it is worthwhile to explore the non-sparking oxidizing process. In this work, AZ91D was electrochemically anodized at different AC voltages in an electrolyte containing 120 g/L NaOH and 80 g/L Na 2 SiO 3 ·9H 2 O. The effects of voltage on the surface morphology, composition and reaction process, especially the non-sparking discharge anodic film formation process, were investigated. The results showed that four different processes would appear according to the applied voltage variation from 6 V to 40 V, and that the non-sparking film formation process occurred in the range of 6–10 V. The film formed on the AZ91D surface under 10 V AC was mainly composed of Mg 2 SiO 4 with a lamellar structure. The horizontal and vertical expansion of the lamellar structure resulted in the formation of a multi-layered structure with a stable, linear growth rate for 30 min. The non-sparking film formation process can be considered to be the result of a balance of electrochemical dissolution and chemical deposition reaction

  8. Non-sparking anodization process of AZ91D magnesium alloy under low AC voltage

    Li, Weiping, E-mail: liweiping@buaa.edu.cn [Key Laboratory of Aerospace Materials and Performance (Ministry of Education), School of Materials Science and Engineering, Beihang University, Beijing 100191 (China); Li, Wen [AVIC Beijing Aeronautical Manufacturing Technology Research Institue, Beijing 100024 (China); Zhu, Liqun; Liu, Huicong; Wang, Xiaofang [Key Laboratory of Aerospace Materials and Performance (Ministry of Education), School of Materials Science and Engineering, Beihang University, Beijing 100191 (China)

    2013-04-20

    Highlights: ► Four different processes appear on magnesium alloys with applied voltage increase. ► Non-sparking film formation process occurred in the range of 6–10 V AC. ► The film was composed of Mg{sub 2}SiO{sub 4} with a stable growth rate in 30 min. ► Film growth was a balance of electrochemical dissolution and chemical deposition. -- Abstract: Anodization is widely recognized as one of the most important surface treatments for magnesium alloys. However, since high voltage oxidation films are limited in some applications due to porosity and brittleness, it is worthwhile to explore the non-sparking oxidizing process. In this work, AZ91D was electrochemically anodized at different AC voltages in an electrolyte containing 120 g/L NaOH and 80 g/L Na{sub 2}SiO{sub 3}·9H{sub 2}O. The effects of voltage on the surface morphology, composition and reaction process, especially the non-sparking discharge anodic film formation process, were investigated. The results showed that four different processes would appear according to the applied voltage variation from 6 V to 40 V, and that the non-sparking film formation process occurred in the range of 6–10 V. The film formed on the AZ91D surface under 10 V AC was mainly composed of Mg{sub 2}SiO{sub 4} with a lamellar structure. The horizontal and vertical expansion of the lamellar structure resulted in the formation of a multi-layered structure with a stable, linear growth rate for 30 min. The non-sparking film formation process can be considered to be the result of a balance of electrochemical dissolution and chemical deposition reaction.

  9. A High Power Linear Solid State Pulser

    Boris Yen; Brent Davis; Rex Booth

    1999-01-01

    Particle Accelerators require high voltage and often high power. Typically the high voltage/power generation utilizes a topology with an extra energy store and a switching means to extract that stored energy. The switches may be active or passive devices. Active switches are hard or soft vacuum tubes, or semiconductors. When required voltages exceed tens of kilovolts, numerous semiconductors are stacked to withstand that potential. Such topologies can use large numbers of critical parts that, when in series, compromise the system reliability and performance. This paper describes a modular, linear, solid state amplifier which uses a parallel array of semiconductors, coupled with transmission line transformers. Such a design can provide output signals with voltages exceeding 10kV (into 50-ohms), and with rise and fall times (10-90 % amplitude) that are less than 1--ns. This compact solid state amplifier is modular, and has both hot-swap and soft fail capabilities

  10. DC-link Voltage Control to Compensate Voltage Deviation for PV–BESSs Integrated System in Low-Voltage (LV Networks

    Lee Gyu-sub

    2016-01-01

    Full Text Available The exhaustion of fossil fuel and the greenhouse gas emission are one of the most significant energy and environmental issues, respectively. Photovoltaic (PV generators and battery energy storage systems (BESSs have been significantly increased for recent years. The BESSs are mainly used for smoothing active power fluctuation of the PV. In this paper, PV–BESSs integration of two DC/DC converters and one AC/DC converter is investigated and DC-link voltage control to compensate the AC voltage deviation is proposed for the PV‒BESS system in low-voltage (LV networks.

  11. Enhanced dielectric-wall linear accelerator

    Sampayan, Stephen E.; Caporaso, George J.; Kirbie, Hugh C.

    1998-01-01

    A dielectric-wall linear accelerator is enhanced by a high-voltage, fast e-time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators. A high voltage is placed between the electrodes sufficient to stress the voltage breakdown of the insulator on command. A light trigger, such as a laser, is focused along at least one line along the edge surface of the laminated alternating layers of isolated conductors and insulators extending between the electrodes. The laser is energized to initiate a surface breakdown by a fluence of photons, thus causing the electrical switch to close very promptly. Such insulators and lasers are incorporated in a dielectric wall linear accelerator with Blumlein modules, and phasing is controlled by adjusting the length of fiber optic cables that carry the laser light to the insulator surface.

  12. linear-quadratic-linear model

    Tanwiwat Jaikuna

    2017-02-01

    Full Text Available Purpose: To develop an in-house software program that is able to calculate and generate the biological dose distribution and biological dose volume histogram by physical dose conversion using the linear-quadratic-linear (LQL model. Material and methods : The Isobio software was developed using MATLAB version 2014b to calculate and generate the biological dose distribution and biological dose volume histograms. The physical dose from each voxel in treatment planning was extracted through Computational Environment for Radiotherapy Research (CERR, and the accuracy was verified by the differentiation between the dose volume histogram from CERR and the treatment planning system. An equivalent dose in 2 Gy fraction (EQD2 was calculated using biological effective dose (BED based on the LQL model. The software calculation and the manual calculation were compared for EQD2 verification with pair t-test statistical analysis using IBM SPSS Statistics version 22 (64-bit. Results: Two and three-dimensional biological dose distribution and biological dose volume histogram were displayed correctly by the Isobio software. Different physical doses were found between CERR and treatment planning system (TPS in Oncentra, with 3.33% in high-risk clinical target volume (HR-CTV determined by D90%, 0.56% in the bladder, 1.74% in the rectum when determined by D2cc, and less than 1% in Pinnacle. The difference in the EQD2 between the software calculation and the manual calculation was not significantly different with 0.00% at p-values 0.820, 0.095, and 0.593 for external beam radiation therapy (EBRT and 0.240, 0.320, and 0.849 for brachytherapy (BT in HR-CTV, bladder, and rectum, respectively. Conclusions : The Isobio software is a feasible tool to generate the biological dose distribution and biological dose volume histogram for treatment plan evaluation in both EBRT and BT.

  13. Solid-state high voltage modulator and its application to rf source high voltage power supplies

    Tooker, J.F.; Huynh, P.; Street, R.W.

    2009-01-01

    A solid-state high voltage modulator is described in which series-connected insulated-gate bipolar transistors (IGBTs) are switched at a fixed frequency by a pulse width modulation (PWM) regulator, that adjusts the pulse width to control the voltage out of an inductor-capacitor filter network. General Atomics proposed the HV power supply (HVPS) topology of multiple IGBT modulators connected to a common HVdc source for the large number of 1 MW klystrons in the linear accelerator of the Accelerator Production of Tritium project. The switching of 24 IGBTs to obtain 20 kVdc at 20 A for short pulses was successfully demonstrated. This effort was incorporated into the design of a -70 kV, 80 A, IGBT modulator, and in a short-pulse test 12 IGBTs regulated -5 kV at 50 A under PWM control. These two tests confirm the practicality of solid-state IGBT modulators to regulate high voltage at reasonable currents. Tokamaks such as ITER require large rf heating and current drive systems with multiple rf sources. A HVPS topology is presented that readily adapts to the three rf heating systems on ITER. To take advantage of the known economy of scale for power conversion equipment, a single HVdc source feeds multiple rf sources. The large power conversion equipment, which is located outside, converts the incoming utility line voltage directly to the HVdc needed for the class of rf sources connected to it, to further reduce cost. The HVdc feeds a set of IGBT modulators, one for each rf source, to independently control the voltage applied to each source, maximizing operational flexibility. Only the modulators are indoors, close to the rf sources, minimizing the use of costly near-tokamak floor space.

  14. Sigma-Delta Voltage to Frequency Converter With Phase Modulation Possibility

    STORK, Milan

    2014-01-01

    Voltage to frequency converter (VFC) is an oscillator whose frequency is linearly proportional to control voltage. There are two common VFC architectures: the current steering multivibrator and the charge-balance VFC. For higher linearity, the charge-balancing method is preferred. The charge balanced VFC may be made in asynchronous or synchronous (clocked) forms. The synchronous charge balanced VFC or "sigma delta" (S-D) VFC is used when output pulses are synchroni...

  15. Modular High Voltage Power Supply

    Newell, Matthew R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-05-18

    The goal of this project is to develop a modular high voltage power supply that will meet the needs of safeguards applications and provide a modular plug and play supply for use with standard electronic racks.

  16. Multiple High Voltage Pulse Stressing of Polymer Thick Film Resistors

    Busi Rambabu

    2014-01-01

    Full Text Available The purpose of this paper is to study high voltage interactions in polymer thick film resistors, namely, polyvinyl chloride- (PVC- graphite thick film resistors, and their applications in universal trimming of these resistors. High voltages in the form of impulses for various pulse durations and with different amplitudes have been applied to polymer thick film resistors and we observed the variation of resistance of these resistors with high voltages. It has been found that the resistance of polymer thick film resistors decreases in the case of higher resistivity materials and the resistance of polymer thick film resistor increases in the case of lower resistivity materials when high voltage impulses are applied to them. It has been also found that multiple high voltage pulse (MHVP stressing can be used to trim the polymer thick film resistors either upwards or downwards.

  17. Organic dielectrics in high voltage cables

    Vermeer, J

    1962-03-01

    It appears that the limit has been reached in the applicability of oil-impregnated paper as the dielectric for ehv cables, as with rising voltages the prevention of conductor losses becomes increasingly difficult, while the dielectric losses of the insulation, increasing as the square of the voltage, contribute to a greater extent to the temperature rise of the conductor. The power transmitting capacity of ehv cables reaches a maximum at 500 to 600 kV for these reasons. Apart from artificial cooling, a substantial improvement can be obtained only with the use of insulating materials with much lower dielectric losses; these can moreover be applied with a smaller wall thickness, but this means higher field strengths. Synthetic polymer materials meet these requirements but can be used successfully only in the form of lapped film tapes impregnated with suitable liquids. The electrical properties of these heterogeneous dielectrics, in particular, their impulse breakdown strengths are studied in detail.

  18. Strategies for Voltage Control and Transient Stability Assessment

    Hiskens, Ian A.

    2013-09-25

    As wind generation grows, its influence on power system performance will becoming increasingly noticeable. Wind generation di ffers from traditional forms of generation in numerous ways though, motivating the need to reconsider the usual approaches to power system assessment and performance enhancement. The project has investigated the impact of wind generation on transient stability and voltage control, identifying and addressing issues at three distinct levels of the power system: 1) at the device level, the physical characteristics of wind turbine generators (WTGs) are quite unlike those of synchronous machines, 2) at the wind-farm level, the provision of reactive support is achieved through coordination of numerous dissimilar devices, rather than straightforward generator control, and 3) from a systems perspective, the location of wind-farms on the sub-transmission network, coupled with the variability inherent in their power output, can cause complex voltage control issues. The project has sought to develop a thorough understanding of the dynamic behaviour of type-3 WTGs, and in particular the WECC generic model. The behaviour of such models is governed by interactions between the continuous dynamics of state variables and discrete events associated with limits. It was shown that these interactions can be quite complex, and may lead to switching deadlock that prevents continuation of the trajectory. Switching hysteresis was proposed for eliminating deadlock situations. Various type-3 WTG models include control blocks that duplicate integrators. It was shown that this leads to non-uniqueness in the conditions governing steady-state, and may result in pre- and post-disturbance equilibria not coinciding. It also gives rise to a zero eigenvalue in the linearized WTG model. In order to eliminate the anomalous behaviour revealed through this investigation, WECC has now released a new generic model for type-3 WTGs. Wind-farms typically incorporate a variety of

  19. Reliability criteria for voltage stability

    Taylor, Carson W; Silverstein, Brian L [Bonneville Power Administration, Portland, OR (United States)

    1994-12-31

    In face of costs pressures, there is need to allocate scare resources more effectively in order to achieve voltage stability. This naturally leads to development of probabilistic criteria and notions of rick management. In this paper it is presented a discussion about criteria for long term voltage stability limited to the case in which the time frames are topically several minutes. (author) 14 refs., 1 fig.

  20. High voltage distributions in RPCs

    Inoue, Y.; Muranishi, Y.; Nakamura, M.; Nakano, E.; Takahashi, T.; Teramoto, Y.

    1996-01-01

    High voltage distributions on the inner surfaces of RPCs electrodes were calculated by using a two-dimensional resistor network model. The calculated result shows that the surface resistivity of the electrodes should be high, compared to their volume resistivity, to get a uniform high voltage over the surface. Our model predicts that the rate capabilities of RPCs should be inversely proportional to the thickness of the electrodes if the ratio of surface-to-volume resistivity is low. (orig.)

  1. Methods, systems and apparatus for controlling third harmonic voltage when operating a multi-space machine in an overmodulation region

    Perisic, Milun; Kinoshita, Michael H; Ranson, Ray M; Gallegos-Lopez, Gabriel

    2014-06-03

    Methods, system and apparatus are provided for controlling third harmonic voltages when operating a multi-phase machine in an overmodulation region. The multi-phase machine can be, for example, a five-phase machine in a vector controlled motor drive system that includes a five-phase PWM controlled inverter module that drives the five-phase machine. Techniques for overmodulating a reference voltage vector are provided. For example, when the reference voltage vector is determined to be within the overmodulation region, an angle of the reference voltage vector can be modified to generate a reference voltage overmodulation control angle, and a magnitude of the reference voltage vector can be modified, based on the reference voltage overmodulation control angle, to generate a modified magnitude of the reference voltage vector. By modifying the reference voltage vector, voltage command signals that control a five-phase inverter module can be optimized to increase output voltages generated by the five-phase inverter module.

  2. Voltage-gated calcium flux mediates Escherichia coli mechanosensation.

    Bruni, Giancarlo N; Weekley, R Andrew; Dodd, Benjamin J T; Kralj, Joel M

    2017-08-29

    Electrically excitable cells harness voltage-coupled calcium influx to transmit intracellular signals, typically studied in neurons and cardiomyocytes. Despite intense study in higher organisms, investigations of voltage and calcium signaling in bacteria have lagged due to their small size and a lack of sensitive tools. Only recently were bacteria shown to modulate their membrane potential on the timescale of seconds, and little is known about the downstream effects from this modulation. In this paper, we report on the effects of electrophysiology in individual bacteria. A genetically encoded calcium sensor expressed in Escherichia coli revealed calcium transients in single cells. A fusion sensor that simultaneously reports voltage and calcium indicated that calcium influx is induced by voltage depolarizations, similar to metazoan action potentials. Cytoplasmic calcium levels and transients increased upon mechanical stimulation with a hydrogel, and single cells altered protein concentrations dependent on the mechanical environment. Blocking voltage and calcium flux altered mechanically induced changes in protein concentration, while inducing calcium flux reproduced these changes. Thus, voltage and calcium relay a bacterial sense of touch and alter cellular lifestyle. Although the calcium effectors remain unknown, these data open a host of new questions about E. coli , including the identity of the underlying molecular players, as well as other signals conveyed by voltage and calcium. These data also provide evidence that dynamic voltage and calcium exists as a signaling modality in the oldest domain of life, and therefore studying electrophysiology beyond canonical electrically excitable cells could yield exciting new findings.

  3. Optimum voltage of auxiliary systems for thermal and nuclear power plants

    Tokumitsu, Iwao; Segawa, Motomichi

    1979-01-01

    In the power plants in Japan, their unit power output has been greatly enhanced since the introduction of new powerful thermal power plants from 1950's to 1960's. In both thermal and nuclear power plants, 1,000 MW machines have been already in operation. The increase of unit power output results in the increase of in-plant load capacity. Of these the voltage adopted for in-plant low voltage systems is now mainly 440 V at load terminals, and the voltage for in-plant high voltage systems has been changing to 6 kV level via 3 kV and 4 kV levels. As plant capacity increases, the load of low voltage systems significantly increases, and it is required to raise the voltage of 400 V level. By the way, the low voltage in AC is specified to be not higher than 600 V. This makes the change within the above range comparatively easy. Considering these conditions, it is recommended to change the voltage for low voltage systems to 575 V at power source terminals and 550 V at load terminals. Some merits in constructing power systems and in economy by raising the voltage were examined. Though demerits are also found, they are only about 15% of total merits. The most advantageous point in raising the voltage is to be capable of increasing the supplying range to low voltage system loads. (Wakatsuki, Y.)

  4. Macroeconomic Assessment of Voltage Sags

    Sinan Küfeoğlu

    2016-12-01

    Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.

  5. Wide-range voltage modulation

    Rust, K.R.; Wilson, J.M.

    1992-06-01

    The Superconducting Super Collider's Medium Energy Booster Abort (MEBA) kicker modulator will supply a current pulse to the abort magnets which deflect the proton beam from the MEB ring into a designated beam stop. The abort kicker will be used extensively during testing of the Low Energy Booster (LEB) and the MEB rings. When the Collider is in full operation, the MEBA kicker modulator will abort the MEB beam in the event of a malfunction during the filling process. The modulator must generate a 14-μs wide pulse with a rise time of less than 1 μs, including the delay and jitter times. It must also be able to deliver a current pulse to the magnet proportional to the beam energy at any time during ramp-up of the accelerator. Tracking the beam energy, which increases from 12 GeV at injection to 200 GeV at extraction, requires the modulator to operate over a wide range of voltages (4 kV to 80 kV). A vacuum spark gap and a thyratron have been chosen for test and evaluation as candidate switches for the abort modulator. Modulator design, switching time delay, jitter and pre-fire data are presented

  6. Coordinated control to mitigate over voltage and under voltage in LV networks

    Viyathukattuva Mohamed Ali, M.M.; Nguyen, H.P.; Cobben, J.F.G.

    2016-01-01

    Increasing penetration of distributed renewable energy resources (DRES) and smart loads into the LV network lead to new power quality challenges. Important power quality challenges are overvoltage and undervoltage. A number of solutions are already developed to mitigate these voltage variations. In

  7. Ion peak narrowing by applying additional AC voltage (ripple voltage) to FAIMS extractor electrode.

    Pervukhin, Viktor V; Sheven, Dmitriy G

    2010-01-01

    The use of a non-uniform electric field in a high-field asymmetric waveform ion mobility spectrometry (FAIMS) analyzer increases sensitivity but decreases resolution. The application of an additional AC voltage to the extractor electrode ("ripple" voltage, U(ripple)) can overcome this effect, which decreases the FAIMS peak width. In this approach, the diffusion ion loss remains minimal in the non-uniform electric field in the cylindrical part of the device, and all ion losses under U(ripple) occur in a short portion of their path. Application of the ripple voltage to the extractor electrode is twice as efficient as the applying of U(ripple) along the total length of the device. 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.

  8. Omega-3 polyunsaturated fatty acid blood biomarkers increase linearly in men and women after tightly controlled intakes of 0.25, 0.5, and 1 g/d of EPA + DHA.

    Patterson, Ashley C; Chalil, Alan; Aristizabal Henao, Juan J; Streit, Isaac T; Stark, Ken D

    2015-12-01

    Blood levels of eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have been related to coronary heart disease risk. Understanding the response of EPA + DHA in blood to dietary intake of EPA + DHA would facilitate the use of blood measures as markers of adherence and enable the development of dietary recommendations. The objective of this study is examine the blood response to intakes of EPA + DHA ≤1 g/d with an intervention designed for dietary adherence. It was hypothesized this relationship would be linear and that intakes of EPA + DHA DHA intake of men and women (n = 20) was determined by food frequency questionnaire and adherence was monitored by weekly fingertip blood sampling for fatty acid determinations. Participants consumed nutraceuticals to achieve intakes of 0.25 g/d and 0.5 g/d EPA + DHA for successive four-week periods. A subgroup (n = 5) had intakes of 1.0 g/d EPA + DHA for an additional 4 weeks. Fatty acid composition of whole blood, erythrocytes, and plasma phospholipids were determined at each time point. Blood levels of EPA and DHA increased linearly in these pools. A comprehensive review of the literature was used to verify the blood-intake relationship. Blood levels of long chain omega-3 polyunsaturated fatty acids reached blood levels associated with the highest levels of primary cardiac arrest reduction and sudden cardiac death risk only with intakes of 1.0 g/d of EPA + DHA. The blood biomarker response to intakes of EPA + DHA ≤1 g/d is linear in a small but highly adherent study sample and this information can assist in determining adherence in clinical studies and help identify dietary intake targets from associations between blood and disease. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Linear resonance acceleration of pellets

    Mills, R.G.

