New non-linear control strategy for non-isolated DC/DC converter with high voltage ratio

International Nuclear Information System (INIS)

Shahin, A.; Huang, B.; Martin, J.P.; Pierfederici, S.; Davat, B.

2010-01-01

In this paper, a non-isolated DC/DC converter with high voltage ratio is proposed to allow the interface between a low voltage power source like fuel cell and a high voltage DC bus. To take into account the low voltage-high density characteristics of power sources, a cascaded structure composed of two sub-converters has been chosen and allows obtaining a high voltage ratio. The choice of each sub-converter is based on the requirements of the source and its performances. Consequently, we have chosen a three-interleaved boost converter as the 1st sub-converter whereas the 2nd sub-converter is a three-level boost converter. The control of the whole system is realized thanks to energetic trajectories planning based on flatness properties of the system. The control of both the current and the balance of voltage across the output serial capacitors of the three-level boost converter is ensured by non-linear controllers based on a new non-linear model. Experimental results allow validating the proposed power architecture and its associated control.

High voltage wide range marx generator design and construction

International Nuclear Information System (INIS)

Thompson, J.E.

1976-01-01

A wide range, long pulse, Marx generator has been designed and constructed for the purpose of exciting a thermionic electron gun utilized for quasi-cw gas laser medium ionization. The Marx generator has been specifically designed to operate over a voltage range variable from 100 kV to 200 kV into a resistive load of between 83 kΩ and open circuit. This wide operating range, both in voltage and load impedance, was obtained using interstage coupling capacitors to assure overvoltage and subsequent breakdown of the three element spark gap switches used. This paper will discuss the motivation and specific application for the Marx generator and will present the relevant design procedure with particular emphasis on the interstage coupling and triggering techniques employed. Experimental data regarding the measured Marx generator performance will also be presented

Low voltage RF MEMS variable capacitor with linear C-V response

KAUST Repository

Elshurafa, Amro M.; Ho, Pak Hung; Salama, Khaled N.

2012-01-01

.2:1 and was achieved at an actuation DC voltage of 8V only. Further, the linear regression coefficient was 0.98. The variable capacitor was created such that it has both vertical and horizontal capacitances present. As the top suspended plate moves towards the bottom

Voltage and pace-capture mapping of linear ablation lesions overestimates chronic ablation gap size.

Science.gov (United States)

O'Neill, Louisa; Harrison, James; Chubb, Henry; Whitaker, John; Mukherjee, Rahul K; Bloch, Lars Ølgaard; Andersen, Niels Peter; Dam, Høgni; Jensen, Henrik K; Niederer, Steven; Wright, Matthew; O'Neill, Mark; Williams, Steven E

2018-04-26

Conducting gaps in lesion sets are a major reason for failure of ablation procedures. Voltage mapping and pace-capture have been proposed for intra-procedural identification of gaps. We aimed to compare gap size measured acutely and chronically post-ablation to macroscopic gap size in a porcine model. Intercaval linear ablation was performed in eight Göttingen minipigs with a deliberate gap of ∼5 mm left in the ablation line. Gap size was measured by interpolating ablation contact force values between ablation tags and thresholding at a low force cut-off of 5 g. Bipolar voltage mapping and pace-capture mapping along the length of the line were performed immediately, and at 2 months, post-ablation. Animals were euthanized and gap sizes were measured macroscopically. Voltage thresholds to define scar were determined by receiver operating characteristic analysis as voltage, pace-capture, and ablation contact force maps. All modalities overestimated chronic gap size, by 1.4 ± 2.0 mm (ablation contact force map), 5.1 ± 3.4 mm (pace-capture), and 9.5 ± 3.8 mm (voltage mapping). Error on ablation contact force map gap measurements were significantly less than for voltage mapping (P = 0.003, Tukey's multiple comparisons test). Chronically, voltage mapping and pace-capture mapping overestimated macroscopic gap size by 11.9 ± 3.7 and 9.8 ± 3.5 mm, respectively. Bipolar voltage and pace-capture mapping overestimate the size of chronic gap formation in linear ablation lesions. The most accurate estimation of chronic gap size was achieved by analysis of catheter-myocardium contact force during ablation.

Colored Range Searching in Linear Space

DEFF Research Database (Denmark)

Grossi, Roberto; Vind, Søren Juhl

2014-01-01

In colored range searching, we are given a set of n colored points in d ≥ 2 dimensions to store, and want to support orthogonal range queries taking colors into account. In the colored range counting problem, a query must report the number of distinct colors found in the query range, while...... an answer to the colored range reporting problem must report the distinct colors in the query range. We give the first linear space data structure for both problems in two dimensions (d = 2) with o(n) worst case query time. We also give the first data structure obtaining almost-linear space usage and o...

Power MOSFET Linearizer of a High-Voltage Power Amplifier for High-Frequency Pulse-Echo Instrumentation.

Science.gov (United States)

Choi, Hojong; Woo, Park Chul; Yeom, Jung-Yeol; Yoon, Changhan

2017-04-04

A power MOSFET linearizer is proposed for a high-voltage power amplifier (HVPA) used in high-frequency pulse-echo instrumentation. The power MOSFET linearizer is composed of a DC bias-controlled series power MOSFET shunt with parallel inductors and capacitors. The proposed scheme is designed to improve the gain deviation characteristics of the HVPA at higher input powers. By controlling the MOSFET bias voltage in the linearizer, the gain reduction into the HVPA was compensated, thereby reducing the echo harmonic distortion components generated by the ultrasonic transducers. In order to verify the performance improvement of the HVPA implementing the power MOSFET linearizer, we measured and found that the gain deviation of the power MOSFET linearizer integrated with HVPA under 10 V DC bias voltage was reduced (-1.8 and -0.96 dB, respectively) compared to that of the HVPA without the power MOSFET linearizer (-2.95 and -3.0 dB, respectively) when 70 and 80 MHz, three-cycle, and 26 dB m input pulse waveforms are applied, respectively. The input 1-dB compression point (an index of linearity) of the HVPA with power MOSFET linearizer (24.17 and 26.19 dB m at 70 and 80 MHz, respectively) at 10 V DC bias voltage was increased compared to that of HVPA without the power MOSFET linearizer (22.03 and 22.13 dB m at 70 and 80 MHz, respectively). To further verify the reduction of the echo harmonic distortion components generated by the ultrasonic transducers, the pulse-echo responses in the pulse-echo instrumentation were compared when using HVPA with and without the power MOSFET linearizer. When three-cycle 26 dB m input power was applied, the second, third, fourth, and fifth harmonic distortion components of a 75 MHz transducer driven by the HVPA with power MOSFET linearizer (-48.34, -44.21, -48.34, and -46.56 dB, respectively) were lower than that of the HVPA without the power MOSFET linearizer (-45.61, -41.57, -45.01, and -45.51 dB, respectively). When five-cycle 20 dB m input

A Bidirectional Resonant DC-DC Converter Suitable for Wide Voltage Gain Range

DEFF Research Database (Denmark)

Shen, Yanfeng; Wang, Huai; Al-Durra, Ahmed

2018-01-01

This paper proposes a new bidirectional resonant dc-dc converter suitable for wide voltage gain range applications (e.g., energy storage systems). The proposed converter overcomes the narrow voltage gain range of conventional resonant dc-dc converters, and meanwhile achieves high efficiency...... losses. The operation principles and characteristics of the proposed converter are firstly analyzed in this paper. Then the analytical solutions for the voltage gain, soft-switching, and rms currents are derived, which facilitates the parameters design and optimization. Finally, the proposed topology...... and analysis are verified with experimental results obtained from a 1-kW converter prototype....

Air-gap field, induced voltage and thrust in the short-stator linear induction motor

Energy Technology Data Exchange (ETDEWEB)

Deleroi, W

1980-07-15

The description of the magnetic field in the air-gap of a short-primary linear induction motor, and the subsequent calculation of the thrust developed and the voltages induced in the stator bars can be made by using balancing waves. These balancing waves are generated at any point where the field wave that would exist in a machine of infinite length is disturbed. In the linear motor these disturbances occur at the ends of the stator iron and at discontinuities in the distribution of the stator winding, which exist in machines having stepped windings. From the points where they are generated, free balancing waves travel in two directions and determine the performance of these machines to a large extent. The voltage they induce in a stator bar can be determined from the core flux and mapped on a phasor diagram. The resulting voltage phasor follows a logarithmic spiral. The resulting voltages induced in the three phase windings form a strongly asymmetrical system which can be split-up into positive-, negative- and zerosequence components depending on the slip. The tangential forces may be calculated as the product of the magnetic flux density in the air-gap and the linear current density in either the stator or the reaction rail. As the 'magnetic tail' outside the machine also gives rise to forces in the direction of motion, both methods yield quite different force distributions, though for the resulting force the same value is found.

Fully Integrated, Low Drop-Out Linear Voltage Regulator in 180 nm CMOS

DEFF Research Database (Denmark)

Yosef-Hay, Yoni; Larsen, Dennis Øland; Llimos Muntal, Pere

2017-01-01

This paper presents a capacitor-free low dropout (LDO) linear regulator based on a dual loop topology. The regulator utilizes two feedback loops to satisfy the challenges of hearing aid devices, which include fast transient performance and small voltage spikes under rapid load-current changes...

Electric field control methods for foil coils in high-voltage linear actuators

NARCIS (Netherlands)

Beek, van T.A.; Jansen, J.W.; Lomonova, E.A.

2015-01-01

This paper describes multiple electric field control methods for foil coils in high-voltage coreless linear actuators. The field control methods are evaluated using 2-D and 3-D boundary element methods. A comparison is presented between the field control methods and their ability to mitigate

An improved direct feedback linearization technique for transient stability enhancement and voltage regulation of power generators

Energy Technology Data Exchange (ETDEWEB)

Kenne, Godpromesse [Laboratoire d' Automatique et d' Informatique Appliquee (LAIA), Departement de Genie Electrique, Universite de Dschang, B.P. 134 Bandjoun, Cameroun; Goma, Raphael; Lamnabhi-Lagarrigue, Francoise [Laboratoire des Signaux et Systemes (L2S), CNRS-SUPELEC, Universite Paris XI, 3 Rue Joliot Curie, 91192 Gif-sur-Yvette (France); Nkwawo, Homere [Departement GEII, Universite Paris XIII, IUT Villetaneuse, 99 Avenue Jean Baptiste Clement, 93430 Villetaneuse (France); Arzande, Amir; Vannier, Jean Claude [Departement Energie, Ecole Superieure d' Electricite-SUPELEC, 3 Rue Joliot Curie, 91192 Gif-sur-Yvette (France)

2010-09-15

In this paper, a simple improved direct feedback linearization design method for transient stability and voltage regulation of power systems is discussed. Starting with the classical direct feedback linearization technique currently applied to power systems, an adaptive nonlinear excitation control of synchronous generators is proposed, which is new and effective for engineering. The power angle and mechanical power input are not assumed to be available. The proposed method is based on a standard third-order model of a synchronous generator which requires only information about the physical available measurements of angular speed, active electric power and generator terminal voltage. Experimental results of a practical power system show that fast response, robustness, damping, steady-state and transient stability as well as voltage regulation are all achieved satisfactorily. (author)

Linear inductive voltage adders (IVA) for advanced hydrodynamic radiography

International Nuclear Information System (INIS)

Mazarakis, M.G.; Boyes, J.D.; Johnson, D.L.

1998-01-01

The electron beam which drifts through the multiple cavities of conventional induction linacs (LIA) is replaced in an IVA by a cylindrical metal conductor which extends along the entire length of the device and effectuates the addition of the accelerator cavity voltages. In the approach to radiography, the linear inductive voltage adder drives a magnetically immersed electron diode with a millimeter diameter cathode electrode and a planar anode/bremsstrahlung converter. Both anode and cathode electrodes are immersed in a strong (15--50 T) solenoidal magnetic field. The electron beam cross section is approximately of the same size as the cathode needle and generates a similar size, very intense x-ray beam when it strikes the anode converter. An IVA driven diode can produce electron beams of equal size and energy as a LIA but with much higher currents (40--50 kA versus 4--5 kA), simpler hardware and thus lower cost. The authors present here first experimental validations of the technology utilizing HERMES 3 and SABRE IVA accelerators. The electron beam voltage and current were respectively of the order of 10 MV and 40 kA. X-ray doses of up to 1 kR at sign 1 m and spot sizes as small as 1.7 mm (at 200 R doses) were measured

A Voltage Doubler Circuit to Extend the Soft-switching Range of Dual Active Bridge Converters

DEFF Research Database (Denmark)

Qin, Zian; Shen, Yanfeng; Wang, Huai

2017-01-01

A voltage doubler circuit is realized to extend the soft-switching range of Dual Active Bridge (DAB) converters. No extra hardware is added to the DAB to form this circuit, since it is composed of the dc blocking capacitor and the low side full bridge converter, which already exist in DAB....... With the voltage doubler, the DAB converter can achieve soft switching and high efficiency when the low side dc voltage is close to 2 pu (1 pu is the high side dc voltage divided by the transformer turn ratio), which can be realized only when the low side dc voltage is close to 1 pu by using the conventional phase...... shift modulation in DAB. Thus the soft switching range is extended. The soft switching boundary conditions are derived. A map to show the soft switching or hard switching in the full load and voltage range is obtained. The feasibility and effectiveness of the proposed method is finally verified...

Association Between Local Bipolar Voltage and Conduction Gap Along the Left Atrial Linear Ablation Lesion in Patients With Atrial Fibrillation.

Science.gov (United States)

Masuda, Masaharu; Fujita, Masashi; Iida, Osamu; Okamoto, Shin; Ishihara, Takayuki; Nanto, Kiyonori; Kanda, Takashi; Sunaga, Akihiro; Tsujimura, Takuya; Matsuda, Yasuhiro; Mano, Toshiaki

2017-08-01

A bipolar voltage reflects a thick musculature where formation of a transmural lesion may be hard to achieve. The purpose of this study was to explore the association between local bipolar voltage and conduction gap in patients with persistent atrial fibrillation (AF) who underwent atrial roof or septal linear ablation. This prospective observational study included 42 and 36 consecutive patients with persistent AF who underwent roof or septal linear ablations, respectively. After pulmonary vein isolation, left atrial linear ablations were performed, and conduction gap sites were identified and ablated after first-touch radiofrequency application. Conduction gap(s) after the first-touch roof and septal linear ablation were observed in 13 (32%) and 19 patients (53%), respectively. Roof and septal area voltages were higher in patients with conduction gap(s) than in those without (roof, 1.23 ± 0.77 vs 0.73 ± 0.42 mV, p = 0.010; septal, 0.96 ± 0.43 vs 0.54 ± 0.18 mV, p = 0.001). Trisected regional analyses revealed that the voltage was higher at the region with a conduction gap than at the region without. Complete conduction block across the roof and septal lines was not achieved in 3 (7%) and 6 patients (17%), respectively. Patients in whom a linear conduction block could not be achieved demonstrated higher ablation area voltage than those with a successful conduction block (roof, 1.91 ± 0.74 vs 0.81 ± 0.51 mV, p = 0.001; septal, 1.15 ± 0.56 vs 0.69 ± 0.31 mV, p = 0.006). In conclusion, a high regional bipolar voltage predicts failure to achieve conduction block after left atrial roof or septal linear ablation. In addition, the conduction gap was located at the preserved voltage area. Copyright © 2017 Elsevier Inc. All rights reserved.

Preliminary Modeling of Permanent Magnet Probe Flowmeter for Voltage Signal Estimation

Energy Technology Data Exchange (ETDEWEB)

Jeong, Uiju; Kim, Sung Joong [Hanyang Univ., Seoul (Korea, Republic of); Jeong, Ji Young; Kim, Tae Joon [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of)

2013-10-15

An experimental study on performance analysis of the flowmeter has been performed. The study shows that sodium flow rate is linearly proportional to the induced voltage signal from the flowmeter under the turbulent flow condition. The experimental results support its availability in the PDRC system. But, the flowmeter should be able to measure sodium flow at low Reynolds number as well. That is because the PDRC system uses sodium natural convection for its operation. Thus, calibration of the flowmeter should be done at very low sodium flow rates. However, Von Weissenfluh et al. showed that the relationship between flow rate and measured voltage signal from the flowmeter may become non-linear at very low flow rates. The nonlinearity restricts the utilization of level sensor which provide reference flow rate in the calibration experiment. The primary objective of this study is to predict the sodium flow rate range where the induced voltage signals are linearly proportional to flow rates by estimating the induced voltage signals against sodium flow rates for a wide range of flows numerically. A commercial code FLUENT is adopted for the analysis of flow field. And MAXWELL which is an electromagnetic analysis software using a finite volume method has been used to analyze the magnetic field generated by permanent magnet of the flowmeter. The induced voltage signals have been estimated by coupling the sodium flow field and the magnetic field using FLUENT MHD module. It is expected that the PMPF voltage signals are linearly proportional to flow rates range of 0.0059 to 1.96 lps. This suggests that simple calibration technique using the linearity between flow rate and the voltage signal can be adopted in calibration of the PMPF.

Cell voltage versus electrode potential range in aqueous supercapacitors

Science.gov (United States)

Dai, Zengxin; Peng, Chuang; Chae, Jung Hoon; Ng, Kok Chiang; Chen, George Z.

2015-01-01

Supercapacitors with aqueous electrolytes and nanostructured composite electrodes are attractive because of their high charging-discharging speed, long cycle life, low environmental impact and wide commercial affordability. However, the energy capacity of aqueous supercapacitors is limited by the electrochemical window of water. In this paper, a recently reported engineering strategy is further developed and demonstrated to correlate the maximum charging voltage of a supercapacitor with the capacitive potential ranges and the capacitance ratio of the two electrodes. Beyond the maximum charging voltage, a supercapacitor may still operate, but at the expense of a reduced cycle life. In addition, it is shown that the supercapacitor performance is strongly affected by the initial and zero charge potentials of the electrodes. Further, the differences are highlighted and elaborated between freshly prepared, aged under open circuit conditions, and cycled electrodes of composites of conducting polymers and carbon nanotubes. The first voltammetric charging-discharging cycle has an electrode conditioning effect to change the electrodes from their initial potentials to the potential of zero voltage, and reduce the irreversibility. PMID:25897670

Submicrosecond linear pulse transformer for 800 kV voltage with modular low-inductance primary power supply

Energy Technology Data Exchange (ETDEWEB)

Bykov, Yu. A.; Krastelev, E. G., E-mail: ekrastelev@yandex.ru; Popov, G. V.; Sedin, A. A.; Feduschak, V. F. [Russian Academy of Sciences, Joint Institute for High Temperatures (Russian Federation)

2016-12-15

A pulsed power source with voltage amplitude up to 800 kV for fast charging (350–400 ns) of the forming line of a high-current nanosecond accelerator is developed. The source includes capacitive energy storage and a linear pulse transformer. The linear transformer consists of a set of 20 inductors with circular ferromagnetic cores surrounded by primary windings inside of which a common stock adder of voltage with film-glycerol insulation is placed. The primary energy storage consists of ten modules, each of which is a low-inductance assembly of two capacitors with a capacitance of 0.35 μF and one gas switch mounted in the same frame. The total energy stored in capacitors is 5.5 kJ at the operating voltage of 40 kV. According to test results, the parameters of the equivalent circuit of the source are the following: shock capacitance = 17.5 nF, inductance = 2 μH, resistance = 3.2 Ω.

A Fixed-Frequency Bidirectional Resonant DC-DC Converter Suitable for Wide Voltage Gain Range

DEFF Research Database (Denmark)

Shen, Yanfeng; Wang, Huai; Blaabjerg, Frede

2017-01-01

This paper proposes a new bidirectional resonant dc-dc converter suitable for wide voltage gain range applications (e.g., energy storage systems). The proposed converter overcomes the narrow voltage gain range of conventional resonant DC-DC converters, and meanwhile achieves high efficiency...... and characteristics of the proposed converter are analyzed. Finally, a 1-kW converter prototype is built and the experimental results verify the theoretical analyses....

Primary Paralleled Isolated Boost Converter with Extended Operating Voltage Range

DEFF Research Database (Denmark)

Hernandez Botella, Juan Carlos; Sen, Gökhan; Mira Albert, Maria del Carmen

2012-01-01

Applications requiring wide input and output voltage range cannot often be satisfied by using buck or boost derived topologies. Primary paralleled isolated boost converter (PPIBC) [1]-[2] is a high efficiency boost derived topology. This paper proposes a new operation mode for extending the input...

Mappings with closed range and finite dimensional linear spaces

International Nuclear Information System (INIS)

Iyahen, S.O.

1984-09-01

This paper looks at two settings, each of continuous linear mappings of linear topological spaces. In one setting, the domain space is fixed while the range space varies over a class of linear topological spaces. In the second setting, the range space is fixed while the domain space similarly varies. The interest is in when the requirement that the mappings have a closed range implies that the domain or range space is finite dimensional. Positive results are obtained for metrizable spaces. (author)

Wide-range voltage modulation

International Nuclear Information System (INIS)

Rust, K.R.; Wilson, J.M.

1992-06-01

The Superconducting Super Collider's Medium Energy Booster Abort (MEBA) kicker modulator will supply a current pulse to the abort magnets which deflect the proton beam from the MEB ring into a designated beam stop. The abort kicker will be used extensively during testing of the Low Energy Booster (LEB) and the MEB rings. When the Collider is in full operation, the MEBA kicker modulator will abort the MEB beam in the event of a malfunction during the filling process. The modulator must generate a 14-μs wide pulse with a rise time of less than 1 μs, including the delay and jitter times. It must also be able to deliver a current pulse to the magnet proportional to the beam energy at any time during ramp-up of the accelerator. Tracking the beam energy, which increases from 12 GeV at injection to 200 GeV at extraction, requires the modulator to operate over a wide range of voltages (4 kV to 80 kV). A vacuum spark gap and a thyratron have been chosen for test and evaluation as candidate switches for the abort modulator. Modulator design, switching time delay, jitter and pre-fire data are presented

Graphene-Based Linear Tandem Micro-Supercapacitors with Metal-Free Current Collectors and High-Voltage Output.

Science.gov (United States)

Shi, Xiaoyu; Wu, Zhong-Shuai; Qin, Jieqiong; Zheng, Shuanghao; Wang, Sen; Zhou, Feng; Sun, Chenglin; Bao, Xinhe

2017-11-01

Printable supercapacitors are regarded as a promising class of microscale power source, but are facing challenges derived from conventional sandwich-like geometry. Herein, the printable fabrication of new-type planar graphene-based linear tandem micro-supercapacitors (LTMSs) on diverse substrates with symmetric and asymmetric configuration, high-voltage output, tailored capacitance, and outstanding flexibility is demonstrated. The resulting graphene-based LTMSs consisting of 10 micro-supercapacitors (MSs) present efficient high-voltage output of 8.0 V, suggestive of superior uniformity of the entire integrated device. Meanwhile, LTMSs possess remarkable flexibility without obvious capacitance degradation under different bending states. Moreover, areal capacitance of LTMSs can be sufficiently modulated by incorporating polyaniline-based pseudocapacitive nanosheets into graphene electrodes, showing enhanced capacitance of 7.6 mF cm -2 . To further improve the voltage output and energy density, asymmetric LTMSs are fabricated through controlled printing of linear-patterned graphene as negative electrodes and MnO 2 nanosheets as positive electrodes. Notably, the asymmetric LTMSs from three serially connected MSs are easily extended to 5.4 V, triple voltage output of the single cell (1.8 V), suggestive of the versatile applicability of this technique. Therefore, this work offers numerous opportunities of graphene and analogous nanosheets for one-step scalable fabrication of flexible tandem energy storage devices integrating with printed electronics on same substrate. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Non-linear Membrane Properties in Entorhinal Cortical Stellate Cells Reduce Modulation of Input-Output Responses by Voltage Fluctuations

Science.gov (United States)

Fernandez, Fernando R.; Malerba, Paola; White, John A.

2015-01-01

The presence of voltage fluctuations arising from synaptic activity is a critical component in models of gain control, neuronal output gating, and spike rate coding. The degree to which individual neuronal input-output functions are modulated by voltage fluctuations, however, is not well established across different cortical areas. Additionally, the extent and mechanisms of input-output modulation through fluctuations have been explored largely in simplified models of spike generation, and with limited consideration for the role of non-linear and voltage-dependent membrane properties. To address these issues, we studied fluctuation-based modulation of input-output responses in medial entorhinal cortical (MEC) stellate cells of rats, which express strong sub-threshold non-linear membrane properties. Using in vitro recordings, dynamic clamp and modeling, we show that the modulation of input-output responses by random voltage fluctuations in stellate cells is significantly limited. In stellate cells, a voltage-dependent increase in membrane resistance at sub-threshold voltages mediated by Na+ conductance activation limits the ability of fluctuations to elicit spikes. Similarly, in exponential leaky integrate-and-fire models using a shallow voltage-dependence for the exponential term that matches stellate cell membrane properties, a low degree of fluctuation-based modulation of input-output responses can be attained. These results demonstrate that fluctuation-based modulation of input-output responses is not a universal feature of neurons and can be significantly limited by subthreshold voltage-gated conductances. PMID:25909971

Boost Half-Bridge DC-DC Converter with Reconfigurable Rectifier for Ultra-Wide Input Voltage Range Applications

DEFF Research Database (Denmark)

Vinnikov, Dmitri; Chub, Andrii; Liivik, Elizaveta

2018-01-01

This paper introduces a novel galvanically isolated boost half-bridge dc-dc converter intended for modern power electronic applications where ultra-wide input voltage regulation range is needed. A reconfigurable output rectifier stage performs a transition between the voltage doubler and the full......-bridge diode rectifiers and, by this means, extends the regulation range significantly. The converter features a low number of components and resonant soft switching of semiconductors, which result in high power conversion efficiency over a wide input voltage and load range. The paper presents the operating...

Multi-stage LLC resonant converters designed for wide output voltage ranges

OpenAIRE

Tsang, C.-W.; Bingham, C. M.; Foster, M. P.; Stone, D. A.; Leech, J. M.

2016-01-01

The paper describes a novel multi-stage LLC resonant converter topology for facilitating wide output voltage ranges. This is achieved by combining the gain range of a capacitor-diode clamped LLC resonant converter with that of a traditional LLC resonant converter. A prototype converter is designed and commissioned to illustrate the design procedure and demonstrate resulting operational characteristics. Experimental results are used to show operational characteristics of the proposed conver...

A low-offset low-voltage CMOS Op Amp with rail-to-rail input and output ranges

NARCIS (Netherlands)

Holzmann, Peter J.; Wiegerink, Remco J.; Gierkink, Sander L.J.; Wassenaar, R.F.; Stroet, Peter; Stroet, P.M.

1996-01-01

A low voltage CMOS op amp is presented. The circuit uses complementary input pairs to achieve a rail-to-rail common mode input voltage range. Special attention has been given to the reduction of the op amp's systematic offset voltage. Gain boost amplifiers are connected in a special way to provide

A new linear inductive voltage adder driver for the Saturn Accelerator

International Nuclear Information System (INIS)

Mazarakis, M.G.; Spielman, R.B.; Struve, K.W.; Long, F.W.

2000-01-01

Saturn is a dual-purpose accelerator. It can be operated as a large-area flash x-ray source for simulation testing or as a Z-pinch driver especially for K-line x-ray production. In the first mode, the accelerator is fitted with three concentric-ring 2-MV electron diodes, while in the Z-pinch mode the current of all the modules is combined via a post-hole convolute arrangement and driven through a cylindrical array of very fine wires. We present here a point design for a new Saturn class driver based on a number of linear inductive voltage adders connected in parallel. A technology recently implemented at the Institute of High Current Electronics in Tomsk (Russia) is being utilized. In the present design we eliminate Marx generators and pulse-forming networks. Each inductive voltage adder cavity is directly fed by a number of fast 100-kV small-size capacitors arranged in a circular array around each accelerating gap. The number of capacitors connected in parallel to each cavity defines the total maximum current. By selecting low inductance switches, voltage pulses as short as 30-50-ns FWHM can be directly achieved. The voltage of each stage is low (100-200 kv). Many stages are required to achieve multi-megavolt accelerator output. However, since the length of each stage is very short (4-10 cm), accelerating gradients of higher than 1 MV/m can easily be obtained. The proposed new driver will be capable of delivering pulses of 15-MA, 36-TW, 1.2-MJ to the diode load, with a peak voltage of -2.2 MV and FWHM of 40-ns. And although its performance will exceed the presently utilized driver, its size and cost could be much smaller (approximately1/3). In addition, no liquid dielectrics like oil or deionized water will be required. Even elimination of ferromagnetic material (by using air-core cavities) is a possibility

Dynamic range of low-voltage cascode current mirrors

DEFF Research Database (Denmark)

Bruun, Erik; Shah, Peter Jivan

1995-01-01

Low-voltage cascode current mirrors are reviewed with respect to the design limitations imposed if all transistors in the mirror are required to operate in the saturation region. It is found that both a lower limit and an upper limit exist for the cascode transistor bias voltage. Further, the use....... The proposed configuration has the advantage of simplicity combined with a complete elimination of the need for fixed bias voltages or bias currents in the current mirror. A disadvantage is that it requires a higher input voltage to the current mirror...

Enhancing Linearity of Voltage Controlled Oscillator Thermistor Signal Conditioning Circuit Using Linear Search

Science.gov (United States)

Rana, K. P. S.; Kumar, Vineet; Prasad, Tapan

2018-02-01

Temperature to Frequency Converters (TFCs) are potential signal conditioning circuits (SCCs) usually employed in temperature measurements using thermistors. A NE/SE-566 based SCC has been recently used in several reported works as TFC. Application of NE/SE-566 based SCC requires a mechanism for finding the optimal values of SCC parameters yielding the optimal linearity and desired sensitivity performances. Two classical methods, namely, inflection point and three point have been employed for this task. In this work, the application of these two methods, on NE/SE-566 based SCC in TFC, is investigated in detail and the conditions for its effective usage are developed. Further, since these classical methods offer an approximate linearization of temperature and frequency relationship an application of a linear search based technique is proposed to further enhance the linearity. The implemented linear search method used results obtained from the above mentioned classical methods. The presented simulation studies, for three different industrial grade thermistors, revealed that the linearity enhancements of 21.7, 18.3 and 17.8% can be achieved over the inflection point method and 4.9, 4.7 and 4.7% over the three point method, for an input temperature range of 0-100 °C.

Low-Voltage, Low-Power, and Wide-Tuning-Range Ring-VCO for Frequency ΔΣ Modulator

DEFF Research Database (Denmark)

Tuan Vu, Cao; Wisland, Dag T.; Lande, Tor Sverre

A low-voltage, low-power, and wide-tuning-range VCO which converts an analog input voltage to phase information for a frequency ΔΣ modulator is proposed in this paper. The VCO is based on a differential ring oscillator, which is improved with modified symmetric load and a positive feedback...

Development of three channel linear bipolar high voltage amplifier (±2 KV) for electrostatic steerer

International Nuclear Information System (INIS)

Rajesh Kumar; Mukesh Kumar; Suman, S.K.; Safvan, C.P.; Mandal, A.

2011-01-01

Electrostatic steerers and scanners are planned for low energy ion beam facilities at IUAC to steer and scan the ion beam on target. The power supplies for electrostatic steerers are high voltage bipolar DC amplifiers and for scanners are bipolar AC amplifiers. To fulfil the requirements a common unit has been designed and assembled for AC and DC applications. It can be used with electrostatic devices in scanning, steering and sweeping of low energy ion beams at high frequencies to attain uniform implantation. The unit consist of three independent limited bandwidth high voltage, linear bipolar amplifiers (for X-axis, Y-axis and Y1-dog leg plates). The unit has been provided with both local and remote control. (author)

The Design and Characterization of a Prototype Wideband Voltage Sensor Based on a Resistive Divider.

Science.gov (United States)

Garnacho, Fernando; Khamlichi, Abderrahim; Rovira, Jorge

2017-11-17

The most important advantage of voltage dividers over traditional voltage transformers is that voltage dividers do not have an iron core with non-linear hysteresis characteristics. The voltage dividers have a linear behavior with respect to over-voltages and a flat frequency response larger frequency range. The weak point of a voltage divider is the influence of external high-voltage (HV) and earth parts in its vicinity. Electrical fields arising from high voltages in neighboring phases and from ground conductors and structures are one of their main sources for systematic measurement errors. This paper describes a shielding voltage divider for a 24 kV medium voltage network insulated in SF6 composed of two resistive-capacitive dividers, one integrated within the other, achieving a flat frequency response up to 10 kHz for ratio error and up to 5 kHz for phase displacement error. The metal shielding improves its immunity against electric and magnetic fields. The characterization performed on the built-in voltage sensor shows an accuracy class of 0.2 for a frequency range from 20 Hz to 5 kHz and a class of 0.5 for 1 Hz up to 20 Hz. A low temperature effect is also achieved for operation conditions of MV power grids.

Design considerations of a linear generator for a range extender application

Directory of Open Access Journals (Sweden)

Seo Un-Jae

2015-12-01

Full Text Available The free piston linear generator is a new range extender concept for the application in a full electric vehicle. The free piston engine driven linear generators can achieve high efficiency at part and full load which is suitable for the range extender application. This paper presents requirements for designing a linear generator deduced from a basic analysis of a free piston linear generator.

Free piston linear generator in comparison to other range-extender technologies

OpenAIRE

Virsik, Roman; Heron, Alex

2013-01-01

The free piston linear generator is a new range-extender technology. It converts chemical energy into electrical energy by means of a combustion process and linear generator. Thereby the technology aims to have better properties than other range extenders. Therefore this publication deals with the explanation of the concept and the characteristics of a free piston linear generator and a comparison to other technologies. In order to compare the range extender systems, fuel cells, micro gas tur...

Voltage Dependence of Supercapacitor Capacitance

Directory of Open Access Journals (Sweden)

Szewczyk Arkadiusz

2016-09-01

Full Text Available Electronic Double-Layer Capacitors (EDLC, called Supercapacitors (SC, are electronic devices that are capable to store a relatively high amount of energy in a small volume comparing to other types of capacitors. They are composed of an activated carbon layer and electrolyte solution. The charge is stored on electrodes, forming the Helmholtz layer, and in electrolyte. The capacitance of supercapacitor is voltage- dependent. We propose an experimental method, based on monitoring of charging and discharging a supercapacitor, which enables to evaluate the charge in an SC structure as well as the Capacitance-Voltage (C-V dependence. The measurement setup, method and experimental results of charging/discharging commercially available supercapacitors in various voltage and current conditions are presented. The total charge stored in an SC structure is proportional to the square of voltage at SC electrodes while the charge on electrodes increases linearly with the voltage on SC electrodes. The Helmholtz capacitance increases linearly with the voltage bias while a sublinear increase of total capacitance was found. The voltage on SC increases after the discharge of electrodes due to diffusion of charges from the electrolyte to the electrodes. We have found that the recovery voltage value is linearly proportional to the initial bias voltage value.

Optimal Design of a High Efficiency LLC Resonant Converter with a Narrow Frequency Range for Voltage Regulation

Directory of Open Access Journals (Sweden)

Junhao Luo

2018-05-01

Full Text Available As a key factor in the design of a voltage-adjustable LLC resonant converter, frequency regulation range is very important to the optimization of magnetic components and efficiency improvement. This paper presents a novel optimal design method for LLC resonant converters, which can narrow the frequency variation range and ensure high efficiency under the premise of a required gain achievement. A simplified gain model was utilized to simplify the calculation and the expected efficiency was initially set as 96.5%. The restricted area of parameter optimization design can be obtained by taking the intersection of the gain requirement, the efficiency requirement, and three restrictions of ZVS (Zero Voltage Switch. The proposed method was verified by simulation and experiments of a 150 W prototype. The results show that the proposed method can achieve ZVS from full-load to no-load conditions and can reach 1.6 times the normalized voltage gain in the frequency variation range of 18 kHz with a peak efficiency of up to 96.3%. Moreover, the expected efficiency is adjustable, which means a converter with a higher efficiency can be designed. The proposed method can also be used for the design of large-power LLC resonant converters to obtain a wide output voltage range and higher efficiency.

Control and Testing of a Dynamic Voltage Restorer (DVR) at Medium Voltage Level

DEFF Research Database (Denmark)

Nielsen, John Godsk; Newman, Michael; Nielsen, Hans Ove

2004-01-01

power sensitive loads from voltage sags. This paper reports practical test results obtained on a medium voltage (10 kV) level using a DVR at a Distribution test facility in Kyndby, Denmark. The DVR was designed to protect a 400-kVA load from a 0.5-p.u. maximum voltage sag. The reported DVR verifies......The dynamic voltage restorer (DVR) has become popular as a cost effective solution for the protection of sensitive loads from voltage sags. Implementations of the DVR have been proposed at both a low voltage (LV) level, as well as a medium voltage (MV) level; and give an opportunity to protect high...... the use of a feed-forward and feed-back technique of the controller and it obtains both good transient and steady state responses. The effect of the DVR on the system is experimentally investigated under both faulted and non-faulted system states, for a variety of linear and non-linear loads. Variable...

A Dynamic Range Enhanced Readout Technique with a Two-Step TDC for High Speed Linear CMOS Image Sensors

Directory of Open Access Journals (Sweden)

Zhiyuan Gao

2015-11-01

Full Text Available This paper presents a dynamic range (DR enhanced readout technique with a two-step time-to-digital converter (TDC for high speed linear CMOS image sensors. A multi-capacitor and self-regulated capacitive trans-impedance amplifier (CTIA structure is employed to extend the dynamic range. The gain of the CTIA is auto adjusted by switching different capacitors to the integration node asynchronously according to the output voltage. A column-parallel ADC based on a two-step TDC is utilized to improve the conversion rate. The conversion is divided into coarse phase and fine phase. An error calibration scheme is also proposed to correct quantization errors caused by propagation delay skew within −Tclk~+Tclk. A linear CMOS image sensor pixel array is designed in the 0.13 μm CMOS process to verify this DR-enhanced high speed readout technique. The post simulation results indicate that the dynamic range of readout circuit is 99.02 dB and the ADC achieves 60.22 dB SNDR and 9.71 bit ENOB at a conversion rate of 2 MS/s after calibration, with 14.04 dB and 2.4 bit improvement, compared with SNDR and ENOB of that without calibration.

Dynamic Range Enhancement of High-Speed Electrical Signal Data via Non-Linear Compression

Science.gov (United States)

Laun, Matthew C. (Inventor)

2016-01-01

Systems and methods for high-speed compression of dynamic electrical signal waveforms to extend the measuring capabilities of conventional measuring devices such as oscilloscopes and high-speed data acquisition systems are discussed. Transfer function components and algorithmic transfer functions can be used to accurately measure signals that are within the frequency bandwidth but beyond the voltage range and voltage resolution capabilities of the measuring device.

One-dimensional breakdown voltage model of SOI RESURF lateral power device based on lateral linearly graded approximation

International Nuclear Information System (INIS)

Zhang Jun; Guo Yu-Feng; Xu Yue; Lin Hong; Yang Hui; Hong Yang; Yao Jia-Fei

2015-01-01

A novel one-dimensional (1D) analytical model is proposed for quantifying the breakdown voltage of a reduced surface field (RESURF) lateral power device fabricated on silicon on an insulator (SOI) substrate. We assume that the charges in the depletion region contribute to the lateral PN junctions along the diagonal of the area shared by the lateral and vertical depletion regions. Based on the assumption, the lateral PN junction behaves as a linearly graded junction, thus resulting in a reduced surface electric field and high breakdown voltage. Using the proposed model, the breakdown voltage as a function of device parameters is investigated and compared with the numerical simulation by the TCAD tools. The analytical results are shown to be in fair agreement with the numerical results. Finally, a new RESURF criterion is derived which offers a useful scheme to optimize the structure parameters. This simple 1D model provides a clear physical insight into the RESURF effect and a new explanation on the improvement in breakdown voltage in an SOI RESURF device. (paper)

Frequency pulling in a low-voltage medium-power gyrotron

Science.gov (United States)

Luo, Li; Du, Chao-Hai; Huang, Ming-Guang; Liu, Pu-Kun

2018-04-01

Many recent biomedical applications use medium-power frequency-tunable terahertz (THz) sources, such as sensitivity-enhanced nuclear magnetic resonance, THz imaging, and biomedical treatment. As a promising candidate, a low-voltage gyrotron can generate watt-level, continuous THz-wave radiation. In particular, the frequency-pulling effect in a gyrotron, namely, the effect of the electron beam parameters on the oscillation frequency, can be used to tune the operating frequency. Most previous investigations used complicated and time-consuming gyrotron nonlinear theory to study the influence of many beam parameters on the interaction performance. While gyrotron linear theory investigation demonstrates the advantages of rapidly and clearly revealing the physical influence of individual key beam parameters on the overall system performance, this paper demonstrates systematically the use of gyrotron linear theory to study the frequency-pulling effect in a low-voltage gyrotron with either a Gaussian or a sinusoidal axial-field profile. Furthermore, simulations of a gyrotron operating in the first axial mode are carried out in the framework of nonlinear theory as a contrast. Close agreement is achieved between the two theories. Besides, some interesting results are obtained. In a low-current sinusoidal-profile cavity, the ranges of frequency variation for different axial modes are isolated from each other, and the frequency tuning bandwidth for each axial mode increases by increasing either the beam voltage or pitch factor. Lowering the voltage, the total tuning ranges are squeezed and become concentrated. However, the isolated frequency regions of each axial mode cannot be linked up unless the beam current is increased, meaning that higher current operation is the key to achieving a wider and continuous tuning frequency range. The results presented in this paper can provide a reference for designing a broadband low-voltage gyrotron.

Charge transport and recombination in bulk heterojunction solar cells studied by the photoinduced charge extraction in linearly increasing voltage technique

OpenAIRE

Mozer, AJ; Sariciftci, NS; Osterbacka, R; Westerling, M; Juska, G; LUTSEN, Laurence; VANDERZANDE, Dirk

2005-01-01

Charge carrier mobility and recombination in a bulk heterojunction solar cell based on the mixture of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)-C-61 (PCBM) has been studied using the novel technique of photoinduced charge carrier extraction in a linearly increasing voltage (Photo-CELIV). In this technique, charge carriers are photogenerated by a short laser flash, and extracted under a reverse bias voltage ramp after ...

Insulation Resistance and Leakage Currents in Low-Voltage Ceramic Capacitors with Cracks

Science.gov (United States)

Teverovsky, Alexander A.

2016-01-01

Measurement of insulation resistance (IR) in multilayer ceramic capacitors (MLCCs) is considered a screening technique that ensures the dielectric is defect-free. This work analyzes the effectiveness of this technique for revealing cracks in ceramic capacitors. It is shown that absorption currents prevail over the intrinsic leakage currents during standard IR measurements at room temperature. Absorption currents, and consequently IR, have a weak temperature dependence, increase linearly with voltage (before saturation), and are not sensitive to the presence of mechanical defects. In contrary, intrinsic leakage currents increase super-linearly with voltage and exponentially with temperature (activation energy is in the range from 0.6 eV to 1.1 eV). Leakage currents associated with the presence of cracks have a weaker dependence on temperature and voltage compared to the intrinsic leakage currents. For this reason, intrinsic leakage currents prevail at high temperatures and voltages, thus masking the presence of defects.

An optical fiber Bragg grating and piezoelectric ceramic voltage sensor

Science.gov (United States)

Yang, Qing; He, Yanxiao; Sun, Shangpeng; Luo, Mandan; Han, Rui

2017-10-01

Voltage measurement is essential in many fields like power grids, telecommunications, metallurgy, railways, and oil production. A voltage-sensing unit, consisting of fiber Bragg gratings (FBGs) and piezoelectric ceramics, based on which an optical over-voltage sensor was proposed and fabricated in this paper. No demodulation devices like spectrometer or Fabry-Perot filter were needed to gain the voltage signal, and a relatively large sensing frequency range was acquired in this paper; thus, the cost of the sensing system is more acceptable in engineering application. The voltage to be measured was directly applied to the piezoelectric ceramic, and deformation of the ceramics and the grating would be caused because of the inverse piezoelectric effect. With a reference grating, the output light intensity change will be caused by the FBG center wavelength change; thus, the relationship between the applied voltage and the output light intensity was established. Validation of the sensor was accomplished in the frequency range from 50 Hz to 20 kHz and switching impulse waves with a test platform; good linearity of the input-output characteristic was achieved. A temperature validation test was completed, showing that the sensor maintains good temperature stability. Experimental results show that the optical over-voltage sensor can be used for voltage monitoring, and if applied with a voltage divider, the sensor can be used to measure high voltage.

An optical fiber Bragg grating and piezoelectric ceramic voltage sensor.

Science.gov (United States)

Yang, Qing; He, Yanxiao; Sun, Shangpeng; Luo, Mandan; Han, Rui

2017-10-01

Voltage measurement is essential in many fields like power grids, telecommunications, metallurgy, railways, and oil production. A voltage-sensing unit, consisting of fiber Bragg gratings (FBGs) and piezoelectric ceramics, based on which an optical over-voltage sensor was proposed and fabricated in this paper. No demodulation devices like spectrometer or Fabry-Perot filter were needed to gain the voltage signal, and a relatively large sensing frequency range was acquired in this paper; thus, the cost of the sensing system is more acceptable in engineering application. The voltage to be measured was directly applied to the piezoelectric ceramic, and deformation of the ceramics and the grating would be caused because of the inverse piezoelectric effect. With a reference grating, the output light intensity change will be caused by the FBG center wavelength change; thus, the relationship between the applied voltage and the output light intensity was established. Validation of the sensor was accomplished in the frequency range from 50 Hz to 20 kHz and switching impulse waves with a test platform; good linearity of the input-output characteristic was achieved. A temperature validation test was completed, showing that the sensor maintains good temperature stability. Experimental results show that the optical over-voltage sensor can be used for voltage monitoring, and if applied with a voltage divider, the sensor can be used to measure high voltage.

Linear variable voltage diode capacitor and adaptive matching networks

NARCIS (Netherlands)

Larson, L.E.; De Vreede, L.C.N.

2006-01-01

An integrated variable voltage diode capacitor topology applied to a circuit providing a variable voltage load for controlling variable capacitance. The topology includes a first pair of anti-series varactor diodes, wherein the diode power-law exponent n for the first pair of anti-series varactor

Note: A high dynamic range, linear response transimpedance amplifier.

Science.gov (United States)

Eckel, S; Sushkov, A O; Lamoreaux, S K

2012-02-01

We have built a high dynamic range (nine decade) transimpedance amplifier with a linear response. The amplifier uses junction-gate field effect transistors (JFETs) to switch between three different resistors in the feedback of a low input bias current operational amplifier. This allows for the creation of multiple outputs, each with a linear response and a different transimpedance gain. The overall bandwidth of the transimpedance amplifier is set by the bandwidth of the most sensitive range. For our application, we demonstrate a three-stage amplifier with transimpedance gains of approximately 10(9)Ω, 3 × 10(7)Ω, and 10(4)Ω with a bandwidth of 100 Hz.

Voltage splay modes and enhanced phase locking in a modified linear Josephson array

Science.gov (United States)

Harris, E. B.; Garland, J. C.

1997-02-01

We analyze a modified linear Josephson-junction array in which additional unbiased junctions are used to greatly enhance phase locking. This geometry exhibits strong correlated behavior, with an external magnetic field tuning the voltage splay angle between adjacent Josephson oscillators. The array displays a coherent in-phase mode for f=, where f is the magnetic frustration, while for 0tolerant of critical current disorder approaching 100%. The stability of the array has also been studied by computing Floquet exponents. These exponents are found to be negative for all array lengths, with a 1/N2 dependence, N being the number of series-connected junctions.

High Voltage Gain Dual Active Bridge Converter with an Extended Operation Range for Renewable Energy Systems

DEFF Research Database (Denmark)

Zhang, Zhe; Tomas Manez, Kevin; Yudi, Xiao

2018-01-01

Bridge (P2DAB) converter, i.e. low-voltage (LV) side parallel and high-voltage (HV) side series, is proposed to achieve high voltage gain and low current stress over switching devices and transformer windings. Given the unmodified P2DAB power stage, by regulating the phase-shift angle between......Developing bidirectional dc-dc converters has become a critical research topic and gains more and more attention in recent years due to the extensive applications of smart grids with energy storages, hybrid and electrical vehicles and dc microgrids. In this paper, a Partial Parallel Dual Active...... the paralleled active bridges, the power equations and voltage gain are then modified, and therefore the operation range can be extended effectively. The operating principles of the proposed converter and its power characteristics under various operation modes are studied, and the design constraints...

Characterization of a low-voltage electron beam

International Nuclear Information System (INIS)

Berejka, A.J.

2004-01-01

Growing interests in low-voltage electron beam (EB) processing in areas that may require regulatory compliance, such as the curing of inks and coatings for food packaging materials and in the surface disinfection of medicinal and food containers, lead to the characterization of a low-voltage EB by two methods: a widely used thin radiochromic film and a film strip made on a continuous basis with an alanine coating. Using a laboratory unit, beam currents and voltages were varied and then optical density and alanine/matrix ratios were, respectively, determined. No inferences as to 'dose' were made. The radiochromic film was found to be insensitive to slight changes at low beam currents and to show considerable divergence and a broadening in response as current was increased across a meaningful range at the three applied beam voltages of 80, 100 and 120 kV. The electron paramagnetic resonance (EPR) increase in response of the alanine coated film taken as a ratio to an internal reference material within the test instrument itself was shown to have a linear response with respect to beam current and no divergence as current increased. The use of an alanine coating of thickness greater than that of the extrapolated range of the electron penetration offers a method for the characterization of the output of such very low-voltage beams

Voltage Quench Dynamics of a Kondo System.

