
Sample records for linear hgh2 molecule

  1. Quantum close coupling calculation of transport and relaxation properties for Hg-H_2 system

    International Nuclear Information System (INIS)

    Nemati-Kande, Ebrahim; Maghari, Ali


    Highlights: • Several relaxation cross sections are calculated for Hg-H_2 van der Waals complex. • These cross sections are calculated from exact close-coupling method. • Energy-dependent SBE cross sections are calculated for ortho- and para-H_2 + Hg systems. • Viscosity and diffusion coefficients are calculated using Mason-Monchick approximation. • The results obtained by Mason-Monchick approximation are compared to the exact close-coupling results. - Abstract: Quantum mechanical close coupling calculation of the state-to-state transport and relaxation cross sections have been done for Hg-H_2 molecular system using a high-level ab initio potential energy surface. Rotationally averaged cross sections were also calculated to obtain the energy dependent Senftleben-Beenakker cross sections at the energy range of 0.005–25,000 cm"−"1. Boltzmann averaging of the energy dependent Senftleben-Beenakker cross sections showed the temperature dependency over a wide temperature range of 50–2500 K. Interaction viscosity and diffusion coefficients were also calculated using close coupling cross sections and full classical Mason-Monchick approximation. The results were compared with each other and with the available experimental data. It was found that Mason-Monchick approximation for viscosity is more reliable than diffusion coefficient. Furthermore, from the comparison of the experimental diffusion coefficients with the result of the close coupling and Mason-Monchick approximation, it was found that the Hg-H_2 potential energy surface used in this work can reliably predict diffusion coefficient data.

  2. Rotational partition functions for linear molecules

    International Nuclear Information System (INIS)

    McDowell, R.S.


    An accurate closed-form expression for the rotational partition function of linear polyatomic molecules in 1 summation electronic states is derived, including the effect of nuclear spin (significant at very low temperatures) and of quartic and sextic centrifugal distortion terms (significant at moderate and high temperatures). The proper first-order quantum correction to the classical rigid-rotator partition function is shown to yield Q/sub r/ ≅β -1 exp(β/3), where βequivalenthcB/kT and B is the rotational constant in cm -1 ; for β≥0.2 additional power-series terms in β are necessary. Comparison between the results of this treatment and exact summations are made for HCN and C 2 H 2 at temperatures from 2 to 5000 K, including separate evaluation of the contributions of nuclear spin and centrifugal distortion

  3. A linear algebraic approach to electron-molecule collisions

    International Nuclear Information System (INIS)

    Collins, L.A.; Schnieder, B.I.


    The linear algebraic approach to electron-molecule collisions is examined by firstly deriving the general set of coupled integrodifferential equations that describe electron collisional processes and then describing the linear algebraic approach for obtaining a solution to the coupled equations. Application of the linear algebraic method to static-exchange, separable exchange and effective optical potential, is examined. (U.K.)

  4. Linear algebraic approach to electron-molecule collisions

    International Nuclear Information System (INIS)

    Schneider, B.I.; Collins, L.A.


    The various levels of sophistication of the linear algebraic method are discussed and its application to electron-molecule collisions of H 2 , N 2 LiH, LiF and HCl is described. 13 references, 2 tables

  5. Conserved linear dynamics of single-molecule Brownian motion

    KAUST Repository

    Serag, Maged F.


    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  6. Conserved linear dynamics of single-molecule Brownian motion (United States)

    Serag, Maged F.; Habuchi, Satoshi


    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  7. Conserved linear dynamics of single-molecule Brownian motion

    KAUST Repository

    Serag, Maged F.; Habuchi, Satoshi


    Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.

  8. Dispersion interaction between an atom and linear molecule

    International Nuclear Information System (INIS)

    Carvalho, I.L. de


    The Jacobi-Csanak method is adapted to the calculation of the dipole-dipole, dipole-quadrupole, quadrupole-dipole, and quadrupole-quadrupole terms of the dispersion energy of an atom-linear molecule system. The angle-dependent parts of the Born amplitudes for the linear molecule are represented by real spherical harmonics. The dispersion energy is finite at all distances and reproduces the usual expression in the asymptotic region (R≥4.7 (angstrom)). In the intermediary region (2.4(angstrom) ≤ R [pt

  9. Excitonic Coupling in Linear and Trefoil Trimer Perylenediimide Molecules Probed by Single-Molecule Spectroscopy

    KAUST Repository

    Yoo, Hyejin


    Perylenediimide (PDI) molecules are promising building blocks for photophysical studies of electronic interactions within multichromophore arrays. Such PDI arrays are important materials for fabrication of molecular nanodevices such as organic light-emitting diodes, organic semiconductors, and biosensors because of their high photostability, chemical and physical inertness, electron affinity, and high tinctorial strength over the entire visible spectrum. In this work, PDIs have been organized into linear (L3) and trefoil (T3) trimer molecules and investigated by single-molecule fluorescence microscopy to probe the relationship between molecular structures and interchromophoric electronic interactions. We found a broad distribution of coupling strengths in both L3 and T3 and hence strong/weak coupling between PDI units by monitoring spectral peak shifts in single-molecule fluorescence spectra upon sequential photobleaching of each constituent chromophore. In addition, we used a wide-field defocused imaging technique to resolve heterogeneities in molecular structures of L3 and T3 embedded in a PMMA polymer matrix. A systematic comparison between the two sets of experimental results allowed us to infer the correlation between intermolecular interactions and molecular structures. Our results show control of the PDI intermolecular interactions using suitable multichromophoric structures. © 2012 American Chemical Society.

  10. Excitonic Coupling in Linear and Trefoil Trimer Perylenediimide Molecules Probed by Single-Molecule Spectroscopy

    KAUST Repository

    Yoo, Hyejin; Furumaki, Shu; Yang, Jaesung; Lee, Ji-Eun; Chung, Heejae; Oba, Tatsuya; Kobayashi, Hiroyuki; Rybtchinski, Boris; Wilson, Thea M.; Wasielewski, Michael R.; Vacha, Martin; Kim, Dongho


    Perylenediimide (PDI) molecules are promising building blocks for photophysical studies of electronic interactions within multichromophore arrays. Such PDI arrays are important materials for fabrication of molecular nanodevices such as organic light-emitting diodes, organic semiconductors, and biosensors because of their high photostability, chemical and physical inertness, electron affinity, and high tinctorial strength over the entire visible spectrum. In this work, PDIs have been organized into linear (L3) and trefoil (T3) trimer molecules and investigated by single-molecule fluorescence microscopy to probe the relationship between molecular structures and interchromophoric electronic interactions. We found a broad distribution of coupling strengths in both L3 and T3 and hence strong/weak coupling between PDI units by monitoring spectral peak shifts in single-molecule fluorescence spectra upon sequential photobleaching of each constituent chromophore. In addition, we used a wide-field defocused imaging technique to resolve heterogeneities in molecular structures of L3 and T3 embedded in a PMMA polymer matrix. A systematic comparison between the two sets of experimental results allowed us to infer the correlation between intermolecular interactions and molecular structures. Our results show control of the PDI intermolecular interactions using suitable multichromophoric structures. © 2012 American Chemical Society.

