Gaubas, E; Ceponis, T; Kusakovskij, J
2011-08-01
A technique for the combined measurement of barrier capacitance and spreading resistance profiles using a linearly increasing voltage pulse is presented. The technique is based on the measurement and analysis of current transients, due to the barrier and diffusion capacitance, and the spreading resistance, between a needle probe and sample. To control the impact of deep traps in the barrier capacitance, a steady state bias illumination with infrared light was employed. Measurements of the spreading resistance and barrier capacitance profiles using a stepwise positioned probe on cross sectioned silicon pin diodes and pnp structures are presented.
Low voltage RF MEMS variable capacitor with linear C-V response
Elshurafa, Amro M.
2012-07-23
An RF MEMS variable capacitor, fabricated in the PolyMUMPS process and tuned electrostatically, possessing a linear capacitance-voltage response is reported. The measured quality factor of the device was 17 at 1GHz, while the tuning range was 1.2:1 and was achieved at an actuation DC voltage of 8V only. Further, the linear regression coefficient was 0.98. The variable capacitor was created such that it has both vertical and horizontal capacitances present. As the top suspended plate moves towards the bottom fixed plate, the vertical capacitance increases whereas the horizontal capacitance decreases simultaneously such that the sum of the two capacitances yields a linear capacitance-voltage relation. © 2012 The Institution of Engineering and Technology.
Mozer, AJ; Sariciftci, NS; Osterbacka, R; Westerling, M; Juska, G; LUTSEN, Laurence; VANDERZANDE, Dirk
2005-01-01
Charge carrier mobility and recombination in a bulk heterojunction solar cell based on the mixture of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)-C-61 (PCBM) has been studied using the novel technique of photoinduced charge carrier extraction in a linearly increasing voltage (Photo-CELIV). In this technique, charge carriers are photogenerated by a short laser flash, and extracted under a reverse bias voltage ramp after ...
Voltage linear transformation circuit design
Sanchez, Lucas R. W.; Jin, Moon-Seob; Scott, R. Phillip; Luder, Ryan J.; Hart, Michael
2017-09-01
Many engineering projects require automated control of analog voltages over a specified range. We have developed a computer interface comprising custom hardware and MATLAB code to provide real-time control of a Thorlabs adaptive optics (AO) kit. The hardware interface includes an op amp cascade to linearly shift and scale a voltage range. With easy modifications, any linear transformation can be accommodated. In AO applications, the design is suitable to drive a range of different types of deformable and fast steering mirrors (FSM's). Our original motivation and application was to control an Optics in Motion (OIM) FSM which requires the customer to devise a unique interface to supply voltages to the mirror controller to set the mirror's angular deflection. The FSM is in an optical servo loop with a wave front sensor (WFS), which controls the dynamic behavior of the mirror's deflection. The code acquires wavefront data from the WFS and fits a plane, which is subsequently converted into its corresponding angular deflection. The FSM provides +/-3° optical angular deflection for a +/-10 V voltage swing. Voltages are applied to the mirror via a National Instruments digital-to-analog converter (DAC) followed by an op amp cascade circuit. This system has been integrated into our Thorlabs AO testbed which currently runs at 11 Hz, but with planned software upgrades, the system update rate is expected to improve to 500 Hz. To show that the FSM subsystem is ready for this speed, we conducted two different PID tuning runs at different step commands. Once 500 Hz is achieved, we plan to make the code and method for our interface solution freely available to the community.
The use of charge extraction by linearly increasing voltage in polar organic light-emitting diodes
Züfle, Simon; Altazin, Stéphane; Hofmann, Alexander; Jäger, Lars; Neukom, Martin T.; Schmidt, Tobias D.; Brütting, Wolfgang; Ruhstaller, Beat
2017-05-01
We demonstrate the application of the CELIV (charge carrier extraction by linearly increasing voltage) technique to bilayer organic light-emitting devices (OLEDs) in order to selectively determine the hole mobility in N,N0-bis(1-naphthyl)-N,N0-diphenyl-1,10-biphenyl-4,40-diamine (α-NPD). In the CELIV technique, mobile charges in the active layer are extracted by applying a negative voltage ramp, leading to a peak superimposed to the measured displacement current whose temporal position is related to the charge carrier mobility. In fully operating devices, however, bipolar carrier transport and recombination complicate the analysis of CELIV transients as well as the assignment of the extracted mobility value to one charge carrier species. This has motivated a new approach of fabricating dedicated metal-insulator-semiconductor (MIS) devices, where the extraction current contains signatures of only one charge carrier type. In this work, we show that the MIS-CELIV concept can be employed in bilayer polar OLEDs as well, which are easy to fabricate using most common electron transport layers (ETLs), like Tris-(8-hydroxyquinoline)aluminum (Alq3). Due to the macroscopic polarization of the ETL, holes are already injected into the hole transport layer below the built-in voltage and accumulate at the internal interface with the ETL. This way, by a standard CELIV experiment only holes will be extracted, allowing us to determine their mobility. The approach can be established as a powerful way of selectively measuring charge mobilities in new materials in a standard device configuration.
Mozer, A. J.; Sariciftci, N. S.; Lutsen, L.; Vanderzande, D.; Österbacka, R.; Westerling, M.; Juška, G.
2005-03-01
Charge carrier mobility and recombination in a bulk heterojunction solar cell based on the mixture of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)-C61 (PCBM) has been studied using the novel technique of photoinduced charge carrier extraction in a linearly increasing voltage (Photo-CELIV). In this technique, charge carriers are photogenerated by a short laser flash, and extracted under a reverse bias voltage ramp after an adjustable delay time (tdel). The Photo-CELIV mobility at room temperature is found to be μ =2×10-4cm2V-1s-1, which is almost independent on charge carrier density, but slightly dependent on tdel. Furthermore, determination of charge carrier lifetime and demonstration of an electric field dependent mobility is presented.
All-Pass Filter Based Linear Voltage Controlled Quadrature Oscillator
Directory of Open Access Journals (Sweden)
Koushick Mathur
2017-01-01
Full Text Available A linear voltage controlled quadrature oscillator implemented from a first-order electronically tunable all-pass filter (ETAF is presented. The active element is commercially available current feedback amplifier (AD844 in conjunction with the relatively new Multiplication Mode Current Conveyor (MMCC device. Electronic tunability is obtained by the control node voltage (V of the MMCC. Effects of the device nonidealities, namely, the parasitic capacitors and the roll-off poles of the port-transfer ratios of the device, are shown to be negligible, even though the usable high-frequency ranges are constrained by these imperfections. Subsequently the filter is looped with an electronically tunable integrator (ETI to implement the quadrature oscillator (QO. Experimental responses on the voltage tunable phase of the filter and the linear-tuning law of the quadrature oscillator up to 9.9 MHz at low THD are verified by simulation and hardware tests.
Voltage-regulating constant-current sources in a linear induction accelerator
International Nuclear Information System (INIS)
Zhao Juan; Cao Kefeng; Deng Jianjun; Zhu Lijun; Yang Jia; Ye Chao; Huang Bin; Cao Ningxiang; Dong Jinxuan; Zhang Jichang; Yu Zhiguo; Chen Min
2002-01-01
Constant-current Sources are one of key units in a linear induction accelerator. The requirements for the sources are to supply stable direct current of high power for the induction coil, be easy to computer-control and highly stable and reliable. Applying the technique of linear current source regulating in series, the primary voltage of the power transformer is regulated through an MJYS-JL-350A type three-phase alterative voltage-regulating module. The output current variation is 300-500 A when the load variation is 0.06-0.1 Ω and the voltage drop of the regulator tube is controlled within 8 V±2V when the variation of mains voltage is in ±10%. Both the current ripple and stability meet the technical requirements. The constant-current sources are controlled through an industrial controller. For each of the constant-current sources has a smallest system comprised of 8051 which is communication-controlled through a RS-485 interface, the sources can be controlled remotely
A new linear induction voltage adder approach to radiography
International Nuclear Information System (INIS)
Mazarakis, M.G.; Poukey, J.W.; Frost, C.A.; Johnson, D.L.; Shope, S.L.; Halbleib, J.A.; Prestwich, K.R.; Turman, B.N.; Smith, I.
1992-01-01
At present, two types of accelerators are being utilized for x-ray radiography: first a linear RF or induction accelerator with multiple accelerating gaps and beam vacuum magnetic transport systems; and second, single gap pulse-power devices with a high voltage Blumlein pulse forming line. The authors present a conceptual design of a new type of linear induction accelerator that can bridge the gap between the two devices. It can produce 30--50-kA electron currents small diameter (∼ 1 mm) and high energy (12--20-MV) beams. There is no beam drifting through the device. The voltage addition of the accelerating gaps occurs at the central self-magnetically insulated cathode electrode. The electron beam is created at the high voltage end in a single gap diode. A magnetically-immersed foilless diode can produce high quality 0.5 mm radius 30--50 kA beams. A short 100--200-kG small bore solenoidal coil is required to maintain the beam radius during transport from the cathode tips to the x-ray converter target, 50--70 cm downstream. The idea of very high impedance MITL voltage adder accelerators was first tested with RADLAC II/SMILE experiments where 12--14-MV, 50-kA 1 cm radius beams were produced with 2--3 mm annulus thickness. A 12.5 m eight-stage voltage adder was utilized, coupled to a 20 kG magnetically immersed foilless diode. In addition the magnetically-immersed foilless diodes with very thin (mm diameter) cathode tips were investigated in experiments with the IBEX accelerator. As an example of this new accelerator technology the authors present the following point design for a 16-MV, 50-kA accelerator producing 1-mm diameter electron beams. The design is based on a cavity fed MITL voltage adder which performs the series addition of the voltage pulses from 16 identical inductively-isolated cavity feed systems. Each cavity is a structure that is driven by one 14 ohm pulse-forming line, providing a 1 MV voltage pulse to the accelerating gap
Modulation linearization of a frequency-modulated voltage controlled oscillator, part 3
Honnell, M. A.
1975-01-01
An analysis is presented for the voltage versus frequency characteristics of a varactor modulated VHF voltage controlled oscillator in which the frequency deviation is linearized by using the nonlinear characteristics of a field effect transistor as a signal amplifier. The equations developed are used to calculate the oscillator output frequency in terms of pertinent circuit parameters. It is shown that the nonlinearity exponent of the FET has a pronounced influence on frequency deviation linearity, whereas the junction exponent of the varactor controls total frequency deviation for a given input signal. A design example for a 250 MHz frequency modulated oscillator is presented.
On the modelling of linear-assisted DC-DC voltage regulators for photovoltaic solar energy systems
Martínez-García, Herminio; García-Vílchez, Encarna
2017-11-01
This paper shows the modelling of linear-assisted or hybrid (linear & switching) DC/DC voltage regulators. In this kind of regulators, an auxiliary linear regulator is used, which objective is to cancel the ripple at the output voltage and provide fast responses for load variations. On the other hand, a switching DC/DC converter, connected in parallel with the linear regulator, allows to supply almost the whole output current demanded by the load. The objective of this topology is to take advantage of the suitable regulation characteristics that series linear voltage regulators have, but almost achieving the high efficiency that switching DC/DC converters provide. Linear-assisted DC/DC regulators are feedback systems with potential instability. Therefore, their modelling is mandatory in order to obtain design guidelines and assure stability of the implemented power supply system.
Choi, Hojong; Woo, Park Chul; Yeom, Jung-Yeol; Yoon, Changhan
2017-04-04
A power MOSFET linearizer is proposed for a high-voltage power amplifier (HVPA) used in high-frequency pulse-echo instrumentation. The power MOSFET linearizer is composed of a DC bias-controlled series power MOSFET shunt with parallel inductors and capacitors. The proposed scheme is designed to improve the gain deviation characteristics of the HVPA at higher input powers. By controlling the MOSFET bias voltage in the linearizer, the gain reduction into the HVPA was compensated, thereby reducing the echo harmonic distortion components generated by the ultrasonic transducers. In order to verify the performance improvement of the HVPA implementing the power MOSFET linearizer, we measured and found that the gain deviation of the power MOSFET linearizer integrated with HVPA under 10 V DC bias voltage was reduced (-1.8 and -0.96 dB, respectively) compared to that of the HVPA without the power MOSFET linearizer (-2.95 and -3.0 dB, respectively) when 70 and 80 MHz, three-cycle, and 26 dB m input pulse waveforms are applied, respectively. The input 1-dB compression point (an index of linearity) of the HVPA with power MOSFET linearizer (24.17 and 26.19 dB m at 70 and 80 MHz, respectively) at 10 V DC bias voltage was increased compared to that of HVPA without the power MOSFET linearizer (22.03 and 22.13 dB m at 70 and 80 MHz, respectively). To further verify the reduction of the echo harmonic distortion components generated by the ultrasonic transducers, the pulse-echo responses in the pulse-echo instrumentation were compared when using HVPA with and without the power MOSFET linearizer. When three-cycle 26 dB m input power was applied, the second, third, fourth, and fifth harmonic distortion components of a 75 MHz transducer driven by the HVPA with power MOSFET linearizer (-48.34, -44.21, -48.34, and -46.56 dB, respectively) were lower than that of the HVPA without the power MOSFET linearizer (-45.61, -41.57, -45.01, and -45.51 dB, respectively). When five-cycle 20 dB m input
A High Performance Silicon-on-Insulator LDMOSTT Using Linearly Increasing Thickness Techniques
International Nuclear Information System (INIS)
Yu-Feng, Guo; Zhi-Gong, Wang; Gene, Sheu; Jian-Bing, Cheng
2010-01-01
We present a new technique to achieve uniform lateral electric field and maximum breakdown voltage in lateral double-diffused metal-oxide-semiconductor transistors fabricated on silicon-on-insulator substrates. A linearly increasing drift-region thickness from the source to the drain is employed to improve the electric field distribution in the devices. Compared to the lateral linear doping technique and the reduced surface field technique, two-dimensional numerical simulations show that the new device exhibits reduced specific on-resistance, maximum off- and on-state breakdown voltages, superior quasi-saturation characteristics and improved safe operating area. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
International Nuclear Information System (INIS)
Shavezipur, M; Nieva, P; Khajepour, A; Hashemi, S M
2010-01-01
This paper presents a design technique that can be used to linearize the capacitance–voltage (C–V) response and extend the tuning range of parallel-plate-based MEMS tunable capacitors beyond that of conventional designs. The proposed technique exploits the curvature of the capacitor's moving electrode which could be induced by either manipulating the stress gradients in the plate's material or using bi-layer structures. The change in curvature generates a nonlinear structural stiffness as the moving electrode undergoes out-of-plane deformation due to the actuation voltage. If the moving plate curvature is tailored such that the capacitance increment is proportional to the voltage increment, then a linear C–V response is obtained. The larger structural resistive force at higher bias voltage also delays the pull-in and increases the maximum tunability of the capacitor. Moreover, for capacitors containing an insulation layer between the two electrodes, the proposed technique completely eliminates the pull-in effect. The experimental data obtained from different capacitors fabricated using PolyMUMPs demonstrate the advantages of this design approach where highly linear C–V responses and tunabilities as high as 1050% were recorded. The design methodology introduced in this paper could be easily extended to for example, capacitive pressure and temperature sensors or infrared detectors to enhance their response characteristics.
Energy Technology Data Exchange (ETDEWEB)
Bi, Ke; Sui, Ning; Zhang, Liquan; Wang, Yinghui, E-mail: yinghui-wang@outlook.com; Liu, Qinghui, E-mail: liuqinghui@jlu.edu.cn; Tan, Mingrui [Jilin University, Femtosecond Laser Laboratory, Key Laboratory of Physics and Technology for Advanced Batteries (Ministry of Education), College of Physics (China); Zhou, Qiang [Jilin University, Key Laboratory of Superhard Materials, College of Physics (China); Zhang, Hanzhuang, E-mail: zhanghz@jlu.edu.cn [Jilin University, Femtosecond Laser Laboratory, Key Laboratory of Physics and Technology for Advanced Batteries (Ministry of Education), College of Physics (China)
2016-12-15
The role of ZnS shell on the photo-physical properties within CuInS{sub 2}/ZnS quantum dots (QDs) is carefully studied in optoelectronic devices. Linearly increasing voltage technique has been employed to investigate the charge carrier dynamics of both CuInS{sub 2} and CuInS{sub 2}/ZnS QDs films. This study shows that charge carriers follow a similar behavior of monomolecular recombination in this film, with their charge transfer rate correlates to the increase of applied voltage. It turns out that the ZnS shell could affect the carrier diffusion process through depressing the trapping states and would build up a potential barrier.
Voltage Dependence of Supercapacitor Capacitance
Directory of Open Access Journals (Sweden)
Szewczyk Arkadiusz
2016-09-01
Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.
A 5 V-to-3.3 V CMOS Linear Regulator with Three-Output Temperature-Independent Reference Voltages
Directory of Open Access Journals (Sweden)
San-Fu Wang
2016-01-01
Full Text Available This paper presents a 5 V-to-3.3 V linear regulator circuit, which uses 3.3 V CMOS transistors to replace the 5 V CMOS transistors. Thus, the complexity of the manufacturing semiconductor process can be improved. The proposed linear regulator is implemented by cascode architecture, which requires three different reference voltages as the bias voltages of its circuit. Thus, the three-output temperature-independent reference voltage circuit is proposed, which provides three accurate reference voltages simultaneously. The three-output temperature-independent reference voltages also can be used in other circuits of the chip. By using the proposed temperature-independent reference voltages, the proposed linear regulator can provide an accurate output voltage, and it is suitable for low cost, small size, and highly integrated system-on-chip (SoC applications. Moreover, the proposed linear regulator uses the cascode technique, which improves both the gain performance and the isolation performance. Therefore, the proposed linear regulator has a good performance in reference voltage to output voltage isolation. The voltage variation of the linear regulator is less than 2.153% in the temperature range of −40°C–120°C, and the power supply rejection ratio (PSRR is less than −42.8 dB at 60 Hz. The regulator can support 0~200 mA output current. The core area is less than 0.16 mm2.
A low-voltage fully balanced CMFF transconductor with improved linearity
Calvo, B.; Celma, S.; Alegre, J. P.; Sanz, M. T.
2007-05-01
This paper presents a new low-voltage pseudo-differential continuous-time CMOS transconductor for wideband applications. The proposed cell is based on a feedforward cancellation of the input common-mode signal and keeps the input common mode voltage constant, while the transconductance is easily tunable through a continuous bias voltage. Linearity is preserved during the tuning process for a moderate range of transconductance values. Simulation results for a 0.35 μm CMOS design show a 1:2 G m tuning range with an almost constant bandwidth over 600 MHz. Total harmonic distortion figures are below -60 dB over the whole range at 10 MHz up to a 200 μA p-p differential output. The proposed cell consumes less than 1.2 mW from a single 2.0 V supply.
Fernandez, Fernando R.; Malerba, Paola; White, John A.
2015-01-01
The presence of voltage fluctuations arising from synaptic activity is a critical component in models of gain control, neuronal output gating, and spike rate coding. The degree to which individual neuronal input-output functions are modulated by voltage fluctuations, however, is not well established across different cortical areas. Additionally, the extent and mechanisms of input-output modulation through fluctuations have been explored largely in simplified models of spike generation, and with limited consideration for the role of non-linear and voltage-dependent membrane properties. To address these issues, we studied fluctuation-based modulation of input-output responses in medial entorhinal cortical (MEC) stellate cells of rats, which express strong sub-threshold non-linear membrane properties. Using in vitro recordings, dynamic clamp and modeling, we show that the modulation of input-output responses by random voltage fluctuations in stellate cells is significantly limited. In stellate cells, a voltage-dependent increase in membrane resistance at sub-threshold voltages mediated by Na+ conductance activation limits the ability of fluctuations to elicit spikes. Similarly, in exponential leaky integrate-and-fire models using a shallow voltage-dependence for the exponential term that matches stellate cell membrane properties, a low degree of fluctuation-based modulation of input-output responses can be attained. These results demonstrate that fluctuation-based modulation of input-output responses is not a universal feature of neurons and can be significantly limited by subthreshold voltage-gated conductances. PMID:25909971
New non-linear control strategy for non-isolated DC/DC converter with high voltage ratio
Energy Technology Data Exchange (ETDEWEB)
Shahin, A.; Huang, B.; Martin, J.P.; Pierfederici, S.; Davat, B. [Groupe de Recherche en Electronique et en Electrotechnique de Nancy - INPL - Nancy Universite, 2, Avenue de la Foret de Haye, 54516 Vandoeuvre-les-Nancy Cedex (France)
2010-01-15
In this paper, a non-isolated DC/DC converter with high voltage ratio is proposed to allow the interface between a low voltage power source like fuel cell and a high voltage DC bus. To take into account the low voltage-high density characteristics of power sources, a cascaded structure composed of two sub-converters has been chosen and allows obtaining a high voltage ratio. The choice of each sub-converter is based on the requirements of the source and its performances. Consequently, we have chosen a three-interleaved boost converter as the 1st sub-converter whereas the 2nd sub-converter is a three-level boost converter. The control of the whole system is realized thanks to energetic trajectories planning based on flatness properties of the system. The control of both the current and the balance of voltage across the output serial capacitors of the three-level boost converter is ensured by non-linear controllers based on a new non-linear model. Experimental results allow validating the proposed power architecture and its associated control. (author)
New non-linear control strategy for non-isolated DC/DC converter with high voltage ratio
International Nuclear Information System (INIS)
Shahin, A.; Huang, B.; Martin, J.P.; Pierfederici, S.; Davat, B.
2010-01-01
In this paper, a non-isolated DC/DC converter with high voltage ratio is proposed to allow the interface between a low voltage power source like fuel cell and a high voltage DC bus. To take into account the low voltage-high density characteristics of power sources, a cascaded structure composed of two sub-converters has been chosen and allows obtaining a high voltage ratio. The choice of each sub-converter is based on the requirements of the source and its performances. Consequently, we have chosen a three-interleaved boost converter as the 1st sub-converter whereas the 2nd sub-converter is a three-level boost converter. The control of the whole system is realized thanks to energetic trajectories planning based on flatness properties of the system. The control of both the current and the balance of voltage across the output serial capacitors of the three-level boost converter is ensured by non-linear controllers based on a new non-linear model. Experimental results allow validating the proposed power architecture and its associated control.
Directory of Open Access Journals (Sweden)
Jovanović Jelena
2016-02-01
Full Text Available A cost-effective method for resolution increase of a two-stage piecewise linear analog-to-digital converter used for sensor linearization is proposed in this paper. In both conversion stages flash analog-to-digital converters are employed. Resolution increase by one bit per conversion stage is performed by introducing one additional comparator in front of each of two flash analog-to-digital converters, while the converters’ resolutions remain the same. As a result, the number of employed comparators, as well as the circuit complexity and the power consumption originating from employed comparators are for almost 50 % lower in comparison to the same parameters referring to the linearization circuit of the conventional design and of the same resolution. Since the number of employed comparators is significantly reduced according to the proposed method, special modifications of the linearization circuit are needed in order to properly adjust reference voltages of employed comparators.
Low voltage RF MEMS variable capacitor with linear C-V response
Elshurafa, Amro M.; Ho, Pak Hung; Salama, Khaled N.
2012-01-01
.2:1 and was achieved at an actuation DC voltage of 8V only. Further, the linear regression coefficient was 0.98. The variable capacitor was created such that it has both vertical and horizontal capacitances present. As the top suspended plate moves towards the bottom
Voltage and pace-capture mapping of linear ablation lesions overestimates chronic ablation gap size.
O'Neill, Louisa; Harrison, James; Chubb, Henry; Whitaker, John; Mukherjee, Rahul K; Bloch, Lars Ølgaard; Andersen, Niels Peter; Dam, Høgni; Jensen, Henrik K; Niederer, Steven; Wright, Matthew; O'Neill, Mark; Williams, Steven E
2018-04-26
Conducting gaps in lesion sets are a major reason for failure of ablation procedures. Voltage mapping and pace-capture have been proposed for intra-procedural identification of gaps. We aimed to compare gap size measured acutely and chronically post-ablation to macroscopic gap size in a porcine model. Intercaval linear ablation was performed in eight Göttingen minipigs with a deliberate gap of ∼5 mm left in the ablation line. Gap size was measured by interpolating ablation contact force values between ablation tags and thresholding at a low force cut-off of 5 g. Bipolar voltage mapping and pace-capture mapping along the length of the line were performed immediately, and at 2 months, post-ablation. Animals were euthanized and gap sizes were measured macroscopically. Voltage thresholds to define scar were determined by receiver operating characteristic analysis as voltage, pace-capture, and ablation contact force maps. All modalities overestimated chronic gap size, by 1.4 ± 2.0 mm (ablation contact force map), 5.1 ± 3.4 mm (pace-capture), and 9.5 ± 3.8 mm (voltage mapping). Error on ablation contact force map gap measurements were significantly less than for voltage mapping (P = 0.003, Tukey's multiple comparisons test). Chronically, voltage mapping and pace-capture mapping overestimated macroscopic gap size by 11.9 ± 3.7 and 9.8 ± 3.5 mm, respectively. Bipolar voltage and pace-capture mapping overestimate the size of chronic gap formation in linear ablation lesions. The most accurate estimation of chronic gap size was achieved by analysis of catheter-myocardium contact force during ablation.
Air-gap field, induced voltage and thrust in the short-stator linear induction motor
Energy Technology Data Exchange (ETDEWEB)
Deleroi, W
1980-07-15
The description of the magnetic field in the air-gap of a short-primary linear induction motor, and the subsequent calculation of the thrust developed and the voltages induced in the stator bars can be made by using balancing waves. These balancing waves are generated at any point where the field wave that would exist in a machine of infinite length is disturbed. In the linear motor these disturbances occur at the ends of the stator iron and at discontinuities in the distribution of the stator winding, which exist in machines having stepped windings. From the points where they are generated, free balancing waves travel in two directions and determine the performance of these machines to a large extent. The voltage they induce in a stator bar can be determined from the core flux and mapped on a phasor diagram. The resulting voltage phasor follows a logarithmic spiral. The resulting voltages induced in the three phase windings form a strongly asymmetrical system which can be split-up into positive-, negative- and zerosequence components depending on the slip. The tangential forces may be calculated as the product of the magnetic flux density in the air-gap and the linear current density in either the stator or the reaction rail. As the 'magnetic tail' outside the machine also gives rise to forces in the direction of motion, both methods yield quite different force distributions, though for the resulting force the same value is found.
Fully Integrated, Low Drop-Out Linear Voltage Regulator in 180 nm CMOS
DEFF Research Database (Denmark)
Yosef-Hay, Yoni; Larsen, Dennis Øland; Llimos Muntal, Pere
2017-01-01
This paper presents a capacitor-free low dropout (LDO) linear regulator based on a dual loop topology. The regulator utilizes two feedback loops to satisfy the challenges of hearing aid devices, which include fast transient performance and small voltage spikes under rapid load-current changes...
Linearity optimizations of analog ring resonator modulators through bias voltage adjustments
Hosseinzadeh, Arash; Middlebrook, Christopher T.
2018-03-01
The linearity of ring resonator modulator (RRM) in microwave photonic links is studied in terms of instantaneous bandwidth, fabrication tolerances, and operational bandwidth. A proposed bias voltage adjustment method is shown to maximize spur-free dynamic range (SFDR) at instantaneous bandwidths required by microwave photonic link (MPL) applications while also mitigating RRM fabrication tolerances effects. The proposed bias voltage adjustment method shows RRM SFDR improvement of ∼5.8 dB versus common Mach-Zehnder modulators at 500 MHz instantaneous bandwidth. Analyzing operational bandwidth effects on SFDR shows RRMs can be promising electro-optic modulators for MPL applications which require high operational frequencies while in a limited bandwidth such as radio-over-fiber 60 GHz wireless network access.
Electric field control methods for foil coils in high-voltage linear actuators
Beek, van T.A.; Jansen, J.W.; Lomonova, E.A.
2015-01-01
This paper describes multiple electric field control methods for foil coils in high-voltage coreless linear actuators. The field control methods are evaluated using 2-D and 3-D boundary element methods. A comparison is presented between the field control methods and their ability to mitigate
Energy Technology Data Exchange (ETDEWEB)
Kenne, Godpromesse [Laboratoire d' Automatique et d' Informatique Appliquee (LAIA), Departement de Genie Electrique, Universite de Dschang, B.P. 134 Bandjoun, Cameroun; Goma, Raphael; Lamnabhi-Lagarrigue, Francoise [Laboratoire des Signaux et Systemes (L2S), CNRS-SUPELEC, Universite Paris XI, 3 Rue Joliot Curie, 91192 Gif-sur-Yvette (France); Nkwawo, Homere [Departement GEII, Universite Paris XIII, IUT Villetaneuse, 99 Avenue Jean Baptiste Clement, 93430 Villetaneuse (France); Arzande, Amir; Vannier, Jean Claude [Departement Energie, Ecole Superieure d' Electricite-SUPELEC, 3 Rue Joliot Curie, 91192 Gif-sur-Yvette (France)
2010-09-15
In this paper, a simple improved direct feedback linearization design method for transient stability and voltage regulation of power systems is discussed. Starting with the classical direct feedback linearization technique currently applied to power systems, an adaptive nonlinear excitation control of synchronous generators is proposed, which is new and effective for engineering. The power angle and mechanical power input are not assumed to be available. The proposed method is based on a standard third-order model of a synchronous generator which requires only information about the physical available measurements of angular speed, active electric power and generator terminal voltage. Experimental results of a practical power system show that fast response, robustness, damping, steady-state and transient stability as well as voltage regulation are all achieved satisfactorily. (author)
Linear inductive voltage adders (IVA) for advanced hydrodynamic radiography
International Nuclear Information System (INIS)
Mazarakis, M.G.; Boyes, J.D.; Johnson, D.L.
1998-01-01
The electron beam which drifts through the multiple cavities of conventional induction linacs (LIA) is replaced in an IVA by a cylindrical metal conductor which extends along the entire length of the device and effectuates the addition of the accelerator cavity voltages. In the approach to radiography, the linear inductive voltage adder drives a magnetically immersed electron diode with a millimeter diameter cathode electrode and a planar anode/bremsstrahlung converter. Both anode and cathode electrodes are immersed in a strong (15--50 T) solenoidal magnetic field. The electron beam cross section is approximately of the same size as the cathode needle and generates a similar size, very intense x-ray beam when it strikes the anode converter. An IVA driven diode can produce electron beams of equal size and energy as a LIA but with much higher currents (40--50 kA versus 4--5 kA), simpler hardware and thus lower cost. The authors present here first experimental validations of the technology utilizing HERMES 3 and SABRE IVA accelerators. The electron beam voltage and current were respectively of the order of 10 MV and 40 kA. X-ray doses of up to 1 kR at sign 1 m and spot sizes as small as 1.7 mm (at 200 R doses) were measured
Masuda, Masaharu; Fujita, Masashi; Iida, Osamu; Okamoto, Shin; Ishihara, Takayuki; Nanto, Kiyonori; Kanda, Takashi; Sunaga, Akihiro; Tsujimura, Takuya; Matsuda, Yasuhiro; Mano, Toshiaki
2017-08-01
A bipolar voltage reflects a thick musculature where formation of a transmural lesion may be hard to achieve. The purpose of this study was to explore the association between local bipolar voltage and conduction gap in patients with persistent atrial fibrillation (AF) who underwent atrial roof or septal linear ablation. This prospective observational study included 42 and 36 consecutive patients with persistent AF who underwent roof or septal linear ablations, respectively. After pulmonary vein isolation, left atrial linear ablations were performed, and conduction gap sites were identified and ablated after first-touch radiofrequency application. Conduction gap(s) after the first-touch roof and septal linear ablation were observed in 13 (32%) and 19 patients (53%), respectively. Roof and septal area voltages were higher in patients with conduction gap(s) than in those without (roof, 1.23 ± 0.77 vs 0.73 ± 0.42 mV, p = 0.010; septal, 0.96 ± 0.43 vs 0.54 ± 0.18 mV, p = 0.001). Trisected regional analyses revealed that the voltage was higher at the region with a conduction gap than at the region without. Complete conduction block across the roof and septal lines was not achieved in 3 (7%) and 6 patients (17%), respectively. Patients in whom a linear conduction block could not be achieved demonstrated higher ablation area voltage than those with a successful conduction block (roof, 1.91 ± 0.74 vs 0.81 ± 0.51 mV, p = 0.001; septal, 1.15 ± 0.56 vs 0.69 ± 0.31 mV, p = 0.006). In conclusion, a high regional bipolar voltage predicts failure to achieve conduction block after left atrial roof or septal linear ablation. In addition, the conduction gap was located at the preserved voltage area. Copyright © 2017 Elsevier Inc. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Bykov, Yu. A.; Krastelev, E. G., E-mail: ekrastelev@yandex.ru; Popov, G. V.; Sedin, A. A.; Feduschak, V. F. [Russian Academy of Sciences, Joint Institute for High Temperatures (Russian Federation)
2016-12-15
A pulsed power source with voltage amplitude up to 800 kV for fast charging (350–400 ns) of the forming line of a high-current nanosecond accelerator is developed. The source includes capacitive energy storage and a linear pulse transformer. The linear transformer consists of a set of 20 inductors with circular ferromagnetic cores surrounded by primary windings inside of which a common stock adder of voltage with film-glycerol insulation is placed. The primary energy storage consists of ten modules, each of which is a low-inductance assembly of two capacitors with a capacitance of 0.35 μF and one gas switch mounted in the same frame. The total energy stored in capacitors is 5.5 kJ at the operating voltage of 40 kV. According to test results, the parameters of the equivalent circuit of the source are the following: shock capacitance = 17.5 nF, inductance = 2 μH, resistance = 3.2 Ω.
Shi, Xiaoyu; Wu, Zhong-Shuai; Qin, Jieqiong; Zheng, Shuanghao; Wang, Sen; Zhou, Feng; Sun, Chenglin; Bao, Xinhe
2017-11-01
Printable supercapacitors are regarded as a promising class of microscale power source, but are facing challenges derived from conventional sandwich-like geometry. Herein, the printable fabrication of new-type planar graphene-based linear tandem micro-supercapacitors (LTMSs) on diverse substrates with symmetric and asymmetric configuration, high-voltage output, tailored capacitance, and outstanding flexibility is demonstrated. The resulting graphene-based LTMSs consisting of 10 micro-supercapacitors (MSs) present efficient high-voltage output of 8.0 V, suggestive of superior uniformity of the entire integrated device. Meanwhile, LTMSs possess remarkable flexibility without obvious capacitance degradation under different bending states. Moreover, areal capacitance of LTMSs can be sufficiently modulated by incorporating polyaniline-based pseudocapacitive nanosheets into graphene electrodes, showing enhanced capacitance of 7.6 mF cm -2 . To further improve the voltage output and energy density, asymmetric LTMSs are fabricated through controlled printing of linear-patterned graphene as negative electrodes and MnO 2 nanosheets as positive electrodes. Notably, the asymmetric LTMSs from three serially connected MSs are easily extended to 5.4 V, triple voltage output of the single cell (1.8 V), suggestive of the versatile applicability of this technique. Therefore, this work offers numerous opportunities of graphene and analogous nanosheets for one-step scalable fabrication of flexible tandem energy storage devices integrating with printed electronics on same substrate. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
A new linear inductive voltage adder driver for the Saturn Accelerator
International Nuclear Information System (INIS)
Mazarakis, M.G.; Spielman, R.B.; Struve, K.W.; Long, F.W.
2000-01-01
Saturn is a dual-purpose accelerator. It can be operated as a large-area flash x-ray source for simulation testing or as a Z-pinch driver especially for K-line x-ray production. In the first mode, the accelerator is fitted with three concentric-ring 2-MV electron diodes, while in the Z-pinch mode the current of all the modules is combined via a post-hole convolute arrangement and driven through a cylindrical array of very fine wires. We present here a point design for a new Saturn class driver based on a number of linear inductive voltage adders connected in parallel. A technology recently implemented at the Institute of High Current Electronics in Tomsk (Russia) is being utilized. In the present design we eliminate Marx generators and pulse-forming networks. Each inductive voltage adder cavity is directly fed by a number of fast 100-kV small-size capacitors arranged in a circular array around each accelerating gap. The number of capacitors connected in parallel to each cavity defines the total maximum current. By selecting low inductance switches, voltage pulses as short as 30-50-ns FWHM can be directly achieved. The voltage of each stage is low (100-200 kv). Many stages are required to achieve multi-megavolt accelerator output. However, since the length of each stage is very short (4-10 cm), accelerating gradients of higher than 1 MV/m can easily be obtained. The proposed new driver will be capable of delivering pulses of 15-MA, 36-TW, 1.2-MJ to the diode load, with a peak voltage of -2.2 MV and FWHM of 40-ns. And although its performance will exceed the presently utilized driver, its size and cost could be much smaller (approximately1/3). In addition, no liquid dielectrics like oil or deionized water will be required. Even elimination of ferromagnetic material (by using air-core cavities) is a possibility
High-output microwave detector using voltage-induced ferromagnetic resonance
International Nuclear Information System (INIS)
Shiota, Yoichi; Suzuki, Yoshishige; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Yuasa, Shinji
2014-01-01
We investigated the voltage-induced ferromagnetic resonance (FMR) with various DC bias voltage and input RF power in magnetic tunnel junctions. We found that the DC bias monotonically increases the homodyne detection voltage due to the nonlinear FMR originating in an asymmetric magnetization-potential in the free layer. In addition, the linear increase of an output voltage to the input RF power in the voltage-induced FMR is more robust than that in spin-torque FMR. These characteristics enable us to obtain an output voltage more than ten times than that of microwave detectors using spin-transfer torque
Increasing Linear Dynamic Range of a CMOS Image Sensor
Pain, Bedabrata
2007-01-01
A generic design and a corresponding operating sequence have been developed for increasing the linear-response dynamic range of a complementary metal oxide/semiconductor (CMOS) image sensor. The design provides for linear calibrated dual-gain pixels that operate at high gain at a low signal level and at low gain at a signal level above a preset threshold. Unlike most prior designs for increasing dynamic range of an image sensor, this design does not entail any increase in noise (including fixed-pattern noise), decrease in responsivity or linearity, or degradation of photometric calibration. The figure is a simplified schematic diagram showing the circuit of one pixel and pertinent parts of its column readout circuitry. The conventional part of the pixel circuit includes a photodiode having a small capacitance, CD. The unconventional part includes an additional larger capacitance, CL, that can be connected to the photodiode via a transfer gate controlled in part by a latch. In the high-gain mode, the signal labeled TSR in the figure is held low through the latch, which also helps to adapt the gain on a pixel-by-pixel basis. Light must be coupled to the pixel through a microlens or by back illumination in order to obtain a high effective fill factor; this is necessary to ensure high quantum efficiency, a loss of which would minimize the efficacy of the dynamic- range-enhancement scheme. Once the level of illumination of the pixel exceeds the threshold, TSR is turned on, causing the transfer gate to conduct, thereby adding CL to the pixel capacitance. The added capacitance reduces the conversion gain, and increases the pixel electron-handling capacity, thereby providing an extension of the dynamic range. By use of an array of comparators also at the bottom of the column, photocharge voltages on sampling capacitors in each column are compared with a reference voltage to determine whether it is necessary to switch from the high-gain to the low-gain mode. Depending upon
Development of three channel linear bipolar high voltage amplifier (±2 KV) for electrostatic steerer
International Nuclear Information System (INIS)
Rajesh Kumar; Mukesh Kumar; Suman, S.K.; Safvan, C.P.; Mandal, A.
2011-01-01
Electrostatic steerers and scanners are planned for low energy ion beam facilities at IUAC to steer and scan the ion beam on target. The power supplies for electrostatic steerers are high voltage bipolar DC amplifiers and for scanners are bipolar AC amplifiers. To fulfil the requirements a common unit has been designed and assembled for AC and DC applications. It can be used with electrostatic devices in scanning, steering and sweeping of low energy ion beams at high frequencies to attain uniform implantation. The unit consist of three independent limited bandwidth high voltage, linear bipolar amplifiers (for X-axis, Y-axis and Y1-dog leg plates). The unit has been provided with both local and remote control. (author)
Directory of Open Access Journals (Sweden)
R. N. Bhowmik
2015-06-01
Full Text Available We have studied current-voltage (I-V characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP 0.345(± 0.001 V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%, magnetoresistance (70-135 % and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.
Bhowmik, R. N.; Vijayasri, G.
2015-06-01
We have studied current-voltage (I-V) characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (˜500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.
Control and Testing of a Dynamic Voltage Restorer (DVR) at Medium Voltage Level
DEFF Research Database (Denmark)
Nielsen, John Godsk; Newman, Michael; Nielsen, Hans Ove
2004-01-01
power sensitive loads from voltage sags. This paper reports practical test results obtained on a medium voltage (10 kV) level using a DVR at a Distribution test facility in Kyndby, Denmark. The DVR was designed to protect a 400-kVA load from a 0.5-p.u. maximum voltage sag. The reported DVR verifies......The dynamic voltage restorer (DVR) has become popular as a cost effective solution for the protection of sensitive loads from voltage sags. Implementations of the DVR have been proposed at both a low voltage (LV) level, as well as a medium voltage (MV) level; and give an opportunity to protect high...... the use of a feed-forward and feed-back technique of the controller and it obtains both good transient and steady state responses. The effect of the DVR on the system is experimentally investigated under both faulted and non-faulted system states, for a variety of linear and non-linear loads. Variable...
International Nuclear Information System (INIS)
Zhang Jun; Guo Yu-Feng; Xu Yue; Lin Hong; Yang Hui; Hong Yang; Yao Jia-Fei
2015-01-01
A novel one-dimensional (1D) analytical model is proposed for quantifying the breakdown voltage of a reduced surface field (RESURF) lateral power device fabricated on silicon on an insulator (SOI) substrate. We assume that the charges in the depletion region contribute to the lateral PN junctions along the diagonal of the area shared by the lateral and vertical depletion regions. Based on the assumption, the lateral PN junction behaves as a linearly graded junction, thus resulting in a reduced surface electric field and high breakdown voltage. Using the proposed model, the breakdown voltage as a function of device parameters is investigated and compared with the numerical simulation by the TCAD tools. The analytical results are shown to be in fair agreement with the numerical results. Finally, a new RESURF criterion is derived which offers a useful scheme to optimize the structure parameters. This simple 1D model provides a clear physical insight into the RESURF effect and a new explanation on the improvement in breakdown voltage in an SOI RESURF device. (paper)
DEFF Research Database (Denmark)
Douglass, Philip James; Garcia-Valle, Rodrigo; Østergaard, Jacob
2014-01-01
This paper presents a novel controller design for controlling appliances based on local measurements of voltage. The controller finds the normalized voltage deviation accounting for the sensitivity of voltage measurements to appliance state. The controller produces a signal indicating desired pow...
Linear variable voltage diode capacitor and adaptive matching networks
Larson, L.E.; De Vreede, L.C.N.
2006-01-01
An integrated variable voltage diode capacitor topology applied to a circuit providing a variable voltage load for controlling variable capacitance. The topology includes a first pair of anti-series varactor diodes, wherein the diode power-law exponent n for the first pair of anti-series varactor
Increased voltage photovoltaic cell
Ross, B.; Bickler, D. B.; Gallagher, B. D. (Inventor)
1985-01-01
A photovoltaic cell, such as a solar cell, is provided which has a higher output voltage than prior cells. The improved cell includes a substrate of doped silicon, a first layer of silicon disposed on the substrate and having opposite doping, and a second layer of silicon carbide disposed on the first layer. The silicon carbide preferably has the same type of doping as the first layer.
Voltage splay modes and enhanced phase locking in a modified linear Josephson array
Harris, E. B.; Garland, J. C.
1997-02-01
We analyze a modified linear Josephson-junction array in which additional unbiased junctions are used to greatly enhance phase locking. This geometry exhibits strong correlated behavior, with an external magnetic field tuning the voltage splay angle between adjacent Josephson oscillators. The array displays a coherent in-phase mode for f=, where f is the magnetic frustration, while for 0tolerant of critical current disorder approaching 100%. The stability of the array has also been studied by computing Floquet exponents. These exponents are found to be negative for all array lengths, with a 1/N2 dependence, N being the number of series-connected junctions.
Insulation Resistance and Leakage Currents in Low-Voltage Ceramic Capacitors with Cracks
Teverovsky, Alexander A.
2016-01-01
Measurement of insulation resistance (IR) in multilayer ceramic capacitors (MLCCs) is considered a screening technique that ensures the dielectric is defect-free. This work analyzes the effectiveness of this technique for revealing cracks in ceramic capacitors. It is shown that absorption currents prevail over the intrinsic leakage currents during standard IR measurements at room temperature. Absorption currents, and consequently IR, have a weak temperature dependence, increase linearly with voltage (before saturation), and are not sensitive to the presence of mechanical defects. In contrary, intrinsic leakage currents increase super-linearly with voltage and exponentially with temperature (activation energy is in the range from 0.6 eV to 1.1 eV). Leakage currents associated with the presence of cracks have a weaker dependence on temperature and voltage compared to the intrinsic leakage currents. For this reason, intrinsic leakage currents prevail at high temperatures and voltages, thus masking the presence of defects.
Energy Technology Data Exchange (ETDEWEB)
Bhowmik, R. N., E-mail: rnbhowmik.phy@pondiuni.edu.in; Vijayasri, G. [Department of Physics, Pondicherry University, R.Venkataraman Nagar, Kalapet, Puducherry - 605 014 (India)
2015-06-15
We have studied current-voltage (I-V) characteristics of α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3}, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔV{sub P}) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.
Directory of Open Access Journals (Sweden)
Ruochen Wang
2017-01-01
Full Text Available To study the effect of supercapacitor initial terminal voltage on the regenerative and semiactive suspension energy-regeneration and dynamic performance, firstly, the relationship between supercapacitor terminal voltage and linear motor electromagnetic damping force and that between supercapacitor terminal voltage and recycled energy by the supercapacitor in one single switching period were both analyzed. The result shows that the linear motor electromagnetic damping force is irrelevant to the supercapacitor terminal voltage, and the recycled energy by the supercapacitor reaches the maximum when initial terminal voltage of the supercapacitor equals output terminal voltage of the linear motor. Then, performances of system dynamics and energy-regeneration were studied as the supercapacitor initial terminal voltage varied in situations of B level and C level road. The result showed that recycled energy by the supercapacitor increased at first and then decreased while the dynamic performance had no obvious change. On the basis of previous study, a mode-switching control strategy of supercapacitor for the regenerative and semiactive suspension system was proposed, and the mode-switching rule was built. According to simulation and experiment results, the system energy-regeneration efficiency can be increased by utilizing the control strategy without influencing suspension dynamic performance, which is highly valuable to practical engineering.
Voltage-Controlled Floating Resistor Using DDCC
Directory of Open Access Journals (Sweden)
M. Kumngern
2011-04-01
Full Text Available This paper presents a new simple configuration to realize the voltage-controlled floating resistor, which is suitable for integrated circuit implementation. The proposed resistor is composed of three main components: MOS transistor operating in the non-saturation region, DDCC, and MOS voltage divider. The MOS transistor operating in the non-saturation region is used to configure a floating linear resistor. The DDCC and the MOS transistor voltage divider are used for canceling the nonlinear component term of MOS transistor in the non-saturation region to obtain a linear current/voltage relationship. The DDCC is employed to provide a simple summer of the circuit. This circuit offers an ease for realizing the voltage divider circuit and the temperature effect that includes in term of threshold voltage can be compensated. The proposed configuration employs only 16 MOS transistors. The performances of the proposed circuit are simulated with PSPICE to confirm the presented theory.
Directory of Open Access Journals (Sweden)
Chih-Lung Shen
2013-01-01
Full Text Available A self-oscillating high-voltage generator is proposed to supply voltage for a suspension system in order to control the damping force of an electrorheological (ER fluid shock absorber. By controlling the output voltage level of the generator, the damping force in the ER fluid shock absorber can be adjusted immediately. The shock absorber is part of the suspension system. The high-voltage generator drives a power transistor based on self-excited oscillation, which converts dc to ac. A high-frequency transformer with high turns ratio is used to increase the voltage. In addition, the system uses the car battery as dc power supply. By regulating the duty cycle of the main switch in the buck converter, the output voltage of the buck converter can be linearly adjusted so as to obtain a specific high voltage for ER. The driving system is self-excited; that is, no additional external driving circuit is required. Thus, it reduces cost and simplifies system structure. A prototype version of the actual product is studied to measure and evaluate the key waveforms. The feasibility of the proposed system is verified based on experimental results.
Resistors Improve Ramp Linearity
Kleinberg, L. L.
1982-01-01
Simple modification to bootstrap ramp generator gives more linear output over longer sweep times. New circuit adds just two resistors, one of which is adjustable. Modification cancels nonlinearities due to variations in load on charging capacitor and due to changes in charging current as the voltage across capacitor increases.
Current-voltage characteristics of C70 solid near Meyer-Neldel temperature
Onishi, Koichi; Sezaimaru, Kouki; Nakashima, Fumihiro; Sun, Yong; Kirimoto, Kenta; Sakaino, Masamichi; Kanemitsu, Shigeru
2017-06-01
The current-voltage characteristics of the C70 solid with hexagonal closed-packed structures were measured in the temperature range of 250-450 K. The current-voltage characteristics can be described as a temporary expedient by a cubic polynomial of the voltage, i = a v 3 + b v 2 + c v + d . Moreover, the Meyer-Neldel temperature of the C70 solid was confirmed to be 310 K, at which a linear relationship between the current and voltage was observed. Also, at temperatures below the Meyer-Neldel temperature, the current increases with increasing voltage. On the other hand, at temperatures above the Meyer-Neldel temperature a negative differential conductivity effect was observed at high voltage side. The negative differential conductivity was related to the electric field and temperature effects on the mobility of charge carrier, which involve two variations in the carrier concentration and the activation energy for carrier hopping transport.
Energy Technology Data Exchange (ETDEWEB)
Erofeev, E. V., E-mail: erofeev@micran.ru [Tomsk State University of Control Systems and Radioelectronics, Research Institute of Electrical-Communication Systems (Russian Federation); Fedin, I. V.; Kutkov, I. V. [Research and Production Company “Micran” (Russian Federation); Yuryev, Yu. N. [National Research Tomsk Polytechnic University, Institute of Physics and Technology (Russian Federation)
2017-02-15
High-electron-mobility transistors (HEMTs) based on AlGaN/GaN epitaxial heterostructures are a promising element base for the fabrication of high voltage electronic devices of the next generation. This is caused by both the high mobility of charge carriers in the transistor channel and the high electric strength of the material, which makes it possible to attain high breakdown voltages. For use in high-power switches, normally off-mode GaN transistors operating under enhancement conditions are required. To fabricate normally off GaN transistors, one most frequently uses a subgate region based on magnesium-doped p-GaN. However, optimization of the p-GaN epitaxial-layer thickness and the doping level makes it possible to attain a threshold voltage of GaN transistors close to V{sub th} = +2 V. In this study, it is shown that the use of low temperature treatment in an atomic hydrogen flow for the p-GaN-based subgate region before the deposition of gate-metallization layers makes it possible to increase the transistor threshold voltage to V{sub th} = +3.5 V. The effects under observation can be caused by the formation of a dipole layer on the p-GaN surface induced by the effect of atomic hydrogen. The heat treatment of hydrogen-treated GaN transistors in a nitrogen environment at a temperature of T = 250°C for 12 h reveals no degradation of the transistor’s electrical parameters, which can be caused by the formation of a thermally stable dipole layer at the metal/p-GaN interface as a result of hydrogenation.
International Nuclear Information System (INIS)
Erofeev, E. V.; Fedin, I. V.; Kutkov, I. V.; Yuryev, Yu. N.
2017-01-01
High-electron-mobility transistors (HEMTs) based on AlGaN/GaN epitaxial heterostructures are a promising element base for the fabrication of high voltage electronic devices of the next generation. This is caused by both the high mobility of charge carriers in the transistor channel and the high electric strength of the material, which makes it possible to attain high breakdown voltages. For use in high-power switches, normally off-mode GaN transistors operating under enhancement conditions are required. To fabricate normally off GaN transistors, one most frequently uses a subgate region based on magnesium-doped p-GaN. However, optimization of the p-GaN epitaxial-layer thickness and the doping level makes it possible to attain a threshold voltage of GaN transistors close to V_t_h = +2 V. In this study, it is shown that the use of low temperature treatment in an atomic hydrogen flow for the p-GaN-based subgate region before the deposition of gate-metallization layers makes it possible to increase the transistor threshold voltage to V_t_h = +3.5 V. The effects under observation can be caused by the formation of a dipole layer on the p-GaN surface induced by the effect of atomic hydrogen. The heat treatment of hydrogen-treated GaN transistors in a nitrogen environment at a temperature of T = 250°C for 12 h reveals no degradation of the transistor’s electrical parameters, which can be caused by the formation of a thermally stable dipole layer at the metal/p-GaN interface as a result of hydrogenation.
Wrigley, Christopher James (Inventor); Hancock, Bruce R. (Inventor); Newton, Kenneth W. (Inventor); Cunningham, Thomas J. (Inventor)
2014-01-01
An analog-to-digital converter (ADC) converts pixel voltages from a CMOS image into a digital output. A voltage ramp generator generates a voltage ramp that has a linear first portion and a non-linear second portion. A digital output generator generates a digital output based on the voltage ramp, the pixel voltages, and comparator output from an array of comparators that compare the voltage ramp to the pixel voltages. A return lookup table linearizes the digital output values.
Energy Technology Data Exchange (ETDEWEB)
Zhu, Bao; Liu, Wen-Jun; Wei, Lei; Zhang, David Wei; Jiang, Anquan; Ding, Shi-Jin, E-mail: sjding@fudan.edu.cn [State Key Laboratory of ASIC and System, School of Microelectronics, Fudan University, Shanghai 200433 (China)
2015-07-07
Excellent voltage linearity of metal-insulator-metal (MIM) capacitors is highly required for next generation radio frequency integration circuits. In this work, employing atomic layer deposition technique, we demonstrated how the voltage linearity of MIM capacitors was modulated by adding different thickness of SiO{sub 2} layer to the nano-stack of Al{sub 2}O{sub 3}/ZrO{sub 2}. It was found that the quadratic voltage coefficient of capacitance (α) can be effectively reduced from 1279 to −75 ppm/V{sup 2} with increasing the thickness of SiO{sub 2} from zero to 4 nm, which is more powerful than increasing the thickness of ZrO{sub 2} in the Al{sub 2}O{sub 3}/ZrO{sub 2} stack. This is attributed to counteraction between the positive α for Al{sub 2}O{sub 3}/ZrO{sub 2} and the negative one for SiO{sub 2} in the MIM capacitors with Al{sub 2}O{sub 3}/ZrO{sub 2}/SiO{sub 2} stacks. Interestingly, voltage-polarity dependent conduction behaviors in the MIM capacitors were observed. For electron bottom-injection, the addition of SiO{sub 2} obviously suppressed the leakage current; however, it abnormally increased the leakage current for electron top-injection. These are ascribed to the co-existence of shallow and deep traps in ZrO{sub 2}, and the former is in favor of the field-assisted tunnelling conduction and the latter contributes to the trap-assisted tunnelling process. The above findings will be beneficial to device design and process optimization for high performance MIM capacitors.