Science.gov (United States)

Antipov, Andrey E; Dong, Qiaoyuan; Gull, Emanuel

2016-01-22

We examine the dynamics of a correlated quantum dot in the mixed valence regime. We perform numerically exact calculations of the current after a quantum quench from equilibrium by rapidly applying a bias voltage in a wide range of initial temperatures. The current exhibits short equilibration times and saturates upon the decrease of temperature at all times, indicating Kondo behavior both in the transient regime and in the steady state. The time-dependent current saturation temperature connects the equilibrium Kondo temperature to a substantially increased value at voltages outside of the linear response. These signatures are directly observable by experiments in the time domain.

Universal Voltage Conveyor and Current Conveyor in Fast Full-Wave Rectifier

Directory of Open Access Journals (Sweden)

Josef Burian

2012-12-01

Full Text Available This paper deals about the design of a fast voltage-mode full-wave rectifier, where universal voltage conveyor and second-generation current conveyor are used as active elements. Thanks to the active elements, the input and output impedance of the non-linear circuit is infinitely high respectively zero in theory. For the rectification only two diodes and three resistors are required as passive elements. The performance of the circuit is shown on experimental measurement results showing the dynamic range, time response, frequency dependent DC transient value and RMS error for different values of input voltage amplitudes.

Profiling of barrier capacitance and spreading resistance using a transient linearly increasing voltage technique.

Science.gov (United States)

Gaubas, E; Ceponis, T; Kusakovskij, J

2011-08-01

A technique for the combined measurement of barrier capacitance and spreading resistance profiles using a linearly increasing voltage pulse is presented. The technique is based on the measurement and analysis of current transients, due to the barrier and diffusion capacitance, and the spreading resistance, between a needle probe and sample. To control the impact of deep traps in the barrier capacitance, a steady state bias illumination with infrared light was employed. Measurements of the spreading resistance and barrier capacitance profiles using a stepwise positioned probe on cross sectioned silicon pin diodes and pnp structures are presented.

An efficient high-voltage power supply for a photomultiplier tube

NARCIS (Netherlands)

Ainutdinov, VM; Vonsovskii, NN; Kompaniets, KG; Kozyr, AI; Mikhailov, YV

2003-01-01

An adjustable power supply for a photomultiplier tube operating in the pulsed spectrometric mode with a wide range of linearity is described. The power consumed by the source is 50 mW. The output voltage is varied from 800 to 2000 V. The maximum ripple amplitude is 2.5 mV.

Quad-copter UAV BLDC Motor Control: Linear v/s non-linear control maps

Directory of Open Access Journals (Sweden)

Deep Parikh

2015-08-01

Full Text Available This paper presents some investigations and comparison of using linear versus non-linear static motor-control maps for the speed control of a BLDC (Brush Less Direct Current motors used in quad-copter UAV (Unmanned Aerial Vehicles. The motor-control map considered here is the inverse of the static map relating motor-speed output to motor-voltage input for a typical out-runner type Brushless DC Motors (BLDCM.  Traditionally, quad-copter BLDC motor speed control uses simple linear motor-control map defined by the motor-constant specification. However, practical BLDC motors show non-linear characteristic, particularly when operated across wide operating speed-range as is commonly required in quad-copter UAV flight operations. In this paper, our investigations to compare performance of linear versus non-linear motor-control maps are presented. The investigations cover simulation-based and experimental study of BLDC motor speed control systems for  quad-copter vehicle available. First the non-linear map relating rotor RPM to motor voltage for quad-copter BLDC motor is obtained experimentally using an optical speed encoder. The performance of the linear versus non-linear motor-control-maps for the speed control are studied. The investigations also cover study of time-responses for various standard test input-signals e.g. step, ramp and pulse inputs, applied as the reference speed-commands. Also, simple 2-degree of freedom test-bed is developed in our laboratory to help test the open-loop and closed-loop experimental investigations. The non-linear motor-control map is found to perform better in BLDC motor speed tracking control performance and thereby helping achieve better quad-copter roll-angle attitude control.

Current-voltage characteristics of C70 solid near Meyer-Neldel temperature

Science.gov (United States)

Onishi, Koichi; Sezaimaru, Kouki; Nakashima, Fumihiro; Sun, Yong; Kirimoto, Kenta; Sakaino, Masamichi; Kanemitsu, Shigeru

2017-06-01

The current-voltage characteristics of the C70 solid with hexagonal closed-packed structures were measured in the temperature range of 250-450 K. The current-voltage characteristics can be described as a temporary expedient by a cubic polynomial of the voltage, i = a v 3 + b v 2 + c v + d . Moreover, the Meyer-Neldel temperature of the C70 solid was confirmed to be 310 K, at which a linear relationship between the current and voltage was observed. Also, at temperatures below the Meyer-Neldel temperature, the current increases with increasing voltage. On the other hand, at temperatures above the Meyer-Neldel temperature a negative differential conductivity effect was observed at high voltage side. The negative differential conductivity was related to the electric field and temperature effects on the mobility of charge carrier, which involve two variations in the carrier concentration and the activation energy for carrier hopping transport.

High-voltage transistor converter for pulsed x-ray sources

International Nuclear Information System (INIS)

Krasil'nikov, S.B.; Kristalinskii, A.L.; Lozovoi, L.N.; Markov, S.N.; Sindalovskii, E.I.

1986-01-01

A 24-V/12-kV converter for MIRA-2D and NORA pulsed x-ray sources is described. When the low-voltage supply varies within 20-26 V, the frequency stability of the x-ray pulses is higher by a factor of 3 ≅ 3 than when the PRIMA converter is used. For 14-24 V, the average output power of the converter is independent of the load impedance and increases linearly with an increase in supply voltage. The efficiency of the converter reaches 60%. The converter operates in the temperature range of -40 to +60 0 C

Artificial intelligence techniques for voltage control

Energy Technology Data Exchange (ETDEWEB)

Ekwue, A.; Cheng, D.T.Y.; Macqueen, J.F.

1997-12-31

In electric power systems, the advantages of reactive power dispatching or optimisation include improved utilisation of reactive power sources and hence reduction in reactive power flows and real losses of the system; unloading of the system and equipment as a result of reactive flow reduction; the power factors of generation are improved and system security is enhanced; reduced voltage gradients and somewhat higher voltages which result across the system from improved operation; deferred capital investment is new reactive power sources as a result of improved utilisation of existing equipment; and for the National Grid Company plc (NGC), the main advantage is reduced out-of-merit operation. The problem of reactive power control has been studied and widely reported in the literature. Non-linear programming methods as well as linear programming techniques for constraint dispatch have been described. Static optimisation of reactive power sources by the use of sensitivity analysis was described by Kishore and Hill. Long range optimum var planning has been considered and the optimum amount and location of network reactive compensation so as to maintain the system voltage within the desired limits, while operating under normal and various insecurity states, have also been studied using several methods. The objective of this chapter is therefore to review conventional methods as well as AI techniques for reactive power control. (Author)

Voltage-Controlled Floating Resistor Using DDCC

Directory of Open Access Journals (Sweden)

M. Kumngern

2011-04-01

Full Text Available This paper presents a new simple configuration to realize the voltage-controlled floating resistor, which is suitable for integrated circuit implementation. The proposed resistor is composed of three main components: MOS transistor operating in the non-saturation region, DDCC, and MOS voltage divider. The MOS transistor operating in the non-saturation region is used to configure a floating linear resistor. The DDCC and the MOS transistor voltage divider are used for canceling the nonlinear component term of MOS transistor in the non-saturation region to obtain a linear current/voltage relationship. The DDCC is employed to provide a simple summer of the circuit. This circuit offers an ease for realizing the voltage divider circuit and the temperature effect that includes in term of threshold voltage can be compensated. The proposed configuration employs only 16 MOS transistors. The performances of the proposed circuit are simulated with PSPICE to confirm the presented theory.

Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing

Science.gov (United States)

Patel, N.; Branch, D. W.; Schamiloglu, E.; Cular, S.

2015-08-01

A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO3) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz-100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10-273 ps for DC voltages and 189-813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250-2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115-1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment.

SiGe HBT linear-in-dB high dynamic range RF envelope detectors and wideband high linearity amplifiers

OpenAIRE

Pan, Hsuan-yu

2010-01-01

This research work aims on exploiting SiGe HBT technologies in high dynamic range wideband RF linear-in- dB envelope detectors and linear amplifiers. First, an improved all-npn broadband highly linear SiGe HBT differential amplifier is presented based on a variation of Caprio's Quad. A broadband linear amplifier with 46dBm OIP₃ at 20MHz, 34dBm OIP₃ at 1GHz, 6dB noise figure and 10.3dBm P₁dB is demonstrated. Second, an improved exact dynamic model of a fast-settling linear-in-dB Automatic Gain...

A Monolithic CMOS Magnetic Hall Sensor with High Sensitivity and Linearity Characteristics.

Science.gov (United States)

Huang, Haiyun; Wang, Dejun; Xu, Yue

2015-10-27

This paper presents a fully integrated linear Hall sensor by means of 0.8 μm high voltage complementary metal-oxide semiconductor (CMOS) technology. This monolithic Hall sensor chip features a highly sensitive horizontal switched Hall plate and an efficient signal conditioner using dynamic offset cancellation technique. An improved cross-like Hall plate achieves high magnetic sensitivity and low offset. A new spinning current modulator stabilizes the quiescent output voltage and improves the reliability of the signal conditioner. The tested results show that at the 5 V supply voltage, the maximum Hall output voltage of the monolithic Hall sensor microsystem, is up to ±2.1 V and the linearity of Hall output voltage is higher than 99% in the magnetic flux density range from ±5 mT to ±175 mT. The output equivalent residual offset is 0.48 mT and the static power consumption is 20 mW.

A Monolithic CMOS Magnetic Hall Sensor with High Sensitivity and Linearity Characteristics

Directory of Open Access Journals (Sweden)

Haiyun Huang

2015-10-01

Full Text Available This paper presents a fully integrated linear Hall sensor by means of 0.8 μm high voltage complementary metal-oxide semiconductor (CMOS technology. This monolithic Hall sensor chip features a highly sensitive horizontal switched Hall plate and an efficient signal conditioner using dynamic offset cancellation technique. An improved cross-like Hall plate achieves high magnetic sensitivity and low offset. A new spinning current modulator stabilizes the quiescent output voltage and improves the reliability of the signal conditioner. The tested results show that at the 5 V supply voltage, the maximum Hall output voltage of the monolithic Hall sensor microsystem, is up to ±2.1 V and the linearity of Hall output voltage is higher than 99% in the magnetic flux density range from ±5 mT to ±175 mT. The output equivalent residual offset is 0.48 mT and the static power consumption is 20 mW.

Mixed Linear/Square-Root Encoded Single Slope Ramp Provides a Fast, Low Noise Analog to Digital Converter with Very High Linearity for Focal Plane Arrays

Science.gov (United States)

Wrigley, Christopher James (Inventor); Hancock, Bruce R. (Inventor); Newton, Kenneth W. (Inventor); Cunningham, Thomas J. (Inventor)

2014-01-01

An analog-to-digital converter (ADC) converts pixel voltages from a CMOS image into a digital output. A voltage ramp generator generates a voltage ramp that has a linear first portion and a non-linear second portion. A digital output generator generates a digital output based on the voltage ramp, the pixel voltages, and comparator output from an array of comparators that compare the voltage ramp to the pixel voltages. A return lookup table linearizes the digital output values.

Voltage splay modes and enhanced phase locking in a modified linear Josephson array

International Nuclear Information System (INIS)

Harris, E.B.; Garland, J.C.

1997-01-01

We analyze a modified linear Josephson-junction array in which additional unbiased junctions are used to greatly enhance phase locking. This geometry exhibits strong correlated behavior, with an external magnetic field tuning the voltage splay angle between adjacent Josephson oscillators. The array displays a coherent in-phase mode for f=(1)/(2), where f is the magnetic frustration, while for 0 p (f)=2aV dc /Φ 0 (1-2f). The locked splay modes are found to be tolerant of critical current disorder approaching 100%. The stability of the array has also been studied by computing Floquet exponents. These exponents are found to be negative for all array lengths, with a 1/N 2 dependence, N being the number of series-connected junctions. copyright 1996 The American Physical Society

[Fast separation and analysis of water-soluble vitamins in spinach by capillary electrophoresis with high voltage].

Science.gov (United States)

Hu, Xiaoqin; You, Huiyan

2009-11-01

In capillary electrophoresis, 0-40 kV (even higher) voltage can be reached by a connecting double-model high voltage power supply. In the article, water-soluble vitamins, VB1, VB2, VB6, VC, calcium D-pantothenate, D-biotin, nicotinic acid and folic acid in vegetable, were separated by using the high voltage power supply under the condition of electrolyte water solution as running buffer. The separation conditions, such as voltage, the concentration of buffer and pH value etc. , were optimized during the experiments. The results showed that eight water-soluble vitamins could be baseline separated in 2.2 min at 40 kV applied voltage, 25 mmol/L sodium tetraborate buffer solution (pH 8.8). The water-soluble vitamins in spinach were quantified and the results were satisfied. The linear correlation coefficients of the water-soluble vitamins ranged from 0.9981 to 0.9999. The detection limits ranged from 0.2 to 0.3 mg/L. The average recoveries ranged from 88.0% to 100.6% with the relative standard deviations (RSD) range of 1.15%-4.13% for the spinach samples.

The use of charge extraction by linearly increasing voltage in polar organic light-emitting diodes

Science.gov (United States)

Züfle, Simon; Altazin, Stéphane; Hofmann, Alexander; Jäger, Lars; Neukom, Martin T.; Schmidt, Tobias D.; Brütting, Wolfgang; Ruhstaller, Beat

2017-05-01

We demonstrate the application of the CELIV (charge carrier extraction by linearly increasing voltage) technique to bilayer organic light-emitting devices (OLEDs) in order to selectively determine the hole mobility in N,N0-bis(1-naphthyl)-N,N0-diphenyl-1,10-biphenyl-4,40-diamine (α-NPD). In the CELIV technique, mobile charges in the active layer are extracted by applying a negative voltage ramp, leading to a peak superimposed to the measured displacement current whose temporal position is related to the charge carrier mobility. In fully operating devices, however, bipolar carrier transport and recombination complicate the analysis of CELIV transients as well as the assignment of the extracted mobility value to one charge carrier species. This has motivated a new approach of fabricating dedicated metal-insulator-semiconductor (MIS) devices, where the extraction current contains signatures of only one charge carrier type. In this work, we show that the MIS-CELIV concept can be employed in bilayer polar OLEDs as well, which are easy to fabricate using most common electron transport layers (ETLs), like Tris-(8-hydroxyquinoline)aluminum (Alq3). Due to the macroscopic polarization of the ETL, holes are already injected into the hole transport layer below the built-in voltage and accumulate at the internal interface with the ETL. This way, by a standard CELIV experiment only holes will be extracted, allowing us to determine their mobility. The approach can be established as a powerful way of selectively measuring charge mobilities in new materials in a standard device configuration.

Improved transmission of electrostatic accelerator in a wide range of terminal voltages by controlling the focal strength of entrance acceleration tube

Science.gov (United States)

Lobanov, Nikolai R.; Tunningley, Thomas; Linardakis, Peter

2018-04-01

Tandem electrostatic accelerators often require the flexibility to operate at a variety of terminal voltages to accommodate various user requirements. However, the ion beam transmission will only be optimal for a limited range of terminal voltages. This paper describes the operational performance of a novel focusing system that expands the range of terminal voltages for optimal transmission. This is accomplished by controlling the gradient of the entrance of the low-energy tube, providing an additional focusing element. In this specific case it is achieved by applying up to 150 kV to the fifth electrode of the first unit of the accelerator tube. Numerical simulations and beam transmission tests have been performed to confirm the effectiveness of the lens. An analytical expression has been derived describing its focal properties. These tests demonstrate that the entrance lens control eliminates the need to short out sections of the tube for operation at low terminal voltage.

Comparative study of 0° X-cut and Y + 36°-cut lithium niobate high-voltage sensing

International Nuclear Information System (INIS)

Patel, N.; Branch, D. W.; Cular, S.; Schamiloglu, E.

2015-01-01

A comparison study between Y + 36° and 0° X-cut lithium niobate (LiNbO 3 ) was performed to evaluate the influence of crystal cut on the acoustic propagation to realize a piezoelectric high-voltage sensor. The acoustic time-of-flight for each crystal cut was measured when applying direct current (DC), alternating current (AC), and pulsed voltages. Results show that the voltage-induced shift in the acoustic wave propagation time scaled quadratically with voltage for DC and AC voltages applied to X-cut crystals. For the Y + 36° crystal, the voltage-induced shift scales linearly with DC voltages and quadratically with AC voltages. When applying 5 μs voltage pulses to both crystals, the voltage-induced shift scaled linearly with voltage. For the Y + 36° cut, the voltage-induced shift from applying DC voltages ranged from 10 to 54 ps and 35 to 778 ps for AC voltages at 640 V over the frequency range of 100 Hz–100 kHz. Using the same conditions as the Y + 36° cut, the 0° X-cut crystal sensed a shift of 10–273 ps for DC voltages and 189–813 ps for AC voltage application. For 5 μs voltage pulses, the 0° X-cut crystal sensed a voltage induced shift of 0.250–2 ns and the Y + 36°-cut crystal sensed a time shift of 0.115–1.6 ns. This suggests a frequency sensitive response to voltage where the influence of the crystal cut was not a significant contributor under DC, AC, or pulsed voltage conditions. The measured DC data were compared to a 1-D impedance matrix model where the predicted incremental length changed as a function of voltage. When the voltage source error was eliminated through physical modeling from the uncertainty budget, the combined uncertainty of the sensor (within a 95% confidence interval) decreased to 0.0033% using a Y + 36°-cut crystal and 0.0032% using an X-cut crystal for all the voltage conditions used in this experiment

Using computational modeling to compare X-ray tube Practical Peak Voltage for Dental Radiology

International Nuclear Information System (INIS)

Holanda Cassiano, Deisemar; Arruda Correa, Samanda Cristine; Monteiro de Souza, Edmilson; Silva, Ademir Xaxier da; Pereira Peixoto, José Guilherme; Tadeu Lopes, Ricardo

2014-01-01

The Practical Peak Voltage-PPV has been adopted to measure the voltage applied to an X-ray tube. The PPV was recommended by the IEC document and accepted and published in the TRS no. 457 code of practice. The PPV is defined and applied to all forms of waves and is related to the spectral distribution of X-rays and to the properties of the image. The calibration of X-rays tubes was performed using the MCNPX Monte Carlo code. An X-ray tube for Dental Radiology (operated from a single phase power supply) and an X-ray tube used as a reference (supplied from a constant potential power supply) were used in simulations across the energy range of interest of 40 kV to 100 kV. Results obtained indicated a linear relationship between the tubes involved. - Highlights: • Computational Model was developed to X-ray tube Practical Peak Voltage for Dental Radiology. • The calibration of X-rays tubes was performed using the MCNPX Monte Carlo code. • The energy range was 40–100 kV. • Results obtained indicated a linear relationship between the Dental Radiology and reference X-ray tubes

Pulse-voltage fast generator

International Nuclear Information System (INIS)

Valeev, R.I.; Nikiforov, M.G.; Kharchenko, A.F.

1988-01-01

The design is described and the test results of a four-channel pulse-voltage generator with maximum output voltage 200 kV are presented. The measurement results of generator triggering time depending on the value and polarity of the triggering voltage pulse for different triggering circuits are presented. The tests have shown stable triggering of all four channels of the generator in the range up to 40 % from selfbreakdown voltage. The generator triggering delay in the given range is <25 ns, asynchronism in channel triggering is <±1 ns

An implantable neurostimulator with an integrated high-voltage inductive power-recovery frontend

International Nuclear Information System (INIS)

Wang Yuan; Zhang Xu; Liu Ming; Li Peng; Chen Hongda

2014-01-01

This paper present a highly-integrated neurostimulator with an on-chip inductive power-recovery frontend and high-voltage stimulus generator. In particular, the power-recovery frontend includes a high-voltage full-wave rectifier (up to 100 V AC input), high-voltage series regulators (24/5 V outputs) and a linear regulator (1.8/3.3 V output) with bandgap voltage reference. With the high voltage output of the series regulator, the proposed neurostimulator could deliver a considerably large current in high electrode-tissue contact impedance. This neurostimulator has been fabricated in a CSMC 1 μm 5/40/700 V BCD process and the total silicon area including pads is 5.8 mm 2 . Preliminary tests are successful as the neurostimulator shows good stability under a 13.56 MHz AC supply. Compared to previously reported works, our design has advantages of a wide induced voltage range (26–100 V), high output voltage (up to 24 V) and high-level integration, which are suitable for implantable neurostimulators. (semiconductor integrated circuits)

Full-range k-domain linearization in spectral-domain optical coherence tomography.

Science.gov (United States)

Jeon, Mansik; Kim, Jeehyun; Jung, Unsang; Lee, Changho; Jung, Woonggyu; Boppart, Stephen A

2011-03-10

A full-bandwidth k-domain linearization method for spectral-domain optical coherence tomography (SD-OCT) is demonstrated. The method uses information of the wavenumber-pixel-position provided by a translating-slit-based wavelength filter. For calibration purposes, the filter is placed either after a broadband source or at the end of the sample path, and the filtered spectrum with a narrowed line width (∼0.5 nm) is incident on a line-scan camera in the detection path. The wavelength-swept spectra are co-registered with the pixel positions according to their central wavelengths, which can be automatically measured with an optical spectrum analyzer. For imaging, the method does not require a filter or a software recalibration algorithm; it simply resamples the OCT signal from the detector array without employing rescaling or interpolation methods. The accuracy of k-linearization is maximized by increasing the k-linearization order, which is known to be a crucial parameter for maintaining a narrow point-spread function (PSF) width at increasing depths. The broadening effect is studied by changing the k-linearization order by undersampling to search for the optimal value. The system provides more position information, surpassing the optimum without compromising the imaging speed. The proposed full-range k-domain linearization method can be applied to SD-OCT systems to simplify their hardware/software, increase their speed, and improve the axial image resolution. The experimentally measured width of PSF in air has an FWHM of 8 μm at the edge of the axial measurement range. At an imaging depth of 2.5 mm, the sensitivity of the full-range calibration case drops less than 10 dB compared with the uncompensated case.

Simulating threshold voltage shift of MOS devices due to radiation in the low-dose range

CERN Document Server

Wan Xin Heng; Gao Wen Yu; Huang Ru; Wang Yang Yuan

2002-01-01

An analytical MOSFET threshold voltage shift model due to radiation in the low-dose range has been developed for circuit simulations. Experimental data in the literature shows that the model predictions are in good agreement. It is simple in functional form and hence computationally efficient. It can be used as a basic circuit simulation tool for analysing MOSFET exposed to a nuclear environment up to about 1 Mrad(Si). In accordance with common believe, radiation induced absolute change of threshold voltage was found to be larger in irradiated PMOS devices. However, if the radiation sensitivity is defined in the way authors did it, the results indicated NMOS rather than PMOS devices are more sensitive, specially at low doses. This is important from the standpoint of their possible application in dosimetry

Study on the construction and its operating characteristics of Marx high voltage pulse generator

International Nuclear Information System (INIS)

Chung, W.K.; Yook, C.C.

1984-01-01

This study is to investigate the operating characteristics of a Marx high voltage pulse generator, which is designed and fabricated for the purpose of constructing a linear theta-pinch plasma generating facility. The Marx generator consists of a 2 kJ capacitor bank of maximum output voltage of 200kV, a set of main spark switch, a triggring system, and high voltage charging power supply. The experimental results show that the operating characteristics of the generator can be controlled through varying nitrogen pressure as a filling gas. The output pulse of the generator is achieved close to the estimated voltage with the rise time of 3*m seconds. The stability of the generator is also very satisfactory within operating range of main spark switch. (Author)

Coherent Voltage Oscillations in Superconducting Polycrystalline Y1Ba2Cu3O7-x

International Nuclear Information System (INIS)

Altinkok, A; Yetis, H; Olutas, M; Kilic, K; Kilic, A; Cetin, O

2006-01-01

We have investigated the voltage response of superconducting polycrystalline bulk Y 1 Ba 2 Cu 3 O 7-x (YBCO) material to a bidirectional square wave current with long periods and dc current by means of the evolution of the voltage-time (V-t) curves near the critical temperature. In a well-defined range of amplitudes and periods of driving current, and temperatures, it was observed that a non-linear response to bidirectional square wave current rides on a time independent background voltage value and manifests itself as regular sinusoidal-like voltage oscillations. It was found that the non-linear response disappears when the bidirectional current was switched to dc current. The spectral content of the voltage oscillations analyzed by the Fast Fourier Transform of the corresponding V-t curves revealed that the fundamental harmonics is comparable to the frequency of bidirectional square wave current. The coherent voltage oscillations were discussed mainly in terms of the dynamic competition between pinning and depinning together with the disorder in the coupling strength between the superconducting grains (i.e Josephson coupling effects). The density fluctuations and semi-elastic coupling of the flux lines with the pinning centers were also considered as possible physical mechanisms in the interpretation of the experimental results

Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

Directory of Open Access Journals (Sweden)

R. N. Bhowmik

2015-06-01

Full Text Available We have studied current-voltage (I-V characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP 0.345(± 0.001 V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%, magnetoresistance (70-135 % and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe1.64Ga0.36O3 oxide

Science.gov (United States)

Bhowmik, R. N.; Vijayasri, G.

2015-06-01

We have studied current-voltage (I-V) characteristics of α-Fe1.64Ga0.36O3, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔVP) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (˜500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

A high linearity current mode multiplier/divider with a wide dynamic range

International Nuclear Information System (INIS)

Liao Pengfei; Luo Ping; Zhang Bo; Li Zhaoji

2012-01-01

A high linearity current mode multiplier/divider (CMM/D) with a wide dynamic range is presented. The proposed CMM/D is based on the voltage—current characteristic of the diode, thus wide dynamic range is achieved. In addition, high linearity is achieved because high accuracy current mirrors are adopted and the output current is insensitive to the temperature and device parameters of the fabrication process. Furthermore, no extra bias current for all input signals is required and thus power saving is realized. With proper selection of establishing the input terminal, the proposed circuit can perform as a multifunction circuit to be operated as a multiplier/divider, without changing its topology. The proposed circuit is implemented in a 0.25 μm BCD process and the chip area is 0.26 × 0.24 mm 2 . The simulation and measurement results show that the maximum static linearity error is ±1.8% and the total harmonic distortion is 0.4% while the input current ranges from 0 to 200 μA. (semiconductor integrated circuits)

Improvement of linear reactivity methods and application to long range fuel management

International Nuclear Information System (INIS)

Woehlke, R.A.; Quan, B.L.

1982-01-01

The original development of the linear reactivity theory assumes flat burnup, batch by batch. The validity of this assumption is explored using multicycle burnup data generated with a detailed 3-D SIMULATE model. The results show that the linear reactivity method can be improved by correcting for batchwise power sharing. The application of linear reactivity to long range fuel management is demonstrated in several examples. Correcting for batchwise power sharing improves the accuracy of the analysis. However, with regard to the sensitivity of fuel cost to changes in various parameters, the corrected and uncorrected linear reactivity theories give remarkably similar results

A high-voltage equipment (high voltage supply, high voltage pulse generators, resonant charging inductance, synchro-instruments for gyrotron frequency measurements) for plasma applications

International Nuclear Information System (INIS)

Spassov, Velin

1996-01-01

This document reports my activities as visitor-professor at the Gyrotron Project - INPE Plasma Laboratory. The main objective of my activities was designing, construction and testing a suitable high-voltage pulse generator for plasma applications, and efforts were concentrated on the following points: Design of high-voltage resonant power supply with tunable output (0 - 50 kV) for line-type high voltage pulse generator; design of line-type pulse generator (4 microseconds pulse duration, 0 - 25 kV tunable voltage) for non linear loads such as a gyrotron and P III reactor; design of resonant charging inductance for resonant line-type pulse generator, and design of high resolution synchro instrument for gyrotron frequency measurement. (author)

Distributed Monitoring of Voltage Collapse Sensitivity Indices

OpenAIRE

Simpson-Porco, John W.; Bullo, Francesco

2016-01-01

The assessment of voltage stability margins is a promising direction for wide-area monitoring systems. Accurate monitoring architectures for long-term voltage instability are typically centralized and lack scalability, while completely decentralized approaches relying on local measurements tend towards inaccuracy. Here we present distributed linear algorithms for the online computation of voltage collapse sensitivity indices. The computations are collectively performed by processors embedded ...

Modulating the Voltage-sensitivity of a Genetically Encoded Voltage Indicator.

Science.gov (United States)

Jung, Arong; Rajakumar, Dhanarajan; Yoon, Bong-June; Baker, Bradley J

2017-10-01

Saturation mutagenesis was performed on a single position in the voltage-sensing domain (VSD) of a genetically encoded voltage indicator (GEVI). The VSD consists of four transmembrane helixes designated S1-S4. The V220 position located near the plasma membrane/extracellular interface had previously been shown to affect the voltage range of the optical signal. Introduction of polar amino acids at this position reduced the voltage-dependent optical signal of the GEVI. Negatively charged amino acids slightly reduced the optical signal by 33 percent while positively charge amino acids at this position reduced the optical signal by 80%. Surprisingly, the range of V220D was similar to that of V220K with shifted optical responses towards negative potentials. In contrast, the V220E mutant mirrored the responses of the V220R mutation suggesting that the length of the side chain plays in role in determining the voltage range of the GEVI. Charged mutations at the 219 position all behaved similarly slightly shifting the optical response to more negative potentials. Charged mutations to the 221 position behaved erratically suggesting interactions with the plasma membrane and/or other amino acids in the VSD. Introduction of bulky amino acids at the V220 position increased the range of the optical response to include hyperpolarizing signals. Combining The V220W mutant with the R217Q mutation resulted in a probe that reduced the depolarizing signal and enhanced the hyperpolarizing signal which may lead to GEVIs that only report neuronal inhibition.

Designing double-gap linear accelerators for a wide mass range

International Nuclear Information System (INIS)

Lysenko, W.P.; Wadlinger, E.A.; Rusnak, B.; Krawczyk, F.; Saadatmand, K.; Wan, Z.

1998-01-01

For applications like ion implantation, rf linacs using double-gap structures with external resonators can be used because they are practical at low frequencies. However, since the two gaps associated with a given resonator cannot be individually phased, it is not obvious how to build a linac that can efficiently accelerate particles having different mass/charge ratios. This paper describes the beam dynamics of double-gap rf linacs and shows how to maximize the range of mass/charge ratios. The theory also tells one how to rescale a linac tune (i.e., reset the voltages and phases) so that a new particle, having a different mass or charge, will behave similarly to the original particle

Charge transport and recombination in bulk heterojunction solar cells studied by the photoinduced charge extraction in linearly increasing voltage technique

Science.gov (United States)

Mozer, A. J.; Sariciftci, N. S.; Lutsen, L.; Vanderzande, D.; Österbacka, R.; Westerling, M.; Juška, G.

2005-03-01

Charge carrier mobility and recombination in a bulk heterojunction solar cell based on the mixture of poly[2-methoxy-5-(3,7-dimethyloctyloxy)-phenylene vinylene] (MDMO-PPV) and 1-(3-methoxycarbonyl)propyl-1-phenyl-(6,6)-C61 (PCBM) has been studied using the novel technique of photoinduced charge carrier extraction in a linearly increasing voltage (Photo-CELIV). In this technique, charge carriers are photogenerated by a short laser flash, and extracted under a reverse bias voltage ramp after an adjustable delay time (tdel). The Photo-CELIV mobility at room temperature is found to be μ =2×10-4cm2V-1s-1, which is almost independent on charge carrier density, but slightly dependent on tdel. Furthermore, determination of charge carrier lifetime and demonstration of an electric field dependent mobility is presented.

Ultra-low-pressure sputtering to improve exchange bias and tune linear ranges in spin valves

Energy Technology Data Exchange (ETDEWEB)

Tang, XiaoLi, E-mail: tangtang1227@163.com; Yu, You; Liu, Ru; Su, Hua; Zhang, HuaiWu; Zhong, ZhiYong; Jing, YuLan

2017-05-01

A series of CoFe/IrMn exchange bilayers was grown by DC-sputtering at different ultra-low argon pressures ranging from 0.008 to 0.1 Pa. This pressure range was one to two orders lower than the normal sputtering pressure. Results revealed that the exchange bias increased from 140 to 250 Oe in CoFe(10 nm)/IrMn (15 nm) bilayers of fixed thickness because of the improved crystalline structure and morphological uniformity of films. Since ferromagnetic /antiferromagnetic (FM/AF) bilayers are always used in linear magnetic sensors as detection layers, the varying exchange bias can successfully achieve tunable linear range in a crossed pinning spin valve. The linear range could be adjustable from −80 Oe – +80 Oe to −150 Oe – +150 Oe on the basis of giant magnetoresistance responses. Therefore, this method provides a simple method to tune the operating range of magnetic field sensors. - Highlights: • Increasing exchange bias was achieved in bilayer at ultra-low-pressure sputtering. • The low void density and smooth surface were achieved in low pressure. • Varying exchange bias achieved tunable linear range in spin valve.

Dielectric-wall linear accelerator with a high voltage fast rise time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators

Science.gov (United States)

Caporaso, George J.; Sampayan, Stephen E.; Kirbie, Hugh C.

1998-01-01

A dielectric-wall linear accelerator is improved by a high-voltage, fast rise-time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators. A high voltage is placed between the electrodes sufficient to stress the voltage breakdown of the insulator on command. A light trigger, such as a laser, is focused along at least one line along the edge surface of the laminated alternating layers of isolated conductors and insulators extending between the electrodes. The laser is energized to initiate a surface breakdown by a fluence of photons, thus causing the electrical switch to close very promptly. Such insulators and lasers are incorporated in a dielectric wall linear accelerator with Blumlein modules, and phasing is controlled by adjusting the length of fiber optic cables that carry the laser light to the insulator surface.

An Improvement on the Junction Temperature Measurement of Light-Emitting Diodes by using the Peak Shift Method Compared with the Forward Voltage Method

International Nuclear Information System (INIS)

He Su-Ming; Wang Jin-Bin; Luo Xiang-Dong; Zhang Bo; Fu Lei; Cheng Li-Wen; Lu Wei

2012-01-01

The junction temperature of red, green and blue high power light emitting diodes (LEDs) is measured by using the emission peak shift method and the forward voltage method. Both the emission peak shift and the forward voltage decrease show a linear relationship relative to junction temperature. The linear coefficients of the red, green and blue LEDs for the peak shift method and the forward voltage method range from 0.03 to 0.15 nm/°C and from 1.33 to 3.59 mV/°C, respectively. Compared with the forward voltage method, the peak shift method is almost independent of bias current and sample difference. The variation of the slopes is less than 2% for the peak shift method and larger than 30% for the forward voltage method, when the LEDs are driven by different bias currents. It is indicated that the peak shift method gives better stability than the forward voltage method under different LED working conditions

Comparison of linear intrascan and interscan dynamic ranges of Orbitrap and ion-mobility time-of-flight mass spectrometers.

Science.gov (United States)

Kaufmann, Anton; Walker, Stephan

2017-11-30

The linear intrascan and interscan dynamic ranges of mass spectrometers are important in metabolome and residue analysis. A large linear dynamic range is mandatory if both low- and high-abundance ions have to be detected and quantitated in heavy matrix samples. These performance criteria, as provided by modern high-resolution mass spectrometry (HRMS), were systematically investigated. The comparison included two generations of Orbitraps, and an ion mobility quadrupole time-of-flight (QTOF) system In addition, different scan modes, as provided by the utilized instruments, were investigated. Calibration curves of different compounds covering a concentration range of five orders of magnitude were measured to evaluate the linear interscan dynamic range. The linear intrascan dynamic range and the resulting mass accuracy were evaluated by repeating these measurements in the presence of a very intense background. Modern HRMS instruments can show linear dynamic ranges of five orders of magnitude. Often, however, the linear dynamic range is limited by the detection capability (sensitivity and selectivity) and by the electrospray ionization. Orbitraps, as opposed to TOF instruments, show a reduced intrascan dynamic range. This is due to the limited C-trap and Orbitrap capacity. The tested TOF instrument shows poorer mass accuracies than the Orbitraps. In contrast, hyphenation with an ion-mobility device seems not to affect the linear dynamic range. The linear dynamic range of modern HRMS instrumentation has been significantly improved. This also refers to the virtual absence of systematic mass shifts at high ion abundances. The intrascan dynamic range of the current Orbitrap technology may still be a limitation when analyzing complex matrix extracts. On the other hand, the linear dynamic range is not only limited by the detector technology, but can also be shortened by peripheral devices, where the ionization and transfer of ions take place. Copyright © 2017 John Wiley

Application of range-test in multiple linear regression analysis in ...

African Journals Online (AJOL)

Application of range-test in multiple linear regression analysis in the presence of outliers is studied in this paper. First, the plot of the explanatory variables (i.e. Administration, Social/Commercial, Economic services and Transfer) on the dependent variable (i.e. GDP) was done to identify the statistical trend over the years.

MEMS earthworm: a thermally actuated peristaltic linear micromotor

Science.gov (United States)

Arthur, Craig; Ellerington, Neil; Hubbard, Ted; Kujath, Marek

2011-03-01

This paper examines the design, fabrication and testing of a bio-mimetic MEMS (micro-electro mechanical systems) earthworm motor with external actuators. The motor consists of a passive mobile shuttle with two flexible diamond-shaped segments; each segment is independently squeezed by a pair of stationary chevron-shaped thermal actuators. Applying a specific sequence of squeezes to the earthworm segments, the shuttle can be driven backward or forward. Unlike existing inchworm drives that use clamping and thrusting actuators, the earthworm actuators apply only clamping forces to the shuttle, and lateral thrust is produced by the shuttle's compliant geometry. The earthworm assembly is fabricated using the PolyMUMPs process with planar dimensions of 400 µm width by 800 µm length. The stationary actuators operate within the range of 4-9 V and provide a maximum shuttle range of motion of 350 µm (approximately half its size), a maximum shuttle speed of 17 mm s-1 at 10 kHz, and a maximum dc shuttle force of 80 µN. The shuttle speed was found to vary linearly with both input voltage and input frequency. The shuttle force was found to vary linearly with the actuator voltage.

MEMS earthworm: a thermally actuated peristaltic linear micromotor

International Nuclear Information System (INIS)

Arthur, Craig; Ellerington, Neil; Hubbard, Ted; Kujath, Marek

2011-01-01

This paper examines the design, fabrication and testing of a bio-mimetic MEMS (micro-electro mechanical systems) earthworm motor with external actuators. The motor consists of a passive mobile shuttle with two flexible diamond-shaped segments; each segment is independently squeezed by a pair of stationary chevron-shaped thermal actuators. Applying a specific sequence of squeezes to the earthworm segments, the shuttle can be driven backward or forward. Unlike existing inchworm drives that use clamping and thrusting actuators, the earthworm actuators apply only clamping forces to the shuttle, and lateral thrust is produced by the shuttle's compliant geometry. The earthworm assembly is fabricated using the PolyMUMPs process with planar dimensions of 400 µm width by 800 µm length. The stationary actuators operate within the range of 4–9 V and provide a maximum shuttle range of motion of 350 µm (approximately half its size), a maximum shuttle speed of 17 mm s −1 at 10 kHz, and a maximum dc shuttle force of 80 µN. The shuttle speed was found to vary linearly with both input voltage and input frequency. The shuttle force was found to vary linearly with the actuator voltage.

Development of a wide-range tritium-concentration detector

International Nuclear Information System (INIS)

Jun, F.; Zhe, L.; Shicheng, L.; Jiangfeng, S.; Deli, L.

2015-01-01

According to the requirements of the tritium related systems of the TBM (Test Blanket Module) for monitoring the on-line tritium concentration, a wide-range tritium-concentration detector has been developed to measure the tritium concentration in the range of 10 4 Bq/ml - 5*10 8 Bq/ml. This detector is combined with a low-memory helium ionization chamber. The weak current signal collected in the ionization chamber is converted to the voltage signal by an I-V converter. The minimum weak current which the detector could be measured is 10 -14 A. The performance of the background current and the current response linearity of the prototype have been tested. The test result indicates that the linear response of the current signal of the prototype without connecting the ionization chamber is good. The linear correlation coefficient is R 2 = 0.998

Manipulating the voltage dependence of tunneling spin torques

KAUST Repository

Manchon, Aurelien

2012-01-01

Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact

SYNTHESIS OF VOLTAGES OF UNIFORM PWM IN TIME REGULATION

Directory of Open Access Journals (Sweden)

A. G. Stryzhniou

2014-01-01

Full Text Available The article describes a process of synthesis and qualitative assessment of the harmonic composition of voltages of multiple and single PWM pulses in time regulation, being, along with amplitude, frequency and phase method, one of control methods of an asynchronous motor. The main point of time regulation is that a pause after any two single PWM pulses with different polarity or after any two groups of multiple PWM pulses with different polarity changes during a process of regulation. Feature of time regulation is that a motor has fast response in the range of small-signal of control and good linearity of speed-torque characteristics in the whole control range. Analytical expressions of parameters of PWM pulses ai and ti are obtained which allow to simplify considerably a process of formation and implementation of time regulation using tabular or indexed-tabular methods. These expressions allow not only to define voltage amplitude of  harmonic but also to perform qualitative assessment of harmonic composition of output voltages at time regulation. It is specified that harmonic frequencies wi = w0/q change in inverse proportion to magnitude of parameter q during a process of regulation and there is a replacement of a fundamental frequency by frequencies of higher harmonics.The offered approach allows to synthesize voltage of uniform single and multiple PWM pulses and to perform their comparative and qualitative analysis and the obtained expressions can be used at modeling of AC motor work. Voltage of multiple PWM pulses which is formed using stepped reference voltage with even quantity of steps in a half period and a pause on a zero level has the best parameters by criterion of a minimum of harmonic components and a maximum of a factor of anharmonicity Kнс at time regulation.

Power conditioning using dynamic voltage restorers under different voltage sag types.

Science.gov (United States)

Saeed, Ahmed M; Abdel Aleem, Shady H E; Ibrahim, Ahmed M; Balci, Murat E; El-Zahab, Essam E A

2016-01-01

Voltage sags can be symmetrical or unsymmetrical depending on the causes of the sag. At the present time, one of the most common procedures for mitigating voltage sags is by the use of dynamic voltage restorers (DVRs). By definition, a DVR is a controlled voltage source inserted between the network and a sensitive load through a booster transformer injecting voltage into the network in order to correct any disturbance affecting a sensitive load voltage. In this paper, modelling of DVR for voltage correction using MatLab software is presented. The performance of the device under different voltage sag types is described, where the voltage sag types are introduced using the different types of short-circuit faults included in the environment of the MatLab/Simulink package. The robustness of the proposed device is evaluated using the common voltage sag indices, while taking into account voltage and current unbalance percentages, where maintaining the total harmonic distortion percentage of the load voltage within a specified range is desired. Finally, several simulation results are shown in order to highlight that the DVR is capable of effective correction of the voltage sag while minimizing the grid voltage unbalance and distortion, regardless of the fault type.

Application of pentacene thin-film transistors with controlled threshold voltages to enhancement/depletion inverters

Science.gov (United States)

Takahashi, Hajime; Hanafusa, Yuki; Kimura, Yoshinari; Kitamura, Masatoshi

2018-03-01

Oxygen plasma treatment has been carried out to control the threshold voltage in organic thin-film transistors (TFTs) having a SiO2 gate dielectric prepared by rf sputtering. The threshold voltage linearly changed in the range of -3.7 to 3.1 V with the increase in plasma treatment time. Although the amount of change is smaller than that for organic TFTs having thermally grown SiO2, the tendency of the change was similar to that for thermally grown SiO2. To realize different plasma treatment times on the same substrate, a certain region on the SiO2 surface was selected using a shadow mask, and was treated with oxygen plasma. Using the process, organic TFTs with negative threshold voltages and those with positive threshold voltages were fabricated on the same substrate. As a result, enhancement/depletion inverters consisting of the organic TFTs operated at supply voltages of 5 to 15 V.

Analysis of loss distribution of Conventional Boost, Z-source and Y-source Converters for wide power and voltage range

DEFF Research Database (Denmark)

Gadalla, Brwene Salah Abdelkarim; Schaltz, Erik; Siwakoti, Yam Prasad

2017-01-01

Boost converters are needed in many applications which require the output voltage to be higher than the input voltage. Recently, boost type converters have been applied for industrial applications, and hence it has become an interesting topic of research. Many researchers proposed different...... impedance source converters with their unique advantages as having a high voltage gain in a small range of duty cycle ratio. However, the thermal behaviour of the semiconductor devices and passive elements in the impedance source converter is an important issue from a reliability point of view and it has...... not been investigated yet. Therefore, this paper presents a comparison between the conventional boost, the Z-source, and the Y-source converters based on a thermal evaluation of the semiconductors. In addition, the three topologies are also compared with respect to their efficiency. In this study...

Development of a wide-range tritium-concentration detector

Energy Technology Data Exchange (ETDEWEB)

Jun, F.; Zhe, L.; Shicheng, L.; Jiangfeng, S.; Deli, L. [China Academy of Engineering Physics, Mianyang (China)

2015-03-15

According to the requirements of the tritium related systems of the TBM (Test Blanket Module) for monitoring the on-line tritium concentration, a wide-range tritium-concentration detector has been developed to measure the tritium concentration in the range of 10{sup 4} Bq/ml - 5*10{sup 8} Bq/ml. This detector is combined with a low-memory helium ionization chamber. The weak current signal collected in the ionization chamber is converted to the voltage signal by an I-V converter. The minimum weak current which the detector could be measured is 10{sup -14} A. The performance of the background current and the current response linearity of the prototype have been tested. The test result indicates that the linear response of the current signal of the prototype without connecting the ionization chamber is good. The linear correlation coefficient is R{sup 2} = 0.998.

Flexible Ferroelectric Sensors with Ultrahigh Pressure Sensitivity and Linear Response over Exceptionally Broad Pressure Range.

Science.gov (United States)

Lee, Youngoh; Park, Jonghwa; Cho, Soowon; Shin, Young-Eun; Lee, Hochan; Kim, Jinyoung; Myoung, Jinyoung; Cho, Seungse; Kang, Saewon; Baig, Chunggi; Ko, Hyunhyub

2018-04-24

Flexible pressure sensors with a high sensitivity over a broad linear range can simplify wearable sensing systems without additional signal processing for the linear output, enabling device miniaturization and low power consumption. Here, we demonstrate a flexible ferroelectric sensor with ultrahigh pressure sensitivity and linear response over an exceptionally broad pressure range based on the material and structural design of ferroelectric composites with a multilayer interlocked microdome geometry. Due to the stress concentration between interlocked microdome arrays and increased contact area in the multilayer design, the flexible ferroelectric sensors could perceive static/dynamic pressure with high sensitivity (47.7 kPa -1 , 1.3 Pa minimum detection). In addition, efficient stress distribution between stacked multilayers enables linear sensing over exceptionally broad pressure range (0.0013-353 kPa) with fast response time (20 ms) and high reliability over 5000 repetitive cycles even at an extremely high pressure of 272 kPa. Our sensor can be used to monitor diverse stimuli from a low to a high pressure range including weak gas flow, acoustic sound, wrist pulse pressure, respiration, and foot pressure with a single device.

A Short-Range Distance Sensor with Exceptional Linearity

Science.gov (United States)

Simmons, Steven; Youngquist, Robert

2013-01-01

A sensor has been demonstrated that can measure distance over a total range of about 300 microns to an accuracy of about 0.1 nm (resolution of about 0.01 nm). This represents an exceptionally large dynamic range of operation - over 1,000,000. The sensor is optical in nature, and requires the attachment of a mirror to the object whose distance is being measured. This work resulted from actively developing a white light interferometric system to be used to measure the depths of defects in the Space Shuttle Orbiter windows. The concept was then applied to measuring distance. The concept later expanded to include spectrometer calibration. In summary, broadband (i.e., white) light is launched into a Michelson interferometer, one mirror of which is fixed and one of which is attached to the object whose distance is to be measured. The light emerging from the interferometer has traveled one of two distances: either the distance to the fixed mirror and back, or the distance to the moving mirror and back. These two light beams mix and produce an interference pattern where some wavelengths interfere constructively and some destructively. Sending this light into a spectrometer allows this interference pattern to be analyzed, yielding the net distance difference between the two paths. The unique feature of this distance sensor is its ability to measure accurately distance over a dynamic range of more than one million, the ratio of its range (about 300 microns) to its accuracy (about 0.1 nanometer). Such a large linear operating range is rare and arises here because both amplitude and phase-matching algorithms contribute to the performance. The sensor is limited by the need to attach a mirror of some kind to the object being tracked, and by the fairly small total range, but the exceptional dynamic range should make it of interest.

