WorldWideScience

Sample records for linear voltage range

  1. Development of parallel-plate-based MEMS tunable capacitors with linearized capacitance–voltage response and extended tuning range

    Shavezipur, M; Nieva, P; Khajepour, A; Hashemi, S M

    2010-01-01

    This paper presents a design technique that can be used to linearize the capacitance–voltage (C–V) response and extend the tuning range of parallel-plate-based MEMS tunable capacitors beyond that of conventional designs. The proposed technique exploits the curvature of the capacitor's moving electrode which could be induced by either manipulating the stress gradients in the plate's material or using bi-layer structures. The change in curvature generates a nonlinear structural stiffness as the moving electrode undergoes out-of-plane deformation due to the actuation voltage. If the moving plate curvature is tailored such that the capacitance increment is proportional to the voltage increment, then a linear C–V response is obtained. The larger structural resistive force at higher bias voltage also delays the pull-in and increases the maximum tunability of the capacitor. Moreover, for capacitors containing an insulation layer between the two electrodes, the proposed technique completely eliminates the pull-in effect. The experimental data obtained from different capacitors fabricated using PolyMUMPs demonstrate the advantages of this design approach where highly linear C–V responses and tunabilities as high as 1050% were recorded. The design methodology introduced in this paper could be easily extended to for example, capacitive pressure and temperature sensors or infrared detectors to enhance their response characteristics.

  2. Voltage linear transformation circuit design

    Sanchez, Lucas R. W.; Jin, Moon-Seob; Scott, R. Phillip; Luder, Ryan J.; Hart, Michael

    2017-09-01

    Many engineering projects require automated control of analog voltages over a specified range. We have developed a computer interface comprising custom hardware and MATLAB code to provide real-time control of a Thorlabs adaptive optics (AO) kit. The hardware interface includes an op amp cascade to linearly shift and scale a voltage range. With easy modifications, any linear transformation can be accommodated. In AO applications, the design is suitable to drive a range of different types of deformable and fast steering mirrors (FSM's). Our original motivation and application was to control an Optics in Motion (OIM) FSM which requires the customer to devise a unique interface to supply voltages to the mirror controller to set the mirror's angular deflection. The FSM is in an optical servo loop with a wave front sensor (WFS), which controls the dynamic behavior of the mirror's deflection. The code acquires wavefront data from the WFS and fits a plane, which is subsequently converted into its corresponding angular deflection. The FSM provides +/-3° optical angular deflection for a +/-10 V voltage swing. Voltages are applied to the mirror via a National Instruments digital-to-analog converter (DAC) followed by an op amp cascade circuit. This system has been integrated into our Thorlabs AO testbed which currently runs at 11 Hz, but with planned software upgrades, the system update rate is expected to improve to 500 Hz. To show that the FSM subsystem is ready for this speed, we conducted two different PID tuning runs at different step commands. Once 500 Hz is achieved, we plan to make the code and method for our interface solution freely available to the community.

  3. Wide-range voltage modulation

    Rust, K.R.; Wilson, J.M.

    1992-06-01

    The Superconducting Super Collider's Medium Energy Booster Abort (MEBA) kicker modulator will supply a current pulse to the abort magnets which deflect the proton beam from the MEB ring into a designated beam stop. The abort kicker will be used extensively during testing of the Low Energy Booster (LEB) and the MEB rings. When the Collider is in full operation, the MEBA kicker modulator will abort the MEB beam in the event of a malfunction during the filling process. The modulator must generate a 14-μs wide pulse with a rise time of less than 1 μs, including the delay and jitter times. It must also be able to deliver a current pulse to the magnet proportional to the beam energy at any time during ramp-up of the accelerator. Tracking the beam energy, which increases from 12 GeV at injection to 200 GeV at extraction, requires the modulator to operate over a wide range of voltages (4 kV to 80 kV). A vacuum spark gap and a thyratron have been chosen for test and evaluation as candidate switches for the abort modulator. Modulator design, switching time delay, jitter and pre-fire data are presented

  4. All-Pass Filter Based Linear Voltage Controlled Quadrature Oscillator

    Koushick Mathur

    2017-01-01

    Full Text Available A linear voltage controlled quadrature oscillator implemented from a first-order electronically tunable all-pass filter (ETAF is presented. The active element is commercially available current feedback amplifier (AD844 in conjunction with the relatively new Multiplication Mode Current Conveyor (MMCC device. Electronic tunability is obtained by the control node voltage (V of the MMCC. Effects of the device nonidealities, namely, the parasitic capacitors and the roll-off poles of the port-transfer ratios of the device, are shown to be negligible, even though the usable high-frequency ranges are constrained by these imperfections. Subsequently the filter is looped with an electronically tunable integrator (ETI to implement the quadrature oscillator (QO. Experimental responses on the voltage tunable phase of the filter and the linear-tuning law of the quadrature oscillator up to 9.9 MHz at low THD are verified by simulation and hardware tests.

  5. Dual-range linearized transimpedance amplifier system

    Wessendorf, Kurt O.

    2010-11-02

    A transimpedance amplifier system is disclosed which simultaneously generates a low-gain output signal and a high-gain output signal from an input current signal using a single transimpedance amplifier having two different feedback loops with different amplification factors to generate two different output voltage signals. One of the feedback loops includes a resistor, and the other feedback loop includes another resistor in series with one or more diodes. The transimpedance amplifier system includes a signal linearizer to linearize one or both of the low- and high-gain output signals by scaling and adding the two output voltage signals from the transimpedance amplifier. The signal linearizer can be formed either as an analog device using one or two summing amplifiers, or alternately can be formed as a digital device using two analog-to-digital converters and a digital signal processor (e.g. a microprocessor or a computer).

  6. Colored Range Searching in Linear Space

    Grossi, Roberto; Vind, Søren Juhl

    2014-01-01

    In colored range searching, we are given a set of n colored points in d ≥ 2 dimensions to store, and want to support orthogonal range queries taking colors into account. In the colored range counting problem, a query must report the number of distinct colors found in the query range, while...... an answer to the colored range reporting problem must report the distinct colors in the query range. We give the first linear space data structure for both problems in two dimensions (d = 2) with o(n) worst case query time. We also give the first data structure obtaining almost-linear space usage and o...

  7. Dual voltage source inverter topology extending machine operating range

    Gerrits, T.; Wijnands, C.G.E.; Paulides, J.J.H.; Duarte, J.L.

    2012-01-01

    Field weakening operation of an electrical machine is a conventional method to extend the angular velocity range of a system above the peak output voltage of the inverter. A downside, however, is that an increased reactive current is required that creates losses but no output torque. A dual voltage

  8. Wide Operating Voltage Range Fuel Cell Battery Charger

    Hernandez Botella, Juan Carlos; Mira Albert, Maria del Carmen; Sen, Gokhan

    2014-01-01

    DC-DC converters for fuel cell applications require wide voltage range operation due to the unique fuel cell characteristic curve. Primary parallel isolated boost converter (PPIBC) is a boost derived topology for low voltage high current applications reaching an efficiency figure up to 98...... by two the converter input-to-output voltage gain. This allows covering the conditions when the fuel cell stack operates in the activation region (maximum output voltage) and increases the degrees of freedom for converter optimization. The transition between operating modes is studied because represents...

  9. A new linear induction voltage adder approach to radiography

    Mazarakis, M.G.; Poukey, J.W.; Frost, C.A.; Johnson, D.L.; Shope, S.L.; Halbleib, J.A.; Prestwich, K.R.; Turman, B.N.; Smith, I.

    1992-01-01

    At present, two types of accelerators are being utilized for x-ray radiography: first a linear RF or induction accelerator with multiple accelerating gaps and beam vacuum magnetic transport systems; and second, single gap pulse-power devices with a high voltage Blumlein pulse forming line. The authors present a conceptual design of a new type of linear induction accelerator that can bridge the gap between the two devices. It can produce 30--50-kA electron currents small diameter (∼ 1 mm) and high energy (12--20-MV) beams. There is no beam drifting through the device. The voltage addition of the accelerating gaps occurs at the central self-magnetically insulated cathode electrode. The electron beam is created at the high voltage end in a single gap diode. A magnetically-immersed foilless diode can produce high quality 0.5 mm radius 30--50 kA beams. A short 100--200-kG small bore solenoidal coil is required to maintain the beam radius during transport from the cathode tips to the x-ray converter target, 50--70 cm downstream. The idea of very high impedance MITL voltage adder accelerators was first tested with RADLAC II/SMILE experiments where 12--14-MV, 50-kA 1 cm radius beams were produced with 2--3 mm annulus thickness. A 12.5 m eight-stage voltage adder was utilized, coupled to a 20 kG magnetically immersed foilless diode. In addition the magnetically-immersed foilless diodes with very thin (mm diameter) cathode tips were investigated in experiments with the IBEX accelerator. As an example of this new accelerator technology the authors present the following point design for a 16-MV, 50-kA accelerator producing 1-mm diameter electron beams. The design is based on a cavity fed MITL voltage adder which performs the series addition of the voltage pulses from 16 identical inductively-isolated cavity feed systems. Each cavity is a structure that is driven by one 14 ohm pulse-forming line, providing a 1 MV voltage pulse to the accelerating gap

  10. Low voltage RF MEMS variable capacitor with linear C-V response

    Elshurafa, Amro M.

    2012-07-23

    An RF MEMS variable capacitor, fabricated in the PolyMUMPS process and tuned electrostatically, possessing a linear capacitance-voltage response is reported. The measured quality factor of the device was 17 at 1GHz, while the tuning range was 1.2:1 and was achieved at an actuation DC voltage of 8V only. Further, the linear regression coefficient was 0.98. The variable capacitor was created such that it has both vertical and horizontal capacitances present. As the top suspended plate moves towards the bottom fixed plate, the vertical capacitance increases whereas the horizontal capacitance decreases simultaneously such that the sum of the two capacitances yields a linear capacitance-voltage relation. © 2012 The Institution of Engineering and Technology.

  11. Primary Paralleled Isolated Boost Converter with Extended Operating Voltage Range

    Hernandez Botella, Juan Carlos; Sen, Gökhan; Mira Albert, Maria del Carmen

    2012-01-01

    Applications requiring wide input and output voltage range cannot often be satisfied by using buck or boost derived topologies. Primary paralleled isolated boost converter (PPIBC) [1]-[2] is a high efficiency boost derived topology. This paper proposes a new operation mode for extending the input...

  12. High voltage wide range marx generator design and construction

    Thompson, J.E.

    1976-01-01

    A wide range, long pulse, Marx generator has been designed and constructed for the purpose of exciting a thermionic electron gun utilized for quasi-cw gas laser medium ionization. The Marx generator has been specifically designed to operate over a voltage range variable from 100 kV to 200 kV into a resistive load of between 83 kΩ and open circuit. This wide operating range, both in voltage and load impedance, was obtained using interstage coupling capacitors to assure overvoltage and subsequent breakdown of the three element spark gap switches used. This paper will discuss the motivation and specific application for the Marx generator and will present the relevant design procedure with particular emphasis on the interstage coupling and triggering techniques employed. Experimental data regarding the measured Marx generator performance will also be presented

  13. Linear inductive voltage adders (IVA) for advanced hydrodynamic radiography

    Mazarakis, M.G.; Boyes, J.D.; Johnson, D.L.

    1998-01-01

    The electron beam which drifts through the multiple cavities of conventional induction linacs (LIA) is replaced in an IVA by a cylindrical metal conductor which extends along the entire length of the device and effectuates the addition of the accelerator cavity voltages. In the approach to radiography, the linear inductive voltage adder drives a magnetically immersed electron diode with a millimeter diameter cathode electrode and a planar anode/bremsstrahlung converter. Both anode and cathode electrodes are immersed in a strong (15--50 T) solenoidal magnetic field. The electron beam cross section is approximately of the same size as the cathode needle and generates a similar size, very intense x-ray beam when it strikes the anode converter. An IVA driven diode can produce electron beams of equal size and energy as a LIA but with much higher currents (40--50 kA versus 4--5 kA), simpler hardware and thus lower cost. The authors present here first experimental validations of the technology utilizing HERMES 3 and SABRE IVA accelerators. The electron beam voltage and current were respectively of the order of 10 MV and 40 kA. X-ray doses of up to 1 kR at sign 1 m and spot sizes as small as 1.7 mm (at 200 R doses) were measured

  14. A low-voltage fully balanced CMFF transconductor with improved linearity

    Calvo, B.; Celma, S.; Alegre, J. P.; Sanz, M. T.

    2007-05-01

    This paper presents a new low-voltage pseudo-differential continuous-time CMOS transconductor for wideband applications. The proposed cell is based on a feedforward cancellation of the input common-mode signal and keeps the input common mode voltage constant, while the transconductance is easily tunable through a continuous bias voltage. Linearity is preserved during the tuning process for a moderate range of transconductance values. Simulation results for a 0.35 μm CMOS design show a 1:2 G m tuning range with an almost constant bandwidth over 600 MHz. Total harmonic distortion figures are below -60 dB over the whole range at 10 MHz up to a 200 μA p-p differential output. The proposed cell consumes less than 1.2 mW from a single 2.0 V supply.

  15. Cell voltage versus electrode potential range in aqueous supercapacitors

    Dai, Zengxin; Peng, Chuang; Chae, Jung Hoon; Ng, Kok Chiang; Chen, George Z.

    2015-01-01

    Supercapacitors with aqueous electrolytes and nanostructured composite electrodes are attractive because of their high charging-discharging speed, long cycle life, low environmental impact and wide commercial affordability. However, the energy capacity of aqueous supercapacitors is limited by the electrochemical window of water. In this paper, a recently reported engineering strategy is further developed and demonstrated to correlate the maximum charging voltage of a supercapacitor with the capacitive potential ranges and the capacitance ratio of the two electrodes. Beyond the maximum charging voltage, a supercapacitor may still operate, but at the expense of a reduced cycle life. In addition, it is shown that the supercapacitor performance is strongly affected by the initial and zero charge potentials of the electrodes. Further, the differences are highlighted and elaborated between freshly prepared, aged under open circuit conditions, and cycled electrodes of composites of conducting polymers and carbon nanotubes. The first voltammetric charging-discharging cycle has an electrode conditioning effect to change the electrodes from their initial potentials to the potential of zero voltage, and reduce the irreversibility. PMID:25897670

  16. Linear variable voltage diode capacitor and adaptive matching networks

    Larson, L.E.; De Vreede, L.C.N.

    2006-01-01

    An integrated variable voltage diode capacitor topology applied to a circuit providing a variable voltage load for controlling variable capacitance. The topology includes a first pair of anti-series varactor diodes, wherein the diode power-law exponent n for the first pair of anti-series varactor

  17. Dynamic range of low-voltage cascode current mirrors

    Bruun, Erik; Shah, Peter Jivan

    1995-01-01

    Low-voltage cascode current mirrors are reviewed with respect to the design limitations imposed if all transistors in the mirror are required to operate in the saturation region. It is found that both a lower limit and an upper limit exist for the cascode transistor bias voltage. Further, the use....... The proposed configuration has the advantage of simplicity combined with a complete elimination of the need for fixed bias voltages or bias currents in the current mirror. A disadvantage is that it requires a higher input voltage to the current mirror...

  18. Mappings with closed range and finite dimensional linear spaces

    Iyahen, S.O.

    1984-09-01

    This paper looks at two settings, each of continuous linear mappings of linear topological spaces. In one setting, the domain space is fixed while the range space varies over a class of linear topological spaces. In the second setting, the range space is fixed while the domain space similarly varies. The interest is in when the requirement that the mappings have a closed range implies that the domain or range space is finite dimensional. Positive results are obtained for metrizable spaces. (author)

  19. Linearity optimizations of analog ring resonator modulators through bias voltage adjustments

    Hosseinzadeh, Arash; Middlebrook, Christopher T.

    2018-03-01

    The linearity of ring resonator modulator (RRM) in microwave photonic links is studied in terms of instantaneous bandwidth, fabrication tolerances, and operational bandwidth. A proposed bias voltage adjustment method is shown to maximize spur-free dynamic range (SFDR) at instantaneous bandwidths required by microwave photonic link (MPL) applications while also mitigating RRM fabrication tolerances effects. The proposed bias voltage adjustment method shows RRM SFDR improvement of ∼5.8 dB versus common Mach-Zehnder modulators at 500 MHz instantaneous bandwidth. Analyzing operational bandwidth effects on SFDR shows RRMs can be promising electro-optic modulators for MPL applications which require high operational frequencies while in a limited bandwidth such as radio-over-fiber 60 GHz wireless network access.

  20. Increasing Linear Dynamic Range of a CMOS Image Sensor

    Pain, Bedabrata

    2007-01-01

    A generic design and a corresponding operating sequence have been developed for increasing the linear-response dynamic range of a complementary metal oxide/semiconductor (CMOS) image sensor. The design provides for linear calibrated dual-gain pixels that operate at high gain at a low signal level and at low gain at a signal level above a preset threshold. Unlike most prior designs for increasing dynamic range of an image sensor, this design does not entail any increase in noise (including fixed-pattern noise), decrease in responsivity or linearity, or degradation of photometric calibration. The figure is a simplified schematic diagram showing the circuit of one pixel and pertinent parts of its column readout circuitry. The conventional part of the pixel circuit includes a photodiode having a small capacitance, CD. The unconventional part includes an additional larger capacitance, CL, that can be connected to the photodiode via a transfer gate controlled in part by a latch. In the high-gain mode, the signal labeled TSR in the figure is held low through the latch, which also helps to adapt the gain on a pixel-by-pixel basis. Light must be coupled to the pixel through a microlens or by back illumination in order to obtain a high effective fill factor; this is necessary to ensure high quantum efficiency, a loss of which would minimize the efficacy of the dynamic- range-enhancement scheme. Once the level of illumination of the pixel exceeds the threshold, TSR is turned on, causing the transfer gate to conduct, thereby adding CL to the pixel capacitance. The added capacitance reduces the conversion gain, and increases the pixel electron-handling capacity, thereby providing an extension of the dynamic range. By use of an array of comparators also at the bottom of the column, photocharge voltages on sampling capacitors in each column are compared with a reference voltage to determine whether it is necessary to switch from the high-gain to the low-gain mode. Depending upon

  1. Enhancing Linearity of Voltage Controlled Oscillator Thermistor Signal Conditioning Circuit Using Linear Search

    Rana, K. P. S.; Kumar, Vineet; Prasad, Tapan

    2018-02-01

    Temperature to Frequency Converters (TFCs) are potential signal conditioning circuits (SCCs) usually employed in temperature measurements using thermistors. A NE/SE-566 based SCC has been recently used in several reported works as TFC. Application of NE/SE-566 based SCC requires a mechanism for finding the optimal values of SCC parameters yielding the optimal linearity and desired sensitivity performances. Two classical methods, namely, inflection point and three point have been employed for this task. In this work, the application of these two methods, on NE/SE-566 based SCC in TFC, is investigated in detail and the conditions for its effective usage are developed. Further, since these classical methods offer an approximate linearization of temperature and frequency relationship an application of a linear search based technique is proposed to further enhance the linearity. The implemented linear search method used results obtained from the above mentioned classical methods. The presented simulation studies, for three different industrial grade thermistors, revealed that the linearity enhancements of 21.7, 18.3 and 17.8% can be achieved over the inflection point method and 4.9, 4.7 and 4.7% over the three point method, for an input temperature range of 0-100 °C.

  2. Cell voltage versus electrode potential range in aqueous supercapacitors

    Dai, Zengxin; Peng, Chuang; Chae, Jung Hoon; Ng, Kok Chiang; Chen, George Z.

    2015-01-01

    Supercapacitors with aqueous electrolytes and nanostructured composite electrodes are attractive because of their high charging-discharging speed, long cycle life, low environmental impact and wide commercial affordability. However, the energy capacity of aqueous supercapacitors is limited by the electrochemical window of water. In this paper, a recently reported engineering strategy is further developed and demonstrated to correlate the maximum charging voltage of a supercapacitor with the c...

  3. Design of a High Linearity Four-Quadrant Analog Multiplier in Wideband Frequency Range

    Abdul kareem Mokif Obais

    2017-05-01

    Full Text Available In this paper, a voltage mode four quadrant analog multiplier in the wideband frequency rangeis designed using a wideband operational amplifier (OPAMP and squaring circuits. The wideband OPAMP is designed using 10 identical NMOS transistorsand operated with supply voltages of ±12V. Two NMOS transistors and two wideband OPAMP are utilized in the design of the proposed squaring circuit. All the NMOS transistors are based on 0.35µm NMOStechnology. The multiplier has input and output voltage ranges of ±10 V, high range of linearity from -10 V to +10 V, and cutoff frequency of about 5 GHz. The proposed multiplier is designed on PSpice in Orcad 16.6

  4. New internal multi-range resistors for ac voltage calibration by using TVC

    Ali, Rasha S M

    2015-01-01

    Accurate calibration of ac voltages up to 1000 V by using thermal converters requires range resistors connected in series with the converter. The combination of a thermal converter and range resistor is known as the thermal voltage converter. In this paper, multi-range internal range resistors are designed and implemented in the National Institute for Standards (NIS), Egypt to cover the ac voltage ranges from 10 V to 750 V. The range resistor values are 2 kΩ, 10 kΩ, 20 kΩ, 40 kΩ, 100 kΩ, and 150 kΩ to cover the voltage ranges 10 V, 50 V, 100 V, 200 V, 500 V, and 750 V, respectively. The six range resistors are mounted in series with a single-junction thermo-element in the same box to provide a new thermal voltage converter. The required range resistor is selected by using a six-pin selector switch. Each resistor is connected to a selector pin. The new thermal voltage converter ranges are automatically calibrated against other standard thermal voltage converters at different frequencies by using a LabVIEW program to determine their ac–dc transfer difference at each range. The expanded uncertainties are estimated according to the GUM for all ranges at different frequencies. The performance of the new thermal voltage converter is also evaluated by comparing its ac–dc differences and its accuracy in measuring the ac voltage at different frequencies with a traditional thermal voltage converter. (paper)

  5. A Voltage Doubler Circuit to Extend the Soft-switching Range of Dual Active Bridge Converters

    Qin, Zian; Shen, Yanfeng; Wang, Huai

    2017-01-01

    A voltage doubler circuit is realized to extend the soft-switching range of Dual Active Bridge (DAB) converters. No extra hardware is added to the DAB to form this circuit, since it is composed of the dc blocking capacitor and the low side full bridge converter, which already exist in DAB....... With the voltage doubler, the DAB converter can achieve soft switching and high efficiency when the low side dc voltage is close to 2 pu (1 pu is the high side dc voltage divided by the transformer turn ratio), which can be realized only when the low side dc voltage is close to 1 pu by using the conventional phase...... shift modulation in DAB. Thus the soft switching range is extended. The soft switching boundary conditions are derived. A map to show the soft switching or hard switching in the full load and voltage range is obtained. The feasibility and effectiveness of the proposed method is finally verified...

  6. Note: A high dynamic range, linear response transimpedance amplifier.

    Eckel, S; Sushkov, A O; Lamoreaux, S K

    2012-02-01

    We have built a high dynamic range (nine decade) transimpedance amplifier with a linear response. The amplifier uses junction-gate field effect transistors (JFETs) to switch between three different resistors in the feedback of a low input bias current operational amplifier. This allows for the creation of multiple outputs, each with a linear response and a different transimpedance gain. The overall bandwidth of the transimpedance amplifier is set by the bandwidth of the most sensitive range. For our application, we demonstrate a three-stage amplifier with transimpedance gains of approximately 10(9)Ω, 3 × 10(7)Ω, and 10(4)Ω with a bandwidth of 100 Hz.

  7. Modulation linearization of a frequency-modulated voltage controlled oscillator, part 3

    Honnell, M. A.

    1975-01-01

    An analysis is presented for the voltage versus frequency characteristics of a varactor modulated VHF voltage controlled oscillator in which the frequency deviation is linearized by using the nonlinear characteristics of a field effect transistor as a signal amplifier. The equations developed are used to calculate the oscillator output frequency in terms of pertinent circuit parameters. It is shown that the nonlinearity exponent of the FET has a pronounced influence on frequency deviation linearity, whereas the junction exponent of the varactor controls total frequency deviation for a given input signal. A design example for a 250 MHz frequency modulated oscillator is presented.

  8. A 5 V-to-3.3 V CMOS Linear Regulator with Three-Output Temperature-Independent Reference Voltages

    San-Fu Wang

    2016-01-01

    Full Text Available This paper presents a 5 V-to-3.3 V linear regulator circuit, which uses 3.3 V CMOS transistors to replace the 5 V CMOS transistors. Thus, the complexity of the manufacturing semiconductor process can be improved. The proposed linear regulator is implemented by cascode architecture, which requires three different reference voltages as the bias voltages of its circuit. Thus, the three-output temperature-independent reference voltage circuit is proposed, which provides three accurate reference voltages simultaneously. The three-output temperature-independent reference voltages also can be used in other circuits of the chip. By using the proposed temperature-independent reference voltages, the proposed linear regulator can provide an accurate output voltage, and it is suitable for low cost, small size, and highly integrated system-on-chip (SoC applications. Moreover, the proposed linear regulator uses the cascode technique, which improves both the gain performance and the isolation performance. Therefore, the proposed linear regulator has a good performance in reference voltage to output voltage isolation. The voltage variation of the linear regulator is less than 2.153% in the temperature range of −40°C–120°C, and the power supply rejection ratio (PSRR is less than −42.8 dB at 60 Hz. The regulator can support 0~200 mA output current. The core area is less than 0.16 mm2.

  9. An improved direct feedback linearization technique for transient stability enhancement and voltage regulation of power generators

    Kenne, Godpromesse [Laboratoire d' Automatique et d' Informatique Appliquee (LAIA), Departement de Genie Electrique, Universite de Dschang, B.P. 134 Bandjoun, Cameroun; Goma, Raphael; Lamnabhi-Lagarrigue, Francoise [Laboratoire des Signaux et Systemes (L2S), CNRS-SUPELEC, Universite Paris XI, 3 Rue Joliot Curie, 91192 Gif-sur-Yvette (France); Nkwawo, Homere [Departement GEII, Universite Paris XIII, IUT Villetaneuse, 99 Avenue Jean Baptiste Clement, 93430 Villetaneuse (France); Arzande, Amir; Vannier, Jean Claude [Departement Energie, Ecole Superieure d' Electricite-SUPELEC, 3 Rue Joliot Curie, 91192 Gif-sur-Yvette (France)

    2010-09-15

    In this paper, a simple improved direct feedback linearization design method for transient stability and voltage regulation of power systems is discussed. Starting with the classical direct feedback linearization technique currently applied to power systems, an adaptive nonlinear excitation control of synchronous generators is proposed, which is new and effective for engineering. The power angle and mechanical power input are not assumed to be available. The proposed method is based on a standard third-order model of a synchronous generator which requires only information about the physical available measurements of angular speed, active electric power and generator terminal voltage. Experimental results of a practical power system show that fast response, robustness, damping, steady-state and transient stability as well as voltage regulation are all achieved satisfactorily. (author)

  10. A Fixed-Frequency Bidirectional Resonant DC-DC Converter Suitable for Wide Voltage Gain Range

    Shen, Yanfeng; Wang, Huai; Blaabjerg, Frede

    2017-01-01

    This paper proposes a new bidirectional resonant dc-dc converter suitable for wide voltage gain range applications (e.g., energy storage systems). The proposed converter overcomes the narrow voltage gain range of conventional resonant DC-DC converters, and meanwhile achieves high efficiency...... and characteristics of the proposed converter are analyzed. Finally, a 1-kW converter prototype is built and the experimental results verify the theoretical analyses....

  11. Voltage and pace-capture mapping of linear ablation lesions overestimates chronic ablation gap size.

    O'Neill, Louisa; Harrison, James; Chubb, Henry; Whitaker, John; Mukherjee, Rahul K; Bloch, Lars Ølgaard; Andersen, Niels Peter; Dam, Høgni; Jensen, Henrik K; Niederer, Steven; Wright, Matthew; O'Neill, Mark; Williams, Steven E

    2018-04-26

    Conducting gaps in lesion sets are a major reason for failure of ablation procedures. Voltage mapping and pace-capture have been proposed for intra-procedural identification of gaps. We aimed to compare gap size measured acutely and chronically post-ablation to macroscopic gap size in a porcine model. Intercaval linear ablation was performed in eight Göttingen minipigs with a deliberate gap of ∼5 mm left in the ablation line. Gap size was measured by interpolating ablation contact force values between ablation tags and thresholding at a low force cut-off of 5 g. Bipolar voltage mapping and pace-capture mapping along the length of the line were performed immediately, and at 2 months, post-ablation. Animals were euthanized and gap sizes were measured macroscopically. Voltage thresholds to define scar were determined by receiver operating characteristic analysis as voltage, pace-capture, and ablation contact force maps. All modalities overestimated chronic gap size, by 1.4 ± 2.0 mm (ablation contact force map), 5.1 ± 3.4 mm (pace-capture), and 9.5 ± 3.8 mm (voltage mapping). Error on ablation contact force map gap measurements were significantly less than for voltage mapping (P = 0.003, Tukey's multiple comparisons test). Chronically, voltage mapping and pace-capture mapping overestimated macroscopic gap size by 11.9 ± 3.7 and 9.8 ± 3.5 mm, respectively. Bipolar voltage and pace-capture mapping overestimate the size of chronic gap formation in linear ablation lesions. The most accurate estimation of chronic gap size was achieved by analysis of catheter-myocardium contact force during ablation.

  12. A Bidirectional Resonant DC-DC Converter Suitable for Wide Voltage Gain Range

    Shen, Yanfeng; Wang, Huai; Al-Durra, Ahmed

    2018-01-01

    This paper proposes a new bidirectional resonant dc-dc converter suitable for wide voltage gain range applications (e.g., energy storage systems). The proposed converter overcomes the narrow voltage gain range of conventional resonant dc-dc converters, and meanwhile achieves high efficiency...... losses. The operation principles and characteristics of the proposed converter are firstly analyzed in this paper. Then the analytical solutions for the voltage gain, soft-switching, and rms currents are derived, which facilitates the parameters design and optimization. Finally, the proposed topology...... and analysis are verified with experimental results obtained from a 1-kW converter prototype....

  13. Low voltage RF MEMS variable capacitor with linear C-V response

    Elshurafa, Amro M.; Ho, Pak Hung; Salama, Khaled N.

    2012-01-01

    .2:1 and was achieved at an actuation DC voltage of 8V only. Further, the linear regression coefficient was 0.98. The variable capacitor was created such that it has both vertical and horizontal capacitances present. As the top suspended plate moves towards the bottom

  14. Electric field control methods for foil coils in high-voltage linear actuators

    Beek, van T.A.; Jansen, J.W.; Lomonova, E.A.

    2015-01-01

    This paper describes multiple electric field control methods for foil coils in high-voltage coreless linear actuators. The field control methods are evaluated using 2-D and 3-D boundary element methods. A comparison is presented between the field control methods and their ability to mitigate

  15. Fully Integrated, Low Drop-Out Linear Voltage Regulator in 180 nm CMOS

    Yosef-Hay, Yoni; Larsen, Dennis Øland; Llimos Muntal, Pere

    2017-01-01

    This paper presents a capacitor-free low dropout (LDO) linear regulator based on a dual loop topology. The regulator utilizes two feedback loops to satisfy the challenges of hearing aid devices, which include fast transient performance and small voltage spikes under rapid load-current changes...

  16. Air-gap field, induced voltage and thrust in the short-stator linear induction motor

    Deleroi, W

    1980-07-15

    The description of the magnetic field in the air-gap of a short-primary linear induction motor, and the subsequent calculation of the thrust developed and the voltages induced in the stator bars can be made by using balancing waves. These balancing waves are generated at any point where the field wave that would exist in a machine of infinite length is disturbed. In the linear motor these disturbances occur at the ends of the stator iron and at discontinuities in the distribution of the stator winding, which exist in machines having stepped windings. From the points where they are generated, free balancing waves travel in two directions and determine the performance of these machines to a large extent. The voltage they induce in a stator bar can be determined from the core flux and mapped on a phasor diagram. The resulting voltage phasor follows a logarithmic spiral. The resulting voltages induced in the three phase windings form a strongly asymmetrical system which can be split-up into positive-, negative- and zerosequence components depending on the slip. The tangential forces may be calculated as the product of the magnetic flux density in the air-gap and the linear current density in either the stator or the reaction rail. As the 'magnetic tail' outside the machine also gives rise to forces in the direction of motion, both methods yield quite different force distributions, though for the resulting force the same value is found.

  17. Extending the Linear Modulation Range to the Full Base Speed Using a Single DC-Link Multilevel Inverter With Capacitor-Fed H-Bridges for IM Drives

    Rahul, Arun; Pramanick, Sumit; Kaarthik, R. Sudharshan

    2017-01-01

    In this paper, a new space vector pulse width modulation method to extend the linear modulation range of a cascaded five level inverter topology with a single dc supply is presented. Using this method, the inverter can be controlled linearly and the peak phase fundamental output voltage of the in......In this paper, a new space vector pulse width modulation method to extend the linear modulation range of a cascaded five level inverter topology with a single dc supply is presented. Using this method, the inverter can be controlled linearly and the peak phase fundamental output voltage...... of the inverter can be increased from 0.577 to 0.637Vdc without increasing the dc bus voltage and without exceeding the induction motor voltage rating. This new technique makes use of cascaded inverter pole voltage redundancy and property of the space vector structure for its operation. Using this, the induction...

  18. Voltage-regulating constant-current sources in a linear induction accelerator

    Zhao Juan; Cao Kefeng; Deng Jianjun; Zhu Lijun; Yang Jia; Ye Chao; Huang Bin; Cao Ningxiang; Dong Jinxuan; Zhang Jichang; Yu Zhiguo; Chen Min

    2002-01-01

    Constant-current Sources are one of key units in a linear induction accelerator. The requirements for the sources are to supply stable direct current of high power for the induction coil, be easy to computer-control and highly stable and reliable. Applying the technique of linear current source regulating in series, the primary voltage of the power transformer is regulated through an MJYS-JL-350A type three-phase alterative voltage-regulating module. The output current variation is 300-500 A when the load variation is 0.06-0.1 Ω and the voltage drop of the regulator tube is controlled within 8 V±2V when the variation of mains voltage is in ±10%. Both the current ripple and stability meet the technical requirements. The constant-current sources are controlled through an industrial controller. For each of the constant-current sources has a smallest system comprised of 8051 which is communication-controlled through a RS-485 interface, the sources can be controlled remotely

  19. High Voltage Gain Dual Active Bridge Converter with an Extended Operation Range for Renewable Energy Systems

    Zhang, Zhe; Tomas Manez, Kevin; Yudi, Xiao

    2018-01-01

    Bridge (P2DAB) converter, i.e. low-voltage (LV) side parallel and high-voltage (HV) side series, is proposed to achieve high voltage gain and low current stress over switching devices and transformer windings. Given the unmodified P2DAB power stage, by regulating the phase-shift angle between......Developing bidirectional dc-dc converters has become a critical research topic and gains more and more attention in recent years due to the extensive applications of smart grids with energy storages, hybrid and electrical vehicles and dc microgrids. In this paper, a Partial Parallel Dual Active...... the paralleled active bridges, the power equations and voltage gain are then modified, and therefore the operation range can be extended effectively. The operating principles of the proposed converter and its power characteristics under various operation modes are studied, and the design constraints...

  20. A Short-Range Distance Sensor with Exceptional Linearity

    Simmons, Steven; Youngquist, Robert

    2013-01-01

    A sensor has been demonstrated that can measure distance over a total range of about 300 microns to an accuracy of about 0.1 nm (resolution of about 0.01 nm). This represents an exceptionally large dynamic range of operation - over 1,000,000. The sensor is optical in nature, and requires the attachment of a mirror to the object whose distance is being measured. This work resulted from actively developing a white light interferometric system to be used to measure the depths of defects in the Space Shuttle Orbiter windows. The concept was then applied to measuring distance. The concept later expanded to include spectrometer calibration. In summary, broadband (i.e., white) light is launched into a Michelson interferometer, one mirror of which is fixed and one of which is attached to the object whose distance is to be measured. The light emerging from the interferometer has traveled one of two distances: either the distance to the fixed mirror and back, or the distance to the moving mirror and back. These two light beams mix and produce an interference pattern where some wavelengths interfere constructively and some destructively. Sending this light into a spectrometer allows this interference pattern to be analyzed, yielding the net distance difference between the two paths. The unique feature of this distance sensor is its ability to measure accurately distance over a dynamic range of more than one million, the ratio of its range (about 300 microns) to its accuracy (about 0.1 nanometer). Such a large linear operating range is rare and arises here because both amplitude and phase-matching algorithms contribute to the performance. The sensor is limited by the need to attach a mirror of some kind to the object being tracked, and by the fairly small total range, but the exceptional dynamic range should make it of interest.

  1. Linear response in the nonequilibrium zero range process

    Maes, Christian; Salazar, Alberto

    2014-01-01

    We explore a number of explicit response formulæ around the boundary driven zero range process to changes in the exit and entrance rates. In such a nonequilibrium regime kinetic (and not only thermodynamic) aspects make a difference in the response. Apart from a number of formal approaches, we illustrate a general decomposition of the linear response into entropic and frenetic contributions, the latter being realized from changes in the dynamical activity at the boundaries. In particular in this way one obtains nonlinear modifications to the Green–Kubo relation. We end by bringing some general remarks about the situation where that nonequilibrium response remains given by the (equilibrium) Kubo formula such as for the density profile in the boundary driven Lorentz gas

  2. Development of three channel linear bipolar high voltage amplifier (±2 KV) for electrostatic steerer

    Rajesh Kumar; Mukesh Kumar; Suman, S.K.; Safvan, C.P.; Mandal, A.

    2011-01-01

    Electrostatic steerers and scanners are planned for low energy ion beam facilities at IUAC to steer and scan the ion beam on target. The power supplies for electrostatic steerers are high voltage bipolar DC amplifiers and for scanners are bipolar AC amplifiers. To fulfil the requirements a common unit has been designed and assembled for AC and DC applications. It can be used with electrostatic devices in scanning, steering and sweeping of low energy ion beams at high frequencies to attain uniform implantation. The unit consist of three independent limited bandwidth high voltage, linear bipolar amplifiers (for X-axis, Y-axis and Y1-dog leg plates). The unit has been provided with both local and remote control. (author)

  3. Multi-stage LLC resonant converters designed for wide output voltage ranges

    Tsang, C.-W.; Bingham, C. M.; Foster, M. P.; Stone, D. A.; Leech, J. M.

    2016-01-01

    The paper describes a novel multi-stage LLC resonant converter topology for facilitating wide output voltage ranges. This is achieved by combining the gain range of a capacitor-diode clamped LLC resonant converter with that of a traditional LLC resonant converter. A prototype converter is designed and commissioned to illustrate the design procedure and demonstrate resulting operational characteristics. Experimental results are used to show operational characteristics of the proposed conver...

  4. A low-offset low-voltage CMOS Op Amp with rail-to-rail input and output ranges

    Holzmann, Peter J.; Wiegerink, Remco J.; Gierkink, Sander L.J.; Wassenaar, R.F.; Stroet, Peter; Stroet, P.M.

    1996-01-01

    A low voltage CMOS op amp is presented. The circuit uses complementary input pairs to achieve a rail-to-rail common mode input voltage range. Special attention has been given to the reduction of the op amp's systematic offset voltage. Gain boost amplifiers are connected in a special way to provide

  5. Profiling of barrier capacitance and spreading resistance using a transient linearly increasing voltage technique.

    Gaubas, E; Ceponis, T; Kusakovskij, J

    2011-08-01

    A technique for the combined measurement of barrier capacitance and spreading resistance profiles using a linearly increasing voltage pulse is presented. The technique is based on the measurement and analysis of current transients, due to the barrier and diffusion capacitance, and the spreading resistance, between a needle probe and sample. To control the impact of deep traps in the barrier capacitance, a steady state bias illumination with infrared light was employed. Measurements of the spreading resistance and barrier capacitance profiles using a stepwise positioned probe on cross sectioned silicon pin diodes and pnp structures are presented.

  6. Voltage splay modes and enhanced phase locking in a modified linear Josephson array

    Harris, E. B.; Garland, J. C.

    1997-02-01

    We analyze a modified linear Josephson-junction array in which additional unbiased junctions are used to greatly enhance phase locking. This geometry exhibits strong correlated behavior, with an external magnetic field tuning the voltage splay angle between adjacent Josephson oscillators. The array displays a coherent in-phase mode for f=, where f is the magnetic frustration, while for 0tolerant of critical current disorder approaching 100%. The stability of the array has also been studied by computing Floquet exponents. These exponents are found to be negative for all array lengths, with a 1/N2 dependence, N being the number of series-connected junctions.

  7. On the modelling of linear-assisted DC-DC voltage regulators for photovoltaic solar energy systems

    Martínez-García, Herminio; García-Vílchez, Encarna

    2017-11-01

    This paper shows the modelling of linear-assisted or hybrid (linear & switching) DC/DC voltage regulators. In this kind of regulators, an auxiliary linear regulator is used, which objective is to cancel the ripple at the output voltage and provide fast responses for load variations. On the other hand, a switching DC/DC converter, connected in parallel with the linear regulator, allows to supply almost the whole output current demanded by the load. The objective of this topology is to take advantage of the suitable regulation characteristics that series linear voltage regulators have, but almost achieving the high efficiency that switching DC/DC converters provide. Linear-assisted DC/DC regulators are feedback systems with potential instability. Therefore, their modelling is mandatory in order to obtain design guidelines and assure stability of the implemented power supply system.

  8. A new linear inductive voltage adder driver for the Saturn Accelerator

    Mazarakis, M.G.; Spielman, R.B.; Struve, K.W.; Long, F.W.

    2000-01-01

    Saturn is a dual-purpose accelerator. It can be operated as a large-area flash x-ray source for simulation testing or as a Z-pinch driver especially for K-line x-ray production. In the first mode, the accelerator is fitted with three concentric-ring 2-MV electron diodes, while in the Z-pinch mode the current of all the modules is combined via a post-hole convolute arrangement and driven through a cylindrical array of very fine wires. We present here a point design for a new Saturn class driver based on a number of linear inductive voltage adders connected in parallel. A technology recently implemented at the Institute of High Current Electronics in Tomsk (Russia) is being utilized. In the present design we eliminate Marx generators and pulse-forming networks. Each inductive voltage adder cavity is directly fed by a number of fast 100-kV small-size capacitors arranged in a circular array around each accelerating gap. The number of capacitors connected in parallel to each cavity defines the total maximum current. By selecting low inductance switches, voltage pulses as short as 30-50-ns FWHM can be directly achieved. The voltage of each stage is low (100-200 kv). Many stages are required to achieve multi-megavolt accelerator output. However, since the length of each stage is very short (4-10 cm), accelerating gradients of higher than 1 MV/m can easily be obtained. The proposed new driver will be capable of delivering pulses of 15-MA, 36-TW, 1.2-MJ to the diode load, with a peak voltage of -2.2 MV and FWHM of 40-ns. And although its performance will exceed the presently utilized driver, its size and cost could be much smaller (approximately1/3). In addition, no liquid dielectrics like oil or deionized water will be required. Even elimination of ferromagnetic material (by using air-core cavities) is a possibility

  9. Simulating threshold voltage shift of MOS devices due to radiation in the low-dose range

    Wan Xin Heng; Gao Wen Yu; Huang Ru; Wang Yang Yuan

    2002-01-01

    An analytical MOSFET threshold voltage shift model due to radiation in the low-dose range has been developed for circuit simulations. Experimental data in the literature shows that the model predictions are in good agreement. It is simple in functional form and hence computationally efficient. It can be used as a basic circuit simulation tool for analysing MOSFET exposed to a nuclear environment up to about 1 Mrad(Si). In accordance with common believe, radiation induced absolute change of threshold voltage was found to be larger in irradiated PMOS devices. However, if the radiation sensitivity is defined in the way authors did it, the results indicated NMOS rather than PMOS devices are more sensitive, specially at low doses. This is important from the standpoint of their possible application in dosimetry

  10. The use of charge extraction by linearly increasing voltage in polar organic light-emitting diodes

    Züfle, Simon; Altazin, Stéphane; Hofmann, Alexander; Jäger, Lars; Neukom, Martin T.; Schmidt, Tobias D.; Brütting, Wolfgang; Ruhstaller, Beat

    2017-05-01

    We demonstrate the application of the CELIV (charge carrier extraction by linearly increasing voltage) technique to bilayer organic light-emitting devices (OLEDs) in order to selectively determine the hole mobility in N,N0-bis(1-naphthyl)-N,N0-diphenyl-1,10-biphenyl-4,40-diamine (α-NPD). In the CELIV technique, mobile charges in the active layer are extracted by applying a negative voltage ramp, leading to a peak superimposed to the measured displacement current whose temporal position is related to the charge carrier mobility. In fully operating devices, however, bipolar carrier transport and recombination complicate the analysis of CELIV transients as well as the assignment of the extracted mobility value to one charge carrier species. This has motivated a new approach of fabricating dedicated metal-insulator-semiconductor (MIS) devices, where the extraction current contains signatures of only one charge carrier type. In this work, we show that the MIS-CELIV concept can be employed in bilayer polar OLEDs as well, which are easy to fabricate using most common electron transport layers (ETLs), like Tris-(8-hydroxyquinoline)aluminum (Alq3). Due to the macroscopic polarization of the ETL, holes are already injected into the hole transport layer below the built-in voltage and accumulate at the internal interface with the ETL. This way, by a standard CELIV experiment only holes will be extracted, allowing us to determine their mobility. The approach can be established as a powerful way of selectively measuring charge mobilities in new materials in a standard device configuration.

  11. Non-linear Membrane Properties in Entorhinal Cortical Stellate Cells Reduce Modulation of Input-Output Responses by Voltage Fluctuations

    Fernandez, Fernando R.; Malerba, Paola; White, John A.

    2015-01-01

    The presence of voltage fluctuations arising from synaptic activity is a critical component in models of gain control, neuronal output gating, and spike rate coding. The degree to which individual neuronal input-output functions are modulated by voltage fluctuations, however, is not well established across different cortical areas. Additionally, the extent and mechanisms of input-output modulation through fluctuations have been explored largely in simplified models of spike generation, and with limited consideration for the role of non-linear and voltage-dependent membrane properties. To address these issues, we studied fluctuation-based modulation of input-output responses in medial entorhinal cortical (MEC) stellate cells of rats, which express strong sub-threshold non-linear membrane properties. Using in vitro recordings, dynamic clamp and modeling, we show that the modulation of input-output responses by random voltage fluctuations in stellate cells is significantly limited. In stellate cells, a voltage-dependent increase in membrane resistance at sub-threshold voltages mediated by Na+ conductance activation limits the ability of fluctuations to elicit spikes. Similarly, in exponential leaky integrate-and-fire models using a shallow voltage-dependence for the exponential term that matches stellate cell membrane properties, a low degree of fluctuation-based modulation of input-output responses can be attained. These results demonstrate that fluctuation-based modulation of input-output responses is not a universal feature of neurons and can be significantly limited by subthreshold voltage-gated conductances. PMID:25909971

  12. Voltage splay modes and enhanced phase locking in a modified linear Josephson array

    Harris, E.B.; Garland, J.C.

    1997-01-01

    We analyze a modified linear Josephson-junction array in which additional unbiased junctions are used to greatly enhance phase locking. This geometry exhibits strong correlated behavior, with an external magnetic field tuning the voltage splay angle between adjacent Josephson oscillators. The array displays a coherent in-phase mode for f=(1)/(2), where f is the magnetic frustration, while for 0 p (f)=2aV dc /Φ 0 (1-2f). The locked splay modes are found to be tolerant of critical current disorder approaching 100%. The stability of the array has also been studied by computing Floquet exponents. These exponents are found to be negative for all array lengths, with a 1/N 2 dependence, N being the number of series-connected junctions. copyright 1996 The American Physical Society

  13. The Role of Data Range in Linear Regression

    da Silva, M. A. Salgueiro; Seixas, T. M.

    2017-01-01

    Measuring one physical quantity as a function of another often requires making some choices prior to the measurement process. Two of these choices are: the data range where measurements should focus and the number (n) of data points to acquire in the chosen data range. Here, we consider data range as the interval of variation of the independent…

  14. Low-Voltage, Low-Power, and Wide-Tuning-Range Ring-VCO for Frequency ΔΣ Modulator

    Tuan Vu, Cao; Wisland, Dag T.; Lande, Tor Sverre

    A low-voltage, low-power, and wide-tuning-range VCO which converts an analog input voltage to phase information for a frequency ΔΣ modulator is proposed in this paper. The VCO is based on a differential ring oscillator, which is improved with modified symmetric load and a positive feedback...

  15. Boost Half-Bridge DC-DC Converter with Reconfigurable Rectifier for Ultra-Wide Input Voltage Range Applications

    Vinnikov, Dmitri; Chub, Andrii; Liivik, Elizaveta

    2018-01-01

    This paper introduces a novel galvanically isolated boost half-bridge dc-dc converter intended for modern power electronic applications where ultra-wide input voltage regulation range is needed. A reconfigurable output rectifier stage performs a transition between the voltage doubler and the full......-bridge diode rectifiers and, by this means, extends the regulation range significantly. The converter features a low number of components and resonant soft switching of semiconductors, which result in high power conversion efficiency over a wide input voltage and load range. The paper presents the operating...

  16. SiGe HBT linear-in-dB high dynamic range RF envelope detectors and wideband high linearity amplifiers

    Pan, Hsuan-yu

    2010-01-01

    This research work aims on exploiting SiGe HBT technologies in high dynamic range wideband RF linear-in- dB envelope detectors and linear amplifiers. First, an improved all-npn broadband highly linear SiGe HBT differential amplifier is presented based on a variation of Caprio's Quad. A broadband linear amplifier with 46dBm OIP₃ at 20MHz, 34dBm OIP₃ at 1GHz, 6dB noise figure and 10.3dBm P₁dB is demonstrated. Second, an improved exact dynamic model of a fast-settling linear-in-dB Automatic Gain...

  17. New non-linear control strategy for non-isolated DC/DC converter with high voltage ratio

    Shahin, A.; Huang, B.; Martin, J.P.; Pierfederici, S.; Davat, B.

    2010-01-01

    In this paper, a non-isolated DC/DC converter with high voltage ratio is proposed to allow the interface between a low voltage power source like fuel cell and a high voltage DC bus. To take into account the low voltage-high density characteristics of power sources, a cascaded structure composed of two sub-converters has been chosen and allows obtaining a high voltage ratio. The choice of each sub-converter is based on the requirements of the source and its performances. Consequently, we have chosen a three-interleaved boost converter as the 1st sub-converter whereas the 2nd sub-converter is a three-level boost converter. The control of the whole system is realized thanks to energetic trajectories planning based on flatness properties of the system. The control of both the current and the balance of voltage across the output serial capacitors of the three-level boost converter is ensured by non-linear controllers based on a new non-linear model. Experimental results allow validating the proposed power architecture and its associated control.

  18. New non-linear control strategy for non-isolated DC/DC converter with high voltage ratio

    Shahin, A.; Huang, B.; Martin, J.P.; Pierfederici, S.; Davat, B. [Groupe de Recherche en Electronique et en Electrotechnique de Nancy - INPL - Nancy Universite, 2, Avenue de la Foret de Haye, 54516 Vandoeuvre-les-Nancy Cedex (France)

    2010-01-15

    In this paper, a non-isolated DC/DC converter with high voltage ratio is proposed to allow the interface between a low voltage power source like fuel cell and a high voltage DC bus. To take into account the low voltage-high density characteristics of power sources, a cascaded structure composed of two sub-converters has been chosen and allows obtaining a high voltage ratio. The choice of each sub-converter is based on the requirements of the source and its performances. Consequently, we have chosen a three-interleaved boost converter as the 1st sub-converter whereas the 2nd sub-converter is a three-level boost converter. The control of the whole system is realized thanks to energetic trajectories planning based on flatness properties of the system. The control of both the current and the balance of voltage across the output serial capacitors of the three-level boost converter is ensured by non-linear controllers based on a new non-linear model. Experimental results allow validating the proposed power architecture and its associated control. (author)

  19. A wideband large dynamic range and high linearity RF front-end for U-band mobile DTV

    Liu Rongjiang; Liu Shengyou; Guo Guiliang; Cheng Xu; Yan Yuepeng

    2013-01-01

    A wideband large dynamic range and high linearity U-band RF front-end for mobile DTV is introduced, and includes a noise-cancelling low-noise amplifier (LNA), an RF programmable gain amplifier (RFPGA) and a current communicating passive mixer. The noise/distortion cancelling structure and RC post-distortion compensation are employed to improve the linearity of the LNA. An RFPGA with five stages provides large dynamic range and fine gain resolution. A simple resistor voltage network in the passive mixer decreases the gate bias voltage of the mixing transistor, and optimum linearity and symmetrical mixing is obtained at the same time. The RF front-end is implemented in a 0.25 μm CMOS process. Tests show that it achieves an IIP3 (third-order intercept point) of −17 dBm, a conversion gain of 39 dB, and a noise figure of 5.8 dB. The RFPGA achieves a dynamic range of −36.2 to 23.5 dB with a resolution of 0.32 dB. (semiconductor integrated circuits)

  20. Dynamic Range Enhancement of High-Speed Electrical Signal Data via Non-Linear Compression

    Laun, Matthew C. (Inventor)

    2016-01-01

    Systems and methods for high-speed compression of dynamic electrical signal waveforms to extend the measuring capabilities of conventional measuring devices such as oscilloscopes and high-speed data acquisition systems are discussed. Transfer function components and algorithmic transfer functions can be used to accurately measure signals that are within the frequency bandwidth but beyond the voltage range and voltage resolution capabilities of the measuring device.