Voltage splay modes and enhanced phase locking in a modified linear Josephson array
International Nuclear Information System (INIS)
Harris, E.B.; Garland, J.C.
1997-01-01
We analyze a modified linear Josephson-junction array in which additional unbiased junctions are used to greatly enhance phase locking. This geometry exhibits strong correlated behavior, with an external magnetic field tuning the voltage splay angle between adjacent Josephson oscillators. The array displays a coherent in-phase mode for f=(1)/(2), where f is the magnetic frustration, while for 0 p (f)=2aV dc /Φ 0 (1-2f). The locked splay modes are found to be tolerant of critical current disorder approaching 100%. The stability of the array has also been studied by computing Floquet exponents. These exponents are found to be negative for all array lengths, with a 1/N 2 dependence, N being the number of series-connected junctions. copyright 1996 The American Physical Society
Characterization of a low-voltage electron beam
International Nuclear Information System (INIS)
Berejka, A.J.
2004-01-01
Growing interests in low-voltage electron beam (EB) processing in areas that may require regulatory compliance, such as the curing of inks and coatings for food packaging materials and in the surface disinfection of medicinal and food containers, lead to the characterization of a low-voltage EB by two methods: a widely used thin radiochromic film and a film strip made on a continuous basis with an alanine coating. Using a laboratory unit, beam currents and voltages were varied and then optical density and alanine/matrix ratios were, respectively, determined. No inferences as to 'dose' were made. The radiochromic film was found to be insensitive to slight changes at low beam currents and to show considerable divergence and a broadening in response as current was increased across a meaningful range at the three applied beam voltages of 80, 100 and 120 kV. The electron paramagnetic resonance (EPR) increase in response of the alanine coated film taken as a ratio to an internal reference material within the test instrument itself was shown to have a linear response with respect to beam current and no divergence as current increased. The use of an alanine coating of thickness greater than that of the extrapolated range of the electron penetration offers a method for the characterization of the output of such very low-voltage beams
Increasing break-down strength of the support colomn of high-voltage accelerators
International Nuclear Information System (INIS)
Rezvykh, K.A.; Romanov, V.A.
1981-01-01
Calculation results of strength of electric field of the EG-2.5 electrostatic accelerator for the support colomn with electrodes of circular and elliptical transverse cross sections are presented. Conducted is the choice of constructing the column under the condition that the dimensions of the tank, high-voltage electrode, step between the sections and internal diameter of the colomn electrodes are not changed. The potential at the high-voltage electrode equals 2.5 MV while the average longitudinal gradient of the colomn field equals 1.25 MV/m. The support insulation colomn of the high-voltage accelerator screened by rings with transverse cross section in the form of orientation oval in some accelerators promotes obtaining higher operating voltage and at the same time increase of operation reliability at the rest unchanged dimensions of the plant because the probability of break-down between the support colomn and the tank wall decreases. The latter is especially significant for most high-energy accelerators as well as for accelerators used in national economy [ru
High-voltage transistor converter for pulsed x-ray sources
International Nuclear Information System (INIS)
Krasil'nikov, S.B.; Kristalinskii, A.L.; Lozovoi, L.N.; Markov, S.N.; Sindalovskii, E.I.
1986-01-01
A 24-V/12-kV converter for MIRA-2D and NORA pulsed x-ray sources is described. When the low-voltage supply varies within 20-26 V, the frequency stability of the x-ray pulses is higher by a factor of 3 ≅ 3 than when the PRIMA converter is used. For 14-24 V, the average output power of the converter is independent of the load impedance and increases linearly with an increase in supply voltage. The efficiency of the converter reaches 60%. The converter operates in the temperature range of -40 to +60 0 C
International Nuclear Information System (INIS)
De-An, Pan; Shen-Gen, Zhang; Jian-Jun, Tian; Li-Jie, Qiao; Jun-Sai, Sun; Volinsky, Alex A.
2010-01-01
Current–voltage measurements obtained from lead zirconate titanate/nickel bilayered hollow cylindrical magnetoelectric composite showed that a sinusoidal current applied to the copper coil wrapped around the hollow cylinder circumference induces voltage across the lead zirconate titanate layer thickness. The current–voltage coefficient and the maximum induced voltage in lead zirconate titanate at 1 kHz and resonance (60.1 kHz) frequencies increased linearly with the number of the coil turns and the applied current. The resonance frequency corresponds to the electromechanical resonance frequency. The current–voltage coefficient can be significantly improved by optimizing the magnetoelectric structure geometry and/or increasing the number of coil turns. Hollow cylindrical lead zirconate titanate/nickel structures can be potentially used as current sensors. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
Heat-pump performance: voltage dip/sag, under-voltage and over-voltage
Directory of Open Access Journals (Sweden)
William J.B. Heffernan
2014-12-01
Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.
Frequency pulling in a low-voltage medium-power gyrotron
Luo, Li; Du, Chao-Hai; Huang, Ming-Guang; Liu, Pu-Kun
2018-04-01
Many recent biomedical applications use medium-power frequency-tunable terahertz (THz) sources, such as sensitivity-enhanced nuclear magnetic resonance, THz imaging, and biomedical treatment. As a promising candidate, a low-voltage gyrotron can generate watt-level, continuous THz-wave radiation. In particular, the frequency-pulling effect in a gyrotron, namely, the effect of the electron beam parameters on the oscillation frequency, can be used to tune the operating frequency. Most previous investigations used complicated and time-consuming gyrotron nonlinear theory to study the influence of many beam parameters on the interaction performance. While gyrotron linear theory investigation demonstrates the advantages of rapidly and clearly revealing the physical influence of individual key beam parameters on the overall system performance, this paper demonstrates systematically the use of gyrotron linear theory to study the frequency-pulling effect in a low-voltage gyrotron with either a Gaussian or a sinusoidal axial-field profile. Furthermore, simulations of a gyrotron operating in the first axial mode are carried out in the framework of nonlinear theory as a contrast. Close agreement is achieved between the two theories. Besides, some interesting results are obtained. In a low-current sinusoidal-profile cavity, the ranges of frequency variation for different axial modes are isolated from each other, and the frequency tuning bandwidth for each axial mode increases by increasing either the beam voltage or pitch factor. Lowering the voltage, the total tuning ranges are squeezed and become concentrated. However, the isolated frequency regions of each axial mode cannot be linked up unless the beam current is increased, meaning that higher current operation is the key to achieving a wider and continuous tuning frequency range. The results presented in this paper can provide a reference for designing a broadband low-voltage gyrotron.
Voltage effect in PTCR ceramics: Calculation by the method of tilted energy band
International Nuclear Information System (INIS)
Fang Chao; Zhou Dongxiang; Gong Shuping
2010-01-01
A numerical model for the calculation of the electrical characteristics of donor-doped BaTiO 3 semiconducting ceramics is suggested. This paper established a differential equation about electron level on the base of Poisson equation, and solved the equation with Runge-Kutta method. Under extra electric field, electrical characteristics have been calculated by the method of tilted energy band. We have quantitatively computed the positive temperature coefficient of resistivity (PTCR) behavior of donor-doped BaTiO 3 semiconducting ceramics and its voltage effect, and further obtained non-linear current-voltage characteristics with different grain sizes at different temperature. The results pointed out that the resistance jumping is reduced with increasing electric field applied; current and voltage relation follows Ohm's law below Curie temperature, and exhibits strong non-linear above Curie temperature; the non-linear coefficient shows a maximum value at temperature the resistivity reaches maximum and with grain size closed to depletion region width. The results are compared with experimental data.
Voltage Quench Dynamics of a Kondo System.
Antipov, Andrey E; Dong, Qiaoyuan; Gull, Emanuel
2016-01-22
We examine the dynamics of a correlated quantum dot in the mixed valence regime. We perform numerically exact calculations of the current after a quantum quench from equilibrium by rapidly applying a bias voltage in a wide range of initial temperatures. The current exhibits short equilibration times and saturates upon the decrease of temperature at all times, indicating Kondo behavior both in the transient regime and in the steady state. The time-dependent current saturation temperature connects the equilibrium Kondo temperature to a substantially increased value at voltages outside of the linear response. These signatures are directly observable by experiments in the time domain.
Ultra-Low-Dropout Linear Regulator
Thornton, Trevor; Lepkowski, William; Wilk, Seth
2011-01-01
A radiation-tolerant, ultra-low-dropout linear regulator can operate between -150 and 150 C. Prototype components were demonstrated to be performing well after a total ionizing dose of 1 Mrad (Si). Unlike existing components, the linear regulator developed during this activity is unconditionally stable over all operating regimes without the need for an external compensation capacitor. The absence of an external capacitor reduces overall system mass/volume, increases reliability, and lowers cost. Linear regulators generate a precisely controlled voltage for electronic circuits regardless of fluctuations in the load current that the circuit draws from the regulator.
International Nuclear Information System (INIS)
Spassov, Velin
1996-01-01
This document reports my activities as visitor-professor at the Gyrotron Project - INPE Plasma Laboratory. The main objective of my activities was designing, construction and testing a suitable high-voltage pulse generator for plasma applications, and efforts were concentrated on the following points: Design of high-voltage resonant power supply with tunable output (0 - 50 kV) for line-type high voltage pulse generator; design of line-type pulse generator (4 microseconds pulse duration, 0 - 25 kV tunable voltage) for non linear loads such as a gyrotron and P III reactor; design of resonant charging inductance for resonant line-type pulse generator, and design of high resolution synchro instrument for gyrotron frequency measurement. (author)
Videometrics-based Detection of Vibration Linearity in MEMS Gyroscope
Directory of Open Access Journals (Sweden)
Yong Zhou
2011-05-01
Full Text Available MEMS gyroscope performs as a sort of sensor to detect angular velocity, with diverse applications in engineering including vehicle and intelligent traffic etc. A balanced vibration of driving module excited by electrostatic driving signal is the base MEMS gyroscope's performance. In order to analyze the linear property of vibration in MEMS Gyroscope, a method of computer vision measuring is applied with the help of high-speed vidicon to obtain video of linear vibration of driving module in gyroscope, under the driving voltage signal of inherent frequency and amplitude linearly increasing. By means of image processing, target identifying, and motion parameter extracting from the obtained video, vibration curve with time variation is acquired. And then, linearity of this vibration system can be analyzed by focusing on the amplitude value of vibration responding to the amplitude variation of driving voltage signal.
Yang, Jun; Wang, Ze-Xin; Lu, Sheng; Lv, Wei-gang; Jiang, Xi-zhi; Sun, Lei
2017-03-01
The micro-arc oxidation process was conducted on ZK60 Mg alloy under two and three steps voltage-increasing modes by DC pulse electrical source. The effect of each mode on current-time responses during MAO process and the coating characteristic were analysed and discussed systematically. The microstructure, thickness and corrosion resistance of MAO coatings were evaluated by scanning electron microscopy (SEM), energy disperse spectroscopy (EDS), microscope with super-depth of field and electrochemical impedance spectroscopy (EIS). The results indicate that two and three steps voltage-increasing modes can improve weak spark discharges with insufficient breakdown strength in later period during the MAO process. Due to higher value of voltage and voltage increment, the coating with maximum thickness of about 20.20μm formed under two steps voltage-increasing mode shows the best corrosion resistance. In addition, the coating fabricated under three steps voltage-increasing mode shows a smoother coating with better corrosion resistance due to the lower amplitude of voltage-increasing.
Arif Malik, Muhammad; Hughes, David
2016-04-01
Improvements in ozone synthesis from air and oxygen by increasing the number density of plasma channels and lower voltage for the same specific input energy (SIE) were explored in a nonthermal plasma based on a sliding discharge. The number of plasma channels and energy per pulse increased in direct proportion to the increase in the effective length of the anode (the high voltage electrode). Decreasing the discharge gap increased the energy per pulse for the same length and allowed the installation of more electrode pairs in the same space. It allowed the increase of the number of plasma channels in the same space to achieve the same SIE at a lower peak voltage with less energy per plasma channel. The ozone concentration gradually increased to ~1500 ppmv (140 to 50 g kWh-1) from air and to ~6000 ppmv (400 to 200 g kWh-1) from oxygen with a gradual increase in the SIE to ~200 J L-1, irrespective of the variations in electrode geometry, applied voltage or flow rate of the feed gas. A gradual increase in SIE beyond 200 J L-1 gradually increased the ozone concentration to a certain maximum value followed by a decline, but the rate of increase and the maximum value was higher for the greater number of plasma channels and lower peak voltage combination. The maximum ozone concentration was ~5000 ppmv (~30 g kWh-1) from air and ~22 000 ppmv (~80 g kWh-1) from oxygen. The results are explained on the basis of characteristics of the plasma and ozone synthesis mechanism.
Distributed Monitoring of Voltage Collapse Sensitivity Indices
Simpson-Porco, John W.; Bullo, Francesco
2016-01-01
The assessment of voltage stability margins is a promising direction for wide-area monitoring systems. Accurate monitoring architectures for long-term voltage instability are typically centralized and lack scalability, while completely decentralized approaches relying on local measurements tend towards inaccuracy. Here we present distributed linear algorithms for the online computation of voltage collapse sensitivity indices. The computations are collectively performed by processors embedded ...
Schneider, A. V.; Popov, S. A.; Batrakov, A. V.; Dubrovskaya, E. L.; Lavrinovich, V. A.
2017-12-01
Vacuum-gap breakdown has been studied after high-current arc interruption with a subsequent increase in the transient recovery voltage across a gap. The effects of factors, such as the rate of the rise in the transient voltage, the potential of the shield that surrounds a discharge gap, and the arc burning time, have been determined. It has been revealed that opening the contacts earlier leads to the formation of an anode spot, which is the source of electrode material vapors into the discharge gap after current zero moment. Under the conditions of increasing voltage, this fact results in the breakdown. Too late opening leads to the breakdown of a short gap due to the high electric fields.
Energy Technology Data Exchange (ETDEWEB)
Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies
2008-04-09
This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.
Caporaso, George J.; Sampayan, Stephen E.; Kirbie, Hugh C.
1998-01-01
A dielectric-wall linear accelerator is improved by a high-voltage, fast rise-time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators. A high voltage is placed between the electrodes sufficient to stress the voltage breakdown of the insulator on command. A light trigger, such as a laser, is focused along at least one line along the edge surface of the laminated alternating layers of isolated conductors and insulators extending between the electrodes. The laser is energized to initiate a surface breakdown by a fluence of photons, thus causing the electrical switch to close very promptly. Such insulators and lasers are incorporated in a dielectric wall linear accelerator with Blumlein modules, and phasing is controlled by adjusting the length of fiber optic cables that carry the laser light to the insulator surface.
Temperature and sowing date affect the linear increase of sunflower harvest index
International Nuclear Information System (INIS)
Bange, M.P.; Hammer, G.L.; Rickert, K.G.
1998-01-01
The linearity of daily linear harvest index (HI) increase can provide a simple means to predict grain growth and yield in field crops. However, the stability of the rate of increase across genotypes and environments is uncertain. Data from three field experiments were collated to investigate the phase of linear HI increase of sunflower (Helianthus annuus L.) across environments by changing genotypes, sowing time, N level, and solar irradiation level. Linear increase in HI was similar among different genotypes, N levels, and radiation treatments (mean 0.0125 d-1), but significant differences occurred between sowings. The linear increase in HI was not stable at very low temperatures (down to 9 degrees C) during grain filling, due to possible limitations to biomass accumulation and translocation (mean 0.0091 d-1). Using the linear increase in HI to predict grain yield requires predictions of the duration from an thesis to the onset of linear HI increase (lag phase) and the cessation of linear HI increase. These studies showed that the lag phase differed, and the linear HI increase ceased when 91% of the anthesis to physiological maturity period had been completed
DEFF Research Database (Denmark)
Rahul, Arun; Pramanick, Sumit; Kaarthik, R. Sudharshan
2017-01-01
In this paper, a new space vector pulse width modulation method to extend the linear modulation range of a cascaded five level inverter topology with a single dc supply is presented. Using this method, the inverter can be controlled linearly and the peak phase fundamental output voltage of the in......In this paper, a new space vector pulse width modulation method to extend the linear modulation range of a cascaded five level inverter topology with a single dc supply is presented. Using this method, the inverter can be controlled linearly and the peak phase fundamental output voltage...... of the inverter can be increased from 0.577 to 0.637Vdc without increasing the dc bus voltage and without exceeding the induction motor voltage rating. This new technique makes use of cascaded inverter pole voltage redundancy and property of the space vector structure for its operation. Using this, the induction...
Manipulating the voltage dependence of tunneling spin torques
Manchon, Aurelien
2012-01-01
Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact
International Nuclear Information System (INIS)
Eriguchi, Koji; Ohta, Hiroaki; Ono, Kouichi; Wei Zhiqiang; Takagi, Takeshi
2009-01-01
Constant voltage stress (CVS) was applied to Fe-O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (t r ) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. From a polarity-dependent resistance increase determined by a time-zero measurement, the voltage and polarity-dependent t r were discussed on the basis of field- and structure-enhanced thermochemical reaction mechanisms
Energy Technology Data Exchange (ETDEWEB)
Izadi-Najafabadi, Ali; Yamada, Takeo; Futaba, Don N.; Iijima, Sumio [Nanotube Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hatori, Hiroaki [Project Headquarters, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hata, Kenji [Japan Science and Technology Agency JST, Kawaguchi (Japan)
2010-12-15
We report the energy and power voltage-dependencies of supercapacitors using single-walled carbon nanotube electrodes. The energy density was dependent on the cell-voltage cubed (up to 4 V: E = 1.43 x V{sup 3}). The cubic relationship was attributed to the linear increase of the capacitance as a function of voltage, enabled by electrochemical doping. Furthermore, while up to 3.5 V, the maximum power rating of the nanotube electrodes increased as a function of the cell-voltage squared, beyond 3.5 V, a decline in power was observed as a result of depletion of the electrolyte's ions. (author)
Total dose induced increase in input offset voltage in JFET input operational amplifiers
International Nuclear Information System (INIS)
Pease, R.L.; Krieg, J.; Gehlhausen, M.; Black, J.
1999-01-01
Four different types of commercial JFET input operational amplifiers were irradiated with ionizing radiation under a variety of test conditions. All experienced significant increases in input offset voltage (Vos). Microprobe measurement of the electrical characteristics of the de-coupled input JFETs demonstrates that the increase in Vos is a result of the mismatch of the degraded JFETs. (authors)
Hysteretic current-voltage characteristics in RF-sputtered nanocrystalline TiO2 thin films
International Nuclear Information System (INIS)
Villafuerte, Manuel; Juarez, Gabriel; Heluani, Silvia P. de; Comedi, David
2007-01-01
We have measured the current-voltage characteristics at room temperature of a nanocrystalline TiO 2 thin film fabricated by reactive RF-sputtering deposition and sandwiched between ITO (indium-tin-oxide)-buffered glass substrate and an indium top electrode. The I-V characteristics are ohmic for low voltages and become non-linear, hysteretic and asymmetric as the voltage is increased. The system is shown to be well represented by two distinct resistance states in the non-ohmic region. Current transient evolutions were also measured for constant voltage excitations. The resistance is stable in time for voltages in the ohmic regime. In contrast, for voltages in the non-ohmic regime, the resistance has a small variation for a short period of time (order of tens seconds) and then increases with time. For those transients, long characteristic times (on the order of tens of minutes up to hours) were found. The behavior of the system is discussed on the basis of experimental results reported in the literature for similar systems and existing models for electric-field induced resistive switching
Moderately nonlinear diffuse-charge dynamics under an ac voltage.
Stout, Robert F; Khair, Aditya S
2015-09-01
The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of V_{o}/(k_{B}T/e), where V_{o} is the amplitude of the driving voltage and k_{B}T/e is the thermal voltage with k_{B} as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D/λ_{D}L, where D is the ion diffusivity, λ_{D} is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O(V_{o}^{3}) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in V_{o}. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing V_{o}. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.
Moderately nonlinear diffuse-charge dynamics under an ac voltage
Stout, Robert F.; Khair, Aditya S.
2015-09-01
The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of Vo/(kBT /e ) , where Vo is the amplitude of the driving voltage and kBT /e is the thermal voltage with kB as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D /λDL , where D is the ion diffusivity, λD is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O (Vo3) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in Vo. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing Vo. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.
Ways for improvement of the LIU-5/5000 linear induction accelerator parameters
International Nuclear Information System (INIS)
Bobylev, V.I.; Kapchinskij, I.M.; Lapitskij, Yu.Ya.; Plotnikov, V.K.; Chuvilo, I.V.
1987-01-01
The reasons of limitaions to increase the beam current and improve the quality of beam in the electron linear induction accelerator LIU-5/5000 are studied. The necessity to increase the voltage in the gaps of the electron gun, increase the diameter of the cathode and aperture of the drift tube, accuracy of axial symmetry electron gun current-carrying elements and accuracy of gun fabrication are shown. Stabilization of beam parameters require a new high voltage modulators. Different versions of the linac modernization with the use of transformers with cores of 430 and 600 mm are studied. Technical possibilities at several versions of high voltage modulators are discussed
Rana, K. P. S.; Kumar, Vineet; Prasad, Tapan
2018-02-01
Temperature to Frequency Converters (TFCs) are potential signal conditioning circuits (SCCs) usually employed in temperature measurements using thermistors. A NE/SE-566 based SCC has been recently used in several reported works as TFC. Application of NE/SE-566 based SCC requires a mechanism for finding the optimal values of SCC parameters yielding the optimal linearity and desired sensitivity performances. Two classical methods, namely, inflection point and three point have been employed for this task. In this work, the application of these two methods, on NE/SE-566 based SCC in TFC, is investigated in detail and the conditions for its effective usage are developed. Further, since these classical methods offer an approximate linearization of temperature and frequency relationship an application of a linear search based technique is proposed to further enhance the linearity. The implemented linear search method used results obtained from the above mentioned classical methods. The presented simulation studies, for three different industrial grade thermistors, revealed that the linearity enhancements of 21.7, 18.3 and 17.8% can be achieved over the inflection point method and 4.9, 4.7 and 4.7% over the three point method, for an input temperature range of 0-100 °C.
Irradiation of intense characteristic x-rays from weakly ionized linear molybdenum plasma
International Nuclear Information System (INIS)
Sato, Eiichi; Hayasi, Yasuomi
2003-01-01
In the plasma flash x-ray generator, a high-voltage main condenser of approximately 200 nF is charged up to 55 kV by a power supply, and electric charges in the condenser are discharged to an x-ray tube after triggering the cathode electrode. The flash x-rays are then produced. The x-ray tube is a demountable triode that is connected to a turbo molecular pump with a pressure of approximately 1 mPa. As electron flows from the cathode electrode are roughly converged to a rod molybdenum target of 2.0 mm in diameter by the electric field in the x-ray tube, weakly ionized linear plasma, which consists of molybdenum ions and electrons, forms by target evaporation. At a charging voltage of 55 kV, the maximum tube voltage was almost equal to the charging voltage of the main condenser, and the peak current was about 20 kA. When the charging voltage was increased, the linear plasma formed, and the K-series characteristic x-ray intensities increased. The K lines were quite sharp and intense, and hardly any bremsstrahlung rays were detected. The x-ray pulse widths were approximately 700 ns, and the time-integrated x-ray intensity had a value of approximately 35 μC/kg at 1.0 m from the x-ray source with a charging voltage of 50 kV. (author)
Preliminary Modeling of Permanent Magnet Probe Flowmeter for Voltage Signal Estimation
Energy Technology Data Exchange (ETDEWEB)
Jeong, Uiju; Kim, Sung Joong [Hanyang Univ., Seoul (Korea, Republic of); Jeong, Ji Young; Kim, Tae Joon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)
2013-10-15
An experimental study on performance analysis of the flowmeter has been performed. The study shows that sodium flow rate is linearly proportional to the induced voltage signal from the flowmeter under the turbulent flow condition. The experimental results support its availability in the PDRC system. But, the flowmeter should be able to measure sodium flow at low Reynolds number as well. That is because the PDRC system uses sodium natural convection for its operation. Thus, calibration of the flowmeter should be done at very low sodium flow rates. However, Von Weissenfluh et al. showed that the relationship between flow rate and measured voltage signal from the flowmeter may become non-linear at very low flow rates. The nonlinearity restricts the utilization of level sensor which provide reference flow rate in the calibration experiment. The primary objective of this study is to predict the sodium flow rate range where the induced voltage signals are linearly proportional to flow rates by estimating the induced voltage signals against sodium flow rates for a wide range of flows numerically. A commercial code FLUENT is adopted for the analysis of flow field. And MAXWELL which is an electromagnetic analysis software using a finite volume method has been used to analyze the magnetic field generated by permanent magnet of the flowmeter. The induced voltage signals have been estimated by coupling the sodium flow field and the magnetic field using FLUENT MHD module. It is expected that the PMPF voltage signals are linearly proportional to flow rates range of 0.0059 to 1.96 lps. This suggests that simple calibration technique using the linearity between flow rate and the voltage signal can be adopted in calibration of the PMPF.
International Nuclear Information System (INIS)
Lotfi, E; Rezania, H; Arghavaninia, B; Yarmohammadi, M
2016-01-01
We address the electrical conductivity of bilayer graphene as a function of temperature, impurity concentration, and scattering strength in the presence of a finite bias voltage at finite doping, beginning with a description of the tight-binding model using the linear response theory and Green’s function approach. Our results show a linear behavior at high doping for the case of high bias voltage. The effects of electron doping on the electrical conductivity have been studied via changing the electronic chemical potential. We also discuss and analyze how the bias voltage affects the temperature behavior of the electrical conductivity. Finally, we study the behavior of the electrical conductivity as a function of the impurity concentration and scattering strength for different bias voltages and chemical potentials respectively. The electrical conductivity is found to be monotonically decreasing with impurity scattering strength due to the increased scattering among electrons at higher impurity scattering strength. (paper)
Sigma-Delta Voltage to Frequency Converter With Phase Modulation Possibility
STORK, Milan
2014-01-01
Voltage to frequency converter (VFC) is an oscillator whose frequency is linearly proportional to control voltage. There are two common VFC architectures: the current steering multivibrator and the charge-balance VFC. For higher linearity, the charge-balancing method is preferred. The charge balanced VFC may be made in asynchronous or synchronous (clocked) forms. The synchronous charge balanced VFC or "sigma delta" (S-D) VFC is used when output pulses are synchroni...
Eriguchi, Koji; Wei, Zhiqiang; Takagi, Takeshi; Ohta, Hiroaki; Ono, Kouichi
2009-01-01
Constant voltage stress (CVS) was applied to Fe–O films prepared by a sputtering process to investigate a stress-induced resistance increase leading to a fundamental mechanism for switching behaviors. Under the CVS, an abrupt resistance increase was found for both stress polarities. A conduction mechanism after the resistance increase exhibited non-Ohmic transport. The time-to-resistance increase (tr) under the CVS was revealed to strongly depend on stress voltage as well as the polarity. Fro...
A two-layer linear piezoelectric micromotor.
Li, Xiaotian; Ci, Penghong; Liu, Guoxi; Dong, Shuxiang
2015-03-01
A first bending (B1) mode two-layer piezoelectric ultrasonic linear micromotor has been developed for microoptics driving applications. The piezo-vibrator of the micromotor was composed of two small Pb(Zr,Ti)O3 (PZT-5) plates, with overall dimensions and mass of only 2.0 × 2.0 × 5.0 mm(3) and 0.2 g, respectively. The proposed micromotor could operate either in single-phase voltage (standing wave) mode or two-phase voltage (traveling wave) mode to drive a slider via friction force to provide bidirectional linear motion. A large thrust of up to 0.30 N, which corresponds to a high unit volume direct driving force of 15 mN/mm(3), and a linear movement velocity of up to 230 mm/s were obtained under an applied voltage of 80 Vpp at the B1 mode resonance frequency of 174 kHz.
International Nuclear Information System (INIS)
Yamin, H.Y.; Shahidehpour, S.M.
2003-01-01
This paper describes a generalized active/reactive iterative coordination process between GENCOs and the Independent System Operator (ISO) for active (transmission congestion) and reactive (voltage profile) management in the day-ahead market. GENCOs apply priced-based unit commitment without transmission and voltage security constraints, schedule their units and submit their initial bids to the ISO. The ISO executes congestion and voltage profile management for eliminating transmission and voltage profile violations. If violations are not eliminated, the ISO minimizes the transmission and voltage profile violations and sends a signal via the Internet to GENCOs. GENCOs reschedule their units taking into account the ISO signals and submit modified bids to the ISO. The voltage problem is addressed and a linear model is formulated and used in the proposed method. The voltage problem is formulated as a linear programming with a block-angular structure and Dantzig-Wolfe decomposition is applied to generate several smaller problems for a faster and easier solution of large-scale power systems. Two 36 unit GENCOs are used to demonstrate the performance of the proposed generalized active/reactive coordination algorithm. (author)
Low cost photomultiplier high-voltage readout system
International Nuclear Information System (INIS)
Oxoby, G.J.; Kunz, P.F.
1976-10-01
The Large Aperture Solenoid Spectrometer (LASS) at Stanford Linear Accelerator Center (SLAC) requires monitoring over 300 voltages. This data is recorded on magnetic tapes along with the event data. It must also be displayed so that operators can easily monitor and adjust the voltages. A low-cost high-voltage readout system has been implemented to offer stand-alone digital readout capability as well as fast data transfer to a host computer. The system is flexible enough to permit use of a DVM or ADC and commercially available analogue multiplexers
Josephson tunneling current in the presence of a time-dependent voltage
International Nuclear Information System (INIS)
Harris, R.E.
1975-01-01
The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field
Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel
Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael
1993-06-01
Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.
Kim, T; Dykstra, J E; Porada, S; van der Wal, A; Yoon, J; Biesheuvel, P M
2015-05-15
Capacitive deionization (CDI) is an electrochemical method for water desalination using porous carbon electrodes. A key parameter in CDI is the charge efficiency, Λ, which is the ratio of salt adsorption over charge in a CDI-cycle. Values for Λ in CDI are typically around 0.5-0.8, significantly less than the theoretical maximum of unity, due to the fact that not only counterions are adsorbed into the pores of the carbon electrodes, but at the same time coions are released. To enhance Λ, ion-exchange membranes (IEMs) can be implemented. With membranes, Λ can be close to unity because the membranes only allow passage for the counterions. Enhancing the value of Λ is advantageous as this implies a lower electrical current and (at a fixed charging voltage) a reduced energy use. We demonstrate how, without the need to include IEMs, the charge efficiency can be increased to values close to the theoretical maximum of unity, by increasing the cell voltage during discharge, with only a small loss of salt adsorption capacity per cycle. In separate constant-current CDI experiments, where after some time the effluent salt concentration reaches a stable value, this value is reached earlier with increased discharge voltage. We compare the experimental results with predictions of porous electrode theory which includes an equilibrium Donnan electrical double layer model for salt adsorption in carbon micropores. Our results highlight the potential of modified operational schemes in CDI to increase charge efficiency and reduce energy use of water desalination. Copyright © 2014 Elsevier Inc. All rights reserved.
Enhanced dielectric-wall linear accelerator
Sampayan, Stephen E.; Caporaso, George J.; Kirbie, Hugh C.
1998-01-01
A dielectric-wall linear accelerator is enhanced by a high-voltage, fast e-time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators. A high voltage is placed between the electrodes sufficient to stress the voltage breakdown of the insulator on command. A light trigger, such as a laser, is focused along at least one line along the edge surface of the laminated alternating layers of isolated conductors and insulators extending between the electrodes. The laser is energized to initiate a surface breakdown by a fluence of photons, thus causing the electrical switch to close very promptly. Such insulators and lasers are incorporated in a dielectric wall linear accelerator with Blumlein modules, and phasing is controlled by adjusting the length of fiber optic cables that carry the laser light to the insulator surface.
High voltage investigations for ITER coils
International Nuclear Information System (INIS)
Fink, S.; Fietz, W.H.
2006-01-01
The superconducting ITER magnets will be excited with high voltage during operation and fast discharge. Because the coils are complex systems the internal voltage distribution can differ to a large extent from the ideal linear voltage distribution. In case of fast excitations internal voltages between conductor and radial plate of a TF coil can be even higher than the terminal voltage of 3.5 kV to ground which appears during a fast discharge without a fault. Hence the determination of the transient voltage distribution is important for a proper insulation co-ordination and will provide a necessary basis for the verification of the individual insulation design and the choice of test voltages and waveforms. Especially the extent of internal overvoltages in case of failures, e. g. malfunction of discharge units and / or arcing is of special interest. Transient calculations for the ITER TF coil system have been performed for fast discharge and fault scenarios to define test voltages for ITER TF. The conductor and radial plate insulation of the ITER TF Model Coil were exposed at room temperature to test voltages derived from the results from these calculations. Breakdown appeared during the highest AC voltage step. A fault scenario for the TF fast discharge system is presented where one fault triggers a second fault, leading to considerable voltage stress. In addition a FEM model of Poloidal Field Coil 3 for the determination of the parameters of a detailed network model is presented in order to prepare detailed investigations of the transient voltage behaviour of the PF coils. (author)
Voltage-dependent gating in a "voltage sensor-less" ion channel.
Directory of Open Access Journals (Sweden)
Harley T Kurata
2010-02-01
Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.
Takahashi, Hajime; Hanafusa, Yuki; Kimura, Yoshinari; Kitamura, Masatoshi
2018-03-01
Oxygen plasma treatment has been carried out to control the threshold voltage in organic thin-film transistors (TFTs) having a SiO2 gate dielectric prepared by rf sputtering. The threshold voltage linearly changed in the range of -3.7 to 3.1 V with the increase in plasma treatment time. Although the amount of change is smaller than that for organic TFTs having thermally grown SiO2, the tendency of the change was similar to that for thermally grown SiO2. To realize different plasma treatment times on the same substrate, a certain region on the SiO2 surface was selected using a shadow mask, and was treated with oxygen plasma. Using the process, organic TFTs with negative threshold voltages and those with positive threshold voltages were fabricated on the same substrate. As a result, enhancement/depletion inverters consisting of the organic TFTs operated at supply voltages of 5 to 15 V.
Non-linear leak currents affect mammalian neuron physiology
Directory of Open Access Journals (Sweden)
Shiwei eHuang
2015-11-01
Full Text Available In their seminal works on squid giant axons, Hodgkin and Huxley approximated the membrane leak current as Ohmic, i.e. linear, since in their preparation, sub-threshold current rectification due to the influence of ionic concentration is negligible. Most studies on mammalian neurons have made the same, largely untested, assumption. Here we show that the membrane time constant and input resistance of mammalian neurons (when other major voltage-sensitive and ligand-gated ionic currents are discounted varies non-linearly with membrane voltage, following the prediction of a Goldman-Hodgkin-Katz-based passive membrane model. The model predicts that under such conditions, the time constant/input resistance-voltage relationship will linearize if the concentration differences across the cell membrane are reduced. These properties were observed in patch-clamp recordings of cerebellar Purkinje neurons (in the presence of pharmacological blockers of other background ionic currents and were more prominent in the sub-threshold region of the membrane potential. Model simulations showed that the non-linear leak affects voltage-clamp recordings and reduces temporal summation of excitatory synaptic input. Together, our results demonstrate the importance of trans-membrane ionic concentration in defining the functional properties of the passive membrane in mammalian neurons as well as other excitable cells.
Energy Technology Data Exchange (ETDEWEB)
Jiang, C.; Samnakay, R.; Balandin, A. A., E-mail: balandin@ee.ucr.edu [Nano-Device Laboratory (NDL), Department of Electrical Engineering, Bourns College of Engineering, University of California—Riverside, Riverside, California 92521 (United States); Phonon Optimized Engineered Materials (POEM) Center, Materials Science and Engineering Program, University of California—Riverside, Riverside, California 92521 (United States); Rumyantsev, S. L. [Department of Electrical, Computer, and Systems Engineering, Center for Integrated Electronics, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States); Ioffe Physical-Technical Institute, St. Petersburg 194021 (Russian Federation); Shur, M. S. [Department of Electrical, Computer, and Systems Engineering, Center for Integrated Electronics, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States)
2015-02-14
We report on fabrication of MoS{sub 2} thin-film transistors (TFTs) and experimental investigations of their high-temperature current-voltage characteristics. The measurements show that MoS{sub 2} devices remain functional to temperatures of at least as high as 500 K. The temperature increase results in decreased threshold voltage and mobility. The comparison of the direct current (DC) and pulse measurements shows that the direct current sub-linear and super-linear output characteristics of MoS{sub 2} thin-films devices result from the Joule heating and the interplay of the threshold voltage and mobility temperature dependences. At temperatures above 450 K, a kink in the drain current occurs at zero gate voltage irrespective of the threshold voltage value. This intriguing phenomenon, referred to as a “memory step,” was attributed to the slow relaxation processes in thin films similar to those in graphene and electron glasses. The fabricated MoS{sub 2} thin-film transistors demonstrated stable operation after two months of aging. The obtained results suggest new applications for MoS{sub 2} thin-film transistors in extreme-temperature electronics and sensors.
DEFF Research Database (Denmark)
Yang, Yongheng; Sangwongwanich, Ariya; Liu, Hongpeng
2017-01-01
In this paper, a cost-effective control scheme for two-stage grid-connected PhotoVoltaic (PV) systems in Low Voltage Ride-Through (LVRT) operation is proposed. In the case of LVRT, the active power injection by PV panels should be limited to prevent from inverter over-current and also energy...... aggregation at the dc-link, which will challenge the dc-link capacitor lifetime if remains uncontrolled. At the same time, reactive currents should be injected upon any demand imposed by the system operators. In the proposed scheme, the two objectives can be feasibly achieved. The active power is regulated...... point tracking controller without significant hardware or software modifications. In this way, the PV system will not operate at the maximum power point, whereas the inverter will not face any over-current challenge but can provide reactive power support in response to the grid voltage fault...
Acoustically determined linear piezoelectric response of lithium niobate up to 1100 V
Energy Technology Data Exchange (ETDEWEB)
Patel, N. [Sandia National Laboratories, Albuquerque, New Mexico 87185 (United States); Department of Electrical and Computer Engineering, University of New Mexico, Albuquerque, New Mexico 87106 (United States); Branch, D. W.; Cular, S. [Sandia National Laboratories, Albuquerque, New Mexico 87185 (United States); Schamiloglu, E. [Department of Electrical and Computer Engineering, University of New Mexico, Albuquerque, New Mexico 87106 (United States)
2014-04-21
We present a method to measure high voltages using the piezoelectric crystal lithium niobate without using voltage dividers. A 36° Y-X cut lithium niobate crystal was coupled to two acoustic transducers, where direct current voltages were applied from 128–1100 V. The time-of-flight through the crystal was determined to be linearly dependent on the applied voltage. A model was developed to predict the time-delay in response to the applied voltage. The results show a sensitivity of 17 fs/V with a measurement error of 1 fs/V was achievable using this method. The sensitivity of this method can be increased by measuring the acoustic wave after multiple passes through the crystal. This method has many advantages over traditional techniques such as: favorable scalability for larger voltages, ease of use, cost effectiveness, and compactness.
Optimal condition of memristance enhancement circuit using external voltage source
Directory of Open Access Journals (Sweden)
Hiroya Tanaka
2014-05-01
Full Text Available Memristor provides nonlinear response in the current-voltage characteristic and the memristance is modulated using an external voltage source. We point out by solving nonlinear equations that an optimal condition of the external voltage source exists for maximizing the memristance in such modulation scheme. We introduce a linear function to describe the nonlinear time response and derive an important design guideline; a constant ratio of the frequency to the amplitude of the external voltage source maximizes the memristance. The analysis completely accounts for the memristance behavior.
Energy Technology Data Exchange (ETDEWEB)
Sharath, S. U., E-mail: sharath@oxide.tu-darmstadt.de; Kurian, J.; Komissinskiy, P.; Hildebrandt, E.; Alff, L. [Institute of Materials Science, Technische Universität Darmstadt, 64287 Darmstadt (Germany); Bertaud, T.; Walczyk, C.; Calka, P. [IHP, Im Technologiepark 25, 15236 Frankfurt Oder (Germany); Schroeder, T. [IHP, Im Technologiepark 25, 15236 Frankfurt Oder (Germany); Brandenburgische Technische Universität, Konrad-Zuse-Strasse 1, 03046 Cottbus (Germany)
2014-08-18
The conducting filament forming voltage of stoichiometric hafnium oxide based resistive switching layers increases linearly with layer thickness. Using strongly reduced oxygen deficient hafnium oxide thin films grown on polycrystalline TiN/Si(001) substrates, the thickness dependence of the forming voltage is strongly suppressed. Instead, an almost constant forming voltage of about 3 V is observed up to 200 nm layer thickness. This effect suggests that filament formation and switching occurs for all samples in an oxidized HfO{sub 2} surface layer of a few nanometer thickness while the highly oxygen deficient thin film itself merely serves as a oxygen vacancy reservoir.
Linearity of bulk-controlled inverter ring VCO in weak and strong inversion
DEFF Research Database (Denmark)
Wismar, Ulrik Sørensen; Wisland, D.; Andreani, Pietro
2007-01-01
In this paper linearity of frequency modulation in voltage controlled inverter ring oscillators for non feedback sigma delta converter applications is studied. The linearity is studied through theoretical models of the oscillator operating at supply voltages above and below the threshold voltage......, process variations and temperature variations have also been simulated to indicate the advantages of having the soft rail bias transistor in the VCO....
Low-Voltage Consumption Coordination for Loss Minimization and Voltage Control
DEFF Research Database (Denmark)
Juelsgaard, Morten; Sloth, Christoffer; Wisniewski, Rafal
2014-01-01
This work presents a strategy for minimizing active power losses in low-voltage grids, by coordinating the consumption of electric vehicles and power generation from solar panels. We show that minimizing losses, also reduces voltage variations, and illustrate how this may be employed for increasing...
DEFF Research Database (Denmark)
Pausas, Guifre Vendrell; Llimos Muntal, Pere; Jørgensen, Ivan Harald Holger
2017-01-01
This paper presents a high-voltage integrated regulator capable of sinking current for driving pulse-triggered level shifters in drivers for ultrasound applications. The regulator utilizes a new topology with a feedback loop and a current sinking circuit to satisfy the requirements of the portable....... The proposed design has been implemented in high-voltage 0.18 μm process whithin an area of 0.11 mm2 and it is suitable for system-on-chip integration due to its low component count and the fully integrated design....
Quad-copter UAV BLDC Motor Control: Linear v/s non-linear control maps
Directory of Open Access Journals (Sweden)
Deep Parikh
2015-08-01
Full Text Available This paper presents some investigations and comparison of using linear versus non-linear static motor-control maps for the speed control of a BLDC (Brush Less Direct Current motors used in quad-copter UAV (Unmanned Aerial Vehicles. The motor-control map considered here is the inverse of the static map relating motor-speed output to motor-voltage input for a typical out-runner type Brushless DC Motors (BLDCM. Traditionally, quad-copter BLDC motor speed control uses simple linear motor-control map defined by the motor-constant specification. However, practical BLDC motors show non-linear characteristic, particularly when operated across wide operating speed-range as is commonly required in quad-copter UAV flight operations. In this paper, our investigations to compare performance of linear versus non-linear motor-control maps are presented. The investigations cover simulation-based and experimental study of BLDC motor speed control systems for quad-copter vehicle available. First the non-linear map relating rotor RPM to motor voltage for quad-copter BLDC motor is obtained experimentally using an optical speed encoder. The performance of the linear versus non-linear motor-control-maps for the speed control are studied. The investigations also cover study of time-responses for various standard test input-signals e.g. step, ramp and pulse inputs, applied as the reference speed-commands. Also, simple 2-degree of freedom test-bed is developed in our laboratory to help test the open-loop and closed-loop experimental investigations. The non-linear motor-control map is found to perform better in BLDC motor speed tracking control performance and thereby helping achieve better quad-copter roll-angle attitude control.
The current-voltage relation of a pore and its asymptotic behavior in a Nernst-Planck model
Directory of Open Access Journals (Sweden)
Marius Birlea
2012-08-01
Full Text Available A model for current-voltage nonlinearity and asymmetry is a good starting point for explaining the electrical behavior of the nanopores in synthetic or biological membranes. Using a Nernst-Planck model, we found three behaviors for the current density in a membrane's pore as a function of voltage: a quasi-ohmic, slow rising linear current at low voltages, a nonlinear current at intermediate voltages, and a non-ohmic, fast rising linear current at large voltages. The slope of the quasi-ohmic current depends mainly on the height of energy barrier inside the pore, w, through an exponential term, ew. The magnitude of the non-ohmic linear current is controlled by the potential energy gradient at the pore entrance, w/r. The current-voltage relation is asymmetric if the ion's potential energy inside the pore has an asymmetric triangular profile. The model has only two assumed parameters, the energy barrier height, w, and the relative size of the entrance region of the pore, r, which is a useful feature for fitting and interpreting experimental data.
Non-linear thermal fluctuations in a diode
Kampen, N.G. van
As an example of non-linear noise the fluctuations in a circuit consisting of a diode and a condenser C are studied. From the master equation for this system the following results are derived. 1. (i) The equilibrium distribution of the voltage is rigorously Gaussian, the average voltage being
Capturing power at higher voltages from arrays of microbial fuel cells without voltage reversal
Kim, Younggy
2011-01-01
Voltages produced by microbial fuel cells (MFCs) cannot be sustainably increased by linking them in series due to voltage reversal, which substantially reduces stack voltages. It was shown here that MFC voltages can be increased with continuous power production using an electronic circuit containing two sets of multiple capacitors that were alternately charged and discharged (every one second). Capacitors were charged in parallel by the MFCs, but linked in series while discharging to the circuit load (resistor). The parallel charging of the capacitors avoided voltage reversal, while discharging the capacitors in series produced up to 2.5 V with four capacitors. There were negligible energy losses in the circuit compared to 20-40% losses typically obtained with MFCs using DC-DC converters to increase voltage. Coulombic efficiencies were 67% when power was generated via four capacitors, compared to only 38% when individual MFCs were operated with a fixed resistance of 250 Ω. The maximum power produced using the capacitors was not adversely affected by variable performance of the MFCs, showing that power generation can be maintained even if individual MFCs perform differently. Longer capacitor charging and discharging cycles of up to 4 min maintained the average power but increased peak power by up to 2.6 times. These results show that capacitors can be used to easily obtain higher voltages from MFCs, allowing for more useful capture of energy from arrays of MFCs. © 2011 The Royal Society of Chemistry.
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Prediction of breakdown voltages in novel gases for high voltage insulation
International Nuclear Information System (INIS)
Koch, M.
2015-01-01
This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF_6) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF_6 is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF_6 in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF_6 based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media
Power supply and stabilization of the supply system on board using decentralized voltage rectifiers
Energy Technology Data Exchange (ETDEWEB)
Grueb, W; Wegerer, K
1987-04-01
The functionally redundant power supply system of the Transrapid 06 II maglev train is described; it comprises four independent, battery-buffered networks and 30 linear generators per train section. Voltage rectifiers adapt the velocity- and load-dependent linear generator voltage to the 440 V d.c. networks and assure dynamic stabilisation as well as buffer battery loading. The result is a high-reliability power supply system on board with optimum utilisation of the power supplied by the linear generators while the train is running.
Piezoelectric self sensing actuators for high voltage excitation
International Nuclear Information System (INIS)
Grasso, E; Totaro, N; Janocha, H; Naso, D
2013-01-01
Self sensing techniques allow the use of a piezoelectric transducer simultaneously as an actuator and as a sensor. Such techniques are based on knowledge of the transducer behaviour and on measurements of electrical quantities, in particular voltage and charge. Past research work has mainly considered the linear behaviour of piezoelectric transducers, consequently restricting the operating driving voltages to low values. In this work a new self sensing technique is proposed which is able to perform self sensing reconstruction both at low and at high driving voltages. This technique, in fact, makes use of a hysteretic model to describe the nonlinear piezoelectric capacitance necessary for self sensing reconstruction. The capacitance can be measured and identified at the antiresonances of a vibrating structure with a good approximation. After providing a mathematical background to deal with the main aspects of self sensing, this technique is compared theoretically and experimentally to a typical linear one by using an aluminum plate with one bonded self sensing transducer and a positive position feedback (PPF) controller to verify the performance in self sensing based vibration control. (paper)
A dynamic voltage restorer (DVR) with selective harmonic compensation at medium voltage level
DEFF Research Database (Denmark)
Newman, M.J.; Holmes, D.G.; Nielsen, J.G.
2005-01-01
Dynamic voltage restorers (DVRs) are now becoming more established in industry to reduce the impact of voltage sags to sensitive loads. However, DVRs spend most of their time in standby mode, since voltage sags occur very infrequently, and hence their utilization is low. In principle, it would...... be advantageous if the series-connected inverter of a DVR could also be used to compensate for any steady-state load voltage harmonics, since this would increase the power quality "value-added" benefits to the grid system. However, before this can be done, consideration must be given to the control of steady......-state power through the DVR, the increased losses, and the low modulation depths at which the scheme must operate to achieve acceptable harmonic compensation performance. This paper presents a selective harmonic feedback control strategy that can be easily added to medium-voltage DVR systems to provide...
Directory of Open Access Journals (Sweden)
Ye. V. Dmitriev
2006-01-01
Full Text Available On the basis of the developed device for protection against of ferro-resonant and high-frequency cumulative over-voltages an algorithm for obtaining a voltage imitating ferro-resonant over-voltages is proposed in the paper. This algorithm presupposes to apply a voltage to the secondary transformer side from an extraneous source is proposed.
Effects of Linear Falling Ramp Reset Pulse on Addressing Operation in AC PDP
International Nuclear Information System (INIS)
Liu Zujun; Liang Zhihu; Liu Chunliang; Meng Lingguo
2006-01-01
The effects of linear falling ramp reset pulse related to addressing operation in an alternating current plasma display panel (AC PDP) were studied. The wall charge waveforms were measured by the electrode balance method in a 12-inch coplanar AC PDP. The wall charge waveforms show the relationship between the slope ratio of the falling ramp reset pulse and the wall charges at the end of the falling ramp reset pulse which influences the addressing stability. Then the effects of the slope ratio of the linear falling ramp reset pulse on the addressing voltage and addressing time were investigated. The experimental results show that the minimum addressing voltage increases with the increase of the slope ratio of the falling ramp reset pulse, and so does the minimum addressing time. Based on the experimental results, the optimization of the addressing time and the slope ratio of the falling ramp pulse is discussed
Optimized Controller Design for a 12-Pulse Voltage Source Converter Based HVDC System
Agarwal, Ruchi; Singh, Sanjeev
2017-12-01
The paper proposes an optimized controller design scheme for power quality improvement in 12-pulse voltage source converter based high voltage direct current system. The proposed scheme is hybrid combination of golden section search and successive linear search method. The paper aims at reduction of current sensor and optimization of controller. The voltage and current controller parameters are selected for optimization due to its impact on power quality. The proposed algorithm for controller optimizes the objective function which is composed of current harmonic distortion, power factor, and DC voltage ripples. The detailed designs and modeling of the complete system are discussed and its simulation is carried out in MATLAB-Simulink environment. The obtained results are presented to demonstrate the effectiveness of the proposed scheme under different transient conditions such as load perturbation, non-linear load condition, voltage sag condition, and tapped load fault under one phase open condition at both points-of-common coupling.
Prediction of breakdown voltages in novel gases for high voltage insulation
Energy Technology Data Exchange (ETDEWEB)
Koch, M.
2015-07-01
This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF{sub 6}) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF{sub 6} is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF{sub 6} in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF{sub 6} based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media.
The Design and Characterization of a Prototype Wideband Voltage Sensor Based on a Resistive Divider.
Garnacho, Fernando; Khamlichi, Abderrahim; Rovira, Jorge
2017-11-17
The most important advantage of voltage dividers over traditional voltage transformers is that voltage dividers do not have an iron core with non-linear hysteresis characteristics. The voltage dividers have a linear behavior with respect to over-voltages and a flat frequency response larger frequency range. The weak point of a voltage divider is the influence of external high-voltage (HV) and earth parts in its vicinity. Electrical fields arising from high voltages in neighboring phases and from ground conductors and structures are one of their main sources for systematic measurement errors. This paper describes a shielding voltage divider for a 24 kV medium voltage network insulated in SF6 composed of two resistive-capacitive dividers, one integrated within the other, achieving a flat frequency response up to 10 kHz for ratio error and up to 5 kHz for phase displacement error. The metal shielding improves its immunity against electric and magnetic fields. The characterization performed on the built-in voltage sensor shows an accuracy class of 0.2 for a frequency range from 20 Hz to 5 kHz and a class of 0.5 for 1 Hz up to 20 Hz. A low temperature effect is also achieved for operation conditions of MV power grids.
A Voltage Modulated DPC Approach for Three-Phase PWM Rectifier
DEFF Research Database (Denmark)
Gui, Yonghao; Li, Mingshen; Lu, Jinghang
2018-01-01
In this paper, a voltage modulated direct power control for three-phase pulse-width modulated rectifier is proposed. With the suggested method, the differential equations describing the rectifier dynamics are changing from a linear time-varying system into a linear time-invariant one. In this way...
Directory of Open Access Journals (Sweden)
Lee Gyu-sub
2016-01-01
Full Text Available The exhaustion of fossil fuel and the greenhouse gas emission are one of the most significant energy and environmental issues, respectively. Photovoltaic (PV generators and battery energy storage systems (BESSs have been significantly increased for recent years. The BESSs are mainly used for smoothing active power fluctuation of the PV. In this paper, PV–BESSs integration of two DC/DC converters and one AC/DC converter is investigated and DC-link voltage control to compensate the AC voltage deviation is proposed for the PV‒BESS system in low-voltage (LV networks.
Benchmarking of Voltage Sag Generators
DEFF Research Database (Denmark)
Yang, Yongheng; Blaabjerg, Frede; Zou, Zhixiang
2012-01-01
The increased penetration of renewable energy systems, like photovoltaic and wind power systems, rises the concern about the power quality and stability of the utility grid. Some regulations for Low Voltage Ride-Through (LVRT) for medium voltage or high voltage applications, are coming into force...
Simulation study on single event burnout in linear doping buffer layer engineered power VDMOSFET
International Nuclear Information System (INIS)
Jia Yunpeng; Su Hongyuan; Hu Dongqing; Wu Yu; Jin Rui
2016-01-01
The addition of a buffer layer can improve the device's secondary breakdown voltage, thus, improving the single event burnout (SEB) threshold voltage. In this paper, an N type linear doping buffer layer is proposed. According to quasi-stationary avalanche simulation and heavy ion beam simulation, the results show that an optimized linear doping buffer layer is critical. As SEB is induced by heavy ions impacting, the electric field of an optimized linear doping buffer device is much lower than that with an optimized constant doping buffer layer at a given buffer layer thickness and the same biasing voltages. Secondary breakdown voltage and the parasitic bipolar turn-on current are much higher than those with the optimized constant doping buffer layer. So the linear buffer layer is more advantageous to improving the device's SEB performance. (paper)
A novel self-biased linear silicon drift detector
International Nuclear Information System (INIS)
Corsi, F.; Gramegna, G.; Marzocca, C.