A large dynamic range radiation-tolerant analog memory in a quarter- micron CMOS technology

CERN Document Server

Anelli, G; Rivetti, A

2001-01-01

An analog memory prototype containing 8*128 cells has been designed in a commercial quarter-micron CMOS process. The aim of this work is to investigate the possibility of designing large dynamic range mixed-mode switched capacitor circuits for high-energy physics (HEP) applications in deep submicron CMOS technologies. Special layout techniques have been used to make the circuit radiation tolerant. The memory cells employ gate-oxide capacitors for storage, permitting a very high density. A voltage write-voltage read architecture has been chosen to minimize the sensitivity to absolute capacitor values. The measured input voltage range is 2.3 V (the power supply voltage V/sub DD/ is equal to 2.5 V), with a linearity of almost 8 bits over 2 V. The dynamic range is more than 11 bits. The pedestal variation is +or-0.5 mV peak-to-peak. The noise measured, which is dominated by the noise of the measurement setup, is around 0.8 mV rms. The characteristics of the memory have been measured before irradiation and after 1...

High-output microwave detector using voltage-induced ferromagnetic resonance

International Nuclear Information System (INIS)

Shiota, Yoichi; Suzuki, Yoshishige; Miwa, Shinji; Tamaru, Shingo; Nozaki, Takayuki; Kubota, Hitoshi; Fukushima, Akio; Yuasa, Shinji

2014-01-01

We investigated the voltage-induced ferromagnetic resonance (FMR) with various DC bias voltage and input RF power in magnetic tunnel junctions. We found that the DC bias monotonically increases the homodyne detection voltage due to the nonlinear FMR originating in an asymmetric magnetization-potential in the free layer. In addition, the linear increase of an output voltage to the input RF power in the voltage-induced FMR is more robust than that in spin-torque FMR. These characteristics enable us to obtain an output voltage more than ten times than that of microwave detectors using spin-transfer torque

Novel birefringence interrogation for Sagnac loop interferometer sensor with unlimited linear measurement range.

Science.gov (United States)

He, Haijun; Shao, Liyang; Qian, Heng; Zhang, Xinpu; Liang, Jiawei; Luo, Bin; Pan, Wei; Yan, Lianshan

2017-03-20

A novel demodulation method for Sagnac loop interferometer based sensor has been proposed and demonstrated, by unwrapping the phase changes with birefringence interrogation. A temperature sensor based on Sagnac loop interferometer has been used to verify the feasibility of the proposed method. Several tests with 40 °C temperature range have been accomplished with a great linearity of 0.9996 in full range. The proposed scheme is universal for all Sagnac loop interferometer based sensors and it has unlimited linear measurable range which overwhelming the conventional demodulation method with peak/dip tracing. Furthermore, the influence of the wavelength sampling interval and wavelength span on the demodulation error has been discussed in this work. The proposed interrogation method has a great significance for Sagnac loop interferometer sensor and it might greatly enhance the availability of this type of sensors in practical application.

Magnetic field cycling effect on the non-linear current-voltage characteristics and magnetic field induced negative differential resistance in α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3} oxide

Energy Technology Data Exchange (ETDEWEB)

Bhowmik, R. N., E-mail: rnbhowmik.phy@pondiuni.edu.in; Vijayasri, G. [Department of Physics, Pondicherry University, R.Venkataraman Nagar, Kalapet, Puducherry - 605 014 (India)

2015-06-15

We have studied current-voltage (I-V) characteristics of α-Fe{sub 1.64}Ga{sub 0.36}O{sub 3}, a typical canted ferromagnetic semiconductor. The sample showed a transformation of the I-V curves from linear to non-linear character with the increase of bias voltage. The I-V curves showed irreversible features with hysteresis loop and bi-stable electronic states for up and down modes of voltage sweep. We report positive magnetoresistance and magnetic field induced negative differential resistance as the first time observed phenomena in metal doped hematite system. The magnitudes of critical voltage at which I-V curve showed peak and corresponding peak current are affected by magnetic field cycling. The shift of the peak voltage with magnetic field showed a step-wise jump between two discrete voltage levels with least gap (ΔV{sub P}) 0.345(± 0.001) V. The magnetic spin dependent electronic charge transport in this new class of magnetic semiconductor opens a wide scope for tuning large electroresistance (∼500-700%), magnetoresistance (70-135 %) and charge-spin dependent conductivity under suitable control of electric and magnetic fields. The electric and magnetic field controlled charge-spin transport is interesting for applications of the magnetic materials in spintronics, e.g., magnetic sensor, memory devices and digital switching.

Sigma-Delta Voltage to Frequency Converter With Phase Modulation Possibility

OpenAIRE

STORK, Milan

2014-01-01

Voltage to frequency converter (VFC) is an oscillator whose frequency is linearly proportional to control voltage. There are two common VFC architectures: the current steering multivibrator and the charge-balance VFC. For higher linearity, the charge-balancing method is preferred. The charge balanced VFC may be made in asynchronous or synchronous (clocked) forms. The synchronous charge balanced VFC or "sigma delta" (S-D) VFC is used when output pulses are synchroni...

Extension of photomultiplier tube dynamic range for the LHAASO-KM2A electromagnetic particle detectors

Energy Technology Data Exchange (ETDEWEB)

Lv, Hongkui, E-mail: lvhk@ihep.ac.cn [Key Laboratory of Particle Astrophysics, Institute of High Energy Physics, Chinese Academy of Sciences, Beijing 100049 (China); University of Chinese Academy of Sciences, Beijing 100049 (China); Sheng, Xiangdong; He, Huihai; Liu, Jia [Key Laboratory of Particle Astrophysics, Institute of High Energy Physics, Chinese Academy of Sciences, Beijing 100049 (China); Zhang, Zhongquan [Shandong University, Jinan 250100 (China); Hou, Chao; Zhao, Jing [Key Laboratory of Particle Astrophysics, Institute of High Energy Physics, Chinese Academy of Sciences, Beijing 100049 (China)

2015-05-01

In the Large High Altitude Air Shower Observatory (LHAASO), the 1 km{sup 2} array (KM2A) requires linear measurement of optical intensity with a wide dynamic range. Over 5000 photomultiplier tubes (PMTs) are employed in this experiment and developed as “two outputs” device (anode and dynode) to meet the relevant requirements. In this study, the linearity of the anode and the eighth dynode (DY8), which is limited by space charge effects and mainly related to the relative dynode voltage ratios of the PMT divider, is examined. A voltage divider for the Hamamatsu R11102 PMT is designed and a dramatically enhanced linearity is demonstrated. Test results show that this design can cover a wide dynamic range from 20 to 2×10{sup 5} photoelectrons and achieve a peak anode current of 380 mA at a PMT gain of 10{sup 5}, which satisfies the requirements of KM2A electromagnetic particle detectors. The circuit design has been successfully simulated using the simulation software Multisim. The details of PMT performance tests and simulations are described.

Extension of photomultiplier tube dynamic range for the LHAASO-KM2A electromagnetic particle detectors

Science.gov (United States)

Lv, Hongkui; Sheng, Xiangdong; He, Huihai; Liu, Jia; Zhang, Zhongquan; Hou, Chao; Zhao, Jing

2015-05-01

In the Large High Altitude Air Shower Observatory (LHAASO), the 1 km2 array (KM2A) requires linear measurement of optical intensity with a wide dynamic range. Over 5000 photomultiplier tubes (PMTs) are employed in this experiment and developed as "two outputs" device (anode and dynode) to meet the relevant requirements. In this study, the linearity of the anode and the eighth dynode (DY8), which is limited by space charge effects and mainly related to the relative dynode voltage ratios of the PMT divider, is examined. A voltage divider for the Hamamatsu R11102 PMT is designed and a dramatically enhanced linearity is demonstrated. Test results show that this design can cover a wide dynamic range from 20 to 2×105 photoelectrons and achieve a peak anode current of 380 mA at a PMT gain of 105, which satisfies the requirements of KM2A electromagnetic particle detectors. The circuit design has been successfully simulated using the simulation software Multisim. The details of PMT performance tests and simulations are described.

Extension of photomultiplier tube dynamic range for the LHAASO-KM2A electromagnetic particle detectors

International Nuclear Information System (INIS)

Lv, Hongkui; Sheng, Xiangdong; He, Huihai; Liu, Jia; Zhang, Zhongquan; Hou, Chao; Zhao, Jing

2015-01-01

In the Large High Altitude Air Shower Observatory (LHAASO), the 1 km 2 array (KM2A) requires linear measurement of optical intensity with a wide dynamic range. Over 5000 photomultiplier tubes (PMTs) are employed in this experiment and developed as “two outputs” device (anode and dynode) to meet the relevant requirements. In this study, the linearity of the anode and the eighth dynode (DY8), which is limited by space charge effects and mainly related to the relative dynode voltage ratios of the PMT divider, is examined. A voltage divider for the Hamamatsu R11102 PMT is designed and a dramatically enhanced linearity is demonstrated. Test results show that this design can cover a wide dynamic range from 20 to 2×10 5 photoelectrons and achieve a peak anode current of 380 mA at a PMT gain of 10 5 , which satisfies the requirements of KM2A electromagnetic particle detectors. The circuit design has been successfully simulated using the simulation software Multisim. The details of PMT performance tests and simulations are described

The effect of external visible light on the breakdown voltage of a long discharge tube

Science.gov (United States)

Shishpanov, A. I.; Ionikh, Yu. Z.; Meshchanov, A. V.

2016-06-01

The breakdown characteristics of a discharge tube with a configuration typical of gas-discharge light sources and electric-discharge lasers (a so-called "long discharge tube") filled with argon or helium at a pressure of 1 Torr have been investigated. A breakdown has been implemented using positive and negative voltage pulses with a linear leading edge having a slope dU/ dt ~ 10-107 V/s. Visible light from an external source (halogen incandescent lamp) is found to affect the breakdown characteristics. The dependences of the dynamic breakdown voltage of the tube on dU/ dt and on the incident light intensity are measured. The breakdown voltage is found to decrease under irradiation of the high-voltage anode of the tube in a wide range of dU/ dt. A dependence of the effect magnitude on the light intensity and spectrum is obtained. Possible physical mechanisms of this phenomenon are discussed.

Technological Aspects: High Voltage

CERN Document Server

Faircloth, D.C.

2013-12-16

This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered.

A two-layer linear piezoelectric micromotor.

Science.gov (United States)

Li, Xiaotian; Ci, Penghong; Liu, Guoxi; Dong, Shuxiang

2015-03-01

A first bending (B1) mode two-layer piezoelectric ultrasonic linear micromotor has been developed for microoptics driving applications. The piezo-vibrator of the micromotor was composed of two small Pb(Zr,Ti)O3 (PZT-5) plates, with overall dimensions and mass of only 2.0 × 2.0 × 5.0 mm(3) and 0.2 g, respectively. The proposed micromotor could operate either in single-phase voltage (standing wave) mode or two-phase voltage (traveling wave) mode to drive a slider via friction force to provide bidirectional linear motion. A large thrust of up to 0.30 N, which corresponds to a high unit volume direct driving force of 15 mN/mm(3), and a linear movement velocity of up to 230 mm/s were obtained under an applied voltage of 80 Vpp at the B1 mode resonance frequency of 174 kHz.

Cell voltage versus electrode potential range in aqueous supercapacitors

OpenAIRE

Dai, Zengxin; Peng, Chuang; Chae, Jung Hoon; Ng, Kok Chiang; Chen, George Z.

2015-01-01

Supercapacitors with aqueous electrolytes and nanostructured composite electrodes are attractive because of their high charging-discharging speed, long cycle life, low environmental impact and wide commercial affordability. However, the energy capacity of aqueous supercapacitors is limited by the electrochemical window of water. In this paper, a recently reported engineering strategy is further developed and demonstrated to correlate the maximum charging voltage of a supercapacitor with the c...

Transmission congestion and voltage profile management coordination in competitive electricity markets

International Nuclear Information System (INIS)

Yamin, H.Y.; Shahidehpour, S.M.

2003-01-01

This paper describes a generalized active/reactive iterative coordination process between GENCOs and the Independent System Operator (ISO) for active (transmission congestion) and reactive (voltage profile) management in the day-ahead market. GENCOs apply priced-based unit commitment without transmission and voltage security constraints, schedule their units and submit their initial bids to the ISO. The ISO executes congestion and voltage profile management for eliminating transmission and voltage profile violations. If violations are not eliminated, the ISO minimizes the transmission and voltage profile violations and sends a signal via the Internet to GENCOs. GENCOs reschedule their units taking into account the ISO signals and submit modified bids to the ISO. The voltage problem is addressed and a linear model is formulated and used in the proposed method. The voltage problem is formulated as a linear programming with a block-angular structure and Dantzig-Wolfe decomposition is applied to generate several smaller problems for a faster and easier solution of large-scale power systems. Two 36 unit GENCOs are used to demonstrate the performance of the proposed generalized active/reactive coordination algorithm. (author)

Low cost photomultiplier high-voltage readout system

International Nuclear Information System (INIS)

Oxoby, G.J.; Kunz, P.F.

1976-10-01

The Large Aperture Solenoid Spectrometer (LASS) at Stanford Linear Accelerator Center (SLAC) requires monitoring over 300 voltages. This data is recorded on magnetic tapes along with the event data. It must also be displayed so that operators can easily monitor and adjust the voltages. A low-cost high-voltage readout system has been implemented to offer stand-alone digital readout capability as well as fast data transfer to a host computer. The system is flexible enough to permit use of a DVM or ADC and commercially available analogue multiplexers

Linear response in the nonequilibrium zero range process

International Nuclear Information System (INIS)

Maes, Christian; Salazar, Alberto

2014-01-01

We explore a number of explicit response formulæ around the boundary driven zero range process to changes in the exit and entrance rates. In such a nonequilibrium regime kinetic (and not only thermodynamic) aspects make a difference in the response. Apart from a number of formal approaches, we illustrate a general decomposition of the linear response into entropic and frenetic contributions, the latter being realized from changes in the dynamical activity at the boundaries. In particular in this way one obtains nonlinear modifications to the Green–Kubo relation. We end by bringing some general remarks about the situation where that nonequilibrium response remains given by the (equilibrium) Kubo formula such as for the density profile in the boundary driven Lorentz gas

A CMOS frontend chip for implantable neural recording with wide voltage supply range

International Nuclear Information System (INIS)

Liu Jialin; Zhang Xu; Hu Xiaohui; Li Peng; Liu Ming; Chen Hongda; Guo Yatao; Li Bin

2015-01-01

A design for a CMOS frontend integrated circuit (chip) for neural signal acquisition working at wide voltage supply range is presented in this paper. The chip consists of a preamplifier, a serial instrumental amplifier (IA) and a cyclic analog-to-digital converter (CADC). The capacitive-coupled and capacitive-feedback topology combined with MOS-bipolar pseudo-resistor element is adopted in the preamplifier to create a −3 dB upper cut-off frequency less than 1 Hz without using a ponderous discrete device. A dual-amplifier instrumental amplifier is used to provide a low output impedance interface for ADC as well as to boost the gain. The preamplifier and the serial instrumental amplifier together provide a midband gain of 45.8 dB and have an input-referred noise of 6.7 μV rms integrated from 1 Hz to 5 kHz. The ADC digitizes the amplified signal at 12-bits precision with a highest sampling rate of 130 kS/s. The measured effective number of bits (ENOB) of the ADC is 8.7 bits. The entire circuit draws 165 to 216 μA current from the supply voltage varied from 1.34 to 3.3 V. The prototype chip is fabricated in the 0.18-μm CMOS process and occupies an area of 1.23 mm 2 (including pads). In-vitro recording was successfully carried out by the proposed frontend chip. (paper)

On the use of small integrating spheres to improve the linearity range of RASNIKS systems

International Nuclear Information System (INIS)

Alberdi, J.; Burgos, C.; Ferrando, A.; Molinero, A.; Schvachkin, V.; Figueroa, C.F.; Matorras, F.; Rodrigo, T.; Ruiz, A.; Vila, I.

1997-10-01

Rasniks elements will be used in the CMS alignment system. The large displacements of the different sub detectors expected in the CMS experiment demands large linearity response of this system. By the use of a small integrating sphere we have optimized the source definition such that a factor three improvement in the linearity range with respect to conventional Rasniks configurations is obtained. The response range reached coincides with the maximum one can get with the components used in the test

Josephson tunneling current in the presence of a time-dependent voltage

International Nuclear Information System (INIS)

Harris, R.E.

1975-01-01

The expression for the current through a small Josephson tunnel junction in the presence of a time-dependent voltage is presented. Four terms appear: the usual sine, cosine, and quasiparticle terms, and a reactive part of the quasiparticle current. The latter is displayed graphically as a function of both energy and temperature. It is shown that in the limit of zero dc voltage and small ac voltage, the Josephson device behaves linearly. Interpretation of the in- and out-of-phase components of the current in this linear limit is given to provide physical insight into some of the details of the general expression. Finally, the tunneling current in the linear limit is shown for thin tunneling barriers to be proportional to the current in a single superconductor in the presence of an electromagnetic field

Technological Aspects: High Voltage

International Nuclear Information System (INIS)

Faircloth, D C

2013-01-01

This paper covers the theory and technological aspects of high-voltage design for ion sources. Electric field strengths are critical to understanding high-voltage breakdown. The equations governing electric fields and the techniques to solve them are discussed. The fundamental physics of high-voltage breakdown and electrical discharges are outlined. Different types of electrical discharges are catalogued and their behaviour in environments ranging from air to vacuum are detailed. The importance of surfaces is discussed. The principles of designing electrodes and insulators are introduced. The use of high-voltage platforms and their relation to system design are discussed. The use of commercially available high-voltage technology such as connectors, feedthroughs and cables are considered. Different power supply technologies and their procurement are briefly outlined. High-voltage safety, electric shocks and system design rules are covered. (author)

Low voltage 80 KV to 125 KV electron processors

International Nuclear Information System (INIS)

Lauppi, U.V.

1999-01-01

The classic electron beam technology made use of accelerating energies in the voltage range of 300 to 800 kV. The first EB processors - built for the curing of coatings - operated at 300 kV. The products to be treated were thicker than a simple layer of coating with thicknesses up to 100g and more. It was only in the beginning of the 1970's that industrial EB processors with accelerating voltages below 300 kV appeared on the market. Our company developed the first commercial electron accelerator without a beam scanner. The new EB machine featured a linear cathode, emitting a shower or 'curtain' of electrons over the full width of the product. These units were much smaller than anv previous EB processors and dedicated to the curing of coatings and other thin layers. ESI's first EB units operated with accelerating voltages between 150 and 200 kV. In 1993 ESI announced the introduction of a new generation of Electrocure. EB processors operating at 120 kV, and in 1998, at the RadTech North America '98 Conference in Chicago, the introduction of an 80 kV electron beam processor under the designation Microbeam LV

The current–voltage and capacitance–voltage characteristics at high temperatures of Au Schottky contact to n-type GaAs

Energy Technology Data Exchange (ETDEWEB)

Özerli, Halil; Karteri, İbrahim [Department of Materials Science And Engineering, Kahramanmaraş Sütçü İmam University, 46100 Kahramanmaraş (Turkey); Karataş, Şükrü, E-mail: skaratas@ksu.edu.tr [Department of Materials Science And Engineering, Kahramanmaraş Sütçü İmam University, 46100 Kahramanmaraş (Turkey); Department of Physics, Kahramanmaraş Sütçü İmam University, 46100 Kahramanmaraş (Turkey); Altindal, Şemsettin [Department of Physics, Gazi University, 06100 Ankara (Turkey)

2014-05-01

Highlights: • The electronic parameters of the diode under temperature were investigated. • The barrier heights have a Gaussian distribution. • Au/n-GaAs diode exhibits a rectification behavior. - Abstract: We have investigated the temperature-dependent current–voltage (I–V) and capacitance–voltage (C–V) characteristics of Au/n-GaAs Schottky barrier diodes (SBDs) in the temperature range of 280–415 K. The barrier height for the Au/n-type GaAs SBDs from the I–V and C–V characteristics have varied from 0.901 eV to 0.963 eV (I–V) and 1.234 eV to 0.967 eV (C–V), and the ideality factor (n) from 1.45 to 1.69 in the temperature range 280–415 K. The conventional Richardson plots are found to be linear in the temperature range measured. Both the ln(I{sub 0}/T{sup 2}) versus (kT){sup −1} and ln(I{sub 0}/T{sup 2}) versus (nkT){sup −1} plots gives a straight line corresponding to activation energies 0.773 eV and 0.870 eV, respectively. A Φ{sub b0} versus 1/T plot was drawn to obtain evidence of a Gaussian distribution of the BHs, and values of Φ{sup ¯}{sub b0} = 1.071 eV and σ{sub 0} = 0.094 V for the mean BH and zero-bias standard deviation have been obtained from this plot.

The current–voltage and capacitance–voltage characteristics at high temperatures of Au Schottky contact to n-type GaAs

International Nuclear Information System (INIS)

Özerli, Halil; Karteri, İbrahim; Karataş, Şükrü; Altindal, Şemsettin

2014-01-01

Highlights: • The electronic parameters of the diode under temperature were investigated. • The barrier heights have a Gaussian distribution. • Au/n-GaAs diode exhibits a rectification behavior. - Abstract: We have investigated the temperature-dependent current–voltage (I–V) and capacitance–voltage (C–V) characteristics of Au/n-GaAs Schottky barrier diodes (SBDs) in the temperature range of 280–415 K. The barrier height for the Au/n-type GaAs SBDs from the I–V and C–V characteristics have varied from 0.901 eV to 0.963 eV (I–V) and 1.234 eV to 0.967 eV (C–V), and the ideality factor (n) from 1.45 to 1.69 in the temperature range 280–415 K. The conventional Richardson plots are found to be linear in the temperature range measured. Both the ln(I 0 /T 2 ) versus (kT) −1 and ln(I 0 /T 2 ) versus (nkT) −1 plots gives a straight line corresponding to activation energies 0.773 eV and 0.870 eV, respectively. A Φ b0 versus 1/T plot was drawn to obtain evidence of a Gaussian distribution of the BHs, and values of Φ ¯ b0 = 1.071 eV and σ 0 = 0.094 V for the mean BH and zero-bias standard deviation have been obtained from this plot

Fuel Cell/Electrochemical Cell Voltage Monitor

Science.gov (United States)

Vasquez, Arturo

2012-01-01

A concept has been developed for a new fuel cell individual-cell-voltage monitor that can be directly connected to a multi-cell fuel cell stack for direct substack power provisioning. It can also provide voltage isolation for applications in high-voltage fuel cell stacks. The technology consists of basic modules, each with an 8- to 16-cell input electrical measurement connection port. For each basic module, a power input connection would be provided for direct connection to a sub-stack of fuel cells in series within the larger stack. This power connection would allow for module power to be available in the range of 9-15 volts DC. The relatively low voltage differences that the module would encounter from the input electrical measurement connection port, coupled with the fact that the module's operating power is supplied by the same substack voltage input (and so will be at similar voltage), provides for elimination of high-commonmode voltage issues within each module. Within each module, there would be options for analog-to-digital conversion and data transfer schemes. Each module would also include a data-output/communication port. Each of these ports would be required to be either non-electrical (e.g., optically isolated) or electrically isolated. This is necessary to account for the fact that the plurality of modules attached to the stack will normally be at a range of voltages approaching the full range of the fuel cell stack operating voltages. A communications/ data bus could interface with the several basic modules. Options have been identified for command inputs from the spacecraft vehicle controller, and for output-status/data feeds to the vehicle.

Enhanced dielectric-wall linear accelerator

Science.gov (United States)

Sampayan, Stephen E.; Caporaso, George J.; Kirbie, Hugh C.

1998-01-01

A dielectric-wall linear accelerator is enhanced by a high-voltage, fast e-time switch that includes a pair of electrodes between which are laminated alternating layers of isolated conductors and insulators. A high voltage is placed between the electrodes sufficient to stress the voltage breakdown of the insulator on command. A light trigger, such as a laser, is focused along at least one line along the edge surface of the laminated alternating layers of isolated conductors and insulators extending between the electrodes. The laser is energized to initiate a surface breakdown by a fluence of photons, thus causing the electrical switch to close very promptly. Such insulators and lasers are incorporated in a dielectric wall linear accelerator with Blumlein modules, and phasing is controlled by adjusting the length of fiber optic cables that carry the laser light to the insulator surface.

Non-linear effects and thermoelectric efficiency of quantum dot-based single-electron transistors.

Science.gov (United States)

Talbo, Vincent; Saint-Martin, Jérôme; Retailleau, Sylvie; Dollfus, Philippe

2017-11-01

By means of advanced numerical simulation, the thermoelectric properties of a Si-quantum dot-based single-electron transistor operating in sequential tunneling regime are investigated in terms of figure of merit, efficiency and power. By taking into account the phonon-induced collisional broadening of energy levels in the quantum dot, both heat and electrical currents are computed in a voltage range beyond the linear response. Using our homemade code consisting in a 3D Poisson-Schrödinger solver and the resolution of the Master equation, the Seebeck coefficient at low bias voltage appears to be material independent and nearly independent on the level broadening, which makes this device promising for metrology applications as a nanoscale standard of Seebeck coefficient. Besides, at higher voltage bias, the non-linear characteristics of the heat current are shown to be related to the multi-level effects. Finally, when considering only the electronic contribution to the thermal conductance, the single-electron transistor operating in generator regime is shown to exhibit very good efficiency at maximum power.

High voltage investigations for ITER coils

International Nuclear Information System (INIS)

Fink, S.; Fietz, W.H.

2006-01-01

The superconducting ITER magnets will be excited with high voltage during operation and fast discharge. Because the coils are complex systems the internal voltage distribution can differ to a large extent from the ideal linear voltage distribution. In case of fast excitations internal voltages between conductor and radial plate of a TF coil can be even higher than the terminal voltage of 3.5 kV to ground which appears during a fast discharge without a fault. Hence the determination of the transient voltage distribution is important for a proper insulation co-ordination and will provide a necessary basis for the verification of the individual insulation design and the choice of test voltages and waveforms. Especially the extent of internal overvoltages in case of failures, e. g. malfunction of discharge units and / or arcing is of special interest. Transient calculations for the ITER TF coil system have been performed for fast discharge and fault scenarios to define test voltages for ITER TF. The conductor and radial plate insulation of the ITER TF Model Coil were exposed at room temperature to test voltages derived from the results from these calculations. Breakdown appeared during the highest AC voltage step. A fault scenario for the TF fast discharge system is presented where one fault triggers a second fault, leading to considerable voltage stress. In addition a FEM model of Poloidal Field Coil 3 for the determination of the parameters of a detailed network model is presented in order to prepare detailed investigations of the transient voltage behaviour of the PF coils. (author)

Ionization effects and linear stability in a coaxial plasma device

Science.gov (United States)

Kurt, Erol; Kurt, Hilal; Bayhan, Ulku

2009-03-01

A 2-D computer simulation of a coaxial plasma device depending on the conservation equations of electrons, ions and excited atoms together with the Poisson equation for a plasma gun is carried out. Some characteristics of the plasma focus device (PF) such as critical wave numbers a c and voltages U c in the cases of various pressures Pare estimated in order to satisfy the necessary conditions of traveling particle densities ( i.e. plasma patterns) via a linear analysis. Oscillatory solutions are characterized by a nonzero imaginary part of the growth rate Im ( σ) for all cases. The model also predicts the minimal voltage ranges of the system for certain pressure intervals.

Evaluation of the Voltage Support Strategies for the Low Voltage Grid Connected PV

DEFF Research Database (Denmark)

Demirok, Erhan; Sera, Dezso; Teodorescu, Remus

2010-01-01

Admissible range of grid voltage is one of the strictest constraints for the penetration of distributed photovoltaic (PV) generators especially connection to low voltage (LV) public networks. Voltage limits are usually fulfilled either by network reinforcements or limiting of power injections from...... PVs. In order to increase PV penetration level further, new voltage support control functions for individual inverters are required. This paper investigates distributed reactive power regulation and active power curtailment strategies regarding the development of PV connection capacity by evaluation...... of reactive power efforts and requirement of minimum active power curtailment. Furthermore, a small scale experimental setup is built to reflect real grid interaction in the laboratory by achieving critical types of grid (weak and sufficiently stiff)....

Design and Implementation of a High-Voltage Generator with Output Voltage Control for Vehicle ER Shock-Absorber Applications

Directory of Open Access Journals (Sweden)

Chih-Lung Shen

2013-01-01

Full Text Available A self-oscillating high-voltage generator is proposed to supply voltage for a suspension system in order to control the damping force of an electrorheological (ER fluid shock absorber. By controlling the output voltage level of the generator, the damping force in the ER fluid shock absorber can be adjusted immediately. The shock absorber is part of the suspension system. The high-voltage generator drives a power transistor based on self-excited oscillation, which converts dc to ac. A high-frequency transformer with high turns ratio is used to increase the voltage. In addition, the system uses the car battery as dc power supply. By regulating the duty cycle of the main switch in the buck converter, the output voltage of the buck converter can be linearly adjusted so as to obtain a specific high voltage for ER. The driving system is self-excited; that is, no additional external driving circuit is required. Thus, it reduces cost and simplifies system structure. A prototype version of the actual product is studied to measure and evaluate the key waveforms. The feasibility of the proposed system is verified based on experimental results.

Low Voltage Electrowetting on Ferroelectric PVDF-HFP Insulator with Highly Tunable Contact Angle Range.

Science.gov (United States)

Sawane, Yogesh B; Ogale, Satishchandra B; Banpurkar, Arun G

2016-09-14

We demonstrate a consistent electrowetting response on ferroelectric poly(vinylidene fluoride-co-hexafluoropropylene) (PVDF-HFP) insulator covered with a thin Teflon AF layer. This bilayer exhibits a factor of 3 enhancement in the contact angle modulation compared to that of conventional single-layered Teflon AF dielectric. On the basis of the proposed model the enhancement is attributed to the high value of effective dielectric constant (εeff ≈ 6) of the bilayer. Furthermore, the bilayer dielectric exhibits a hysteresis-free contact angle modulation over many AC voltage cycles. But the contact angle modulation for DC voltage shows a hysteresis because of the field-induced residual polarization in the ferroelectric layer. Finally, we show that a thin bilayer exhibits contact angle modulation of Δθ (U) ≈ 60° at merely 15 V amplitude of AC voltage indicating a potential dielectric for practical low voltage electrowetting applications. A proof of concept confirms electrowetting based rapid mixing of a fluorescent dye in aqueous glycerol solution for 15 V AC signal.

A large dynamic range radiation tolerant analog memory in a quarter micron CMOS technology

CERN Document Server

Anelli, G; Rivetti, A

2000-01-01

A 8*128 cell analog memory prototype has been designed in a commercial 0.25 jam CMOS process. The aim of this work was to investigate the possibility of designing large dynamic range mixed- mode switched capacitor circuits for High-Energy Physics (HEP) applications in deep submicron CMOS technologies. Special layout techniques have been used to make the circuit radiation tolerant left bracket 1 right bracket . The memory cells employ gate-oxide capacitors for storage, allowing for a very high density. A voltage write - voltage read architecture has been chosen to minimize the sensitivity to absolute capacitor values. The measured input voltage range is 2.3 V (V//D//D = 2.5 V), with a linearity of at least 7.5 bits over 2 V. The dynamic range is more than 11 bits. The pedestal variation is plus or minus 0.5 mV peak-to-peak. The noise measured, which is dominated by the noise of the measurement setup, is around 0.8 mV rms. The characteristics of the memory have been measured before irradiation and after lOMrd (...

Non-linear leak currents affect mammalian neuron physiology

Directory of Open Access Journals (Sweden)

Shiwei eHuang

2015-11-01

Full Text Available In their seminal works on squid giant axons, Hodgkin and Huxley approximated the membrane leak current as Ohmic, i.e. linear, since in their preparation, sub-threshold current rectification due to the influence of ionic concentration is negligible. Most studies on mammalian neurons have made the same, largely untested, assumption. Here we show that the membrane time constant and input resistance of mammalian neurons (when other major voltage-sensitive and ligand-gated ionic currents are discounted varies non-linearly with membrane voltage, following the prediction of a Goldman-Hodgkin-Katz-based passive membrane model. The model predicts that under such conditions, the time constant/input resistance-voltage relationship will linearize if the concentration differences across the cell membrane are reduced. These properties were observed in patch-clamp recordings of cerebellar Purkinje neurons (in the presence of pharmacological blockers of other background ionic currents and were more prominent in the sub-threshold region of the membrane potential. Model simulations showed that the non-linear leak affects voltage-clamp recordings and reduces temporal summation of excitatory synaptic input. Together, our results demonstrate the importance of trans-membrane ionic concentration in defining the functional properties of the passive membrane in mammalian neurons as well as other excitable cells.

Low Voltage Ride-Through of Two-Stage Grid-Connected Photovoltaic Systems Through the Inherent Linear Power-Voltage Characteristic

DEFF Research Database (Denmark)

Yang, Yongheng; Sangwongwanich, Ariya; Liu, Hongpeng

2017-01-01

In this paper, a cost-effective control scheme for two-stage grid-connected PhotoVoltaic (PV) systems in Low Voltage Ride-Through (LVRT) operation is proposed. In the case of LVRT, the active power injection by PV panels should be limited to prevent from inverter over-current and also energy...... aggregation at the dc-link, which will challenge the dc-link capacitor lifetime if remains uncontrolled. At the same time, reactive currents should be injected upon any demand imposed by the system operators. In the proposed scheme, the two objectives can be feasibly achieved. The active power is regulated...... point tracking controller without significant hardware or software modifications. In this way, the PV system will not operate at the maximum power point, whereas the inverter will not face any over-current challenge but can provide reactive power support in response to the grid voltage fault...

Optimal condition of memristance enhancement circuit using external voltage source

Directory of Open Access Journals (Sweden)

Hiroya Tanaka

2014-05-01

Full Text Available Memristor provides nonlinear response in the current-voltage characteristic and the memristance is modulated using an external voltage source. We point out by solving nonlinear equations that an optimal condition of the external voltage source exists for maximizing the memristance in such modulation scheme. We introduce a linear function to describe the nonlinear time response and derive an important design guideline; a constant ratio of the frequency to the amplitude of the external voltage source maximizes the memristance. The analysis completely accounts for the memristance behavior.

Linearity of bulk-controlled inverter ring VCO in weak and strong inversion

DEFF Research Database (Denmark)

Wismar, Ulrik Sørensen; Wisland, D.; Andreani, Pietro

2007-01-01

In this paper linearity of frequency modulation in voltage controlled inverter ring oscillators for non feedback sigma delta converter applications is studied. The linearity is studied through theoretical models of the oscillator operating at supply voltages above and below the threshold voltage......, process variations and temperature variations have also been simulated to indicate the advantages of having the soft rail bias transistor in the VCO....

A CMOS frontend chip for implantable neural recording with wide voltage supply range

Science.gov (United States)

Jialin, Liu; Xu, Zhang; Xiaohui, Hu; Yatao, Guo; Peng, Li; Ming, Liu; Bin, Li; Hongda, Chen

2015-10-01

A design for a CMOS frontend integrated circuit (chip) for neural signal acquisition working at wide voltage supply range is presented in this paper. The chip consists of a preamplifier, a serial instrumental amplifier (IA) and a cyclic analog-to-digital converter (CADC). The capacitive-coupled and capacitive-feedback topology combined with MOS-bipolar pseudo-resistor element is adopted in the preamplifier to create a -3 dB upper cut-off frequency less than 1 Hz without using a ponderous discrete device. A dual-amplifier instrumental amplifier is used to provide a low output impedance interface for ADC as well as to boost the gain. The preamplifier and the serial instrumental amplifier together provide a midband gain of 45.8 dB and have an input-referred noise of 6.7 μVrms integrated from 1 Hz to 5 kHz. The ADC digitizes the amplified signal at 12-bits precision with a highest sampling rate of 130 kS/s. The measured effective number of bits (ENOB) of the ADC is 8.7 bits. The entire circuit draws 165 to 216 μA current from the supply voltage varied from 1.34 to 3.3 V. The prototype chip is fabricated in the 0.18-μm CMOS process and occupies an area of 1.23 mm2 (including pads). In-vitro recording was successfully carried out by the proposed frontend chip. Project supported by the National Natural Science Foundation of China (Nos. 61474107, 61372060, 61335010, 61275200, 61178051) and the Key Program of the Chinese Academy of Sciences (No. KJZD-EW-L11-01).

Vivitron 1995, transient voltage simulation, high voltage insulator tests, electric field calculation

International Nuclear Information System (INIS)

Frick, G.; Osswald, F.; Heusch, B.

1996-01-01

Preliminary investigations showed clearly that, because of the discrete electrode structure of the Vivitron, important overvoltage leading to insulator damage can appear in case of a spark. The first high voltage tests showed damage connected with such events. This fact leads to a severe voltage limitation. This work describes, at first, studies made to understand the effects of transients and the associated over-voltage appearing in the Vivitron. Then we present the high voltage tests made with full size Vivitron components using the CN 6 MV machine as a pilot machine. Extensive field calculations were made. These involve simulations of static stresses and transient overvoltages, on insulating boards and electrodes. This work gave us the solutions for arrangements and modifications in the machine. After application, the Vivitron runs now without any sparks and damage at 20 MV. In the same manner, we tested column insulators of a new design and so we will find out how to get to higher voltages. Electric field calculation around the tie bars connecting the discrete electrodes together showed field enhancements when the voltages applied on the discrete electrodes are not equally distributed. This fact is one of the sources of discharges and voltage limitations. A scenario of a spark event is described and indications are given how to proceed towards higher voltages, in the 30 MV range. (orig.)

High-voltage integrated linear regulator with current sinking capabilities for portable ultrasound scanners

DEFF Research Database (Denmark)

Pausas, Guifre Vendrell; Llimos Muntal, Pere; Jørgensen, Ivan Harald Holger

2017-01-01

This paper presents a high-voltage integrated regulator capable of sinking current for driving pulse-triggered level shifters in drivers for ultrasound applications. The regulator utilizes a new topology with a feedback loop and a current sinking circuit to satisfy the requirements of the portable....... The proposed design has been implemented in high-voltage 0.18 μm process whithin an area of 0.11 mm2 and it is suitable for system-on-chip integration due to its low component count and the fully integrated design....

Linearity improvement on wide-range log signal of neutron measurement system for HANARO

International Nuclear Information System (INIS)

Kim, Young-Ki; Tuetken, Jeffrey S.

1998-01-01

This paper discusses engineering activities for improving the linearity characteristics of the Log Power signal from the neutron measurement system for HANARO. This neutron measurement system uses a fission chamber based detector which covers 10.3 decade-wide range from 10 -8 % full power(FP) up to 200%FP, The Log Power signal is designed to control the reactor at low power levels where most of the reactor physics tests are carried out. Therefore, the linearity characteristics of the Log Power signal is the major factor for accurate reactor power control. During the commissioning of the neutron measurement system, it was found that the linearity characteristics of the Log Power signal, especially near 10 -2 %FP, were not accurate enough for controlling the reactor during physics testing. Analysis of the system linearity data directly measured with reactor operating determined that the system was not operating per the design characteristics established from previous installations. The linearity data, which were taken as the reactor was increased in power, were sent to manufacturer's engineering group and a follow-up measures based on the analysis were then fed back to the field. Through step by step trouble-shooting activities, which included minor circuit modifications and alignment procedure changes, the linearity characteristics have been successfully improved and now exceed minimum performance requirements. This paper discusses the trouble-shooting techniques applied, the changes in the linearity characteristics, special circumstances in the HANARO application and the final resolution. (author)

Conservation voltage regulation (CVR) applied to energy savings by voltage-adjusting equipment through AMI

Science.gov (United States)

Lan, B.-R.; Chang, C.-A.; Huang, P.-Y.; Kuo, C.-H.; Ye, Z.-J.; Shen, B.-C.; Chen, B.-K.

2017-11-01

Conservation voltage reduction (CVR) includes peak demand reduction, energy conservation, carbon emission reduction, and electricity bill reduction. This paper analyzes the energy-reduction of Siwei Feeders with applying CVR, which are situated in Penghu region and equipped with smart meters. Furthermore, the applicable voltage reduction range for the feeders will be explored. This study will also investigate how the CVR effect and energy conservation are improved with the voltage control devices integrated. The results of this study can serve as a reference for the Taiwan Power Company to promote and implement voltage reduction and energy conservation techniques. This study is expected to enhance the energy-reduction performance of the Penghu Low Carbon Island Project.

The current-voltage relation of a pore and its asymptotic behavior in a Nernst-Planck model

Directory of Open Access Journals (Sweden)

Marius Birlea

2012-08-01

Full Text Available A model for current-voltage nonlinearity and asymmetry is a good starting point for explaining the electrical behavior of the nanopores in synthetic or biological membranes. Using a Nernst-Planck model, we found three behaviors for the current density in a membrane's pore as a function of voltage: a quasi-ohmic, slow rising linear current at low voltages, a nonlinear current at intermediate voltages, and a non-ohmic, fast rising linear current at large voltages. The slope of the quasi-ohmic current depends mainly on the height of energy barrier inside the pore, w, through an exponential term, ew. The magnitude of the non-ohmic linear current is controlled by the potential energy gradient at the pore entrance, w/r. The current-voltage relation is asymmetric if the ion's potential energy inside the pore has an asymmetric triangular profile. The model has only two assumed parameters, the energy barrier height, w, and the relative size of the entrance region of the pore, r, which is a useful feature for fitting and interpreting experimental data.

Design and implementation of a 3-A source and sink linear regulator for bus terminators

International Nuclear Information System (INIS)

Li Yanming; Wen Changbao; Wen Limin; Mao Xiangyu

2012-01-01

According to the requirements of the bus terminal regulator, a linear regulator with 3-A source-sink current ability is presented. The use of the NMOS pass transistor and load current feedback technique enhances the system current ability and response speed. The method of adaptive zero compensation realizes loop stability over the whole load range for either source or sink loop. Furthermore, the transconductance matching technique reduces the shoot-through current through the output stage to less than 3 μA. The regulator has been fabricated with a 0.6-μm 30 V BCD process successfully, and the area size is about 1 mm 2 . With a 20 μF output capacitor, the maximum transient output-voltage variation is within 3.5% of the output voltage with load step changes of ±2 A/1 μs. At the load range of ±3 A, the variation of output voltage is less than ±15 mV.

Non-linear thermal fluctuations in a diode

NARCIS (Netherlands)

Kampen, N.G. van

As an example of non-linear noise the fluctuations in a circuit consisting of a diode and a condenser C are studied. From the master equation for this system the following results are derived. 1. (i) The equilibrium distribution of the voltage is rigorously Gaussian, the average voltage being

Voltage-assisted polymer wafer bonding

International Nuclear Information System (INIS)

Varsanik, J S; Bernstein, J J

2012-01-01

Polymer wafer bonding is a widely used process for fabrication of microfluidic devices. However, best practices for polymer bonds do not achieve sufficient bond strength for many applications. By applying a voltage to a polymer bond in a process called voltage-assisted bonding, bond strength is shown to improve dramatically for two polymers (Cytop™ and poly(methyl methacrylate)). Several experiments were performed to provide a starting point for further exploration of this technique. An optimal voltage range is experimentally observed with a reduction in bonding strength at higher voltages. Additionally, voltage-assisted bonding is shown to reduce void diameter due to bond defects. An electrostatic force model is proposed to explain the improved bond characteristics. This process can be used to improve bond strength for most polymers. (paper)

LED Current Balance Using a Variable Voltage Regulator with Low Dropout vDS Control

Directory of Open Access Journals (Sweden)

Hung-I Hsieh

2017-02-01

Full Text Available A cost-effective light-emitting diode (LED current balance strategy using a variable voltage regulator (VVR with low dropout vDS control is proposed. This can regulate the multiple metal-oxide-semiconductor field-effect transistors (MOSFETs of the linear current regulators (LCR, maintaining low dropout vDS on the flat vGS-characteristic curves and making all drain currents almost the same. Simple group LCRs respectively loaded with a string LED are employed to implement the theme. The voltage VVdc from a VVR is synthesized by a string LED voltage NvD, source voltage vR, and a specified low dropout vDS = VQ. The VVdc updates instantly, through the control loop of the master LCR, which means that all slave MOSFETs have almost the same biases on their flat vGS-characteristic curves. This leads to all of the string LED currents being equal to each other, producing an almost even luminance. An experimental setup with microchip control is built to verify the estimations. Experimental results show that the luminance of all of the string LEDs are almost equal to one another, with a maximum deviation below 1% during a wide dimming range, while keeping all vDS of the MOSFETs at a low dropout voltage, as expected.

Wide-range bipolar pulse conductance instrument employing current and voltage modes with sampled or integrated signal acquisition

Energy Technology Data Exchange (ETDEWEB)

Calhoun, R K; Holler, F J [Kentucky Univ., Lexington, KY (United States). Dept. of Chemistry; Geiger, jr, R F; Nieman, T A [Illinois Univ., Urbana, IL (United States). Dept. of Chemistry; Caserta, K J [Procter and Gamble Co., Cincinnati, OH (United States)

1991-11-05

An instrument for measuring solution conductance using the bipolar pulse technique is described. The instrument is capable of measuring conductances in the range of 5x10{sup -9}-10{Omega}{sup -1} with 1% accuracy or better in as little as 32 {mu}s. Accuracy of 0.001-0.01% is achievable over the range 1x10{sup -6}-1{Omega}{sup -1}. Circuitry and software are described that allow the instrument to adjust automatically the pulse height, pulse duration, excitation mode (current or voltage pulse) and data acquisition mode (sampled or integrated) to acquire data of optimum accuracy and precision. The urease-catalyzed decomposition of urea is used to illustrate the versality of the instrument, and other applications are cited. (author). 60 refs.; 7 figs.; 2 tabs.

A linear accelerator for simulated micrometeors.

Science.gov (United States)

Slattery, J. C.; Becker, D. G.; Hamermesh, B.; Roy, N. L.

1973-01-01

Review of the theory, design parameters, and construction details of a linear accelerator designed to impart meteoric velocities to charged microparticles in the 1- to 10-micron diameter range. The described linac is of the Sloan Lawrence type and, in a significant departure from conventional accelerator practice, is adapted to single particle operation by employing a square wave driving voltage with the frequency automatically adjusted from 12.5 to 125 kHz according to the variable velocity of each injected particle. Any output velocity up to about 30 km/sec can easily be selected, with a repetition rate of approximately two particles per minute.

Improved measurement linearity and precision for AMCW time-of-flight range imaging cameras.

Science.gov (United States)

Payne, Andrew D; Dorrington, Adrian A; Cree, Michael J; Carnegie, Dale A

2010-08-10

Time-of-flight range imaging systems utilizing the amplitude modulated continuous wave (AMCW) technique often suffer from measurement nonlinearity due to the presence of aliased harmonics within the amplitude modulation signals. Typically a calibration is performed to correct these errors. We demonstrate an alternative phase encoding approach that attenuates the harmonics during the sampling process, thereby improving measurement linearity in the raw measurements. This mitigates the need to measure the system's response or calibrate for environmental changes. In conjunction with improved linearity, we demonstrate that measurement precision can also be increased by reducing the duty cycle of the amplitude modulated illumination source (while maintaining overall illumination power).

Power supply and stabilization of the supply system on board using decentralized voltage rectifiers

Energy Technology Data Exchange (ETDEWEB)

Grueb, W; Wegerer, K

1987-04-01

The functionally redundant power supply system of the Transrapid 06 II maglev train is described; it comprises four independent, battery-buffered networks and 30 linear generators per train section. Voltage rectifiers adapt the velocity- and load-dependent linear generator voltage to the 440 V d.c. networks and assure dynamic stabilisation as well as buffer battery loading. The result is a high-reliability power supply system on board with optimum utilisation of the power supplied by the linear generators while the train is running.

Piezoelectric self sensing actuators for high voltage excitation

International Nuclear Information System (INIS)

Grasso, E; Totaro, N; Janocha, H; Naso, D

2013-01-01

Self sensing techniques allow the use of a piezoelectric transducer simultaneously as an actuator and as a sensor. Such techniques are based on knowledge of the transducer behaviour and on measurements of electrical quantities, in particular voltage and charge. Past research work has mainly considered the linear behaviour of piezoelectric transducers, consequently restricting the operating driving voltages to low values. In this work a new self sensing technique is proposed which is able to perform self sensing reconstruction both at low and at high driving voltages. This technique, in fact, makes use of a hysteretic model to describe the nonlinear piezoelectric capacitance necessary for self sensing reconstruction. The capacitance can be measured and identified at the antiresonances of a vibrating structure with a good approximation. After providing a mathematical background to deal with the main aspects of self sensing, this technique is compared theoretically and experimentally to a typical linear one by using an aluminum plate with one bonded self sensing transducer and a positive position feedback (PPF) controller to verify the performance in self sensing based vibration control. (paper)

Optimized Controller Design for a 12-Pulse Voltage Source Converter Based HVDC System

Science.gov (United States)

Agarwal, Ruchi; Singh, Sanjeev

2017-12-01

The paper proposes an optimized controller design scheme for power quality improvement in 12-pulse voltage source converter based high voltage direct current system. The proposed scheme is hybrid combination of golden section search and successive linear search method. The paper aims at reduction of current sensor and optimization of controller. The voltage and current controller parameters are selected for optimization due to its impact on power quality. The proposed algorithm for controller optimizes the objective function which is composed of current harmonic distortion, power factor, and DC voltage ripples. The detailed designs and modeling of the complete system are discussed and its simulation is carried out in MATLAB-Simulink environment. The obtained results are presented to demonstrate the effectiveness of the proposed scheme under different transient conditions such as load perturbation, non-linear load condition, voltage sag condition, and tapped load fault under one phase open condition at both points-of-common coupling.