  1. Design considerations of a linear generator for a range extender application

    Seo Un-Jae

    2015-12-01

    Full Text Available The free piston linear generator is a new range extender concept for the application in a full electric vehicle. The free piston engine driven linear generators can achieve high efficiency at part and full load which is suitable for the range extender application. This paper presents requirements for designing a linear generator deduced from a basic analysis of a free piston linear generator.

  2. Association Between Local Bipolar Voltage and Conduction Gap Along the Left Atrial Linear Ablation Lesion in Patients With Atrial Fibrillation.

    Masuda, Masaharu; Fujita, Masashi; Iida, Osamu; Okamoto, Shin; Ishihara, Takayuki; Nanto, Kiyonori; Kanda, Takashi; Sunaga, Akihiro; Tsujimura, Takuya; Matsuda, Yasuhiro; Mano, Toshiaki

    2017-08-01

    A bipolar voltage reflects a thick musculature where formation of a transmural lesion may be hard to achieve. The purpose of this study was to explore the association between local bipolar voltage and conduction gap in patients with persistent atrial fibrillation (AF) who underwent atrial roof or septal linear ablation. This prospective observational study included 42 and 36 consecutive patients with persistent AF who underwent roof or septal linear ablations, respectively. After pulmonary vein isolation, left atrial linear ablations were performed, and conduction gap sites were identified and ablated after first-touch radiofrequency application. Conduction gap(s) after the first-touch roof and septal linear ablation were observed in 13 (32%) and 19 patients (53%), respectively. Roof and septal area voltages were higher in patients with conduction gap(s) than in those without (roof, 1.23 ± 0.77 vs 0.73 ± 0.42 mV, p = 0.010; septal, 0.96 ± 0.43 vs 0.54 ± 0.18 mV, p = 0.001). Trisected regional analyses revealed that the voltage was higher at the region with a conduction gap than at the region without. Complete conduction block across the roof and septal lines was not achieved in 3 (7%) and 6 patients (17%), respectively. Patients in whom a linear conduction block could not be achieved demonstrated higher ablation area voltage than those with a successful conduction block (roof, 1.91 ± 0.74 vs 0.81 ± 0.51 mV, p = 0.001; septal, 1.15 ± 0.56 vs 0.69 ± 0.31 mV, p = 0.006). In conclusion, a high regional bipolar voltage predicts failure to achieve conduction block after left atrial roof or septal linear ablation. In addition, the conduction gap was located at the preserved voltage area. Copyright © 2017 Elsevier Inc. All rights reserved.

  3. A CMOS frontend chip for implantable neural recording with wide voltage supply range

    Liu Jialin; Zhang Xu; Hu Xiaohui; Li Peng; Liu Ming; Chen Hongda; Guo Yatao; Li Bin

    2015-01-01

    A design for a CMOS frontend integrated circuit (chip) for neural signal acquisition working at wide voltage supply range is presented in this paper. The chip consists of a preamplifier, a serial instrumental amplifier (IA) and a cyclic analog-to-digital converter (CADC). The capacitive-coupled and capacitive-feedback topology combined with MOS-bipolar pseudo-resistor element is adopted in the preamplifier to create a −3 dB upper cut-off frequency less than 1 Hz without using a ponderous discrete device. A dual-amplifier instrumental amplifier is used to provide a low output impedance interface for ADC as well as to boost the gain. The preamplifier and the serial instrumental amplifier together provide a midband gain of 45.8 dB and have an input-referred noise of 6.7 μV rms integrated from 1 Hz to 5 kHz. The ADC digitizes the amplified signal at 12-bits precision with a highest sampling rate of 130 kS/s. The measured effective number of bits (ENOB) of the ADC is 8.7 bits. The entire circuit draws 165 to 216 μA current from the supply voltage varied from 1.34 to 3.3 V. The prototype chip is fabricated in the 0.18-μm CMOS process and occupies an area of 1.23 mm 2 (including pads). In-vitro recording was successfully carried out by the proposed frontend chip. (paper)

  4. A CMOS frontend chip for implantable neural recording with wide voltage supply range

    Jialin, Liu; Xu, Zhang; Xiaohui, Hu; Yatao, Guo; Peng, Li; Ming, Liu; Bin, Li; Hongda, Chen

    2015-10-01

    A design for a CMOS frontend integrated circuit (chip) for neural signal acquisition working at wide voltage supply range is presented in this paper. The chip consists of a preamplifier, a serial instrumental amplifier (IA) and a cyclic analog-to-digital converter (CADC). The capacitive-coupled and capacitive-feedback topology combined with MOS-bipolar pseudo-resistor element is adopted in the preamplifier to create a -3 dB upper cut-off frequency less than 1 Hz without using a ponderous discrete device. A dual-amplifier instrumental amplifier is used to provide a low output impedance interface for ADC as well as to boost the gain. The preamplifier and the serial instrumental amplifier together provide a midband gain of 45.8 dB and have an input-referred noise of 6.7 μVrms integrated from 1 Hz to 5 kHz. The ADC digitizes the amplified signal at 12-bits precision with a highest sampling rate of 130 kS/s. The measured effective number of bits (ENOB) of the ADC is 8.7 bits. The entire circuit draws 165 to 216 μA current from the supply voltage varied from 1.34 to 3.3 V. The prototype chip is fabricated in the 0.18-μm CMOS process and occupies an area of 1.23 mm2 (including pads). In-vitro recording was successfully carried out by the proposed frontend chip. Project supported by the National Natural Science Foundation of China (Nos. 61474107, 61372060, 61335010, 61275200, 61178051) and the Key Program of the Chinese Academy of Sciences (No. KJZD-EW-L11-01).

  5. Free piston linear generator in comparison to other range-extender technologies

    Virsik, Roman; Heron, Alex

    2013-01-01

    The free piston linear generator is a new range-extender technology. It converts chemical energy into electrical energy by means of a combustion process and linear generator. Thereby the technology aims to have better properties than other range extenders. Therefore this publication deals with the explanation of the concept and the characteristics of a free piston linear generator and a comparison to other technologies. In order to compare the range extender systems, fuel cells, micro gas tur...

  6. Charge transport and recombination in bulk heterojunction solar cells studied by the photoinduced charge extraction in linearly increasing voltage technique

    Mozer, AJ; Sariciftci, NS; Osterbacka, R; Westerling, M; Juska, G; LUTSEN, Laurence; VANDERZANDE, Dirk

    2005-01-01

    Charge carrier mobility and recombination in a bulk heterojunction solar cell based on the mixture of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)-C-61 (PCBM) has been studied using the novel technique of photoinduced charge carrier extraction in a linearly increasing voltage (Photo-CELIV). In this technique, charge carriers are photogenerated by a short laser flash, and extracted under a reverse bias voltage ramp after ...

  7. Graphene-Based Linear Tandem Micro-Supercapacitors with Metal-Free Current Collectors and High-Voltage Output.

    Shi, Xiaoyu; Wu, Zhong-Shuai; Qin, Jieqiong; Zheng, Shuanghao; Wang, Sen; Zhou, Feng; Sun, Chenglin; Bao, Xinhe

    2017-11-01

    Printable supercapacitors are regarded as a promising class of microscale power source, but are facing challenges derived from conventional sandwich-like geometry. Herein, the printable fabrication of new-type planar graphene-based linear tandem micro-supercapacitors (LTMSs) on diverse substrates with symmetric and asymmetric configuration, high-voltage output, tailored capacitance, and outstanding flexibility is demonstrated. The resulting graphene-based LTMSs consisting of 10 micro-supercapacitors (MSs) present efficient high-voltage output of 8.0 V, suggestive of superior uniformity of the entire integrated device. Meanwhile, LTMSs possess remarkable flexibility without obvious capacitance degradation under different bending states. Moreover, areal capacitance of LTMSs can be sufficiently modulated by incorporating polyaniline-based pseudocapacitive nanosheets into graphene electrodes, showing enhanced capacitance of 7.6 mF cm -2 . To further improve the voltage output and energy density, asymmetric LTMSs are fabricated through controlled printing of linear-patterned graphene as negative electrodes and MnO 2 nanosheets as positive electrodes. Notably, the asymmetric LTMSs from three serially connected MSs are easily extended to 5.4 V, triple voltage output of the single cell (1.8 V), suggestive of the versatile applicability of this technique. Therefore, this work offers numerous opportunities of graphene and analogous nanosheets for one-step scalable fabrication of flexible tandem energy storage devices integrating with printed electronics on same substrate. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Power MOSFET Linearizer of a High-Voltage Power Amplifier for High-Frequency Pulse-Echo Instrumentation.

    Choi, Hojong; Woo, Park Chul; Yeom, Jung-Yeol; Yoon, Changhan

    2017-04-04

    A power MOSFET linearizer is proposed for a high-voltage power amplifier (HVPA) used in high-frequency pulse-echo instrumentation. The power MOSFET linearizer is composed of a DC bias-controlled series power MOSFET shunt with parallel inductors and capacitors. The proposed scheme is designed to improve the gain deviation characteristics of the HVPA at higher input powers. By controlling the MOSFET bias voltage in the linearizer, the gain reduction into the HVPA was compensated, thereby reducing the echo harmonic distortion components generated by the ultrasonic transducers. In order to verify the performance improvement of the HVPA implementing the power MOSFET linearizer, we measured and found that the gain deviation of the power MOSFET linearizer integrated with HVPA under 10 V DC bias voltage was reduced (-1.8 and -0.96 dB, respectively) compared to that of the HVPA without the power MOSFET linearizer (-2.95 and -3.0 dB, respectively) when 70 and 80 MHz, three-cycle, and 26 dB m input pulse waveforms are applied, respectively. The input 1-dB compression point (an index of linearity) of the HVPA with power MOSFET linearizer (24.17 and 26.19 dB m at 70 and 80 MHz, respectively) at 10 V DC bias voltage was increased compared to that of HVPA without the power MOSFET linearizer (22.03 and 22.13 dB m at 70 and 80 MHz, respectively). To further verify the reduction of the echo harmonic distortion components generated by the ultrasonic transducers, the pulse-echo responses in the pulse-echo instrumentation were compared when using HVPA with and without the power MOSFET linearizer. When three-cycle 26 dB m input power was applied, the second, third, fourth, and fifth harmonic distortion components of a 75 MHz transducer driven by the HVPA with power MOSFET linearizer (-48.34, -44.21, -48.34, and -46.56 dB, respectively) were lower than that of the HVPA without the power MOSFET linearizer (-45.61, -41.57, -45.01, and -45.51 dB, respectively). When five-cycle 20 dB m input

  9. High-voltage integrated linear regulator with current sinking capabilities for portable ultrasound scanners

    Pausas, Guifre Vendrell; Llimos Muntal, Pere; Jørgensen, Ivan Harald Holger

    2017-01-01

    This paper presents a high-voltage integrated regulator capable of sinking current for driving pulse-triggered level shifters in drivers for ultrasound applications. The regulator utilizes a new topology with a feedback loop and a current sinking circuit to satisfy the requirements of the portable....... The proposed design has been implemented in high-voltage 0.18 μm process whithin an area of 0.11 mm2 and it is suitable for system-on-chip integration due to its low component count and the fully integrated design....

  10. One-dimensional breakdown voltage model of SOI RESURF lateral power device based on lateral linearly graded approximation

    Zhang Jun; Guo Yu-Feng; Xu Yue; Lin Hong; Yang Hui; Hong Yang; Yao Jia-Fei

    2015-01-01

    A novel one-dimensional (1D) analytical model is proposed for quantifying the breakdown voltage of a reduced surface field (RESURF) lateral power device fabricated on silicon on an insulator (SOI) substrate. We assume that the charges in the depletion region contribute to the lateral PN junctions along the diagonal of the area shared by the lateral and vertical depletion regions. Based on the assumption, the lateral PN junction behaves as a linearly graded junction, thus resulting in a reduced surface electric field and high breakdown voltage. Using the proposed model, the breakdown voltage as a function of device parameters is investigated and compared with the numerical simulation by the TCAD tools. The analytical results are shown to be in fair agreement with the numerical results. Finally, a new RESURF criterion is derived which offers a useful scheme to optimize the structure parameters. This simple 1D model provides a clear physical insight into the RESURF effect and a new explanation on the improvement in breakdown voltage in an SOI RESURF device. (paper)

  11. Optimal Design of a High Efficiency LLC Resonant Converter with a Narrow Frequency Range for Voltage Regulation

    Junhao Luo

    2018-05-01

    Full Text Available As a key factor in the design of a voltage-adjustable LLC resonant converter, frequency regulation range is very important to the optimization of magnetic components and efficiency improvement. This paper presents a novel optimal design method for LLC resonant converters, which can narrow the frequency variation range and ensure high efficiency under the premise of a required gain achievement. A simplified gain model was utilized to simplify the calculation and the expected efficiency was initially set as 96.5%. The restricted area of parameter optimization design can be obtained by taking the intersection of the gain requirement, the efficiency requirement, and three restrictions of ZVS (Zero Voltage Switch. The proposed method was verified by simulation and experiments of a 150 W prototype. The results show that the proposed method can achieve ZVS from full-load to no-load conditions and can reach 1.6 times the normalized voltage gain in the frequency variation range of 18 kHz with a peak efficiency of up to 96.3%. Moreover, the expected efficiency is adjustable, which means a converter with a higher efficiency can be designed. The proposed method can also be used for the design of large-power LLC resonant converters to obtain a wide output voltage range and higher efficiency.

  12. Submicrosecond linear pulse transformer for 800 kV voltage with modular low-inductance primary power supply

    Bykov, Yu. A.; Krastelev, E. G., E-mail: ekrastelev@yandex.ru; Popov, G. V.; Sedin, A. A.; Feduschak, V. F. [Russian Academy of Sciences, Joint Institute for High Temperatures (Russian Federation)

    2016-12-15

    A pulsed power source with voltage amplitude up to 800 kV for fast charging (350–400 ns) of the forming line of a high-current nanosecond accelerator is developed. The source includes capacitive energy storage and a linear pulse transformer. The linear transformer consists of a set of 20 inductors with circular ferromagnetic cores surrounded by primary windings inside of which a common stock adder of voltage with film-glycerol insulation is placed. The primary energy storage consists of ten modules, each of which is a low-inductance assembly of two capacitors with a capacitance of 0.35 μF and one gas switch mounted in the same frame. The total energy stored in capacitors is 5.5 kJ at the operating voltage of 40 kV. According to test results, the parameters of the equivalent circuit of the source are the following: shock capacitance = 17.5 nF, inductance = 2 μH, resistance = 3.2 Ω.

  13. Charge transport and recombination in bulk heterojunction solar cells studied by the photoinduced charge extraction in linearly increasing voltage technique

    Mozer, A. J.; Sariciftci, N. S.; Lutsen, L.; Vanderzande, D.; Österbacka, R.; Westerling, M.; Juška, G.

    2005-03-01

    Charge carrier mobility and recombination in a bulk heterojunction solar cell based on the mixture of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)-C61 (PCBM) has been studied using the novel technique of photoinduced charge carrier extraction in a linearly increasing voltage (Photo-CELIV). In this technique, charge carriers are photogenerated by a short laser flash, and extracted under a reverse bias voltage ramp after an adjustable delay time (tdel). The Photo-CELIV mobility at room temperature is found to be μ =2×10-4cm2V-1s-1, which is almost independent on charge carrier density, but slightly dependent on tdel. Furthermore, determination of charge carrier lifetime and demonstration of an electric field dependent mobility is presented.

  14. Low Voltage Electrowetting on Ferroelectric PVDF-HFP Insulator with Highly Tunable Contact Angle Range.

    Sawane, Yogesh B; Ogale, Satishchandra B; Banpurkar, Arun G

    2016-09-14

    We demonstrate a consistent electrowetting response on ferroelectric poly(vinylidene fluoride-co-hexafluoropropylene) (PVDF-HFP) insulator covered with a thin Teflon AF layer. This bilayer exhibits a factor of 3 enhancement in the contact angle modulation compared to that of conventional single-layered Teflon AF dielectric. On the basis of the proposed model the enhancement is attributed to the high value of effective dielectric constant (εeff ≈ 6) of the bilayer. Furthermore, the bilayer dielectric exhibits a hysteresis-free contact angle modulation over many AC voltage cycles. But the contact angle modulation for DC voltage shows a hysteresis because of the field-induced residual polarization in the ferroelectric layer. Finally, we show that a thin bilayer exhibits contact angle modulation of Δθ (U) ≈ 60° at merely 15 V amplitude of AC voltage indicating a potential dielectric for practical low voltage electrowetting applications. A proof of concept confirms electrowetting based rapid mixing of a fluorescent dye in aqueous glycerol solution for 15 V AC signal.

  15. On the use of small integrating spheres to improve the linearity range of RASNIKS systems

    Alberdi, J.; Burgos, C.; Ferrando, A.; Molinero, A.; Schvachkin, V.; Figueroa, C.F.; Matorras, F.; Rodrigo, T.; Ruiz, A.; Vila, I.

    1997-10-01

    Rasniks elements will be used in the CMS alignment system. The large displacements of the different sub detectors expected in the CMS experiment demands large linearity response of this system. By the use of a small integrating sphere we have optimized the source definition such that a factor three improvement in the linearity range with respect to conventional Rasniks configurations is obtained. The response range reached coincides with the maximum one can get with the components used in the test

  16. Improvement of linear reactivity methods and application to long range fuel management

    Woehlke, R.A.; Quan, B.L.

    1982-01-01

    The original development of the linear reactivity theory assumes flat burnup, batch by batch. The validity of this assumption is explored using multicycle burnup data generated with a detailed 3-D SIMULATE model. The results show that the linear reactivity method can be improved by correcting for batchwise power sharing. The application of linear reactivity to long range fuel management is demonstrated in several examples. Correcting for batchwise power sharing improves the accuracy of the analysis. However, with regard to the sensitivity of fuel cost to changes in various parameters, the corrected and uncorrected linear reactivity theories give remarkably similar results

  17. Assessment of the setup dependence of detector response functions for mega-voltage linear accelerators

    Fox, Christopher; Simon, Tom; Simon, Bill; Dempsey, James F.; Kahler, Darren; Palta, Jatinder R.; Liu Chihray; Yan Guanghua [Sun Nuclear Inc., 425-A Pineda Court, Melbourne, Florida 32940 and Department of Radiation Oncology, University of Florida, P.O. Box 100385, Gainesville, Florida 32610-0385 (United States); NRE, 202 Nuclear Science Building, University of Florida, P.O. Box 118300, Gainesville, Florida 32611-8300 and Sun Nuclear Inc., 425-A Pineda Court, Melbourne, Florida 32940 (United States); Sun Nuclear Inc., 425-A Pineda Court, Melbourne, Florida 32940 (United States); ViewRay Inc., 2 Thermo Fisher Way, Oakwood Village, Ohio 44146 (United States); Department of Radiation Oncology, University of Florida, P.O. Box 100385, Gainesville, Florida 32610-0385 (United States)

    2010-02-15

    Purpose: Accurate modeling of beam profiles is important for precise treatment planning dosimetry. Calculated beam profiles need to precisely replicate profiles measured during machine commissioning. Finite detector size introduces perturbations into the measured profiles, which, in turn, impact the resulting modeled profiles. The authors investigate a method for extracting the unperturbed beam profiles from those measured during linear accelerator commissioning. Methods: In-plane and cross-plane data were collected for an Elekta Synergy linac at 6 MV using ionization chambers of volume 0.01, 0.04, 0.13, and 0.65 cm{sup 3} and a diode of surface area 0.64 mm{sup 2}. The detectors were orientated with the stem perpendicular to the beam and pointing away from the gantry. Profiles were measured for a 10x10 cm{sup 2} field at depths ranging from 0.8 to 25.0 cm and SSDs from 90 to 110 cm. Shaping parameters of a Gaussian response function were obtained relative to the Edge detector. The Gaussian function was deconvolved from the measured ionization chamber data. The Edge detector profile was taken as an approximation to the true profile, to which deconvolved data were compared. Data were also collected with CC13 and Edge detectors for additional fields and energies on an Elekta Synergy, Varian Trilogy, and Siemens Oncor linear accelerator and response functions obtained. Response functions were compared as a function of depth, SSD, and detector scan direction. Variations in the shaping parameter were introduced and the effect on the resulting deconvolution profiles assessed. Results: Up to 10% setup dependence in the Gaussian shaping parameter occurred, for each detector for a particular plane. This translated to less than a {+-}0.7 mm variation in the 80%-20% penumbral width. For large volume ionization chambers such as the FC65 Farmer type, where the cavity length to diameter ratio is far from 1, the scan direction produced up to a 40% difference in the shaping

  18. Assessment of the setup dependence of detector response functions for mega-voltage linear accelerators

    Fox, Christopher; Simon, Tom; Simon, Bill; Dempsey, James F.; Kahler, Darren; Palta, Jatinder R.; Liu Chihray; Yan Guanghua

    2010-01-01

    Purpose: Accurate modeling of beam profiles is important for precise treatment planning dosimetry. Calculated beam profiles need to precisely replicate profiles measured during machine commissioning. Finite detector size introduces perturbations into the measured profiles, which, in turn, impact the resulting modeled profiles. The authors investigate a method for extracting the unperturbed beam profiles from those measured during linear accelerator commissioning. Methods: In-plane and cross-plane data were collected for an Elekta Synergy linac at 6 MV using ionization chambers of volume 0.01, 0.04, 0.13, and 0.65 cm 3 and a diode of surface area 0.64 mm 2 . The detectors were orientated with the stem perpendicular to the beam and pointing away from the gantry. Profiles were measured for a 10x10 cm 2 field at depths ranging from 0.8 to 25.0 cm and SSDs from 90 to 110 cm. Shaping parameters of a Gaussian response function were obtained relative to the Edge detector. The Gaussian function was deconvolved from the measured ionization chamber data. The Edge detector profile was taken as an approximation to the true profile, to which deconvolved data were compared. Data were also collected with CC13 and Edge detectors for additional fields and energies on an Elekta Synergy, Varian Trilogy, and Siemens Oncor linear accelerator and response functions obtained. Response functions were compared as a function of depth, SSD, and detector scan direction. Variations in the shaping parameter were introduced and the effect on the resulting deconvolution profiles assessed. Results: Up to 10% setup dependence in the Gaussian shaping parameter occurred, for each detector for a particular plane. This translated to less than a ±0.7 mm variation in the 80%-20% penumbral width. For large volume ionization chambers such as the FC65 Farmer type, where the cavity length to diameter ratio is far from 1, the scan direction produced up to a 40% difference in the shaping parameter between in

  19. A Dynamic Range Enhanced Readout Technique with a Two-Step TDC for High Speed Linear CMOS Image Sensors

    Zhiyuan Gao

    2015-11-01

    Full Text Available This paper presents a dynamic range (DR enhanced readout technique with a two-step time-to-digital converter (TDC for high speed linear CMOS image sensors. A multi-capacitor and self-regulated capacitive trans-impedance amplifier (CTIA structure is employed to extend the dynamic range. The gain of the CTIA is auto adjusted by switching different capacitors to the integration node asynchronously according to the output voltage. A column-parallel ADC based on a two-step TDC is utilized to improve the conversion rate. The conversion is divided into coarse phase and fine phase. An error calibration scheme is also proposed to correct quantization errors caused by propagation delay skew within −Tclk~+Tclk. A linear CMOS image sensor pixel array is designed in the 0.13 μm CMOS process to verify this DR-enhanced high speed readout technique. The post simulation results indicate that the dynamic range of readout circuit is 99.02 dB and the ADC achieves 60.22 dB SNDR and 9.71 bit ENOB at a conversion rate of 2 MS/s after calibration, with 14.04 dB and 2.4 bit improvement, compared with SNDR and ENOB of that without calibration.

  20. A Capacitor-Free, Fast Transient Response Linear Voltage Regulator In a 180nm CMOS

    Deleuran, Alexander N.; Lindbjerg, Nicklas; Pedersen, Martin K.

    2015-01-01

    A 1.8 V capacitor-free linear regulator with fast transient response based on a new topology with a fast and slow regulation loop is presented. The design has been laid out and simulated in a 0.18 µm CMOS process. The design has a low component count and is tailored for system-on-chip integration...

  1. Internal friction and linear expansion coefficient in zirconium and cobalt within the range of phase transitions

    Boyarskij, S.V.

    1986-01-01

    Experimental results are presented for internal friction and linear expansion coefficient at zirconium and cobalt in the temperature range from 440 K to the point of the phase transition of the first kind (1138 K for Zr and 706 for Co). Anomalous changes of the internal friction and linear expansion coefficient in the phase transition region are found. Theoretical considerations are given to explain the sharp decrease of the internal friction as temperature approaches the phase transition point

  2. Ultra-low-pressure sputtering to improve exchange bias and tune linear ranges in spin valves

    Tang, XiaoLi, E-mail: tangtang1227@163.com; Yu, You; Liu, Ru; Su, Hua; Zhang, HuaiWu; Zhong, ZhiYong; Jing, YuLan

    2017-05-01

    A series of CoFe/IrMn exchange bilayers was grown by DC-sputtering at different ultra-low argon pressures ranging from 0.008 to 0.1 Pa. This pressure range was one to two orders lower than the normal sputtering pressure. Results revealed that the exchange bias increased from 140 to 250 Oe in CoFe(10 nm)/IrMn (15 nm) bilayers of fixed thickness because of the improved crystalline structure and morphological uniformity of films. Since ferromagnetic /antiferromagnetic (FM/AF) bilayers are always used in linear magnetic sensors as detection layers, the varying exchange bias can successfully achieve tunable linear range in a crossed pinning spin valve. The linear range could be adjustable from −80 Oe – +80 Oe to −150 Oe – +150 Oe on the basis of giant magnetoresistance responses. Therefore, this method provides a simple method to tune the operating range of magnetic field sensors. - Highlights: • Increasing exchange bias was achieved in bilayer at ultra-low-pressure sputtering. • The low void density and smooth surface were achieved in low pressure. • Varying exchange bias achieved tunable linear range in spin valve.

  3. Enhanced Rate Capability of Oxide Coated Lithium Titanate within Extended Voltage Ranges

    Ahn, Dongjoon [College of Engineering, University of Kentucky, Lexington, KY (United States); Xiao, Xingcheng, E-mail: xingcheng.xiao@gm.com [Chemical and Materials Systems Laboratory, General Motors R& D Center, Warren, MI (United States)

    2015-06-30

    Lithium titanate (Li{sub 4}Ti{sub 5}O{sub 12} or LTO) is a promising negative electrode material of high-power lithium-ion batteries, due to its superior rate capability and excellent capacity retention. However, the specific capacity of LTO is less than one half of that of graphite electrode. In this work, we applied ultrathin oxide coating on LTO by the atomic layer deposition technique, aiming for increasing the energy density by extending the cell voltage window and specific capacity of LTO. We demonstrated that a few nanometer thick Al{sub 2}O{sub 3} coating can suppress the mechanical distortion of LTO cycled at low potential, which enable the higher specific capacity and excellent capacity retention. Furthermore, the surface coating can facilitate the charge transfer, leading to significantly improved rate capabilities, comparing with the uncoated LTO.

  4. Experimental Analysis of Linear Induction Motor under Variable Voltage Variable Frequency (VVVF Power Supply

    Prasenjit D. Wakode

    2016-07-01

    Full Text Available This paper presents the complete analysis of Linear Induction Motor (LIM under VVVF. The complete variation of LIM air gap flux under ‘blocked Linor’ condition and starting force is analyzed and presented when LIM is given VVVF supply. The analysis of this data is important in further understanding of the equivalent circuit parameters of LIM and to study the magnetic circuit of LIM. The variation of these parameters is important to know the LIM response at different frequencies. The simulation and application of different control strategies such as vector control thus becomes quite easy to apply and understand motor’s response under such strategy of control.

  5. Linearity improvement on wide-range log signal of neutron measurement system for HANARO

    Kim, Young-Ki; Tuetken, Jeffrey S.

    1998-01-01

    This paper discusses engineering activities for improving the linearity characteristics of the Log Power signal from the neutron measurement system for HANARO. This neutron measurement system uses a fission chamber based detector which covers 10.3 decade-wide range from 10 -8 % full power(FP) up to 200%FP, The Log Power signal is designed to control the reactor at low power levels where most of the reactor physics tests are carried out. Therefore, the linearity characteristics of the Log Power signal is the major factor for accurate reactor power control. During the commissioning of the neutron measurement system, it was found that the linearity characteristics of the Log Power signal, especially near 10 -2 %FP, were not accurate enough for controlling the reactor during physics testing. Analysis of the system linearity data directly measured with reactor operating determined that the system was not operating per the design characteristics established from previous installations. The linearity data, which were taken as the reactor was increased in power, were sent to manufacturer's engineering group and a follow-up measures based on the analysis were then fed back to the field. Through step by step trouble-shooting activities, which included minor circuit modifications and alignment procedure changes, the linearity characteristics have been successfully improved and now exceed minimum performance requirements. This paper discusses the trouble-shooting techniques applied, the changes in the linearity characteristics, special circumstances in the HANARO application and the final resolution. (author)

  6. Flexible Ferroelectric Sensors with Ultrahigh Pressure Sensitivity and Linear Response over Exceptionally Broad Pressure Range.

    Lee, Youngoh; Park, Jonghwa; Cho, Soowon; Shin, Young-Eun; Lee, Hochan; Kim, Jinyoung; Myoung, Jinyoung; Cho, Seungse; Kang, Saewon; Baig, Chunggi; Ko, Hyunhyub

    2018-04-24

    Flexible pressure sensors with a high sensitivity over a broad linear range can simplify wearable sensing systems without additional signal processing for the linear output, enabling device miniaturization and low power consumption. Here, we demonstrate a flexible ferroelectric sensor with ultrahigh pressure sensitivity and linear response over an exceptionally broad pressure range based on the material and structural design of ferroelectric composites with a multilayer interlocked microdome geometry. Due to the stress concentration between interlocked microdome arrays and increased contact area in the multilayer design, the flexible ferroelectric sensors could perceive static/dynamic pressure with high sensitivity (47.7 kPa -1 , 1.3 Pa minimum detection). In addition, efficient stress distribution between stacked multilayers enables linear sensing over exceptionally broad pressure range (0.0013-353 kPa) with fast response time (20 ms) and high reliability over 5000 repetitive cycles even at an extremely high pressure of 272 kPa. Our sensor can be used to monitor diverse stimuli from a low to a high pressure range including weak gas flow, acoustic sound, wrist pulse pressure, respiration, and foot pressure with a single device.

  7. Application of range-test in multiple linear regression analysis in ...

    Application of range-test in multiple linear regression analysis in the presence of outliers is studied in this paper. First, the plot of the explanatory variables (i.e. Administration, Social/Commercial, Economic services and Transfer) on the dependent variable (i.e. GDP) was done to identify the statistical trend over the years.

  8. Comparison of experimental and theoretical reaction rail currents, rail voltages, and airgap fields for the linear induction motor research vehicle

    Elliott, D. G.

    1977-01-01

    Measurements of reaction rail currents, reaction rail voltages, and airgap magnetic fields in tests of the Linear Induction Motor Research Vehicle (LIMRV) were compared with theoretical calculations from the mesh/matrix theory. It was found that the rail currents and magnetic fields predicted by the theory are within 20 percent of the measured currents and fields at most motor locations in most of the runs, but differ by as much as a factor of two in some cases. The most consistent difference is a higher experimental than theoretical magnetic field near the entrance of the motor and a lower experimental than theoretical magnetic field near the exit. The observed differences between the theoretical and experimental magnetic fields and currents do not account for the differences of as much as 26 percent between the theoretical and experimental thrusts.

  9. Novel birefringence interrogation for Sagnac loop interferometer sensor with unlimited linear measurement range.

    He, Haijun; Shao, Liyang; Qian, Heng; Zhang, Xinpu; Liang, Jiawei; Luo, Bin; Pan, Wei; Yan, Lianshan

    2017-03-20

    A novel demodulation method for Sagnac loop interferometer based sensor has been proposed and demonstrated, by unwrapping the phase changes with birefringence interrogation. A temperature sensor based on Sagnac loop interferometer has been used to verify the feasibility of the proposed method. Several tests with 40 °C temperature range have been accomplished with a great linearity of 0.9996 in full range. The proposed scheme is universal for all Sagnac loop interferometer based sensors and it has unlimited linear measurable range which overwhelming the conventional demodulation method with peak/dip tracing. Furthermore, the influence of the wavelength sampling interval and wavelength span on the demodulation error has been discussed in this work. The proposed interrogation method has a great significance for Sagnac loop interferometer sensor and it might greatly enhance the availability of this type of sensors in practical application.

  10. Improved measurement linearity and precision for AMCW time-of-flight range imaging cameras.

    Payne, Andrew D; Dorrington, Adrian A; Cree, Michael J; Carnegie, Dale A

    2010-08-10

    Time-of-flight range imaging systems utilizing the amplitude modulated continuous wave (AMCW) technique often suffer from measurement nonlinearity due to the presence of aliased harmonics within the amplitude modulation signals. Typically a calibration is performed to correct these errors. We demonstrate an alternative phase encoding approach that attenuates the harmonics during the sampling process, thereby improving measurement linearity in the raw measurements. This mitigates the need to measure the system's response or calibrate for environmental changes. In conjunction with improved linearity, we demonstrate that measurement precision can also be increased by reducing the duty cycle of the amplitude modulated illumination source (while maintaining overall illumination power).

  11. Full-range k-domain linearization in spectral-domain optical coherence tomography.

    Jeon, Mansik; Kim, Jeehyun; Jung, Unsang; Lee, Changho; Jung, Woonggyu; Boppart, Stephen A

    2011-03-10

    A full-bandwidth k-domain linearization method for spectral-domain optical coherence tomography (SD-OCT) is demonstrated. The method uses information of the wavenumber-pixel-position provided by a translating-slit-based wavelength filter. For calibration purposes, the filter is placed either after a broadband source or at the end of the sample path, and the filtered spectrum with a narrowed line width (∼0.5 nm) is incident on a line-scan camera in the detection path. The wavelength-swept spectra are co-registered with the pixel positions according to their central wavelengths, which can be automatically measured with an optical spectrum analyzer. For imaging, the method does not require a filter or a software recalibration algorithm; it simply resamples the OCT signal from the detector array without employing rescaling or interpolation methods. The accuracy of k-linearization is maximized by increasing the k-linearization order, which is known to be a crucial parameter for maintaining a narrow point-spread function (PSF) width at increasing depths. The broadening effect is studied by changing the k-linearization order by undersampling to search for the optimal value. The system provides more position information, surpassing the optimum without compromising the imaging speed. The proposed full-range k-domain linearization method can be applied to SD-OCT systems to simplify their hardware/software, increase their speed, and improve the axial image resolution. The experimentally measured width of PSF in air has an FWHM of 8 μm at the edge of the axial measurement range. At an imaging depth of 2.5 mm, the sensitivity of the full-range calibration case drops less than 10 dB compared with the uncompensated case.

  12. Designing double-gap linear accelerators for a wide mass range

    Lysenko, W.P.; Wadlinger, E.A.; Rusnak, B.; Krawczyk, F.; Saadatmand, K.; Wan, Z.

    1998-01-01

    For applications like ion implantation, rf linacs using double-gap structures with external resonators can be used because they are practical at low frequencies. However, since the two gaps associated with a given resonator cannot be individually phased, it is not obvious how to build a linac that can efficiently accelerate particles having different mass/charge ratios. This paper describes the beam dynamics of double-gap rf linacs and shows how to maximize the range of mass/charge ratios. The theory also tells one how to rescale a linac tune (i.e., reset the voltages and phases) so that a new particle, having a different mass or charge, will behave similarly to the original particle

  13. A high linearity current mode multiplier/divider with a wide dynamic range

    Liao Pengfei; Luo Ping; Zhang Bo; Li Zhaoji

    2012-01-01

    A high linearity current mode multiplier/divider (CMM/D) with a wide dynamic range is presented. The proposed CMM/D is based on the voltage—current characteristic of the diode, thus wide dynamic range is achieved. In addition, high linearity is achieved because high accuracy current mirrors are adopted and the output current is insensitive to the temperature and device parameters of the fabrication process. Furthermore, no extra bias current for all input signals is required and thus power saving is realized. With proper selection of establishing the input terminal, the proposed circuit can perform as a multifunction circuit to be operated as a multiplier/divider, without changing its topology. The proposed circuit is implemented in a 0.25 μm BCD process and the chip area is 0.26 × 0.24 mm 2 . The simulation and measurement results show that the maximum static linearity error is ±1.8% and the total harmonic distortion is 0.4% while the input current ranges from 0 to 200 μA. (semiconductor integrated circuits)

  14. Wide-range bipolar pulse conductance instrument employing current and voltage modes with sampled or integrated signal acquisition

    Calhoun, R K; Holler, F J [Kentucky Univ., Lexington, KY (United States). Dept. of Chemistry; Geiger, jr, R F; Nieman, T A [Illinois Univ., Urbana, IL (United States). Dept. of Chemistry; Caserta, K J [Procter and Gamble Co., Cincinnati, OH (United States)

    1991-11-05

    An instrument for measuring solution conductance using the bipolar pulse technique is described. The instrument is capable of measuring conductances in the range of 5x10{sup -9}-10{Omega}{sup -1} with 1% accuracy or better in as little as 32 {mu}s. Accuracy of 0.001-0.01% is achievable over the range 1x10{sup -6}-1{Omega}{sup -1}. Circuitry and software are described that allow the instrument to adjust automatically the pulse height, pulse duration, excitation mode (current or voltage pulse) and data acquisition mode (sampled or integrated) to acquire data of optimum accuracy and precision. The urease-catalyzed decomposition of urea is used to illustrate the versality of the instrument, and other applications are cited. (author). 60 refs.; 7 figs.; 2 tabs.

  15. Calculation of elastic-plastic strain ranges for fatigue analysis based on linear elastic stresses

    Sauer, G.

    1998-01-01

    Fatigue analysis requires that the maximum strain ranges be known. These strain ranges are generally computed from linear elastic analysis. The elastic strain ranges are enhanced by a factor K e to obtain the total elastic-plastic strain range. The reliability of the fatigue analysis depends on the quality of this factor. Formulae for calculating the K e factor are proposed. A beam is introduced as a computational model for determining the elastic-plastic strains. The beam is loaded by the elastic stresses of the real structure. The elastic-plastic strains of the beam are compared with the beam's elastic strains. This comparison furnishes explicit expressions for the K e factor. The K e factor is tested by means of seven examples. (orig.)

  16. Long-range correlation in synchronization and syncopation tapping: a linear phase correction model.

    Didier Delignières

    Full Text Available We propose in this paper a model for accounting for the increase in long-range correlations observed in asynchrony series in syncopation tapping, as compared with synchronization tapping. Our model is an extension of the linear phase correction model for synchronization tapping. We suppose that the timekeeper represents a fractal source in the system, and that a process of estimation of the half-period of the metronome, obeying a random-walk dynamics, combines with the linear phase correction process. Comparing experimental and simulated series, we show that our model allows accounting for the experimentally observed pattern of serial dependence. This model complete previous modeling solutions proposed for self-paced and synchronization tapping, for a unifying framework of event-based timing.

  17. A high sensitive 66 dB linear dynamic range receiver for 3-D laser radar

    Ma, Rui; Zheng, Hao; Zhu, Zhangming

    2017-08-01

    This study presents a CMOS receiver chip realized in 0.18 μm standard CMOS technology and intended for high precision 3-D laser radar. The chip includes an adjustable gain transimpedance pre-amplifier, a post-amplifier and two timing comparators. An additional feedback is employed in the regulated cascode transimpedance amplifier to decrease the input impedance, and a variable gain transimpedance amplifier controlled by digital switches and analog multiplexer is utilized to realize four gain modes, extending the input dynamic range. The measurement shows that the highest transimpedance of the channel is 50 k {{Ω }}, the uncompensated walk error is 1.44 ns in a wide linear dynamic range of 66 dB (1:2000), and the input referred noise current is 2.3 pA/\\sqrt{{Hz}} (rms), resulting in a very low detectable input current of 1 μA with SNR = 5.

  18. Low Voltage Ride-Through of Two-Stage Grid-Connected Photovoltaic Systems Through the Inherent Linear Power-Voltage Characteristic

    Yang, Yongheng; Sangwongwanich, Ariya; Liu, Hongpeng

    2017-01-01

    In this paper, a cost-effective control scheme for two-stage grid-connected PhotoVoltaic (PV) systems in Low Voltage Ride-Through (LVRT) operation is proposed. In the case of LVRT, the active power injection by PV panels should be limited to prevent from inverter over-current and also energy...... aggregation at the dc-link, which will challenge the dc-link capacitor lifetime if remains uncontrolled. At the same time, reactive currents should be injected upon any demand imposed by the system operators. In the proposed scheme, the two objectives can be feasibly achieved. The active power is regulated...... point tracking controller without significant hardware or software modifications. In this way, the PV system will not operate at the maximum power point, whereas the inverter will not face any over-current challenge but can provide reactive power support in response to the grid voltage fault...

  19. High Dynamic Range RF Front End with Noise Cancellation and Linearization for WiMAX Receivers

    J.-M. Wu

    2012-06-01

    Full Text Available This research deals with verification of the high dynamic range for a heterodyne radio frequency (RF front end. A 2.6 GHz RF front end is designed and implemented in a hybrid microwave integrated circuit (HMIC for worldwide interoperability for microwave access (WiMAX receivers. The heterodyne RF front end consists of a low-noise amplifier (LNA with noise cancellation, an RF bandpass filter (BPF, a downconverter with linearization, and an intermediate frequency (IF BPF. A noise canceling technique used in the low-noise amplifier eliminates a thermal noise and then reduces the noise figure (NF of the RF front end by 0.9 dB. Use of a downconverter with diode linearizer also compensates for gain compression, which increases the input-referred third-order intercept point (IIP3 of the RF front end by 4.3 dB. The proposed method substantially increases the spurious-free dynamic range (DRf of the RF front end by 3.5 dB.

  20. Improved linearity using harmonic error rejection in a full-field range imaging system

    Payne, Andrew D.; Dorrington, Adrian A.; Cree, Michael J.; Carnegie, Dale A.

    2008-02-01

    Full field range imaging cameras are used to simultaneously measure the distance for every pixel in a given scene using an intensity modulated illumination source and a gain modulated receiver array. The light is reflected from an object in the scene, and the modulation envelope experiences a phase shift proportional to the target distance. Ideally the waveforms are sinusoidal, allowing the phase, and hence object range, to be determined from four measurements using an arctangent function. In practice these waveforms are often not perfectly sinusoidal, and in some cases square waveforms are instead used to simplify the electronic drive requirements. The waveforms therefore commonly contain odd harmonics which contribute a nonlinear error to the phase determination, and therefore an error in the range measurement. We have developed a unique sampling method to cancel the effect of these harmonics, with the results showing an order of magnitude improvement in the measurement linearity without the need for calibration or lookup tables, while the acquisition time remains unchanged. The technique can be applied to existing range imaging systems without having to change or modify the complex illumination or sensor systems, instead only requiring a change to the signal generation and timing electronics.

  1. Improved transmission of electrostatic accelerator in a wide range of terminal voltages by controlling the focal strength of entrance acceleration tube

    Lobanov, Nikolai R.; Tunningley, Thomas; Linardakis, Peter

    2018-04-01

    Tandem electrostatic accelerators often require the flexibility to operate at a variety of terminal voltages to accommodate various user requirements. However, the ion beam transmission will only be optimal for a limited range of terminal voltages. This paper describes the operational performance of a novel focusing system that expands the range of terminal voltages for optimal transmission. This is accomplished by controlling the gradient of the entrance of the low-energy tube, providing an additional focusing element. In this specific case it is achieved by applying up to 150 kV to the fifth electrode of the first unit of the accelerator tube. Numerical simulations and beam transmission tests have been performed to confirm the effectiveness of the lens. An analytical expression has been derived describing its focal properties. These tests demonstrate that the entrance lens control eliminates the need to short out sections of the tube for operation at low terminal voltage.

  2. Comparison of linear intrascan and interscan dynamic ranges of Orbitrap and ion-mobility time-of-flight mass spectrometers.

    Kaufmann, Anton; Walker, Stephan

    2017-11-30

    The linear intrascan and interscan dynamic ranges of mass spectrometers are important in metabolome and residue analysis. A large linear dynamic range is mandatory if both low- and high-abundance ions have to be detected and quantitated in heavy matrix samples. These performance criteria, as provided by modern high-resolution mass spectrometry (HRMS), were systematically investigated. The comparison included two generations of Orbitraps, and an ion mobility quadrupole time-of-flight (QTOF) system In addition, different scan modes, as provided by the utilized instruments, were investigated. Calibration curves of different compounds covering a concentration range of five orders of magnitude were measured to evaluate the linear interscan dynamic range. The linear intrascan dynamic range and the resulting mass accuracy were evaluated by repeating these measurements in the presence of a very intense background. Modern HRMS instruments can show linear dynamic ranges of five orders of magnitude. Often, however, the linear dynamic range is limited by the detection capability (sensitivity and selectivity) and by the electrospray ionization. Orbitraps, as opposed to TOF instruments, show a reduced intrascan dynamic range. This is due to the limited C-trap and Orbitrap capacity. The tested TOF instrument shows poorer mass accuracies than the Orbitraps. In contrast, hyphenation with an ion-mobility device seems not to affect the linear dynamic range. The linear dynamic range of modern HRMS instrumentation has been significantly improved. This also refers to the virtual absence of systematic mass shifts at high ion abundances. The intrascan dynamic range of the current Orbitrap technology may still be a limitation when analyzing complex matrix extracts. On the other hand, the linear dynamic range is not only limited by the detector technology, but can also be shortened by peripheral devices, where the ionization and transfer of ions take place. Copyright © 2017 John Wiley

  3. Linear response theory for long-range interacting systems in quasistationary states.

    Patelli, Aurelio; Gupta, Shamik; Nardini, Cesare; Ruffo, Stefano

    2012-02-01

    Long-range interacting systems, while relaxing to equilibrium, often get trapped in long-lived quasistationary states which have lifetimes that diverge with the system size. In this work, we address the question of how a long-range system in a quasistationary state (QSS) responds to an external perturbation. We consider a long-range system that evolves under deterministic Hamilton dynamics. The perturbation is taken to couple to the canonical coordinates of the individual constituents. Our study is based on analyzing the Vlasov equation for the single-particle phase-space distribution. The QSS represents a stable stationary solution of the Vlasov equation in the absence of the external perturbation. In the presence of small perturbation, we linearize the perturbed Vlasov equation about the QSS to obtain a formal expression for the response observed in a single-particle dynamical quantity. For a QSS that is homogeneous in the coordinate, we obtain an explicit formula for the response. We apply our analysis to a paradigmatic model, the Hamiltonian mean-field model, which involves particles moving on a circle under Hamiltonian dynamics. Our prediction for the response of three representative QSSs in this model (the water-bag QSS, the Fermi-Dirac QSS, and the Gaussian QSS) is found to be in good agreement with N-particle simulations for large N. We also show the long-time relaxation of the water-bag QSS to the Boltzmann-Gibbs equilibrium state. © 2012 American Physical Society

  4. Non-linear characteristics and long-range correlations in Asian stock markets

    Jiang, J.; Ma, K.; Cai, X.

    2007-05-01

    We test several non-linear characteristics of Asian stock markets, which indicates the failure of efficient market hypothesis and shows the essence of fractal of the financial markets. In addition, by using the method of detrended fluctuation analysis (DFA) to investigate the long range correlation of the volatility in the stock markets, we find that the crossover phenomena exist in the results of DFA. Further, in the region of small volatility, the scaling behavior is more complicated; in the region of large volatility, the scaling exponent is close to 0.5, which suggests the market is more efficient. All these results may indicate the possibility of characteristic multifractal scaling behaviors of the financial markets.

  5. Analog Circuit Design Low Voltage Low Power; Short Range Wireless Front-Ends; Power Management and DC-DC

    Roermund, Arthur; Baschirotto, Andrea

    2012-01-01

    The book contains the contribution of 18 tutorials of the 20th workshop on Advances in Analog Circuit Design.  Each part discusses a specific to-date topic on new and valuable design ideas in the area of analog circuit design. Each part is presented by six experts in that field and state of the art information is shared and overviewed. This book is number 20 in this successful series of Analog Circuit Design, providing valuable information and excellent overviews of Low-Voltage Low-Power Data Converters - Chaired by Prof. Anderea Baschirotto, University of Milan-Bicocca Short Range Wireless Front-Ends - Chaired by Prof. Arthur van Roermund, Eindhoven University of Technology Power management and DC-DC - Chaired by Prof. M. Steyaert, Katholieke University Leuven Analog Circuit Design is an essential reference source for analog circuit designers and researchers wishing to keep abreast with the latest development in the field. The tutorial coverage also makes it suitable for use in an advanced design.

  6. A Fourier Transform Spectrometer Based on an Electrothermal MEMS Mirror with Improved Linear Scan Range

    Wei Wang

    2016-09-01

    Full Text Available A Fourier transform spectrometer (FTS that incorporates a closed-loop controlled, electrothermally actuated microelectromechanical systems (MEMS micromirror is proposed and experimentally verified. The scan range and the tilting angle of the mirror plate are the two critical parameters for MEMS-based FTS. In this work, the MEMS mirror with a footprint of 4.3 mm × 3.1 mm is based on a modified lateral-shift-free (LSF bimorph actuator design with large piston and reduced tilting. Combined with a position-sensitive device (PSD for tilt angle sensing, the feedback controlled MEMS mirror generates a 430 µm stable linear piston scan with the mirror plate tilting angle less than ±0.002°. The usable piston scan range is increased to 78% of the MEMS mirror’s full scan capability, and a spectral resolution of 0.55 nm at 531.9 nm wavelength, has been achieved. It is a significant improvement compared to the prior work.

  7. Transformer-assisted PWM zero-voltage switching pole inverter with high output bandwidth applied to linear motor drives

    Myrzik, J.M.A.; Duarte, J.L.; Haardt, de P.; Vissers, J.

    2002-01-01

    An application of the transformer-assisted PWM zero-voltage switching pole inverter (TRAP) is described in this paper. The TRAP is based on the auxiliary resonant commutated pole inverter (ARCP), but avoids its disadvantages. This paper describes the converter functionality and its applicability

  8. Investigation of Efficiency and Thermal Performance of The Y-source Converters for a Wide Voltage Range

    Brwene Salah Gadalla

    2015-12-01

    Full Text Available The Y-source topology has a unique advantage of having high voltages gain with small shoot through duty cycles. Furthermore, having the advantage of high modulation index which increase the power density and improve the performance of the converter. In this paper, a collective thermal and efficiency investigation has been performed in order to improve the reliability of the converter. Evaluation of relevant losses as ( switching, conduction, capacitor ESR, core and winding losses , and evaluation of the junction temperature of the devices under 25C ambient temperature. The analysis is done for different voltage gain factors (2, 3, and 4, and different winding factor (4, and 5 using PLECS toolbox. The results shows that the higher the voltage gain and winding factor, the higher power losses and rising in the junction temperature of the device.

  9. A Dual Active Bridge Converter with an Extended High-Efficiency Range by DC Blocking Capacitor Voltage Control

    Qin, Zian; Shen, Yanfeng; Loh, Poh Chiang

    2018-01-01

    of hard switching and high circulating power. Thus, a new modulation scheme has been proposed, whose main idea is to introduce a voltage offset across the dc blocking capacitor connected in series with the transformer. Operational principle of the proposed modulation has been introduced, before analyzing...