    1978-01-01

    A possible requirement for the acceleration of macroscopic pellets to velocities exceeding 10 4 meters per second implies the development of new apparatus. A satisfactory approach might be the linear resonance accelerator. Such apparatus would require the charging of pellets to very high values not yet demonstrated. The incompatibility of phase stability with radial stability in these machines may require abandoning phase stability and adopting feedback control of the accelerating voltage to accommodate statistical fluctuations in the charge to mass ratio of successive pellets

  10. Increasing in the Passo Fundo Hydroelectric Power Plant generation availability and improvement of the voltage level for the regional system; Aumento de disponibilidade de geracao da Usina Hidroeletrica de Passo Fundo e melhoria no nivel de tensao do sistema regional

    Mandelli, Clademir; Coghetto, Gladistone [Centrais Geradoras do Sul do Brasil S.A. (GERASUL), Entre Rios do Sul, RS (Brazil). Usina Hidreletrica de Passo Fundo

    1998-07-01

    This work reports the modifications and arrangements performed allowing the reduction of the time required for isolation, normalization and test on the generator groups, and new operation bands as well, and consequently resulting in increasing of availability and reduction of the plant failure.

  11. Voltage-Balancing Method for Modular Multilevel Converters Switched at Grid Frequency

    Deng, Fujin; Chen, Zhe

    2015-01-01

    The modular multilevel converter (MMC) becomes attractive for high-voltage and high-power applications due to its high modularity, availability, and power quality. The voltage balance issue of capacitors is very important in the MMC, and the balancing of the capacitor voltage is increasingly...

  12. Performance test of 100 W linear compressor

    Ko, J; Ko, D. Y.; Park, S. J.; Kim, H. B.; Hong, Y. J.; Yeom, H. K. [Korea Institute of Machinery and Materials, Daejeon(Korea, Republic of)

    2013-09-15

    In this paper, we present test results of developed 100 W class linear compressor for Stirling-type pulse tube refrigerator. The fabricated linear compressor has dual-opposed configuration, free piston and moving magnet type linear motor. Power transfer, efficiency and required pressure waveform are predicted with designed and measured specifications. In experiments, room temperature test with flow impedance is conducted to evaluate performance of developed linear compressor. Flow impedance is loaded to compressor with metering valve for flow resistance, inertance tube for flow inertance and buffer volumes for flow compliance. Several operating parameters such as input voltage, current, piston displacement and pressure wave are measured for various operating frequency and fixed input current level. Behaviors of dynamics and performance of linear compressor as varying flow impedance are discussed with measured experimental results. The developed linear compressor shows 124 W of input power, 86 % of motor efficiency and 60 % of compressor efficiency at its resonant operating condition.

  13. Plasma resistance behavior during the linear decay phase of RFPs in ETA BETA II

    Nalesso, G.F.

    1982-01-01

    In the aided-reversal mode RFP discharges produced in ETA BETA II, the plasma current is characterized by a linear decay phase, which follows an approximately exponential phase. During the same period the measured toroidal voltage is negative and initially increasing in absolute value (exponential phase) and then decreasing to almost zero during the linear phase before the current termination. The same behavior of the current has been observed in the quiescent phase in Zeta where a negative toroidal electric field was also observed. In this note we present a model that can explain the linear decay phase and fits with the experimental parameters and allows us to estimate the plasma resistance behavior during the linear phase of slow reversed field pinch discharges

  14. Mitigation of voltage sags in the distribution system with dynamic voltage restorer

    Viglas, D.; Belan, A.

    2012-01-01

    Dynamic voltage restorer is a custom power device that is used to improve voltage sags or swells in electrical distribution system. The components of the Dynamic Voltage Restorer consist of injection transformers, voltage source inverter, passive filters and energy storage. The main function of the Dynamic voltage restorer is used to inject three phase voltage in series and in synchronism with the grid voltages in order to compensate voltage disturbances. This article deals with mitigation of voltage sags caused by three-phase short circuit. Dynamic voltage restorer is modelled in MATLAB/Simulink. (Authors)

  15. Optimized Controller Design for a 12-Pulse Voltage Source Converter Based HVDC System

    Agarwal, Ruchi; Singh, Sanjeev

    2017-12-01

    The paper proposes an optimized controller design scheme for power quality improvement in 12-pulse voltage source converter based high voltage direct current system. The proposed scheme is hybrid combination of golden section search and successive linear search method. The paper aims at reduction of current sensor and optimization of controller. The voltage and current controller parameters are selected for optimization due to its impact on power quality. The proposed algorithm for controller optimizes the objective function which is composed of current harmonic distortion, power factor, and DC voltage ripples. The detailed designs and modeling of the complete system are discussed and its simulation is carried out in MATLAB-Simulink environment. The obtained results are presented to demonstrate the effectiveness of the proposed scheme under different transient conditions such as load perturbation, non-linear load condition, voltage sag condition, and tapped load fault under one phase open condition at both points-of-common coupling.

  16. Improvement the Capacity of Cockcroft-Walton High Voltage Source from 300 kV/20 mA to 500 kV/20 mA for Accelerating Voltage of Electron Beam Machine

    Suprapto; Djasiman

    2002-01-01

    The improvement capacity of Cockcroft-Walton high voltage source from 300 kV/20 mA to 500 kV/mA has been carrying out. To improve the capacity of high voltage source was done by means of increasing the stage number of voltage multiplier from 11 to 18 and its output voltage measuring resistance. Each stage of voltage multiplier consists of 2 capacitors and 2 circuits of high voltage diode. This voltage multiplier is constructed using main components of high voltage capacitor and high voltage diode each of 0.22 μF/50 kV and UF 5408 respectively. To avoid stray discharge and corona it was provided with high voltage electrode and corona ring. The test result indicated that the output voltage obtained from 16 stages was 350 kV according to operating condition of 25 MΩ resistive load and first stage voltage of 28.5 kV with oscillator frequency of 24 Hz. That condition requires anode voltage and current of 5.5 kV and 2.5 A respectively. The no load test for 16 stages indicates 400 kV of output voltage and 28.5 kV first stage voltage. Efficiency of high voltage source was 48 % at 6.75 kW of output power. The expected test of 500 kV with 18 stages of voltage multiplier can not be carried out because of some restrictive of loading system. From the test result can be predicted that the output voltage of 500 kV with 18 stages of voltage multiplier requires 31.2 kV of first stage voltage. Then the expected high voltage source of Cockcroft-Walton is capable as accelerating voltage source for Electron Beam Machine with energy of 500 kV. (author)

  17. Thermal voltage noise in layered superconductors

    Ashkenazy, V.D.; Jung, G.; Shapiro, B.Y.

    1995-01-01

    Thermal voltage noise in the mixed state of type-II superconductors has been calculated taking into account fluctuation modes of nonrigid vortices. It has been shown that bending of vortices leads to new effects in thermal-voltage-noise spectra at high frequencies. The power spectrum reflecting fluctuations of rigid vortices is suppressed at very low frequencies and saturates into a white spectrum at a characteristic frequency depending on the strip width. At high frequencies tilt modes of flexible vortices start to contribute to the fluctuating voltages and the power spectrum undergoes three subsequent magnitude increases, following ω 1/2 -, ω 2 -, and again ω 1/2 -like behavior before becoming white again. It has been shown that for layered superconductors of a moderate anisotropy the second ω 1/2 -like increase disappears at magnetic fields exceeding a certain threshold field corresponding to the crossover field between two-dimensional and three-dimensional vortex-lattice melting. Field dependencies of characteristic frequencies separating different regimes of spectral behavior have been evaluated and shown to be qualitatively different for low and high magnetic fields

  18. Voltage current characteristics of type III superconductors

    Dorofejev, G.L.; Imenitov, A.B.; Klimenko, E.Y.

    1980-01-01

    An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb 3 Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T. (author)

  19. Voltage current characteristics of type III superconductors

    Dorofeiev, G L; Imenitov, A B; Klimenko, E Y [Gosudarstvennyi Komitet po Ispol' zovaniyu Atomnoi Ehnergii SSSR, Moscow. Inst. Atomnoi Ehnergii

    1980-06-01

    An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb/sub 3/Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T.

  20. Linearly Adjustable International Portfolios

    Fonseca, R. J.; Kuhn, D.; Rustem, B.

    2010-09-01

    We present an approach to multi-stage international portfolio optimization based on the imposition of a linear structure on the recourse decisions. Multiperiod decision problems are traditionally formulated as stochastic programs. Scenario tree based solutions however can become intractable as the number of stages increases. By restricting the space of decision policies to linear rules, we obtain a conservative tractable approximation to the original problem. Local asset prices and foreign exchange rates are modelled separately, which allows for a direct measure of their impact on the final portfolio value.

  1. Linearly Adjustable International Portfolios

    Fonseca, R. J.; Kuhn, D.; Rustem, B.

    2010-01-01

    We present an approach to multi-stage international portfolio optimization based on the imposition of a linear structure on the recourse decisions. Multiperiod decision problems are traditionally formulated as stochastic programs. Scenario tree based solutions however can become intractable as the number of stages increases. By restricting the space of decision policies to linear rules, we obtain a conservative tractable approximation to the original problem. Local asset prices and foreign exchange rates are modelled separately, which allows for a direct measure of their impact on the final portfolio value.

  2. Dual-range linearized transimpedance amplifier system

    Wessendorf, Kurt O.

    2010-11-02

    A transimpedance amplifier system is disclosed which simultaneously generates a low-gain output signal and a high-gain output signal from an input current signal using a single transimpedance amplifier having two different feedback loops with different amplification factors to generate two different output voltage signals. One of the feedback loops includes a resistor, and the other feedback loop includes another resistor in series with one or more diodes. The transimpedance amplifier system includes a signal linearizer to linearize one or both of the low- and high-gain output signals by scaling and adding the two output voltage signals from the transimpedance amplifier. The signal linearizer can be formed either as an analog device using one or two summing amplifiers, or alternately can be formed as a digital device using two analog-to-digital converters and a digital signal processor (e.g. a microprocessor or a computer).

  3. Polarized electron sources for linear colliders

    Clendenin, J.E.; Ecklund, S.D.; Miller, R.H.; Schultz, D.C.; Sheppard, J.C.

    1992-07-01

    Linear colliders require high peak current beams with low duty factors. Several methods to produce polarized e - beams for accelerators have been developed. The SLC, the first linear collider, utilizes a photocathode gun with a GaAs cathode. Although photocathode sources are probably the only practical alternative for the next generation of linear colliders, several problems remain to be solved, including high voltage breakdown which poisons the cathode, charge limitations that are associated with the condition of the semiconductor cathode, and a relatively low polarization of ≤5O%. Methods to solve or at least greatly reduce the impact of each of these problems are at hand

  4. High voltage high brightness electron accelerators with MITL voltage adder coupled to foilless diodes

    Mazarakis, M.G.; Poukey, J.W.; Frost, C.A.; Shope, S.L.; Halbleib, J.A.; Turman, B.N.

    1993-01-01

    During the last ten years the authors have extensively studied the physics and operation of magnetically-immersed electron foilless diodes. Most of these sources were utilized as injectors to high current, high energy linear induction accelerators such as those of the RADLAC family. Recently they have experimentally and theoretically demonstrated that foilless diodes can be successfully coupled to self-magnetically insulated transmission line voltage adders to produce very small high brightness, high definition (no halo) electron beams. The RADLAC/SMILE experience opened the path to a new approach in high brightness, high energy induction accelerators. There is no beam drifting through the device. The voltage addition occurs in a center conductor, and the beam is created at the high voltage end in an applied magnetic field diode. This work was motivated by the remarkable success of the HERMES-III accelerator and the need to produce small radius, high energy, high current electron beams for air propagation studies and flash x-ray radiography. In this paper they present experimental results compared with analytical and numerical simulations in addition to design examples of devices that can produce multikiloamp electron beams of as high as 100 MV energies and radii as small as 1 mm

  5. A comprehensive analysis and hardware implementation of control strategies for high output voltage DC-DC boost power converter

    Padmanaban, Sanjeevikumar; Grandi, Gabriele; Blaabjerg, Frede; Wheeler, Patrick; Siano, Pierluigi; Hammami, Manel

    2017-01-01

    Classical DC-DC converters used in high voltage direct current (HVDC) power transmission systems, lack in terms of efficiency, reduced transfer gain and increased cost with sensor (voltage/current) numbers. Besides, the internal self-parasitic behavior of the power components reduces the output voltage and efficiency of classical HV converters. This paper deals with extra high-voltage (EHV) dc-dc boost converter by the application of voltage-lift technique to overcome the aforementioned defic...

  6. Inductive voltage adder (IVA) for submillimeter radius electron beam

    Mazarakis, M.G.; Poukey, J.W.; Maenchen, J.E.

    1996-01-01

    The authors have already demonstrated the utility of inductive voltage adder accelerators for production of small-size electron beams. In this approach, the inductive voltage adder drives a magnetically immersed foilless diode to produce high-energy (10--20 MeV), high-brightness pencil electron beams. This concept was first demonstrated with the successful experiments which converted the linear induction accelerator RADLAC II into an IVA fitted with a small 1-cm radius cathode magnetically immersed foilless diode (RADLAC II/SMILE). They present here first validations of extending this idea to mm-scale electron beams using the SABRE and HERMES-III inductive voltage adders as test beds. The SABRE experiments are already completed and have produced 30-kA, 9-MeV electron beams with envelope diameter of 1.5-mm FWHM. The HERMES-III experiments are currently underway

  7. Low Voltage Current Mode Switched-Current-Mirror Mixer

    Chunhua Wang

    2009-09-01

    Full Text Available A new CMOS active mixer topology can operate at 1 V supply voltage by use of SCM (switched currentmirror. Such current-mode mixer requires less voltage headroom with good linearization. Mixing is achieved with four improved current mirrors, which are alternatively activated. For ideal switching, the operation is equivalent to a conventional active mixer. This paper analyzes the performance of the SCM mixer, in comparison with the conventional mixer, demonstrating competitive performance at a lower supply voltage. Moreover, the new mixer’s die, without any passive components, is very small, and the conversion gain is easy to adjust. An experimental prototype was designed and simulated in standard chartered 0.18μm RF CMOS Process with Spectre in Cadence Design Systems. Experimental results show satisfactory mixer performance at 2.4 GHz.

  8. Linearity of bulk-controlled inverter ring VCO in weak and strong inversion

    Wismar, Ulrik Sørensen; Wisland, D.; Andreani, Pietro

    2007-01-01

    In this paper linearity of frequency modulation in voltage controlled inverter ring oscillators for non feedback sigma delta converter applications is studied. The linearity is studied through theoretical models of the oscillator operating at supply voltages above and below the threshold voltage......, process variations and temperature variations have also been simulated to indicate the advantages of having the soft rail bias transistor in the VCO....

  9. High Efficiency Power Converter for Low Voltage High Power Applications

    Nymand, Morten

    The topic of this thesis is the design of high efficiency power electronic dc-to-dc converters for high-power, low-input-voltage to high-output-voltage applications. These converters are increasingly required for emerging sustainable energy systems such as fuel cell, battery or photo voltaic based......, and remote power generation for light towers, camper vans, boats, beacons, and buoys etc. A review of current state-of-the-art is presented. The best performing converters achieve moderately high peak efficiencies at high input voltage and medium power level. However, system dimensioning and cost are often...

  10. Low-Energy Real-Time OS Using Voltage Scheduling Algorithm for Variable Voltage Processors

    Okuma, Takanori; Yasuura, Hiroto

    2001-01-01

    This paper presents a real-time OS based on $ mu $ITRON using proposed voltage scheduling algorithm for variable voltage processors which can vary supply voltage dynamically. The proposed voltage scheduling algorithms assign voltage level for each task dynamically in order to minimize energy consumption under timing constraints. Using the presented real-time OS, running tasks with low supply voltage leads to drastic energy reduction. In addition, the presented voltage scheduling algorithm is ...

  11. Development of a New Cascade Voltage-Doubler for Voltage Multiplication

    Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri

    2014-01-01

    For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.

  12. Cavity Voltage Phase Modulation MD

    Mastoridis, Themistoklis; Molendijk, John; Timko, Helga; CERN. Geneva. ATS Department

    2016-01-01

    The LHC RF/LLRF system is currently configured for extremely stable RF voltage to minimize transient beam loading effects. The present scheme cannot be extended beyond nominal beam current since the demanded power would exceed the peak klystron power and lead to saturation. A new scheme has therefore been proposed: for beam currents above nominal (and possibly earlier), the cavity phase modulation by the beam will not be corrected (transient beam loading), but the strong RF feedback and One-Turn Delay feedback will still be active for loop and beam stability in physics. To achieve this, the voltage set point will be adapted for each bunch. The goal of this MD was to test a new algorithm that would adjust the voltage set point to achieve the cavity phase modulation that would minimize klystron forward power.

  13. Hysteresis analysis of graphene transistor under repeated test and gate voltage stress

    Yang Jie; Jia Kunpeng; Su Yajuan; Zhao Chao; Chen Yang

    2014-01-01

    The current transport characteristic is studied systematically based on a back-gate graphene field effect transistor, under repeated test and gate voltage stress. The interface trapped charges caused by the gate voltage sweep process screens the gate electric field, and results in the neutral point voltage shift between the forth and back sweep direction. In the repeated test process, the neutral point voltage keeps increasing with test times in both forth and back sweeps, which indicates the existence of interface trapped electrons residual and accumulation. In gate voltage stress experiment, the relative neutral point voltage significantly decreases with the reducing of stress voltage, especially in −40 V, which illustrates the driven-out phenomenon of trapped electrons under negative voltage stress. (semiconductor devices)

  14. Unbalanced Voltage Compensation in Low Voltage Residential AC Grids

    Trintis, Ionut; Douglass, Philip; Munk-Nielsen, Stig

    2016-01-01

    This paper describes the design and test of a control algorithm for active front-end rectifiers that draw power from a residential AC grid to feed heat pump loads. The control algorithm is able to control the phase to neutral or phase to phase RMS voltages at the point of common coupling...

  15. The high voltage homopolar generator

    Price, J. H.; Gully, J. H.; Driga, M. D.

    1986-11-01

    System and component design features of proposed high voltage homopolar generator (HVHPG) are described. The system is to have an open circuit voltage of 500 V, a peak output current of 500 kA, 3.25 MJ of stored inertial energy and possess an average magnetic-flux density of 5 T. Stator assembly components are discussed, including the stator, mount structure, hydrostatic bearings, main and motoring brushgears and rotor. Planned operational procedures such as monitoring the rotor to full speed and operation with a superconducting field coil are delineated.

  16. Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing

    Patel, N.; Branch, D. W.; Schamiloglu, E.; Cular, S.

    2015-08-01

    A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO3) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz-100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10-273 ps for DC voltages and 189-813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250-2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115-1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.

  17. Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing

    Patel, N.; Branch, D. W.; Cular, S.; Schamiloglu, E.

    2015-01-01

    A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO 3 ) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz–100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10–273 ps for DC voltages and 189–813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250–2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115–1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment

  18. Linear Algebra and Smarandache Linear Algebra

    Vasantha, Kandasamy

    2003-01-01

    The present book, on Smarandache linear algebra, not only studies the Smarandache analogues of linear algebra and its applications, it also aims to bridge the need for new research topics pertaining to linear algebra, purely in the algebraic sense. We have introduced Smarandache semilinear algebra, Smarandache bilinear algebra and Smarandache anti-linear algebra and their fuzzy equivalents. Moreover, in this book, we have brought out the study of linear algebra and vector spaces over finite p...

  19. A novel self-biased linear silicon drift detector

    Corsi, F.; Gramegna, G.; Marzocca, C.