Non-linear dielectric spectroscopy of microbiological suspensions

Science.gov (United States)

Treo, Ernesto F; Felice, Carmelo J

2009-01-01

Background Non-linear dielectric spectroscopy (NLDS) of microorganism was characterized by the generation of harmonics in the polarization current when a microorganism suspension was exposed to a sinusoidal electric field. The biological nonlinear response initially described was not well verified by other authors and the results were susceptible to ambiguous interpretation. In this paper NLDS was performed to yeast suspension in tripolar and tetrapolar configuration with a recently developed analyzer. Methods Tripolar analysis was carried out by applying sinusoidal voltages up to 1 V at the electrode interface. Tetrapolar analysis was carried on with sinusoidal field strengths from 0.1 V cm-1 to 70 V cm-1. Both analyses were performed within a frequency range from 1 Hz through 100 Hz. The harmonic amplitudes were Fourier-analyzed and expressed in dB. The third harmonic, as reported previously, was investigated. Statistical analysis (ANOVA) was used to test the effect of inhibitor an activator of the plasma membrane enzyme in the measured response. Results No significant non-linearities were observed in tetrapolar analysis, and no observable changes occurred when inhibitor and activator were added to the suspension. Statistical analysis confirmed these results. When a pure sinus voltage was applied to an electrode-yeast suspension interface, variations higher than 25 dB for the 3rd harmonic were observed. Variation higher than 20 dB in the 3rd harmonics has also been found when adding an inhibitor or activator of the membrane-bounded enzymes. These variations did not occur when the suspension was boiled. Discussion The lack of result in tetrapolar cells suggest that there is no, if any, harmonic generation in microbiological bulk suspension. The non-linear response observed was originated in the electrode-electrolyte interface. The frequency and voltage windows observed in previous tetrapolar analysis were repeated in the tripolar measurements, but maximum were not

Non-linear dielectric spectroscopy of microbiological suspensions

Directory of Open Access Journals (Sweden)

Felice Carmelo J

2009-09-01

Full Text Available Abstract Background Non-linear dielectric spectroscopy (NLDS of microorganism was characterized by the generation of harmonics in the polarization current when a microorganism suspension was exposed to a sinusoidal electric field. The biological nonlinear response initially described was not well verified by other authors and the results were susceptible to ambiguous interpretation. In this paper NLDS was performed to yeast suspension in tripolar and tetrapolar configuration with a recently developed analyzer. Methods Tripolar analysis was carried out by applying sinusoidal voltages up to 1 V at the electrode interface. Tetrapolar analysis was carried on with sinusoidal field strengths from 0.1 V cm-1 to 70 V cm-1. Both analyses were performed within a frequency range from 1 Hz through 100 Hz. The harmonic amplitudes were Fourier-analyzed and expressed in dB. The third harmonic, as reported previously, was investigated. Statistical analysis (ANOVA was used to test the effect of inhibitor an activator of the plasma membrane enzyme in the measured response. Results No significant non-linearities were observed in tetrapolar analysis, and no observable changes occurred when inhibitor and activator were added to the suspension. Statistical analysis confirmed these results. When a pure sinus voltage was applied to an electrode-yeast suspension interface, variations higher than 25 dB for the 3rd harmonic were observed. Variation higher than 20 dB in the 3rd harmonics has also been found when adding an inhibitor or activator of the membrane-bounded enzymes. These variations did not occur when the suspension was boiled. Discussion The lack of result in tetrapolar cells suggest that there is no, if any, harmonic generation in microbiological bulk suspension. The non-linear response observed was originated in the electrode-electrolyte interface. The frequency and voltage windows observed in previous tetrapolar analysis were repeated in the tripolar

A Voltage Modulated DPC Approach for Three-Phase PWM Rectifier

DEFF Research Database (Denmark)

Gui, Yonghao; Li, Mingshen; Lu, Jinghang

2018-01-01

In this paper, a voltage modulated direct power control for three-phase pulse-width modulated rectifier is proposed. With the suggested method, the differential equations describing the rectifier dynamics are changing from a linear time-varying system into a linear time-invariant one. In this way...

Research into the Effect of Supercapacitor Terminal Voltage on Regenerative Suspension Energy-Regeneration and Dynamic Performance

Directory of Open Access Journals (Sweden)

Ruochen Wang

2017-01-01

Full Text Available To study the effect of supercapacitor initial terminal voltage on the regenerative and semiactive suspension energy-regeneration and dynamic performance, firstly, the relationship between supercapacitor terminal voltage and linear motor electromagnetic damping force and that between supercapacitor terminal voltage and recycled energy by the supercapacitor in one single switching period were both analyzed. The result shows that the linear motor electromagnetic damping force is irrelevant to the supercapacitor terminal voltage, and the recycled energy by the supercapacitor reaches the maximum when initial terminal voltage of the supercapacitor equals output terminal voltage of the linear motor. Then, performances of system dynamics and energy-regeneration were studied as the supercapacitor initial terminal voltage varied in situations of B level and C level road. The result showed that recycled energy by the supercapacitor increased at first and then decreased while the dynamic performance had no obvious change. On the basis of previous study, a mode-switching control strategy of supercapacitor for the regenerative and semiactive suspension system was proposed, and the mode-switching rule was built. According to simulation and experiment results, the system energy-regeneration efficiency can be increased by utilizing the control strategy without influencing suspension dynamic performance, which is highly valuable to practical engineering.

Wide Range Portable Radiation Survey Meter for Emergency Monitoring

Energy Technology Data Exchange (ETDEWEB)

Gangadharan, P.; Bhave, D. G.; Gokarn, R. S.; Khadake, R. G. [Directorate Of Radiation Protection, Bhabha Atomic Research Centre, Trombay, Bombay (India)

1969-05-15

The paper describes a portable battery-operated radiation survey meter for monitoring a wide range of X- and gamma-ray exposure rates from 1 mR/h to 100 R/h. The instrument Incorporates a halogen GM tube as the detector and a count-rate meter for indication. A transistorized d.c. -d.c. converter supplies the necessary high voltage to the GM counter. The instrument response has been made energy independent in the energy range 80 keV to 1.25 MeV. Further, the response is linear over the entire range of exposure rates. Suitable extension rods have been designed to provide sufficient separation between the probe and the meter in cases where remote monitoring is necessary because of high fields. (author)

The pulse-driven AC Josephson voltage normal

International Nuclear Information System (INIS)

Kieler, Oliver

2016-01-01

In this contribution quantum precise alternating-voltage sources are presented, which make the generation of arbitrary wave forms with highest spectral purity with a high bandwidth from DC up to the MHz range possible. Heartpiece of these Josephson voltage normals is a serial circuit of many thousand Josephson contacts, which make by irradiation with high-frequency radiation (microwaves) the generation of highly precise voltage values possible. Thereby in the current-voltage characteristics stages of constant voltage, so called Shapiro stages, occur. Illustratively these stages can be described by the transfer of a certain number of flux quanta through the Josephson contacts.

Simulation study on single event burnout in linear doping buffer layer engineered power VDMOSFET

International Nuclear Information System (INIS)

Jia Yunpeng; Su Hongyuan; Hu Dongqing; Wu Yu; Jin Rui

2016-01-01

The addition of a buffer layer can improve the device's secondary breakdown voltage, thus, improving the single event burnout (SEB) threshold voltage. In this paper, an N type linear doping buffer layer is proposed. According to quasi-stationary avalanche simulation and heavy ion beam simulation, the results show that an optimized linear doping buffer layer is critical. As SEB is induced by heavy ions impacting, the electric field of an optimized linear doping buffer device is much lower than that with an optimized constant doping buffer layer at a given buffer layer thickness and the same biasing voltages. Secondary breakdown voltage and the parasitic bipolar turn-on current are much higher than those with the optimized constant doping buffer layer. So the linear buffer layer is more advantageous to improving the device's SEB performance. (paper)

Non-sparking anodization process of AZ91D magnesium alloy under low AC voltage

International Nuclear Information System (INIS)

Li, Weiping; Li, Wen; Zhu, Liqun; Liu, Huicong; Wang, Xiaofang

2013-01-01

Highlights: ► Four different processes appear on magnesium alloys with applied voltage increase. ► Non-sparking film formation process occurred in the range of 6–10 V AC. ► The film was composed of Mg 2 SiO 4 with a stable growth rate in 30 min. ► Film growth was a balance of electrochemical dissolution and chemical deposition. -- Abstract: Anodization is widely recognized as one of the most important surface treatments for magnesium alloys. However, since high voltage oxidation films are limited in some applications due to porosity and brittleness, it is worthwhile to explore the non-sparking oxidizing process. In this work, AZ91D was electrochemically anodized at different AC voltages in an electrolyte containing 120 g/L NaOH and 80 g/L Na 2 SiO 3 ·9H 2 O. The effects of voltage on the surface morphology, composition and reaction process, especially the non-sparking discharge anodic film formation process, were investigated. The results showed that four different processes would appear according to the applied voltage variation from 6 V to 40 V, and that the non-sparking film formation process occurred in the range of 6–10 V. The film formed on the AZ91D surface under 10 V AC was mainly composed of Mg 2 SiO 4 with a lamellar structure. The horizontal and vertical expansion of the lamellar structure resulted in the formation of a multi-layered structure with a stable, linear growth rate for 30 min. The non-sparking film formation process can be considered to be the result of a balance of electrochemical dissolution and chemical deposition reaction

Third-Order Elliptic Lowpass Filter for Multi-Standard Baseband Chain Using Highly Linear Digitally Programmable OTA

Science.gov (United States)

Elamien, Mohamed B.; Mahmoud, Soliman A.

2018-03-01

In this paper, a third-order elliptic lowpass filter is designed using highly linear digital programmable balanced OTA. The filter exhibits a cutoff frequency tuning range from 2.2 MHz to 7.1 MHz, thus, it covers W-CDMA, UMTS, and DVB-H standards. The programmability concept in the filter is achieved by using digitally programmable operational transconductors amplifier (DPOTA). The DPOTA employs three linearization techniques which are the source degeneration, double differential pair and the adaptive biasing. Two current division networks (CDNs) are used to control the value of the transconductance. For the DPOTA, the third-order harmonic distortion (HD3) remains below -65 dB up to 0.4 V differential input voltage at 1.2 V supply voltage. The DPOTA and the filter are designed and simulated in 90 nm CMOS technology with LTspice simulator.

The study, design and simulation of a free piston Stirling engine linear alternatorThe study, design and simulation of a free piston Stirling engine linear alternator

Directory of Open Access Journals (Sweden)

Teodora Susana Oros

2014-12-01

Full Text Available This paper presents a study, design and simulation of a Free Piston Stirling Engine Linear Alternator. There are presented the main steps of the magnetic and electric calculations for a permanent magnet linear alternator of fixed coil and moving magnets type. Finally, a detailed thermal, mechanical and electrical model for a Stirling engine linear alternator have been made in SIMULINK simulation program. The linear alternator simulation model uses a controllable DC voltage which simulates the linear alternator combined with a rectifier, a variable load and a DC-DC converter, which compensates for the variable nature of Stirling engine operation, and ensures a constant voltage output regardless of the load.

Analysis of the device characteristics of AlGaN/GaN HEMTs over a wide temperature range

International Nuclear Information System (INIS)

Zhao, M.; Liu, X.Y.; Zheng, Y.K.; Li, Yankui; Ouyang, Sihua

2013-01-01

Highlights: ► We report the behavior of the current–voltage characteristics of AlGaN/GaN HEMT in the temperature range of 223–398 K. ► The origin of the leakage current and the current transport behaviors are reported. ► There is a linear relationship between the barrier height and the ideality factor, which is attributed to barrier height in homogeneities. -- Abstract: In this study, we investigate the behavior of the current–voltage (I–V) characteristics of AlGaN/GaN HEMT in the temperature range of 223–398 K. Temperature dependent device characteristics and the current transport mechanism are reported. It is observed that the Schottky barrier height Φ increases and the ideality factor n decreases with temperature. There is a linear relationship between the barrier height and the ideality factor, which is attributed to barrier height inhomogeneities of AlGaN/GaN HEMT. The estimated values of the series resistances (R s ) are in the range of 144.2 Ω at 223 K to 74.3 Ω at 398 K. The Φ, n, R s , G m and Schottky leakage current values are seen to be strongly temperature dependent

Synchronised Voltage Space Vector Modulation for Three-level Inverters with Common-mode Voltage Elimination

DEFF Research Database (Denmark)

Oleschuk, Valentin; Blaabjerg, Frede

2002-01-01

A novel method of direct synchronous pulse-width modulation (PWM) is disseminated to three-level voltage source inverters with control algorithms with elimination of the common-mode voltages in three-phase drive systems with PWM. It provides smooth pulses-ratio changing and a quarter-wave symmetry...... of the voltage waveforms during the whole control range including overmodulation. Continuous, discontinuous and "direct-direct" schemes of synchronous PWM with both algebraic and trigonometric control functions have been analysed and compared. Simulations give the behaviour of the proposed methods and show some...... advantages of synchronous PWM in comparison with asynchronous at low ratios between the switching frequency and fundamental frequency....

Improved detection of electrical activity with a voltage probe based on a voltage-sensing phosphatase.

Science.gov (United States)

Tsutsui, Hidekazu; Jinno, Yuka; Tomita, Akiko; Niino, Yusuke; Yamada, Yoshiyuki; Mikoshiba, Katsuhiko; Miyawaki, Atsushi; Okamura, Yasushi

2013-09-15

  One of the most awaited techniques in modern physiology is the sensitive detection of spatiotemporal electrical activity in a complex network of excitable cells. The use of genetically encoded voltage probes has been expected to enable such analysis. However, in spite of recent progress, existing probes still suffer from low signal amplitude and/or kinetics too slow to detect fast electrical activity. Here, we have developed an improved voltage probe named Mermaid2, which is based on the voltage-sensor domain of the voltage-sensing phosphatase from Ciona intestinalis and Förster energy transfer between a pair of fluorescent proteins. In mammalian cells, Mermaid2 permits ratiometric readouts of fractional changes of more than 50% over a physiologically relevant voltage range with fast kinetics, and it was used to follow a train of action potentials at frequencies of up to 150 Hz. Mermaid2 was also able to detect single action potentials and subthreshold voltage responses in hippocampal neurons in vitro, in addition to cortical electrical activity evoked by sound stimuli in single trials in living mice.

Long-range correlation in synchronization and syncopation tapping: a linear phase correction model.

Directory of Open Access Journals (Sweden)

Didier Delignières

Full Text Available We propose in this paper a model for accounting for the increase in long-range correlations observed in asynchrony series in syncopation tapping, as compared with synchronization tapping. Our model is an extension of the linear phase correction model for synchronization tapping. We suppose that the timekeeper represents a fractal source in the system, and that a process of estimation of the half-period of the metronome, obeying a random-walk dynamics, combines with the linear phase correction process. Comparing experimental and simulated series, we show that our model allows accounting for the experimentally observed pattern of serial dependence. This model complete previous modeling solutions proposed for self-paced and synchronization tapping, for a unifying framework of event-based timing.

Voltage effect in PTCR ceramics: Calculation by the method of tilted energy band

International Nuclear Information System (INIS)

Fang Chao; Zhou Dongxiang; Gong Shuping

2010-01-01

A numerical model for the calculation of the electrical characteristics of donor-doped BaTiO 3 semiconducting ceramics is suggested. This paper established a differential equation about electron level on the base of Poisson equation, and solved the equation with Runge-Kutta method. Under extra electric field, electrical characteristics have been calculated by the method of tilted energy band. We have quantitatively computed the positive temperature coefficient of resistivity (PTCR) behavior of donor-doped BaTiO 3 semiconducting ceramics and its voltage effect, and further obtained non-linear current-voltage characteristics with different grain sizes at different temperature. The results pointed out that the resistance jumping is reduced with increasing electric field applied; current and voltage relation follows Ohm's law below Curie temperature, and exhibits strong non-linear above Curie temperature; the non-linear coefficient shows a maximum value at temperature the resistivity reaches maximum and with grain size closed to depletion region width. The results are compared with experimental data.

Calculation of elastic-plastic strain ranges for fatigue analysis based on linear elastic stresses

International Nuclear Information System (INIS)

Sauer, G.

1998-01-01

Fatigue analysis requires that the maximum strain ranges be known. These strain ranges are generally computed from linear elastic analysis. The elastic strain ranges are enhanced by a factor K e to obtain the total elastic-plastic strain range. The reliability of the fatigue analysis depends on the quality of this factor. Formulae for calculating the K e factor are proposed. A beam is introduced as a computational model for determining the elastic-plastic strains. The beam is loaded by the elastic stresses of the real structure. The elastic-plastic strains of the beam are compared with the beam's elastic strains. This comparison furnishes explicit expressions for the K e factor. The K e factor is tested by means of seven examples. (orig.)

Charge carrier dynamics investigation of CuInS{sub 2} quantum dots films using injected charge extraction by linearly increasing voltage (i-CELIV): the role of ZnS Shell

Energy Technology Data Exchange (ETDEWEB)

Bi, Ke; Sui, Ning; Zhang, Liquan; Wang, Yinghui, E-mail: yinghui-wang@outlook.com; Liu, Qinghui, E-mail: liuqinghui@jlu.edu.cn; Tan, Mingrui [Jilin University, Femtosecond Laser Laboratory, Key Laboratory of Physics and Technology for Advanced Batteries (Ministry of Education), College of Physics (China); Zhou, Qiang [Jilin University, Key Laboratory of Superhard Materials, College of Physics (China); Zhang, Hanzhuang, E-mail: zhanghz@jlu.edu.cn [Jilin University, Femtosecond Laser Laboratory, Key Laboratory of Physics and Technology for Advanced Batteries (Ministry of Education), College of Physics (China)

2016-12-15

The role of ZnS shell on the photo-physical properties within CuInS{sub 2}/ZnS quantum dots (QDs) is carefully studied in optoelectronic devices. Linearly increasing voltage technique has been employed to investigate the charge carrier dynamics of both CuInS{sub 2} and CuInS{sub 2}/ZnS QDs films. This study shows that charge carriers follow a similar behavior of monomolecular recombination in this film, with their charge transfer rate correlates to the increase of applied voltage. It turns out that the ZnS shell could affect the carrier diffusion process through depressing the trapping states and would build up a potential barrier.

Separating inverse spin Hall voltage and spin rectification voltage by inverting spin injection direction

Energy Technology Data Exchange (ETDEWEB)

Zhang, Wenxu, E-mail: xwzhang@uestc.edu.cn; Peng, Bin; Han, Fangbin; Wang, Qiuru; Zhang, Wanli [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China); Soh, Wee Tee; Ong, Chong Kim [Center for Superconducting and Magnetic Materials, Department of Physics, National University of Singapore, 2 Science Drive 3, Singapore 117551 (Singapore)

2016-03-07

We develop a method for universally resolving the important issue of separating the inverse spin Hall effect (ISHE) from the spin rectification effect (SRE) signal. This method is based on the consideration that the two effects depend on the spin injection direction: The ISHE is an odd function of the spin injection direction while the SRE is independent on it. Thus, the inversion of the spin injection direction changes the ISHE voltage signal, while the SRE voltage remains. It applies generally to analyzing the different voltage contributions without fitting them to special line shapes. This fast and simple method can be used in a wide frequency range and has the flexibility of sample preparation.

Non-sparking anodization process of AZ91D magnesium alloy under low AC voltage

Energy Technology Data Exchange (ETDEWEB)

Li, Weiping, E-mail: liweiping@buaa.edu.cn [Key Laboratory of Aerospace Materials and Performance (Ministry of Education), School of Materials Science and Engineering, Beihang University, Beijing 100191 (China); Li, Wen [AVIC Beijing Aeronautical Manufacturing Technology Research Institue, Beijing 100024 (China); Zhu, Liqun; Liu, Huicong; Wang, Xiaofang [Key Laboratory of Aerospace Materials and Performance (Ministry of Education), School of Materials Science and Engineering, Beihang University, Beijing 100191 (China)

2013-04-20

Highlights: ► Four different processes appear on magnesium alloys with applied voltage increase. ► Non-sparking film formation process occurred in the range of 6–10 V AC. ► The film was composed of Mg{sub 2}SiO{sub 4} with a stable growth rate in 30 min. ► Film growth was a balance of electrochemical dissolution and chemical deposition. -- Abstract: Anodization is widely recognized as one of the most important surface treatments for magnesium alloys. However, since high voltage oxidation films are limited in some applications due to porosity and brittleness, it is worthwhile to explore the non-sparking oxidizing process. In this work, AZ91D was electrochemically anodized at different AC voltages in an electrolyte containing 120 g/L NaOH and 80 g/L Na{sub 2}SiO{sub 3}·9H{sub 2}O. The effects of voltage on the surface morphology, composition and reaction process, especially the non-sparking discharge anodic film formation process, were investigated. The results showed that four different processes would appear according to the applied voltage variation from 6 V to 40 V, and that the non-sparking film formation process occurred in the range of 6–10 V. The film formed on the AZ91D surface under 10 V AC was mainly composed of Mg{sub 2}SiO{sub 4} with a lamellar structure. The horizontal and vertical expansion of the lamellar structure resulted in the formation of a multi-layered structure with a stable, linear growth rate for 30 min. The non-sparking film formation process can be considered to be the result of a balance of electrochemical dissolution and chemical deposition reaction.

Performance improvement of a slip energy recovery drive system by a voltage-controlled technique

Energy Technology Data Exchange (ETDEWEB)

Tunyasrirut, Satean [Department of Instrumentation Engineering, Faculty of Engineering, Pathumwan Institute of Technology, 833 Rama1 Road, Pathumwan, Bangkok 10330 (Thailand); Kinnares, Vijit [Department of Electrical Engineering, Faculty of Engineering, King Mongkut' s Institute of Technology Ladkrabang, Bangkok 10520 (Thailand); Ngamwiwit, Jongkol [Department of Control Engineering, Faculty of Engineering, King Mongkut' s Institute of Technology Ladkrabang, Bangkok 10520 (Thailand)

2010-10-15

This paper introduces the performance improvement of a slip energy recovery drive system for the speed control of a wound rotor induction motor by a voltage-controlled technique. The slip energy occurred in the rotor circuit is transferred back to ac mains supply through a reactor instead of a step up transformer. The objective of the voltage-controlled technique is to increase power factor of the system and to reduce low order harmonics of the input line current. The drive system is designed and implemented using a voltage source inverter in conjunction with a boost chopper for DC link voltage, instead of a conventional drive using a 6 pulse converter or a Scherbius system. The slip power is recovered by the help of a voltage source inverter (VSI) based on a space vector pulse width modulation (SVPWM) technique. In order to keep the speed of the wound rotor induction motor constant over a certain range of operating conditions, the servo state feedback controller designed by a linear quadratic regulator (LQR) is also introduced in this paper. The overall control system is implemented on DSP, DS1104'TMS320F240 controller board. The performance improvement of the proposed system is tested in comparison with the conventional Scherbius system and the modified conventional Scherbius system by a 12 pulse converter in conjunction with a chopper at steady state and at dynamic conditions. A 220 W wound motor is employed for testing. It is found that the motor speed can be controlled to be constant in the operating range of 450-1200 rpm at no load and full load. It is also found that the efficiency of the proposed system is remarkably increased since the harmonics of the input ac line current is reduced while the ac line input power factor is increased. (author)

A double B1-mode 4-layer laminated piezoelectric linear motor.

Science.gov (United States)

Li, Xiaotian; Chen, Zhijiang; Dong, Shuxiang

2012-12-01

We report a miniature piezoelectric ultrasonic linear motor that is made of four Pb(Zr,Ti)O(3) (PZT) piezoelectric ceramic layers for low-voltage work. The 4-layer piezoelectric laminate works in two orthogonal first-bending modes for producing elliptical oscillations, which are then used to drive a contacting slider into continuous linear motion. Experimental results show that the miniature linear motor (size: 4 × 4 × 12 mm, weight: 1.7 g) can generate a large driving force of 0.48 N and a linear motion speed of up to 160 mm/s, using a 40 V(pp)/mm voltage drive at its resonance frequency of 64.5 kHz. The maximum efficiency of the linear motor is 30%.

Computation of Steady State Nodal Voltages for Fast Security Assessment in Power Systems

DEFF Research Database (Denmark)

Møller, Jakob Glarbo; Jóhannsson, Hjörtur; Østergaard, Jacob

2014-01-01

Development of a method for real-time assess-ment of post-contingency nodal voltages is introduced. Linear network theory is applied in an algorithm that utilizes Thevenin equivalent representation of power systems as seen from every voltage-controlled node in a network. The method is evaluated b...

Low-voltage analog front-end processor design for ISFET-based sensor and H+ sensing applications

Science.gov (United States)

Chung, Wen-Yaw; Yang, Chung-Huang; Peng, Kang-Chu; Yeh, M. H.

2003-04-01

This paper presents a modular-based low-voltage analog-front-end processor design in a 0.5mm double-poly double-metal CMOS technology for Ion Sensitive Field Effect Transistor (ISFET)-based sensor and H+ sensing applications. To meet the potentiometric response of the ISFET that is proportional to various H+ concentrations, the constant-voltage and constant current (CVCS) testing configuration has been used. Low-voltage design skills such as bulk-driven input pair, folded-cascode amplifier, bootstrap switch control circuits have been designed and integrated for 1.5V supply and nearly rail-to-rail analog to digital signal processing. Core modules consist of an 8-bit two-step analog-digital converter and bulk-driven pre-amplifiers have been developed in this research. The experimental results show that the proposed circuitry has an acceptable linearity to 0.1 pH-H+ sensing conversions with the buffer solution in the range of pH2 to pH12. The processor has a potential usage in battery-operated and portable healthcare devices and environmental monitoring applications.

Linear induction accelerators

International Nuclear Information System (INIS)

Briggs, R.J.

1986-06-01

The development of linear induction accelerators has been motivated by applications requiring high-pulsed currents of charged particles at voltages exceeding the capability of single-stage, diode-type accelerators and at currents too high for rf accelerators. In principle, one can accelerate charged particles to arbitrarily high voltages using a multi-stage induction machine, but the 50-MeV, 10-kA Advanced Test Accelerator (ATA) at LLNL is the highest voltage machine in existence at this time. The advent of magnetic pulse power systems makes sustained operation at high-repetition rates practical, and this capability for high-average power is very likely to open up many new applications of induction machines in the future. This paper surveys the US induction linac technology with primary emphasis on electron machines. A simplified description of how induction machines couple energy to the electron beam is given, to illustrate many of the general issues that bound the design space of induction linacs

Resistors Improve Ramp Linearity

Science.gov (United States)

Kleinberg, L. L.

1982-01-01

Simple modification to bootstrap ramp generator gives more linear output over longer sweep times. New circuit adds just two resistors, one of which is adjustable. Modification cancels nonlinearities due to variations in load on charging capacitor and due to changes in charging current as the voltage across capacitor increases.

Design of a linear neutron source

International Nuclear Information System (INIS)

Buzarbaruah, N.; Dutta, N.J.; Bhardwaz, J.K.; Mohanty, S.R.

2015-01-01

Highlights: • This paper reports the design of a linear neutron source based on inertial electrostatic confinement fusion scheme. • The voltage and current that is to be applied to the grid is computed theoretically. • Neutron production rate is theoretically estimated and found to be of the order of 10 7 –10 8 neutrons/s. • Electric potential distribution and ion trajectories are studied using SIMION code. • Optimized condition for the inner grid transparency has been found out. - Abstract: In this paper, we present the design of a linear neutron source based on the concept of inertial electrostatic confinement fusion. The source mainly comprises of a concentric coaxial cylindrical grid assembly housed inside a double walled cylindrical vacuum chamber, a gas injection system, a high voltage feedthrough and a high voltage negative polarity power supply. The inner grid will be kept at a high negative potential with respect to the outer grid that will be grounded. The effect of grid transparency on electric potential distribution and ion trajectories has been studied using SIMION. A diffuse deuterium plasma will be initially created by making filament discharge and subsequently, on application of high negative voltage to the inner grid, deuterons will be accelerated towards the axis of the device. These deuterons will oscillate in the negative potential and consequently fuse in between the grids to produce neutrons. This source is expected to produce 10 7 –10 8 neutrons/s. The proposed linear neutron source will be operated both in the continuous and pulse modes and it will be utilized for a few near term applications namely fusion reactor material studies and explosive detection

Internal friction and linear expansion coefficient in zirconium and cobalt within the range of phase transitions

International Nuclear Information System (INIS)

Boyarskij, S.V.

1986-01-01

Experimental results are presented for internal friction and linear expansion coefficient at zirconium and cobalt in the temperature range from 440 K to the point of the phase transition of the first kind (1138 K for Zr and 706 for Co). Anomalous changes of the internal friction and linear expansion coefficient in the phase transition region are found. Theoretical considerations are given to explain the sharp decrease of the internal friction as temperature approaches the phase transition point

Characteristics of output voltage and current of integrated nanogenerators

KAUST Repository

Yang, Rusen; Qin, Yong; Li, Cheng; Dai, Liming; Wang, Zhong Lin

2009-01-01

three criteria: Schottky behavior test, switching-polarity tests, and linear superposition of current and voltage tests. The 11 tests can effectively rule out the system artifacts, whose sign does not change with the switching measurement polarity

Videometrics-based Detection of Vibration Linearity in MEMS Gyroscope

Directory of Open Access Journals (Sweden)

Yong Zhou

2011-05-01

Full Text Available MEMS gyroscope performs as a sort of sensor to detect angular velocity, with diverse applications in engineering including vehicle and intelligent traffic etc. A balanced vibration of driving module excited by electrostatic driving signal is the base MEMS gyroscope's performance. In order to analyze the linear property of vibration in MEMS Gyroscope, a method of computer vision measuring is applied with the help of high-speed vidicon to obtain video of linear vibration of driving module in gyroscope, under the driving voltage signal of inherent frequency and amplitude linearly increasing. By means of image processing, target identifying, and motion parameter extracting from the obtained video, vibration curve with time variation is acquired. And then, linearity of this vibration system can be analyzed by focusing on the amplitude value of vibration responding to the amplitude variation of driving voltage signal.

Heat-pump performance: voltage dip/sag, under-voltage and over-voltage

Directory of Open Access Journals (Sweden)

William J.B. Heffernan

2014-12-01

Full Text Available Reverse cycle air-source heat-pumps are an increasingly significant load in New Zealand and in many other countries. This has raised concern over the impact wide-spread use of heat-pumps may have on the grid. The characteristics of the loads connected to the power system are changing because of heat-pumps. Their performance during under-voltage events such as voltage dips has the potential to compound the event and possibly cause voltage collapse. In this study, results from testing six heat-pumps are presented to assess their performance at various voltages and hence their impact on voltage stability.

A voltage to frequency converter for astronomical photometry

Science.gov (United States)

Dunham, E.; Elliot, J. L.

1978-01-01

A voltage to frequency converter (VFC) for general use with photomultipliers is described. For high light levels, when the dead-time corrections for a photon counter would be excessive, the VFC maintains a linear response and allows the recording of data at high time resolution. Results of laboratory tests are given for the signal-to-noise characteristics, linearity, stability, and transient response of the VFC when used in conjunction with EMI 9658 and RCA C31034 photomultipliers.

Nonlinear Parasitic Capacitance Modelling of High Voltage Power MOSFETs in Partial SOI Process

DEFF Research Database (Denmark)

Fan, Lin; Knott, Arnold; Jørgensen, Ivan Harald Holger

2016-01-01

: off-state, sub-threshold region, and on-state in the linear region. A high voltage power MOSFET is designed in a partial Silicon on Insulator (SOI) process, with the bulk as a separate terminal. 3D plots and contour plots of the capacitances versus bias voltages for the transistor summarize...

Optimal dynamic voltage scaling for wireless sensor nodes with real-time constraints

Science.gov (United States)

Cassandras, Christos G.; Zhuang, Shixin

2005-11-01

Sensors are increasingly embedded in manufacturing systems and wirelessly networked to monitor and manage operations ranging from process and inventory control to tracking equipment and even post-manufacturing product monitoring. In building such sensor networks, a critical issue is the limited and hard to replenish energy in the devices involved. Dynamic voltage scaling is a technique that controls the operating voltage of a processor to provide desired performance while conserving energy and prolonging the overall network's lifetime. We consider such power-limited devices processing time-critical tasks which are non-preemptive, aperiodic and have uncertain arrival times. We treat voltage scaling as a dynamic optimization problem whose objective is to minimize energy consumption subject to hard or soft real-time execution constraints. In the case of hard constraints, we build on prior work (which engages a voltage scaling controller at task completion times) by developing an intra-task controller that acts at all arrival times of incoming tasks. We show that this optimization problem can be decomposed into two simpler ones whose solution leads to an algorithm that does not actually require solving any nonlinear programming problems. In the case of soft constraints, this decomposition must be partly relaxed, but it still leads to a scalable (linear in the number of tasks) algorithm. Simulation results are provided to illustrate performance improvements in systems with intra-task controllers compared to uncontrolled systems or those using inter-task control.

Mitigation of Unbalanced Voltage Sags and Voltage Unbalance in CIGRE Low Voltage Distribution Network

DEFF Research Database (Denmark)

Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

2013-01-01

Any problem with voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM) etc. can be used to mitigate the voltage problems in the distribution system...... to unbalanced faults. The compensation of unbalanced voltage sags and voltage unbalance in the CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0........ The voltage problems dealt with in this paper are to show how to mitigate unbalanced voltage sags and voltage unbalance in the CIGRE Low Voltage (LV) test network and net-works like this. The voltage unbalances, for the tested cases in the CIGRE LV test network are mainly due to single phase loads and due...

Low Voltage Current Mode Switched-Current-Mirror Mixer

Directory of Open Access Journals (Sweden)

Chunhua Wang

2009-09-01

Full Text Available A new CMOS active mixer topology can operate at 1 V supply voltage by use of SCM (switched currentmirror. Such current-mode mixer requires less voltage headroom with good linearization. Mixing is achieved with four improved current mirrors, which are alternatively activated. For ideal switching, the operation is equivalent to a conventional active mixer. This paper analyzes the performance of the SCM mixer, in comparison with the conventional mixer, demonstrating competitive performance at a lower supply voltage. Moreover, the new mixer’s die, without any passive components, is very small, and the conversion gain is easy to adjust. An experimental prototype was designed and simulated in standard chartered 0.18μm RF CMOS Process with Spectre in Cadence Design Systems. Experimental results show satisfactory mixer performance at 2.4 GHz.

High Dynamic Range RF Front End with Noise Cancellation and Linearization for WiMAX Receivers

Directory of Open Access Journals (Sweden)

J.-M. Wu

2012-06-01

Full Text Available This research deals with verification of the high dynamic range for a heterodyne radio frequency (RF front end. A 2.6 GHz RF front end is designed and implemented in a hybrid microwave integrated circuit (HMIC for worldwide interoperability for microwave access (WiMAX receivers. The heterodyne RF front end consists of a low-noise amplifier (LNA with noise cancellation, an RF bandpass filter (BPF, a downconverter with linearization, and an intermediate frequency (IF BPF. A noise canceling technique used in the low-noise amplifier eliminates a thermal noise and then reduces the noise figure (NF of the RF front end by 0.9 dB. Use of a downconverter with diode linearizer also compensates for gain compression, which increases the input-referred third-order intercept point (IIP3 of the RF front end by 4.3 dB. The proposed method substantially increases the spurious-free dynamic range (DRf of the RF front end by 3.5 dB.

Output voltage calculations in double barrier magnetic tunnel junctions with asymmetric voltage behavior

KAUST Repository

Useinov, Arthur; Mryasov, Oleg; Kosel, Jü rgen

2011-01-01

In this paper we study the asymmetric voltage behavior (AVB) of the tunnel magnetoresistance (TMR) for single and double barrier magnetic tunnel junctions (MTJs) in range of a quasi-classical free electron model. Numerical calculations of the TMR

Cooperative Control with Virtual Selective Harmonic Capacitance for Harmonic Voltage Compensation in Islanded MicroGrids

DEFF Research Database (Denmark)

Micallef, A.; Apap, M.; Spitero-Stanies, C.

2012-01-01

This paper focuses on the islanded operation of microgrids. In this mode of operation, the microsources are required to cooperate autonomously to regulate the local grid voltage and frequency. Droop control is typically used to achieve this autonomous voltage and frequency regulation. Inverters...... having LCL output filters would cause voltage distortion to be present at the PCC of the local load when non-linear current is supplied to the load due to the voltage drop across the grid side inductor. Techniques to reduce the output voltage distortion typically consist of installing either passive...

Absolute Determination of High DC Voltages by Means of Frequency Measurement

Science.gov (United States)

Peier, Dirk; Schulz, Bernd

1983-01-01

A novel absolute measuring procedure is presented for the definition of fixed points of the voltage in the 100 kV range. The method is based on transit time measurements with accelerated electrons. By utilizing the selective interaction of a monoenergetic electron beam with the electromagnetic field of a special cavity resonator, the voltage is referred to fundamental constants and the base unit second. Possible balance voltages are indicated by a current detector. Experimental investigations are carried out with resonators in the normal conducting range. With a copper resonator operating at the temperature of boiling nitrogen (77 K), the relative uncertainty of the voltage points is estimated to be +/- 4 × 10-4. The technically realizable uncertainty can be reduced to +/- 1 × 10-5 by the proposed application of a superconducting niobium resonator. Thus this measuring device becomes suitable as a primary standard for the high-voltage range.

Simulation study on single event burnout in linear doping buffer layer engineered power VDMOSFET

Science.gov (United States)

Yunpeng, Jia; Hongyuan, Su; Rui, Jin; Dongqing, Hu; Yu, Wu

2016-02-01

The addition of a buffer layer can improve the device's secondary breakdown voltage, thus, improving the single event burnout (SEB) threshold voltage. In this paper, an N type linear doping buffer layer is proposed. According to quasi-stationary avalanche simulation and heavy ion beam simulation, the results show that an optimized linear doping buffer layer is critical. As SEB is induced by heavy ions impacting, the electric field of an optimized linear doping buffer device is much lower than that with an optimized constant doping buffer layer at a given buffer layer thickness and the same biasing voltages. Secondary breakdown voltage and the parasitic bipolar turn-on current are much higher than those with the optimized constant doping buffer layer. So the linear buffer layer is more advantageous to improving the device's SEB performance. Project supported by the National Natural Science Foundation of China (No. 61176071), the Doctoral Fund of Ministry of Education of China (No. 20111103120016), and the Science and Technology Program of State Grid Corporation of China (No. SGRI-WD-71-13-006).

Justifying threshold voltage definition for undoped body transistors through 'crossover point' concept

International Nuclear Information System (INIS)

Baruah, Ratul Kumar; Mahapatra, Santanu

2009-01-01

Two different definitions, one is potential based and the other is charge based, are used in the literatures to define the threshold voltage of undoped body symmetric double gate transistors. This paper, by introducing a novel concept of crossover point, proves that the charge based definition is more accurate than the potential based definition. It is shown that for a given channel length the potential based definition predicts anomalous change in threshold voltage with body thickness variation while the charge based definition results in monotonous change. The threshold voltage is then extracted from drain current versus gate voltage characteristics using linear extrapolation, transconductance and match-point methods. In all the three cases it is found that trend of threshold voltage variation support the charge based definition.

Direct model-based predictive control scheme without cost function for voltage source inverters with reduced common-mode voltage

Science.gov (United States)

Kim, Jae-Chang; Moon, Sung-Ki; Kwak, Sangshin

2018-04-01

This paper presents a direct model-based predictive control scheme for voltage source inverters (VSIs) with reduced common-mode voltages (CMVs). The developed method directly finds optimal vectors without using repetitive calculation of a cost function. To adjust output currents with the CMVs in the range of -Vdc/6 to +Vdc/6, the developed method uses voltage vectors, as finite control resources, excluding zero voltage vectors which produce the CMVs in the VSI within ±Vdc/2. In a model-based predictive control (MPC), not using zero voltage vectors increases the output current ripples and the current errors. To alleviate these problems, the developed method uses two non-zero voltage vectors in one sampling step. In addition, the voltage vectors scheduled to be used are directly selected at every sampling step once the developed method calculates the future reference voltage vector, saving the efforts of repeatedly calculating the cost function. And the two non-zero voltage vectors are optimally allocated to make the output current approach the reference current as close as possible. Thus, low CMV, rapid current-following capability and sufficient output current ripple performance are attained by the developed method. The results of a simulation and an experiment verify the effectiveness of the developed method.

A Hybrid Optimization Method for Reactive Power and Voltage Control Considering Power Loss Minimization

DEFF Research Database (Denmark)

Liu, Chengxi; Qin, Nan; Bak, Claus Leth

2015-01-01

This paper proposes a hybrid optimization method to optimally control the voltage and reactive power with minimum power loss in transmission grid. This approach is used for the Danish automatic voltage control (AVC) system which is typically a non-linear non-convex problem mixed with both...

Ultra-Low-Dropout Linear Regulator

Science.gov (United States)

Thornton, Trevor; Lepkowski, William; Wilk, Seth

2011-01-01

A radiation-tolerant, ultra-low-dropout linear regulator can operate between -150 and 150 C. Prototype components were demonstrated to be performing well after a total ionizing dose of 1 Mrad (Si). Unlike existing components, the linear regulator developed during this activity is unconditionally stable over all operating regimes without the need for an external compensation capacitor. The absence of an external capacitor reduces overall system mass/volume, increases reliability, and lowers cost. Linear regulators generate a precisely controlled voltage for electronic circuits regardless of fluctuations in the load current that the circuit draws from the regulator.

Non-linear characteristics and long-range correlations in Asian stock markets

Science.gov (United States)

Jiang, J.; Ma, K.; Cai, X.

2007-05-01

We test several non-linear characteristics of Asian stock markets, which indicates the failure of efficient market hypothesis and shows the essence of fractal of the financial markets. In addition, by using the method of detrended fluctuation analysis (DFA) to investigate the long range correlation of the volatility in the stock markets, we find that the crossover phenomena exist in the results of DFA. Further, in the region of small volatility, the scaling behavior is more complicated; in the region of large volatility, the scaling exponent is close to 0.5, which suggests the market is more efficient. All these results may indicate the possibility of characteristic multifractal scaling behaviors of the financial markets.

Voltage linearity modulation and polarity dependent conduction in metal-insulator-metal capacitors with atomic-layer-deposited Al{sub 2}O{sub 3}/ZrO{sub 2}/SiO{sub 2} nano-stacks

Energy Technology Data Exchange (ETDEWEB)

Zhu, Bao; Liu, Wen-Jun; Wei, Lei; Zhang, David Wei; Jiang, Anquan; Ding, Shi-Jin, E-mail: sjding@fudan.edu.cn [State Key Laboratory of ASIC and System, School of Microelectronics, Fudan University, Shanghai 200433 (China)

2015-07-07

Excellent voltage linearity of metal-insulator-metal (MIM) capacitors is highly required for next generation radio frequency integration circuits. In this work, employing atomic layer deposition technique, we demonstrated how the voltage linearity of MIM capacitors was modulated by adding different thickness of SiO{sub 2} layer to the nano-stack of Al{sub 2}O{sub 3}/ZrO{sub 2}. It was found that the quadratic voltage coefficient of capacitance (α) can be effectively reduced from 1279 to −75 ppm/V{sup 2} with increasing the thickness of SiO{sub 2} from zero to 4 nm, which is more powerful than increasing the thickness of ZrO{sub 2} in the Al{sub 2}O{sub 3}/ZrO{sub 2} stack. This is attributed to counteraction between the positive α for Al{sub 2}O{sub 3}/ZrO{sub 2} and the negative one for SiO{sub 2} in the MIM capacitors with Al{sub 2}O{sub 3}/ZrO{sub 2}/SiO{sub 2} stacks. Interestingly, voltage-polarity dependent conduction behaviors in the MIM capacitors were observed. For electron bottom-injection, the addition of SiO{sub 2} obviously suppressed the leakage current; however, it abnormally increased the leakage current for electron top-injection. These are ascribed to the co-existence of shallow and deep traps in ZrO{sub 2}, and the former is in favor of the field-assisted tunnelling conduction and the latter contributes to the trap-assisted tunnelling process. The above findings will be beneficial to device design and process optimization for high performance MIM capacitors.

Voltage distribution in tapered winding of tesla-transformer during discharge process of PFL

International Nuclear Information System (INIS)

Xin Jiaqi; Chang Anbi; Li Mingjia; Kang Qiang

2007-01-01

The operation principle of integral construction of Tesla transformer and PFL was investigated in Tesla-transformer-type accelerator. Experiment was carried out on Tesla transformer's secondary winding to study the impulse voltage distribution while PFL was discharging. The regularities of turn-ground voltage distribution and interturn voltage distribution were summarized. Voltage distribution within PFL was calculated and it was compared with the experimental result. Structural winding of parallel coils in the head, parallel coils in the end and shading ring were used to improve voltage distribution and that was testified by experiment. The results indicate that taper winding doesn't effect electric field within PFL, the turn-ground voltage appears linearly, the interturn voltage fluctuates seriously and it is the biggest in head of winding. The three optimized methods help to depress oscillation, the structural winding of parallel coils in the head decreases the interturn voltage in head of winding remark-ably and the parallel coils in the end decrease the interturn voltage in the end. (authors)

Flow-driven voltage generation in carbon nanotubes

Indian Academy of Sciences (India)

The flow of various liquids and gases over single-walled carbon nanotube bundles induces an electrical signal (voltage/current) in the sample along the direction of the flow. The electrical response generated by the flow of liquids is found to be logarithmic in the flow speed over a wide range. In contrast, voltage generated ...

Comparison of experimental and theoretical reaction rail currents, rail voltages, and airgap fields for the linear induction motor research vehicle

Science.gov (United States)

Elliott, D. G.

1977-01-01

Measurements of reaction rail currents, reaction rail voltages, and airgap magnetic fields in tests of the Linear Induction Motor Research Vehicle (LIMRV) were compared with theoretical calculations from the mesh/matrix theory. It was found that the rail currents and magnetic fields predicted by the theory are within 20 percent of the measured currents and fields at most motor locations in most of the runs, but differ by as much as a factor of two in some cases. The most consistent difference is a higher experimental than theoretical magnetic field near the entrance of the motor and a lower experimental than theoretical magnetic field near the exit. The observed differences between the theoretical and experimental magnetic fields and currents do not account for the differences of as much as 26 percent between the theoretical and experimental thrusts.

Study on the streamer inception characteristics under positive lightning impulse voltage

Directory of Open Access Journals (Sweden)

Zezhong Wang

2017-11-01

Full Text Available The streamer is the main process in an air gap discharge, and the inception characteristics of streamers have been widely applied in engineering. Streamer inception characteristics under DC voltage have been studied by many researchers, but the inception characteristics under impulse voltage, and particularly under lightning impulse voltage with a high voltage rise rate have rarely been studied. A measurement system based on integrated optoelectronic technology has been proposed in this paper, and the streamer inception characteristics in a 1-m-long rod-plane air gap that was energized by a positive lightning impulse voltage have been researched. We have also measured the streamer inception electric field using electrodes with different radii of curvature and different voltage rise rates. As a result, a modified empirical criterion for the streamer inception electric field that considers the voltage rise rate has been proposed, and the wide applicability of this criterion has been proved. Based on the streamer inception time-lag obtained, we determined that the field distribution obeys a Rayleigh distribution, which explains the change law of the streamer inception time-lag. The characteristic parameter of the Rayleigh distribution lies in the range from 0.6 to 2.5 when the radius of curvature of the electrode head is in the range from 0.5 cm to 2.5 cm and the voltage rise rate ranges from 80 kV/μs to 240kV/μs under positive lightning impulse voltage.

Study on the streamer inception characteristics under positive lightning impulse voltage

Science.gov (United States)

Wang, Zezhong; Geng, Yinan

2017-11-01

The streamer is the main process in an air gap discharge, and the inception characteristics of streamers have been widely applied in engineering. Streamer inception characteristics under DC voltage have been studied by many researchers, but the inception characteristics under impulse voltage, and particularly under lightning impulse voltage with a high voltage rise rate have rarely been studied. A measurement system based on integrated optoelectronic technology has been proposed in this paper, and the streamer inception characteristics in a 1-m-long rod-plane air gap that was energized by a positive lightning impulse voltage have been researched. We have also measured the streamer inception electric field using electrodes with different radii of curvature and different voltage rise rates. As a result, a modified empirical criterion for the streamer inception electric field that considers the voltage rise rate has been proposed, and the wide applicability of this criterion has been proved. Based on the streamer inception time-lag obtained, we determined that the field distribution obeys a Rayleigh distribution, which explains the change law of the streamer inception time-lag. The characteristic parameter of the Rayleigh distribution lies in the range from 0.6 to 2.5 when the radius of curvature of the electrode head is in the range from 0.5 cm to 2.5 cm and the voltage rise rate ranges from 80 kV/μs to 240kV/μs under positive lightning impulse voltage.

Atomic mean-square displacements and the critical-voltage effect in cubic solid solutions

International Nuclear Information System (INIS)

Shirley, C.G.; Fisher, R.M.