  10. Analysis of loss distribution of Conventional Boost, Z-source and Y-source Converters for wide power and voltage range

    Gadalla, Brwene Salah Abdelkarim; Schaltz, Erik; Siwakoti, Yam Prasad

    2017-01-01

    Boost converters are needed in many applications which require the output voltage to be higher than the input voltage. Recently, boost type converters have been applied for industrial applications, and hence it has become an interesting topic of research. Many researchers proposed different...... impedance source converters with their unique advantages as having a high voltage gain in a small range of duty cycle ratio. However, the thermal behaviour of the semiconductor devices and passive elements in the impedance source converter is an important issue from a reliability point of view and it has...... not been investigated yet. Therefore, this paper presents a comparison between the conventional boost, the Z-source, and the Y-source converters based on a thermal evaluation of the semiconductors. In addition, the three topologies are also compared with respect to their efficiency. In this study...

  11. Generating linear regression model to predict motor functions by use of laser range finder during TUG.

    Adachi, Daiki; Nishiguchi, Shu; Fukutani, Naoto; Hotta, Takayuki; Tashiro, Yuto; Morino, Saori; Shirooka, Hidehiko; Nozaki, Yuma; Hirata, Hinako; Yamaguchi, Moe; Yorozu, Ayanori; Takahashi, Masaki; Aoyama, Tomoki

    2017-05-01

    The purpose of this study was to investigate which spatial and temporal parameters of the Timed Up and Go (TUG) test are associated with motor function in elderly individuals. This study included 99 community-dwelling women aged 72.9 ± 6.3 years. Step length, step width, single support time, variability of the aforementioned parameters, gait velocity, cadence, reaction time from starting signal to first step, and minimum distance between the foot and a marker placed to 3 in front of the chair were measured using our analysis system. The 10-m walk test, five times sit-to-stand (FTSTS) test, and one-leg standing (OLS) test were used to assess motor function. Stepwise multivariate linear regression analysis was used to determine which TUG test parameters were associated with each motor function test. Finally, we calculated a predictive model for each motor function test using each regression coefficient. In stepwise linear regression analysis, step length and cadence were significantly associated with the 10-m walk test, FTSTS and OLS test. Reaction time was associated with the FTSTS test, and step width was associated with the OLS test. Each predictive model showed a strong correlation with the 10-m walk test and OLS test (P motor function test. Moreover, the TUG test time regarded as the lower extremity function and mobility has strong predictive ability in each motor function test. Copyright © 2017 The Japanese Orthopaedic Association. Published by Elsevier B.V. All rights reserved.

  12. Expanding the linear dynamic range for quantitative liquid chromatography-high resolution mass spectrometry utilizing natural isotopologue signals

    Liu, Hanghui; Lam, Lily; Yan, Lin; Chi, Bert; Dasgupta, Purnendu K.

    2014-01-01

    Highlights: • Less abundant isotopologue ions were utilized to decrease detector saturation. • A 25–50 fold increase in the upper limit of dynamic range was demonstrated. • Linear dynamic range was expanded without compromising mass resolution. - Abstract: The linear dynamic range (LDR) for quantitative liquid chromatography–mass spectrometry can be extended until ionization saturation is reached by using a number of target isotopologue ions in addition to the normally used target ion that provides the highest sensitivity. Less abundant isotopologue ions extend the LDR: the lower ion abundance decreases the probability of ion detector saturation. Effectively the sensitivity decreases and the upper limit of the LDR increases. We show in this paper that the technique is particularly powerful with a high resolution time of flight mass spectrometer because the data for all ions are automatically acquired, and we demonstrated this for four small organic molecules; the upper limits of LDRs increased by 25–50 times

  13. Fiber optics frequency comb enabled linear optical sampling with operation wavelength range extension.

    Liao, Ruolin; Wu, Zhichao; Fu, Songnian; Zhu, Shengnan; Yu, Zhe; Tang, Ming; Liu, Deming

    2018-02-01

    Although the linear optical sampling (LOS) technique is powerful enough to characterize various advanced modulation formats with high symbol rates, the central wavelength of a pulsed local oscillator (LO) needs to be carefully set according to that of the signal under test, due to the coherent mixing operation. Here, we experimentally demonstrate wideband LOS enabled by a fiber optics frequency comb (FOFC). Meanwhile, when the broadband FOFC acts as the pulsed LO, we propose a scheme to mitigate the enhanced sampling error arising in the non-ideal response of a balanced photodetector. Finally, precise characterizations of arbitrary 128 Gbps PDM-QPSK wavelength channels from 1550 to 1570 nm are successfully achieved, when a 101.3 MHz frequency spaced comb with a 3 dB spectral power ripple of 20 nm is used.

  14. Prediction of failures in linear systems with the use of tolerance ranges

    Gadzhiev, Ch.M.

    1993-01-01

    The problem of predicting the technical state of an object can be stated in a general case as that of predicting potential failures on the basis of a quantitative evaluation of the predicted parameters in relation to the set of tolerances on these parameters. The main stages in the prediction are collecting and preparing source data on the prehistory of the predicted phenomenon, forming a mathematical model of this phenomenon, working out the algorithm for the prediction, and adopting a solution from the prediction results. The final two stages of prediction are considered in this article. The prediction algorithm is proposed based on construction of the tolerance range for the signal of error between output coordinates of the system and its mathematical model. A solution regarding possible occurrence of failure in the system is formulated as a result of comparison of the tolerance range and the found confidence interval. 5 refs

  15. Polarizable embedding with a multiconfiguration short-range density functional theory linear response method

    Hedegård, Erik D.; Olsen, Jógvan Magnus Haugaard; Knecht, Stefan

    2015-01-01

    . To demonstrate the capabilities of PE-MC-srDFT, we also investigated the retinylidene Schiff base chromophore embedded in the channelrhodopsin protein. While using a much more compact reference wave function in terms of active space, our PE-MC-srDFT approach yields excitation energies comparable in quality......We present here the coupling of a polarizable embedding (PE) model to the recently developed multiconfiguration short-range density functional theory method (MC-srDFT), which can treat multiconfigurational systems with a simultaneous account for dynamical and static correlation effects. PE......-MC-srDFT is designed to combine efficient treatment of complicated electronic structures with inclusion of effects from the surrounding environment. The environmental effects encompass classical electrostatic interactions as well as polarization of both the quantum region and the environment. Using response theory...

  16. A Facile Approach to Preparing Molecularly Imprinted Chitosan for Detecting 2,4,6-Tribromophenol with a Widely Linear Range

    Limei Huang

    2017-04-01

    Full Text Available The environmental pollution of 2,4,6-tribromophenol (TBP has attracted attention. Based on an urgent need for the better provision of clean water, in situ determination of TBP is of great importance. Here, a facile and effective approach for detecting TBP is developed, based on coupling molecular imprinting technique with electrodeposition of chitosan (CS on the gold electrode. The TBP imprinting CS film was fabricated by using CS as functional material and TBP as template molecule. The experiments show that the morphologies and electrochemical properties of the imprinted film sensor was different from non-imprinted film electrode. The current of the imprinted film was linearly proportional to the TBP concentration, with a wide linear range of 1.0 × 10−7 mol•L−1 to 1.0 × 10−3 mol•L−1. By selecting drop-coating method as a reference for controlled trials with the same functional material, the results illustrated that the electrodeposition enjoyed a widely linear range advantage.

  17. High-resolution continuum source electrothermal atomic absorption spectrometry: Linearization of the calibration curves within a broad concentration range

    Katskov, Dmitri, E-mail: katskovda@tut.ac.za [Tshwane University of Technology, Chemistry Department, Pretoria 0001 (South Africa); Hlongwane, Miranda [Tshwane University of Technology, Chemistry Department, Pretoria 0001 (South Africa); Heitmann, Uwe [German Aerospace Center, Rose-Luxemburg Str. 2, 10178 Berlin (Germany); Florek, Stefan [ISAS-Leibniz-Institut fuer Analytische Wissenschaften e.V., Albert-Einstein-Str. 9,12489 Berlin (Germany)

    2012-05-15

    The calculation algorithm suggested provides linearization of the calibration curves in high-resolution continuum source electrothermal atomic absorption spectrometry. The algorithm is based on the modification of the function wavelength-integrated absorbance vs. concentration of analyte vapor in the absorption volume. According to the suggested approach, the absorption line is represented by a triangle for low and trapezium for high analyte vapor concentration in the absorption volume. The respective semi-empirical formulas include two linearization parameters, which depend on properties of the absorption line and characteristics of the atomizer and spectrometer. The parameters can be approximately evaluated from the theory and determined in practice from the original broad-range calibration curve. The parameters were found and the proposed calculation algorithm verified in the experiments on direct determination of Ag, Cd, Cu, Fe, Mn and Pb in the solutions within a concentration ranges from 0.15 to 625 {mu}g{center_dot}L{sup -1} using tube, platform tube and filter furnace atomizers. The use of various atomizers, lines, elements and atomization temperatures made possible the simulation of various practical analytical conditions. It was found that the algorithm and optimal linearization parameters made it possible to obtain for each line and atomizer linear approximations of the calibration curves within 3-4 orders of magnitude with correlation coefficients close to 0.999. The algorithm makes possible to employ a single line for the direct element determination over a broad concentration range. The sources of errors and the possibility of a priori theoretical evaluation of the linearization parameters are discussed. - Highlights: Black-Right-Pointing-Pointer New calculation algorithm for HR-CS ET AAS measurements was proposed and applied. Black-Right-Pointing-Pointer The suggested formulas include two parameters to be determined experimentally. Black

  18. Muscle shear elastic modulus is linearly related to muscle torque over the entire range of isometric contraction intensity.

    Ateş, Filiz; Hug, François; Bouillard, Killian; Jubeau, Marc; Frappart, Thomas; Couade, Mathieu; Bercoff, Jeremy; Nordez, Antoine

    2015-08-01

    Muscle shear elastic modulus is linearly related to muscle torque during low-level contractions (torque over the entire range of isometric contraction and (ii) the influence of the size of the region of interest (ROI) used to average the shear modulus value. Ten healthy males performed two incremental isometric little finger abductions. The joint torque produced by Abductor Digiti Minimi was considered as an index of muscle torque and elastic modulus. A high coefficient of determination (R(2)) (range: 0.86-0.98) indicated that the relationship between elastic modulus and torque can be accurately modeled by a linear regression over the entire range (0% to 100% of MVC). The changes in shear elastic modulus as a function of torque were highly repeatable. Lower R(2) values (0.89±0.13 for 1/16 of ROI) and significantly increased absolute errors were observed when the shear elastic modulus was averaged over smaller ROI, half, 1/4 and 1/16 of the full ROI) than the full ROI (mean size: 1.18±0.24cm(2)). It suggests that the ROI should be as large as possible for accurate measurement of muscle shear modulus. Copyright © 2015 Elsevier Ltd. All rights reserved.

  19. On the predictability of extreme events in records with linear and nonlinear long-range memory: Efficiency and noise robustness

    Bogachev, Mikhail I.; Bunde, Armin

    2011-06-01

    We study the predictability of extreme events in records with linear and nonlinear long-range memory in the presence of additive white noise using two different approaches: (i) the precursory pattern recognition technique (PRT) that exploits solely the information about short-term precursors, and (ii) the return interval approach (RIA) that exploits long-range memory incorporated in the elapsed time after the last extreme event. We find that the PRT always performs better when only linear memory is present. In the presence of nonlinear memory, both methods demonstrate comparable efficiency in the absence of white noise. When additional white noise is present in the record (which is the case in most observational records), the efficiency of the PRT decreases monotonously with increasing noise level. In contrast, the RIA shows an abrupt transition between a phase of low level noise where the prediction is as good as in the absence of noise, and a phase of high level noise where the prediction becomes poor. In the phase of low and intermediate noise the RIA predicts considerably better than the PRT, which explains our recent findings in physiological and financial records.

  20. Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

    Bhowmik, R. N.; Vijayasri, G.

    2015-06-01

    We have studied current-voltage (I-V) characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (˜500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

  1. Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3} oxide

    Bhowmik, R. N., E-mail: rnbhowmik.phy@pondiuni.edu.in; Vijayasri, G. [Department of Physics, Pondicherry University, R.Venkataraman Nagar, Kalapet, Puducherry - 605 014 (India)

    2015-06-15

    We have studied current-voltage (I-V) characteristics of α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3}, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔV{sub P}) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

  2. Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

    R. N. Bhowmik

    2015-06-01

    Full Text Available We have studied current-voltage (I-V characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP 0.345(± 0.001 V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%, magnetoresistance (70-135 % and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

  3. Electrochemical study of RuO2 and/or TiO2 pyrolytic films on titanium in the range of voltage corresponding to water stability

    Barral, Gerard

    1988-01-01

    This research thesis can be considered as a preliminary part of the investigation of electrocatalytic properties of ruthenium and titanium dioxides. It proposes a presentation of electrochemical properties of interfaces between these oxides and the aqueous electrolyte in a voltage range corresponding to thermodynamic stabilities of water and dioxides. After a bibliographical study of methods of preparation of these materials and on the influence of the preparation mode on their physical characteristics and transient electrochemical behaviours, the author reports a detailed study of the hydrogen atom electro-sorption reaction. He discusses the variation of the main electrostatic characteristics of the space charge layer of various semiconducting phases with respect to the initial electric potential between the ends of this layer. He reports the experimental study of electrodes with porous ruthenium and / or titanium dioxides formed by pyrolysis or co-pyrolysis of chlorides of these metals [fr

  4. Dielectric-wall linear accelerator with a high voltage fast rise time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators

    Caporaso, George J.; Sampayan, Stephen E.; Kirbie, Hugh C.

    1998-01-01

    A dielectric-wall linear accelerator is improved by a high-voltage, fast rise-time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators. A high voltage is placed between the electrodes sufficient to stress the voltage breakdown of the insulator on command. A light trigger, such as a laser, is focused along at least one line along the edge surface of the laminated alternating layers of isolated conductors and insulators extending between the electrodes. The laser is energized to initiate a surface breakdown by a fluence of photons, thus causing the electrical switch to close very promptly. Such insulators and lasers are incorporated in a dielectric wall linear accelerator with Blumlein modules, and phasing is controlled by adjusting the length of fiber optic cables that carry the laser light to the insulator surface.

  5. Kinetics of oriented crystallization of polymers in the linear stress-orientation range in the series expansion approach

    L. Jarecki

    2018-04-01

    Full Text Available An analytical formula is derived for the oriented crystallization coefficient governing kinetics of oriented crystallization under uniaxial amorphous orientation in the entire temperature range. A series expansion approach is applied to the free energy of crystallization in the Hoffman-Lauritzen kinetic model of crystallization at accounting for the entropy of orientation of the amorphous chains. The series expansion coefficients are calculated for systems of Gaussian chains in linear stress-orientation range. Oriented crystallization rate functions are determined basing on the ‘proportional expansion’ approach proposed by Ziabicki in the steady-state limit. Crystallization kinetics controlled by separate predetermined and sporadic primary nucleation is considered, as well as the kinetics involving both nucleation mechanisms potentially present in oriented systems. The involvement of sporadic nucleation in the transformation kinetics is predicted to increase with increasing amorphous orientation. Example computations illustrate the dependence of the calculated functions on temperature and amorphous orientation, as well as qualitative agreement of the calculations with experimental results.

  6. Lifetime estimates of a fusion reactor first wall by linear damage summation and strain range partitioning methods

    Liu, K.C.; Grossbeck, M.L.

    1979-01-01

    A generalized model of a first wall made of 20% cold-worked steel was examined for neutron wall loadings ranging from 2 to 5 MW/m 2 . A spectrum of simplified on-off duty cycles was assumed with a 95% burn time. Independent evaluations of cyclic lifetimes were based on two methods: the method of linear damage summation currently being employed for use in ASME high-temperature design Code Case N-47 and that of strain range partitioning being studied for inclusion in the design code. An important point is that the latter method can incorporate a known decrease in ductility for materials subject to irradiation as a parameter, so low-cycle fatigue behavior can be estimated for irradiated material. Lifetimes predicted by the two methods agree reasonably well despite their diversity in concept. Lack of high-cycle fatigue data for the material tested at temperatures within the range of our interest precludes making conclusions on the accuracy of the predicted results, but such data are forthcoming. The analysis includes stress relaxation due to thermal and irradiation-induced creep. Reduced ductility values from irradiations that simulate the environment of the first wall of a fusion reactor were used to estimate the lifetime of the first wall under irradiation. These results indicate that 20% cold-worked type 316 stainless steel could be used as a first-wall material meeting a 8 to 10 MW-year/m 2 lifetime goal for a neutron wall loading of about 2 MW-year/m 2 and a maximum temperature of about 500 0 C

  7. Algorithm оf Computer Model Realization оf High-Frequency Processes in Switchgears Containing Non-Linear Over-Voltage Limiters

    Ye. V. Dmitriev

    2007-01-01

    Full Text Available Analysis of the Over-Voltage Limiter (OVL influence on electromagnetic high-frequency over-voltages at commutations with isolators of unloaded sections of wires and possibility of application of a frequency-dependent resistor in case of necessity to facilitate OVL operation conditions is provided in the paper.It is shown that it is necessary to take into account characteristics of OVL by IEEE circuit and its modifications at computer modeling of high-frequency over-voltages.

  8. An optical fiber Bragg grating and piezoelectric ceramic voltage sensor

    Yang, Qing; He, Yanxiao; Sun, Shangpeng; Luo, Mandan; Han, Rui

    2017-10-01

    Voltage measurement is essential in many fields like power grids, telecommunications, metallurgy, railways, and oil production. A voltage-sensing unit, consisting of fiber Bragg gratings (FBGs) and piezoelectric ceramics, based on which an optical over-voltage sensor was proposed and fabricated in this paper. No demodulation devices like spectrometer or Fabry-Perot filter were needed to gain the voltage signal, and a relatively large sensing frequency range was acquired in this paper; thus, the cost of the sensing system is more acceptable in engineering application. The voltage to be measured was directly applied to the piezoelectric ceramic, and deformation of the ceramics and the grating would be caused because of the inverse piezoelectric effect. With a reference grating, the output light intensity change will be caused by the FBG center wavelength change; thus, the relationship between the applied voltage and the output light intensity was established. Validation of the sensor was accomplished in the frequency range from 50 Hz to 20 kHz and switching impulse waves with a test platform; good linearity of the input-output characteristic was achieved. A temperature validation test was completed, showing that the sensor maintains good temperature stability. Experimental results show that the optical over-voltage sensor can be used for voltage monitoring, and if applied with a voltage divider, the sensor can be used to measure high voltage.

  9. An optical fiber Bragg grating and piezoelectric ceramic voltage sensor.

    Yang, Qing; He, Yanxiao; Sun, Shangpeng; Luo, Mandan; Han, Rui

    2017-10-01

    Voltage measurement is essential in many fields like power grids, telecommunications, metallurgy, railways, and oil production. A voltage-sensing unit, consisting of fiber Bragg gratings (FBGs) and piezoelectric ceramics, based on which an optical over-voltage sensor was proposed and fabricated in this paper. No demodulation devices like spectrometer or Fabry-Perot filter were needed to gain the voltage signal, and a relatively large sensing frequency range was acquired in this paper; thus, the cost of the sensing system is more acceptable in engineering application. The voltage to be measured was directly applied to the piezoelectric ceramic, and deformation of the ceramics and the grating would be caused because of the inverse piezoelectric effect. With a reference grating, the output light intensity change will be caused by the FBG center wavelength change; thus, the relationship between the applied voltage and the output light intensity was established. Validation of the sensor was accomplished in the frequency range from 50 Hz to 20 kHz and switching impulse waves with a test platform; good linearity of the input-output characteristic was achieved. A temperature validation test was completed, showing that the sensor maintains good temperature stability. Experimental results show that the optical over-voltage sensor can be used for voltage monitoring, and if applied with a voltage divider, the sensor can be used to measure high voltage.

  10. Deposition and characterization of zirconium nitride (ZrN) thin films by reactive magnetron sputtering with linear gas ion source and bias voltage

    Kavitha, A.; Kannan, R. [Department of Physics, University College of Engineering, Anna University, Dindugal-624622 (India); Subramanian, N. Sankara [Department of Physics, Thiagarajar College of Engineering, Madurai -625015, Tamilnadu (India); Loganathan, S. [Ion Plating, Titan Industries Ltd., Hosur - 635126, Tamilnadu (India)

    2014-04-24

    Zirconium nitride thin films have been prepared on stainless steel substrate (304L grade) by reactive cylindrical magnetron sputtering method with Gas Ion Source (GIS) and bias voltage using optimized coating parameters. The structure and surface morphologies of the ZrN films were characterized using X-ray diffraction, atomic microscopy and scanning electron microscopy. The adhesion property of ZrN thin film has been increased due to the GIS. The coating exhibits better adhesion strength up to 10 N whereas the ZrN thin film with bias voltage exhibits adhesion up to 500 mN.

  11. Voltage Quench Dynamics of a Kondo System.

    Antipov, Andrey E; Dong, Qiaoyuan; Gull, Emanuel

    2016-01-22

    We examine the dynamics of a correlated quantum dot in the mixed valence regime. We perform numerically exact calculations of the current after a quantum quench from equilibrium by rapidly applying a bias voltage in a wide range of initial temperatures. The current exhibits short equilibration times and saturates upon the decrease of temperature at all times, indicating Kondo behavior both in the transient regime and in the steady state. The time-dependent current saturation temperature connects the equilibrium Kondo temperature to a substantially increased value at voltages outside of the linear response. These signatures are directly observable by experiments in the time domain.

  12. Technological Aspects: High Voltage

    Faircloth, D C

    2013-01-01

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)

  13. Technological Aspects: High Voltage

    Faircloth, D.C.

    2013-12-16

    This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

  14. Energy response of imaging plates to radiation beams from standard beta sources, ortho-voltage and cobalt-60 units and linear accelerators

    Gonzalez, Albin Leonel

    literature for comparison purposes. Finally it is important to mention that the dynamic range of the imaging plates measured in this work is about 10 orders of magnitude (10-7--10 3 Gy) where the response is still linear.

  15. DC power flow control for radial offshore multi-terminal HVDC transmission system by considering steady-state DC voltage operation range

    Irnawan, Roni; Silva, Filipe Miguel Faria da; Bak, Claus Leth

    2017-01-01

    This paper deals with a radial offshore multi-terminal HVDC (MTDC) transmission system which is formed by interconnection several existing offshore wind farm (OWF) HVDC links with a shore-to-shore (StS) HVDC link. A challenge arises when deciding the steady-state DC voltage operating level...

  16. Charge carrier dynamics investigation of CuInS{sub 2} quantum dots films using injected charge extraction by linearly increasing voltage (i-CELIV): the role of ZnS Shell

    Bi, Ke; Sui, Ning; Zhang, Liquan; Wang, Yinghui, E-mail: yinghui-wang@outlook.com; Liu, Qinghui, E-mail: liuqinghui@jlu.edu.cn; Tan, Mingrui [Jilin University, Femtosecond Laser Laboratory, Key Laboratory of Physics and Technology for Advanced Batteries (Ministry of Education), College of Physics (China); Zhou, Qiang [Jilin University, Key Laboratory of Superhard Materials, College of Physics (China); Zhang, Hanzhuang, E-mail: zhanghz@jlu.edu.cn [Jilin University, Femtosecond Laser Laboratory, Key Laboratory of Physics and Technology for Advanced Batteries (Ministry of Education), College of Physics (China)

    2016-12-15

    The role of ZnS shell on the photo-physical properties within CuInS{sub 2}/ZnS quantum dots (QDs) is carefully studied in optoelectronic devices. Linearly increasing voltage technique has been employed to investigate the charge carrier dynamics of both CuInS{sub 2} and CuInS{sub 2}/ZnS QDs films. This study shows that charge carriers follow a similar behavior of monomolecular recombination in this film, with their charge transfer rate correlates to the increase of applied voltage. It turns out that the ZnS shell could affect the carrier diffusion process through depressing the trapping states and would build up a potential barrier.

  17. Voltage linearity modulation and polarity dependent conduction in metal-insulator-metal capacitors with atomic-layer-deposited Al{sub 2}O{sub 3}/ZrO{sub 2}/SiO{sub 2} nano-stacks

    Zhu, Bao; Liu, Wen-Jun; Wei, Lei; Zhang, David Wei; Jiang, Anquan; Ding, Shi-Jin, E-mail: sjding@fudan.edu.cn [State Key Laboratory of ASIC and System, School of Microelectronics, Fudan University, Shanghai 200433 (China)

    2015-07-07

    Excellent voltage linearity of metal-insulator-metal (MIM) capacitors is highly required for next generation radio frequency integration circuits. In this work, employing atomic layer deposition technique, we demonstrated how the voltage linearity of MIM capacitors was modulated by adding different thickness of SiO{sub 2} layer to the nano-stack of Al{sub 2}O{sub 3}/ZrO{sub 2}. It was found that the quadratic voltage coefficient of capacitance (α) can be effectively reduced from 1279 to −75 ppm/V{sup 2} with increasing the thickness of SiO{sub 2} from zero to 4 nm, which is more powerful than increasing the thickness of ZrO{sub 2} in the Al{sub 2}O{sub 3}/ZrO{sub 2} stack. This is attributed to counteraction between the positive α for Al{sub 2}O{sub 3}/ZrO{sub 2} and the negative one for SiO{sub 2} in the MIM capacitors with Al{sub 2}O{sub 3}/ZrO{sub 2}/SiO{sub 2} stacks. Interestingly, voltage-polarity dependent conduction behaviors in the MIM capacitors were observed. For electron bottom-injection, the addition of SiO{sub 2} obviously suppressed the leakage current; however, it abnormally increased the leakage current for electron top-injection. These are ascribed to the co-existence of shallow and deep traps in ZrO{sub 2}, and the former is in favor of the field-assisted tunnelling conduction and the latter contributes to the trap-assisted tunnelling process. The above findings will be beneficial to device design and process optimization for high performance MIM capacitors.

  18. The Design and Characterization of a Prototype Wideband Voltage Sensor Based on a Resistive Divider.

    Garnacho, Fernando; Khamlichi, Abderrahim; Rovira, Jorge

    2017-11-17

    The most important advantage of voltage dividers over traditional voltage transformers is that voltage dividers do not have an iron core with non-linear hysteresis characteristics. The voltage dividers have a linear behavior with respect to over-voltages and a flat frequency response larger frequency range. The weak point of a voltage divider is the influence of external high-voltage (HV) and earth parts in its vicinity. Electrical fields arising from high voltages in neighboring phases and from ground conductors and structures are one of their main sources for systematic measurement errors. This paper describes a shielding voltage divider for a 24 kV medium voltage network insulated in SF6 composed of two resistive-capacitive dividers, one integrated within the other, achieving a flat frequency response up to 10 kHz for ratio error and up to 5 kHz for phase displacement error. The metal shielding improves its immunity against electric and magnetic fields. The characterization performed on the built-in voltage sensor shows an accuracy class of 0.2 for a frequency range from 20 Hz to 5 kHz and a class of 0.5 for 1 Hz up to 20 Hz. A low temperature effect is also achieved for operation conditions of MV power grids.

  19. Linear interpolation method in ensemble Kohn-Sham and range-separated density-functional approximations for excited states

    Senjean, Bruno; Knecht, Stefan; Jensen, Hans Jørgen Aa

    2015-01-01

    Gross-Oliveira-Kohn density-functional theory (GOK-DFT) for ensembles is, in principle, very attractive but has been hard to use in practice. A practical model based on GOK-DFT for the calculation of electronic excitation energies is discussed. The model relies on two modifications of GOK-DFT: use...... promising results have been obtained for both single (including charge transfer) and double excitations with spin-independent short-range local and semilocal functionals. Even at the Kohn-Sham ensemble DFT level, which is recovered when the range-separation parameter is set to 0, LIM performs better than...

  20. Molecular magnetism of a linear Fe(III)-Mn(II)-Fe(III) complex. Influence of long-range exchange interaction

    Lengen, M.; Chaudhuri, P.

    1994-01-01

    The magnetic properties of [L-Fe(III)-dmg 3 Mn(II)-Fe(III)-L] (ClO 4 ) 2 have been characterized by magnetic susceptibility, EPR, and Moessbauer studies. L represents 1,4,7-trimethyl-,1,4,7-triazacyclononane and dmg represents dimethylglyoxime. X-ray diffraction measurements yield that the arrangement of the three metal centers is strictly linear with atomic distances d Fe-Mn 0.35 nm and d Fe-Fe = 0.7 nm. Magnetic susceptibility measurements (3-295 K) were analyzed in the framework of the spin-Hamiltonian formalism considering Heisenberg exchange and Zeeman interaction: H = J Fe-Mn (S Fe1 + S Fe2 )S Mn + J Fe-Fe S Fe1 S Fe2 + gμ B S total B. The spins S Fe1 = S Fe2 = S Mn = 5/2 of the complex are antiferromagnetically coupled, yielding a total spin of S total = 5/2 with exchange coupling constants F Fe-Mn = 13.4 cm -1 and J Fe-Fe = 4.5 cm -1 . Magnetically split Moessbauer spectra were recorded at 1.5 K under various applied fields (20 mT, 170 mT, 4 T). The spin-Hamiltonian analysis of these spectra yields isotropic magnetic hyperfine coupling with A total /(g N μ N ) = -18.5 T. The corresponding local component A Fe is related to A total via spin-projection: A total = (6/7)A Fe . The resulting A Fe /(g N μ N ) -21.6 T is in agreement with standard values of ferric high-spin complexes. Spin-Hamiltonian parameters as obtained from Moessbauer studies and exchange coupling constants as derived from susceptibility measurements are corroborated by temperature-dependent EPR studies. (orig.)

  1. Some remarks on the time of flight and range of a projectile in a linear resisting medium

    S. M. Stewart

    2011-01-01

    Full Text Available In view of the recent work by Karkantzakos [Journal of Engineering Science and Technology Review 2 (2009 76–81], anumber of remarks highlighting the connection between the Lambert W function and the time of flight and range of a projectilemoving in a resisting medium where the retarding force acting on the projectile is proportional to its velocity are made.In particular, we show how each of these quantities can be expressed in closed form in terms of the Lambert W function andindicate how the analysis of the motion becomes greatly simplified by its introduction.

  2. Voltage Dependence of Supercapacitor Capacitance

    Szewczyk Arkadiusz

    2016-09-01

    Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

  3. Multibloc system electronic equipment: D.C. linear - logarithmic amplifier and periodmeter and wide range (pulses, fluctuations and direct current) measuring set

    Guerre, J.; Plaige, Y.; Vaux, C.

    1974-01-01

    The requirements which have led to the design of a specific equipment for reactor neutron control (Multibloc system) are briefly recalled. It is shown how, for reasons of saving the cost of installation, the development tended towards a multifunction performance from signals delivered by one detector. Two major achievments in accordance with the above trend are described: the D.C. linear - logarithmic amplifier and periodmeter, and the wide dynamics range measuring set [fr

  4. Creep-fatigue life prediction for different heats of Type 304 stainless steel by linear-damage rule, strain-range partitioning method, and damage-rate approach

    Maiya, P.S.

    1978-07-01

    The creep-fatigue life results for five different heats of Type 304 stainless steel at 593 0 C (1100 0 F), generated under push-pull conditions in the axial strain-control mode, are presented. The life predictions for the various heats based on the linear-damage rule, strain-range partitioning method, and damage-rate approach are discussed. The appropriate material properties required for computation of fatigue life are also included

  5. A Wide Linearity Range Method for the Determination of Lenalidomide in Plasma by High-Performance Liquid Chromatography: Application to Pharmacokinetic Studies.

    Guglieri-López, Beatriz; Pérez-Pitarch, Alejandro; Martinez-Gómez, Maria Amparo; Porta-Oltra, Begoña; Climente-Martí, Mónica; Merino-Sanjuán, Matilde

    2016-12-01

    A wide linearity range analytical method for the determination of lenalidomide in patients with multiple myeloma for pharmacokinetic studies is required. Plasma samples were ultrasonicated for protein precipitation. A solid-phase extraction was performed. The eluted samples were evaporated to dryness under vacuum, and the solid obtained was diluted and injected into the high-performance liquid chromatography (HPLC) system. Separation of lenalidomide was performed on an Xterra RP C18 (250 mm length × 4.6 mm i.d., 5 µm) using a mobile phase consisting of phosphate buffer/acetonitrile (85:15, v/v, pH 3.2) at a flow rate of 0.5 mL · min -1 The samples were monitored at a wavelength of 311 nm. A linear relationship with good correlation coefficient (r = 0.997, n = 9) was found between the peak area and lenalidomide concentrations in the range of 100 to 950 ng · mL -1 The limits of detection and quantitation were 28 and 100 ng · mL -1 , respectively. The intra- and interassay precisions were satisfactory, and the accuracy of the method was proved. In conclusion, the proposed method is suitable for the accurate quantification of lenalidomide in human plasma with a wide linear range, from 100 to 950 ng · mL -1 This is a valuable method for pharmacokinetic studies of lenalidomide in human subjects. © 2016 Society for Laboratory Automation and Screening.

  6. A high-efficiency low-voltage class-E PA for IoT applications in sub-1 GHz frequency range

    Zhou, Chenyi; Lu, Zhenghao; Gu, Jiangmin; Yu, Xiaopeng

    2017-10-01

    We present and propose a complete and iterative integrated-circuit and electro-magnetic (EM) co-design methodology and procedure for a low-voltage sub-1 GHz class-E PA. The presented class-E PA consists of the on-chip power transistor, the on-chip gate driving circuits, the off-chip tunable LC load network and the off-chip LC ladder low pass filter. The design methodology includes an explicit design equation based circuit components values' analysis and numerical derivation, output power targeted transistor size and low pass filter design, and power efficiency oriented design optimization. The proposed design procedure includes the power efficiency oriented LC network tuning, the detailed circuit/EM co-simulation plan on integrated circuit level, package level and PCB level to ensure an accurate simulation to measurement match and first pass design success. The proposed PA is targeted to achieve more than 15 dBm output power delivery and 40% power efficiency at 433 MHz frequency band with 1.5 V low voltage supply. The LC load network is designed to be off-chip for the purpose of easy tuning and optimization. The same circuit can be extended to all sub-1 GHz applications with the same tuning and optimization on the load network at different frequencies. The amplifier is implemented in 0.13 μm CMOS technology with a core area occupation of 400 μm by 300 μm. Measurement results showed that it provided power delivery of 16.42 dBm at antenna with efficiency of 40.6%. A harmonics suppression of 44 dBc is achieved, making it suitable for massive deployment of IoT devices. Project supported by the National Natural Science Foundation of China (No. 61574125) and the Industry Innovation Project of Suzhou City of China (No. SYG201641).

  7. Study of deuteron photodisintegration with linearly polarized photons over the energy range E/sub el/ = 0. 4 to 0. 8 GeV

    Agababyan, K.S.; Adamyan, F.V.; Akopyan, G.G.; Vartapetyan, G.A.; Galumyan, P.I.; Grabskii, V.O.; Karapetyan, V.V.; Karapetyan, G.V.; Kordonskii, M.S.

    1985-06-01

    We describe the experimental methods and the results of measurements of the asymmetry of the cross section of the eld pn reaction induced by linearly polarized photons over the energy range E/sub el/ = 0.4 to 0.8 GeV and proton angles in the c.m. system theta* = 45 to 95. Experiments were conducted on a two-arm spectrometer installation. The results obtained do not agree either with calculations within the framework of phenomenological models, or with predictions of a partial-wave analysis that includes the contribution of dibaryon resonances.

  8. Aplicación de modelos de regresión lineal para determinar las armónicas de tensión y corriente; Application of linear regression models to determine the current and voltage harmonics

    Juan Miguel Astorga Gómez

    2015-04-01

    Full Text Available En este artículo se evalúan las armónicas individuales de tensión como función de las armónicas individuales de corriente usando los análisis estadísticos de regresión lineal simple, regresión polinomial y regresión lineal múltiple. Para la selección del modelo, se usan el coeficiente de determinación R2 y el criterio de información de Akaike (AIC. Se utiliza como caso de estudio un sistema eléctrico de un proceso minero ubicado en la región de Atacama Copiapó Chile,  que ocupa la técnica de electro obtención de cobre como parte principal de su proceso productivo. Se muestran y comparan los resultados para los distintos modelos estadísticos y se discute la información de éstos para el estudio de calidad de energía. Finalmente, usando el modelo que mejor se ajusta a las mediciones de armónicas de tensión y corriente, se muestran algunas predicciones para la componente armónica dominante de tensión. This paper assesses the individual voltage harmonics as a function of the individual current harmonics using the statistical analyses of simple linear regression, polynomial regression and multiple linear regression. For model choice, the coefficient of determination R2 and Akaike information criterion (AIC are used. A mining process electrical system located in the Atacama Copiapó Chile, is used as a case study. This uses the technique copper electrowining as the main part of its production process.  The results for different statistical models are shown and their information discussed for the power quality study. Finally, using the model that better fits to the measurements of voltage and current harmonics, some predictions for the dominant voltage harmonic are shown.

  9. Pulse-voltage fast generator

    Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.

    1988-01-01

    The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns

  10. Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing

    Patel, N.; Branch, D. W.; Schamiloglu, E.; Cular, S.

    2015-08-01

    A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO3) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz-100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10-273 ps for DC voltages and 189-813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250-2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115-1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.

  11. Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing

    Patel, N.; Branch, D. W.; Cular, S.; Schamiloglu, E.

    2015-01-01

    A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO 3 ) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz–100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10–273 ps for DC voltages and 189–813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250–2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115–1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment

  12. Current-voltage characteristics of C70 solid near Meyer-Neldel temperature

    Onishi, Koichi; Sezaimaru, Kouki; Nakashima, Fumihiro; Sun, Yong; Kirimoto, Kenta; Sakaino, Masamichi; Kanemitsu, Shigeru

    2017-06-01

    The current-voltage characteristics of the C70 solid with hexagonal closed-packed structures were measured in the temperature range of 250-450 K. The current-voltage characteristics can be described as a temporary expedient by a cubic polynomial of the voltage, i = a v 3 + b v 2 + c v + d . Moreover, the Meyer-Neldel temperature of the C70 solid was confirmed to be 310 K, at which a linear relationship between the current and voltage was observed. Also, at temperatures below the Meyer-Neldel temperature, the current increases with increasing voltage. On the other hand, at temperatures above the Meyer-Neldel temperature a negative differential conductivity effect was observed at high voltage side. The negative differential conductivity was related to the electric field and temperature effects on the mobility of charge carrier, which involve two variations in the carrier concentration and the activation energy for carrier hopping transport.

  13. Lung tumors and radon inhalation in over 2000 rats: Approximate linearity across a wide range of doses and potentiation by tobacco smoke

    Gray, R.G.; Lafuma, J.; Parish, S.E.; Peto, R.; CEA Centre d'Etudes Nucleaires de Fontenay-aux-Roses

    1986-01-01

    More than 2000 rats were exposed to cumulative doses of up to 28,000 WLMs of radon gas. More than 300 pulmonary tumors were induced by this exposure, most being nonfatal lesions detected only at autopsy of animals that had died of unrelated causes. Above 6000 WLMs rats suffered increasingly from life shortening due to radiation-induced nonneoplastic causes and so had less time in which to develop tumors. When adjusted for these competing causes of death, the hazard function for the excess risk of developing pulmonary tumors was approximately linearly related to dose throughout the range of doses studied. This suggests that some previously reported high-dose ''reductions'' in radiogenic tumor-induction rates may chiefly have involved the killing of rats rather than the killing of precursor cells. Rats exposed to radon and then to six months of inhalation of tobacco smoke had a four times greater age-specific prevalence of pulmonary tumors than rats exposed to an identical radon dose either alone or preceded by tobacco smoke inhalation. This suggests that tobacco smoke may accelerate the carcinogenic process by acting as a promoter of radiation-induced somatic damage. These data suggest that, for assessing human risk from exposure to radon, the linear model should be assumed, but that the WLM is not on its own an adequate index of carcinogenic insult. 7 refs., 2 figs., 4 tabs

  14. Rational design of binder-free noble metal/metal oxide arrays with nanocauliflower structure for wide linear range nonenzymatic glucose detection

    Li, Zhenzhen

    2015-06-12

    One-dimensional nanocomposites of metal-oxide and noble metal were expected to present superior performance for nonenzymatic glucose detection due to its good conductivity and high catalytic activity inherited from noble metal and metal oxide respectively. As a proof of concept, we synthesized gold and copper oxide (Au/CuO) composite with unique one-dimensional nanocauliflowers structure. Due to the nature of the synthesis method, no any foreign binder was needed in keeping either Au or CuO in place. To the best of our knowledge, this is the first attempt in combining metal oxide and noble metal in a binder-free style for fabricating nonenzymatic glucose sensor. The Au/CuO nanocauliflowers with large electrochemical active surface and high electrolyte contact area would promise a wide linear range and high sensitive detection of glucose with good stability and reproducibility due to its good electrical conductivity of Au and high electrocatalytic activity of CuO.

  15. X-ray diffraction measurement of the linear thermal expansion coefficients of WCoB in the range 300 to 973 K

    Petrov, K.; Will, G.

    1981-01-01

    High-temperature treatment of tungsten carbide-cobalt hard alloys in TiB 2 media leads to the formation of a surface diffusion coating which contains orthorhombic WCoB. The function of this compound in enhancing wear resistance of cutting tools, is discussed. The thermal expansion of WCoB is of primary interest, since the wear resistance of the coating reflects the degree of matching of the thermal expansion coefficients of the different phases. Preparation of the samples is described and experimental details of the X-ray diffraction measurements are given. The temperature dependence of the lattice parameters for the range 300 to 973 K, and the corresponding linear thermal expansion coefficients along the three principal crystallographic directions, are given. The results are discussed in terms of the bonding features of the solid. (U.K.)

  16. The Cu-MOF-199/single-walled carbon nanotubes modified electrode for simultaneous determination of hydroquinone and catechol with extended linear ranges and lower detection limits

    Zhou, Jian; Li, Xi; Yang, Linlin; Yan, Songlin; Wang, Mengmeng; Cheng, Dan; Chen, Qi; Dong, Yulin; Liu, Peng; Cai, Weiquan; Zhang, Chaocan

    2015-01-01

    A novel electrochemical sensor based on Cu-MOF-199 [Cu-MOF-199 = Cu 3 (BTC) 2 (BTC = 1,3,5-benzenetricarboxylicacid)] and SWCNTs (single-walled carbon nanotubes) was fabricated for the simultaneous determination of hydroquinone (HQ) and catechol (CT). The modification procedure was carried out through casting SWCNTs on the bare glassy carbon electrode (GCE) and followed by the electrodeposition of Cu-MOF-199 on the SWCNTs modified electrode. Cyclic voltammetry (CV), electrochemical impedance spectroscopy (EIS) and scanning electron microscopy (SEM) were performed to characterize the electrochemical performance and surface characteristics of the as-prepared sensor. The composite electrode exhibited an excellent electrocatalytic activity with increased electrochemical signals towards the oxidation of HQ and CT, owing to the synergistic effect of SWCNTs and Cu-MOF-199. Under the optimized condition, the linear response range were from 0.1 to 1453 μmol L −1 (R HQ  = 0.9999) for HQ and 0.1–1150 μmol L −1 (R CT  = 0.9990) for CT. The detection limits for HQ and CT were as low as 0.08 and 0.1 μmol L −1 , respectively. Moreover, the modified electrode presented the good reproducibility and the excellent anti-interference performance. The analytical performance of the developed sensor for the simultaneous detection of HQ and CT had been evaluated in practical samples with satisfying results. - Highlights: • Cu-MOF-199/SWCNTs/GCE was facilely fabricated by the electrodeposition on SWCNTs/GCE. • An electrochemical sensor for detecting HQ and CT was constructed based on this modified electrode. • The proposed electrochemical sensor showed an extended linear range and lower detection limits. • The proposed electrochemical sensor had an excellent stability and reproducibility.

  17. Artificial intelligence techniques for voltage control

    Ekwue, A.; Cheng, D.T.Y.; Macqueen, J.F.

    1997-12-31

    In electric power systems, the advantages of reactive power dispatching or optimisation include improved utilisation of reactive power sources and hence reduction in reactive power flows and real losses of the system; unloading of the system and equipment as a result of reactive flow reduction; the power factors of generation are improved and system security is enhanced; reduced voltage gradients and somewhat higher voltages which result across the system from improved operation; deferred capital investment is new reactive power sources as a result of improved utilisation of existing equipment; and for the National Grid Company plc (NGC), the main advantage is reduced out-of-merit operation. The problem of reactive power control has been studied and widely reported in the literature. Non-linear programming methods as well as linear programming techniques for constraint dispatch have been described. Static optimisation of reactive power sources by the use of sensitivity analysis was described by Kishore and Hill. Long range optimum var planning has been considered and the optimum amount and location of network reactive compensation so as to maintain the system voltage within the desired limits, while operating under normal and various insecurity states, have also been studied using several methods. The objective of this chapter is therefore to review conventional methods as well as AI techniques for reactive power control. (Author)

  18. Pixel multiplexing technique for real-time three-dimensional-imaging laser detection and ranging system using four linear-mode avalanche photodiodes

    Xu, Fan; Wang, Yuanqing, E-mail: yqwang@nju.edu.cn; Li, Fenfang [School of Electronic Science and Engineering, Nanjing University, Nanjing 210046 (China)

    2016-03-15

    The avalanche-photodiode-array (APD-array) laser detection and ranging (LADAR) system has been continually developed owing to its superiority of nonscanning, large field of view, high sensitivity, and high precision. However, how to achieve higher-efficient detection and better integration of the LADAR system for real-time three-dimensional (3D) imaging continues to be a problem. In this study, a novel LADAR system using four linear mode APDs (LmAPDs) is developed for high-efficient detection by adopting a modulation and multiplexing technique. Furthermore, an automatic control system for the array LADAR system is proposed and designed by applying the virtual instrumentation technique. The control system aims to achieve four functions: synchronization of laser emission and rotating platform, multi-channel synchronous data acquisition, real-time Ethernet upper monitoring, and real-time signal processing and 3D visualization. The structure and principle of the complete system are described in the paper. The experimental results demonstrate that the LADAR system is capable of achieving real-time 3D imaging on an omnidirectional rotating platform under the control of the virtual instrumentation system. The automatic imaging LADAR system utilized only 4 LmAPDs to achieve 256-pixel-per-frame detection with by employing 64-bit demodulator. Moreover, the lateral resolution is ∼15 cm and range accuracy is ∼4 cm root-mean-square error at a distance of ∼40 m.

  19. Preliminary Modeling of Permanent Magnet Probe Flowmeter for Voltage Signal Estimation

    Jeong, Uiju; Kim, Sung Joong [Hanyang Univ., Seoul (Korea, Republic of); Jeong, Ji Young; Kim, Tae Joon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

    2013-10-15

    An experimental study on performance analysis of the flowmeter has been performed. The study shows that sodium flow rate is linearly proportional to the induced voltage signal from the flowmeter under the turbulent flow condition. The experimental results support its availability in the PDRC system. But, the flowmeter should be able to measure sodium flow at low Reynolds number as well. That is because the PDRC system uses sodium natural convection for its operation. Thus, calibration of the flowmeter should be done at very low sodium flow rates. However, Von Weissenfluh et al. showed that the relationship between flow rate and measured voltage signal from the flowmeter may become non-linear at very low flow rates. The nonlinearity restricts the utilization of level sensor which provide reference flow rate in the calibration experiment. The primary objective of this study is to predict the sodium flow rate range where the induced voltage signals are linearly proportional to flow rates by estimating the induced voltage signals against sodium flow rates for a wide range of flows numerically. A commercial code FLUENT is adopted for the analysis of flow field. And MAXWELL which is an electromagnetic analysis software using a finite volume method has been used to analyze the magnetic field generated by permanent magnet of the flowmeter. The induced voltage signals have been estimated by coupling the sodium flow field and the magnetic field using FLUENT MHD module. It is expected that the PMPF voltage signals are linearly proportional to flow rates range of 0.0059 to 1.96 lps. This suggests that simple calibration technique using the linearity between flow rate and the voltage signal can be adopted in calibration of the PMPF.

  20. Universal Voltage Conveyor and Current Conveyor in Fast Full-Wave Rectifier

    Josef Burian

    2012-12-01

    Full Text Available This paper deals about the design of a fast voltage-mode full-wave rectifier, where universal voltage conveyor and second-generation current conveyor are used as active elements. Thanks to the active elements, the input and output impedance of the non-linear circuit is infinitely high respectively zero in theory. For the rectification only two diodes and three resistors are required as passive elements. The performance of the circuit is shown on experimental measurement results showing the dynamic range, time response, frequency dependent DC transient value and RMS error for different values of input voltage amplitudes.

  1. Insulation Resistance and Leakage Currents in Low-Voltage Ceramic Capacitors with Cracks

    Teverovsky, Alexander A.

    2016-01-01

    Measurement of insulation resistance (IR) in multilayer ceramic capacitors (MLCCs) is considered a screening technique that ensures the dielectric is defect-free. This work analyzes the effectiveness of this technique for revealing cracks in ceramic capacitors. It is shown that absorption currents prevail over the intrinsic leakage currents during standard IR measurements at room temperature. Absorption currents, and consequently IR, have a weak temperature dependence, increase linearly with voltage (before saturation), and are not sensitive to the presence of mechanical defects. In contrary, intrinsic leakage currents increase super-linearly with voltage and exponentially with temperature (activation energy is in the range from 0.6 eV to 1.1 eV). Leakage currents associated with the presence of cracks have a weaker dependence on temperature and voltage compared to the intrinsic leakage currents. For this reason, intrinsic leakage currents prevail at high temperatures and voltages, thus masking the presence of defects.

  2. Manipulating the voltage dependence of tunneling spin torques

    Manchon, Aurelien

    2012-01-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

  3. Voltage-Controlled Floating Resistor Using DDCC

    M. Kumngern

    2011-04-01

    Full Text Available This paper presents a new simple configuration to realize the voltage-controlled floating resistor, which is suitable for integrated circuit implementation. The proposed resistor is composed of three main components: MOS transistor operating in the non-saturation region, DDCC, and MOS voltage divider. The MOS transistor operating in the non-saturation region is used to configure a floating linear resistor. The DDCC and the MOS transistor voltage divider are used for canceling the nonlinear component term of MOS transistor in the non-saturation region to obtain a linear current/voltage relationship. The DDCC is employed to provide a simple summer of the circuit. This circuit offers an ease for realizing the voltage divider circuit and the temperature effect that includes in term of threshold voltage can be compensated. The proposed configuration employs only 16 MOS transistors. The performances of the proposed circuit are simulated with PSPICE to confirm the presented theory.

  4. Mixed Linear/Square-Root Encoded Single Slope Ramp Provides a Fast, Low Noise Analog to Digital Converter with Very High Linearity for Focal Plane Arrays

    Wrigley, Christopher James (Inventor); Hancock, Bruce R. (Inventor); Newton, Kenneth W. (Inventor); Cunningham, Thomas J. (Inventor)

    2014-01-01

    An analog-to-digital converter (ADC) converts pixel voltages from a CMOS image into a digital output. A voltage ramp generator generates a voltage ramp that has a linear first portion and a non-linear second portion. A digital output generator generates a digital output based on the voltage ramp, the pixel voltages, and comparator output from an array of comparators that compare the voltage ramp to the pixel voltages. A return lookup table linearizes the digital output values.

  5. Characterization of a low-voltage electron beam

    Berejka, A.J.