  11. The interaction of linear and ring forms of DNA molecules with nanodiamonds synthesized by detonation

    International Nuclear Information System (INIS)

    Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S


    Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters

  12. Evaluation of synthetic linear motor-molecule actuation energetics


    Brough, Branden; Northrop, Brian H.; Schmidt, Jacob J.; Tseng, Hsian-Rong; Houk, Kendall N.; Stoddart, J. Fraser; Ho, Chih-Ming


    By applying atomic force microscope (AFM)-based force spectroscopy together with computational modeling in the form of molecular force-field simulations, we have determined quantitatively the actuation energetics of a synthetic motor-molecule. This multidisciplinary approach was performed on specifically designed, bistable, redox-controllable [2]rotaxanes to probe the steric and electrostatic interactions that dictate their mechanical switching at the single-molecule level. The fusion of expe...

  13. Superradiance Effects in the Linear and Nonlinear Optical Response of Quantum Dot Molecules (United States)

    Sitek, A.; Machnikowski, P.


    We calculate the linear optical response from a single quantum dot molecule and the nonlinear, four-wave-mixing response from an inhomogeneously broadened ensemble of such molecules. We show that both optical signals are affected by the coupling-dependent superradiance effect and by optical interference between the two polarizations. As a result, the linear and nonlinear responses are not identical.

  14. Strong-field ionization of linear molecules by a bicircular laser field: Symmetry considerations (United States)

    Gazibegović-Busuladžić, A.; Busuladžić, M.; Hasović, E.; Becker, W.; Milošević, D. B.


    Using the improved molecular strong-field approximation, we investigate (high-order) above-threshold ionization [(H)ATI] of various linear polyatomic molecules by a two-color laser field of frequencies r ω and s ω (with integer numbers r and s ) having coplanar counter-rotating circularly polarized components (a so-called bicircular field). Reflection and rotational symmetries for molecules aligned in the laser-field polarization plane, analyzed for diatomic homonuclear molecules in Phys. Rev. A 95, 033411 (2017), 10.1103/PhysRevA.95.033411, are now considered for diatomic heteronuclear molecules and symmetric and asymmetric linear triatomic molecules. There are additional rotational symmetries for (H)ATI spectra of symmetric linear molecules compared to (H)ATI spectra of the asymmetric ones. It is shown that these symmetries manifest themselves differently for r +s odd and r +s even. For example, HATI spectra for symmetric molecules with r +s even obey inversion symmetry. For ATI spectra of linear molecules, reflection symmetry appears only for certain molecular orientation angles ±90∘-j r 180∘/(r +s ) (j integer). For symmetric linear molecules, reflection symmetry appears also for the angles -j r 180∘/(r +s ) . For perpendicular orientation of molecules with respect to the laser-field polarization plane, the HATI spectra are very similar to those of the atomic targets, i.e., both spectra are characterized by the same type of the (r +s )-fold symmetry.

  15. Rotational and vibrational synthetic spectra of linear parent molecules in comets

    International Nuclear Information System (INIS)

    Crovisier, J.


    We evaluate and model the excitation conditions of linear parent molecules in cometary atmospheres. The model is valid for most linear molecules without electronic angular momentum. It takes into account collisions and infrared excitation. The molecule rotational population distribution is computed as a function of distance to nucleus. The line intensities of the strongest parallel and perpendicular fundamental vibrational bands, as well as the pure rotational lines, can then be evaluated. This model is applied to several candidate parent molecules, for observing conditions corresponding to available or planned instruments, either ground-based or aboard aircrafts, satellites or space probes

  16. Application of the method of continued fractions for electron scattering by linear molecules

    International Nuclear Information System (INIS)

    Lee, M.-T.; Iga, I.; Fujimoto, M.M.; Lara, O.; Brasilia Univ., DF


    The method of continued fractions (MCF) of Horacek and Sasakawa is adapted for the first time to study low-energy electron scattering by linear molecules. Particularly, we have calculated the reactance K-matrices for an electron scattered by hydrogen molecule and hydrogen molecular ion as well as by a polar LiH molecule in the static-exchange level. For all the applications studied herein. the calculated physical quantities converge rapidly, even for a strongly polar molecule such as LiH, to the correct values and in most cases the convergence is monotonic. Our study suggests that the MCF could be an efficient method for studying electron-molecule scattering and also photoionization of molecules. (Author)

  17. Study on infrared multiphoton excitation of the linear triatomic molecule by the Lie-algebra approach

    International Nuclear Information System (INIS)

    Feng, H.; Zheng, Y.; Ding, S.


    Infrared multiphoton vibrational excitation of the linear triatomic molecule has been studied using the quadratic anharmonic Lie-algebra model, unitary transformations, and Magnus approximation. An explicit Lie-algebra expression for the vibrational transition probability is obtained by using a Lie-algebra approach. This explicit Lie-algebra expressions for time-evolution operator and vibrational transition probabilities make the computation clearer and easier. The infrared multiphoton vibrational excitation of the DCN linear tri-atomic molecule is discussed as an example

  18. Developing Density of Laser-Cooled Neutral Atoms and Molecules in a Linear Magnetic Trap (United States)

    Velasquez, Joe, III; Walstrom, Peter; di Rosa, Michael


    In this poster we show that neutral particle injection and accumulation using laser-induced spin flips may be used to form dense ensembles of ultracold magnetic particles, i.e., laser-cooled paramagnetic atoms and molecules. Particles are injected in a field-seeking state, are switched by optical pumping to a field-repelled state, and are stored in the minimum-B trap. The analogous process in high-energy charged-particle accumulator rings is charge-exchange injection using stripper foils. The trap is a linear array of sextupoles capped by solenoids. Particle-tracking calculations and design of our linear accumulator along with related experiments involving 7Li will be presented. We test these concepts first with atoms in preparation for later work with selected molecules. Finally, we present our preliminary results with CaH, our candidate molecule for laser cooling. This project is funded by the LDRD program of Los Alamos National Laboratory.

  19. Electron re-scattering from aligned linear molecules using the R-matrix method

    International Nuclear Information System (INIS)

    Harvey, A G; Tennyson, J


    Electron re-scattering in a strong laser field provides an important probe of molecular structure and processes. The laser field drives the ionization of the molecule, followed by acceleration and subsequent recollision of the electron with the parent molecular ion, the scattered electrons carry information about the nuclear geometry and electronic states of the molecular ion. It is advantageous in strong field experiments to work with aligned molecules, which introduces extra physics compared to the standard gas-phase, electron-molecule scattering problem. The formalism for scattering from oriented linear molecules is presented and applied to H 2 and CO 2 . Differential cross sections are presented for (re-)scattering by these systems concentrating on the most common, linear alignment. In H 2 these cross sections show significant angular structure which, particularly for a scattering angle of 90 deg., are predicted to vary significantly between re-collisions stimulated by an even or an odd number of photons. In CO 2 these cross sections are zero indicating the necessity of using non-parallel alignment with this molecule.

  20. Detection of kinetic change points in piece-wise linear single molecule motion (United States)

    Hill, Flynn R.; van Oijen, Antoine M.; Duderstadt, Karl E.