1979-01-01

The critical-voltage phenomena observed in high-voltage electron microscope images of bend contours as well as in corresponding Kikuchi or convergent-beam diffraction patterns provide sensitive methods of determining submicroscopic alloy parameters such as Debye temperatures, short-range order, and atomic scattering factors. Only a very limited number of critical voltages can be observed in metal crystals in the voltage range usually available, 100 to 1200 kV, so that quantitative interpretation of the data must be based on a few-parameter model which incorporates all the pertinent factors. A satisfactory two-parameter model has been developed which can be used to interpret or compute the critical voltages of substitutional solid solutions as functions of composition, temperature and short-range order. In the alloy systems Fe-Cr, Ni-Au, Cu-Au and Cu-Al, sufficient critical voltage data are available to derive the model parameters which pertain to atomic bonding in the lattice. In addition to atomic scattering amplitudes, the critical voltage depends strongly on the atomic mean-square displacements. The static contribution to the mean-square displacements is large in alloys with large atomic-radius disparity, and is especially sensitive to short-range order in f.c.c. solid solutions. Well-defined best estimates for the model parameters are used to predict the critical voltage and its sensitivity to composition, temperature and short-range order for a large number of solid solutions. Systems for which critical-voltage studies may be of considerable interest are indicated. (author)

Update on Linear Mode Photon Counting with the HgCdTe Linear Mode Avalanche Photodiode

Science.gov (United States)

Beck, Jeffrey D.; Kinch, Mike; Sun, Xiaoli

2014-01-01

The behavior of the gain-voltage characteristic of the mid-wavelength infrared cutoff HgCdTe linear mode avalanche photodiode (e-APD) is discussed both experimentally and theoretically as a function of the width of the multiplication region. Data are shown that demonstrate a strong dependence of the gain at a given bias voltage on the width of the n- gain region. Geometrical and fundamental theoretical models are examined to explain this behavior. The geometrical model takes into account the gain-dependent optical fill factor of the cylindrical APD. The theoretical model is based on the ballistic ionization model being developed for the HgCdTe APD. It is concluded that the fundamental theoretical explanation is the dominant effect. A model is developed that combines both the geometrical and fundamental effects. The model also takes into account the effect of the varying multiplication width in the low bias region of the gain-voltage curve. It is concluded that the lower than expected gain seen in the first 2 × 8 HgCdTe linear mode photon counting APD arrays, and higher excess noise factor, was very likely due to the larger than typical multiplication region length in the photon counting APD pixel design. The implications of these effects on device photon counting performance are discussed.

Complete low power controller for high voltage power systems

International Nuclear Information System (INIS)

Sumner, R.; Blanar, G.

1997-01-01

The MHV100 is a custom CMOS integrated circuit, developed for the AMS experiment. It provides complete control for a single channel high voltage (HV) generator and integrates all the required digital communications, D to A and A to D converters, the analog feedback loop and output drivers. This chip has been designed for use in both distributed high voltage systems or for low cost single channel high voltage systems. The output voltage and current range is determined by the external components

Expanding the linear dynamic range for quantitative liquid chromatography-high resolution mass spectrometry utilizing natural isotopologue signals

International Nuclear Information System (INIS)

Liu, Hanghui; Lam, Lily; Yan, Lin; Chi, Bert; Dasgupta, Purnendu K.

2014-01-01

Highlights: • Less abundant isotopologue ions were utilized to decrease detector saturation. • A 25–50 fold increase in the upper limit of dynamic range was demonstrated. • Linear dynamic range was expanded without compromising mass resolution. - Abstract: The linear dynamic range (LDR) for quantitative liquid chromatography–mass spectrometry can be extended until ionization saturation is reached by using a number of target isotopologue ions in addition to the normally used target ion that provides the highest sensitivity. Less abundant isotopologue ions extend the LDR: the lower ion abundance decreases the probability of ion detector saturation. Effectively the sensitivity decreases and the upper limit of the LDR increases. We show in this paper that the technique is particularly powerful with a high resolution time of flight mass spectrometer because the data for all ions are automatically acquired, and we demonstrated this for four small organic molecules; the upper limits of LDRs increased by 25–50 times

New method for determining avalanche breakdown voltage of silicon photomultipliers

International Nuclear Information System (INIS)

Chirikov-Zorin, I.

2017-01-01

The avalanche breakdown and Geiger mode of the silicon p-n junction is considered. A precise physically motivated method is proposed for determining the avalanche breakdown voltage of silicon photomultipliers (SiPM). The method is based on measuring the dependence of the relative photon detection efficiency (PDE rel ) on the bias voltage when one type of carriers (electron or hole) is injected into the avalanche multiplication zone of the p-n junction. The injection of electrons or holes from the base region of the SiPM semiconductor structure is performed using short-wave or long-wave light. At a low overvoltage (1-2 V) the detection efficiency is linearly dependent on the bias voltage; therefore, extrapolation to zero PDE rel value determines the SiPM avalanche breakdown voltage with an accuracy within a few millivolts. [ru

Selective virtual capacitive impedance loop for harmonics voltage compensation in islanded microgrids

DEFF Research Database (Denmark)

Micallef, Alexander; Apap, Maurice; Spiteri-Staines, Cyril

2013-01-01

Parallel inverters having LCL output filters cause voltage distortions at the point of common coupling (PCC) in islanded microgrids when non-linear loads are present. A capacitive virtual impedance loop could be used to provide selective harmonic compensation in islanded microgrids, instead of in...... resistance for selective harmonic compensation in islanded microgrids. Simulation results were given to show the suitability of the proposed algorithms in reducing the voltage harmonics at the PCC.......Parallel inverters having LCL output filters cause voltage distortions at the point of common coupling (PCC) in islanded microgrids when non-linear loads are present. A capacitive virtual impedance loop could be used to provide selective harmonic compensation in islanded microgrids, instead...... of introducing additional active or passive filters into the system that could compromise the stability of the microgrid. However, the performance of these compensation loops becomes degraded when a virtual resistance is introduced with the aim to improve the overall stability of the parallel inverters...

Novel ocean energy permanent magnet linear generator buoy

Energy Technology Data Exchange (ETDEWEB)

Rhinefrank, K.; Agamloh, E.B.; Jouanne, A. von; Wallace, A.K.; Prudell, J.; Kimble, K.; Aills, J.; Schmidt, E.; Schacher, A. [School of Electrical Engineering and Computer Science, Oregon State University, Corvallis, OR 97331-3211 (United States); Chan, P.; Sweeny, B. [Department of Mechanical Engineering, Oregon State University, Corvallis, OR 97331-3211 (United States)

2006-07-15

This paper describes the research, design, construction and prototype testing process of a novel ocean energy direct drive permanent magnet linear generator buoy. The buoy employs the vertical component of the motion of ocean waves to power a linear generator. The generator consists of a permanent magnet field system (mounted on the central translator shaft) and an armature, in which the power is generated (mounted on the buoy). The translator shaft is anchored to the sea floor, and the buoy/floater moves armature coils relative to the permanent magnet translator to induce voltages. The electrical and mechanical structures of the buoy generator are provided, along with performance characteristics, including voltage, current and developed power. (author)

High voltage high brightness electron accelerators with MITL voltage adder coupled to foilless diodes

International Nuclear Information System (INIS)

Mazarakis, M.G.; Poukey, J.W.; Frost, C.A.; Shope, S.L.; Halbleib, J.A.; Turman, B.N.

1993-01-01

During the last ten years the authors have extensively studied the physics and operation of magnetically-immersed electron foilless diodes. Most of these sources were utilized as injectors to high current, high energy linear induction accelerators such as those of the RADLAC family. Recently they have experimentally and theoretically demonstrated that foilless diodes can be successfully coupled to self-magnetically insulated transmission line voltage adders to produce very small high brightness, high definition (no halo) electron beams. The RADLAC/SMILE experience opened the path to a new approach in high brightness, high energy induction accelerators. There is no beam drifting through the device. The voltage addition occurs in a center conductor, and the beam is created at the high voltage end in an applied magnetic field diode. This work was motivated by the remarkable success of the HERMES-III accelerator and the need to produce small radius, high energy, high current electron beams for air propagation studies and flash x-ray radiography. In this paper they present experimental results compared with analytical and numerical simulations in addition to design examples of devices that can produce multikiloamp electron beams of as high as 100 MV energies and radii as small as 1 mm

0.45 v and 18 μA/MHz MCU SOC with Advanced Adaptive Dynamic Voltage Control (ADVC

Directory of Open Access Journals (Sweden)

Uzi Zangi

2018-05-01

Full Text Available An ultra-low-power MicroController Unit System-on-Chip (MCU SOC is described with integrated DC to DC power management and Adaptive Dynamic Voltage Control (ADVC mechanism. The SOC, designed and fabricated in a 40 nm ULP standard CMOS technology, includes the complete Synopsys ARC EM5D core MCU, featuring a full set of DSP instructions and minimizing energy consumption at a wide range of frequencies: 312 K–80 MHz. A number of unique low voltage digital libraries, comprising of approximately 300 logic cells and sequential elements, were used for the MCU SOC design. On-die silicon sensors were utilized to continuously change the operating voltage to optimize power/performance for a given frequency and environmental conditions, and also to resolve yield and life time problems, while operating at low voltages. A First Fail (FFail mechanism, which can be digitally and linearly controlled with up to 8 bits, detects the failing SOC voltage at a given frequency. The core operates between 0.45–1.1 V volts with a direct battery connection for an input voltage of 1.6–3.6 V. Measurement results show that the peak energy efficiency is 18μW/MHz. A comparison to state-of-the-art commercial SOCs is presented, showing a 3–5× improved current/DMIPS (Dhrystone Million Instructions per second compared to the next best chip.

Investigation of Efficiency and Thermal Performance of The Y-source Converters for a Wide Voltage Range

Directory of Open Access Journals (Sweden)

Brwene Salah Gadalla

2015-12-01

Full Text Available The Y-source topology has a unique advantage of having high voltages gain with small shoot through duty cycles. Furthermore, having the advantage of high modulation index which increase the power density and improve the performance of the converter. In this paper, a collective thermal and efficiency investigation has been performed in order to improve the reliability of the converter. Evaluation of relevant losses as ( switching, conduction, capacitor ESR, core and winding losses , and evaluation of the junction temperature of the devices under 25C ambient temperature. The analysis is done for different voltage gain factors (2, 3, and 4, and different winding factor (4, and 5 using PLECS toolbox. The results shows that the higher the voltage gain and winding factor, the higher power losses and rising in the junction temperature of the device.

Improved linearity using harmonic error rejection in a full-field range imaging system

Science.gov (United States)

Payne, Andrew D.; Dorrington, Adrian A.; Cree, Michael J.; Carnegie, Dale A.

2008-02-01

Full field range imaging cameras are used to simultaneously measure the distance for every pixel in a given scene using an intensity modulated illumination source and a gain modulated receiver array. The light is reflected from an object in the scene, and the modulation envelope experiences a phase shift proportional to the target distance. Ideally the waveforms are sinusoidal, allowing the phase, and hence object range, to be determined from four measurements using an arctangent function. In practice these waveforms are often not perfectly sinusoidal, and in some cases square waveforms are instead used to simplify the electronic drive requirements. The waveforms therefore commonly contain odd harmonics which contribute a nonlinear error to the phase determination, and therefore an error in the range measurement. We have developed a unique sampling method to cancel the effect of these harmonics, with the results showing an order of magnitude improvement in the measurement linearity without the need for calibration or lookup tables, while the acquisition time remains unchanged. The technique can be applied to existing range imaging systems without having to change or modify the complex illumination or sensor systems, instead only requiring a change to the signal generation and timing electronics.

Optimum voltage of auxiliary systems for thermal and nuclear power plants

International Nuclear Information System (INIS)

Tokumitsu, Iwao; Segawa, Motomichi

1979-01-01

In the power plants in Japan, their unit power output has been greatly enhanced since the introduction of new powerful thermal power plants from 1950's to 1960's. In both thermal and nuclear power plants, 1,000 MW machines have been already in operation. The increase of unit power output results in the increase of in-plant load capacity. Of these the voltage adopted for in-plant low voltage systems is now mainly 440 V at load terminals, and the voltage for in-plant high voltage systems has been changing to 6 kV level via 3 kV and 4 kV levels. As plant capacity increases, the load of low voltage systems significantly increases, and it is required to raise the voltage of 400 V level. By the way, the low voltage in AC is specified to be not higher than 600 V. This makes the change within the above range comparatively easy. Considering these conditions, it is recommended to change the voltage for low voltage systems to 575 V at power source terminals and 550 V at load terminals. Some merits in constructing power systems and in economy by raising the voltage were examined. Though demerits are also found, they are only about 15% of total merits. The most advantageous point in raising the voltage is to be capable of increasing the supplying range to low voltage system loads. (Wakatsuki, Y.)

Manipulating the voltage dependence of tunneling spin torques

KAUST Repository

Manchon, Aurelien

2012-10-01

Voltage-driven spin transfer torques in magnetic tunnel junctions provide an outstanding tool to design advanced spin-based devices for memory and reprogrammable logic applications. The non-linear voltage dependence of the torque has a direct impact on current-driven magnetization dynamics and on devices performances. After a brief overview of the progress made to date in the theoretical description of the spin torque in tunnel junctions, I present different ways to alter and control the bias dependence of both components of the spin torque. Engineering the junction (barrier and electrodes) structural asymmetries or controlling the spin accumulation profile in the free layer offer promising tools to design effcient spin devices.

High-voltage pulse generator for electron gun power supply

International Nuclear Information System (INIS)

Korenev, S.A.; Enchevich, I.B.; Mikhov, M.K.

1987-01-01

High-voltage pulse generator with combined capacitive and inductive energy storages for electron gun power supply is described. Hydrogen thyratron set in a short magnetic lense is a current breaker. Times of current interruption in thyratrons are in the range from 100 to 300 ns. With 1 kV charging voltage of capacitive energy storage 25 kV voltage pulse is obtained in the load. The given high-voltage pulse generator was used for supply of an electron gun generating 10-30 keV low-energy electron beam

Output voltage calculations in double barrier magnetic tunnel junctions with asymmetric voltage behavior

KAUST Repository

Useinov, Arthur

2011-10-22

In this paper we study the asymmetric voltage behavior (AVB) of the tunnel magnetoresistance (TMR) for single and double barrier magnetic tunnel junctions (MTJs) in range of a quasi-classical free electron model. Numerical calculations of the TMR-V curves, output voltages and I-V characteristics for negative and positive values of applied voltages were carried out using MTJs with CoFeB/MgO interfaces as an example. Asymmetry of the experimental TMR-V curves is explained by different values of the minority and majority Fermi wave vectors for the left and right sides of the tunnel barrier, which arises due to different annealing regimes. Electron tunneling in DMTJs was simulated in two ways: (i) Coherent tunneling, where the DMTJ is modeled as one tunnel system and (ii) consecutive tunneling, where the DMTJ is modeled by two single barrier junctions connected in series. © 2012 Elsevier B.V. All rights reserved.

Pulsed voltage electrospray ion source and method for preventing analyte electrolysis

Science.gov (United States)

Kertesz, Vilmos [Knoxville, TN; Van Berkel, Gary [Clinton, TN

2011-12-27

An electrospray ion source and method of operation includes the application of pulsed voltage to prevent electrolysis of analytes with a low electrochemical potential. The electrospray ion source can include an emitter, a counter electrode, and a power supply. The emitter can include a liquid conduit, a primary working electrode having a liquid contacting surface, and a spray tip, where the liquid conduit and the working electrode are in liquid communication. The counter electrode can be proximate to, but separated from, the spray tip. The power system can supply voltage to the working electrode in the form of a pulse wave, where the pulse wave oscillates between at least an energized voltage and a relaxation voltage. The relaxation duration of the relaxation voltage can range from 1 millisecond to 35 milliseconds. The pulse duration of the energized voltage can be less than 1 millisecond and the frequency of the pulse wave can range from 30 to 800 Hz.

Coordinated Voltage Control of Distributed PV Inverters for Voltage Regulation in Low Voltage Distribution Networks

DEFF Research Database (Denmark)

Nainar, Karthikeyan; Pokhrel, Basanta Raj; Pillai, Jayakrishnan Radhakrishna

2017-01-01

This paper reviews and analyzes the existing voltage control methods of distributed solar PV inverters to improve the voltage regulation and thereby the hosting capacity of a low-voltage distribution network. A novel coordinated voltage control method is proposed based on voltage sensitivity...... optimization. The proposed method is used to calculate the voltage bands and droop settings of PV inverters at each node by the supervisory controller. The local controller of each PV inverter implements the volt/var control and if necessary, the active power curtailment as per the received settings and based...... on measured local voltages. The advantage of the proposed method is that the calculated reactive power and active power droop settings enable fair contribution of the PV inverters at each node to the voltage regulation. Simulation studies are conducted using DigSilent Power factory software on a simplified...

Linear response theory for long-range interacting systems in quasistationary states.

Science.gov (United States)

Patelli, Aurelio; Gupta, Shamik; Nardini, Cesare; Ruffo, Stefano

2012-02-01

Long-range interacting systems, while relaxing to equilibrium, often get trapped in long-lived quasistationary states which have lifetimes that diverge with the system size. In this work, we address the question of how a long-range system in a quasistationary state (QSS) responds to an external perturbation. We consider a long-range system that evolves under deterministic Hamilton dynamics. The perturbation is taken to couple to the canonical coordinates of the individual constituents. Our study is based on analyzing the Vlasov equation for the single-particle phase-space distribution. The QSS represents a stable stationary solution of the Vlasov equation in the absence of the external perturbation. In the presence of small perturbation, we linearize the perturbed Vlasov equation about the QSS to obtain a formal expression for the response observed in a single-particle dynamical quantity. For a QSS that is homogeneous in the coordinate, we obtain an explicit formula for the response. We apply our analysis to a paradigmatic model, the Hamiltonian mean-field model, which involves particles moving on a circle under Hamiltonian dynamics. Our prediction for the response of three representative QSSs in this model (the water-bag QSS, the Fermi-Dirac QSS, and the Gaussian QSS) is found to be in good agreement with N-particle simulations for large N. We also show the long-time relaxation of the water-bag QSS to the Boltzmann-Gibbs equilibrium state. © 2012 American Physical Society

Planning aspects of ac extra high voltage lines

Energy Technology Data Exchange (ETDEWEB)

Engelhardt, H

1964-01-01

The technical points arising in any project for application of higher voltages on power grids in Europe are discussed. The cost aspects of two alternative ways of extending the voltage level of existing systems are discussed in detail. The short-circuit current in a high-power system with isolated or grounded neutral point and its relation to the mode of grounding is examined. For a transmission distance of 200 kVm, operating cost for each kWh transmitted are shown on curves for voltages of 220, 380 and 700 kV against transmitted energy. This shows that for any rated voltage there is a range of energy values which can be transmitted economically. Factors to be considered in maintaining, selecting or rejecting transformers and switchgear of other systems for higher voltage purposes are mentioned.

Solid-state high voltage modulator and its application to rf source high voltage power supplies

International Nuclear Information System (INIS)

Tooker, J.F.; Huynh, P.; Street, R.W.

2009-01-01

A solid-state high voltage modulator is described in which series-connected insulated-gate bipolar transistors (IGBTs) are switched at a fixed frequency by a pulse width modulation (PWM) regulator, that adjusts the pulse width to control the voltage out of an inductor-capacitor filter network. General Atomics proposed the HV power supply (HVPS) topology of multiple IGBT modulators connected to a common HVdc source for the large number of 1 MW klystrons in the linear accelerator of the Accelerator Production of Tritium project. The switching of 24 IGBTs to obtain 20 kVdc at 20 A for short pulses was successfully demonstrated. This effort was incorporated into the design of a -70 kV, 80 A, IGBT modulator, and in a short-pulse test 12 IGBTs regulated -5 kV at 50 A under PWM control. These two tests confirm the practicality of solid-state IGBT modulators to regulate high voltage at reasonable currents. Tokamaks such as ITER require large rf heating and current drive systems with multiple rf sources. A HVPS topology is presented that readily adapts to the three rf heating systems on ITER. To take advantage of the known economy of scale for power conversion equipment, a single HVdc source feeds multiple rf sources. The large power conversion equipment, which is located outside, converts the incoming utility line voltage directly to the HVdc needed for the class of rf sources connected to it, to further reduce cost. The HVdc feeds a set of IGBT modulators, one for each rf source, to independently control the voltage applied to each source, maximizing operational flexibility. Only the modulators are indoors, close to the rf sources, minimizing the use of costly near-tokamak floor space.

Current—voltage characteristics of lead zirconate titanate/nickel bilayered hollow cylindrical magnetoelectric composites

International Nuclear Information System (INIS)

De-An, Pan; Shen-Gen, Zhang; Jian-Jun, Tian; Li-Jie, Qiao; Jun-Sai, Sun; Volinsky, Alex A.

2010-01-01

Current–voltage measurements obtained from lead zirconate titanate/nickel bilayered hollow cylindrical magnetoelectric composite showed that a sinusoidal current applied to the copper coil wrapped around the hollow cylinder circumference induces voltage across the lead zirconate titanate layer thickness. The current–voltage coefficient and the maximum induced voltage in lead zirconate titanate at 1 kHz and resonance (60.1 kHz) frequencies increased linearly with the number of the coil turns and the applied current. The resonance frequency corresponds to the electromechanical resonance frequency. The current–voltage coefficient can be significantly improved by optimizing the magnetoelectric structure geometry and/or increasing the number of coil turns. Hollow cylindrical lead zirconate titanate/nickel structures can be potentially used as current sensors. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

Cell design for the DARHT linear induction accelerators

International Nuclear Information System (INIS)

Burns, M.; Allison, P.; Earley, L.; Liska, D.; Mockler, C.; Ruhe, J.; Tucker, H.; Walling, L.

1991-01-01

The Dual-Axis Radiographic Hydrotest (DARHT) facility will employ two linear induction accelerators to produce intense, bremsstrahlung x- ray pulses for flash radiography. The accelerator cell design for a 3- kA, 16--20 MeV, 60-ns flattop, high-brightness electron beam is presented. The cell is optimized for high-voltage stand-off while also minimizing the its transverse impedance. Measurements of high- voltage and rf characteristics are summarized. 7 refs., 5 figs

New Insights into the Operating Voltage of Aqueous Supercapacitors.

Science.gov (United States)

Yu, Minghao; Lu, Yongzhuang; Zheng, Haibing; Lu, Xihong

2018-03-12

The main limitation of aqueous supercapacitors (SCs) lies in their narrow operating voltages, especially when compared with organic SCs. Fundamental understanding of factors relevant to the operating voltage helps providing guidance for the assembly of high-voltage aqueous SCs. In this regard, this concept analyzes the deciding factors for the operating voltage of aqueous SCs. Strategies applied to expand the operating voltage are summarized and discussed from the aspects of electrolyte, electrode, and asymmetric structure. Dynamic factors associated with water electrolysis and maximally using the available potential ranges of electrodes are particularly emphasized. Finally, other promising approaches that have not been explored and their challenges are also elaborated, hoping to provide more insights for the design of high-voltage aqueous SCs. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

High-resolution continuum source electrothermal atomic absorption spectrometry: Linearization of the calibration curves within a broad concentration range

Energy Technology Data Exchange (ETDEWEB)

Katskov, Dmitri, E-mail: katskovda@tut.ac.za [Tshwane University of Technology, Chemistry Department, Pretoria 0001 (South Africa); Hlongwane, Miranda [Tshwane University of Technology, Chemistry Department, Pretoria 0001 (South Africa); Heitmann, Uwe [German Aerospace Center, Rose-Luxemburg Str. 2, 10178 Berlin (Germany); Florek, Stefan [ISAS-Leibniz-Institut fuer Analytische Wissenschaften e.V., Albert-Einstein-Str. 9,12489 Berlin (Germany)

2012-05-15

The calculation algorithm suggested provides linearization of the calibration curves in high-resolution continuum source electrothermal atomic absorption spectrometry. The algorithm is based on the modification of the function wavelength-integrated absorbance vs. concentration of analyte vapor in the absorption volume. According to the suggested approach, the absorption line is represented by a triangle for low and trapezium for high analyte vapor concentration in the absorption volume. The respective semi-empirical formulas include two linearization parameters, which depend on properties of the absorption line and characteristics of the atomizer and spectrometer. The parameters can be approximately evaluated from the theory and determined in practice from the original broad-range calibration curve. The parameters were found and the proposed calculation algorithm verified in the experiments on direct determination of Ag, Cd, Cu, Fe, Mn and Pb in the solutions within a concentration ranges from 0.15 to 625 {mu}g{center_dot}L{sup -1} using tube, platform tube and filter furnace atomizers. The use of various atomizers, lines, elements and atomization temperatures made possible the simulation of various practical analytical conditions. It was found that the algorithm and optimal linearization parameters made it possible to obtain for each line and atomizer linear approximations of the calibration curves within 3-4 orders of magnitude with correlation coefficients close to 0.999. The algorithm makes possible to employ a single line for the direct element determination over a broad concentration range. The sources of errors and the possibility of a priori theoretical evaluation of the linearization parameters are discussed. - Highlights: Black-Right-Pointing-Pointer New calculation algorithm for HR-CS ET AAS measurements was proposed and applied. Black-Right-Pointing-Pointer The suggested formulas include two parameters to be determined experimentally. Black

Voltage gradient mapping and electrophysiologically guided cryoablation in children with AVNRT.

Science.gov (United States)

Drago, Fabrizio; Battipaglia, Irma; Russo, Mario Salvatore; Remoli, Romolo; Pazzano, Vincenzo; Grifoni, Gino; Allegretti, Greta; Silvetti, Massimo Stefano

2018-04-01

Recently, voltage gradient mapping of Koch's triangle to find low-voltage connections, or 'voltage bridges', corresponding to the anatomic position of the slow pathway, has been introduced as a method to ablate atrioventricular nodal reentry tachycardia (AVNRT) in children. Thus, we aimed to assess the effectiveness of voltage mapping of Koch's triangle, combined with the search for the slow potential signal in 'low-voltage bridges', to guide cryoablation of AVNRT in children. From June 2015 to May 2016, 35 consecutive paediatric patients (mean age 12.1 ± 4.5 years) underwent 3D-guided cryoablation of AVNRT at our Institution. Fifteen children were enrolled as control group (mean age 14 ± 4 years). A voltage gradient mapping of Koch's triangle was obtained in all patients, showing low-voltage connections in all children with AVNRT but not in controls. Prior to performing cryoablation, we looked for the typical 'hump and spike' electrogram, generally considered to be representative of slow pathway potential within a low-voltage bridge. In all patients the 'hump and spike' electrogram was found inside bridges of low voltage. Focal or high-density linear lesions, extended or not, were delivered guided by low-voltage bridge visualization. Acute success rate was 100%, and no recurrence was reported at a mean follow-up of 8 ± 3 months. Voltage gradient mapping of Koch's triangle, combined with the search for the slow potential signal in low-voltage bridges, is effective in guiding cryoablation of AVNRT in paediatric patients, with a complete acute success rate and no AVNRT recurrences at mid-term follow-up.

A 60-dB linear VGA with novel exponential gain approximation

International Nuclear Information System (INIS)

Zhou Jiaye; Tan Xi; Wang Junyu; Tang Zhangwen; Min Hao

2009-01-01

A CMOS variable gain amplifier (VGA) that adopts a novel exponential gain approximation is presented. No additional exponential gain control circuit is required in the proposed VGA used in a direct conversion receiver. A wide gain control voltage from 0.4 to 1.8 V and a high linearity performance are achieved. The three-stage VGA with automatic gain control (AGC) and DC offset cancellation (DCOC) is fabricated in a 0.18-μm CMOS technology and shows a linear gain range of more than 58-dB with a linearity error less than ±1 dB. The 3-dB bandwidth is over 8 MHz at all gain settings. The measured input-referred third intercept point (IIP3) of the proposed VGA varies from -18.1 to 13.5 dBm, and the measured noise figure varies from 27 to 65 dB at a frequency of 1 MHz. The dynamic range of the closed-loop AGC exceeds 56 dB, where the output signal-to-noise-and-distortion ratio (SNDR) reaches 20 dB. The whole circuit, occupying 0.3 mm 2 of chip area, dissipates less than 3.7 mA from a 1.8-V supply.

Non-linear dielectric monitoring of biological suspensions

International Nuclear Information System (INIS)

Treo, E F; Felice, C J

2007-01-01

Non-linear dielectric spectroscopy as a tool for in situ monitoring of enzyme assumes a non-linear behavior of the sample when a sinusoidal voltage is applied to it. Even many attempts have been made to improve the original experiments, all of them had limited success. In this paper we present upgrades made to a non-linear dielectric spectrometer developed and the results obtained when using different cells. We emphasized on the electrode surface, characterizing the grinding and polishing procedure. We found that the biological medium does not behave as expected, and the non-linear response is generated in the electrode-electrolyte interface. The electrochemistry of this interface can bias unpredictably the measured non-linear response

Impurity effects on electrical conductivity of doped bilayer graphene in the presence of a bias voltage

International Nuclear Information System (INIS)

Lotfi, E; Rezania, H; Arghavaninia, B; Yarmohammadi, M

2016-01-01

We address the electrical conductivity of bilayer graphene as a function of temperature, impurity concentration, and scattering strength in the presence of a finite bias voltage at finite doping, beginning with a description of the tight-binding model using the linear response theory and Green’s function approach. Our results show a linear behavior at high doping for the case of high bias voltage. The effects of electron doping on the electrical conductivity have been studied via changing the electronic chemical potential. We also discuss and analyze how the bias voltage affects the temperature behavior of the electrical conductivity. Finally, we study the behavior of the electrical conductivity as a function of the impurity concentration and scattering strength for different bias voltages and chemical potentials respectively. The electrical conductivity is found to be monotonically decreasing with impurity scattering strength due to the increased scattering among electrons at higher impurity scattering strength. (paper)

Algorithm оf Computer Model Realization оf High-Frequency Processes in Switchgears Containing Non-Linear Over-Voltage Limiters

Directory of Open Access Journals (Sweden)

Ye. V. Dmitriev

2007-01-01

Full Text Available Analysis of the Over-Voltage Limiter (OVL influence on electromagnetic high-frequency over-voltages at commutations with isolators of unloaded sections of wires and possibility of application of a frequency-dependent resistor in case of necessity to facilitate OVL operation conditions is provided in the paper.It is shown that it is necessary to take into account characteristics of OVL by IEEE circuit and its modifications at computer modeling of high-frequency over-voltages.

High voltage pulse generator. [Patent application

Science.gov (United States)

Fasching, G.E.

1975-06-12

An improved high-voltage pulse generator is described which is especially useful in ultrasonic testing of rock core samples. An N number of capacitors are charged in parallel to V volts and at the proper instance are coupled in series to produce a high-voltage pulse of N times V volts. Rapid switching of the capacitors from the paralleled charging configuration to the series discharging configuration is accomplished by using silicon-controlled rectifiers which are chain self-triggered following the initial triggering of the first rectifier connected between the first and second capacitors. A timing and triggering circuit is provided to properly synchronize triggering pulses to the first SCR at a time when the charging voltage is not being applied to the parallel-connected charging capacitors. The output voltage can be readily increased by adding additional charging networks. The circuit allows the peak level of the output to be easily varied over a wide range by using a variable autotransformer in the charging circuit.

Inductive voltage adder (IVA) for submillimeter radius electron beam

International Nuclear Information System (INIS)

Mazarakis, M.G.; Poukey, J.W.; Maenchen, J.E.

1996-01-01

The authors have already demonstrated the utility of inductive voltage adder accelerators for production of small-size electron beams. In this approach, the inductive voltage adder drives a magnetically immersed foilless diode to produce high-energy (10--20 MeV), high-brightness pencil electron beams. This concept was first demonstrated with the successful experiments which converted the linear induction accelerator RADLAC II into an IVA fitted with a small 1-cm radius cathode magnetically immersed foilless diode (RADLAC II/SMILE). They present here first validations of extending this idea to mm-scale electron beams using the SABRE and HERMES-III inductive voltage adders as test beds. The SABRE experiments are already completed and have produced 30-kA, 9-MeV electron beams with envelope diameter of 1.5-mm FWHM. The HERMES-III experiments are currently underway

Mitigation of Voltage Sags in CIGRE Low Voltage Distribution Network

DEFF Research Database (Denmark)

Mustafa, Ghullam; Bak-Jensen, Birgitte; Mahat, Pukar

2013-01-01

Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage p....... The compensation of voltage sags in the different parts of CIGRE distribution network is done by using the four STATCOM compensators already existing in the test grid. The simulations are carried out in DIgSILENT power factory software version 15.0.......Any problem in voltage in a power network is undesirable as it aggravates the quality of the power. Power electronic devices such as Voltage Source Converter (VSC) based Static Synchronous Compensator (STATCOM), Dynamic Voltage Restorer (DVR) etc. are commonly used for the mitigation of voltage...... problems in the distribution system. The voltage problems dealt with in this paper are to show how to mitigate voltage sags in the CIGRE Low Voltage (LV) test network and networks like this. The voltage sags, for the tested cases in the CIGRE LV test network are mainly due to three phase faults...

Development of a New Cascade Voltage-Doubler for Voltage Multiplication

OpenAIRE

Toudeshki, Arash; Mariun, Norman; Hizam, Hashim; Abdul Wahab, Noor Izzri

2014-01-01

For more than eight decades, cascade voltage-doubler circuits are used as a method to produce DC output voltage higher than the input voltage. In this paper, the topological developments of cascade voltage-doublers are reviewed. A new circuit configuration for cascade voltage-doubler is presented. This circuit can produce a higher value of the DC output voltage and better output quality compared to the conventional cascade voltage-doubler circuits, with the same number of stages.

Suppressing voltage transients in high voltage power supplies

International Nuclear Information System (INIS)

Lickel, K.F.; Stonebank, R.

1979-01-01

A high voltage power supply for an X-ray tubes includes voltage adjusting means, a high voltage transformer, switch means connected to make and interrupt the primary current of the transformer, and over-voltage suppression means to suppress the voltage transient produced when the current is switched on. In order to reduce the power losses in the suppression means, an impedance is connected in the transformer primary circuit on operation of the switch means and is subsequently short-circuited by a switch controlled by a timer after a period which is automatically adjusted to the duration of the transient overvoltage. (U.K.)

Design of high voltage power supply of miniature X-ray tube based on resonant Royer

International Nuclear Information System (INIS)

Liu Xiyao; Zeng Guoqiang; Tan Chengjun; Luo Qun; Gong Chunhui; Huang Rui

2013-01-01

Background: In recent years, X rays are widely used in various fields. With the rapid development of national economy, the demand of high quality, high reliability, and high stability miniature X-ray tube has grown rapidly. As an important core component of miniature X-ray tube, high voltage power supply has attracted wide attention. Purpose: To match miniature, the high voltage power supply should be small, lightweight, good quality, etc. Based on the basic performance requirements of existing micro-X-ray tube high voltage power supply, this paper designs an output from 0 to -30 kV adjustable miniature X-ray tube voltage DC power supply. Compared to half-bridge and full-bridge switching-mode power supply, its driving circuit is simple. With working on the linear condition, it has no switching noise. Methods: The main circuit makes use of DC power supply to provide the energy. The resonant Royer circuit supplies sine wave which drives to the high frequency transformer's primary winding with resultant sine-like high voltage appearing across the secondary winding. Then, the voltage doubling rectifying circuit would achieve further boost. In the regulator circuit, a feedback control resonant transistor base current is adopted. In order to insulate air, a silicone rubber is used for high pressure part packaging, and the output voltage is measured by the dividing voltage below -5 kV. Results: The stability of circuit is better than 0.2%/6 h and the percent of the output ripple voltage is less than 0.3%. Keeping the output voltage constant, the output current can reach 57 μA by changing the size of load resistor. This high voltage power supply based on resonant Royer can meet the requirement of miniature X-ray tube. Conclusions: The circuit can satisfy low noise, low ripple, low power and high voltage regulator power supply design. However, its efficiency is not high enough because of the linear condition. In the next design, to further reduce power consumption, we

High linearity current communicating passive mixer employing a simple resistor bias

International Nuclear Information System (INIS)

Liu Rongjiang; Guo Guiliang; Yan Yuepeng

2013-01-01

A high linearity current communicating passive mixer including the mixing cell and transimpedance amplifier (TIA) is introduced. It employs the resistor in the TIA to reduce the source voltage and the gate voltage of the mixing cell. The optimum linearity and the maximum symmetric switching operation are obtained at the same time. The mixer is implemented in a 0.25 μm CMOS process. The test shows that it achieves an input third-order intercept point of 13.32 dBm, conversion gain of 5.52 dB, and a single sideband noise figure of 20 dB. (semiconductor integrated circuits)

A Facile Approach to Preparing Molecularly Imprinted Chitosan for Detecting 2,4,6-Tribromophenol with a Widely Linear Range

Directory of Open Access Journals (Sweden)

Limei Huang

2017-04-01

Full Text Available The environmental pollution of 2,4,6-tribromophenol (TBP has attracted attention. Based on an urgent need for the better provision of clean water, in situ determination of TBP is of great importance. Here, a facile and effective approach for detecting TBP is developed, based on coupling molecular imprinting technique with electrodeposition of chitosan (CS on the gold electrode. The TBP imprinting CS film was fabricated by using CS as functional material and TBP as template molecule. The experiments show that the morphologies and electrochemical properties of the imprinted film sensor was different from non-imprinted film electrode. The current of the imprinted film was linearly proportional to the TBP concentration, with a wide linear range of 1.0 × 10−7 mol•L−1 to 1.0 × 10−3 mol•L−1. By selecting drop-coating method as a reference for controlled trials with the same functional material, the results illustrated that the electrodeposition enjoyed a widely linear range advantage.

Linear induction accelerator

Science.gov (United States)

Buttram, M.T.; Ginn, J.W.

1988-06-21

A linear induction accelerator includes a plurality of adder cavities arranged in a series and provided in a structure which is evacuated so that a vacuum inductance is provided between each adder cavity and the structure. An energy storage system for the adder cavities includes a pulsed current source and a respective plurality of bipolar converting networks connected thereto. The bipolar high-voltage, high-repetition-rate square pulse train sets and resets the cavities. 4 figs.

The Linearity of Optical Tomography: Sensor Model and Experimental Verification

Directory of Open Access Journals (Sweden)

Siti Zarina MOHD. MUJI

2011-09-01

Full Text Available The aim of this paper is to show the linearization of optical sensor. Linearity of the sensor response is a must in optical tomography application, which affects the tomogram result. Two types of testing are used namely, testing using voltage parameter and testing with time unit parameter. For the former, the testing is by measuring the voltage when the obstacle is placed between transmitter and receiver. The obstacle diameters are between 0.5 until 3 mm. The latter is also the same testing but the obstacle is bigger than the former which is 59.24 mm and the testing purpose is to measure the time unit spend for the ball when it cut the area of sensing circuit. Both results show a linear relation that proves the optical sensors is suitable for process tomography application.

Polarized electron sources for linear colliders

International Nuclear Information System (INIS)

Clendenin, J.E.; Ecklund, S.D.; Miller, R.H.; Schultz, D.C.; Sheppard, J.C.

1992-07-01

Linear colliders require high peak current beams with low duty factors. Several methods to produce polarized e - beams for accelerators have been developed. The SLC, the first linear collider, utilizes a photocathode gun with a GaAs cathode. Although photocathode sources are probably the only practical alternative for the next generation of linear colliders, several problems remain to be solved, including high voltage breakdown which poisons the cathode, charge limitations that are associated with the condition of the semiconductor cathode, and a relatively low polarization of ≤5O%. Methods to solve or at least greatly reduce the impact of each of these problems are at hand

Logarithmic circuit with wide dynamic range

Science.gov (United States)

Wiley, P. H.; Manus, E. A. (Inventor)

1978-01-01

A circuit deriving an output voltage that is proportional to the logarithm of a dc input voltage susceptible to wide variations in amplitude includes a constant current source which forward biases a diode so that the diode operates in the exponential portion of its voltage versus current characteristic, above its saturation current. The constant current source includes first and second, cascaded feedback, dc operational amplifiers connected in negative feedback circuit. An input terminal of the first amplifier is responsive to the input voltage. A circuit shunting the first amplifier output terminal includes a resistor in series with the diode. The voltage across the resistor is sensed at the input of the second dc operational feedback amplifier. The current flowing through the resistor is proportional to the input voltage over the wide range of variations in amplitude of the input voltage.

Modification of Modulating Anode Voltage Supply of Klystron for PEFP 20 MeV Linac

International Nuclear Information System (INIS)

Kim, Dae Il; Kwon, Hyeok Jung; Kim, Han Sung; Cho, Yong Sub

2011-01-01

The klystron (TH2089F, THALES) for PEFP 20MeV proton linear accelerator has a triode type electron gun and the modulating anode voltage should be supplied. The klystron has gone through some modification in the modulating anode voltage supply circuit. Formerly, the mod-anode voltage was supplied by using the tetrode-controlled voltage divider. This system requires addition power supply for the tetrode and the grid control circuit. Recently we modified the mod-anode supply from the tetrode-controlled voltage divider to a resistive voltage divider. The resistors for the previous voltage divider were installed at a supporter with high voltage bushing structure next to the klystron. In the previous system, the resistors were exposed to the air and their size was very bulky, length of which was about 1m long. To reduce the space occupied by the voltage divider and to improve the electrical insulation performance, the voltage dividing resistors were moved into the oil tank of the klystron. During the operation of the 20 MeV linac, the klystron parameters were measured. In this paper, the modification of the voltage divider and the operational characteristics of the klystron with modified voltage divider circuit are presented

AC Voltage Control of DC/DC Converters Based on Modular Multilevel Converters in Multi-Terminal High-Voltage Direct Current Transmission Systems

Directory of Open Access Journals (Sweden)

Rui Li

2016-12-01

Full Text Available The AC voltage control of a DC/DC converter based on the modular multilevel converter (MMC is considered under normal operation and during a local DC fault. By actively setting the AC voltage according to the two DC voltages of the DC/DC converter, the modulation index can be near unity, and the DC voltage is effectively utilized to output higher AC voltage. This significantly decreases submodule (SM capacitance and conduction losses of the DC/DC converter, yielding reduced capital cost, volume, and higher efficiency. Additionally, the AC voltage is limited in the controllable range of both the MMCs in the DC/DC converter; thus, over-modulation and uncontrolled currents are actively avoided. The AC voltage control of the DC/DC converter during local DC faults, i.e., standby operation, is also proposed, where only the MMC connected on the faulty cable is blocked, while the other MMC remains operational with zero AC voltage output. Thus, the capacitor voltages can be regulated at the rated value and the decrease of the SM capacitor voltages after the blocking of the DC/DC converter is avoided. Moreover, the fault can still be isolated as quickly as the conventional approach, where both MMCs are blocked and the DC/DC converter is not exposed to the risk of overcurrent. The proposed AC voltage control strategy is assessed in a three-terminal high-voltage direct current (HVDC system incorporating a DC/DC converter, and the simulation results confirm its feasibility.

High voltage short plus generation based on avalanche circuit

International Nuclear Information System (INIS)

Hu Yuanfeng; Yu Xiaoqi

2006-01-01

Simulate the avalanche circuit in series with PSPICE module, design the high voltage short plus generation circuit by avalanche transistor in series for the sweep deflection circuit of streak camera. The output voltage ranges 1.2 KV into 50 ohm load. The rise time of the circuit is less than 3 ns. (authors)

Design and performance testing of an ultrasonic linear motor with dual piezoelectric actuators.

Science.gov (United States)

Smithmaitrie, Pruittikorn; Suybangdum, Panumas; Laoratanakul, Pitak; Muensit, Nantakan

2012-05-01

In this work, design and performance testing of an ultrasonic linear motor with dual piezoelectric actuator patches are studied. The motor system consists of a linear stator, a pre-load weight, and two piezoelectric actuator patches. The piezoelectric actuators are bonded with the linear elastic stator at specific locations. The stator generates propagating waves when the piezoelectric actuators are subjected to harmonic excitations. Vibration characteristics of the linear stator are analyzed and compared with finite element and experimental results. The analytical, finite element, and experimental results show agreement. In the experiments, performance of the ultrasonic linear motor is tested. Relationships between velocity and pre-load weight, velocity and applied voltage, driving force and applied voltage, and velocity and driving force are reported. The design of the dual piezoelectric actuators yields a simpler structure with a smaller number of actuators and lower stator stiffness compared with a conventional design of an ultrasonic linear motor with fully laminated piezoelectric actuators.

Note: A 102 dB dynamic-range charge-sampling readout for ionizing particle/radiation detectors based on an application-specific integrated circuit (ASIC)

Science.gov (United States)

Pullia, A.; Zocca, F.; Capra, S.

2018-02-01

An original technique for the measurement of charge signals from ionizing particle/radiation detectors has been implemented in an application-specific integrated circuit form. The device performs linear measurements of the charge both within and beyond its output voltage swing. The device features an unprecedented spectroscopic dynamic range of 102 dB and is suitable for high-resolution ion and X-γ ray spectroscopy. We believe that this approach may change a widespread paradigm according to which no high-resolution spectroscopy is possible when working close to or beyond the limit of the preamplifier's output voltage swing.

Voltage-dependent gating in a "voltage sensor-less" ion channel.

Directory of Open Access Journals (Sweden)

Harley T Kurata

2010-02-01

Full Text Available The voltage sensitivity of voltage-gated cation channels is primarily attributed to conformational changes of a four transmembrane segment voltage-sensing domain, conserved across many levels of biological complexity. We have identified a remarkable point mutation that confers significant voltage dependence to Kir6.2, a ligand-gated channel that lacks any canonical voltage-sensing domain. Similar to voltage-dependent Kv channels, the Kir6.2[L157E] mutant exhibits time-dependent activation upon membrane depolarization, resulting in an outwardly rectifying current-voltage relationship. This voltage dependence is convergent with the intrinsic ligand-dependent gating mechanisms of Kir6.2, since increasing the membrane PIP2 content saturates Po and eliminates voltage dependence, whereas voltage activation is more dramatic when channel Po is reduced by application of ATP or poly-lysine. These experiments thus demonstrate an inherent voltage dependence of gating in a "ligand-gated" K+ channel, and thereby provide a new view of voltage-dependent gating mechanisms in ion channels. Most interestingly, the voltage- and ligand-dependent gating of Kir6.2[L157E] is highly sensitive to intracellular [K+], indicating an interaction between ion permeation and gating. While these two key features of channel function are classically dealt with separately, the results provide a framework for understanding their interaction, which is likely to be a general, if latent, feature of the superfamily of cation channels.

Transient voltage sharing in series-coupled high voltage switches

Directory of Open Access Journals (Sweden)

Editorial Office

1992-07-01

Full Text Available For switching voltages in excess of the maximum blocking voltage of a switching element (for example, thyristor, MOSFET or bipolar transistor such elements are often coupled in series - and additional circuitry has to be provided to ensure equal voltage sharing. Between each such series element and system ground there is a certain parasitic capacitance that may draw a significant current during high-speed voltage transients. The "open" switch is modelled as a ladder network. Analy­sis reveals an exponential progression in the distribution of the applied voltage across the elements. Overstressing thus oc­curs in some of the elements at levels of the total voltage that are significantly below the design value. This difficulty is overcome by grading the voltage sharing circuitry, coupled in parallel with each element, in a prescribed manner, as set out here.

Passive longitudinal phase space linearizer

Directory of Open Access Journals (Sweden)

P. Craievich

2010-03-01

Full Text Available We report on the possibility to passively linearize the bunch compression process in electron linacs for the next generation x-ray free electron lasers. This can be done by using the monopole wakefields in a dielectric-lined waveguide. The optimum longitudinal voltage loss over the length of the bunch is calculated in order to compensate both the second-order rf time curvature and the second-order momentum compaction terms. Thus, the longitudinal phase space after the compression process is linearized up to a fourth-order term introduced by the convolution between the bunch and the monopole wake function.

Multi-Period Optimization for Voltage Control System in Transmission Grids

DEFF Research Database (Denmark)

Qin, Nan; Chen, Si; Liu, Chengxi

2015-01-01

Automatic Voltage Control (AVC) systems maintain the voltage in an acceptable range and minimize the power loss of the grid by coordinately regulating the controllable components. Switchable shunts and tap-able transformers are expected to be operated as few times as possible. This paper proposes...

A High Power Linear Solid State Pulser

International Nuclear Information System (INIS)

Boris Yen; Brent Davis; Rex Booth

1999-01-01

Particle Accelerators require high voltage and often high power. Typically the high voltage/power generation utilizes a topology with an extra energy store and a switching means to extract that stored energy. The switches may be active or passive devices. Active switches are hard or soft vacuum tubes, or semiconductors. When required voltages exceed tens of kilovolts, numerous semiconductors are stacked to withstand that potential. Such topologies can use large numbers of critical parts that, when in series, compromise the system reliability and performance. This paper describes a modular, linear, solid state amplifier which uses a parallel array of semiconductors, coupled with transmission line transformers. Such a design can provide output signals with voltages exceeding 10kV (into 50-ohms), and with rise and fall times (10-90 % amplitude) that are less than 1--ns. This compact solid state amplifier is modular, and has both hot-swap and soft fail capabilities

Considering system non-linearity in transmission pricing

International Nuclear Information System (INIS)

Oloomi-Buygi, M.; Salehizadeh, M. Reza

2008-01-01

In this paper a new approach for transmission pricing is presented. The contribution of a contract on power flow of a transmission line is used as extent-of-use criterion for transmission pricing. In order to determine the contribution of each contract on power flow of each transmission line, first the contribution of each contract on each voltage angle is determined, which is called voltage angle decomposition. To this end, DC power flow is used to compute a primary solution for voltage angle decomposition. To consider the impacts of system non-linearity on voltage angle decomposition, a method is presented to determine the share of different terms of sine argument in sine value. Then the primary solution is corrected in different iterations of decoupled Newton-Raphson power flow using the presented sharing method. The presented approach is applied to a 4-bus test system and IEEE 30-bus test system and the results are analyzed. (author)

1.5V fully programmable CMOS Membership Function Generator Circuit with proportional DC-voltage control

Directory of Open Access Journals (Sweden)

C. Muñiz-Montero

2013-06-01

Full Text Available A Membership Function Generator Circuit (MFGC with bias supply of 1.5 Volts and independent DC-voltage programmable functionalities is presented. The realization is based on a programmable differential current mirror and three compact voltage-to-current converters, allowing continuous and quasi-linear adjustment of the center position, height, width and slopes of the triangular/trapezoidal output waveforms. HSPICE simulation results of the proposed circuit using the parameters of a double-poly, three metal layers, 0.5 μm CMOS technology validate the functionality of the proposed architecture, which exhibits a maximum deviation of the linearity in the programmability of 7 %.