    1999-01-01

    A novel linear silicon drift detector (SDD) is proposed in which the proper potential profile is established by the voltage drop along a unique p + cathode implanted across the surfaces. This p + implant, arranged in a zigzag shape, acts at the same time as voltage divider and field cathode and allows one to increase the sensitive area, improving also the uniformity of the thermal distribution and thus minimizing the fluctuation of the electron mobility on the sensitive zone of the SDD. The perturbations of the drift field due to the asymmetry of the strips constituting the zigzag cathode have been evaluated by solving analytically Poisson's equation for a simplified model of the structure. Three-dimensional numerical simulations have been carried out to prove the negligible amount of the perturbation and the effectiveness of the proposed structure. Based on this principle, a prototype has been manufactured at Canberra Semiconductor Company. Dynamic measurements of the time-of-flight of an injected charge prove that the linearity of the prototype and the drift uniformity in the anode direction are very high

  20. Resilient architecture design for voltage variation

    Reddi, Vijay Janapa

    2013-01-01

    Shrinking feature size and diminishing supply voltage are making circuits sensitive to supply voltage fluctuations within the microprocessor, caused by normal workload activity changes. If left unattended, voltage fluctuations can lead to timing violations or even transistor lifetime issues that degrade processor robustness. Mechanisms that learn to tolerate, avoid, and eliminate voltage fluctuations based on program and microarchitectural events can help steer the processor clear of danger, thus enabling tighter voltage margins that improve performance or lower power consumption. We describe

  1. Voltage balancing strategies for serial connection of microbial fuel cells

    Khaled, Firas; Ondel, Olivier; Allard, Bruno; Buret, François

    2015-07-01

    The microbial fuel cell (MFC) converts electrochemically organic matter into electricity by means of metabolisms of bacteria. The MFC power output is limited by low voltage and low current characteristics in the range of microwatts or milliwatts per litre. In order to produce a sufficient voltage level (>1.5 V) and sufficient power to supply real applications such as autonomous sensors, it is necessary to either scale-up one single unit or to connect multiple units together. Many topologies of connection are possible as the serial association to improve the output voltage, or the parallel connection to improve the output current or the series/parallel connection to step-up both voltage and current. The association of MFCs in series is a solution to increase the voltage to an acceptable value and to mutualize the unit's output power. The serial association of a large number of MFCs presents several issues. The first one is the hydraulic coupling among MFCs when they share the same substrate. The second one is the dispersion between generators that lead to a non-optimal stack efficiency because the maximum power point (MPP) operation of all MFCs is not permitted. Voltage balancing is a solution to compensate non-uniformities towards MPP. This paper presents solutions to improve the efficiency of a stack of serially connected MFCs through a voltage-balancing circuit. Contribution to the topical issue "Electrical Engineering Symposium (SGE 2014)", edited by Adel Razek

  2. Copper wire theft and high voltage electrical burns.

    Francis, Eamon C; Shelley, Odhran P

    2014-01-01

    High voltage electrical burns are uncommon. However in the midst of our economic recession we are noticing an increasing number of these injuries. Copper wire is a valuable commodity with physical properties as an excellent conductor of electricity making it both ubiquitous in society and prized on the black market. We present two consecutive cases referred to the National Burns Unit who sustained life threatening injuries from the alleged theft of high voltage copper wire and its omnipresence on an international scale.

  3. Copper wire theft and high voltage electrical burns

    Francis, Eamon C; Shelley, Odhran P

    2014-01-01

    High voltage electrical burns are uncommon. However in the midst of our economic recession we are noticing an increasing number of these injuries. Copper wire is a valuable commodity with physical properties as an excellent conductor of electricity making it both ubiquitous in society and prized on the black market. We present two consecutive cases referred to the National Burns Unit who sustained life threatening injuries from the alleged theft of high voltage copper wire and its omnipresenc...

  4. Fabrication and current–voltage characteristics of NiOx/ZnO based MIIM tunnel diode

    Singh, Aparajita, E-mail: asing044@fiu.edu [BioMEMS and Microsystems Laboratory, Department of Electrical and Computer Engineering, Florida International University, Miami, Florida 33174, United States of America (United States); Ratnadurai, Rudraskandan [Global Foundaries, Malta, New York 12020 (United States); Kumar, Rajesh [BioMEMS and Microsystems Laboratory, Department of Electrical and Computer Engineering, Florida International University, Miami, Florida 33174 (United States); Department of Physics, Panjab University, Chandigarh 160014 (India); Krishnan, Subramanian [BioMEMS and Microsystems Laboratory, Department of Electrical and Computer Engineering, Florida International University, Miami, Florida 33174 (United States); Emirov, Yusuf [Advanced Materials Engineering Research Institute, Florida International University, Miami, Florida 33174 (United States); Bhansali, Shekhar [BioMEMS and Microsystems Laboratory, Department of Electrical and Computer Engineering, Florida International University, Miami, Florida 33174 (United States)

    2015-04-15

    Highlights: • Fabrication of single and bilayer tunnel diodes by sputter deposition. • Current–voltage characteristics study. • Enhanced asymmetry and non-linearity. • Study of tunneling mechanism. - Abstract: Enhanced asymmetric and non-linear characteristics of Ni–NiOx based MIM diode has been reported by the addition of a second insulator layer ZnO to form MIIM configuration. These properties are required for applications like energy-harvesting devices, terahertz electronics, macro electronics, etc. In this work, single insulator layer Ni–NiOx–Cr and double insulator Ni–NiOx–ZnO–Cr tunnel diodes were fabricated and their I–V characteristics were studied. A significant increase by one order of magnitude in asymmetry has been observed in case of bilayer NiOx/ZnO dielectric configuration at low voltages. The sensitivity of the NiOx and NiOx/ZnO dielectric configuration in MIM stack was 11 V{sup −1} and 16 V{sup −1}. The improved performance of the bilayer insulator diode is due to the second insulator which enables resonant tunneling or step-tunneling. Resonant tunneling was found to be dominant through trap assisted tunneling in the NiOx/ZnO diode.

  5. Design Analysis of Taper Width Variations in Magnetless Linear Machine for Traction Applications

    Saadha Aminath

    2018-01-01

    Full Text Available Linear motors are being used in a different application with a huge popularity in the use of transport industry. With the invention of maglev trains and other high-speed trains, linear motors are being used for the translation and braking applications for these systems. However, a huge drawback of the linear motor design is the cogging force, low thrust values, and voltage ripples. This paper aims to study the force analysis with change in taper/teeth width of the motor stator and mover to understand the best teeth ratio to obtain a high flux density and a high thrust. The analysis is conducted through JMAG software and it is found that the optimum teeth ratio for both the stator and mover gives an increase of 94.4% increases compared to the 0.5mm stator and mover width.

  6. SVPWM Technique with Varying DC-Link Voltage for Common Mode Voltage Reduction in a Matrix Converter and Analytical Estimation of its Output Voltage Distortion

    Padhee, Varsha

    Common Mode Voltage (CMV) in any power converter has been the major contributor to premature motor failures, bearing deterioration, shaft voltage build up and electromagnetic interference. Intelligent control methods like Space Vector Pulse Width Modulation (SVPWM) techniques provide immense potential and flexibility to reduce CMV, thereby targeting all the afore mentioned problems. Other solutions like passive filters, shielded cables and EMI filters add to the volume and cost metrics of the entire system. Smart SVPWM techniques therefore, come with a very important advantage of being an economical solution. This thesis discusses a modified space vector technique applied to an Indirect Matrix Converter (IMC) which results in the reduction of common mode voltages and other advanced features. The conventional indirect space vector pulse-width modulation (SVPWM) method of controlling matrix converters involves the usage of two adjacent active vectors and one zero vector for both rectifying and inverting stages of the converter. By suitable selection of space vectors, the rectifying stage of the matrix converter can generate different levels of virtual DC-link voltage. This capability can be exploited for operation of the converter in different ranges of modulation indices for varying machine speeds. This results in lower common mode voltage and improves the harmonic spectrum of the output voltage, without increasing the number of switching transitions as compared to conventional modulation. To summarize it can be said that the responsibility of formulating output voltages with a particular magnitude and frequency has been transferred solely to the rectifying stage of the IMC. Estimation of degree of distortion in the three phase output voltage is another facet discussed in this thesis. An understanding of the SVPWM technique and the switching sequence of the space vectors in detail gives the potential to estimate the RMS value of the switched output voltage of any

  7. A Voltage Modulated DPC Approach for Three-Phase PWM Rectifier

    Gui, Yonghao; Li, Mingshen; Lu, Jinghang

    2018-01-01

    In this paper, a voltage modulated direct power control for three-phase pulse-width modulated rectifier is proposed. With the suggested method, the differential equations describing the rectifier dynamics are changing from a linear time-varying system into a linear time-invariant one. In this way...

  8. Grain boundary effect of ZnO voltage sensitive ceramic

    Zhu Ziying; Lei Deming; Li Jingde

    1991-01-01

    Positron annihilation techenique has been to study the non-linear Ohmic effect of ZnO. The resemblence of curve representing the short life-time τ 1 and its component I 1 vs. current i with the voltage drop curve proves that this component I 1 belongs to the annihilation of transporting electron and positron. The experimental results give support to the explaination of Schottky barrier model for the effect of intergranular boundary

  9. Voltage Weak DC Distribution Grids

    Hailu, T.G.; Mackay, L.J.; Ramirez Elizondo, L.M.; Ferreira, J.A.

    2017-01-01

    This paper describes the behavior of voltage weak DC distribution systems. These systems have relatively small system capacitance. The size of system capacitance, which stores energy, has a considerable effect on the value of fault currents, control complexity, and system reliability. A number of

  10. High voltage power network construction

    Harker, Keith

    2018-01-01

    This book examines the key requirements, considerations, complexities and constraints relevant to the task of high voltage power network construction, from design, finance, contracts and project management to installation and commissioning, with the aim of providing an overview of the holistic end to end construction task in a single volume.

  11. Voltage control of ferromagnetic resonance

    Ziyao Zhou

    2016-06-01

    Full Text Available Voltage control of magnetism in multiferroics, where the ferromagnetism and ferroelectricity are simultaneously exhibiting, is of great importance to achieve compact, fast and energy efficient voltage controllable magnetic/microwave devices. Particularly, these devices are widely used in radar, aircraft, cell phones and satellites, where volume, response time and energy consumption is critical. Researchers realized electric field tuning of magnetic properties like magnetization, magnetic anisotropy and permeability in varied multiferroic heterostructures such as bulk, thin films and nanostructure by different magnetoelectric (ME coupling mechanism: strain/stress, interfacial charge, spin–electromagnetic (EM coupling and exchange coupling, etc. In this review, we focus on voltage control of ferromagnetic resonance (FMR in multiferroics. ME coupling-induced FMR change is critical in microwave devices, where the electric field tuning of magnetic effective anisotropic field determines the tunability of the performance of microwave devices. Experimentally, FMR measurement technique is also an important method to determine the small effective magnetic field change in small amount of magnetic material precisely due to its high sensitivity and to reveal the deep science of multiferroics, especially, voltage control of magnetism in novel mechanisms like interfacial charge, spin–EM coupling and exchange coupling.

  12. High voltage MOSFET switching circuit

    McEwan, Thomas E.

    1994-01-01

    The problem of source lead inductance in a MOSFET switching circuit is compensated for by adding an inductor to the gate circuit. The gate circuit inductor produces an inductive spike which counters the source lead inductive drop to produce a rectangular drive voltage waveform at the internal gate-source terminals of the MOSFET.

  13. Power supply and stabilization of the supply system on board using decentralized voltage rectifiers

    Grueb, W; Wegerer, K

    1987-04-01

    The functionally redundant power supply system of the Transrapid 06 II maglev train is described; it comprises four independent, battery-buffered networks and 30 linear generators per train section. Voltage rectifiers adapt the velocity- and load-dependent linear generator voltage to the 440 V d.c. networks and assure dynamic stabilisation as well as buffer battery loading. The result is a high-reliability power supply system on board with optimum utilisation of the power supplied by the linear generators while the train is running.

  14. Thyristor voltage converter in induction electric drives with microprocessor control

    Braslavsky, I.; Zuzev, A.; Shilin, S. [Electric Drive Department, Urals State Technical University, Ekaterinburg (Russian Federation)

    1997-12-31

    The paper consists of some results on developed pulse model of thyristor voltage converter which is one of the most mathematically complicated unit of electric drive. The model structure and model parameter calculating method are represented. The application of the model allows to analyse stability in `locally` by the linear pulse system theory methods with talking into consideration quantise processes within the converter. Such application provides the obtaining higher accurate results comparing with the non-linear system theory approximate methods. Logarithmic frequency characteristics are used to analyse converter dynamic features and they are represented too. (orig.) 4 refs.

  15. Voltage and temperature dependence of the grain boundary tunneling magnetoresistance in manganites

    Hoefener, C.; Philipp, J. B.; Klein, J.; Alff, L.; Marx, A.; Buechner, B.; Gross, R.

    2000-01-01

    We have performed a systematic analysis of the voltage and temperature dependence of the tunneling magnetoresistance (TMR) of grain boundaries (GB) in the manganites. We find a strong decrease of the TMR with increasing voltage and temperature. The decrease of the TMR with increasing voltage scales with an increase of the inelastic tunneling current due to multi-step inelastic tunneling via localized defect states in the tunneling barrier. This behavior can be described within a three-current...

  16. Control voltage and power fluctuations when connecting wind farms

    Berinde, Ioan; Bǎlan, Horia; Oros Pop, Teodora Susana

    2015-12-01

    Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.

  17. Control voltage and power fluctuations when connecting wind farms

    Berinde, Ioan; Bălan, Horia; Oros, Teodora Susana

    2015-01-01

    Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve

  18. Control voltage and power fluctuations when connecting wind farms

    Berinde, Ioan, E-mail: ioan-berinde@yahoo.com; Bălan, Horia, E-mail: hbalan@mail.utcluj.ro; Oros, Teodora Susana, E-mail: teodoraoros-87@yahoo.com [Technical University of Cluj-Napoca, Romania, Faculty of Electrical Engineering, Department of Power Engineering and Management (Romania)

    2015-12-23

    Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.

  19. Double input converters for different voltage sources with isolated charger

    Chalash Sattayarak

    2014-09-01

    Full Text Available This paper presents the double input converters for different voltage input sources with isolated charger coils. This research aims to increase the performance of the battery charger circuit. In the circuit, there are the different voltage levels of input source. The operating modes of the switch in the circuit use the microcontroller to control the battery charge and to control discharge mode automatically when the input voltage sources are lost from the system. The experimental result of this research shows better performance for charging at any time period of the switch, while the voltage input sources work together. Therefore, this research can use and develop to battery charger for present or future.

  20. High-voltage test and training of plastic streamer tubes for the DELPHI hadron calorimeter

    Alekseev, G.D.; Cellar, S.; Khomenko, B.A.; Korytov, A.V.; Kulinich, P.A.; Micelmacher, G.V.; Sedykh, Yu.V.; Toledo, R.

    1987-01-01

    The results of high-voltage test and training of plastic streamer tubes of the DELPHI hadron calorimeter are presented. The testing technique is considered in detail. The equipment for high-voltage training consists of a mini-computer, CAMAC-electronics, a controllable high-voltage supply and a digital ampermeter. The experimental results shows that high-voltage training of streamer tubes improves their characteristics. The value of dark current decreased up to 1 μA. The operational voltage range increased by a value more than 300 V

  1. Numerical analysis on the effect of voltage change on removing condensed water inside the GDL of a PEM fuel cell

    Lee, Nam Woo [Fuel Cell Technology Development Team, Eco-Technology Center, Hyundai-Kia Motors, Yongin (Korea, Republic of); Kim, Young Sang; Kim, Min Soo [Dept. of Mechanical and Aerospace Engineering, Seoul National University, Seoul (Korea, Republic of); Kim, Min Sung [School of Energy Systems Engineering, Chung-Ang University, Seoul (Korea, Republic of)

    2016-09-15

    Decreasing the voltage of a fuel cell through hydrogen mixing or using low-air stoichiometry ratio is beneficial to remove condensed water inside GDL under flooding condition. In this study, the effect of voltage level of a fuel cell on water distribution in GDL under flooding condition was numerically analyzed. Water content in GDL was dependent on the voltage level of a fuel cell, that is, the water content was low when the cell voltage was maintained low. The effect of voltage change under flooding condition was also simulated. The flow rate of condensed water inside GDL considerably increased immediately after decreasing the cell voltage. The oxygen concentration in the catalyst layer was increased by decreasing the voltage of the fuel cell. Consequently, the cell voltage was recovered. Therefore, decreasing cell voltage under flooding condition can facilitate removal of condensed water in GDL.

  2. The supply voltage scaled dependency of the recovery of single event upset in advanced complementary metal—oxide—semiconductor static random-access memory cells

    Li Da-Wei; Qin Jun-Rui; Chen Shu-Ming

    2013-01-01

    Using computer-aided design three-dimensional simulation technology, the supply voltage scaled dependency of the recovery of single event upset and charge collection in static random-access memory cells are investigated. It reveals that the recovery linear energy transfer threshold decreases with the supply voltage reducing, which is quite attractive for dynamic voltage scaling and subthreshold circuit radiation-hardened design. Additionally, the effect of supply voltage on charge collection is also investigated. It is concluded that the supply voltage mainly affects the bipolar gain of the parasitical bipolar junction transistor (BJT) and the existence of the source plays an important role in supply voltage variation. (geophysics, astronomy, and astrophysics)

  3. Cogging force investigation of a free piston permanent magnet linear generator

    Abdalla, I. I.; Zainal, A. E. Z.; Ramlan, N. A.; Firmansyah; Aziz, A. R. A.; Heikal, M. R.

    2017-10-01

    Better performance and higher efficiency of the vehicles can be achieved by using free piston engine, in which the piston is connected directly to the linear generator and waiving of any mechanical means. The free piston engine has the ability to overcome or reduce many of the challenges, such as the carbon dioxide (CO2) emission and fossil fuel consumption. The cogging force produces undesired vibration and acoustic noise in the generator. However, the cogging force must be minimized as much as possible, in order to have a high performance. This paper studies the effects of ferromagnetic materials on the cogging force of the permanent magnet linear generator (PMLG) to be used in a free piston engine using nonlinear finite-element analysis (FEA) under ANSYS Maxwell. The comparisons have been established for the cogging force of the PMLG under various translator velocities and three different ferromagnetic materials for the stator core, namely, Silicon Steel laminations, Mild Steel and Somaloy. It has been shown that the PMLG with a stator core made of Somaloy has a lower cogging force among them. Furthermore, the induced voltage of the PMLG at different accelerations has been studied. It is found that the PMLG with Mild Steel and Somaloy, respectively give larger induced voltage. Moreover, as the translator speed increase the induced voltage increased.

  4. Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.

    Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J

    2017-10-01

    Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.

  5. The study, design and simulation of a free piston Stirling engine linear alternatorThe study, design and simulation of a free piston Stirling engine linear alternator

    Teodora Susana Oros

    2014-12-01

    Full Text Available This paper presents a study, design and simulation of a Free Piston Stirling Engine Linear Alternator. There are presented the main steps of the magnetic and electric calculations for a permanent magnet linear alternator of fixed coil and moving magnets type. Finally, a detailed thermal, mechanical and electrical model for a Stirling engine linear alternator have been made in SIMULINK simulation program. The linear alternator simulation model uses a controllable DC voltage which simulates the linear alternator combined with a rectifier, a variable load and a DC-DC converter, which compensates for the variable nature of Stirling engine operation, and ensures a constant voltage output regardless of the load.

  6. Low start-up voltage dc–dc converter with negative voltage control for thermoelectric energy harvesting

    Pui-Sun Lei

    2015-01-01

    Full Text Available This Letter presents a low start-up voltage dc–dc converter for low-power thermoelectric systems which uses a native n-type MOS transistor as the start-up switch. The start-up voltage of the proposed converter is 300 mV and the converter does not need batteries to start up. The negative voltage control is proposed to reduce the leakage current caused by native n-type transistor and increase the efficiency. The proposed converter was designed using standard 0.18 µm CMOS process with chip size of 0.388 mm^2. The peak efficiency is 63% at load current of 1.5 mA. The proposed converter provides output voltage >1 V at maximum load current of 3.2 mA.

  7. Non-linear osmosis

    Diamond, Jared M.

    1966-01-01

    1. The relation between osmotic gradient and rate of osmotic water flow has been measured in rabbit gall-bladder by a gravimetric procedure and by a rapid method based on streaming potentials. Streaming potentials were directly proportional to gravimetrically measured water fluxes. 2. As in many other tissues, water flow was found to vary with gradient in a markedly non-linear fashion. There was no consistent relation between the water permeability and either the direction or the rate of water flow. 3. Water flow in response to a given gradient decreased at higher osmolarities. The resistance to water flow increased linearly with osmolarity over the range 186-825 m-osM. 4. The resistance to water flow was the same when the gall-bladder separated any two bathing solutions with the same average osmolarity, regardless of the magnitude of the gradient. In other words, the rate of water flow is given by the expression (Om — Os)/[Ro′ + ½k′ (Om + Os)], where Ro′ and k′ are constants and Om and Os are the bathing solution osmolarities. 5. Of the theories advanced to explain non-linear osmosis in other tissues, flow-induced membrane deformations, unstirred layers, asymmetrical series-membrane effects, and non-osmotic effects of solutes could not explain the results. However, experimental measurements of water permeability as a function of osmolarity permitted quantitative reconstruction of the observed water flow—osmotic gradient curves. Hence non-linear osmosis in rabbit gall-bladder is due to a decrease in water permeability with increasing osmolarity. 6. The results suggest that aqueous channels in the cell membrane behave as osmometers, shrinking in concentrated solutions of impermeant molecules and thereby increasing membrane resistance to water flow. A mathematical formulation of such a membrane structure is offered. PMID:5945254

  8. Improved linearity in AlGaN/GaN metal-insulator-semiconductor high electron mobility transistors with nonlinear polarization dielectric

    Gao, Tao; Xu, Ruimin; Kong, Yuechan; Zhou, Jianjun; Kong, Cen; Dong, Xun; Chen, Tangsheng

    2015-01-01

    We demonstrate highly improved linearity in a nonlinear ferroelectric of Pb(Zr 0.52 Ti 0.48 )-gated AlGaN/GaN metal-insulator-semiconductor high electron mobility transistor (MIS-HEMT). Distinct double-hump feature in the transconductance-gate voltage (g m -V g ) curve is observed, yielding remarkable enhancement in gate voltage swing as compared to MIS-HEMT with conventional linear gate dielectric. By incorporating the ferroelectric polarization into a self-consistent calculation, it is disclosed that in addition to the common hump corresponding to the onset of electron accumulation, the second hump at high current level is originated from the nonlinear polar nature of ferroelectric, which enhances the gate capacitance by increasing equivalent dielectric constant nonlinearly. This work paves a way for design of high linearity GaN MIS-HEMT by exploiting the nonlinear properties of dielectric

  9. Improved linearity in AlGaN/GaN metal-insulator-semiconductor high electron mobility transistors with nonlinear polarization dielectric

    Gao, Tao [Fundamental Science on EHF Laboratory, University of Electronic Science and Technology of China (UESTC), Chengdu 611731 (China); Science and Technology on Monolithic Integrated Circuits and Modules Laboratory, Nanjing Electronic Devices Institute, Nanjing 210016 (China); Xu, Ruimin [Fundamental Science on EHF Laboratory, University of Electronic Science and Technology of China (UESTC), Chengdu 611731 (China); Kong, Yuechan, E-mail: kycfly@163.com; Zhou, Jianjun; Kong, Cen; Dong, Xun; Chen, Tangsheng [Science and Technology on Monolithic Integrated Circuits and Modules Laboratory, Nanjing Electronic Devices Institute, Nanjing 210016 (China)

    2015-06-15

    We demonstrate highly improved linearity in a nonlinear ferroelectric of Pb(Zr{sub 0.52}Ti{sub 0.48})-gated AlGaN/GaN metal-insulator-semiconductor high electron mobility transistor (MIS-HEMT). Distinct double-hump feature in the transconductance-gate voltage (g{sub m}-V{sub g}) curve is observed, yielding remarkable enhancement in gate voltage swing as compared to MIS-HEMT with conventional linear gate dielectric. By incorporating the ferroelectric polarization into a self-consistent calculation, it is disclosed that in addition to the common hump corresponding to the onset of electron accumulation, the second hump at high current level is originated from the nonlinear polar nature of ferroelectric, which enhances the gate capacitance by increasing equivalent dielectric constant nonlinearly. This work paves a way for design of high linearity GaN MIS-HEMT by exploiting the nonlinear properties of dielectric.