    Single-molecule approaches present a powerful way to obtain detailed kinetic information at the molecular level. However, the identification of small rate changes is often hindered by the considerable noise present in such single-molecule kinetic data. We present a general method to detect such kinetic change points in trajectories of motion of processive single molecules having Gaussian noise, with a minimum number of parameters and without the need of an assumed kinetic model beyond piece-wise linearity of motion. Kinetic change points are detected using a likelihood ratio test in which the probability of no change is compared to the probability of a change occurring, given the experimental noise. A predetermined confidence interval minimizes the occurrence of false detections. Applying the method recursively to all sub-regions of a single molecule trajectory ensures that all kinetic change points are located. The algorithm presented allows rigorous and quantitative determination of kinetic change points in noisy single molecule observations without the need for filtering or binning, which reduce temporal resolution and obscure dynamics. The statistical framework for the approach and implementation details are discussed. The detection power of the algorithm is assessed using simulations with both single kinetic changes and multiple kinetic changes that typically arise in observations of single-molecule DNA-replication reactions. Implementations of the algorithm are provided in ImageJ plugin format written in Java and in the Julia language for numeric computing, with accompanying Jupyter Notebooks to allow reproduction of the analysis presented here.

  1. Symmetry Adaptation of the Rotation-Vibration Theory for Linear Molecules

    Directory of Open Access Journals (Sweden)

    Katy L. Chubb


    Full Text Available A numerical application of linear-molecule symmetry properties, described by the D ∞ h point group, is formulated in terms of lower-order symmetry groups D n h with finite n. Character tables and irreducible representation transformation matrices are presented for D n h groups with arbitrary n-values. These groups can subsequently be used in the construction of symmetry-adapted ro-vibrational basis functions for solving the Schrödinger equations of linear molecules. Their implementation into the symmetrisation procedure based on a set of “reduced” vibrational eigenvalue problems with simplified Hamiltonians is used as a practical example. It is shown how the solutions of these eigenvalue problems can also be extended to include the classification of basis-set functions using ℓ, the eigenvalue (in units of ℏ of the vibrational angular momentum operator L ^ z . This facilitates the symmetry adaptation of the basis set functions in terms of the irreducible representations of D n h . 12 C 2 H 2 is used as an example of a linear molecule of D ∞ h point group symmetry to illustrate the symmetrisation procedure of the variational nuclear motion program Theoretical ROVibrational Energies (TROVE.

  2. Conformational Effects in Non-Stoichiometric Complexes of Two Hyperbranched Molecules with a Linear Polyelectrolyte

    Directory of Open Access Journals (Sweden)

    Alexey Lyulin


    Full Text Available We report results from Brownian dynamics computer simulations of systems comprised by two terminally charged hyperbranched molecules preferentially branched in the periphery, with an oppositely charged linear chain of varying length. Comparison of the findings from the present study to stoichiometric counterparts and to analogous dendrimer-based complexes, reveal that the presence of the second hyperbranched molecule incurs significant changes in the conformational characteristics of both components of the complex. Instead of step-like changes in the average size and shape of the hyperbranched component that were noted in the previously studied stoichiometric systems, a rather smooth change is observed upon increase of the length of the linear component. In addition, a markedly different behavior is also noticed in the conformational characteristics of the linear chain when compared to that in similar dendrimer-based systems. The above findings are consistent with the higher degree of deformability of the peripherally branched molecules which allow appropriate rearrangements in shape in order to accommodate the favorable Coulombic interactions between the two components of the complex. This behavior offers new insight towards the design of more efficient hyperbranched-based systems which can take advantage of the multifunctionality and the structural properties of the highly branched polymer components.

  3. Lanczos-driven coupled-cluster damped linear response theory for molecules in polarizable environments

    DEFF Research Database (Denmark)

    List, Nanna Holmgaard; Coriani, Sonia; Kongsted, Jacob


    are specifically motivated by a twofold aim: (i) computation of core excitations in realistic surroundings and (ii) examination of the effect of the differential response of the environment upon excitation solely related to the CC multipliers (herein denoted the J matrix) in computations of excitation energies......We present an extension of a previously reported implementation of a Lanczos-driven coupled-cluster (CC) damped linear response approach to molecules in condensed phases, where the effects of a surrounding environment are incorporated by means of the polarizable embedding formalism. We...... and transition moments of polarizable-embedded molecules. Numerical calculations demonstrate that the differential polarization of the environment due to the first-order CC multipliers provides only minor contributions to the solvatochromic shift for all transitions considered. We thus complement previous works...

  4. Linear-algebraic approach to electronic excitation of atoms and molecules by electron impact

    International Nuclear Information System (INIS)

    Collins, L.A.; Schneider, B.I.


    A linear-algebraic method, based on an integral equations formulation, is applied to the excitation of atoms and molecules by electron impact. Various schemes are devised for treating the one-electron terms that sometimes cause instabilities when directly incorporated into the solution matrix. These include introducing Lagrange undetermined multipliers and correlation terms. Good agreement between the method and other computational techniques is obtained for electron scattering for hydrogenic and Li-like atomic ions and for H 2 + in two- to five-state close-coupling calculations

  5. Electronic excitation of atoms and molecules by electron impact in a linear algebraic, separable potential approach

    International Nuclear Information System (INIS)

    Collins, L.A.; Schneider, B.I.


    The linear algebraic, separable potential approach is applied to the electronic excitation of atoms and molecules by electron impact. By representing the exchange and off-diagonal direct terms on a basis, the standard set of coupled inelastic equations is reduced to a set of elastic inhomogeneous equations. The procedure greatly simplifies the formulation by allowing a large portion of the problem to be handled by standard bound-state techniques and by greatly reducing the order of the scattering equations that must be solved. Application is made to the excitation of atomic hydrogen in the three-state close-coupling (1s, 2s, 2p) approximation. (author)

  6. Linear-algebraic approach to electron-molecule collisions: General formulation

    International Nuclear Information System (INIS)

    Collins, L.A.; Schneider, B.I.