Voltage-carrying states in superconducting microstrips

International Nuclear Information System (INIS)

Stuivinga, M.E.C.

1983-01-01

When the critical current is exceeded in a superconducting microstrip, voltage-carrying states with a resistance significantly below the normal state resistance can occur. Phase-slip centers (PSC) appear at about the critical temperature. These are successive local voltage units which manifest themselves as strip-like increments in voltage in the I-V characteristic. For temperatures off the critical temperature the PSC regime degenerates into a region of normal material, a so-called hot spot. These two phenomena, PSC and hot spots, form the subject of this thesis. To gain a better understanding of the phase-slip center process, an experiment was designed to measure local values of the quasi-particle and pair potential. The results of local potential and gap measurements at a PSC in aluminium are presented and discussed. Special attention is paid to pair-breaking interactions which can shorten the relaxation time. A non-linear differential equation is derived which describes the development of a PSC into a normal hot spot under the influence of Joule heating. It incorporates the temperature rise due to the dissipative processes occurring in the charge imbalance tails. Numerical solutions are presented for a set of parameters, including those for aluminium and tin. Subsequently, they are compared with experiments. (Auth.)

SVPWM Technique with Varying DC-Link Voltage for Common Mode Voltage Reduction in a Matrix Converter and Analytical Estimation of its Output Voltage Distortion

Science.gov (United States)

Padhee, Varsha

Common Mode Voltage (CMV) in any power converter has been the major contributor to premature motor failures, bearing deterioration, shaft voltage build up and electromagnetic interference. Intelligent control methods like Space Vector Pulse Width Modulation (SVPWM) techniques provide immense potential and flexibility to reduce CMV, thereby targeting all the afore mentioned problems. Other solutions like passive filters, shielded cables and EMI filters add to the volume and cost metrics of the entire system. Smart SVPWM techniques therefore, come with a very important advantage of being an economical solution. This thesis discusses a modified space vector technique applied to an Indirect Matrix Converter (IMC) which results in the reduction of common mode voltages and other advanced features. The conventional indirect space vector pulse-width modulation (SVPWM) method of controlling matrix converters involves the usage of two adjacent active vectors and one zero vector for both rectifying and inverting stages of the converter. By suitable selection of space vectors, the rectifying stage of the matrix converter can generate different levels of virtual DC-link voltage. This capability can be exploited for operation of the converter in different ranges of modulation indices for varying machine speeds. This results in lower common mode voltage and improves the harmonic spectrum of the output voltage, without increasing the number of switching transitions as compared to conventional modulation. To summarize it can be said that the responsibility of formulating output voltages with a particular magnitude and frequency has been transferred solely to the rectifying stage of the IMC. Estimation of degree of distortion in the three phase output voltage is another facet discussed in this thesis. An understanding of the SVPWM technique and the switching sequence of the space vectors in detail gives the potential to estimate the RMS value of the switched output voltage of any

Modeling and simulation of dynamic voltage restorer in power system

International Nuclear Information System (INIS)

Abdel Aziz, M.A.A.M.

2012-01-01

There are many loads subjected to several Power Quality Problems such as voltage sags/swells, unbalance, harmonics distortion, and short interruption. These loads encompass a wide range of equipment which are very sensitive to voltage disturbances. The Dynamic Voltage Restorer (DVR) has recently been introduced to protect sensitive loads from voltage sags and other voltage disturbances in addition to this, it mitigates current harmonics distortion. It is a series connected power electronic based device. It is considered as one of the most efficient and effective solutions. Its appeal includes smaller size and fast dynamic response to disturbances. This work describes a proposal of the DVR to improve power quality distribution (medium voltage) system. The control of the compensation voltage and harmonics cancellation in the DVR is based on Adaptive Noise Canceling (ANC) technique. Simulation results carried out by PSCAD/EMTDC to investigate the performance of the proposed method.

Mitigation of voltage sags in the distribution system with dynamic voltage restorer

International Nuclear Information System (INIS)

Viglas, D.; Belan, A.

2012-01-01

Dynamic voltage restorer is a custom power device that is used to improve voltage sags or swells in electrical distribution system. The components of the Dynamic Voltage Restorer consist of injection transformers, voltage source inverter, passive filters and energy storage. The main function of the Dynamic voltage restorer is used to inject three phase voltage in series and in synchronism with the grid voltages in order to compensate voltage disturbances. This article deals with mitigation of voltage sags caused by three-phase short circuit. Dynamic voltage restorer is modelled in MATLAB/Simulink. (Authors)

Note: Wide-operating-range control for thermoelectric coolers

Science.gov (United States)

Peronio, P.; Labanca, I.; Ghioni, M.; Rech, I.

2017-11-01

A new algorithm for controlling the temperature of a thermoelectric cooler is proposed. Unlike a classic proportional-integral-derivative (PID) control, which computes the bias voltage from the temperature error, the proposed algorithm exploits the linear relation that exists between the cold side's temperature and the amount of heat that is removed per unit time. Since this control is based on an existing linear relation, it is insensitive to changes in the operating point that are instead crucial in classic PID control of a non-linear system.

Design & Fabrication of a High-Voltage Photovoltaic Cell

Energy Technology Data Exchange (ETDEWEB)

Felder, Jennifer; /North Carolina State U. /SLAC

2012-09-05

Silicon photovoltaic (PV) cells are alternative energy sources that are important in sustainable power generation. Currently, applications of PV cells are limited by the low output voltage and somewhat low efficiency of such devices. In light of this fact, this project investigates the possibility of fabricating high-voltage PV cells on float-zone silicon wafers having output voltages ranging from 50 V to 2000 V. Three designs with different geometries of diffusion layers were simulated and compared in terms of metal coverage, recombination, built-in potential, and conduction current density. One design was then chosen and optimized to be implemented in the final device design. The results of the simulation serve as a feasibility test for the design concept and provide supportive evidence of the effectiveness of silicon PV cells as high-voltage power supplies.

High-frequency high-voltage high-power DC-to-DC converters

Science.gov (United States)

Wilson, T. G.; Owen, H. A.; Wilson, P. M.

1982-09-01

A simple analysis of the current and voltage waveshapes associated with the power transistor and the power diode in an example current-or-voltage step-up (buck-boost) converter is presented. The purpose of the analysis is to provide an overview of the problems and design trade-offs which must be addressed as high-power high-voltage converters are operated at switching frequencies in the range of 100 kHz and beyond. Although the analysis focuses on the current-or-voltage step-up converter as the vehicle for discussion, the basic principles presented are applicable to other converter topologies as well.

Control system analysis for the perturbed linear accelerator rf system

CERN Document Server

Sung Il Kwon

2002-01-01

This paper addresses the modeling problem of the linear accelerator RF system in SNS. Klystrons are modeled as linear parameter varying systems. The effect of the high voltage power supply ripple on the klystron output voltage and the output phase is modeled as an additive disturbance. The cavity is modeled as a linear system and the beam current is modeled as the exogenous disturbance. The output uncertainty of the low level RF system which results from the uncertainties in the RF components and cabling is modeled as multiplicative uncertainty. Also, the feedback loop uncertainty and digital signal processing signal conditioning subsystem uncertainties are lumped together and are modeled as multiplicative uncertainty. Finally, the time delays in the loop are modeled as a lumped time delay. For the perturbed open loop system, the closed loop system performance, and stability are analyzed with the PI feedback controller.

CONTROL SYSTEM ANALYSIS FOR THE PERTURBED LINEAR ACCELERATOR RF SYSTEM

International Nuclear Information System (INIS)

SUNG-IL KWON; AMY H. REGAN

2002-01-01

This paper addresses the modeling problem of the linear accelerator RF system in SNS. Klystrons are modeled as linear parameter varying systems. The effect of the high voltage power supply ripple on the klystron output voltage and the output phase is modeled as an additive disturbance. The cavity is modeled as a linear system and the beam current is modeled as the exogenous disturbance. The output uncertainty of the low level RF system which results from the uncertainties in the RF components and cabling is modeled as multiplicative uncertainty. Also, the feedback loop uncertainty and digital signal processing signal conditioning subsystem uncertainties are lumped together and are modeled as multiplicative uncertainty. Finally, the time delays in the loop are modeled as a lumped time delay. For the perturbed open loop system, the closed loop system performance, and stability are analyzed with the PI feedback controller

Strategies for Voltage Control and Transient Stability Assessment

Energy Technology Data Exchange (ETDEWEB)

Hiskens, Ian A.

2013-09-25

As wind generation grows, its influence on power system performance will becoming increasingly noticeable. Wind generation di ffers from traditional forms of generation in numerous ways though, motivating the need to reconsider the usual approaches to power system assessment and performance enhancement. The project has investigated the impact of wind generation on transient stability and voltage control, identifying and addressing issues at three distinct levels of the power system: 1) at the device level, the physical characteristics of wind turbine generators (WTGs) are quite unlike those of synchronous machines, 2) at the wind-farm level, the provision of reactive support is achieved through coordination of numerous dissimilar devices, rather than straightforward generator control, and 3) from a systems perspective, the location of wind-farms on the sub-transmission network, coupled with the variability inherent in their power output, can cause complex voltage control issues. The project has sought to develop a thorough understanding of the dynamic behaviour of type-3 WTGs, and in particular the WECC generic model. The behaviour of such models is governed by interactions between the continuous dynamics of state variables and discrete events associated with limits. It was shown that these interactions can be quite complex, and may lead to switching deadlock that prevents continuation of the trajectory. Switching hysteresis was proposed for eliminating deadlock situations. Various type-3 WTG models include control blocks that duplicate integrators. It was shown that this leads to non-uniqueness in the conditions governing steady-state, and may result in pre- and post-disturbance equilibria not coinciding. It also gives rise to a zero eigenvalue in the linearized WTG model. In order to eliminate the anomalous behaviour revealed through this investigation, WECC has now released a new generic model for type-3 WTGs. Wind-farms typically incorporate a variety of

Moderately nonlinear diffuse-charge dynamics under an ac voltage.

Science.gov (United States)

Stout, Robert F; Khair, Aditya S

2015-09-01

The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of V_{o}/(k_{B}T/e), where V_{o} is the amplitude of the driving voltage and k_{B}T/e is the thermal voltage with k_{B} as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D/λ_{D}L, where D is the ion diffusivity, λ_{D} is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O(V_{o}^{3}) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in V_{o}. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing V_{o}. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

Moderately nonlinear diffuse-charge dynamics under an ac voltage

Science.gov (United States)

Stout, Robert F.; Khair, Aditya S.

2015-09-01

The response of a symmetric binary electrolyte between two parallel, blocking electrodes to a moderate amplitude ac voltage is quantified. The diffuse charge dynamics are modeled via the Poisson-Nernst-Planck equations for a dilute solution of point-like ions. The solution to these equations is expressed as a Fourier series with a voltage perturbation expansion for arbitrary Debye layer thickness and ac frequency. Here, the perturbation expansion in voltage proceeds in powers of Vo/(kBT /e ) , where Vo is the amplitude of the driving voltage and kBT /e is the thermal voltage with kB as Boltzmann's constant, T as the temperature, and e as the fundamental charge. We show that the response of the electrolyte remains essentially linear in voltage amplitude at frequencies greater than the RC frequency of Debye layer charging, D /λDL , where D is the ion diffusivity, λD is the Debye layer thickness, and L is half the cell width. In contrast, nonlinear response is predicted at frequencies below the RC frequency. We find that the ion densities exhibit symmetric deviations from the (uniform) equilibrium density at even orders of the voltage amplitude. This leads to the voltage dependence of the current in the external circuit arising from the odd orders of voltage. For instance, the first nonlinear contribution to the current is O (Vo3) which contains the expected third harmonic but also a component oscillating at the applied frequency. We use this to compute a generalized impedance for moderate voltages, the first nonlinear contribution to which is quadratic in Vo. This contribution predicts a decrease in the imaginary part of the impedance at low frequency, which is due to the increase in Debye layer capacitance with increasing Vo. In contrast, the real part of the impedance increases at low frequency, due to adsorption of neutral salt from the bulk to the Debye layer.

Linear Model for Optimal Distributed Generation Size Predication

Directory of Open Access Journals (Sweden)

Ahmed Al Ameri

2017-01-01

Full Text Available This article presents a linear model predicting optimal size of Distributed Generation (DG that addresses the minimum power loss. This method is based fundamentally on strong coupling between active power and voltage angle as well as between reactive power and voltage magnitudes. This paper proposes simplified method to calculate the total power losses in electrical grid for different distributed generation sizes and locations. The method has been implemented and tested on several IEEE bus test systems. The results show that the proposed method is capable of predicting approximate optimal size of DG when compared with precision calculations. The method that linearizes a complex model showed a good result, which can actually reduce processing time required. The acceptable accuracy with less time and memory required can help the grid operator to assess power system integrated within large-scale distribution generation.

Mechanism of voltage-gated channel formation in lipid membranes.

Science.gov (United States)

Guidelli, Rolando; Becucci, Lucia

2016-04-01

Although several molecular models for voltage-gated ion channels in lipid membranes have been proposed, a detailed mechanism accounting for the salient features of experimental data is lacking. A general treatment accounting for peptide dipole orientation in the electric field and their nucleation and growth kinetics with ion channel formation is provided. This is the first treatment that explains all the main features of the experimental current-voltage curves of peptides forming voltage-gated channels available in the literature. It predicts a regime of weakly voltage-dependent conductance, followed by one of strong voltage-dependent conductance at higher voltages. It also predicts values of the parameters expressing the exponential dependence of conductance upon voltage and peptide bulk concentration for both regimes, in good agreement with those reported in the literature. Most importantly, the only two adjustable parameters involved in the kinetics of nucleation and growth of ion channels can be varied over broad ranges without affecting the above predictions to a significant extent. Thus, the fitting of experimental current-voltage curves stems naturally from the treatment and depends only slightly upon the choice of the kinetic parameters. Copyright © 2015 Elsevier B.V. All rights reserved.

Voltage regulating circuit

NARCIS (Netherlands)

2005-01-01

A voltage regulating circuit comprising a rectifier (2) for receiving an AC voltage (Vmains) and for generating a rectified AC voltage (vrec), and a capacitor (3) connected in parallel with said rectified AC voltage for providing a DC voltage (VDC) over a load (5), characterized by a unidirectional

Irradiation of intense characteristic x-rays from weakly ionized linear molybdenum plasma

International Nuclear Information System (INIS)

Sato, Eiichi; Hayasi, Yasuomi

2003-01-01

In the plasma flash x-ray generator, a high-voltage main condenser of approximately 200 nF is charged up to 55 kV by a power supply, and electric charges in the condenser are discharged to an x-ray tube after triggering the cathode electrode. The flash x-rays are then produced. The x-ray tube is a demountable triode that is connected to a turbo molecular pump with a pressure of approximately 1 mPa. As electron flows from the cathode electrode are roughly converged to a rod molybdenum target of 2.0 mm in diameter by the electric field in the x-ray tube, weakly ionized linear plasma, which consists of molybdenum ions and electrons, forms by target evaporation. At a charging voltage of 55 kV, the maximum tube voltage was almost equal to the charging voltage of the main condenser, and the peak current was about 20 kA. When the charging voltage was increased, the linear plasma formed, and the K-series characteristic x-ray intensities increased. The K lines were quite sharp and intense, and hardly any bremsstrahlung rays were detected. The x-ray pulse widths were approximately 700 ns, and the time-integrated x-ray intensity had a value of approximately 35 μC/kg at 1.0 m from the x-ray source with a charging voltage of 50 kV. (author)

Power Quality Assessment in Real Shipboard Microgrid Systems under Unbalanced and Harmonic AC Bus Voltage

DEFF Research Database (Denmark)

Liu, Wenzhao; Tarasiuk, Tomasz; Gorniak, Mariusz

2018-01-01

were proposed and carried out in a real ship under sea-going conditions to address this problem. The ship experimental results were presented and discussed considering non-linear bow thruster load and high power ballast pump loads under unbalanced and harmonic voltage conditions. In addition......, the analysis of voltage transient dips during ballast pump starting up is presented. Further, the voltage/current distortions of working generator, bow thruster and pump loads are analyzed. The paper provides a valuable analysis for coping with PQ issues in the real ship power system....

Current-voltage-temperature characteristics of DNA origami

Energy Technology Data Exchange (ETDEWEB)

Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M [Department of Chemical Engineering, Texas A and M University, College Station, TX 77843 (United States); Zhong Hong; Norton, Michael L [Department of Chemistry, Marshall University, Huntington, WV 25755 (United States); Sinitskii, Alexander [Department of Chemistry, Rice University, Houston, TX 77005 (United States)

2009-04-29

The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of {approx}0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.

Current-voltage-temperature characteristics of DNA origami

International Nuclear Information System (INIS)

Bellido, Edson P; Bobadilla, Alfredo D; Rangel, Norma L; Seminario, Jorge M; Zhong Hong; Norton, Michael L; Sinitskii, Alexander

2009-01-01

The temperature dependences of the current-voltage characteristics of a sample of triangular DNA origami deposited in a 100 nm gap between platinum electrodes are measured using a probe station. Below 240 K, the sample shows high impedance, similar to that of the substrate. Near room temperature the current shows exponential behavior with respect to the inverse of temperature. Sweep times of 1 s do not yield a steady state; however sweep times of 450 s for the bias voltage secure a steady state. The thermionic emission and hopping conduction models yield similar barriers of ∼0.7 eV at low voltages. For high voltages, the hopping conduction mechanism yields a barrier of 0.9 eV and the thermionic emission yields 1.1 eV. The experimental data set suggests that the dominant conduction mechanism is hopping in the range 280-320 K. The results are consistent with theoretical and experimental estimates of the barrier for related molecules.

Automatic Voltage Control (AVC) System under Uncertainty from Wind Power

DEFF Research Database (Denmark)

Qin, Nan; Abildgaard, Hans; Flynn, Damian

2016-01-01

An automatic voltage control (AVC) system maintains the voltage profile of a power system in an acceptable range and minimizes the operational cost by coordinating the regulation of controllable components. Typically, all of the parameters in the optimization problem are assumed to be certain...... and constant in the decision making process. However, for high shares of wind power, uncertainty in the decision process due to wind power variability may result in an infeasible AVC solution. This paper proposes a voltage control approach which considers the voltage uncertainty from wind power productions....... The proposed method improves the performance and the robustness of a scenario based approach by estimating the potential voltage variations due to fluctuating wind power production, and introduces a voltage margin to protect the decision against uncertainty for each scenario. The effectiveness of the proposed...

Analog Circuit Design Low Voltage Low Power; Short Range Wireless Front-Ends; Power Management and DC-DC

CERN Document Server

Roermund, Arthur; Baschirotto, Andrea

2012-01-01

The book contains the contribution of 18 tutorials of the 20th workshop on Advances in Analog Circuit Design.  Each part discusses a specific to-date topic on new and valuable design ideas in the area of analog circuit design. Each part is presented by six experts in that field and state of the art information is shared and overviewed. This book is number 20 in this successful series of Analog Circuit Design, providing valuable information and excellent overviews of Low-Voltage Low-Power Data Converters - Chaired by Prof. Anderea Baschirotto, University of Milan-Bicocca Short Range Wireless Front-Ends - Chaired by Prof. Arthur van Roermund, Eindhoven University of Technology Power management and DC-DC - Chaired by Prof. M. Steyaert, Katholieke University Leuven Analog Circuit Design is an essential reference source for analog circuit designers and researchers wishing to keep abreast with the latest development in the field. The tutorial coverage also makes it suitable for use in an advanced design.

Hysteretic current-voltage characteristics in RF-sputtered nanocrystalline TiO2 thin films

International Nuclear Information System (INIS)

Villafuerte, Manuel; Juarez, Gabriel; Heluani, Silvia P. de; Comedi, David

2007-01-01

We have measured the current-voltage characteristics at room temperature of a nanocrystalline TiO 2 thin film fabricated by reactive RF-sputtering deposition and sandwiched between ITO (indium-tin-oxide)-buffered glass substrate and an indium top electrode. The I-V characteristics are ohmic for low voltages and become non-linear, hysteretic and asymmetric as the voltage is increased. The system is shown to be well represented by two distinct resistance states in the non-ohmic region. Current transient evolutions were also measured for constant voltage excitations. The resistance is stable in time for voltages in the ohmic regime. In contrast, for voltages in the non-ohmic regime, the resistance has a small variation for a short period of time (order of tens seconds) and then increases with time. For those transients, long characteristic times (on the order of tens of minutes up to hours) were found. The behavior of the system is discussed on the basis of experimental results reported in the literature for similar systems and existing models for electric-field induced resistive switching

Reliability of semiconductor and gas-filled diodes for over-voltage protection exposed to ionizing radiation

Directory of Open Access Journals (Sweden)

Stanković Koviljka

2009-01-01

Full Text Available The wide-spread use of semiconductor and gas-filled diodes for non-linear over-voltage protection results in a variety of possible working conditions. It is therefore essential to have a thorough insight into their reliability in exploitation environments which imply exposure to ionizing radiation. The aim of this paper is to investigate the influence of irradiation on over-voltage diode characteristics by exposing the diodes to californium-252 combined neutron/gamma radiation field. The irradiation of semiconductor over-voltage diodes causes severe degradation of their protection characteristics. On the other hand, gas-filled over-voltage diodes exhibit a temporal improvement of performance. The results are presented with the accompanying theoretical interpretations of the observed changes in over-voltage diode behaviour, based on the interaction of radiation with materials constituting the diodes.

Summary of transient high-voltage calculations for the FRX-C experiment

International Nuclear Information System (INIS)

Kewish, R.W. Jr.; Rej, D.J.

1982-06-01

Calculations of the electrical circuit equations are performed over a wide range of parameters corresponding to the FRX-C field-reversed THETA-pinch experiment at Los Alamos. Without any plasma or external damping, serious voltage doubling and quadrupling of the main capacitor bank charge voltage are observed. These oscillating high voltages are found to be adequately suppressed by the strategic placement of external snubber circuitry. On the other hand, no doubling of the THETA-pinch preionization bank charge voltage is found. Calculations of the equations for the z-pinch preionization circuit are also performed

Optimal Operation of Distribution Electronic Power Transformer Using Linear Quadratic Regulator Method

Directory of Open Access Journals (Sweden)

Mohammad Hosein Rezaei

2011-10-01

Full Text Available Transformers perform many functions such as voltage transformation, isolation and noise decoupling. They are indispensable components in electric power distribution system. However, at low frequencies (50 Hz, they are one of the heaviest and the most expensive equipment in an electrical distribution system. Nowadays, electronic power transformers are used instead of conventional power transformers that do voltage transformation and power delivery in power system by power electronic converter. In this paper, the structure of distribution electronic power transformer (DEPT are analized and then paid attention on the design of a linear-quadratic-regulator (LQR with integral action to improve dynamic performance of DEPT with voltage unbalance, voltage sags, voltage harmonics and voltage flicker. The presentation control strategy is simulated by MATLAB/SIMULINK. In addition, the results that are in terms of dc-link reference voltage, input and output voltages clearly show that a better dynamic performance can be achieved by using the LQR method when compared to other techniques.

Possible influence of the voltage dependence of the Josephson tunneling current I(V,psi) on the corresponding current-voltage characteristic

International Nuclear Information System (INIS)

Hahlbohm, H.D.; Luebbig, H.; Luther, H.

1975-01-01

Analog computer calculations of the current-voltage characteristic involving the voltage dependence of the amplitudes of the tunneling current equation explicitly, for the case of a current driven tunneling junction at different temperatures are reported on. These studies are based upon the adiabatic representation of the current-phase relation. The influence of retarding effects is not included. Therefore the computational results can lead to practical consequences at best in the range near the transition temperature. (Auth.)

Modeling Single-Phase Inverter and Its Decentralized Coordinated Control by Using Feedback Linearization

Directory of Open Access Journals (Sweden)

Renke Han

2014-01-01

Full Text Available It is a very crucial problem to make a microgrid operated reasonably and stably. Considering the nonlinear mathematics model of inverter established in this paper, the input-output feedback linearization method is used to transform the nonlinear mathematics model of inverters to a linear tracking synchronization and consensus regulation control problem. Based on the linear mathematics model and multiagent consensus algorithm, a decentralized coordinated controller is proposed to make amplitudes and angles of voltages from inverters be consensus and active and reactive power shared in the desired ratio. The proposed control is totally distributed because each inverter only requires local and one neighbor’s information with sparse communication structure based on multiagent system. The hybrid consensus algorithm is used to keep the amplitude of the output voltages following the leader and the angles of output voltage as consensus. Then the microgrid can be operated more efficiently and the circulating current between DGs can be effectively suppressed. The effectiveness of the proposed method is proved through simulation results of a typical microgrid system.

Beyond voltage-gated ion channels: Voltage-operated membrane proteins and cellular processes.

Science.gov (United States)

Zhang, Jianping; Chen, Xingjuan; Xue, Yucong; Gamper, Nikita; Zhang, Xuan

2018-04-18

Voltage-gated ion channels were believed to be the only voltage-sensitive proteins in excitable (and some non-excitable) cells for a long time. Emerging evidence indicates that the voltage-operated model is shared by some other transmembrane proteins expressed in both excitable and non-excitable cells. In this review, we summarize current knowledge about voltage-operated proteins, which are not classic voltage-gated ion channels as well as the voltage-dependent processes in cells for which single voltage-sensitive proteins have yet to be identified. Particularly, we will focus on the following. (1) Voltage-sensitive phosphoinositide phosphatases (VSP) with four transmembrane segments homologous to the voltage sensor domain (VSD) of voltage-gated ion channels; VSPs are the first family of proteins, other than the voltage-gated ion channels, for which there is sufficient evidence for the existence of the VSD domain; (2) Voltage-gated proton channels comprising of a single voltage-sensing domain and lacking an identified pore domain; (3) G protein coupled receptors (GPCRs) that mediate the depolarization-evoked potentiation of Ca 2+ mobilization; (4) Plasma membrane (PM) depolarization-induced but Ca 2+ -independent exocytosis in neurons. (5) Voltage-dependent metabolism of phosphatidylinositol 4,5-bisphosphate (PtdIns[4,5]P 2 , PIP 2 ) in the PM. These recent discoveries expand our understanding of voltage-operated processes within cellular membranes. © 2018 Wiley Periodicals, Inc.

A speed estimation unit for induction motors based on adaptive linear combiner

International Nuclear Information System (INIS)

Marei, Mostafa I.; Shaaban, Mostafa F.; El-Sattar, Ahmed A.

2009-01-01

This paper presents a new induction motor speed estimation technique, which can estimate the rotor resistance as well, from the measured voltage and current signals. Moreover, the paper utilizes a novel adaptive linear combiner (ADALINE) structure for speed and rotor resistance estimations. This structure can deal with the multi-output systems and it is called MO-ADALINE. The model of the induction motor is arranged in a linear form, in the stationary reference frame, to cope with the proposed speed estimator. There are many advantages of the proposed unit such as wide speed range capability, immunity against harmonics of measured waveforms, and precise estimation of the speed and the rotor resistance at different dynamic changes. Different types of induction motor drive systems are used to evaluate the dynamic performance and to examine the accuracy of the proposed unit for speed and rotor resistance estimation.

The pulse-driven AC Josephson voltage normal; Das pulsgetriebene AC-Josephson-Spannungsnormal

Energy Technology Data Exchange (ETDEWEB)

Kieler, Oliver [Physikalisch-Technische Bundesanstalt (PTB), Braunschweig (Germany). Arbeitsgruppe 2.43 ' ' Josephson-Schaltungen' '

2016-09-15

In this contribution quantum precise alternating-voltage sources are presented, which make the generation of arbitrary wave forms with highest spectral purity with a high bandwidth from DC up to the MHz range possible. Heartpiece of these Josephson voltage normals is a serial circuit of many thousand Josephson contacts, which make by irradiation with high-frequency radiation (microwaves) the generation of highly precise voltage values possible. Thereby in the current-voltage characteristics stages of constant voltage, so called Shapiro stages, occur. Illustratively these stages can be described by the transfer of a certain number of flux quanta through the Josephson contacts.

Dual voltage power supply with 48 volt

Energy Technology Data Exchange (ETDEWEB)

Froeschl, Joachim; Proebstle, Hartmut; Sirch, Ottmar [BMW Group, Muenchen (Germany)

2012-11-01

Automotive electrics/electronics have just reached a period of tremendous change. High voltage systems for Hybrid, Plug-In Hybrid or Battery Electric Vehicles with high power electric motors, high energy accumulators and electric climate compressors will be introduced in order to achieve the challenging targets for CO{sub 2} emissions and energy efficiency and to anticipate the mobility of the future. Additionally, innovations and the continuous increase of functionality for comfort, safety, driver assistance and infotainment systems require more and more electrical power of the vehicle power supply at all. On the one hand side electrified vehicles will certainly achieve a significant market share, on the other hand side they will increase the pressure to conventional vehicles with combustion engines for fuel consumption and CO{sub 2} emissions. These vehicles will be enabled to keep their competitiveness by new functions and the optimization of their electric systems. A dual voltage power supply with 48 Volt and 12 Volt will be one of the key technologies to realize these requirements. The power capability of the existing 12 Volt power supply has reached its limits. Further potentials can only be admitted by the introduction of 48 Volt. For this reason the car manufacturers Audi, BMW, Daimler, Porsche and Volkswagen started very early on this item and developed a common specification of the new voltage range. Now, it is necessary to identify the probable systems at this voltage range and to start the developments. (orig.)

High-temperature performance of MoS{sub 2} thin-film transistors: Direct current and pulse current-voltage characteristics

Energy Technology Data Exchange (ETDEWEB)

Jiang, C.; Samnakay, R.; Balandin, A. A., E-mail: balandin@ee.ucr.edu [Nano-Device Laboratory (NDL), Department of Electrical Engineering, Bourns College of Engineering, University of California—Riverside, Riverside, California 92521 (United States); Phonon Optimized Engineered Materials (POEM) Center, Materials Science and Engineering Program, University of California—Riverside, Riverside, California 92521 (United States); Rumyantsev, S. L. [Department of Electrical, Computer, and Systems Engineering, Center for Integrated Electronics, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States); Ioffe Physical-Technical Institute, St. Petersburg 194021 (Russian Federation); Shur, M. S. [Department of Electrical, Computer, and Systems Engineering, Center for Integrated Electronics, Rensselaer Polytechnic Institute, Troy, New York 12180 (United States)

2015-02-14

We report on fabrication of MoS{sub 2} thin-film transistors (TFTs) and experimental investigations of their high-temperature current-voltage characteristics. The measurements show that MoS{sub 2} devices remain functional to temperatures of at least as high as 500 K. The temperature increase results in decreased threshold voltage and mobility. The comparison of the direct current (DC) and pulse measurements shows that the direct current sub-linear and super-linear output characteristics of MoS{sub 2} thin-films devices result from the Joule heating and the interplay of the threshold voltage and mobility temperature dependences. At temperatures above 450 K, a kink in the drain current occurs at zero gate voltage irrespective of the threshold voltage value. This intriguing phenomenon, referred to as a “memory step,” was attributed to the slow relaxation processes in thin films similar to those in graphene and electron glasses. The fabricated MoS{sub 2} thin-film transistors demonstrated stable operation after two months of aging. The obtained results suggest new applications for MoS{sub 2} thin-film transistors in extreme-temperature electronics and sensors.

A novel MR-compatible sensor to assess active medical device safety: stimulation monitoring, rectified radio frequency pulses, and gradient-induced voltage measurements.

Science.gov (United States)

Barbier, Thérèse; Aissani, Sarra; Weber, Nicolas; Pasquier, Cédric; Felblinger, Jacques

2018-03-30

To evaluate the function of an active implantable medical device (AIMD) during magnetic resonance imaging (MRI) scans. The induced voltages caused by the switching of magnetic field gradients and rectified radio frequency (RF) pulse were measured, along with the AIMD stimulations. An MRI-compatible voltage probe with a bandwidth of 0-40 kHz was designed. Measurements were carried out both on the bench with an overvoltage protection circuit commonly used for AIMD and with a pacemaker during MRI scans on a 1.5 T (64 MHz) MR scanner. The sensor exhibits a measurement range of ± 15 V with an amplitude resolution of 7 mV and a temporal resolution of 10 µs. Rectification was measured on the bench with the overvoltage protection circuit. Linear proportionality was confirmed between the induced voltage and the magnetic field gradient slew rate. The pacemaker pacing was recorded successfully during MRI scans. The characteristics of this low-frequency voltage probe allow its use with extreme RF transmission power and magnetic field gradient positioning for MR safety test of AIMD during MRI scans.

Stray voltage mitigation

Energy Technology Data Exchange (ETDEWEB)

Jamali, B.; Piercy, R.; Dick, P. [Kinetrics Inc., Toronto, ON (Canada). Transmission and Distribution Technologies

2008-04-09

This report discussed issues related to farm stray voltage and evaluated mitigation strategies and costs for limiting voltage to farms. A 3-phase, 3-wire system with no neutral ground was used throughout North America before the 1930s. Transformers were connected phase to phase without any electrical connection between the primary and secondary sides of the transformers. Distribution voltage levels were then increased and multi-grounded neutral wires were added. The earth now forms a parallel return path for the neutral current that allows part of the neutral current to flow continuously through the earth. The arrangement is responsible for causing stray voltage. Stray voltage causes uneven milk production, increased incidences of mastitis, and can create a reluctance to drink water amongst cows when stray voltages are present. Off-farm sources of stray voltage include phase unbalances, undersized neutral wire, and high resistance splices on the neutral wire. Mitigation strategies for reducing stray voltage include phase balancing; conversion from single to 3-phase; increasing distribution voltage levels, and changing pole configurations. 22 refs., 5 tabs., 13 figs.

A High Performance Silicon-on-Insulator LDMOSTT Using Linearly Increasing Thickness Techniques

International Nuclear Information System (INIS)

Yu-Feng, Guo; Zhi-Gong, Wang; Gene, Sheu; Jian-Bing, Cheng

2010-01-01

We present a new technique to achieve uniform lateral electric field and maximum breakdown voltage in lateral double-diffused metal-oxide-semiconductor transistors fabricated on silicon-on-insulator substrates. A linearly increasing drift-region thickness from the source to the drain is employed to improve the electric field distribution in the devices. Compared to the lateral linear doping technique and the reduced surface field technique, two-dimensional numerical simulations show that the new device exhibits reduced specific on-resistance, maximum off- and on-state breakdown voltages, superior quasi-saturation characteristics and improved safe operating area. (condensed matter: electronic structure, electrical, magnetic, and optical properties)

Wideband Electrostatic Vibration Energy Harvester (e-VEH) Having a Low Start-Up Voltage Employing a High-Voltage Integrated Interface

International Nuclear Information System (INIS)

Dudka, A; Galayko, D; Basset, P; Cottone, F; Blokhina, E

2013-01-01

This paper reports on an electrostatic Vibration Energy Harvester (e-VEH) system, for which the energy conversion process is initiated with a low bias voltage and is compatible with wideband stochastic external vibrations. The system employs the auto-synchronous conditioning circuit topology with the use of a novel dedicated integrated low-power high-voltage switch that is needed to connect the charge pump and flyback – two main parts of the used conditioning circuit. The proposed switch is designed and implemented in AMS035HV CMOS technology. Thanks to the proposed switch device, which is driven with a low-voltage ground-referenced logic, the e-VEH system may operate within a large voltage range, from a pre-charge low voltage up to several tens volts. With such a high-voltage e-VEH operation, it is possible to obtain a strong mechanical coupling and a high rate of vibration energy conversion. The used transducer/resonator device is fabricated with a batch-processed MEMS technology. When excited with stochastic vibrations having an acceleration level of 0.8 g rms distributed in the band 110–170 Hz, up to 0.75 μW of net electrical power has been harvested with our system. This work presents an important milestone in the challenge of designing a fully integrated smart conditioning interface for the capacitive e-VEHs

Square pulse linear transformer driver

Directory of Open Access Journals (Sweden)

A. A. Kim

2012-04-01

Full Text Available The linear transformer driver (LTD technological approach can result in relatively compact devices that can deliver fast, high current, and high-voltage pulses straight out of the LTD cavity without any complicated pulse forming and pulse compression network. Through multistage inductively insulated voltage adders, the output pulse, increased in voltage amplitude, can be applied directly to the load. The usual LTD architecture [A. A. Kim, M. G. Mazarakis, V. A. Sinebryukhov, B. M. Kovalchuk, V. A. Vizir, S. N Volkov, F. Bayol, A. N. Bastrikov, V. G. Durakov, S. V. Frolov, V. M. Alexeenko, D. H. McDaniel, W. E. Fowler, K. LeCheen, C. Olson, W. A. Stygar, K. W. Struve, J. Porter, and R. M. Gilgenbach, Phys. Rev. ST Accel. Beams 12, 050402 (2009PRABFM1098-440210.1103/PhysRevSTAB.12.050402; M. G. Mazarakis, W. E. Fowler, A. A. Kim, V. A. Sinebryukhov, S. T. Rogowski, R. A. Sharpe, D. H. McDaniel, C. L. Olson, J. L. Porter, K. W. Struve, W. A. Stygar, and J. R. Woodworth, Phys. Rev. ST Accel. Beams 12, 050401 (2009PRABFM1098-440210.1103/PhysRevSTAB.12.050401] provides sine shaped output pulses that may not be well suited for some applications like z-pinch drivers, flash radiography, high power microwaves, etc. A more suitable power pulse would have a flat or trapezoidal (rising or falling top. In this paper, we present the design and first test results of an LTD cavity that generates such a type of output pulse by including within its circular array a number of third harmonic bricks in addition to the main bricks. A voltage adder made out of a square pulse cavity linear array will produce the same shape output pulses provided that the timing of each cavity is synchronized with the propagation of the electromagnetic pulse.

Lightning-induced overvoltages in low-voltage systems

Energy Technology Data Exchange (ETDEWEB)

Hoeidalen, Hans Kristian

1997-12-31

Lightning-induced overvoltages (LIOs) are a main source of failures in low-voltage overhead line systems. This thesis deals mainly with calculations of LIOs aiming to enable the design of a proper voltage protection. Models for calculation of LIOs are adapted from the literature or developed based on measurements. The models used are believed to be fairly accurate for the first few microseconds, which is usually sufficient for predicting the maximum induced voltage in the system. The lightning channel is modelled by the Modified Transmission Line (MTL) model with the Transmission Line (TL) model as a special case. The coupling between the electrical fields from a lightning channel and an overhead line is modelled by Agrawal`s model. The attenuation of electrical fields over a lossy ground is modelled by Norton`s- or the Surface Impedance methods. The validity of all the applied models is analysed. In addition, measurements have been performed in order to develop models of distribution transformers and low-voltage power installation (LVPI) networks. Simple models of typical transformers and LVPIs are developed for calculations when specific data are unavailable. The practical range of values and its influence on the LIOs in a system is investigated. The main frequency range of interest related to LIOs is 10 kHz - 1 MHz in which all the models are accurate. The adapted or developed models are used to calculate LIOs in low-voltage systems. The influence of various key parameters in the system is investigated. Most important are the return stroke amplitude and rise time, the overhead line height and location, the termination of overhead line segments, neutral grounding, and the ground conductivity. 135 refs., 136 figs., 12 tabs.

In situ scanning tunnelling microscopy of redox molecules. Coherent electron transfer at large bias voltages

DEFF Research Database (Denmark)

Zhang, Jingdong; Kuznetsov, A.M.; Ulstrup, Jens

2003-01-01

Theories of in situ scanning tunnelling microscopy (STM) of molecules with redox levels near the substrate and tip Fermi levels point to 'spectroscopic' current-overpotential features. Prominent features require a narrow 'probing tip', i.e. a small bias voltage, eV(bias), compared...... a broad tunnelling current-overpotential range at a constant (large) bias voltage of +0.2 V. The current is found to be constant over a 0.25 V overpotential range, which covers roughly the range where the oxidised and reduced redox levels are located within the energy tip. STM contrast and apparent...... of previous theoretical work on in situ STM of redox molecules, to large bias voltages, \\eV(bias)\\ > E-r. Large bias voltages give tunnelling contrasts independent of the overpotential over a broad range, as both the oxidised and reduced redox levels are located within the 'energy tip' between the substrate...

Single-InN-Nanowire Nanogenerator with Upto 1 V Output Voltage

KAUST Repository

Huang, Chi-Te

2010-07-30

Piezoelectric potential of a InN nanowire (NW) growing along [011̄0] can be positive, negative, and zero depending on the direction of the applied transverse force. By measuring the output voltage of a InN-NW-based nanogenerator, about 40% to 55% of output voltages are within the range of ?1 and ?20 mV, and 25% to 30% of output voltages would exceed ?100 mV. Some output voltages could reach the magnitude of ?1000 mV, showing its great potential for fabricating high-output nanogenerators. © 2010 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Development of anode high voltage power supply system for ECRH of HL-2A tokamak

International Nuclear Information System (INIS)

Chen Wenguang

2009-01-01

The anode high voltage power supply system consist of DC high-voltage power supply (HVPS) and pulse modulator. SCR is used to vary AC input voltage of the step-up transformer by controlling the trigger phase in the HVPS, and regulate the DC output voltage linearly at the potential of low-end via BJT, Dual closed-loop control technology is applied in the controller, and its maximum output is at 30kV and 130mA. Tetrode is the core component of the modulator. The circuit design is optimized by using the simulation software. Test and HL-2A discharge experimental results show that the power supply system is designed with some characteristics of output scale widely, low ripple and modulate quickly. (authors)

Reliability of supply of switchgear for auxiliary low voltage in substations extra high voltage to high voltage

Directory of Open Access Journals (Sweden)

Perić Dragoslav M.

2015-01-01

Full Text Available Switchgear for auxiliary low voltage in substations (SS of extra high voltages (EHV to high voltage (HV - SS EHV/HV kV/kV is of special interest for the functioning of these important SS, as it provides a supply for system of protection and other vital functions of SS. The article addresses several characteristic examples involving MV lines with varying degrees of independence of their supply, and the possible application of direct transformation EHV/LV through special voltage transformers. Auxiliary sources such as inverters and diesel generators, which have limited power and expensive energy, are also used for the supply of switchgear for auxiliary low voltage. Corresponding reliability indices are calculated for all examples including mean expected annual engagement of diesel generators. The applicability of certain solutions of switchgear for auxiliary low voltage SS EHV/HV, taking into account their reliability, feasibility and cost-effectiveness is analyzed too. In particular, the analysis of applications of direct transformation EHV/LV for supply of switchgear for auxiliary low voltage, for both new and existing SS EHV/HV.

Charge-pump voltage converter

Science.gov (United States)

Brainard, John P [Albuquerque, NM; Christenson, Todd R [Albuquerque, NM

2009-11-03

A charge-pump voltage converter for converting a low voltage provided by a low-voltage source to a higher voltage. Charge is inductively generated on a transfer rotor electrode during its transit past an inductor stator electrode and subsequently transferred by the rotating rotor to a collector stator electrode for storage or use. Repetition of the charge transfer process leads to a build-up of voltage on a charge-receiving device. Connection of multiple charge-pump voltage converters in series can generate higher voltages, and connection of multiple charge-pump voltage converters in parallel can generate higher currents. Microelectromechanical (MEMS) embodiments of this invention provide a small and compact high-voltage (several hundred V) voltage source starting with a few-V initial voltage source. The microscale size of many embodiments of this invention make it ideally suited for MEMS- and other micro-applications where integration of the voltage or charge source in a small package is highly desirable.

High voltage systems

International Nuclear Information System (INIS)

Martin, M.

1991-01-01

Industrial processes usually require electrical power. This power is used to drive motors, to heat materials, or in electrochemical processes. Often the power requirements of a plant require the electric power to be delivered at high voltage. In this paper high voltage is considered any voltage over 600 V. This voltage could be as high as 138,000 V for some very large facilities. The characteristics of this voltage and the enormous amounts of power being transmitted necessitate special safety considerations. Safety must be considered during the four activities associated with a high voltage electrical system. These activities are: Design; Installation; Operation; and Maintenance

Intelligent voltage control in a DC micro-grid containing PV generation and energy storage

OpenAIRE

Rouzbehi, Kumars; Miranian, Arash; Candela García, José Ignacio; Luna Alloza, Álvaro; Rodríguez Cortés, Pedro

2014-01-01

This paper proposes an intelligent control scheme for DC voltage regulationin a DC micro-grid integrating photovoltaic (PV) generation, energy storage and electric loads. The maximum power generation of the PV panel is followed using the incremental conductance (IC) maximum power point tracking (MPPT) algorithm while a high-performance local linear controller (LLC)is developed for the DC voltage control in the micro-grid.The LLC, as a data-driven control strategy, controls the bidirectional c...

Voltage control in smart grid using T2FLS

DEFF Research Database (Denmark)

Khodayar, Yaser; Sabahi, Kamel; Hajizadeh, Amin

2017-01-01

coordinated to keep the voltage within the standard range. Therefore, in this paper, a multi-agent controller based on type-2 fuzzy logic system (T2FLS) is utilized to coordinate the DG, ULTC, and load to regulate the voltage of the smart grid in the presence of noise and uncertainty. The proposed fuzzy...... system identifies the different parts of the smart grid as an agent (i.e. ULTC, DG, and load) and regulates the voltage by managing them. A 16-bus power system has been utilized to demonstrate the effectiveness of the proposed method. It has been shown that the proposed T2FLS controller outperforms...... the type-1 fuzzy controller and regulates the voltage in an appropriate way even in the presence of the different levels of measurement noise and uncertainty....

Impact of cell-voltage on energy and power performance of supercapacitors with single-walled carbon nanotube electrodes

Energy Technology Data Exchange (ETDEWEB)

Izadi-Najafabadi, Ali; Yamada, Takeo; Futaba, Don N.; Iijima, Sumio [Nanotube Research Center, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hatori, Hiroaki [Project Headquarters, National Institute of Advanced Industrial Science and Technology, Tsukuba (Japan); Hata, Kenji [Japan Science and Technology Agency JST, Kawaguchi (Japan)

2010-12-15

We report the energy and power voltage-dependencies of supercapacitors using single-walled carbon nanotube electrodes. The energy density was dependent on the cell-voltage cubed (up to 4 V: E = 1.43 x V{sup 3}). The cubic relationship was attributed to the linear increase of the capacitance as a function of voltage, enabled by electrochemical doping. Furthermore, while up to 3.5 V, the maximum power rating of the nanotube electrodes increased as a function of the cell-voltage squared, beyond 3.5 V, a decline in power was observed as a result of depletion of the electrolyte's ions. (author)

Effect of temperature and pressure on non-linear conduction in GeTeSe chalcogenide glass

International Nuclear Information System (INIS)

El-Mansy, M.K.

1998-01-01

The I-V characteristic curves were studied in the temperature range 301-359 K and pressure range up to 7.15 x 10 9 Pa which illustrate a non-linear behaviour below (high-resistance region) and beyond (negative-resistance region) a breakdown point characterising Ge 27 Te 62 Se 11 chalcogenide glasses. The general behaviour is shifted towards lower voltage and higher current when the ambient temperature and/or the applied pressure were increased. The non-linear behaviour in the pre breakdown region is discussed according to the Poole-Frenkel field emission of electrons from deep traps located at a depth equal to 0.372eV. The analysis of the effect of field on the non-linear conduction in Ge 27 Te 62 Se 11 chalcogenide glass suggests a modification of the energy difference between filled and empty sites, where the effect of pressure suggests a reduction of the energy gap width. The analysis based on simple thermal effects in the region closer to the breakdown point implies the electrothermal process initiating the negative resistance region. The results of post breakdown region (negative-resistance region) imply the electron hopping between filled and empty localised states at Fermi level. The density of localised states is estimated which lies in the range 5.7 x 10 16 -1.84 x 10 18 cm -3 /eV

Performance test of 100 W linear compressor

Energy Technology Data Exchange (ETDEWEB)

Ko, J; Ko, D. Y.; Park, S. J.; Kim, H. B.; Hong, Y. J.; Yeom, H. K. [Korea Institute of Machinery and Materials, Daejeon(Korea, Republic of)

2013-09-15

In this paper, we present test results of developed 100 W class linear compressor for Stirling-type pulse tube refrigerator. The fabricated linear compressor has dual-opposed configuration, free piston and moving magnet type linear motor. Power transfer, efficiency and required pressure waveform are predicted with designed and measured specifications. In experiments, room temperature test with flow impedance is conducted to evaluate performance of developed linear compressor. Flow impedance is loaded to compressor with metering valve for flow resistance, inertance tube for flow inertance and buffer volumes for flow compliance. Several operating parameters such as input voltage, current, piston displacement and pressure wave are measured for various operating frequency and fixed input current level. Behaviors of dynamics and performance of linear compressor as varying flow impedance are discussed with measured experimental results. The developed linear compressor shows 124 W of input power, 86 % of motor efficiency and 60 % of compressor efficiency at its resonant operating condition.