  10. Force and Motion Characteristics of Contamination Particles near the High Voltage End of UHVDC Insulator

    Lei Lan

    2017-07-01

    Full Text Available It is important to reveal the relations of physical factors to deposition of contaminants on insulator. In this paper, the simulation model of high voltage end of insulator was established to study the force and motion characteristics of particles affected by electric force and airflow drag force near the ultra-high voltage direct current (UHVDC insulator. By finite element method, the electric field was set specially to be similar to the one near practical insulator, the steady fluid field was simulated. The electric force and air drag force were loaded on the uniformly charged particles. The characteristics of the two forces on particles, the relationship between quantity of electric charge on particles and probability of particles contacting the insulator were analyzed. It was found that, near the sheds, airflow drag force on particles is significantly greater than electric force with less electric charge. As the charge multiplies, electric force increases linearly, airflow drag force grows more slowly. There is a trend that the magnitude of electric force and drag force is going to similar. Meanwhile, the probability of particles contacting the insulator is increased too. However, at a certain level of charge which has different value with different airflow velocity, the contact probability has extremum here. After exceeding the value, as the charge increasing, the contact probability decreases gradually.

  11. Voltage distribution in tapered winding of tesla-transformer during discharge process of PFL

    Xin Jiaqi; Chang Anbi; Li Mingjia; Kang Qiang

    2007-01-01

    The operation principle of integral construction of Tesla transformer and PFL was investigated in Tesla-transformer-type accelerator. Experiment was carried out on Tesla transformer's secondary winding to study the impulse voltage distribution while PFL was discharging. The regularities of turn-ground voltage distribution and interturn voltage distribution were summarized. Voltage distribution within PFL was calculated and it was compared with the experimental result. Structural winding of parallel coils in the head, parallel coils in the end and shading ring were used to improve voltage distribution and that was testified by experiment. The results indicate that taper winding doesn't effect electric field within PFL, the turn-ground voltage appears linearly, the interturn voltage fluctuates seriously and it is the biggest in head of winding. The three optimized methods help to depress oscillation, the structural winding of parallel coils in the head decreases the interturn voltage in head of winding remark-ably and the parallel coils in the end decrease the interturn voltage in the end. (authors)

  12. The eGo grid model: An open source approach towards a model of German high and extra-high voltage power grids

    Mueller, Ulf Philipp; Wienholt, Lukas; Kleinhans, David; Cussmann, Ilka; Bunke, Wolf-Dieter; Pleßmann, Guido; Wendiggensen, Jochen

    2018-02-01

    There are several power grid modelling approaches suitable for simulations in the field of power grid planning. The restrictive policies of grid operators, regulators and research institutes concerning their original data and models lead to an increased interest in open source approaches of grid models based on open data. By including all voltage levels between 60 kV (high voltage) and 380kV (extra high voltage), we dissolve the common distinction between transmission and distribution grid in energy system models and utilize a single, integrated model instead. An open data set for primarily Germany, which can be used for non-linear, linear and linear-optimal power flow methods, was developed. This data set consists of an electrically parameterised grid topology as well as allocated generation and demand characteristics for present and future scenarios at high spatial and temporal resolution. The usability of the grid model was demonstrated by the performance of exemplary power flow optimizations. Based on a marginal cost driven power plant dispatch, being subject to grid restrictions, congested power lines were identified. Continuous validation of the model is nescessary in order to reliably model storage and grid expansion in progressing research.

  13. Analyzing randomly occurring voltage breakdowns

    Wiltshire, C.W.

    1977-01-01

    During acceptance testing of high-vacuum neutron tubes, 40% of the tubes failed after experiencing high-voltage breakdowns during the aging process. Use of a digitizer in place of an oscilloscope revealed two types of breakdowns, only one of which affected acceptance testing. This information allowed redesign of the aging sequence to prevent tube damage and improve yield and quality of the final product

  14. Advances in high voltage engineering

    Haddad, A

    2005-01-01

    This book addresses the very latest research and development issues in high voltage technology and is intended as a reference source for researchers and students in the field, specifically covering developments throughout the past decade. This unique blend of expert authors and comprehensive subject coverage means that this book is ideally suited as a reference source for engineers and academics in the field for years to come.

  15. High-voltage CMOS detectors

    Ehrler, F.; Blanco, R.; Leys, R.; Perić, I.

    2016-01-01

    High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.

  16. Low voltage electron beam accelerators

    Ochi, Masafumi

    2003-01-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  17. High-voltage CMOS detectors

    Ehrler, F., E-mail: felix.ehrler@student.kit.edu; Blanco, R.; Leys, R.; Perić, I.

    2016-07-11

    High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.

  18. Low voltage electron beam accelerators

    Ochi, Masafumi [Iwasaki Electric Co., Ltd., Tokyo (Japan)

    2003-02-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  19. Light-voltage conversion apparatus

    Fujioka, Yoshiki

    1987-09-19

    In a light-voltage conversion unit, when input signal is applied, the output signal to the control circuit has quick rise-up time and slow breaking time. In order to improve this, a short-circuit transistor is placed at the diode, and this transistor is forced ON, when an output signal to the control circuit is lowered down to a constant voltage, to short-circuit between the output terminals. This, however, has a demerit of high power consumption by a transistor. In this invention, by connecting a light-emitting element which gets ON at the first transition and a light-emitting element which gets ON at the last transition, placing a light receiving element in front of each light-emitting element, when an input signal is applied; thus a load is driven only with ON signal of each light-emitting element, eliminating the delay in the last transition. All of these give a quick responsive light-voltage conversion without unnecessary power consumption. (5 figs)

  20. The SLAC linear collider

    Phinney, N.

    1992-01-01

    The SLAC Linear Collider has begun a new era of operation with the SLD detector. During 1991 there was a first engineering run for the SLD in parallel with machine improvements to increase luminosity and reliability. For the 1992 run, a polarized electron source was added and more than 10,000 Zs with an average of 23% polarization have been logged by the SLD. This paper discusses the performance of the SLC in 1991 and 1992 and the technical advances that have produced higher luminosity. Emphasis will be placed on issues relevant to future linear colliders such as producing and maintaining high current, low emittance beams and focusing the beams to the micron scale for collisions. (Author) tab., 2 figs., 18 refs

  1. SYNTHESIS OF VOLTAGES OF UNIFORM PWM IN TIME REGULATION

    A. G. Stryzhniou

    2014-01-01

    Full Text Available The article describes a process of synthesis and qualitative assessment of the harmonic composition of voltages of multiple and single PWM pulses in time regulation, being, along with amplitude, frequency and phase method, one of control methods of an asynchronous motor. The main point of time regulation is that a pause after any two single PWM pulses with different polarity or after any two groups of multiple PWM pulses with different polarity changes during a process of regulation. Feature of time regulation is that a motor has fast response in the range of small-signal of control and good linearity of speed-torque characteristics in the whole control range. Analytical expressions of parameters of PWM pulses ai and ti are obtained which allow to simplify considerably a process of formation and implementation of time regulation using tabular or indexed-tabular methods. These expressions allow not only to define voltage amplitude of  harmonic but also to perform qualitative assessment of harmonic composition of output voltages at time regulation. It is specified that harmonic frequencies wi = w0/q change in inverse proportion to magnitude of parameter q during a process of regulation and there is a replacement of a fundamental frequency by frequencies of higher harmonics.The offered approach allows to synthesize voltage of uniform single and multiple PWM pulses and to perform their comparative and qualitative analysis and the obtained expressions can be used at modeling of AC motor work. Voltage of multiple PWM pulses which is formed using stepped reference voltage with even quantity of steps in a half period and a pause on a zero level has the best parameters by criterion of a minimum of harmonic components and a maximum of a factor of anharmonicity Kнс at time regulation.

  2. [Development of residual voltage testing equipment].

    Zeng, Xiaohui; Wu, Mingjun; Cao, Li; He, Jinyi; Deng, Zhensheng

    2014-07-01

    For the existing measurement methods of residual voltage which can't turn the power off at peak voltage exactly and simultaneously display waveforms, a new residual voltage detection method is put forward in this paper. First, the zero point of the power supply is detected with zero cross detection circuit and is inputted to a single-chip microcomputer in the form of pulse signal. Secend, when the zero point delays to the peak voltage, the single-chip microcomputer sends control signal to power off the relay. At last, the waveform of the residual voltage is displayed on a principal computer or oscilloscope. The experimental results show that the device designed in this paper can turn the power off at peak voltage and is able to accurately display the voltage waveform immediately after power off and the standard deviation of the residual voltage is less than 0.2 V at exactly one second and later.

  3. The application of structural nonlinearity in the development of linearly tunable MEMS capacitors

    Shavezipur, M; Khajepour, A; Hashemi, S M

    2008-01-01

    Electrostatically actuated parallel-plate tunable capacitors are the most desired MEMS capacitors because of their smaller sizes and higher Q-factors. However, these capacitors suffer from low tunability and exhibit high sensitivity near the pull-in voltage which counters the concept of tunability. In this paper, a novel design for parallel-plate tunable capacitors with high tunability and linear capacitance–voltage (C–V) response is developed. The design uses nonlinear structural rigidities to relieve intrinsic electrostatic nonlinearity in MEMS capacitors. Based on the force–displacement characteristic of an ideally linear capacitor, a real beam-like nonlinear spring model is developed. The variable stiffness coefficients of such springs improve the linearity of the C–V curve. Moreover, because the structural stiffness increases with deformations, the pull-in is delayed and higher tunability is achieved. Finite element simulations reveal that capacitors with air gaps larger than 4 µm and supporting beams thinner than 1 µm can generate highly linear C–V responses and tunabilities over 120%. Experimental results for capacitors fabricated by PolyMUMPs verify the effect of weak nonlinear geometric stiffness on improving the tunability for designs with a small air gap and relatively thick structural layers

  4. Characteristics and Breakdown Behaviors of Polysilicon Resistors for High Voltage Applications

    Xiao-Yu Tang

    2015-01-01

    Full Text Available With the rapid development of the power integrated circuit technology, polysilicon resistors have been widely used not only in traditional CMOS circuits, but also in the high voltage applications. However, there have been few detailed reports about the polysilicon resistors’ characteristics, like voltage and temperature coefficients and breakdown behaviors which are critical parameters of high voltage applications. In this study, we experimentally find that the resistance of the polysilicon resistor with a relatively low doping concentration shows negative voltage and temperature coefficients, while that of the polysilicon resistor with a high doping concentration has positive voltage and temperature coefficients. Moreover, from the experimental results of breakdown voltages of the polysilicon resistors, it could be deduced that the breakdown of polysilicon resistors is thermally rather than electrically induced. We also proposed to add an N-type well underneath the oxide to increase the breakdown voltage in the vertical direction when the substrate is P-type doped.

  5. A new approach to voltage sag detection based on wavelet transform

    Gencer, Oezguer; Oeztuerk, Semra; Erfidan, Tarik [Kocaeli University, Faculty of Engineering, Department of Electrical Engineering, Veziroglu Kampuesue, Eski Goelcuek Yolu, Kocaeli (Turkey)

    2010-02-15

    In this work, a new voltage sag detection method based on wavelet transform is developed. Voltage sag detection algorithms, so far have proved their efficiency and computational ability. Using several windowing techniques take long computational times for disturbance detection. Also researchers have been working on separating voltage sags from other voltage disturbances for the last decade. Due to increasing power quality standards new high performance disturbance detection algorithms are necessary to obtain high power quality standards. For this purpose, the wavelet technique is used for detecting voltage sag duration and magnitude. The developed voltage sag detection algorithm is implemented with high speed microcontroller. Test results show that, the new approach provides very accurate and satisfactory voltage sag detection. (author)

  6. Lightning Overvoltage on Low-Voltage Distribution System

    Michishita, Koji

    The portion of the faults of a medium-voltage line, cause by lightning, tends to increase with often reaching beyond 30%. However, due to the recent progress of the lightning protection design, the number of faults has decreased to 1/3 of that at 30 years ago. As for the low-voltage distribution line, the fault rate has been estimated primarily, although the details of the overvoltages have not been studied yet. For the further development of highly information-oriented society, improvement of reliability of electric power supply to the appliance in a low-voltage customer will be socially expected. Therefore, it is important to establish effective lightning protection design of the low-voltage distribution system, defined to be composed of lines having mutual interaction on the customers' electric circuits, such as a low-voltage distribution line, an antenna line and a telecommunication line. In this report, the author interprets the recent research on the lightning overvoltage on a low-voltage distribution system.

  7. A support vector machine (SVM) based voltage stability classifier

    Dosano, R.D.; Song, H. [Kunsan National Univ., Kunsan, Jeonbuk (Korea, Republic of); Lee, B. [Korea Univ., Seoul (Korea, Republic of)

    2007-07-01

    Power system stability has become even more complex and critical with the advent of deregulated energy markets and the growing desire to completely employ existing transmission and infrastructure. The economic pressure on electricity markets forces the operation of power systems and components to their limit of capacity and performance. System conditions can be more exposed to instability due to greater uncertainty in day to day system operations and increase in the number of potential components for system disturbances potentially resulting in voltage stability. This paper proposed a support vector machine (SVM) based power system voltage stability classifier using local measurements of voltage and active power of load. It described the procedure for fast classification of long-term voltage stability using the SVM algorithm. The application of the SVM based voltage stability classifier was presented with reference to the choice of input parameters; input data preconditioning; moving window for feature vector; determination of learning samples; and other considerations in SVM applications. The paper presented a case study with numerical examples of an 11-bus test system. The test results for the feasibility study demonstrated that the classifier could offer an excellent performance in classification with time-series measurements in terms of long-term voltage stability. 9 refs., 14 figs.

  8. Cell design for the DARHT linear induction accelerators

    Burns, M.; Allison, P.; Earley, L.; Liska, D.; Mockler, C.; Ruhe, J.; Tucker, H.; Walling, L.

    1991-01-01

    The Dual-Axis Radiographic Hydrotest (DARHT) facility will employ two linear induction accelerators to produce intense, bremsstrahlung x- ray pulses for flash radiography. The accelerator cell design for a 3- kA, 16--20 MeV, 60-ns flattop, high-brightness electron beam is presented. The cell is optimized for high-voltage stand-off while also minimizing the its transverse impedance. Measurements of high- voltage and rf characteristics are summarized. 7 refs., 5 figs

  9. Symmetric voltage-controlled variable resistance

    Vanelli, J. C.

    1978-01-01

    Feedback network makes resistance of field-effect transistor (FET) same for current flowing in either direction. It combines control voltage with source and load voltages to give symmetric current/voltage characteristics. Since circuit produces same magnitude output voltage for current flowing in either direction, it introduces no offset in presense of altering polarity signals. It is therefore ideal for sensor and effector circuits in servocontrol systems.

  10. Ultra Low-Voltage Energy Harvesting

    2013-09-01

    if in a solar battery charger the level of illumination were to drop due to cloud cover, the diode would prevent discharging of the battery when...the source voltage becomes lower than battery voltage. The drawback of a simple circuit like this is that once the source voltage is lower than the...longer charged when the battery voltage is above the OV setting. Figure 13. Block diagram of BQ25504 circuit . (From [10]) 18 THIS PAGE

  11. Voltage gradient mapping and electrophysiologically guided cryoablation in children with AVNRT.

    Drago, Fabrizio; Battipaglia, Irma; Russo, Mario Salvatore; Remoli, Romolo; Pazzano, Vincenzo; Grifoni, Gino; Allegretti, Greta; Silvetti, Massimo Stefano

    2018-04-01

    Recently, voltage gradient mapping of Koch's triangle to find low-voltage connections, or 'voltage bridges', corresponding to the anatomic position of the slow pathway, has been introduced as a method to ablate atrioventricular nodal reentry tachycardia (AVNRT) in children. Thus, we aimed to assess the effectiveness of voltage mapping of Koch's triangle, combined with the search for the slow potential signal in 'low-voltage bridges', to guide cryoablation of AVNRT in children. From June 2015 to May 2016, 35 consecutive paediatric patients (mean age 12.1 ± 4.5 years) underwent 3D-guided cryoablation of AVNRT at our Institution. Fifteen children were enrolled as control group (mean age 14 ± 4 years). A voltage gradient mapping of Koch's triangle was obtained in all patients, showing low-voltage connections in all children with AVNRT but not in controls. Prior to performing cryoablation, we looked for the typical 'hump and spike' electrogram, generally considered to be representative of slow pathway potential within a low-voltage bridge. In all patients the 'hump and spike' electrogram was found inside bridges of low voltage. Focal or high-density linear lesions, extended or not, were delivered guided by low-voltage bridge visualization. Acute success rate was 100%, and no recurrence was reported at a mean follow-up of 8 ± 3 months. Voltage gradient mapping of Koch's triangle, combined with the search for the slow potential signal in low-voltage bridges, is effective in guiding cryoablation of AVNRT in paediatric patients, with a complete acute success rate and no AVNRT recurrences at mid-term follow-up.

  12. LINEAR2007, Linear-Linear Interpolation of ENDF Format Cross-Sections

    2007-01-01

    1 - Description of program or function: LINEAR converts evaluated cross sections in the ENDF/B format into a tabular form that is subject to linear-linear interpolation in energy and cross section. The code also thins tables of cross sections already in that form. Codes used subsequently need thus to consider only linear-linear data. IAEA1311/15: This version include the updates up to January 30, 2007. Changes in ENDF/B-VII Format and procedures, as well as the evaluations themselves, make it impossible for versions of the ENDF/B pre-processing codes earlier than PREPRO 2007 (2007 Version) to accurately process current ENDF/B-VII evaluations. The present code can handle all existing ENDF/B-VI evaluations through release 8, which will be the last release of ENDF/B-VI. Modifications from previous versions: - Linear VERS. 2007-1 (JAN. 2007): checked against all ENDF/B-VII; increased page size from 60,000 to 600,000 points 2 - Method of solution: Each section of data is considered separately. Each section of File 3, 23, and 27 data consists of a table of cross section versus energy with any of five interpolation laws. LINEAR will replace each section with a new table of energy versus cross section data in which the interpolation law is always linear in energy and cross section. The histogram (constant cross section between two energies) interpolation law is converted to linear-linear by substituting two points for each initial point. The linear-linear is not altered. For the log-linear, linear-log and log- log laws, the cross section data are converted to linear by an interval halving algorithm. Each interval is divided in half until the value at the middle of the interval can be approximated by linear-linear interpolation to within a given accuracy. The LINEAR program uses a multipoint fractional error thinning algorithm to minimize the size of each cross section table

  13. Justifying threshold voltage definition for undoped body transistors through 'crossover point' concept

    Baruah, Ratul Kumar; Mahapatra, Santanu

    2009-01-01

    Two different definitions, one is potential based and the other is charge based, are used in the literatures to define the threshold voltage of undoped body symmetric double gate transistors. This paper, by introducing a novel concept of crossover point, proves that the charge based definition is more accurate than the potential based definition. It is shown that for a given channel length the potential based definition predicts anomalous change in threshold voltage with body thickness variation while the charge based definition results in monotonous change. The threshold voltage is then extracted from drain current versus gate voltage characteristics using linear extrapolation, transconductance and match-point methods. In all the three cases it is found that trend of threshold voltage variation support the charge based definition.