1999-01-01
A novel linear silicon drift detector (SDD) is proposed in which the proper potential profile is established by the voltage drop along a unique p + cathode implanted across the surfaces. This p + implant, arranged in a zigzag shape, acts at the same time as voltage divider and field cathode and allows one to increase the sensitive area, improving also the uniformity of the thermal distribution and thus minimizing the fluctuation of the electron mobility on the sensitive zone of the SDD. The perturbations of the drift field due to the asymmetry of the strips constituting the zigzag cathode have been evaluated by solving analytically Poisson's equation for a simplified model of the structure. Three-dimensional numerical simulations have been carried out to prove the negligible amount of the perturbation and the effectiveness of the proposed structure. Based on this principle, a prototype has been manufactured at Canberra Semiconductor Company. Dynamic measurements of the time-of-flight of an injected charge prove that the linearity of the prototype and the drift uniformity in the anode direction are very high
Artificial intelligence techniques for voltage control
Energy Technology Data Exchange (ETDEWEB)
Ekwue, A.; Cheng, D.T.Y.; Macqueen, J.F.
1997-12-31
In electric power systems, the advantages of reactive power dispatching or optimisation include improved utilisation of reactive power sources and hence reduction in reactive power flows and real losses of the system; unloading of the system and equipment as a result of reactive flow reduction; the power factors of generation are improved and system security is enhanced; reduced voltage gradients and somewhat higher voltages which result across the system from improved operation; deferred capital investment is new reactive power sources as a result of improved utilisation of existing equipment; and for the National Grid Company plc (NGC), the main advantage is reduced out-of-merit operation. The problem of reactive power control has been studied and widely reported in the literature. Non-linear programming methods as well as linear programming techniques for constraint dispatch have been described. Static optimisation of reactive power sources by the use of sensitivity analysis was described by Kishore and Hill. Long range optimum var planning has been considered and the optimum amount and location of network reactive compensation so as to maintain the system voltage within the desired limits, while operating under normal and various insecurity states, have also been studied using several methods. The objective of this chapter is therefore to review conventional methods as well as AI techniques for reactive power control. (Author)
Directory of Open Access Journals (Sweden)
Teodora Susana Oros
2014-12-01
Full Text Available This paper presents a study, design and simulation of a Free Piston Stirling Engine Linear Alternator. There are presented the main steps of the magnetic and electric calculations for a permanent magnet linear alternator of fixed coil and moving magnets type. Finally, a detailed thermal, mechanical and electrical model for a Stirling engine linear alternator have been made in SIMULINK simulation program. The linear alternator simulation model uses a controllable DC voltage which simulates the linear alternator combined with a rectifier, a variable load and a DC-DC converter, which compensates for the variable nature of Stirling engine operation, and ensures a constant voltage output regardless of the load.
Square pulse linear transformer driver
Directory of Open Access Journals (Sweden)
A. A. Kim
2012-04-01
Full Text Available The linear transformer driver (LTD technological approach can result in relatively compact devices that can deliver fast, high current, and high-voltage pulses straight out of the LTD cavity without any complicated pulse forming and pulse compression network. Through multistage inductively insulated voltage adders, the output pulse, increased in voltage amplitude, can be applied directly to the load. The usual LTD architecture [A. A. Kim, M. G. Mazarakis, V. A. Sinebryukhov, B. M. Kovalchuk, V. A. Vizir, S. N Volkov, F. Bayol, A. N. Bastrikov, V. G. Durakov, S. V. Frolov, V. M. Alexeenko, D. H. McDaniel, W. E. Fowler, K. LeCheen, C. Olson, W. A. Stygar, K. W. Struve, J. Porter, and R. M. Gilgenbach, Phys. Rev. ST Accel. Beams 12, 050402 (2009PRABFM1098-440210.1103/PhysRevSTAB.12.050402; M. G. Mazarakis, W. E. Fowler, A. A. Kim, V. A. Sinebryukhov, S. T. Rogowski, R. A. Sharpe, D. H. McDaniel, C. L. Olson, J. L. Porter, K. W. Struve, W. A. Stygar, and J. R. Woodworth, Phys. Rev. ST Accel. Beams 12, 050401 (2009PRABFM1098-440210.1103/PhysRevSTAB.12.050401] provides sine shaped output pulses that may not be well suited for some applications like z-pinch drivers, flash radiography, high power microwaves, etc. A more suitable power pulse would have a flat or trapezoidal (rising or falling top. In this paper, we present the design and first test results of an LTD cavity that generates such a type of output pulse by including within its circular array a number of third harmonic bricks in addition to the main bricks. A voltage adder made out of a square pulse cavity linear array will produce the same shape output pulses provided that the timing of each cavity is synchronized with the propagation of the electromagnetic pulse.
Cogging force investigation of a free piston permanent magnet linear generator
Abdalla, I. I.; Zainal, A. E. Z.; Ramlan, N. A.; Firmansyah; Aziz, A. R. A.; Heikal, M. R.
2017-10-01
Better performance and higher efficiency of the vehicles can be achieved by using free piston engine, in which the piston is connected directly to the linear generator and waiving of any mechanical means. The free piston engine has the ability to overcome or reduce many of the challenges, such as the carbon dioxide (CO2) emission and fossil fuel consumption. The cogging force produces undesired vibration and acoustic noise in the generator. However, the cogging force must be minimized as much as possible, in order to have a high performance. This paper studies the effects of ferromagnetic materials on the cogging force of the permanent magnet linear generator (PMLG) to be used in a free piston engine using nonlinear finite-element analysis (FEA) under ANSYS Maxwell. The comparisons have been established for the cogging force of the PMLG under various translator velocities and three different ferromagnetic materials for the stator core, namely, Silicon Steel laminations, Mild Steel and Somaloy. It has been shown that the PMLG with a stator core made of Somaloy has a lower cogging force among them. Furthermore, the induced voltage of the PMLG at different accelerations has been studied. It is found that the PMLG with Mild Steel and Somaloy, respectively give larger induced voltage. Moreover, as the translator speed increase the induced voltage increased.
International Nuclear Information System (INIS)
Sahar, Alialy; Şlemsettin, Altındal; Ahmet, Kaya; İ, Uslu
2015-01-01
Au/n-Si (MS) structures with a high dielectric interlayer (0.03 graphene-doped PVA) are fabricated to investigate the illumination and voltage effects on electrical and dielectric properties by using capacitance-voltage (C-V) and conductance-voltage (G/ω-V) measurements at room temperature and at 1 MHz. Some of the main electrical parameters such as concentration of doping atoms (N D ), barrier height (ϕ B (C - V)), depletion layer width (W D ) and series resistance (R s ) show fairly large illumination dispersion. The voltage-dependent profile of surface states (N ss ) and resistance of the structure (R i ) are also obtained by using the dark-illumination capacitance (C dark -C ill ) and Nicollian-Brews methods, respectively. For a clear observation of changes in electrical parameters with illumination, the values of N D , W D , ϕ B (C - V) and R s are drawn as a function of illumination intensity. The values of N D and W D change almost linearly with illumination intensity. On the other hand, R s decreases almost exponentially with increasing illumination intensity whereas ϕ B (C - V) increases. The experimental results suggest that the use of a high dielectric interlayer (0.03 graphene-doped PVA) considerably passivates or reduces the magnitude of the surface states. The large change or dispersion in main electrical parameters can be attributed to generation of electron-hole pairs in the junction under illumination and to a good light absorption. All of these experimental results confirm that the fabricated Au/0.03 graphene-doped PVA/n-Si structure can be used as a photodiode or a capacitor in optoelectronic applications. (paper)
Dual-range linearized transimpedance amplifier system
Wessendorf, Kurt O.
2010-11-02
A transimpedance amplifier system is disclosed which simultaneously generates a low-gain output signal and a high-gain output signal from an input current signal using a single transimpedance amplifier having two different feedback loops with different amplification factors to generate two different output voltage signals. One of the feedback loops includes a resistor, and the other feedback loop includes another resistor in series with one or more diodes. The transimpedance amplifier system includes a signal linearizer to linearize one or both of the low- and high-gain output signals by scaling and adding the two output voltage signals from the transimpedance amplifier. The signal linearizer can be formed either as an analog device using one or two summing amplifiers, or alternately can be formed as a digital device using two analog-to-digital converters and a digital signal processor (e.g. a microprocessor or a computer).
Marran, K J; Davey, B; Lang, A; Segal, D G
2013-04-10
Postprandial glucose excursions contribute significantly to average blood glucose, glycaemic variability and cardiovascular risk. Carbohydrate counting is a method of insulin dosing that balances carbohydrate load to insulin dose using a fixed ratio. Many patients and current insulin pumps calculate insulin delivery for meals based on a linear carbohydrate-to-insulin relationship. It is our hypothesis that a non-linear relationship exists between the amounts of carbohydrate consumed and the insulin required to cover it. To document blood glucose exposure in response to increasing carbohydrate loads on fixed carbohydrate-to-insulin ratios. Five type 1 diabetic subjects receiving insulin pump therapy with good control were recruited. Morning basal rates and carbohydrate- to-insulin ratios were optimised. A Medtronic glucose sensor was used for 5 days to collect data for area-under-the-curve (AUC) analysis, during which standardised meals of increasing carbohydrate loads were consumed. Increasing carbohydrate loads using a fixed carbohydrate-to-insulin ratio resulted in increasing glucose AUC. The relationship was found to be exponential rather than linear. Late postprandial hypoglycaemia followed carbohydrate loads of >60 g and this was often followed by rebound hyperglycaemia that lasted >6 hours. A non-linear relationship exists between carbohydrates consumed and the insulin required to cover them. This has implications for control of postprandial blood sugars, especially when consuming large carbohydrate loads. Further studies are required to look at the optimal ratios, duration and type of insulin boluses required to cover increasing carbohydrate loads.
Mitchell, Rachel L C
2010-05-01
Selective attention is popularly assessed with colour Stroop tasks in which participants name the ink colour of colour words, whilst resisting interference from the natural tendency to read the words. Prior studies hinted that the key brain regions (dorsolateral prefrontal (dlPFC) and anterior cingulate cortex (ACC)) may vary their degree of involvement, dependent on attentional demand. This study aimed to determine whether a parametrically varied increase in attentional demand resulted in linearly increased activity in these regions, and/or whether additional regions would be recruited during high attentional demand. Twenty-eight healthy young adults underwent fMRI whilst naming the font colour of colour words. Linear increases in BOLD response were assessed with increasing percentage incongruent trials per block (0, 20, 40, 60, 80, and 100%). Whilst ACC activation increased linearly according to incongruity level, dlPFC activity appeared constant. Together with behavioural evidence of reduced Stroop interference, these data support a load-dependent conflict-related response in ACC, but not dlPFC.
High frequency breakdown voltage
International Nuclear Information System (INIS)
Chu, Thanh Duy.
1992-03-01
This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance
International Nuclear Information System (INIS)
Gower, E J; Sullivan, J S
2002-01-01
High voltage, solid state, inductive adder, pulse generators have found increasing application as fast kicker pulse modulators for charged particle beams. The solid state, inductive adder, pulse generator is similar in operation to the linear induction accelerator. The main difference is that the solid state, adder couples energy by transformer action from multiple primaries to a voltage summing stalk, instead of an electron beam. Ideally, the inductive adder produces a rectangular voltage pulse at the load. In reality, there is usually some voltage variation at the load due to droop on primary circuit storage capacitors, or, temporal variations in the load impedance. Power MOSFET circuits have been developed to provide analog modulation of the output voltage amplitude of a solid state, inductive adder, pulse generator. The modulation is achieved by including MOSFET based, variable subtraction circuits in the multiple primary stack. The subtraction circuits can be used to compensate for voltage droop, or, to tailor the output pulse amplitude to provide a desired effect in the load. Power MOSFET subtraction circuits have been developed to modulate short, temporal (60-400 ns), voltage and current pulses. MOSFET devices have been tested up to 20 amps and 800 Volts with a band pass of 50 MHz. An analog modulation cell has been tested in a five cell high, voltage adder stack
A high linearity current mode second IF CMOS mixer for a DRM/DAB receiver
International Nuclear Information System (INIS)
Xu Jian; Zhou Zheng; Wu Yiqiang; Wang Zhigong; Chen Jianping
2015-01-01
A passive current switch mixer was designed for the second IF down-conversion in a DRM/DAB receiver. The circuit consists of an input transconductance stage, a passive current switching stage, and a current amplifier stage. The input transconductance stage employs a self-biasing current reusing technique, with a resistor shunt feedback to increase the gain and output impedance. A dynamic bias technique is used in the switching stage to ensure the stability of the overdrive voltage versus the PVT variations. A current shunt feedback is introduced to the conventional low-voltage second-generation fully balanced multi-output current converter (FBMOCCII), which provides very low input impedance and high output impedance. With the circuit working in current mode, the linearity is effectively improved with low supply voltages. Especially, the transimpedance stage can be removed, which simplifies the design considerably. The design is verified with a SMIC 0.18 μm RF CMOS process. The measurement results show that the voltage conversation gain is 1.407 dB, the NF is 16.22 dB, and the IIP3 is 4.5 dBm, respectively. The current consumption is 9.30 mA with a supply voltage of 1.8 V. This exhibits a good compromise among the gain, noise, and linearity for the second IF mixer in DRM/DAB receivers. (paper)
A double B1-mode 4-layer laminated piezoelectric linear motor.
Li, Xiaotian; Chen, Zhijiang; Dong, Shuxiang
2012-12-01
We report a miniature piezoelectric ultrasonic linear motor that is made of four Pb(Zr,Ti)O(3) (PZT) piezoelectric ceramic layers for low-voltage work. The 4-layer piezoelectric laminate works in two orthogonal first-bending modes for producing elliptical oscillations, which are then used to drive a contacting slider into continuous linear motion. Experimental results show that the miniature linear motor (size: 4 × 4 × 12 mm, weight: 1.7 g) can generate a large driving force of 0.48 N and a linear motion speed of up to 160 mm/s, using a 40 V(pp)/mm voltage drive at its resonance frequency of 64.5 kHz. The maximum efficiency of the linear motor is 30%.
Computation of Steady State Nodal Voltages for Fast Security Assessment in Power Systems
DEFF Research Database (Denmark)
Møller, Jakob Glarbo; Jóhannsson, Hjörtur; Østergaard, Jacob
2014-01-01
Development of a method for real-time assess-ment of post-contingency nodal voltages is introduced. Linear network theory is applied in an algorithm that utilizes Thevenin equivalent representation of power systems as seen from every voltage-controlled node in a network. The method is evaluated b...
International Nuclear Information System (INIS)
Briggs, R.J.
1986-06-01
The development of linear induction accelerators has been motivated by applications requiring high-pulsed currents of charged particles at voltages exceeding the capability of single-stage, diode-type accelerators and at currents too high for rf accelerators. In principle, one can accelerate charged particles to arbitrarily high voltages using a multi-stage induction machine, but the 50-MeV, 10-kA Advanced Test Accelerator (ATA) at LLNL is the highest voltage machine in existence at this time. The advent of magnetic pulse power systems makes sustained operation at high-repetition rates practical, and this capability for high-average power is very likely to open up many new applications of induction machines in the future. This paper surveys the US induction linac technology with primary emphasis on electron machines. A simplified description of how induction machines couple energy to the electron beam is given, to illustrate many of the general issues that bound the design space of induction linacs
The application of structural nonlinearity in the development of linearly tunable MEMS capacitors
International Nuclear Information System (INIS)
Shavezipur, M; Khajepour, A; Hashemi, S M
2008-01-01
Electrostatically actuated parallel-plate tunable capacitors are the most desired MEMS capacitors because of their smaller sizes and higher Q-factors. However, these capacitors suffer from low tunability and exhibit high sensitivity near the pull-in voltage which counters the concept of tunability. In this paper, a novel design for parallel-plate tunable capacitors with high tunability and linear capacitance–voltage (C–V) response is developed. The design uses nonlinear structural rigidities to relieve intrinsic electrostatic nonlinearity in MEMS capacitors. Based on the force–displacement characteristic of an ideally linear capacitor, a real beam-like nonlinear spring model is developed. The variable stiffness coefficients of such springs improve the linearity of the C–V curve. Moreover, because the structural stiffness increases with deformations, the pull-in is delayed and higher tunability is achieved. Finite element simulations reveal that capacitors with air gaps larger than 4 µm and supporting beams thinner than 1 µm can generate highly linear C–V responses and tunabilities over 120%. Experimental results for capacitors fabricated by PolyMUMPs verify the effect of weak nonlinear geometric stiffness on improving the tunability for designs with a small air gap and relatively thick structural layers
Design of a linear neutron source
International Nuclear Information System (INIS)
Buzarbaruah, N.; Dutta, N.J.; Bhardwaz, J.K.; Mohanty, S.R.
2015-01-01
Highlights: • This paper reports the design of a linear neutron source based on inertial electrostatic confinement fusion scheme. • The voltage and current that is to be applied to the grid is computed theoretically. • Neutron production rate is theoretically estimated and found to be of the order of 10 7 –10 8 neutrons/s. • Electric potential distribution and ion trajectories are studied using SIMION code. • Optimized condition for the inner grid transparency has been found out. - Abstract: In this paper, we present the design of a linear neutron source based on the concept of inertial electrostatic confinement fusion. The source mainly comprises of a concentric coaxial cylindrical grid assembly housed inside a double walled cylindrical vacuum chamber, a gas injection system, a high voltage feedthrough and a high voltage negative polarity power supply. The inner grid will be kept at a high negative potential with respect to the outer grid that will be grounded. The effect of grid transparency on electric potential distribution and ion trajectories has been studied using SIMION. A diffuse deuterium plasma will be initially created by making filament discharge and subsequently, on application of high negative voltage to the inner grid, deuterons will be accelerated towards the axis of the device. These deuterons will oscillate in the negative potential and consequently fuse in between the grids to produce neutrons. This source is expected to produce 10 7 –10 8 neutrons/s. The proposed linear neutron source will be operated both in the continuous and pulse modes and it will be utilized for a few near term applications namely fusion reactor material studies and explosive detection
Mueller, Ulf Philipp; Wienholt, Lukas; Kleinhans, David; Cussmann, Ilka; Bunke, Wolf-Dieter; Pleßmann, Guido; Wendiggensen, Jochen
2018-02-01
There are several power grid modelling approaches suitable for simulations in the field of power grid planning. The restrictive policies of grid operators, regulators and research institutes concerning their original data and models lead to an increased interest in open source approaches of grid models based on open data. By including all voltage levels between 60 kV (high voltage) and 380kV (extra high voltage), we dissolve the common distinction between transmission and distribution grid in energy system models and utilize a single, integrated model instead. An open data set for primarily Germany, which can be used for non-linear, linear and linear-optimal power flow methods, was developed. This data set consists of an electrically parameterised grid topology as well as allocated generation and demand characteristics for present and future scenarios at high spatial and temporal resolution. The usability of the grid model was demonstrated by the performance of exemplary power flow optimizations. Based on a marginal cost driven power plant dispatch, being subject to grid restrictions, congested power lines were identified. Continuous validation of the model is nescessary in order to reliably model storage and grid expansion in progressing research.
DEFF Research Database (Denmark)
A Razak, Aliff Hisyam; Yu, Liyun; Skov, Anne Ladegaard
2017-01-01
Increased electrical breakdown strength and increased dielectric permittivity of silicone-based dielectric elastomers are achieved by means of the addition of so-called voltage-stabilisers prepared from PDMS–PPMS copolymers as well as PDMS–PEG copolymers in order to compensate for the negative...... effect of softness on electrical stability of silicone elastomers. The voltage-stabilised elastomer, incorporating a high-permittivity PDMS–PEG copolymer, possesses increased relative permittivity, high electrical breakdown strength, excellent network integrity and low dielectric loss and paves the way...
Characteristics of output voltage and current of integrated nanogenerators
Yang, Rusen; Qin, Yong; Li, Cheng; Dai, Liming; Wang, Zhong Lin
2009-01-01
three criteria: Schottky behavior test, switching-polarity tests, and linear superposition of current and voltage tests. The 11 tests can effectively rule out the system artifacts, whose sign does not change with the switching measurement polarity
A voltage to frequency converter for astronomical photometry
Dunham, E.; Elliot, J. L.
1978-01-01
A voltage to frequency converter (VFC) for general use with photomultipliers is described. For high light levels, when the dead-time corrections for a photon counter would be excessive, the VFC maintains a linear response and allows the recording of data at high time resolution. Results of laboratory tests are given for the signal-to-noise characteristics, linearity, stability, and transient response of the VFC when used in conjunction with EMI 9658 and RCA C31034 photomultipliers.
Energy Technology Data Exchange (ETDEWEB)
Kavitha, A.; Kannan, R. [Department of Physics, University College of Engineering, Anna University, Dindugal-624622 (India); Subramanian, N. Sankara [Department of Physics, Thiagarajar College of Engineering, Madurai -625015, Tamilnadu (India); Loganathan, S. [Ion Plating, Titan Industries Ltd., Hosur - 635126, Tamilnadu (India)
2014-04-24
Zirconium nitride thin films have been prepared on stainless steel substrate (304L grade) by reactive cylindrical magnetron sputtering method with Gas Ion Source (GIS) and bias voltage using optimized coating parameters. The structure and surface morphologies of the ZrN films were characterized using X-ray diffraction, atomic microscopy and scanning electron microscopy. The adhesion property of ZrN thin film has been increased due to the GIS. The coating exhibits better adhesion strength up to 10 N whereas the ZrN thin film with bias voltage exhibits adhesion up to 500 mN.
Nonlinear Parasitic Capacitance Modelling of High Voltage Power MOSFETs in Partial SOI Process
DEFF Research Database (Denmark)
Fan, Lin; Knott, Arnold; Jørgensen, Ivan Harald Holger
2016-01-01
: off-state, sub-threshold region, and on-state in the linear region. A high voltage power MOSFET is designed in a partial Silicon on Insulator (SOI) process, with the bulk as a separate terminal. 3D plots and contour plots of the capacitances versus bias voltages for the transistor summarize...
DEFF Research Database (Denmark)
Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar
2013-01-01
Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...
Low Voltage Current Mode Switched-Current-Mirror Mixer
Directory of Open Access Journals (Sweden)
Chunhua Wang
2009-09-01
Full Text Available A new CMOS active mixer topology can operate at 1 V supply voltage by use of SCM (switched currentmirror. Such current-mode mixer requires less voltage headroom with good linearization. Mixing is achieved with four improved current mirrors, which are alternatively activated. For ideal switching, the operation is equivalent to a conventional active mixer. This paper analyzes the performance of the SCM mixer, in comparison with the conventional mixer, demonstrating competitive performance at a lower supply voltage. Moreover, the new mixer’s die, without any passive components, is very small, and the conversion gain is easy to adjust. An experimental prototype was designed and simulated in standard chartered 0.18μm RF CMOS Process with Spectre in Cadence Design Systems. Experimental results show satisfactory mixer performance at 2.4 GHz.
Evaluation of the Voltage Support Strategies for the Low Voltage Grid Connected PV
DEFF Research Database (Denmark)
Demirok, Erhan; Sera, Dezso; Teodorescu, Remus
2010-01-01
Admissible range of grid voltage is one of the strictest constraints for the penetration of distributed photovoltaic (PV) generators especially connection to low voltage (LV) public networks. Voltage limits are usually fulfilled either by network reinforcements or limiting of power injections from...... PVs. In order to increase PV penetration level further, new voltage support control functions for individual inverters are required. This paper investigates distributed reactive power regulation and active power curtailment strategies regarding the development of PV connection capacity by evaluation...... of reactive power efforts and requirement of minimum active power curtailment. Furthermore, a small scale experimental setup is built to reflect real grid interaction in the laboratory by achieving critical types of grid (weak and sufficiently stiff)....
DEFF Research Database (Denmark)
Micallef, A.; Apap, M.; Spitero-Stanies, C.
2012-01-01
This paper focuses on the islanded operation of microgrids. In this mode of operation, the microsources are required to cooperate autonomously to regulate the local grid voltage and frequency. Droop control is typically used to achieve this autonomous voltage and frequency regulation. Inverters...... having LCL output filters would cause voltage distortion to be present at the PCC of the local load when non-linear current is supplied to the load due to the voltage drop across the grid side inductor. Techniques to reduce the output voltage distortion typically consist of installing either passive...
Simulation study on single event burnout in linear doping buffer layer engineered power VDMOSFET
Yunpeng, Jia; Hongyuan, Su; Rui, Jin; Dongqing, Hu; Yu, Wu
2016-02-01
The addition of a buffer layer can improve the device's secondary breakdown voltage, thus, improving the single event burnout (SEB) threshold voltage. In this paper, an N type linear doping buffer layer is proposed. According to quasi-stationary avalanche simulation and heavy ion beam simulation, the results show that an optimized linear doping buffer layer is critical. As SEB is induced by heavy ions impacting, the electric field of an optimized linear doping buffer device is much lower than that with an optimized constant doping buffer layer at a given buffer layer thickness and the same biasing voltages. Secondary breakdown voltage and the parasitic bipolar turn-on current are much higher than those with the optimized constant doping buffer layer. So the linear buffer layer is more advantageous to improving the device's SEB performance. Project supported by the National Natural Science Foundation of China (No. 61176071), the Doctoral Fund of Ministry of Education of China (No. 20111103120016), and the Science and Technology Program of State Grid Corporation of China (No. SGRI-WD-71-13-006).
International Nuclear Information System (INIS)
Baruah, Ratul Kumar; Mahapatra, Santanu
2009-01-01
Two different definitions, one is potential based and the other is charge based, are used in the literatures to define the threshold voltage of undoped body symmetric double gate transistors. This paper, by introducing a novel concept of crossover point, proves that the charge based definition is more accurate than the potential based definition. It is shown that for a given channel length the potential based definition predicts anomalous change in threshold voltage with body thickness variation while the charge based definition results in monotonous change. The threshold voltage is then extracted from drain current versus gate voltage characteristics using linear extrapolation, transconductance and match-point methods. In all the three cases it is found that trend of threshold voltage variation support the charge based definition.
An optical fiber Bragg grating and piezoelectric ceramic voltage sensor
Yang, Qing; He, Yanxiao; Sun, Shangpeng; Luo, Mandan; Han, Rui
2017-10-01
Voltage measurement is essential in many fields like power grids, telecommunications, metallurgy, railways, and oil production. A voltage-sensing unit, consisting of fiber Bragg gratings (FBGs) and piezoelectric ceramics, based on which an optical over-voltage sensor was proposed and fabricated in this paper. No demodulation devices like spectrometer or Fabry-Perot filter were needed to gain the voltage signal, and a relatively large sensing frequency range was acquired in this paper; thus, the cost of the sensing system is more acceptable in engineering application. The voltage to be measured was directly applied to the piezoelectric ceramic, and deformation of the ceramics and the grating would be caused because of the inverse piezoelectric effect. With a reference grating, the output light intensity change will be caused by the FBG center wavelength change; thus, the relationship between the applied voltage and the output light intensity was established. Validation of the sensor was accomplished in the frequency range from 50 Hz to 20 kHz and switching impulse waves with a test platform; good linearity of the input-output characteristic was achieved. A temperature validation test was completed, showing that the sensor maintains good temperature stability. Experimental results show that the optical over-voltage sensor can be used for voltage monitoring, and if applied with a voltage divider, the sensor can be used to measure high voltage.
An optical fiber Bragg grating and piezoelectric ceramic voltage sensor.
Yang, Qing; He, Yanxiao; Sun, Shangpeng; Luo, Mandan; Han, Rui
2017-10-01
Voltage measurement is essential in many fields like power grids, telecommunications, metallurgy, railways, and oil production. A voltage-sensing unit, consisting of fiber Bragg gratings (FBGs) and piezoelectric ceramics, based on which an optical over-voltage sensor was proposed and fabricated in this paper. No demodulation devices like spectrometer or Fabry-Perot filter were needed to gain the voltage signal, and a relatively large sensing frequency range was acquired in this paper; thus, the cost of the sensing system is more acceptable in engineering application. The voltage to be measured was directly applied to the piezoelectric ceramic, and deformation of the ceramics and the grating would be caused because of the inverse piezoelectric effect. With a reference grating, the output light intensity change will be caused by the FBG center wavelength change; thus, the relationship between the applied voltage and the output light intensity was established. Validation of the sensor was accomplished in the frequency range from 50 Hz to 20 kHz and switching impulse waves with a test platform; good linearity of the input-output characteristic was achieved. A temperature validation test was completed, showing that the sensor maintains good temperature stability. Experimental results show that the optical over-voltage sensor can be used for voltage monitoring, and if applied with a voltage divider, the sensor can be used to measure high voltage.
DEFF Research Database (Denmark)
Liu, Chengxi; Qin, Nan; Bak, Claus Leth
2015-01-01
This paper proposes a hybrid optimization method to optimally control the voltage and reactive power with minimum power loss in transmission grid. This approach is used for the Danish automatic voltage control (AVC) system which is typically a non-linear non-convex problem mixed with both...
Voltage distribution in tapered winding of tesla-transformer during discharge process of PFL
International Nuclear Information System (INIS)
Xin Jiaqi; Chang Anbi; Li Mingjia; Kang Qiang
2007-01-01
The operation principle of integral construction of Tesla transformer and PFL was investigated in Tesla-transformer-type accelerator. Experiment was carried out on Tesla transformer's secondary winding to study the impulse voltage distribution while PFL was discharging. The regularities of turn-ground voltage distribution and interturn voltage distribution were summarized. Voltage distribution within PFL was calculated and it was compared with the experimental result. Structural winding of parallel coils in the head, parallel coils in the end and shading ring were used to improve voltage distribution and that was testified by experiment. The results indicate that taper winding doesn't effect electric field within PFL, the turn-ground voltage appears linearly, the interturn voltage fluctuates seriously and it is the biggest in head of winding. The three optimized methods help to depress oscillation, the structural winding of parallel coils in the head decreases the interturn voltage in head of winding remark-ably and the parallel coils in the end decrease the interturn voltage in the end. (authors)
Universal Voltage Conveyor and Current Conveyor in Fast Full-Wave Rectifier
Directory of Open Access Journals (Sweden)
Josef Burian
2012-12-01
Full Text Available This paper deals about the design of a fast voltage-mode full-wave rectifier, where universal voltage conveyor and second-generation current conveyor are used as active elements. Thanks to the active elements, the input and output impedance of the non-linear circuit is infinitely high respectively zero in theory. For the rectification only two diodes and three resistors are required as passive elements. The performance of the circuit is shown on experimental measurement results showing the dynamic range, time response, frequency dependent DC transient value and RMS error for different values of input voltage amplitudes.
Elliott, D. G.
1977-01-01
Measurements of reaction rail currents, reaction rail voltages, and airgap magnetic fields in tests of the Linear Induction Motor Research Vehicle (LIMRV) were compared with theoretical calculations from the mesh/matrix theory. It was found that the rail currents and magnetic fields predicted by the theory are within 20 percent of the measured currents and fields at most motor locations in most of the runs, but differ by as much as a factor of two in some cases. The most consistent difference is a higher experimental than theoretical magnetic field near the entrance of the motor and a lower experimental than theoretical magnetic field near the exit. The observed differences between the theoretical and experimental magnetic fields and currents do not account for the differences of as much as 26 percent between the theoretical and experimental thrusts.
Experimental research for vacuum gap breakdown in high voltage multi-pulse
International Nuclear Information System (INIS)
Huang Ziping; He Jialong; Chen Sifu; Deng Jianjun; Wang Liping
2008-01-01
Base on the breakdown theory of vacuum gaps, experiments have been done to find out the breakdown electric field intensities in high voltage single-and triple-pulse for 26 vacuum gaps with different shapes. The experimental results match up to the theory and confirm the effect of the pulse-number increase on the breakdown electric field intensity. The key point to decide the macroscopical breakdown electric field intensity of a vacuum gap has been pointed out with some advises about the design of a multi-pulse linear inductive accelerator's accelerate gap. (authors)
A Monolithic CMOS Magnetic Hall Sensor with High Sensitivity and Linearity Characteristics.
Huang, Haiyun; Wang, Dejun; Xu, Yue
2015-10-27
This paper presents a fully integrated linear Hall sensor by means of 0.8 μm high voltage complementary metal-oxide semiconductor (CMOS) technology. This monolithic Hall sensor chip features a highly sensitive horizontal switched Hall plate and an efficient signal conditioner using dynamic offset cancellation technique. An improved cross-like Hall plate achieves high magnetic sensitivity and low offset. A new spinning current modulator stabilizes the quiescent output voltage and improves the reliability of the signal conditioner. The tested results show that at the 5 V supply voltage, the maximum Hall output voltage of the monolithic Hall sensor microsystem, is up to ±2.1 V and the linearity of Hall output voltage is higher than 99% in the magnetic flux density range from ±5 mT to ±175 mT. The output equivalent residual offset is 0.48 mT and the static power consumption is 20 mW.
A Monolithic CMOS Magnetic Hall Sensor with High Sensitivity and Linearity Characteristics
Directory of Open Access Journals (Sweden)
Haiyun Huang
2015-10-01
Full Text Available This paper presents a fully integrated linear Hall sensor by means of 0.8 μm high voltage complementary metal-oxide semiconductor (CMOS technology. This monolithic Hall sensor chip features a highly sensitive horizontal switched Hall plate and an efficient signal conditioner using dynamic offset cancellation technique. An improved cross-like Hall plate achieves high magnetic sensitivity and low offset. A new spinning current modulator stabilizes the quiescent output voltage and improves the reliability of the signal conditioner. The tested results show that at the 5 V supply voltage, the maximum Hall output voltage of the monolithic Hall sensor microsystem, is up to ±2.1 V and the linearity of Hall output voltage is higher than 99% in the magnetic flux density range from ±5 mT to ±175 mT. The output equivalent residual offset is 0.48 mT and the static power consumption is 20 mW.
Update on Linear Mode Photon Counting with the HgCdTe Linear Mode Avalanche Photodiode
Beck, Jeffrey D.; Kinch, Mike; Sun, Xiaoli
2014-01-01
The behavior of the gain-voltage characteristic of the mid-wavelength infrared cutoff HgCdTe linear mode avalanche photodiode (e-APD) is discussed both experimentally and theoretically as a function of the width of the multiplication region. Data are shown that demonstrate a strong dependence of the gain at a given bias voltage on the width of the n- gain region. Geometrical and fundamental theoretical models are examined to explain this behavior. The geometrical model takes into account the gain-dependent optical fill factor of the cylindrical APD. The theoretical model is based on the ballistic ionization model being developed for the HgCdTe APD. It is concluded that the fundamental theoretical explanation is the dominant effect. A model is developed that combines both the geometrical and fundamental effects. The model also takes into account the effect of the varying multiplication width in the low bias region of the gain-voltage curve. It is concluded that the lower than expected gain seen in the first 2 × 8 HgCdTe linear mode photon counting APD arrays, and higher excess noise factor, was very likely due to the larger than typical multiplication region length in the photon counting APD pixel design. The implications of these effects on device photon counting performance are discussed.
DEFF Research Database (Denmark)
Lu, Xiaonan; Guerrero, Josep M.; Sun, Kai
2014-01-01
Droop control is the basic control method for load current sharing in dc microgrid applications. The conventional dc droop control method is realized by linearly reducing the dc output voltage as the output current increases. This method has two limitations. First, with the consideration of line...... resistance in a droop-controlled dc microgrid, since the output voltage of each converter cannot be exactly the same, the output current sharing accuracy is degraded. Second, the DC bus voltage deviation increases with the load due to the droop action. In this paper, in order to improve the performance......, and the LBC system is only used for changing the values of the dc voltage and current. Hence, a decentralized control scheme is accomplished. The simulation test based on Matlab/Simulink and the experimental validation based on a 2×2.2 kW prototype were implemented to demonstrate the proposed approach....
Baker, Bradley J; Jin, Lei; Han, Zhou; Cohen, Lawrence B; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent
2012-07-15
A substantial increase in the speed of the optical response of genetically encoded fluorescent protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1-S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tau(off)voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2ms of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. Copyright © 2012 Elsevier B.V. All rights reserved.
Baker, Bradley J.; Jin, Lei; Han, Zhou; Cohen, Lawrence B.; Popovic, Marko; Platisa, Jelena; Pieribone, Vincent
2012-01-01
A substantial increase in the speed of the optical response of genetically-encoded Fluorescent Protein voltage sensors (FP voltage sensors) was achieved by using the voltage-sensing phosphatase genes of Nematostella vectensis and Danio rerio. A potential N. vectensis voltage-sensing phosphatase was identified in silico. The voltage-sensing domain (S1–S4) of the N. vectensis homolog was used to create an FP voltage sensor called Nema. By replacing the phosphatase with a cerulean/citrine FRET pair, a new FP voltage sensor was synthesized with fast off kinetics (Tauoff voltage-sensing phosphatase homolog, designated Zahra and Zahra 2, exhibited fast on and off kinetics within 2 msec of the time constants observed with the organic voltage-sensitive dye, di4-ANEPPS. Mutagenesis of the S4 region of the Danio FP voltage sensor shifted the voltage dependence to more negative potentials but did not noticeably affect the kinetics of the optical signal. PMID:22634212
New method for determining avalanche breakdown voltage of silicon photomultipliers
International Nuclear Information System (INIS)
Chirikov-Zorin, I.
2017-01-01
The avalanche breakdown and Geiger mode of the silicon p-n junction is considered. A precise physically motivated method is proposed for determining the avalanche breakdown voltage of silicon photomultipliers (SiPM). The method is based on measuring the dependence of the relative photon detection efficiency (PDE rel ) on the bias voltage when one type of carriers (electron or hole) is injected into the avalanche multiplication zone of the p-n junction. The injection of electrons or holes from the base region of the SiPM semiconductor structure is performed using short-wave or long-wave light. At a low overvoltage (1-2 V) the detection efficiency is linearly dependent on the bias voltage; therefore, extrapolation to zero PDE rel value determines the SiPM avalanche breakdown voltage with an accuracy within a few millivolts. [ru
DEFF Research Database (Denmark)
Micallef, Alexander; Apap, Maurice; Spiteri-Staines, Cyril
2013-01-01
Parallel inverters having LCL output filters cause voltage distortions at the point of common coupling (PCC) in islanded microgrids when non-linear loads are present. A capacitive virtual impedance loop could be used to provide selective harmonic compensation in islanded microgrids, instead of in...... resistance for selective harmonic compensation in islanded microgrids. Simulation results were given to show the suitability of the proposed algorithms in reducing the voltage harmonics at the PCC.......Parallel inverters having LCL output filters cause voltage distortions at the point of common coupling (PCC) in islanded microgrids when non-linear loads are present. A capacitive virtual impedance loop could be used to provide selective harmonic compensation in islanded microgrids, instead...... of introducing additional active or passive filters into the system that could compromise the stability of the microgrid. However, the performance of these compensation loops becomes degraded when a virtual resistance is introduced with the aim to improve the overall stability of the parallel inverters...
Novel ocean energy permanent magnet linear generator buoy
Energy Technology Data Exchange (ETDEWEB)
Rhinefrank, K.; Agamloh, E.B.; Jouanne, A. von; Wallace, A.K.; Prudell, J.; Kimble, K.; Aills, J.; Schmidt, E.; Schacher, A. [School of Electrical Engineering and Computer Science, Oregon State University, Corvallis, OR 97331-3211 (United States); Chan, P.; Sweeny, B. [Department of Mechanical Engineering, Oregon State University, Corvallis, OR 97331-3211 (United States)
2006-07-15
This paper describes the research, design, construction and prototype testing process of a novel ocean energy direct drive permanent magnet linear generator buoy. The buoy employs the vertical component of the motion of ocean waves to power a linear generator. The generator consists of a permanent magnet field system (mounted on the central translator shaft) and an armature, in which the power is generated (mounted on the buoy). The translator shaft is anchored to the sea floor, and the buoy/floater moves armature coils relative to the permanent magnet translator to induce voltages. The electrical and mechanical structures of the buoy generator are provided, along with performance characteristics, including voltage, current and developed power. (author)
International Nuclear Information System (INIS)
Mazarakis, M.G.; Poukey, J.W.; Frost, C.A.; Shope, S.L.; Halbleib, J.A.; Turman, B.N.
1993-01-01
During the last ten years the authors have extensively studied the physics and operation of magnetically-immersed electron foilless diodes. Most of these sources were utilized as injectors to high current, high energy linear induction accelerators such as those of the RADLAC family. Recently they have experimentally and theoretically demonstrated that foilless diodes can be successfully coupled to self-magnetically insulated transmission line voltage adders to produce very small high brightness, high definition (no halo) electron beams. The RADLAC/SMILE experience opened the path to a new approach in high brightness, high energy induction accelerators. There is no beam drifting through the device. The voltage addition occurs in a center conductor, and the beam is created at the high voltage end in an applied magnetic field diode. This work was motivated by the remarkable success of the HERMES-III accelerator and the need to produce small radius, high energy, high current electron beams for air propagation studies and flash x-ray radiography. In this paper they present experimental results compared with analytical and numerical simulations in addition to design examples of devices that can produce multikiloamp electron beams of as high as 100 MV energies and radii as small as 1 mm
International Nuclear Information System (INIS)
Gao, Tao; Xu, Ruimin; Kong, Yuechan; Zhou, Jianjun; Kong, Cen; Dong, Xun; Chen, Tangsheng
2015-01-01
We demonstrate highly improved linearity in a nonlinear ferroelectric of Pb(Zr 0.52 Ti 0.48 )-gated AlGaN/GaN metal-insulator-semiconductor high electron mobility transistor (MIS-HEMT). Distinct double-hump feature in the transconductance-gate voltage (g m -V g ) curve is observed, yielding remarkable enhancement in gate voltage swing as compared to MIS-HEMT with conventional linear gate dielectric. By incorporating the ferroelectric polarization into a self-consistent calculation, it is disclosed that in addition to the common hump corresponding to the onset of electron accumulation, the second hump at high current level is originated from the nonlinear polar nature of ferroelectric, which enhances the gate capacitance by increasing equivalent dielectric constant nonlinearly. This work paves a way for design of high linearity GaN MIS-HEMT by exploiting the nonlinear properties of dielectric
Voltage Controlled Dynamic Demand Response
DEFF Research Database (Denmark)
Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar
2013-01-01
Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...
Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing
Patel, N.; Branch, D. W.; Schamiloglu, E.; Cular, S.
2015-08-01
A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO3) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz-100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10-273 ps for DC voltages and 189-813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250-2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115-1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.
International Nuclear Information System (INIS)
Glyavin, M. Yu.; Zavolskiy, N. A.; Sedov, A. S.; Nusinovich, G. S.
2013-01-01
For a long time, the gyrotrons were primarily developed for electron cyclotron heating and current drive of plasmas in controlled fusion reactors where a multi-megawatt, quasi-continuous millimeter-wave power is required. In addition to this important application, there are other applications (and their number increases with time) which do not require a very high power level, but such issues as the ability to operate at low voltages and have compact devices are very important. For example, gyrotrons are of interest for a dynamic nuclear polarization, which improves the sensitivity of the nuclear magnetic resonance spectroscopy. In this paper, some issues important for operation of gyrotrons driven by low-voltage electron beams are analyzed. An emphasis is made on the efficiency of low-voltage gyrotron operation at the fundamental and higher cyclotron harmonics. These efficiencies calculated with the account for ohmic losses were, first, determined in the framework of the generalized gyrotron theory based on the cold-cavity approximation. Then, more accurate, self-consistent calculations for the fundamental and second harmonic low-voltage sub-THz gyrotron designs were carried out. Results of these calculations are presented and discussed. It is shown that operation of the fundamental and second harmonic gyrotrons with noticeable efficiencies is possible even at voltages as low as 5–10 kV. Even the third harmonic gyrotrons can operate at voltages about 15 kV, albeit with rather low efficiency (1%–2% in the submillimeter wavelength region).
Application of Minimum-time Optimal Control System in Buck-Boost Bi-linear Converters
Directory of Open Access Journals (Sweden)
S. M. M. Shariatmadar
2017-08-01
Full Text Available In this study, the theory of minimum-time optimal control system in buck-boost bi-linear converters is described, so that output voltage regulation is carried out within minimum time. For this purpose, the Pontryagin's Minimum Principle is applied to find optimal switching level applying minimum-time optimal control rules. The results revealed that by utilizing an optimal switching level instead of classical switching patterns, output voltage regulation will be carried out within minimum time. However, transient energy index of increased overvoltage significantly reduces in order to attain minimum time optimal control in reduced output load. The laboratory results were used in order to verify numerical simulations.
Radiation effects on residual voltage of polyethylene films
International Nuclear Information System (INIS)
Kyokane, Jun; Park, Dae-Hee; Yoshino, Katsumi.
1986-01-01
It has recently been pointed out that diagnosis of deterioration in insulating materials for electric cables used in nuclear power plants and outer space (communications satellite in particular) can be effectively performed based on measurements of residual voltage. In the present study, polyethylene films are irradiated with γ-rays or electron beam to examine the changes in residual voltage characteristics. Irradiation of electron beam and γ-rays are carried out to a dose of 0 - 90 Mrad and 0 - 100 Mrad, respectively. Measurements are made of the dependence of residual voltage on applied voltage, electron beam and γ-ray irradiation, annealing temperature and annealing time. Results show that carriers, which are once trapped after being released from the electrode, move within the material after the opening of the circuit to produce resiual voltage. The residual voltage increases with increasing dose of electron beam or γ-ray and levels off at high dose. Residual voltage is increased about several times by either electron beam or γ-rays, but electron beam tends to cause greater residual voltage than γ-ray. Polyethylene films irradiated with electron beam can recover upon annealing. It is concluded from observations made that residual voltage has close relations with defects in molecular structures caused by radiations, particularly the breaking of backbone chains and alteration in superstructures. (Nogami, K.)
Manipulating the voltage dependence of tunneling spin torques
Manchon, Aurelien
2012-10-01
Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.
Coherent Voltage Oscillations in Superconducting Polycrystalline Y1Ba2Cu3O7-x
International Nuclear Information System (INIS)
Altinkok, A; Yetis, H; Olutas, M; Kilic, K; Kilic, A; Cetin, O
2006-01-01
We have investigated the voltage response of superconducting polycrystalline bulk Y 1 Ba 2 Cu 3 O 7-x (YBCO) material to a bidirectional square wave current with long periods and dc current by means of the evolution of the voltage-time (V-t) curves near the critical temperature. In a well-defined range of amplitudes and periods of driving current, and temperatures, it was observed that a non-linear response to bidirectional square wave current rides on a time independent background voltage value and manifests itself as regular sinusoidal-like voltage oscillations. It was found that the non-linear response disappears when the bidirectional current was switched to dc current. The spectral content of the voltage oscillations analyzed by the Fast Fourier Transform of the corresponding V-t curves revealed that the fundamental harmonics is comparable to the frequency of bidirectional square wave current. The coherent voltage oscillations were discussed mainly in terms of the dynamic competition between pinning and depinning together with the disorder in the coupling strength between the superconducting grains (i.e Josephson coupling effects). The density fluctuations and semi-elastic coupling of the flux lines with the pinning centers were also considered as possible physical mechanisms in the interpretation of the experimental results
Performance improvement of a slip energy recovery drive system by a voltage-controlled technique
Energy Technology Data Exchange (ETDEWEB)
Tunyasrirut, Satean [Department of Instrumentation Engineering, Faculty of Engineering, Pathumwan Institute of Technology, 833 Rama1 Road, Pathumwan, Bangkok 10330 (Thailand); Kinnares, Vijit [Department of Electrical Engineering, Faculty of Engineering, King Mongkut' s Institute of Technology Ladkrabang, Bangkok 10520 (Thailand); Ngamwiwit, Jongkol [Department of Control Engineering, Faculty of Engineering, King Mongkut' s Institute of Technology Ladkrabang, Bangkok 10520 (Thailand)
2010-10-15
This paper introduces the performance improvement of a slip energy recovery drive system for the speed control of a wound rotor induction motor by a voltage-controlled technique. The slip energy occurred in the rotor circuit is transferred back to ac mains supply through a reactor instead of a step up transformer. The objective of the voltage-controlled technique is to increase power factor of the system and to reduce low order harmonics of the input line current. The drive system is designed and implemented using a voltage source inverter in conjunction with a boost chopper for DC link voltage, instead of a conventional drive using a 6 pulse converter or a Scherbius system. The slip power is recovered by the help of a voltage source inverter (VSI) based on a space vector pulse width modulation (SVPWM) technique. In order to keep the speed of the wound rotor induction motor constant over a certain range of operating conditions, the servo state feedback controller designed by a linear quadratic regulator (LQR) is also introduced in this paper. The overall control system is implemented on DSP, DS1104'TMS320F240 controller board. The performance improvement of the proposed system is tested in comparison with the conventional Scherbius system and the modified conventional Scherbius system by a 12 pulse converter in conjunction with a chopper at steady state and at dynamic conditions. A 220 W wound motor is employed for testing. It is found that the motor speed can be controlled to be constant in the operating range of 450-1200 rpm at no load and full load. It is also found that the efficiency of the proposed system is remarkably increased since the harmonics of the input ac line current is reduced while the ac line input power factor is increased. (author)
DEFF Research Database (Denmark)
Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna
2017-01-01
This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...
An implantable neurostimulator with an integrated high-voltage inductive power-recovery frontend
International Nuclear Information System (INIS)
Wang Yuan; Zhang Xu; Liu Ming; Li Peng; Chen Hongda
2014-01-01
This paper present a highly-integrated neurostimulator with an on-chip inductive power-recovery frontend and high-voltage stimulus generator. In particular, the power-recovery frontend includes a high-voltage full-wave rectifier (up to 100 V AC input), high-voltage series regulators (24/5 V outputs) and a linear regulator (1.8/3.3 V output) with bandgap voltage reference. With the high voltage output of the series regulator, the proposed neurostimulator could deliver a considerably large current in high electrode-tissue contact impedance. This neurostimulator has been fabricated in a CSMC 1 μm 5/40/700 V BCD process and the total silicon area including pads is 5.8 mm 2 . Preliminary tests are successful as the neurostimulator shows good stability under a 13.56 MHz AC supply. Compared to previously reported works, our design has advantages of a wide induced voltage range (26–100 V), high output voltage (up to 24 V) and high-level integration, which are suitable for implantable neurostimulators. (semiconductor integrated circuits)
Solid-state high voltage modulator and its application to rf source high voltage power supplies
International Nuclear Information System (INIS)
Tooker, J.F.; Huynh, P.; Street, R.W.
2009-01-01
A solid-state high voltage modulator is described in which series-connected insulated-gate bipolar transistors (IGBTs) are switched at a fixed frequency by a pulse width modulation (PWM) regulator, that adjusts the pulse width to control the voltage out of an inductor-capacitor filter network. General Atomics proposed the HV power supply (HVPS) topology of multiple IGBT modulators connected to a common HVdc source for the large number of 1 MW klystrons in the linear accelerator of the Accelerator Production of Tritium project. The switching of 24 IGBTs to obtain 20 kVdc at 20 A for short pulses was successfully demonstrated. This effort was incorporated into the design of a -70 kV, 80 A, IGBT modulator, and in a short-pulse test 12 IGBTs regulated -5 kV at 50 A under PWM control. These two tests confirm the practicality of solid-state IGBT modulators to regulate high voltage at reasonable currents. Tokamaks such as ITER require large rf heating and current drive systems with multiple rf sources. A HVPS topology is presented that readily adapts to the three rf heating systems on ITER. To take advantage of the known economy of scale for power conversion equipment, a single HVdc source feeds multiple rf sources. The large power conversion equipment, which is located outside, converts the incoming utility line voltage directly to the HVdc needed for the class of rf sources connected to it, to further reduce cost. The HVdc feeds a set of IGBT modulators, one for each rf source, to independently control the voltage applied to each source, maximizing operational flexibility. Only the modulators are indoors, close to the rf sources, minimizing the use of costly near-tokamak floor space.
Asahi, Shigeo; Kusaki, Kazuki; Harada, Yukihiro; Kita, Takashi
2018-01-17
Development of high-efficiency solar cells is one of the attractive challenges in renewable energy technologies. Photon up-conversion can reduce the transmission loss and is one of the promising concepts which improve conversion efficiency. Here we present an analysis of the conversion efficiency, which can be increased by up-conversion in a single-junction solar cell with a hetero-interface that boosts the output voltage. We confirm that an increase in the quasi-Fermi gap and substantial photocurrent generation result in a high conversion efficiency.
Design Analysis of Taper Width Variations in Magnetless Linear Machine for Traction Applications
Directory of Open Access Journals (Sweden)
Saadha Aminath
2018-01-01
Full Text Available Linear motors are being used in a different application with a huge popularity in the use of transport industry. With the invention of maglev trains and other high-speed trains, linear motors are being used for the translation and braking applications for these systems. However, a huge drawback of the linear motor design is the cogging force, low thrust values, and voltage ripples. This paper aims to study the force analysis with change in taper/teeth width of the motor stator and mover to understand the best teeth ratio to obtain a high flux density and a high thrust. The analysis is conducted through JMAG software and it is found that the optimum teeth ratio for both the stator and mover gives an increase of 94.4% increases compared to the 0.5mm stator and mover width.
Cell design for the DARHT linear induction accelerators
International Nuclear Information System (INIS)
Burns, M.; Allison, P.; Earley, L.; Liska, D.; Mockler, C.; Ruhe, J.; Tucker, H.; Walling, L.
1991-01-01
The Dual-Axis Radiographic Hydrotest (DARHT) facility will employ two linear induction accelerators to produce intense, bremsstrahlung x- ray pulses for flash radiography. The accelerator cell design for a 3- kA, 16--20 MeV, 60-ns flattop, high-brightness electron beam is presented. The cell is optimized for high-voltage stand-off while also minimizing the its transverse impedance. Measurements of high- voltage and rf characteristics are summarized. 7 refs., 5 figs
Energy Technology Data Exchange (ETDEWEB)
Gao, Tao [Fundamental Science on EHF Laboratory, University of Electronic Science and Technology of China (UESTC), Chengdu 611731 (China); Science and Technology on Monolithic Integrated Circuits and Modules Laboratory, Nanjing Electronic Devices Institute, Nanjing 210016 (China); Xu, Ruimin [Fundamental Science on EHF Laboratory, University of Electronic Science and Technology of China (UESTC), Chengdu 611731 (China); Kong, Yuechan, E-mail: kycfly@163.com; Zhou, Jianjun; Kong, Cen; Dong, Xun; Chen, Tangsheng [Science and Technology on Monolithic Integrated Circuits and Modules Laboratory, Nanjing Electronic Devices Institute, Nanjing 210016 (China)
2015-06-15
We demonstrate highly improved linearity in a nonlinear ferroelectric of Pb(Zr{sub 0.52}Ti{sub 0.48})-gated AlGaN/GaN metal-insulator-semiconductor high electron mobility transistor (MIS-HEMT). Distinct double-hump feature in the transconductance-gate voltage (g{sub m}-V{sub g}) curve is observed, yielding remarkable enhancement in gate voltage swing as compared to MIS-HEMT with conventional linear gate dielectric. By incorporating the ferroelectric polarization into a self-consistent calculation, it is disclosed that in addition to the common hump corresponding to the onset of electron accumulation, the second hump at high current level is originated from the nonlinear polar nature of ferroelectric, which enhances the gate capacitance by increasing equivalent dielectric constant nonlinearly. This work paves a way for design of high linearity GaN MIS-HEMT by exploiting the nonlinear properties of dielectric.