    2004-01-01

    Growing interests in low-voltage electron beam (EB) processing in areas that may require regulatory compliance, such as the curing of inks and coatings for food packaging materials and in the surface disinfection of medicinal and food containers, lead to the characterization of a low-voltage EB by two methods: a widely used thin radiochromic film and a film strip made on a continuous basis with an alanine coating. Using a laboratory unit, beam currents and voltages were varied and then optical density and alanine/matrix ratios were, respectively, determined. No inferences as to 'dose' were made. The radiochromic film was found to be insensitive to slight changes at low beam currents and to show considerable divergence and a broadening in response as current was increased across a meaningful range at the three applied beam voltages of 80, 100 and 120 kV. The electron paramagnetic resonance (EPR) increase in response of the alanine coated film taken as a ratio to an internal reference material within the test instrument itself was shown to have a linear response with respect to beam current and no divergence as current increased. The use of an alanine coating of thickness greater than that of the extrapolated range of the electron penetration offers a method for the characterization of the output of such very low-voltage beams

  6. Modelling of plasma-antenna coupling and non-linear radio frequency wave-plasma-wall interactions in the magnetized plasma device under ion cyclotron range of frequencies

    Lu, LingFeng

    2016-01-01

    Ion Cyclotron Resonant Heating (ICRH) by waves in 30-80 MHz range is currently used in magnetic fusion plasmas. Excited by phased arrays of current straps at the plasma periphery, these waves exist under two polarizations. The Fast Wave tunnels through the tenuous plasma edge and propagates to its center where it is absorbed. The parasitically emitted Slow Wave only exists close to the launchers. How much power can be coupled to the center with 1 A current on the straps? How do the emitted radiofrequency (RF) near and far fields interact parasitically with the edge plasma via RF sheath rectification at plasma-wall interfaces? To address these two issues simultaneously, in realistic geometry over the size of ICRH antennas, this thesis upgraded and tested the Self-consistent Sheaths and Waves for ICH (SSWICH) code. SSWICH couples self-consistently RF wave propagation and Direct Current (DC) plasma biasing via non-linear RF and DC sheath boundary conditions (SBCs) at plasma/wall interfaces. Its upgrade is full wave and was implemented in two dimensions (toroidal/radial). New SBCs coupling the two polarizations were derived and implemented along shaped walls tilted with respect to the confinement magnetic field. Using this new tool in the absence of SBCs, we studied the impact of a density decaying continuously inside the antenna box and across the Lower Hybrid (LH) resonance. Up to the memory limits of our workstation, the RF fields below the LH resonance changed with the grid size. However the coupled power spectrum hardly evolved and was only weakly affected by the density inside the box. In presence of SBCs, SSWICH-FW simulations have identified the role of the fast wave on RF sheath excitation and reproduced some key experimental observations. SSWICH-FW was finally adapted to conduct the first electromagnetic and RF-sheath 2D simulations of the cylindrical magnetized plasma device ALINE. (author) [fr

  7. Distributed Monitoring of Voltage Collapse Sensitivity Indices

    Simpson-Porco, John W.; Bullo, Francesco

    2016-01-01

    The assessment of voltage stability margins is a promising direction for wide-area monitoring systems. Accurate monitoring architectures for long-term voltage instability are typically centralized and lack scalability, while completely decentralized approaches relying on local measurements tend towards inaccuracy. Here we present distributed linear algorithms for the online computation of voltage collapse sensitivity indices. The computations are collectively performed by processors embedded ...

  8. An efficient high-voltage power supply for a photomultiplier tube

    Ainutdinov, VM; Vonsovskii, NN; Kompaniets, KG; Kozyr, AI; Mikhailov, YV

    2003-01-01

    An adjustable power supply for a photomultiplier tube operating in the pulsed spectrometric mode with a wide range of linearity is described. The power consumed by the source is 50 mW. The output voltage is varied from 800 to 2000 V. The maximum ripple amplitude is 2.5 mV.

  9. Voltage regulating circuit

    2005-01-01

    A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional

  10. Electrochemical Characteristics and Li+ Ion Intercalation Kinetics of Dual-phase Li4Ti5O12/Li2TiO3 Composite in Voltage Range of 0−3 V

    Bhatti, Humaira S

    2016-04-20

    Li4Ti5O12, Li2TiO3 and dual-phase Li4Ti5O12/Li2TiO3 composite were prepared by sol-gel method with average particle size of 1 µm, 0.3 µm and 0.4 µm, respectively. Though Li2TiO3 is electrochemically inactive, the rate capability of Li4Ti5O12/Li2TiO3 is comparable to Li4Ti5O12 at different current rates. Li4Ti5O12/Li2TiO3 also shows good rate performance of 90 mA h g-1 at high rate of 10 C in voltage range of 1−3 V, attributable to increased interfaces in the composite. While Li4Ti5O12 delivers capacity retention of 88.6 % at 0.2 C over 50 cycles, Li4Ti5O12/Li2TiO3 exhibits no capacity fading at 0.2 C (40 cycles) and capacity retention of 98.45 % at 0.5 C (50 cycles). This highly stable cycling performance is attributed to the contribution of Li2TiO3 in preventing undesirable reaction of Li4Ti5O12 with the electrolyte during cycling. CV curves of Li4Ti5O12/Li2TiO3 in 0−3 V range exhibit two anodic peaks at 1.51 V and 0.7−0.0 V, indicating two modes of lithium intercalation into the lattice sites of active material. Owing to enhanced intercalation/de-intercalation kinetics in 0−3 V, composite electrode delivers superior rate performance of 203 mAh/g at 2.85 C and 140 mAh/g at 5.7 C with good reversible capacity retention over 100 cycles.

  11. Electrochemical Characteristics and Li+ Ion Intercalation Kinetics of Dual-phase Li4Ti5O12/Li2TiO3 Composite in Voltage Range of 0−3 V

    Bhatti, Humaira S; Anjum, Dalaver H.; Ullah, Shafiq; Ahmed, Bilal; Habib, Amir; Karim, Altaf; Hasanain, Syed Khurshid

    2016-01-01

    Li4Ti5O12, Li2TiO3 and dual-phase Li4Ti5O12/Li2TiO3 composite were prepared by sol-gel method with average particle size of 1 µm, 0.3 µm and 0.4 µm, respectively. Though Li2TiO3 is electrochemically inactive, the rate capability of Li4Ti5O12/Li2TiO3 is comparable to Li4Ti5O12 at different current rates. Li4Ti5O12/Li2TiO3 also shows good rate performance of 90 mA h g-1 at high rate of 10 C in voltage range of 1−3 V, attributable to increased interfaces in the composite. While Li4Ti5O12 delivers capacity retention of 88.6 % at 0.2 C over 50 cycles, Li4Ti5O12/Li2TiO3 exhibits no capacity fading at 0.2 C (40 cycles) and capacity retention of 98.45 % at 0.5 C (50 cycles). This highly stable cycling performance is attributed to the contribution of Li2TiO3 in preventing undesirable reaction of Li4Ti5O12 with the electrolyte during cycling. CV curves of Li4Ti5O12/Li2TiO3 in 0−3 V range exhibit two anodic peaks at 1.51 V and 0.7−0.0 V, indicating two modes of lithium intercalation into the lattice sites of active material. Owing to enhanced intercalation/de-intercalation kinetics in 0−3 V, composite electrode delivers superior rate performance of 203 mAh/g at 2.85 C and 140 mAh/g at 5.7 C with good reversible capacity retention over 100 cycles.

  12. A Monolithic CMOS Magnetic Hall Sensor with High Sensitivity and Linearity Characteristics.

    Huang, Haiyun; Wang, Dejun; Xu, Yue

    2015-10-27

    This paper presents a fully integrated linear Hall sensor by means of 0.8 μm high voltage complementary metal-oxide semiconductor (CMOS) technology. This monolithic Hall sensor chip features a highly sensitive horizontal switched Hall plate and an efficient signal conditioner using dynamic offset cancellation technique. An improved cross-like Hall plate achieves high magnetic sensitivity and low offset. A new spinning current modulator stabilizes the quiescent output voltage and improves the reliability of the signal conditioner. The tested results show that at the 5 V supply voltage, the maximum Hall output voltage of the monolithic Hall sensor microsystem, is up to ±2.1 V and the linearity of Hall output voltage is higher than 99% in the magnetic flux density range from ±5 mT to ±175 mT. The output equivalent residual offset is 0.48 mT and the static power consumption is 20 mW.

  13. Linear and mass attenuation coefficient for CdTe compound of X-rays from 10 to 100 keV energy range in different phases

    Saim, A., E-mail: saim1989asma@gmail.com; Tebboune, A.; Berkok, H.; Belameiri, N.; Belbachir, A.H.

    2014-07-25

    The Full Potential Linear Muffin Tin Orbitals method within the density functional theory has been utilized to calculate structural and electronic properties of the CdTe compound. We have checked that the CdTe has two phase-transitions from zinc-blend to cinnabar and from cinnabar to rocksalt. We have found that the rigidity, the energy and the nature of the gap change according to the phase change, so we can predict that a CdTe detector may have different behaviors in different phase conditions. In order to investigate this behavior change, the linear and the mass attenuation coefficients of X-ray in rocksalt, zinc-blend and cinnabar structures are calculated from 10 keV to100 keV, using the XCOM data. We have found that when CdTe undergoes a phase transition from zinc-blend to cinnabar, its linear attenuation coefficient decreases down to a value of about 100 times smaller than its initial one, and when it undergoes a transition from cinnabar to rocksalt it increases up to a value about 90 times larger than its initial one.

  14. Power conditioning using dynamic voltage restorers under different voltage sag types.

    Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

    2016-01-01

    Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

  15. SYNTHESIS OF VOLTAGES OF UNIFORM PWM IN TIME REGULATION

    A. G. Stryzhniou

    2014-01-01

    Full Text Available The article describes a process of synthesis and qualitative assessment of the harmonic composition of voltages of multiple and single PWM pulses in time regulation, being, along with amplitude, frequency and phase method, one of control methods of an asynchronous motor. The main point of time regulation is that a pause after any two single PWM pulses with different polarity or after any two groups of multiple PWM pulses with different polarity changes during a process of regulation. Feature of time regulation is that a motor has fast response in the range of small-signal of control and good linearity of speed-torque characteristics in the whole control range. Analytical expressions of parameters of PWM pulses ai and ti are obtained which allow to simplify considerably a process of formation and implementation of time regulation using tabular or indexed-tabular methods. These expressions allow not only to define voltage amplitude of  harmonic but also to perform qualitative assessment of harmonic composition of output voltages at time regulation. It is specified that harmonic frequencies wi = w0/q change in inverse proportion to magnitude of parameter q during a process of regulation and there is a replacement of a fundamental frequency by frequencies of higher harmonics.The offered approach allows to synthesize voltage of uniform single and multiple PWM pulses and to perform their comparative and qualitative analysis and the obtained expressions can be used at modeling of AC motor work. Voltage of multiple PWM pulses which is formed using stepped reference voltage with even quantity of steps in a half period and a pause on a zero level has the best parameters by criterion of a minimum of harmonic components and a maximum of a factor of anharmonicity Kнс at time regulation.

  16. The effect of external visible light on the breakdown voltage of a long discharge tube

    Shishpanov, A. I.; Ionikh, Yu. Z.; Meshchanov, A. V.

    2016-06-01

    The breakdown characteristics of a discharge tube with a configuration typical of gas-discharge light sources and electric-discharge lasers (a so-called "long discharge tube") filled with argon or helium at a pressure of 1 Torr have been investigated. A breakdown has been implemented using positive and negative voltage pulses with a linear leading edge having a slope dU/ dt ~ 10-107 V/s. Visible light from an external source (halogen incandescent lamp) is found to affect the breakdown characteristics. The dependences of the dynamic breakdown voltage of the tube on dU/ dt and on the incident light intensity are measured. The breakdown voltage is found to decrease under irradiation of the high-voltage anode of the tube in a wide range of dU/ dt. A dependence of the effect magnitude on the light intensity and spectrum is obtained. Possible physical mechanisms of this phenomenon are discussed.

  17. Study on the construction and its operating characteristics of Marx high voltage pulse generator

    Chung, W.K.; Yook, C.C.

    1984-01-01

    This study is to investigate the operating characteristics of a Marx high voltage pulse generator, which is designed and fabricated for the purpose of constructing a linear theta-pinch plasma generating facility. The Marx generator consists of a 2 kJ capacitor bank of maximum output voltage of 200kV, a set of main spark switch, a triggring system, and high voltage charging power supply. The experimental results show that the operating characteristics of the generator can be controlled through varying nitrogen pressure as a filling gas. The output pulse of the generator is achieved close to the estimated voltage with the rise time of 3*m seconds. The stability of the generator is also very satisfactory within operating range of main spark switch. (Author)

  18. Coherent Voltage Oscillations in Superconducting Polycrystalline Y1Ba2Cu3O7-x

    Altinkok, A; Yetis, H; Olutas, M; Kilic, K; Kilic, A; Cetin, O

    2006-01-01

    We have investigated the voltage response of superconducting polycrystalline bulk Y 1 Ba 2 Cu 3 O 7-x (YBCO) material to a bidirectional square wave current with long periods and dc current by means of the evolution of the voltage-time (V-t) curves near the critical temperature. In a well-defined range of amplitudes and periods of driving current, and temperatures, it was observed that a non-linear response to bidirectional square wave current rides on a time independent background voltage value and manifests itself as regular sinusoidal-like voltage oscillations. It was found that the non-linear response disappears when the bidirectional current was switched to dc current. The spectral content of the voltage oscillations analyzed by the Fast Fourier Transform of the corresponding V-t curves revealed that the fundamental harmonics is comparable to the frequency of bidirectional square wave current. The coherent voltage oscillations were discussed mainly in terms of the dynamic competition between pinning and depinning together with the disorder in the coupling strength between the superconducting grains (i.e Josephson coupling effects). The density fluctuations and semi-elastic coupling of the flux lines with the pinning centers were also considered as possible physical mechanisms in the interpretation of the experimental results

  19. High voltage systems

    Martin, M.

    1991-01-01

    Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance

  20. Linear Colliders

    Alcaraz, J.

    2001-01-01

    After several years of study e''+ e''- linear colliders in the TeV range have emerged as the major and optimal high-energy physics projects for the post-LHC era. These notes summarize the present status form the main accelerator and detector features to their physics potential. The LHC era. These notes summarize the present status, from the main accelerator and detector features to their physics potential. The LHC is expected to provide first discoveries in the new energy domain, whereas an e''+ e''- linear collider in the 500 GeV-1 TeV will be able to complement it to an unprecedented level of precision in any possible areas: Higgs, signals beyond the SM and electroweak measurements. It is evident that the Linear Collider program will constitute a major step in the understanding of the nature of the new physics beyond the Standard Model. (Author) 22 refs

  1. Resistors Improve Ramp Linearity

    Kleinberg, L. L.

    1982-01-01

    Simple modification to bootstrap ramp generator gives more linear output over longer sweep times. New circuit adds just two resistors, one of which is adjustable. Modification cancels nonlinearities due to variations in load on charging capacitor and due to changes in charging current as the voltage across capacitor increases.

  2. An implantable neurostimulator with an integrated high-voltage inductive power-recovery frontend

    Wang Yuan; Zhang Xu; Liu Ming; Li Peng; Chen Hongda

    2014-01-01

    This paper present a highly-integrated neurostimulator with an on-chip inductive power-recovery frontend and high-voltage stimulus generator. In particular, the power-recovery frontend includes a high-voltage full-wave rectifier (up to 100 V AC input), high-voltage series regulators (24/5 V outputs) and a linear regulator (1.8/3.3 V output) with bandgap voltage reference. With the high voltage output of the series regulator, the proposed neurostimulator could deliver a considerably large current in high electrode-tissue contact impedance. This neurostimulator has been fabricated in a CSMC 1 μm 5/40/700 V BCD process and the total silicon area including pads is 5.8 mm 2 . Preliminary tests are successful as the neurostimulator shows good stability under a 13.56 MHz AC supply. Compared to previously reported works, our design has advantages of a wide induced voltage range (26–100 V), high output voltage (up to 24 V) and high-level integration, which are suitable for implantable neurostimulators. (semiconductor integrated circuits)

  3. Voltage regulator for generator

    Naoi, K

    1989-01-17

    It is an object of this invention to provide a voltage regulator for a generator charging a battery, wherein even if the ambient temperature at the voltage regulator rises abnormally high, possible thermal breakage of the semiconductor elements constituting the voltage regulator can be avoided. A feature of this invention is that the semiconductor elements can be protected from thermal breakage, even at an abnormal ambient temperature rise at the voltage regulator for the battery charging generator, by controlling a maximum conduction ratio of a power transistor in the voltage regulator in accordance with the temperature at the voltage regulator. This is achieved through a switching device connected in series to the field coil of the generator and adapted to be controlled in accordance with an output voltage of the generator and the ambient temperature at the voltage regulator. 6 figs.

  4. Automatic voltage imbalance detector

    Bobbett, Ronald E.; McCormick, J. Byron; Kerwin, William J.

    1984-01-01

    A device for indicating and preventing damage to voltage cells such as galvanic cells and fuel cells connected in series by detecting sequential voltages and comparing these voltages to adjacent voltage cells. The device is implemented by using operational amplifiers and switching circuitry is provided by transistors. The device can be utilized in battery powered electric vehicles to prevent galvanic cell damage and also in series connected fuel cells to prevent fuel cell damage.

  5. Ionization effects and linear stability in a coaxial plasma device

    Kurt, Erol; Kurt, Hilal; Bayhan, Ulku

    2009-03-01

    A 2-D computer simulation of a coaxial plasma device depending on the conservation equations of electrons, ions and excited atoms together with the Poisson equation for a plasma gun is carried out. Some characteristics of the plasma focus device (PF) such as critical wave numbers a c and voltages U c in the cases of various pressures Pare estimated in order to satisfy the necessary conditions of traveling particle densities ( i.e. plasma patterns) via a linear analysis. Oscillatory solutions are characterized by a nonzero imaginary part of the growth rate Im ( σ) for all cases. The model also predicts the minimal voltage ranges of the system for certain pressure intervals.

  6. Multiaxial fatigue criteria for AISI 304 and 2-1/4 Cr-1 Mo steel at 5380C with applications to strain-range partitioning and linear summation of creep and fatigue damage

    Blass, J.J.

    1982-01-01

    An improved multiaxial fatigue failure criterion was developed based on the results of combined axial-torsional strain cycling tests of AISI 304 and 2-1/4 Cr-1 Mo steel conducted at 538 0 C (1000 0 F). The formulation of this criterion involves the shear and normal components of inelastic strain range on the planes of maximum inelastic shear strain range. Optimum values of certain parameters contained in the formulation were obtained for each material by the method of least squares. The ability of this criterion to correlate the test results was compared with that of the usual (Mises) equivalent inelastic strain range criterion. An improved definition of equivalent inelastic strain range resulting from these considerations was used to generalize the theory of Strain Range Partitioning to multiaxial stress-strain conditions and was also applied to the linear summation of creep and fatigue damage

  7. High voltage investigations for ITER coils

    Fink, S.; Fietz, W.H.

    2006-01-01

    The superconducting ITER magnets will be excited with high voltage during operation and fast discharge. Because the coils are complex systems the internal voltage distribution can differ to a large extent from the ideal linear voltage distribution. In case of fast excitations internal voltages between conductor and radial plate of a TF coil can be even higher than the terminal voltage of 3.5 kV to ground which appears during a fast discharge without a fault. Hence the determination of the transient voltage distribution is important for a proper insulation co-ordination and will provide a necessary basis for the verification of the individual insulation design and the choice of test voltages and waveforms. Especially the extent of internal overvoltages in case of failures, e. g. malfunction of discharge units and / or arcing is of special interest. Transient calculations for the ITER TF coil system have been performed for fast discharge and fault scenarios to define test voltages for ITER TF. The conductor and radial plate insulation of the ITER TF Model Coil were exposed at room temperature to test voltages derived from the results from these calculations. Breakdown appeared during the highest AC voltage step. A fault scenario for the TF fast discharge system is presented where one fault triggers a second fault, leading to considerable voltage stress. In addition a FEM model of Poloidal Field Coil 3 for the determination of the parameters of a detailed network model is presented in order to prepare detailed investigations of the transient voltage behaviour of the PF coils. (author)

  8. Quad-copter UAV BLDC Motor Control: Linear v/s non-linear control maps

    Deep Parikh

    2015-08-01

    Full Text Available This paper presents some investigations and comparison of using linear versus non-linear static motor-control maps for the speed control of a BLDC (Brush Less Direct Current motors used in quad-copter UAV (Unmanned Aerial Vehicles. The motor-control map considered here is the inverse of the static map relating motor-speed output to motor-voltage input for a typical out-runner type Brushless DC Motors (BLDCM.  Traditionally, quad-copter BLDC motor speed control uses simple linear motor-control map defined by the motor-constant specification. However, practical BLDC motors show non-linear characteristic, particularly when operated across wide operating speed-range as is commonly required in quad-copter UAV flight operations. In this paper, our investigations to compare performance of linear versus non-linear motor-control maps are presented. The investigations cover simulation-based and experimental study of BLDC motor speed control systems for  quad-copter vehicle available. First the non-linear map relating rotor RPM to motor voltage for quad-copter BLDC motor is obtained experimentally using an optical speed encoder. The performance of the linear versus non-linear motor-control-maps for the speed control are studied. The investigations also cover study of time-responses for various standard test input-signals e.g. step, ramp and pulse inputs, applied as the reference speed-commands. Also, simple 2-degree of freedom test-bed is developed in our laboratory to help test the open-loop and closed-loop experimental investigations. The non-linear motor-control map is found to perform better in BLDC motor speed tracking control performance and thereby helping achieve better quad-copter roll-angle attitude control.

  9. High-voltage transistor converter for pulsed x-ray sources

    Krasil'nikov, S.B.; Kristalinskii, A.L.; Lozovoi, L.N.; Markov, S.N.; Sindalovskii, E.I.

    1986-01-01

    A 24-V/12-kV converter for MIRA-2D and NORA pulsed x-ray sources is described. When the low-voltage supply varies within 20-26 V, the frequency stability of the x-ray pulses is higher by a factor of 3 ≅ 3 than when the PRIMA converter is used. For 14-24 V, the average output power of the converter is independent of the load impedance and increases linearly with an increase in supply voltage. The efficiency of the converter reaches 60%. The converter operates in the temperature range of -40 to +60 0 C

  10. A linear programming manual

    Tuey, R. C.

    1972-01-01

    Computer solutions of linear programming problems are outlined. Information covers vector spaces, convex sets, and matrix algebra elements for solving simultaneous linear equations. Dual problems, reduced cost analysis, ranges, and error analysis are illustrated.

  11. [Comparison of film-screen combinations with contrast detail diagram and interactive image analysis. 2: Linear assessment of grey scale ranges with interactive image analysis].

    Stamm, G; Eichbaum, G; Hagemann, G

    1997-09-01

    The following three screen-film combinations were compared: a) a combination of anticrossover film and UV-light emitting screens, b) a combination of blue-light emitting screens and film, and c) a conventional green fluorescing screen-film combination. Radiographs of a specially designed plexiglass phantom (0.2 x 0.2 x 0.12 m3) with bar patterns of lead and plaster and of air, respectively were obtained using the following parameters: 12 pulse generator, 0.6 mm focus size, 4.7 mm aluminum pre-filter, a grid with 40 lines/cm (12:1) and a focus-detector distance of 1.15 m. Image analysis was performed using an IBAS system and a Zeiss Kontron computer. Display conditions were the following: display distance 0.12 m, a vario film objective 35/70 (Zeiss), a video camera tube with a PbO photocathode, 625 lines (Siemens Heimann), an IBAS image matrix of 512 x 512 pixels with a resolution of 7 lines/mm, the projected matrix area was 5000 microns2. Grey scale ranges were measured on a line perpendicular to the grouped bar patterns. The difference between the maximum and minimum density value served as signal. The spatial resolution of the detector system was measured when the signal value was three times higher than the standard deviation of the means of multiple density measurements. The results showed considerable advantages of the two new screen-film combinations as compared to the conventional screen-film combination. The result was contradictory to the findings with pure visual assessment of thresholds (part I) that had found no differences. The authors concluded that (automatic) interactive image analysis algorithms serve as an objective measure and are specifically advantageous when small differences in image quality are to be evaluated.

  12. A linear accelerator for simulated micrometeors.

    Slattery, J. C.; Becker, D. G.; Hamermesh, B.; Roy, N. L.

    1973-01-01

    Review of the theory, design parameters, and construction details of a linear accelerator designed to impart meteoric velocities to charged microparticles in the 1- to 10-micron diameter range. The described linac is of the Sloan Lawrence type and, in a significant departure from conventional accelerator practice, is adapted to single particle operation by employing a square wave driving voltage with the frequency automatically adjusted from 12.5 to 125 kHz according to the variable velocity of each injected particle. Any output velocity up to about 30 km/sec can easily be selected, with a repetition rate of approximately two particles per minute.

  13. Stray voltage mitigation

    Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies

    2008-04-09

    This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.

  14. High voltage engineering

    Rizk, Farouk AM

    2014-01-01

    Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec

  15. High voltage test techniques

    Kind, Dieter

    2001-01-01

    The second edition of High Voltage Test Techniques has been completely revised. The present revision takes into account the latest international developments in High Voltage and Measurement technology, making it an essential reference for engineers in the testing field.High Voltage Technology belongs to the traditional area of Electrical Engineering. However, this is not to say that the area has stood still. New insulating materials, computing methods and voltage levels repeatedly pose new problems or open up methods of solution; electromagnetic compatibility (EMC) or components and systems al

  16. Voltage-assisted polymer wafer bonding

    Varsanik, J S; Bernstein, J J

    2012-01-01

    Polymer wafer bonding is a widely used process for fabrication of microfluidic devices. However, best practices for polymer bonds do not achieve sufficient bond strength for many applications. By applying a voltage to a polymer bond in a process called voltage-assisted bonding, bond strength is shown to improve dramatically for two polymers (Cytop™ and poly(methyl methacrylate)). Several experiments were performed to provide a starting point for further exploration of this technique. An optimal voltage range is experimentally observed with a reduction in bonding strength at higher voltages. Additionally, voltage-assisted bonding is shown to reduce void diameter due to bond defects. An electrostatic force model is proposed to explain the improved bond characteristics. This process can be used to improve bond strength for most polymers. (paper)

  17. Linear induction accelerator

    Buttram, M.T.; Ginn, J.W.

    1988-06-21

    A linear induction accelerator includes a plurality of adder cavities arranged in a series and provided in a structure which is evacuated so that a vacuum inductance is provided between each adder cavity and the structure. An energy storage system for the adder cavities includes a pulsed current source and a respective plurality of bipolar converting networks connected thereto. The bipolar high-voltage, high-repetition-rate square pulse train sets and resets the cavities. 4 figs.

  18. Complete low power controller for high voltage power systems

    Sumner, R.; Blanar, G.

    1997-01-01

    The MHV100 is a custom CMOS integrated circuit, developed for the AMS experiment. It provides complete control for a single channel high voltage (HV) generator and integrates all the required digital communications, D to A and A to D converters, the analog feedback loop and output drivers. This chip has been designed for use in both distributed high voltage systems or for low cost single channel high voltage systems. The output voltage and current range is determined by the external components

  19. Control and Testing of a Dynamic Voltage Restorer (DVR) at Medium Voltage Level

    Nielsen, John Godsk; Newman, Michael; Nielsen, Hans Ove

    2004-01-01

    power sensitive loads from voltage sags. This paper reports practical test results obtained on a medium voltage (10 kV) level using a DVR at a Distribution test facility in Kyndby, Denmark. The DVR was designed to protect a 400-kVA load from a 0.5-p.u. maximum voltage sag. The reported DVR verifies......The dynamic voltage restorer (DVR) has become popular as a cost effective solution for the protection of sensitive loads from voltage sags. Implementations of the DVR have been proposed at both a low voltage (LV) level, as well as a medium voltage (MV) level; and give an opportunity to protect high...... the use of a feed-forward and feed-back technique of the controller and it obtains both good transient and steady state responses. The effect of the DVR on the system is experimentally investigated under both faulted and non-faulted system states, for a variety of linear and non-linear loads. Variable...

  20. Fuel Cell/Electrochemical Cell Voltage Monitor

    Vasquez, Arturo

    2012-01-01

    A concept has been developed for a new fuel cell individual-cell-voltage monitor that can be directly connected to a multi-cell fuel cell stack for direct substack power provisioning. It can also provide voltage isolation for applications in high-voltage fuel cell stacks. The technology consists of basic modules, each with an 8- to 16-cell input electrical measurement connection port. For each basic module, a power input connection would be provided for direct connection to a sub-stack of fuel cells in series within the larger stack. This power connection would allow for module power to be available in the range of 9-15 volts DC. The relatively low voltage differences that the module would encounter from the input electrical measurement connection port, coupled with the fact that the module's operating power is supplied by the same substack voltage input (and so will be at similar voltage), provides for elimination of high-commonmode voltage issues within each module. Within each module, there would be options for analog-to-digital conversion and data transfer schemes. Each module would also include a data-output/communication port. Each of these ports would be required to be either non-electrical (e.g., optically isolated) or electrically isolated. This is necessary to account for the fact that the plurality of modules attached to the stack will normally be at a range of voltages approaching the full range of the fuel cell stack operating voltages. A communications/ data bus could interface with the several basic modules. Options have been identified for command inputs from the spacecraft vehicle controller, and for output-status/data feeds to the vehicle.

  1. Low voltage 80 KV to 125 KV electron processors

    Lauppi, U.V.

    1999-01-01

    The classic electron beam technology made use of accelerating energies in the voltage range of 300 to 800 kV. The first EB processors - built for the curing of coatings - operated at 300 kV. The products to be treated were thicker than a simple layer of coating with thicknesses up to 100g and more. It was only in the beginning of the 1970's that industrial EB processors with accelerating voltages below 300 kV appeared on the market. Our company developed the first commercial electron accelerator without a beam scanner. The new EB machine featured a linear cathode, emitting a shower or 'curtain' of electrons over the full width of the product. These units were much smaller than anv previous EB processors and dedicated to the curing of coatings and other thin layers. ESI's first EB units operated with accelerating voltages between 150 and 200 kV. In 1993 ESI announced the introduction of a new generation of Electrocure. EB processors operating at 120 kV, and in 1998, at the RadTech North America '98 Conference in Chicago, the introduction of an 80 kV electron beam processor under the designation Microbeam LV

  2. Characteristics of output voltage and current of integrated nanogenerators

    Yang, Rusen; Qin, Yong; Li, Cheng; Dai, Liming; Wang, Zhong Lin

    2009-01-01

    three criteria: Schottky behavior test, switching-polarity tests, and linear superposition of current and voltage tests. The 11 tests can effectively rule out the system artifacts, whose sign does not change with the switching measurement polarity

  3. Linear algebra

    Shilov, Georgi E

    1977-01-01

    Covers determinants, linear spaces, systems of linear equations, linear functions of a vector argument, coordinate transformations, the canonical form of the matrix of a linear operator, bilinear and quadratic forms, Euclidean spaces, unitary spaces, quadratic forms in Euclidean and unitary spaces, finite-dimensional space. Problems with hints and answers.

  4. Output voltage calculations in double barrier magnetic tunnel junctions with asymmetric voltage behavior

    Useinov, Arthur; Mryasov, Oleg; Kosel, Jü rgen

    2011-01-01

    In this paper we study the asymmetric voltage behavior (AVB) of the tunnel magnetoresistance (TMR) for single and double barrier magnetic tunnel junctions (MTJs) in range of a quasi-classical free electron model. Numerical calculations of the TMR

  5. based dynamic voltage restorer

    HOD

    operation due to presence of increased use of nonlinear loads (computers, microcontrollers ... simulations of a dynamic voltage restorer (DVR) was achieved using MATLAB/Simulink. ..... using Discrete PWM generator, then the IGBT inverter.

  6. [Fast separation and analysis of water-soluble vitamins in spinach by capillary electrophoresis with high voltage].

    Hu, Xiaoqin; You, Huiyan

    2009-11-01

    In capillary electrophoresis, 0-40 kV (even higher) voltage can be reached by a connecting double-model high voltage power supply. In the article, water-soluble vitamins, VB1, VB2, VB6, VC, calcium D-pantothenate, D-biotin, nicotinic acid and folic acid in vegetable, were separated by using the high voltage power supply under the condition of electrolyte water solution as running buffer. The separation conditions, such as voltage, the concentration of buffer and pH value etc. , were optimized during the experiments. The results showed that eight water-soluble vitamins could be baseline separated in 2.2 min at 40 kV applied voltage, 25 mmol/L sodium tetraborate buffer solution (pH 8.8). The water-soluble vitamins in spinach were quantified and the results were satisfied. The linear correlation coefficients of the water-soluble vitamins ranged from 0.9981 to 0.9999. The detection limits ranged from 0.2 to 0.3 mg/L. The average recoveries ranged from 88.0% to 100.6% with the relative standard deviations (RSD) range of 1.15%-4.13% for the spinach samples.

  7. Frequency pulling in a low-voltage medium-power gyrotron

    Luo, Li; Du, Chao-Hai; Huang, Ming-Guang; Liu, Pu-Kun

    2018-04-01

    Many recent biomedical applications use medium-power frequency-tunable terahertz (THz) sources, such as sensitivity-enhanced nuclear magnetic resonance, THz imaging, and biomedical treatment. As a promising candidate, a low-voltage gyrotron can generate watt-level, continuous THz-wave radiation. In particular, the frequency-pulling effect in a gyrotron, namely, the effect of the electron beam parameters on the oscillation frequency, can be used to tune the operating frequency. Most previous investigations used complicated and time-consuming gyrotron nonlinear theory to study the influence of many beam parameters on the interaction performance. While gyrotron linear theory investigation demonstrates the advantages of rapidly and clearly revealing the physical influence of individual key beam parameters on the overall system performance, this paper demonstrates systematically the use of gyrotron linear theory to study the frequency-pulling effect in a low-voltage gyrotron with either a Gaussian or a sinusoidal axial-field profile. Furthermore, simulations of a gyrotron operating in the first axial mode are carried out in the framework of nonlinear theory as a contrast. Close agreement is achieved between the two theories. Besides, some interesting results are obtained. In a low-current sinusoidal-profile cavity, the ranges of frequency variation for different axial modes are isolated from each other, and the frequency tuning bandwidth for each axial mode increases by increasing either the beam voltage or pitch factor. Lowering the voltage, the total tuning ranges are squeezed and become concentrated. However, the isolated frequency regions of each axial mode cannot be linked up unless the beam current is increased, meaning that higher current operation is the key to achieving a wider and continuous tuning frequency range. The results presented in this paper can provide a reference for designing a broadband low-voltage gyrotron.

  8. High voltage engineering fundamentals

    Kuffel, E; Hammond, P

    1984-01-01

    Provides a comprehensive treatment of high voltage engineering fundamentals at the introductory and intermediate levels. It covers: techniques used for generation and measurement of high direct, alternating and surge voltages for general application in industrial testing and selected special examples found in basic research; analytical and numerical calculation of electrostatic fields in simple practical insulation system; basic ionisation and decay processes in gases and breakdown mechanisms of gaseous, liquid and solid dielectrics; partial discharges and modern discharge detectors; and over

  9. Low-voltage gyrotrons

    Glyavin, M. Yu.; Zavolskiy, N. A.; Sedov, A. S.; Nusinovich, G. S.

    2013-01-01

    For a long time, the gyrotrons were primarily developed for electron cyclotron heating and current drive of plasmas in controlled fusion reactors where a multi-megawatt, quasi-continuous millimeter-wave power is required. In addition to this important application, there are other applications (and their number increases with time) which do not require a very high power level, but such issues as the ability to operate at low voltages and have compact devices are very important. For example, gyrotrons are of interest for a dynamic nuclear polarization, which improves the sensitivity of the nuclear magnetic resonance spectroscopy. In this paper, some issues important for operation of gyrotrons driven by low-voltage electron beams are analyzed. An emphasis is made on the efficiency of low-voltage gyrotron operation at the fundamental and higher cyclotron harmonics. These efficiencies calculated with the account for ohmic losses were, first, determined in the framework of the generalized gyrotron theory based on the cold-cavity approximation. Then, more accurate, self-consistent calculations for the fundamental and second harmonic low-voltage sub-THz gyrotron designs were carried out. Results of these calculations are presented and discussed. It is shown that operation of the fundamental and second harmonic gyrotrons with noticeable efficiencies is possible even at voltages as low as 5–10 kV. Even the third harmonic gyrotrons can operate at voltages about 15 kV, albeit with rather low efficiency (1%–2% in the submillimeter wavelength region).

  10. Optimal condition of memristance enhancement circuit using external voltage source

    Hiroya Tanaka

    2014-05-01

    Full Text Available Memristor provides nonlinear response in the current-voltage characteristic and the memristance is modulated using an external voltage source. We point out by solving nonlinear equations that an optimal condition of the external voltage source exists for maximizing the memristance in such modulation scheme. We introduce a linear function to describe the nonlinear time response and derive an important design guideline; a constant ratio of the frequency to the amplitude of the external voltage source maximizes the memristance. The analysis completely accounts for the memristance behavior.

  11. LED Current Balance Using a Variable Voltage Regulator with Low Dropout vDS Control

    Hung-I Hsieh

    2017-02-01

    Full Text Available A cost-effective light-emitting diode (LED current balance strategy using a variable voltage regulator (VVR with low dropout vDS control is proposed. This can regulate the multiple metal-oxide-semiconductor field-effect transistors (MOSFETs of the linear current regulators (LCR, maintaining low dropout vDS on the flat vGS-characteristic curves and making all drain currents almost the same. Simple group LCRs respectively loaded with a string LED are employed to implement the theme. The voltage VVdc from a VVR is synthesized by a string LED voltage NvD, source voltage vR, and a specified low dropout vDS = VQ. The VVdc updates instantly, through the control loop of the master LCR, which means that all slave MOSFETs have almost the same biases on their flat vGS-characteristic curves. This leads to all of the string LED currents being equal to each other, producing an almost even luminance. An experimental setup with microchip control is built to verify the estimations. Experimental results show that the luminance of all of the string LEDs are almost equal to one another, with a maximum deviation below 1% during a wide dimming range, while keeping all vDS of the MOSFETs at a low dropout voltage, as expected.

  12. Application of pentacene thin-film transistors with controlled threshold voltages to enhancement/depletion inverters

    Takahashi, Hajime; Hanafusa, Yuki; Kimura, Yoshinari; Kitamura, Masatoshi

    2018-03-01

    Oxygen plasma treatment has been carried out to control the threshold voltage in organic thin-film transistors (TFTs) having a SiO2 gate dielectric prepared by rf sputtering. The threshold voltage linearly changed in the range of -3.7 to 3.1 V with the increase in plasma treatment time. Although the amount of change is smaller than that for organic TFTs having thermally grown SiO2, the tendency of the change was similar to that for thermally grown SiO2. To realize different plasma treatment times on the same substrate, a certain region on the SiO2 surface was selected using a shadow mask, and was treated with oxygen plasma. Using the process, organic TFTs with negative threshold voltages and those with positive threshold voltages were fabricated on the same substrate. As a result, enhancement/depletion inverters consisting of the organic TFTs operated at supply voltages of 5 to 15 V.

  13. Device for monitoring cell voltage

    Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE

    2012-08-21

    A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.

  14. The pulse-driven AC Josephson voltage normal

    Kieler, Oliver

    2016-01-01

    In this contribution quantum precise alternating-voltage sources are presented, which make the generation of arbitrary wave forms with highest spectral purity with a high bandwidth from DC up to the MHz range possible. Heartpiece of these Josephson voltage normals is a serial circuit of many thousand Josephson contacts, which make by irradiation with high-frequency radiation (microwaves) the generation of highly precise voltage values possible. Thereby in the current-voltage characteristics stages of constant voltage, so called Shapiro stages, occur. Illustratively these stages can be described by the transfer of a certain number of flux quanta through the Josephson contacts.

  15. Development of a wide-range tritium-concentration detector

    Jun, F.; Zhe, L.; Shicheng, L.; Jiangfeng, S.; Deli, L. [China Academy of Engineering Physics, Mianyang (China)

    2015-03-15

    According to the requirements of the tritium related systems of the TBM (Test Blanket Module) for monitoring the on-line tritium concentration, a wide-range tritium-concentration detector has been developed to measure the tritium concentration in the range of 10{sup 4} Bq/ml - 5*10{sup 8} Bq/ml. This detector is combined with a low-memory helium ionization chamber. The weak current signal collected in the ionization chamber is converted to the voltage signal by an I-V converter. The minimum weak current which the detector could be measured is 10{sup -14} A. The performance of the background current and the current response linearity of the prototype have been tested. The test result indicates that the linear response of the current signal of the prototype without connecting the ionization chamber is good. The linear correlation coefficient is R{sup 2} = 0.998.

  16. Development of a wide-range tritium-concentration detector

    Jun, F.; Zhe, L.; Shicheng, L.; Jiangfeng, S.; Deli, L.

    2015-01-01

    According to the requirements of the tritium related systems of the TBM (Test Blanket Module) for monitoring the on-line tritium concentration, a wide-range tritium-concentration detector has been developed to measure the tritium concentration in the range of 10 4 Bq/ml - 5*10 8 Bq/ml. This detector is combined with a low-memory helium ionization chamber. The weak current signal collected in the ionization chamber is converted to the voltage signal by an I-V converter. The minimum weak current which the detector could be measured is 10 -14 A. The performance of the background current and the current response linearity of the prototype have been tested. The test result indicates that the linear response of the current signal of the prototype without connecting the ionization chamber is good. The linear correlation coefficient is R 2 = 0.998

  17. 10 ps resolution, 160 ns full scale range and less than 1.5% differential non-linearity time-to-digital converter module for high performance timing measurements

    Markovic, B.; Tamborini, D.; Villa, F.; Tisa, S.; Tosi, A.; Zappa, F. [Politecnico di Milano, Dipartimento di Elettronica e Informazione, Piazza Leonardo da Vinci 32, 20133 Milano (Italy)

    2012-07-15

    We present a compact high performance time-to-digital converter (TDC) module that provides 10 ps timing resolution, 160 ns dynamic range and a differential non-linearity better than 1.5% LSB{sub rms}. The TDC can be operated either as a general-purpose time-interval measurement device, when receiving external START and STOP pulses, or in photon-timing mode, when employing the on-chip SPAD (single photon avalanche diode) detector for detecting photons and time-tagging them. The instrument precision is 15 ps{sub rms} (i.e., 36 ps{sub FWHM}) and in photon timing mode it is still better than 70 ps{sub FWHM}. The USB link to the remote PC allows the easy setting of measurement parameters, the fast download of acquired data, and their visualization and storing via an user-friendly software interface. The module proves to be the best candidate for a wide variety of applications such as: fluorescence lifetime imaging, time-of-flight ranging measurements, time-resolved positron emission tomography, single-molecule spectroscopy, fluorescence correlation spectroscopy, diffuse optical tomography, optical time-domain reflectometry, quantum optics, etc.

  18. High frequency breakdown voltage

    Chu, Thanh Duy.

    1992-03-01

    This report contains information about the effect of frequency on the breakdown voltage of an air gap at standard pressure and temperature, 76 mm Hg and O degrees C, respectively. The frequencies of interest are 47 MHz and 60 MHz. Additionally, the breakdown in vacuum is briefly considered. The breakdown mechanism is explained on the basis of collision and ionization. The presence of the positive ions produced by ionization enhances the field in the gap, and thus determines the breakdown. When a low-frequency voltage is applied across the gap, the breakdown mechanism is the same as that caused by the DC or static voltage. However, when the frequency exceeds the first critical value f c , the positive ions are trapped in the gap, increasing the field considerably. This makes the breakdown occur earlier; in other words, the breakdown voltage is lowered. As the frequency increases two decades or more, the second critical frequency, f ce , is reached. This time the electrons start being trapped in the gap. Those electrons that travel multiple times across the gap before reaching the positive electrode result in an enormous number of electrons and positive ions being present in the gap. The result is a further decrease of the breakdown voltage. However, increasing the frequency does not decrease the breakdown voltage correspondingly. In fact, the associated breakdown field intensity is almost constant (about 29 kV/cm).The reason is that the recombination rate increases and counterbalances the production rate, thus reducing the effect of the positive ions' concentration in the gap. The theory of collision and ionization does not apply to the breakdown in vacuum. It seems that the breakdown in vacuum is primarily determined by the irregularities on the surfaces of the electrodes. Therefore, the effect of frequency on the breakdown, if any, is of secondary importance

  19. Vivitron 1995, transient voltage simulation, high voltage insulator tests, electric field calculation

    Frick, G.; Osswald, F.; Heusch, B.

    1996-01-01

    Preliminary investigations showed clearly that, because of the discrete electrode structure of the Vivitron, important overvoltage leading to insulator damage can appear in case of a spark. The first high voltage tests showed damage connected with such events. This fact leads to a severe voltage limitation. This work describes, at first, studies made to understand the effects of transients and the associated over-voltage appearing in the Vivitron. Then we present the high voltage tests made with full size Vivitron components using the CN 6 MV machine as a pilot machine. Extensive field calculations were made. These involve simulations of static stresses and transient overvoltages, on insulating boards and electrodes. This work gave us the solutions for arrangements and modifications in the machine. After application, the Vivitron runs now without any sparks and damage at 20 MV. In the same manner, we tested column insulators of a new design and so we will find out how to get to higher voltages. Electric field calculation around the tie bars connecting the discrete electrodes together showed field enhancements when the voltages applied on the discrete electrodes are not equally distributed. This fact is one of the sources of discharges and voltage limitations. A scenario of a spark event is described and indications are given how to proceed towards higher voltages, in the 30 MV range. (orig.)

  20. 0.45 v and 18 μA/MHz MCU SOC with Advanced Adaptive Dynamic Voltage Control (ADVC

    Uzi Zangi

    2018-05-01

    Full Text Available An ultra-low-power MicroController Unit System-on-Chip (MCU SOC is described with integrated DC to DC power management and Adaptive Dynamic Voltage Control (ADVC mechanism. The SOC, designed and fabricated in a 40 nm ULP standard CMOS technology, includes the complete Synopsys ARC EM5D core MCU, featuring a full set of DSP instructions and minimizing energy consumption at a wide range of frequencies: 312 K–80 MHz. A number of unique low voltage digital libraries, comprising of approximately 300 logic cells and sequential elements, were used for the MCU SOC design. On-die silicon sensors were utilized to continuously change the operating voltage to optimize power/performance for a given frequency and environmental conditions, and also to resolve yield and life time problems, while operating at low voltages. A First Fail (FFail mechanism, which can be digitally and linearly controlled with up to 8 bits, detects the failing SOC voltage at a given frequency. The core operates between 0.45–1.1 V volts with a direct battery connection for an input voltage of 1.6–3.6 V. Measurement results show that the peak energy efficiency is 18μW/MHz. A comparison to state-of-the-art commercial SOCs is presented, showing a 3–5× improved current/DMIPS (Dhrystone Million Instructions per second compared to the next best chip.

  1. Modeling and simulation of dynamic voltage restorer in power system

    Abdel Aziz, M.A.A.M.

    2012-01-01

    There are many loads subjected to several Power Quality Problems such as voltage sags/swells, unbalance, harmonics distortion, and short interruption. These loads encompass a wide range of equipment which are very sensitive to voltage disturbances. The Dynamic Voltage Restorer (DVR) has recently been introduced to protect sensitive loads from voltage sags and other voltage disturbances in addition to this, it mitigates current harmonics distortion. It is a series connected power electronic based device. It is considered as one of the most efficient and effective solutions. Its appeal includes smaller size and fast dynamic response to disturbances. This work describes a proposal of the DVR to improve power quality distribution (medium voltage) system. The control of the compensation voltage and harmonics cancellation in the DVR is based on Adaptive Noise Canceling (ANC) technique. Simulation results carried out by PSCAD/EMTDC to investigate the performance of the proposed method.

  2. Using computational modeling to compare X-ray tube Practical Peak Voltage for Dental Radiology

    Holanda Cassiano, Deisemar; Arruda Correa, Samanda Cristine; Monteiro de Souza, Edmilson; Silva, Ademir Xaxier da; Pereira Peixoto, José Guilherme; Tadeu Lopes, Ricardo

    2014-01-01

    The Practical Peak Voltage-PPV has been adopted to measure the voltage applied to an X-ray tube. The PPV was recommended by the IEC document and accepted and published in the TRS no. 457 code of practice. The PPV is defined and applied to all forms of waves and is related to the spectral distribution of X-rays and to the properties of the image. The calibration of X-rays tubes was performed using the MCNPX Monte Carlo code. An X-ray tube for Dental Radiology (operated from a single phase power supply) and an X-ray tube used as a reference (supplied from a constant potential power supply) were used in simulations across the energy range of interest of 40 kV to 100 kV. Results obtained indicated a linear relationship between the tubes involved. - Highlights: • Computational Model was developed to X-ray tube Practical Peak Voltage for Dental Radiology. • The calibration of X-rays tubes was performed using the MCNPX Monte Carlo code. • The energy range was 40–100 kV. • Results obtained indicated a linear relationship between the Dental Radiology and reference X-ray tubes

  3. Digital voltage discriminator

    Zhou Zhicheng

    1992-01-01

    A digital voltage discriminator is described, which is synthesized by digital comparator and ADC. The threshold is program controllable with high stability. Digital region of confusion is approximately equal to 1.5 LSB. This discriminator has a single channel analyzer function model with channel width of 1.5 LSB

  4. High-voltage picoamperemeter

    Bugl, Andrea; Ball, Markus; Boehmer, Michael; Doerheim, Sverre; Hoenle, Andreas; Konorov, Igor [Technische Universitaet Muenchen, Garching (Germany); Ketzer, Bernhard [Technische Universitaet Muenchen, Garching (Germany); Helmholtz-Institut fuer Strahlen- und Kernphysik, Bonn (Germany)

    2014-07-01

    Current measurements in the nano- and picoampere region on high voltage are an important tool to understand charge transfer processes in micropattern gas detectors like the Gas Electron Multiplier (GEM). They are currently used to e.g. optimize the field configuration in a multi-GEM stack to be used in the ALICE TPC after the upgrade of the experiment during the 2nd long shutdown of the LHC. Devices which allow measurements down to 1pA at high voltage up to 6 kV have been developed at TU Muenchen. They are based on analog current measurements via the voltage drop over a switchable shunt. A microcontroller collects 128 digital ADC values and calculates their mean and standard deviation. This information is sent with a wireless transmitting unit to a computer and stored in a root file. A nearly unlimited number of devices can be operated simultaneously and read out by a single receiver. The results can also be displayed on a LCD directly at the device. Battery operation and the wireless readout are important to protect the user from any contact to high voltage. The principle of the device is explained, and systematic studies of their properties are shown.

  5. Geomagnetism and Induced Voltage

    Abdul-Razzaq, W.; Biller, R. D.

    2010-01-01

    Introductory physics laboratories have seen an influx of "conceptual integrated science" over time in their classrooms with elements of other sciences such as chemistry, biology, Earth science, and astronomy. We describe a laboratory to introduce this development, as it attracts attention to the voltage induced in the human brain as it…

  6. Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

  7. Linear gate

    Suwono.

    1978-01-01

    A linear gate providing a variable gate duration from 0,40μsec to 4μsec was developed. The electronic circuity consists of a linear circuit and an enable circuit. The input signal can be either unipolar or bipolar. If the input signal is bipolar, the negative portion will be filtered. The operation of the linear gate is controlled by the application of a positive enable pulse. (author)

  8. Linear Accelerators

    Vretenar, M

    2014-01-01

    The main features of radio-frequency linear accelerators are introduced, reviewing the different types of accelerating structures and presenting the main characteristics aspects of linac beam dynamics

  9. Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network

    Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...

  10. An Improvement on the Junction Temperature Measurement of Light-Emitting Diodes by using the Peak Shift Method Compared with the Forward Voltage Method

    He Su-Ming; Wang Jin-Bin; Luo Xiang-Dong; Zhang Bo; Fu Lei; Cheng Li-Wen; Lu Wei

    2012-01-01

    The junction temperature of red, green and blue high power light emitting diodes (LEDs) is measured by using the emission peak shift method and the forward voltage method. Both the emission peak shift and the forward voltage decrease show a linear relationship relative to junction temperature. The linear coefficients of the red, green and blue LEDs for the peak shift method and the forward voltage method range from 0.03 to 0.15 nm/°C and from 1.33 to 3.59 mV/°C, respectively. Compared with the forward voltage method, the peak shift method is almost independent of bias current and sample difference. The variation of the slopes is less than 2% for the peak shift method and larger than 30% for the forward voltage method, when the LEDs are driven by different bias currents. It is indicated that the peak shift method gives better stability than the forward voltage method under different LED working conditions

  11. Linearization Method and Linear Complexity

    Tanaka, Hidema

    We focus on the relationship between the linearization method and linear complexity and show that the linearization method is another effective technique for calculating linear complexity. We analyze its effectiveness by comparing with the logic circuit method. We compare the relevant conditions and necessary computational cost with those of the Berlekamp-Massey algorithm and the Games-Chan algorithm. The significant property of a linearization method is that it needs no output sequence from a pseudo-random number generator (PRNG) because it calculates linear complexity using the algebraic expression of its algorithm. When a PRNG has n [bit] stages (registers or internal states), the necessary computational cost is smaller than O(2n). On the other hand, the Berlekamp-Massey algorithm needs O(N2) where N(≅2n) denotes period. Since existing methods calculate using the output sequence, an initial value of PRNG influences a resultant value of linear complexity. Therefore, a linear complexity is generally given as an estimate value. On the other hand, a linearization method calculates from an algorithm of PRNG, it can determine the lower bound of linear complexity.