  14. Linearly constrained minimax optimization

    Madsen, Kaj; Schjær-Jacobsen, Hans

    1978-01-01

    We present an algorithm for nonlinear minimax optimization subject to linear equality and inequality constraints which requires first order partial derivatives. The algorithm is based on successive linear approximations to the functions defining the problem. The resulting linear subproblems...

  15. Voltage Quality of Grid Connected Wind Turbines

    Chen, Zhe; Blaabjerg, Frede; Sun, Tao

    2004-01-01

    Grid connected wind turbines may cause quality problems, such as voltage variation and flicker. This paper discusses the voltage variation and flicker emission of grid connected wind turbines with doubly-fed induction generators. A method to compensate flicker by using a voltage source converter...

  16. Manufacturing technology for practical Josephson voltage normals

    Kohlmann, Johannes; Kieler, Oliver

    2016-01-01

    In this contribution we present the manufacturing technology for the fabrication of integrated superconducting Josephson serial circuits for voltage normals. First we summarize some foundations for Josephson voltage normals and sketch the concept and the setup of the circuits, before we describe the manufacturing technology form modern practical Josephson voltage normals.

  17. 49 CFR 234.221 - Lamp voltage.

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Lamp voltage. 234.221 Section 234.221 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION..., Inspection, and Testing Maintenance Standards § 234.221 Lamp voltage. The voltage at each lamp shall be...

  18. Bootstrapped Low-Voltage Analog Switches

    Steensgaard-Madsen, Jesper

    1999-01-01

    Novel low-voltage constant-impedance analog switch circuits are proposed. The switch element is a single MOSFET, and constant-impedance operation is obtained using simple circuits to adjust the gate and bulk voltages relative to the switched signal. Low-voltage (1-volt) operation is made feasible...

  19. Novel Step-Up DC/DC Converter with No Right Half Plane Zero and Reduced Switched Voltage Stress Characteristics

    Mostaan, Ali; Alizadeh, Ebrahim; Soltani, Mohsen

    2014-01-01

    and the voltage transfer gain is obtained. It is also demonstrated that the voltage stress on all semiconductor devices is restricted to input voltage which allows the utilization of a power switch with lower drain source resistance. In order to further increase the voltage gain another switched capacitor voltage......Novel step-up DC/DC converter is introduced in this paper. This converter is realized with adding the switched capacitor voltage multiplier cell to the three switch step-down DC/DC converter that has been proposed in the literature. The proposed converter is analyzed in the steady state...

  20. Voltage current characteristics of type III superconductors

    Dorofejev, G. L.; Imenitov, A. B.; Klimenko, E. Yu.

    1980-06-01

    An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogenious monofilament and multifilament Nb-Ti, Nb-Zr, Nb 3Sn wires were investigated in different ranges of magnetic field, temperature and current. The longitudinal electric field for homogenious wires may be described by E=J ρnexp- T c/T 0+ T/T 0+ B/B 0+ J/J 0, where To, Bo, Jo are the increasing parameters, which depend weakly on B and T, of the electric field. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (ie the surface corresponding to a certain conventional effective resistivity in T, B, J - space) and a description of any increasing parameter that depends on B and T.

  1. Intelligent voltage control in a DC micro-grid containing PV generation and energy storage

    Rouzbehi, Kumars; Miranian, Arash; Candela García, José Ignacio; Luna Alloza, Álvaro; Rodríguez Cortés, Pedro

    2014-01-01

    This paper proposes an intelligent control scheme for DC voltage regulationin a DC micro-grid integrating photovoltaic (PV) generation, energy storage and electric loads. The maximum power generation of the PV panel is followed using the incremental conductance (IC) maximum power point tracking (MPPT) algorithm while a high-performance local linear controller (LLC)is developed for the DC voltage control in the micro-grid.The LLC, as a data-driven control strategy, controls the bidirectional c...

  2. Reference voltage calculation method based on zero-sequence component optimisation for a regional compensation DVR

    Jian, Le; Cao, Wang; Jintao, Yang; Yinge, Wang

    2018-04-01

    This paper describes the design of a dynamic voltage restorer (DVR) that can simultaneously protect several sensitive loads from voltage sags in a region of an MV distribution network. A novel reference voltage calculation method based on zero-sequence voltage optimisation is proposed for this DVR to optimise cost-effectiveness in compensation of voltage sags with different characteristics in an ungrounded neutral system. Based on a detailed analysis of the characteristics of voltage sags caused by different types of faults and the effect of the wiring mode of the transformer on these characteristics, the optimisation target of the reference voltage calculation is presented with several constraints. The reference voltages under all types of voltage sags are calculated by optimising the zero-sequence component, which can reduce the degree of swell in the phase-to-ground voltage after compensation to the maximum extent and can improve the symmetry degree of the output voltages of the DVR, thereby effectively increasing the compensation ability. The validity and effectiveness of the proposed method are verified by simulation and experimental results.

  3. Regulation of the Output Voltage of an Inverter in Case of Load Variation

    Diouri, Omar; Errahimi, Fatima; Es-Sbai, Najia

    2018-05-01

    In a DC/AC photovoltaic application, the stability of the output voltage of the inverter plays a very important role in the electrical systems. Such a photovoltaic system is constituted by an inverter, which makes it possible to convert the continuous energy to the alternative energy used in systems which operate under a voltage of 230V. The output of this inverter can be connected to a single load or more, at which time a second load is added in parallel with the first load. In this case, it proves a voltage drop at the output of the inverter. This problem influences the proper functioning of the electrical loads. Therefore, our contribution is to give a solution to this by compensating this voltage drop using a boost converter at the input of the inverter. This boost converter will play the role of the compensator that will provide the necessary voltage to the inverter in order to increase the voltage across the loads. But the use of this boost without controlling it is not enough because it generates a voltage that depends on the duty cycle of the control signal. To stabilize the output voltage of the inverter, we used a Proportional, Integral, and Derivative control (PID), which makes it possible to generate the necessary control signal for the voltage boost in order to have a good regulation of the output voltage of the inverter. Finally, we have solved the problem of the voltage drop even though there is loads variation.

  4. Spike voltage topography in temporal lobe epilepsy.

    Asadi-Pooya, Ali A; Asadollahi, Marjan; Shimamoto, Shoichi; Lorenzo, Matthew; Sperling, Michael R

    2016-07-15

    We investigated the voltage topography of interictal spikes in patients with temporal lobe epilepsy (TLE) to see whether topography was related to etiology for TLE. Adults with TLE, who had epilepsy surgery for drug-resistant seizures from 2011 until 2014 at Jefferson Comprehensive Epilepsy Center were selected. Two groups of patients were studied: patients with mesial temporal sclerosis (MTS) on MRI and those with other MRI findings. The voltage topography maps of the interictal spikes at the peak were created using BESA software. We classified the interictal spikes as polar, basal, lateral, or others. Thirty-four patients were studied, from which the characteristics of 340 spikes were investigated. The most common type of spike orientation was others (186 spikes; 54.7%), followed by lateral (146; 42.9%), polar (5; 1.5%), and basal (3; 0.9%). Characteristics of the voltage topography maps of the spikes between the two groups of patients were somewhat different. Five spikes in patients with MTS had polar orientation, but none of the spikes in patients with other MRI findings had polar orientation (odds ratio=6.98, 95% confidence interval=0.38 to 127.38; p=0.07). Scalp topographic mapping of interictal spikes has the potential to offer different information than visual inspection alone. The present results do not allow an immediate clinical application of our findings; however, detecting a polar spike in a patient with TLE may increase the possibility of mesial temporal sclerosis as the underlying etiology. Copyright © 2016 Elsevier B.V. All rights reserved.

  5. Power Quality Assessment in Real Shipboard Microgrid Systems under Unbalanced and Harmonic AC Bus Voltage

    Liu, Wenzhao; Tarasiuk, Tomasz; Gorniak, Mariusz

    2018-01-01

    were proposed and carried out in a real ship under sea-going conditions to address this problem. The ship experimental results were presented and discussed considering non-linear bow thruster load and high power ballast pump loads under unbalanced and harmonic voltage conditions. In addition......, the analysis of voltage transient dips during ballast pump starting up is presented. Further, the voltage/current distortions of working generator, bow thruster and pump loads are analyzed. The paper provides a valuable analysis for coping with PQ issues in the real ship power system....

  6. Universal Voltage Conveyor and Current Conveyor in Fast Full-Wave Rectifier

    Josef Burian

    2012-12-01

    Full Text Available This paper deals about the design of a fast voltage-mode full-wave rectifier, where universal voltage conveyor and second-generation current conveyor are used as active elements. Thanks to the active elements, the input and output impedance of the non-linear circuit is infinitely high respectively zero in theory. For the rectification only two diodes and three resistors are required as passive elements. The performance of the circuit is shown on experimental measurement results showing the dynamic range, time response, frequency dependent DC transient value and RMS error for different values of input voltage amplitudes.

  7. Preliminary Modeling of Permanent Magnet Probe Flowmeter for Voltage Signal Estimation

    Jeong, Uiju; Kim, Sung Joong [Hanyang Univ., Seoul (Korea, Republic of); Jeong, Ji Young; Kim, Tae Joon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2013-10-15

    An experimental study on performance analysis of the flowmeter has been performed. The study shows that sodium flow rate is linearly proportional to the induced voltage signal from the flowmeter under the turbulent flow condition. The experimental results support its availability in the PDRC system. But, the flowmeter should be able to measure sodium flow at low Reynolds number as well. That is because the PDRC system uses sodium natural convection for its operation. Thus, calibration of the flowmeter should be done at very low sodium flow rates. However, Von Weissenfluh et al. showed that the relationship between flow rate and measured voltage signal from the flowmeter may become non-linear at very low flow rates. The nonlinearity restricts the utilization of level sensor which provide reference flow rate in the calibration experiment. The primary objective of this study is to predict the sodium flow rate range where the induced voltage signals are linearly proportional to flow rates by estimating the induced voltage signals against sodium flow rates for a wide range of flows numerically. A commercial code FLUENT is adopted for the analysis of flow field. And MAXWELL which is an electromagnetic analysis software using a finite volume method has been used to analyze the magnetic field generated by permanent magnet of the flowmeter. The induced voltage signals have been estimated by coupling the sodium flow field and the magnetic field using FLUENT MHD module. It is expected that the PMPF voltage signals are linearly proportional to flow rates range of 0.0059 to 1.96 lps. This suggests that simple calibration technique using the linearity between flow rate and the voltage signal can be adopted in calibration of the PMPF.

  8. Transmission congestion and voltage profile management coordination in competitive electricity markets

    Yamin, H.Y.; Shahidehpour, S.M.

    2003-01-01

    This paper describes a generalized active/reactive iterative coordination process between GENCOs and the Independent System Operator (ISO) for active (transmission congestion) and reactive (voltage profile) management in the day-ahead market. GENCOs apply priced-based unit commitment without transmission and voltage security constraints, schedule their units and submit their initial bids to the ISO. The ISO executes congestion and voltage profile management for eliminating transmission and voltage profile violations. If violations are not eliminated, the ISO minimizes the transmission and voltage profile violations and sends a signal via the Internet to GENCOs. GENCOs reschedule their units taking into account the ISO signals and submit modified bids to the ISO. The voltage problem is addressed and a linear model is formulated and used in the proposed method. The voltage problem is formulated as a linear programming with a block-angular structure and Dantzig-Wolfe decomposition is applied to generate several smaller problems for a faster and easier solution of large-scale power systems. Two 36 unit GENCOs are used to demonstrate the performance of the proposed generalized active/reactive coordination algorithm. (author)

  9. The experiment of grid characteristics for high-voltage radiography of chest

    Kim, Jung Min; Ahn, Bong Seon

    1992-01-01

    Grids can improve the diagnostic quality of chest radiography by trapping the greater part of scattered radiation thus providing more detailed chest radiographic images. It is most effective method of reduce the scatter ratio but must increase the expour factor. The benefit of use of grid is improve the contrast and the loss is increase of patient dose. In chest radiography especially hard quality high voltage radiography it will have to be considered to select the optimum grid with view point of benefit and loss. In this experiment, auther got some result of characteristics about 4 different grids with film method. 1. There was no difference the scatter ratio in case of no grid and the scatter ratio was about 60 % 2. 16 : 1 grid was excellent of scatter reduction factor in high voltage chest radiography, next was 10 : 1, CROSS, MICRO FINE grid have low scatter reduction rate compare to 16:1,10:1 grid. 3. The bucky factor of CROSS grid in accordance of kVp was find out the highest in 4 grids, on the contrary 10 : 1 grid was profitable to the. exposure does. 4. With careful consideration in the point of scatter reduction rate and bucky factor, auther suggest the 10 : 1 linear grid on the use of chest radiography in 80∼120 kVp, 16 : 1 grid in 120∼140 kVp

  10. Power angle control of grid-connected voltage source converter in a wind energy application

    Svensson, Jan [Chalmers Univ. of Technology, Goeteborg (Sweden). Dept. of Electric Power Engineering

    1996-12-31

    In this thesis, the connection of a voltage source converter to the grid in a wind energy application is examined. The possibility of using a cheap control system without grid current measurements, is investigated. The control method is based on controlling the voltage angle of the inverter, which governs the active power flow. The highest frequency of the power variation, coming from wind turbine, is approx. 5 Hz. Since the proposed control method easily can handle such power variations it is very well suited for wind turbine applications. The characteristics of the system depend on the DC-link capacitor, the grid filter inductance and resistance. Large values of the resistance damp the system well but increase the energy losses. A high inductance leads to a reduced harmonic level on the grid but makes the system slower. By using feed-forward of the generator/rectifier current signal, the performance is increased compared to an ordinary PI-control. Combining the Linear Quadratic (LQ) control method with Kalman filtered input signals, a robust control method with a good performance is obtained. The LQ controller controls both the phase displacement angle and the modulation index, resulting in higher bandwidth, and the typical power angle resonance at the grid frequency disappears. 22 refs, 109 figs, 14 tabs

  11. Piezoelectric self sensing actuators for high voltage excitation

    Grasso, E; Totaro, N; Janocha, H; Naso, D

    2013-01-01

    Self sensing techniques allow the use of a piezoelectric transducer simultaneously as an actuator and as a sensor. Such techniques are based on knowledge of the transducer behaviour and on measurements of electrical quantities, in particular voltage and charge. Past research work has mainly considered the linear behaviour of piezoelectric transducers, consequently restricting the operating driving voltages to low values. In this work a new self sensing technique is proposed which is able to perform self sensing reconstruction both at low and at high driving voltages. This technique, in fact, makes use of a hysteretic model to describe the nonlinear piezoelectric capacitance necessary for self sensing reconstruction. The capacitance can be measured and identified at the antiresonances of a vibrating structure with a good approximation. After providing a mathematical background to deal with the main aspects of self sensing, this technique is compared theoretically and experimentally to a typical linear one by using an aluminum plate with one bonded self sensing transducer and a positive position feedback (PPF) controller to verify the performance in self sensing based vibration control. (paper)

  12. Application of Minimum-time Optimal Control System in Buck-Boost Bi-linear Converters

    S. M. M. Shariatmadar

    2017-08-01

    Full Text Available In this study, the theory of minimum-time optimal control system in buck-boost bi-linear converters is described, so that output voltage regulation is carried out within minimum time. For this purpose, the Pontryagin's Minimum Principle is applied to find optimal switching level applying minimum-time optimal control rules. The results revealed that by utilizing an optimal switching level instead of classical switching patterns, output voltage regulation will be carried out within minimum time. However, transient energy index of increased overvoltage significantly reduces in order to attain minimum time optimal control in reduced output load. The laboratory results were used in order to verify numerical simulations.

  13. Voltage Management in Unbalanced Low Voltage Networks Using a Decoupled Phase-Tap-Changer Transformer

    Coppo, Massimiliano; Turri, Roberto; Marinelli, Mattia

    2014-01-01

    The paper studies a medium voltage-low voltage transformer with a decoupled on load tap changer capability on each phase. The overall objective is the evaluation of the potential benefits on a low voltage network of such possibility. A realistic Danish low voltage network is used for the analysis...

  14. 76 FR 70721 - Voltage Coordination on High Voltage Grids; Notice of Staff Workshop

    2011-11-15

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Staff Workshop Take notice that the Federal Energy Regulatory Commission will hold a Workshop on Voltage Coordination on High Voltage Grids on Thursday, December 1, 2011...

  15. Foundations of linear and generalized linear models

    Agresti, Alan

    2015-01-01

    A valuable overview of the most important ideas and results in statistical analysis Written by a highly-experienced author, Foundations of Linear and Generalized Linear Models is a clear and comprehensive guide to the key concepts and results of linear statistical models. The book presents a broad, in-depth overview of the most commonly used statistical models by discussing the theory underlying the models, R software applications, and examples with crafted models to elucidate key ideas and promote practical model building. The book begins by illustrating the fundamentals of linear models,

  16. Experimental investigation of open circuit voltage during start-up process of HT-PEMFC

    Abdul Rasheed, Raj Kamal; Chan, Siew Hwa

    2015-01-01

    Highlights: • OCV reduces non-linearly with temperature under constant power input. • The reduction gradient of OCV is observed to be non-linear with time. • Nernst equation is less accurate for HT-PEMFC start-up models. - Abstract: This paper investigates the open circuit voltage (OCV) during the warm-up process of a high temperature proton exchange membrane fuel cell (HT-PEMFC) from 140 °C to the desired temperature of 180 °C, where the temperature increases with time. The heating strategy involves the external heating of the fuel cell with constant heat input rate. The commonly used Nernst equation, to predict the OCV of the fuel cell, is usually used in transient start-up models. Thus, this papers highlights the limitations of using the Nernst equation where the temperature increases transiently with time. A polybenzimidazole-based HTPEM single cell was set up and the OCV was measured under constant heating power supplied by an external source. A parametric study was done by varying the external heating power and the effect on the OCV was observed. The results showed that the OCV reduces non-linearly with respect to temperature, when the fuel cell is subjected to a constant heating power. This behaviour is clearly in contrast with the Nernst equation, which considers the temperature as steady state. For effective comparison, the OCV was also measured under steady state temperatures, showing an almost constant reduction gradient of ∼ −2.3×10 −4 V/°C. However, the behaviour under a constant heating power show curvilinear reduction of the OCV as the temperature increases. In addition, as the external heating power is increased, the degree of curvature of the OCV profile is greater. Thus, the results clearly indicate that the accuracy of using the Nernst equation in transient thermal start-up models can be improved, by considering a non linear behaviour, as shown in this paper.

  17. Piezo Voltage Controlled Planar Hall Effect Devices.

    Zhang, Bao; Meng, Kang-Kang; Yang, Mei-Yin; Edmonds, K W; Zhang, Hao; Cai, Kai-Ming; Sheng, Yu; Zhang, Nan; Ji, Yang; Zhao, Jian-Hua; Zheng, Hou-Zhi; Wang, Kai-You

    2016-06-22

    The electrical control of the magnetization switching in ferromagnets is highly desired for future spintronic applications. Here we report on hybrid piezoelectric (PZT)/ferromagnetic (Co2FeAl) devices in which the planar Hall voltage in the ferromagnetic layer is tuned solely by piezo voltages. The change of planar Hall voltage is associated with magnetization switching through 90° in the plane under piezo voltages. Room temperature magnetic NOT and NOR gates are demonstrated based on the piezo voltage controlled Co2FeAl planar Hall effect devices without the external magnetic field. Our demonstration may lead to the realization of both information storage and processing using ferromagnetic materials.

  18. Capacitor Voltages Measurement and Balancing in Flying Capacitor Multilevel Converters Utilizing a Single Voltage Sensor

    Farivar, Glen; Ghias, Amer M. Y. M.; Hredzak, Branislav

    2017-01-01

    This paper proposes a new method for measuring capacitor voltages in multilevel flying capacitor (FC) converters that requires only one voltage sensor per phase leg. Multiple dc voltage sensors traditionally used to measure the capacitor voltages are replaced with a single voltage sensor at the ac...... side of the phase leg. The proposed method is subsequently used to balance the capacitor voltages using only the measured ac voltage. The operation of the proposed measurement and balancing method is independent of the number of the converter levels. Experimental results presented for a five-level FC...

  19. Josephson tunneling current in the presence of a time-dependent voltage

    Harris, R.E.

    1975-01-01

    The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field

  20. Voltage-Gated Calcium Channels

    Zamponi, Gerald Werner

    Voltage Gated Calcium Channels is the first comprehensive book in the calcium channel field, encompassing over thirty years of progress towards our understanding of calcium channel structure, function, regulation, physiology, pharmacology, and genetics. This book balances contributions from many of the leading authorities in the calcium channel field with fresh perspectives from risings stars in the area, taking into account the most recent literature and concepts. This is the only all-encompassing calcium channel book currently available, and is an essential resource for academic researchers at all levels in the areas neuroscience, biophysics, and cardiovascular sciences, as well as to researchers in the drug discovery area.

  1. Water Electrolysis at Different Current - Voltage Regimes

    Kleperis, J.; Blums, J.; Vanags, M.