    We present a linear-algebraic approach to electron-molecule collisions based on an integral equations form with either logarithmic or asymptotic boundary conditions. The introduction of exchange effects does not alter the basic form or order of the linear-algebraic equations for a local potential. In addition to the standard procedure of directly evaluating the exchange integrals by numerical quadrature, we also incorporate exchange effects through a separable-potential approximation. Efficient schemes are developed for reducing the number of points and channels that must be included. The method is applied at the static-exchange level to a number of molecular systems including H 2 , N 2 , LiH, and CO 2

  7. Linear Ion Traps in Space: The Mars Organic Molecule Analyzer (MOMA) Instrument and Beyond (United States)

    Arevalo, Ricardo; Brinckerhoff, William; Mahaffy, Paul; van Amerom, Friso; Danell, Ryan; Pinnick, Veronica; Li, Xiang; Hovmand, Lars; Getty, Stephanie; Grubisic, Andrej; Goesmann, Fred; Cottin, Hervé


    Historically, quadrupole mass spectrometer (QMS) instruments have been used to explore a wide survey of planetary targets in our solar system, from Venus (Pioneer Venus) to Saturn (Cassini-Huygens). However, linear ion trap (LIT) mass spectrometers have found a niche as smaller, versatile alternatives to traditional quadrupole analyzers.The core astrobiological experiment of ESA’s ExoMars Program is the Mars Organic Molecule Analyzer (MOMA) onboard the ExoMars 2018 rover. The MOMA instrument is centered on a linear (or 2-D) ion trap mass spectrometer. As opposed to 3-D traps, LIT-based instruments accommodate two symmetrical ion injection pathways, enabling two complementary ion sources to be used. In the case of MOMA, these two analytical approaches are laser desorption mass spectrometry (LDMS) at Mars ambient pressures, and traditional gas chromatography mass spectrometry (GCMS). The LIT analyzer employed by MOMA also offers: higher ion capacity compared to a 3-D trap of the same volume; redundant detection subassemblies for extended lifetime; and, a link to heritage QMS designs and assembly logistics. The MOMA engineering test unit (ETU) has demonstrated the detection of organics in the presence of wt.%-levels of perchlorate, effective ion enhancement via stored waveform inverse Fourier transform (SWIFT), and derivation of structural information through tandem mass spectrometry (MS/MS).A more progressive linear ion trap mass spectrometer (LITMS), funded by the NASA ROSES MatISSE Program, is being developed at NASA GSFC and promises to augment the capabilities of the MOMA instrument by way of: an expanded mass range (i.e., 20 - 2000 Da); detection of both positive and negative ions; spatially resolved (<1 mm) characterization of individual rock core layers; and, evolved gas analysis and GCMS with pyrolysis up to 1300° C (enabling breakdown of refractory phases). The Advanced Resolution Organic Molecule Analyzer (AROMA) instrument, being developed through NASA

  8. Polarization properties of below-threshold harmonics from aligned molecules H2+ in linearly polarized laser fields. (United States)

    Dong, Fulong; Tian, Yiqun; Yu, Shujuan; Wang, Shang; Yang, Shiping; Chen, Yanjun


    We investigate the polarization properties of below-threshold harmonics from aligned molecules in linearly polarized laser fields numerically and analytically. We focus on lower-order harmonics (LOHs). Our simulations show that the ellipticity of below-threshold LOHs depends strongly on the orientation angle and differs significantly for different harmonic orders. Our analysis reveals that this LOH ellipticity is closely associated with resonance effects and the axis symmetry of the molecule. These results shed light on the complex generation mechanism of below-threshold harmonics from aligned molecules.

  9. Polarization and ellipticity of high-order harmonics from aligned molecules generated by linearly polarized intense laser pulses

    International Nuclear Information System (INIS)

    Le, Anh-Thu; Lin, C. D.; Lucchese, R. R.


    We present theoretical calculations for polarization and ellipticity of high-order harmonics from aligned N 2 , CO 2 , and O 2 molecules generated by linearly polarized lasers. Within the rescattering model, the two polarization amplitudes of the harmonics are determined by the photo-recombination amplitudes for photons emitted with polarization parallel or perpendicular to the direction of the same returning electron wave packet. Our results show clear species-dependent polarization states, in excellent agreement with experiments. We further note that the measured polarization ellipse of the harmonic furnishes the needed parameters for a 'complete' experiment in molecules.

  10. Collision cross section calculations for polyatomic ions considering rotating diatomic/linear gas molecules

    International Nuclear Information System (INIS)

    Larriba-Andaluz, Carlos; Hogan, Christopher J.


    Structural characterization of ions in the gas phase is facilitated by measurement of ion collision cross sections (CCS) using techniques such as ion mobility spectrometry. Further information is gained from CCS measurement when comparison is made between measurements and accurately predicted CCSs for model ion structures and the gas in which measurements are made. While diatomic gases, namely molecular nitrogen and air, are being used in CCS measurement with increasingly prevalency, the majority of studies in which measurements are compared to predictions use models in which gas molecules are spherical or non-rotating, which is not necessarily appropriate for diatomic gases. Here, we adapt a momentum transfer based CCS calculation approach to consider rotating, diatomic gas molecule collisions with polyatomic ions, and compare CCS predictions with a diatomic gas molecule to those made with a spherical gas molecular for model spherical ions, tetra-alkylammonium ions, and multiply charged polyethylene glycol ions. CCS calculations are performed using both specular-elastic and diffuse-inelastic collisions rules, which mimic negligible internal energy exchange and complete thermal accommodation, respectively, between gas molecule and ion. The influence of the long range ion-induced dipole potential on calculations is also examined with both gas molecule models. In large part we find that CCSs calculated with specular-elastic collision rules decrease, while they increase with diffuse-inelastic collision rules when using diatomic gas molecules. Results clearly show the structural model of both the ion and gas molecule, the potential energy field between ion and gas molecule, and finally the modeled degree of kinetic energy exchange between ion and gas molecule internal energy are coupled to one another in CCS calculations, and must be considered carefully to obtain results which agree with measurements

  11. Revival structures of linear molecules in a field-free alignment condition as probed by high-order harmonic generation

    International Nuclear Information System (INIS)

    Lee, G. H.; Kim, H. T.; Park, J. Y.; Nam, C. H.; Kim, T. K.; Lee, J. H.; Ihee, H.


    Revival structures (rotational coherence) of three linear molecules (N 2 , O 2 , and CO 2 ) in a field free alignment condition have been investigated using high-order harmonic generation. The harmonic yields of these molecules were measured in a pump-probe manner by using a weak femtosecond (fs) laser pulse for field-free alignment of molecules and another intense fs laser pulse for harmonic generation. The harmonic intensities from 23rd to 29th order with respect to the time delay between the pump and the probe pulses showed revival structures in the condition of a field-free alignment of molecules. While the revival structure of a N 2 molecule had one-fourth the period of the full revival time and different degrees of modulation among different fractional revival times, the revival structures of O 2 and CO 2 molecules showed one-eighth the periods of the full revival time and similar degrees of modulation among all fractional revival times. The revival structures could be interpreted in terms of the nature of the highest occupied molecular orbital and the total nuclear spin.