  12. Analytic Morse/long-range potential energy surfaces and "adiabatic-hindered-rotor" treatment for a symmetric top-linear molecule dimer: A case study of CH3F-H2

    Zhang, Xiao-Long; Ma, Yong-Tao; Zhai, Yu; Li, Hui

    2018-03-01

    A first effective six-dimensional ab initio potential energy surface (PES) for CH3F-H2 which explicitly includes the intramolecular Q3 stretching normal mode of the CH3F monomer is presented. The electronic structure computations have been carried out at the explicitly correlated coupled cluster level of theory [CCSD(T)-F12a] with an augmented correlation-consistent triple zeta basis set. Five-dimensional analytical intermolecular PESs for ν3(CH3F) = 0 and 1 are then obtained by fitting the vibrationally averaged potentials to the Morse/Long-Range (MLR) potential function form. The MLR function form is applied to the nonlinear molecule-linear molecule case for the first time. These fits to 25 015 points have root-mean-square deviations of 0.74 cm-1 and 0.082 cm-1 for interaction energies less than 0.0 cm-1. Using the adiabatic hindered-rotor approximation, three-dimensional PESs for CH3F-paraH2 are generated from the 5D PESs over all possible orientations of the hydrogen monomer. The infrared and microwave spectra for CH3F-paraH2 dimer are predicted for the first time. These analytic PESs can be used for modeling the dynamical behavior in CH3F-(H2)N clusters, including the possible appearance of microscopic superfluidity.

  13. High-output microwave detector using voltage-induced ferromagnetic resonance

    Shiota, Yoichi; Suzuki, Yoshishige; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Yuasa, Shinji

    2014-01-01

    We investigated the voltage-induced ferromagnetic resonance (FMR) with various DC bias voltage and input RF power in magnetic tunnel junctions. We found that the DC bias monotonically increases the homodyne detection voltage due to the nonlinear FMR originating in an asymmetric magnetization-potential in the free layer. In addition, the linear increase of an output voltage to the input RF power in the voltage-induced FMR is more robust than that in spin-torque FMR. These characteristics enable us to obtain an output voltage more than ten times than that of microwave detectors using spin-transfer torque

  14. Linear induction accelerators

    Briggs, R.J.

    1986-06-01

    The development of linear induction accelerators has been motivated by applications requiring high-pulsed currents of charged particles at voltages exceeding the capability of single-stage, diode-type accelerators and at currents too high for rf accelerators. In principle, one can accelerate charged particles to arbitrarily high voltages using a multi-stage induction machine, but the 50-MeV, 10-kA Advanced Test Accelerator (ATA) at LLNL is the highest voltage machine in existence at this time. The advent of magnetic pulse power systems makes sustained operation at high-repetition rates practical, and this capability for high-average power is very likely to open up many new applications of induction machines in the future. This paper surveys the US induction linac technology with primary emphasis on electron machines. A simplified description of how induction machines couple energy to the electron beam is given, to illustrate many of the general issues that bound the design space of induction linacs

  15. Linear algebra

    Said-Houari, Belkacem

    2017-01-01

    This self-contained, clearly written textbook on linear algebra is easily accessible for students. It begins with the simple linear equation and generalizes several notions from this equation for the system of linear equations and introduces the main ideas using matrices. It then offers a detailed chapter on determinants and introduces the main ideas with detailed proofs. The third chapter introduces the Euclidean spaces using very simple geometric ideas and discusses various major inequalities and identities. These ideas offer a solid basis for understanding general Hilbert spaces in functional analysis. The following two chapters address general vector spaces, including some rigorous proofs to all the main results, and linear transformation: areas that are ignored or are poorly explained in many textbooks. Chapter 6 introduces the idea of matrices using linear transformation, which is easier to understand than the usual theory of matrices approach. The final two chapters are more advanced, introducing t...

  16. High Voltage Charge Pump

    Emira, Ahmed A.; Abdelghany, Mohamed A.; Elsayed, Mohannad Yomn; Elshurafa, Amro M; Salama, Khaled N.

    2014-01-01

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  17. High Voltage Charge Pump

    Emira, Ahmed A.

    2014-10-09

    Various embodiments of a high voltage charge pump are described. One embodiment is a charge pump circuit that comprises a plurality of switching stages each including a clock input, a clock input inverse, a clock output, and a clock output inverse. The circuit further comprises a plurality of pumping capacitors, wherein one or more pumping capacitors are coupled to a corresponding switching stage. The circuit also comprises a maximum selection circuit coupled to a last switching stage among the plurality of switching stages, the maximum selection circuit configured to filter noise on the output clock and the output clock inverse of the last switching stage, the maximum selection circuit further configured to generate a DC output voltage based on the output clock and the output clock inverse of the last switching stage.

  18. High Voltage Seismic Generator

    Bogacz, Adrian; Pala, Damian; Knafel, Marcin

    2015-04-01

    This contribution describes the preliminary result of annual cooperation of three student research groups from AGH UST in Krakow, Poland. The aim of this cooperation was to develop and construct a high voltage seismic wave generator. Constructed device uses a high-energy electrical discharge to generate seismic wave in ground. This type of device can be applied in several different methods of seismic measurement, but because of its limited power it is mainly dedicated for engineering geophysics. The source operates on a basic physical principles. The energy is stored in capacitor bank, which is charged by two stage low to high voltage converter. Stored energy is then released in very short time through high voltage thyristor in spark gap. The whole appliance is powered from li-ion battery and controlled by ATmega microcontroller. It is possible to construct larger and more powerful device. In this contribution the structure of device with technical specifications is resented. As a part of the investigation the prototype was built and series of experiments conducted. System parameter was measured, on this basis specification of elements for the final device were chosen. First stage of the project was successful. It was possible to efficiently generate seismic waves with constructed device. Then the field test was conducted. Spark gap wasplaced in shallowborehole(0.5 m) filled with salt water. Geophones were placed on the ground in straight line. The comparison of signal registered with hammer source and sparker source was made. The results of the test measurements are presented and discussed. Analysis of the collected data shows that characteristic of generated seismic signal is very promising, thus confirms possibility of practical application of the new high voltage generator. The biggest advantage of presented device after signal characteristics is its size which is 0.5 x 0.25 x 0.2 m and weight approximately 7 kg. This features with small li-ion battery makes

  19. Increased voltage photovoltaic cell

    Ross, B.; Bickler, D. B.; Gallagher, B. D. (Inventor)

    1985-01-01

    A photovoltaic cell, such as a solar cell, is provided which has a higher output voltage than prior cells. The improved cell includes a substrate of doped silicon, a first layer of silicon disposed on the substrate and having opposite doping, and a second layer of silicon carbide disposed on the first layer. The silicon carbide preferably has the same type of doping as the first layer.

  20. Linear algebra

    Stoll, R R

    1968-01-01

    Linear Algebra is intended to be used as a text for a one-semester course in linear algebra at the undergraduate level. The treatment of the subject will be both useful to students of mathematics and those interested primarily in applications of the theory. The major prerequisite for mastering the material is the readiness of the student to reason abstractly. Specifically, this calls for an understanding of the fact that axioms are assumptions and that theorems are logical consequences of one or more axioms. Familiarity with calculus and linear differential equations is required for understand

  1. A Monolithic CMOS Magnetic Hall Sensor with High Sensitivity and Linearity Characteristics

    Haiyun Huang

    2015-10-01

    Full Text Available This paper presents a fully integrated linear Hall sensor by means of 0.8 μm high voltage complementary metal-oxide semiconductor (CMOS technology. This monolithic Hall sensor chip features a highly sensitive horizontal switched Hall plate and an efficient signal conditioner using dynamic offset cancellation technique. An improved cross-like Hall plate achieves high magnetic sensitivity and low offset. A new spinning current modulator stabilizes the quiescent output voltage and improves the reliability of the signal conditioner. The tested results show that at the 5 V supply voltage, the maximum Hall output voltage of the monolithic Hall sensor microsystem, is up to ±2.1 V and the linearity of Hall output voltage is higher than 99% in the magnetic flux density range from ±5 mT to ±175 mT. The output equivalent residual offset is 0.48 mT and the static power consumption is 20 mW.

  2. Suppressing voltage transients in high voltage power supplies

    Lickel, K.F.; Stonebank, R.

    1979-01-01

    A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)

  3. Linear programming

    Solow, Daniel

    2014-01-01

    This text covers the basic theory and computation for a first course in linear programming, including substantial material on mathematical proof techniques and sophisticated computation methods. Includes Appendix on using Excel. 1984 edition.

  4. Linear algebra

    Liesen, Jörg

    2015-01-01

    This self-contained textbook takes a matrix-oriented approach to linear algebra and presents a complete theory, including all details and proofs, culminating in the Jordan canonical form and its proof. Throughout the development, the applicability of the results is highlighted. Additionally, the book presents special topics from applied linear algebra including matrix functions, the singular value decomposition, the Kronecker product and linear matrix equations. The matrix-oriented approach to linear algebra leads to a better intuition and a deeper understanding of the abstract concepts, and therefore simplifies their use in real world applications. Some of these applications are presented in detailed examples. In several ‘MATLAB-Minutes’ students can comprehend the concepts and results using computational experiments. Necessary basics for the use of MATLAB are presented in a short introduction. Students can also actively work with the material and practice their mathematical skills in more than 300 exerc...

  5. Linear algebra

    Berberian, Sterling K

    2014-01-01

    Introductory treatment covers basic theory of vector spaces and linear maps - dimension, determinants, eigenvalues, and eigenvectors - plus more advanced topics such as the study of canonical forms for matrices. 1992 edition.

  6. Linear Models

    Searle, Shayle R

    2012-01-01

    This 1971 classic on linear models is once again available--as a Wiley Classics Library Edition. It features material that can be understood by any statistician who understands matrix algebra and basic statistical methods.

  7. Benchmarking of Voltage Sag Generators

    Yang, Yongheng; Blaabjerg, Frede; Zou, Zhixiang

    2012-01-01

    The increased penetration of renewable energy systems, like photovoltaic and wind power systems, rises the concern about the power quality and stability of the utility grid. Some regulations for Low Voltage Ride-Through (LVRT) for medium voltage or high voltage applications, are coming into force...

  8. Charge-pump voltage converter

    Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

    2009-11-03

    A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

  9. LINEAR ACCELERATOR

    Christofilos, N.C.; Polk, I.J.

    1959-02-17

    Improvements in linear particle accelerators are described. A drift tube system for a linear ion accelerator reduces gap capacity between adjacent drift tube ends. This is accomplished by reducing the ratio of the diameter of the drift tube to the diameter of the resonant cavity. Concentration of magnetic field intensity at the longitudinal midpoint of the external sunface of each drift tube is reduced by increasing the external drift tube diameter at the longitudinal center region.

  10. Conservation voltage regulation (CVR) applied to energy savings by voltage-adjusting equipment through AMI

    Lan, B.-R.; Chang, C.-A.; Huang, P.-Y.; Kuo, C.-H.; Ye, Z.-J.; Shen, B.-C.; Chen, B.-K.

    2017-11-01

    Conservation voltage reduction (CVR) includes peak demand reduction, energy conservation, carbon emission reduction, and electricity bill reduction. This paper analyzes the energy-reduction of Siwei Feeders with applying CVR, which are situated in Penghu region and equipped with smart meters. Furthermore, the applicable voltage reduction range for the feeders will be explored. This study will also investigate how the CVR effect and energy conservation are improved with the voltage control devices integrated. The results of this study can serve as a reference for the Taiwan Power Company to promote and implement voltage reduction and energy conservation techniques. This study is expected to enhance the energy-reduction performance of the Penghu Low Carbon Island Project.

  11. Evaluation of the Voltage Support Strategies for the Low Voltage Grid Connected PV

    Demirok, Erhan; Sera, Dezso; Teodorescu, Remus

    2010-01-01

    Admissible range of grid voltage is one of the strictest constraints for the penetration of distributed photovoltaic (PV) generators especially connection to low voltage (LV) public networks. Voltage limits are usually fulfilled either by network reinforcements or limiting of power injections from...... PVs. In order to increase PV penetration level further, new voltage support control functions for individual inverters are required. This paper investigates distributed reactive power regulation and active power curtailment strategies regarding the development of PV connection capacity by evaluation...... of reactive power efforts and requirement of minimum active power curtailment. Furthermore, a small scale experimental setup is built to reflect real grid interaction in the laboratory by achieving critical types of grid (weak and sufficiently stiff)....

  12. Optimal dynamic voltage scaling for wireless sensor nodes with real-time constraints

    Cassandras, Christos G.; Zhuang, Shixin

    2005-11-01

    Sensors are increasingly embedded in manufacturing systems and wirelessly networked to monitor and manage operations ranging from process and inventory control to tracking equipment and even post-manufacturing product monitoring. In building such sensor networks, a critical issue is the limited and hard to replenish energy in the devices involved. Dynamic voltage scaling is a technique that controls the operating voltage of a processor to provide desired performance while conserving energy and prolonging the overall network's lifetime. We consider such power-limited devices processing time-critical tasks which are non-preemptive, aperiodic and have uncertain arrival times. We treat voltage scaling as a dynamic optimization problem whose objective is to minimize energy consumption subject to hard or soft real-time execution constraints. In the case of hard constraints, we build on prior work (which engages a voltage scaling controller at task completion times) by developing an intra-task controller that acts at all arrival times of incoming tasks. We show that this optimization problem can be decomposed into two simpler ones whose solution leads to an algorithm that does not actually require solving any nonlinear programming problems. In the case of soft constraints, this decomposition must be partly relaxed, but it still leads to a scalable (linear in the number of tasks) algorithm. Simulation results are provided to illustrate performance improvements in systems with intra-task controllers compared to uncontrolled systems or those using inter-task control.

  13. Flow-driven voltage generation in carbon nanotubes

    The flow of various liquids and gases over single-walled carbon nanotube bundles induces an electrical signal (voltage/current) in the sample along the direction of the flow. The electrical response generated by the flow of liquids is found to be logarithmic in the flow speed over a wide range. In contrast, voltage generated ...

  14. High voltage short plus generation based on avalanche circuit

    Hu Yuanfeng; Yu Xiaoqi

    2006-01-01

    Simulate the avalanche circuit in series with PSPICE module, design the high voltage short plus generation circuit by avalanche transistor in series for the sweep deflection circuit of streak camera. The output voltage ranges 1.2 KV into 50 ohm load. The rise time of the circuit is less than 3 ns. (authors)

  15. Transient voltage sharing in series-coupled high voltage switches

    Editorial Office

    1992-07-01

    Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analy­sis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus oc­curs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.

  16. High-voltage pulse generator for electron gun power supply

    Korenev, S.A.; Enchevich, I.B.; Mikhov, M.K.

    1987-01-01

    High-voltage pulse generator with combined capacitive and inductive energy storages for electron gun power supply is described. Hydrogen thyratron set in a short magnetic lense is a current breaker. Times of current interruption in thyratrons are in the range from 100 to 300 ns. With 1 kV charging voltage of capacitive energy storage 25 kV voltage pulse is obtained in the load. The given high-voltage pulse generator was used for supply of an electron gun generating 10-30 keV low-energy electron beam

  17. Coordinated Voltage Control of Distributed PV Inverters for Voltage Regulation in Low Voltage Distribution Networks

    Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna

    2017-01-01

    This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...

  18. Low cost photomultiplier high-voltage readout system

    Oxoby, G.J.; Kunz, P.F.

    1976-10-01

    The Large Aperture Solenoid Spectrometer (LASS) at Stanford Linear Accelerator Center (SLAC) requires monitoring over 300 voltages. This data is recorded on magnetic tapes along with the event data. It must also be displayed so that operators can easily monitor and adjust the voltages. A low-cost high-voltage readout system has been implemented to offer stand-alone digital readout capability as well as fast data transfer to a host computer. The system is flexible enough to permit use of a DVM or ADC and commercially available analogue multiplexers

  19. Logarithmic circuit with wide dynamic range

    Wiley, P. H.; Manus, E. A. (Inventor)

    1978-01-01

    A circuit deriving an output voltage that is proportional to the logarithm of a dc input voltage susceptible to wide variations in amplitude includes a constant current source which forward biases a diode so that the diode operates in the exponential portion of its voltage versus current characteristic, above its saturation current. The constant current source includes first and second, cascaded feedback, dc operational amplifiers connected in negative feedback circuit. An input terminal of the first amplifier is responsive to the input voltage. A circuit shunting the first amplifier output terminal includes a resistor in series with the diode. The voltage across the resistor is sensed at the input of the second dc operational feedback amplifier. The current flowing through the resistor is proportional to the input voltage over the wide range of variations in amplitude of the input voltage.

  20. New Insights into the Operating Voltage of Aqueous Supercapacitors.

    Yu, Minghao; Lu, Yongzhuang; Zheng, Haibing; Lu, Xihong

    2018-03-12

    The main limitation of aqueous supercapacitors (SCs) lies in their narrow operating voltages, especially when compared with organic SCs. Fundamental understanding of factors relevant to the operating voltage helps providing guidance for the assembly of high-voltage aqueous SCs. In this regard, this concept analyzes the deciding factors for the operating voltage of aqueous SCs. Strategies applied to expand the operating voltage are summarized and discussed from the aspects of electrolyte, electrode, and asymmetric structure. Dynamic factors associated with water electrolysis and maximally using the available potential ranges of electrodes are particularly emphasized. Finally, other promising approaches that have not been explored and their challenges are also elaborated, hoping to provide more insights for the design of high-voltage aqueous SCs. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Automatic Voltage Control (AVC) System under Uncertainty from Wind Power

    Qin, Nan; Abildgaard, Hans; Flynn, Damian

    2016-01-01

    An automatic voltage control (AVC) system maintains the voltage profile of a power system in an acceptable range and minimizes the operational cost by coordinating the regulation of controllable components. Typically, all of the parameters in the optimization problem are assumed to be certain...... and constant in the decision making process. However, for high shares of wind power, uncertainty in the decision process due to wind power variability may result in an infeasible AVC solution. This paper proposes a voltage control approach which considers the voltage uncertainty from wind power productions....... The proposed method improves the performance and the robustness of a scenario based approach by estimating the potential voltage variations due to fluctuating wind power production, and introduces a voltage margin to protect the decision against uncertainty for each scenario. The effectiveness of the proposed...

  2. Sensing voltage across lipid membranes

    Swartz, Kenton J.

    2009-01-01

    The detection of electrical potentials across lipid bilayers by specialized membrane proteins is required for many fundamental cellular processes such as the generation and propagation of nerve impulses. These membrane proteins possess modular voltage-sensing domains, a notable example being the S1-S4 domains of voltage-activated ion channels. Ground-breaking structural studies on these domains explain how voltage sensors are designed and reveal important interactions with the surrounding lipid membrane. Although further structures are needed to fully understand the conformational changes that occur during voltage sensing, the available data help to frame several key concepts that are fundamental to the mechanism of voltage sensing. PMID:19092925

  3. Non-sparking anodization process of AZ91D magnesium alloy under low AC voltage

    Li, Weiping; Li, Wen; Zhu, Liqun; Liu, Huicong; Wang, Xiaofang

    2013-01-01

    Highlights: ► Four different processes appear on magnesium alloys with applied voltage increase. ► Non-sparking film formation process occurred in the range of 6–10 V AC. ► The film was composed of Mg 2 SiO 4 with a stable growth rate in 30 min. ► Film growth was a balance of electrochemical dissolution and chemical deposition. -- Abstract: Anodization is widely recognized as one of the most important surface treatments for magnesium alloys. However, since high voltage oxidation films are limited in some applications due to porosity and brittleness, it is worthwhile to explore the non-sparking oxidizing process. In this work, AZ91D was electrochemically anodized at different AC voltages in an electrolyte containing 120 g/L NaOH and 80 g/L Na 2 SiO 3 ·9H 2 O. The effects of voltage on the surface morphology, composition and reaction process, especially the non-sparking discharge anodic film formation process, were investigated. The results showed that four different processes would appear according to the applied voltage variation from 6 V to 40 V, and that the non-sparking film formation process occurred in the range of 6–10 V. The film formed on the AZ91D surface under 10 V AC was mainly composed of Mg 2 SiO 4 with a lamellar structure. The horizontal and vertical expansion of the lamellar structure resulted in the formation of a multi-layered structure with a stable, linear growth rate for 30 min. The non-sparking film formation process can be considered to be the result of a balance of electrochemical dissolution and chemical deposition reaction

  4. Non-sparking anodization process of AZ91D magnesium alloy under low AC voltage

    Li, Weiping, E-mail: liweiping@buaa.edu.cn [Key Laboratory of Aerospace Materials and Performance (Ministry of Education), School of Materials Science and Engineering, Beihang University, Beijing 100191 (China); Li, Wen [AVIC Beijing Aeronautical Manufacturing Technology Research Institue, Beijing 100024 (China); Zhu, Liqun; Liu, Huicong; Wang, Xiaofang [Key Laboratory of Aerospace Materials and Performance (Ministry of Education), School of Materials Science and Engineering, Beihang University, Beijing 100191 (China)

    2013-04-20

    Highlights: ► Four different processes appear on magnesium alloys with applied voltage increase. ► Non-sparking film formation process occurred in the range of 6–10 V AC. ► The film was composed of Mg{sub 2}SiO{sub 4} with a stable growth rate in 30 min. ► Film growth was a balance of electrochemical dissolution and chemical deposition. -- Abstract: Anodization is widely recognized as one of the most important surface treatments for magnesium alloys. However, since high voltage oxidation films are limited in some applications due to porosity and brittleness, it is worthwhile to explore the non-sparking oxidizing process. In this work, AZ91D was electrochemically anodized at different AC voltages in an electrolyte containing 120 g/L NaOH and 80 g/L Na{sub 2}SiO{sub 3}·9H{sub 2}O. The effects of voltage on the surface morphology, composition and reaction process, especially the non-sparking discharge anodic film formation process, were investigated. The results showed that four different processes would appear according to the applied voltage variation from 6 V to 40 V, and that the non-sparking film formation process occurred in the range of 6–10 V. The film formed on the AZ91D surface under 10 V AC was mainly composed of Mg{sub 2}SiO{sub 4} with a lamellar structure. The horizontal and vertical expansion of the lamellar structure resulted in the formation of a multi-layered structure with a stable, linear growth rate for 30 min. The non-sparking film formation process can be considered to be the result of a balance of electrochemical dissolution and chemical deposition reaction.

  5. Performance improvement of a slip energy recovery drive system by a voltage-controlled technique

    Tunyasrirut, Satean [Department of Instrumentation Engineering, Faculty of Engineering, Pathumwan Institute of Technology, 833 Rama1 Road, Pathumwan, Bangkok 10330 (Thailand); Kinnares, Vijit [Department of Electrical Engineering, Faculty of Engineering, King Mongkut' s Institute of Technology Ladkrabang, Bangkok 10520 (Thailand); Ngamwiwit, Jongkol [Department of Control Engineering, Faculty of Engineering, King Mongkut' s Institute of Technology Ladkrabang, Bangkok 10520 (Thailand)

    2010-10-15

    This paper introduces the performance improvement of a slip energy recovery drive system for the speed control of a wound rotor induction motor by a voltage-controlled technique. The slip energy occurred in the rotor circuit is transferred back to ac mains supply through a reactor instead of a step up transformer. The objective of the voltage-controlled technique is to increase power factor of the system and to reduce low order harmonics of the input line current. The drive system is designed and implemented using a voltage source inverter in conjunction with a boost chopper for DC link voltage, instead of a conventional drive using a 6 pulse converter or a Scherbius system. The slip power is recovered by the help of a voltage source inverter (VSI) based on a space vector pulse width modulation (SVPWM) technique. In order to keep the speed of the wound rotor induction motor constant over a certain range of operating conditions, the servo state feedback controller designed by a linear quadratic regulator (LQR) is also introduced in this paper. The overall control system is implemented on DSP, DS1104'TMS320F240 controller board. The performance improvement of the proposed system is tested in comparison with the conventional Scherbius system and the modified conventional Scherbius system by a 12 pulse converter in conjunction with a chopper at steady state and at dynamic conditions. A 220 W wound motor is employed for testing. It is found that the motor speed can be controlled to be constant in the operating range of 450-1200 rpm at no load and full load. It is also found that the efficiency of the proposed system is remarkably increased since the harmonics of the input ac line current is reduced while the ac line input power factor is increased. (author)

  6. Linear regression

    Olive, David J

    2017-01-01

    This text covers both multiple linear regression and some experimental design models. The text uses the response plot to visualize the model and to detect outliers, does not assume that the error distribution has a known parametric distribution, develops prediction intervals that work when the error distribution is unknown, suggests bootstrap hypothesis tests that may be useful for inference after variable selection, and develops prediction regions and large sample theory for the multivariate linear regression model that has m response variables. A relationship between multivariate prediction regions and confidence regions provides a simple way to bootstrap confidence regions. These confidence regions often provide a practical method for testing hypotheses. There is also a chapter on generalized linear models and generalized additive models. There are many R functions to produce response and residual plots, to simulate prediction intervals and hypothesis tests, to detect outliers, and to choose response trans...

  7. Linear algebra

    Edwards, Harold M

    1995-01-01

    In his new undergraduate textbook, Harold M Edwards proposes a radically new and thoroughly algorithmic approach to linear algebra Originally inspired by the constructive philosophy of mathematics championed in the 19th century by Leopold Kronecker, the approach is well suited to students in the computer-dominated late 20th century Each proof is an algorithm described in English that can be translated into the computer language the class is using and put to work solving problems and generating new examples, making the study of linear algebra a truly interactive experience Designed for a one-semester course, this text adopts an algorithmic approach to linear algebra giving the student many examples to work through and copious exercises to test their skills and extend their knowledge of the subject Students at all levels will find much interactive instruction in this text while teachers will find stimulating examples and methods of approach to the subject

  8. Linearity in Process Languages

    Nygaard, Mikkel; Winskel, Glynn

    2002-01-01

    The meaning and mathematical consequences of linearity (managing without a presumed ability to copy) are studied for a path-based model of processes which is also a model of affine-linear logic. This connection yields an affine-linear language for processes, automatically respecting open......-map bisimulation, in which a range of process operations can be expressed. An operational semantics is provided for the tensor fragment of the language. Different ways to make assemblies of processes lead to different choices of exponential, some of which respect bisimulation....

  9. A high-voltage equipment (high voltage supply, high voltage pulse generators, resonant charging inductance, synchro-instruments for gyrotron frequency measurements) for plasma applications

    Spassov, Velin

    1996-01-01

    This document reports my activities as visitor-professor at the Gyrotron Project - INPE Plasma Laboratory. The main objective of my activities was designing, construction and testing a suitable high-voltage pulse generator for plasma applications, and efforts were concentrated on the following points: Design of high-voltage resonant power supply with tunable output (0 - 50 kV) for line-type high voltage pulse generator; design of line-type pulse generator (4 microseconds pulse duration, 0 - 25 kV tunable voltage) for non linear loads such as a gyrotron and P III reactor; design of resonant charging inductance for resonant line-type pulse generator, and design of high resolution synchro instrument for gyrotron frequency measurement. (author)

  10. Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

    William J.B. Heffernan

    2014-12-01

    Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

  11. Dual voltage power supply with 48 volt

    Froeschl, Joachim; Proebstle, Hartmut; Sirch, Ottmar [BMW Group, Muenchen (Germany)

    2012-11-01

    Automotive electrics/electronics have just reached a period of tremendous change. High voltage systems for Hybrid, Plug-In Hybrid or Battery Electric Vehicles with high power electric motors, high energy accumulators and electric climate compressors will be introduced in order to achieve the challenging targets for CO{sub 2} emissions and energy efficiency and to anticipate the mobility of the future. Additionally, innovations and the continuous increase of functionality for comfort, safety, driver assistance and infotainment systems require more and more electrical power of the vehicle power supply at all. On the one hand side electrified vehicles will certainly achieve a significant market share, on the other hand side they will increase the pressure to conventional vehicles with combustion engines for fuel consumption and CO{sub 2} emissions. These vehicles will be enabled to keep their competitiveness by new functions and the optimization of their electric systems. A dual voltage power supply with 48 Volt and 12 Volt will be one of the key technologies to realize these requirements. The power capability of the existing 12 Volt power supply has reached its limits. Further potentials can only be admitted by the introduction of 48 Volt. For this reason the car manufacturers Audi, BMW, Daimler, Porsche and Volkswagen started very early on this item and developed a common specification of the new voltage range. Now, it is necessary to identify the probable systems at this voltage range and to start the developments. (orig.)

  12. Improved detection of electrical activity with a voltage probe based on a voltage-sensing phosphatase.

    Tsutsui, Hidekazu; Jinno, Yuka; Tomita, Akiko; Niino, Yusuke; Yamada, Yoshiyuki; Mikoshiba, Katsuhiko; Miyawaki, Atsushi; Okamura, Yasushi

    2013-09-15

      One of the most awaited techniques in modern physiology is the sensitive detection of spatiotemporal electrical activity in a complex network of excitable cells. The use of genetically encoded voltage probes has been expected to enable such analysis. However, in spite of recent progress, existing probes still suffer from low signal amplitude and/or kinetics too slow to detect fast electrical activity. Here, we have developed an improved voltage probe named Mermaid2, which is based on the voltage-sensor domain of the voltage-sensing phosphatase from Ciona intestinalis and Förster energy transfer between a pair of fluorescent proteins. In mammalian cells, Mermaid2 permits ratiometric readouts of fractional changes of more than 50% over a physiologically relevant voltage range with fast kinetics, and it was used to follow a train of action potentials at frequencies of up to 150 Hz. Mermaid2 was also able to detect single action potentials and subthreshold voltage responses in hippocampal neurons in vitro, in addition to cortical electrical activity evoked by sound stimuli in single trials in living mice.

  13. Passive longitudinal phase space linearizer

    P. Craievich

    2010-03-01

    Full Text Available We report on the possibility to passively linearize the bunch compression process in electron linacs for the next generation x-ray free electron lasers. This can be done by using the monopole wakefields in a dielectric-lined waveguide. The optimum longitudinal voltage loss over the length of the bunch is calculated in order to compensate both the second-order rf time curvature and the second-order momentum compaction terms. Thus, the longitudinal phase space after the compression process is linearized up to a fourth-order term introduced by the convolution between the bunch and the monopole wake function.

  14. Cooperative Control with Virtual Selective Harmonic Capacitance for Harmonic Voltage Compensation in Islanded MicroGrids

    Micallef, A.; Apap, M.; Spitero-Stanies, C.

    2012-01-01

    This paper focuses on the islanded operation of microgrids. In this mode of operation, the microsources are required to cooperate autonomously to regulate the local grid voltage and frequency. Droop control is typically used to achieve this autonomous voltage and frequency regulation. Inverters...... having LCL output filters would cause voltage distortion to be present at the PCC of the local load when non-linear current is supplied to the load due to the voltage drop across the grid side inductor. Techniques to reduce the output voltage distortion typically consist of installing either passive...

  15. High voltage isolation transformer

    Clatterbuck, C. H.; Ruitberg, A. P. (Inventor)

    1985-01-01

    A high voltage isolation transformer is provided with primary and secondary coils separated by discrete electrostatic shields from the surfaces of insulating spools on which the coils are wound. The electrostatic shields are formed by coatings of a compound with a low electrical conductivity which completely encase the coils and adhere to the surfaces of the insulating spools adjacent to the coils. Coatings of the compound also line axial bores of the spools, thereby forming electrostatic shields separating the spools from legs of a ferromagnetic core extending through the bores. The transformer is able to isolate a high constant potential applied to one of its coils, without the occurrence of sparking or corona, by coupling the coatings, lining the axial bores to the ferromagnetic core and by coupling one terminal of each coil to the respective coating encasing the coil.

  16. Linear particle accelerator

    Richards, J.A.

    1977-01-01

    A linear particle accelerator which provides a pulsed beam of charged particles of uniform energy is described. The accelerator is in the form of an evacuated dielectric tube, inside of which a particle source is located at one end of the tube, with a target or window located at the other end of the dielectric tube. Along the length of the tube are externally located pairs of metal plates, each insulated from each other in an insulated housing. Each of the plates of a pair are connected to an electrical source of voltage of opposed polarity, with the polarity of the voltage of the plates oriented so that the plate of a pair, nearer to the particle source, is of the opposed polarity to the charge of the particle emitted by the source. Thus, a first plate about the tube located nearest the particle source, attracts a particle which as it passes through the tube past the first plate is then repelled by the reverse polarity of the second plate of the pair to continue moving towards the target

  17. A two-layer linear piezoelectric micromotor.

    Li, Xiaotian; Ci, Penghong; Liu, Guoxi; Dong, Shuxiang

    2015-03-01

    A first bending (B1) mode two-layer piezoelectric ultrasonic linear micromotor has been developed for microoptics driving applications. The piezo-vibrator of the micromotor was composed of two small Pb(Zr,Ti)O3 (PZT-5) plates, with overall dimensions and mass of only 2.0 × 2.0 × 5.0 mm(3) and 0.2 g, respectively. The proposed micromotor could operate either in single-phase voltage (standing wave) mode or two-phase voltage (traveling wave) mode to drive a slider via friction force to provide bidirectional linear motion. A large thrust of up to 0.30 N, which corresponds to a high unit volume direct driving force of 15 mN/mm(3), and a linear movement velocity of up to 230 mm/s were obtained under an applied voltage of 80 Vpp at the B1 mode resonance frequency of 174 kHz.

  18. Linear programming

    Karloff, Howard

    1991-01-01

    To this reviewer’s knowledge, this is the first book accessible to the upper division undergraduate or beginning graduate student that surveys linear programming from the Simplex Method…via the Ellipsoid algorithm to Karmarkar’s algorithm. Moreover, its point of view is algorithmic and thus it provides both a history and a case history of work in complexity theory. The presentation is admirable; Karloff's style is informal (even humorous at times) without sacrificing anything necessary for understanding. Diagrams (including horizontal brackets that group terms) aid in providing clarity. The end-of-chapter notes are helpful...Recommended highly for acquisition, since it is not only a textbook, but can also be used for independent reading and study. —Choice Reviews The reader will be well served by reading the monograph from cover to cover. The author succeeds in providing a concise, readable, understandable introduction to modern linear programming. —Mathematics of Computing This is a textbook intend...

  19. Direct model-based predictive control scheme without cost function for voltage source inverters with reduced common-mode voltage

    Kim, Jae-Chang; Moon, Sung-Ki; Kwak, Sangshin

    2018-04-01

    This paper presents a direct model-based predictive control scheme for voltage source inverters (VSIs) with reduced common-mode voltages (CMVs). The developed method directly finds optimal vectors without using repetitive calculation of a cost function. To adjust output currents with the CMVs in the range of -Vdc/6 to +Vdc/6, the developed method uses voltage vectors, as finite control resources, excluding zero voltage vectors which produce the CMVs in the VSI within ±Vdc/2. In a model-based predictive control (MPC), not using zero voltage vectors increases the output current ripples and the current errors. To alleviate these problems, the developed method uses two non-zero voltage vectors in one sampling step. In addition, the voltage vectors scheduled to be used are directly selected at every sampling step once the developed method calculates the future reference voltage vector, saving the efforts of repeatedly calculating the cost function. And the two non-zero voltage vectors are optimally allocated to make the output current approach the reference current as close as possible. Thus, low CMV, rapid current-following capability and sufficient output current ripple performance are attained by the developed method. The results of a simulation and an experiment verify the effectiveness of the developed method.

  20. Moderately nonlinear diffuse-charge dynamics under an ac voltage.

    Stout, Robert F; Khair, Aditya S

    2015-09-01

    The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of V_{o}/(k_{B}T/e), where V_{o} is the amplitude of the driving voltage and k_{B}T/e is the thermal voltage with k_{B} as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D/λ_{D}L, where D is the ion diffusivity, λ_{D} is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O(V_{o}^{3}) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in V_{o}. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing V_{o}. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

  1. Moderately nonlinear diffuse-charge dynamics under an ac voltage

    Stout, Robert F.; Khair, Aditya S.

    2015-09-01

    The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of Vo/(kBT /e ) , where Vo is the amplitude of the driving voltage and kBT /e is the thermal voltage with kB as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D /λDL , where D is the ion diffusivity, λD is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O (Vo3) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in Vo. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing Vo. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

  2. Temporary over voltages in the high voltage networks

    Vukelja, Petar; Naumov, Radomir; Mrvic, Jovan; Minovski, Risto

    2001-01-01

    The paper treats the temporary over voltages that may arise in the high voltage networks as a result of: ground faults, loss of load, loss of one or two phases and switching operation. Based on the analysis, the measures for their limitation are proposed. (Original)

  3. A novel high voltage start up circuit for an integrated switched mode power supply

    Hu Hao; Chen Xingbi, E-mail: huhao21@uestc.edu.c [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China)

    2010-09-15

    A novel high voltage start up circuit for providing an initial bias voltage to an integrated switched mode power supply (SMPS) is presented. An enhanced mode VDMOS transistor, the gate of which is biased by a floating p-island, is used to provide start up current and sustain high voltage. An NMOS transistor having a high source to ground breakdown voltage is included to extend the bias voltage range to the SMPS. Simulation results indicate that the high voltage start up circuit can start and restart as designed. The proposed structure is believed to be more energy saving and cost-effective compared with other solutions. (semiconductor devices)

  4. MEMS earthworm: a thermally actuated peristaltic linear micromotor

    Arthur, Craig; Ellerington, Neil; Hubbard, Ted; Kujath, Marek

    2011-03-01

    This paper examines the design, fabrication and testing of a bio-mimetic MEMS (micro-electro mechanical systems) earthworm motor with external actuators. The motor consists of a passive mobile shuttle with two flexible diamond-shaped segments; each segment is independently squeezed by a pair of stationary chevron-shaped thermal actuators. Applying a specific sequence of squeezes to the earthworm segments, the shuttle can be driven backward or forward. Unlike existing inchworm drives that use clamping and thrusting actuators, the earthworm actuators apply only clamping forces to the shuttle, and lateral thrust is produced by the shuttle's compliant geometry. The earthworm assembly is fabricated using the PolyMUMPs process with planar dimensions of 400 µm width by 800 µm length. The stationary actuators operate within the range of 4-9 V and provide a maximum shuttle range of motion of 350 µm (approximately half its size), a maximum shuttle speed of 17 mm s-1 at 10 kHz, and a maximum dc shuttle force of 80 µN. The shuttle speed was found to vary linearly with both input voltage and input frequency. The shuttle force was found to vary linearly with the actuator voltage.

  5. MEMS earthworm: a thermally actuated peristaltic linear micromotor

    Arthur, Craig; Ellerington, Neil; Hubbard, Ted; Kujath, Marek

    2011-01-01

    This paper examines the design, fabrication and testing of a bio-mimetic MEMS (micro-electro mechanical systems) earthworm motor with external actuators. The motor consists of a passive mobile shuttle with two flexible diamond-shaped segments; each segment is independently squeezed by a pair of stationary chevron-shaped thermal actuators. Applying a specific sequence of squeezes to the earthworm segments, the shuttle can be driven backward or forward. Unlike existing inchworm drives that use clamping and thrusting actuators, the earthworm actuators apply only clamping forces to the shuttle, and lateral thrust is produced by the shuttle's compliant geometry. The earthworm assembly is fabricated using the PolyMUMPs process with planar dimensions of 400 µm width by 800 µm length. The stationary actuators operate within the range of 4–9 V and provide a maximum shuttle range of motion of 350 µm (approximately half its size), a maximum shuttle speed of 17 mm s −1 at 10 kHz, and a maximum dc shuttle force of 80 µN. The shuttle speed was found to vary linearly with both input voltage and input frequency. The shuttle force was found to vary linearly with the actuator voltage.

  6. High voltage pulse generator. [Patent application

    Fasching, G.E.

    1975-06-12

    An improved high-voltage pulse generator is described which is especially useful in ultrasonic testing of rock core samples. An N number of capacitors are charged in parallel to V volts and at the proper instance are coupled in series to produce a high-voltage pulse of N times V volts. Rapid switching of the capacitors from the paralleled charging configuration to the series discharging configuration is accomplished by using silicon-controlled rectifiers which are chain self-triggered following the initial triggering of the first rectifier connected between the first and second capacitors. A timing and triggering circuit is provided to properly synchronize triggering pulses to the first SCR at a time when the charging voltage is not being applied to the parallel-connected charging capacitors. The output voltage can be readily increased by adding additional charging networks. The circuit allows the peak level of the output to be easily varied over a wide range by using a variable autotransformer in the charging circuit.

  7. A voltage to frequency converter for astronomical photometry

    Dunham, E.; Elliot, J. L.

    1978-01-01

    A voltage to frequency converter (VFC) for general use with photomultipliers is described. For high light levels, when the dead-time corrections for a photon counter would be excessive, the VFC maintains a linear response and allows the recording of data at high time resolution. Results of laboratory tests are given for the signal-to-noise characteristics, linearity, stability, and transient response of the VFC when used in conjunction with EMI 9658 and RCA C31034 photomultipliers.

  8. New method for determining avalanche breakdown voltage of silicon photomultipliers

    Chirikov-Zorin, I.

    2017-01-01

    The avalanche breakdown and Geiger mode of the silicon p-n junction is considered. A precise physically motivated method is proposed for determining the avalanche breakdown voltage of silicon photomultipliers (SiPM). The method is based on measuring the dependence of the relative photon detection efficiency (PDE rel ) on the bias voltage when one type of carriers (electron or hole) is injected into the avalanche multiplication zone of the p-n junction. The injection of electrons or holes from the base region of the SiPM semiconductor structure is performed using short-wave or long-wave light. At a low overvoltage (1-2 V) the detection efficiency is linearly dependent on the bias voltage; therefore, extrapolation to zero PDE rel value determines the SiPM avalanche breakdown voltage with an accuracy within a few millivolts. [ru

  9. Voltage-carrying states in superconducting microstrips

    Stuivinga, M.E.C.

    1983-01-01

    When the critical current is exceeded in a superconducting microstrip, voltage-carrying states with a resistance significantly below the normal state resistance can occur. Phase-slip centers (PSC) appear at about the critical temperature. These are successive local voltage units which manifest themselves as strip-like increments in voltage in the I-V characteristic. For temperatures off the critical temperature the PSC regime degenerates into a region of normal material, a so-called hot spot. These two phenomena, PSC and hot spots, form the subject of this thesis. To gain a better understanding of the phase-slip center process, an experiment was designed to measure local values of the quasi-particle and pair potential. The results of local potential and gap measurements at a PSC in aluminium are presented and discussed. Special attention is paid to pair-breaking interactions which can shorten the relaxation time. A non-linear differential equation is derived which describes the development of a PSC into a normal hot spot under the influence of Joule heating. It incorporates the temperature rise due to the dissipative processes occurring in the charge imbalance tails. Numerical solutions are presented for a set of parameters, including those for aluminium and tin. Subsequently, they are compared with experiments. (Auth.)

  10. Planning aspects of ac extra high voltage lines

    Engelhardt, H

    1964-01-01

    The technical points arising in any project for application of higher voltages on power grids in Europe are discussed. The cost aspects of two alternative ways of extending the voltage level of existing systems are discussed in detail. The short-circuit current in a high-power system with isolated or grounded neutral point and its relation to the mode of grounding is examined. For a transmission distance of 200 kVm, operating cost for each kWh transmitted are shown on curves for voltages of 220, 380 and 700 kV against transmitted energy. This shows that for any rated voltage there is a range of energy values which can be transmitted economically. Factors to be considered in maintaining, selecting or rejecting transformers and switchgear of other systems for higher voltage purposes are mentioned.

  11. Computer controlled high voltage system

    Kunov, B; Georgiev, G; Dimitrov, L [and others

    1996-12-31

    A multichannel computer controlled high-voltage power supply system is developed. The basic technical parameters of the system are: output voltage -100-3000 V, output current - 0-3 mA, maximum number of channels in one crate - 78. 3 refs.

  12. A Voltage Quality Detection Method

    Chen, Zhe; Wei, Mu

    2008-01-01

    This paper presents a voltage quality detection method based on a phase-locked loop (PLL) technique. The technique can detect the voltage magnitude and phase angle of each individual phase under both normal and fault power system conditions. The proposed method has the potential to evaluate various...

  13. Wide Range Portable Radiation Survey Meter for Emergency Monitoring

    Gangadharan, P.; Bhave, D. G.; Gokarn, R. S.; Khadake, R. G. [Directorate Of Radiation Protection, Bhabha Atomic Research Centre, Trombay, Bombay (India)

    1969-05-15

    The paper describes a portable battery-operated radiation survey meter for monitoring a wide range of X- and gamma-ray exposure rates from 1 mR/h to 100 R/h. The instrument Incorporates a halogen GM tube as the detector and a count-rate meter for indication. A transistorized d.c. -d.c. converter supplies the necessary high voltage to the GM counter. The instrument response has been made energy independent in the energy range 80 keV to 1.25 MeV. Further, the response is linear over the entire range of exposure rates. Suitable extension rods have been designed to provide sufficient separation between the probe and the meter in cases where remote monitoring is necessary because of high fields. (author)

  14. Voltage Controlled Dynamic Demand Response

    Bhattarai, Bishnu Prasad; Bak-Jensen, Birgitte; Mahat, Pukar

    2013-01-01

    Future power system is expected to be characterized by increased penetration of intermittent sources. Random and rapid fluctuations in demands together with intermittency in generation impose new challenges for power balancing in the existing system. Conventional techniques of balancing by large...... central or dispersed generations might not be sufficient for future scenario. One of the effective methods to cope with this scenario is to enable demand response. This paper proposes a dynamic voltage regulation based demand response technique to be applied in low voltage (LV) distribution feeders....... An adaptive dynamic model has been developed to determine composite voltage dependency of an aggregated load on feeder level. Following the demand dispatch or control signal, optimum voltage setting at the LV substation is determined based on the voltage dependency of the load. Furthermore, a new technique...

  15. Transient voltage oscillations in coils

    Chowdhuri, P.

    1985-01-01

    Magnet coils may be excited into internal voltage oscillations by transient voltages. Such oscillations may electrically stress the magnet's dielectric components to many times its normal stress. This may precipitate a dielectric failure, and the attendant prolonged loss of service and costly repair work. Therefore, it is important to know the natural frequencies of oscillations of a magnet during the design stage, and to determine whether the expected switching transient voltages can excite the magnet into high-voltage internal oscillations. The series capacitance of a winding significantly affects its natural frequencies. However, the series capacitance is difficult to calculate, because it may comprise complex capacitance network, consisting of intra- and inter-coil turn-to-turn capacitances of the coil sections. A method of calculating the series capacitance of a winding is proposed. This method is rigorous but simple to execute. The time-varying transient voltages along the winding are also calculated

  16. Design and Implementation of a High-Voltage Generator with Output Voltage Control for Vehicle ER Shock-Absorber Applications

    Chih-Lung Shen

    2013-01-01

    Full Text Available A self-oscillating high-voltage generator is proposed to supply voltage for a suspension system in order to control the damping force of an electrorheological (ER fluid shock absorber. By controlling the output voltage level of the generator, the damping force in the ER fluid shock absorber can be adjusted immediately. The shock absorber is part of the suspension system. The high-voltage generator drives a power transistor based on self-excited oscillation, which converts dc to ac. A high-frequency transformer with high turns ratio is used to increase the voltage. In addition, the system uses the car battery as dc power supply. By regulating the duty cycle of the main switch in the buck converter, the output voltage of the buck converter can be linearly adjusted so as to obtain a specific high voltage for ER. The driving system is self-excited; that is, no additional external driving circuit is required. Thus, it reduces cost and simplifies system structure. A prototype version of the actual product is studied to measure and evaluate the key waveforms. The feasibility of the proposed system is verified based on experimental results.

  17. Reduction of Linear Programming to Linear Approximation

    Vaserstein, Leonid N.

    2006-01-01

    It is well known that every Chebyshev linear approximation problem can be reduced to a linear program. In this paper we show that conversely every linear program can be reduced to a Chebyshev linear approximation problem.

  18. Strategies for Voltage Control and Transient Stability Assessment

    Hiskens, Ian A.

    2013-09-25

    As wind generation grows, its influence on power system performance will becoming increasingly noticeable. Wind generation di ffers from traditional forms of generation in numerous ways though, motivating the need to reconsider the usual approaches to power system assessment and performance enhancement. The project has investigated the impact of wind generation on transient stability and voltage control, identifying and addressing issues at three distinct levels of the power system: 1) at the device level, the physical characteristics of wind turbine generators (WTGs) are quite unlike those of synchronous machines, 2) at the wind-farm level, the provision of reactive support is achieved through coordination of numerous dissimilar devices, rather than straightforward generator control, and 3) from a systems perspective, the location of wind-farms on the sub-transmission network, coupled with the variability inherent in their power output, can cause complex voltage control issues. The project has sought to develop a thorough understanding of the dynamic behaviour of type-3 WTGs, and in particular the WECC generic model. The behaviour of such models is governed by interactions between the continuous dynamics of state variables and discrete events associated with limits. It was shown that these interactions can be quite complex, and may lead to switching deadlock that prevents continuation of the trajectory. Switching hysteresis was proposed for eliminating deadlock situations. Various type-3 WTG models include control blocks that duplicate integrators. It was shown that this leads to non-uniqueness in the conditions governing steady-state, and may result in pre- and post-disturbance equilibria not coinciding. It also gives rise to a zero eigenvalue in the linearized WTG model. In order to eliminate the anomalous behaviour revealed through this investigation, WECC has now released a new generic model for type-3 WTGs. Wind-farms typically incorporate a variety of

  19. Output voltage calculations in double barrier magnetic tunnel junctions with asymmetric voltage behavior

    Useinov, Arthur

    2011-10-22

    In this paper we study the asymmetric voltage behavior (AVB) of the tunnel magnetoresistance (TMR) for single and double barrier magnetic tunnel junctions (MTJs) in range of a quasi-classical free electron model. Numerical calculations of the TMR-V curves, output voltages and I-V characteristics for negative and positive values of applied voltages were carried out using MTJs with CoFeB/MgO interfaces as an example. Asymmetry of the experimental TMR-V curves is explained by different values of the minority and majority Fermi wave vectors for the left and right sides of the tunnel barrier, which arises due to different annealing regimes. Electron tunneling in DMTJs was simulated in two ways: (i) Coherent tunneling, where the DMTJ is modeled as one tunnel system and (ii) consecutive tunneling, where the DMTJ is modeled by two single barrier junctions connected in series. © 2012 Elsevier B.V. All rights reserved.

  20. Separating inverse spin Hall voltage and spin rectification voltage by inverting spin injection direction

    Zhang, Wenxu, E-mail: xwzhang@uestc.edu.cn; Peng, Bin; Han, Fangbin; Wang, Qiuru; Zhang, Wanli [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Soh, Wee Tee; Ong, Chong Kim [Center for Superconducting and Magnetic Materials, Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117551 (Singapore)

    2016-03-07

    We develop a method for universally resolving the important issue of separating the inverse spin Hall effect (ISHE) from the spin rectification effect (SRE) signal. This method is based on the consideration that the two effects depend on the spin injection direction: The ISHE is an odd function of the spin injection direction while the SRE is independent on it. Thus, the inversion of the spin injection direction changes the ISHE voltage signal, while the SRE voltage remains. It applies generally to analyzing the different voltage contributions without fitting them to special line shapes. This fast and simple method can be used in a wide frequency range and has the flexibility of sample preparation.

  1. Synchronised Voltage Space Vector Modulation for Three-level Inverters with Common-mode Voltage Elimination

    Oleschuk, Valentin; Blaabjerg, Frede

    2002-01-01

    A novel method of direct synchronous pulse-width modulation (PWM) is disseminated to three-level voltage source inverters with control algorithms with elimination of the common-mode voltages in three-phase drive systems with PWM. It provides smooth pulses-ratio changing and a quarter-wave symmetry...... of the voltage waveforms during the whole control range including overmodulation. Continuous, discontinuous and "direct-direct" schemes of synchronous PWM with both algebraic and trigonometric control functions have been analysed and compared. Simulations give the behaviour of the proposed methods and show some...... advantages of synchronous PWM in comparison with asynchronous at low ratios between the switching frequency and fundamental frequency....

  2. Mechanism of voltage-gated channel formation in lipid membranes.

    Guidelli, Rolando; Becucci, Lucia

    2016-04-01

    Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.

    Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J

    2017-10-01

    Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.