Process engineering of high voltage alginate encapsulation of mesenchymal stem cells

International Nuclear Information System (INIS)

Gryshkov, Oleksandr; Pogozhykh, Denys; Zernetsch, Holger; Hofmann, Nicola; Mueller, Thomas; Glasmacher, Birgit

2014-01-01

Encapsulation of stem cells in alginate beads is promising as a sophisticated drug delivery system in treatment of a wide range of acute and chronic diseases. However, common use of air flow encapsulation of cells in alginate beads fails to produce beads with narrow size distribution, intact spherical structure and controllable sizes that can be scaled up. Here we show that high voltage encapsulation (≥ 15 kV) can be used to reproducibly generate spherical alginate beads (200–400 μm) with narrow size distribution (± 5–7%) in a controlled manner under optimized process parameters. Flow rate of alginate solution ranged from 0.5 to 10 ml/h allowed producing alginate beads with a size of 320 and 350 μm respectively, suggesting that this approach can be scaled up. Moreover, we found that applied voltages (15–25 kV) did not alter the viability and proliferation of encapsulated mesenchymal stem cells post-encapsulation and cryopreservation as compared to air flow. We are the first who employed a comparative analysis of electro-spraying and air flow encapsulation to study the effect of high voltage on alginate encapsulated cells. This report provides background in application of high voltage to encapsulate living cells for further medical purposes. Long-term comparison and work on alginate–cell interaction within these structures will be forthcoming. - Highlights: • High voltage alginate encapsulation of mesenchymal stem cells (MSCs) was designed. • Reproducible and spherical alginate beads were generated via high voltage. • Air flow encapsulation was utilized as a comparative approach to high voltage. • High voltage did not alter the viability and proliferation of encapsulated MSCs. • High voltage encapsulation can be scaled up and applied in cell-based therapy

Application of active electrode compensation to perform continuous voltage-clamp recordings with sharp microelectrodes.

Science.gov (United States)

Gómez-González, J F; Destexhe, A; Bal, T

2014-10-01

Electrophysiological recordings of single neurons in brain tissues are very common in neuroscience. Glass microelectrodes filled with an electrolyte are used to impale the cell membrane in order to record the membrane potential or to inject current. Their high resistance induces a high voltage drop when passing current and it is essential to correct the voltage measurements. In particular, for voltage clamping, the traditional alternatives are two-electrode voltage-clamp technique or discontinuous single electrode voltage-clamp (dSEVC). Nevertheless, it is generally difficult to impale two electrodes in a same neuron and the switching frequency is limited to low frequencies in the case of dSEVC. We present a novel fully computer-implemented alternative to perform continuous voltage-clamp recordings with a single sharp-electrode. To reach such voltage-clamp recordings, we combine an active electrode compensation algorithm (AEC) with a digital controller (AECVC). We applied two types of control-systems: a linear controller (proportional plus integrative controller) and a model-based controller (optimal control). We compared the performance of the two methods to dSEVC using a dynamic model cell and experiments in brain slices. The AECVC method provides an entirely digital method to perform continuous recording and smooth switching between voltage-clamp, current clamp or dynamic-clamp configurations without introducing artifacts.

RADLAC II/SMILE performance with a magnetically insulated voltage adder

International Nuclear Information System (INIS)

Shope, S.L.; Mazarakis, M.G.; Frost, C.A.; Crist, C.E.; Poukey, J.W.; Prestwich, K.R.; Turman, B.N.; Struve, K.; Welch, D.

1991-01-01

A 12.5-m long Self Magnetically Insulate Transmission LinE (SMILE) that sums the voltages of 8, 2 -MV pulse forming lines was installed in the RADLAC-II linear induction accelerator. The magnetic insulation criteria was calculated using parapotential flow theory and found to agree with MAGIC simulations. High quality annular beams with β perpendicular ≤ 0.1 and a radius r b < 2 cm were measured for currents of 50-100-kA extracted from a magnetic immersed foilless diode. These parameters were achieved with 11 to 15-MV accelerating voltages and 6 to 16-kG diode magnetic field. The experimental results exceeded the design expectations and are in good agreement with code simulations

X-ray spectral meter of high voltages for X-ray apparatuses

International Nuclear Information System (INIS)

Zubkov, I.P.; Larchikov, Yu.V.

1993-01-01

Design of the X-ray spectral meter of high voltages (XRSMHV) for medical X-ray apparatuses permitting to conduct the voltage measurements without connection to current circuits. The XRSMHV consists of two main units: the detector unit based on semiconductor detector and the LP4900B multichannel analyzer (Afora, Finland). The XRSMYV was tested using the pilot plant based on RUM-20 X-ray diagnostic apparatus with high-voltage regulator. It was shown that the developed XRSMHV could be certify in the range of high constant voltages form 40 up to 120 kV with the basic relative error limits ±0.15%. The XRSMHV is used at present as the reference means for calibration of high-voltage medical X-ray equipment

Power Quality Improvement Using an Enhanced Network-Side-Shunt-Connected Dynamic Voltage Restorer

Science.gov (United States)

Fereidouni, Alireza; Masoum, Mohammad A. S.; Moghbel, Moayed

2015-10-01

Among the four basic dynamic voltage restorer (DVR) topologies, the network-side shunt-connected DVR (NSSC-DVR) has a relatively poor performance and is investigated in this paper. A new configuration is proposed and implemented for NSSC-DVR to enhance its performance in compensating (un)symmetrical deep and long voltage sags and mitigate voltage harmonics. The enhanced NSSC-DVR model includes a three-phase half-bridge semi-controlled network-side-shunt-connected rectifier and a three-phase full-bridge series-connected inverter implemented with a back-to-back configuration through a bidirectional buck-boost converter. The network-side-shunt-connected rectifier is employed to inject/draw the required energy by NSSC-DVR to restore the load voltage to its pre-fault value under sag/swell conditions. The buck-boost converter is responsible for maintaining the DC-link voltage of the series-connected inverter at its designated value in order to improve the NSSC-DVR capability in compensating deep and long voltage sags/swells. The full-bridge series-connected inverter permits to compensate unbalance voltage sags containing zero-sequence component. The harmonic compensation of the load voltage is achieved by extracting harmonics from the distorted network voltage using an artificial neural network (ANN) method called adaptive linear neuron (Adaline) strategy. Detailed simulations are performed by SIMULINK/MATLAB software for six case studies to verify the highly robustness of the proposed NSSC-DVR model under various conditions.

Muscle shear elastic modulus is linearly related to muscle torque over the entire range of isometric contraction intensity.

Science.gov (United States)

Ateş, Filiz; Hug, François; Bouillard, Killian; Jubeau, Marc; Frappart, Thomas; Couade, Mathieu; Bercoff, Jeremy; Nordez, Antoine

2015-08-01

Muscle shear elastic modulus is linearly related to muscle torque during low-level contractions (torque over the entire range of isometric contraction and (ii) the influence of the size of the region of interest (ROI) used to average the shear modulus value. Ten healthy males performed two incremental isometric little finger abductions. The joint torque produced by Abductor Digiti Minimi was considered as an index of muscle torque and elastic modulus. A high coefficient of determination (R(2)) (range: 0.86-0.98) indicated that the relationship between elastic modulus and torque can be accurately modeled by a linear regression over the entire range (0% to 100% of MVC). The changes in shear elastic modulus as a function of torque were highly repeatable. Lower R(2) values (0.89±0.13 for 1/16 of ROI) and significantly increased absolute errors were observed when the shear elastic modulus was averaged over smaller ROI, half, 1/4 and 1/16 of the full ROI) than the full ROI (mean size: 1.18±0.24cm(2)). It suggests that the ROI should be as large as possible for accurate measurement of muscle shear modulus. Copyright © 2015 Elsevier Ltd. All rights reserved.

Equilibrium fluctuation relations for voltage coupling in membrane proteins.

Science.gov (United States)

Kim, Ilsoo; Warshel, Arieh

2015-11-01

A general theoretical framework is developed to account for the effects of an external potential on the energetics of membrane proteins. The framework is based on the free energy relation between two (forward/backward) probability densities, which was recently generalized to non-equilibrium processes, culminating in the work-fluctuation theorem. Starting from the probability densities of the conformational states along the "voltage coupling" reaction coordinate, we investigate several interconnected free energy relations between these two conformational states, considering voltage activation of ion channels. The free energy difference between the two conformational states at zero (depolarization) membrane potential (i.e., known as the chemical component of free energy change in ion channels) is shown to be equivalent to the free energy difference between the two "equilibrium" (resting and activated) conformational states along the one-dimensional voltage couplin reaction coordinate. Furthermore, the requirement that the application of linear response approximation to the free energy functionals of voltage coupling should satisfy the general free energy relations, yields a novel closed-form expression for the gating charge in terms of other basic properties of ion channels. This connection is familiar in statistical mechanics, known as the equilibrium fluctuation-response relation. The theory is illustrated by considering the coupling of a unit charge to the external voltage in the two sites near the surface of membrane, representing the activated and resting states. This is done using a coarse-graining (CG) model of membrane proteins, which includes the membrane, the electrolytes and the electrodes. The CG model yields Marcus-type voltage dependent free energy parabolas for the response of the electrostatic environment (electrolytes etc.) to the transition from the initial to the final configuratinal states, leading to equilibrium free energy difference and free

Thyristor voltage converter in induction electric drives with microprocessor control

Energy Technology Data Exchange (ETDEWEB)

Braslavsky, I.; Zuzev, A.; Shilin, S. [Electric Drive Department, Urals State Technical University, Ekaterinburg (Russian Federation)

1997-12-31

The paper consists of some results on developed pulse model of thyristor voltage converter which is one of the most mathematically complicated unit of electric drive. The model structure and model parameter calculating method are represented. The application of the model allows to analyse stability in `locally` by the linear pulse system theory methods with talking into consideration quantise processes within the converter. Such application provides the obtaining higher accurate results comparing with the non-linear system theory approximate methods. Logarithmic frequency characteristics are used to analyse converter dynamic features and they are represented too. (orig.) 4 refs.

Low-Energy Real-Time OS Using Voltage Scheduling Algorithm for Variable Voltage Processors

OpenAIRE

Okuma, Takanori; Yasuura, Hiroto

2001-01-01

This paper presents a real-time OS based on $ mu $ITRON using proposed voltage scheduling algorithm for variable voltage processors which can vary supply voltage dynamically. The proposed voltage scheduling algorithms assign voltage level for each task dynamically in order to minimize energy consumption under timing constraints. Using the presented real-time OS, running tasks with low supply voltage leads to drastic energy reduction. In addition, the presented voltage scheduling algorithm is ...

A comparative study of voltage stability indices in a power system

Energy Technology Data Exchange (ETDEWEB)

Sinha, A.K. [I.I.T., Kharagpur (India). Dept. of Electrical Engineering; Hazarika, D. [Assam Engineering College (India)

2000-11-01

The paper compares the effectiveness of voltage stability indices in providing information about the proximity of voltage instability of a power system. Three simple voltage stability indices are proposed and their effectiveness is compared with some of the recently proposed indices. The comparison is carried out over a wide range of system operating conditions by changing the load power factor and feeder X/R ratios. Test results for the IEEE 57 bus and IEEE 118 bus system are presented. (author)

High-voltage test and training of plastic streamer tubes for the DELPHI hadron calorimeter

International Nuclear Information System (INIS)

Alekseev, G.D.; Cellar, S.; Khomenko, B.A.; Korytov, A.V.; Kulinich, P.A.; Micelmacher, G.V.; Sedykh, Yu.V.; Toledo, R.

1987-01-01

The results of high-voltage test and training of plastic streamer tubes of the DELPHI hadron calorimeter are presented. The testing technique is considered in detail. The equipment for high-voltage training consists of a mini-computer, CAMAC-electronics, a controllable high-voltage supply and a digital ampermeter. The experimental results shows that high-voltage training of streamer tubes improves their characteristics. The value of dark current decreased up to 1 μA. The operational voltage range increased by a value more than 300 V

Efficient Wide Range Converters (EWiRaC): A new family of high efficient AC-DC Converters

DEFF Research Database (Denmark)

Petersen, Lars; Andersen, Michael Andreas E.

2006-01-01

The performance in terms of efficiency of the existing power supplies used for PFC is very dependent on the input voltage range. The boost converter is the most commonly used PFC converter because of its simplicity and high efficiency. But, the boost converter as well as other known converters...... suffers a major penalty in efficiency when used at the low end of the voltage range (90VAC) in a universal voltage range application (90-270VAC). This paper addresses this problem by suggesting a new family of converters that effectively reduces the apparent voltage range with a factor of 2 by changing...... the converter topology according to the input voltage. This new converter type has been named: efficient wide range converter (EWiRaC). The performance of the EWiRaC is experimental verified in a universal input range (90-270VAC) application with an output voltage of 185VDC capable of 500W output power. The EWi...

Acoustically determined linear piezoelectric response of lithium niobate up to 1100 V

Energy Technology Data Exchange (ETDEWEB)

Patel, N. [Sandia National Laboratories, Albuquerque, New Mexico 87185 (United States); Department of Electrical and Computer Engineering, University of New Mexico, Albuquerque, New Mexico 87106 (United States); Branch, D. W.; Cular, S. [Sandia National Laboratories, Albuquerque, New Mexico 87185 (United States); Schamiloglu, E. [Department of Electrical and Computer Engineering, University of New Mexico, Albuquerque, New Mexico 87106 (United States)

2014-04-21

We present a method to measure high voltages using the piezoelectric crystal lithium niobate without using voltage dividers. A 36° Y-X cut lithium niobate crystal was coupled to two acoustic transducers, where direct current voltages were applied from 128–1100 V. The time-of-flight through the crystal was determined to be linearly dependent on the applied voltage. A model was developed to predict the time-delay in response to the applied voltage. The results show a sensitivity of 17 fs/V with a measurement error of 1 fs/V was achievable using this method. The sensitivity of this method can be increased by measuring the acoustic wave after multiple passes through the crystal. This method has many advantages over traditional techniques such as: favorable scalability for larger voltages, ease of use, cost effectiveness, and compactness.

Ultra-Low Voltage Class AB Switched Current Memory Cell

DEFF Research Database (Denmark)

Igor, Mucha

1996-01-01

This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process with thr......This paper presents the theoretical basis for the design of class AB switched current memory cells employing floating-gate MOS transistors, suitable for ultra-low-voltage applications. To support the theoretical assumptions circuits based on these cells were designed using a CMOS process...... with threshold voltages of 0.9V. Both hand calculations and PSPICE simulations showed that the cells designed allowed a maximum signal range better than +/-13 micoamp, with a supply voltage down to 1V and a quiescent bias current of 1 microamp, resulting in a very high current efficiency and effective power...

Linear particle accelerator

International Nuclear Information System (INIS)

Richards, J.A.

1977-01-01

A linear particle accelerator which provides a pulsed beam of charged particles of uniform energy is described. The accelerator is in the form of an evacuated dielectric tube, inside of which a particle source is located at one end of the tube, with a target or window located at the other end of the dielectric tube. Along the length of the tube are externally located pairs of metal plates, each insulated from each other in an insulated housing. Each of the plates of a pair are connected to an electrical source of voltage of opposed polarity, with the polarity of the voltage of the plates oriented so that the plate of a pair, nearer to the particle source, is of the opposed polarity to the charge of the particle emitted by the source. Thus, a first plate about the tube located nearest the particle source, attracts a particle which as it passes through the tube past the first plate is then repelled by the reverse polarity of the second plate of the pair to continue moving towards the target

The transfer voltage standard for calibration outside of a laboratory

Directory of Open Access Journals (Sweden)

Urekar Marjan

2017-01-01

Full Text Available The transfer voltage standard is designed for transferring the analog voltage from a calibrator to the process control workstation for multi-electrode electrolysis process in a plating plant. Transfer voltage standard is based on polypropylene capacitors and operational amplifiers with tera-ohm range input resistance needed for capacitor self-discharging effect cancellation. Dielectric absorption effect is described. An instrument for comparison of reference and control voltages is devised, based on precise window comparator. Detailed description of the main task is given, including constraints, theoretical and practical solutions. Procedure for usage of the standard outside of a laboratory conditions is explained. Comparison of expected and realized standard characteristics is given. [Project of the Serbian Ministry of Education, Science and Technological Development, Grant no. TR-32019

Spectrum analysis of a voltage source converter due to semiconductor voltage drops

DEFF Research Database (Denmark)

Rasmussen, Tonny Wederberg; Eltouki, Mustafa

2017-01-01

It is known that power electronic voltage source converters are non-ideal. This paper presents a state-of-the-art review on the effect of semiconductor voltage drop on the output voltage spectrum, using single-phase H-bridge two-level converter topology with natural sampled pulse width modulation....... The paper describes the analysis of output voltage spectrum, when the semiconductor voltage drop is added. The results of the analysis of the spectral contribution including and excluding semiconductor voltage drop reveal a good agreement between the theoretical results, simulations and laboratory...

Charge Gain, Voltage Gain, and Node Capacitance of the SAPHIRA Detector Pixel by Pixel

Science.gov (United States)

Pastrana, Izabella M.; Hall, Donald N. B.; Baker, Ian M.; Jacobson, Shane M.; Goebel, Sean B.

2018-01-01

The University of Hawai`i Institute for Astronomy has partnered with Leonardo (formerly Selex) in the development of HgCdTe linear mode avalanche photodiode (L-APD) SAPHIRA detectors. The SAPHIRA (Selex Avalanche Photodiode High-speed Infra-Red Array) is ideally suited for photon-starved astronomical observations, particularly near infrared (NIR) adaptive optics (AO) wave-front sensing. I have measured the stability, and linearity with current, of a 1.7-um (10% spectral bandpass) infrared light emitting diode (IR LED) used to illuminate the SAPHIRA and have then utilized this source to determine the charge gain (in e-/ADU), voltage gain (in uV/ADU), and node capacitance (in fF) for each pixel of the 320x256@24um SAPHIRA. These have previously only been averages over some sub-array. Determined from the ratio of the temporal averaged signal level to variance under constant 1.7-um LED illumination, I present the charge gain pixel-by-pixel in a 64x64 sub-array at the center of the active area of the SAPHIRA (analyzed separately as four 32x32 sub-arrays) to be about 1.6 e-/ADU (σ=0.5 e-/ADU). Additionally, the standard technique of varying the pixel reset voltage (PRV) in 10 mV increments and recording output frames for the same 64x64 subarray found the voltage gain per pixel to be about 11.7 uV/ADU (σ=0.2 uV/ADU). Finally, node capacitance was found to be approximately 23 fF (σ=6 fF) utilizing the aforementioned charge and voltage gain measurements. I further discuss the linearity measurements of the 1.7-um LED used in the charge gain characterization procedure.

Response of dairy cattle to transient voltages and magnetic fields

International Nuclear Information System (INIS)

Reinemann, D.J.; Laughlin, N.K.; Stetson, L.E.

1995-01-01

Stray voltages in dairy facilities have been studied since the 1970's. Previous research using steady-state ac and dc voltages has defined cow-contact voltage levels which may cause behavior and associated production problems. This research was designed to address concerns over possible effects of transient voltages and magnetic fields on dairy cows. Dairy cows response to transient voltages and magnetic fields was measured. The waveforms of the transient voltages applied were: 5 cycles of 60-Hz ac with a total pulse time of 83 ms, 1 cycle of 60-Hz ac with a total pulse time of 16 ms, and 1 cycle of an ac square wave (spiking positive and negative) of 2-ms duration. Alternating magnetic fields were produced by passing 60-Hz ac fundamental frequency with 2nd and 3rd harmonic and random noise components in metal structures around the cows. The maximum magnetic field associated with this current flow was in excess of 4 G. A wide range of sensitivity to transient voltages was observed among cows. Response levels from 24 cows to each transient exposure were normally distributed. No responses to magnetic fields were observed

Small disturbance voltage stability assessment of power systems by modal analysis and dynamic simulation

International Nuclear Information System (INIS)

Amjady, Nima; Ansari, Mohammad Reza

2008-01-01

The introduction of liberalized electricity markets in many countries has resulted in more highly stressed power systems. On the other hand, operating points of a power system are acceptable in the feasible region, which is surrounded by the borders of different stabilities. Power system instability is critical for all participants of the electricity market. Determination of different stability margins can result in the optimum utilization of power system with minimum risk. This paper focuses on the small disturbance voltage stability, which is an important subset of the power system global stability. This kind of voltage stability is usually evaluated by static analysis tools such as continuation power flow, while it essentially has dynamic nature. Besides, a combination of linear and nonlinear analysis tools is required to correctly analyze it. In this paper, a hybrid evaluation method composed of static, dynamic, linear, and nonlinear analysis tools is proposed for this purpose. Effect of load scenario, generation pattern, branch and generator contingency on the small disturbance voltage stability are evaluated by the hybrid method. The test results are given for New England and IEEE68 bus test systems. (author)

Poisson simulation for high voltage terminal of test stand for 1MV electrostatic accelerator

Energy Technology Data Exchange (ETDEWEB)

Park, Sae-Hoon; Kim, Jeong-Tae; Kwon, Hyeok-Jung; Cho, Yong-Sub [Korea Atomic Energy Research Institute, Daejeon (Korea, Republic of); Kim, Yu-Seok [Dongguk Univ.., Gyeongju (Korea, Republic of)

2014-10-15

KOMAC provide ion beam to user which energy range need to expand to MeV range and develop 1 MV electrostatic accelerator. The specifications of the electrostatic accelerator are 1MV acceleration voltage, 10 mA peak current and variable gas ion. We are developing test stand before set up 1 MV electrostatic accelerator. The test stand voltage is 300 kV and operating time is 8 hours. The test stand is consist of 300 kV high voltage terminal, DC-AC-DC inverter, power supply device inside terminal, 200MHz RF power, 5 kV extraction power supply, 300 kV accelerating tube and vacuum system.. The beam measurement system and beam dump will be installed next to accelerating tube. Poisson code simulation results of the high voltage terminal are presented in this paper. Poisson code has been used to calculate the electric field for high voltage terminal. The results of simulation were verified with reasonable results. The poisson code structure could be apply to the high voltage terminal of the test stand.

Poisson simulation for high voltage terminal of test stand for 1MV electrostatic accelerator

International Nuclear Information System (INIS)

Park, Sae-Hoon; Kim, Jeong-Tae; Kwon, Hyeok-Jung; Cho, Yong-Sub; Kim, Yu-Seok

2014-01-01

KOMAC provide ion beam to user which energy range need to expand to MeV range and develop 1 MV electrostatic accelerator. The specifications of the electrostatic accelerator are 1MV acceleration voltage, 10 mA peak current and variable gas ion. We are developing test stand before set up 1 MV electrostatic accelerator. The test stand voltage is 300 kV and operating time is 8 hours. The test stand is consist of 300 kV high voltage terminal, DC-AC-DC inverter, power supply device inside terminal, 200MHz RF power, 5 kV extraction power supply, 300 kV accelerating tube and vacuum system.. The beam measurement system and beam dump will be installed next to accelerating tube. Poisson code simulation results of the high voltage terminal are presented in this paper. Poisson code has been used to calculate the electric field for high voltage terminal. The results of simulation were verified with reasonable results. The poisson code structure could be apply to the high voltage terminal of the test stand

High voltage, fast turn-on and turn-off switch: Final report for period September 2, 1998 - March 17, 1999

International Nuclear Information System (INIS)

Jochen Schein; Xiaoxi Xu; Niansheng Qi; Steven Gensler; Rahul Prasad; Mahadevan Krishnan

1999-01-01

The aspect to be investigated during this contract was an electron-beam triggered diamond switch to be used in high power modulators. Today's high power modulators require higher voltage switches than those developed to date. Specifically, the proposed 1 TeV linear collider, the NLC/ILC at the Stanford Linear Accelerator Center (SLAC), consists of two linacs with 6600 X-Band klystrons powered by 3300 high power modulators. These modulators require switches capable of handling 80 kV, switching 8 kA with pulse durations ranging from 2 ps (linac) to 6 micros (pre-linac) with switching times <50 ns at pulse repetition frequencies up to 180 Hz. In addition the large number of switches and other components dictate a pulse to pulse jitter of <10 ns and a mean time between failures of at least 50,000 hours. The present approach is to use hydrogen filled thyratrons. While these switches meet the voltage and conduction current requirements they lack the required reliability (pulse to pulse jitter) and lifetime. Research to improve these aspects is in progress. A solid state switch inherently offers the required reliability and lifetime. However, Si-based switches developed to date are limited to about 5 kV and several must be stacked in series to deliver the required voltage. This further increases the already large parts count and compromises reliability and lifetime. A monolithic, solid state switch capable of meeting all the requirements for X-Band modulators would be ideal. DOE selected this proposal for a Phase 1 SBIR award and this final report describes the progress made during the contract

High voltage, fast turn-on and turn-off switch: Final report for period September 2, 1998 - March 17, 1999

Energy Technology Data Exchange (ETDEWEB)

Jochen Schein; Xiaoxi Xu; Niansheng Qi; Steven Gensler; Rahul Prasad; Mahadevan Krishnan

1999-04-10

The aspect to be investigated during this contract was an electron-beam triggered diamond switch to be used in high power modulators. Today's high power modulators require higher voltage switches than those developed to date. Specifically, the proposed 1 TeV linear collider, the NLC/ILC at the Stanford Linear Accelerator Center (SLAC), consists of two linacs with 6600 X-Band klystrons powered by 3300 high power modulators. These modulators require switches capable of handling 80 kV, switching 8 kA with pulse durations ranging from 2 ps (linac) to 6 {micro}s (pre-linac) with switching times <50 ns at pulse repetition frequencies up to 180 Hz. In addition the large number of switches and other components dictate a pulse to pulse jitter of <10 ns and a mean time between failures of at least 50,000 hours. The present approach is to use hydrogen filled thyratrons. While these switches meet the voltage and conduction current requirements they lack the required reliability (pulse to pulse jitter) and lifetime. Research to improve these aspects is in progress. A solid state switch inherently offers the required reliability and lifetime. However, Si-based switches developed to date are limited to about 5 kV and several must be stacked in series to deliver the required voltage. This further increases the already large parts count and compromises reliability and lifetime. A monolithic, solid state switch capable of meeting all the requirements for X-Band modulators would be ideal. DOE selected this proposal for a Phase 1 SBIR award and this final report describes the progress made during the contract.

Rad-Hard, Miniaturized, Scalable, High-Voltage Switching Module for Power Applications Rad-Hard, Miniaturized

Science.gov (United States)

Adell, Philippe C.; Mojarradi, Mohammad; DelCastillo, Linda Y.; Vo, Tuan A.

2011-01-01

A paper discusses the successful development of a miniaturized radiation hardened high-voltage switching module operating at 2.5 kV suitable for space application. The high-voltage architecture was designed, fabricated, and tested using a commercial process that uses a unique combination of 0.25 micrometer CMOS (complementary metal oxide semiconductor) transistors and high-voltage lateral DMOS (diffusion metal oxide semiconductor) device with high breakdown voltage (greater than 650 V). The high-voltage requirements are achieved by stacking a number of DMOS devices within one module, while two modules can be placed in series to achieve higher voltages. Besides the high-voltage requirements, a second generation prototype is currently being developed to provide improved switching capabilities (rise time and fall time for full range of target voltages and currents), the ability to scale the output voltage to a desired value with good accuracy (few percent) up to 10 kV, to cover a wide range of high-voltage applications. In addition, to ensure miniaturization, long life, and high reliability, the assemblies will require intensive high-voltage electrostatic modeling (optimized E-field distribution throughout the module) to complete the proposed packaging approach and test the applicability of using advanced materials in a space-like environment (temperature and pressure) to help prevent potential arcing and corona due to high field regions. Finally, a single-event effect evaluation would have to be performed and single-event mitigation methods implemented at the design and system level or developed to ensure complete radiation hardness of the module.

Prediction of picosecond voltage collapse and electromagnetic wave generation in gas avalanche switches

International Nuclear Information System (INIS)

Mayhall, D.J.; Yee, J.H.; Duong-Van, M.; Villa, F.

1988-01-01

A picosecond speed switch, the Gas Avalanche Switch (GAS), has been proposed for GeV linear accelerators. The medium is gas at high pressure (100 - 700 atm). An avalanche discharge is induced between pulse-charged high voltage electrodes by electron deposition from a fast laser pulse. Avalanche electrons move to the positive electrode, causing the applied voltage to collapse in picoseconds. A two-dimensional (2D) electromagnetic electron fluid computer code calculates the avalanche evolution and voltage collapse in air for an infinite parallel plate capacitor with a 0.1 mm spacing. Calculations are done for an accelerator switch geometry consisting of a 0.7 mm wide by 0.8 mm high, rectangular, high voltage center electrode (CE) between the grounded plates of a parallel plate line of 2 mm spacing. Several variations of CE elevation and initial electron deposition are investigated The 2D character of the outgoing TEM waves is shown

A temperature monitor circuit with small voltage sensitivity using a topology-reconfigurable ring oscillator

Science.gov (United States)

Kishimoto, Tadashi; Ishihara, Tohru; Onodera, Hidetoshi

2018-04-01

In this paper, we propose a temperature monitor circuit that exhibits a small supply voltage sensitivity adopting a circuit topology of a reconfigurable ring oscillator. The circuit topology of the monitor is crafted such that the oscillation frequency is determined by the amount of subthreshold leakage current, which has an exponential dependence on temperature. Another important characteristic of the monitor is its small supply voltage sensitivity. The measured oscillation frequency of a test chip fabricated in a 65 nm CMOS process varies only 2.6% under a wide range of supply voltages from 0.4 to 1.0 V at room temperature. The temperature estimation error ranges from -0.3 to 0.4 °C over a temperature range of 10 to 100 °C.

A high sensitive 66 dB linear dynamic range receiver for 3-D laser radar

Science.gov (United States)

Ma, Rui; Zheng, Hao; Zhu, Zhangming

2017-08-01

This study presents a CMOS receiver chip realized in 0.18 μm standard CMOS technology and intended for high precision 3-D laser radar. The chip includes an adjustable gain transimpedance pre-amplifier, a post-amplifier and two timing comparators. An additional feedback is employed in the regulated cascode transimpedance amplifier to decrease the input impedance, and a variable gain transimpedance amplifier controlled by digital switches and analog multiplexer is utilized to realize four gain modes, extending the input dynamic range. The measurement shows that the highest transimpedance of the channel is 50 k {{Ω }}, the uncompensated walk error is 1.44 ns in a wide linear dynamic range of 66 dB (1:2000), and the input referred noise current is 2.3 pA/\\sqrt{{Hz}} (rms), resulting in a very low detectable input current of 1 μA with SNR = 5.

Design of a 7-MV Linear Transformer Driver (LTD) for down-hole flash x-ray radiography

International Nuclear Information System (INIS)

Cordova, Steve Ray; Welch, Dale Robert; Oliver, Bryan Velten; Rose, David Vincent; Johnson, David Lee; Bruner, Nichelle Lee; Leckbee, Joshua J.

2008-01-01

Pulsed power driven flash x-ray radiography is a valuable diagnostic for subcritical experiments at the Nevada Test Site. The existing dual-axis Cygnus system produces images using a 2.25 MV electron beam diode to produce intense x-rays from a small source. Future hydrodynamic experiments will likely use objects with higher areal mass, requiring increased x-ray dose and higher voltages while maintaining small source spot size. A linear transformer driver (LTD) is a compact pulsed power technology with applications ranging from pulsed power flash x-ray radiography to high current Z-pinch accelerators. This report describes the design of a 7-MV dual-axis system that occupies the same lab space as the Cygnus accelerators. The work builds on a design proposed in a previous report [1]. This new design provides increased diode voltage from a lower impedance accelerator to improve coupling to low impedance diodes such as the self magnetic pinch (SMP) diode. The design also improves the predicted reliability by operating at a lower charge voltage and removing components that have proven vulnerable to failure. Simulations of the new design and experimental results of the 1-MV prototype are presented

The Role of Data Range in Linear Regression

Science.gov (United States)

da Silva, M. A. Salgueiro; Seixas, T. M.

2017-01-01

Measuring one physical quantity as a function of another often requires making some choices prior to the measurement process. Two of these choices are: the data range where measurements should focus and the number (n) of data points to acquire in the chosen data range. Here, we consider data range as the interval of variation of the independent…

Induction sensor for measuring the accelerating voltage in an iron-free induction accelerator

International Nuclear Information System (INIS)

Bol'nykh, N.S.; Il'in, Yu.M.; Kostyushok, A.A.; Suvorov, V.A.

1987-01-01

An inductive sensor is described for measuring the amplitude and form of the accelerating-voltage pulse in the storage coils in a radial iron-free linear induction accelerator. The sensor does not respond to interference from external fields and does not require adjustment after calibration

A novel high voltage start up circuit for an integrated switched mode power supply

Energy Technology Data Exchange (ETDEWEB)

Hu Hao; Chen Xingbi, E-mail: huhao21@uestc.edu.c [State Key Laboratory of Electronic Thin Films and Integrated Devices, University of Electronic Science and Technology of China, Chengdu 610054 (China)

2010-09-15

A novel high voltage start up circuit for providing an initial bias voltage to an integrated switched mode power supply (SMPS) is presented. An enhanced mode VDMOS transistor, the gate of which is biased by a floating p-island, is used to provide start up current and sustain high voltage. An NMOS transistor having a high source to ground breakdown voltage is included to extend the bias voltage range to the SMPS. Simulation results indicate that the high voltage start up circuit can start and restart as designed. The proposed structure is believed to be more energy saving and cost-effective compared with other solutions. (semiconductor devices)

Efficient Low-Voltage Operation of a CW Gyrotron Oscillator at 233 GHz.

Science.gov (United States)

Hornstein, Melissa K; Bajaj, Vikram S; Griffin, Robert G; Temkin, Richard J

2007-02-01

The gyrotron oscillator is a source of high average power millimeter-wave through terahertz radiation. In this paper, we report low beam power and high-efficiency operation of a tunable gyrotron oscillator at 233 GHz. The low-voltage operating mode provides a path to further miniaturization of the gyrotron through reduction in the size of the electron gun, power supply, collector, and cooling system, which will benefit industrial and scientific applications requiring portability. Detailed studies of low-voltage operation in the TE(2) (,) (3) (,) (1) mode reveal that the mode can be excited with less than 7 W of beam power at 3.5 kV. During CW operation with 3.5-kV beam voltage and 50-mA beam current, the gyrotron generates 12 W of RF power at 233.2 GHz. The EGUN electron optics code describes the low-voltage operation of the electron gun. Using gun-operating parameters derived from EGUN simulations, we show that a linear theory adequately predicts the low experimental starting currents.

Feedback Linearization Control of a Shunt Active Power Filter Using a Fuzzy Controller

Directory of Open Access Journals (Sweden)

Tianhua Li

2013-09-01

Full Text Available In this paper, a novel feedback linearization based sliding mode controlled parallel active power filter using a fuzzy controller is presented in a three-phase three-wire grid. A feedback linearization control with fuzzy parameter self-tuning is used to implement the DC side voltage regulation while a novel integral sliding mode controller is applied to reduce the total harmonic distortion of the supply current. Since traditional unit synchronous sinusoidal signal calculation methods are not applicable when the supply voltage contains harmonics, a novel unit synchronous sinusoidal signal computing method based on synchronous frame transforming theory is presented to overcome this disadvantage. The simulation results verify that the DC side voltage is very stable for the given value and responds quickly to the external disturbance. A comparison is also made to show the advantages of the novel unit sinusoidal signal calculating method and the super harmonic treatment property of the designed active power filter.

A Cost-effective Method for Resolution Increase of the Twostage Piecewise Linear ADC Used for Sensor Linearization

Directory of Open Access Journals (Sweden)

Jovanović Jelena

2016-02-01

Full Text Available A cost-effective method for resolution increase of a two-stage piecewise linear analog-to-digital converter used for sensor linearization is proposed in this paper. In both conversion stages flash analog-to-digital converters are employed. Resolution increase by one bit per conversion stage is performed by introducing one additional comparator in front of each of two flash analog-to-digital converters, while the converters’ resolutions remain the same. As a result, the number of employed comparators, as well as the circuit complexity and the power consumption originating from employed comparators are for almost 50 % lower in comparison to the same parameters referring to the linearization circuit of the conventional design and of the same resolution. Since the number of employed comparators is significantly reduced according to the proposed method, special modifications of the linearization circuit are needed in order to properly adjust reference voltages of employed comparators.

E-beam high voltage switching power supply

Science.gov (United States)

Shimer, Daniel W.; Lange, Arnold C.

1997-01-01

A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360.degree./n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load.

E-beam high voltage switching power supply

International Nuclear Information System (INIS)

Shimer, D.W.; Lange, A.C.

1997-01-01

A high power, solid state power supply is described for producing a controllable, constant high voltage output under varying and arcing loads suitable for powering an electron beam gun or other ion source. The present power supply is most useful for outputs in a range of about 100-400 kW or more. The power supply is comprised of a plurality of discrete switching type dc-dc converter modules, each comprising a voltage regulator, an inductor, an inverter for producing a high frequency square wave current of alternating polarity, an improved inverter voltage clamping circuit, a step up transformer, and an output rectifier for producing a dc voltage at the output of each module. The inputs to the converter modules are fed from a common dc rectifier/filter and are linked together in parallel through decoupling networks to suppress high frequency input interactions. The outputs of the converter modules are linked together in series and connected to the input of the transmission line to the load through a decoupling and line matching network. The dc-dc converter modules are phase activated such that for n modules, each module is activated equally 360 degree/n out of phase with respect to a successive module. The phased activation of the converter modules, combined with the square current waveforms out of the step up transformers, allows the power supply to operate with greatly reduced output capacitance values which minimizes the stored energy available for discharge into an electron beam gun or the like during arcing. The present power supply also provides dynamic response to varying loads by controlling the voltage regulator duty cycle using simulated voltage feedback signals and voltage feedback loops. Circuitry is also provided for sensing incipient arc currents reflected at the output of the power supply and for simultaneously decoupling the power supply circuitry from the arcing load. 7 figs

Extension algorithm for generic low-voltage networks

Science.gov (United States)

Marwitz, S.; Olk, C.

2018-02-01

Distributed energy resources (DERs) are increasingly penetrating the energy system which is driven by climate and sustainability goals. These technologies are mostly connected to low- voltage electrical networks and change the demand and supply situation in these networks. This can cause critical network states. Network topologies vary significantly and depend on several conditions including geography, historical development, network design or number of network connections. In the past, only some of these aspects were taken into account when estimating the network investment needs for Germany on the low-voltage level. Typically, fixed network topologies are examined or a Monte Carlo approach is used to quantify the investment needs at this voltage level. Recent research has revealed that DERs differ substantially between rural, suburban and urban regions. The low-voltage network topologies have different design concepts in these regions, so that different network topologies have to be considered when assessing the need for network extensions and investments due to DERs. An extension algorithm is needed to calculate network extensions and investment needs for the different typologies of generic low-voltage networks. We therefore present a new algorithm, which is capable of calculating the extension for generic low-voltage networks of any given topology based on voltage range deviations and thermal overloads. The algorithm requires information about line and cable lengths, their topology and the network state only. We test the algorithm on a radial, a loop, and a heavily meshed network. Here we show that the algorithm functions for electrical networks with these topologies. We found that the algorithm is able to extend different networks efficiently by placing cables between network nodes. The main value of the algorithm is that it does not require any information about routes for additional cables or positions for additional substations when it comes to estimating

Multifunction Voltage-Mode Filter Using Single Voltage Differencing Differential Difference Amplifier

Directory of Open Access Journals (Sweden)

Chaichana Amornchai

2017-01-01

Full Text Available In this paper, a voltage mode multifunction filter based on single voltage differencing differential difference amplifier (VDDDA is presented. The proposed filter with three input voltages and single output voltage is constructed with single VDDDA, two capacitors and two resistors. Its quality factor can be adjusted without affecting natural frequency. Also, the natural frequency can be electronically tuned via adjusting of bias current. The filter can offer five output responses, high-pas (HP, band-pass (BP, band-reject (BR, low-pass (LP and all-ass (AP functions in the same circuit topology. The output response can be selected by choosing the suitable input voltage without the component matching condition and the requirement of additional double gain voltage amplifier. PSpice simulation results to confirm an operation of the proposed filter correspond to the theory.

dc analysis and design of zero-voltage-switched multi-resonant converters

Science.gov (United States)

Tabisz, Wojciech A.; Lee, Fred C.

Recently introduced multiresonant converters (MRCs) provide zero-voltage switching (ZVS) of both active and passive switches and offer a substantial reduction of transistor voltage stress and an increase of load range, compared to their quasi-resonant converter counterparts. Using the resonant switch concept, a simple, generalized analysis of ZVS MRCs is presented. The conversion ratio and voltage stress characteristics are derived for basic ZVS MRCs, including buck, boost, and buck/boost converters. Based on the analysis, a design procedure that optimizes the selection of resonant elements for maximum conversion efficiency is proposed.

Linear electrostatic micromotors for nano- and micro-positioning

Science.gov (United States)

Baginsky, I. L.; Kostsov, Edvard G.

2004-05-01

The functioning of the linear step electrostatic film micromotors with the short controlling pulse (less then 100-200 ´s) is studied to create nano- and micro-positioners. The theoretical study of the step movement of the given mass in this time frame is carried out. The results of the experimental studies of the multipetal reciprocal micromotors created on the basis of La modified Ba0.5Sr0.5Nb2O6 ferroelectric films with 1-3 μm thickness are shown. The petals were made of beryllium bronze. It is shown that the electrostatic rolling can last less than 50 μs, and the process of separating two surfaces (the metal and the ferroelectric) can last less than 1 μs. These parameters allow one to operate the micromotor at 1-10 kHz frequency, and the propulsion force in the beginning (the first 20-100 μs) of the electrostatic rolling can be as high as 1-10 N per 1 mm2 of the rolling surface with the voltage pulse amplitude of 40-50 V. The possibility of obtaining moving plate (MP) step in the nanometer range is studied, as well as the precision of these steps during the continuous MP movement with the different clock frequencies and durations of the voltage pulses. The recommendations are given to improve the accuracy and the speed of the positioning in the nano- and micro-movement range. Possible fields of micromotor application are micromechanics, including precision micromechanics, microelectronics, microrobots, microoptics, microscanners, micropumps (e.g. in the jet printers), micro flying vehicles etc.

Temporary over voltages in the high voltage networks

International Nuclear Information System (INIS)

Vukelja, Petar; Naumov, Radomir; Mrvic, Jovan; Minovski, Risto

2001-01-01

The paper treats the temporary over voltages that may arise in the high voltage networks as a result of: ground faults, loss of load, loss of one or two phases and switching operation. Based on the analysis, the measures for their limitation are proposed. (Original)

Development of high voltage PEEK wire with radiation-resistance and cryogenic characteristics

International Nuclear Information System (INIS)

Fujita, T.; Hirata, T.; Araki, S.; Ohara, H.; Nishimura, H.

1989-01-01

High voltage electric wires insulated with highly-refined polyetheretherketone (PEEK) have been developed for the wiring in fusion reactors, where the wire is required to withstand high voltage under high vacuum up to 10 -5 Torr. The PEEK wires having the advantages of PEEK resin including superior radiation resistance and cryogenic characteristics are usable over a wide range of temperature and in radiation fields. The results of withstand voltage tests proved that the PEEK wires exceeding 0.8 mm in insulation thickness withstand such specified high voltage conditions as 24 kV for 1 minutes by 10 times and 6.6 kV for 110 hours. The results also revealed that the withstand voltage is improved by providing a jacket layer over the insulation and decreased by periodical voltage charge, by bending of the specimen and by water in the conductor. This paper deal with the withstand voltage test results under varied conditions of the PEEK wires. (author)

THREE-ELECTRODE AIR SWITCHBOARD WITH THE GRAPHITE ELECTRODES OF KATG-50 ON VOLTAGE TO ±50 KV AND IMPULSE CURRENT BY AMPLITUDE TO ±220 KA

Directory of Open Access Journals (Sweden)

M. I. Baranov

2015-04-01

Full Text Available Purpose. Development and creation of the simplified construction of a high-voltage heavy-current air three-electrode switchboard with graphite electrodes, intended for operation in composition the powerful generator of large impulsive current of artificial of linear lightning. Methodology. Electrophysics bases of technique of high-voltage and scientific and technical bases of planning of devices of high-voltage impulsive technique. Results. Developed and made a new construction of a high-voltage heavy-current air three-electrode switchboard with the graphite electrodes of KATG-50 on nominal voltage ±50 kV. This construction of switchboard KATG-50 has been passed experimental approbation in composition the heavy-current bit chain of powerful high-voltage generator of the аperiodic impulses of current of artificial linear lightning rationed on operating foreign standards with amplitude of Im=±(200±20 кА at their duration τP=(350±35 μs at level 0,5∙Im. Originality. First in domestic practice of development and creation of high-voltage heavy-current switchboards for the generators of large impulse currents of artificial lightning the ground of necessity of the use for their basic and managing electrodes of electrical engineering graphite is carried out. Practical value. The developed and made high-voltage heavy-current switchboard of cascade-tray KATG-50 from application in its composition of graphite electrodes possesses an enhanceable working resource and enhanceable stability of wearing-out at the use of similar switchboard in the bit chain of powerful pulsed current of the imitated linear lightning.

Voltage regulator for generator

Energy Technology Data Exchange (ETDEWEB)

Naoi, K

1989-01-17

It is an object of this invention to provide a voltage regulator for a generator charging a battery, wherein even if the ambient temperature at the voltage regulator rises abnormally high, possible thermal breakage of the semiconductor elements constituting the voltage regulator can be avoided. A feature of this invention is that the semiconductor elements can be protected from thermal breakage, even at an abnormal ambient temperature rise at the voltage regulator for the battery charging generator, by controlling a maximum conduction ratio of a power transistor in the voltage regulator in accordance with the temperature at the voltage regulator. This is achieved through a switching device connected in series to the field coil of the generator and adapted to be controlled in accordance with an output voltage of the generator and the ambient temperature at the voltage regulator. 6 figs.

Low-temperature VRH conduction through complex materials in the presence of a temperature-dependent voltage threshold: A semi-classical percolative approach

International Nuclear Information System (INIS)

Sen, A.K.; Bhattacharya, S.

2006-12-01

In this paper, we study the variation of low temperature (T) dc conductance, G(T), of a semi-classical percolative Random Resistor cum Tunneling-bond Network (RRTN), in the presence of a linearly temperature-dependent microscopic voltage threshold, υ g (T). This model (proposed by our group in the early 90's) considers a phenomenological semi-classical tunneling (or, hopping through a barrier) process. Just as in our previous constant-υ g case, we find in the present study also that the variable range hopping (VRH) exponent γ varies continuously with the ohmic concentration p in a non-monotonic fashion. In addition, we observe a new shoulder-like behaviour of G(T) in the intermediate temperature range, below the conductance maximum. (author)

Grain boundary effect of ZnO voltage sensitive ceramic

International Nuclear Information System (INIS)

Zhu Ziying; Lei Deming; Li Jingde

1991-01-01

Positron annihilation techenique has been to study the non-linear Ohmic effect of ZnO. The resemblence of curve representing the short life-time τ 1 and its component I 1 vs. current i with the voltage drop curve proves that this component I 1 belongs to the annihilation of transporting electron and positron. The experimental results give support to the explaination of Schottky barrier model for the effect of intergranular boundary

Voltage-controlled Enzymes: The new Janus Bifrons

Directory of Open Access Journals (Sweden)

Carlos Alberto Villalba-Galea

2012-09-01

Full Text Available The Ciona intestinalis voltage sensitive phosphatase, Ci-VSP, was the first Voltage-controlled Enzyme (VEnz proven to be under direct command of the membrane potential. The discovery of Ci-VSP conjugated voltage sensitivity and enzymatic activity in a single protein. These two facets of Ci-VSP activity have provided a unique model for studying how membrane potential is sensed by proteins and a novel mechanism for control of enzymatic activity. These facets make Ci-VSP a fascinating and versatile enzyme.Ci-VSP has a voltage sensing domain (VSD that resembles those found in voltage-gated channels (VGC. The VSD resides in the N-terminus and is formed by four putative trans-membrane segments. The fourth segment contains charged residues which are likely involved in voltage sensing. Ci-VSP produces sensing currents in response to changes in potential, within a defined range of voltages. Sensing currents are analogous to gating currents in VGC. As known, these latter proteins contain four VSDs which are entangled in a complex interaction with the pore domain –the effector domain in VGC. This complexity makes studying the basis of voltage sensing in VGC a difficult enterprise. In contrast, Ci-VSP is thought to be monomeric and its catalytic domain –the VSP’s effector domain– can be cleaved off without disrupting the basic electrical functioning of the VSD. For these reasons, VSPs are considered a great model for studying the activity of a VSD in isolation. Finally, VSPs are also phosphoinositide phosphatases. Phosphoinositides are signaling lipids found in eukaryotes and are involved in many processes, including modulation of VGC activity and regulation of cell proliferation. Understanding VSPs as VEnz has been the center of attention in recent years and several reviews has been dedicated to this area. Thus, this review will be focused instead on the other face of this true Janus Bifrons and recapitulate what is known about VSPs as electrically

Highly efficient integrated rectifier and voltage boosting circuits for energy harvesting applications

Directory of Open Access Journals (Sweden)

D. Maurath

2008-05-01

Full Text Available This paper presents novel circuit concepts for integrated rectifiers and voltage converting interfaces for energy harvesting micro-generators. In the context of energy harvesting, usually only small voltages are supplied by vibration-driven generators. Therefore, rectification with minimum voltage losses and low reverse currents is an important issue. This is realized by novel integrated rectifiers which were fabricated and are presented in this article. Additionally, there is a crucial need for dynamic load adaptation as well as voltage up-conversion. A circuit concept is presented, which is able to obtain both requirements. This generator interface adapts its input impedance for an optimal energy transfer efficiency. Furthermore, this generator interface provides implicit voltage up-conversion, whereas the generator output energy is stored on a buffer, which is connected to the output of the voltage converting interface. As simulations express, this fully integrated converter is able to boost ac-voltages greater than |0.35 V| to an output dc-voltage of 2.0 V–2.5 V. Thereby, high harvesting efficiencies above 80% are possible within the entire operational range.