Plasma resistance behavior during the linear decay phase of RFPs in ETA BETA II
International Nuclear Information System (INIS)
Nalesso, G.F.
1982-01-01
In the aided-reversal mode RFP discharges produced in ETA BETA II, the plasma current is characterized by a linear decay phase, which follows an approximately exponential phase. During the same period the measured toroidal voltage is negative and initially increasing in absolute value (exponential phase) and then decreasing to almost zero during the linear phase before the current termination. The same behavior of the current has been observed in the quiescent phase in Zeta where a negative toroidal electric field was also observed. In this note we present a model that can explain the linear decay phase and fits with the experimental parameters and allows us to estimate the plasma resistance behavior during the linear phase of slow reversed field pinch discharges
Fabrication and current–voltage characteristics of NiOx/ZnO based MIIM tunnel diode
Energy Technology Data Exchange (ETDEWEB)
Singh, Aparajita, E-mail: asing044@fiu.edu [BioMEMS and Microsystems Laboratory, Department of Electrical and Computer Engineering, Florida International University, Miami, Florida 33174, United States of America (United States); Ratnadurai, Rudraskandan [Global Foundaries, Malta, New York 12020 (United States); Kumar, Rajesh [BioMEMS and Microsystems Laboratory, Department of Electrical and Computer Engineering, Florida International University, Miami, Florida 33174 (United States); Department of Physics, Panjab University, Chandigarh 160014 (India); Krishnan, Subramanian [BioMEMS and Microsystems Laboratory, Department of Electrical and Computer Engineering, Florida International University, Miami, Florida 33174 (United States); Emirov, Yusuf [Advanced Materials Engineering Research Institute, Florida International University, Miami, Florida 33174 (United States); Bhansali, Shekhar [BioMEMS and Microsystems Laboratory, Department of Electrical and Computer Engineering, Florida International University, Miami, Florida 33174 (United States)
2015-04-15
Highlights: • Fabrication of single and bilayer tunnel diodes by sputter deposition. • Current–voltage characteristics study. • Enhanced asymmetry and non-linearity. • Study of tunneling mechanism. - Abstract: Enhanced asymmetric and non-linear characteristics of Ni–NiOx based MIM diode has been reported by the addition of a second insulator layer ZnO to form MIIM configuration. These properties are required for applications like energy-harvesting devices, terahertz electronics, macro electronics, etc. In this work, single insulator layer Ni–NiOx–Cr and double insulator Ni–NiOx–ZnO–Cr tunnel diodes were fabricated and their I–V characteristics were studied. A significant increase by one order of magnitude in asymmetry has been observed in case of bilayer NiOx/ZnO dielectric configuration at low voltages. The sensitivity of the NiOx and NiOx/ZnO dielectric configuration in MIM stack was 11 V{sup −1} and 16 V{sup −1}. The improved performance of the bilayer insulator diode is due to the second insulator which enables resonant tunneling or step-tunneling. Resonant tunneling was found to be dominant through trap assisted tunneling in the NiOx/ZnO diode.
Hwang, Yuh-Shyan; Kung, Che-Min; Lin, Ho-Cheng; Chen, Jiann-Jong
2009-02-01
A low-sensitivity, low-bounce, high-linearity current-controlled oscillator (CCO) suitable for a single-supply mixed-mode instrumentation system is designed and proposed in this paper. The designed CCO can be operated at low voltage (2 V). The power bounce and ground bounce generated by this CCO is less than 7 mVpp when the power-line parasitic inductance is increased to 100 nH to demonstrate the effect of power bounce and ground bounce. The power supply noise caused by the proposed CCO is less than 0.35% in reference to the 2 V supply voltage. The average conversion ratio KCCO is equal to 123.5 GHz/A. The linearity of conversion ratio is high and its tolerance is within +/-1.2%. The sensitivity of the proposed CCO is nearly independent of the power supply voltage, which is less than a conventional current-starved oscillator. The performance of the proposed CCO has been compared with the current-starved oscillator. It is shown that the proposed CCO is suitable for single-supply mixed-mode instrumentation systems.
Voltage gradient mapping and electrophysiologically guided cryoablation in children with AVNRT.
Drago, Fabrizio; Battipaglia, Irma; Russo, Mario Salvatore; Remoli, Romolo; Pazzano, Vincenzo; Grifoni, Gino; Allegretti, Greta; Silvetti, Massimo Stefano
2018-04-01
Recently, voltage gradient mapping of Koch's triangle to find low-voltage connections, or 'voltage bridges', corresponding to the anatomic position of the slow pathway, has been introduced as a method to ablate atrioventricular nodal reentry tachycardia (AVNRT) in children. Thus, we aimed to assess the effectiveness of voltage mapping of Koch's triangle, combined with the search for the slow potential signal in 'low-voltage bridges', to guide cryoablation of AVNRT in children. From June 2015 to May 2016, 35 consecutive paediatric patients (mean age 12.1 ± 4.5 years) underwent 3D-guided cryoablation of AVNRT at our Institution. Fifteen children were enrolled as control group (mean age 14 ± 4 years). A voltage gradient mapping of Koch's triangle was obtained in all patients, showing low-voltage connections in all children with AVNRT but not in controls. Prior to performing cryoablation, we looked for the typical 'hump and spike' electrogram, generally considered to be representative of slow pathway potential within a low-voltage bridge. In all patients the 'hump and spike' electrogram was found inside bridges of low voltage. Focal or high-density linear lesions, extended or not, were delivered guided by low-voltage bridge visualization. Acute success rate was 100%, and no recurrence was reported at a mean follow-up of 8 ± 3 months. Voltage gradient mapping of Koch's triangle, combined with the search for the slow potential signal in low-voltage bridges, is effective in guiding cryoablation of AVNRT in paediatric patients, with a complete acute success rate and no AVNRT recurrences at mid-term follow-up.
Non-linear dielectric monitoring of biological suspensions
International Nuclear Information System (INIS)
Treo, E F; Felice, C J
2007-01-01
Non-linear dielectric spectroscopy as a tool for in situ monitoring of enzyme assumes a non-linear behavior of the sample when a sinusoidal voltage is applied to it. Even many attempts have been made to improve the original experiments, all of them had limited success. In this paper we present upgrades made to a non-linear dielectric spectrometer developed and the results obtained when using different cells. We emphasized on the electrode surface, characterizing the grinding and polishing procedure. We found that the biological medium does not behave as expected, and the non-linear response is generated in the electrode-electrolyte interface. The electrochemistry of this interface can bias unpredictably the measured non-linear response
Directory of Open Access Journals (Sweden)
Ye. V. Dmitriev
2007-01-01
Full Text Available Analysis of the Over-Voltage Limiter (OVL influence on electromagnetic high-frequency over-voltages at commutations with isolators of unloaded sections of wires and possibility of application of a frequency-dependent resistor in case of necessity to facilitate OVL operation conditions is provided in the paper.It is shown that it is necessary to take into account characteristics of OVL by IEEE circuit and its modifications at computer modeling of high-frequency over-voltages.
Inductive voltage adder (IVA) for submillimeter radius electron beam
International Nuclear Information System (INIS)
Mazarakis, M.G.; Poukey, J.W.; Maenchen, J.E.
1996-01-01
The authors have already demonstrated the utility of inductive voltage adder accelerators for production of small-size electron beams. In this approach, the inductive voltage adder drives a magnetically immersed foilless diode to produce high-energy (10--20 MeV), high-brightness pencil electron beams. This concept was first demonstrated with the successful experiments which converted the linear induction accelerator RADLAC II into an IVA fitted with a small 1-cm radius cathode magnetically immersed foilless diode (RADLAC II/SMILE). They present here first validations of extending this idea to mm-scale electron beams using the SABRE and HERMES-III inductive voltage adders as test beds. The SABRE experiments are already completed and have produced 30-kA, 9-MeV electron beams with envelope diameter of 1.5-mm FWHM. The HERMES-III experiments are currently underway
Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network
DEFF Research Database (Denmark)
Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar
2013-01-01
Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...
Design of shielded voltage divider for impulse voltage measurement
International Nuclear Information System (INIS)
Kato, Shohei; Kouno, Teruya; Maruyama, Yoshio; Kikuchi, Koji.
1976-01-01
The dividers used for the study of the insulation and electric discharge phenomena in high voltage equipments have the problems of the change of response characteristics owing to adjacent bodies and of induced noise. To improve the characteristics, the enclosed type divider shielded with metal has been investigated, and the divider of excellent response has been obtained by adopting the frequency-separating divider system, which is divided into two parts, resistance divider (lower frequency region) and capacitance divider (higher frequency region), for avoiding to degrade the response. Theoretical analysis was carried out in the cases that residual inductance can be neglected or can not be neglected in the small capacitance divider, and that the connecting wires are added. Next, the structure of the divider and the design of the electric field for the divider manufactured on the basis of the theory are described. The response characteristics were measured. The results show that 1 MV impulse voltage can be measured within the response time of 10 ns. Though this divider aims at the impulse voltage, the duration time of which is about that of standard lightning impulse, in view of the heat capacity because of the input resistance of 10.5 kΩ, it is expected that the divider can be applied to the voltage of longer duration time by increasing the input resistance in future. (Wakatsuki, Y.)
Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing
International Nuclear Information System (INIS)
Patel, N.; Branch, D. W.; Cular, S.; Schamiloglu, E.
2015-01-01
A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO 3 ) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz–100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10–273 ps for DC voltages and 189–813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250–2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115–1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment
Optimum voltage of auxiliary systems for thermal and nuclear power plants
International Nuclear Information System (INIS)
Tokumitsu, Iwao; Segawa, Motomichi
1979-01-01
In the power plants in Japan, their unit power output has been greatly enhanced since the introduction of new powerful thermal power plants from 1950's to 1960's. In both thermal and nuclear power plants, 1,000 MW machines have been already in operation. The increase of unit power output results in the increase of in-plant load capacity. Of these the voltage adopted for in-plant low voltage systems is now mainly 440 V at load terminals, and the voltage for in-plant high voltage systems has been changing to 6 kV level via 3 kV and 4 kV levels. As plant capacity increases, the load of low voltage systems significantly increases, and it is required to raise the voltage of 400 V level. By the way, the low voltage in AC is specified to be not higher than 600 V. This makes the change within the above range comparatively easy. Considering these conditions, it is recommended to change the voltage for low voltage systems to 575 V at power source terminals and 550 V at load terminals. Some merits in constructing power systems and in economy by raising the voltage were examined. Though demerits are also found, they are only about 15% of total merits. The most advantageous point in raising the voltage is to be capable of increasing the supplying range to low voltage system loads. (Wakatsuki, Y.)
Development of a New Cascade Voltage-Doubler for Voltage Multiplication
Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri
2014-01-01
For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.
Directory of Open Access Journals (Sweden)
Pui-Sun Lei
2015-01-01
Full Text Available This Letter presents a low start-up voltage dc–dc converter for low-power thermoelectric systems which uses a native n-type MOS transistor as the start-up switch. The start-up voltage of the proposed converter is 300 mV and the converter does not need batteries to start up. The negative voltage control is proposed to reduce the leakage current caused by native n-type transistor and increase the efficiency. The proposed converter was designed using standard 0.18 µm CMOS process with chip size of 0.388 mm^2. The peak efficiency is 63% at load current of 1.5 mA. The proposed converter provides output voltage >1 V at maximum load current of 3.2 mA.
Suppressing voltage transients in high voltage power supplies
International Nuclear Information System (INIS)
Lickel, K.F.; Stonebank, R.
1979-01-01
A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)
Design of high voltage power supply of miniature X-ray tube based on resonant Royer
International Nuclear Information System (INIS)
Liu Xiyao; Zeng Guoqiang; Tan Chengjun; Luo Qun; Gong Chunhui; Huang Rui
2013-01-01
Background: In recent years, X rays are widely used in various fields. With the rapid development of national economy, the demand of high quality, high reliability, and high stability miniature X-ray tube has grown rapidly. As an important core component of miniature X-ray tube, high voltage power supply has attracted wide attention. Purpose: To match miniature, the high voltage power supply should be small, lightweight, good quality, etc. Based on the basic performance requirements of existing micro-X-ray tube high voltage power supply, this paper designs an output from 0 to -30 kV adjustable miniature X-ray tube voltage DC power supply. Compared to half-bridge and full-bridge switching-mode power supply, its driving circuit is simple. With working on the linear condition, it has no switching noise. Methods: The main circuit makes use of DC power supply to provide the energy. The resonant Royer circuit supplies sine wave which drives to the high frequency transformer's primary winding with resultant sine-like high voltage appearing across the secondary winding. Then, the voltage doubling rectifying circuit would achieve further boost. In the regulator circuit, a feedback control resonant transistor base current is adopted. In order to insulate air, a silicone rubber is used for high pressure part packaging, and the output voltage is measured by the dividing voltage below -5 kV. Results: The stability of circuit is better than 0.2%/6 h and the percent of the output ripple voltage is less than 0.3%. Keeping the output voltage constant, the output current can reach 57 μA by changing the size of load resistor. This high voltage power supply based on resonant Royer can meet the requirement of miniature X-ray tube. Conclusions: The circuit can satisfy low noise, low ripple, low power and high voltage regulator power supply design. However, its efficiency is not high enough because of the linear condition. In the next design, to further reduce power consumption, we
High linearity current communicating passive mixer employing a simple resistor bias
International Nuclear Information System (INIS)
Liu Rongjiang; Guo Guiliang; Yan Yuepeng
2013-01-01
A high linearity current communicating passive mixer including the mixing cell and transimpedance amplifier (TIA) is introduced. It employs the resistor in the TIA to reduce the source voltage and the gate voltage of the mixing cell. The optimum linearity and the maximum symmetric switching operation are obtained at the same time. The mixer is implemented in a 0.25 μm CMOS process. The test shows that it achieves an input third-order intercept point of 13.32 dBm, conversion gain of 5.52 dB, and a single sideband noise figure of 20 dB. (semiconductor integrated circuits)
Ko, Sangwon
2012-03-21
Conjugated polymers with nearly planar backbones have been the most commonly investigated materials for organic-based electronic devices. More twisted polymer backbones have been shown to achieve larger open-circuit voltages in solar cells, though with decreased short-circuit current densities. We systematically impose twists within a family of poly(hexylthiophene)s and examine their influence on the performance of polymer:fullerene bulk heterojunction (BHJ) solar cells. A simple chemical modification concerning the number and placement of alkyl side chains along the conjugated backbone is used to control the degree of backbone twisting. Density functional theory calculations were carried out on a series of oligothiophene structures to provide insights on how the sterically induced twisting influences the geometric, electronic, and optical properties. Grazing incidence X-ray scattering measurements were performed to investigate how the thin-film packing structure was affected. The open-circuit voltage and charge-transfer state energy of the polymer:fullerene BHJ solar cells increased substantially with the degree of twist induced within the conjugated backbone-due to an increase in the polymer ionization potential-while the short-circuit current decreased as a result of a larger optical gap and lower hole mobility. A controlled, moderate degree of twist along the poly(3,4-dihexyl-2,2′:5′,2′′- terthiophene) (PDHTT) conjugated backbone led to a 19% enhancement in the open-circuit voltage (0.735 V) vs poly(3-hexylthiophene)-based devices, while similar short-circuit current densities, fill factors, and hole-carrier mobilities were maintained. These factors resulted in a power conversion efficiency of 4.2% for a PDHTT:[6,6]-phenyl-C 71-butyric acid methyl ester (PC 71BM) blend solar cell without thermal annealing. This simple approach reveals a molecular design avenue to increase open-circuit voltage while retaining the short-circuit current. © 2012 American
Ko, Sangwon; Hoke, Eric T; Pandey, Laxman; Hong, Sanghyun; Mondal, Rajib; Risko, Chad; Yi, Yuanping; Noriega, Rodrigo; McGehee, Michael D; Brédas, Jean-Luc; Salleo, Alberto; Bao, Zhenan
2012-03-21
Conjugated polymers with nearly planar backbones have been the most commonly investigated materials for organic-based electronic devices. More twisted polymer backbones have been shown to achieve larger open-circuit voltages in solar cells, though with decreased short-circuit current densities. We systematically impose twists within a family of poly(hexylthiophene)s and examine their influence on the performance of polymer:fullerene bulk heterojunction (BHJ) solar cells. A simple chemical modification concerning the number and placement of alkyl side chains along the conjugated backbone is used to control the degree of backbone twisting. Density functional theory calculations were carried out on a series of oligothiophene structures to provide insights on how the sterically induced twisting influences the geometric, electronic, and optical properties. Grazing incidence X-ray scattering measurements were performed to investigate how the thin-film packing structure was affected. The open-circuit voltage and charge-transfer state energy of the polymer:fullerene BHJ solar cells increased substantially with the degree of twist induced within the conjugated backbone--due to an increase in the polymer ionization potential--while the short-circuit current decreased as a result of a larger optical gap and lower hole mobility. A controlled, moderate degree of twist along the poly(3,4-dihexyl-2,2':5',2''-terthiophene) (PDHTT) conjugated backbone led to a 19% enhancement in the open-circuit voltage (0.735 V) vs poly(3-hexylthiophene)-based devices, while similar short-circuit current densities, fill factors, and hole-carrier mobilities were maintained. These factors resulted in a power conversion efficiency of 4.2% for a PDHTT:[6,6]-phenyl-C(71)-butyric acid methyl ester (PC(71)BM) blend solar cell without thermal annealing. This simple approach reveals a molecular design avenue to increase open-circuit voltage while retaining the short-circuit current.
Buttram, M.T.; Ginn, J.W.
1988-06-21
A linear induction accelerator includes a plurality of adder cavities arranged in a series and provided in a structure which is evacuated so that a vacuum inductance is provided between each adder cavity and the structure. An energy storage system for the adder cavities includes a pulsed current source and a respective plurality of bipolar converting networks connected thereto. The bipolar high-voltage, high-repetition-rate square pulse train sets and resets the cavities. 4 figs.
The Linearity of Optical Tomography: Sensor Model and Experimental Verification
Directory of Open Access Journals (Sweden)
Siti Zarina MOHD. MUJI
2011-09-01
Full Text Available The aim of this paper is to show the linearization of optical sensor. Linearity of the sensor response is a must in optical tomography application, which affects the tomogram result. Two types of testing are used namely, testing using voltage parameter and testing with time unit parameter. For the former, the testing is by measuring the voltage when the obstacle is placed between transmitter and receiver. The obstacle diameters are between 0.5 until 3 mm. The latter is also the same testing but the obstacle is bigger than the former which is 59.24 mm and the testing purpose is to measure the time unit spend for the ball when it cut the area of sensing circuit. Both results show a linear relation that proves the optical sensors is suitable for process tomography application.
Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.
Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J
2017-10-01
Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.
Polarized electron sources for linear colliders
International Nuclear Information System (INIS)
Clendenin, J.E.; Ecklund, S.D.; Miller, R.H.; Schultz, D.C.; Sheppard, J.C.
1992-07-01
Linear colliders require high peak current beams with low duty factors. Several methods to produce polarized e - beams for accelerators have been developed. The SLC, the first linear collider, utilizes a photocathode gun with a GaAs cathode. Although photocathode sources are probably the only practical alternative for the next generation of linear colliders, several problems remain to be solved, including high voltage breakdown which poisons the cathode, charge limitations that are associated with the condition of the semiconductor cathode, and a relatively low polarization of ≤5O%. Methods to solve or at least greatly reduce the impact of each of these problems are at hand
Reduced Voltage Scaling in Clock Distribution Networks
Directory of Open Access Journals (Sweden)
Khader Mohammad
2009-01-01
Full Text Available We propose a novel circuit technique to generate a reduced voltage swing (RVS signals for active power reduction on main buses and clocks. This is achieved without performance degradation, without extra power supply requirement, and with minimum area overhead. The technique stops the discharge path on the net that is swinging low at a certain voltage value. It reduces active power on the target net by as much as 33% compared to traditional full swing signaling. The logic 0 voltage value is programmable through control bits. If desired, the reduced-swing mode can also be disabled. The approach assumes that the logic 0 voltage value is always less than the threshold voltage of the nMOS receivers, which eliminate the need of the low to high voltage translation. The reduced noise margin and the increased leakage on the receiver transistors using this approach have been addressed through the selective usage of multithreshold voltage (MTV devices and the programmability of the low voltage value.
Energy Technology Data Exchange (ETDEWEB)
Sellner, Bernhard; Kathmann, Shawn M., E-mail: Shawn.Kathmann@pnnl.gov [Physical Sciences Division, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)
2014-11-14
Voltages inside matter are relevant to crystallization, materials science, biology, catalysis, and aqueous chemistry. The variation of voltages in matter can be measured by experiment, however, modern supercomputers allow the calculation of accurate quantum voltages with spatial resolutions of bulk systems well beyond what can currently be measured provided a sufficient level of theory is employed. Of particular interest is the Mean Inner Potential (V{sub o}) – the spatial average of these quantum voltages referenced to the vacuum. Here we establish a protocol to reliably evaluate V{sub o} from quantum calculations. Voltages are very sensitive to the distribution of electrons and provide metrics to understand interactions in condensed phases. In the present study, we find excellent agreement with measurements of V{sub o} for vitrified water and salt crystals and demonstrate the impact of covalent and ionic bonding as well as intermolecular/atomic interactions. Certain aspects in this regard are highlighted making use of simple model systems/approximations. Furthermore, we predict V{sub o} as well as the fluctuations of these voltages in aqueous NaCl electrolytes and characterize the changes in their behavior as the resolution increases below the size of atoms.
Modification of Modulating Anode Voltage Supply of Klystron for PEFP 20 MeV Linac
International Nuclear Information System (INIS)
Kim, Dae Il; Kwon, Hyeok Jung; Kim, Han Sung; Cho, Yong Sub
2011-01-01
The klystron (TH2089F, THALES) for PEFP 20MeV proton linear accelerator has a triode type electron gun and the modulating anode voltage should be supplied. The klystron has gone through some modification in the modulating anode voltage supply circuit. Formerly, the mod-anode voltage was supplied by using the tetrode-controlled voltage divider. This system requires addition power supply for the tetrode and the grid control circuit. Recently we modified the mod-anode supply from the tetrode-controlled voltage divider to a resistive voltage divider. The resistors for the previous voltage divider were installed at a supporter with high voltage bushing structure next to the klystron. In the previous system, the resistors were exposed to the air and their size was very bulky, length of which was about 1m long. To reduce the space occupied by the voltage divider and to improve the electrical insulation performance, the voltage dividing resistors were moved into the oil tank of the klystron. During the operation of the 20 MeV linac, the klystron parameters were measured. In this paper, the modification of the voltage divider and the operational characteristics of the klystron with modified voltage divider circuit are presented
Design and performance testing of an ultrasonic linear motor with dual piezoelectric actuators.
Smithmaitrie, Pruittikorn; Suybangdum, Panumas; Laoratanakul, Pitak; Muensit, Nantakan
2012-05-01
In this work, design and performance testing of an ultrasonic linear motor with dual piezoelectric actuator patches are studied. The motor system consists of a linear stator, a pre-load weight, and two piezoelectric actuator patches. The piezoelectric actuators are bonded with the linear elastic stator at specific locations. The stator generates propagating waves when the piezoelectric actuators are subjected to harmonic excitations. Vibration characteristics of the linear stator are analyzed and compared with finite element and experimental results. The analytical, finite element, and experimental results show agreement. In the experiments, performance of the ultrasonic linear motor is tested. Relationships between velocity and pre-load weight, velocity and applied voltage, driving force and applied voltage, and velocity and driving force are reported. The design of the dual piezoelectric actuators yields a simpler structure with a smaller number of actuators and lower stator stiffness compared with a conventional design of an ultrasonic linear motor with fully laminated piezoelectric actuators.
Transient voltage sharing in series-coupled high voltage switches
Directory of Open Access Journals (Sweden)
Editorial Office
1992-07-01
Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analysis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus occurs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.
Shi, Ji-Lei; Zhang, Jie-Nan; He, Min; Zhang, Xu-Dong; Yin, Ya-Xia; Li, Hong; Guo, Yu-Guo; Gu, Lin; Wan, Li-Jun
2016-08-10
Li-rich layered materials have been considered as the most promising cathode materials for future high-energy-density lithium-ion batteries. However, they suffer from severe voltage decay upon cycling, which hinders their further commercialization. Here, we report a Li-rich layered material 0.5Li2MnO3·0.5LiNi0.8Co0.1Mn0.1O2 with high nickel content, which exhibits much slower voltage decay during long-term cycling compared to conventional Li-rich materials. The voltage decay after 200 cycles is 201 mV. Combining in situ X-ray diffraction (XRD), ex situ XRD, ex situ X-ray photoelectron spectroscopy, and scanning transmission electron microscopy, we demonstrate that nickel ions act as stabilizing ions to inhibit the Jahn-Teller effect of active Mn(3+) ions, improving d-p hybridization and supporting the layered structure as a pillar. In addition, nickel ions can migrate between the transition-metal layer and the interlayer, thus avoiding the formation of spinel-like structures and consequently mitigating the voltage decay. Our results provide a simple and effective avenue for developing Li-rich layered materials with mitigated voltage decay and a long lifespan, thereby promoting their further application in lithium-ion batteries with high energy density.
DEFF Research Database (Denmark)
Liu, Changjin; Xu, Dehong; Zhu, Nan
2013-01-01
Unbalanced grid voltage causes a large second-order harmonic current in the dc-link capacitors as well as dc-voltage fluctuation, which potentially will degrade the lifespan and reliability of the capacitors in voltage source converters. This paper proposes a novel dc-capacitor current control...... method for a grid-side converter (GSC) to eliminate the negative impact of unbalanced grid voltage on the dc-capacitors. In this method, a dc-capacitor current control loop, where a negative-sequence resonant controller is used to increase the loop gain, is added to the conventional GSC current control...... loop. The rejection capability to the unbalanced grid voltage and the stability of the proposed control system are discussed. The second-order harmonic current in the dc capacitor as well as dc-voltage fluctuation is very well eliminated. Hence, the dc capacitors will be more reliable under unbalanced...
Passive longitudinal phase space linearizer
Directory of Open Access Journals (Sweden)
P. Craievich
2010-03-01
Full Text Available We report on the possibility to passively linearize the bunch compression process in electron linacs for the next generation x-ray free electron lasers. This can be done by using the monopole wakefields in a dielectric-lined waveguide. The optimum longitudinal voltage loss over the length of the bunch is calculated in order to compensate both the second-order rf time curvature and the second-order momentum compaction terms. Thus, the longitudinal phase space after the compression process is linearized up to a fourth-order term introduced by the convolution between the bunch and the monopole wake function.
A High Power Linear Solid State Pulser
International Nuclear Information System (INIS)
Boris Yen; Brent Davis; Rex Booth
1999-01-01
Particle Accelerators require high voltage and often high power. Typically the high voltage/power generation utilizes a topology with an extra energy store and a switching means to extract that stored energy. The switches may be active or passive devices. Active switches are hard or soft vacuum tubes, or semiconductors. When required voltages exceed tens of kilovolts, numerous semiconductors are stacked to withstand that potential. Such topologies can use large numbers of critical parts that, when in series, compromise the system reliability and performance. This paper describes a modular, linear, solid state amplifier which uses a parallel array of semiconductors, coupled with transmission line transformers. Such a design can provide output signals with voltages exceeding 10kV (into 50-ohms), and with rise and fall times (10-90 % amplitude) that are less than 1--ns. This compact solid state amplifier is modular, and has both hot-swap and soft fail capabilities
Considering system non-linearity in transmission pricing
International Nuclear Information System (INIS)
Oloomi-Buygi, M.; Salehizadeh, M. Reza
2008-01-01
In this paper a new approach for transmission pricing is presented. The contribution of a contract on power flow of a transmission line is used as extent-of-use criterion for transmission pricing. In order to determine the contribution of each contract on power flow of each transmission line, first the contribution of each contract on each voltage angle is determined, which is called voltage angle decomposition. To this end, DC power flow is used to compute a primary solution for voltage angle decomposition. To consider the impacts of system non-linearity on voltage angle decomposition, a method is presented to determine the share of different terms of sine argument in sine value. Then the primary solution is corrected in different iterations of decoupled Newton-Raphson power flow using the presented sharing method. The presented approach is applied to a 4-bus test system and IEEE 30-bus test system and the results are analyzed. (author)
Optimal dynamic voltage scaling for wireless sensor nodes with real-time constraints
Cassandras, Christos G.; Zhuang, Shixin
2005-11-01
Sensors are increasingly embedded in manufacturing systems and wirelessly networked to monitor and manage operations ranging from process and inventory control to tracking equipment and even post-manufacturing product monitoring. In building such sensor networks, a critical issue is the limited and hard to replenish energy in the devices involved. Dynamic voltage scaling is a technique that controls the operating voltage of a processor to provide desired performance while conserving energy and prolonging the overall network's lifetime. We consider such power-limited devices processing time-critical tasks which are non-preemptive, aperiodic and have uncertain arrival times. We treat voltage scaling as a dynamic optimization problem whose objective is to minimize energy consumption subject to hard or soft real-time execution constraints. In the case of hard constraints, we build on prior work (which engages a voltage scaling controller at task completion times) by developing an intra-task controller that acts at all arrival times of incoming tasks. We show that this optimization problem can be decomposed into two simpler ones whose solution leads to an algorithm that does not actually require solving any nonlinear programming problems. In the case of soft constraints, this decomposition must be partly relaxed, but it still leads to a scalable (linear in the number of tasks) algorithm. Simulation results are provided to illustrate performance improvements in systems with intra-task controllers compared to uncontrolled systems or those using inter-task control.
A structured approach to increase situational awareness in low voltage distribution grids
Helmholt, K.A.; Groote Schaarsberg, M.; Broersma, T.; Morren, J.; Kruizinga, B.; Wouters, P.A.A.F.; Steennis, E.F.; Baldinger, F.
2015-01-01
Wear and tear, electrification and aging of (low voltage) distribution grids require maintenance in order to assure continuous provision of electricity. Situational awareness is required to find out when parts of the grid need maintenance and which parts should be prioritized. The paper proposes a
Power conditioning using dynamic voltage restorers under different voltage sag types.
Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A
2016-01-01
Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.
Directory of Open Access Journals (Sweden)
C. Muñiz-Montero
2013-06-01
Full Text Available A Membership Function Generator Circuit (MFGC with bias supply of 1.5 Volts and independent DC-voltage programmable functionalities is presented. The realization is based on a programmable differential current mirror and three compact voltage-to-current converters, allowing continuous and quasi-linear adjustment of the center position, height, width and slopes of the triangular/trapezoidal output waveforms. HSPICE simulation results of the proposed circuit using the parameters of a double-poly, three metal layers, 0.5 μm CMOS technology validate the functionality of the proposed architecture, which exhibits a maximum deviation of the linearity in the programmability of 7 %.
Voltage-carrying states in superconducting microstrips
International Nuclear Information System (INIS)
Stuivinga, M.E.C.
1983-01-01
When the critical current is exceeded in a superconducting microstrip, voltage-carrying states with a resistance significantly below the normal state resistance can occur. Phase-slip centers (PSC) appear at about the critical temperature. These are successive local voltage units which manifest themselves as strip-like increments in voltage in the I-V characteristic. For temperatures off the critical temperature the PSC regime degenerates into a region of normal material, a so-called hot spot. These two phenomena, PSC and hot spots, form the subject of this thesis. To gain a better understanding of the phase-slip center process, an experiment was designed to measure local values of the quasi-particle and pair potential. The results of local potential and gap measurements at a PSC in aluminium are presented and discussed. Special attention is paid to pair-breaking interactions which can shorten the relaxation time. A non-linear differential equation is derived which describes the development of a PSC into a normal hot spot under the influence of Joule heating. It incorporates the temperature rise due to the dissipative processes occurring in the charge imbalance tails. Numerical solutions are presented for a set of parameters, including those for aluminium and tin. Subsequently, they are compared with experiments. (Auth.)
Mitigation of voltage sags in the distribution system with dynamic voltage restorer
International Nuclear Information System (INIS)
Viglas, D.; Belan, A.
2012-01-01
Dynamic voltage restorer is a custom power device that is used to improve voltage sags or swells in electrical distribution system. The components of the Dynamic Voltage Restorer consist of injection transformers, voltage source inverter, passive filters and energy storage. The main function of the Dynamic voltage restorer is used to inject three phase voltage in series and in synchronism with the grid voltages in order to compensate voltage disturbances. This article deals with mitigation of voltage sags caused by three-phase short circuit. Dynamic voltage restorer is modelled in MATLAB/Simulink. (Authors)
Control system analysis for the perturbed linear accelerator rf system
Sung Il Kwon
2002-01-01
This paper addresses the modeling problem of the linear accelerator RF system in SNS. Klystrons are modeled as linear parameter varying systems. The effect of the high voltage power supply ripple on the klystron output voltage and the output phase is modeled as an additive disturbance. The cavity is modeled as a linear system and the beam current is modeled as the exogenous disturbance. The output uncertainty of the low level RF system which results from the uncertainties in the RF components and cabling is modeled as multiplicative uncertainty. Also, the feedback loop uncertainty and digital signal processing signal conditioning subsystem uncertainties are lumped together and are modeled as multiplicative uncertainty. Finally, the time delays in the loop are modeled as a lumped time delay. For the perturbed open loop system, the closed loop system performance, and stability are analyzed with the PI feedback controller.
CONTROL SYSTEM ANALYSIS FOR THE PERTURBED LINEAR ACCELERATOR RF SYSTEM
International Nuclear Information System (INIS)
SUNG-IL KWON; AMY H. REGAN
2002-01-01
This paper addresses the modeling problem of the linear accelerator RF system in SNS. Klystrons are modeled as linear parameter varying systems. The effect of the high voltage power supply ripple on the klystron output voltage and the output phase is modeled as an additive disturbance. The cavity is modeled as a linear system and the beam current is modeled as the exogenous disturbance. The output uncertainty of the low level RF system which results from the uncertainties in the RF components and cabling is modeled as multiplicative uncertainty. Also, the feedback loop uncertainty and digital signal processing signal conditioning subsystem uncertainties are lumped together and are modeled as multiplicative uncertainty. Finally, the time delays in the loop are modeled as a lumped time delay. For the perturbed open loop system, the closed loop system performance, and stability are analyzed with the PI feedback controller
Linear Model for Optimal Distributed Generation Size Predication
Directory of Open Access Journals (Sweden)
Ahmed Al Ameri
2017-01-01
Full Text Available This article presents a linear model predicting optimal size of Distributed Generation (DG that addresses the minimum power loss. This method is based fundamentally on strong coupling between active power and voltage angle as well as between reactive power and voltage magnitudes. This paper proposes simplified method to calculate the total power losses in electrical grid for different distributed generation sizes and locations. The method has been implemented and tested on several IEEE bus test systems. The results show that the proposed method is capable of predicting approximate optimal size of DG when compared with precision calculations. The method that linearizes a complex model showed a good result, which can actually reduce processing time required. The acceptable accuracy with less time and memory required can help the grid operator to assess power system integrated within large-scale distribution generation.
Voltage generators of high voltage high power accelerators
International Nuclear Information System (INIS)
Svinin, M.P.
1981-01-01
High voltage electron accelerators are widely used in modern radiation installations for industrial purposes. In the near future further increasing of their power may be effected, which enables to raise the efficiency of the radiation processes known and to master new power-consuming production in industry. Improvement of HV generators by increasing their power and efficiency is one of many scientific and engineering aspects the successful solution of which provides further development of these accelerators and their technical parameters. The subject is discussed in detail. (author)
Cross-sectional area of the murine aorta linearly increases with increasing core body temperature.
Crouch, A Colleen; Manders, Adam B; Cao, Amos A; Scheven, Ulrich M; Greve, Joan M
2017-11-06
The cardiovascular (CV) system plays a vital role in thermoregulation. To date, the response of core vasculature to increasing core temperature has not been adequately studied in vivo. Our objective was to non-invasively quantify the arterial response in murine models due to increases in body temperature, with a focus on core vessels of the torso and investigate whether responses were dependent on sex or age. Male and female, adult and aged mice were anaesthetised and underwent magnetic resonance imaging (MRI). Data were acquired from the circle of Willis (CoW), heart, infrarenal aorta and peripheral arteries at core temperatures of 35, 36, 37 and 38 °C (±0.2 °C). Vessels in the CoW did not change. Ejection fraction decreased and cardiac output (CO) increased with increasing temperature in adult female mice. Cross-sectional area of the aorta increased significantly and linearly with temperature for all groups, but at a diminished rate for aged animals (p temperature are biologically important because they may affect conductive and convective heat transfer. Leveraging non-invasive methodology to quantify sex and age dependent vascular responses due to increasing core temperature could be combined with bioheat modelling in order to improve understanding of thermoregulation.
2005-01-01
A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional
DEFF Research Database (Denmark)
Liu, Wenzhao; Tarasiuk, Tomasz; Gorniak, Mariusz
2018-01-01
were proposed and carried out in a real ship under sea-going conditions to address this problem. The ship experimental results were presented and discussed considering non-linear bow thruster load and high power ballast pump loads under unbalanced and harmonic voltage conditions. In addition......, the analysis of voltage transient dips during ballast pump starting up is presented. Further, the voltage/current distortions of working generator, bow thruster and pump loads are analyzed. The paper provides a valuable analysis for coping with PQ issues in the real ship power system....
Kim, Jae-Chang; Moon, Sung-Ki; Kwak, Sangshin
2018-04-01
This paper presents a direct model-based predictive control scheme for voltage source inverters (VSIs) with reduced common-mode voltages (CMVs). The developed method directly finds optimal vectors without using repetitive calculation of a cost function. To adjust output currents with the CMVs in the range of -Vdc/6 to +Vdc/6, the developed method uses voltage vectors, as finite control resources, excluding zero voltage vectors which produce the CMVs in the VSI within ±Vdc/2. In a model-based predictive control (MPC), not using zero voltage vectors increases the output current ripples and the current errors. To alleviate these problems, the developed method uses two non-zero voltage vectors in one sampling step. In addition, the voltage vectors scheduled to be used are directly selected at every sampling step once the developed method calculates the future reference voltage vector, saving the efforts of repeatedly calculating the cost function. And the two non-zero voltage vectors are optimally allocated to make the output current approach the reference current as close as possible. Thus, low CMV, rapid current-following capability and sufficient output current ripple performance are attained by the developed method. The results of a simulation and an experiment verify the effectiveness of the developed method.
An efficient high-voltage power supply for a photomultiplier tube
Ainutdinov, VM; Vonsovskii, NN; Kompaniets, KG; Kozyr, AI; Mikhailov, YV
2003-01-01
An adjustable power supply for a photomultiplier tube operating in the pulsed spectrometric mode with a wide range of linearity is described. The power consumed by the source is 50 mW. The output voltage is varied from 800 to 2000 V. The maximum ripple amplitude is 2.5 mV.
Study on the construction and its operating characteristics of Marx high voltage pulse generator
International Nuclear Information System (INIS)
Chung, W.K.; Yook, C.C.
1984-01-01
This study is to investigate the operating characteristics of a Marx high voltage pulse generator, which is designed and fabricated for the purpose of constructing a linear theta-pinch plasma generating facility. The Marx generator consists of a 2 kJ capacitor bank of maximum output voltage of 200kV, a set of main spark switch, a triggring system, and high voltage charging power supply. The experimental results show that the operating characteristics of the generator can be controlled through varying nitrogen pressure as a filling gas. The output pulse of the generator is achieved close to the estimated voltage with the rise time of 3*m seconds. The stability of the generator is also very satisfactory within operating range of main spark switch. (Author)
Directory of Open Access Journals (Sweden)
Stanković Koviljka
2009-01-01
Full Text Available The wide-spread use of semiconductor and gas-filled diodes for non-linear over-voltage protection results in a variety of possible working conditions. It is therefore essential to have a thorough insight into their reliability in exploitation environments which imply exposure to ionizing radiation. The aim of this paper is to investigate the influence of irradiation on over-voltage diode characteristics by exposing the diodes to californium-252 combined neutron/gamma radiation field. The irradiation of semiconductor over-voltage diodes causes severe degradation of their protection characteristics. On the other hand, gas-filled over-voltage diodes exhibit a temporal improvement of performance. The results are presented with the accompanying theoretical interpretations of the observed changes in over-voltage diode behaviour, based on the interaction of radiation with materials constituting the diodes.
Effect of neutron irradiation on the breakdown voltage of power MOSFET's
International Nuclear Information System (INIS)
Hasan, S.M.Y.; Kosier, S.L.; Schrimpf, R.D.; Galloway, K.F.
1994-01-01
The effect of neutron irradiation on power metal-oxide-semiconductor field effect transistor (power MOSFET) breakdown voltage has been investigated. Transistors with various breakdown voltage ratings were irradiated in a TRIGA nuclear reactor with cumulative fluence levels up to 5 x 10 14 neutrons/cm 2 (1 MeV equivalent). Noticeable increases in the breakdown voltages are observed in n-type MOSFET's after 10 13 neutrons/cm 2 and in p-type MOSFETs after 10 12 neutrons/cm 2 . An increase in breakdown voltage of as much as 30% is observed after 5 x 10 14 neutrons/cm 2 . The increase in breakdown voltage is attributed to the neutron-irradiation-induced defects which decrease the mean free path and trap majority carriers in the space charge region. The effect of positive trapped oxide charge due to concomitant gamma radiation and the effect of the termination structure on the increase in breakdown voltage are considered. An empirical model is presented to predict the value of the breakdown voltage as a function of neutron fluence
Extrinsic contribution to the non-linearity in a PZT disc
Energy Technology Data Exchange (ETDEWEB)
Perez, Rafel [Departament de Fisica Aplicada, Universitat Politecnica de Catalunya, Jordi Girona 1-3, Campus Nord, 08034 Barcelona (Spain); Albareda, Alfons [Departament de Fisica Aplicada, Universitat Politecnica de Catalunya, Jordi Girona 1-3, Campus Nord, 08034 Barcelona (Spain); Garcia, Jose E [Departament de Fisica Aplicada, Universitat Politecnica de Catalunya, Jordi Girona 1-3, Campus Nord, 08034 Barcelona (Spain); Tiana, Jordi [Departament de Fisica Aplicada, Universitat Politecnica de Catalunya, Jordi Girona 1-3, Campus Nord, 08034 Barcelona (Spain); Ringgaard, Erling [Ferroperm Piezoceramics A/S, Hejreskovvej 18, DK-3490 Kvistgaard (Denmark); Wolny, Wanda W [Ferroperm Piezoceramics A/S, Hejreskovvej 18, DK-3490 Kvistgaard (Denmark)
2004-10-07
Non-linear increases in elastic, piezoelectric (direct and reverse) and dielectric coefficients have been measured under a high electrical field or under high mechanical stress. The permittivity and reverse piezoelectric coefficient can be measured by applying a high voltage at a low frequency, while the elastic compliance and direct piezoelectric coefficient can be measured at the first radial resonance frequency in order to apply a high stress. The non-linear behaviour has been analysed at the radial resonance of a disc. In all the materials tested, the results show that there is a close relation between the non-linear increments of the different coefficients. An empirical model has been proposed in order to describe and understand these relations. It is assumed that either the strain or the electrical displacement is produced by intrinsic and extrinsic processes, but only the latter, which consist mainly in the motion of domain walls, contribute to the non-linearity. The model enables us to find the domain wall contribution to elastic, piezoelectric and dielectric non-linearities, and allows us to compare the amplitudes of the fields and stresses that produce the same displacement of domain walls.
A simple method to increase effective PMT gain by amplifier circuit powered from voltage divider
International Nuclear Information System (INIS)
Popov, V.; Majewski, S.; Wojtsekhowski, B.; Guerin, D
2001-01-01
A novel concept is introduced of additional effective signal amplification by employing a dedicated circuit to process anode or dynode signals prior to sending them through a standard 50 /spl Omega/ line/cable. The circuit is entirely powered by the current flowing through the base voltage divider. Additional gain factors of 2-10 were easily achieved with preserved operation speed and rate capability up to several MHz. This additional signal boost can be used in many applications where higher gain and/or lower PMT operational voltages are desirable. For example, in the case of a PMT employed in a low input light signal (such as a Cherenkov counter), this technique will permit operation at a lower voltage and, therefore, will result in better operational PMT stability and longer PMT lifetime. At present, two experimental set-ups at Jefferson Lab are using PMT bases using this concept
Directory of Open Access Journals (Sweden)
Yongchun Yang
2018-04-01
Full Text Available The modular multilevel converter (MMC, as a new type of voltage source converter, is increasingly used because it is a distributed storage system. There are many advantages of using the topological structure of the MMC on a unified power quality controller (UPQC, and voltage sag mitigation is an important use of the MMC energy storage system for the power quality compensation process. In this paper, based on the analysis of the topology of the MMC, the essence of energy conversion in a UPQC of voltage sag compensation is analyzed; then, the energy storage characteristics are calculated and analyzed to determine the performance index of voltage sag compensation; in addition, the simulation method is used to verify the voltage sag compensation characteristics of the UPQC; finally, an industrial prototype of the UPQC based on an MMC for 10 kV of medium voltage distribution network has been developed, and the basic functions of UPQC have been tested.
Ion peak narrowing by applying additional AC voltage (ripple voltage) to FAIMS extractor electrode.
Pervukhin, Viktor V; Sheven, Dmitriy G
2010-01-01
The use of a non-uniform electric field in a high-field asymmetric waveform ion mobility spectrometry (FAIMS) analyzer increases sensitivity but decreases resolution. The application of an additional AC voltage to the extractor electrode ("ripple" voltage, U(ripple)) can overcome this effect, which decreases the FAIMS peak width. In this approach, the diffusion ion loss remains minimal in the non-uniform electric field in the cylindrical part of the device, and all ion losses under U(ripple) occur in a short portion of their path. Application of the ripple voltage to the extractor electrode is twice as efficient as the applying of U(ripple) along the total length of the device. 2010 American Society for Mass Spectrometry. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Mohammad Hosein Rezaei
2011-10-01
Full Text Available Transformers perform many functions such as voltage transformation, isolation and noise decoupling. They are indispensable components in electric power distribution system. However, at low frequencies (50 Hz, they are one of the heaviest and the most expensive equipment in an electrical distribution system. Nowadays, electronic power transformers are used instead of conventional power transformers that do voltage transformation and power delivery in power system by power electronic converter. In this paper, the structure of distribution electronic power transformer (DEPT are analized and then paid attention on the design of a linear-quadratic-regulator (LQR with integral action to improve dynamic performance of DEPT with voltage unbalance, voltage sags, voltage harmonics and voltage flicker. The presentation control strategy is simulated by MATLAB/SIMULINK. In addition, the results that are in terms of dc-link reference voltage, input and output voltages clearly show that a better dynamic performance can be achieved by using the LQR method when compared to other techniques.
Directory of Open Access Journals (Sweden)
Renke Han
2014-01-01
Full Text Available It is a very crucial problem to make a microgrid operated reasonably and stably. Considering the nonlinear mathematics model of inverter established in this paper, the input-output feedback linearization method is used to transform the nonlinear mathematics model of inverters to a linear tracking synchronization and consensus regulation control problem. Based on the linear mathematics model and multiagent consensus algorithm, a decentralized coordinated controller is proposed to make amplitudes and angles of voltages from inverters be consensus and active and reactive power shared in the desired ratio. The proposed control is totally distributed because each inverter only requires local and one neighbor’s information with sparse communication structure based on multiagent system. The hybrid consensus algorithm is used to keep the amplitude of the output voltages following the leader and the angles of output voltage as consensus. Then the microgrid can be operated more efficiently and the circulating current between DGs can be effectively suppressed. The effectiveness of the proposed method is proved through simulation results of a typical microgrid system.
based dynamic voltage restorer
African Journals Online (AJOL)
HOD
operation due to presence of increased use of nonlinear loads (computers, microcontrollers ... simulations of a dynamic voltage restorer (DVR) was achieved using MATLAB/Simulink. ..... using Discrete PWM generator, then the IGBT inverter.
International Nuclear Information System (INIS)
He Su-Ming; Wang Jin-Bin; Luo Xiang-Dong; Zhang Bo; Fu Lei; Cheng Li-Wen; Lu Wei
2012-01-01
The junction temperature of red, green and blue high power light emitting diodes (LEDs) is measured by using the emission peak shift method and the forward voltage method. Both the emission peak shift and the forward voltage decrease show a linear relationship relative to junction temperature. The linear coefficients of the red, green and blue LEDs for the peak shift method and the forward voltage method range from 0.03 to 0.15 nm/°C and from 1.33 to 3.59 mV/°C, respectively. Compared with the forward voltage method, the peak shift method is almost independent of bias current and sample difference. The variation of the slopes is less than 2% for the peak shift method and larger than 30% for the forward voltage method, when the LEDs are driven by different bias currents. It is indicated that the peak shift method gives better stability than the forward voltage method under different LED working conditions
Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.
Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan
2018-04-18
Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.
Nonlinear electrokinetics at large voltages
Energy Technology Data Exchange (ETDEWEB)
Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu
2009-07-15
The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.
Lightning Overvoltage on Low-Voltage Distribution System
Michishita, Koji
The portion of the faults of a medium-voltage line, cause by lightning, tends to increase with often reaching beyond 30%. However, due to the recent progress of the lightning protection design, the number of faults has decreased to 1/3 of that at 30 years ago. As for the low-voltage distribution line, the fault rate has been estimated primarily, although the details of the overvoltages have not been studied yet. For the further development of highly information-oriented society, improvement of reliability of electric power supply to the appliance in a low-voltage customer will be socially expected. Therefore, it is important to establish effective lightning protection design of the low-voltage distribution system, defined to be composed of lines having mutual interaction on the customers' electric circuits, such as a low-voltage distribution line, an antenna line and a telecommunication line. In this report, the author interprets the recent research on the lightning overvoltage on a low-voltage distribution system.
International Nuclear Information System (INIS)
Lytvynenko, Ia.M.; Hauet, T.; Montaigne, F.; Bibyk, V.V.; Andrieu, S.
2015-01-01
Interplay between voltage-induced magnetic anisotropy transition and voltage-induced atomic diffusion is studied in epitaxial V/Fe (0.7 nm)/ MgO/ Fe(5 nm)/Co/Au magnetic tunnel junction where thin Fe soft electrode has in-plane or out-of-plane anisotropy depending on the sign of the bias voltage. We investigate the origin of the slow resistance variation occurring when switching bias voltage in opposite polarity. We demonstrate that the time to reach resistance stability after voltage switching is reduced when increasing the voltage amplitude or the temperature. A single energy barrier of about 0.2 eV height is deduced from temperature dependence. Finally, we demonstrate that the resistance change is not correlated to a change in soft electrode anisotropy. This conclusion contrasts with observations recently reported on analogous systems. - Highlights: • Voltage-induced time dependence of resistance is studied in epitaxial Fe/MgO/Fe. • Resistance change is not related to the bottom Fe/MgO interface. • The effect is thermally activated with an energy barrier of the order of 0.2 eV height
Wide Operating Voltage Range Fuel Cell Battery Charger
DEFF Research Database (Denmark)
Hernandez Botella, Juan Carlos; Mira Albert, Maria del Carmen; Sen, Gokhan
2014-01-01
DC-DC converters for fuel cell applications require wide voltage range operation due to the unique fuel cell characteristic curve. Primary parallel isolated boost converter (PPIBC) is a boost derived topology for low voltage high current applications reaching an efficiency figure up to 98...... by two the converter input-to-output voltage gain. This allows covering the conditions when the fuel cell stack operates in the activation region (maximum output voltage) and increases the degrees of freedom for converter optimization. The transition between operating modes is studied because represents...
Development of anode high voltage power supply system for ECRH of HL-2A tokamak
International Nuclear Information System (INIS)
Chen Wenguang
2009-01-01
The anode high voltage power supply system consist of DC high-voltage power supply (HVPS) and pulse modulator. SCR is used to vary AC input voltage of the step-up transformer by controlling the trigger phase in the HVPS, and regulate the DC output voltage linearly at the potential of low-end via BJT, Dual closed-loop control technology is applied in the controller, and its maximum output is at 30kV and 130mA. Tetrode is the core component of the modulator. The circuit design is optimized by using the simulation software. Test and HL-2A discharge experimental results show that the power supply system is designed with some characteristics of output scale widely, low ripple and modulate quickly. (authors)
Directory of Open Access Journals (Sweden)
Perić Dragoslav M.
2015-01-01
Full Text Available Switchgear for auxiliary low voltage in substations (SS of extra high voltages (EHV to high voltage (HV - SS EHV/HV kV/kV is of special interest for the functioning of these important SS, as it provides a supply for system of protection and other vital functions of SS. The article addresses several characteristic examples involving MV lines with varying degrees of independence of their supply, and the possible application of direct transformation EHV/LV through special voltage transformers. Auxiliary sources such as inverters and diesel generators, which have limited power and expensive energy, are also used for the supply of switchgear for auxiliary low voltage. Corresponding reliability indices are calculated for all examples including mean expected annual engagement of diesel generators. The applicability of certain solutions of switchgear for auxiliary low voltage SS EHV/HV, taking into account their reliability, feasibility and cost-effectiveness is analyzed too. In particular, the analysis of applications of direct transformation EHV/LV for supply of switchgear for auxiliary low voltage, for both new and existing SS EHV/HV.
Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM
2009-11-03
A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.
International Nuclear Information System (INIS)
Martin, M.
1991-01-01
Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance
Intelligent voltage control in a DC micro-grid containing PV generation and energy storage
Rouzbehi, Kumars; Miranian, Arash; Candela García, José Ignacio; Luna Alloza, Álvaro; Rodríguez Cortés, Pedro
2014-01-01
This paper proposes an intelligent control scheme for DC voltage regulationin a DC micro-grid integrating photovoltaic (PV) generation, energy storage and electric loads. The maximum power generation of the PV panel is followed using the incremental conductance (IC) maximum power point tracking (MPPT) algorithm while a high-performance local linear controller (LLC)is developed for the DC voltage control in the micro-grid.The LLC, as a data-driven control strategy, controls the bidirectional c...