  4. Non-linear thermal fluctuations in a diode

    Kampen, N.G. van

    As an example of non-linear noise the fluctuations in a circuit consisting of a diode and a condenser C are studied. From the master equation for this system the following results are derived. 1. (i) The equilibrium distribution of the voltage is rigorously Gaussian, the average voltage being

  5. A large dynamic range radiation-tolerant analog memory in a quarter- micron CMOS technology

    Anelli, G; Rivetti, A

    2001-01-01

    An analog memory prototype containing 8*128 cells has been designed in a commercial quarter-micron CMOS process. The aim of this work is to investigate the possibility of designing large dynamic range mixed-mode switched capacitor circuits for high-energy physics (HEP) applications in deep submicron CMOS technologies. Special layout techniques have been used to make the circuit radiation tolerant. The memory cells employ gate-oxide capacitors for storage, permitting a very high density. A voltage write-voltage read architecture has been chosen to minimize the sensitivity to absolute capacitor values. The measured input voltage range is 2.3 V (the power supply voltage V/sub DD/ is equal to 2.5 V), with a linearity of almost 8 bits over 2 V. The dynamic range is more than 11 bits. The pedestal variation is +or-0.5 mV peak-to-peak. The noise measured, which is dominated by the noise of the measurement setup, is around 0.8 mV rms. The characteristics of the memory have been measured before irradiation and after 1...

  6. Modification of Modulating Anode Voltage Supply of Klystron for PEFP 20 MeV Linac

    Kim, Dae Il; Kwon, Hyeok Jung; Kim, Han Sung; Cho, Yong Sub

    2011-01-01

    The klystron (TH2089F, THALES) for PEFP 20MeV proton linear accelerator has a triode type electron gun and the modulating anode voltage should be supplied. The klystron has gone through some modification in the modulating anode voltage supply circuit. Formerly, the mod-anode voltage was supplied by using the tetrode-controlled voltage divider. This system requires addition power supply for the tetrode and the grid control circuit. Recently we modified the mod-anode supply from the tetrode-controlled voltage divider to a resistive voltage divider. The resistors for the previous voltage divider were installed at a supporter with high voltage bushing structure next to the klystron. In the previous system, the resistors were exposed to the air and their size was very bulky, length of which was about 1m long. To reduce the space occupied by the voltage divider and to improve the electrical insulation performance, the voltage dividing resistors were moved into the oil tank of the klystron. During the operation of the 20 MeV linac, the klystron parameters were measured. In this paper, the modification of the voltage divider and the operational characteristics of the klystron with modified voltage divider circuit are presented

  7. Equilibrium fluctuation relations for voltage coupling in membrane proteins.

    Kim, Ilsoo; Warshel, Arieh

    2015-11-01

    A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free

  8. A Hybrid Optimization Method for Reactive Power and Voltage Control Considering Power Loss Minimization

    Liu, Chengxi; Qin, Nan; Bak, Claus Leth

    2015-01-01

    This paper proposes a hybrid optimization method to optimally control the voltage and reactive power with minimum power loss in transmission grid. This approach is used for the Danish automatic voltage control (AVC) system which is typically a non-linear non-convex problem mixed with both...

  9. Computation of Steady State Nodal Voltages for Fast Security Assessment in Power Systems

    Møller, Jakob Glarbo; Jóhannsson, Hjörtur; Østergaard, Jacob

    2014-01-01

    Development of a method for real-time assess-ment of post-contingency nodal voltages is introduced. Linear network theory is applied in an algorithm that utilizes Thevenin equivalent representation of power systems as seen from every voltage-controlled node in a network. The method is evaluated b...

  10. Nonlinear Parasitic Capacitance Modelling of High Voltage Power MOSFETs in Partial SOI Process

    Fan, Lin; Knott, Arnold; Jørgensen, Ivan Harald Holger

    2016-01-01

    : off-state, sub-threshold region, and on-state in the linear region. A high voltage power MOSFET is designed in a partial Silicon on Insulator (SOI) process, with the bulk as a separate terminal. 3D plots and contour plots of the capacitances versus bias voltages for the transistor summarize...

  11. Voltage current characteristics of type III superconductors

    Dorofejev, G.L.; Imenitov, A.B.; Klimenko, E.Y.

    1980-01-01

    An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb 3 Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T. (author)

  12. Voltage current characteristics of type III superconductors

    Dorofeiev, G L; Imenitov, A B; Klimenko, E Y [Gosudarstvennyi Komitet po Ispol' zovaniyu Atomnoi Ehnergii SSSR, Moscow. Inst. Atomnoi Ehnergii

    1980-06-01

    An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogeneous monofilament and multifilament Nb-Ti, Nb-Zr,Nb/sub 3/Sn wires were investigated in different ranges of magnetic field, temperature and current. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (i.e. the surface corresponding to a certain conventional effective resistivity in T,B,J-space) and a description of any increasing parameter that depends on B and T.

  13. LOFT voltage insertion calibaration program

    Tillitt, D.N.; Miyasaki, F.S.

    1975-08-01

    The Loss-of-Fluid Test (LOFT) Facility is an experimental facility built around a ''scaled'' version of a large pressurized water reactor (LPWR). Part of this facility is the Data Acquisition and Visual Display System (DAVDS) as defined by the LOFT System Design Document SDD 1.4.2C. The DAVDS has a 702 data channel recording capability of which 548 are recorded digitally. The DAVDS also contains a Voltage Insertion Calibration Subsystem used to inject precise and known voltage steps into the recording systems. The computer program that controls the Voltage Insertion Calibration Subsystem is presented. 7 references. (auth)

  14. Power-MOSFET Voltage Regulator

    Miller, W. N.; Gray, O. E.

    1982-01-01

    Ninety-six parallel MOSFET devices with two-stage feedback circuit form a high-current dc voltage regulator that also acts as fully-on solid-state switch when fuel-cell out-put falls below regulated voltage. Ripple voltage is less than 20 mV, transient recovery time is less than 50 ms. Parallel MOSFET's act as high-current dc regulator and switch. Regulator can be used wherever large direct currents must be controlled. Can be applied to inverters, industrial furnaces photovoltaic solar generators, dc motors, and electric autos.

  15. A High Power Linear Solid State Pulser

    Boris Yen; Brent Davis; Rex Booth

    1999-01-01

    Particle Accelerators require high voltage and often high power. Typically the high voltage/power generation utilizes a topology with an extra energy store and a switching means to extract that stored energy. The switches may be active or passive devices. Active switches are hard or soft vacuum tubes, or semiconductors. When required voltages exceed tens of kilovolts, numerous semiconductors are stacked to withstand that potential. Such topologies can use large numbers of critical parts that, when in series, compromise the system reliability and performance. This paper describes a modular, linear, solid state amplifier which uses a parallel array of semiconductors, coupled with transmission line transformers. Such a design can provide output signals with voltages exceeding 10kV (into 50-ohms), and with rise and fall times (10-90 % amplitude) that are less than 1--ns. This compact solid state amplifier is modular, and has both hot-swap and soft fail capabilities

  16. Enhanced dielectric-wall linear accelerator

    Sampayan, Stephen E.; Caporaso, George J.; Kirbie, Hugh C.

    1998-01-01

    A dielectric-wall linear accelerator is enhanced by a high-voltage, fast e-time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators. A high voltage is placed between the electrodes sufficient to stress the voltage breakdown of the insulator on command. A light trigger, such as a laser, is focused along at least one line along the edge surface of the laminated alternating layers of isolated conductors and insulators extending between the electrodes. The laser is energized to initiate a surface breakdown by a fluence of photons, thus causing the electrical switch to close very promptly. Such insulators and lasers are incorporated in a dielectric wall linear accelerator with Blumlein modules, and phasing is controlled by adjusting the length of fiber optic cables that carry the laser light to the insulator surface.

  17. linear-quadratic-linear model

    Tanwiwat Jaikuna

    2017-02-01

    Full Text Available Purpose: To develop an in-house software program that is able to calculate and generate the biological dose distribution and biological dose volume histogram by physical dose conversion using the linear-quadratic-linear (LQL model. Material and methods : The Isobio software was developed using MATLAB version 2014b to calculate and generate the biological dose distribution and biological dose volume histograms. The physical dose from each voxel in treatment planning was extracted through Computational Environment for Radiotherapy Research (CERR, and the accuracy was verified by the differentiation between the dose volume histogram from CERR and the treatment planning system. An equivalent dose in 2 Gy fraction (EQD2 was calculated using biological effective dose (BED based on the LQL model. The software calculation and the manual calculation were compared for EQD2 verification with pair t-test statistical analysis using IBM SPSS Statistics version 22 (64-bit. Results: Two and three-dimensional biological dose distribution and biological dose volume histogram were displayed correctly by the Isobio software. Different physical doses were found between CERR and treatment planning system (TPS in Oncentra, with 3.33% in high-risk clinical target volume (HR-CTV determined by D90%, 0.56% in the bladder, 1.74% in the rectum when determined by D2cc, and less than 1% in Pinnacle. The difference in the EQD2 between the software calculation and the manual calculation was not significantly different with 0.00% at p-values 0.820, 0.095, and 0.593 for external beam radiation therapy (EBRT and 0.240, 0.320, and 0.849 for brachytherapy (BT in HR-CTV, bladder, and rectum, respectively. Conclusions : The Isobio software is a feasible tool to generate the biological dose distribution and biological dose volume histogram for treatment plan evaluation in both EBRT and BT.

  18. Solid-state high voltage modulator and its application to rf source high voltage power supplies

    Tooker, J.F.; Huynh, P.; Street, R.W.

    2009-01-01

    A solid-state high voltage modulator is described in which series-connected insulated-gate bipolar transistors (IGBTs) are switched at a fixed frequency by a pulse width modulation (PWM) regulator, that adjusts the pulse width to control the voltage out of an inductor-capacitor filter network. General Atomics proposed the HV power supply (HVPS) topology of multiple IGBT modulators connected to a common HVdc source for the large number of 1 MW klystrons in the linear accelerator of the Accelerator Production of Tritium project. The switching of 24 IGBTs to obtain 20 kVdc at 20 A for short pulses was successfully demonstrated. This effort was incorporated into the design of a -70 kV, 80 A, IGBT modulator, and in a short-pulse test 12 IGBTs regulated -5 kV at 50 A under PWM control. These two tests confirm the practicality of solid-state IGBT modulators to regulate high voltage at reasonable currents. Tokamaks such as ITER require large rf heating and current drive systems with multiple rf sources. A HVPS topology is presented that readily adapts to the three rf heating systems on ITER. To take advantage of the known economy of scale for power conversion equipment, a single HVdc source feeds multiple rf sources. The large power conversion equipment, which is located outside, converts the incoming utility line voltage directly to the HVdc needed for the class of rf sources connected to it, to further reduce cost. The HVdc feeds a set of IGBT modulators, one for each rf source, to independently control the voltage applied to each source, maximizing operational flexibility. Only the modulators are indoors, close to the rf sources, minimizing the use of costly near-tokamak floor space.

  19. Underwater Ranging

    S. P. Gaba

    1984-01-01

    The paper deals with underwater laser ranging system, its principle of operation and maximum depth capability. The sources of external noise and methods to improve signal-to-noise ratio are also discussed.

  20. Sigma-Delta Voltage to Frequency Converter With Phase Modulation Possibility

    STORK, Milan

    2014-01-01

    Voltage to frequency converter (VFC) is an oscillator whose frequency is linearly proportional to control voltage. There are two common VFC architectures: the current steering multivibrator and the charge-balance VFC. For higher linearity, the charge-balancing method is preferred. The charge balanced VFC may be made in asynchronous or synchronous (clocked) forms. The synchronous charge balanced VFC or "sigma delta" (S-D) VFC is used when output pulses are synchroni...

  1. Modular High Voltage Power Supply

    Newell, Matthew R. [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)

    2017-05-18

    The goal of this project is to develop a modular high voltage power supply that will meet the needs of safeguards applications and provide a modular plug and play supply for use with standard electronic racks.

  2. Design and Analysis of a Slope Voltage Control for a DFIG Wind Power Plant

    Martínez, J.; Kjær, P. C.; Rodriguez, Pedro

    2012-01-01

    This paper addresses a detailed design of a wind power plant and turbine slope voltage control in the presence of communication delays for a wide short-circuit ratio range operation. The implemented voltage control scheme is based upon the secondary voltage control concept, which offers fast...... of connection with the grid. The performance has been tested using PSCAD/EMTDC program. The plant layout used in the simulations is based on an installed wind power plant, composed of 23 doubly fed generator wind turbines. The resulting performance is evaluated using a compilation of grid code voltage control...... response to grid disturbances, despite the communication delays, i.e., this concept is based on a primary voltage control, located in the wind turbine, which follows an external voltage reference sent by a central controller, called secondary voltage control, which is controlling the voltage at the point...

  3. Reliability criteria for voltage stability

    Taylor, Carson W; Silverstein, Brian L [Bonneville Power Administration, Portland, OR (United States)

    1994-12-31

    In face of costs pressures, there is need to allocate scare resources more effectively in order to achieve voltage stability. This naturally leads to development of probabilistic criteria and notions of rick management. In this paper it is presented a discussion about criteria for long term voltage stability limited to the case in which the time frames are topically several minutes. (author) 14 refs., 1 fig.

  4. High voltage distributions in RPCs

    Inoue, Y.; Muranishi, Y.; Nakamura, M.; Nakano, E.; Takahashi, T.; Teramoto, Y.

    1996-01-01

    High voltage distributions on the inner surfaces of RPCs electrodes were calculated by using a two-dimensional resistor network model. The calculated result shows that the surface resistivity of the electrodes should be high, compared to their volume resistivity, to get a uniform high voltage over the surface. Our model predicts that the rate capabilities of RPCs should be inversely proportional to the thickness of the electrodes if the ratio of surface-to-volume resistivity is low. (orig.)

  5. Optimum voltage of auxiliary systems for thermal and nuclear power plants

    Tokumitsu, Iwao; Segawa, Motomichi

    1979-01-01

    In the power plants in Japan, their unit power output has been greatly enhanced since the introduction of new powerful thermal power plants from 1950's to 1960's. In both thermal and nuclear power plants, 1,000 MW machines have been already in operation. The increase of unit power output results in the increase of in-plant load capacity. Of these the voltage adopted for in-plant low voltage systems is now mainly 440 V at load terminals, and the voltage for in-plant high voltage systems has been changing to 6 kV level via 3 kV and 4 kV levels. As plant capacity increases, the load of low voltage systems significantly increases, and it is required to raise the voltage of 400 V level. By the way, the low voltage in AC is specified to be not higher than 600 V. This makes the change within the above range comparatively easy. Considering these conditions, it is recommended to change the voltage for low voltage systems to 575 V at power source terminals and 550 V at load terminals. Some merits in constructing power systems and in economy by raising the voltage were examined. Though demerits are also found, they are only about 15% of total merits. The most advantageous point in raising the voltage is to be capable of increasing the supplying range to low voltage system loads. (Wakatsuki, Y.)

  6. Macroeconomic Assessment of Voltage Sags

    Sinan Küfeoğlu

    2016-12-01

    Full Text Available The electric power sector has changed dramatically since the 1980s. Electricity customers are now demanding uninterrupted and high quality service from both utilities and authorities. By becoming more and more dependent on the voltage sensitive electronic equipment, the industry sector is the one which is affected the most by voltage disturbances. Voltage sags are one of the most crucial problems for these customers. The utilities, on the other hand, conduct cost-benefit analyses before going through new investment projects. At this point, understanding the costs of voltage sags become imperative for planning purposes. The characteristics of electric power consumption and hence the susceptibility against voltage sags differ considerably among different industry subsectors. Therefore, a model that will address the estimation of worth of electric power reliability for a large number of customer groups is necessary. This paper introduces a macroeconomic model to calculate Customer Voltage Sag Costs (CVSCs for the industry sector customers. The proposed model makes use of analytical data such as value added, annual energy consumption, working hours, and average outage durations and provides a straightforward, credible, and easy to follow methodology for the estimation of CVSCs.

  7. A matter of quantum voltages

    Sellner, Bernhard; Kathmann, Shawn M., E-mail: Shawn.Kathmann@pnnl.gov [Physical Sciences Division, Pacific Northwest National Laboratory, Richland, Washington 99352 (United States)

    2014-11-14

    Voltages inside matter are relevant to crystallization, materials science, biology, catalysis, and aqueous chemistry. The variation of voltages in matter can be measured by experiment, however, modern supercomputers allow the calculation of accurate quantum voltages with spatial resolutions of bulk systems well beyond what can currently be measured provided a sufficient level of theory is employed. Of particular interest is the Mean Inner Potential (V{sub o}) – the spatial average of these quantum voltages referenced to the vacuum. Here we establish a protocol to reliably evaluate V{sub o} from quantum calculations. Voltages are very sensitive to the distribution of electrons and provide metrics to understand interactions in condensed phases. In the present study, we find excellent agreement with measurements of V{sub o} for vitrified water and salt crystals and demonstrate the impact of covalent and ionic bonding as well as intermolecular/atomic interactions. Certain aspects in this regard are highlighted making use of simple model systems/approximations. Furthermore, we predict V{sub o} as well as the fluctuations of these voltages in aqueous NaCl electrolytes and characterize the changes in their behavior as the resolution increases below the size of atoms.

  8. Linear resonance acceleration of pellets

    Mills, R.G.

    1978-01-01

    A possible requirement for the acceleration of macroscopic pellets to velocities exceeding 10 4 meters per second implies the development of new apparatus. A satisfactory approach might be the linear resonance accelerator. Such apparatus would require the charging of pellets to very high values not yet demonstrated. The incompatibility of phase stability with radial stability in these machines may require abandoning phase stability and adopting feedback control of the accelerating voltage to accommodate statistical fluctuations in the charge to mass ratio of successive pellets

  9. Response of dairy cattle to transient voltages and magnetic fields

    Reinemann, D.J.; Laughlin, N.K.; Stetson, L.E.

    1995-01-01

    Stray voltages in dairy facilities have been studied since the 1970's. Previous research using steady-state ac and dc voltages has defined cow-contact voltage levels which may cause behavior and associated production problems. This research was designed to address concerns over possible effects of transient voltages and magnetic fields on dairy cows. Dairy cows response to transient voltages and magnetic fields was measured. The waveforms of the transient voltages applied were: 5 cycles of 60-Hz ac with a total pulse time of 83 ms, 1 cycle of 60-Hz ac with a total pulse time of 16 ms, and 1 cycle of an ac square wave (spiking positive and negative) of 2-ms duration. Alternating magnetic fields were produced by passing 60-Hz ac fundamental frequency with 2nd and 3rd harmonic and random noise components in metal structures around the cows. The maximum magnetic field associated with this current flow was in excess of 4 G. A wide range of sensitivity to transient voltages was observed among cows. Response levels from 24 cows to each transient exposure were normally distributed. No responses to magnetic fields were observed

  10. Voltage balancing strategies for serial connection of microbial fuel cells

    Khaled, Firas; Ondel, Olivier; Allard, Bruno; Buret, François

    2015-07-01

    The microbial fuel cell (MFC) converts electrochemically organic matter into electricity by means of metabolisms of bacteria. The MFC power output is limited by low voltage and low current characteristics in the range of microwatts or milliwatts per litre. In order to produce a sufficient voltage level (>1.5 V) and sufficient power to supply real applications such as autonomous sensors, it is necessary to either scale-up one single unit or to connect multiple units together. Many topologies of connection are possible as the serial association to improve the output voltage, or the parallel connection to improve the output current or the series/parallel connection to step-up both voltage and current. The association of MFCs in series is a solution to increase the voltage to an acceptable value and to mutualize the unit's output power. The serial association of a large number of MFCs presents several issues. The first one is the hydraulic coupling among MFCs when they share the same substrate. The second one is the dispersion between generators that lead to a non-optimal stack efficiency because the maximum power point (MPP) operation of all MFCs is not permitted. Voltage balancing is a solution to compensate non-uniformities towards MPP. This paper presents solutions to improve the efficiency of a stack of serially connected MFCs through a voltage-balancing circuit. Contribution to the topical issue "Electrical Engineering Symposium (SGE 2014)", edited by Adel Razek

  11. Performance test of 100 W linear compressor

    Ko, J; Ko, D. Y.; Park, S. J.; Kim, H. B.; Hong, Y. J.; Yeom, H. K. [Korea Institute of Machinery and Materials, Daejeon(Korea, Republic of)

    2013-09-15

    In this paper, we present test results of developed 100 W class linear compressor for Stirling-type pulse tube refrigerator. The fabricated linear compressor has dual-opposed configuration, free piston and moving magnet type linear motor. Power transfer, efficiency and required pressure waveform are predicted with designed and measured specifications. In experiments, room temperature test with flow impedance is conducted to evaluate performance of developed linear compressor. Flow impedance is loaded to compressor with metering valve for flow resistance, inertance tube for flow inertance and buffer volumes for flow compliance. Several operating parameters such as input voltage, current, piston displacement and pressure wave are measured for various operating frequency and fixed input current level. Behaviors of dynamics and performance of linear compressor as varying flow impedance are discussed with measured experimental results. The developed linear compressor shows 124 W of input power, 86 % of motor efficiency and 60 % of compressor efficiency at its resonant operating condition.

  12. Enhanced Voltage Control of VSC-HVDC Connected Offshore Wind Farms Based on Model Predictive Control

    Guo, Yifei; Gao, Houlei; Wu, Qiuwei

    2018-01-01

    This paper proposes an enhanced voltage control strategy (EVCS) based on model predictive control (MPC) for voltage source converter based high voltage direct current (VSCHVDC) connected offshore wind farms (OWFs). In the proposed MPC based EVCS, all wind turbine generators (WTGs) as well...... as the wind farm side VSC are optimally coordinated to keep voltages within the feasible range and reduce system power losses. Considering the high ratio of the OWF collector system, the effects of active power outputs of WTGs on voltage control are also taken into consideration. The predictive model of VSC...

  13. The pulse-driven AC Josephson voltage normal; Das pulsgetriebene AC-Josephson-Spannungsnormal

    Kieler, Oliver [Physikalisch-Technische Bundesanstalt (PTB), Braunschweig (Germany). Arbeitsgruppe 2.43 ' ' Josephson-Schaltungen' '

    2016-09-15

    In this contribution quantum precise alternating-voltage sources are presented, which make the generation of arbitrary wave forms with highest spectral purity with a high bandwidth from DC up to the MHz range possible. Heartpiece of these Josephson voltage normals is a serial circuit of many thousand Josephson contacts, which make by irradiation with high-frequency radiation (microwaves) the generation of highly precise voltage values possible. Thereby in the current-voltage characteristics stages of constant voltage, so called Shapiro stages, occur. Illustratively these stages can be described by the transfer of a certain number of flux quanta through the Josephson contacts.

  14. High-voltage test and training of plastic streamer tubes for the DELPHI hadron calorimeter

    Alekseev, G.D.; Cellar, S.; Khomenko, B.A.; Korytov, A.V.; Kulinich, P.A.; Micelmacher, G.V.; Sedykh, Yu.V.; Toledo, R.

    1987-01-01

    The results of high-voltage test and training of plastic streamer tubes of the DELPHI hadron calorimeter are presented. The testing technique is considered in detail. The equipment for high-voltage training consists of a mini-computer, CAMAC-electronics, a controllable high-voltage supply and a digital ampermeter. The experimental results shows that high-voltage training of streamer tubes improves their characteristics. The value of dark current decreased up to 1 μA. The operational voltage range increased by a value more than 300 V

  15. Mitigation of voltage sags in the distribution system with dynamic voltage restorer

    Viglas, D.; Belan, A.

    2012-01-01

    Dynamic voltage restorer is a custom power device that is used to improve voltage sags or swells in electrical distribution system. The components of the Dynamic Voltage Restorer consist of injection transformers, voltage source inverter, passive filters and energy storage. The main function of the Dynamic voltage restorer is used to inject three phase voltage in series and in synchronism with the grid voltages in order to compensate voltage disturbances. This article deals with mitigation of voltage sags caused by three-phase short circuit. Dynamic voltage restorer is modelled in MATLAB/Simulink. (Authors)

  16. Optimized Controller Design for a 12-Pulse Voltage Source Converter Based HVDC System

    Agarwal, Ruchi; Singh, Sanjeev

    2017-12-01

    The paper proposes an optimized controller design scheme for power quality improvement in 12-pulse voltage source converter based high voltage direct current system. The proposed scheme is hybrid combination of golden section search and successive linear search method. The paper aims at reduction of current sensor and optimization of controller. The voltage and current controller parameters are selected for optimization due to its impact on power quality. The proposed algorithm for controller optimizes the objective function which is composed of current harmonic distortion, power factor, and DC voltage ripples. The detailed designs and modeling of the complete system are discussed and its simulation is carried out in MATLAB-Simulink environment. The obtained results are presented to demonstrate the effectiveness of the proposed scheme under different transient conditions such as load perturbation, non-linear load condition, voltage sag condition, and tapped load fault under one phase open condition at both points-of-common coupling.

  17. Note: A 102 dB dynamic-range charge-sampling readout for ionizing particle/radiation detectors based on an application-specific integrated circuit (ASIC)

    Pullia, A.; Zocca, F.; Capra, S.

    2018-02-01

    An original technique for the measurement of charge signals from ionizing particle/radiation detectors has been implemented in an application-specific integrated circuit form. The device performs linear measurements of the charge both within and beyond its output voltage swing. The device features an unprecedented spectroscopic dynamic range of 102 dB and is suitable for high-resolution ion and X-γ ray spectroscopy. We believe that this approach may change a widespread paradigm according to which no high-resolution spectroscopy is possible when working close to or beyond the limit of the preamplifier's output voltage swing.

  18. The art of linear electronics

    Hood, John Linsley

    2013-01-01

    The Art of Linear Electronics presents the principal aspects of linear electronics and techniques in linear electronic circuit design. The book provides a wide range of information on the elucidation of the methods and techniques in the design of linear electronic circuits. The text discusses such topics as electronic component symbols and circuit drawing; passive and active semiconductor components; DC and low frequency amplifiers; and the basic effects of feedback. Subjects on frequency response modifying circuits and filters; audio amplifiers; low frequency oscillators and waveform generato

  19. Third-Order Elliptic Lowpass Filter for Multi-Standard Baseband Chain Using Highly Linear Digitally Programmable OTA

    Elamien, Mohamed B.; Mahmoud, Soliman A.

    2018-03-01

    In this paper, a third-order elliptic lowpass filter is designed using highly linear digital programmable balanced OTA. The filter exhibits a cutoff frequency tuning range from 2.2 MHz to 7.1 MHz, thus, it covers W-CDMA, UMTS, and DVB-H standards. The programmability concept in the filter is achieved by using digitally programmable operational transconductors amplifier (DPOTA). The DPOTA employs three linearization techniques which are the source degeneration, double differential pair and the adaptive biasing. Two current division networks (CDNs) are used to control the value of the transconductance. For the DPOTA, the third-order harmonic distortion (HD3) remains below -65 dB up to 0.4 V differential input voltage at 1.2 V supply voltage. The DPOTA and the filter are designed and simulated in 90 nm CMOS technology with LTspice simulator.

  20. Mammalian cortical astrocytes align themselves in a physiological voltage gradient.

    Borgens, R B; Shi, R; Mohr, T J; Jaeger, C B

    1994-07-01

    Astrocytes obtained from primary cultures of newborn rat cerebral cortex show a marked structural rearrangement to weak (50-500 mV/mm) applied voltage gradients. Astrocytes reorient their processes so that the cells are aligned perpendicular to the voltage gradient. At field strengths of 100 mV/mm or greater, this realignment occurs in over 90% of the cell population. Furthermore, these magnitudes of electric fields completely eliminate any parallel alignments originally observed prior to application of the voltage. Realignment usually occurs by a withdrawal, followed by an extension, of cell processes. These responses occur at voltage gradients within the physiological range that naturally exist across the neural tube during early development. We suggest the possibility that architectural arrangements of developing glia and, subsequently, neurons may be regulated by endogenous transepithelial potentials that exist across embryonic neuroepithelium.

  1. Ultra-Low Voltage Class AB Switched Current Memory Cell

    Igor, Mucha

    1996-01-01

    This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process with thr......This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process...... with threshold voltages of 0.9V. Both hand calculations and PSPICE simulations showed that the cells designed allowed a maximum signal range better than +/-13 micoamp, with a supply voltage down to 1V and a quiescent bias current of 1 microamp, resulting in a very high current efficiency and effective power...

  2. The transfer voltage standard for calibration outside of a laboratory

    Urekar Marjan

    2017-01-01

    Full Text Available The transfer voltage standard is designed for transferring the analog voltage from a calibrator to the process control workstation for multi-electrode electrolysis process in a plating plant. Transfer voltage standard is based on polypropylene capacitors and operational amplifiers with tera-ohm range input resistance needed for capacitor self-discharging effect cancellation. Dielectric absorption effect is described. An instrument for comparison of reference and control voltages is devised, based on precise window comparator. Detailed description of the main task is given, including constraints, theoretical and practical solutions. Procedure for usage of the standard outside of a laboratory conditions is explained. Comparison of expected and realized standard characteristics is given. [Project of the Serbian Ministry of Education, Science and Technological Development, Grant no. TR-32019

  3. Voltage control in smart grid using T2FLS

    Khodayar, Yaser; Sabahi, Kamel; Hajizadeh, Amin

    2017-01-01

    coordinated to keep the voltage within the standard range. Therefore, in this paper, a multi-agent controller based on type-2 fuzzy logic system (T2FLS) is utilized to coordinate the DG, ULTC, and load to regulate the voltage of the smart grid in the presence of noise and uncertainty. The proposed fuzzy...... system identifies the different parts of the smart grid as an agent (i.e. ULTC, DG, and load) and regulates the voltage by managing them. A 16-bus power system has been utilized to demonstrate the effectiveness of the proposed method. It has been shown that the proposed T2FLS controller outperforms...... the type-1 fuzzy controller and regulates the voltage in an appropriate way even in the presence of the different levels of measurement noise and uncertainty....

  4. Design & Fabrication of a High-Voltage Photovoltaic Cell

    Felder, Jennifer; /North Carolina State U. /SLAC

    2012-09-05

    Silicon photovoltaic (PV) cells are alternative energy sources that are important in sustainable power generation. Currently, applications of PV cells are limited by the low output voltage and somewhat low efficiency of such devices. In light of this fact, this project investigates the possibility of fabricating high-voltage PV cells on float-zone silicon wafers having output voltages ranging from 50 V to 2000 V. Three designs with different geometries of diffusion layers were simulated and compared in terms of metal coverage, recombination, built-in potential, and conduction current density. One design was then chosen and optimized to be implemented in the final device design. The results of the simulation serve as a feasibility test for the design concept and provide supportive evidence of the effectiveness of silicon PV cells as high-voltage power supplies.

  5. Polarized electron sources for linear colliders

    Clendenin, J.E.; Ecklund, S.D.; Miller, R.H.; Schultz, D.C.; Sheppard, J.C.

    1992-07-01

    Linear colliders require high peak current beams with low duty factors. Several methods to produce polarized e - beams for accelerators have been developed. The SLC, the first linear collider, utilizes a photocathode gun with a GaAs cathode. Although photocathode sources are probably the only practical alternative for the next generation of linear colliders, several problems remain to be solved, including high voltage breakdown which poisons the cathode, charge limitations that are associated with the condition of the semiconductor cathode, and a relatively low polarization of ≤5O%. Methods to solve or at least greatly reduce the impact of each of these problems are at hand

  6. Ultra-Low-Dropout Linear Regulator

    Thornton, Trevor; Lepkowski, William; Wilk, Seth

    2011-01-01

    A radiation-tolerant, ultra-low-dropout linear regulator can operate between -150 and 150 C. Prototype components were demonstrated to be performing well after a total ionizing dose of 1 Mrad (Si). Unlike existing components, the linear regulator developed during this activity is unconditionally stable over all operating regimes without the need for an external compensation capacitor. The absence of an external capacitor reduces overall system mass/volume, increases reliability, and lowers cost. Linear regulators generate a precisely controlled voltage for electronic circuits regardless of fluctuations in the load current that the circuit draws from the regulator.

  7. High voltage high brightness electron accelerators with MITL voltage adder coupled to foilless diodes

    Mazarakis, M.G.; Poukey, J.W.; Frost, C.A.; Shope, S.L.; Halbleib, J.A.; Turman, B.N.

    1993-01-01

    During the last ten years the authors have extensively studied the physics and operation of magnetically-immersed electron foilless diodes. Most of these sources were utilized as injectors to high current, high energy linear induction accelerators such as those of the RADLAC family. Recently they have experimentally and theoretically demonstrated that foilless diodes can be successfully coupled to self-magnetically insulated transmission line voltage adders to produce very small high brightness, high definition (no halo) electron beams. The RADLAC/SMILE experience opened the path to a new approach in high brightness, high energy induction accelerators. There is no beam drifting through the device. The voltage addition occurs in a center conductor, and the beam is created at the high voltage end in an applied magnetic field diode. This work was motivated by the remarkable success of the HERMES-III accelerator and the need to produce small radius, high energy, high current electron beams for air propagation studies and flash x-ray radiography. In this paper they present experimental results compared with analytical and numerical simulations in addition to design examples of devices that can produce multikiloamp electron beams of as high as 100 MV energies and radii as small as 1 mm

  8. Miniature linear cooler development

    Pruitt, G.R.

    1993-01-01

    An overview is presented of the status of a family of miniature linear coolers currently under development by Hughes Aircraft Co. for use in hand held, volume limited or power limited infrared applications. These coolers, representing the latest additions to the Hughes family of TOP trademark [twin-opposed piston] linear coolers, have been fabricated and tested in three different configurations. Each configuration is designed to utilize a common compressor assembly resulting in reduced manufacturing costs. The baseline compressor has been integrated with two different expander configurations and has been operated with two different levels of input power. These various configuration combinations offer a wide range of performance and interface characteristics which may be tailored to applications requiring limited power and size without significantly compromising cooler capacity or cooldown characteristics. Key cooler characteristics and test data are summarized for three combinations of cooler configurations which are representative of the versatility of this linear cooler design. Configurations reviewed include the shortened coldfinger [1.50 to 1.75 inches long], limited input power [less than 17 Watts] for low power availability applications; the shortened coldfinger with higher input power for lightweight, higher performance applications; and coldfingers compatible with DoD 0.4 Watt Common Module coolers for wider range retrofit capability. Typical weight of these miniature linear coolers is less than 500 grams for the compressor, expander and interconnecting transfer line. Cooling capacity at 80K at room ambient conditions ranges from 400 mW to greater than 550 mW. Steady state power requirements for maintaining a heat load of 150 mW at 80K has been shown to be less than 8 Watts. Ongoing reliability growth testing is summarized including a review of the latest test article results

  9. SVPWM Technique with Varying DC-Link Voltage for Common Mode Voltage Reduction in a Matrix Converter and Analytical Estimation of its Output Voltage Distortion

    Padhee, Varsha

    Common Mode Voltage (CMV) in any power converter has been the major contributor to premature motor failures, bearing deterioration, shaft voltage build up and electromagnetic interference. Intelligent control methods like Space Vector Pulse Width Modulation (SVPWM) techniques provide immense potential and flexibility to reduce CMV, thereby targeting all the afore mentioned problems. Other solutions like passive filters, shielded cables and EMI filters add to the volume and cost metrics of the entire system. Smart SVPWM techniques therefore, come with a very important advantage of being an economical solution. This thesis discusses a modified space vector technique applied to an Indirect Matrix Converter (IMC) which results in the reduction of common mode voltages and other advanced features. The conventional indirect space vector pulse-width modulation (SVPWM) method of controlling matrix converters involves the usage of two adjacent active vectors and one zero vector for both rectifying and inverting stages of the converter. By suitable selection of space vectors, the rectifying stage of the matrix converter can generate different levels of virtual DC-link voltage. This capability can be exploited for operation of the converter in different ranges of modulation indices for varying machine speeds. This results in lower common mode voltage and improves the harmonic spectrum of the output voltage, without increasing the number of switching transitions as compared to conventional modulation. To summarize it can be said that the responsibility of formulating output voltages with a particular magnitude and frequency has been transferred solely to the rectifying stage of the IMC. Estimation of degree of distortion in the three phase output voltage is another facet discussed in this thesis. An understanding of the SVPWM technique and the switching sequence of the space vectors in detail gives the potential to estimate the RMS value of the switched output voltage of any

  10. Inductive voltage adder (IVA) for submillimeter radius electron beam

    Mazarakis, M.G.; Poukey, J.W.; Maenchen, J.E.

    1996-01-01

    The authors have already demonstrated the utility of inductive voltage adder accelerators for production of small-size electron beams. In this approach, the inductive voltage adder drives a magnetically immersed foilless diode to produce high-energy (10--20 MeV), high-brightness pencil electron beams. This concept was first demonstrated with the successful experiments which converted the linear induction accelerator RADLAC II into an IVA fitted with a small 1-cm radius cathode magnetically immersed foilless diode (RADLAC II/SMILE). They present here first validations of extending this idea to mm-scale electron beams using the SABRE and HERMES-III inductive voltage adders as test beds. The SABRE experiments are already completed and have produced 30-kA, 9-MeV electron beams with envelope diameter of 1.5-mm FWHM. The HERMES-III experiments are currently underway

  11. Low Voltage Current Mode Switched-Current-Mirror Mixer

    Chunhua Wang

    2009-09-01

    Full Text Available A new CMOS active mixer topology can operate at 1 V supply voltage by use of SCM (switched currentmirror. Such current-mode mixer requires less voltage headroom with good linearization. Mixing is achieved with four improved current mirrors, which are alternatively activated. For ideal switching, the operation is equivalent to a conventional active mixer. This paper analyzes the performance of the SCM mixer, in comparison with the conventional mixer, demonstrating competitive performance at a lower supply voltage. Moreover, the new mixer’s die, without any passive components, is very small, and the conversion gain is easy to adjust. An experimental prototype was designed and simulated in standard chartered 0.18μm RF CMOS Process with Spectre in Cadence Design Systems. Experimental results show satisfactory mixer performance at 2.4 GHz.

  12. Linearity of bulk-controlled inverter ring VCO in weak and strong inversion

    Wismar, Ulrik Sørensen; Wisland, D.; Andreani, Pietro

    2007-01-01

    In this paper linearity of frequency modulation in voltage controlled inverter ring oscillators for non feedback sigma delta converter applications is studied. The linearity is studied through theoretical models of the oscillator operating at supply voltages above and below the threshold voltage......, process variations and temperature variations have also been simulated to indicate the advantages of having the soft rail bias transistor in the VCO....

  13. Low-Energy Real-Time OS Using Voltage Scheduling Algorithm for Variable Voltage Processors

    Okuma, Takanori; Yasuura, Hiroto

    2001-01-01

    This paper presents a real-time OS based on $ mu $ITRON using proposed voltage scheduling algorithm for variable voltage processors which can vary supply voltage dynamically. The proposed voltage scheduling algorithms assign voltage level for each task dynamically in order to minimize energy consumption under timing constraints. Using the presented real-time OS, running tasks with low supply voltage leads to drastic energy reduction. In addition, the presented voltage scheduling algorithm is ...

  14. Development of a New Cascade Voltage-Doubler for Voltage Multiplication

    Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri

    2014-01-01

    For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.

  15. Reactive power and voltage control strategy based on dynamic and adaptive segment for DG inverter

    Zhai, Jianwei; Lin, Xiaoming; Zhang, Yongjun

    2018-03-01

    The inverter of distributed generation (DG) can support reactive power to help solve the problem of out-of-limit voltage in active distribution network (ADN). Therefore, a reactive voltage control strategy based on dynamic and adaptive segment for DG inverter is put forward to actively control voltage in this paper. The proposed strategy adjusts the segmented voltage threshold of Q(U) droop curve dynamically and adaptively according to the voltage of grid-connected point and the power direction of adjacent downstream line. And then the reactive power reference of DG inverter can be got through modified Q(U) control strategy. The reactive power of inverter is controlled to trace the reference value. The proposed control strategy can not only control the local voltage of grid-connected point but also help to maintain voltage within qualified range considering the terminal voltage of distribution feeder and the reactive support for adjacent downstream DG. The scheme using the proposed strategy is compared with the scheme without the reactive support of DG inverter and the scheme using the Q(U) control strategy with constant segmented voltage threshold. The simulation results suggest that the proposed method has a significant improvement on solving the problem of out-of-limit voltage, restraining voltage variation and improving voltage quality.

  16. Cavity Voltage Phase Modulation MD

    Mastoridis, Themistoklis; Molendijk, John; Timko, Helga; CERN. Geneva. ATS Department

    2016-01-01

    The LHC RF/LLRF system is currently configured for extremely stable RF voltage to minimize transient beam loading effects. The present scheme cannot be extended beyond nominal beam current since the demanded power would exceed the peak klystron power and lead to saturation. A new scheme has therefore been proposed: for beam currents above nominal (and possibly earlier), the cavity phase modulation by the beam will not be corrected (transient beam loading), but the strong RF feedback and One-Turn Delay feedback will still be active for loop and beam stability in physics. To achieve this, the voltage set point will be adapted for each bunch. The goal of this MD was to test a new algorithm that would adjust the voltage set point to achieve the cavity phase modulation that would minimize klystron forward power.

  17. Design of shielded voltage divider for impulse voltage measurement

    Kato, Shohei; Kouno, Teruya; Maruyama, Yoshio; Kikuchi, Koji.

    1976-01-01

    The dividers used for the study of the insulation and electric discharge phenomena in high voltage equipments have the problems of the change of response characteristics owing to adjacent bodies and of induced noise. To improve the characteristics, the enclosed type divider shielded with metal has been investigated, and the divider of excellent response has been obtained by adopting the frequency-separating divider system, which is divided into two parts, resistance divider (lower frequency region) and capacitance divider (higher frequency region), for avoiding to degrade the response. Theoretical analysis was carried out in the cases that residual inductance can be neglected or can not be neglected in the small capacitance divider, and that the connecting wires are added. Next, the structure of the divider and the design of the electric field for the divider manufactured on the basis of the theory are described. The response characteristics were measured. The results show that 1 MV impulse voltage can be measured within the response time of 10 ns. Though this divider aims at the impulse voltage, the duration time of which is about that of standard lightning impulse, in view of the heat capacity because of the input resistance of 10.5 kΩ, it is expected that the divider can be applied to the voltage of longer duration time by increasing the input resistance in future. (Wakatsuki, Y.)

  18. Unbalanced Voltage Compensation in Low Voltage Residential AC Grids

    Trintis, Ionut; Douglass, Philip; Munk-Nielsen, Stig

    2016-01-01

    This paper describes the design and test of a control algorithm for active front-end rectifiers that draw power from a residential AC grid to feed heat pump loads. The control algorithm is able to control the phase to neutral or phase to phase RMS voltages at the point of common coupling...

  19. The high voltage homopolar generator

    Price, J. H.; Gully, J. H.; Driga, M. D.

    1986-11-01

    System and component design features of proposed high voltage homopolar generator (HVHPG) are described. The system is to have an open circuit voltage of 500 V, a peak output current of 500 kA, 3.25 MJ of stored inertial energy and possess an average magnetic-flux density of 5 T. Stator assembly components are discussed, including the stator, mount structure, hydrostatic bearings, main and motoring brushgears and rotor. Planned operational procedures such as monitoring the rotor to full speed and operation with a superconducting field coil are delineated.

  20. Linear Algebra and Smarandache Linear Algebra

    Vasantha, Kandasamy

    2003-01-01

    The present book, on Smarandache linear algebra, not only studies the Smarandache analogues of linear algebra and its applications, it also aims to bridge the need for new research topics pertaining to linear algebra, purely in the algebraic sense. We have introduced Smarandache semilinear algebra, Smarandache bilinear algebra and Smarandache anti-linear algebra and their fuzzy equivalents. Moreover, in this book, we have brought out the study of linear algebra and vector spaces over finite p...

  1. Comparison of screen-film combinations: results of a contrast detail study and interactive image quality analysis. Pt. 2. Linear assessment of grey scale ranges with interactive (automatic) image analysis

    Stamm, G.; Eichbaum, G.; Hagemann, G.

    1997-01-01

    The following three screen-film combinations were compared: (a) A combination of anticross-over film and UV-light emitting screens, (b) a combination of blue-light emitting screens and film, and (c) a conventional green fluorescing screen-film combination. Radiographs of a specially designed plexiglass phantom (0.2x0.2x0.12 m 3 ) with bar patterns of lead and plaster and of air, respectively were obtained using the following parameters: 12 pulse generator, 0.6 mm focus size, 4.7 mm aluminium prefilter, a grid with 40 lines/cm (12:1) and a focus-detector distance of 1.15 m. Image analysis was performed using an IBAS system and a Zeiss Kontron computer. Display conditions were the following: Display distance 0.12 m, a vario film objective 35/70 (Zeiss), a video camera tube with a Pb0 photocathode, 625 lines (Siemens Heimann), an IBAS image matrix of 512x512 pixels with a resolution of 7 lines/mm, the projected matrix area was 5000 μm 2 . Grey scale ranges were measured on a line perpendicular to the grouped bar patterns. The difference between the maximum and minimum density value served as signal. The spatial resolution of the detector system was measured when the signal value was three times higher than the standard deviation of the means of multiple density measurements. The results showed considerable advantages of the two new screen-film combinations as compared to the conventional screen-film combination. The result was contradictory to the findings with pure visual assessment of thresholds (part I) that had found no differences. The authors concluded that (automatic) interactive image analysis algorithms serve as an objective measure and are specifically advantageous when small differences in image quality are to be evaluated. (orig.) [de

  2. Resilient architecture design for voltage variation

    Reddi, Vijay Janapa

    2013-01-01

    Shrinking feature size and diminishing supply voltage are making circuits sensitive to supply voltage fluctuations within the microprocessor, caused by normal workload activity changes. If left unattended, voltage fluctuations can lead to timing violations or even transistor lifetime issues that degrade processor robustness. Mechanisms that learn to tolerate, avoid, and eliminate voltage fluctuations based on program and microarchitectural events can help steer the processor clear of danger, thus enabling tighter voltage margins that improve performance or lower power consumption. We describe

  3. Extended linear chain compounds

    Linear chain substances span a large cross section of contemporary chemistry ranging from covalent polymers, to organic charge transfer com­ plexes to nonstoichiometric transition metal coordination complexes. Their commonality, which coalesced intense interest in the theoretical and exper­ imental solid state physics/chemistry communities, was based on the obser­ vation that these inorganic and organic polymeric substrates exhibit striking metal-like electrical and optical properties. Exploitation and extension of these systems has led to the systematic study of both the chemistry and physics of highly and poorly conducting linear chain substances. To gain a salient understanding of these complex materials rich in anomalous aniso­ tropic electrical, optical, magnetic, and mechanical properties, the conver­ gence of diverse skills and talents was required. The constructive blending of traditionally segregated disciplines such as synthetic and physical organic, inorganic, and polymer chemistry, crystallog...

  4. Non-linear dielectric spectroscopy of microbiological suspensions

    Treo, Ernesto F; Felice, Carmelo J

    2009-01-01

    Background Non-linear dielectric spectroscopy (NLDS) of microorganism was characterized by the generation of harmonics in the polarization current when a microorganism suspension was exposed to a sinusoidal electric field. The biological nonlinear response initially described was not well verified by other authors and the results were susceptible to ambiguous interpretation. In this paper NLDS was performed to yeast suspension in tripolar and tetrapolar configuration with a recently developed analyzer. Methods Tripolar analysis was carried out by applying sinusoidal voltages up to 1 V at the electrode interface. Tetrapolar analysis was carried on with sinusoidal field strengths from 0.1 V cm-1 to 70 V cm-1. Both analyses were performed within a frequency range from 1 Hz through 100 Hz. The harmonic amplitudes were Fourier-analyzed and expressed in dB. The third harmonic, as reported previously, was investigated. Statistical analysis (ANOVA) was used to test the effect of inhibitor an activator of the plasma membrane enzyme in the measured response. Results No significant non-linearities were observed in tetrapolar analysis, and no observable changes occurred when inhibitor and activator were added to the suspension. Statistical analysis confirmed these results. When a pure sinus voltage was applied to an electrode-yeast suspension interface, variations higher than 25 dB for the 3rd harmonic were observed. Variation higher than 20 dB in the 3rd harmonics has also been found when adding an inhibitor or activator of the membrane-bounded enzymes. These variations did not occur when the suspension was boiled. Discussion The lack of result in tetrapolar cells suggest that there is no, if any, harmonic generation in microbiological bulk suspension. The non-linear response observed was originated in the electrode-electrolyte interface. The frequency and voltage windows observed in previous tetrapolar analysis were repeated in the tripolar measurements, but maximum were not

  5. Non-linear dielectric spectroscopy of microbiological suspensions

    Felice Carmelo J

    2009-09-01

    Full Text Available Abstract Background Non-linear dielectric spectroscopy (NLDS of microorganism was characterized by the generation of harmonics in the polarization current when a microorganism suspension was exposed to a sinusoidal electric field. The biological nonlinear response initially described was not well verified by other authors and the results were susceptible to ambiguous interpretation. In this paper NLDS was performed to yeast suspension in tripolar and tetrapolar configuration with a recently developed analyzer. Methods Tripolar analysis was carried out by applying sinusoidal voltages up to 1 V at the electrode interface. Tetrapolar analysis was carried on with sinusoidal field strengths from 0.1 V cm-1 to 70 V cm-1. Both analyses were performed within a frequency range from 1 Hz through 100 Hz. The harmonic amplitudes were Fourier-analyzed and expressed in dB. The third harmonic, as reported previously, was investigated. Statistical analysis (ANOVA was used to test the effect of inhibitor an activator of the plasma membrane enzyme in the measured response. Results No significant non-linearities were observed in tetrapolar analysis, and no observable changes occurred when inhibitor and activator were added to the suspension. Statistical analysis confirmed these results. When a pure sinus voltage was applied to an electrode-yeast suspension interface, variations higher than 25 dB for the 3rd harmonic were observed. Variation higher than 20 dB in the 3rd harmonics has also been found when adding an inhibitor or activator of the membrane-bounded enzymes. These variations did not occur when the suspension was boiled. Discussion The lack of result in tetrapolar cells suggest that there is no, if any, harmonic generation in microbiological bulk suspension. The non-linear response observed was originated in the electrode-electrolyte interface. The frequency and voltage windows observed in previous tetrapolar analysis were repeated in the tripolar

  6. Development of high voltage PEEK wire with radiation-resistance and cryogenic characteristics

    Fujita, T.; Hirata, T.; Araki, S.; Ohara, H.; Nishimura, H.

    1989-01-01

    High voltage electric wires insulated with highly-refined polyetheretherketone (PEEK) have been developed for the wiring in fusion reactors, where the wire is required to withstand high voltage under high vacuum up to 10 -5 Torr. The PEEK wires having the advantages of PEEK resin including superior radiation resistance and cryogenic characteristics are usable over a wide range of temperature and in radiation fields. The results of withstand voltage tests proved that the PEEK wires exceeding 0.8 mm in insulation thickness withstand such specified high voltage conditions as 24 kV for 1 minutes by 10 times and 6.6 kV for 110 hours. The results also revealed that the withstand voltage is improved by providing a jacket layer over the insulation and decreased by periodical voltage charge, by bending of the specimen and by water in the conductor. This paper deal with the withstand voltage test results under varied conditions of the PEEK wires. (author)

  7. A Voltage Modulated DPC Approach for Three-Phase PWM Rectifier

    Gui, Yonghao; Li, Mingshen; Lu, Jinghang

    2018-01-01

    In this paper, a voltage modulated direct power control for three-phase pulse-width modulated rectifier is proposed. With the suggested method, the differential equations describing the rectifier dynamics are changing from a linear time-varying system into a linear time-invariant one. In this way...

  8. Grain boundary effect of ZnO voltage sensitive ceramic

    Zhu Ziying; Lei Deming; Li Jingde

    1991-01-01

    Positron annihilation techenique has been to study the non-linear Ohmic effect of ZnO. The resemblence of curve representing the short life-time τ 1 and its component I 1 vs. current i with the voltage drop curve proves that this component I 1 belongs to the annihilation of transporting electron and positron. The experimental results give support to the explaination of Schottky barrier model for the effect of intergranular boundary

  9. Voltage Weak DC Distribution Grids

    Hailu, T.G.; Mackay, L.J.; Ramirez Elizondo, L.M.; Ferreira, J.A.

    2017-01-01

    This paper describes the behavior of voltage weak DC distribution systems. These systems have relatively small system capacitance. The size of system capacitance, which stores energy, has a considerable effect on the value of fault currents, control complexity, and system reliability. A number of

  10. Nonlinear electrokinetics at large voltages

    Bazant, Martin Z [Department of Chemical Engineering and Institute for Soldier Nanotechnologies, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Sabri Kilic, Mustafa; Ajdari, Armand [Department of Mathematics, Massachusetts Institute of Technology, Cambridge, MA 02139 (United States); Storey, Brian D [Franklin W Olin College of Engineering, Needham, MA 02492 (United States)], E-mail: bazant@mit.edu

    2009-07-15

    The classical theory of electrokinetic phenomena assumes a dilute solution of point-like ions in chemical equilibrium with a surface whose double-layer voltage is of order the thermal voltage, k{sub B}T/e=25 mV. In nonlinear 'induced-charge' electrokinetic phenomena, such as ac electro-osmosis, several volts {approx}100k{sub B}T/e are applied to the double layer, and the theory breaks down and cannot explain many observed features. We argue that, under such a large voltage, counterions 'condense' near the surface, even for dilute bulk solutions. Based on simple models, we predict that the double-layer capacitance decreases and the electro-osmotic mobility saturates at large voltages, due to steric repulsion and increased viscosity of the condensed layer, respectively. The former suffices to explain observed high-frequency flow reversal in ac electro-osmosis; the latter leads to a salt concentration dependence of induced-charge flows comparable to experiments, although a complete theory is still lacking.