High-voltage pulsed generator for dynamic fragmentation of rocks.

Science.gov (United States)

Kovalchuk, B M; Kharlov, A V; Vizir, V A; Kumpyak, V V; Zorin, V B; Kiselev, V N

2010-10-01

A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ∼50 ns, current amplitude of ∼6 kA with the 40 Ω active load, and ∼20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.

High-voltage pulsed generator for dynamic fragmentation of rocks

Science.gov (United States)

Kovalchuk, B. M.; Kharlov, A. V.; Vizir, V. A.; Kumpyak, V. V.; Zorin, V. B.; Kiselev, V. N.

2010-10-01

A portable high-voltage (HV) pulsed generator has been designed for rock fragmentation experiments. The generator can be used also for other technological applications. The installation consists of low voltage block, HV block, coaxial transmission line, fragmentation chamber, and control system block. Low voltage block of the generator, consisting of a primary capacitor bank (300 μF) and a thyristor switch, stores pulse energy and transfers it to the HV block. The primary capacitor bank stores energy of 600 J at the maximum charging voltage of 2 kV. HV block includes HV pulsed step up transformer, HV capacitive storage, and two electrode gas switch. The following technical parameters of the generator were achieved: output voltage up to 300 kV, voltage rise time of ˜50 ns, current amplitude of ˜6 kA with the 40 Ω active load, and ˜20 kA in a rock fragmentation regime (with discharge in a rock-water mixture). Typical operation regime is a burst of 1000 pulses with a frequency of 10 Hz. The operation process can be controlled within a wide range of parameters. The entire installation (generator, transmission line, treatment chamber, and measuring probes) is designed like a continuous Faraday's cage (complete shielding) to exclude external electromagnetic perturbations.

Prediction of breakdown voltages in novel gases for high voltage insulation

International Nuclear Information System (INIS)

Koch, M.

2015-01-01

This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF_6) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF_6 is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF_6 in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF_6 based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media

Liquid–Solid Dual-Gate Organic Transistors with Tunable Threshold Voltage for Cell Sensing

KAUST Repository

Zhang, Yu

2017-10-17

Liquid electrolyte-gated organic field effect transistors and organic electrochemical transistors have recently emerged as powerful technology platforms for sensing and simulation of living cells and organisms. For such applications, the transistors are operated at a gate voltage around or below 0.3 V because prolonged application of a higher voltage bias can lead to membrane rupturing and cell death. This constraint often prevents the operation of the transistors at their maximum transconductance or most sensitive regime. Here, we exploit a solid–liquid dual-gate organic transistor structure, where the threshold voltage of the liquid-gated conduction channel is controlled by an additional gate that is separated from the channel by a metal-oxide gate dielectric. With this design, the threshold voltage of the “sensing channel” can be linearly tuned in a voltage window exceeding 0.4 V. We have demonstrated that the dual-gate structure enables a much better sensor response to the detachment of human mesenchymal stem cells. In general, the capability of tuning the optimal sensing bias will not only improve the device performance but also broaden the material selection for cell-based organic bioelectronics.

Liquid-Solid Dual-Gate Organic Transistors with Tunable Threshold Voltage for Cell Sensing.

Science.gov (United States)

Zhang, Yu; Li, Jun; Li, Rui; Sbircea, Dan-Tiberiu; Giovannitti, Alexander; Xu, Junling; Xu, Huihua; Zhou, Guodong; Bian, Liming; McCulloch, Iain; Zhao, Ni

2017-11-08

Liquid electrolyte-gated organic field effect transistors and organic electrochemical transistors have recently emerged as powerful technology platforms for sensing and simulation of living cells and organisms. For such applications, the transistors are operated at a gate voltage around or below 0.3 V because prolonged application of a higher voltage bias can lead to membrane rupturing and cell death. This constraint often prevents the operation of the transistors at their maximum transconductance or most sensitive regime. Here, we exploit a solid-liquid dual-gate organic transistor structure, where the threshold voltage of the liquid-gated conduction channel is controlled by an additional gate that is separated from the channel by a metal-oxide gate dielectric. With this design, the threshold voltage of the "sensing channel" can be linearly tuned in a voltage window exceeding 0.4 V. We have demonstrated that the dual-gate structure enables a much better sensor response to the detachment of human mesenchymal stem cells. In general, the capability of tuning the optimal sensing bias will not only improve the device performance but also broaden the material selection for cell-based organic bioelectronics.

Thickness independent reduced forming voltage in oxygen engineered HfO{sub 2} based resistive switching memories

Energy Technology Data Exchange (ETDEWEB)

Sharath, S. U., E-mail: sharath@oxide.tu-darmstadt.de; Kurian, J.; Komissinskiy, P.; Hildebrandt, E.; Alff, L. [Institute of Materials Science, Technische Universität Darmstadt, 64287 Darmstadt (Germany); Bertaud, T.; Walczyk, C.; Calka, P. [IHP, Im Technologiepark 25, 15236 Frankfurt Oder (Germany); Schroeder, T. [IHP, Im Technologiepark 25, 15236 Frankfurt Oder (Germany); Brandenburgische Technische Universität, Konrad-Zuse-Strasse 1, 03046 Cottbus (Germany)

2014-08-18

The conducting filament forming voltage of stoichiometric hafnium oxide based resistive switching layers increases linearly with layer thickness. Using strongly reduced oxygen deficient hafnium oxide thin films grown on polycrystalline TiN/Si(001) substrates, the thickness dependence of the forming voltage is strongly suppressed. Instead, an almost constant forming voltage of about 3 V is observed up to 200 nm layer thickness. This effect suggests that filament formation and switching occurs for all samples in an oxidized HfO{sub 2} surface layer of a few nanometer thickness while the highly oxygen deficient thin film itself merely serves as a oxygen vacancy reservoir.

A Fourier Transform Spectrometer Based on an Electrothermal MEMS Mirror with Improved Linear Scan Range

Directory of Open Access Journals (Sweden)

Wei Wang

2016-09-01

Full Text Available A Fourier transform spectrometer (FTS that incorporates a closed-loop controlled, electrothermally actuated microelectromechanical systems (MEMS micromirror is proposed and experimentally verified. The scan range and the tilting angle of the mirror plate are the two critical parameters for MEMS-based FTS. In this work, the MEMS mirror with a footprint of 4.3 mm × 3.1 mm is based on a modified lateral-shift-free (LSF bimorph actuator design with large piston and reduced tilting. Combined with a position-sensitive device (PSD for tilt angle sensing, the feedback controlled MEMS mirror generates a 430 µm stable linear piston scan with the mirror plate tilting angle less than ±0.002°. The usable piston scan range is increased to 78% of the MEMS mirror’s full scan capability, and a spectral resolution of 0.55 nm at 531.9 nm wavelength, has been achieved. It is a significant improvement compared to the prior work.

Voltage dependency of transmission probability of aperiodic DNA molecule

Science.gov (United States)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Intermodulation Linearity in High-k/Metal Gate 28 nm RF CMOS Transistors

Directory of Open Access Journals (Sweden)

Zhen Li

2015-09-01

Full Text Available This paper presents experimental characterization, simulation, and Volterra series based analysis of intermodulation linearity on a high-k/metal gate 28 nm RF CMOS technology. A figure-of-merit is proposed to account for both VGS and VDS nonlinearity, and extracted from frequency dependence of measured IIP3. Implications to biasing current and voltage optimization for linearity are discussed.

Detector with internal gain for short-wave infrared ranging applications

Science.gov (United States)

Fathipour, Vala; Mohseni, Hooman

2017-09-01

Abstarct.Highly sensitive photon detectors are regarded as the key enabling elements in many applications. Due to the low photon energy at the short-wave infrared (SWIR), photon detection and imaging at this band are very challenging. As such, many efforts in photon detector research are directed toward improving the performance of the photon detectors operating in this wavelength range. To solve these problems, we have developed an electron-injection (EI) technique. The significance of this detection mechanism is that it can provide both high efficiency and high sensitivity at room temperature, a condition that is very difficult to achieve in conventional SWIR detectors. An EI detector offers an overall system-level sensitivity enhancement due to a feedback stabilized internal avalanche-free gain. Devices exhibit an excess noise of unity, operate in linear mode, require bias voltage of a few volts, and have a cutoff wavelength of 1700 nm. We review the material system, operating principle, and development of EI detectors. The shortcomings of the first-generation devices were addressed in the second-generation detectors. Measurement on second-generation devices showed a high-speed response of ˜6 ns rise time, low jitter of less than 20 ps, high amplification of more than 2000 (at optical power levels larger than a few nW), unity excess noise factor, and low leakage current (amplified dark current ˜10 nA at a bias voltage of -3 V and at room temperature. These characteristics make EI detectors a good candidate for high-resolution flash light detection and ranging (LiDAR) applications with millimeter scale depth resolution at longer ranges compared with conventional p-i-n diodes. Based on our experimentally measured device characteristics, we compare the performance of the EI detector with commercially available linear mode InGaAs avalanche photodiode (APD) as well as a p-i-n diode using a theoretical model. Flash LiDAR images obtained by our model show that the EI

Reduced Order Extended Luenberger Observer Based Sensorless Vector Control Fed by Matrix Converter with Non-linearity Modeling

DEFF Research Database (Denmark)

Lee, Kyo-Beum; Blaabjerg, Frede

2004-01-01

This paper presents a new sensorless vector control system for high performance induction motor drives fed by a matrix converter with non-linearity compensation. The nonlinear voltage distortion that is caused by commutation delay and on-state voltage drop in switching device is corrected by a new...

Design and Analysis of a Slope Voltage Control for a DFIG Wind Power Plant

DEFF Research Database (Denmark)

Martínez, J.; Kjær, P. C.; Rodriguez, Pedro

2012-01-01

This paper addresses a detailed design of a wind power plant and turbine slope voltage control in the presence of communication delays for a wide short-circuit ratio range operation. The implemented voltage control scheme is based upon the secondary voltage control concept, which offers fast...... of connection with the grid. The performance has been tested using PSCAD/EMTDC program. The plant layout used in the simulations is based on an installed wind power plant, composed of 23 doubly fed generator wind turbines. The resulting performance is evaluated using a compilation of grid code voltage control...... response to grid disturbances, despite the communication delays, i.e., this concept is based on a primary voltage control, located in the wind turbine, which follows an external voltage reference sent by a central controller, called secondary voltage control, which is controlling the voltage at the point...

The supply voltage scaled dependency of the recovery of single event upset in advanced complementary metal—oxide—semiconductor static random-access memory cells

International Nuclear Information System (INIS)

Li Da-Wei; Qin Jun-Rui; Chen Shu-Ming

2013-01-01

Using computer-aided design three-dimensional simulation technology, the supply voltage scaled dependency of the recovery of single event upset and charge collection in static random-access memory cells are investigated. It reveals that the recovery linear energy transfer threshold decreases with the supply voltage reducing, which is quite attractive for dynamic voltage scaling and subthreshold circuit radiation-hardened design. Additionally, the effect of supply voltage on charge collection is also investigated. It is concluded that the supply voltage mainly affects the bipolar gain of the parasitical bipolar junction transistor (BJT) and the existence of the source plays an important role in supply voltage variation. (geophysics, astronomy, and astrophysics)

SYNTHESIS OF AUTOMATIC CONTROL SYSTEM FOR STEPPING-UP CONVERTER OF DC VOLTAGE AT ACTIVE LOAD OPERATION

Directory of Open Access Journals (Sweden)

A. V. Мironovich

2005-01-01

Full Text Available Investigation of a nontransformer stepping-up converter of dc voltage has been carried out. A non-linear structural circuit of the converter has been developed with the help of the controlled current injection method. A linearization of an object and an automation control system synthesis have been conducted applying method of successive optimization of the circuits. The paper contains results of transient process simulation in the linear computer model and in the power electronics computer model. 

A low-power wide range transimpedance amplifier for biochemical sensing.

Science.gov (United States)

Rodriguez-Villegas, Esther

2007-01-01

This paper presents a novel low voltage and low power transimpedance amplifier for amperometric potentiostats. The power is optimized by having three different gain settings for different current ranges, which can be programmed with a biasing current. The voltage ranges have been optimized by using FGMOS transistors in a second voltage amplification stage that simultaneously allow for offset calibration as well as independent biasing of the gates. The circuit operates with input currents from 1 pA to 1 microA, with a maximum power supply voltage of 1.5 V and consumes 82.5 nW, 9.825 microW, 47.325 microW for currents varying from (1 pA, 0.25 nA), (0.25 nA, 62.5 nA) and (62.5 nA, 1 microA) respectively.

On-site voltage measurement with capacitive sensors on high voltage systems

NARCIS (Netherlands)

Wu, L.; Wouters, P.A.A.F.; Heesch, van E.J.M.; Steennis, E.F.

2011-01-01

In Extra/High-Voltage (EHV/HV) power systems, over-voltages occur e.g. due to transients or resonances. At places where no conventional voltage measurement devices can be installed, on-site measurement of these occurrences requires preferably non intrusive sensors, which can be installed with little

A novel self-biased linear silicon drift detector

International Nuclear Information System (INIS)

Corsi, F.; Gramegna, G.; Marzocca, C.

1999-01-01

A novel linear silicon drift detector (SDD) is proposed in which the proper potential profile is established by the voltage drop along a unique p + cathode implanted across the surfaces. This p + implant, arranged in a zigzag shape, acts at the same time as voltage divider and field cathode and allows one to increase the sensitive area, improving also the uniformity of the thermal distribution and thus minimizing the fluctuation of the electron mobility on the sensitive zone of the SDD. The perturbations of the drift field due to the asymmetry of the strips constituting the zigzag cathode have been evaluated by solving analytically Poisson's equation for a simplified model of the structure. Three-dimensional numerical simulations have been carried out to prove the negligible amount of the perturbation and the effectiveness of the proposed structure. Based on this principle, a prototype has been manufactured at Canberra Semiconductor Company. Dynamic measurements of the time-of-flight of an injected charge prove that the linearity of the prototype and the drift uniformity in the anode direction are very high

Prediction of breakdown voltages in novel gases for high voltage insulation

Energy Technology Data Exchange (ETDEWEB)

Koch, M.

2015-07-01

This thesis submitted to the Swiss Federal Institute of Technology ETH in Zurich examines the use of sulphur hexafluoride (SF{sub 6}) and similar gases as important insulation media for high voltage equipment. Due to its superior insulation properties, SF{sub 6} is widely used in gas-insulated switchgear. However, the gas also has a very high global warming potential and the content of SF{sub 6} in the atmosphere is constantly increasing. The search for new insulation gases using classical breakdown experiments is discussed. A model for SF{sub 6} based on the stepped leader model is described. This calculates the breakdown voltages in arbitrary electrode configurations and under standard voltage waveforms. Thus, the thesis provides a method for the prediction of breakdown voltages of arbitrary field configurations under standard voltage waveforms for gases with electron-attaching properties. With this, further gases can be characterized for usage as high voltage insulation media.

Integrated reconfigurable high-voltage transmitting circuit for CMUTs

DEFF Research Database (Denmark)

Llimos Muntal, Pere; Larsen, Dennis Øland; Jørgensen, Ivan Harald Holger

2015-01-01

In this paper a high-voltage transmitting circuit aimed for capacitive micromachined ultrasonic transducers (CMUTs) used in scanners for medical applications is designed and implemented in a 0.35 μm high-voltage CMOS process. The transmitting circuit is reconfigurable externally making it able...... to drive a wide variety of CMUTs. The transmitting circuit can generate several pulse shapes with voltages up to 100 V, maximum pulse range of 50 V, frequencies up to 5 MHz and different driving slew rates. Measurements are performed on the circuit in order to assess its functionality and power consumption...... performance. The design occupies an on-chip area of 0.938 mm2 and the power consumption of a 128-element transmitting circuit array that would be used in an portable ultrasound scanner is found to be a maximum of 181 mW....

Ways for improvement of the LIU-5/5000 linear induction accelerator parameters

International Nuclear Information System (INIS)

Bobylev, V.I.; Kapchinskij, I.M.; Lapitskij, Yu.Ya.; Plotnikov, V.K.; Chuvilo, I.V.

1987-01-01

The reasons of limitaions to increase the beam current and improve the quality of beam in the electron linear induction accelerator LIU-5/5000 are studied. The necessity to increase the voltage in the gaps of the electron gun, increase the diameter of the cathode and aperture of the drift tube, accuracy of axial symmetry electron gun current-carrying elements and accuracy of gun fabrication are shown. Stabilization of beam parameters require a new high voltage modulators. Different versions of the linac modernization with the use of transformers with cores of 430 and 600 mm are studied. Technical possibilities at several versions of high voltage modulators are discussed

High voltage engineering

CERN Document Server

Rizk, Farouk AM

2014-01-01

Inspired by a new revival of worldwide interest in extra-high-voltage (EHV) and ultra-high-voltage (UHV) transmission, High Voltage Engineering merges the latest research with the extensive experience of the best in the field to deliver a comprehensive treatment of electrical insulation systems for the next generation of utility engineers and electric power professionals. The book offers extensive coverage of the physical basis of high-voltage engineering, from insulation stress and strength to lightning attachment and protection and beyond. Presenting information critical to the design, selec

Design of Low Voltage Low Power CMOS OP-AMPS with Rail-to-Rail Input/Output Swing

OpenAIRE

Gopalaiah, SV; Shivaprasad, AP; Panigrahi, Sukanta K

2004-01-01

A novel input and output biasing circuit to extend the input common mode (CM) voltage range and the output swing to rail-to-rail in a low voltage op-amp in standard CMOS technology is presented. The input biasing circuit uses a Switched Capacitor Based Attenuator (SCBA) approach to establish rail-to-rail common mode input voltage range. And the output biasing circuit uses an Output Driver (OD), with floating bias to give the rail-to-rail swing at output stage. Three different OD schemes in op...

Device for monitoring cell voltage

Science.gov (United States)

Doepke, Matthias [Garbsen, DE; Eisermann, Henning [Edermissen, DE

2012-08-21

A device for monitoring a rechargeable battery having a number of electrically connected cells includes at least one current interruption switch for interrupting current flowing through at least one associated cell and a plurality of monitoring units for detecting cell voltage. Each monitoring unit is associated with a single cell and includes a reference voltage unit for producing a defined reference threshold voltage and a voltage comparison unit for comparing the reference threshold voltage with a partial cell voltage of the associated cell. The reference voltage unit is electrically supplied from the cell voltage of the associated cell. The voltage comparison unit is coupled to the at least one current interruption switch for interrupting the current of at least the current flowing through the associated cell, with a defined minimum difference between the reference threshold voltage and the partial cell voltage.

Enhanced Voltage Control of VSC-HVDC Connected Offshore Wind Farms Based on Model Predictive Control

DEFF Research Database (Denmark)

Guo, Yifei; Gao, Houlei; Wu, Qiuwei

2018-01-01

This paper proposes an enhanced voltage control strategy (EVCS) based on model predictive control (MPC) for voltage source converter based high voltage direct current (VSCHVDC) connected offshore wind farms (OWFs). In the proposed MPC based EVCS, all wind turbine generators (WTGs) as well...... as the wind farm side VSC are optimally coordinated to keep voltages within the feasible range and reduce system power losses. Considering the high ratio of the OWF collector system, the effects of active power outputs of WTGs on voltage control are also taken into consideration. The predictive model of VSC...

Re-evaluating the role of sterics and electronic coupling in determining the open-circuit voltage of organic solar cells

KAUST Repository

Graham, Kenneth; Erwin, Patrick; Nordlund, Dennis; Vandewal, Koen; Li, Ruipeng; Ngongang Ndjawa, Guy Olivier; Hoke, Eric T.; Salleo, Alberto; Thompson, Mark E.; McGehee, Michael D.; Amassian, Aram

2013-01-01

The effects of sterics and molecular orientation on the open-circuit voltage and absorbance properties of charge-transfer states are explored in model bilayer organic photovoltaics. It is shown that the open-circuit voltage correlates linearly with the charge-transfer state energy and is not significantly influenced by electronic coupling. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Re-evaluating the role of sterics and electronic coupling in determining the open-circuit voltage of organic solar cells

KAUST Repository

Graham, Kenneth

2013-07-30

The effects of sterics and molecular orientation on the open-circuit voltage and absorbance properties of charge-transfer states are explored in model bilayer organic photovoltaics. It is shown that the open-circuit voltage correlates linearly with the charge-transfer state energy and is not significantly influenced by electronic coupling. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Mammalian cortical astrocytes align themselves in a physiological voltage gradient.

Science.gov (United States)

Borgens, R B; Shi, R; Mohr, T J; Jaeger, C B

1994-07-01

Astrocytes obtained from primary cultures of newborn rat cerebral cortex show a marked structural rearrangement to weak (50-500 mV/mm) applied voltage gradients. Astrocytes reorient their processes so that the cells are aligned perpendicular to the voltage gradient. At field strengths of 100 mV/mm or greater, this realignment occurs in over 90% of the cell population. Furthermore, these magnitudes of electric fields completely eliminate any parallel alignments originally observed prior to application of the voltage. Realignment usually occurs by a withdrawal, followed by an extension, of cell processes. These responses occur at voltage gradients within the physiological range that naturally exist across the neural tube during early development. We suggest the possibility that architectural arrangements of developing glia and, subsequently, neurons may be regulated by endogenous transepithelial potentials that exist across embryonic neuroepithelium.

Enhanced Rate Capability of Oxide Coated Lithium Titanate within Extended Voltage Ranges

Energy Technology Data Exchange (ETDEWEB)

Ahn, Dongjoon [College of Engineering, University of Kentucky, Lexington, KY (United States); Xiao, Xingcheng, E-mail: xingcheng.xiao@gm.com [Chemical and Materials Systems Laboratory, General Motors R& D Center, Warren, MI (United States)

2015-06-30

Lithium titanate (Li{sub 4}Ti{sub 5}O{sub 12} or LTO) is a promising negative electrode material of high-power lithium-ion batteries, due to its superior rate capability and excellent capacity retention. However, the specific capacity of LTO is less than one half of that of graphite electrode. In this work, we applied ultrathin oxide coating on LTO by the atomic layer deposition technique, aiming for increasing the energy density by extending the cell voltage window and specific capacity of LTO. We demonstrated that a few nanometer thick Al{sub 2}O{sub 3} coating can suppress the mechanical distortion of LTO cycled at low potential, which enable the higher specific capacity and excellent capacity retention. Furthermore, the surface coating can facilitate the charge transfer, leading to significantly improved rate capabilities, comparing with the uncoated LTO.

Non-linear response of electrode-electrolyte interface at high current density

International Nuclear Information System (INIS)

Ruiz, G.A.; Felice, C.J.; Valentinuzzi, M.E.

2005-01-01

A distributed parameter non-linear circuit is presented as fractal model of an electrode-electrolyte interface. It includes the charge transfer resistance and the double layer capacitance at each fractal level. The circuit explains the linear behavior of its series equivalent resistance R eq with signals of amplitudes eq Fourier spectrum. As a consequence, both the equivalent resistance and reactance drop with voltage, facts reported experimentally by other authors

Voltage stability in low voltage microgrids in aspects of active and reactive power demand

Directory of Open Access Journals (Sweden)

Parol Mirosław

2016-03-01

Full Text Available Low voltage microgrids are autonomous subsystems, in which generation, storage and power and electrical energy consumption appear. In the paper the main attention has been paid to the voltage stability issue in low voltage microgrid for different variants of its operation. In the introduction a notion of microgrid has been presented, and also the issue of influence of active and reactive power balance on node voltage level has been described. Then description of voltage stability issue has been presented. The conditions of voltage stability and indicators used to determine voltage stability margin in the microgrid have been described. Description of the low voltage test microgrid, as well as research methodology along with definition of considered variants of its operation have been presented further. The results of exemplary calculations carried out for the daily changes in node load of the active and reactive power, i.e. the voltage and the voltage stability margin indexes in nodes have been presented. Furthermore, the changes of voltage stability margin indexes depending on the variant of the microgrid operation have been presented. Summary and formulation of conclusions related to the issue of voltage stability in microgrids have been included at the end of the paper.

76 FR 70721 - Voltage Coordination on High Voltage Grids; Notice of Staff Workshop

Science.gov (United States)

2011-11-15

... DEPARTMENT OF ENERGY Federal Energy Regulatory Commission [Docket No. AD12-5-000] Voltage Coordination on High Voltage Grids; Notice of Staff Workshop Take notice that the Federal Energy Regulatory Commission will hold a Workshop on Voltage Coordination on High Voltage Grids on Thursday, December 1, 2011...

Doped nanocrystalline ZnO powders for non-linear resistor applications by spray pyrolysis method.

Science.gov (United States)

Hembram, Kaliyan; Vijay, R; Rao, Y S; Rao, T N

2009-07-01

Homogeneous and doped nanocrystalline ZnO powders (30-200 nm) were synthesized by spray pyrolysis technique. The spray pyrolysed powders were calcined in the temperature range of 500-750 degrees C. Formation of insulating pyrochlore phase started from 700 degrees C during the calcination itself. The calcined powders were compacted and sintered at different temperatures ranging from 900-1200 degrees C for 0.5-4 h. The densification behavior was found to be dependent on calcination temperature of the nanopowder. The resulting discs were found to have density (5.34-5.62 g/cc) in the range of 96-99% of theoretical density. The breakdown voltage value obtained for the nanopowder based non-linear resistor is 10.3 kV/cm with low leakage current density of 0.7 microA/cm2 and coefficient of nonlinearity as high as 193. The activation energy for grain growth of the doped ZnO nanopowder powders is 449.4 +/- 15 kJ/mol.

Hybrid finite difference/finite element solution method development for non-linear superconducting magnet and electrical circuit breakdown transient analysis

International Nuclear Information System (INIS)

Kraus, H.G.; Jones, J.L.

1986-01-01

The problem of non-linear superconducting magnet and electrical protection circuit system transients is formulated. To enable studying the effects of coil normalization transients, coil distortion (due to imbalanced magnetic forces), internal coil arcs and shorts, and other normal and off-normal circuit element responses, the following capabilities are included: temporal, voltage and current-dependent voltage sources, current sources, resistors, capacitors and inductors. The concept of self-mutual inductance, and the form of the associated inductance matrix, is discussed for internally shorted coils. This is a Kirchhoff's voltage loop law and Kirchhoff's current node law formulation. The non-linear integrodifferential equation set is solved via a unique hybrid finite difference/integral finite element technique. (author)

Analog Amplitude Modulation of a High Voltage, Solid State Inductive Adder, Pulse Generator Using MOSFETS

International Nuclear Information System (INIS)

Gower, E J; Sullivan, J S

2002-01-01

High voltage, solid state, inductive adder, pulse generators have found increasing application as fast kicker pulse modulators for charged particle beams. The solid state, inductive adder, pulse generator is similar in operation to the linear induction accelerator. The main difference is that the solid state, adder couples energy by transformer action from multiple primaries to a voltage summing stalk, instead of an electron beam. Ideally, the inductive adder produces a rectangular voltage pulse at the load. In reality, there is usually some voltage variation at the load due to droop on primary circuit storage capacitors, or, temporal variations in the load impedance. Power MOSFET circuits have been developed to provide analog modulation of the output voltage amplitude of a solid state, inductive adder, pulse generator. The modulation is achieved by including MOSFET based, variable subtraction circuits in the multiple primary stack. The subtraction circuits can be used to compensate for voltage droop, or, to tailor the output pulse amplitude to provide a desired effect in the load. Power MOSFET subtraction circuits have been developed to modulate short, temporal (60-400 ns), voltage and current pulses. MOSFET devices have been tested up to 20 amps and 800 Volts with a band pass of 50 MHz. An analog modulation cell has been tested in a five cell high, voltage adder stack

A high linearity current mode second IF CMOS mixer for a DRM/DAB receiver

International Nuclear Information System (INIS)

Xu Jian; Zhou Zheng; Wu Yiqiang; Wang Zhigong; Chen Jianping

2015-01-01

A passive current switch mixer was designed for the second IF down-conversion in a DRM/DAB receiver. The circuit consists of an input transconductance stage, a passive current switching stage, and a current amplifier stage. The input transconductance stage employs a self-biasing current reusing technique, with a resistor shunt feedback to increase the gain and output impedance. A dynamic bias technique is used in the switching stage to ensure the stability of the overdrive voltage versus the PVT variations. A current shunt feedback is introduced to the conventional low-voltage second-generation fully balanced multi-output current converter (FBMOCCII), which provides very low input impedance and high output impedance. With the circuit working in current mode, the linearity is effectively improved with low supply voltages. Especially, the transimpedance stage can be removed, which simplifies the design considerably. The design is verified with a SMIC 0.18 μm RF CMOS process. The measurement results show that the voltage conversation gain is 1.407 dB, the NF is 16.22 dB, and the IIP3 is 4.5 dBm, respectively. The current consumption is 9.30 mA with a supply voltage of 1.8 V. This exhibits a good compromise among the gain, noise, and linearity for the second IF mixer in DRM/DAB receivers. (paper)

Analysis of the current-voltage characteristics lineshapes of resonant tunneling diodes

International Nuclear Information System (INIS)

Rivera, P.H.; Schulz, P.A.

1996-01-01

It is discussed the influence of a two dimensional electron gas at the emitter-barrier interface on the current-voltage characteristics of a Ga As-Al Ga As double-barrier quantum well resonant tunneling diode. This effect is characterized by the modification of the space charge distribution along the structure. Within the framework of a self-consistent calculation we analyse the current-voltage characteristics of the tunneling diodes. This analysis permits us to infer different tunneling ways, related to the formation of confined states in the emitter region, and their signatures in the current-voltage characteristics. We show that varying the spacer layer, together with barrier heights, changes drastically the current density-voltage characteristics lineshapes. We compare our results with a variety of current-voltage characteristics lineshapes. We compare our results with a variety of current-voltage characteristics reported in the literature. The general trend of experimental lineshapes can be reproduced and interpreted with our model. The possibility of tunneling paths is predicted for a range that has not yet been explored experimentally. (author). 12 refs., 4 figs

Mechanisms of Gain Control by Voltage-Gated Channels in Intrinsically-Firing Neurons

Science.gov (United States)

Patel, Ameera X.; Burdakov, Denis

2015-01-01

Gain modulation is a key feature of neural information processing, but underlying mechanisms remain unclear. In single neurons, gain can be measured as the slope of the current-frequency (input-output) relationship over any given range of inputs. While much work has focused on the control of basal firing rates and spike rate adaptation, gain control has been relatively unstudied. Of the limited studies on gain control, some have examined the roles of synaptic noise and passive somatic currents, but the roles of voltage-gated channels present ubiquitously in neurons have been less explored. Here, we systematically examined the relationship between gain and voltage-gated ion channels in a conductance-based, tonically-active, model neuron. Changes in expression (conductance density) of voltage-gated channels increased (Ca2+ channel), reduced (K+ channels), or produced little effect (h-type channel) on gain. We found that the gain-controlling ability of channels increased exponentially with the steepness of their activation within the dynamic voltage window (voltage range associated with firing). For depolarization-activated channels, this produced a greater channel current per action potential at higher firing rates. This allowed these channels to modulate gain by contributing to firing preferentially at states of higher excitation. A finer analysis of the current-voltage relationship during tonic firing identified narrow voltage windows at which the gain-modulating channels exerted their effects. As a proof of concept, we show that h-type channels can be tuned to modulate gain by changing the steepness of their activation within the dynamic voltage window. These results show how the impact of an ion channel on gain can be predicted from the relationship between channel kinetics and the membrane potential during firing. This is potentially relevant to understanding input-output scaling in a wide class of neurons found throughout the brain and other nervous systems

State reference design and saturated control of doubly-fed induction generators under voltage dips

Science.gov (United States)

Tilli, Andrea; Conficoni, Christian; Hashemi, Ahmad

2017-04-01

In this paper, the stator/rotor currents control problem of doubly-fed induction generator under faulty line voltage is carried out. Common grid faults cause a steep decline in the line voltage profile, commonly denoted as voltage dip. This point is critical for such kind of machines, having their stator windings directly connected to the grid. In this respect, solid methodological nonlinear control theory arguments are exploited and applied to design a novel controller, whose main goal is to improve the system behaviour during voltage dips, endowing it with low voltage ride through capability, a fundamental feature required by modern Grid Codes. The proposed solution exploits both feedforward and feedback actions. The feedforward part relies on suitable reference trajectories for the system internal dynamics, which are designed to prevent large oscillations in the rotor currents and command voltages, excited by line perturbations. The feedback part uses state measurements and is designed according to Linear Matrix Inequalities (LMI) based saturated control techniques to further reduce oscillations, while explicitly accounting for the system constraints. Numerical simulations verify the benefits of the internal dynamics trajectory planning, and the saturated state feedback action, in crucially improving the Doubly-Fed Induction Machine response under severe grid faults.

Current-voltage characteristics of porous-silicon structures

International Nuclear Information System (INIS)

Diligenti, A.; Nannini, A.; Pennelli, G.; Pieri, F.; Fuso, F.; Allegrini, M.

1996-01-01

I-V DC characteristics have been measured on metal/porous-silicon structures. In particular, the measurements on metal/free-standing porous-silicon film/metal devices confirmed the result, already obtained, that the metal/porous-silicon interface plays a crucial role in the transport of any device. Four-contacts measurements on free-standing layers showed that the current linearly depends on the voltage and that the conduction process is thermally activated, the activation energy depending on the porous silicon film production parameters. Finally, annealing experiments performed in order to improve the conduction of rectifying contacts, are described

A Wide Linearity Range Method for the Determination of Lenalidomide in Plasma by High-Performance Liquid Chromatography: Application to Pharmacokinetic Studies.

Science.gov (United States)

Guglieri-López, Beatriz; Pérez-Pitarch, Alejandro; Martinez-Gómez, Maria Amparo; Porta-Oltra, Begoña; Climente-Martí, Mónica; Merino-Sanjuán, Matilde

2016-12-01

A wide linearity range analytical method for the determination of lenalidomide in patients with multiple myeloma for pharmacokinetic studies is required. Plasma samples were ultrasonicated for protein precipitation. A solid-phase extraction was performed. The eluted samples were evaporated to dryness under vacuum, and the solid obtained was diluted and injected into the high-performance liquid chromatography (HPLC) system. Separation of lenalidomide was performed on an Xterra RP C18 (250 mm length × 4.6 mm i.d., 5 µm) using a mobile phase consisting of phosphate buffer/acetonitrile (85:15, v/v, pH 3.2) at a flow rate of 0.5 mL · min -1 The samples were monitored at a wavelength of 311 nm. A linear relationship with good correlation coefficient (r = 0.997, n = 9) was found between the peak area and lenalidomide concentrations in the range of 100 to 950 ng · mL -1 The limits of detection and quantitation were 28 and 100 ng · mL -1 , respectively. The intra- and interassay precisions were satisfactory, and the accuracy of the method was proved. In conclusion, the proposed method is suitable for the accurate quantification of lenalidomide in human plasma with a wide linear range, from 100 to 950 ng · mL -1 This is a valuable method for pharmacokinetic studies of lenalidomide in human subjects. © 2016 Society for Laboratory Automation and Screening.

Transformer-assisted PWM zero-voltage switching pole inverter with high output bandwidth applied to linear motor drives

NARCIS (Netherlands)

Myrzik, J.M.A.; Duarte, J.L.; Haardt, de P.; Vissers, J.

2002-01-01

An application of the transformer-assisted PWM zero-voltage switching pole inverter (TRAP) is described in this paper. The TRAP is based on the auxiliary resonant commutated pole inverter (ARCP), but avoids its disadvantages. This paper describes the converter functionality and its applicability

Design of High-Voltage Switch-Mode Power Amplifier Based on Digital-Controlled Hybrid Multilevel Converter

Directory of Open Access Journals (Sweden)

Yanbin Hou

2016-01-01

Full Text Available Compared with conventional Class-A, Class-B, and Class-AB amplifiers, Class-D amplifier, also known as switching amplifier, employs pulse width modulation (PWM technology and solid-state switching devices, capable of achieving much higher efficiency. However, PWM-based switching amplifier is usually designed for low-voltage application, offering a maximum output voltage of several hundred Volts. Therefore, a step-up transformer is indispensably adopted in PWM-based Class-D amplifier to produce high-voltage output. In this paper, a switching amplifier without step-up transformer is developed based on digital pulse step modulation (PSM and hybrid multilevel converter. Under the control of input signal, cascaded power converters with separate DC sources operate in PSM switch mode to directly generate high-voltage and high-power output. The relevant topological structure, operating principle, and design scheme are introduced. Finally, a prototype system is built, which can provide power up to 1400 Watts and peak voltage up to ±1700 Volts. And the performance, including efficiency, linearity, and distortion, is evaluated by experimental tests.

Model Development for Current–Voltage and Transconductance Characteristics of Normally-off AlN/GaN MOSHEMT

International Nuclear Information System (INIS)

Swain, R.; Jena, K.; Lenka, T. R.

2016-01-01

In this paper, an AlN/GaN-based MOSHEMT is proposed, in accordance to this, a charge control model has been developed analytically and simulated with MATLAB to predict the characteristics of threshold voltage, drain currents and transconductance. The physics based models for 2DEG density, threshold voltage and quantum capacitance in the channel has been put forward. By using these developed models, the drain current for both linear and saturation models is derived. The predicted threshold voltage with the variation of barrier thickness has been plotted. A positive threshold voltage can be obtained by decreasing the barrier thickness which builds up the foundation for enhancement mode MOSHEMT devices. The predicted I_d–V_g_s, I_d–V_d_s and transconductance characteristics show an excellent agreement with the experimental results and hence validate the model.

High current, 0.5-MA, fast, 100-ns, linear transformer driver experiments

Directory of Open Access Journals (Sweden)

Michael G. Mazarakis

2009-05-01

Full Text Available The linear transformer driver (LTD is a new method for constructing high current, high-voltage pulsed accelerators. The salient feature of the approach is switching and inductively adding the pulses at low voltage straight out of the capacitors through low inductance transfer and soft iron core isolation. Sandia National Laboratories are actively pursuing the development of a new class of accelerator based on the LTD technology. Presently, the high current LTD experimental research is concentrated on two aspects: first, to study the repetition rate capabilities, reliability, reproducibility of the output pulses, switch prefires, jitter, electrical power and energy efficiency, and lifetime measurements of the cavity active components; second, to study how a multicavity linear array performs in a voltage adder configuration relative to current transmission, energy and power addition, and wall plug to output pulse electrical efficiency. Here we report the repetition rate and lifetime studies performed in the Sandia High Current LTD Laboratory. We first utilized the prototype ∼0.4-MA, LTD I cavity which could be reliably operated up to ±90-kV capacitor charging. Later we obtained an improved 0.5-MA, LTD II version that can be operated at ±100  kV maximum charging voltage. The experimental results presented here were obtained with both cavities and pertain to evaluating the maximum achievable repetition rate and LTD cavity performance. The voltage adder experiments with a series of double sized cavities (1 MA, ±100  kV will be reported in future publications.

An Improved Continuous-Time Model Predictive Control of Permanent Magnetic Synchronous Motors for a Wide-Speed Range

Directory of Open Access Journals (Sweden)

Dandan Su

2017-12-01

Full Text Available This paper proposes an improved continuous-time model predictive control (CTMPC of permanent magnetic synchronous motors (PMSMs for a wide-speed range, including the constant torque region and the flux-weakening (FW region. In the constant torque region, the mathematic models of PMSMs in dq-axes are decoupled without the limitation of DC-link voltage. However, in the FW region, the mathematic models of PMSMs in dq-axes are cross-coupled together with the limitation of DC-link voltage. A nonlinear PMSMs mathematic model in the FW region is presented based on the voltage angle. The solving of the nonlinear mathematic model of PMSMs in FW region will lead to heavy computation load for digital signal processing (DSP. To overcome such a problem, a linearization method of the voltage angle is also proposed to reduce the computation load. The selection of transiting points between the constant torque region and FW regions is researched to improve the performance of the driven system. Compared with the proportional integral (PI controller, the proposed CTMPC has obvious advantages in dealing with systems’ nonlinear constraints and improving system performance by restraining overshoot current under step torque changing. Both simulation and experimental results confirm the effectiveness of the proposed method in achieving good steady-state performance and smooth switching between the constant torque and FW regions.

Characterization of high density SiPM non-linearity and energy resolution for prompt gamma imaging applications

Science.gov (United States)

Regazzoni, V.; Acerbi, F.; Cozzi, G.; Ferri, A.; Fiorini, C.; Paternoster, G.; Piemonte, C.; Rucatti, D.; Zappalà, G.; Zorzi, N.; Gola, A.

2017-07-01

Fondazione Bruno Kessler (FBK) (Trento, Italy) has recently introduced High Density (HD) and Ultra High-Density (UHD) SiPMs, featuring very small micro-cell pitch. The high cell density is a very important factor to improve the linearity of the SiPM in high-dynamic-range applications, such as the scintillation light readout in high-energy gamma-ray spectroscopy and in prompt gamma imaging for proton therapy. The energy resolution at high energies is a trade-off between the excess noise factor caused by the non-linearity of the SiPM and the photon detection efficiency of the detector. To study these effects, we developed a new setup that simulates the LYSO light emission in response to gamma photons up to 30 MeV, using a pulsed light source. We measured the non-linearity and energy resolution vs. energy of the FBK RGB-HD e RGB-UHD SiPM technologies. We considered five different cell sizes, ranging from 10 μm up to 25 μm. With the UHD technology we were able to observe a remarkable reduction of the SiPM non-linearity, less than 5% at 5 MeV with 10 μm cells, which should be compared to a non-linearity of 50% with 25 μm-cell HD-SiPMs. With the same setup, we also measured the different components of the energy resolution (intrinsic, statistical, detector and electronic noise) vs. cell size, over-voltage and energy and we separated the different sources of excess noise factor.

Enhanced Buck–Boost Neutral-Point-Clamped Inverters With Simple Capacitive-Voltage Balancing

DEFF Research Database (Denmark)

Tan, Kuan Khoon; Gao, Feng; Loh, Poh Chiang

2010-01-01

introduced for extending the inverters’ variation range to include voltageboost operation, but they generally require the inclusion of large passive components or have not yet been optimized in terms of waveform quality. The balancing of their capacitive voltages using a simple technique has also not yet...... simultaneously, two new buck–boost NPC inverters with simple capacitive-voltage-balancing capability are proposed. Both inverters are demonstrated to exhibit a doubling of voltage gain, with one of them also shown to produce a better output waveform quality. Simulation and experimental results are provided...

Low Voltage, High-Q SOI MEMS Varactors for RF Applications

DEFF Research Database (Denmark)

Yalcinkaya, Arda Deniz; Jensen, Søren; Hansen, Ole

2003-01-01

A micro electromechanical tunable capacitor with a low control voltage, a wide tuning range and high electrical quality factor is presented with detailed characterizations. A 50μm thick single-crystalline silicon layer was etched using deep reactive ion etching (DRIE) for obtaining high-aspect ra...... is a suitable passive component to be used in band-pass filtering, voltage controlled oscillator or impedance matching applications on the very high frequency(VHF) and ultra high frequency (UHF) bands....

Photodiode 1 × 64 linear array based on a double p-InAsSbP/n-InAs{sub 0.92}Sb{sub 0.08}/n{sup +}-InAs heterostructure

Energy Technology Data Exchange (ETDEWEB)

Il’inskaya, N. D., E-mail: ioffeled@mail.ru; Karandashev, S. A. [Russian Academy of Sciences, Ioffe Institute (Russian Federation); Karpukhina, N. G. [Limited Liability Company Ioffe LED Ltd. (Russian Federation); Lavrov, A. A.; Matveev, B. A.; Remennyi, M. A.; Stus, N. M.; Usikova, A. A. [Russian Academy of Sciences, Ioffe Institute (Russian Federation)

2016-05-15

The results of studies of the current–voltage characteristics and of the photoelectric and luminescence properties of a monolithic diode 1 × 64 linear array based on p-InAsSbP/n-InAsSb/n{sup +}-InAs with the n{sup +}-InAs-substrate side illuminated and sensitive in the region of 4-μm are reported. An analysis is performed of the mechanisms of current flow in the temperature range of 77–353 K and also of the photosensitivity and the speed of response taking into account the spatial distribution of nonequilibrium radiation and the data of capacitance–voltage measurements.

Lithium-Ion Electrolytes with Improved Safety Tolerance to High Voltage Systems

Science.gov (United States)

Smart, Marshall C. (Inventor); Bugga, Ratnakumar V. (Inventor); Prakash, Surya G. (Inventor); Krause, Frederick C. (Inventor)

2015-01-01

The invention discloses various embodiments of electrolytes for use in lithium-ion batteries, the electrolytes having improved safety and the ability to operate with high capacity anodes and high voltage cathodes. In one embodiment there is provided an electrolyte for use in a lithium-ion battery comprising an anode and a high voltage cathode. The electrolyte has a mixture of a cyclic carbonate of ethylene carbonate (EC) or mono-fluoroethylene carbonate (FEC) co-solvent, ethyl methyl carbonate (EMC), a flame retardant additive, a lithium salt, and an electrolyte additive that improves compatibility and performance of the lithium-ion battery with a high voltage cathode. The lithium-ion battery is charged to a voltage in a range of from about 2.0 V (Volts) to about 5.0 V (Volts).

Linear resonance acceleration of pellets

International Nuclear Information System (INIS)

Mills, R.G.

1978-01-01

A possible requirement for the acceleration of macroscopic pellets to velocities exceeding 10 4 meters per second implies the development of new apparatus. A satisfactory approach might be the linear resonance accelerator. Such apparatus would require the charging of pellets to very high values not yet demonstrated. The incompatibility of phase stability with radial stability in these machines may require abandoning phase stability and adopting feedback control of the accelerating voltage to accommodate statistical fluctuations in the charge to mass ratio of successive pellets

On Dynamic Range Limitations of CMOS Current Conveyors

DEFF Research Database (Denmark)

Bruun, Erik

1999-01-01

frequency band and for the situation where the conveyor is used over the full bandwidth achievable. Finally, the optimisation of the current input range is related to the distortion characteristics and it is pointed out that to a first order approximation the distortion is independent of the current range.......This paper is concerned with the dynamic range of continuous time CMOS current mode circuits. As a representative current mode device a class AB current conveyor is examined. First, the voltage input range of the high impedance Y input is investigated. Next, the current input range of the low...... impedance X input is investigated. It is compared to the thermal noise in the X to Z signal path in order to evaluate the dynamic range, and the dependencies of the dynamic range on the supply voltage and the transistor lay-out is derived, both for the situation where the conveyor is used over a narrow...

Influence of current limitation on voltage stability with voltage sourced converter HVDC

DEFF Research Database (Denmark)

Zeni, Lorenzo; Jóhannsson, Hjörtur; Hansen, Anca Daniela

2013-01-01

A first study of voltage stability with relevant amount of Voltage Sourced Converter based High Voltage Direct Current (VSC-HVDC) transmission is presented, with particular focus on the converters’ behaviour when reaching their rated current. The detrimental effect of entering the current...

Mapping of Residues Forming the Voltage Sensor of the Voltage-Dependent Anion-Selective Channel

Science.gov (United States)

Thomas, Lorie; Blachly-Dyson, Elizabeth; Colombini, Marco; Forte, Michael

1993-06-01

Voltage-gated ion-channel proteins contain "voltage-sensing" domains that drive the conformational transitions between open and closed states in response to changes in transmembrane voltage. We have used site-directed mutagenesis to identify residues affecting the voltage sensitivity of a mitochondrial channel, the voltage-dependent anion-selective channel (VDAC). Although charge changes at many sites had no effect, at other sites substitutions that increased positive charge also increased the steepness of voltage dependance and substitutions that decreased positive charge decreased voltage dependance by an appropriate amount. In contrast to the plasma membrane K^+ and Na^+ channels, these residues are distributed over large parts of the VDAC protein. These results have been used to define the conformational transitions that accompany voltage gating of an ion channel. This gating mechanism requires the movement of large portions of the VDAC protein through the membrane.

Molecular mechanism of voltage sensing in voltage-gated proton channels

Science.gov (United States)

Rebolledo, Santiago; Perez, Marta E.

2013-01-01

Voltage-gated proton (Hv) channels play an essential role in phagocytic cells by generating a hyperpolarizing proton current that electrically compensates for the depolarizing current generated by the NADPH oxidase during the respiratory burst, thereby ensuring a sustained production of reactive oxygen species by the NADPH oxidase in phagocytes to neutralize engulfed bacteria. Despite the importance of the voltage-dependent Hv current, it is at present unclear which residues in Hv channels are responsible for the voltage activation. Here we show that individual neutralizations of three charged residues in the fourth transmembrane domain, S4, all reduce the voltage dependence of activation. In addition, we show that the middle S4 charged residue moves from a position accessible from the cytosolic solution to a position accessible from the extracellular solution, suggesting that this residue moves across most of the membrane electric field during voltage activation of Hv channels. Our results show for the first time that the charge movement of these three S4 charges accounts for almost all of the measured gating charge in Hv channels. PMID:23401575

Special features of the current-voltage characteristics of short superconducting bridges