Maximum permissible voltage of YBCO coated conductors
Energy Technology Data Exchange (ETDEWEB)
Wen, J.; Lin, B.; Sheng, J.; Xu, J.; Jin, Z. [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Hong, Z., E-mail: zhiyong.hong@sjtu.edu.cn [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Wang, D.; Zhou, H.; Shen, X.; Shen, C. [Qingpu Power Supply Company, State Grid Shanghai Municipal Electric Power Company, Shanghai (China)
2014-06-15
Highlights: • We examine three kinds of tapes’ maximum permissible voltage. • We examine the relationship between quenching duration and maximum permissible voltage. • Continuous I{sub c} degradations under repetitive quenching where tapes reaching maximum permissible voltage. • The relationship between maximum permissible voltage and resistance, temperature. - Abstract: Superconducting fault current limiter (SFCL) could reduce short circuit currents in electrical power system. One of the most important thing in developing SFCL is to find out the maximum permissible voltage of each limiting element. The maximum permissible voltage is defined as the maximum voltage per unit length at which the YBCO coated conductors (CC) do not suffer from critical current (I{sub c}) degradation or burnout. In this research, the time of quenching process is changed and voltage is raised until the I{sub c} degradation or burnout happens. YBCO coated conductors test in the experiment are from American superconductor (AMSC) and Shanghai Jiao Tong University (SJTU). Along with the quenching duration increasing, the maximum permissible voltage of CC decreases. When quenching duration is 100 ms, the maximum permissible of SJTU CC, 12 mm AMSC CC and 4 mm AMSC CC are 0.72 V/cm, 0.52 V/cm and 1.2 V/cm respectively. Based on the results of samples, the whole length of CCs used in the design of a SFCL can be determined.
Performance test of 100 W linear compressor
Energy Technology Data Exchange (ETDEWEB)
Ko, J; Ko, D. Y.; Park, S. J.; Kim, H. B.; Hong, Y. J.; Yeom, H. K. [Korea Institute of Machinery and Materials, Daejeon(Korea, Republic of)
2013-09-15
In this paper, we present test results of developed 100 W class linear compressor for Stirling-type pulse tube refrigerator. The fabricated linear compressor has dual-opposed configuration, free piston and moving magnet type linear motor. Power transfer, efficiency and required pressure waveform are predicted with designed and measured specifications. In experiments, room temperature test with flow impedance is conducted to evaluate performance of developed linear compressor. Flow impedance is loaded to compressor with metering valve for flow resistance, inertance tube for flow inertance and buffer volumes for flow compliance. Several operating parameters such as input voltage, current, piston displacement and pressure wave are measured for various operating frequency and fixed input current level. Behaviors of dynamics and performance of linear compressor as varying flow impedance are discussed with measured experimental results. The developed linear compressor shows 124 W of input power, 86 % of motor efficiency and 60 % of compressor efficiency at its resonant operating condition.
Coordinated control to mitigate over voltage and under voltage in LV networks
Viyathukattuva Mohamed Ali, M.M.; Nguyen, H.P.; Cobben, J.F.G.
2016-01-01
Increasing penetration of distributed renewable energy resources (DRES) and smart loads into the LV network lead to new power quality challenges. Important power quality challenges are overvoltage and undervoltage. A number of solutions are already developed to mitigate these voltage variations. In
Gómez-González, J F; Destexhe, A; Bal, T
2014-10-01
Electrophysiological recordings of single neurons in brain tissues are very common in neuroscience. Glass microelectrodes filled with an electrolyte are used to impale the cell membrane in order to record the membrane potential or to inject current. Their high resistance induces a high voltage drop when passing current and it is essential to correct the voltage measurements. In particular, for voltage clamping, the traditional alternatives are two-electrode voltage-clamp technique or discontinuous single electrode voltage-clamp (dSEVC). Nevertheless, it is generally difficult to impale two electrodes in a same neuron and the switching frequency is limited to low frequencies in the case of dSEVC. We present a novel fully computer-implemented alternative to perform continuous voltage-clamp recordings with a single sharp-electrode. To reach such voltage-clamp recordings, we combine an active electrode compensation algorithm (AEC) with a digital controller (AECVC). We applied two types of control-systems: a linear controller (proportional plus integrative controller) and a model-based controller (optimal control). We compared the performance of the two methods to dSEVC using a dynamic model cell and experiments in brain slices. The AECVC method provides an entirely digital method to perform continuous recording and smooth switching between voltage-clamp, current clamp or dynamic-clamp configurations without introducing artifacts.
RADLAC II/SMILE performance with a magnetically insulated voltage adder
International Nuclear Information System (INIS)
Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Crist, C.E.; Poukey, J.W.; Prestwich, K.R.; Turman, B.N.; Struve, K.; Welch, D.
1991-01-01
A 12.5-m long Self Magnetically Insulate Transmission LinE (SMILE) that sums the voltages of 8, 2 -MV pulse forming lines was installed in the RADLAC-II linear induction accelerator. The magnetic insulation criteria was calculated using parapotential flow theory and found to agree with MAGIC simulations. High quality annular beams with β perpendicular ≤ 0.1 and a radius r b < 2 cm were measured for currents of 50-100-kA extracted from a magnetic immersed foilless diode. These parameters were achieved with 11 to 15-MV accelerating voltages and 6 to 16-kG diode magnetic field. The experimental results exceeded the design expectations and are in good agreement with code simulations
Power Quality Improvement Using an Enhanced Network-Side-Shunt-Connected Dynamic Voltage Restorer
Fereidouni, Alireza; Masoum, Mohammad A. S.; Moghbel, Moayed
2015-10-01
Among the four basic dynamic voltage restorer (DVR) topologies, the network-side shunt-connected DVR (NSSC-DVR) has a relatively poor performance and is investigated in this paper. A new configuration is proposed and implemented for NSSC-DVR to enhance its performance in compensating (un)symmetrical deep and long voltage sags and mitigate voltage harmonics. The enhanced NSSC-DVR model includes a three-phase half-bridge semi-controlled network-side-shunt-connected rectifier and a three-phase full-bridge series-connected inverter implemented with a back-to-back configuration through a bidirectional buck-boost converter. The network-side-shunt-connected rectifier is employed to inject/draw the required energy by NSSC-DVR to restore the load voltage to its pre-fault value under sag/swell conditions. The buck-boost converter is responsible for maintaining the DC-link voltage of the series-connected inverter at its designated value in order to improve the NSSC-DVR capability in compensating deep and long voltage sags/swells. The full-bridge series-connected inverter permits to compensate unbalance voltage sags containing zero-sequence component. The harmonic compensation of the load voltage is achieved by extracting harmonics from the distorted network voltage using an artificial neural network (ANN) method called adaptive linear neuron (Adaline) strategy. Detailed simulations are performed by SIMULINK/MATLAB software for six case studies to verify the highly robustness of the proposed NSSC-DVR model under various conditions.
Equilibrium fluctuation relations for voltage coupling in membrane proteins.
Kim, Ilsoo; Warshel, Arieh
2015-11-01
A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free
Thyristor voltage converter in induction electric drives with microprocessor control
Energy Technology Data Exchange (ETDEWEB)
Braslavsky, I.; Zuzev, A.; Shilin, S. [Electric Drive Department, Urals State Technical University, Ekaterinburg (Russian Federation)
1997-12-31
The paper consists of some results on developed pulse model of thyristor voltage converter which is one of the most mathematically complicated unit of electric drive. The model structure and model parameter calculating method are represented. The application of the model allows to analyse stability in `locally` by the linear pulse system theory methods with talking into consideration quantise processes within the converter. Such application provides the obtaining higher accurate results comparing with the non-linear system theory approximate methods. Logarithmic frequency characteristics are used to analyse converter dynamic features and they are represented too. (orig.) 4 refs.
Low-Energy Real-Time OS Using Voltage Scheduling Algorithm for Variable Voltage Processors
Okuma, Takanori; Yasuura, Hiroto
2001-01-01
This paper presents a real-time OS based on $ mu $ITRON using proposed voltage scheduling algorithm for variable voltage processors which can vary supply voltage dynamically. The proposed voltage scheduling algorithms assign voltage level for each task dynamically in order to minimize energy consumption under timing constraints. Using the presented real-time OS, running tasks with low supply voltage leads to drastic energy reduction. In addition, the presented voltage scheduling algorithm is ...
Rectangular waveform linear transformer driver module design
International Nuclear Information System (INIS)
Zhao Yue; Xie Weiping; Zhou Liangji; Chen Lin
2014-01-01
Linear Transformer Driver is a novel pulsed power technology, its main merits include a parallel LC discharge array and Inductive Voltage Adder. The parallel LC discharge array lowers the whole circuit equivalent inductance and the Inductive Voltage Adder unites the modules in series in order to create a high electric field grads, meanwhile, restricts the high voltage in a small space. The lower inductance in favor of LTD output a fast waveform and IVA confine high voltage in secondary cavity. In recently, some LTD-based pulsed power system has been development yet. The usual LTD architecture provides damped sine shaped output pulses that may not be suitable in flash radiography, high power microwave production, z-pinch drivers, and certain other applications. A more suitable driver output pulse would have a flat or inclined top (slightly rising or falling). In this paper, we present the design of an LTD cavity that generates this type of the output pulse by including within its circular array some number of the harmonic bricks in addition to the standard bricks according to Fourier progression theory. The parallel LC discharge array circuit formula is introduced by Kirchhoff Law, and the sum of harmonic is proofed as an analytic result, meanwhile, rationality of design is proved by simulation. Varying gas spark discharge dynamic resistance with harmonic order and switches jitter are analyzed. The results are as following: The more harmonic order is an approach to the ideal rectangular waveform, but lead to more system complexity. The capacity decreases as harmonic order increase, and gas spark discharge dynamic resistance rises with the capacity. The rising time protracts and flat is decay or even vanishes and the shot to shot reproducibility is degenerate as the switches jitter is high. (authors)
Impact of Crack on Stability of Slope with Linearly Increasing Undrained Strength
Directory of Open Access Journals (Sweden)
Bing Li
2018-01-01
Full Text Available This paper presents a procedure for assessment of the impact of tension crack on stability of slope in clays with linearly increasing undrained strength. The procedure is based on the limit equilibrium method with variational extremization. The distribution of the normal stress over slip surface is mathematically obtained for slopes in clays with the linearly increasing undrained strength and then used to determine the tension crack for clays with zero tensile strength. The seismic effect is also included using the pseudostatic approach. Closed-form solutions to the minimum safety factor and the maximum crack depth can be derived and given in the form of chart for convenient use. The results demonstrate a significant effect of the tension crack on the stability of steep slopes, especially for strong seismic conditions. In this situation, neglecting the impact of tension crack in traditional ϕ=0 analyses may overestimate the slope safety. The most adverse location of the tension crack can be also determined and presented in the charts, which may be useful in designing reinforcements and remedial measures for slope stabilization.
Voltage-dependent gating of hERG potassium channels
Directory of Open Access Journals (Sweden)
Yen May eCheng
2012-05-01
Full Text Available The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4-S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-a-go-go related gene, hERG, which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure-function relationships underlying voltage-dependent gating in Shaker and hERG channels, with a focus on the roles of the voltage sensing domain and the S4-S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter charge interactions. More recent data suggest that key amino acid differences in the hERG voltage sensing unit and S4-S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor.
The experiment of grid characteristics for high-voltage radiography of chest
International Nuclear Information System (INIS)
Kim, Jung Min; Ahn, Bong Seon
1992-01-01
Grids can improve the diagnostic quality of chest radiography by trapping the greater part of scattered radiation thus providing more detailed chest radiographic images. It is most effective method of reduce the scatter ratio but must increase the expour factor. The benefit of use of grid is improve the contrast and the loss is increase of patient dose. In chest radiography especially hard quality high voltage radiography it will have to be considered to select the optimum grid with view point of benefit and loss. In this experiment, auther got some result of characteristics about 4 different grids with film method. 1. There was no difference the scatter ratio in case of no grid and the scatter ratio was about 60 % 2. 16 : 1 grid was excellent of scatter reduction factor in high voltage chest radiography, next was 10 : 1, CROSS, MICRO FINE grid have low scatter reduction rate compare to 16:1,10:1 grid. 3. The bucky factor of CROSS grid in accordance of kVp was find out the highest in 4 grids, on the contrary 10 : 1 grid was profitable to the. exposure does. 4. With careful consideration in the point of scatter reduction rate and bucky factor, auther suggest the 10 : 1 linear grid on the use of chest radiography in 80∼120 kVp, 16 : 1 grid in 120∼140 kVp
Effect of Anode Floating Voltage and its Applications in Characterizing Silicon Drift Detectors
International Nuclear Information System (INIS)
Guang-Guo, Wu; Hong-Ri, Li; Kun, Liang; Ru, Yang; De-Jun, Han; Xue-Lei, Cao; Huan-Yu, Wang; Jun-Ming, An; Xiong-Wei, Hu
2009-01-01
Anode Boating voltage is predicted and investigated for silicon drift detectors (SDDs) with an active area of 5 mm 2 fabricated by a double-side parallel technology. It is demonstrated that the anode Boating voltage increases with the increasing inner ring voltage, and is almost unchanged with the external ring voltage. The anode Boating voltage will not be affected by the back electrode biased voltage until it reaches the full-depleted voltage (−50 V) of the SDD. Theoretical analysis and experimental results show that the anode Boating voltage is equal to the sum of the inner ring voltage and the built-in potential between the p + inner ring and the n + anode. A fast checking method before detector encapsulation is proposed by employing the anode Boating voltage along with checking the leakage current, potential distribution and drift properties
Small Distributed Renewable Energy Generation for Low Voltage Distribution Networks
Directory of Open Access Journals (Sweden)
Chindris M.
2016-08-01
Full Text Available Driven by the existing energy policies, the use of renewable energy has increased considerably all over the world in order to respond to the increasing energy consumption and to reduce the environmental impact of the electricity generation. Although most policy makers and companies are focusing on large applications, the use of cheap small generation units, based on local renewable resources, has become increasingly attractive for the general public, small farms and remote communities. The paper presents several results of a research project aiming to identify the power quality issues and the impact of RES based distributed generation (DG or other non-linear loads on low voltage (LV distribution networks in Romania; the final goal is to develop a Universal Power Quality Conditioner (UPQC able to diminish the existing disturbances. Basically, the work analyses the existing DG technologies and identifies possible solutions for their integration in Romania; taking into account the existent state of the art, the attention was paid on small systems, using wind and solar energy, and on possibility to integrate them into suburban and rural LV distribution networks. The presence of DG units at distribution voltage level means the transition from traditional passive to active distribution networks. In general, the relatively low penetration levels of DG does not produce problems; however, the nowadays massive increase of local power generation have led to new integration challenges in order to ensure the reliability and quality of the power supply. Power quality issues are identified and their assessment is the key element in the design of measures aiming to diminish all existing disturbances.
International Nuclear Information System (INIS)
Richards, J.A.
1977-01-01
A linear particle accelerator which provides a pulsed beam of charged particles of uniform energy is described. The accelerator is in the form of an evacuated dielectric tube, inside of which a particle source is located at one end of the tube, with a target or window located at the other end of the dielectric tube. Along the length of the tube are externally located pairs of metal plates, each insulated from each other in an insulated housing. Each of the plates of a pair are connected to an electrical source of voltage of opposed polarity, with the polarity of the voltage of the plates oriented so that the plate of a pair, nearer to the particle source, is of the opposed polarity to the charge of the particle emitted by the source. Thus, a first plate about the tube located nearest the particle source, attracts a particle which as it passes through the tube past the first plate is then repelled by the reverse polarity of the second plate of the pair to continue moving towards the target
Non-sparking anodization process of AZ91D magnesium alloy under low AC voltage
International Nuclear Information System (INIS)
Li, Weiping; Li, Wen; Zhu, Liqun; Liu, Huicong; Wang, Xiaofang
2013-01-01
Highlights: ► Four different processes appear on magnesium alloys with applied voltage increase. ► Non-sparking film formation process occurred in the range of 6–10 V AC. ► The film was composed of Mg 2 SiO 4 with a stable growth rate in 30 min. ► Film growth was a balance of electrochemical dissolution and chemical deposition. -- Abstract: Anodization is widely recognized as one of the most important surface treatments for magnesium alloys. However, since high voltage oxidation films are limited in some applications due to porosity and brittleness, it is worthwhile to explore the non-sparking oxidizing process. In this work, AZ91D was electrochemically anodized at different AC voltages in an electrolyte containing 120 g/L NaOH and 80 g/L Na 2 SiO 3 ·9H 2 O. The effects of voltage on the surface morphology, composition and reaction process, especially the non-sparking discharge anodic film formation process, were investigated. The results showed that four different processes would appear according to the applied voltage variation from 6 V to 40 V, and that the non-sparking film formation process occurred in the range of 6–10 V. The film formed on the AZ91D surface under 10 V AC was mainly composed of Mg 2 SiO 4 with a lamellar structure. The horizontal and vertical expansion of the lamellar structure resulted in the formation of a multi-layered structure with a stable, linear growth rate for 30 min. The non-sparking film formation process can be considered to be the result of a balance of electrochemical dissolution and chemical deposition reaction
Spectrum analysis of a voltage source converter due to semiconductor voltage drops
DEFF Research Database (Denmark)
Rasmussen, Tonny Wederberg; Eltouki, Mustafa
2017-01-01
It is known that power electronic voltage source converters are non-ideal. This paper presents a state-of-the-art review on the effect of semiconductor voltage drop on the output voltage spectrum, using single-phase H-bridge two-level converter topology with natural sampled pulse width modulation....... The paper describes the analysis of output voltage spectrum, when the semiconductor voltage drop is added. The results of the analysis of the spectral contribution including and excluding semiconductor voltage drop reveal a good agreement between the theoretical results, simulations and laboratory...
Charge Gain, Voltage Gain, and Node Capacitance of the SAPHIRA Detector Pixel by Pixel
Pastrana, Izabella M.; Hall, Donald N. B.; Baker, Ian M.; Jacobson, Shane M.; Goebel, Sean B.
2018-01-01
The University of Hawai`i Institute for Astronomy has partnered with Leonardo (formerly Selex) in the development of HgCdTe linear mode avalanche photodiode (L-APD) SAPHIRA detectors. The SAPHIRA (Selex Avalanche Photodiode High-speed Infra-Red Array) is ideally suited for photon-starved astronomical observations, particularly near infrared (NIR) adaptive optics (AO) wave-front sensing. I have measured the stability, and linearity with current, of a 1.7-um (10% spectral bandpass) infrared light emitting diode (IR LED) used to illuminate the SAPHIRA and have then utilized this source to determine the charge gain (in e-/ADU), voltage gain (in uV/ADU), and node capacitance (in fF) for each pixel of the 320x256@24um SAPHIRA. These have previously only been averages over some sub-array. Determined from the ratio of the temporal averaged signal level to variance under constant 1.7-um LED illumination, I present the charge gain pixel-by-pixel in a 64x64 sub-array at the center of the active area of the SAPHIRA (analyzed separately as four 32x32 sub-arrays) to be about 1.6 e-/ADU (σ=0.5 e-/ADU). Additionally, the standard technique of varying the pixel reset voltage (PRV) in 10 mV increments and recording output frames for the same 64x64 subarray found the voltage gain per pixel to be about 11.7 uV/ADU (σ=0.2 uV/ADU). Finally, node capacitance was found to be approximately 23 fF (σ=6 fF) utilizing the aforementioned charge and voltage gain measurements. I further discuss the linearity measurements of the 1.7-um LED used in the charge gain characterization procedure.
Voltage-Dependent Gating of hERG Potassium Channels
Cheng, Yen May; Claydon, Tom W.
2012-01-01
The mechanisms by which voltage-gated channels sense changes in membrane voltage and energetically couple this with opening of the ion conducting pore has been the source of significant interest. In voltage-gated potassium (Kv) channels, much of our knowledge in this area comes from Shaker-type channels, for which voltage-dependent gating is quite rapid. In these channels, activation and deactivation are associated with rapid reconfiguration of the voltage-sensing domain unit that is electromechanically coupled, via the S4–S5 linker helix, to the rate-limiting opening of an intracellular pore gate. However, fast voltage-dependent gating kinetics are not typical of all Kv channels, such as Kv11.1 (human ether-à-go-go related gene, hERG), which activates and deactivates very slowly. Compared to Shaker channels, our understanding of the mechanisms underlying slow hERG gating is much poorer. Here, we present a comparative review of the structure–function relationships underlying activation and deactivation gating in Shaker and hERG channels, with a focus on the roles of the voltage-sensing domain and the S4–S5 linker that couples voltage sensor movements to the pore. Measurements of gating current kinetics and fluorimetric analysis of voltage sensor movement are consistent with models suggesting that the hERG activation pathway contains a voltage independent step, which limits voltage sensor transitions. Constraints upon hERG voltage sensor movement may result from loose packing of the S4 helices and additional intra-voltage sensor counter-charge interactions. More recent data suggest that key amino acid differences in the hERG voltage-sensing unit and S4–S5 linker, relative to fast activating Shaker-type Kv channels, may also contribute to the increased stability of the resting state of the voltage sensor. PMID:22586397
Using computational modeling to compare X-ray tube Practical Peak Voltage for Dental Radiology
International Nuclear Information System (INIS)
Holanda Cassiano, Deisemar; Arruda Correa, Samanda Cristine; Monteiro de Souza, Edmilson; Silva, Ademir Xaxier da; Pereira Peixoto, José Guilherme; Tadeu Lopes, Ricardo
2014-01-01
The Practical Peak Voltage-PPV has been adopted to measure the voltage applied to an X-ray tube. The PPV was recommended by the IEC document and accepted and published in the TRS no. 457 code of practice. The PPV is defined and applied to all forms of waves and is related to the spectral distribution of X-rays and to the properties of the image. The calibration of X-rays tubes was performed using the MCNPX Monte Carlo code. An X-ray tube for Dental Radiology (operated from a single phase power supply) and an X-ray tube used as a reference (supplied from a constant potential power supply) were used in simulations across the energy range of interest of 40 kV to 100 kV. Results obtained indicated a linear relationship between the tubes involved. - Highlights: • Computational Model was developed to X-ray tube Practical Peak Voltage for Dental Radiology. • The calibration of X-rays tubes was performed using the MCNPX Monte Carlo code. • The energy range was 40–100 kV. • Results obtained indicated a linear relationship between the Dental Radiology and reference X-ray tubes
International Nuclear Information System (INIS)
Amjady, Nima; Ansari, Mohammad Reza
2008-01-01
The introduction of liberalized electricity markets in many countries has resulted in more highly stressed power systems. On the other hand, operating points of a power system are acceptable in the feasible region, which is surrounded by the borders of different stabilities. Power system instability is critical for all participants of the electricity market. Determination of different stability margins can result in the optimum utilization of power system with minimum risk. This paper focuses on the small disturbance voltage stability, which is an important subset of the power system global stability. This kind of voltage stability is usually evaluated by static analysis tools such as continuation power flow, while it essentially has dynamic nature. Besides, a combination of linear and nonlinear analysis tools is required to correctly analyze it. In this paper, a hybrid evaluation method composed of static, dynamic, linear, and nonlinear analysis tools is proposed for this purpose. Effect of load scenario, generation pattern, branch and generator contingency on the small disturbance voltage stability are evaluated by the hybrid method. The test results are given for New England and IEEE68 bus test systems. (author)
Padhee, Varsha
Common Mode Voltage (CMV) in any power converter has been the major contributor to premature motor failures, bearing deterioration, shaft voltage build up and electromagnetic interference. Intelligent control methods like Space Vector Pulse Width Modulation (SVPWM) techniques provide immense potential and flexibility to reduce CMV, thereby targeting all the afore mentioned problems. Other solutions like passive filters, shielded cables and EMI filters add to the volume and cost metrics of the entire system. Smart SVPWM techniques therefore, come with a very important advantage of being an economical solution. This thesis discusses a modified space vector technique applied to an Indirect Matrix Converter (IMC) which results in the reduction of common mode voltages and other advanced features. The conventional indirect space vector pulse-width modulation (SVPWM) method of controlling matrix converters involves the usage of two adjacent active vectors and one zero vector for both rectifying and inverting stages of the converter. By suitable selection of space vectors, the rectifying stage of the matrix converter can generate different levels of virtual DC-link voltage. This capability can be exploited for operation of the converter in different ranges of modulation indices for varying machine speeds. This results in lower common mode voltage and improves the harmonic spectrum of the output voltage, without increasing the number of switching transitions as compared to conventional modulation. To summarize it can be said that the responsibility of formulating output voltages with a particular magnitude and frequency has been transferred solely to the rectifying stage of the IMC. Estimation of degree of distortion in the three phase output voltage is another facet discussed in this thesis. An understanding of the SVPWM technique and the switching sequence of the space vectors in detail gives the potential to estimate the RMS value of the switched output voltage of any
International Nuclear Information System (INIS)
Mayhall, D.J.; Yee, J.H.; Duong-Van, M.; Villa, F.
1988-01-01
A picosecond speed switch, the Gas Avalanche Switch (GAS), has been proposed for GeV linear accelerators. The medium is gas at high pressure (100 - 700 atm). An avalanche discharge is induced between pulse-charged high voltage electrodes by electron deposition from a fast laser pulse. Avalanche electrons move to the positive electrode, causing the applied voltage to collapse in picoseconds. A two-dimensional (2D) electromagnetic electron fluid computer code calculates the avalanche evolution and voltage collapse in air for an infinite parallel plate capacitor with a 0.1 mm spacing. Calculations are done for an accelerator switch geometry consisting of a 0.7 mm wide by 0.8 mm high, rectangular, high voltage center electrode (CE) between the grounded plates of a parallel plate line of 2 mm spacing. Several variations of CE elevation and initial electron deposition are investigated The 2D character of the outgoing TEM waves is shown
Induction sensor for measuring the accelerating voltage in an iron-free induction accelerator
International Nuclear Information System (INIS)
Bol'nykh, N.S.; Il'in, Yu.M.; Kostyushok, A.A.; Suvorov, V.A.
1987-01-01
An inductive sensor is described for measuring the amplitude and form of the accelerating-voltage pulse in the storage coils in a radial iron-free linear induction accelerator. The sensor does not respond to interference from external fields and does not require adjustment after calibration
Efficient Low-Voltage Operation of a CW Gyrotron Oscillator at 233 GHz.
Hornstein, Melissa K; Bajaj, Vikram S; Griffin, Robert G; Temkin, Richard J
2007-02-01
The gyrotron oscillator is a source of high average power millimeter-wave through terahertz radiation. In this paper, we report low beam power and high-efficiency operation of a tunable gyrotron oscillator at 233 GHz. The low-voltage operating mode provides a path to further miniaturization of the gyrotron through reduction in the size of the electron gun, power supply, collector, and cooling system, which will benefit industrial and scientific applications requiring portability. Detailed studies of low-voltage operation in the TE(2) (,) (3) (,) (1) mode reveal that the mode can be excited with less than 7 W of beam power at 3.5 kV. During CW operation with 3.5-kV beam voltage and 50-mA beam current, the gyrotron generates 12 W of RF power at 233.2 GHz. The EGUN electron optics code describes the low-voltage operation of the electron gun. Using gun-operating parameters derived from EGUN simulations, we show that a linear theory adequately predicts the low experimental starting currents.
High voltage pulse generator. [Patent application
Fasching, G.E.
1975-06-12
An improved high-voltage pulse generator is described which is especially useful in ultrasonic testing of rock core samples. An N number of capacitors are charged in parallel to V volts and at the proper instance are coupled in series to produce a high-voltage pulse of N times V volts. Rapid switching of the capacitors from the paralleled charging configuration to the series discharging configuration is accomplished by using silicon-controlled rectifiers which are chain self-triggered following the initial triggering of the first rectifier connected between the first and second capacitors. A timing and triggering circuit is provided to properly synchronize triggering pulses to the first SCR at a time when the charging voltage is not being applied to the parallel-connected charging capacitors. The output voltage can be readily increased by adding additional charging networks. The circuit allows the peak level of the output to be easily varied over a wide range by using a variable autotransformer in the charging circuit.
SYNTHESIS OF VOLTAGES OF UNIFORM PWM IN TIME REGULATION
Directory of Open Access Journals (Sweden)
A. G. Stryzhniou
2014-01-01
Full Text Available The article describes a process of synthesis and qualitative assessment of the harmonic composition of voltages of multiple and single PWM pulses in time regulation, being, along with amplitude, frequency and phase method, one of control methods of an asynchronous motor. The main point of time regulation is that a pause after any two single PWM pulses with different polarity or after any two groups of multiple PWM pulses with different polarity changes during a process of regulation. Feature of time regulation is that a motor has fast response in the range of small-signal of control and good linearity of speed-torque characteristics in the whole control range. Analytical expressions of parameters of PWM pulses ai and ti are obtained which allow to simplify considerably a process of formation and implementation of time regulation using tabular or indexed-tabular methods. These expressions allow not only to define voltage amplitude of harmonic but also to perform qualitative assessment of harmonic composition of output voltages at time regulation. It is specified that harmonic frequencies wi = w0/q change in inverse proportion to magnitude of parameter q during a process of regulation and there is a replacement of a fundamental frequency by frequencies of higher harmonics.The offered approach allows to synthesize voltage of uniform single and multiple PWM pulses and to perform their comparative and qualitative analysis and the obtained expressions can be used at modeling of AC motor work. Voltage of multiple PWM pulses which is formed using stepped reference voltage with even quantity of steps in a half period and a pause on a zero level has the best parameters by criterion of a minimum of harmonic components and a maximum of a factor of anharmonicity Kнс at time regulation.
Feedback Linearization Control of a Shunt Active Power Filter Using a Fuzzy Controller
Directory of Open Access Journals (Sweden)
Tianhua Li
2013-09-01
Full Text Available In this paper, a novel feedback linearization based sliding mode controlled parallel active power filter using a fuzzy controller is presented in a three-phase three-wire grid. A feedback linearization control with fuzzy parameter self-tuning is used to implement the DC side voltage regulation while a novel integral sliding mode controller is applied to reduce the total harmonic distortion of the supply current. Since traditional unit synchronous sinusoidal signal calculation methods are not applicable when the supply voltage contains harmonics, a novel unit synchronous sinusoidal signal computing method based on synchronous frame transforming theory is presented to overcome this disadvantage. The simulation results verify that the DC side voltage is very stable for the given value and responds quickly to the external disturbance. A comparison is also made to show the advantages of the novel unit sinusoidal signal calculating method and the super harmonic treatment property of the designed active power filter.
International Nuclear Information System (INIS)
Carpenter, R.T.; Torven, S.
1986-07-01
The properties of a strong double layer in a current circuit with a capacitance and an inductance are investigated in a triple plasma device. The double layer gives rise to a region of negative differential resistance in the current-voltage characteristic of the device, and this gives non-linear oscillations in the current and the potential drop over the double layer (PhiDL). For a sufficiently large circuit inductance PhiDL reaches an amplitude given by the induced voltage (-LdI/dt) which is much larger than the circuit EMF due to the rapid current decrease when PhiDL increases. A variable potential minimum exists in the plasma on the low potential side of the double layer, and the depth of the minimum increases when PhiDL increases. An increasing fraction of the electrons incident at the double layer are then reflected, and this is found to be the main process giving rise to the negative differential resistance. A qualitative model for the variation of the minimum potential with PhiDL is also proposed. It is based on the condition that the minimum potential must adjust itself self-consistentely so that quasi-neutrality is maintained in the plasma region where the minimum is assumed. (authors)
Directory of Open Access Journals (Sweden)
Chaichana Amornchai
2017-01-01
Full Text Available In this paper, a voltage mode multifunction filter based on single voltage differencing differential difference amplifier (VDDDA is presented. The proposed filter with three input voltages and single output voltage is constructed with single VDDDA, two capacitors and two resistors. Its quality factor can be adjusted without affecting natural frequency. Also, the natural frequency can be electronically tuned via adjusting of bias current. The filter can offer five output responses, high-pas (HP, band-pass (BP, band-reject (BR, low-pass (LP and all-ass (AP functions in the same circuit topology. The output response can be selected by choosing the suitable input voltage without the component matching condition and the requirement of additional double gain voltage amplifier. PSpice simulation results to confirm an operation of the proposed filter correspond to the theory.
Temporary over voltages in the high voltage networks
International Nuclear Information System (INIS)
Vukelja, Petar; Naumov, Radomir; Mrvic, Jovan; Minovski, Risto
2001-01-01
The paper treats the temporary over voltages that may arise in the high voltage networks as a result of: ground faults, loss of load, loss of one or two phases and switching operation. Based on the analysis, the measures for their limitation are proposed. (Original)
Directory of Open Access Journals (Sweden)
M. I. Baranov
2015-04-01
Full Text Available Purpose. Development and creation of the simplified construction of a high-voltage heavy-current air three-electrode switchboard with graphite electrodes, intended for operation in composition the powerful generator of large impulsive current of artificial of linear lightning. Methodology. Electrophysics bases of technique of high-voltage and scientific and technical bases of planning of devices of high-voltage impulsive technique. Results. Developed and made a new construction of a high-voltage heavy-current air three-electrode switchboard with the graphite electrodes of KATG-50 on nominal voltage ±50 kV. This construction of switchboard KATG-50 has been passed experimental approbation in composition the heavy-current bit chain of powerful high-voltage generator of the аperiodic impulses of current of artificial linear lightning rationed on operating foreign standards with amplitude of Im=±(200±20 кА at their duration τP=(350±35 μs at level 0,5∙Im. Originality. First in domestic practice of development and creation of high-voltage heavy-current switchboards for the generators of large impulse currents of artificial lightning the ground of necessity of the use for their basic and managing electrodes of electrical engineering graphite is carried out. Practical value. The developed and made high-voltage heavy-current switchboard of cascade-tray KATG-50 from application in its composition of graphite electrodes possesses an enhanceable working resource and enhanceable stability of wearing-out at the use of similar switchboard in the bit chain of powerful pulsed current of the imitated linear lightning.
Voltage regulator for generator
Energy Technology Data Exchange (ETDEWEB)
Naoi, K
1989-01-17
It is an object of this invention to provide a voltage regulator for a generator charging a battery, wherein even if the ambient temperature at the voltage regulator rises abnormally high, possible thermal breakage of the semiconductor elements constituting the voltage regulator can be avoided. A feature of this invention is that the semiconductor elements can be protected from thermal breakage, even at an abnormal ambient temperature rise at the voltage regulator for the battery charging generator, by controlling a maximum conduction ratio of a power transistor in the voltage regulator in accordance with the temperature at the voltage regulator. This is achieved through a switching device connected in series to the field coil of the generator and adapted to be controlled in accordance with an output voltage of the generator and the ambient temperature at the voltage regulator. 6 figs.
Maximum penetration level of distributed generation without violating voltage limits
Morren, J.; Haan, de S.W.H.
2009-01-01
Connection of Distributed Generation (DG) units to a distribution network will result in a local voltage increase. As there will be a maximum on the allowable voltage increase, this will limit the maximum allowable penetration level of DG. By reactive power compensation (by the DG unit itself) a
Design of a 7-MV Linear Transformer Driver (LTD) for down-hole flash x-ray radiography
International Nuclear Information System (INIS)
Cordova, Steve Ray; Welch, Dale Robert; Oliver, Bryan Velten; Rose, David Vincent; Johnson, David Lee; Bruner, Nichelle Lee; Leckbee, Joshua J.
2008-01-01
Pulsed power driven flash x-ray radiography is a valuable diagnostic for subcritical experiments at the Nevada Test Site. The existing dual-axis Cygnus system produces images using a 2.25 MV electron beam diode to produce intense x-rays from a small source. Future hydrodynamic experiments will likely use objects with higher areal mass, requiring increased x-ray dose and higher voltages while maintaining small source spot size. A linear transformer driver (LTD) is a compact pulsed power technology with applications ranging from pulsed power flash x-ray radiography to high current Z-pinch accelerators. This report describes the design of a 7-MV dual-axis system that occupies the same lab space as the Cygnus accelerators. The work builds on a design proposed in a previous report [1]. This new design provides increased diode voltage from a lower impedance accelerator to improve coupling to low impedance diodes such as the self magnetic pinch (SMP) diode. The design also improves the predicted reliability by operating at a lower charge voltage and removing components that have proven vulnerable to failure. Simulations of the new design and experimental results of the 1-MV prototype are presented
Stability of high current diode under 100-nanosecond-pulse voltage
International Nuclear Information System (INIS)
Lai Dingguo; Qiu Aici; Zhang Yongmin; Huang Jianjun; Ren Shuqing; Yang Li
2012-01-01
Stability of high current diode under pulse voltage with 80 ns and 34 ns rise time was studied on the flash Ⅱ accelerator. Influence of rise time of diode voltage on startup time and cathode emission uniformity and repeatability of diode impedance was analyzed by comparing the experimental results with numerically simulated results, and the influence mechanism was discussed. The startup time of diode increases with the increasing of rise time of voltage, and the repeatability of diode impedance decreases. Discal plane cathode is prone to emit rays intensely in the center area, the time that plasma covers the surface of the cathode increases and the shielding effect has more impact on cathode emission according to the increase of rise time. Local intense emission on the cathode increases expansion speed of plasma and reduces the effective emission area. The stability of characteristic impedance of diode under a pulse voltage with slow rise time is decreased by the combined action of expansion speed of plasma and the effective emission area. (authors)
Grain boundary effect of ZnO voltage sensitive ceramic
International Nuclear Information System (INIS)
Zhu Ziying; Lei Deming; Li Jingde
1991-01-01
Positron annihilation techenique has been to study the non-linear Ohmic effect of ZnO. The resemblence of curve representing the short life-time τ 1 and its component I 1 vs. current i with the voltage drop curve proves that this component I 1 belongs to the annihilation of transporting electron and positron. The experimental results give support to the explaination of Schottky barrier model for the effect of intergranular boundary
Strategies for Voltage Control and Transient Stability Assessment
Energy Technology Data Exchange (ETDEWEB)
Hiskens, Ian A.
2013-09-25
As wind generation grows, its influence on power system performance will becoming increasingly noticeable. Wind generation di ffers from traditional forms of generation in numerous ways though, motivating the need to reconsider the usual approaches to power system assessment and performance enhancement. The project has investigated the impact of wind generation on transient stability and voltage control, identifying and addressing issues at three distinct levels of the power system: 1) at the device level, the physical characteristics of wind turbine generators (WTGs) are quite unlike those of synchronous machines, 2) at the wind-farm level, the provision of reactive support is achieved through coordination of numerous dissimilar devices, rather than straightforward generator control, and 3) from a systems perspective, the location of wind-farms on the sub-transmission network, coupled with the variability inherent in their power output, can cause complex voltage control issues. The project has sought to develop a thorough understanding of the dynamic behaviour of type-3 WTGs, and in particular the WECC generic model. The behaviour of such models is governed by interactions between the continuous dynamics of state variables and discrete events associated with limits. It was shown that these interactions can be quite complex, and may lead to switching deadlock that prevents continuation of the trajectory. Switching hysteresis was proposed for eliminating deadlock situations. Various type-3 WTG models include control blocks that duplicate integrators. It was shown that this leads to non-uniqueness in the conditions governing steady-state, and may result in pre- and post-disturbance equilibria not coinciding. It also gives rise to a zero eigenvalue in the linearized WTG model. In order to eliminate the anomalous behaviour revealed through this investigation, WECC has now released a new generic model for type-3 WTGs. Wind-farms typically incorporate a variety of
Fluorescence profiles and cooling dynamics of laser-cooled Mg+ ions in a linear rf ion trap
International Nuclear Information System (INIS)
Zhao Xianzhen; Ryjkov, Vladimir L.; Schuessler, Hans A.
2006-01-01
Fluorescence line profiles and their implications on the cooling dynamics of the Mg + ions stored in a linear rf trap are studied. The line profile is dictated by the temperature of the ion cloud at different laser detunings. The upper bound of the lowest temperature was estimated for different values of the rf trapping potential amplitude and the buffer gas pressure. A general trend of this ultimate temperature to increase with the rf trapping voltage and buffer gas pressure is expected, with an abrupt change at some critical value corresponding to the transition to and from a strongly correlated liquid or crystal state. While on the one hand this expectation was confirmed when the buffer gas pressure was varied; on the other hand the influence of the amplitude of the trapping voltage on the ultimate temperature shows an interesting new feature of first dipping down before the sharp increase occurs
Non-linear dielectric spectroscopy of microbiological suspensions
Treo, Ernesto F; Felice, Carmelo J
2009-01-01
Background Non-linear dielectric spectroscopy (NLDS) of microorganism was characterized by the generation of harmonics in the polarization current when a microorganism suspension was exposed to a sinusoidal electric field. The biological nonlinear response initially described was not well verified by other authors and the results were susceptible to ambiguous interpretation. In this paper NLDS was performed to yeast suspension in tripolar and tetrapolar configuration with a recently developed analyzer. Methods Tripolar analysis was carried out by applying sinusoidal voltages up to 1 V at the electrode interface. Tetrapolar analysis was carried on with sinusoidal field strengths from 0.1 V cm-1 to 70 V cm-1. Both analyses were performed within a frequency range from 1 Hz through 100 Hz. The harmonic amplitudes were Fourier-analyzed and expressed in dB. The third harmonic, as reported previously, was investigated. Statistical analysis (ANOVA) was used to test the effect of inhibitor an activator of the plasma membrane enzyme in the measured response. Results No significant non-linearities were observed in tetrapolar analysis, and no observable changes occurred when inhibitor and activator were added to the suspension. Statistical analysis confirmed these results. When a pure sinus voltage was applied to an electrode-yeast suspension interface, variations higher than 25 dB for the 3rd harmonic were observed. Variation higher than 20 dB in the 3rd harmonics has also been found when adding an inhibitor or activator of the membrane-bounded enzymes. These variations did not occur when the suspension was boiled. Discussion The lack of result in tetrapolar cells suggest that there is no, if any, harmonic generation in microbiological bulk suspension. The non-linear response observed was originated in the electrode-electrolyte interface. The frequency and voltage windows observed in previous tetrapolar analysis were repeated in the tripolar measurements, but maximum were not
Non-linear dielectric spectroscopy of microbiological suspensions
Directory of Open Access Journals (Sweden)
Felice Carmelo J
2009-09-01
Full Text Available Abstract Background Non-linear dielectric spectroscopy (NLDS of microorganism was characterized by the generation of harmonics in the polarization current when a microorganism suspension was exposed to a sinusoidal electric field. The biological nonlinear response initially described was not well verified by other authors and the results were susceptible to ambiguous interpretation. In this paper NLDS was performed to yeast suspension in tripolar and tetrapolar configuration with a recently developed analyzer. Methods Tripolar analysis was carried out by applying sinusoidal voltages up to 1 V at the electrode interface. Tetrapolar analysis was carried on with sinusoidal field strengths from 0.1 V cm-1 to 70 V cm-1. Both analyses were performed within a frequency range from 1 Hz through 100 Hz. The harmonic amplitudes were Fourier-analyzed and expressed in dB. The third harmonic, as reported previously, was investigated. Statistical analysis (ANOVA was used to test the effect of inhibitor an activator of the plasma membrane enzyme in the measured response. Results No significant non-linearities were observed in tetrapolar analysis, and no observable changes occurred when inhibitor and activator were added to the suspension. Statistical analysis confirmed these results. When a pure sinus voltage was applied to an electrode-yeast suspension interface, variations higher than 25 dB for the 3rd harmonic were observed. Variation higher than 20 dB in the 3rd harmonics has also been found when adding an inhibitor or activator of the membrane-bounded enzymes. These variations did not occur when the suspension was boiled. Discussion The lack of result in tetrapolar cells suggest that there is no, if any, harmonic generation in microbiological bulk suspension. The non-linear response observed was originated in the electrode-electrolyte interface. The frequency and voltage windows observed in previous tetrapolar analysis were repeated in the tripolar
Liquid–Solid Dual-Gate Organic Transistors with Tunable Threshold Voltage for Cell Sensing
Zhang, Yu
2017-10-17
Liquid electrolyte-gated organic field effect transistors and organic electrochemical transistors have recently emerged as powerful technology platforms for sensing and simulation of living cells and organisms. For such applications, the transistors are operated at a gate voltage around or below 0.3 V because prolonged application of a higher voltage bias can lead to membrane rupturing and cell death. This constraint often prevents the operation of the transistors at their maximum transconductance or most sensitive regime. Here, we exploit a solid–liquid dual-gate organic transistor structure, where the threshold voltage of the liquid-gated conduction channel is controlled by an additional gate that is separated from the channel by a metal-oxide gate dielectric. With this design, the threshold voltage of the “sensing channel” can be linearly tuned in a voltage window exceeding 0.4 V. We have demonstrated that the dual-gate structure enables a much better sensor response to the detachment of human mesenchymal stem cells. In general, the capability of tuning the optimal sensing bias will not only improve the device performance but also broaden the material selection for cell-based organic bioelectronics.
Liquid-Solid Dual-Gate Organic Transistors with Tunable Threshold Voltage for Cell Sensing.
Zhang, Yu; Li, Jun; Li, Rui; Sbircea, Dan-Tiberiu; Giovannitti, Alexander; Xu, Junling; Xu, Huihua; Zhou, Guodong; Bian, Liming; McCulloch, Iain; Zhao, Ni
2017-11-08
Liquid electrolyte-gated organic field effect transistors and organic electrochemical transistors have recently emerged as powerful technology platforms for sensing and simulation of living cells and organisms. For such applications, the transistors are operated at a gate voltage around or below 0.3 V because prolonged application of a higher voltage bias can lead to membrane rupturing and cell death. This constraint often prevents the operation of the transistors at their maximum transconductance or most sensitive regime. Here, we exploit a solid-liquid dual-gate organic transistor structure, where the threshold voltage of the liquid-gated conduction channel is controlled by an additional gate that is separated from the channel by a metal-oxide gate dielectric. With this design, the threshold voltage of the "sensing channel" can be linearly tuned in a voltage window exceeding 0.4 V. We have demonstrated that the dual-gate structure enables a much better sensor response to the detachment of human mesenchymal stem cells. In general, the capability of tuning the optimal sensing bias will not only improve the device performance but also broaden the material selection for cell-based organic bioelectronics.
Voltage-Balancing Method for Modular Multilevel Converters Switched at Grid Frequency
DEFF Research Database (Denmark)
Deng, Fujin; Chen, Zhe
2015-01-01
The modular multilevel converter (MMC) becomes attractive for high-voltage and high-power applications due to its high modularity, availability, and power quality. The voltage balance issue of capacitors is very important in the MMC, and the balancing of the capacitor voltage is increasingly...
Low voltage 80 KV to 125 KV electron processors
International Nuclear Information System (INIS)
Lauppi, U.V.
1999-01-01
The classic electron beam technology made use of accelerating energies in the voltage range of 300 to 800 kV. The first EB processors - built for the curing of coatings - operated at 300 kV. The products to be treated were thicker than a simple layer of coating with thicknesses up to 100g and more. It was only in the beginning of the 1970's that industrial EB processors with accelerating voltages below 300 kV appeared on the market. Our company developed the first commercial electron accelerator without a beam scanner. The new EB machine featured a linear cathode, emitting a shower or 'curtain' of electrons over the full width of the product. These units were much smaller than anv previous EB processors and dedicated to the curing of coatings and other thin layers. ESI's first EB units operated with accelerating voltages between 150 and 200 kV. In 1993 ESI announced the introduction of a new generation of Electrocure. EB processors operating at 120 kV, and in 1998, at the RadTech North America '98 Conference in Chicago, the introduction of an 80 kV electron beam processor under the designation Microbeam LV
Intermodulation Linearity in High-k/Metal Gate 28 nm RF CMOS Transistors
Directory of Open Access Journals (Sweden)
Zhen Li
2015-09-01
Full Text Available This paper presents experimental characterization, simulation, and Volterra series based analysis of intermodulation linearity on a high-k/metal gate 28 nm RF CMOS technology. A figure-of-merit is proposed to account for both VGS and VDS nonlinearity, and extracted from frequency dependence of measured IIP3. Implications to biasing current and voltage optimization for linearity are discussed.
Bio-Inspired Carbon Monoxide Sensors with Voltage-Activated Sensitivity
Savagatrup, Suchol; Schroeder, Vera; He, Xin; Lin, Sibo; He, Maggie; Yassine, Omar; Salama, Khaled N.; Zhang, Xixiang; Swager, Timothy M.
2017-01-01
voltage offers a predicted extra dimension for sensing. Specifically, the sensors show a significant increase in sensitivity toward CO when negative gate voltage is applied. The dosimetric sensors are selective to ppm levels of CO and functional in air. UV
Harmonic current interaction at a low voltage customer's installations
Bhattacharyya, S.; Myrzik, J.M.A.; Kling, W.L.; Cobben, J.F.G.; Casteren, van J.
2009-01-01
The increased uses of power electronics and switching devices in the electricity network have changed the operational environment of the power system. These devices have nonlinear voltage-current characteristics and produce harmonic currents, and consequently distort the voltage waveform. A low
DEFF Research Database (Denmark)
Lee, Kyo-Beum; Blaabjerg, Frede
2004-01-01
This paper presents a new sensorless vector control system for high performance induction motor drives fed by a matrix converter with non-linearity compensation. The nonlinear voltage distortion that is caused by commutation delay and on-state voltage drop in switching device is corrected by a new...
International Nuclear Information System (INIS)
Li Da-Wei; Qin Jun-Rui; Chen Shu-Ming
2013-01-01
Using computer-aided design three-dimensional simulation technology, the supply voltage scaled dependency of the recovery of single event upset and charge collection in static random-access memory cells are investigated. It reveals that the recovery linear energy transfer threshold decreases with the supply voltage reducing, which is quite attractive for dynamic voltage scaling and subthreshold circuit radiation-hardened design. Additionally, the effect of supply voltage on charge collection is also investigated. It is concluded that the supply voltage mainly affects the bipolar gain of the parasitical bipolar junction transistor (BJT) and the existence of the source plays an important role in supply voltage variation. (geophysics, astronomy, and astrophysics)
Directory of Open Access Journals (Sweden)
A. V. Мironovich
2005-01-01
Full Text Available Investigation of a nontransformer stepping-up converter of dc voltage has been carried out. A non-linear structural circuit of the converter has been developed with the help of the controlled current injection method. A linearization of an object and an automation control system synthesis have been conducted applying method of successive optimization of the circuits. The paper contains results of transient process simulation in the linear computer model and in the power electronics computer model.
Non-sparking anodization process of AZ91D magnesium alloy under low AC voltage
Energy Technology Data Exchange (ETDEWEB)
Li, Weiping, E-mail: liweiping@buaa.edu.cn [Key Laboratory of Aerospace Materials and Performance (Ministry of Education), School of Materials Science and Engineering, Beihang University, Beijing 100191 (China); Li, Wen [AVIC Beijing Aeronautical Manufacturing Technology Research Institue, Beijing 100024 (China); Zhu, Liqun; Liu, Huicong; Wang, Xiaofang [Key Laboratory of Aerospace Materials and Performance (Ministry of Education), School of Materials Science and Engineering, Beihang University, Beijing 100191 (China)
2013-04-20
Highlights: ► Four different processes appear on magnesium alloys with applied voltage increase. ► Non-sparking film formation process occurred in the range of 6–10 V AC. ► The film was composed of Mg{sub 2}SiO{sub 4} with a stable growth rate in 30 min. ► Film growth was a balance of electrochemical dissolution and chemical deposition. -- Abstract: Anodization is widely recognized as one of the most important surface treatments for magnesium alloys. However, since high voltage oxidation films are limited in some applications due to porosity and brittleness, it is worthwhile to explore the non-sparking oxidizing process. In this work, AZ91D was electrochemically anodized at different AC voltages in an electrolyte containing 120 g/L NaOH and 80 g/L Na{sub 2}SiO{sub 3}·9H{sub 2}O. The effects of voltage on the surface morphology, composition and reaction process, especially the non-sparking discharge anodic film formation process, were investigated. The results showed that four different processes would appear according to the applied voltage variation from 6 V to 40 V, and that the non-sparking film formation process occurred in the range of 6–10 V. The film formed on the AZ91D surface under 10 V AC was mainly composed of Mg{sub 2}SiO{sub 4} with a lamellar structure. The horizontal and vertical expansion of the lamellar structure resulted in the formation of a multi-layered structure with a stable, linear growth rate for 30 min. The non-sparking film formation process can be considered to be the result of a balance of electrochemical dissolution and chemical deposition reaction.
On-site voltage measurement with capacitive sensors on high voltage systems
Wu, L.; Wouters, P.A.A.F.; Heesch, van E.J.M.; Steennis, E.F.
2011-01-01
In Extra/High-Voltage (EHV/HV) power systems, over-voltages occur e.g. due to transients or resonances. At places where no conventional voltage measurement devices can be installed, on-site measurement of these occurrences requires preferably non intrusive sensors, which can be installed with little
Thermal voltage noise in layered superconductors
International Nuclear Information System (INIS)
Ashkenazy, V.D.; Jung, G.; Shapiro, B.Y.
1995-01-01
Thermal voltage noise in the mixed state of type-II superconductors has been calculated taking into account fluctuation modes of nonrigid vortices. It has been shown that bending of vortices leads to new effects in thermal-voltage-noise spectra at high frequencies. The power spectrum reflecting fluctuations of rigid vortices is suppressed at very low frequencies and saturates into a white spectrum at a characteristic frequency depending on the strip width. At high frequencies tilt modes of flexible vortices start to contribute to the fluctuating voltages and the power spectrum undergoes three subsequent magnitude increases, following ω 1/2 -, ω 2 -, and again ω 1/2 -like behavior before becoming white again. It has been shown that for layered superconductors of a moderate anisotropy the second ω 1/2 -like increase disappears at magnetic fields exceeding a certain threshold field corresponding to the crossover field between two-dimensional and three-dimensional vortex-lattice melting. Field dependencies of characteristic frequencies separating different regimes of spectral behavior have been evaluated and shown to be qualitatively different for low and high magnetic fields
Voltage and temperature dependence of the grain boundary tunneling magnetoresistance in manganites
Hoefener, C.; Philipp, J. B.; Klein, J.; Alff, L.; Marx, A.; Buechner, B.; Gross, R.
2000-01-01
We have performed a systematic analysis of the voltage and temperature dependence of the tunneling magnetoresistance (TMR) of grain boundaries (GB) in the manganites. We find a strong decrease of the TMR with increasing voltage and temperature. The decrease of the TMR with increasing voltage scales with an increase of the inelastic tunneling current due to multi-step inelastic tunneling via localized defect states in the tunneling barrier. This behavior can be described within a three-current...
Rizk, Farouk AM
2014-01-01
Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec
Device for monitoring cell voltage
Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE
2012-08-21
A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.
Graham, Kenneth; Erwin, Patrick; Nordlund, Dennis; Vandewal, Koen; Li, Ruipeng; Ngongang Ndjawa, Guy Olivier; Hoke, Eric T.; Salleo, Alberto; Thompson, Mark E.; McGehee, Michael D.; Amassian, Aram
2013-01-01
The effects of sterics and molecular orientation on the open-circuit voltage and absorbance properties of charge-transfer states are explored in model bilayer organic photovoltaics. It is shown that the open-circuit voltage correlates linearly with the charge-transfer state energy and is not significantly influenced by electronic coupling. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Graham, Kenneth
2013-07-30
The effects of sterics and molecular orientation on the open-circuit voltage and absorbance properties of charge-transfer states are explored in model bilayer organic photovoltaics. It is shown that the open-circuit voltage correlates linearly with the charge-transfer state energy and is not significantly influenced by electronic coupling. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DEFF Research Database (Denmark)
Kutluyarov, Ruslan V.; Bagmanov, Valeriy Kh; Antonov, Vyacheslav V.