  12. Importance of the alignment of polar π conjugated molecules inside carbon nanotubes in determining second-order non-linear optical properties. (United States)

    Yumura, Takashi; Yamamoto, Wataru


    We employed density functional theory (DFT) calculations with dispersion corrections to investigate energetically preferred alignments of certain p,p'-dimethylaminonitrostilbene (DANS) molecules inside an armchair (m,m) carbon nanotube (n × DANS@(m,m)), where the number of inner molecules (n) is no greater than 3. Here, three types of alignments of DANS are considered: a linear alignment in a parallel fashion and stacking alignments in parallel and antiparallel fashions. According to DFT calculations, a threshold tube diameter for containing DANS molecules in linear or stacking alignments was found to be approximately 1.0 nm. Nanotubes with diameters smaller than 1.0 nm result in the selective formation of linearly aligned DANS molecules due to strong confinement effects within the nanotubes. By contrast, larger diameter nanotubes allow DANS molecules to align in a stacking and linear fashion. The type of alignment adopted by the DANS molecules inside a nanotube is responsible for their second-order non-linear optical properties represented by their static hyperpolarizability (β 0 values). In fact, we computed β 0 values of DANS assemblies taken from optimized n × DANS@(m,m) structures, and their values were compared with those of a single DANS molecule. DFT calculations showed that β 0 values of DANS molecules depend on their alignment, which decrease in the following order: linear alignment > parallel stacking alignment > antiparallel stacking alignment. In particular, a linear alignment has a β 0 value more significant than that of the same number of isolated molecules. Therefore, the linear alignment of DANS molecules, which is only allowed inside smaller diameter nanotubes, can strongly enhance their second-order non-linear optical properties. Since the nanotube confinement determines the alignment of DANS molecules, a restricted nanospace can be utilized to control their second-order non-linear optical properties. These DFT findings can assist in the

  13. Application of the weak-field asymptotic theory to the analysis of tunneling ionization of linear molecules

    DEFF Research Database (Denmark)

    Madsen, Lars Bojer; Tolstikhin, Oleg I.; Morishita, Toru


    The recently developed weak-field asymptotic theory [ Phys. Rev. A 84 053423 (2011)] is applied to the analysis of tunneling ionization of a molecular ion (H2+), several homonuclear (H2, N2, O2) and heteronuclear (CO, HF) diatomic molecules, and a linear triatomic molecule (CO2) in a static...... electric field. The dependence of the ionization rate on the angle between the molecular axis and the field is determined by a structure factor for the highest occupied molecular orbital. This factor is calculated using a virtually exact discrete variable representation wave function for H2+, very accurate...... Hartree-Fock wave functions for the diatomics, and a Hartree-Fock quantum chemistry wave function for CO2. The structure factors are expanded in terms of standard functions and the associated structure coefficients, allowing the determination of the ionization rate for any orientation of the molecule...

  14. Before the Ring: synthesis of linear organic molecules in astrophysical ices by low energy electron impact (United States)

    Huels, Michael A.; Bass Andrew, D.; Mirsaleh-Kohan, Nasrin; Sanche, Leon

    The question of the origin for the building blocks of life, either synthesized here on earth, or in space [1], has been the subject of much debate, experimental investigation, or astronomical observation, much of it stimulated by the early experiments of Miller [2], and subsequent space radiation related variations thereof [3-5]. And while the precise details of the formation of even the simplest biomolecules that make up life on earth still remain shrouded inmystery, one of the notions that persist throughout the debate is that the building blocks of life, such as amino-acids, or even the cyclic components of RNA and DNA, or other cyclic hydrocarbons (e.g. PHAs), where synthesized via radiolysis [6] either in the earths proto-atmosphere, its early oceans, or in the near interstellar space surrounding the early earth. Here we provide experimental evidence for the hypothesis that interactions of low energy secondary electrons and ions, formed during the radiolysis of matter, with atoms and molecules in the medium, may have played, and may still play an important role in the chemical transformation of astrophysical or planetary surface ices [7], where they lead to the synthesis of more complex chemical species from less complex, naturally occurring components. We report the synthesis and desorption of new chemical species from simple molecular surface ices, containing CH4 / CD4 , C2 D2 , O2 , CO, CO2 , or N2 in various combination mixtures, irradiated by low energy (CO+ (n = 1-3), among others. The formation of all these linear, pre-biotic molecular species, produced here by electron initiated cation-reactions in simple molecular films, suggests that similar mechanisms likely precede the synthesis of life's most basic cyclic molecular components in planetary, or astrophysical surface ices that are continuously subjected to the types of space radiations (UV, X-or -ray, or heavy ions) that can generate such low energy secondary electrons. [Funded by NSERC and Canadian

  15. Theoretical study of molecular vibration and Application to linear triatomic molecules: case of OCS

    International Nuclear Information System (INIS)

    Andrianavalomahefa, A.


    Our aim is to give a theoretical approach to the calculation of vibrational energy levels of polyatomic molecules. By using matrix calculation, we have to solve an eigenvalue equation that gives normal vibration frequencies of the system. A basis change introduces normal coordinates of vibration, which diagonalize the Hamiltonian. The harmonic approximation gives a rough evaluation of parameters which describe the system. Then, we introduce nonlinear terms to take into account the anharmonicity of interatomic bounds. Morse oscillator gives good approximation for diatomic molecules. We consider cubic and quartic potential terms for polyatomic molecules. We treat the problem both in classical and quantum approach. The results thus obtained are applied to study longitudinal vibration of carbonyl sulfide. [fr

  16. Molecules with linear pi-conjugated pathways between all substituents : Omniconjugation

    NARCIS (Netherlands)

    van der Veen, M.H.; Rispens, M.T; Jonkman, H.T.; Hummelen, J.C.

    In this paper, omniconjugation is introduced as a topological phenomenon in pi-conjugated systems. Omniconjugated molecules are defined by the fact that they provide direct and fully pi-conjugated pathways between all subdstituents attached to them. Surprisingly, until now such topologies have never

  17. Molecules with Linear π-Conjugated Pathways between All Substituents : Omniconjugation

    NARCIS (Netherlands)

    Veen, Marleen H. van der; Rispens, Minze T.; Jonkman, Harry T.; Hummelen, Jan C.


    In this paper, omniconjugation is introduced as a topological phenomenon in π-conjugated systems. Omniconjugated molecules are defined by the fact that they provide direct and fully π-conjugated pathways between all substituents attached to them. Surprisingly, until now such topologies have never

  18. Conductance mechanism in a linear non-conjugated trimethylsilyl-acetylene molecule: tunneling through localized states

    NARCIS (Netherlands)

    Petrov, E.G.; Marchenko, A.; Kapitanchuk, O.; Katsonis, Nathalie Hélène; Fichou, D.


    The conductance properties of 1,3-(trimethylsilyl)-1-tridecene-6,12-diyne, a non-conjugated trimethylsil-acetylene molecule have been investigated both experimentally and theoretically. Based on scanning tunnelling spectroscopy experiments, a discussion on the mechanisms controlling the charge

  19. Inducing elliptically polarized high-order harmonics from aligned molecules with linearly polarized femtosecond pulses

    DEFF Research Database (Denmark)

    Etches, Adam; Madsen, Christian Bruun; Madsen, Lars Bojer


    A recent paper reported elliptically polarized high-order harmonics from aligned N2 using a linearly polarized driving field [X. Zhou et al., Phys. Rev. Lett. 102, 073902 (2009)]. This observation cannot be explained in the standard treatment of the Lewenstein model and has been ascribed to many...

  20. A Linear Tetranuclear Dysprosium(III) Compound Showing Single-Molecule Magnet Behavior

    Energy Technology Data Exchange (ETDEWEB)

    Ke, Hongshan; Xu, Gong Feng; Guo, Yun-Nan; Gamez, Patrick; Beavers, Christine M; Teat, Simon J; Tang, Jinkui


    Although magnetic measurements reveal a single-relaxation time for a linear tetranuclear Dy(III) compound, the wide distribution of the relaxation time observed clearly suggests the presence of two slightly different anisotropic centres, therefore opening new avenues for investigating the relaxation dynamics of lanthanide aggregates.