    2007-01-01

    Full text: Electrochemical impedance and volt-amperic methods were used to compare an efficiency of water electrolysis for different materials and different electrode configurations. Two and three electrode measurements were made, using standard calomel reference electrode. Non-standard capacitative electrolysis was analyzed in special cell made from cylindrical steel electrodes. Volt-amperic measurements from - 15V to +15V DC didn't indicated the presence of oxidation - reduction reactions when distilled water was used as electrolyte. Impedance measurements showed unusual frequency behavior when the AC voltage increased till 0.5V. Different nickel and carbon electrodes (plate, porous and textile - type) were used to learn classical Faraday electrolysis in strong alkali solutions. Flying increase of current was indicator of the presence of electrolysis, and characteristic potential was used differ between materials accordingly they effectiveness for usage in an electrolyser device. (Aithors)

  2. Charging and absorption characteristics of small particulates under alternative and electrostatic voltages in an electrostatic precipitator

    Jiang Xue-Dong; Xu He; Wang Xin

    2014-01-01

    The charge quantity of small particulates such as PM2.5 plays a key role in the collection efficiency of an electrostatic precipitator (ESP). Under a single electrostatic voltage, it is difficult to charge and absorb small particulates. A new method of superimposing an alternative voltage on the electrostatic voltage is provided in this paper. Characteristics of small particulates are analyzed under alternative and electrostatic voltages. It is demonstrated that an alternative voltage can significantly improve the collection efficiency in three aspects: preventing anti-corona, increasing the charge quantity of small particulates, and increasing the median particulate size by electric agglomeration. In addition, practical usage with the superposition of alternative voltage is provided, and the results are in agreement with the theoretical analysis. (physics of gases, plasmas, and electric discharges)

  3. Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

    Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

    2018-04-18

    Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

  4. Manipulating the voltage dependence of tunneling spin torques

    Manchon, Aurelien

    2012-10-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

  5. Quad-copter UAV BLDC Motor Control: Linear v/s non-linear control maps

    Deep Parikh

    2015-08-01

    Full Text Available This paper presents some investigations and comparison of using linear versus non-linear static motor-control maps for the speed control of a BLDC (Brush Less Direct Current motors used in quad-copter UAV (Unmanned Aerial Vehicles. The motor-control map considered here is the inverse of the static map relating motor-speed output to motor-voltage input for a typical out-runner type Brushless DC Motors (BLDCM.  Traditionally, quad-copter BLDC motor speed control uses simple linear motor-control map defined by the motor-constant specification. However, practical BLDC motors show non-linear characteristic, particularly when operated across wide operating speed-range as is commonly required in quad-copter UAV flight operations. In this paper, our investigations to compare performance of linear versus non-linear motor-control maps are presented. The investigations cover simulation-based and experimental study of BLDC motor speed control systems for  quad-copter vehicle available. First the non-linear map relating rotor RPM to motor voltage for quad-copter BLDC motor is obtained experimentally using an optical speed encoder. The performance of the linear versus non-linear motor-control-maps for the speed control are studied. The investigations also cover study of time-responses for various standard test input-signals e.g. step, ramp and pulse inputs, applied as the reference speed-commands. Also, simple 2-degree of freedom test-bed is developed in our laboratory to help test the open-loop and closed-loop experimental investigations. The non-linear motor-control map is found to perform better in BLDC motor speed tracking control performance and thereby helping achieve better quad-copter roll-angle attitude control.

  6. Design of a linear neutron source

    Buzarbaruah, N.; Dutta, N.J.; Bhardwaz, J.K.; Mohanty, S.R.

    2015-01-01

    Highlights: • This paper reports the design of a linear neutron source based on inertial electrostatic confinement fusion scheme. • The voltage and current that is to be applied to the grid is computed theoretically. • Neutron production rate is theoretically estimated and found to be of the order of 10 7 –10 8 neutrons/s. • Electric potential distribution and ion trajectories are studied using SIMION code. • Optimized condition for the inner grid transparency has been found out. - Abstract: In this paper, we present the design of a linear neutron source based on the concept of inertial electrostatic confinement fusion. The source mainly comprises of a concentric coaxial cylindrical grid assembly housed inside a double walled cylindrical vacuum chamber, a gas injection system, a high voltage feedthrough and a high voltage negative polarity power supply. The inner grid will be kept at a high negative potential with respect to the outer grid that will be grounded. The effect of grid transparency on electric potential distribution and ion trajectories has been studied using SIMION. A diffuse deuterium plasma will be initially created by making filament discharge and subsequently, on application of high negative voltage to the inner grid, deuterons will be accelerated towards the axis of the device. These deuterons will oscillate in the negative potential and consequently fuse in between the grids to produce neutrons. This source is expected to produce 10 7 –10 8 neutrons/s. The proposed linear neutron source will be operated both in the continuous and pulse modes and it will be utilized for a few near term applications namely fusion reactor material studies and explosive detection

  7. Application of active electrode compensation to perform continuous voltage-clamp recordings with sharp microelectrodes.

    Gómez-González, J F; Destexhe, A; Bal, T

    2014-10-01

    Electrophysiological recordings of single neurons in brain tissues are very common in neuroscience. Glass microelectrodes filled with an electrolyte are used to impale the cell membrane in order to record the membrane potential or to inject current. Their high resistance induces a high voltage drop when passing current and it is essential to correct the voltage measurements. In particular, for voltage clamping, the traditional alternatives are two-electrode voltage-clamp technique or discontinuous single electrode voltage-clamp (dSEVC). Nevertheless, it is generally difficult to impale two electrodes in a same neuron and the switching frequency is limited to low frequencies in the case of dSEVC. We present a novel fully computer-implemented alternative to perform continuous voltage-clamp recordings with a single sharp-electrode. To reach such voltage-clamp recordings, we combine an active electrode compensation algorithm (AEC) with a digital controller (AECVC). We applied two types of control-systems: a linear controller (proportional plus integrative controller) and a model-based controller (optimal control). We compared the performance of the two methods to dSEVC using a dynamic model cell and experiments in brain slices. The AECVC method provides an entirely digital method to perform continuous recording and smooth switching between voltage-clamp, current clamp or dynamic-clamp configurations without introducing artifacts.

  8. Extension algorithm for generic low-voltage networks

    Marwitz, S.; Olk, C.

    2018-02-01

    Distributed energy resources (DERs) are increasingly penetrating the energy system which is driven by climate and sustainability goals. These technologies are mostly connected to low- voltage electrical networks and change the demand and supply situation in these networks. This can cause critical network states. Network topologies vary significantly and depend on several conditions including geography, historical development, network design or number of network connections. In the past, only some of these aspects were taken into account when estimating the network investment needs for Germany on the low-voltage level. Typically, fixed network topologies are examined or a Monte Carlo approach is used to quantify the investment needs at this voltage level. Recent research has revealed that DERs differ substantially between rural, suburban and urban regions. The low-voltage network topologies have different design concepts in these regions, so that different network topologies have to be considered when assessing the need for network extensions and investments due to DERs. An extension algorithm is needed to calculate network extensions and investment needs for the different typologies of generic low-voltage networks. We therefore present a new algorithm, which is capable of calculating the extension for generic low-voltage networks of any given topology based on voltage range deviations and thermal overloads. The algorithm requires information about line and cable lengths, their topology and the network state only. We test the algorithm on a radial, a loop, and a heavily meshed network. Here we show that the algorithm functions for electrical networks with these topologies. We found that the algorithm is able to extend different networks efficiently by placing cables between network nodes. The main value of the algorithm is that it does not require any information about routes for additional cables or positions for additional substations when it comes to estimating

  9. Giant, Voltage-Actuated Deformation of a Dielectric Elastomer under Dead Load

    Huang, Jiangshui; Li, Tiefeng; Foo, Choon Chiang; Clarke, David R.; Zhu, Jian; Suo, Zhigang

    2012-01-01

    Far greater voltage-actuated deformation is achievable for a dielectric elastomer under equal-biaxial dead load than under rigid constraint usually employed. Areal strains of 488% are demonstrated. The dead load suppresses electric breakdown, enabling the elastomer to survive the snap-through electromechanical instability. The breakdown voltage is found to increase with the voltage ramp rate. A nonlinear model for viscoelastic dielectric elastomers is developed and shown to be consistent with...

  10. Impact of distributed generators on the power loss and voltage profile of sub-transmission network

    A.S.O. Ogunjuyigbe

    2016-05-01

    Full Text Available This paper presents the impact of distributed generator (DG on the power loss and voltage profile of sub-transmission network at different penetration levels (PLs. The various DG technologies are modeled based on their electrical output characteristics. Voltage profile index which allows a single value to represent how well the voltage matches the ideal value is developed. The index allows a fair comparison of the voltage profile obtained from different scenarios. The extent to which DGs affect power losses and voltage profile depend on the type of DG technology, PL and the location in which the DG is connected to the grid. The integration of DGs reduces power losses on the network, however, as the PL increases, the power losses begin to increase. A PL of 50–75% is achieved on 69 kV voltage level and 25–50% penetration on 13.8 kV voltage level without an increase in the power loss. Also more DG can be integrated into the network at point of common connection of higher voltage level compared to the low voltage level.

  11. Power conditioning using dynamic voltage restorers under different voltage sag types.

    Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

    2016-01-01

    Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

  12. Experimental study on the influence of radiation on high-voltage insulation gases

    Fujiwara, Yukio; Inoue, Takashi; Miyamoto, Kenji; Miyamoto, Naoki; Ohara, Yoshihiro; Okumura, Yoshikazu; Watanabe, Kazuhiro

    1999-12-01

    In a neutral beam injection (NBI) system for next generation tokamaks such as International Thermonuclear Experimental Reactor (ITER), insulation gas around a beam source will be irradiated with neutrons and gamma rays from the reactor. It is necessary to evaluate the influence of the radiation on the insulation gas for the engineering design of the ITER-NBI system. In the present paper, the influence of the 60 Co gamma rays on air, SF 6 , C 2 F 6 , CO 2 , and mixing gas of air and SF 6 was studied. Ionization current and voltage-holding characteristics of the gases were measured for an absorbed dose rate of 0.45 Gy/s using parallel disk electrodes whose diameter is 130 mm. Saturation current proved to increase linearly with a gap length between the electrodes, gas pressure, an absorbed dose rate, and molecular weight of the gases. Voltage-holding capability was degraded by about 10 %; the degree of the degradation did not depend on the absorbed dose rate. Dissociative products of SF 6 by the irradiation were also analyzed with a quadrupole mass spectrometer. News peaks that did not exist before irradiation appeared at the m/e of 48, 64, 67, 83, 86, 102, and 105 after irradiation. The amount of the dissociative products turned out to be saturated at a higher absorbed dose. (author)

  13. A Photostable Silicon Rhodamine Platform for Optical Voltage Sensing

    Huang, Yi-Lin; Walker, Alison S.; Miller, Evan W.

    2015-01-01

    This paper describes the design and synthesis of a photostable, far-red to near-infrared (NIR) platform for optical voltage sensing. We developed a new, sulfonated silicon rhodamine fluorophore and integrated it with a phenylenevinylene molecular wire to create a Berkeley Red Sensor of Transmembrane potential, or BeRST 1 (“burst”). BeRST 1 is the first member of a class of farred to NIR voltage sensitive dyes that make use of a photoinduced electron transfer (PeT) trigger for optical interrogation of membrane voltage. We show that BeRST 1 displays bright, membrane-localized fluorescence in living cells, high photostability, and excellent voltage sensitivity in neurons. Depolarization of the plasma membrane results in rapid fluorescence increases (24% ΔF/F per 100 mV). BeRST 1 can be used in conjunction with fluorescent stains for organelles, Ca2+ indicators, and voltage-sensitive fluorescent proteins. In addition, the red-shifted spectral profile of BeRST 1, relative to commonly employed optogenetic actuators like ChannelRhodopsin2 (ChR2), which require blue light, enables optical electrophysiology in neurons. The high speed, sensitivity, photostability and long-wavelength fluorescence profiles of BeRST 1 make it a useful platform for the non-invasive, optical dissection of neuronal activity. PMID:26237573

  14. Voltage harmonics mitigation through hybrid active power filer

    Sahito, A.A.; Tunio, S.M.; Khizer, A.N.

    2016-01-01

    Fast dynamic response, high efficiency, low cost and small size of power electronic converters have exponentially increased their use in modern power system which resulted in harmonically distorted voltage and currents. Voltage harmonics mainly caused by current harmonics are more dangerous as performance and expected operating life of other power system equipment are affected by harmonically distorted supply voltage. Electronic filter circuits are used to improve system power quality by mitigating adverse effects of harmonics. Hybrid filters having advantages of both passive and active filters are preferred to resolve the problem of harmonics efficiently and avoiding any chance of resonance. In this paper, a three phase three wire network is considered to supply an adjustable speed drive represented by a resistive load connected across a three phase bridge rectifier. Simulation of the considered system shows THD (Total Harmonic Distortion) of 18.91 and 7.61 percentage in supply current and voltage respectively. A HAPF (Hybrid Active Power Filter) is proposed to reduce these THD values below 5 percentage as recommended by IEEE Standard-519. P-Q theorem is used to calculate required parameters for proposed filter, which is implemented through hysteresis control. Simulation results confirm the effectiveness of the designed filter as THD for both current and voltage have reduced below allowable limit of 5 percentage. (author)

  15. Voltage Harmonics Mitigation through Hybrid Active Power Filter

    Anwer Ali Sahito

    2016-01-01

    Full Text Available Fast dynamic response, high efficiency, low cost and small size of power electronic converters have exponentially increased their use in modern power system which resulted in harmonically distorted voltage and currents. Voltage harmonics mainly caused by current harmonics are more dangerous as performance and expected operating life of other power system equipment are affected by harmonically distorted supply voltage. Electronic filter circuits are used to improve system power quality by mitigating adverse effects of harmonics. Hybrid filters having advantages of both passive and active filters are preferred to resolve the problem of harmonics efficiently and avoiding any chance of resonance. In this paper, a three phase three wire network is considered to supply an adjustable speed drive represented by a resistive load connected across a three phase bridge rectifier. Simulation of the considered system shows THD (Total Harmonic Distortion of 18.91 and 7.61% in supply current and voltage respectively. A HAPF (Hybrid Active Power Filter is proposed to reduce these THD values below 5% as recommended by IEEE Standard-519. P-Q theorem is used to calculate required parameters for proposed filter, which is implemented through hysteresis control. Simulation results confirm the effectiveness of the designed filter as THD for both current and voltage have reduced below allowable limit of 5%.

  16. High-voltage short-fall pulse generator

    Dolbilov, G.V.; Fateev, A.A.; Petrov, V.A.

    1986-01-01

    Powerful high-voltage pulses with short fall times and relatively low afterpulse amplitude are required for the deflection systems of accelerators. A generator is described that provides, into a 75-ohm load, a voltage pulse of up to 100 kV with a fall time of less than 1 nsec and a relative afterpulse amplitude of less than or equal to 15%. The generator employs a short-circuited ferrite-filled line in which shock waves are formed. A magnetic section is used to increase power. The switch is a TGI1-2500/50 thyratron. The main causes of afterpulses and methods for reducing their amplitude are examined

  17. Mass impregnation plant speeds high voltage cable production

    1965-05-07

    A mass impregnation and continuous sheath extrusion plant that will eliminate the long period of vacuum treatment usually required for high voltage oil-filled cables is among the latest techniques included in the new factory at Pirelli General's Eastleigh works. The new factory is said to be the first in Europe designed solely for the manufacture of the full range of oil-filled cables. Possible future increases of system voltages to about 750-kV ac or 1000-kV dc have been taken into account in the design of the works, so that only a small amount of modification and new plant will be involved.

  18. Copper wire theft and high voltage electrical burns

    Francis, Eamon C; Shelley, Odhran P

    2014-01-01

    High voltage electrical burns are uncommon. However in the midst of our economic recession we are noticing an increasing number of these injuries. Copper wire is a valuable commodity with physical properties as an excellent conductor of electricity making it both ubiquitous in society and prized on the black market. We present two consecutive cases referred to the National Burns Unit who sustained life threatening injuries from the alleged theft of high voltage copper wire and its omnipresence on an international scale. PMID:25356371

  19. High voltage load resistor array

    Lehmann, Monty Ray [Smithfield, VA

    2005-01-18

    A high voltage resistor comprising an array of a plurality of parallel electrically connected resistor elements each containing a resistive solution, attached at each end thereof to an end plate, and about the circumference of each of the end plates, a corona reduction ring. Each of the resistor elements comprises an insulating tube having an electrode inserted into each end thereof and held in position by one or more hose clamps about the outer periphery of the insulating tube. According to a preferred embodiment, the electrode is fabricated from stainless steel and has a mushroom shape at one end, that inserted into the tube, and a flat end for engagement with the end plates that provides connection of the resistor array and with a load.

  20. Voltage Estimation in Active Distribution Grids Using Neural Networks

    Pertl, Michael; Heussen, Kai; Gehrke, Oliver

    2016-01-01

    the observability of distribution systems has to be improved. To increase the situational awareness of the power system operator data driven methods can be employed. These methods benefit from newly available data sources such as smart meters. This paper presents a voltage estimation method based on neural networks...

  1. On Stability of Voltage Source Inverters in Weak Grids

    Adib, Aswad; Mirafza, Behrooz; Wang, Xiongfei

    2018-01-01

    As the number of inverters increases in the power grid, the stability of grid-tied inverters becomes an important concern for the power industry. In particular, a weak grid can lead to voltage fluctuations at the inverter terminals and consequently cause inverter instability. In this paper, impac...

  2. Theoretical analysis of magnetic sensor output voltage

    Liu Haishun; Dun Chaochao; Dou Linming; Yang Weiming

    2011-01-01

    The output voltage is an important parameter to determine the stress state in magnetic stress measurement, the relationship between the output voltage and the difference in the principal stresses was investigated by a comprehensive application of magnetic circuit theory, magnetization theory, stress analysis as well as the law of electromagnetic induction, and a corresponding quantitative equation was derived. It is drawn that the output voltage is proportional to the difference in the principal stresses, and related to the angle between the principal stress and the direction of the sensor. This investigation provides a theoretical basis for the principle stresses measurement by output voltage. - Research highlights: → A comprehensive investigation of magnetic stress signal. → Derived a quantitative equation about output voltage and the principal stresses. → The output voltage is proportional to the difference of the principal stresses. → Provide a theoretical basis for the principle stresses measurement.

  3. Partial discharge characteristics and mechanism in voids at impulse voltages

    Zhao, X F; Guo, Z F; Wang, Y Y; Li, J H; Li, Y M; Yao, X

    2011-01-01

    Partial discharge (PD) characteristics and mechanism in artificial cavities in an epoxy plate have been investigated for different void dimensions and impulse voltage waveforms. A differential measurement system was developed in order to detect PD current pulses effectively. Experimental results showed that the 50% probability PD inception voltage (PDIV 50 ) increases initially as the cavity diameter decreases at constant depth for double exponential impulses as well as oscillating impulses, but after aging, it becomes independent of the cavity diameter. Moreover, some distinctive characteristics of PD (e.g. main discharge and reverse discharge during the rise and fall phases of the applied voltage) were also investigated. The differences of the PD propagation and the mechanism between double exponential impulses and oscillating impulse were discussed

  4. Quasi-Linear Circuit

    Bradley, William; Bird, Ross; Eldred, Dennis; Zook, Jon; Knowles, Gareth

    2013-01-01

    This work involved developing spacequalifiable switch mode DC/DC power supplies that improve performance with fewer components, and result in elimination of digital components and reduction in magnetics. This design is for missions where systems may be operating under extreme conditions, especially at elevated temperature levels from 200 to 300 degC. Prior art for radiation-tolerant DC/DC converters has been accomplished utilizing classical magnetic-based switch mode converter topologies; however, this requires specific shielding and component de-rating to meet the high-reliability specifications. It requires complex measurement and feedback components, and will not enable automatic re-optimization for larger changes in voltage supply or electrical loading condition. The innovation is a switch mode DC/DC power supply that eliminates the need for processors and most magnetics. It can provide a well-regulated voltage supply with a gain of 1:100 step-up to 8:1 step down, tolerating an up to 30% fluctuation of the voltage supply parameters. The circuit incorporates a ceramic core transformer in a manner that enables it to provide a well-regulated voltage output without use of any processor components or magnetic transformers. The circuit adjusts its internal parameters to re-optimize its performance for changes in supply voltage, environmental conditions, or electrical loading at the output

  5. High Voltage Power Transmission for Wind Energy

    Kim, Young il

    The high wind speeds and wide available area at sea have recently increased the interests on offshore wind farms in the U.S.A. As offshore wind farms become larger and are placed further from the shore, the power transmission to the onshore grid becomes a key feature. Power transmission of the offshore wind farm, in which good wind conditions and a larger installation area than an onshore site are available, requires the use of submarine cable systems. Therefore, an underground power cable system requires unique design and installation challenges not found in the overhead power cable environment. This paper presents analysis about the benefit and drawbacks of three different transmission solutions: HVAC, LCC/VSC HVDC in the grid connecting offshore wind farms and also analyzed the electrical characteristics of underground cables. In particular, loss of HV (High Voltage) subsea power of the transmission cables was evaluated by the Brakelmann's theory, taking into account the distributions of current and temperature.