2017-01-01
This paper is focused on the analysis of linear and nonlinear mode coupling in space division multiplexed (SDM) optical communications over step-index fiber in few-mode regime. Linear mode coupling is caused by the fiber imperfections, while the nonlinear coupling is caused by the Kerr......-nonlinearities. Therefore, we use the system of generalized coupled nonlinear Schrödinger equations (GCNLSE) to describe the signal propagation. We analytically show that the presence of linear mode coupling may cause increasing of the nonlinear signal distortions. For the detailed study we solve GCNLSE numerically...... for the standard step index fiber at the wavelength of 850 nm in the basis of spatial modes with helical phase front (vortex modes) and for a special kind of few-mode fiber with enlarged core, providing propagation of five spatial modes at 1550 nm. Simulation results confirm that the linear mode coupling may lead...
Voltage scheduling for low power/energy
Manzak, Ali
2001-07-01
Power considerations have become an increasingly dominant factor in the design of both portable and desk-top systems. An effective way to reduce power consumption is to lower the supply voltage since voltage is quadratically related to power. This dissertation considers the problem of lowering the supply voltage at (i) the system level and at (ii) the behavioral level. At the system level, the voltage of the variable voltage processor is dynamically changed with the work load. Processors with limited sized buffers as well as those with very large buffers are considered. Given the task arrival times, deadline times, execution times, periods and switching activities, task scheduling algorithms that minimize energy or peak power are developed for the processors equipped with very large buffers. A relation between the operating voltages of the tasks for minimum energy/power is determined using the Lagrange multiplier method, and an iterative algorithm that utilizes this relation is developed. Experimental results show that the voltage assignment obtained by the proposed algorithm is very close (0.1% error) to that of the optimal energy assignment and the optimal peak power (1% error) assignment. Next, on-line and off-fine minimum energy task scheduling algorithms are developed for processors with limited sized buffers. These algorithms have polynomial time complexity and present optimal (off-line) and close-to-optimal (on-line) solutions. A procedure to calculate the minimum buffer size given information about the size of the task (maximum, minimum), execution time (best case, worst case) and deadlines is also presented. At the behavioral level, resources operating at multiple voltages are used to minimize power while maintaining the throughput. Such a scheme has the advantage of allowing modules on the critical paths to be assigned to the highest voltage levels (thus meeting the required timing constraints) while allowing modules on non-critical paths to be assigned
A new approach to voltage sag detection based on wavelet transform
Energy Technology Data Exchange (ETDEWEB)
Gencer, Oezguer; Oeztuerk, Semra; Erfidan, Tarik [Kocaeli University, Faculty of Engineering, Department of Electrical Engineering, Veziroglu Kampuesue, Eski Goelcuek Yolu, Kocaeli (Turkey)
2010-02-15
In this work, a new voltage sag detection method based on wavelet transform is developed. Voltage sag detection algorithms, so far have proved their efficiency and computational ability. Using several windowing techniques take long computational times for disturbance detection. Also researchers have been working on separating voltage sags from other voltage disturbances for the last decade. Due to increasing power quality standards new high performance disturbance detection algorithms are necessary to obtain high power quality standards. For this purpose, the wavelet technique is used for detecting voltage sag duration and magnitude. The developed voltage sag detection algorithm is implemented with high speed microcontroller. Test results show that, the new approach provides very accurate and satisfactory voltage sag detection. (author)
Non-linear response of electrode-electrolyte interface at high current density
International Nuclear Information System (INIS)
Ruiz, G.A.; Felice, C.J.; Valentinuzzi, M.E.
2005-01-01
A distributed parameter non-linear circuit is presented as fractal model of an electrode-electrolyte interface. It includes the charge transfer resistance and the double layer capacitance at each fractal level. The circuit explains the linear behavior of its series equivalent resistance R eq with signals of amplitudes eq Fourier spectrum. As a consequence, both the equivalent resistance and reactance drop with voltage, facts reported experimentally by other authors
Loss Minimization and Voltage Control in Smart Distribution Grid
DEFF Research Database (Denmark)
Juelsgaard, Morten; Sloth, Christoffer; Wisniewski, Rafal
2014-01-01
This work presents a strategy for increasing the installation of electric vehicles and solar panels in low-voltage grids, while obeying voltage variation constraints. Our approach employs minimization of active power losses for coordinating consumption and generation of power, as well as reactive...
Voltage stability in low voltage microgrids in aspects of active and reactive power demand
Directory of Open Access Journals (Sweden)
Parol Mirosław
2016-03-01
Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.
76 FR 70721 - Voltage Coordination on High Voltage Grids; Notice of Staff Workshop
2011-11-15
... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Staff Workshop Take notice that the Federal Energy Regulatory Commission will hold a Workshop on Voltage Coordination on High Voltage Grids on Thursday, December 1, 2011...
High voltage switches having one or more floating conductor layers
Werne, Roger W.; Sampayan, Stephen; Harris, John Richardson
2015-11-24
This patent document discloses high voltage switches that include one or more electrically floating conductor layers that are isolated from one another in the dielectric medium between the top and bottom switch electrodes. The presence of the one or more electrically floating conductor layers between the top and bottom switch electrodes allow the dielectric medium between the top and bottom switch electrodes to exhibit a higher breakdown voltage than the breakdown voltage when the one or more electrically floating conductor layers are not present between the top and bottom switch electrodes. This increased breakdown voltage in the presence of one or more electrically floating conductor layers in a dielectric medium enables the switch to supply a higher voltage for various high voltage circuits and electric systems.
Ketabi, N; Mobasheri, H; Faraji-Dana, R
2015-03-01
The effects of ultra high frequency (UHF) nonionizing electromagnetic fields (EMF) on the channel activities of nanopore forming protein, OmpF porin, were investigated. The voltage clamp technique was used to study the single channel activity of the pore in an artificial bilayer in the presence and absence of the electromagnetic fields at 910 to 990 MHz in real time. Channel activity patterns were used to address the effect of EMF on the dynamic, arrangement and dielectric properties of water molecules, as well as on the hydration state and arrangements of side chains lining the channel barrel. Based on the varied voltage sensitivity of the channel at different temperatures in the presence and absence of EMF, the amount of energy transferred to nano-environments of accessible groups was estimated to address the possible thermal effects of EMF. Our results show that the effects of EMF on channel activities are frequency dependent, with a maximum effect at 930 MHz. The frequency of channel gating and the voltage sensitivity is increased when the channel is exposed to EMF, while its conductance remains unchanged at all frequencies applied. We have not identified any changes in the capacitance and permeability of membrane in the presence of EMF. The effect of the EMF irradiated by cell phones is measured by Specific Absorption Rate (SAR) in artificial model of human head, Phantom. Thus, current approach applied to biological molecules and electrolytes might be considered as complement to evaluate safety of irradiating sources on biological matter at molecular level.
International Nuclear Information System (INIS)
Birinyi-Strachan, Liesl C.; Gunning, Simon J.; Lewis, Richard J.; Nicholson, Graham M.
2005-01-01
The present study investigated the actions of the polyether marine toxin Pacific ciguatoxin-1 (P-CTX-1) on neuronal excitability in rat dorsal root ganglion (DRG) neurons using patch-clamp recording techniques. Under current-clamp conditions, bath application of 2-20 nM P-CTX-1 caused a rapid, concentration-dependent depolarization of the resting membrane potential in neurons expressing tetrodotoxin (TTX)-sensitive voltage-gated sodium (Na v ) channels. This action was completely suppressed by the addition of 200 nM TTX to the external solution, indicating that this effect was mediated through TTX-sensitive Na v channels. In addition, P-CTX-1 also prolonged action potential and afterhyperpolarization (AHP) duration. In a subpopulation of neurons, P-CTX-1 also produced tonic action potential firing, an effect that was not accompanied by significant oscillation of the resting membrane potential. Conversely, in neurons expressing TTX-resistant Na v currents, P-CTX-1 failed to alter any parameter of neuronal excitability examined in this study. Under voltage-clamp conditions in rat DRG neurons, P-CTX-1 inhibited both delayed-rectifier and 'A-type' potassium currents in a dose-dependent manner, actions that occurred in the absence of alterations to the voltage dependence of activation. These actions appear to underlie the prolongation of the action potential and AHP, and contribute to repetitive firing. These data indicate that a block of potassium channels contributes to the increase in neuronal excitability, associated with a modulation of Na v channel gating, observed clinically in response to ciguatera poisoning
International Nuclear Information System (INIS)
Kraus, H.G.; Jones, J.L.
1986-01-01
The problem of non-linear superconducting magnet and electrical protection circuit system transients is formulated. To enable studying the effects of coil normalization transients, coil distortion (due to imbalanced magnetic forces), internal coil arcs and shorts, and other normal and off-normal circuit element responses, the following capabilities are included: temporal, voltage and current-dependent voltage sources, current sources, resistors, capacitors and inductors. The concept of self-mutual inductance, and the form of the associated inductance matrix, is discussed for internally shorted coils. This is a Kirchhoff's voltage loop law and Kirchhoff's current node law formulation. The non-linear integrodifferential equation set is solved via a unique hybrid finite difference/integral finite element technique. (author)
The effect of external visible light on the breakdown voltage of a long discharge tube
Shishpanov, A. I.; Ionikh, Yu. Z.; Meshchanov, A. V.
2016-06-01
The breakdown characteristics of a discharge tube with a configuration typical of gas-discharge light sources and electric-discharge lasers (a so-called "long discharge tube") filled with argon or helium at a pressure of 1 Torr have been investigated. A breakdown has been implemented using positive and negative voltage pulses with a linear leading edge having a slope dU/ dt ~ 10-107 V/s. Visible light from an external source (halogen incandescent lamp) is found to affect the breakdown characteristics. The dependences of the dynamic breakdown voltage of the tube on dU/ dt and on the incident light intensity are measured. The breakdown voltage is found to decrease under irradiation of the high-voltage anode of the tube in a wide range of dU/ dt. A dependence of the effect magnitude on the light intensity and spectrum is obtained. Possible physical mechanisms of this phenomenon are discussed.
Power angle control of grid-connected voltage source converter in a wind energy application
Energy Technology Data Exchange (ETDEWEB)
Svensson, Jan [Chalmers Univ. of Technology, Goeteborg (Sweden). Dept. of Electric Power Engineering
1996-12-31
In this thesis, the connection of a voltage source converter to the grid in a wind energy application is examined. The possibility of using a cheap control system without grid current measurements, is investigated. The control method is based on controlling the voltage angle of the inverter, which governs the active power flow. The highest frequency of the power variation, coming from wind turbine, is approx. 5 Hz. Since the proposed control method easily can handle such power variations it is very well suited for wind turbine applications. The characteristics of the system depend on the DC-link capacitor, the grid filter inductance and resistance. Large values of the resistance damp the system well but increase the energy losses. A high inductance leads to a reduced harmonic level on the grid but makes the system slower. By using feed-forward of the generator/rectifier current signal, the performance is increased compared to an ordinary PI-control. Combining the Linear Quadratic (LQ) control method with Kalman filtered input signals, a robust control method with a good performance is obtained. The LQ controller controls both the phase displacement angle and the modulation index, resulting in higher bandwidth, and the typical power angle resonance at the grid frequency disappears. 22 refs, 109 figs, 14 tabs
State reference design and saturated control of doubly-fed induction generators under voltage dips
Tilli, Andrea; Conficoni, Christian; Hashemi, Ahmad
2017-04-01
In this paper, the stator/rotor currents control problem of doubly-fed induction generator under faulty line voltage is carried out. Common grid faults cause a steep decline in the line voltage profile, commonly denoted as voltage dip. This point is critical for such kind of machines, having their stator windings directly connected to the grid. In this respect, solid methodological nonlinear control theory arguments are exploited and applied to design a novel controller, whose main goal is to improve the system behaviour during voltage dips, endowing it with low voltage ride through capability, a fundamental feature required by modern Grid Codes. The proposed solution exploits both feedforward and feedback actions. The feedforward part relies on suitable reference trajectories for the system internal dynamics, which are designed to prevent large oscillations in the rotor currents and command voltages, excited by line perturbations. The feedback part uses state measurements and is designed according to Linear Matrix Inequalities (LMI) based saturated control techniques to further reduce oscillations, while explicitly accounting for the system constraints. Numerical simulations verify the benefits of the internal dynamics trajectory planning, and the saturated state feedback action, in crucially improving the Doubly-Fed Induction Machine response under severe grid faults.
Yang, Z.; Li, X.; Li, J.; Long, J. D.; Lan, C. H.; Wang, T.; Dong, P.; He, J. L.
2017-03-01
A large amount of back streaming electrons will bring about a part of current drain on power supply, cause sparking or high-voltage breakdowns, and affect the neutron yield and waveform for a compact sealed-tube pulsed neutron generator. A novel idea which uses a ZnO varistor to provide a constant self-biased voltage to suppress the secondary electrons is introduced. The I-V curve for the ZnO varistor was measured in the experiment. The effects of suppressing the secondary electrons were investigated using a ZnO varistor, linear resistors, and an independent power supply, respectively. The results show that the secondary electrons are suppressed effectively by the compact ZnO varistor, while not increasing the size and the component of the device. It is a promising design for compact sealed-tube neutron generators.
Current-voltage characteristics of porous-silicon structures
International Nuclear Information System (INIS)
Diligenti, A.; Nannini, A.; Pennelli, G.; Pieri, F.; Fuso, F.; Allegrini, M.
1996-01-01
I-V DC characteristics have been measured on metal/porous-silicon structures. In particular, the measurements on metal/free-standing porous-silicon film/metal devices confirmed the result, already obtained, that the metal/porous-silicon interface plays a crucial role in the transport of any device. Four-contacts measurements on free-standing layers showed that the current linearly depends on the voltage and that the conduction process is thermally activated, the activation energy depending on the porous silicon film production parameters. Finally, annealing experiments performed in order to improve the conduction of rectifying contacts, are described
Myrzik, J.M.A.; Duarte, J.L.; Haardt, de P.; Vissers, J.
2002-01-01
An application of the transformer-assisted PWM zero-voltage switching pole inverter (TRAP) is described in this paper. The TRAP is based on the auxiliary resonant commutated pole inverter (ARCP), but avoids its disadvantages. This paper describes the converter functionality and its applicability
Directory of Open Access Journals (Sweden)
Yanbin Hou
2016-01-01
Full Text Available Compared with conventional Class-A, Class-B, and Class-AB amplifiers, Class-D amplifier, also known as switching amplifier, employs pulse width modulation (PWM technology and solid-state switching devices, capable of achieving much higher efficiency. However, PWM-based switching amplifier is usually designed for low-voltage application, offering a maximum output voltage of several hundred Volts. Therefore, a step-up transformer is indispensably adopted in PWM-based Class-D amplifier to produce high-voltage output. In this paper, a switching amplifier without step-up transformer is developed based on digital pulse step modulation (PSM and hybrid multilevel converter. Under the control of input signal, cascaded power converters with separate DC sources operate in PSM switch mode to directly generate high-voltage and high-power output. The relevant topological structure, operating principle, and design scheme are introduced. Finally, a prototype system is built, which can provide power up to 1400 Watts and peak voltage up to ±1700 Volts. And the performance, including efficiency, linearity, and distortion, is evaluated by experimental tests.
International Nuclear Information System (INIS)
Swain, R.; Jena, K.; Lenka, T. R.
2016-01-01
In this paper, an AlN/GaN-based MOSHEMT is proposed, in accordance to this, a charge control model has been developed analytically and simulated with MATLAB to predict the characteristics of threshold voltage, drain currents and transconductance. The physics based models for 2DEG density, threshold voltage and quantum capacitance in the channel has been put forward. By using these developed models, the drain current for both linear and saturation models is derived. The predicted threshold voltage with the variation of barrier thickness has been plotted. A positive threshold voltage can be obtained by decreasing the barrier thickness which builds up the foundation for enhancement mode MOSHEMT devices. The predicted I_d–V_g_s, I_d–V_d_s and transconductance characteristics show an excellent agreement with the experimental results and hence validate the model.
High current, 0.5-MA, fast, 100-ns, linear transformer driver experiments
Directory of Open Access Journals (Sweden)
Michael G. Mazarakis
2009-05-01
Full Text Available The linear transformer driver (LTD is a new method for constructing high current, high-voltage pulsed accelerators. The salient feature of the approach is switching and inductively adding the pulses at low voltage straight out of the capacitors through low inductance transfer and soft iron core isolation. Sandia National Laboratories are actively pursuing the development of a new class of accelerator based on the LTD technology. Presently, the high current LTD experimental research is concentrated on two aspects: first, to study the repetition rate capabilities, reliability, reproducibility of the output pulses, switch prefires, jitter, electrical power and energy efficiency, and lifetime measurements of the cavity active components; second, to study how a multicavity linear array performs in a voltage adder configuration relative to current transmission, energy and power addition, and wall plug to output pulse electrical efficiency. Here we report the repetition rate and lifetime studies performed in the Sandia High Current LTD Laboratory. We first utilized the prototype ∼0.4-MA, LTD I cavity which could be reliably operated up to ±90-kV capacitor charging. Later we obtained an improved 0.5-MA, LTD II version that can be operated at ±100 kV maximum charging voltage. The experimental results presented here were obtained with both cavities and pertain to evaluating the maximum achievable repetition rate and LTD cavity performance. The voltage adder experiments with a series of double sized cavities (1 MA, ±100 kV will be reported in future publications.
Current-Voltage Characteristics of Bi-dithiolbenzene in Parallel Arrangement
International Nuclear Information System (INIS)
Boudjella, Aissa
2011-01-01
The low voltage conductance of interacting two 1,4-dithiolbenzene (DTB) molecules is investigated. The simulation results show that the electron transport can be controlled either by changing the Fermi level position E f or modifying its inter-molecular spacing d. Molecular assembly system with close interaction between DTB units, affects significantly the conductance. In addition, the position of the Fermi plays an important role in determining the current flow. Moreover, it is important to note that E f affects not only the threshold voltage V th , but also the saturation voltage V sat . When E f approaches the LUMO energy level, V th decreases, while V sat increases. To conclude, the threshold voltage and the saturation voltage depend on the Fermi level position and the inter-molecular spacing.
Linear resonance acceleration of pellets
International Nuclear Information System (INIS)
Mills, R.G.
1978-01-01
A possible requirement for the acceleration of macroscopic pellets to velocities exceeding 10 4 meters per second implies the development of new apparatus. A satisfactory approach might be the linear resonance accelerator. Such apparatus would require the charging of pellets to very high values not yet demonstrated. The incompatibility of phase stability with radial stability in these machines may require abandoning phase stability and adopting feedback control of the accelerating voltage to accommodate statistical fluctuations in the charge to mass ratio of successive pellets
Influence of current limitation on voltage stability with voltage sourced converter HVDC
DEFF Research Database (Denmark)
Zeni, Lorenzo; Jóhannsson, Hjörtur; Hansen, Anca Daniela
2013-01-01
A first study of voltage stability with relevant amount of Voltage Sourced Converter based High Voltage Direct Current (VSC-HVDC) transmission is presented, with particular focus on the converters’ behaviour when reaching their rated current. The detrimental effect of entering the current...
Contacts, non-linear transport effects and failure in multi-walled carbon nanotubes
International Nuclear Information System (INIS)
Berger, C; Yi, Y; Gezo, J; Poncharal, P; Heer, W A de
2003-01-01
Pristine arc-produced multi-walled carbon nanotubes are contacted to liquid mercury in situ in a transmission electron microscope. The conductance G(V) for all tubes increases with increasing bias voltage V. This is related to the electronic density of the nanotubes. Similar G(V) behaviour is observed for HOPG-graphite contacted in air with Hg, with dG(V)/dV∼0.3G 0 . Variations observed in the conductance are related to nanotube-Hg contact effects. For tubes barely touching the Hg surface, the conductance is low (typically G(V=0)∼0.1-0.5G 0 ); G(V) may maximize around V=1.5-2 V or continue to increase linearly depending on the MWNT-Hg contact. For good contacts the maximum low-bias conductance is 1G 0 . Non-conducting tubes are observed having a low-bias conductance smaller than 10 -3 G 0 . High-voltage tube failure usually occurs at the contact with Hg for clean tubes, or at tube defects. An important phenomenon is the formation of a Hg bubble near the contact nanotube-Hg surface when the nanotube is negatively biased, under high bias current conditions, indicating the heating effect of hot electrons injected into the mercury
Molecular mechanism of voltage sensing in voltage-gated proton channels
Rebolledo, Santiago; Perez, Marta E.
2013-01-01
Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575
Non-linear effects and thermoelectric efficiency of quantum dot-based single-electron transistors.
Talbo, Vincent; Saint-Martin, Jérôme; Retailleau, Sylvie; Dollfus, Philippe
2017-11-01
By means of advanced numerical simulation, the thermoelectric properties of a Si-quantum dot-based single-electron transistor operating in sequential tunneling regime are investigated in terms of figure of merit, efficiency and power. By taking into account the phonon-induced collisional broadening of energy levels in the quantum dot, both heat and electrical currents are computed in a voltage range beyond the linear response. Using our homemade code consisting in a 3D Poisson-Schrödinger solver and the resolution of the Master equation, the Seebeck coefficient at low bias voltage appears to be material independent and nearly independent on the level broadening, which makes this device promising for metrology applications as a nanoscale standard of Seebeck coefficient. Besides, at higher voltage bias, the non-linear characteristics of the heat current are shown to be related to the multi-level effects. Finally, when considering only the electronic contribution to the thermal conductance, the single-electron transistor operating in generator regime is shown to exhibit very good efficiency at maximum power.
Special features of the current-voltage characteristics of short superconducting bridges
International Nuclear Information System (INIS)
Zhilinskii, S.; Latyshev, Y.; Nad', F.
1981-01-01
A study was made of variable-thickness superconducting bridges made of tin and indium. The current-voltage characteristics were determined for these bridges as a function of their length and width. The characteristics exhibited a linear region as well as an inflection. The temperature of the appearance of such an inflection depended on the length of the bridge but was independent of the bridge material
International Nuclear Information System (INIS)
Frick, G.; Osswald, F.; Heusch, B.
1996-01-01
Preliminary investigations showed clearly that, because of the discrete electrode structure of the Vivitron, important overvoltage leading to insulator damage can appear in case of a spark. The first high voltage tests showed damage connected with such events. This fact leads to a severe voltage limitation. This work describes, at first, studies made to understand the effects of transients and the associated over-voltage appearing in the Vivitron. Then we present the high voltage tests made with full size Vivitron components using the CN 6 MV machine as a pilot machine. Extensive field calculations were made. These involve simulations of static stresses and transient overvoltages, on insulating boards and electrodes. This work gave us the solutions for arrangements and modifications in the machine. After application, the Vivitron runs now without any sparks and damage at 20 MV. In the same manner, we tested column insulators of a new design and so we will find out how to get to higher voltages. Electric field calculation around the tie bars connecting the discrete electrodes together showed field enhancements when the voltages applied on the discrete electrodes are not equally distributed. This fact is one of the sources of discharges and voltage limitations. A scenario of a spark event is described and indications are given how to proceed towards higher voltages, in the 30 MV range. (orig.)
Dual voltage source inverter topology extending machine operating range
Gerrits, T.; Wijnands, C.G.E.; Paulides, J.J.H.; Duarte, J.L.
2012-01-01
Field weakening operation of an electrical machine is a conventional method to extend the angular velocity range of a system above the peak output voltage of the inverter. A downside, however, is that an increased reactive current is required that creates losses but no output torque. A dual voltage
A linear current injection generator for the generation of electrons in a nuclear reactor
International Nuclear Information System (INIS)
Kar, Moutushi; Thakur, Satish Kumar; Agiwal, Mamta; Sholapurwala, Zarir H.
2011-01-01
While, operating a nuclear reactor it is absolutely necessary for generating a chain reaction or fission. A chain reaction can be initiated by bombardment of a heavy nucleus with fast moving particles. One of the common methods used for generating a fast moving particle is injecting a very high voltage into a particle accelerator and accelerating high energy particle beams using machine like cyclotron, synchrotron, linear accelerators i.e. linac and similar equipment. These equipment generated and run by several high voltage applications like simple high voltage DC systems and supplies or pulsed electron systems. (author)
Technological Aspects: High Voltage
Faircloth, D.C.
2013-12-16
This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.
DEFF Research Database (Denmark)
Farivar, Glen; Ghias, Amer M. Y. M.; Hredzak, Branislav
2017-01-01
This paper proposes a new method for measuring capacitor voltages in multilevel flying capacitor (FC) converters that requires only one voltage sensor per phase leg. Multiple dc voltage sensors traditionally used to measure the capacitor voltages are replaced with a single voltage sensor at the ac...... side of the phase leg. The proposed method is subsequently used to balance the capacitor voltages using only the measured ac voltage. The operation of the proposed measurement and balancing method is independent of the number of the converter levels. Experimental results presented for a five-level FC...
Hysteresis analysis of graphene transistor under repeated test and gate voltage stress
International Nuclear Information System (INIS)
Yang Jie; Jia Kunpeng; Su Yajuan; Zhao Chao; Chen Yang
2014-01-01
The current transport characteristic is studied systematically based on a back-gate graphene field effect transistor, under repeated test and gate voltage stress. The interface trapped charges caused by the gate voltage sweep process screens the gate electric field, and results in the neutral point voltage shift between the forth and back sweep direction. In the repeated test process, the neutral point voltage keeps increasing with test times in both forth and back sweeps, which indicates the existence of interface trapped electrons residual and accumulation. In gate voltage stress experiment, the relative neutral point voltage significantly decreases with the reducing of stress voltage, especially in −40 V, which illustrates the driven-out phenomenon of trapped electrons under negative voltage stress. (semiconductor devices)
International Nuclear Information System (INIS)
Ward, Kevin S.; Long, Finis W.; Sinebryukhov, Vadim A.; Kim, Alexandre A.; Wakeland, Peter Eric; McKee, G. Randall; Woodworth, Joseph Ray; McDaniel, Dillon Heirman; Fowler, William E.; Mazarakis, Michael Gerrassimos; Porter, John Larry Jr.; Struve, Kenneth William; Stygar, William A.; LeChien, Keith R.; Matzen, Maurice Keith
2010-01-01
Sandia National Laboratories, Albuquerque, N.M., USA, in collaboration with the High Current Electronic Institute (HCEI), Tomsk, Russia, is developing a new paradigm in pulsed power technology: the Linear Transformer Driver (LTD) technology. This technological approach can provide very compact devices that can deliver very fast high current and high voltage pulses straight out of the cavity with out any complicated pulse forming and pulse compression network. Through multistage inductively insulated voltage adders, the output pulse, increased in voltage amplitude, can be applied directly to the load. The load may be a vacuum electron diode, a z-pinch wire array, a gas puff, a liner, an isentropic compression load (ICE) to study material behavior under very high magnetic fields, or a fusion energy (IFE) target. This is because the output pulse rise time and width can be easily tailored to the specific application needs. In this paper we briefly summarize the developmental work done in Sandia and HCEI during the last few years, and describe our new MYKONOS Sandia High Current LTD Laboratory.
Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar; Akemann, Walther; Knöpfel, Thomas
2008-06-25
Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP) in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.
Directory of Open Access Journals (Sweden)
Lei Lan
2017-07-01
Full Text Available It is important to reveal the relations of physical factors to deposition of contaminants on insulator. In this paper, the simulation model of high voltage end of insulator was established to study the force and motion characteristics of particles affected by electric force and airflow drag force near the ultra-high voltage direct current (UHVDC insulator. By finite element method, the electric field was set specially to be similar to the one near practical insulator, the steady fluid field was simulated. The electric force and air drag force were loaded on the uniformly charged particles. The characteristics of the two forces on particles, the relationship between quantity of electric charge on particles and probability of particles contacting the insulator were analyzed. It was found that, near the sheds, airflow drag force on particles is significantly greater than electric force with less electric charge. As the charge multiplies, electric force increases linearly, airflow drag force grows more slowly. There is a trend that the magnitude of electric force and drag force is going to similar. Meanwhile, the probability of particles contacting the insulator is increased too. However, at a certain level of charge which has different value with different airflow velocity, the contact probability has extremum here. After exceeding the value, as the charge increasing, the contact probability decreases gradually.
Technological Aspects: High Voltage
International Nuclear Information System (INIS)
Faircloth, D C
2013-01-01
This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)
DEFF Research Database (Denmark)
Coppo, Massimiliano; Turri, Roberto; Marinelli, Mattia
2014-01-01
The paper studies a medium voltage-low voltage transformer with a decoupled on load tap changer capability on each phase. The overall objective is the evaluation of the potential benefits on a low voltage network of such possibility. A realistic Danish low voltage network is used for the analysis...
Automatic voltage imbalance detector
Bobbett, Ronald E.; McCormick, J. Byron; Kerwin, William J.
1984-01-01
A device for indicating and preventing damage to voltage cells such as galvanic cells and fuel cells connected in series by detecting sequential voltages and comparing these voltages to adjacent voltage cells. The device is implemented by using operational amplifiers and switching circuitry is provided by transistors. The device can be utilized in battery powered electric vehicles to prevent galvanic cell damage and also in series connected fuel cells to prevent fuel cell damage.
Directory of Open Access Journals (Sweden)
Alicia Lundby
2008-06-01
Full Text Available Ci-VSP contains a voltage-sensing domain (VSD homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development of a genetically encodable fluorescent protein voltage sensor (VSFP in which the fast, voltage-dependent conformational changes of the Ci-VSP voltage sensor are transduced to similarly fast fluorescence read-outs.
Ci, Penghong; Chen, Zhijiang; Liu, Guoxi; Dong, Shuxiang
2014-01-01
We report a piezoelectric linear motor made of a single Pb(Zr,Ti)O3 square-plate, which operates in two orthogonal and isomorphic face-diagonal-bending modes to produce precision linear motion. A 15 × 15 × 2 mm prototype was fabricated, and the motor generated a driving force of up to 1.8 N and a speed of 170 mm/s under an applied voltage of 100 Vpp at the resonance frequency of 136.5 kHz. The motor shows such advantages as large driving force under relatively low driving voltage, simple structure, and stable motion because of its isomorphic face-diagonal-bending mode.
Reducing burn-in voltage loss in polymer solar cells by increasing the polymer crystallinity
Heumueller, Thomas
2014-08-01
In order to commercialize polymer solar cells, the fast initial performance losses present in many high efficiency materials will have to be managed. This burn-in degradation is caused by light-induced traps and its characteristics depend on which polymer is used. We show that the light-induced traps are in the bulk of the active layer and we find a direct correlation between their presence and the open-circuit voltage loss in devices made with amorphous polymers. Solar cells made with crystalline polymers do not show characteristic open circuit voltage losses, even though light-induced traps are also present in these devices. This indicates that crystalline materials are more resistant against the influence of traps on device performance. Recent work on crystalline materials has shown there is an energetic driving force for charge carriers to leave amorphous, mixed regions of bulk heterojunctions, and charges are dominantly transported in pure, ordered phases. This energetic landscape allows efficient charge generation as well as extraction and also may benefit the stability against light-induced traps. This journal is © the Partner Organisations 2014.
Reversible voltage dependent transition of abnormal and normal bipolar resistive switching.
Wang, Guangyu; Li, Chen; Chen, Yan; Xia, Yidong; Wu, Di; Xu, Qingyu
2016-11-14
Clear understanding the mechanism of resistive switching is the important prerequisite for the realization of high performance nonvolatile resistive random access memory. In this paper, binary metal oxide MoO x layer sandwiched by ITO and Pt electrodes was taken as a model system, reversible transition of abnormal and normal bipolar resistive switching (BRS) in dependence on the maximum voltage was observed. At room temperature, below a critical maximum voltage of 2.6 V, butterfly shaped I-V curves of abnormal BRS has been observed with low resistance state (LRS) to high resistance state (HRS) transition in both polarities and always LRS at zero field. Above 2.6 V, normal BRS was observed, and HRS to LRS transition happened with increasing negative voltage applied. Temperature dependent I-V measurements showed that the critical maximum voltage increased with decreasing temperature, suggesting the thermal activated motion of oxygen vacancies. Abnormal BRS has been explained by the partial compensation of electric field from the induced dipoles opposite to the applied voltage, which has been demonstrated by the clear amplitude-voltage and phase-voltage hysteresis loops observed by piezoelectric force microscopy. The normal BRS was due to the barrier modification at Pt/MoO x interface by the accumulation and depletion of oxygen vacancies.
Directory of Open Access Journals (Sweden)
Jaw-Kuen Shiau
2015-04-01
Full Text Available This paper presents the design of a fuzzy-logic-based voltage-regulated solar power maximum power point tracking (MPPT system for applications involving hybrid power systems. The system contains a solar power system and battery as the primary and secondary power sources, respectively. The solar system alone supplies power to the electric motor and maintains the output voltage at a predetermined level when it has sufficient power. When the solar power is insufficient, the solar system is operated at its maximum power point (MPP and the battery is engaged to compensate for the insufficiency. First, a variant of the incremental conductance MPP condition was established. Under the MPP condition, the voltage-regulated MPPT system was formulated as a feedback control system, where the MPP condition and voltage regulation requirements were used as the system inputs. Next, a fuzzy controller was developed to perform the voltage-regulated MPPT function for the hybrid power system. A simulation model based on Matrix laboratory (MATLAB/SIMULINK (a block diagram environment for multi-domain simulation and model-based design and a piecewise linear electric circuit simulation (PLECS tool for controlling the dc motor velocity was developed to verify the voltage-regulated solar power MPPT system.
Energy Technology Data Exchange (ETDEWEB)
Chao, Jin Yu [Shanxi Province Key Laboratory High Gravity Chemical Engineering, North University of China, Taiyuan 030051 (China); Ningbo Institute of Material Technology and Engineering, Chinese Academy of Sciences, Ningbo 315201 (China); Zhu, Li Qiang, E-mail: lqzhu@nimte.ac.cn; Xiao, Hui [Ningbo Institute of Material Technology and Engineering, Chinese Academy of Sciences, Ningbo 315201 (China); Yuan, Zhi Guo, E-mail: ncityzg@163.com [Shanxi Province Key Laboratory High Gravity Chemical Engineering, North University of China, Taiyuan 030051 (China)
2015-12-21
Modulation of charge carrier density in condensed materials based on ionic/electronic interaction has attracted much attention. Here, protonic/electronic hybrid indium-zinc-oxide (IZO) transistors gated by chitosan based electrolyte were obtained. The chitosan-based electrolyte illustrates a high proton conductivity and an extremely strong proton gating behavior. The transistor illustrates good electrical performances at a low operating voltage of ∼1.0 V such as on/off ratio of ∼3 × 10{sup 7}, subthreshold swing of ∼65 mV/dec, threshold voltage of ∼0.3 V, and mobility of ∼7 cm{sup 2}/V s. Good positive gate bias stress stabilities are obtained. Furthermore, a low voltage driven resistor-loaded inverter was built by using an IZO transistor in series with a load resistor, exhibiting a linear relationship between the voltage gain and the supplied voltage. The inverter is also used for decreasing noises of input signals. The protonic/electronic hybrid IZO transistors have potential applications in biochemical sensors and portable electronics.
Directory of Open Access Journals (Sweden)
Juan Miguel Astorga Gómez
2015-04-01
Full Text Available En este artículo se evalúan las armónicas individuales de tensión como función de las armónicas individuales de corriente usando los análisis estadísticos de regresión lineal simple, regresión polinomial y regresión lineal múltiple. Para la selección del modelo, se usan el coeficiente de determinación R2 y el criterio de información de Akaike (AIC. Se utiliza como caso de estudio un sistema eléctrico de un proceso minero ubicado en la región de Atacama Copiapó Chile, que ocupa la técnica de electro obtención de cobre como parte principal de su proceso productivo. Se muestran y comparan los resultados para los distintos modelos estadísticos y se discute la información de éstos para el estudio de calidad de energía. Finalmente, usando el modelo que mejor se ajusta a las mediciones de armónicas de tensión y corriente, se muestran algunas predicciones para la componente armónica dominante de tensión. This paper assesses the individual voltage harmonics as a function of the individual current harmonics using the statistical analyses of simple linear regression, polynomial regression and multiple linear regression. For model choice, the coefficient of determination R2 and Akaike information criterion (AIC are used. A mining process electrical system located in the Atacama Copiapó Chile, is used as a case study. This uses the technique copper electrowining as the main part of its production process. The results for different statistical models are shown and their information discussed for the power quality study. Finally, using the model that better fits to the measurements of voltage and current harmonics, some predictions for the dominant voltage harmonic are shown.
MEMS earthworm: a thermally actuated peristaltic linear micromotor
Arthur, Craig; Ellerington, Neil; Hubbard, Ted; Kujath, Marek
2011-03-01
This paper examines the design, fabrication and testing of a bio-mimetic MEMS (micro-electro mechanical systems) earthworm motor with external actuators. The motor consists of a passive mobile shuttle with two flexible diamond-shaped segments; each segment is independently squeezed by a pair of stationary chevron-shaped thermal actuators. Applying a specific sequence of squeezes to the earthworm segments, the shuttle can be driven backward or forward. Unlike existing inchworm drives that use clamping and thrusting actuators, the earthworm actuators apply only clamping forces to the shuttle, and lateral thrust is produced by the shuttle's compliant geometry. The earthworm assembly is fabricated using the PolyMUMPs process with planar dimensions of 400 µm width by 800 µm length. The stationary actuators operate within the range of 4-9 V and provide a maximum shuttle range of motion of 350 µm (approximately half its size), a maximum shuttle speed of 17 mm s-1 at 10 kHz, and a maximum dc shuttle force of 80 µN. The shuttle speed was found to vary linearly with both input voltage and input frequency. The shuttle force was found to vary linearly with the actuator voltage.
MEMS earthworm: a thermally actuated peristaltic linear micromotor
International Nuclear Information System (INIS)
Arthur, Craig; Ellerington, Neil; Hubbard, Ted; Kujath, Marek
2011-01-01
This paper examines the design, fabrication and testing of a bio-mimetic MEMS (micro-electro mechanical systems) earthworm motor with external actuators. The motor consists of a passive mobile shuttle with two flexible diamond-shaped segments; each segment is independently squeezed by a pair of stationary chevron-shaped thermal actuators. Applying a specific sequence of squeezes to the earthworm segments, the shuttle can be driven backward or forward. Unlike existing inchworm drives that use clamping and thrusting actuators, the earthworm actuators apply only clamping forces to the shuttle, and lateral thrust is produced by the shuttle's compliant geometry. The earthworm assembly is fabricated using the PolyMUMPs process with planar dimensions of 400 µm width by 800 µm length. The stationary actuators operate within the range of 4–9 V and provide a maximum shuttle range of motion of 350 µm (approximately half its size), a maximum shuttle speed of 17 mm s −1 at 10 kHz, and a maximum dc shuttle force of 80 µN. The shuttle speed was found to vary linearly with both input voltage and input frequency. The shuttle force was found to vary linearly with the actuator voltage.
Kim, Diana H; Verdino, Ralph J
To define clinical correlates of low voltage isolated to precordial leads on the surface electrocardiogram (ECG). Low voltage (V) on the ECG is defined as QRS Vvoltage isolated to the precordial leads with normal limb lead voltages is unclear. Twelve-lead ECGs with QRS V>5mm in one or more limb leads and voltage was found in 256 of 150,000 ECGs (~0.2%). 50.4% of patients had discordant ECGs that correlated with classic etiologies, with a higher incidence of LV dilation in those with classic etiologies than those without. Low precordial voltage is associated with classic etiologies and LV dilation. Copyright © 2017 Elsevier Inc. All rights reserved.
Linearity correction device for a scintillation camera
Energy Technology Data Exchange (ETDEWEB)
Lange, Kai
1978-06-16
This invention concerns the scintillation cameras still called gamma ray camera. The invention particularly covers the improvement in the resolution and the uniformity of these cameras. Briefly, in the linearity correction device of the invention, the sum is made of the voltage signals of different amplitudes produced by the preamplifiers of all the photomultiplier tubes and the signal obtained is employed to generate bias voltages which represent predetermined percentages of the sum signal. In one design mode, pairs of transistors are blocked when the output signal of the corresponding preamplifier is under a certain point on its gain curve. When the summation of the energies of a given scintillation exceeds this level which corresponds to a first percentage of the total signal, the first transistor of each pair of each line is unblocked, thereby modifying the gain and curve slop. When the total energy of an event exceeds the next preset level, the second transistor is unblocked to alter the shape again, so much so that the curve shows two break points. If needs be, the device can be designed so as to obtain more break points for the increasingly higher levels of energy. Once the signals have been processed as described above, they may be used for calculating the co-ordinates of the scintillation by one of the conventional methods.
Impact of distributed generators on the power loss and voltage profile of sub-transmission network
Directory of Open Access Journals (Sweden)
A.S.O. Ogunjuyigbe
2016-05-01
Full Text Available This paper presents the impact of distributed generator (DG on the power loss and voltage profile of sub-transmission network at different penetration levels (PLs. The various DG technologies are modeled based on their electrical output characteristics. Voltage profile index which allows a single value to represent how well the voltage matches the ideal value is developed. The index allows a fair comparison of the voltage profile obtained from different scenarios. The extent to which DGs affect power losses and voltage profile depend on the type of DG technology, PL and the location in which the DG is connected to the grid. The integration of DGs reduces power losses on the network, however, as the PL increases, the power losses begin to increase. A PL of 50–75% is achieved on 69 kV voltage level and 25–50% penetration on 13.8 kV voltage level without an increase in the power loss. Also more DG can be integrated into the network at point of common connection of higher voltage level compared to the low voltage level.
A Robust Control Scheme for Medium-Voltage-Level DVR Implementation
DEFF Research Database (Denmark)
Blaabjerg, Frede; Loh, Poh Chiang; Li, Yun Wei
2007-01-01
of Hinfin controller weighting function selection, inner current loop tuning, and system disturbance rejection capability is presented. Finally, the designed control scheme is extensively tested on a laboratory 10-kV MV-level DVR system with varying voltage sag (balanced and unbalanced) and loading (linear....../nonlinear load and induction motor load) conditions. It is shown that the proposed control scheme is effective in both balanced and unbalanced sag compensation and load disturbance rejection, as its robustness is explicitly specified....
International Nuclear Information System (INIS)
Jost, G; Pietsch, H; Lengsfeld, P; Voth, M; Schmid, E
2010-01-01
The aim of this study was to investigate the dose response relationship of dicentrics in human lymphocytes after CT scans at tube voltages of 80 and 140 kV. Blood samples from a healthy donor placed in tissue equivalent abdomen phantoms of standard, pediatric and adipose sizes were exposed at dose levels up to 0.1 Gy using a 64-slice CT scanner. It was found that both the tube voltage and the phantom size significantly influenced the CT scan-induced linear dose-response relationship of dicentrics in human lymphocytes. Using the same phantom (standard abdomen), 80 kV CT x-rays were biologically more effective than 140 kV CT x-rays. However, it could also be determined that the applied phantom size had much more influence on the biological effectiveness. Obviously, the increasing slopes of the CT scan-induced dose response relationships of dicentrics in human lymphocytes obtained in a pediatric, a standard and an adipose abdomen have been induced by scattering effects of photons, which strongly increase with increasing phantom size.
Energy Technology Data Exchange (ETDEWEB)
Jost, G; Pietsch, H [TRG Diagnostic Imaging, Bayer Schering Pharma AG, Berlin (Germany); Lengsfeld, P; Voth, M [Global Medical Affairs Diagnostic Imaging, Bayer Schering Pharma AG, Berlin (Germany); Schmid, E, E-mail: Ernst.Schmid@lrz.uni-muenchen.d [Institute for Cell Biology, Center for Integrated Protein Science, University of Munich (Germany)
2010-06-07
The aim of this study was to investigate the dose response relationship of dicentrics in human lymphocytes after CT scans at tube voltages of 80 and 140 kV. Blood samples from a healthy donor placed in tissue equivalent abdomen phantoms of standard, pediatric and adipose sizes were exposed at dose levels up to 0.1 Gy using a 64-slice CT scanner. It was found that both the tube voltage and the phantom size significantly influenced the CT scan-induced linear dose-response relationship of dicentrics in human lymphocytes. Using the same phantom (standard abdomen), 80 kV CT x-rays were biologically more effective than 140 kV CT x-rays. However, it could also be determined that the applied phantom size had much more influence on the biological effectiveness. Obviously, the increasing slopes of the CT scan-induced dose response relationships of dicentrics in human lymphocytes obtained in a pediatric, a standard and an adipose abdomen have been induced by scattering effects of photons, which strongly increase with increasing phantom size.
Voltage-gated calcium flux mediates Escherichia coli mechanosensation.
Bruni, Giancarlo N; Weekley, R Andrew; Dodd, Benjamin J T; Kralj, Joel M
2017-08-29
Electrically excitable cells harness voltage-coupled calcium influx to transmit intracellular signals, typically studied in neurons and cardiomyocytes. Despite intense study in higher organisms, investigations of voltage and calcium signaling in bacteria have lagged due to their small size and a lack of sensitive tools. Only recently were bacteria shown to modulate their membrane potential on the timescale of seconds, and little is known about the downstream effects from this modulation. In this paper, we report on the effects of electrophysiology in individual bacteria. A genetically encoded calcium sensor expressed in Escherichia coli revealed calcium transients in single cells. A fusion sensor that simultaneously reports voltage and calcium indicated that calcium influx is induced by voltage depolarizations, similar to metazoan action potentials. Cytoplasmic calcium levels and transients increased upon mechanical stimulation with a hydrogel, and single cells altered protein concentrations dependent on the mechanical environment. Blocking voltage and calcium flux altered mechanically induced changes in protein concentration, while inducing calcium flux reproduced these changes. Thus, voltage and calcium relay a bacterial sense of touch and alter cellular lifestyle. Although the calcium effectors remain unknown, these data open a host of new questions about E. coli , including the identity of the underlying molecular players, as well as other signals conveyed by voltage and calcium. These data also provide evidence that dynamic voltage and calcium exists as a signaling modality in the oldest domain of life, and therefore studying electrophysiology beyond canonical electrically excitable cells could yield exciting new findings.
Variation of microchannel plate resistance with temperature and applied voltage
International Nuclear Information System (INIS)
Pearson, J.F.; Fraser, G.W.; Whiteley, M.J.
1987-01-01
The resistance of microchannel plate electron multiplier is well known to be a function of both applied voltage and detector temperature. We show that the apparent variation of resistance with bias voltage is simply due to plate temperature increases resulting from resistive heating. (orig.)
Novel high-voltage power lateral MOSFET with adaptive buried electrodes
International Nuclear Information System (INIS)
Zhang Wen-Tong; Wu Li-Juan; Qiao Ming; Luo Xiao-Rong; Zhang Bo; Li Zhao-Ji
2012-01-01
A new high-voltage and low-specific on-resistance (R on,sp ) adaptive buried electrode (ABE) silicon-on-insulator (SOI) power lateral MOSFET and its analytical model of the electric fields are proposed. The MOSFET features are that the electrodes are in the buried oxide (BOX) layer, the negative drain voltage V d is divided into many partial voltages and the output to the electrodes is in the buried oxide layer and the potentials on the electrodes change linearly from the drain to the source. Because the interface silicon layer potentials are lower than the neighboring electrode potentials, the electronic potential wells are formed above the electrode regions, and the hole potential wells are formed in the spacing of two neighbouring electrode regions. The interface hole concentration is much higher than the electron concentration through designing the buried layer electrode potentials. Based on the interface charge enhanced dielectric layer field theory, the electric field strength in the buried layer is enhanced. The vertical electric field E I and the breakdown voltage (BV) of ABE SOI are 545 V/μm and −587 V in the 50 μm long drift region and the 1 μm thick dielectric layer, and a low R on,sp is obtained. Furthermore, the structure also alleviates the self-heating effect (SHE). The analytical model matches the simulation results. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
Experimental investigation of open circuit voltage during start-up process of HT-PEMFC
International Nuclear Information System (INIS)
Abdul Rasheed, Raj Kamal; Chan, Siew Hwa
2015-01-01
Highlights: • OCV reduces non-linearly with temperature under constant power input. • The reduction gradient of OCV is observed to be non-linear with time. • Nernst equation is less accurate for HT-PEMFC start-up models. - Abstract: This paper investigates the open circuit voltage (OCV) during the warm-up process of a high temperature proton exchange membrane fuel cell (HT-PEMFC) from 140 °C to the desired temperature of 180 °C, where the temperature increases with time. The heating strategy involves the external heating of the fuel cell with constant heat input rate. The commonly used Nernst equation, to predict the OCV of the fuel cell, is usually used in transient start-up models. Thus, this papers highlights the limitations of using the Nernst equation where the temperature increases transiently with time. A polybenzimidazole-based HTPEM single cell was set up and the OCV was measured under constant heating power supplied by an external source. A parametric study was done by varying the external heating power and the effect on the OCV was observed. The results showed that the OCV reduces non-linearly with respect to temperature, when the fuel cell is subjected to a constant heating power. This behaviour is clearly in contrast with the Nernst equation, which considers the temperature as steady state. For effective comparison, the OCV was also measured under steady state temperatures, showing an almost constant reduction gradient of ∼ −2.3×10 −4 V/°C. However, the behaviour under a constant heating power show curvilinear reduction of the OCV as the temperature increases. In addition, as the external heating power is increased, the degree of curvature of the OCV profile is greater. Thus, the results clearly indicate that the accuracy of using the Nernst equation in transient thermal start-up models can be improved, by considering a non linear behaviour, as shown in this paper.
Influence of Ambient Humidity on the Voltage Response of Ionic Polymer-Metal Composite Sensor.
Zhu, Zicai; Horiuchi, Tetsuya; Kruusamäe, Karl; Chang, Longfei; Asaka, Kinji
2016-03-31
Electrical potential based on ion migration exists not only in natural systems but also in ionic polymer materials. In order to investigate the influence of ambient humidity on voltage response, classical Au-Nafion IPMC was chosen as the reference sample. Voltage response under a bending deformation was measured in two ways: first, continuous measurement of voltage response in the process of absorption and desorption of water to study the tendency of voltage variation at all water states; second, measurements at multiple fixed ambient humidity levels to characterize the process of voltage response quantitatively. Ambient humidity influences the voltage response mainly by varying water content in ionic polymer. Under a step bending, the amplitude of initial voltage peak first increases and then decreases as the ambient humidity and the inherent water content decrease. This tendency is explained semiquantitatively by mass storage capacity related to the stretchable state of the Nafion polymer network. Following the initial peak, the voltage shows a slow decay to a steady state, which is first characterized in this paper. The relative voltage decay during the steady state always decreases as the ambient humidity is lowered. It is ascribed to progressive increase of the ratio between the water molecules in the cation hydration shell to the free water. Under sinusoidal mechanical bending excitation in the range of 0.1-10 Hz, the voltage magnitude increases with frequency at high ambient humidity but decreases with frequency at low ambient humidity. The relationship is mainly controlled by the voltage decay effect and the response speed.
An inductor-based converter with EMI reduction for low-voltage thermoelectric energy harvesting
Wang, Chuang; Zhao, Kai; Li, Zunchao
2017-07-01
This paper presents a self-powered inductor-based converter which harvests thermoelectric energy and boosts extremely low voltage to a typical voltage level for supplying body sensor nodes. Electromagnetic interference (EMI) of the converter is reduced by spreading spectrum of fundamental frequency and harmonics via pseudo-random modulation, which is obtained via combining the linear feedback shift register and digitally controlled oscillator. Besides, the methods, namely extracting energy near MPP and reducing the power dissipation, are employed to improve the power efficiency. The presented inductor-based converter is designed and verified in CSMC CMOS 0.18-µm 1P6M process. The results reveal that it achieves the high efficiency and EMI reduction at the same time.
Ceramic capacitor insulation resistance failures accelerated by low voltage
Brennan, T. F.
1978-01-01
Ceramic capacitors failed insulation resistance testing at less than one-tenth their rated voltage. Many failures recovered as the voltage was increased. Comprehensive failure analysis techniques, some of which are unprecedented, were used to examine these failures. It was determined that there was more than one failure mechanism, and the results indicate a need for special additional screening.
Design of a High Linearity Four-Quadrant Analog Multiplier in Wideband Frequency Range
Directory of Open Access Journals (Sweden)
Abdul kareem Mokif Obais
2017-05-01
Full Text Available In this paper, a voltage mode four quadrant analog multiplier in the wideband frequency rangeis designed using a wideband operational amplifier (OPAMP and squaring circuits. The wideband OPAMP is designed using 10 identical NMOS transistorsand operated with supply voltages of ±12V. Two NMOS transistors and two wideband OPAMP are utilized in the design of the proposed squaring circuit. All the NMOS transistors are based on 0.35µm NMOStechnology. The multiplier has input and output voltage ranges of ±10 V, high range of linearity from -10 V to +10 V, and cutoff frequency of about 5 GHz. The proposed multiplier is designed on PSpice in Orcad 16.6
Best voltage bias-flipping strategy towards maximum piezoelectric power generation
International Nuclear Information System (INIS)
Liang, Junrui; Chung, Henry Shu-Hung
2013-01-01
In piezoelectric energy harvesting (PEH) systems, energy extracted from piezoelectric structure can be increased by making piezoelectric voltage in phase with vibration velocity and raising the voltage amplitude. Such voltage manipulations can be realized by synchronously flipping the piezoelectric voltage with respect to a bias dc source at every displacement extremum. Given that net harvested energy is obtained by deducting dissipated energy from total extracted energy, a sophisticated voltage bias-flipping scheme, which can maximize extracted energy at low dissipative cost, is required towards harvested energy optimization. This paper extends the state of the art by proposing the best bias-flip strategy, which is delivered on conceptual synchronized multiple bias-flip (SMBF) interface circuits. The proposed strategy coordinates both requirements on larger voltage change in synchronized instant for more extracted energy and smaller voltage change in each bias-flip action for less dissipated energy. It not only leads to further enhancement of harvesting capability beyond existing solutions, but also provides an unprecedented physical insight on maximum achievable harvesting capability of PEH interface circuit
LED Current Balance Using a Variable Voltage Regulator with Low Dropout vDS Control
Directory of Open Access Journals (Sweden)
Hung-I Hsieh
2017-02-01
Full Text Available A cost-effective light-emitting diode (LED current balance strategy using a variable voltage regulator (VVR with low dropout vDS control is proposed. This can regulate the multiple metal-oxide-semiconductor field-effect transistors (MOSFETs of the linear current regulators (LCR, maintaining low dropout vDS on the flat vGS-characteristic curves and making all drain currents almost the same. Simple group LCRs respectively loaded with a string LED are employed to implement the theme. The voltage VVdc from a VVR is synthesized by a string LED voltage NvD, source voltage vR, and a specified low dropout vDS = VQ. The VVdc updates instantly, through the control loop of the master LCR, which means that all slave MOSFETs have almost the same biases on their flat vGS-characteristic curves. This leads to all of the string LED currents being equal to each other, producing an almost even luminance. An experimental setup with microchip control is built to verify the estimations. Experimental results show that the luminance of all of the string LEDs are almost equal to one another, with a maximum deviation below 1% during a wide dimming range, while keeping all vDS of the MOSFETs at a low dropout voltage, as expected.