  1. Nuclear spin-spin coupling constants of linear carbon chains terminated by coronene molecules: a first principles study

    International Nuclear Information System (INIS)

    Oliveira, Joao Paulo Cavalcante; Mota, F. de Brito; Rivelino, Roberto


    Full text. Carbon nano wires made of long linear atomic chains have attracted considerable interest due to their potential applications in nano electronics. We report a density-functional-theory study of the nuclear spin-spin coupling constants for nano assemblies made of two coronene molecules bridged by carbon linear chains, considering distinct sizes and spin multiplicities. Also, we examine the effects of two terminal conformations (syn and anti) of the terminal anchor pieces on the magnetic properties of the carbon chains via 13 C NMR calculations. Our results reveal that simplified chemical models such as those based on cumulenes or polyynes are not appropriate to describe the linear chains with sp 2 terminations. For these types of atomic chains, the electronic ground state of the even-numbered chains can be singlet or triplet, whereas the ground state of the odd-numbered chains can be doublet or quartet. We discuss how the 13 C NMR chemical shift absorption is affected by increasing the size and changing the parity of the linear carbon chains. We have found that the J coupling constants between the carbon atoms in the linear chains present a well-defined pattern, in good accordance with our electronic structure calculations. For example, in the -C 4 - units we obtain couplings of 43.8, 114.5, 84.6, 114.5, and 43.8 Hz from one end to the other

  2. Ejection of Coulomb Crystals from a Linear Paul Ion Trap for Ion-Molecule Reaction Studies. (United States)

    Meyer, K A E; Pollum, L L; Petralia, L S; Tauschinsky, A; Rennick, C J; Softley, T P; Heazlewood, B R


    Coulomb crystals are being increasingly employed as a highly localized source of cold ions for the study of ion-molecule chemical reactions. To extend the scope of reactions that can be studied in Coulomb crystals-from simple reactions involving laser-cooled atomic ions, to more complex systems where molecular reactants give rise to multiple product channels-sensitive product detection methodologies are required. The use of a digital ion trap (DIT) and a new damped cosine trap (DCT) are described, which facilitate the ejection of Coulomb-crystallized ions onto an external detector for the recording of time-of-flight (TOF) mass spectra. This enables the examination of reaction dynamics and kinetics between Coulomb-crystallized ions and neutral molecules: ionic products are typically cotrapped, thus ejecting the crystal onto an external detector reveals the masses, identities, and quantities of all ionic species at a selected point in the reaction. Two reaction systems are examined: the reaction of Ca(+) with deuterated isotopologues of water, and the charge exchange between cotrapped Xe(+) with deuterated isotopologues of ammonia. These reactions are examples of two distinct types of experiment, the first involving direct reaction of the laser-cooled ions, and the second involving reaction of sympathetically-cooled heavy ions to form a mixture of light product ions. Extensive simulations are conducted to interpret experimental results and calculate optimal operating parameters, facilitating a comparison between the DIT and DCT approaches. The simulations also demonstrate a correlation between crystal shape and image shape on the detector, suggesting a possible means for determining crystal geometry for nonfluorescing ions.

  3. Theoretical studies of MHD plasma molecules. I. Potential energy curves and dipole moments of linear KOH

    International Nuclear Information System (INIS)

    England, W.B.


    Uncorrelated and correlated potential energy curves and dipole moments are reported for linear KOH. The compound is found to be ionic, K + OH - . Minimum energy bond lengths are R/sub KO/=4.2913 au and R/sub OH/=1.7688 au, with an estimated accuracy of 2%. The corresponding dipole moment is 3.3 au (8.46 D) with a similar accuracy estimate. This is to our knowledge the first value ever reported for the KOH dipole moment, and the large value suggests that KOH will be an effective electron scatterer in MHD plasmas

  4. Molecular-beam electric-resonance studies of linear triatomic molecules

    International Nuclear Information System (INIS)

    Reinartz, J.M.L.J.


    In the present work, the MBER technique has been employed to investigate the spectra of the high temperature species KCN and CsOH and at low temperatures the spectra of five different isotopic species of OCS in natural mixture and the most abundant isotopic species of N 2 O and ClCN. For the low temperature species, spectra in the ground state and in the first excited state of the bending mode have been obtained. Bending vibrational effects on hyperfine constants and on electric and magnetic constants have been deduced from these spectra. The introduction of nozzle beam sources has been a factor of great importance for this study. For the ground states, high resolution spectra have been obtained both in external electric and in combined parallel electric and magnetic fields. These spectra could well be explained by the known theories for molecules in a 1 Σ state to within an experimental accuracy of about 50-150 Hz. Extension of the theory needed for the interpretation of the spectra for excited bending states is given. Hyperfine properties and electric and magnetic constants have been obtained with very high accuracy from the analysis of the frequencies of the observed transitions within one rotational state (ΔJ = 0 transitions)

  5. The inherent dynamics of a molecular liquid: Geodesic pathways through the potential energy landscape of a liquid of linear molecules (United States)

    Jacobson, Daniel; Stratt, Richard M.


    Because the geodesic pathways that a liquid follows through its potential energy landscape govern its slow, diffusive motion, we suggest that these pathways are logical candidates for the title of a liquid's "inherent dynamics." Like their namesake "inherent structures," these objects are simply features of the system's potential energy surface and thus provide views of the system's structural evolution unobstructed by thermal kinetic energy. This paper shows how these geodesic pathways can be computed for a liquid of linear molecules, allowing us to see precisely how such molecular liquids mix rotational and translational degrees of freedom into their dynamics. The ratio of translational to rotational components of the geodesic path lengths, for example, is significantly larger than would be expected on equipartition grounds, with a value that scales with the molecular aspect ratio. These and other features of the geodesics are consistent with a picture in which molecular reorientation adiabatically follows translation—molecules largely thread their way through narrow channels available in the potential energy landscape.

  6. The synthesis and properties of linear A-π-D-π-A type organic small molecule containing diketopyrrolopyrrole terminal units (United States)

    Zhang, Shanshan; Niu, Qingfen; Sun, Tao; Li, Yang; Li, Tianduo; Liu, Haixia


    A novel linear A-π-D-π-A-type organic small molecule Ph2(PDPP)2 consisting diketopyrrolopyrrole (DPP) as acceptor unit, biphenylene as donor unit and acetylene unit as π-linkage has been successfully designed and synthesized. Its corresponding thermal, photophysical and electrochemical properties as well as the photoinduced charge-separation process were investigated. Ph2(PDPP)2 exhibits high thermal stability and it can be soluble in common organic solvents such as chloroform and tetrahydrofuran. The photophysical properties show that DPP2Ph2 harvests sunlight over the entire visible spectrum range in the thin-film state (300-800 nm). DPP2Ph2 has lower band gaps and appropriate energy levels to satisfy the requirement of solution-processable organic solar cells. The efficient photoinduced charge separation process was clearly observed between DPP2Ph2 with PC61BM and the Ksv value was found to be as high as 2.13 × 104 M- 1. Therefore, these excellent properties demonstrate that the designed A-π-D-π-A-type small molecule Ph2(PDPP)2 is the prospective candidate as donor material for organic photovoltaic material.