  11. High voltage power network construction

    Harker, Keith

    2018-01-01

    This book examines the key requirements, considerations, complexities and constraints relevant to the task of high voltage power network construction, from design, finance, contracts and project management to installation and commissioning, with the aim of providing an overview of the holistic end to end construction task in a single volume.

  12. Voltage control of ferromagnetic resonance

    Ziyao Zhou

    2016-06-01

    Full Text Available Voltage control of magnetism in multiferroics, where the ferromagnetism and ferroelectricity are simultaneously exhibiting, is of great importance to achieve compact, fast and energy efficient voltage controllable magnetic/microwave devices. Particularly, these devices are widely used in radar, aircraft, cell phones and satellites, where volume, response time and energy consumption is critical. Researchers realized electric field tuning of magnetic properties like magnetization, magnetic anisotropy and permeability in varied multiferroic heterostructures such as bulk, thin films and nanostructure by different magnetoelectric (ME coupling mechanism: strain/stress, interfacial charge, spin–electromagnetic (EM coupling and exchange coupling, etc. In this review, we focus on voltage control of ferromagnetic resonance (FMR in multiferroics. ME coupling-induced FMR change is critical in microwave devices, where the electric field tuning of magnetic effective anisotropic field determines the tunability of the performance of microwave devices. Experimentally, FMR measurement technique is also an important method to determine the small effective magnetic field change in small amount of magnetic material precisely due to its high sensitivity and to reveal the deep science of multiferroics, especially, voltage control of magnetism in novel mechanisms like interfacial charge, spin–EM coupling and exchange coupling.

  13. High voltage MOSFET switching circuit

    McEwan, Thomas E.

    1994-01-01

    The problem of source lead inductance in a MOSFET switching circuit is compensated for by adding an inductor to the gate circuit. The gate circuit inductor produces an inductive spike which counters the source lead inductive drop to produce a rectangular drive voltage waveform at the internal gate-source terminals of the MOSFET.

  14. Non-linear effects and thermoelectric efficiency of quantum dot-based single-electron transistors.

    Talbo, Vincent; Saint-Martin, Jérôme; Retailleau, Sylvie; Dollfus, Philippe

    2017-11-01

    By means of advanced numerical simulation, the thermoelectric properties of a Si-quantum dot-based single-electron transistor operating in sequential tunneling regime are investigated in terms of figure of merit, efficiency and power. By taking into account the phonon-induced collisional broadening of energy levels in the quantum dot, both heat and electrical currents are computed in a voltage range beyond the linear response. Using our homemade code consisting in a 3D Poisson-Schrödinger solver and the resolution of the Master equation, the Seebeck coefficient at low bias voltage appears to be material independent and nearly independent on the level broadening, which makes this device promising for metrology applications as a nanoscale standard of Seebeck coefficient. Besides, at higher voltage bias, the non-linear characteristics of the heat current are shown to be related to the multi-level effects. Finally, when considering only the electronic contribution to the thermal conductance, the single-electron transistor operating in generator regime is shown to exhibit very good efficiency at maximum power.

  15. High-voltage pulsed generator for dynamic fragmentation of rocks.

    Kovalchuk, B M; Kharlov, A V; Vizir, V A; Kumpyak, V V; Zorin, V B; Kiselev, V N

    2010-10-01

    A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ∼50 ns, current amplitude of ∼6 kA with the 40 Ω active load, and ∼20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.

  16. High-voltage pulsed generator for dynamic fragmentation of rocks

    Kovalchuk, B. M.; Kharlov, A. V.; Vizir, V. A.; Kumpyak, V. V.; Zorin, V. B.; Kiselev, V. N.

    2010-10-01

    A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ˜50 ns, current amplitude of ˜6 kA with the 40 Ω active load, and ˜20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.

  17. Power supply and stabilization of the supply system on board using decentralized voltage rectifiers

    Grueb, W; Wegerer, K

    1987-04-01

    The functionally redundant power supply system of the Transrapid 06 II maglev train is described; it comprises four independent, battery-buffered networks and 30 linear generators per train section. Voltage rectifiers adapt the velocity- and load-dependent linear generator voltage to the 440 V d.c. networks and assure dynamic stabilisation as well as buffer battery loading. The result is a high-reliability power supply system on board with optimum utilisation of the power supplied by the linear generators while the train is running.

  18. Thyristor voltage converter in induction electric drives with microprocessor control

    Braslavsky, I.; Zuzev, A.; Shilin, S. [Electric Drive Department, Urals State Technical University, Ekaterinburg (Russian Federation)

    1997-12-31

    The paper consists of some results on developed pulse model of thyristor voltage converter which is one of the most mathematically complicated unit of electric drive. The model structure and model parameter calculating method are represented. The application of the model allows to analyse stability in `locally` by the linear pulse system theory methods with talking into consideration quantise processes within the converter. Such application provides the obtaining higher accurate results comparing with the non-linear system theory approximate methods. Logarithmic frequency characteristics are used to analyse converter dynamic features and they are represented too. (orig.) 4 refs.

  19. Extension of photomultiplier tube dynamic range for the LHAASO-KM2A electromagnetic particle detectors

    Lv, Hongkui, E-mail: lvhk@ihep.ac.cn [Key Laboratory of Particle Astrophysics, Institute of High Energy Physics, Chinese Academy of Sciences, Beijing 100049 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Sheng, Xiangdong; He, Huihai; Liu, Jia [Key Laboratory of Particle Astrophysics, Institute of High Energy Physics, Chinese Academy of Sciences, Beijing 100049 (China); Zhang, Zhongquan [Shandong University, Jinan 250100 (China); Hou, Chao; Zhao, Jing [Key Laboratory of Particle Astrophysics, Institute of High Energy Physics, Chinese Academy of Sciences, Beijing 100049 (China)

    2015-05-01

    In the Large High Altitude Air Shower Observatory (LHAASO), the 1 km{sup 2} array (KM2A) requires linear measurement of optical intensity with a wide dynamic range. Over 5000 photomultiplier tubes (PMTs) are employed in this experiment and developed as “two outputs” device (anode and dynode) to meet the relevant requirements. In this study, the linearity of the anode and the eighth dynode (DY8), which is limited by space charge effects and mainly related to the relative dynode voltage ratios of the PMT divider, is examined. A voltage divider for the Hamamatsu R11102 PMT is designed and a dramatically enhanced linearity is demonstrated. Test results show that this design can cover a wide dynamic range from 20 to 2×10{sup 5} photoelectrons and achieve a peak anode current of 380 mA at a PMT gain of 10{sup 5}, which satisfies the requirements of KM2A electromagnetic particle detectors. The circuit design has been successfully simulated using the simulation software Multisim. The details of PMT performance tests and simulations are described.

  20. Extension of photomultiplier tube dynamic range for the LHAASO-KM2A electromagnetic particle detectors

    Lv, Hongkui; Sheng, Xiangdong; He, Huihai; Liu, Jia; Zhang, Zhongquan; Hou, Chao; Zhao, Jing

    2015-05-01

    In the Large High Altitude Air Shower Observatory (LHAASO), the 1 km2 array (KM2A) requires linear measurement of optical intensity with a wide dynamic range. Over 5000 photomultiplier tubes (PMTs) are employed in this experiment and developed as "two outputs" device (anode and dynode) to meet the relevant requirements. In this study, the linearity of the anode and the eighth dynode (DY8), which is limited by space charge effects and mainly related to the relative dynode voltage ratios of the PMT divider, is examined. A voltage divider for the Hamamatsu R11102 PMT is designed and a dramatically enhanced linearity is demonstrated. Test results show that this design can cover a wide dynamic range from 20 to 2×105 photoelectrons and achieve a peak anode current of 380 mA at a PMT gain of 105, which satisfies the requirements of KM2A electromagnetic particle detectors. The circuit design has been successfully simulated using the simulation software Multisim. The details of PMT performance tests and simulations are described.

  1. Extension of photomultiplier tube dynamic range for the LHAASO-KM2A electromagnetic particle detectors

    Lv, Hongkui; Sheng, Xiangdong; He, Huihai; Liu, Jia; Zhang, Zhongquan; Hou, Chao; Zhao, Jing

    2015-01-01

    In the Large High Altitude Air Shower Observatory (LHAASO), the 1 km 2 array (KM2A) requires linear measurement of optical intensity with a wide dynamic range. Over 5000 photomultiplier tubes (PMTs) are employed in this experiment and developed as “two outputs” device (anode and dynode) to meet the relevant requirements. In this study, the linearity of the anode and the eighth dynode (DY8), which is limited by space charge effects and mainly related to the relative dynode voltage ratios of the PMT divider, is examined. A voltage divider for the Hamamatsu R11102 PMT is designed and a dramatically enhanced linearity is demonstrated. Test results show that this design can cover a wide dynamic range from 20 to 2×10 5 photoelectrons and achieve a peak anode current of 380 mA at a PMT gain of 10 5 , which satisfies the requirements of KM2A electromagnetic particle detectors. The circuit design has been successfully simulated using the simulation software Multisim. The details of PMT performance tests and simulations are described

  2. PLATEAUING COSMIC RAY DETECTORS TO ACHIEVE OPTIMUM OPERATING VOLTAGE

    Knoff, E.N.; Peterson, R.S.

    2008-01-01

    Through QuarkNet, students across the country have access to cosmic ray detectors in their high school classrooms. These detectors operate using a scintillator material and a photomultiplier tube (PMT). A data acquisition (DAQ) board counts cosmic ray hits from the counters. Through an online e-Lab, students can analyze and share their data. In order to collect viable data, the PMTs should operate at their plateau voltages. In these plateau ranges, the number of counts per minute remains relatively constant with small changes in PMT voltage. We sought to plateau the counters in the test array and to clarify the plateauing procedure itself. In order to most effectively plateau the counters, the counters should be stacked and programmed to record the number of coincident hits as well as their singles rates. We also changed the threshold value that a signal must exceed in order to record a hit and replateaued the counters. For counter 1, counter 2, and counter 3, we found plateau voltages around 1V. The singles rate plateau was very small, while the coincidence plateau was very long. The plateau voltages corresponded to a singles rate of 700–850 counts per minute. We found very little effect of changing the threshold voltages. Our chosen plateau voltages produced good performance studies on the e-Lab. Keeping in mind the nature of the experiments conducted by the high school students, we recommend a streamlined plateauing process. Because changing the threshold did not drastically affect the plateau voltage or the performance study, students should choose a threshold value, construct plateau graphs, and analyze their data using a performance study. Even if the counters operate slightly off their plateau voltage, they should deliver good performance studies and return reliable results.

  3. The current–voltage and capacitance–voltage characteristics at high temperatures of Au Schottky contact to n-type GaAs

    Özerli, Halil; Karteri, İbrahim [Department of Materials Science And Engineering, Kahramanmaraş Sütçü İmam University, 46100 Kahramanmaraş (Turkey); Karataş, Şükrü, E-mail: skaratas@ksu.edu.tr [Department of Materials Science And Engineering, Kahramanmaraş Sütçü İmam University, 46100 Kahramanmaraş (Turkey); Department of Physics, Kahramanmaraş Sütçü İmam University, 46100 Kahramanmaraş (Turkey); Altindal, Şemsettin [Department of Physics, Gazi University, 06100 Ankara (Turkey)

    2014-05-01

    Highlights: • The electronic parameters of the diode under temperature were investigated. • The barrier heights have a Gaussian distribution. • Au/n-GaAs diode exhibits a rectification behavior. - Abstract: We have investigated the temperature-dependent current–voltage (I–V) and capacitance–voltage (C–V) characteristics of Au/n-GaAs Schottky barrier diodes (SBDs) in the temperature range of 280–415 K. The barrier height for the Au/n-type GaAs SBDs from the I–V and C–V characteristics have varied from 0.901 eV to 0.963 eV (I–V) and 1.234 eV to 0.967 eV (C–V), and the ideality factor (n) from 1.45 to 1.69 in the temperature range 280–415 K. The conventional Richardson plots are found to be linear in the temperature range measured. Both the ln(I{sub 0}/T{sup 2}) versus (kT){sup −1} and ln(I{sub 0}/T{sup 2}) versus (nkT){sup −1} plots gives a straight line corresponding to activation energies 0.773 eV and 0.870 eV, respectively. A Φ{sub b0} versus 1/T plot was drawn to obtain evidence of a Gaussian distribution of the BHs, and values of Φ{sup ¯}{sub b0} = 1.071 eV and σ{sub 0} = 0.094 V for the mean BH and zero-bias standard deviation have been obtained from this plot.

  4. The current–voltage and capacitance–voltage characteristics at high temperatures of Au Schottky contact to n-type GaAs

    Özerli, Halil; Karteri, İbrahim; Karataş, Şükrü; Altindal, Şemsettin

    2014-01-01

    Highlights: • The electronic parameters of the diode under temperature were investigated. • The barrier heights have a Gaussian distribution. • Au/n-GaAs diode exhibits a rectification behavior. - Abstract: We have investigated the temperature-dependent current–voltage (I–V) and capacitance–voltage (C–V) characteristics of Au/n-GaAs Schottky barrier diodes (SBDs) in the temperature range of 280–415 K. The barrier height for the Au/n-type GaAs SBDs from the I–V and C–V characteristics have varied from 0.901 eV to 0.963 eV (I–V) and 1.234 eV to 0.967 eV (C–V), and the ideality factor (n) from 1.45 to 1.69 in the temperature range 280–415 K. The conventional Richardson plots are found to be linear in the temperature range measured. Both the ln(I 0 /T 2 ) versus (kT) −1 and ln(I 0 /T 2 ) versus (nkT) −1 plots gives a straight line corresponding to activation energies 0.773 eV and 0.870 eV, respectively. A Φ b0 versus 1/T plot was drawn to obtain evidence of a Gaussian distribution of the BHs, and values of Φ ¯ b0 = 1.071 eV and σ 0 = 0.094 V for the mean BH and zero-bias standard deviation have been obtained from this plot

  5. Pulsed voltage electrospray ion source and method for preventing analyte electrolysis

    Kertesz, Vilmos [Knoxville, TN; Van Berkel, Gary [Clinton, TN

    2011-12-27

    An electrospray ion source and method of operation includes the application of pulsed voltage to prevent electrolysis of analytes with a low electrochemical potential. The electrospray ion source can include an emitter, a counter electrode, and a power supply. The emitter can include a liquid conduit, a primary working electrode having a liquid contacting surface, and a spray tip, where the liquid conduit and the working electrode are in liquid communication. The counter electrode can be proximate to, but separated from, the spray tip. The power system can supply voltage to the working electrode in the form of a pulse wave, where the pulse wave oscillates between at least an energized voltage and a relaxation voltage. The relaxation duration of the relaxation voltage can range from 1 millisecond to 35 milliseconds. The pulse duration of the energized voltage can be less than 1 millisecond and the frequency of the pulse wave can range from 30 to 800 Hz.

  6. The supply voltage scaled dependency of the recovery of single event upset in advanced complementary metal—oxide—semiconductor static random-access memory cells

    Li Da-Wei; Qin Jun-Rui; Chen Shu-Ming

    2013-01-01

    Using computer-aided design three-dimensional simulation technology, the supply voltage scaled dependency of the recovery of single event upset and charge collection in static random-access memory cells are investigated. It reveals that the recovery linear energy transfer threshold decreases with the supply voltage reducing, which is quite attractive for dynamic voltage scaling and subthreshold circuit radiation-hardened design. Additionally, the effect of supply voltage on charge collection is also investigated. It is concluded that the supply voltage mainly affects the bipolar gain of the parasitical bipolar junction transistor (BJT) and the existence of the source plays an important role in supply voltage variation. (geophysics, astronomy, and astrophysics)

  7. A large dynamic range radiation tolerant analog memory in a quarter micron CMOS technology

    Anelli, G; Rivetti, A

    2000-01-01

    A 8*128 cell analog memory prototype has been designed in a commercial 0.25 jam CMOS process. The aim of this work was to investigate the possibility of designing large dynamic range mixed- mode switched capacitor circuits for High-Energy Physics (HEP) applications in deep submicron CMOS technologies. Special layout techniques have been used to make the circuit radiation tolerant left bracket 1 right bracket . The memory cells employ gate-oxide capacitors for storage, allowing for a very high density. A voltage write - voltage read architecture has been chosen to minimize the sensitivity to absolute capacitor values. The measured input voltage range is 2.3 V (V//D//D = 2.5 V), with a linearity of at least 7.5 bits over 2 V. The dynamic range is more than 11 bits. The pedestal variation is plus or minus 0.5 mV peak-to-peak. The noise measured, which is dominated by the noise of the measurement setup, is around 0.8 mV rms. The characteristics of the memory have been measured before irradiation and after lOMrd (...

  8. A comparative study of voltage stability indices in a power system

    Sinha, A.K. [I.I.T., Kharagpur (India). Dept. of Electrical Engineering; Hazarika, D. [Assam Engineering College (India)

    2000-11-01

    The paper compares the effectiveness of voltage stability indices in providing information about the proximity of voltage instability of a power system. Three simple voltage stability indices are proposed and their effectiveness is compared with some of the recently proposed indices. The comparison is carried out over a wide range of system operating conditions by changing the load power factor and feeder X/R ratios. Test results for the IEEE 57 bus and IEEE 118 bus system are presented. (author)

  9. The study, design and simulation of a free piston Stirling engine linear alternatorThe study, design and simulation of a free piston Stirling engine linear alternator

    Teodora Susana Oros

    2014-12-01

    Full Text Available This paper presents a study, design and simulation of a Free Piston Stirling Engine Linear Alternator. There are presented the main steps of the magnetic and electric calculations for a permanent magnet linear alternator of fixed coil and moving magnets type. Finally, a detailed thermal, mechanical and electrical model for a Stirling engine linear alternator have been made in SIMULINK simulation program. The linear alternator simulation model uses a controllable DC voltage which simulates the linear alternator combined with a rectifier, a variable load and a DC-DC converter, which compensates for the variable nature of Stirling engine operation, and ensures a constant voltage output regardless of the load.

  10. Square pulse linear transformer driver

    A. A. Kim

    2012-04-01

    Full Text Available The linear transformer driver (LTD technological approach can result in relatively compact devices that can deliver fast, high current, and high-voltage pulses straight out of the LTD cavity without any complicated pulse forming and pulse compression network. Through multistage inductively insulated voltage adders, the output pulse, increased in voltage amplitude, can be applied directly to the load. The usual LTD architecture [A. A. Kim, M. G. Mazarakis, V. A. Sinebryukhov, B. M. Kovalchuk, V. A. Vizir, S. N Volkov, F. Bayol, A. N. Bastrikov, V. G. Durakov, S. V. Frolov, V. M. Alexeenko, D. H. McDaniel, W. E. Fowler, K. LeCheen, C. Olson, W. A. Stygar, K. W. Struve, J. Porter, and R. M. Gilgenbach, Phys. Rev. ST Accel. Beams 12, 050402 (2009PRABFM1098-440210.1103/PhysRevSTAB.12.050402; M. G. Mazarakis, W. E. Fowler, A. A. Kim, V. A. Sinebryukhov, S. T. Rogowski, R. A. Sharpe, D. H. McDaniel, C. L. Olson, J. L. Porter, K. W. Struve, W. A. Stygar, and J. R. Woodworth, Phys. Rev. ST Accel. Beams 12, 050401 (2009PRABFM1098-440210.1103/PhysRevSTAB.12.050401] provides sine shaped output pulses that may not be well suited for some applications like z-pinch drivers, flash radiography, high power microwaves, etc. A more suitable power pulse would have a flat or trapezoidal (rising or falling top. In this paper, we present the design and first test results of an LTD cavity that generates such a type of output pulse by including within its circular array a number of third harmonic bricks in addition to the main bricks. A voltage adder made out of a square pulse cavity linear array will produce the same shape output pulses provided that the timing of each cavity is synchronized with the propagation of the electromagnetic pulse.

  11. Functionalized linear and cyclic polyolefins

    Tuba, Robert; Grubbs, Robert H.

    2018-02-13

    This invention relates to methods and compositions for preparing linear and cyclic polyolefins. More particularly, the invention relates to methods and compositions for preparing functionalized linear and cyclic polyolefins via olefin metathesis reactions. Polymer products produced via the olefin metathesis reactions of the invention may be utilized for a wide range of materials applications. The invention has utility in the fields of polymer and materials chemistry and manufacture.

  12. Effect of bias voltage on microstructure and mechanical properties of ...

    In the present study, authors report on the effect that substrate bias voltage has on the ... ings and at high deposition rates, having a wide range of .... The coatings were then ultra- ... The results of a typical compositional analysis carried out.

  13. Integrated Reconfigurable High-Voltage Transmitting Circuit for CMUTs

    Llimos Muntal, Pere; Larsen, Dennis Øland; Jørgensen, Ivan Harald Holger

    2014-01-01

    -out and measurements are performed on the integrated circuit. The transmitting circuit is reconfigurable externally making it able to drive a wide variety of CMUTs. The transmitting circuit can generate several pulse shapes, pulse voltages up to 100 V, maximum pulse range of 50 V and frequencies up to 5 MHz. The area...

  14. Non-linear osmosis

    Diamond, Jared M.

    1966-01-01

    1. The relation between osmotic gradient and rate of osmotic water flow has been measured in rabbit gall-bladder by a gravimetric procedure and by a rapid method based on streaming potentials. Streaming potentials were directly proportional to gravimetrically measured water fluxes. 2. As in many other tissues, water flow was found to vary with gradient in a markedly non-linear fashion. There was no consistent relation between the water permeability and either the direction or the rate of water flow. 3. Water flow in response to a given gradient decreased at higher osmolarities. The resistance to water flow increased linearly with osmolarity over the range 186-825 m-osM. 4. The resistance to water flow was the same when the gall-bladder separated any two bathing solutions with the same average osmolarity, regardless of the magnitude of the gradient. In other words, the rate of water flow is given by the expression (Om — Os)/[Ro′ + ½k′ (Om + Os)], where Ro′ and k′ are constants and Om and Os are the bathing solution osmolarities. 5. Of the theories advanced to explain non-linear osmosis in other tissues, flow-induced membrane deformations, unstirred layers, asymmetrical series-membrane effects, and non-osmotic effects of solutes could not explain the results. However, experimental measurements of water permeability as a function of osmolarity permitted quantitative reconstruction of the observed water flow—osmotic gradient curves. Hence non-linear osmosis in rabbit gall-bladder is due to a decrease in water permeability with increasing osmolarity. 6. The results suggest that aqueous channels in the cell membrane behave as osmometers, shrinking in concentrated solutions of impermeant molecules and thereby increasing membrane resistance to water flow. A mathematical formulation of such a membrane structure is offered. PMID:5945254

  15. Study on the streamer inception characteristics under positive lightning impulse voltage

    Zezhong Wang

    2017-11-01

    Full Text Available The streamer is the main process in an air gap discharge, and the inception characteristics of streamers have been widely applied in engineering. Streamer inception characteristics under DC voltage have been studied by many researchers, but the inception characteristics under impulse voltage, and particularly under lightning impulse voltage with a high voltage rise rate have rarely been studied. A measurement system based on integrated optoelectronic technology has been proposed in this paper, and the streamer inception characteristics in a 1-m-long rod-plane air gap that was energized by a positive lightning impulse voltage have been researched. We have also measured the streamer inception electric field using electrodes with different radii of curvature and different voltage rise rates. As a result, a modified empirical criterion for the streamer inception electric field that considers the voltage rise rate has been proposed, and the wide applicability of this criterion has been proved. Based on the streamer inception time-lag obtained, we determined that the field distribution obeys a Rayleigh distribution, which explains the change law of the streamer inception time-lag. The characteristic parameter of the Rayleigh distribution lies in the range from 0.6 to 2.5 when the radius of curvature of the electrode head is in the range from 0.5 cm to 2.5 cm and the voltage rise rate ranges from 80 kV/μs to 240kV/μs under positive lightning impulse voltage.

  16. Study on the streamer inception characteristics under positive lightning impulse voltage

    Wang, Zezhong; Geng, Yinan

    2017-11-01

    The streamer is the main process in an air gap discharge, and the inception characteristics of streamers have been widely applied in engineering. Streamer inception characteristics under DC voltage have been studied by many researchers, but the inception characteristics under impulse voltage, and particularly under lightning impulse voltage with a high voltage rise rate have rarely been studied. A measurement system based on integrated optoelectronic technology has been proposed in this paper, and the streamer inception characteristics in a 1-m-long rod-plane air gap that was energized by a positive lightning impulse voltage have been researched. We have also measured the streamer inception electric field using electrodes with different radii of curvature and different voltage rise rates. As a result, a modified empirical criterion for the streamer inception electric field that considers the voltage rise rate has been proposed, and the wide applicability of this criterion has been proved. Based on the streamer inception time-lag obtained, we determined that the field distribution obeys a Rayleigh distribution, which explains the change law of the streamer inception time-lag. The characteristic parameter of the Rayleigh distribution lies in the range from 0.6 to 2.5 when the radius of curvature of the electrode head is in the range from 0.5 cm to 2.5 cm and the voltage rise rate ranges from 80 kV/μs to 240kV/μs under positive lightning impulse voltage.

  17. Voltage distribution in tapered winding of tesla-transformer during discharge process of PFL

    Xin Jiaqi; Chang Anbi; Li Mingjia; Kang Qiang

    2007-01-01

    The operation principle of integral construction of Tesla transformer and PFL was investigated in Tesla-transformer-type accelerator. Experiment was carried out on Tesla transformer's secondary winding to study the impulse voltage distribution while PFL was discharging. The regularities of turn-ground voltage distribution and interturn voltage distribution were summarized. Voltage distribution within PFL was calculated and it was compared with the experimental result. Structural winding of parallel coils in the head, parallel coils in the end and shading ring were used to improve voltage distribution and that was testified by experiment. The results indicate that taper winding doesn't effect electric field within PFL, the turn-ground voltage appears linearly, the interturn voltage fluctuates seriously and it is the biggest in head of winding. The three optimized methods help to depress oscillation, the structural winding of parallel coils in the head decreases the interturn voltage in head of winding remark-ably and the parallel coils in the end decrease the interturn voltage in the end. (authors)

  18. Analyzing randomly occurring voltage breakdowns

    Wiltshire, C.W.

    1977-01-01

    During acceptance testing of high-vacuum neutron tubes, 40% of the tubes failed after experiencing high-voltage breakdowns during the aging process. Use of a digitizer in place of an oscilloscope revealed two types of breakdowns, only one of which affected acceptance testing. This information allowed redesign of the aging sequence to prevent tube damage and improve yield and quality of the final product

  19. Advances in high voltage engineering

    Haddad, A

    2005-01-01

    This book addresses the very latest research and development issues in high voltage technology and is intended as a reference source for researchers and students in the field, specifically covering developments throughout the past decade. This unique blend of expert authors and comprehensive subject coverage means that this book is ideally suited as a reference source for engineers and academics in the field for years to come.

  20. High-voltage CMOS detectors

    Ehrler, F.; Blanco, R.; Leys, R.; Perić, I.

    2016-01-01

    High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.

  1. Low voltage electron beam accelerators

    Ochi, Masafumi

    2003-01-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  2. High-voltage CMOS detectors

    Ehrler, F., E-mail: felix.ehrler@student.kit.edu; Blanco, R.; Leys, R.; Perić, I.

    2016-07-11

    High-voltage CMOS (HVCMOS) pixel sensors are depleted active pixel sensors implemented in standard commercial CMOS processes. The sensor element is the n-well/p-substrate diode. The sensor electronics are entirely placed inside the n-well which is at the same time used as the charge collection electrode. High voltage is used to deplete the part of the substrate around the n-well. HVCMOS sensors allow implementation of complex in-pixel electronics. This, together with fast signal collection, allows a good time resolution, which is required for particle tracking in high energy physics. HVCMOS sensors will be used in Mu3e experiment at PSI and are considered as an option for both ATLAS and CLIC (CERN). Radiation tolerance and time walk compensation have been tested and results are presented. - Highlights: • High-voltage CMOS sensors will be used in Mu3e experiment at PSI (Switzerland). • HVCMOS sensors are considered as an option for ATLAS (LHC/CERN) and CLIC (CERN). • Efficiency of more than 95% (99%) has been measured with (un-)irradiated chips. • The time resolution measured in the beam tests is nearly 100 ns. • We plan to improve time resolution and efficiency by using high-resistive substrate.

  3. Low voltage electron beam accelerators

    Ochi, Masafumi [Iwasaki Electric Co., Ltd., Tokyo (Japan)

    2003-02-01

    Widely used electron accelerators in industries are the electron beams with acceleration voltage at 300 kV or less. The typical examples are shown on manufactures in Japan, equipment configuration, operation, determination of process parameters, and basic maintenance requirement of the electron beam processors. New electron beam processors with acceleration voltage around 100 kV were introduced maintaining the relatively high dose speed capability of around 10,000 kGy x mpm at production by ESI (Energy Science Inc. USA, Iwasaki Electric Group). The application field like printing and coating for packaging requires treating thickness of 30 micron or less. It does not require high voltage over 110 kV. Also recently developed is a miniature bulb type electron beam tube with energy less than 60 kV. The new application area for this new electron beam tube is being searched. The drive force of this technology to spread in the industries would be further development of new application, process and market as well as the price reduction of the equipment, upon which further acknowledgement and acceptance of the technology to societies and industries would entirely depend. (Y. Tanaka)

  4. Light-voltage conversion apparatus

    Fujioka, Yoshiki

    1987-09-19

    In a light-voltage conversion unit, when input signal is applied, the output signal to the control circuit has quick rise-up time and slow breaking time. In order to improve this, a short-circuit transistor is placed at the diode, and this transistor is forced ON, when an output signal to the control circuit is lowered down to a constant voltage, to short-circuit between the output terminals. This, however, has a demerit of high power consumption by a transistor. In this invention, by connecting a light-emitting element which gets ON at the first transition and a light-emitting element which gets ON at the last transition, placing a light receiving element in front of each light-emitting element, when an input signal is applied; thus a load is driven only with ON signal of each light-emitting element, eliminating the delay in the last transition. All of these give a quick responsive light-voltage conversion without unnecessary power consumption. (5 figs)

  5. Low-voltage analog front-end processor design for ISFET-based sensor and H+ sensing applications

    Chung, Wen-Yaw; Yang, Chung-Huang; Peng, Kang-Chu; Yeh, M. H.

    2003-04-01

    This paper presents a modular-based low-voltage analog-front-end processor design in a 0.5mm double-poly double-metal CMOS technology for Ion Sensitive Field Effect Transistor (ISFET)-based sensor and H+ sensing applications. To meet the potentiometric response of the ISFET that is proportional to various H+ concentrations, the constant-voltage and constant current (CVCS) testing configuration has been used. Low-voltage design skills such as bulk-driven input pair, folded-cascode amplifier, bootstrap switch control circuits have been designed and integrated for 1.5V supply and nearly rail-to-rail analog to digital signal processing. Core modules consist of an 8-bit two-step analog-digital converter and bulk-driven pre-amplifiers have been developed in this research. The experimental results show that the proposed circuitry has an acceptable linearity to 0.1 pH-H+ sensing conversions with the buffer solution in the range of pH2 to pH12. The processor has a potential usage in battery-operated and portable healthcare devices and environmental monitoring applications.

  6. Voltage current characteristics of type III superconductors

    Dorofejev, G. L.; Imenitov, A. B.; Klimenko, E. Yu.

    1980-06-01

    An adequate description of voltage-current characteristics is important in order to understand the nature of high critical current for the electrodynamic construction of type-III superconductors and for commercial superconductor specification. Homogenious monofilament and multifilament Nb-Ti, Nb-Zr, Nb 3Sn wires were investigated in different ranges of magnetic field, temperature and current. The longitudinal electric field for homogenious wires may be described by E=J ρnexp- T c/T 0+ T/T 0+ B/B 0+ J/J 0, where To, Bo, Jo are the increasing parameters, which depend weakly on B and T, of the electric field. The shape of the voltage-current characteristics of multifilament wires, and the parameter's dependence on temperature and magnetic field may be explained qualitatively by the longitudinal heterogeneous nature of the filaments. A method of attaining the complete specification of the wire's electro-physical properties is proposed. It includes the traditional description of a critical surface (ie the surface corresponding to a certain conventional effective resistivity in T, B, J - space) and a description of any increasing parameter that depends on B and T.

  7. High Voltage GaN Schottky Rectifiers

    CAO,X.A.; CHO,H.; CHU,S.N.G.; CHUO,C.-C.; CHYI,J.-I.; DANG,G.T.; HAN,JUNG; LEE,C.-M.; PEARTON,S.J.; REN,F.; WILSON,R.G.; ZHANG,A.P.

    1999-10-25

    Mesa and planar GaN Schottky diode rectifiers with reverse breakdown voltages (V{sub RB}) up to 550V and >2000V, respectively, have been fabricated. The on-state resistance, R{sub ON}, was 6m{Omega}{center_dot} cm{sup 2} and 0.8{Omega}cm{sup 2}, respectively, producing figure-of-merit values for (V{sub RB}){sup 2}/R{sub ON} in the range 5-48 MW{center_dot}cm{sup -2}. At low biases the reverse leakage current was proportional to the size of the rectifying contact perimeter, while at high biases the current was proportional to the area of this contact. These results suggest that at low reverse biases, the leakage is dominated by the surface component, while at higher biases the bulk component dominates. On-state voltages were 3.5V for the 550V diodes and {ge}15 for the 2kV diodes. Reverse recovery times were <0.2{micro}sec for devices switched from a forward current density of {approx}500A{center_dot}cm{sup -2} to a reverse bias of 100V.

  8. Accelerator System Development at High Voltage Engineering

    Klein, M. G.; Gottdang, A.; Haitsma, R. G.; Mous, D. J. W.

    2009-01-01

    Throughout the years, HVE has continuously extended the capabilities of its accelerator systems to meet the rising demands from a diverse field of applications, among which are deep level ion implantation, micro-machining, neutron production for biomedical research, isotope production or accelerator mass spectrometry. Characteristic for HVE accelerators is the coaxial construction of the all solid state power supply around the acceleration tubes. With the use of solid state technology, the accelerators feature high stability and very low ripple. Terminal voltages range from 1 to 6 MV for HVE Singletrons and Tandetrons. The high-current versions of these accelerators can provide ion beams with powers of several kW. In the last years, several systems have been built with terminal voltages of 1.25 MV, 2 MV and 5 MV. Recently, the first system based on a 6 MV Tandetron has passed the factory tests. In this paper we describe the characteristics of the HVE accelerator systems and present as example recent systems.

  9. [Development of residual voltage testing equipment].

    Zeng, Xiaohui; Wu, Mingjun; Cao, Li; He, Jinyi; Deng, Zhensheng

    2014-07-01

    For the existing measurement methods of residual voltage which can't turn the power off at peak voltage exactly and simultaneously display waveforms, a new residual voltage detection method is put forward in this paper. First, the zero point of the power supply is detected with zero cross detection circuit and is inputted to a single-chip microcomputer in the form of pulse signal. Secend, when the zero point delays to the peak voltage, the single-chip microcomputer sends control signal to power off the relay. At last, the waveform of the residual voltage is displayed on a principal computer or oscilloscope. The experimental results show that the device designed in this paper can turn the power off at peak voltage and is able to accurately display the voltage waveform immediately after power off and the standard deviation of the residual voltage is less than 0.2 V at exactly one second and later.

  10. Impurity effects on electrical conductivity of doped bilayer graphene in the presence of a bias voltage

    Lotfi, E; Rezania, H; Arghavaninia, B; Yarmohammadi, M

    2016-01-01

    We address the electrical conductivity of bilayer graphene as a function of temperature, impurity concentration, and scattering strength in the presence of a finite bias voltage at finite doping, beginning with a description of the tight-binding model using the linear response theory and Green’s function approach. Our results show a linear behavior at high doping for the case of high bias voltage. The effects of electron doping on the electrical conductivity have been studied via changing the electronic chemical potential. We also discuss and analyze how the bias voltage affects the temperature behavior of the electrical conductivity. Finally, we study the behavior of the electrical conductivity as a function of the impurity concentration and scattering strength for different bias voltages and chemical potentials respectively. The electrical conductivity is found to be monotonically decreasing with impurity scattering strength due to the increased scattering among electrons at higher impurity scattering strength. (paper)

  11. Cell design for the DARHT linear induction accelerators

    Burns, M.; Allison, P.; Earley, L.; Liska, D.; Mockler, C.; Ruhe, J.; Tucker, H.; Walling, L.

    1991-01-01

    The Dual-Axis Radiographic Hydrotest (DARHT) facility will employ two linear induction accelerators to produce intense, bremsstrahlung x- ray pulses for flash radiography. The accelerator cell design for a 3- kA, 16--20 MeV, 60-ns flattop, high-brightness electron beam is presented. The cell is optimized for high-voltage stand-off while also minimizing the its transverse impedance. Measurements of high- voltage and rf characteristics are summarized. 7 refs., 5 figs

  12. Symmetric voltage-controlled variable resistance

    Vanelli, J. C.

    1978-01-01

    Feedback network makes resistance of field-effect transistor (FET) same for current flowing in either direction. It combines control voltage with source and load voltages to give symmetric current/voltage characteristics. Since circuit produces same magnitude output voltage for current flowing in either direction, it introduces no offset in presense of altering polarity signals. It is therefore ideal for sensor and effector circuits in servocontrol systems.

  13. Ultra Low-Voltage Energy Harvesting

    2013-09-01

    if in a solar battery charger the level of illumination were to drop due to cloud cover, the diode would prevent discharging of the battery when...the source voltage becomes lower than battery voltage. The drawback of a simple circuit like this is that once the source voltage is lower than the...longer charged when the battery voltage is above the OV setting. Figure 13. Block diagram of BQ25504 circuit . (From [10]) 18 THIS PAGE

  14. Design and implementation of a 3-A source and sink linear regulator for bus terminators

    Li Yanming; Wen Changbao; Wen Limin; Mao Xiangyu

    2012-01-01

    According to the requirements of the bus terminal regulator, a linear regulator with 3-A source-sink current ability is presented. The use of the NMOS pass transistor and load current feedback technique enhances the system current ability and response speed. The method of adaptive zero compensation realizes loop stability over the whole load range for either source or sink loop. Furthermore, the transconductance matching technique reduces the shoot-through current through the output stage to less than 3 μA. The regulator has been fabricated with a 0.6-μm 30 V BCD process successfully, and the area size is about 1 mm 2 . With a 20 μF output capacitor, the maximum transient output-voltage variation is within 3.5% of the output voltage with load step changes of ±2 A/1 μs. At the load range of ±3 A, the variation of output voltage is less than ±15 mV.

  15. Absolute Determination of High DC Voltages by Means of Frequency Measurement

    Peier, Dirk; Schulz, Bernd

    1983-01-01

    A novel absolute measuring procedure is presented for the definition of fixed points of the voltage in the 100 kV range. The method is based on transit time measurements with accelerated electrons. By utilizing the selective interaction of a monoenergetic electron beam with the electromagnetic field of a special cavity resonator, the voltage is referred to fundamental constants and the base unit second. Possible balance voltages are indicated by a current detector. Experimental investigations are carried out with resonators in the normal conducting range. With a copper resonator operating at the temperature of boiling nitrogen (77 K), the relative uncertainty of the voltage points is estimated to be +/- 4 × 10-4. The technically realizable uncertainty can be reduced to +/- 1 × 10-5 by the proposed application of a superconducting niobium resonator. Thus this measuring device becomes suitable as a primary standard for the high-voltage range.

  16. Mass impregnation plant speeds high voltage cable production

    1965-05-07

    A mass impregnation and continuous sheath extrusion plant that will eliminate the long period of vacuum treatment usually required for high voltage oil-filled cables is among the latest techniques included in the new factory at Pirelli General's Eastleigh works. The new factory is said to be the first in Europe designed solely for the manufacture of the full range of oil-filled cables. Possible future increases of system voltages to about 750-kV ac or 1000-kV dc have been taken into account in the design of the works, so that only a small amount of modification and new plant will be involved.

  17. Voltage gradient mapping and electrophysiologically guided cryoablation in children with AVNRT.

    Drago, Fabrizio; Battipaglia, Irma; Russo, Mario Salvatore; Remoli, Romolo; Pazzano, Vincenzo; Grifoni, Gino; Allegretti, Greta; Silvetti, Massimo Stefano

    2018-04-01

    Recently, voltage gradient mapping of Koch's triangle to find low-voltage connections, or 'voltage bridges', corresponding to the anatomic position of the slow pathway, has been introduced as a method to ablate atrioventricular nodal reentry tachycardia (AVNRT) in children. Thus, we aimed to assess the effectiveness of voltage mapping of Koch's triangle, combined with the search for the slow potential signal in 'low-voltage bridges', to guide cryoablation of AVNRT in children. From June 2015 to May 2016, 35 consecutive paediatric patients (mean age 12.1 ± 4.5 years) underwent 3D-guided cryoablation of AVNRT at our Institution. Fifteen children were enrolled as control group (mean age 14 ± 4 years). A voltage gradient mapping of Koch's triangle was obtained in all patients, showing low-voltage connections in all children with AVNRT but not in controls. Prior to performing cryoablation, we looked for the typical 'hump and spike' electrogram, generally considered to be representative of slow pathway potential within a low-voltage bridge. In all patients the 'hump and spike' electrogram was found inside bridges of low voltage. Focal or high-density linear lesions, extended or not, were delivered guided by low-voltage bridge visualization. Acute success rate was 100%, and no recurrence was reported at a mean follow-up of 8 ± 3 months. Voltage gradient mapping of Koch's triangle, combined with the search for the slow potential signal in low-voltage bridges, is effective in guiding cryoablation of AVNRT in paediatric patients, with a complete acute success rate and no AVNRT recurrences at mid-term follow-up.

  18. AC Voltage Control of DC/DC Converters Based on Modular Multilevel Converters in Multi-Terminal High-Voltage Direct Current Transmission Systems

    Rui Li

    2016-12-01

    Full Text Available The AC voltage control of a DC/DC converter based on the modular multilevel converter (MMC is considered under normal operation and during a local DC fault. By actively setting the AC voltage according to the two DC voltages of the DC/DC converter, the modulation index can be near unity, and the DC voltage is effectively utilized to output higher AC voltage. This significantly decreases submodule (SM capacitance and conduction losses of the DC/DC converter, yielding reduced capital cost, volume, and higher efficiency. Additionally, the AC voltage is limited in the controllable range of both the MMCs in the DC/DC converter; thus, over-modulation and uncontrolled currents are actively avoided. The AC voltage control of the DC/DC converter during local DC faults, i.e., standby operation, is also proposed, where only the MMC connected on the faulty cable is blocked, while the other MMC remains operational with zero AC voltage output. Thus, the capacitor voltages can be regulated at the rated value and the decrease of the SM capacitor voltages after the blocking of the DC/DC converter is avoided. Moreover, the fault can still be isolated as quickly as the conventional approach, where both MMCs are blocked and the DC/DC converter is not exposed to the risk of overcurrent. The proposed AC voltage control strategy is assessed in a three-terminal high-voltage direct current (HVDC system incorporating a DC/DC converter, and the simulation results confirm its feasibility.

  19. Current—voltage characteristics of lead zirconate titanate/nickel bilayered hollow cylindrical magnetoelectric composites

    De-An, Pan; Shen-Gen, Zhang; Jian-Jun, Tian; Li-Jie, Qiao; Jun-Sai, Sun; Volinsky, Alex A.

    2010-01-01

    Current–voltage measurements obtained from lead zirconate titanate/nickel bilayered hollow cylindrical magnetoelectric composite showed that a sinusoidal current applied to the copper coil wrapped around the hollow cylinder circumference induces voltage across the lead zirconate titanate layer thickness. The current–voltage coefficient and the maximum induced voltage in lead zirconate titanate at 1 kHz and resonance (60.1 kHz) frequencies increased linearly with the number of the coil turns and the applied current. The resonance frequency corresponds to the electromechanical resonance frequency. The current–voltage coefficient can be significantly improved by optimizing the magnetoelectric structure geometry and/or increasing the number of coil turns. Hollow cylindrical lead zirconate titanate/nickel structures can be potentially used as current sensors. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

  20. Justifying threshold voltage definition for undoped body transistors through 'crossover point' concept

    Baruah, Ratul Kumar; Mahapatra, Santanu

    2009-01-01

    Two different definitions, one is potential based and the other is charge based, are used in the literatures to define the threshold voltage of undoped body symmetric double gate transistors. This paper, by introducing a novel concept of crossover point, proves that the charge based definition is more accurate than the potential based definition. It is shown that for a given channel length the potential based definition predicts anomalous change in threshold voltage with body thickness variation while the charge based definition results in monotonous change. The threshold voltage is then extracted from drain current versus gate voltage characteristics using linear extrapolation, transconductance and match-point methods. In all the three cases it is found that trend of threshold voltage variation support the charge based definition.

  1. Linearly constrained minimax optimization

    Madsen, Kaj; Schjær-Jacobsen, Hans

    1978-01-01

    We present an algorithm for nonlinear minimax optimization subject to linear equality and inequality constraints which requires first order partial derivatives. The algorithm is based on successive linear approximations to the functions defining the problem. The resulting linear subproblems...

  2. Linear feedback controls the essentials

    Haidekker, Mark A

    2013-01-01

    The design of control systems is at the very core of engineering. Feedback controls are ubiquitous, ranging from simple room thermostats to airplane engine control. Helping to make sense of this wide-ranging field, this book provides a new approach by keeping a tight focus on the essentials with a limited, yet consistent set of examples. Analysis and design methods are explained in terms of theory and practice. The book covers classical, linear feedback controls, and linear approximations are used when needed. In parallel, the book covers time-discrete (digital) control systems and juxtapos

  3. Photodiode 1 × 64 linear array based on a double p-InAsSbP/n-InAs{sub 0.92}Sb{sub 0.08}/n{sup +}-InAs heterostructure

    Il’inskaya, N. D., E-mail: ioffeled@mail.ru; Karandashev, S. A. [Russian Academy of Sciences, Ioffe Institute (Russian Federation); Karpukhina, N. G. [Limited Liability Company Ioffe LED Ltd. (Russian Federation); Lavrov, A. A.; Matveev, B. A.; Remennyi, M. A.; Stus, N. M.; Usikova, A. A. [Russian Academy of Sciences, Ioffe Institute (Russian Federation)

    2016-05-15

    The results of studies of the current–voltage characteristics and of the photoelectric and luminescence properties of a monolithic diode 1 × 64 linear array based on p-InAsSbP/n-InAsSb/n{sup +}-InAs with the n{sup +}-InAs-substrate side illuminated and sensitive in the region of 4-μm are reported. An analysis is performed of the mechanisms of current flow in the temperature range of 77–353 K and also of the photosensitivity and the speed of response taking into account the spatial distribution of nonequilibrium radiation and the data of capacitance–voltage measurements.

  4. Voltage Quality of Grid Connected Wind Turbines

    Chen, Zhe; Blaabjerg, Frede; Sun, Tao

    2004-01-01

    Grid connected wind turbines may cause quality problems, such as voltage variation and flicker. This paper discusses the voltage variation and flicker emission of grid connected wind turbines with doubly-fed induction generators. A method to compensate flicker by using a voltage source converter...

  5. Manufacturing technology for practical Josephson voltage normals

    Kohlmann, Johannes; Kieler, Oliver

    2016-01-01

    In this contribution we present the manufacturing technology for the fabrication of integrated superconducting Josephson serial circuits for voltage normals. First we summarize some foundations for Josephson voltage normals and sketch the concept and the setup of the circuits, before we describe the manufacturing technology form modern practical Josephson voltage normals.

  6. 49 CFR 234.221 - Lamp voltage.

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Lamp voltage. 234.221 Section 234.221 Transportation Other Regulations Relating to Transportation (Continued) FEDERAL RAILROAD ADMINISTRATION..., Inspection, and Testing Maintenance Standards § 234.221 Lamp voltage. The voltage at each lamp shall be...

  7. Bootstrapped Low-Voltage Analog Switches

    Steensgaard-Madsen, Jesper

    1999-01-01

    Novel low-voltage constant-impedance analog switch circuits are proposed. The switch element is a single MOSFET, and constant-impedance operation is obtained using simple circuits to adjust the gate and bulk voltages relative to the switched signal. Low-voltage (1-volt) operation is made feasible...

  8. Energy reduction through voltage scaling and lightweight checking

    Kadric, Edin

    , and we get diminishing returns from continuing to scale voltage. To ensure that memories do not become a bottleneck, we also design an energy-robust FPGA memory architecture, which attempts to minimize communication energy due to mismatches between application and architecture. We do this alongside application parallelism tuning. We show our techniques on a wide range of applications, including a large real-time system used for Wide-Area Motion Imaging (WAMI).

  9. Voltage generators of high voltage high power accelerators

    Svinin, M.P.

    1981-01-01

    High voltage electron accelerators are widely used in modern radiation installations for industrial purposes. In the near future further increasing of their power may be effected, which enables to raise the efficiency of the radiation processes known and to master new power-consuming production in industry. Improvement of HV generators by increasing their power and efficiency is one of many scientific and engineering aspects the successful solution of which provides further development of these accelerators and their technical parameters. The subject is discussed in detail. (author)

  10. Intelligent voltage control in a DC micro-grid containing PV generation and energy storage

    Rouzbehi, Kumars; Miranian, Arash; Candela García, José Ignacio; Luna Alloza, Álvaro; Rodríguez Cortés, Pedro

    2014-01-01

    This paper proposes an intelligent control scheme for DC voltage regulationin a DC micro-grid integrating photovoltaic (PV) generation, energy storage and electric loads. The maximum power generation of the PV panel is followed using the incremental conductance (IC) maximum power point tracking (MPPT) algorithm while a high-performance local linear controller (LLC)is developed for the DC voltage control in the micro-grid.The LLC, as a data-driven control strategy, controls the bidirectional c...

  11. A novel MR-compatible sensor to assess active medical device safety: stimulation monitoring, rectified radio frequency pulses, and gradient-induced voltage measurements.

    Barbier, Thérèse; Aissani, Sarra; Weber, Nicolas; Pasquier, Cédric; Felblinger, Jacques

    2018-03-30

    To evaluate the function of an active implantable medical device (AIMD) during magnetic resonance imaging (MRI) scans. The induced voltages caused by the switching of magnetic field gradients and rectified radio frequency (RF) pulse were measured, along with the AIMD stimulations. An MRI-compatible voltage probe with a bandwidth of 0-40 kHz was designed. Measurements were carried out both on the bench with an overvoltage protection circuit commonly used for AIMD and with a pacemaker during MRI scans on a 1.5 T (64 MHz) MR scanner. The sensor exhibits a measurement range of ± 15 V with an amplitude resolution of 7 mV and a temporal resolution of 10 µs. Rectification was measured on the bench with the overvoltage protection circuit. Linear proportionality was confirmed between the induced voltage and the magnetic field gradient slew rate. The pacemaker pacing was recorded successfully during MRI scans. The characteristics of this low-frequency voltage probe allow its use with extreme RF transmission power and magnetic field gradient positioning for MR safety test of AIMD during MRI scans.

  12. Multi-Period Optimization for Voltage Control System in Transmission Grids

    Qin, Nan; Chen, Si; Liu, Chengxi

    2015-01-01

    Automatic Voltage Control (AVC) systems maintain the voltage in an acceptable range and minimize the power loss of the grid by coordinately regulating the controllable components. Switchable shunts and tap-able transformers are expected to be operated as few times as possible. This paper proposes...

  13. E-beam high voltage switching power supply

    Shimer, Daniel W.; Lange, Arnold C.

    1997-01-01

    A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360.degree./n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load.

  14. E-beam high voltage switching power supply

    Shimer, D.W.; Lange, A.C.

    1997-01-01

    A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360 degree/n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load. 7 figs

  15. Extension algorithm for generic low-voltage networks

    Marwitz, S.; Olk, C.