  6. Spectrum analysis of a voltage source converter due to semiconductor voltage drops

    Rasmussen, Tonny Wederberg; Eltouki, Mustafa

    2017-01-01

    It is known that power electronic voltage source converters are non-ideal. This paper presents a state-of-the-art review on the effect of semiconductor voltage drop on the output voltage spectrum, using single-phase H-bridge two-level converter topology with natural sampled pulse width modulation....... The paper describes the analysis of output voltage spectrum, when the semiconductor voltage drop is added. The results of the analysis of the spectral contribution including and excluding semiconductor voltage drop reveal a good agreement between the theoretical results, simulations and laboratory...

  7. Influence of negative substrate bias voltage on the impurity concentrations in Zr films

    Lim, J.-W.; Bae, J.W.; Mimura, K.; Isshiki, M.

    2006-01-01

    Zr films were deposited on Si(1 0 0) substrates without a substrate bias voltage and with substrate bias voltages of -50 V and -100 V using a non-mass separated ion beam deposition system. Secondary ion mass spectrometry and glow discharge mass spectrometry were used to determine the impurity concentrations in a Zr target and Zr films. It was found that the total amount of impurities in the Zr film deposited at the substrate bias voltage of -50 V was much lower than that in the Zr film deposited without the substrate bias voltage. It means that applying a negative bias voltage to the substrate can suppress the increase in impurities of Zr films. Furthermore, it was confirmed that dominant impurity elements such as C, N and O have a considerable effect on the purity of Zr films and these impurities can be remarkably reduced by applying the negative substrate bias voltage

  8. Restoration of Low-Voltage Distribution Systems with Inverter-Interfaced DG Units

    Dietmannsberger, Markus; Wang, Xiongfei; Blaabjerg, Frede

    2018-01-01

    -area voltage collapse. This paper proposes a restoration strategy from zero voltage conditions for inverter-interfaced DG under islanded conditions. In the approach, a flexible and scalable Master DG inverter concept is introduced for distributed generations, where no communication is needed and an outage......The increasing share of distributed generation (DG) offers new chances in grid restoration of low-voltage distribution grids. Instead of relying on the transmission or high- and medium-voltage levels, establishing islanding operation in low-voltage grids might be a good option after a wide...... of the Master can be balanced by other DG inverters. The control strategy ensures the tracking of nominal values of the system voltage and frequency without zero steady-state error. The influences of non-controllable DG are also taken into account in the strategy with an effective countermeasure developed...

  9. Effect of inductance between middle and outer cylinders on diode voltage of pulse forming line

    Liu Jinliang; Wang Xinxin

    2008-01-01

    Based on the experimental device of the water spiral pulse forming line(PFL) type electron beam accelerator, the effect of inductance between the middle and outer cylinders of PFL on diode voltage is theoretically and experimentally studied in this paper. The formulae are introduced, with which the effect of inductance on diode voltage is calculated. In addition, the diode voltage waveform is simulated through the Pspice software. The theoretical and simulated results agree well with the experimental results, which show that large inductance between middle and outer cylinders can shorten the waveform flat part of diode voltage, increase waveform rise time and reduce the diode peak voltage. When the inductance is smaller than 200 nH, a nearly square voltage waveform can be obtained in field-emission diode. (authors)

  10. Output pressure and harmonic characteristics of a CMUT as function of bias and excitation voltage

    Lei, Anders; Diederichsen, Søren Elmin; Hansen, Sebastian Molbech

    2015-01-01

    of the transmitted signal. The generation of intrinsic harmonics by the CMUT can be minimized by decreasing the excitation signal. This, however, leads to lower fundamental pressure which limits the desired generation of harmonics in the medium. This work examines the output pressure and harmonic characteristics...... of a CMUT as function of bias and excitation voltage. The harmonic to fundamental ratio of the surface pressures declines for decreasing excitation voltage and increasing bias voltage. The ratio, however, becomes unchanged for bias levels close to the pull-in voltage. The harmonic limitations of the CMUT...

  11. Current-voltage characteristics of porous-silicon structures

    Diligenti, A.; Nannini, A.; Pennelli, G.; Pieri, F.; Fuso, F.; Allegrini, M.

    1996-01-01

    I-V DC characteristics have been measured on metal/porous-silicon structures. In particular, the measurements on metal/free-standing porous-silicon film/metal devices confirmed the result, already obtained, that the metal/porous-silicon interface plays a crucial role in the transport of any device. Four-contacts measurements on free-standing layers showed that the current linearly depends on the voltage and that the conduction process is thermally activated, the activation energy depending on the porous silicon film production parameters. Finally, annealing experiments performed in order to improve the conduction of rectifying contacts, are described

  12. Characteristics of output voltage and current of integrated nanogenerators

    Yang, Rusen

    2009-01-01

    Owing to the anisotropic property and small output signals of the piezoelectric nanogenerators (NGs) and the influence of the measurement system and environment, identification of the true signal generated by the NG is critical. We have developed three criteria: Schottky behavior test, switching-polarity tests, and linear superposition of current and voltage tests. The 11 tests can effectively rule out the system artifacts, whose sign does not change with the switching measurement polarity, and random signals, which might change signs but cannot consistently add up or cancel out under designed connection configurations. This study establishes the standards for designing and scale up of integrated nanogenerators. © 2009 American Institute of Physics.

  13. Simulation study on single event burnout in linear doping buffer layer engineered power VDMOSFET

    Jia Yunpeng; Su Hongyuan; Hu Dongqing; Wu Yu; Jin Rui

    2016-01-01

    The addition of a buffer layer can improve the device's secondary breakdown voltage, thus, improving the single event burnout (SEB) threshold voltage. In this paper, an N type linear doping buffer layer is proposed. According to quasi-stationary avalanche simulation and heavy ion beam simulation, the results show that an optimized linear doping buffer layer is critical. As SEB is induced by heavy ions impacting, the electric field of an optimized linear doping buffer device is much lower than that with an optimized constant doping buffer layer at a given buffer layer thickness and the same biasing voltages. Secondary breakdown voltage and the parasitic bipolar turn-on current are much higher than those with the optimized constant doping buffer layer. So the linear buffer layer is more advantageous to improving the device's SEB performance. (paper)

  14. Microprocessor-controlled, programmable ramp voltage generator

    Hopwood, J.

    1978-11-01

    A special-purpose voltage generator has been developed for driving the quadrupole mass filter of a residual gas analyzer. The generator is microprocessor-controlled with desired ramping parameters programmed by setting front-panel digital thumb switches. The start voltage, stop voltage, and time of each excursion are selectable. A maximum of five start-stop levels may be pre-selected for each program. The ramp voltage is 0 to 10 volts with sweep times from 0.1 to 999.99 seconds

  15. Low-Voltage Switched-Capacitor Circuits

    Bidari, E.; Keskin, M.; Maloberti, F.

    1999-01-01

    Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications.......Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications....

  16. A linear programming manual

    Tuey, R. C.

    1972-01-01

    Computer solutions of linear programming problems are outlined. Information covers vector spaces, convex sets, and matrix algebra elements for solving simultaneous linear equations. Dual problems, reduced cost analysis, ranges, and error analysis are illustrated.

  17. Coherent Voltage Oscillations in Superconducting Polycrystalline Y1Ba2Cu3O7-x

    Altinkok, A; Yetis, H; Olutas, M; Kilic, K; Kilic, A; Cetin, O

    2006-01-01

    We have investigated the voltage response of superconducting polycrystalline bulk Y 1 Ba 2 Cu 3 O 7-x (YBCO) material to a bidirectional square wave current with long periods and dc current by means of the evolution of the voltage-time (V-t) curves near the critical temperature. In a well-defined range of amplitudes and periods of driving current, and temperatures, it was observed that a non-linear response to bidirectional square wave current rides on a time independent background voltage value and manifests itself as regular sinusoidal-like voltage oscillations. It was found that the non-linear response disappears when the bidirectional current was switched to dc current. The spectral content of the voltage oscillations analyzed by the Fast Fourier Transform of the corresponding V-t curves revealed that the fundamental harmonics is comparable to the frequency of bidirectional square wave current. The coherent voltage oscillations were discussed mainly in terms of the dynamic competition between pinning and depinning together with the disorder in the coupling strength between the superconducting grains (i.e Josephson coupling effects). The density fluctuations and semi-elastic coupling of the flux lines with the pinning centers were also considered as possible physical mechanisms in the interpretation of the experimental results

  18. Fluorescence profiles and cooling dynamics of laser-cooled Mg+ ions in a linear rf ion trap

    Zhao Xianzhen; Ryjkov, Vladimir L.; Schuessler, Hans A.

    2006-01-01

    Fluorescence line profiles and their implications on the cooling dynamics of the Mg + ions stored in a linear rf trap are studied. The line profile is dictated by the temperature of the ion cloud at different laser detunings. The upper bound of the lowest temperature was estimated for different values of the rf trapping potential amplitude and the buffer gas pressure. A general trend of this ultimate temperature to increase with the rf trapping voltage and buffer gas pressure is expected, with an abrupt change at some critical value corresponding to the transition to and from a strongly correlated liquid or crystal state. While on the one hand this expectation was confirmed when the buffer gas pressure was varied; on the other hand the influence of the amplitude of the trapping voltage on the ultimate temperature shows an interesting new feature of first dipping down before the sharp increase occurs

  19. Geometry optimization of linear and annular plasma synthetic jet actuators

    Neretti, G; Seri, P; Taglioli, M; Borghi, C A; Shaw, A; Iza, F

    2017-01-01

    The electrohydrodynamic (EHD) interaction induced in atmospheric air pressure by a surface dielectric barrier discharge (DBD) actuator has been experimentally investigated. Plasma synthetic jet actuators (PSJAs) are DBD actuators able to induce an air stream perpendicular to the actuator surface. These devices can be used in the field of aerodynamics to prevent or induce flow separation, modify the laminar to turbulent transition inside the boundary layer, and stabilize or mix air flows. They can also be used to enhance indirect plasma treatment effects, increasing the reactive species delivery rate onto surfaces and liquids. This can play a major role in plasma processing and chemical kinetics modelling, where often only diffusive mechanisms are considered. This paper reports on the importance that different electrode geometries can have on the performance of different PSJAs. A series of DBD aerodynamic actuators designed to produce perpendicular jets has been fabricated on two-layer printed circuit boards (PCBs). Both linear and annular geometries were considered, testing different upper electrode distances in the linear case and different diameters in the annular one. An AC voltage supplied at a peak of 11.5 kV and a frequency of 5 kHz was used. Lower electrodes were connected to the ground and buried in epoxy resin to avoid undesired plasma generation on the lower actuator surface. Voltage and current measurements were carried out to evaluate the active power delivered to the discharges. Schlieren imaging allowed the induced jets to be visualized and gave an estimate of their evolution and geometry. Pitot tube measurements were performed to obtain the velocity profiles of the PSJAs and to estimate the mechanical power delivered to the fluid. The optimal values of the inter-electrode distance and diameter were found in order to maximize jet velocity, mechanical power or efficiency. Annular geometries were found to achieve the best performance. (paper)

  20. Linear shaped charge

    Peterson, David; Stofleth, Jerome H.; Saul, Venner W.

    2017-07-11

    Linear shaped charges are described herein. In a general embodiment, the linear shaped charge has an explosive with an elongated arrowhead-shaped profile. The linear shaped charge also has and an elongated v-shaped liner that is inset into a recess of the explosive. Another linear shaped charge includes an explosive that is shaped as a star-shaped prism. Liners are inset into crevices of the explosive, where the explosive acts as a tamper.

  1. Classifying Linear Canonical Relations

    Lorand, Jonathan

    2015-01-01

    In this Master's thesis, we consider the problem of classifying, up to conjugation by linear symplectomorphisms, linear canonical relations (lagrangian correspondences) from a finite-dimensional symplectic vector space to itself. We give an elementary introduction to the theory of linear canonical relations and present partial results toward the classification problem. This exposition should be accessible to undergraduate students with a basic familiarity with linear algebra.

  2. Note: Self-biased voltage to suppress secondary electrons by a ZnO varistor in a compact pulsed neutron generator

    Yang, Z.; Li, X.; Li, J.; Long, J. D.; Lan, C. H.; Wang, T.; Dong, P.; He, J. L.

    2017-03-01

    A large amount of back streaming electrons will bring about a part of current drain on power supply, cause sparking or high-voltage breakdowns, and affect the neutron yield and waveform for a compact sealed-tube pulsed neutron generator. A novel idea which uses a ZnO varistor to provide a constant self-biased voltage to suppress the secondary electrons is introduced. The I-V curve for the ZnO varistor was measured in the experiment. The effects of suppressing the secondary electrons were investigated using a ZnO varistor, linear resistors, and an independent power supply, respectively. The results show that the secondary electrons are suppressed effectively by the compact ZnO varistor, while not increasing the size and the component of the device. It is a promising design for compact sealed-tube neutron generators.

  3. Excitation of voltage oscillations in an induction voltage adder

    Nichelle Bruner

    2009-07-01

    Full Text Available The induction voltage adder is an accelerator architecture used in recent designs of pulsed-power driven x-ray radiographic systems such as Sandia National Laboratories’ Radiographic Integrated Test Stand (RITS, the Atomic Weapons Establishment’s planned Hydrus Facility, and the Naval Research Laboratory’s Mercury. Each of these designs relies on magnetic insulation to prevent electron loss across the anode-cathode gap in the vicinity of the adder as well as in the coaxial transmission line. Particle-in-cell simulations of the RITS adder and transmission line show that, as magnetic insulation is being established during a pulse, some electron loss occurs across the gap. Sufficient delay in the cavity pulse timings provides an opportunity for high-momentum electrons to deeply penetrate the cavities of the adder cells where they can excite radio-frequency resonances. These oscillations may be amplified in subsequent gaps, resulting in oscillations in the output power. The specific modes supported by the RITS-6 accelerator and details of the mechanism by which they are excited are presented in this paper.

  4. Linear-Algebra Programs

    Lawson, C. L.; Krogh, F. T.; Gold, S. S.; Kincaid, D. R.; Sullivan, J.; Williams, E.; Hanson, R. J.; Haskell, K.; Dongarra, J.; Moler, C. B.

    1982-01-01

    The Basic Linear Algebra Subprograms (BLAS) library is a collection of 38 FORTRAN-callable routines for performing basic operations of numerical linear algebra. BLAS library is portable and efficient source of basic operations for designers of programs involving linear algebriac computations. BLAS library is supplied in portable FORTRAN and Assembler code versions for IBM 370, UNIVAC 1100 and CDC 6000 series computers.

  5. Considering system non-linearity in transmission pricing

    Oloomi-Buygi, M.; Salehizadeh, M. Reza

    2008-01-01

    In this paper a new approach for transmission pricing is presented. The contribution of a contract on power flow of a transmission line is used as extent-of-use criterion for transmission pricing. In order to determine the contribution of each contract on power flow of each transmission line, first the contribution of each contract on each voltage angle is determined, which is called voltage angle decomposition. To this end, DC power flow is used to compute a primary solution for voltage angle decomposition. To consider the impacts of system non-linearity on voltage angle decomposition, a method is presented to determine the share of different terms of sine argument in sine value. Then the primary solution is corrected in different iterations of decoupled Newton-Raphson power flow using the presented sharing method. The presented approach is applied to a 4-bus test system and IEEE 30-bus test system and the results are analyzed. (author)

  6. HEAVY ION LINEAR ACCELERATOR

    Van Atta, C.M.; Beringer, R.; Smith, L.

    1959-01-01

    A linear accelerator of heavy ions is described. The basic contributions of the invention consist of a method and apparatus for obtaining high energy particles of an element with an increased charge-to-mass ratio. The method comprises the steps of ionizing the atoms of an element, accelerating the resultant ions to an energy substantially equal to one Mev per nucleon, stripping orbital electrons from the accelerated ions by passing the ions through a curtain of elemental vapor disposed transversely of the path of the ions to provide a second charge-to-mass ratio, and finally accelerating the resultant stripped ions to a final energy of at least ten Mev per nucleon.

  7. Determination of the internal parameters of tc from the current-voltage characteristics

    Kaibyshev, V.Z.

    1986-01-01

    This paper proposes a method for determining the effective work function of a collector, the electron temperature, and the voltage drop in the interelectrode gap from the experimental vurrent-voltage characteristics (IVC). Analysis of the boundary conditions at the collector shows that as the emission from the collector increases the height of the potential jump retarding plasma electrons decrease

  8. Multi-objective optimization control of plug-in electric vehicles in low voltage distribution networks

    García-Villalobos, J.; Zamora, I.; Knezovic, Katarina

    2016-01-01

    The massive introduction of plug-in electric vehicles (PEVs) into low voltage (LV) distribution networks will lead to several problems, such as: increase of energy losses, decrease of distribution transformer lifetime, lines and transformer overload issues, voltage drops and unbalances...

  9. A case study of using OLTC to mitigate overvoltage in a rural european low voltage network

    Mawarni, Delina Endang; Ali, M. M. Viyathukattuva Mohamed; Nguyen, P. H.; Kling, W.L.; Jerele, Marjan

    Increasing penetration of distributed renewable energy sources such as PV may lead to voltage rise in the LV distribution networks. When local production exceeds local consumption, this voltage rise may lead to overvoltage, i.e. violation of the EN 50160 standard. A number of solutions have been

  10. The effect of external visible light on the breakdown voltage of a long discharge tube

    Shishpanov, A. I.; Ionikh, Yu. Z.; Meshchanov, A. V.

    2016-06-01

    The breakdown characteristics of a discharge tube with a configuration typical of gas-discharge light sources and electric-discharge lasers (a so-called "long discharge tube") filled with argon or helium at a pressure of 1 Torr have been investigated. A breakdown has been implemented using positive and negative voltage pulses with a linear leading edge having a slope dU/ dt ~ 10-107 V/s. Visible light from an external source (halogen incandescent lamp) is found to affect the breakdown characteristics. The dependences of the dynamic breakdown voltage of the tube on dU/ dt and on the incident light intensity are measured. The breakdown voltage is found to decrease under irradiation of the high-voltage anode of the tube in a wide range of dU/ dt. A dependence of the effect magnitude on the light intensity and spectrum is obtained. Possible physical mechanisms of this phenomenon are discussed.

  11. Study on the construction and its operating characteristics of Marx high voltage pulse generator

    Chung, W.K.; Yook, C.C.

    1984-01-01

    This study is to investigate the operating characteristics of a Marx high voltage pulse generator, which is designed and fabricated for the purpose of constructing a linear theta-pinch plasma generating facility. The Marx generator consists of a 2 kJ capacitor bank of maximum output voltage of 200kV, a set of main spark switch, a triggring system, and high voltage charging power supply. The experimental results show that the operating characteristics of the generator can be controlled through varying nitrogen pressure as a filling gas. The output pulse of the generator is achieved close to the estimated voltage with the rise time of 3*m seconds. The stability of the generator is also very satisfactory within operating range of main spark switch. (Author)

  12. Development of anode high voltage power supply system for ECRH of HL-2A tokamak

    Chen Wenguang

    2009-01-01

    The anode high voltage power supply system consist of DC high-voltage power supply (HVPS) and pulse modulator. SCR is used to vary AC input voltage of the step-up transformer by controlling the trigger phase in the HVPS, and regulate the DC output voltage linearly at the potential of low-end via BJT, Dual closed-loop control technology is applied in the controller, and its maximum output is at 30kV and 130mA. Tetrode is the core component of the modulator. The circuit design is optimized by using the simulation software. Test and HL-2A discharge experimental results show that the power supply system is designed with some characteristics of output scale widely, low ripple and modulate quickly. (authors)

  13. Prediction of picosecond voltage collapse and electromagnetic wave generation in gas avalanche switches

    Mayhall, D.J.; Yee, J.H.; Duong-Van, M.; Villa, F.

    1988-01-01

    A picosecond speed switch, the Gas Avalanche Switch (GAS), has been proposed for GeV linear accelerators. The medium is gas at high pressure (100 - 700 atm). An avalanche discharge is induced between pulse-charged high voltage electrodes by electron deposition from a fast laser pulse. Avalanche electrons move to the positive electrode, causing the applied voltage to collapse in picoseconds. A two-dimensional (2D) electromagnetic electron fluid computer code calculates the avalanche evolution and voltage collapse in air for an infinite parallel plate capacitor with a 0.1 mm spacing. Calculations are done for an accelerator switch geometry consisting of a 0.7 mm wide by 0.8 mm high, rectangular, high voltage center electrode (CE) between the grounded plates of a parallel plate line of 2 mm spacing. Several variations of CE elevation and initial electron deposition are investigated The 2D character of the outgoing TEM waves is shown

  14. A utility piezoelectric energy harvester with low frequency and high-output voltage: Theoretical model, experimental verification and energy storage

    Guangyi Zhang

    2016-09-01

    Full Text Available In this paper, a utility piezoelectric energy harvester with low frequency and high-output voltage is presented. Firstly, the harvester’s three theoretical models are presented, namely the static model, the quasi static model and the dynamic vibration model. By analyzing the influence of the mass ratio of the mass block to the beam on output characteristics of the harvester, we compare the quasi static model and the dynamic vibration model and then define their applicable ranges. Secondly, simulation and experiments are done to verify the models, using the harvester with PZT-5H piezoelectric material, which are proved to be consistent with each other. The experimental results show that the output open-circuit voltage and the output power can reach up to 86.36V and 27.5mW respectively. The experiments are conducted when this harvester system is excited by the first modal frequency (58.90Hz with the acceleration 10m/s2. In this low frequency vibration case, it is easy to capture the energy in the daily environment. In addition, LTC 3588-1 chip (Linear Technology Corporation is used as the medium energy circuit to transfer charges from the PZT-5H electrode to the 0.22F 5V super capacitor and ML621 rechargeable button battery. For this super-capacitor, it takes about 100min for the capacitor voltage to rise from 0V to 3.6V. For this button battery, it takes about 200min to increase the battery voltage from 2.5V to 3.48V.