  7. Theoretical studies on nuclear spin selective quantum dynamics of non-linear molecules; Theoretische Untersuchung zur Quantendynamik der Kernspinisomere nicht-linearer Molekuele

    Energy Technology Data Exchange (ETDEWEB)

    Grohmann, Thomas


    In this thesis the wave packet dynamics of nuclear spin isomers of polyatomic molecules after interaction with static and time-dependent magnetic fields and moderate intense nonresonant laser pulses is investigated. In particular, the process of inducing (internal) molecular rotation as well as alignment of molecules by manipulating their rotational or rotational-torsional degrees of freedom is studied. In the first part of the thesis all theoretical concepts for identifying nuclear spin isomers and for describing their quantum dynamics will be discussed. Especially the symmetrization postulate and themolecular symmetry group will be introduced and illustrated for some examples of molecules. These concepts will be extended to the case of identifying nuclear spin isomers in the presence of an external field. In the second part it is shown for nitromethane that magnetic fields are able to induce unidirectional rotations in opposite directions for different nuclear spin isomers of molecules containing methyl groups if the dipolar interaction is included. Additionally, it is demonstrated that different nuclear spin isomers of a chemical compound may show different alignment after the interaction with a moderate intense laser pulse. As shown for the rigid symmetric top propadien and the rigid asymmetric tops ethene and analogues, distinct pairs of nuclear spin isomers show at certain points in time a complementary behavior: while one isomer is showing alignment the partner isomer is showing anti-alignment. Moreover, it is illustrated that not every nuclear spin isomer can be aligned equally efficient. The alignment of non-rigid molecules is considered as well. As an example for a molecule with feasible torsion in the electronic ground state, the alignment of diboron tetrafluoride is investigated. It becomes apparent that not only rotational but also the torsional dynamics of the molecules is nuclear spin selective; different nuclear spin isomers have at distinct points

  8. Study of two examples of non linear interaction of a laser wave with matter: laser-induced damage of dielectrics and non linear optical properties of organometallic molecules in solution

    International Nuclear Information System (INIS)

    Gaudry, Jean-Baptiste


    This research thesis reports the study of two mechanisms of non linear interaction of a laser wave with matter. More particularly, it reports the experimental investigation of non linear optical properties of organometallic molecules in solution, as well as the damage of perfect silica under laser irradiation by using simulation codes. As far as optical properties are concerned, the author highlights the influence of the electronic configuration of the metal present in the organometallic compound, and the influence of the ligand on the second-order non-linear response. As far as the simulation is concerned, some experimental results have been reproduced. This work can be useful for the investigation of the extrinsic damage of imperfect materials, and for the design of experiments of transient measurements of excited silica [fr

  9. A series of fluorene-based two-photon absorbing molecules: synthesis, linear and nonlinear characterization, and bioimaging (United States)

    Andrade, Carolina D.; Yanez, Ciceron O.; Rodriguez, Luis; Belfield, Kevin D.


    The synthesis, structural, and photophysical characterization of a series of new fluorescent donor–acceptor and acceptor-acceptor molecules, based on the fluorenyl ring system, with two-photon absorbing properties is described. These new compounds exhibited large Stokes shifts, high fluorescent quantum yields, and, significantly, high two-photon absorption cross sections, making them well suited for two-photon fluorescence microscopy (2PFM) imaging. Confocal and two-photon fluorescence microscopy imaging of COS-7 and HCT 116 cells incubated with probe I showed endosomal selectivity, demonstrating the potential of this class of fluorescent probes in multiphoton fluorescence microscopy. PMID:20481596

  10. Quantum coherent π-electron rotations in a non-planar chiral molecule induced by using a linearly polarized UV laser pulse (United States)

    Mineo, Hirobumi; Fujimura, Yuichi


    We propose an ultrafast quantum switching method of π-electron rotations, which are switched among four rotational patterns in a nonplanar chiral aromatic molecule (P)-2,2’- biphenol and perform the sequential switching among four rotational patterns which are performed by the overlapped pump-dump laser pulses. Coherent π-electron dynamics are generated by applying the linearly polarized UV pulse laser to create a pair of coherent quasidegenerated excited states. We also plot the time-dependent π-electron ring current, and discussed ring current transfer between two aromatic rings.

  11. Quantum switching of π-electron rotations in a nonplanar chiral molecule by using linearly polarized UV laser pulses. (United States)

    Mineo, Hirobumi; Yamaki, Masahiro; Teranishi, Yoshiaki; Hayashi, Michitoshi; Lin, Sheng Hsien; Fujimura, Yuichi


    Nonplanar chiral aromatic molecules are candidates for use as building blocks of multidimensional switching devices because the π electrons can generate ring currents with a variety of directions. We employed (P)-2,2'-biphenol because four patterns of π-electron rotations along the two phenol rings are possible and theoretically determine how quantum switching of the π-electron rotations can be realized. We found that each rotational pattern can be driven by a coherent excitation of two electronic states under two conditions: one is the symmetry of the electronic states and the other is their relative phase. On the basis of the results of quantum dynamics simulations, we propose a quantum control method for sequential switching among the four rotational patterns that can be performed by using ultrashort overlapped pump and dump pulses with properly selected relative phases and photon polarization directions. The results serve as a theoretical basis for the design of confined ultrafast switching of ring currents of nonplanar molecules and further current-induced magnetic fluxes of more sophisticated systems.

  12. Bond-based linear indices of the non-stochastic and stochastic edge-adjacency matrix. 1. Theory and modeling of ChemPhys properties of organic molecules. (United States)

    Marrero-Ponce, Yovani; Martínez-Albelo, Eugenio R; Casañola-Martín, Gerardo M; Castillo-Garit, Juan A; Echevería-Díaz, Yunaimy; Zaldivar, Vicente Romero; Tygat, Jan; Borges, José E Rodriguez; García-Domenech, Ramón; Torrens, Francisco; Pérez-Giménez, Facundo


    Novel bond-level molecular descriptors are proposed, based on linear maps similar to the ones defined in algebra theory. The kth edge-adjacency matrix (E(k)) denotes the matrix of bond linear indices (non-stochastic) with regard to canonical basis set. The kth stochastic edge-adjacency matrix, ES(k), is here proposed as a new molecular representation easily calculated from E(k). Then, the kth stochastic bond linear indices are calculated using ES(k) as operators of linear transformations. In both cases, the bond-type formalism is developed. The kth non-stochastic and stochastic total linear indices are calculated by adding the kth non-stochastic and stochastic bond linear indices, respectively, of all bonds in molecule. First, the new bond-based molecular descriptors (MDs) are tested for suitability, for the QSPRs, by analyzing regressions of novel indices for selected physicochemical properties of octane isomers (first round). General performance of the new descriptors in this QSPR studies is evaluated with regard to the well-known sets of 2D/3D MDs. From the analysis, we can conclude that the non-stochastic and stochastic bond-based linear indices have an overall good modeling capability proving their usefulness in QSPR studies. Later, the novel bond-level MDs are also used for the description and prediction of the boiling point of 28 alkyl-alcohols (second round), and to the modeling of the specific rate constant (log k), partition coefficient (log P), as well as the antibacterial activity of 34 derivatives of 2-furylethylenes (third round). The comparison with other approaches (edge- and vertices-based connectivity indices, total and local spectral moments, and quantum chemical descriptors as well as E-state/biomolecular encounter parameters) exposes a good behavior of our method in this QSPR studies. Finally, the approach described in this study appears to be a very promising structural invariant, useful not only for QSPR studies but also for similarity