    2018-02-01

    Distributed energy resources (DERs) are increasingly penetrating the energy system which is driven by climate and sustainability goals. These technologies are mostly connected to low- voltage electrical networks and change the demand and supply situation in these networks. This can cause critical network states. Network topologies vary significantly and depend on several conditions including geography, historical development, network design or number of network connections. In the past, only some of these aspects were taken into account when estimating the network investment needs for Germany on the low-voltage level. Typically, fixed network topologies are examined or a Monte Carlo approach is used to quantify the investment needs at this voltage level. Recent research has revealed that DERs differ substantially between rural, suburban and urban regions. The low-voltage network topologies have different design concepts in these regions, so that different network topologies have to be considered when assessing the need for network extensions and investments due to DERs. An extension algorithm is needed to calculate network extensions and investment needs for the different typologies of generic low-voltage networks. We therefore present a new algorithm, which is capable of calculating the extension for generic low-voltage networks of any given topology based on voltage range deviations and thermal overloads. The algorithm requires information about line and cable lengths, their topology and the network state only. We test the algorithm on a radial, a loop, and a heavily meshed network. Here we show that the algorithm functions for electrical networks with these topologies. We found that the algorithm is able to extend different networks efficiently by placing cables between network nodes. The main value of the algorithm is that it does not require any information about routes for additional cables or positions for additional substations when it comes to estimating

  16. Single-InN-Nanowire Nanogenerator with Upto 1 V Output Voltage

    Huang, Chi-Te

    2010-07-30

    Piezoelectric potential of a InN nanowire (NW) growing along [011̄0] can be positive, negative, and zero depending on the direction of the applied transverse force. By measuring the output voltage of a InN-NW-based nanogenerator, about 40% to 55% of output voltages are within the range of ?1 and ?20 mV, and 25% to 30% of output voltages would exceed ?100 mV. Some output voltages could reach the magnitude of ?1000 mV, showing its great potential for fabricating high-output nanogenerators. © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. High-frequency high-voltage high-power DC-to-DC converters

    Wilson, T. G.; Owen, H. A.; Wilson, P. M.

    1982-09-01

    A simple analysis of the current and voltage waveshapes associated with the power transistor and the power diode in an example current-or-voltage step-up (buck-boost) converter is presented. The purpose of the analysis is to provide an overview of the problems and design trade-offs which must be addressed as high-power high-voltage converters are operated at switching frequencies in the range of 100 kHz and beyond. Although the analysis focuses on the current-or-voltage step-up converter as the vehicle for discussion, the basic principles presented are applicable to other converter topologies as well.

  18. Summary of transient high-voltage calculations for the FRX-C experiment

    Kewish, R.W. Jr.; Rej, D.J.

    1982-06-01

    Calculations of the electrical circuit equations are performed over a wide range of parameters corresponding to the FRX-C field-reversed THETA-pinch experiment at Los Alamos. Without any plasma or external damping, serious voltage doubling and quadrupling of the main capacitor bank charge voltage are observed. These oscillating high voltages are found to be adequately suppressed by the strategic placement of external snubber circuitry. On the other hand, no doubling of the THETA-pinch preionization bank charge voltage is found. Calculations of the equations for the z-pinch preionization circuit are also performed

  19. Integrated reconfigurable high-voltage transmitting circuit for CMUTs

    Llimos Muntal, Pere; Larsen, Dennis Øland; Jørgensen, Ivan Harald Holger

    2015-01-01

    In this paper a high-voltage transmitting circuit aimed for capacitive micromachined ultrasonic transducers (CMUTs) used in scanners for medical applications is designed and implemented in a 0.35 μm high-voltage CMOS process. The transmitting circuit is reconfigurable externally making it able...... to drive a wide variety of CMUTs. The transmitting circuit can generate several pulse shapes with voltages up to 100 V, maximum pulse range of 50 V, frequencies up to 5 MHz and different driving slew rates. Measurements are performed on the circuit in order to assess its functionality and power consumption...... performance. The design occupies an on-chip area of 0.938 mm2 and the power consumption of a 128-element transmitting circuit array that would be used in an portable ultrasound scanner is found to be a maximum of 181 mW....

  20. Power Quality Assessment in Real Shipboard Microgrid Systems under Unbalanced and Harmonic AC Bus Voltage

    Liu, Wenzhao; Tarasiuk, Tomasz; Gorniak, Mariusz

    2018-01-01

    were proposed and carried out in a real ship under sea-going conditions to address this problem. The ship experimental results were presented and discussed considering non-linear bow thruster load and high power ballast pump loads under unbalanced and harmonic voltage conditions. In addition......, the analysis of voltage transient dips during ballast pump starting up is presented. Further, the voltage/current distortions of working generator, bow thruster and pump loads are analyzed. The paper provides a valuable analysis for coping with PQ issues in the real ship power system....

  1. Transmission congestion and voltage profile management coordination in competitive electricity markets

    Yamin, H.Y.; Shahidehpour, S.M.

    2003-01-01

    This paper describes a generalized active/reactive iterative coordination process between GENCOs and the Independent System Operator (ISO) for active (transmission congestion) and reactive (voltage profile) management in the day-ahead market. GENCOs apply priced-based unit commitment without transmission and voltage security constraints, schedule their units and submit their initial bids to the ISO. The ISO executes congestion and voltage profile management for eliminating transmission and voltage profile violations. If violations are not eliminated, the ISO minimizes the transmission and voltage profile violations and sends a signal via the Internet to GENCOs. GENCOs reschedule their units taking into account the ISO signals and submit modified bids to the ISO. The voltage problem is addressed and a linear model is formulated and used in the proposed method. The voltage problem is formulated as a linear programming with a block-angular structure and Dantzig-Wolfe decomposition is applied to generate several smaller problems for a faster and easier solution of large-scale power systems. Two 36 unit GENCOs are used to demonstrate the performance of the proposed generalized active/reactive coordination algorithm. (author)

  2. Piezoelectric self sensing actuators for high voltage excitation

    Grasso, E; Totaro, N; Janocha, H; Naso, D

    2013-01-01

    Self sensing techniques allow the use of a piezoelectric transducer simultaneously as an actuator and as a sensor. Such techniques are based on knowledge of the transducer behaviour and on measurements of electrical quantities, in particular voltage and charge. Past research work has mainly considered the linear behaviour of piezoelectric transducers, consequently restricting the operating driving voltages to low values. In this work a new self sensing technique is proposed which is able to perform self sensing reconstruction both at low and at high driving voltages. This technique, in fact, makes use of a hysteretic model to describe the nonlinear piezoelectric capacitance necessary for self sensing reconstruction. The capacitance can be measured and identified at the antiresonances of a vibrating structure with a good approximation. After providing a mathematical background to deal with the main aspects of self sensing, this technique is compared theoretically and experimentally to a typical linear one by using an aluminum plate with one bonded self sensing transducer and a positive position feedback (PPF) controller to verify the performance in self sensing based vibration control. (paper)

  3. Voltage Management in Unbalanced Low Voltage Networks Using a Decoupled Phase-Tap-Changer Transformer

    Coppo, Massimiliano; Turri, Roberto; Marinelli, Mattia

    2014-01-01

    The paper studies a medium voltage-low voltage transformer with a decoupled on load tap changer capability on each phase. The overall objective is the evaluation of the potential benefits on a low voltage network of such possibility. A realistic Danish low voltage network is used for the analysis...

  4. 76 FR 70721 - Voltage Coordination on High Voltage Grids; Notice of Staff Workshop

    2011-11-15

    ... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Staff Workshop Take notice that the Federal Energy Regulatory Commission will hold a Workshop on Voltage Coordination on High Voltage Grids on Thursday, December 1, 2011...

  5. Foundations of linear and generalized linear models

    Agresti, Alan

    2015-01-01

    A valuable overview of the most important ideas and results in statistical analysis Written by a highly-experienced author, Foundations of Linear and Generalized Linear Models is a clear and comprehensive guide to the key concepts and results of linear statistical models. The book presents a broad, in-depth overview of the most commonly used statistical models by discussing the theory underlying the models, R software applications, and examples with crafted models to elucidate key ideas and promote practical model building. The book begins by illustrating the fundamentals of linear models,

  6. Construction of control and instrumentation devices of high voltage power supply of double chamber plasma nitrogen

    Saminto; Eko Priyono; Sugeng Riyanto

    2013-01-01

    A control and instrumentation devices of high voltage power supply of double chamber plasma nitrogen have been made. This device consists of the software and hardware component. Hardware component consists of SCR phase angle controller LPC-50HDA type, T100MD1616+ PLC, high voltage transformer and voltage rectifier system. Software component used a LADDER program and TBasic serves to control of the high voltage output. The components in these devices have been tested in the double chamber plasma nitrogen. Its performance meet with the design criteria that can supply of plasma nitrogen operation voltage in the range 290 Vdc to 851 Vdc with glow discharge current 0.4 A to 1.4 A. In general it can be said that the control and instrumentation devices of high voltage power supply is ready for use at the double chamber plasma nitrogen device. (author)

  7. Power Quality Problems Mitigation using Dynamic Voltage Restorer in Egypt Thermal Research Reactor (ETRR-2)

    Kandil, T.; Ayad, N.M.; Abdel Haleam, A.; Mahmoud, M.

    2013-01-01

    Egypt thermal research reactor (ETRR-2) was subjected to several Power Quality Problems such as voltage sags/swells, harmonics distortion, and short interruption. ETRR-2 encompasses a wide range of loads which are very sensitive to voltage variations and this leads to several unplanned shutdowns of the reactor due to trigger of the Reactor Protection System (RPS). The Dynamic Voltage Restorer (DVR) has recently been introduced to protect sensitive loads from voltage sags and other voltage disturbances. It is considered as one of the most efficient and effective solution. Its appeal includes smaller size and fast dynamic response to the disturbance. This paper describes a proposal of a DVR to improve power quality in ETRR-2 electrical distribution systems . The control of the compensation voltage is based on d-q-o algorithm. Simulation is carried out by Matlab/Simulink to verify the performance of the proposed method

  8. Piezo Voltage Controlled Planar Hall Effect Devices.

    Zhang, Bao; Meng, Kang-Kang; Yang, Mei-Yin; Edmonds, K W; Zhang, Hao; Cai, Kai-Ming; Sheng, Yu; Zhang, Nan; Ji, Yang; Zhao, Jian-Hua; Zheng, Hou-Zhi; Wang, Kai-You

    2016-06-22

    The electrical control of the magnetization switching in ferromagnets is highly desired for future spintronic applications. Here we report on hybrid piezoelectric (PZT)/ferromagnetic (Co2FeAl) devices in which the planar Hall voltage in the ferromagnetic layer is tuned solely by piezo voltages. The change of planar Hall voltage is associated with magnetization switching through 90° in the plane under piezo voltages. Room temperature magnetic NOT and NOR gates are demonstrated based on the piezo voltage controlled Co2FeAl planar Hall effect devices without the external magnetic field. Our demonstration may lead to the realization of both information storage and processing using ferromagnetic materials.

  9. Capacitor Voltages Measurement and Balancing in Flying Capacitor Multilevel Converters Utilizing a Single Voltage Sensor

    Farivar, Glen; Ghias, Amer M. Y. M.; Hredzak, Branislav

    2017-01-01

    This paper proposes a new method for measuring capacitor voltages in multilevel flying capacitor (FC) converters that requires only one voltage sensor per phase leg. Multiple dc voltage sensors traditionally used to measure the capacitor voltages are replaced with a single voltage sensor at the ac...... side of the phase leg. The proposed method is subsequently used to balance the capacitor voltages using only the measured ac voltage. The operation of the proposed measurement and balancing method is independent of the number of the converter levels. Experimental results presented for a five-level FC...

  10. Josephson tunneling current in the presence of a time-dependent voltage

    Harris, R.E.

    1975-01-01

    The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field

  11. Voltage-Gated Calcium Channels

    Zamponi, Gerald Werner

    Voltage Gated Calcium Channels is the first comprehensive book in the calcium channel field, encompassing over thirty years of progress towards our understanding of calcium channel structure, function, regulation, physiology, pharmacology, and genetics. This book balances contributions from many of the leading authorities in the calcium channel field with fresh perspectives from risings stars in the area, taking into account the most recent literature and concepts. This is the only all-encompassing calcium channel book currently available, and is an essential resource for academic researchers at all levels in the areas neuroscience, biophysics, and cardiovascular sciences, as well as to researchers in the drug discovery area.

  12. PC-based control of a high-voltage injector

    Constantin, F.

    1998-01-01

    The stability of high voltage injectors is one of the major problems in any accelerator system. Most of the troubles encountered in the normal operation of an accelerator are connected with the ion source and associated high voltage platforms, regardless of the source or high voltage generator type. The quality of the ion beam injected in the accelerator strongly depends on the power supplies used in the injector and on the ability to control the non-electrical parameters (gas-flow, temperature, etc.). A wide used method in controlling is based on optical links between high-voltage platform and computer, the adjustments being more or less automated. Although the method mentioned above can be still useful in injector control, a different approach is presented in this work, i.e., the computer itself is placed inside the high-voltage terminal. Only one optical link is still necessary to connect this computer with an user-friendly host at ground potential. Requirements: - varying and monitoring the filament current; - gas flow control in the ion source; - reading the vacuum values; - current and voltage control for the anodic, magnet, extraction, suppression and lens' sources. Even in the high voltage terminal there are compartments with different voltages regardless the floating ground. In our injector the extraction voltage is applied on the top of the ion source including the filament and the anodic voltage. The extraction voltage is of maximum 30 kV. In this situation a second optical link is required to transfer the control for the anodic and magnet source power supply assuming the dedicated computer on the floating ground. One PC is placed inside the high voltage terminal and one PC outside the injector. The optical link (more precisely two optical wires) connects the serial ports. The inside computer is equipped with two multipurpose ADC/DAC and digital I/O card. They permit to read or output DC levels ranging between 0 to 10 volts or TTL signals. The filament

  13. A speed estimation unit for induction motors based on adaptive linear combiner

    Marei, Mostafa I.; Shaaban, Mostafa F.; El-Sattar, Ahmed A.

    2009-01-01

    This paper presents a new induction motor speed estimation technique, which can estimate the rotor resistance as well, from the measured voltage and current signals. Moreover, the paper utilizes a novel adaptive linear combiner (ADALINE) structure for speed and rotor resistance estimations. This structure can deal with the multi-output systems and it is called MO-ADALINE. The model of the induction motor is arranged in a linear form, in the stationary reference frame, to cope with the proposed speed estimator. There are many advantages of the proposed unit such as wide speed range capability, immunity against harmonics of measured waveforms, and precise estimation of the speed and the rotor resistance at different dynamic changes. Different types of induction motor drive systems are used to evaluate the dynamic performance and to examine the accuracy of the proposed unit for speed and rotor resistance estimation.

  14. Impact of cell-voltage on energy and power performance of supercapacitors with single-walled carbon nanotube electrodes

    Izadi-Najafabadi, Ali; Yamada, Takeo; Futaba, Don N.; Iijima, Sumio [Nanotube Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hatori, Hiroaki [Project Headquarters, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hata, Kenji [Japan Science and Technology Agency JST, Kawaguchi (Japan)

    2010-12-15

    We report the energy and power voltage-dependencies of supercapacitors using single-walled carbon nanotube electrodes. The energy density was dependent on the cell-voltage cubed (up to 4 V: E = 1.43 x V{sup 3}). The cubic relationship was attributed to the linear increase of the capacitance as a function of voltage, enabled by electrochemical doping. Furthermore, while up to 3.5 V, the maximum power rating of the nanotube electrodes increased as a function of the cell-voltage squared, beyond 3.5 V, a decline in power was observed as a result of depletion of the electrolyte's ions. (author)

  15. Towards the International Linear Collider

    Lopez-Fernandez, Ricardo

    2006-01-01

    The broad physics potential of e+e- linear colliders was recognized by the high energy physics community right after the end of LEP in 2000. In 2007, the Large Hadron Collider (LHC) now under construction at CERN will obtain its first collisions. The LHC, colliding protons with protons at 14 TeV, will discover a standard model Higgs boson over the full potential mass range, and should be sensitive to new physics into the several TeV range. The program for the Linear Collider (LC) will be set in the context of the discoveries made at the LHC. All the proposals for a Linear Collider will extend the discoveries and provide a wealth of measurements that are essential for giving deeper understanding of their meaning, and pointing the way to further evolution of particle physics in the future. For the mexican groups is the right time to join such an effort

  16. Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

    Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

    2018-04-18

    Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

  17. Voltage dependency of transmission probability of aperiodic DNA molecule

    Wiliyanti, V.; Yudiarsah, E.

    2017-07-01

    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  18. Manipulating the voltage dependence of tunneling spin torques

    Manchon, Aurelien

    2012-10-01

    Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

  19. A utility piezoelectric energy harvester with low frequency and high-output voltage: Theoretical model, experimental verification and energy storage

    Guangyi Zhang

    2016-09-01

    Full Text Available In this paper, a utility piezoelectric energy harvester with low frequency and high-output voltage is presented. Firstly, the harvester’s three theoretical models are presented, namely the static model, the quasi static model and the dynamic vibration model. By analyzing the influence of the mass ratio of the mass block to the beam on output characteristics of the harvester, we compare the quasi static model and the dynamic vibration model and then define their applicable ranges. Secondly, simulation and experiments are done to verify the models, using the harvester with PZT-5H piezoelectric material, which are proved to be consistent with each other. The experimental results show that the output open-circuit voltage and the output power can reach up to 86.36V and 27.5mW respectively. The experiments are conducted when this harvester system is excited by the first modal frequency (58.90Hz with the acceleration 10m/s2. In this low frequency vibration case, it is easy to capture the energy in the daily environment. In addition, LTC 3588-1 chip (Linear Technology Corporation is used as the medium energy circuit to transfer charges from the PZT-5H electrode to the 0.22F 5V super capacitor and ML621 rechargeable button battery. For this super-capacitor, it takes about 100min for the capacitor voltage to rise from 0V to 3.6V. For this button battery, it takes about 200min to increase the battery voltage from 2.5V to 3.48V.

  20. Design of a linear neutron source

    Buzarbaruah, N.; Dutta, N.J.; Bhardwaz, J.K.; Mohanty, S.R.

    2015-01-01

    Highlights: • This paper reports the design of a linear neutron source based on inertial electrostatic confinement fusion scheme. • The voltage and current that is to be applied to the grid is computed theoretically. • Neutron production rate is theoretically estimated and found to be of the order of 10 7 –10 8 neutrons/s. • Electric potential distribution and ion trajectories are studied using SIMION code. • Optimized condition for the inner grid transparency has been found out. - Abstract: In this paper, we present the design of a linear neutron source based on the concept of inertial electrostatic confinement fusion. The source mainly comprises of a concentric coaxial cylindrical grid assembly housed inside a double walled cylindrical vacuum chamber, a gas injection system, a high voltage feedthrough and a high voltage negative polarity power supply. The inner grid will be kept at a high negative potential with respect to the outer grid that will be grounded. The effect of grid transparency on electric potential distribution and ion trajectories has been studied using SIMION. A diffuse deuterium plasma will be initially created by making filament discharge and subsequently, on application of high negative voltage to the inner grid, deuterons will be accelerated towards the axis of the device. These deuterons will oscillate in the negative potential and consequently fuse in between the grids to produce neutrons. This source is expected to produce 10 7 –10 8 neutrons/s. The proposed linear neutron source will be operated both in the continuous and pulse modes and it will be utilized for a few near term applications namely fusion reactor material studies and explosive detection

  1. Analog Amplitude Modulation of a High Voltage, Solid State Inductive Adder, Pulse Generator Using MOSFETS

    Gower, E J; Sullivan, J S

    2002-01-01

    High voltage, solid state, inductive adder, pulse generators have found increasing application as fast kicker pulse modulators for charged particle beams. The solid state, inductive adder, pulse generator is similar in operation to the linear induction accelerator. The main difference is that the solid state, adder couples energy by transformer action from multiple primaries to a voltage summing stalk, instead of an electron beam. Ideally, the inductive adder produces a rectangular voltage pulse at the load. In reality, there is usually some voltage variation at the load due to droop on primary circuit storage capacitors, or, temporal variations in the load impedance. Power MOSFET circuits have been developed to provide analog modulation of the output voltage amplitude of a solid state, inductive adder, pulse generator. The modulation is achieved by including MOSFET based, variable subtraction circuits in the multiple primary stack. The subtraction circuits can be used to compensate for voltage droop, or, to tailor the output pulse amplitude to provide a desired effect in the load. Power MOSFET subtraction circuits have been developed to modulate short, temporal (60-400 ns), voltage and current pulses. MOSFET devices have been tested up to 20 amps and 800 Volts with a band pass of 50 MHz. An analog modulation cell has been tested in a five cell high, voltage adder stack

  2. Application of active electrode compensation to perform continuous voltage-clamp recordings with sharp microelectrodes.

    Gómez-González, J F; Destexhe, A; Bal, T

    2014-10-01

    Electrophysiological recordings of single neurons in brain tissues are very common in neuroscience. Glass microelectrodes filled with an electrolyte are used to impale the cell membrane in order to record the membrane potential or to inject current. Their high resistance induces a high voltage drop when passing current and it is essential to correct the voltage measurements. In particular, for voltage clamping, the traditional alternatives are two-electrode voltage-clamp technique or discontinuous single electrode voltage-clamp (dSEVC). Nevertheless, it is generally difficult to impale two electrodes in a same neuron and the switching frequency is limited to low frequencies in the case of dSEVC. We present a novel fully computer-implemented alternative to perform continuous voltage-clamp recordings with a single sharp-electrode. To reach such voltage-clamp recordings, we combine an active electrode compensation algorithm (AEC) with a digital controller (AECVC). We applied two types of control-systems: a linear controller (proportional plus integrative controller) and a model-based controller (optimal control). We compared the performance of the two methods to dSEVC using a dynamic model cell and experiments in brain slices. The AECVC method provides an entirely digital method to perform continuous recording and smooth switching between voltage-clamp, current clamp or dynamic-clamp configurations without introducing artifacts.

  3. Observability of Low Voltage grids

    Martin-Loeches, Ruben Sánchez; Iov, Florin; Kemal, Mohammed Seifu

    2017-01-01

    Low Voltage (LV) distribution power grids are experiencing a transformation from a passive to a more active role due to the increasing penetration of distributed generation, heat pumps and electrical vehicles. The first step towards a smarter operation of LV electrical systems is to provide grid ...... an updated state of the art on DSSE-AMI based, adaptive data collection techniques and database management system types. Moreover, the ongoing Danish RemoteGRID project is presented as a realistic case study.......Low Voltage (LV) distribution power grids are experiencing a transformation from a passive to a more active role due to the increasing penetration of distributed generation, heat pumps and electrical vehicles. The first step towards a smarter operation of LV electrical systems is to provide grid....... It becomes unrealistic to provide near real time full observability of the LV grid by applying Distribution System State Estimation (DSSE) utilizing the classical data collection and storage/preprocessing techniques. This paper investigates up-todate the observability problem in LV grids by providing...

  4. Non-Flammable, High Voltage Electrolytes for Lithium Ion Batteries, Phase I

    National Aeronautics and Space Administration — An electrolyte will be demonstrated for lithium ion batteries with increased range of charge and discharge voltages and with improved fire safety. Experimental...

  5. In situ scanning tunnelling microscopy of redox molecules. Coherent electron transfer at large bias voltages

    Zhang, Jingdong; Kuznetsov, A.M.; Ulstrup, Jens

    2003-01-01

    Theories of in situ scanning tunnelling microscopy (STM) of molecules with redox levels near the substrate and tip Fermi levels point to 'spectroscopic' current-overpotential features. Prominent features require a narrow 'probing tip', i.e. a small bias voltage, eV(bias), compared...... a broad tunnelling current-overpotential range at a constant (large) bias voltage of +0.2 V. The current is found to be constant over a 0.25 V overpotential range, which covers roughly the range where the oxidised and reduced redox levels are located within the energy tip. STM contrast and apparent...... of previous theoretical work on in situ STM of redox molecules, to large bias voltages, \\eV(bias)\\ > E-r. Large bias voltages give tunnelling contrasts independent of the overpotential over a broad range, as both the oxidised and reduced redox levels are located within the 'energy tip' between the substrate...

  6. High voltage load resistor array

    Lehmann, Monty Ray [Smithfield, VA

    2005-01-18

    A high voltage resistor comprising an array of a plurality of parallel electrically connected resistor elements each containing a resistive solution, attached at each end thereof to an end plate, and about the circumference of each of the end plates, a corona reduction ring. Each of the resistor elements comprises an insulating tube having an electrode inserted into each end thereof and held in position by one or more hose clamps about the outer periphery of the insulating tube. According to a preferred embodiment, the electrode is fabricated from stainless steel and has a mushroom shape at one end, that inserted into the tube, and a flat end for engagement with the end plates that provides connection of the resistor array and with a load.

  7. Theoretical analysis of magnetic sensor output voltage

    Liu Haishun; Dun Chaochao; Dou Linming; Yang Weiming

    2011-01-01

    The output voltage is an important parameter to determine the stress state in magnetic stress measurement, the relationship between the output voltage and the difference in the principal stresses was investigated by a comprehensive application of magnetic circuit theory, magnetization theory, stress analysis as well as the law of electromagnetic induction, and a corresponding quantitative equation was derived. It is drawn that the output voltage is proportional to the difference in the principal stresses, and related to the angle between the principal stress and the direction of the sensor. This investigation provides a theoretical basis for the principle stresses measurement by output voltage. - Research highlights: → A comprehensive investigation of magnetic stress signal. → Derived a quantitative equation about output voltage and the principal stresses. → The output voltage is proportional to the difference of the principal stresses. → Provide a theoretical basis for the principle stresses measurement.

  8. Linear electrostatic micromotors for nano- and micro-positioning

    Baginsky, I. L.; Kostsov, Edvard G.

    2004-05-01

    The functioning of the linear step electrostatic film micromotors with the short controlling pulse (less then 100-200 ´s) is studied to create nano- and micro-positioners. The theoretical study of the step movement of the given mass in this time frame is carried out. The results of the experimental studies of the multipetal reciprocal micromotors created on the basis of La modified Ba0.5Sr0.5Nb2O6 ferroelectric films with 1-3 μm thickness are shown. The petals were made of beryllium bronze. It is shown that the electrostatic rolling can last less than 50 μs, and the process of separating two surfaces (the metal and the ferroelectric) can last less than 1 μs. These parameters allow one to operate the micromotor at 1-10 kHz frequency, and the propulsion force in the beginning (the first 20-100 μs) of the electrostatic rolling can be as high as 1-10 N per 1 mm2 of the rolling surface with the voltage pulse amplitude of 40-50 V. The possibility of obtaining moving plate (MP) step in the nanometer range is studied, as well as the precision of these steps during the continuous MP movement with the different clock frequencies and durations of the voltage pulses. The recommendations are given to improve the accuracy and the speed of the positioning in the nano- and micro-movement range. Possible fields of micromotor application are micromechanics, including precision micromechanics, microelectronics, microrobots, microoptics, microscanners, micropumps (e.g. in the jet printers), micro flying vehicles etc.

  9. Quasi-Linear Circuit

    Bradley, William; Bird, Ross; Eldred, Dennis; Zook, Jon; Knowles, Gareth

    2013-01-01

    This work involved developing spacequalifiable switch mode DC/DC power supplies that improve performance with fewer components, and result in elimination of digital components and reduction in magnetics. This design is for missions where systems may be operating under extreme conditions, especially at elevated temperature levels from 200 to 300 degC. Prior art for radiation-tolerant DC/DC converters has been accomplished utilizing classical magnetic-based switch mode converter topologies; however, this requires specific shielding and component de-rating to meet the high-reliability specifications. It requires complex measurement and feedback components, and will not enable automatic re-optimization for larger changes in voltage supply or electrical loading condition. The innovation is a switch mode DC/DC power supply that eliminates the need for processors and most magnetics. It can provide a well-regulated voltage supply with a gain of 1:100 step-up to 8:1 step down, tolerating an up to 30% fluctuation of the voltage supply parameters. The circuit incorporates a ceramic core transformer in a manner that enables it to provide a well-regulated voltage output without use of any processor components or magnetic transformers. The circuit adjusts its internal parameters to re-optimize its performance for changes in supply voltage, environmental conditions, or electrical loading at the output

  10. Spectrum analysis of a voltage source converter due to semiconductor voltage drops

    Rasmussen, Tonny Wederberg; Eltouki, Mustafa

    2017-01-01

    It is known that power electronic voltage source converters are non-ideal. This paper presents a state-of-the-art review on the effect of semiconductor voltage drop on the output voltage spectrum, using single-phase H-bridge two-level converter topology with natural sampled pulse width modulation....... The paper describes the analysis of output voltage spectrum, when the semiconductor voltage drop is added. The results of the analysis of the spectral contribution including and excluding semiconductor voltage drop reveal a good agreement between the theoretical results, simulations and laboratory...

  11. Bias-Voltage Stabilizer for HVHF Amplifiers in VHF Pulse-Echo Measurement Systems.

    Choi, Hojong; Park, Chulwoo; Kim, Jungsuk; Jung, Hayong

    2017-10-23

    The impact of high-voltage-high-frequency (HVHF) amplifiers on echo-signal quality is greater with very-high-frequency (VHF, ≥100 MHz) ultrasound transducers than with low-frequency (LF, ≤15 MHz) ultrasound transducers. Hence, the bias voltage of an HVHF amplifier must be stabilized to ensure stable echo-signal amplitudes. We propose a bias-voltage stabilizer circuit to maintain stable DC voltages over a wide input range, thus reducing the harmonic-distortion components of the echo signals in VHF pulse-echo measurement systems. To confirm the feasibility of the bias-voltage stabilizer, we measured and compared the deviations in the gain of the HVHF amplifier with and without a bias-voltage stabilizer. Between -13 and 26 dBm, the measured gain deviations of a HVHF amplifier with a bias-voltage stabilizer are less than that of an amplifier without a bias-voltage stabilizer. In order to confirm the feasibility of the bias-voltage stabilizer, we compared the pulse-echo responses of the amplifiers, which are typically used for the evaluation of transducers or electronic components used in pulse-echo measurement systems. From the responses, we observed that the amplitudes of the echo signals of a VHF transducer triggered by the HVHF amplifier with a bias-voltage stabilizer were higher than those of the transducer triggered by the HVHF amplifier alone. The second, third, and fourth harmonic-distortion components of the HVHF amplifier with the bias-voltage stabilizer were also lower than those of the HVHF amplifier alone. Hence, the proposed scheme is a promising method for stabilizing the bias voltage of an HVHF amplifier, and improving the echo-signal quality of VHF transducers.

  12. Current-voltage characteristics of porous-silicon structures

    Diligenti, A.; Nannini, A.; Pennelli, G.; Pieri, F.; Fuso, F.; Allegrini, M.

    1996-01-01

    I-V DC characteristics have been measured on metal/porous-silicon structures. In particular, the measurements on metal/free-standing porous-silicon film/metal devices confirmed the result, already obtained, that the metal/porous-silicon interface plays a crucial role in the transport of any device. Four-contacts measurements on free-standing layers showed that the current linearly depends on the voltage and that the conduction process is thermally activated, the activation energy depending on the porous silicon film production parameters. Finally, annealing experiments performed in order to improve the conduction of rectifying contacts, are described

  13. Characteristics of output voltage and current of integrated nanogenerators

    Yang, Rusen

    2009-01-01

    Owing to the anisotropic property and small output signals of the piezoelectric nanogenerators (NGs) and the influence of the measurement system and environment, identification of the true signal generated by the NG is critical. We have developed three criteria: Schottky behavior test, switching-polarity tests, and linear superposition of current and voltage tests. The 11 tests can effectively rule out the system artifacts, whose sign does not change with the switching measurement polarity, and random signals, which might change signs but cannot consistently add up or cancel out under designed connection configurations. This study establishes the standards for designing and scale up of integrated nanogenerators. © 2009 American Institute of Physics.

  14. Videometrics-based Detection of Vibration Linearity in MEMS Gyroscope

    Yong Zhou

    2011-05-01

    Full Text Available MEMS gyroscope performs as a sort of sensor to detect angular velocity, with diverse applications in engineering including vehicle and intelligent traffic etc. A balanced vibration of driving module excited by electrostatic driving signal is the base MEMS gyroscope's performance. In order to analyze the linear property of vibration in MEMS Gyroscope, a method of computer vision measuring is applied with the help of high-speed vidicon to obtain video of linear vibration of driving module in gyroscope, under the driving voltage signal of inherent frequency and amplitude linearly increasing. By means of image processing, target identifying, and motion parameter extracting from the obtained video, vibration curve with time variation is acquired. And then, linearity of this vibration system can be analyzed by focusing on the amplitude value of vibration responding to the amplitude variation of driving voltage signal.

  15. An Improved Continuous-Time Model Predictive Control of Permanent Magnetic Synchronous Motors for a Wide-Speed Range

    Dandan Su

    2017-12-01

    Full Text Available This paper proposes an improved continuous-time model predictive control (CTMPC of permanent magnetic synchronous motors (PMSMs for a wide-speed range, including the constant torque region and the flux-weakening (FW region. In the constant torque region, the mathematic models of PMSMs in dq-axes are decoupled without the limitation of DC-link voltage. However, in the FW region, the mathematic models of PMSMs in dq-axes are cross-coupled together with the limitation of DC-link voltage. A nonlinear PMSMs mathematic model in the FW region is presented based on the voltage angle. The solving of the nonlinear mathematic model of PMSMs in FW region will lead to heavy computation load for digital signal processing (DSP. To overcome such a problem, a linearization method of the voltage angle is also proposed to reduce the computation load. The selection of transiting points between the constant torque region and FW regions is researched to improve the performance of the driven system. Compared with the proportional integral (PI controller, the proposed CTMPC has obvious advantages in dealing with systems’ nonlinear constraints and improving system performance by restraining overshoot current under step torque changing. Both simulation and experimental results confirm the effectiveness of the proposed method in achieving good steady-state performance and smooth switching between the constant torque and FW regions.

  16. Simulation study on single event burnout in linear doping buffer layer engineered power VDMOSFET

    Jia Yunpeng; Su Hongyuan; Hu Dongqing; Wu Yu; Jin Rui

    2016-01-01

    The addition of a buffer layer can improve the device's secondary breakdown voltage, thus, improving the single event burnout (SEB) threshold voltage. In this paper, an N type linear doping buffer layer is proposed. According to quasi-stationary avalanche simulation and heavy ion beam simulation, the results show that an optimized linear doping buffer layer is critical. As SEB is induced by heavy ions impacting, the electric field of an optimized linear doping buffer device is much lower than that with an optimized constant doping buffer layer at a given buffer layer thickness and the same biasing voltages. Secondary breakdown voltage and the parasitic bipolar turn-on current are much higher than those with the optimized constant doping buffer layer. So the linear buffer layer is more advantageous to improving the device's SEB performance. (paper)

  17. Atomic mean-square displacements and the critical-voltage effect in cubic solid solutions

    Shirley, C.G.; Fisher, R.M.

    1979-01-01

    The critical-voltage phenomena observed in high-voltage electron microscope images of bend contours as well as in corresponding Kikuchi or convergent-beam diffraction patterns provide sensitive methods of determining submicroscopic alloy parameters such as Debye temperatures, short-range order, and atomic scattering factors. Only a very limited number of critical voltages can be observed in metal crystals in the voltage range usually available, 100 to 1200 kV, so that quantitative interpretation of the data must be based on a few-parameter model which incorporates all the pertinent factors. A satisfactory two-parameter model has been developed which can be used to interpret or compute the critical voltages of substitutional solid solutions as functions of composition, temperature and short-range order. In the alloy systems Fe-Cr, Ni-Au, Cu-Au and Cu-Al, sufficient critical voltage data are available to derive the model parameters which pertain to atomic bonding in the lattice. In addition to atomic scattering amplitudes, the critical voltage depends strongly on the atomic mean-square displacements. The static contribution to the mean-square displacements is large in alloys with large atomic-radius disparity, and is especially sensitive to short-range order in f.c.c. solid solutions. Well-defined best estimates for the model parameters are used to predict the critical voltage and its sensitivity to composition, temperature and short-range order for a large number of solid solutions. Systems for which critical-voltage studies may be of considerable interest are indicated. (author)

  18. Maximum permissible voltage of YBCO coated conductors

    Wen, J.; Lin, B.; Sheng, J.; Xu, J.; Jin, Z. [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Hong, Z., E-mail: zhiyong.hong@sjtu.edu.cn [Department of Electrical Engineering, Shanghai Jiao Tong University, Shanghai (China); Wang, D.; Zhou, H.; Shen, X.; Shen, C. [Qingpu Power Supply Company, State Grid Shanghai Municipal Electric Power Company, Shanghai (China)

    2014-06-15

    Highlights: • We examine three kinds of tapes’ maximum permissible voltage. • We examine the relationship between quenching duration and maximum permissible voltage. • Continuous I{sub c} degradations under repetitive quenching where tapes reaching maximum permissible voltage. • The relationship between maximum permissible voltage and resistance, temperature. - Abstract: Superconducting fault current limiter (SFCL) could reduce short circuit currents in electrical power system. One of the most important thing in developing SFCL is to find out the maximum permissible voltage of each limiting element. The maximum permissible voltage is defined as the maximum voltage per unit length at which the YBCO coated conductors (CC) do not suffer from critical current (I{sub c}) degradation or burnout. In this research, the time of quenching process is changed and voltage is raised until the I{sub c} degradation or burnout happens. YBCO coated conductors test in the experiment are from American superconductor (AMSC) and Shanghai Jiao Tong University (SJTU). Along with the quenching duration increasing, the maximum permissible voltage of CC decreases. When quenching duration is 100 ms, the maximum permissible of SJTU CC, 12 mm AMSC CC and 4 mm AMSC CC are 0.72 V/cm, 0.52 V/cm and 1.2 V/cm respectively. Based on the results of samples, the whole length of CCs used in the design of a SFCL can be determined.

  19. Microprocessor-controlled, programmable ramp voltage generator

    Hopwood, J.

    1978-11-01

    A special-purpose voltage generator has been developed for driving the quadrupole mass filter of a residual gas analyzer. The generator is microprocessor-controlled with desired ramping parameters programmed by setting front-panel digital thumb switches. The start voltage, stop voltage, and time of each excursion are selectable. A maximum of five start-stop levels may be pre-selected for each program. The ramp voltage is 0 to 10 volts with sweep times from 0.1 to 999.99 seconds

  20. Low-Voltage Switched-Capacitor Circuits

    Bidari, E.; Keskin, M.; Maloberti, F.

    1999-01-01

    Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications.......Switched-capacitor stages are described which can function with very low (typically 1 V) supply voltages, without using voltage boosting or switched op-amps. Simulations indicate that high performance may be achieved using these circuits in filter or data converter applications....

  1. Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

    Hahlbohm, H.D.; Luebbig, H.; Luther, H.

    1975-01-01

    Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

  2. Voltage-dependent gating in a "voltage sensor-less" ion channel.

    Harley T Kurata

    2010-02-01

    Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

  3. Lightning-induced overvoltages in low-voltage systems

    Hoeidalen, Hans Kristian

    1997-12-31

    Lightning-induced overvoltages (LIOs) are a main source of failures in low-voltage overhead line systems. This thesis deals mainly with calculations of LIOs aiming to enable the design of a proper voltage protection. Models for calculation of LIOs are adapted from the literature or developed based on measurements. The models used are believed to be fairly accurate for the first few microseconds, which is usually sufficient for predicting the maximum induced voltage in the system. The lightning channel is modelled by the Modified Transmission Line (MTL) model with the Transmission Line (TL) model as a special case. The coupling between the electrical fields from a lightning channel and an overhead line is modelled by Agrawal`s model. The attenuation of electrical fields over a lossy ground is modelled by Norton`s- or the Surface Impedance methods. The validity of all the applied models is analysed. In addition, measurements have been performed in order to develop models of distribution transformers and low-voltage power installation (LVPI) networks. Simple models of typical transformers and LVPIs are developed for calculations when specific data are unavailable. The practical range of values and its influence on the LIOs in a system is investigated. The main frequency range of interest related to LIOs is 10 kHz - 1 MHz in which all the models are accurate. The adapted or developed models are used to calculate LIOs in low-voltage systems. The influence of various key parameters in the system is investigated. Most important are the return stroke amplitude and rise time, the overhead line height and location, the termination of overhead line segments, neutral grounding, and the ground conductivity. 135 refs., 136 figs., 12 tabs.

  4. Linear shaped charge

    Peterson, David; Stofleth, Jerome H.; Saul, Venner W.

    2017-07-11

    Linear shaped charges are described herein. In a general embodiment, the linear shaped charge has an explosive with an elongated arrowhead-shaped profile. The linear shaped charge also has and an elongated v-shaped liner that is inset into a recess of the explosive. Another linear shaped charge includes an explosive that is shaped as a star-shaped prism. Liners are inset into crevices of the explosive, where the explosive acts as a tamper.

  5. Classifying Linear Canonical Relations

    Lorand, Jonathan

    2015-01-01

    In this Master's thesis, we consider the problem of classifying, up to conjugation by linear symplectomorphisms, linear canonical relations (lagrangian correspondences) from a finite-dimensional symplectic vector space to itself. We give an elementary introduction to the theory of linear canonical relations and present partial results toward the classification problem. This exposition should be accessible to undergraduate students with a basic familiarity with linear algebra.

  6. Voltage-controlled Enzymes: The new Janus Bifrons

    Carlos Alberto Villalba-Galea

    2012-09-01

    Full Text Available The Ciona intestinalis voltage sensitive phosphatase, Ci-VSP, was the first Voltage-controlled Enzyme (VEnz proven to be under direct command of the membrane potential. The discovery of Ci-VSP conjugated voltage sensitivity and enzymatic activity in a single protein. These two facets of Ci-VSP activity have provided a unique model for studying how membrane potential is sensed by proteins and a novel mechanism for control of enzymatic activity. These facets make Ci-VSP a fascinating and versatile enzyme.Ci-VSP has a voltage sensing domain (VSD that resembles those found in voltage-gated channels (VGC. The VSD resides in the N-terminus and is formed by four putative trans-membrane segments. The fourth segment contains charged residues which are likely involved in voltage sensing. Ci-VSP produces sensing currents in response to changes in potential, within a defined range of voltages. Sensing currents are analogous to gating currents in VGC. As known, these latter proteins contain four VSDs which are entangled in a complex interaction with the pore domain –the effector domain in VGC. This complexity makes studying the basis of voltage sensing in VGC a difficult enterprise. In contrast, Ci-VSP is thought to be monomeric and its catalytic domain –the VSP’s effector domain– can be cleaved off without disrupting the basic electrical functioning of the VSD. For these reasons, VSPs are considered a great model for studying the activity of a VSD in isolation. Finally, VSPs are also phosphoinositide phosphatases. Phosphoinositides are signaling lipids found in eukaryotes and are involved in many processes, including modulation of VGC activity and regulation of cell proliferation. Understanding VSPs as VEnz has been the center of attention in recent years and several reviews has been dedicated to this area. Thus, this review will be focused instead on the other face of this true Janus Bifrons and recapitulate what is known about VSPs as electrically

  7. Excitation of voltage oscillations in an induction voltage adder

    Nichelle Bruner

    2009-07-01

    Full Text Available The induction voltage adder is an accelerator architecture used in recent designs of pulsed-power driven x-ray radiographic systems such as Sandia National Laboratories’ Radiographic Integrated Test Stand (RITS, the Atomic Weapons Establishment’s planned Hydrus Facility, and the Naval Research Laboratory’s Mercury. Each of these designs relies on magnetic insulation to prevent electron loss across the anode-cathode gap in the vicinity of the adder as well as in the coaxial transmission line. Particle-in-cell simulations of the RITS adder and transmission line show that, as magnetic insulation is being established during a pulse, some electron loss occurs across the gap. Sufficient delay in the cavity pulse timings provides an opportunity for high-momentum electrons to deeply penetrate the cavities of the adder cells where they can excite radio-frequency resonances. These oscillations may be amplified in subsequent gaps, resulting in oscillations in the output power. The specific modes supported by the RITS-6 accelerator and details of the mechanism by which they are excited are presented in this paper.

  8. Linear-Algebra Programs

    Lawson, C. L.; Krogh, F. T.; Gold, S. S.; Kincaid, D. R.; Sullivan, J.; Williams, E.; Hanson, R. J.; Haskell, K.; Dongarra, J.; Moler, C. B.

    1982-01-01

    The Basic Linear Algebra Subprograms (BLAS) library is a collection of 38 FORTRAN-callable routines for performing basic operations of numerical linear algebra. BLAS library is portable and efficient source of basic operations for designers of programs involving linear algebriac computations. BLAS library is supplied in portable FORTRAN and Assembler code versions for IBM 370, UNIVAC 1100 and CDC 6000 series computers.

  9. Considering system non-linearity in transmission pricing

    Oloomi-Buygi, M.; Salehizadeh, M. Reza

    2008-01-01

    In this paper a new approach for transmission pricing is presented. The contribution of a contract on power flow of a transmission line is used as extent-of-use criterion for transmission pricing. In order to determine the contribution of each contract on power flow of each transmission line, first the contribution of each contract on each voltage angle is determined, which is called voltage angle decomposition. To this end, DC power flow is used to compute a primary solution for voltage angle decomposition. To consider the impacts of system non-linearity on voltage angle decomposition, a method is presented to determine the share of different terms of sine argument in sine value. Then the primary solution is corrected in different iterations of decoupled Newton-Raphson power flow using the presented sharing method. The presented approach is applied to a 4-bus test system and IEEE 30-bus test system and the results are analyzed. (author)

  10. Current integrator using the voltage to frequency converter

    Ukai, K.; Gomi, K.

    1975-01-01

    A current integrator using the Voltage to Frequency Converter has been constructed to measure the beam intensity of the 1.3 GeV Electron Synchrotron at the INS. This integrator ranges the current 10 -7 to 10 -11 amperes and has been calibrated by the extracted electron beam and constant current sources. The accuracy of this integrator agrees with the previous integrator within 1%. (auth.)

  11. Current voltage characteristics of composite superconductors with high contact resistance

    Akhmetov, A.A.; Baev, V.P.

    1984-01-01

    An experimental study has been made of current-voltage characteristics of composite superconductors with contact resistance between superconducting filaments and normal metal with high electrical conductivity. It is shown that stable resistive states exist in such conductors over a wide range of currents. The presence of resistive states is interpreted in terms of the resistive domain concept. The minimum and maximum currents of resistive states are found to be dependent on the electrical resistance of normal metal and magnetic field. (author)

  12. Programmable differential capacitance-to-voltage converter for MEMS accelerometers

    Royo, G.; Sánchez-Azqueta, C.; Gimeno, C.; Aldea, C.; Celma, S.

    2017-05-01

    Capacitive MEMS sensors exhibit an excellent noise performance, high sensitivity and low power consumption. They offer a huge range of applications, being the accelerometer one of its main uses. In this work, we present the design of a capacitance-to-voltage converter in CMOS technology to measure the acceleration from the capacitance variations. It is based on a low-power, fully-differential transimpedance amplifier with low input impedance and a very low input noise.

  13. Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

    Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

    1993-06-01

    Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

  14. Topics in quaternion linear algebra

    Rodman, Leiba

    2014-01-01

    Quaternions are a number system that has become increasingly useful for representing the rotations of objects in three-dimensional space and has important applications in theoretical and applied mathematics, physics, computer science, and engineering. This is the first book to provide a systematic, accessible, and self-contained exposition of quaternion linear algebra. It features previously unpublished research results with complete proofs and many open problems at various levels, as well as more than 200 exercises to facilitate use by students and instructors. Applications presented in the book include numerical ranges, invariant semidefinite subspaces, differential equations with symmetries, and matrix equations. Designed for researchers and students across a variety of disciplines, the book can be read by anyone with a background in linear algebra, rudimentary complex analysis, and some multivariable calculus. Instructors will find it useful as a complementary text for undergraduate linear algebra courses...

  15. Current-voltage-temperature characteristics of DNA origami

    Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M [Department of Chemical Engineering, Texas A and M University, College Station, TX 77843 (United States); Zhong Hong; Norton, Michael L [Department of Chemistry, Marshall University, Huntington, WV 25755 (United States); Sinitskii, Alexander [Department of Chemistry, Rice University, Houston, TX 77005 (United States)

    2009-04-29

    The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of {approx}0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.

  16. Current-voltage-temperature characteristics of DNA origami

    Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M; Zhong Hong; Norton, Michael L; Sinitskii, Alexander

    2009-01-01

    The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of ∼0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.

  17. Topologically protected loop flows in high voltage AC power grids

    Coletta, T; Delabays, R; Jacquod, Ph; Adagideli, I

    2016-01-01

    Geographical features such as mountain ranges or big lakes and inland seas often result in large closed loops in high voltage AC power grids. Sizable circulating power flows have been recorded around such loops, which take up transmission line capacity and dissipate but do not deliver electric power. Power flows in high voltage AC transmission grids are dominantly governed by voltage angle differences between connected buses, much in the same way as Josephson currents depend on phase differences between tunnel-coupled superconductors. From this previously overlooked similarity we argue here that circulating power flows in AC power grids are analogous to supercurrents flowing in superconducting rings and in rings of Josephson junctions. We investigate how circulating power flows can be created and how they behave in the presence of ohmic dissipation. We show how changing operating conditions may generate them, how significantly more power is ohmically dissipated in their presence and how they are topologically protected, even in the presence of dissipation, so that they persist when operating conditions are returned to their original values. We identify three mechanisms for creating circulating power flows, (i) by loss of stability of the equilibrium state carrying no circulating loop flow, (ii) by tripping of a line traversing a large loop in the network and (iii) by reclosing a loop that tripped or was open earlier. Because voltages are uniquely defined, circulating power flows can take on only discrete values, much in the same way as circulation around vortices is quantized in superfluids. (paper)

  18. Development of anode high voltage power supply system for ECRH of HL-2A tokamak

    Chen Wenguang

    2009-01-01

    The anode high voltage power supply system consist of DC high-voltage power supply (HVPS) and pulse modulator. SCR is used to vary AC input voltage of the step-up transformer by controlling the trigger phase in the HVPS, and regulate the DC output voltage linearly at the potential of low-end via BJT, Dual closed-loop control technology is applied in the controller, and its maximum output is at 30kV and 130mA. Tetrode is the core component of the modulator. The circuit design is optimized by using the simulation software. Test and HL-2A discharge experimental results show that the power supply system is designed with some characteristics of output scale widely, low ripple and modulate quickly. (authors)

  19. Prediction of picosecond voltage collapse and electromagnetic wave generation in gas avalanche switches

    Mayhall, D.J.; Yee, J.H.; Duong-Van, M.; Villa, F.

    1988-01-01

    A picosecond speed switch, the Gas Avalanche Switch (GAS), has been proposed for GeV linear accelerators. The medium is gas at high pressure (100 - 700 atm). An avalanche discharge is induced between pulse-charged high voltage electrodes by electron deposition from a fast laser pulse. Avalanche electrons move to the positive electrode, causing the applied voltage to collapse in picoseconds. A two-dimensional (2D) electromagnetic electron fluid computer code calculates the avalanche evolution and voltage collapse in air for an infinite parallel plate capacitor with a 0.1 mm spacing. Calculations are done for an accelerator switch geometry consisting of a 0.7 mm wide by 0.8 mm high, rectangular, high voltage center electrode (CE) between the grounded plates of a parallel plate line of 2 mm spacing. Several variations of CE elevation and initial electron deposition are investigated The 2D character of the outgoing TEM waves is shown

  20. Non-linear leak currents affect mammalian neuron physiology

    Shiwei eHuang

    2015-11-01

    Full Text Available In their seminal works on squid giant axons, Hodgkin and Huxley approximated the membrane leak current as Ohmic, i.e. linear, since in their preparation, sub-threshold current rectification due to the influence of ionic concentration is negligible. Most studies on mammalian neurons have made the same, largely untested, assumption. Here we show that the membrane time constant and input resistance of mammalian neurons (when other major voltage-sensitive and ligand-gated ionic currents are discounted varies non-linearly with membrane voltage, following the prediction of a Goldman-Hodgkin-Katz-based passive membrane model. The model predicts that under such conditions, the time constant/input resistance-voltage relationship will linearize if the concentration differences across the cell membrane are reduced. These properties were observed in patch-clamp recordings of cerebellar Purkinje neurons (in the presence of pharmacological blockers of other background ionic currents and were more prominent in the sub-threshold region of the membrane potential. Model simulations showed that the non-linear leak affects voltage-clamp recordings and reduces temporal summation of excitatory synaptic input. Together, our results demonstrate the importance of trans-membrane ionic concentration in defining the functional properties of the passive membrane in mammalian neurons as well as other excitable cells.