High Efficiency Power Converter for Low Voltage High Power Applications
DEFF Research Database (Denmark)
Nymand, Morten
The topic of this thesis is the design of high efficiency power electronic dc-to-dc converters for high-power, low-input-voltage to high-output-voltage applications. These converters are increasingly required for emerging sustainable energy systems such as fuel cell, battery or photo voltaic based...
On the Response of Interleaved Transformer Windings to Surge Voltages
DEFF Research Database (Denmark)
Pedersen, A.
1963-01-01
The high series capacitance theory for the response of interleaved transformer windings to surge voltages is criticized from the point of view that an increased series capacitance as a result of interleaving is incompatible with the concept of a pure capacitive initial voltage distribution. A new...
Field angle dependence of voltage-induced ferromagnetic resonance under DC bias voltage
International Nuclear Information System (INIS)
Shiota, Yoichi; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Suzuki, Yoshishige; Yuasa, Shinji
2016-01-01
We studied the rectification function of microwaves in CoFeB/MgO-based magnetic tunnel junctions using voltage-induced ferromagnetic resonance (FMR). Our findings reveal that the shape of the structure of the spectrum depends on the rotation angle of the external magnetic field, providing clear evidence that FMR dynamics are excited by voltage-induced magnetic anisotropy changes. Further, enhancement of the rectified voltage was demonstrated under a DC bias voltage. In our experiments, the highest microwave detection sensitivity obtained was 350 mV/mW, at an RF frequency of 1.0 GHz and field angle of θ_H=80°, ϕ_H=0°. The experimental results correlated with those obtained via simulation, and the calculated results revealed the magnetization dynamics at the resonance state. - Highlights: • Examined voltage-induced ferromagnetic resonance (FMR) under various field angles. • FMR dynamics are excited by voltage-induced magnetic anisotropy changes. • Microwave detection sensitivity depends on input RF and elevation angle. • Microwave detection sensitivity=350 mV/mW at RF=1.0 GHz, θ_H=80°, ϕ_H=0°.
Linearized Programming of Memristors for Artificial Neuro-Sensor Signal Processing.
Yang, Changju; Kim, Hyongsuk
2016-08-19
A linearized programming method of memristor-based neural weights is proposed. Memristor is known as an ideal element to implement a neural synapse due to its embedded functions of analog memory and analog multiplication. Its resistance variation with a voltage input is generally a nonlinear function of time. Linearization of memristance variation about time is very important for the easiness of memristor programming. In this paper, a method utilizing an anti-serial architecture for linear programming is proposed. The anti-serial architecture is composed of two memristors with opposite polarities. It linearizes the variation of memristance due to complimentary actions of two memristors. For programming a memristor, additional memristor with opposite polarity is employed. The linearization effect of weight programming of an anti-serial architecture is investigated and memristor bridge synapse which is built with two sets of anti-serial memristor architecture is taken as an application example of the proposed method. Simulations are performed with memristors of both linear drift model and nonlinear model.
Effect of solar-cell junction geometry on open-circuit voltage
Weizer, V. G.; Godlewski, M. P.
1985-01-01
Simple analytical models have been found that adequately describe the voltage behavior of both the stripe junction and dot junction grating cells as a function of junction area. While the voltage in the former case is found to be insensitive to junction area reduction, significant voltage increases are shown to be possible for the dot junction cell. With regard to cells in which the junction area has been increased in a quest for better performance, it was found that (1) texturation does not affect the average saturation current density J0, indicating that the texturation process is equivalent to a simple extension of junction area by a factor of square root of 3 and (2) the vertical junction cell geometry produces a sizable decrease in J0 that, unfortunately, is more than offset by the effects of attendant areal increases.
Research on electrodischarge drilling of polycrystalline diamond with increased gap voltage
Skoczypiec, Sebastian; Bizoń, Wojciech; Żyra, Agnieszka
2018-05-01
This paper presents an experimental investigation of the machining characteristics of polycrystalline diamond (PCD). Machining of PCD by conventional technologies is not an effective solution. Due to presence of cobalt this material can be machined by application of electrical discharges. On the other side, electrical conductivity of PCD is on the limit of electrodischarge machining (EDM) possibilities. Proposed paper reports experimental investigation on electrodischarge drilling of PCD samples. The test were carried out with application on of high-voltage (up to 550 V) pulse power unit for two kinds of dielectrics: carbon based (Exxsol D80) and de-ionized water. As output parameters machining accuracy (side gap), material removal rate were selected. Also, based on SEM photographs and energy dispersive X-ray spectroscopy (EDS) analysis, a qualitative evaluation of the obtained results was presented.
A Method for the Realization of an Interruption Generator Based on Voltage Source Converters
Directory of Open Access Journals (Sweden)
Junhui Li
2017-10-01
Full Text Available In this paper we described the structure and working principle of an interruption generator based on voltage source converters (VSCs. The main circuit parameters of the VSCs are determined according to the target of power transfer capability, harmonic suppression, and dynamic response capability. A state feedback linearization method in nonlinear differential geometry theory was used for dq axis current decoupling, based on the mathematical model used in the dq coordinate system of VSCs. The direct current control strategy was adopted to achieve the independent regulation of active power and reactive power. The proportional integral (PI link was used to optimize the dynamic performance of the controller, and PI parameters were adjusted. Disturbance voltage waves were generated by the regular sampling method. PSCAD/EMTDC simulation results and physical prototype experiments showed that the device could generate various disturbance voltage waveforms steadily, and had good dynamic and steady-state performance.
Kind, Dieter
2001-01-01
The second edition of High Voltage Test Techniques has been completely revised. The present revision takes into account the latest international developments in High Voltage and Measurement technology, making it an essential reference for engineers in the testing field.High Voltage Technology belongs to the traditional area of Electrical Engineering. However, this is not to say that the area has stood still. New insulating materials, computing methods and voltage levels repeatedly pose new problems or open up methods of solution; electromagnetic compatibility (EMC) or components and systems al
International Nuclear Information System (INIS)
Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.
1988-01-01
The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns
International Nuclear Information System (INIS)
Jochen Schein; Xiaoxi Xu; Niansheng Qi; Steven Gensler; Rahul Prasad; Mahadevan Krishnan
1999-01-01
The aspect to be investigated during this contract was an electron-beam triggered diamond switch to be used in high power modulators. Today's high power modulators require higher voltage switches than those developed to date. Specifically, the proposed 1 TeV linear collider, the NLC/ILC at the Stanford Linear Accelerator Center (SLAC), consists of two linacs with 6600 X-Band klystrons powered by 3300 high power modulators. These modulators require switches capable of handling 80 kV, switching 8 kA with pulse durations ranging from 2 ps (linac) to 6 micros (pre-linac) with switching times <50 ns at pulse repetition frequencies up to 180 Hz. In addition the large number of switches and other components dictate a pulse to pulse jitter of <10 ns and a mean time between failures of at least 50,000 hours. The present approach is to use hydrogen filled thyratrons. While these switches meet the voltage and conduction current requirements they lack the required reliability (pulse to pulse jitter) and lifetime. Research to improve these aspects is in progress. A solid state switch inherently offers the required reliability and lifetime. However, Si-based switches developed to date are limited to about 5 kV and several must be stacked in series to deliver the required voltage. This further increases the already large parts count and compromises reliability and lifetime. A monolithic, solid state switch capable of meeting all the requirements for X-Band modulators would be ideal. DOE selected this proposal for a Phase 1 SBIR award and this final report describes the progress made during the contract
Energy Technology Data Exchange (ETDEWEB)
Jochen Schein; Xiaoxi Xu; Niansheng Qi; Steven Gensler; Rahul Prasad; Mahadevan Krishnan
1999-04-10
The aspect to be investigated during this contract was an electron-beam triggered diamond switch to be used in high power modulators. Today's high power modulators require higher voltage switches than those developed to date. Specifically, the proposed 1 TeV linear collider, the NLC/ILC at the Stanford Linear Accelerator Center (SLAC), consists of two linacs with 6600 X-Band klystrons powered by 3300 high power modulators. These modulators require switches capable of handling 80 kV, switching 8 kA with pulse durations ranging from 2 ps (linac) to 6 {micro}s (pre-linac) with switching times <50 ns at pulse repetition frequencies up to 180 Hz. In addition the large number of switches and other components dictate a pulse to pulse jitter of <10 ns and a mean time between failures of at least 50,000 hours. The present approach is to use hydrogen filled thyratrons. While these switches meet the voltage and conduction current requirements they lack the required reliability (pulse to pulse jitter) and lifetime. Research to improve these aspects is in progress. A solid state switch inherently offers the required reliability and lifetime. However, Si-based switches developed to date are limited to about 5 kV and several must be stacked in series to deliver the required voltage. This further increases the already large parts count and compromises reliability and lifetime. A monolithic, solid state switch capable of meeting all the requirements for X-Band modulators would be ideal. DOE selected this proposal for a Phase 1 SBIR award and this final report describes the progress made during the contract.
Directory of Open Access Journals (Sweden)
M. R. Aghamohammadi
2011-06-01
Full Text Available Abstract: Voltage instability is a major threat for security of power systems. Preserving voltage security margin at a certain limit is a vital requirement for today’s power systems. Assessment of voltage security margin is a challenging task demanding sophisticated indices. In this paper, for the purpose of on line voltage security assessment a new index based on the correlation characteristic of network voltage profile is proposed. Voltage profile comprising all bus voltages contains the effect of network structure, load-generation patterns and reactive power compensation on the system behaviour and voltage security margin. Therefore, the proposed index is capable to clearly reveal the effect of system characteristics and events on the voltage security margin. The most attractive feature for this index is its fast and easy calculation from synchronously measured voltage profile without any need to system modelling and simulation and without any dependency on network size. At any instant of system operation by merely measuring network voltage profile and no further simulation calculation this index could be evaluated with respect to a specific reference profile. The results show that the behaviour of this index with respect to the change in system security is independent of the selected reference profile. The simplicity and easy calculation make this index very suitable for on line application. The proposed approach has been demonstrated on IEEE 39 bus test system with promising results showing its effectiveness and applicability.
Safety of wet welding with increased open circuit voltages up to 150 V d.c
International Nuclear Information System (INIS)
Schmidt, K.; Kozig, G.; Ross, J.A.S.; Green, H.L.
1991-01-01
An experimental test programme was performed to demonstrate that wet welding with open circuit voltages up to 150 V d.c. would not result in dangerous situations for the diver induced by electric shock. Sea water, fresh water, different types of diving suits and some worst case situations, resulting from a disregard of good working practice were considered to be test parameters. In sea water a diver will not be endangered by corresponding electric potentials if good working practice is adopted. This was demonstrated even for worst case conditions, e.g. water leakage into the dry suit, accidental positioning to the diver between torch and work piece (stretched arm) and partial removal of coating from the welding rod. The fresh water tests demonstrated higher voltages on the diver but well below accepted threshold limit values. The term 'fresh water' should be critically considered, however, the test results relate only to the water conductivity studied. (orig.) With 30 figs [de
Directory of Open Access Journals (Sweden)
Abderrahmane Beroual
2017-04-01
Full Text Available This paper deals with a comparative study of AC and DC breakdown voltages of based mineral oil mixtures with natural and synthetic esters mainly used in high voltage power transformers. The goal was to analyze the performances of oil mixtures from the dielectric withstand point of view and to predict the behavior of transformers originally filled with mineral oil and re-filled with synthetic or natural ester oils when emptied for maintenance. The study concerns mixtures based on 20%, 50%, and 80% of natural and synthetic ester oils. AC breakdown voltages were measured using a sphere-sphere electrode system according to IEC 60156 specifications; the same specification was adopted for DC measurements since there is no standard specifications for this voltage waveform. A statistical analysis of the mean values, standard deviations, and histograms of breakdown voltage data was carried out. The Normal and Weibull distribution functions were used to analyze the experimental data and the best function that the data followed was used to estimate the breakdown voltage with risk of 1%, 10%, and 50% probability. It was shown that whatever the applied voltage waveforms, ester oils always have a significantly higher breakdown voltage than mineral oil. The addition of only 20% of natural or synthetic ester oil was sufficient to considerably increase the breakdown voltage of mineral oil. The dielectric strength of such a mixture is much higher than that of mineral oil alone and can reach that of ester oils. From the point of view of dielectric strength, the mixtures constitute an option for improving the performance of mineral oil. Thus, re-filling of transformers containing up to 20% mineral oil residues with ester oils, does not present any problem; it is even advantageous when considering only the breakdown voltage. Under AC, the mixtures with natural ester always follow the behavior of vegetable oil alone. With the exception of the 20% mixture of natural
Advanced Control of the Dynamic Voltage Restorer for Mitigating Voltage Sags in Power Systems
Directory of Open Access Journals (Sweden)
Dung Vo Tien
2018-01-01
Full Text Available The paper presents a vector control with two cascaded loops to improve the properties of Dynamic Voltage Restorer (DVR to minimize Voltage Sags on the grid. Thereby, a vector controlled structure was built on the rotating dq-coordinate system with the combination of voltage control and the current control. The proposed DVR control method is modelled using MATLAB-Simulink. It is tested using balanced/unbalanced voltage sags as well as fluctuant and distorted voltages. As a result, by using this controlling method, the dynamic characteristics of the system have been improved significantly. The system performed with higher accuracy, faster response and lower distortion in the voltage sags compensation. The paper presents real time experimental results to verify the performance of the proposed method in real environments.
Giant, Voltage-Actuated Deformation of a Dielectric Elastomer under Dead Load
Huang, Jiangshui; Li, Tiefeng; Foo, Choon Chiang; Clarke, David R.; Zhu, Jian; Suo, Zhigang
2012-01-01
Far greater voltage-actuated deformation is achievable for a dielectric elastomer under equal-biaxial dead load than under rigid constraint usually employed. Areal strains of 488% are demonstrated. The dead load suppresses electric breakdown, enabling the elastomer to survive the snap-through electromechanical instability. The breakdown voltage is found to increase with the voltage ramp rate. A nonlinear model for viscoelastic dielectric elastomers is developed and shown to be consistent with...
DEFF Research Database (Denmark)
Young, Stephanie Z; Platel, Jean-Claude; Nielsen, Jakob V
2010-01-01
In the adult neurogenic subventricular zone (SVZ), the behavior of astrocyte-like cells and some of their functions depend on changes in intracellular Ca(2+) levels and tonic GABA(A) receptor activation. However, it is unknown whether, and if so how, GABA(A) receptor activity regulates...... intracellular Ca(2+) dynamics in SVZ astrocytes. To monitor Ca(2+) activity selectively in astrocyte-like cells, we used two lines of transgenic mice expressing either GFP fused to a Gq-coupled receptor or DsRed under the human glial fibrillary acidic protein (hGFAP) promoter. GABA(A) receptor activation...... induced Ca(2+) increases in 40-50% of SVZ astrocytes. GABA(A)-induced Ca(2+) increases were prevented with nifedipine and mibefradil, blockers of L- and T-type voltage-gated calcium channels (VGCC). The L-type Ca(2+) channel activator BayK 8644 increased the percentage of GABA(A)-responding astrocyte...
Characteristics and Breakdown Behaviors of Polysilicon Resistors for High Voltage Applications
Directory of Open Access Journals (Sweden)
Xiao-Yu Tang
2015-01-01
Full Text Available With the rapid development of the power integrated circuit technology, polysilicon resistors have been widely used not only in traditional CMOS circuits, but also in the high voltage applications. However, there have been few detailed reports about the polysilicon resistors’ characteristics, like voltage and temperature coefficients and breakdown behaviors which are critical parameters of high voltage applications. In this study, we experimentally find that the resistance of the polysilicon resistor with a relatively low doping concentration shows negative voltage and temperature coefficients, while that of the polysilicon resistor with a high doping concentration has positive voltage and temperature coefficients. Moreover, from the experimental results of breakdown voltages of the polysilicon resistors, it could be deduced that the breakdown of polysilicon resistors is thermally rather than electrically induced. We also proposed to add an N-type well underneath the oxide to increase the breakdown voltage in the vertical direction when the substrate is P-type doped.
Dual voltage power supply with 48 volt
Energy Technology Data Exchange (ETDEWEB)
Froeschl, Joachim; Proebstle, Hartmut; Sirch, Ottmar [BMW Group, Muenchen (Germany)
2012-11-01
Automotive electrics/electronics have just reached a period of tremendous change. High voltage systems for Hybrid, Plug-In Hybrid or Battery Electric Vehicles with high power electric motors, high energy accumulators and electric climate compressors will be introduced in order to achieve the challenging targets for CO{sub 2} emissions and energy efficiency and to anticipate the mobility of the future. Additionally, innovations and the continuous increase of functionality for comfort, safety, driver assistance and infotainment systems require more and more electrical power of the vehicle power supply at all. On the one hand side electrified vehicles will certainly achieve a significant market share, on the other hand side they will increase the pressure to conventional vehicles with combustion engines for fuel consumption and CO{sub 2} emissions. These vehicles will be enabled to keep their competitiveness by new functions and the optimization of their electric systems. A dual voltage power supply with 48 Volt and 12 Volt will be one of the key technologies to realize these requirements. The power capability of the existing 12 Volt power supply has reached its limits. Further potentials can only be admitted by the introduction of 48 Volt. For this reason the car manufacturers Audi, BMW, Daimler, Porsche and Volkswagen started very early on this item and developed a common specification of the new voltage range. Now, it is necessary to identify the probable systems at this voltage range and to start the developments. (orig.)
Mitigating voltage lead errors of an AC Josephson voltage standard by impedance matching
Zhao, Dongsheng; van den Brom, Helko E.; Houtzager, Ernest
2017-09-01
A pulse-driven AC Josephson voltage standard (ACJVS) generates calculable AC voltage signals at low temperatures, whereas measurements are performed with a device under test (DUT) at room temperature. The voltage leads cause the output voltage to show deviations that scale with the frequency squared. Error correction mechanisms investigated so far allow the ACJVS to be operational for frequencies up to 100 kHz. In this paper, calculations are presented to deal with these errors in terms of reflected waves. Impedance matching at the source side of the system, which is loaded with a high-impedance DUT, is proposed as an accurate method to mitigate these errors for frequencies up to 1 MHz. Simulations show that the influence of non-ideal component characteristics, such as the tolerance of the matching resistor, the capacitance of the load input impedance, losses in the voltage leads, non-homogeneity in the voltage leads, a non-ideal on-chip connection and inductors between the Josephson junction array and the voltage leads, can be corrected for using the proposed procedures. The results show that an expanded uncertainty of 12 parts in 106 (k = 2) at 1 MHz and 0.5 part in 106 (k = 2) at 100 kHz is within reach.
Restoration of Low-Voltage Distribution Systems with Inverter-Interfaced DG Units
DEFF Research Database (Denmark)
Dietmannsberger, Markus; Wang, Xiongfei; Blaabjerg, Frede
2018-01-01
-area voltage collapse. This paper proposes a restoration strategy from zero voltage conditions for inverter-interfaced DG under islanded conditions. In the approach, a flexible and scalable Master DG inverter concept is introduced for distributed generations, where no communication is needed and an outage......The increasing share of distributed generation (DG) offers new chances in grid restoration of low-voltage distribution grids. Instead of relying on the transmission or high- and medium-voltage levels, establishing islanding operation in low-voltage grids might be a good option after a wide...... of the Master can be balanced by other DG inverters. The control strategy ensures the tracking of nominal values of the system voltage and frequency without zero steady-state error. The influences of non-controllable DG are also taken into account in the strategy with an effective countermeasure developed...
Multiple High Voltage Pulse Stressing of Polymer Thick Film Resistors
Directory of Open Access Journals (Sweden)
Busi Rambabu
2014-01-01
Full Text Available The purpose of this paper is to study high voltage interactions in polymer thick film resistors, namely, polyvinyl chloride- (PVC- graphite thick film resistors, and their applications in universal trimming of these resistors. High voltages in the form of impulses for various pulse durations and with different amplitudes have been applied to polymer thick film resistors and we observed the variation of resistance of these resistors with high voltages. It has been found that the resistance of polymer thick film resistors decreases in the case of higher resistivity materials and the resistance of polymer thick film resistor increases in the case of lower resistivity materials when high voltage impulses are applied to them. It has been also found that multiple high voltage pulse (MHVP stressing can be used to trim the polymer thick film resistors either upwards or downwards.
Directory of Open Access Journals (Sweden)
Zetty Adibah Kamaruzzaman
2016-06-01
Full Text Available This paper presents the impact of grid-connected photovoltaic (PV generator on dynamic voltage stability of a power distribution system by considering solar intermittency, PV penetration level, and contingencies such as line outage and load increase. The IEEE 13 node test feeder is used as a test system, and a solar PV of 0.48 kV/0.5 MVA is integrated into the test system. Test results show that system voltage is stable at high PV penetration levels. Increase in load causes voltage instability, in which voltage drops below its allowable operating limit. Thus, increase in PV penetration level does not improve system voltage stability because the system experiences voltage collapse during line outage.
High-voltage short-fall pulse generator
International Nuclear Information System (INIS)
Dolbilov, G.V.; Fateev, A.A.; Petrov, V.A.
1986-01-01
Powerful high-voltage pulses with short fall times and relatively low afterpulse amplitude are required for the deflection systems of accelerators. A generator is described that provides, into a 75-ohm load, a voltage pulse of up to 100 kV with a fall time of less than 1 nsec and a relative afterpulse amplitude of less than or equal to 15%. The generator employs a short-circuited ferrite-filled line in which shock waves are formed. A magnetic section is used to increase power. The switch is a TGI1-2500/50 thyratron. The main causes of afterpulses and methods for reducing their amplitude are examined
Extension algorithm for generic low-voltage networks
Marwitz, S.; Olk, C.
2018-02-01
Distributed energy resources (DERs) are increasingly penetrating the energy system which is driven by climate and sustainability goals. These technologies are mostly connected to low- voltage electrical networks and change the demand and supply situation in these networks. This can cause critical network states. Network topologies vary significantly and depend on several conditions including geography, historical development, network design or number of network connections. In the past, only some of these aspects were taken into account when estimating the network investment needs for Germany on the low-voltage level. Typically, fixed network topologies are examined or a Monte Carlo approach is used to quantify the investment needs at this voltage level. Recent research has revealed that DERs differ substantially between rural, suburban and urban regions. The low-voltage network topologies have different design concepts in these regions, so that different network topologies have to be considered when assessing the need for network extensions and investments due to DERs. An extension algorithm is needed to calculate network extensions and investment needs for the different typologies of generic low-voltage networks. We therefore present a new algorithm, which is capable of calculating the extension for generic low-voltage networks of any given topology based on voltage range deviations and thermal overloads. The algorithm requires information about line and cable lengths, their topology and the network state only. We test the algorithm on a radial, a loop, and a heavily meshed network. Here we show that the algorithm functions for electrical networks with these topologies. We found that the algorithm is able to extend different networks efficiently by placing cables between network nodes. The main value of the algorithm is that it does not require any information about routes for additional cables or positions for additional substations when it comes to estimating
LINEAR2007, Linear-Linear Interpolation of ENDF Format Cross-Sections
International Nuclear Information System (INIS)
2007-01-01
1 - Description of program or function: LINEAR converts evaluated cross sections in the ENDF/B format into a tabular form that is subject to linear-linear interpolation in energy and cross section. The code also thins tables of cross sections already in that form. Codes used subsequently need thus to consider only linear-linear data. IAEA1311/15: This version include the updates up to January 30, 2007. Changes in ENDF/B-VII Format and procedures, as well as the evaluations themselves, make it impossible for versions of the ENDF/B pre-processing codes earlier than PREPRO 2007 (2007 Version) to accurately process current ENDF/B-VII evaluations. The present code can handle all existing ENDF/B-VI evaluations through release 8, which will be the last release of ENDF/B-VI. Modifications from previous versions: - Linear VERS. 2007-1 (JAN. 2007): checked against all ENDF/B-VII; increased page size from 60,000 to 600,000 points 2 - Method of solution: Each section of data is considered separately. Each section of File 3, 23, and 27 data consists of a table of cross section versus energy with any of five interpolation laws. LINEAR will replace each section with a new table of energy versus cross section data in which the interpolation law is always linear in energy and cross section. The histogram (constant cross section between two energies) interpolation law is converted to linear-linear by substituting two points for each initial point. The linear-linear is not altered. For the log-linear, linear-log and log- log laws, the cross section data are converted to linear by an interval halving algorithm. Each interval is divided in half until the value at the middle of the interval can be approximated by linear-linear interpolation to within a given accuracy. The LINEAR program uses a multipoint fractional error thinning algorithm to minimize the size of each cross section table
Double input converters for different voltage sources with isolated charger
Directory of Open Access Journals (Sweden)
Chalash Sattayarak
2014-09-01
Full Text Available This paper presents the double input converters for different voltage input sources with isolated charger coils. This research aims to increase the performance of the battery charger circuit. In the circuit, there are the different voltage levels of input source. The operating modes of the switch in the circuit use the microcontroller to control the battery charge and to control discharge mode automatically when the input voltage sources are lost from the system. The experimental result of this research shows better performance for charging at any time period of the switch, while the voltage input sources work together. Therefore, this research can use and develop to battery charger for present or future.
Kamhawi, Hani; Huang, Wensheng; Haag, Thomas; Spektor, Rostislav
2014-01-01
The National Aeronautics and Space Administration (NASA) Science Mission Directorate In-Space Propulsion Technology office is sponsoring NASA Glenn Research Center to develop a 4 kW-class Hall thruster propulsion system for implementation in NASA science missions. A study was conducted to assess the impact of varying the facility background pressure on the High Voltage Hall Accelerator (HiVHAc) thruster performance and voltage-current characteristics. This present study evaluated the HiVHAc thruster performance in the lowest attainable background pressure condition at NASA GRC Vacuum Facility 5 to best simulate space-like conditions. Additional tests were performed at selected thruster operating conditions to investigate and elucidate the underlying physics that change during thruster operation at elevated facility background pressure. Tests were performed at background pressure conditions that are three and ten times higher than the lowest realized background pressure. Results indicated that the thruster discharge specific impulse and efficiency increased with elevated facility background pressure. The voltage-current profiles indicated a narrower stable operating region with increased background pressure. Experimental observations of the thruster operation indicated that increasing the facility background pressure shifted the ionization and acceleration zones upstream towards the thruster's anode. Future tests of the HiVHAc thruster are planned at background pressure conditions that are expected to be two to three times lower than what was achieved during this test campaign. These tests will not only assess the impact of reduced facility background pressure on thruster performance, voltage-current characteristics, and plume properties; but will also attempt to quantify the magnitude of the ionization and acceleration zones upstream shifting as a function of increased background pressure.
Energy Technology Data Exchange (ETDEWEB)
Ivanov, P. A., E-mail: Pavel.Ivanov@mail.ioffe.ru; Potapov, A. S.; Samsonova, T. P.; Grekhov, I. V. [Ioffe Physical–Technical Institute (Russian Federation)
2017-03-15
p{sup +}–n{sub 0}–n{sup +} 4H-SiC diodes with homogeneous avalanche breakdown at 1860 V are fabricated. The pulse current–voltage characteristics are measured in the avalanche-breakdown mode up to a current density of 4000 A/cm{sup 2}. It is shown that the avalanche-breakdown voltage increases with increasing temperature. The following diode parameters are determined: the avalanche resistance (8.6 × 10{sup –2} Ω cm{sup 2}), the electron drift velocity in the n{sub 0} base at electric fields higher than 10{sup 6} V/cm (7.8 × 10{sup 6} cm/s), and the relative temperature coefficient of the breakdown voltage (2.1 × 10{sup –4} K{sup –1}).
Hu, Xiaoqin; You, Huiyan
2009-11-01
In capillary electrophoresis, 0-40 kV (even higher) voltage can be reached by a connecting double-model high voltage power supply. In the article, water-soluble vitamins, VB1, VB2, VB6, VC, calcium D-pantothenate, D-biotin, nicotinic acid and folic acid in vegetable, were separated by using the high voltage power supply under the condition of electrolyte water solution as running buffer. The separation conditions, such as voltage, the concentration of buffer and pH value etc. , were optimized during the experiments. The results showed that eight water-soluble vitamins could be baseline separated in 2.2 min at 40 kV applied voltage, 25 mmol/L sodium tetraborate buffer solution (pH 8.8). The water-soluble vitamins in spinach were quantified and the results were satisfied. The linear correlation coefficients of the water-soluble vitamins ranged from 0.9981 to 0.9999. The detection limits ranged from 0.2 to 0.3 mg/L. The average recoveries ranged from 88.0% to 100.6% with the relative standard deviations (RSD) range of 1.15%-4.13% for the spinach samples.
Coupling and decoupling of the accelerating units for pulsed synchronous linear accelerator
Shen, Yi; Liu, Yi; Ye, Mao; Zhang, Huang; Wang, Wei; Xia, Liansheng; Wang, Zhiwen; Yang, Chao; Shi, Jinshui; Zhang, Linwen; Deng, Jianjun
2017-12-01
A pulsed synchronous linear accelerator (PSLA), based on the solid-state pulse forming line, photoconductive semiconductor switch, and high gradient insulator technologies, is a novel linear accelerator. During the prototype PSLA commissioning, the energy gain of proton beams was found to be much lower than expected. In this paper, the degradation of the energy gain is explained by the circuit and cavity coupling effect of the accelerating units. The coupling effects of accelerating units are studied, and the circuit topologies of these two kinds of coupling effects are presented. Two methods utilizing inductance and membrane isolations, respectively, are proposed to reduce the circuit coupling effects. The effectiveness of the membrane isolation method is also supported by simulations. The decoupling efficiency of the metal drift tube is also researched. We carried out the experiments on circuit decoupling of the multiple accelerating cavity. The result shows that both circuit decoupling methods could increase the normalized voltage.
Copper wire theft and high voltage electrical burns
Francis, Eamon C; Shelley, Odhran P
2014-01-01
High voltage electrical burns are uncommon. However in the midst of our economic recession we are noticing an increasing number of these injuries. Copper wire is a valuable commodity with physical properties as an excellent conductor of electricity making it both ubiquitous in society and prized on the black market. We present two consecutive cases referred to the National Burns Unit who sustained life threatening injuries from the alleged theft of high voltage copper wire and its omnipresenc...
International Nuclear Information System (INIS)
Leon, Andres E.; Solsona, Jorge A.; Busada, Claudio; Chiacchiarini, Hector; Valla, Maria Ines
2009-01-01
In this paper a new control strategy for voltage-source converters (VSC) is introduced. The proposed strategy consists of a nonlinear feedback controller based on feedback linearization plus a feedforward compensation of the estimated load current. In our proposal an energy function and the direct-axis current are considered as outputs, in order to avoid the internal dynamics. In this way, a full linearization is obtained via nonlinear transformation and feedback. An estimate of the load current is feedforwarded to improve the performance of the whole system and to diminish the capacitor size. This estimation allows to obtain a more rugged and cheaper implementation. The estimate is calculated by using a nonlinear reduced-order observer. The proposal is validated through different tests. These tests include performance in presence of switching frequency, measurement filters delays, parameters uncertainties and disturbances in the input voltage.
A non-linear piezoelectric actuator calibration using N-dimensional Lissajous figure
Albertazzi, A.; Viotti, M. R.; Veiga, C. L. N.; Fantin, A. V.
2016-08-01
Piezoelectric translators (PZTs) are very often used as phase shifters in interferometry. However, they typically present a non-linear behavior and strong hysteresis. The use of an additional resistive or capacitive sensor make possible to linearize the response of the PZT by feedback control. This approach works well, but makes the device more complex and expensive. A less expensive approach uses a non-linear calibration. In this paper, the authors used data from at least five interferograms to form N-dimensional Lissajous figures to establish the actual relationship between the applied voltages and the resulting phase shifts [1]. N-dimensional Lissajous figures are formed when N sinusoidal signals are combined in an N-dimensional space, where one signal is assigned to each axis. It can be verified that the resulting Ndimensional ellipsis lays in a 2D plane. By fitting an ellipsis equation to the resulting 2D ellipsis it is possible to accurately compute the resulting phase value for each interferogram. In this paper, the relationship between the resulting phase shift and the applied voltage is simultaneously established for a set of 12 increments by a fourth degree polynomial. The results in speckle interferometry show that, after two or three interactions, the calibration error is usually smaller than 1°.
Methods of computing steady-state voltage stability margins of power systems
Chow, Joe Hong; Ghiocel, Scott Gordon
2018-03-20
In steady-state voltage stability analysis, as load increases toward a maximum, conventional Newton-Raphson power flow Jacobian matrix becomes increasingly ill-conditioned so power flow fails to converge before reaching maximum loading. A method to directly eliminate this singularity reformulates the power flow problem by introducing an AQ bus with specified bus angle and reactive power consumption of a load bus. For steady-state voltage stability analysis, the angle separation between the swing bus and AQ bus can be varied to control power transfer to the load, rather than specifying the load power itself. For an AQ bus, the power flow formulation is only made up of a reactive power equation, thus reducing the size of the Jacobian matrix by one. This reduced Jacobian matrix is nonsingular at the critical voltage point, eliminating a major difficulty in voltage stability analysis for power system operations.
ON THE NEED TO INCREASE THE RELIABILITY OF LINEAR INSULATORS FOR DISTRIBUTION NETWORKS 10-20 KV
Directory of Open Access Journals (Sweden)
Yu. N. Shumilov
2018-02-01
Full Text Available Introduction. In Ukraine high voltage overhead distribution lines (OL of class 6 and 10 kV are the most extended. Their total length exceeds 280,000 km. More than 95% of the lines are made on line supports from reinforced concrete racks. On all poles of the overhead line, pin insulators are installed. According to the data of operation experience, up to 60-70% of single-phase earth (SPE faults due to «insulation» occurs on VL supports due to damage to line pin insulators, mainly during the thunderstorm period. Problem. Insufficient reliability of pin insulators leads to interruptions in power supply, accidents on the line, accidents in the area of reinforced concrete poles, where in the case of insulator damages, a long process of SPE occurs. Goal. The purpose of the work is to select the design and develop requirements for new linear insulators of 10-20 kV overhead lines that provide high resistance to lightning overvoltages with direct and inductive effects of lightning. Methodology. The research methodology consists in analyzing operational experience, calculating insulator parameters and laboratory tests. Results. Using statistical data on lightning parameters and data on mechanical loads on insulators, the main dimensions of line post insulators have been determined that will ensure their reliable operation under conditions of intense thunderstorm activity and extreme ice and wind loads. Conclusions. The main technical requirements for line post insulators for 10-20 kV distribution lines were formulated. On the 10 kV OL located in areas with increased thunderstorm activity it is recommended to use line post insulators instead of pin-type ones. On the OL-20 kV it is recommended to use only line post insulators. The use of high-lightning-resistant line post insulators on OL-10-20 kV will significantly increase the electrical safety and reliability of power supply to consumers. Increased by 2-3 times the cost of line post insulators in
Linear Power-Flow Models in Multiphase Distribution Networks: Preprint
Energy Technology Data Exchange (ETDEWEB)
Bernstein, Andrey; Dall' Anese, Emiliano
2017-05-26
This paper considers multiphase unbalanced distribution systems and develops approximate power-flow models where bus-voltages, line-currents, and powers at the point of common coupling are linearly related to the nodal net power injections. The linearization approach is grounded on a fixed-point interpretation of the AC power-flow equations, and it is applicable to distribution systems featuring (i) wye connections; (ii) ungrounded delta connections; (iii) a combination of wye-connected and delta-connected sources/loads; and, (iv) a combination of line-to-line and line-to-grounded-neutral devices at the secondary of distribution transformers. The proposed linear models can facilitate the development of computationally-affordable optimization and control applications -- from advanced distribution management systems settings to online and distributed optimization routines. Performance of the proposed models is evaluated on different test feeders.
Symmetric voltage-controlled variable resistance
Vanelli, J. C.
1978-01-01
Feedback network makes resistance of field-effect transistor (FET) same for current flowing in either direction. It combines control voltage with source and load voltages to give symmetric current/voltage characteristics. Since circuit produces same magnitude output voltage for current flowing in either direction, it introduces no offset in presense of altering polarity signals. It is therefore ideal for sensor and effector circuits in servocontrol systems.
Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain
Directory of Open Access Journals (Sweden)
Yukiko eMishina
2014-09-01
Full Text Available Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviours. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP prototypical design or on the voltage dependent state transitions of microbial opsins.We recently introduced a new VSFP design in which the voltage-sensing domain (VSD is sandwiched between a FRET pair of fluorescent proteins (termed VSFP-Butterflies and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase (Ci-VSP are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.
Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain.
Mishina, Yukiko; Mutoh, Hiroki; Song, Chenchen; Knöpfel, Thomas
2014-01-01
Deciphering how the brain generates cognitive function from patterns of electrical signals is one of the ultimate challenges in neuroscience. To this end, it would be highly desirable to monitor the activities of very large numbers of neurons while an animal engages in complex behaviors. Optical imaging of electrical activity using genetically encoded voltage indicators (GEVIs) has the potential to meet this challenge. Currently prevalent GEVIs are based on the voltage-sensitive fluorescent protein (VSFP) prototypical design or on the voltage-dependent state transitions of microbial opsins. We recently introduced a new VSFP design in which the voltage-sensing domain (VSD) is sandwiched between a fluorescence resonance energy transfer pair of fluorescent proteins (termed VSFP-Butterflies) and also demonstrated a series of chimeric VSD in which portions of the VSD of Ciona intestinalis voltage-sensitive phosphatase are substituted by homologous portions of a voltage-gated potassium channel subunit. These chimeric VSD had faster sensing kinetics than that of the native Ci-VSD. Here, we describe a new set of VSFPs that combine chimeric VSD with the Butterfly structure. We show that these chimeric VSFP-Butterflies can report membrane voltage oscillations of up to 200 Hz in cultured cells and report sensory evoked cortical population responses in living mice. This class of GEVIs may be suitable for imaging of brain rhythms in behaving mammalians.
Increased linear bone growth by GH in the absence of SOCS2 is independent of IGF-1.
Dobie, Ross; Ahmed, Syed F; Staines, Katherine A; Pass, Chloe; Jasim, Seema; MacRae, Vicky E; Farquharson, Colin
2015-11-01
Growth hormone (GH) signaling is essential for postnatal linear bone growth, but the relative importance of GHs actions on the liver and/or growth plate cartilage remains unclear. The importance of liver derived insulin like-growth factor-1 (IGF-1) for endochondral growth has recently been challenged. Here, we investigate linear growth in Suppressor of Cytokine Signaling-2 (SOCS2) knockout mice, which have enhanced growth despite normal systemic GH/IGF-1 levels. Wild-type embryonic ex vivo metatarsals failed to exhibit increased linear growth in response to GH, but displayed increased Socs2 transcript levels (P growth over a 12 day period. Despite this increase, IGF-1 transcript and protein levels were not increased in response to GH. In accordance with these data, IGF-1 levels were unchanged in GH-challenged postnatal Socs2(-/-) conditioned medium despite metatarsals showing enhanced linear growth. Growth-plate Igf1 mRNA levels were not elevated in juvenile Socs2(-/-) mice. GH did however elevate IGF-binding protein 3 levels in conditioned medium from GH challenged metatarsals and this was more apparent in Socs2(-/-) metatarsals. GH did not enhance the growth of Socs2(-/-) metatarsals when the IGF receptor was inhibited, suggesting that IGF receptor mediated mechanisms are required. IGF-2 may be responsible as IGF-2 promoted metatarsal growth and Igf2 expression was elevated in Socs2(-/-) (but not WT) metatarsals in response to GH. These studies emphasise the critical importance of SOCS2 in regulating GHs ability to promote bone growth. Also, GH appears to act directly on the metatarsals of Socs2(-/-) mice, promoting growth via a mechanism that is independent of IGF-1. © 2014 The Authors. Journal of Cellular Physiology Published by Wiley Periodicals, Inc.
Forward voltage short-pulse technique for measuring high power laser array junction temperature
Meadows, Byron L. (Inventor); Amzajerdian, Frazin (Inventor); Barnes, Bruce W. (Inventor); Baker, Nathaniel R. (Inventor)
2012-01-01
The present invention relates to a method of measuring the temperature of the P-N junction within the light-emitting region of a quasi-continuous-wave or pulsed semiconductor laser diode device. A series of relatively short and low current monitor pulses are applied to the laser diode in the period between the main drive current pulses necessary to cause the semiconductor to lase. At the sufficiently low current level of the monitor pulses, the laser diode device does not lase and behaves similar to an electronic diode. The voltage across the laser diode resulting from each of these low current monitor pulses is measured with a high degree of precision. The junction temperature is then determined from the measured junction voltage using their known linear relationship.
Observability of Low Voltage grids
DEFF Research Database (Denmark)
Martin-Loeches, Ruben Sánchez; Iov, Florin; Kemal, Mohammed Seifu
2017-01-01
Low Voltage (LV) distribution power grids are experiencing a transformation from a passive to a more active role due to the increasing penetration of distributed generation, heat pumps and electrical vehicles. The first step towards a smarter operation of LV electrical systems is to provide grid ...... an updated state of the art on DSSE-AMI based, adaptive data collection techniques and database management system types. Moreover, the ongoing Danish RemoteGRID project is presented as a realistic case study.......Low Voltage (LV) distribution power grids are experiencing a transformation from a passive to a more active role due to the increasing penetration of distributed generation, heat pumps and electrical vehicles. The first step towards a smarter operation of LV electrical systems is to provide grid....... It becomes unrealistic to provide near real time full observability of the LV grid by applying Distribution System State Estimation (DSSE) utilizing the classical data collection and storage/preprocessing techniques. This paper investigates up-todate the observability problem in LV grids by providing...
High Efficiency Power Converter for Low Voltage High Power Applications
DEFF Research Database (Denmark)
Nymand, Morten
The topic of this thesis is the design of high efficiency power electronic dc-to-dc converters for high-power, low-input-voltage to high-output-voltage applications. These converters are increasingly required for emerging sustainable energy systems such as fuel cell, battery or photo voltaic based......, and remote power generation for light towers, camper vans, boats, beacons, and buoys etc. A review of current state-of-the-art is presented. The best performing converters achieve moderately high peak efficiencies at high input voltage and medium power level. However, system dimensioning and cost are often...
International Nuclear Information System (INIS)
Sakai, Seiji; Mitani, Seiji; Matsumoto, Yoshihiro; Entani, Shiro; Avramov, Pavel; Ohtomo, Manabu; Naramoto, Hiroshi; Takanashi, Koki
2012-01-01
Voltage-dependence of the tunneling magnetoresistance effect in the granular C 60 –Co films has been investigated for the samples with the current-perpendicular-to-plane geometry. The transport measurements under this geometry demonstrate that the granular C 60 –Co films show an unusual exponential bias voltage dependence of the magnetoresistance ratio down to zero voltage. Small characteristic energies of less than 10's meV are derived from the temperature dependences of the characteristic voltage in the exponential relationship. Considering the magnitudes of the voltage drop between Co nanoparticles and also the effect of cotunneling on the energy values, the characteristic energies for the voltage-induced degradation of the spin polarization are found to show a satisfactory agreement with that for the thermally-induced one. It can be reasonably expected that the onset of magnetic disorder to the localized d-electron spins at the interface region of the C 60 -based matrix (C 60 –Co compound) with Co nanoparticles leading to the unusual voltage and temperature dependence of the magnetoresistance ratio and the spin polarization at low temperatures. - Highlights: ► Unusual voltage dependence of the TMR effect in granular C 60 –Co films is studied. ► Linear temperature-characteristic voltage dependence in the MR–V relationship. ► Spin-flip scattering by the exchange-coupled d-electron spins at the interface.
Impacts of Voltage Control Methods on Distribution Circuit’s Photovoltaic (PV Integration Limits
Directory of Open Access Journals (Sweden)
Anamika Dubey
2017-10-01
Full Text Available The widespread integration of photovoltaic (PV units may result in a number of operational issues for the utility distribution system. The advances in smart-grid technologies with better communication and control capabilities may help to mitigate these challenges. The objective of this paper is to evaluate multiple voltage control methods and compare their effectiveness in mitigating the impacts of high levels of PV penetrations on distribution system voltages. A Monte Carlo based stochastic analysis framework is used to evaluate the impacts of PV integration, with and without voltage control. Both snapshot power flow and time-series analysis are conducted for the feeder with varying levels of PV penetrations. The methods are compared for their impacts on (1 the feeder’s PV hosting capacity; (2 the number of voltage violations and the magnitude of the largest bus voltage; (3 the net reactive power demand from the substation; and (4 the number of switching operations of feeder’s legacy voltage support devices i.e., capacitor banks and load tap changers (LTCs. The simulation results show that voltage control help in mitigating overvoltage concerns and increasing the feeder’s hosting capacity. Although, the legacy control solves the voltage concerns for primary feeders, a smart inverter control is required to mitigate both primary and secondary feeder voltage regulation issues. The smart inverter control, however, increases the feeder’s reactive power demand and the number of LTC and capacitor switching operations. For the 34.5-kV test circuit, it is observed that the reactive power demand increases from 0 to 6.8 MVAR on enabling Volt-VAR control for PV inverters. The total number of capacitor and LTC operations over a 1-year period also increases from 455 operations to 1991 operations with Volt-VAR control mode. It is also demonstrated that by simply changing the control mode of capacitor banks, a significant reduction in the unnecessary
Ionization effects and linear stability in a coaxial plasma device
Kurt, Erol; Kurt, Hilal; Bayhan, Ulku
2009-03-01
A 2-D computer simulation of a coaxial plasma device depending on the conservation equations of electrons, ions and excited atoms together with the Poisson equation for a plasma gun is carried out. Some characteristics of the plasma focus device (PF) such as critical wave numbers a c and voltages U c in the cases of various pressures Pare estimated in order to satisfy the necessary conditions of traveling particle densities ( i.e. plasma patterns) via a linear analysis. Oscillatory solutions are characterized by a nonzero imaginary part of the growth rate Im ( σ) for all cases. The model also predicts the minimal voltage ranges of the system for certain pressure intervals.
Compensation techniques for non-linearities in H-bridge inverters
Directory of Open Access Journals (Sweden)
Daniel Zammit
2016-12-01
Full Text Available This paper presents compensation techniques for component non-linearities in H-bridge inverters as those used in grid-connected photovoltaic (PV inverters. Novel compensation techniques depending on the switching device current were formulated to compensate for the non-linearities in inverter circuits caused by the voltage drops on the switching devices. Both simulation and experimental results will be presented. Testing was carried out on a PV inverter which was designed and constructed for this research. Very satisfactory results were obtained from all the compensation techniques presented, however the exact compensation method was the most effective, providing the highest reduction in harmonics.
Noise analysis and performance of a selfscanned linear InSb detector array
International Nuclear Information System (INIS)
Finger, G.; Meyer, M.; Moorwood, A.F.M.
1987-01-01
A noise model for detectors operated in the capacitive discharge mode is presented. It is used to analyze the noise performance of the ESO nested timing readout technique applied to a linear 32-element InSb array which is multiplexed by a silicon switched-FET shift register. Analysis shows that KTC noise of the videoline is the major noise contribution; it can be eliminated by weighted double-correlated sampling. Best noise performance of this array is achieved at the smallest possible reverse bias voltage (not more than 20 mV) whereas excess noise is observed at higher reverse bias voltages. 5 references
Linear induction accelerator and pulse forming networks therefor
Buttram, Malcolm T.; Ginn, Jerry W.
1989-01-01
A linear induction accelerator includes a plurality of adder cavities arranged in a series and provided in a structure which is evacuated so that a vacuum inductance is provided between each adder cavity and the structure. An energy storage system for the adder cavities includes a pulsed current source and a respective plurality of bipolar converting networks connected thereto. The bipolar high-voltage, high-repetition-rate square pulse train sets and resets the cavities.
Nonlinear current-voltage behavior in PZT thin films
Energy Technology Data Exchange (ETDEWEB)
Xiao, Mi; Zhang, Weikang; Zhang, Zebin; Li, Shida; Zhang, Ping; Lan, Kuibo [Tianjin University, School of Electrical and Information Engineering, Tianjin (China)
2017-05-15
In this paper, Pb(Zr{sub 0.52}Ti{sub 0.48})O{sub 3} (PZT) thin films were prepared by sol-gel synthesis and characterized by X-ray diffraction, field emission scanning electron microscopy and current-voltage measurements. Here, we demonstrate that in addition to the outstanding ferroelectric and dielectric properties, the PZT films also have remarkably nonlinear current-voltage characteristics. Considering the contact of semi-conductive grains in the PZT films, a double Schottky barrier (DSB) model may be responsible for such phenomena. The test results show that with the decrease of annealing temperature and the increase of the film thickness, the threshold voltages (V{sub th}) increase obviously. The maximum V{sub th} value of 60.95 V and the minimum value of 6.9 V in our experiments were obtained from the five-layered samples annealed at 600 C and the two-layered samples annealed at 700 C, respectively. As a result, PZT thin film may lead to efficient switching and sensing devices. (orig.)
PMU-Aided Voltage Security Assessment for a Wind Power Plant: Preprint
Energy Technology Data Exchange (ETDEWEB)
Jiang, H.; Zhang, Y. C.; Zhang, J. J.; Muljadi, E.
2015-04-08
Because wind power penetration levels in electric power systems are continuously increasing, voltage stability is a critical issue for maintaining power system security and operation. The traditional methods to analyze voltage stability can be classified into two categories: dynamic and steady-state. Dynamic analysis relies on time-domain simulations of faults at different locations; however, this method needs to exhaust faults at all locations to find the security region for voltage at a single bus. With the widely located phasor measurement units (PMUs), the Thevenin equivalent matrix can be calculated by the voltage and current information collected by the PMUs. This paper proposes a method based on a Thevenin equivalent matrix to identify system locations that will have the greatest impact on the voltage at the wind power plant’s point of interconnection. The number of dynamic voltage stability analysis runs is greatly reduced by using the proposed method. The numerical results demonstrate the feasibility, effectiveness, and robustness of the proposed approach for voltage security assessment for a wind power plant.
Experimental study on the influence of radiation on high-voltage insulation gases
International Nuclear Information System (INIS)
Fujiwara, Yukio; Inoue, Takashi; Miyamoto, Kenji; Miyamoto, Naoki; Ohara, Yoshihiro; Okumura, Yoshikazu; Watanabe, Kazuhiro
1999-12-01
In a neutral beam injection (NBI) system for next generation tokamaks such as International Thermonuclear Experimental Reactor (ITER), insulation gas around a beam source will be irradiated with neutrons and gamma rays from the reactor. It is necessary to evaluate the influence of the radiation on the insulation gas for the engineering design of the ITER-NBI system. In the present paper, the influence of the 60 Co gamma rays on air, SF 6 , C 2 F 6 , CO 2 , and mixing gas of air and SF 6 was studied. Ionization current and voltage-holding characteristics of the gases were measured for an absorbed dose rate of 0.45 Gy/s using parallel disk electrodes whose diameter is 130 mm. Saturation current proved to increase linearly with a gap length between the electrodes, gas pressure, an absorbed dose rate, and molecular weight of the gases. Voltage-holding capability was degraded by about 10 %; the degree of the degradation did not depend on the absorbed dose rate. Dissociative products of SF 6 by the irradiation were also analyzed with a quadrupole mass spectrometer. News peaks that did not exist before irradiation appeared at the m/e of 48, 64, 67, 83, 86, 102, and 105 after irradiation. The amount of the dissociative products turned out to be saturated at a higher absorbed dose. (author)
International Nuclear Information System (INIS)
Kollar, D.; Kollarova, L.; Khorvat, P.
1976-01-01
A system is elaborated to control stability and linearity of the Cherenkov counter spectrometric channels in an experiment on a magnetic monopole search. Linearity of a light characteristic of a photoelectric multiplier is checked with the help of the calibrated light-strikings of light emitting diodes with flare intensity adjusted by controlling generator voltage across the mercury body. A program algorithm is presented for checking stability and linearity of the Cherenkov counter spectrometric channels which helps to consider the fatigue effects of the photoelectric multiplier resulting from the considerable loads
Copper wire theft and high voltage electrical burns.
Francis, Eamon C; Shelley, Odhran P
2014-01-01
High voltage electrical burns are uncommon. However in the midst of our economic recession we are noticing an increasing number of these injuries. Copper wire is a valuable commodity with physical properties as an excellent conductor of electricity making it both ubiquitous in society and prized on the black market. We present two consecutive cases referred to the National Burns Unit who sustained life threatening injuries from the alleged theft of high voltage copper wire and its omnipresence on an international scale.
Sensing voltage across lipid membranes
Swartz, Kenton J.
2009-01-01
The detection of electrical potentials across lipid bilayers by specialized membrane proteins is required for many fundamental cellular processes such as the generation and propagation of nerve impulses. These membrane proteins possess modular voltage-sensing domains, a notable example being the S1-S4 domains of voltage-activated ion channels. Ground-breaking structural studies on these domains explain how voltage sensors are designed and reveal important interactions with the surrounding lipid membrane. Although further structures are needed to fully understand the conformational changes that occur during voltage sensing, the available data help to frame several key concepts that are fundamental to the mechanism of voltage sensing. PMID:19092925
Additional ion bombardment in PVD processes generated by a superimposed pulse bias voltage
International Nuclear Information System (INIS)
Olbrich, W.; Kampschulte, G.
1993-01-01
The superimposed pulse bias voltage is a tool to apply an additional ion bombardment during deposition in physical vapour deposition (PVD) processes. It is generated by the combination of a d.c. ground voltage and a higher d.c. pulse voltage. Using a superimposed pulse bias voltage in ion-assisted PVD processes effects an additional all-around ion bombardment on the surface with ions of higher energy. Both metal and reactive or inert-gas ions are accelerated to the surface. The basic principles and important characteristics of this newly developed process such as ion fluxes or deposition rates are shown. Because of pulsing the high voltage, the deposition temperature does not increase much. The adhesion, structure, morphology and internal stresses are influenced by these additional ion impacts. The columnar growth of the deposited films could be suppressed by using the superimposed pulse bias voltage without increasing the deposition temperature. Different metallizations (Cr and Cu) produced by arc and sputter ion plating are investigated. Carbon-fibre-reinforced epoxy are coated with PVD copper films for further treatment in electrochemical processes. (orig.)