  15. An implantable neurostimulator with an integrated high-voltage inductive power-recovery frontend

    Wang Yuan; Zhang Xu; Liu Ming; Li Peng; Chen Hongda

    2014-01-01

    This paper present a highly-integrated neurostimulator with an on-chip inductive power-recovery frontend and high-voltage stimulus generator. In particular, the power-recovery frontend includes a high-voltage full-wave rectifier (up to 100 V AC input), high-voltage series regulators (24/5 V outputs) and a linear regulator (1.8/3.3 V output) with bandgap voltage reference. With the high voltage output of the series regulator, the proposed neurostimulator could deliver a considerably large current in high electrode-tissue contact impedance. This neurostimulator has been fabricated in a CSMC 1 μm 5/40/700 V BCD process and the total silicon area including pads is 5.8 mm 2 . Preliminary tests are successful as the neurostimulator shows good stability under a 13.56 MHz AC supply. Compared to previously reported works, our design has advantages of a wide induced voltage range (26–100 V), high output voltage (up to 24 V) and high-level integration, which are suitable for implantable neurostimulators. (semiconductor integrated circuits)

  16. Low voltage 80 KV to 125 KV electron processors

    Lauppi, U.V.

    1999-01-01

    The classic electron beam technology made use of accelerating energies in the voltage range of 300 to 800 kV. The first EB processors - built for the curing of coatings - operated at 300 kV. The products to be treated were thicker than a simple layer of coating with thicknesses up to 100g and more. It was only in the beginning of the 1970's that industrial EB processors with accelerating voltages below 300 kV appeared on the market. Our company developed the first commercial electron accelerator without a beam scanner. The new EB machine featured a linear cathode, emitting a shower or 'curtain' of electrons over the full width of the product. These units were much smaller than anv previous EB processors and dedicated to the curing of coatings and other thin layers. ESI's first EB units operated with accelerating voltages between 150 and 200 kV. In 1993 ESI announced the introduction of a new generation of Electrocure. EB processors operating at 120 kV, and in 1998, at the RadTech North America '98 Conference in Chicago, the introduction of an 80 kV electron beam processor under the designation Microbeam LV

  17. Non-linear leak currents affect mammalian neuron physiology

    Shiwei eHuang

    2015-11-01

    Full Text Available In their seminal works on squid giant axons, Hodgkin and Huxley approximated the membrane leak current as Ohmic, i.e. linear, since in their preparation, sub-threshold current rectification due to the influence of ionic concentration is negligible. Most studies on mammalian neurons have made the same, largely untested, assumption. Here we show that the membrane time constant and input resistance of mammalian neurons (when other major voltage-sensitive and ligand-gated ionic currents are discounted varies non-linearly with membrane voltage, following the prediction of a Goldman-Hodgkin-Katz-based passive membrane model. The model predicts that under such conditions, the time constant/input resistance-voltage relationship will linearize if the concentration differences across the cell membrane are reduced. These properties were observed in patch-clamp recordings of cerebellar Purkinje neurons (in the presence of pharmacological blockers of other background ionic currents and were more prominent in the sub-threshold region of the membrane potential. Model simulations showed that the non-linear leak affects voltage-clamp recordings and reduces temporal summation of excitatory synaptic input. Together, our results demonstrate the importance of trans-membrane ionic concentration in defining the functional properties of the passive membrane in mammalian neurons as well as other excitable cells.

  18. The current-voltage characteristic and potential oscillations of a double layer in a triple plasma device

    Carpenter, R.T.; Torven, S.

    1986-07-01

    The properties of a strong double layer in a current circuit with a capacitance and an inductance are investigated in a triple plasma device. The double layer gives rise to a region of negative differential resistance in the current-voltage characteristic of the device, and this gives non-linear oscillations in the current and the potential drop over the double layer (PhiDL). For a sufficiently large circuit inductance PhiDL reaches an amplitude given by the induced voltage (-LdI/dt) which is much larger than the circuit EMF due to the rapid current decrease when PhiDL increases. A variable potential minimum exists in the plasma on the low potential side of the double layer, and the depth of the minimum increases when PhiDL increases. An increasing fraction of the electrons incident at the double layer are then reflected, and this is found to be the main process giving rise to the negative differential resistance. A qualitative model for the variation of the minimum potential with PhiDL is also proposed. It is based on the condition that the minimum potential must adjust itself self-consistentely so that quasi-neutrality is maintained in the plasma region where the minimum is assumed. (authors)

  19. Selective virtual capacitive impedance loop for harmonics voltage compensation in islanded microgrids

    Micallef, Alexander; Apap, Maurice; Spiteri-Staines, Cyril

    2013-01-01

    Parallel inverters having LCL output filters cause voltage distortions at the point of common coupling (PCC) in islanded microgrids when non-linear loads are present. A capacitive virtual impedance loop could be used to provide selective harmonic compensation in islanded microgrids, instead of in...... resistance for selective harmonic compensation in islanded microgrids. Simulation results were given to show the suitability of the proposed algorithms in reducing the voltage harmonics at the PCC.......Parallel inverters having LCL output filters cause voltage distortions at the point of common coupling (PCC) in islanded microgrids when non-linear loads are present. A capacitive virtual impedance loop could be used to provide selective harmonic compensation in islanded microgrids, instead...... of introducing additional active or passive filters into the system that could compromise the stability of the microgrid. However, the performance of these compensation loops becomes degraded when a virtual resistance is introduced with the aim to improve the overall stability of the parallel inverters...

  20. Design of high voltage power supply of miniature X-ray tube based on resonant Royer

    Liu Xiyao; Zeng Guoqiang; Tan Chengjun; Luo Qun; Gong Chunhui; Huang Rui

    2013-01-01

    Background: In recent years, X rays are widely used in various fields. With the rapid development of national economy, the demand of high quality, high reliability, and high stability miniature X-ray tube has grown rapidly. As an important core component of miniature X-ray tube, high voltage power supply has attracted wide attention. Purpose: To match miniature, the high voltage power supply should be small, lightweight, good quality, etc. Based on the basic performance requirements of existing micro-X-ray tube high voltage power supply, this paper designs an output from 0 to -30 kV adjustable miniature X-ray tube voltage DC power supply. Compared to half-bridge and full-bridge switching-mode power supply, its driving circuit is simple. With working on the linear condition, it has no switching noise. Methods: The main circuit makes use of DC power supply to provide the energy. The resonant Royer circuit supplies sine wave which drives to the high frequency transformer's primary winding with resultant sine-like high voltage appearing across the secondary winding. Then, the voltage doubling rectifying circuit would achieve further boost. In the regulator circuit, a feedback control resonant transistor base current is adopted. In order to insulate air, a silicone rubber is used for high pressure part packaging, and the output voltage is measured by the dividing voltage below -5 kV. Results: The stability of circuit is better than 0.2%/6 h and the percent of the output ripple voltage is less than 0.3%. Keeping the output voltage constant, the output current can reach 57 μA by changing the size of load resistor. This high voltage power supply based on resonant Royer can meet the requirement of miniature X-ray tube. Conclusions: The circuit can satisfy low noise, low ripple, low power and high voltage regulator power supply design. However, its efficiency is not high enough because of the linear condition. In the next design, to further reduce power consumption, we

  1. Voltage stability in low voltage microgrids in aspects of active and reactive power demand

    Parol Mirosław

    2016-03-01

    Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.

  2. Influence of current limitation on voltage stability with voltage sourced converter HVDC

    Zeni, Lorenzo; Jóhannsson, Hjörtur; Hansen, Anca Daniela

    2013-01-01

    A first study of voltage stability with relevant amount of Voltage Sourced Converter based High Voltage Direct Current (VSC-HVDC) transmission is presented, with particular focus on the converters’ behaviour when reaching their rated current. The detrimental effect of entering the current...

  3. On-site voltage measurement with capacitive sensors on high voltage systems

    Wu, L.; Wouters, P.A.A.F.; Heesch, van E.J.M.; Steennis, E.F.

    2011-01-01

    In Extra/High-Voltage (EHV/HV) power systems, over-voltages occur e.g. due to transients or resonances. At places where no conventional voltage measurement devices can be installed, on-site measurement of these occurrences requires preferably non intrusive sensors, which can be installed with little

  4. 76 FR 72203 - Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda

    2011-11-22

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda As announced in the Notice of Staff..., from 9 a.m. to 4:30 p.m. to explore the interaction between voltage control, reliability, and economic...

  5. Influence of Ambient Humidity on the Voltage Response of Ionic Polymer-Metal Composite Sensor.

    Zhu, Zicai; Horiuchi, Tetsuya; Kruusamäe, Karl; Chang, Longfei; Asaka, Kinji

    2016-03-31

    Electrical potential based on ion migration exists not only in natural systems but also in ionic polymer materials. In order to investigate the influence of ambient humidity on voltage response, classical Au-Nafion IPMC was chosen as the reference sample. Voltage response under a bending deformation was measured in two ways: first, continuous measurement of voltage response in the process of absorption and desorption of water to study the tendency of voltage variation at all water states; second, measurements at multiple fixed ambient humidity levels to characterize the process of voltage response quantitatively. Ambient humidity influences the voltage response mainly by varying water content in ionic polymer. Under a step bending, the amplitude of initial voltage peak first increases and then decreases as the ambient humidity and the inherent water content decrease. This tendency is explained semiquantitatively by mass storage capacity related to the stretchable state of the Nafion polymer network. Following the initial peak, the voltage shows a slow decay to a steady state, which is first characterized in this paper. The relative voltage decay during the steady state always decreases as the ambient humidity is lowered. It is ascribed to progressive increase of the ratio between the water molecules in the cation hydration shell to the free water. Under sinusoidal mechanical bending excitation in the range of 0.1-10 Hz, the voltage magnitude increases with frequency at high ambient humidity but decreases with frequency at low ambient humidity. The relationship is mainly controlled by the voltage decay effect and the response speed.

  6. Modeling and Simulation of Low Voltage Arcs

    Ghezzi, L.; Balestrero, A.

    2010-01-01

    Modeling and Simulation of Low Voltage Arcs is an attempt to improve the physical understanding, mathematical modeling and numerical simulation of the electric arcs that are found during current interruptions in low voltage circuit breakers. An empirical description is gained by refined electrical

  7. The LMF triaxial MITL voltage adder system

    Mazarakis, M.G.; Smith, D.L.; Bennett, L.F.; Lockner, T.R.; Olson, R.E.; Poukey, J.W.

    1992-01-01

    The light-ion microfusion driver design consists of multiple accelerating modules fired in coincidence and sequentially in order to provide the desired ion energy, power pulse shape and energy deposition uniformity on an Inertial Confinement Fusion (ICF) target. The basic energy source is a number of Marx generators which, through the appropriate pulse power conditioning, provide the necessary voltage pulse wave form to the accelerating gaps or feeds of each module. The cavity gaps are inductively isolated, and the voltage addition occurs in the center conductor of the voltage adder which is the positive electrode while the electrons of the sheath flow closer to the outer cylinder which is the magnetically insulated cathode electrode. Each module powers a separate two-stage extraction diode which provides a low divergence ion beam. In order to provide the two separate voltage pulses required by the diode, a triaxial adder system is designed for each module. The voltage addition occurs in two separate MITLs. The center hollow cylinder (anode) of the second MITL also serves as the outer cathode electrode for the extension of the first voltage adder MITL. The voltage of the second stage is about twice that of the first stage. The cavities are connected in series to form the outer cylinder of each module. The accelerating modules are positioned radially in a symmetrical way around the fusion chamber. A preliminary conceptual design of the LMF modules with emphasis on the voltage adders and extension MITLs will be presented and discussed

  8. Time isolation high-voltage impulse generator

    Chodorow, A.M.

    1975-01-01

    Lewis' high-voltage impulse generator is analyzed in greater detail, demonstrating that voltage between adjacent nodes can be equalized by proper selection of parasitic impedances. This permits improved TEM mode propagation to a matched load, with more faithful source waveform preservation

  9. High-voltage engineering and testing

    Ryan, Hugh M

    2013-01-01

    This 3rd edition of High Voltage Engineering Testing describes strategic developments in the field and reflects on how they can best be managed. All the key components of high voltage and distribution systems are covered including electric power networks, UHV and HV. Distribution systems including HVDC and power electronic systems are also considered.

  10. Improving transition voltage spectroscopy of molecular junctions

    Markussen, Troels; Chen, Jingzhe; Thygesen, Kristian Sommer

    2011-01-01

    Transition voltage spectroscopy (TVS) is a promising spectroscopic tool for molecular junctions. The principles in TVS is to find the minimum on a Fowler-Nordheim plot where ln(I/V2) is plotted against 1/V and relate the voltage at the minimum Vmin to the closest molecular level. Importantly, Vmin...

  11. Reducing Ripple In A Switching Voltage Regulator

    Paulkovich, John; Rodriguez, G. Ernest

    1994-01-01

    Ripple voltage in output of switching voltage regulator reduced substantially by simple additional circuitry adding little to overall weight and size of regulator. Heretofore, additional filtering circuitry needed to obtain comparable reductions in ripple typically as large and heavy as original regulator. Current opposing ripple current injected into filter capacitor.

  12. An efficient high-voltage power supply for a photomultiplier tube

    Ainutdinov, VM; Vonsovskii, NN; Kompaniets, KG; Kozyr, AI; Mikhailov, YV

    2003-01-01

    An adjustable power supply for a photomultiplier tube operating in the pulsed spectrometric mode with a wide range of linearity is described. The power consumed by the source is 50 mW. The output voltage is varied from 800 to 2000 V. The maximum ripple amplitude is 2.5 mV.

  13. Induction sensor for measuring the accelerating voltage in an iron-free induction accelerator

    Bol'nykh, N.S.; Il'in, Yu.M.; Kostyushok, A.A.; Suvorov, V.A.

    1987-01-01

    An inductive sensor is described for measuring the amplitude and form of the accelerating-voltage pulse in the storage coils in a radial iron-free linear induction accelerator. The sensor does not respond to interference from external fields and does not require adjustment after calibration

  14. Study and Experiment on Non-Contact Voltage Sensor Suitable for Three-Phase Transmission Line.

    Zhou, Qiang; He, Wei; Xiao, Dongping; Li, Songnong; Zhou, Kongjun

    2015-12-30

    A voltage transformer, as voltage signal detection equipment, plays an important role in a power system. Presently, more and more electric power systems are adopting potential transformer and capacitance voltage transformers. Transformers are often large in volume and heavyweight, their insulation design is difficult, and an iron core or multi-grade capacitance voltage division structure is generally adopted. As a result, the detection accuracy of transformer is reduced, a huge phase difference exists between detection signal and voltage signal to be measured, and the detection signal cannot accurately and timely reflect the change of conductor voltage signal to be measured. By aiming at the current problems of electric transformation, based on electrostatic induction principle, this paper designed a non-contact voltage sensor and gained detection signal of the sensor through electrostatic coupling for the electric field generated by electric charges of the conductor to be measured. The insulation structure design of the sensor is simple and its volume is small; phase difference of sensor measurement is effectively reduced through optimization design of the electrode; and voltage division ratio and measurement accuracy are increased. The voltage sensor was tested on the experimental platform of simulating three-phase transmission line. According to the result, the designed non-contact voltage sensor can realize accurate and real-time measurement for the conductor voltage. It can be applied to online monitoring for the voltage of three-phase transmission line or three-phase distribution network line, which is in accordance with the development direction of the smart grid.

  15. Effects of Electrode Material on the Voltage of a Tree-Based Energy Generator.

    Hao, Zhibin; Wang, Guozhu; Li, Wenbin; Zhang, Junguo; Kan, Jiangming

    2015-01-01

    The voltage between a standing tree and its surrounding soil is regarded as an innovative renewable energy source. This source is expected to provide a new power generation system for the low-power electrical equipment used in forestry. However, the voltage is weak, which has caused great difficulty in application. Consequently, the development of a method to increase the voltage is a key issue that must be addressed in this area of applied research. As the front-end component for energy harvesting, a metal electrode has a material effect on the level and stability of the voltage obtained. This study aimed to preliminarily ascertain the rules and mechanisms that underlie the effects of electrode material on voltage. Electrodes of different materials were used to measure the tree-source voltage, and the data were employed in a comparative analysis. The results indicate that the conductivity of the metal electrode significantly affects the contact resistance of the electrode-soil and electrode-trunk contact surfaces, thereby influencing the voltage level. The metal reactivity of the electrode has no significant effect on the voltage. However, passivation of the electrode materials markedly reduces the voltage. Suitable electrode materials are demonstrated and recommended.

  16. Effects of Electrode Material on the Voltage of a Tree-Based Energy Generator.

    Zhibin Hao

    Full Text Available The voltage between a standing tree and its surrounding soil is regarded as an innovative renewable energy source. This source is expected to provide a new power generation system for the low-power electrical equipment used in forestry. However, the voltage is weak, which has caused great difficulty in application. Consequently, the development of a method to increase the voltage is a key issue that must be addressed in this area of applied research. As the front-end component for energy harvesting, a metal electrode has a material effect on the level and stability of the voltage obtained. This study aimed to preliminarily ascertain the rules and mechanisms that underlie the effects of electrode material on voltage. Electrodes of different materials were used to measure the tree-source voltage, and the data were employed in a comparative analysis. The results indicate that the conductivity of the metal electrode significantly affects the contact resistance of the electrode-soil and electrode-trunk contact surfaces, thereby influencing the voltage level. The metal reactivity of the electrode has no significant effect on the voltage. However, passivation of the electrode materials markedly reduces the voltage. Suitable electrode materials are demonstrated and recommended.

  17. Practical considerations in voltage stability assessment

    Kundur, P; Gao, B [Powertech Labs. Inc., Surrey, BC (Canada)

    1994-12-31

    This paper deals with some of the most important practical issues related to voltage stability assessment of large practical systems. A brief discussion of the practical aspects of voltage stability problem and prevention of voltage instability is given first, followed by descriptions of different analytical techniques and tools for voltage stability analysis. Presentations of analytical tools is focused on the VSTAB program which incorporates the modal analysis, continuation power flow, and shortest distance to instability techniques, Finally, an example case study of a practical large system is presented. The case study illustrates how modal analysis is used to determine the most effective load shedding scheme for preventing voltage instability. (author) 15 refs., 2 figs., 2 tabs.

  18. Voltage-assisted polymer wafer bonding

    Varsanik, J S; Bernstein, J J

    2012-01-01

    Polymer wafer bonding is a widely used process for fabrication of microfluidic devices. However, best practices for polymer bonds do not achieve sufficient bond strength for many applications. By applying a voltage to a polymer bond in a process called voltage-assisted bonding, bond strength is shown to improve dramatically for two polymers (Cytop™ and poly(methyl methacrylate)). Several experiments were performed to provide a starting point for further exploration of this technique. An optimal voltage range is experimentally observed with a reduction in bonding strength at higher voltages. Additionally, voltage-assisted bonding is shown to reduce void diameter due to bond defects. An electrostatic force model is proposed to explain the improved bond characteristics. This process can be used to improve bond strength for most polymers. (paper)

  19. Voltage-gated lipid ion channels

    Blicher, Andreas; Heimburg, Thomas Rainer

    2013-01-01

    Synthetic lipid membranes can display channel-like ion conduction events even in the absence of proteins. We show here that these events are voltage-gated with a quadratic voltage dependence as expected from electrostatic theory of capacitors. To this end, we recorded channel traces and current...... histograms in patch-experiments on lipid membranes. We derived a theoretical current-voltage relationship for pores in lipid membranes that describes the experimental data very well when assuming an asymmetric membrane. We determined the equilibrium constant between closed and open state and the open...... probability as a function of voltage. The voltage-dependence of the lipid pores is found comparable to that of protein channels. Lifetime distributions of open and closed events indicate that the channel open distribution does not follow exponential statistics but rather power law behavior for long open times...

  20. Non-contact current and voltage sensor

    Carpenter, Gary D; El-Essawy, Wael; Ferreira, Alexandre Peixoto; Keller, Thomas Walter; Rubio, Juan C; Schappert, Michael A

    2014-03-25

    A detachable current and voltage sensor provides an isolated and convenient device to measure current passing through a conductor such as an AC branch circuit wire, as well as providing an indication of an electrostatic potential on the wire, which can be used to indicate the phase of the voltage on the wire, and optionally a magnitude of the voltage. The device includes a housing that contains the current and voltage sensors, which may be a ferrite cylinder with a hall effect sensor disposed in a gap along the circumference to measure current, or alternative a winding provided through the cylinder along its axis and a capacitive plate or wire disposed adjacent to, or within, the ferrite cylinder to provide the indication of the voltage.