International Nuclear Information System (INIS)
Suprapto; Djasiman
2002-01-01
The improvement capacity of Cockcroft-Walton high voltage source from 300 kV/20 mA to 500 kV/mA has been carrying out. To improve the capacity of high voltage source was done by means of increasing the stage number of voltage multiplier from 11 to 18 and its output voltage measuring resistance. Each stage of voltage multiplier consists of 2 capacitors and 2 circuits of high voltage diode. This voltage multiplier is constructed using main components of high voltage capacitor and high voltage diode each of 0.22 μF/50 kV and UF 5408 respectively. To avoid stray discharge and corona it was provided with high voltage electrode and corona ring. The test result indicated that the output voltage obtained from 16 stages was 350 kV according to operating condition of 25 MΩ resistive load and first stage voltage of 28.5 kV with oscillator frequency of 24 Hz. That condition requires anode voltage and current of 5.5 kV and 2.5 A respectively. The no load test for 16 stages indicates 400 kV of output voltage and 28.5 kV first stage voltage. Efficiency of high voltage source was 48 % at 6.75 kW of output power. The expected test of 500 kV with 18 stages of voltage multiplier can not be carried out because of some restrictive of loading system. From the test result can be predicted that the output voltage of 500 kV with 18 stages of voltage multiplier requires 31.2 kV of first stage voltage. Then the expected high voltage source of Cockcroft-Walton is capable as accelerating voltage source for Electron Beam Machine with energy of 500 kV. (author)
Effect of anodizing voltage on the sorption of water molecules on porous alumina
Energy Technology Data Exchange (ETDEWEB)
Vrublevsky, I., E-mail: vrublevsky@bsuir.edu.by [Belarusian State University of Informatics and Radioelectronics, Department of Micro and Nanoelectronics, 220013 Minsk (Belarus); Chernyakova, K. [Belarusian State University of Informatics and Radioelectronics, Department of Micro and Nanoelectronics, 220013 Minsk (Belarus); Bund, A.; Ispas, A.; Schmidt, U. [Fachgebiet Elektrochemie und Galvanotechnik, Technische Universitaet Ilmenau, 98693 Ilmenau (Germany)
2012-05-01
The amount of water adsorbed on different centers on the surface of oxalic acid alumina films is a function of the anodizing voltage. It is decreased with increasing the anodizing voltage from 20 up to 50 V, came up to maximum value at 20-30 V and slightly increased at voltages above 50 V. Water adsorption by oxide films formed at voltages below 50 V can be due to the negative surface charge that is present on the alumina surface. The negative surface charge disappears in the films formed at voltages higher than 50 V, and thus, the water is adsorbed on aluminum ions in a tetrahedral and octahedral environment. The correlation between anodizing conditions of aluminum in oxalic acid and the structure and composition of anodic alumina was established by Fourier transform infrared spectroscopy (FTIR) and scanning electron microscopy (SEM), thermogravimetric and differential thermal analyses (TG/DTA).
76 FR 72203 - Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda
2011-11-22
... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Reliability Workshop Agenda As announced in the Notice of Staff..., from 9 a.m. to 4:30 p.m. to explore the interaction between voltage control, reliability, and economic...
Directory of Open Access Journals (Sweden)
Supachai Klungtong
2017-01-01
Full Text Available This paper presents a second-order voltage-mode filter with three inputs and single-output voltage using single commercially available IC, one resistor, and two capacitors. The used commercially available IC, called LT1228, is manufactured by Linear Technology Corporation. The proposed filter is based on parallel RLC circuit. The filter provides five output filter responses, namely, band-pass (BP, band-reject (BR, low-pass (LP, high-pass (HP, and all-pass (AP functions. The selection of each filter response can be done without the requirement of active and passive component matching condition. Furthermore, the natural frequency and quality factor are electronically controlled. Besides, the nonideal case is also investigated. The output voltage node exhibits low impedance. The experimental results can validate the theoretical analyses.
A support vector machine (SVM) based voltage stability classifier
Energy Technology Data Exchange (ETDEWEB)
Dosano, R.D.; Song, H. [Kunsan National Univ., Kunsan, Jeonbuk (Korea, Republic of); Lee, B. [Korea Univ., Seoul (Korea, Republic of)
2007-07-01
Power system stability has become even more complex and critical with the advent of deregulated energy markets and the growing desire to completely employ existing transmission and infrastructure. The economic pressure on electricity markets forces the operation of power systems and components to their limit of capacity and performance. System conditions can be more exposed to instability due to greater uncertainty in day to day system operations and increase in the number of potential components for system disturbances potentially resulting in voltage stability. This paper proposed a support vector machine (SVM) based power system voltage stability classifier using local measurements of voltage and active power of load. It described the procedure for fast classification of long-term voltage stability using the SVM algorithm. The application of the SVM based voltage stability classifier was presented with reference to the choice of input parameters; input data preconditioning; moving window for feature vector; determination of learning samples; and other considerations in SVM applications. The paper presented a case study with numerical examples of an 11-bus test system. The test results for the feasibility study demonstrated that the classifier could offer an excellent performance in classification with time-series measurements in terms of long-term voltage stability. 9 refs., 14 figs.
Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi
2016-07-05
The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane.
Sakata, Souhei; Jinno, Yuka; Kawanabe, Akira; Okamura, Yasushi
2016-01-01
The cytoplasmic region of voltage-sensing phosphatase (VSP) derives the voltage dependence of its catalytic activity from coupling to a voltage sensor homologous to that of voltage-gated ion channels. To assess the conformational changes in the cytoplasmic region upon activation of the voltage sensor, we genetically incorporated a fluorescent unnatural amino acid, 3-(6-acetylnaphthalen-2-ylamino)-2-aminopropanoic acid (Anap), into the catalytic region of Ciona intestinalis VSP (Ci-VSP). Measurements of Anap fluorescence under voltage clamp in Xenopus oocytes revealed that the catalytic region assumes distinct conformations dependent on the degree of voltage-sensor activation. FRET analysis showed that the catalytic region remains situated beneath the plasma membrane, irrespective of the voltage level. Moreover, Anap fluorescence from a membrane-facing loop in the C2 domain showed a pattern reflecting substrate turnover. These results indicate that the voltage sensor regulates Ci-VSP catalytic activity by causing conformational changes in the entire catalytic region, without changing their distance from the plasma membrane. PMID:27330112
New circuits high-voltage pulse generators with inductive-capacitive energy storage
International Nuclear Information System (INIS)
Gordeev, V.S.; Myskov, G.A.
2001-01-01
The paper describes new electric circuits of multi-cascade generators based on stepped lines. The distinction of the presented circuits consists in initial storage of energy in electric and magnetic fields simultaneously. The circuit of each generator,relations of impedances,values of initial current and charge voltages are selected in such a manner that the whole of initially stored energy is concentrated at the generator output as a result of transient wave processes. In ideal case the energy is transferred with 100% efficiency to the resistive load where a rectangular voltage pulse is formed, whose duration is equals to the double electrical length of the individual cascade. At the same time there is realized a several time increase of output voltage as compared to the charge voltage of the generator. The use of the circuits proposed makes it possible to ensure a several time increase (as compared to the selection of the number of cascades) of the generator energy storage, pulse current and output electric power
Stress-Dependent Voltage Offsets From Polymer Insulators Used in Rock Mechanics and Material Testing
Carlson, G. G.; Dahlgren, Robert; Gray, Amber; Vanderbilt, V. C.; Freund, F.; Johnston, M. J.; Dunson, C.
2013-01-01
Dielectric insulators are used in a variety of laboratory settings when performing experiments in rock mechanics, petrology, and electromagnetic studies of rocks in the fields of geophysics,material science, and civil engineering. These components may be used to electrically isolate geological samples from the experimental equipment, to perform a mechanical compliance function between brittle samples and the loading equipment, to match ultrasonic transducers, or perform other functions. In manyexperimental configurations the insulators bear the full brunt of force applied to the sample but do not need to withstand high voltages, therefore the insulators are often thin sheets of mechanically tough polymers. From an instrument perspective, transduction from various types of mechanical perturbation has beenqualitatively compared for a number of polymers [1, 2] and these error sources are readily apparent duringhigh-impedance measurements if not mitigated. However even when following best practices, a force dependent voltage signal still remains and its behavior is explored in this presentation. In this experimenttwo thin sheets (0.25 mm) of high-density polyethylene (HDPE) were set up in a stack, held alternatelybetween three aluminum bars; this stack was placed on the platen of a 60T capacity hydraulic testingmachine. The surface area, A, over which the force is applied to the PE sheets in this sandwich is roughly 40 square cm, each sheet forming a parallel-plate capacitor having roughly 320 pF [3], assuming therelative dielectric permittivity of PE is approximately 2.3. The outer two aluminum bars were connected to the LO input ofthe electrometer and the central aluminum bar was connected to the HI input of a Keithley model 617 electrometer. Once the stack is mechanically well-seated with no air gaps, the voltage offset is observed tobe a linear function of the baseline voltage for a given change in applied force. For a periodically appliedforce of 66.7 kN the
Dimerization of the voltage-sensing phosphatase controls its voltage-sensing and catalytic activity.
Rayaprolu, Vamseedhar; Royal, Perrine; Stengel, Karen; Sandoz, Guillaume; Kohout, Susy C
2018-05-07
Multimerization is a key characteristic of most voltage-sensing proteins. The main exception was thought to be the Ciona intestinalis voltage-sensing phosphatase (Ci-VSP). In this study, we show that multimerization is also critical for Ci-VSP function. Using coimmunoprecipitation and single-molecule pull-down, we find that Ci-VSP stoichiometry is flexible. It exists as both monomers and dimers, with dimers favored at higher concentrations. We show strong dimerization via the voltage-sensing domain (VSD) and weak dimerization via the phosphatase domain. Using voltage-clamp fluorometry, we also find that VSDs cooperate to lower the voltage dependence of activation, thus favoring the activation of Ci-VSP. Finally, using activity assays, we find that dimerization alters Ci-VSP substrate specificity such that only dimeric Ci-VSP is able to dephosphorylate the 3-phosphate from PI(3,4,5)P 3 or PI(3,4)P 2 Our results indicate that dimerization plays a significant role in Ci-VSP function. © 2018 Rayaprolu et al.
DEFF Research Database (Denmark)
Pankratov, A.L.; Sobolev, A.S.; Koshelets, V.P.
2007-01-01
We have numerically investigated the dynamics of a long linear Josephson tunnel junction with overlap geometry. Biased by a direct current (dc) and an applied dc magnetic field, the junction has important applications as tunable high frequency oscillator [flux-flow oscillator (FFO......) placed at both ends of the FFO. In our model, the damping parameter depends both on the spatial coordinate and on the amplitude of the ac voltage. In order to find the dc current-voltage curves, the damping parameter has to be calculated self-consistently by successive approximations and time integration...
The electric strength of high-voltage transformers insulation at effect of partial dischargers
International Nuclear Information System (INIS)
Khoshravan, E.; Zeraatparvar, A.; Gashimov, A.M.; Mehdizadeh, R.N.
2001-01-01
Full text : In paper the change of electric strength of high-voltage transformers insulation at the effect of partial discharges with space charge accumulation was investigated. It is revealed that the effect of partial discharges of insulation materials results the reduction of their pulsing electric strength which can restore the own initial value at releasing of saved charge the volume of a material under condition of absence the ineversible structural changes in it. Researches of high-voltage transformers insulation's non-failure operation conditions show, that at increasing of insulation work time in a strong electrical field the reduction of average breakdown voltages with simultaneous increasing of spread in discharge voltage values takes place. It authentically testifies to reduction of short-time discharge voltage of insulation materials during their electrical aging. As the basic reason of insulation electrical aging the partial discharges occurring in gas cavities inside insulation were considered. It is known that the space charges will be formed in insulation elements of high-voltage devices which effects in dielectrical property of these elements including the electric strength and the space charge formation can occur also at partial discharges in an alternating voltage while the service of high-voltage transformers. In the given work the experiments in revealing separate influence partial discharges in pulsing electric strength of insulation materials at presence and at absence inside them the space charge were spent
Ultra Low-Voltage Energy Harvesting
2013-09-01
if in a solar battery charger the level of illumination were to drop due to cloud cover, the diode would prevent discharging of the battery when...the source voltage becomes lower than battery voltage. The drawback of a simple circuit like this is that once the source voltage is lower than the...longer charged when the battery voltage is above the OV setting. Figure 13. Block diagram of BQ25504 circuit . (From [10]) 18 THIS PAGE
The dynamic response of a linear brushless D.C. motor
Energy Technology Data Exchange (ETDEWEB)
Moghani, J.S.; Eastham, J.F. [Univ. of Bath (United Kingdom). School of Electrical and Electronic Engineering
1995-12-31
The paper describes the use of the Matlab Analogue Simulation Toolbox SIMULINK for the closed loop dynamic modeling of a linear brushless dc motor which is supplied from a delta-modulated inverter. The work is validated by experimental results taken from a large test rig. Linear version of all rotating machines are possible; a rotating machine can be notionally cut along a radial plane and unrolled to yield a linear version. The most popular form of linear machine, as judged by the quantities that have been produced is the linear induction motor. This has the advantage of first an inexpensive secondary that is often a simple iron backed conducting plate, and secondly the possibility of simple voltage control. The linear brushless synchronous motor is potentially more expensive to produce than its induction counterpart because of the permanent magnets which provide the excitation mmf and the necessity of an inverter supply. However the machine has a power factor efficiency product which can be double that of an induction motor together with about twice the tractive force per pole area.
Polymer solar cells with enhanced open-circuit voltage and efficiency
Chen, Hsiang-Yu; Hou, Jianhui; Zhang, Shaoqing; Liang, Yongye; Yang, Guanwen; Yang, Yang; Yu, Luping; Wu, Yue; Li, Gang
2009-11-01
Following the development of the bulk heterojunction structure, recent years have seen a dramatic improvement in the efficiency of polymer solar cells. Maximizing the open-circuit voltage in a low-bandgap polymer is one of the critical factors towards enabling high-efficiency solar cells. Study of the relation between open-circuit voltage and the energy levels of the donor/acceptor in bulk heterojunction polymer solar cells has stimulated interest in modifying the open-circuit voltage by tuning the energy levels of polymers. Here, we show that the open-circuit voltage of polymer solar cells constructed based on the structure of a low-bandgap polymer, PBDTTT, can be tuned, step by step, using different functional groups, to achieve values as high as 0.76 V. This increased open-circuit voltage combined with a high short-circuit current density results in a polymer solar cell with a power conversion efficiency as high as 6.77%, as certified by the National Renewable Energy Laboratory.
Radio and television interference caused by corona discharges from high-voltage transmission lines
International Nuclear Information System (INIS)
Sarmadi, M.
1996-01-01
Increase in power utility loads in industrialized countries, as well as developing countries, demands a higher level of transmission line voltage. Radio interference (RI) problems have been determined to be a limiting factor in selecting the size of transmission line conductors. Transmission line noise is primarily caused by corona discharges in the immediate vicinity of the conductor. It has been observed that discharges occur during both half-cycles of the applied voltage, but positive corona is usually predominant at AM radio frequencies range with practical high-voltage and extra high-voltage transmission lines. The corona radio noise effect is highly dependent upon the presence of particles on the surface of the conductor and the increase of the electrical gradient beyond the breakdown value of the air. Therefore, corona radio noise varies significantly with the weather and atmospheric conditions and generally increases by 10 to 30 dB in foul weather
Organic dielectrics in high voltage cables
Energy Technology Data Exchange (ETDEWEB)
Vermeer, J
1962-03-01
It appears that the limit has been reached in the applicability of oil-impregnated paper as the dielectric for ehv cables, as with rising voltages the prevention of conductor losses becomes increasingly difficult, while the dielectric losses of the insulation, increasing as the square of the voltage, contribute to a greater extent to the temperature rise of the conductor. The power transmitting capacity of ehv cables reaches a maximum at 500 to 600 kV for these reasons. Apart from artificial cooling, a substantial improvement can be obtained only with the use of insulating materials with much lower dielectric losses; these can moreover be applied with a smaller wall thickness, but this means higher field strengths. Synthetic polymer materials meet these requirements but can be used successfully only in the form of lapped film tapes impregnated with suitable liquids. The electrical properties of these heterogeneous dielectrics, in particular, their impulse breakdown strengths are studied in detail.
High-voltage test and training of plastic streamer tubes for the DELPHI hadron calorimeter
International Nuclear Information System (INIS)
Alekseev, G.D.; Cellar, S.; Khomenko, B.A.; Korytov, A.V.; Kulinich, P.A.; Micelmacher, G.V.; Sedykh, Yu.V.; Toledo, R.
1987-01-01
The results of high-voltage test and training of plastic streamer tubes of the DELPHI hadron calorimeter are presented. The testing technique is considered in detail. The equipment for high-voltage training consists of a mini-computer, CAMAC-electronics, a controllable high-voltage supply and a digital ampermeter. The experimental results shows that high-voltage training of streamer tubes improves their characteristics. The value of dark current decreased up to 1 μA. The operational voltage range increased by a value more than 300 V
Novel phenomena in one-dimensional non-linear transport in long quantum wires
International Nuclear Information System (INIS)
Morimoto, T; Hemmi, M; Naito, R; Tsubaki, K; Park, J-S; Aoki, N; Bird, J P; Ochiai, Y
2006-01-01
We have investigated the non-linear transport properties of split-gate quantum wires of various channel lengths. In this report, we present results on a resonant enhancement of the non-linear conductance that is observed near pinch-off under a finite source-drain bias voltage. The resonant phenomenon exhibits a strong dependence on temperature and in-plane magnetic field. We discuss the possible relationship of this phenomenon to the spin-polarized manybody state that has recently been suggested to occur in quasi-one dimensional systems
Copper wire theft and high voltage electrical burns
Francis, Eamon C; Shelley, Odhran P
2014-01-01
High voltage electrical burns are uncommon. However in the midst of our economic recession we are noticing an increasing number of these injuries. Copper wire is a valuable commodity with physical properties as an excellent conductor of electricity making it both ubiquitous in society and prized on the black market. We present two consecutive cases referred to the National Burns Unit who sustained life threatening injuries from the alleged theft of high voltage copper wire and its omnipresence on an international scale. PMID:25356371
Low-Voltage Switched-Capacitor Circuits
DEFF Research Database (Denmark)
Bidari, E.; Keskin, M.; Maloberti, F.
1999-01-01
Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications.......Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications....
Modeling charge polarization voltage for large lithium-ion batteries in electric vehicles
Directory of Open Access Journals (Sweden)
Yan Jiang
2013-06-01
Full Text Available Purpose: Polarization voltage of the lithium-ion battery is an important parameter that has direct influence on battery performance. The paper aims to analyze the impedance characteristics of the lithium-ion battery based on EIS data. Design/methodology/approach: The effects of currents, initial SOC of the battery on charge polarization voltage are investigated, which is approximately linear function of charge current. The change of charge polarization voltage is also analyzed with the gradient analytical method in the SOC domain. The charge polarization model with two RC networks is presented, and parts of model parameters like Ohmic resistance and charge transfer impedance are estimated by both EIS method and battery constant current testing method. Findings: This paper reveals that the Ohmic resistance accounts for much contribution to battery total polarization compared to charge transfer impedance. Practical implications: Experimental results demonstrate the efficacy of the model with the proposed identification method, which provides the foundation for battery charging optimization. Originality/value: The paper analyzed the impedance characteristics of the lithium-ion battery based on EIS data, presented a charge polarization model with two RC networks, and estimated parameters like Ohmic resistance and charge transfer impedance.
DC-link Voltage Coordinative-Proportional Control in Cascaded Converter Systems
DEFF Research Database (Denmark)
Tian, Yanjun; Loh, Poh Chiang; Deng, Fujin
2015-01-01
PI controllers are frequently implemented in cascaded converter system to control the DC-link voltage, because they can achieve zero steady state error. However the PI controller adds a pole at the origin point and a zero on the left half plane, and it increases the control system type number......, and then the system is more difficult to control. This paper proposed a DC-link control method for the two stages cascaded converter, and it uses proportional controller for the DC-link voltage control. This control method can achieve zero steady state error on the DC-link voltage; reduce the control system type...
Autonomous Voltage Unbalance Compensation in an Islanded Droop-Controlled Microgrid
DEFF Research Database (Denmark)
Savaghebi, Mehdi; Jalilian, Alireza; Vasquez, Juan Carlos
2013-01-01
Recently, there is an increasing interest in using distributed generators (DGs) not only to inject power into the grid, but also to enhance the power quality. In this paper, a stationary-frame control method for voltage unbalance compensation in an islanded microgrid is proposed. This method...... is based on the proper control of DGs interface converters. The DGs are controlled to compensate voltage unbalance autonomously while share the compensation effort and also active and reactive power, properly. The control system of the DGs mainly consists of active and reactive power droop controllers......, virtual impedance loop, voltage and current controllers and unbalance compensator. The design approach of the control system is discussed in detail and simulation and experimental results are presented. The results demonstrate the effectiveness of the proposed method in compensation of voltage unbalance....
Bootstrapped Low-Voltage Analog Switches
DEFF Research Database (Denmark)
Steensgaard-Madsen, Jesper
1999-01-01
Novel low-voltage constant-impedance analog switch circuits are proposed. The switch element is a single MOSFET, and constant-impedance operation is obtained using simple circuits to adjust the gate and bulk voltages relative to the switched signal. Low-voltage (1-volt) operation is made feasible...
[Development of residual voltage testing equipment].
Zeng, Xiaohui; Wu, Mingjun; Cao, Li; He, Jinyi; Deng, Zhensheng
2014-07-01
For the existing measurement methods of residual voltage which can't turn the power off at peak voltage exactly and simultaneously display waveforms, a new residual voltage detection method is put forward in this paper. First, the zero point of the power supply is detected with zero cross detection circuit and is inputted to a single-chip microcomputer in the form of pulse signal. Secend, when the zero point delays to the peak voltage, the single-chip microcomputer sends control signal to power off the relay. At last, the waveform of the residual voltage is displayed on a principal computer or oscilloscope. The experimental results show that the device designed in this paper can turn the power off at peak voltage and is able to accurately display the voltage waveform immediately after power off and the standard deviation of the residual voltage is less than 0.2 V at exactly one second and later.
Plasma simulation of electron avalanche in a linear thyratron
International Nuclear Information System (INIS)
Kushner, M.J.
1985-01-01
Thyratrons typically operate at sufficiently small PD (pressure x electrode separation) that holdoff is obtained by operating on the near side of the Paschen curve, and by shielding the slot in the control grid so there is no straight line path for electrons to reach the anode from the cathode. Electron avalanche is initiated by pulsing the control grid to a high voltage. Upon collapse of voltage in the cathode-control grid space, the discharge is sustained by penetration of potential through the control grid slot into the cathode-control grid region. To better understand the electron avalanche process in multi-grid and slotted structures such as thyratrons, a plasma simulation code has been constructed. This effort is in support of a companion program in which a linear thyratron is being electrically and spectroscopically characterized
Czech Academy of Sciences Publication Activity Database
Chomát, Miroslav; Schreier, Luděk
2005-01-01
Roč. 152, č. 3 (2005), s. 494-500 ISSN 1350-2352 R&D Projects: GA ČR(CZ) GA102/02/0554 Institutional research plan: CEZ:AV0Z20570509 Keywords : DC-link voltage * unbalanced three-phase voltage Subject RIV: JA - Electronics ; Optoelectronics, Electrical Engineering Impact factor: 0.587, year: 2005
Bunch compression at the Stanford Linear Collider
International Nuclear Information System (INIS)
Holtzapple, R.L.; Decker, F.J.; Simopoulos, C.
1995-08-01
The production and measurement of short electron and positron bunches in the Stanford Linear Collider (SLC) will be presented in this paper. The bunches are compressed in a transport line between the damping rings and the linac. The electron and positron bunch distributions in the SLC linac have been measured using a Hamamatsu, model N3373-02, 500-femtosecond streak camera. The distributions were measured at the end of the SLC linac versus the bunch compressor RF voltage. The measurements are compared with simulations
DEFF Research Database (Denmark)
Lundby, Alicia; Mutoh, Hiroki; Dimitrov, Dimitar
2008-01-01
Ci-VSP contains a voltage-sensing domain (VSD) homologous to that of voltage-gated potassium channels. Using charge displacement ('gating' current) measurements we show that voltage-sensing movements of this VSD can occur within 1 ms in mammalian membranes. Our analysis lead to development...
Shaping charge excitations in chiral edge states with a time-dependent gate voltage
Misiorny, Maciej; Fève, Gwendal; Splettstoesser, Janine
2018-02-01
We study a coherent conductor supporting a single edge channel in which alternating current pulses are created by local time-dependent gating and sent on a beam-splitter realized by a quantum point contact. The current response to the gate voltage in this setup is intrinsically linear. Based on a fully self-consistent treatment employing a Floquet scattering theory, we analyze the effect of different voltage shapes and frequencies, as well as the role of the gate geometry on the injected signal. In particular, we highlight the impact of frequency-dependent screening on the process of shaping the current signal. The feasibility of creating true single-particle excitations with this method is confirmed by investigating the suppression of excess noise, which is otherwise created by additional electron-hole pair excitations in the current signal.
Investigation of leakage current and breakdown voltage in irradiated double-sided 3D silicon sensors
International Nuclear Information System (INIS)
Betta, G.-F. Dalla; Mendicino, R.; Povoli, M.; Sultan, D.M.S.; Ayllon, N.; Hoeferkamp, M.; McDuff, H.; Seidel, S.; Boscardin, M.; Zorzi, N.; Mattiazzo, S.
2016-01-01
We report on an experimental study aimed at gaining deeper insight into the leakage current and breakdown voltage of irradiated double-sided 3D silicon sensors from FBK, so as to improve both the design and the fabrication technology for use at future hadron colliders such as the High Luminosity LHC. Several 3D diode samples of different technologies and layout are considered, as well as several irradiations with different particle types. While the leakage current follows the expected linear trend with radiation fluence, the breakdown voltage is found to depend on both the bulk damage and the surface damage, and its values can vary significantly with sensor geometry and process details.
Lörinczi, Éva; Gómez-Posada, Juan Camilo; de La Peña, Pilar; Tomczak, Adam P.; Fernández-Trillo, Jorge; Leipscher, Ulrike; Stühmer, Walter; Barros, Francisco; Pardo, Luis A.
2015-03-01
Voltage-gated channels open paths for ion permeation upon changes in membrane potential, but how voltage changes are coupled to gating is not entirely understood. Two modules can be recognized in voltage-gated potassium channels, one responsible for voltage sensing (transmembrane segments S1 to S4), the other for permeation (S5 and S6). It is generally assumed that the conversion of a conformational change in the voltage sensor into channel gating occurs through the intracellular S4-S5 linker that provides physical continuity between the two regions. Using the pathophysiologically relevant KCNH family, we show that truncated proteins interrupted at, or lacking the S4-S5 linker produce voltage-gated channels in a heterologous model that recapitulate both the voltage-sensing and permeation properties of the complete protein. These observations indicate that voltage sensing by the S4 segment is transduced to the channel gate in the absence of physical continuity between the modules.
Development of Multi-Functional Voltage Restore System
Suzuki, Satoshi; Ueda, Yoshinobu; Koganezawa, Takehisa; Ogihara, Yoshinori; Mori, Kenjiro; Fukazu, Naoaki
Recently, with the dawn of the electric deregulation, the installation of distributed generation with power electronics device has grown. This current causes a greater concern of power quality, primarily voltage disturbance for power companies, and their interest in power quality is peaking. Utilities are also interested in keeping their customers satisfied, as well as keeping them on-line and creating more revenue for the utility. As a countermeasure against the above surroundings, a variety type of devices based on power electronics has been developed to protect customers' load from power line voltage disturbance. One of them is the series type voltage restore. The series device is an active device, designed to provide a pure sinusoidal load voltage at all times, correcting voltage disturbance. Series type device compensates for voltage anomalies by inserting the ‘missing’ voltage onto the line through insertion transformer and inverter. This paper shows the setting guideline of target level to compensate voltage disturbance, that is, voltage dip, voltage harmonics, voltage imbalance and voltage flicker, and the design approach of the prototype of series voltage restores to accomplish the required compensation level. The prototype system gives satisfactory compensation performance through evaluation tests, which confirm the validity and effectiveness of the system.
Triple Line-Voltage Cascaded VIENNA Converter Applied as the Medium-Voltage AC Drive
Directory of Open Access Journals (Sweden)
Jia Zou
2018-04-01
Full Text Available A novel rectifier based on a triple line-voltage cascaded VIENNA converter (LVC-VC was proposed. Compared to the conventional cascaded H-bridge converters, the switch voltage stress is lower, and the numbers of switches and dc capacitors are fewer under similar operating conditions in the proposed new multilevel converter. The modeling and control for the LVC-VC ware presented. Based on the analysis of the operation principle of the new converter, the power factor correction of the proposed converter was realized by employing a traditional one-cycle control strategy. The minimum average value and maximum harmonic components of the dc-link voltages of the three VIENNA rectifier modules ware calculated. Three VIENNA dc-link voltages were unbalanced under the unbalanced load conditions, so the zero sequence current was injected to the three inner currents for balancing three VIENNA dc-link voltages. Simulation and the results of the experiment verified the availability of the new proposed multilevel converter and the effectiveness of the corresponding control strategy applied.
Coordinated single-phase control scheme for voltage unbalance reduction in low voltage network.
Pullaguram, Deepak; Mishra, Sukumar; Senroy, Nilanjan
2017-08-13
Low voltage (LV) distribution systems are typically unbalanced in nature due to unbalanced loading and unsymmetrical line configuration. This situation is further aggravated by single-phase power injections. A coordinated control scheme is proposed for single-phase sources, to reduce voltage unbalance. A consensus-based coordination is achieved using a multi-agent system, where each agent estimates the averaged global voltage and current magnitudes of individual phases in the LV network. These estimated values are used to modify the reference power of individual single-phase sources, to ensure system-wide balanced voltages and proper power sharing among sources connected to the same phase. Further, the high X / R ratio of the filter, used in the inverter of the single-phase source, enables control of reactive power, to minimize voltage unbalance locally. The proposed scheme is validated by simulating a LV distribution network with multiple single-phase sources subjected to various perturbations.This article is part of the themed issue 'Energy management: flexibility, risk and optimization'. © 2017 The Author(s).
Linear Transformer Drivers for Z-pinch Based Propulsion
Adams, Robert; Seidler, William; Giddens, Patrick; Fabisinski, Leo; Cassibry, Jason
2017-01-01
The MSFC/UAH team has been developing of a novel power management and distribution system called a Linear Transformer Driver (LTD). LTD's hold the promise of dramatically reducing the required mass to drive a z-pinch by replacing the capacitor banks which constitute half the mass of the entire system. The MSFC?UAH tea, is developing this technology in hope of integrating it with the Pulsed Fission Fusion (PuFF) propulsion concept. High-Voltage pulsed power systems used for Z-Pinch experimentation have in the past largely been based on Marx Generators. Marx generators deliver the voltage and current required for the Z-Pinch, but suffer from two significant drawbacks when applied to a flight system: they are very massive, consisting of high-voltage capacitor banks insulated in oil-filled tanks and they do not lend themselves to rapid pulsing. The overall goal of Phase 2 is to demonstrate the construction of a higher voltage stack from a number of cavities each of the design proven in Phase 1 and to characterize and understand the techniques for designing the stack. The overall goal of Phase 3 is to demonstrate the feasibility of constructing a higher energy cavity from a number of smaller LTD stacks, to characterize and understand the way in which the constituent stacks combine, and to extend this demonstration LTD to serve as the basis for a 64 kJ pulse generator for Z-Pinch experiments.
Control voltage and power fluctuations when connecting wind farms
Berinde, Ioan; Bǎlan, Horia; Oros Pop, Teodora Susana
2015-12-01
Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.
Control voltage and power fluctuations when connecting wind farms
International Nuclear Information System (INIS)
Berinde, Ioan; Bălan, Horia; Oros, Teodora Susana
2015-01-01
Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve
Bio-Inspired Carbon Monoxide Sensors with Voltage-Activated Sensitivity
Savagatrup, Suchol
2017-09-27
Carbon monoxide (CO) outcompetes oxygen when binding to the iron center of hemeproteins, leading to a reduction in blood oxygen level and acute poisoning. Harvesting the strong specific interaction between CO and the iron porphyrin provides a highly selective and customizable sensor. We report the development of chemiresistive sensors with voltage-activated sensitivity for the detection of CO comprising iron porphyrin and functionalized single-walled carbon nanotubes (F-SWCNTs). Modulation of the gate voltage offers a predicted extra dimension for sensing. Specifically, the sensors show a significant increase in sensitivity toward CO when negative gate voltage is applied. The dosimetric sensors are selective to ppm levels of CO and functional in air. UV/Vis spectroscopy, differential pulse voltammetry, and density functional theory reveal that the in situ reduction of FeIII to FeII enhances the interaction between the F-SWCNTs and CO. Our results illustrate a new mode of sensors wherein redox active recognition units are voltage-activated to give enhanced and highly specific responses.
Control voltage and power fluctuations when connecting wind farms
Energy Technology Data Exchange (ETDEWEB)
Berinde, Ioan, E-mail: ioan-berinde@yahoo.com; Bălan, Horia, E-mail: hbalan@mail.utcluj.ro; Oros, Teodora Susana, E-mail: teodoraoros-87@yahoo.com [Technical University of Cluj-Napoca, Romania, Faculty of Electrical Engineering, Department of Power Engineering and Management (Romania)
2015-12-23
Voltage, frequency, active power and reactive power are very important parameters in terms of power quality. These parameters are followed when connecting any power plant, the more the connection of wind farms. Connecting wind farms to the electricity system must not cause interference outside the limits set by regulations. Modern solutions for fast and automatic voltage control and power fluctuations using electronic control systems of reactive power flows. FACTS (Flexible Alternating Current Transmision System) systems, established on the basis of power electronic circuits ensure control of electrical status quantities to achieve the necessary transfer of power to the power grid. FACTS devices can quickly control parameters and sizes of state power lines, such as impedance line voltages and phase angles of the voltages of the two ends of the line. Their use can lead to improvement in power system operation by increasing the transmission capacity of power lines, power flow control lines, improved static and transient stability reserve.
Yunxiao, ZHANG; Yuanxiang, ZHOU; Ling, ZHANG; Zhen, LIN; Jie, LIU; Zhongliu, ZHOU
2018-05-01
In this paper, work was conducted to reveal electrical tree behaviors (initiation and propagation) of silicone rubber (SIR) under an impulse voltage with high temperature. Impulse frequencies ranging from 10 Hz to 1 kHz were applied and the temperature was controlled between 30 °C and 90 °C. Experimental results show that tree initiation voltage decreases with increasing pulse frequency, and the descending amplitude is different in different frequency bands. As the pulse frequency increases, more frequent partial discharges occur in the channel, increasing the tree growth rate and the final shape intensity. As for temperature, the initiation voltage decreases and the tree shape becomes denser as the temperature gets higher. Based on differential scanning calorimetry results, we believe that partial segment relaxation of SIR at high temperature leads to a decrease in the initiation voltage. However, the tree growth rate decreases with increasing temperature. Carbonization deposition in the channel under high temperature was observed under microscope and proven by Raman analysis. Different tree growth models considering tree channel characteristics are proposed. It is believed that increasing the conductivity in the tree channel restrains the partial discharge, holding back the tree growth at high temperature.
Energy Technology Data Exchange (ETDEWEB)
Molburg, J. C.; Kavicky, J. A.; Picel, K. C.
2008-03-03
This report focuses on transmission lines, which operate at voltages of 115 kV and higher. Currently, the highest voltage lines comprising the North American power grid are at 765 kV. The grid is the network of transmission lines that interconnect most large power plants on the North American continent. One transmission line at this high voltage was built near Chicago as part of the interconnection for three large nuclear power plants southwest of the city. Lines at this voltage also serve markets in New York and New England, also very high demand regions. The large power transfers along the West Coast are generally at 230 or 500 kV. Just as there are practical limits to centralization of power production, there are practical limits to increasing line voltage. As voltage increases, the height of the supporting towers, the size of the insulators, the distance between conductors on a tower, and even the width of the right-of-way (ROW) required increase. These design features safely isolate the electric power, which has an increasing tendency to arc to ground as the voltage (or electrical potential) increases. In addition, very high voltages (345 kV and above) are subject to corona losses. These losses are a result of ionization of the atmosphere, and can amount to several megawatts of wasted power. Furthermore, they are a local nuisance to radio transmission and can produce a noticeable hum. Centralized power production has advantages of economies of scale and special resource availability (for instance, hydro resources), but centralized power requires long-distance transfers of power both to reach customers and to provide interconnections for reliability. Long distances are most economically served at high voltages, which require large-scale equipment and impose a substantial footprint on the corridors through which power passes. The most visible components of the transmission system are the conductors that provide paths for the power and the towers that keep these
Resilient architecture design for voltage variation
Reddi, Vijay Janapa
2013-01-01
Shrinking feature size and diminishing supply voltage are making circuits sensitive to supply voltage fluctuations within the microprocessor, caused by normal workload activity changes. If left unattended, voltage fluctuations can lead to timing violations or even transistor lifetime issues that degrade processor robustness. Mechanisms that learn to tolerate, avoid, and eliminate voltage fluctuations based on program and microarchitectural events can help steer the processor clear of danger, thus enabling tighter voltage margins that improve performance or lower power consumption. We describe
Aghamohammadi, Mahdieh; Rödel, Reinhold; Zschieschang, Ute; Ocal, Carmen; Boschker, Hans; Weitz, R Thomas; Barrena, Esther; Klauk, Hagen
2015-10-21
The mechanisms behind the threshold-voltage shift in organic transistors due to functionalizing of the gate dielectric with self-assembled monolayers (SAMs) are still under debate. We address the mechanisms by which SAMs determine the threshold voltage, by analyzing whether the threshold voltage depends on the gate-dielectric capacitance. We have investigated transistors based on five oxide thicknesses and two SAMs with rather diverse chemical properties, using the benchmark organic semiconductor dinaphtho[2,3-b:2',3'-f]thieno[3,2-b]thiophene. Unlike several previous studies, we have found that the dependence of the threshold voltage on the gate-dielectric capacitance is completely different for the two SAMs. In transistors with an alkyl SAM, the threshold voltage does not depend on the gate-dielectric capacitance and is determined mainly by the dipolar character of the SAM, whereas in transistors with a fluoroalkyl SAM the threshold voltages exhibit a linear dependence on the inverse of the gate-dielectric capacitance. Kelvin probe force microscopy measurements indicate this behavior is attributed to an electronic coupling between the fluoroalkyl SAM and the organic semiconductor.
International Nuclear Information System (INIS)
Jiang Xue-Dong; Xu He; Wang Xin
2014-01-01
The charge quantity of small particulates such as PM2.5 plays a key role in the collection efficiency of an electrostatic precipitator (ESP). Under a single electrostatic voltage, it is difficult to charge and absorb small particulates. A new method of superimposing an alternative voltage on the electrostatic voltage is provided in this paper. Characteristics of small particulates are analyzed under alternative and electrostatic voltages. It is demonstrated that an alternative voltage can significantly improve the collection efficiency in three aspects: preventing anti-corona, increasing the charge quantity of small particulates, and increasing the median particulate size by electric agglomeration. In addition, practical usage with the superposition of alternative voltage is provided, and the results are in agreement with the theoretical analysis. (physics of gases, plasmas, and electric discharges)
A linear two-layer model for flat-band shift in irradiated MOS devices
Energy Technology Data Exchange (ETDEWEB)
Churchill, J N; Holstrom, F E; Collins, T W [International Business Machines Corp., San Jose, Calif. (USA)
1976-04-01
A closed-form mathematical expression is derived for the flat-band shift as a function of gate bias during electron irradiation. The model assumes that the charge in the oxide consists of charged layers of variable thickness at each of the two interfaces, depending on voltage polarity and magnitude. The region of extreme linearity which has been observed by numerous investigators and which normally occurs for the relatively small values of gate bias voltages fits this closed-form solution. Analytical results compare favourably with data obtained from 500 to 700 A thick oxides and with other previously published data.
DEFF Research Database (Denmark)
Ni, Ronggang; Xu, Dianguo; Blaabjerg, Frede
2017-01-01
relationship with the magnetic field distortion. Position estimation errors caused by higher order harmonic inductances and voltage harmonics generated by the SVPWM are also discussed. Both simulations and experiments are carried out based on a commercial PMSM to verify the superiority of the proposed method......Rotor position estimated with high-frequency (HF) voltage injection methods can be distorted by voltage errors due to inverter nonlinearities, motor resistance, and rotational voltage drops, etc. This paper proposes an improved HF square-wave voltage injection algorithm, which is robust to voltage...... errors without any compensations meanwhile has less fluctuation in the position estimation error. The average position estimation error is investigated based on the analysis of phase harmonic inductances, and deduced in the form of the phase shift of the second-order harmonic inductances to derive its...
Power-MOSFET Voltage Regulator
Miller, W. N.; Gray, O. E.
1982-01-01
Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.
International Nuclear Information System (INIS)
Povzner, A.A.; Volkov, A.G.
2017-01-01
Graphical abstract: We investigate nonequilibrium states of strongly correlated electron subsystem of lanthanum manganite, resulting in an external electric field. It is shown that the Joule heat leads to localization of electrons. As result, electric resistance, magnetization and other characteristics of the electronic system are depending on the applied voltage. This leads to the formation of the bistable state of the electronic system in the vicinity of the Curie point in an external electric field. This manifests itself in non-linear current-voltage characteristics of these substances, and should lead to oscillations of the magnetization and current. - Abstract: The nonequilibrium processes of “self-heating” arising during the flow of electric current are studied for ferromagnetic semiconductors with colossal magnetoresistance near the Curie temperature. These processes lead to the emergence of “hot” paramagnons and the destruction of ferromagnetic order. The solution to the heat balance equation takes into account the temperature dependence of the electrical conductivity caused by Anderson localization of electrons due to their scattering on magnetic inhomogeneities. Description of delocalized electrons subsystem takes into account the spin-flip processes leading to the double exchange. At that, the value of the Anderson percolation threshold and the double exchange depends on the amplitude of spin fluctuations. It was found that N-shaped current-voltage characteristics and hysteresis dependencies of magnetization on the voltage arise in a steady state due to the emergence of “hot” (by internal sample temperature) semiconductor paramagnetic phase. It is shown that the occurrence of self-oscillations of current and magnetization there may be.
Energy Technology Data Exchange (ETDEWEB)
Povzner, A.A., E-mail: a.a.povzner@urfu.ru; Volkov, A.G., E-mail: agvolkov@yandex.ru
2017-06-15
Graphical abstract: We investigate nonequilibrium states of strongly correlated electron subsystem of lanthanum manganite, resulting in an external electric field. It is shown that the Joule heat leads to localization of electrons. As result, electric resistance, magnetization and other characteristics of the electronic system are depending on the applied voltage. This leads to the formation of the bistable state of the electronic system in the vicinity of the Curie point in an external electric field. This manifests itself in non-linear current-voltage characteristics of these substances, and should lead to oscillations of the magnetization and current. - Abstract: The nonequilibrium processes of “self-heating” arising during the flow of electric current are studied for ferromagnetic semiconductors with colossal magnetoresistance near the Curie temperature. These processes lead to the emergence of “hot” paramagnons and the destruction of ferromagnetic order. The solution to the heat balance equation takes into account the temperature dependence of the electrical conductivity caused by Anderson localization of electrons due to their scattering on magnetic inhomogeneities. Description of delocalized electrons subsystem takes into account the spin-flip processes leading to the double exchange. At that, the value of the Anderson percolation threshold and the double exchange depends on the amplitude of spin fluctuations. It was found that N-shaped current-voltage characteristics and hysteresis dependencies of magnetization on the voltage arise in a steady state due to the emergence of “hot” (by internal sample temperature) semiconductor paramagnetic phase. It is shown that the occurrence of self-oscillations of current and magnetization there may be.
CMOS-compatible high-voltage integrated circuits
Energy Technology Data Exchange (ETDEWEB)
Parpia, Z
1988-01-01
Considerable savings in cost and development time can be achieved if high-voltage ICs (HVICs) are fabricated in an existing low-voltage process. In this thesis, the feasibility of fabricating HVICs in a standard CMOS process is investigated. The high-voltage capabilities of an existing 5-{mu}m CMOS process are first studied. High-voltage n- and p-channel transistors with breakdown voltages of 50 and 190 V, respectively, were fabricated without any modifications to the process under consideration. SPICE models for these transistors are developed, and their accuracy verified by comparison with experimental results. In addition, the effect of the interconnect metallization on the high-voltage performance of these devices is also examined. Polysilicon field plates are found to be effective in preventing premature interconnect induced breakdown in these devices. A novel high-voltage transistor structure, the insulated base transistor (IBT), based on a merged MOS-bipolar concept, is proposed and implemented. In order to enhance the high-voltage device capabilities, an improved CMOS-compatible HVIC process using junction isolation is developed.
Linear induction accelerators made from pulse-line cavities with external pulse injection
International Nuclear Information System (INIS)
Smith, I.
1979-01-01
Two types of linear induction accelerator have been reported previously. In one, unidirectional voltage pulses are generated outside the accelerator and injected into the accelerator cavity modules, which contain ferromagnetic material to reduce energy losses in the form of currents induced, in parallel with the beam, in the cavity structure. In the other type, the accelerator cavity modules are themselves pulse-forming lines with energy storage and switches; parallel current losses are made zero by the use of circuits that generate bidirectional acceleration waveforms with a zero voltage-time integral. In a third type of design described here, the cavities are externally driven, and 100% efficient coupling of energy to the beam is obtained by designing the external pulse generators to produce bidirectional voltage waveforms with zero voltage-time integral. A design for such a pulse generator is described that is itself one hundred percent efficient and which is well suited to existing pulse power techniques. Two accelerator cavity designs are described that can couple the pulse from such a generator to the beam; one of these designs provides voltage doubling. Comparison is made between the accelerating gradients that can be obtained with this and the preceding types of induction accelerator
Voltage-assisted polymer wafer bonding
International Nuclear Information System (INIS)
Varsanik, J S; Bernstein, J J
2012-01-01
Polymer wafer bonding is a widely used process for fabrication of microfluidic devices. However, best practices for polymer bonds do not achieve sufficient bond strength for many applications. By applying a voltage to a polymer bond in a process called voltage-assisted bonding, bond strength is shown to improve dramatically for two polymers (Cytop™ and poly(methyl methacrylate)). Several experiments were performed to provide a starting point for further exploration of this technique. An optimal voltage range is experimentally observed with a reduction in bonding strength at higher voltages. Additionally, voltage-assisted bonding is shown to reduce void diameter due to bond defects. An electrostatic force model is proposed to explain the improved bond characteristics. This process can be used to improve bond strength for most polymers. (paper)
Flying capacitor resonant pole inverter applying five voltage levels
Settels, S.J.
2017-01-01
Industrial applications, e.g. semiconductor manufacturing equipment, require power amplifiers providing high power with high precision and bandwidth. Due to limitations in system infrastructure, increasing voltage is favorable to increasing current to generate more output power. This research
Voltage harmonics mitigation through hybrid active power filer
International Nuclear Information System (INIS)
Sahito, A.A.; Tunio, S.M.; Khizer, A.N.
2016-01-01
Fast dynamic response, high efficiency, low cost and small size of power electronic converters have exponentially increased their use in modern power system which resulted in harmonically distorted voltage and currents. Voltage harmonics mainly caused by current harmonics are more dangerous as performance and expected operating life of other power system equipment are affected by harmonically distorted supply voltage. Electronic filter circuits are used to improve system power quality by mitigating adverse effects of harmonics. Hybrid filters having advantages of both passive and active filters are preferred to resolve the problem of harmonics efficiently and avoiding any chance of resonance. In this paper, a three phase three wire network is considered to supply an adjustable speed drive represented by a resistive load connected across a three phase bridge rectifier. Simulation of the considered system shows THD (Total Harmonic Distortion) of 18.91 and 7.61 percentage in supply current and voltage respectively. A HAPF (Hybrid Active Power Filter) is proposed to reduce these THD values below 5 percentage as recommended by IEEE Standard-519. P-Q theorem is used to calculate required parameters for proposed filter, which is implemented through hysteresis control. Simulation results confirm the effectiveness of the designed filter as THD for both current and voltage have reduced below allowable limit of 5 percentage. (author)
Voltage Harmonics Mitigation through Hybrid Active Power Filter
Directory of Open Access Journals (Sweden)
Anwer Ali Sahito
2016-01-01
Full Text Available Fast dynamic response, high efficiency, low cost and small size of power electronic converters have exponentially increased their use in modern power system which resulted in harmonically distorted voltage and currents. Voltage harmonics mainly caused by current harmonics are more dangerous as performance and expected operating life of other power system equipment are affected by harmonically distorted supply voltage. Electronic filter circuits are used to improve system power quality by mitigating adverse effects of harmonics. Hybrid filters having advantages of both passive and active filters are preferred to resolve the problem of harmonics efficiently and avoiding any chance of resonance. In this paper, a three phase three wire network is considered to supply an adjustable speed drive represented by a resistive load connected across a three phase bridge rectifier. Simulation of the considered system shows THD (Total Harmonic Distortion of 18.91 and 7.61% in supply current and voltage respectively. A HAPF (Hybrid Active Power Filter is proposed to reduce these THD values below 5% as recommended by IEEE Standard-519. P-Q theorem is used to calculate required parameters for proposed filter, which is implemented through hysteresis control. Simulation results confirm the effectiveness of the designed filter as THD for both current and voltage have reduced below allowable limit of 5%.
International Nuclear Information System (INIS)
Bora, B.
2015-01-01
On the basis of nonlinear global model, a dual frequency capacitively coupled radio frequency plasma driven by 13.56 MHz and 27.12 MHz has been studied to investigate the influences of driving voltages on the generation of dc self-bias and plasma heating. Fluid equations for the ions inside the plasma sheath have been considered to determine the voltage-charge relations of the plasma sheath. Geometrically symmetric as well as asymmetric cases with finite geometrical asymmetry of 1.2 (ratio of electrodes area) have been considered to make the study more reasonable to experiment. The electrical asymmetry effect (EAE) and finite geometrical asymmetry is found to work differently in controlling the dc self-bias. The amount of EAE has been primarily controlled by the phase angle between the two consecutive harmonics waveforms. The incorporation of the finite geometrical asymmetry in the calculations shift the dc self-bias towards negative polarity direction while increasing the amount of EAE is found to increase the dc self-bias in either direction. For phase angle between the two waveforms ϕ = 0 and ϕ = π/2, the amount of EAE increases significantly with increasing the low frequency voltage, whereas no such increase in the amount of EAE is found with increasing high frequency voltage. In contrast to the geometrically symmetric case, where the variation of the dc self-bias with driving voltages for phase angle ϕ = 0 and π/2 are just opposite in polarity, the variation for the geometrically asymmetric case is different for ϕ = 0 and π/2. In asymmetric case, for ϕ = 0, the dc self-bias increases towards the negative direction with increasing both the low and high frequency voltages, but for the ϕ = π/2, the dc-self bias is increased towards positive direction with increasing low frequency voltage while dc self-bias increases towards negative direction with increasing high frequency voltage
dc analysis and design of zero-voltage-switched multi-resonant converters
Tabisz, Wojciech A.; Lee, Fred C.
Recently introduced multiresonant converters (MRCs) provide zero-voltage switching (ZVS) of both active and passive switches and offer a substantial reduction of transistor voltage stress and an increase of load range, compared to their quasi-resonant converter counterparts. Using the resonant switch concept, a simple, generalized analysis of ZVS MRCs is presented. The conversion ratio and voltage stress characteristics are derived for basic ZVS MRCs, including buck, boost, and buck/boost converters. Based on the analysis, a design procedure that optimizes the selection of resonant elements for maximum conversion efficiency is proposed.
Directory of Open Access Journals (Sweden)
M. Hosseini Abardeh
2015-03-01
Full Text Available The matrix converter instability can cause a substantial distortion in the input currents and voltages which leads to the malfunction of the converter. This paper deals with the effects of input filter type, grid inductance, voltage fed to the modulation algorithm and the synchronous rotating digital filter time constant on the stability and performance of the matrix converter. The studies are carried out using eigenvalues of the linearized system and simulations. Two most common schemes for the input filter (LC and RLC are analyzed. It is shown that by a proper choice of voltage input to the modulation algorithm, structure of the input filter and its parameters, the need for the digital filter for ensuring the stability can be resolved. Moreover, a detailed model of the system considering the switching effects is simulated and the results are used to validate the analytical outcomes. The agreement between simulation and analytical results implies that the system performance is not deteriorated by neglecting the nonlinear switching behavior of the converter. Hence, the eigenvalue analysis of the linearized system can be a proper indicator of the system stability.
Modified SOGI based shunt active power filter to tackle various grid voltage abnormalities
Directory of Open Access Journals (Sweden)
Kalpeshkumar Patil
2017-10-01
Full Text Available Shunt Active Power Filters (SAPF have been effectively used to compensate the harmonics generated by the non-linear loads. The SAPF’s performance depends on the accurate generation of reference current, which is dependent greatly on the template of supply voltage. When the grid voltage (or its template is characterized by different abnormalities like presence of harmonics, imbalance, dc-offset etc., some of the conventional techniques of frequency estimation may fail to correctly estimate the frequency. This ultimately affects the reference current generation and hence, the SAPF operation, ultimately leading to high distortion of the grid currents. The paper presents modified dual second-order generalized integrator (MDSOGI based SAPF to ensure effective compensation of harmonics, even when the grid voltage is characterized by all the abnormalities mentioned above. It is highlighted with one case that when the sensed voltage is having dc-offset, DSOGI-SAPF results into the source current with THD, dc-offset and harmonic with values 5.82%, 0.8% and 4.5%, respectively. For the same case, the proposed technique yields grid current which is free of dc-offset and 2nd harmonic and has THD = 3.57%. The dynamic performance of the MDSOGI-SAPF is validated and its superior performance over DSOGI-SAPF is illustrated even with experimental results.
International Nuclear Information System (INIS)
Takata, N.
2000-01-01
It is necessary to obtain precise values of signal currents for the measurement of exposure rates for gamma rays with cavity ionization chambers. Signal currents are usually expected to have the same absolute values for both polarities of applied voltages. In the case of cylindrical cavity ionization chambers, volume recombination loss of ion pairs depends on the polarity of the applied voltage. This is because the values of mobility are different for positive and negative ions. It was found, however, that values of signal currents from a cylindrical ionization chamber change slightly more with a negative than with a positive applied voltage, even after being corrected for volume recombination loss. Moreover, absolute values of saturation currents, which are obtained by extrapolation of correction of initial recombination and diffusion loss, were larger for the negative than for the positive applied voltage. It is known from an experiment with parallel plate ionization chambers that when negative voltage is applied to the repeller electrode, the saturated signal current decreases with an increase in the applied voltage. This is because secondary electrons are accelerated and the stopping power of air for these electrons decreases. When positive voltage is applied, the reverse is true. The effects of acceleration and deceleration of secondary electrons by the electric field thus seem to cause a tendency opposite to the experimental results on the signal currents from cylindrical ionization chambers. The experimental results for the cylindrical ionization chamber can be explained as follows. When negative voltage is applied, secondary electrons are attracted to the central (collecting) electrode. Consequently, the path length of the trajectories of these secondary electrons in the ionization volume increases and signal current increases. The energy gain from the electric field by secondary electrons which stop in the ionization chamber also contributes to the