  13. Viscous properties of isotropic fluids composed of linear molecules: departure from the classical Navier-Stokes theory in nano-confined geometries. (United States)

    Hansen, J S; Daivis, Peter J; Todd, B D


    In this paper we present equilibrium molecular-dynamics results for the shear, rotational, and spin viscosities for fluids composed of linear molecules. The density dependence of the shear viscosity follows a stretched exponential function, whereas the rotational viscosity and the spin viscosities show approximately power-law dependencies. The frequency-dependent shear and spin viscosities are also studied. It is found that viscoelastic behavior is first manifested in the shear viscosity and that the real part of the spin viscosities features a maximum for nonzero frequency. The calculated transport coefficients are used together with the extended Navier-Stokes equations to investigate the effect of the coupling between the intrinsic angular momentum and linear momentum for highly confined fluids. Both steady and oscillatory flows are studied. It is shown, for example, that the fluid flow rate for Poiseuille flow is reduced by up to 10% in a 2 nm channel for a buta-triene fluid at density 236 kg m(-3) and temperature 306 K. The coupling effect may, therefore, become very important for nanofluidic applications.

  14. A harmonic approximation of intramolecular vibrations in a mixed quantum-classical methodology: Linear absorbance of a dissolved Pheophorbid-a molecule as an example

    International Nuclear Information System (INIS)

    Megow, Joerg; Kulesza, Alexander; Qu Zhengwang; Ronneberg, Thomas; Bonacic-Koutecky, Vlasta; May, Volkhard


    Graphical abstract: Structure of a single Pheo (green: C-atoms, blue: N-atoms, red; O-atoms, light grey: H-atoms). - Abstract: Linear absorption spectra of a single Pheophorbid-a molecule (Pheo) dissolved in ethanol are calculated in a mixed quantum-classical approach. In this computational scheme the absorbance is mainly determined by the time-dependent fluctuations of the energy gap between the Pheo ground and excited electronic state. The actual magnitude of the energy gap is caused by the electrostatic solvent solute coupling as well as by contributions due to intra Pheo vibrations. For the latter a new approach is proposed which is based on precalculated potential energy surfaces (PES) described in a harmonic approximation. To get the respective nuclear equilibrium configurations and Hessian matrices of the two involved electronic states we carried out the necessary electronic structure calculations in a DFT-framework. Since the Pheo changes its spatial orientation in the course of a MD run, the nuclear equilibrium configurations change their spatial position, too. Introducing a particular averaging procedure, these configurations are determined from the actual MD trajectories. The usability of the approach is underlined by a perfect reproduction of experimental data. This also demonstrates that our proposed method is suitable for the description of more complex systems in future investigations.

  15. Performance of the Linear Ion Trap Mass Spectrometer for the Mars Organic Molecule Analyzer (MOMA) Investigation on the 2018 Exomars Rover (United States)

    Arevalo, Ricardo, Jr.; Brinckerhoff, William B.; Pinnick, Veronica T.; van Amerom, Friso H. W.; Danell, Ryan M.; Li, Xiang; Getty, Stephanie; Hovmand, Lars; Atanassova, Martina; Mahaffy, Paul R.; hide


    The 2018 ExoMars rover mission includes the Mars Organic Molecule Analyzer (MOMA) investigation. MOMA will examine the chemical composition of samples acquired from depths of up to two meters below the martian surface, where organics may be protected from degradation derived from cosmic radiation and/or oxidative chemical reactions. When combined with the complement of instruments in the rover's Pasteur Payload, MOMA has the potential to reveal the presence of a wide range of organics preserved in a variety of mineralogical environments, and to begin to understand the structural character and potential origin of those compounds. The MOMA investigation is led by the Max Planck Institute for Solar System Research (MPS) with the mass spectrometer subsystem provided by NASA GSFC. MOMA's linear ion trap mass spectrometer (ITMS) is designed to analyze molecular composition of: (i) gas evolved from pyrolyzed powder samples and separated in a gas chromatograph; and, (ii) ions directly desorbed from crushed solid samples at Mars ambient pressure, as enabled by a pulsed UV laser system, fast-actuating aperture valve and capillary ion inlet. Breadboard ITMS and associated electronics have been advanced to high end-to-end fidelity in preparation for flight hardware delivery to Germany in 2015.

  16. A study on the electro-oxidation and electropolymerization of a new OPE linear molecule by EQCM and in situ FTIR spectroelectrochemistry

    International Nuclear Information System (INIS)

    Luo Jiao; Liu Meiling; Zhao Qiangqin; Zhao Jie; Zhang Youyu; Tan Liang; Tang Hao; Xie Qingji; Li Haitao; Yao Shouzhuo


    A novel symmetric conjugated oligo(phenylene-ethynylene) (OPE) linear molecule (1,4-bis(4-aminophenylethynyl)benzene); BAB) was synthesized by Sonogashira cross-coupling reactions. The structure and purity of the compound were confirmed by 1 H NMR, 13 C NMR and infrared (IR) and mass spectrometry (MS). The electrochemical oxidation process and mechanism of BAB were investigated via in situ Fourier transform infrared (FTIR) spectroelectrochemistry and electrochemical quartz crystal microbalance (EQCM). The electrochemical oxidation mechanism of BAB was proposed. The studies revealed that the BAB concentration and oxidation potential had a significant influence on the growth of the polymer film. A densely packed polymer film, which exhibited nonelectroactivity, was formed when a high monomer concentration and a high oxidation potential were used. When the electropolymerization of BAB was conducted at a lower concentration, a new pair of redox peaks appeared, and the resultant thin film had better electroactivity. The in situ FTIR studies confirmed that BAB could be electro-oxidized into radical cations and then electropolymerized via para (N-N) and/or ortho (N-C) coupling reactions to form polymers with a larger conjugated π-electron system. The surface morphology of the poly-BAB was also investigated with atomic force microscopy (AFM) and scanning electron microscopy (SEM).

  17. Two Dimensional Symmetric Correlation Functions of the S Operator and Two Dimensional Fourier Transforms: Considering the Line Coupling for P and R Lines of Linear Molecules (United States)

    Ma, Q.; Boulet, C.; Tipping, R. H.


    The refinement of the Robert-Bonamy (RB) formalism by considering the line coupling for isotropic Raman Q lines of linear molecules developed in our previous study [Q. Ma, C. Boulet, and R. H. Tipping, J. Chem. Phys. 139, 034305 (2013)] has been extended to infrared P and R lines. In these calculations, the main task is to derive diagonal and off-diagonal matrix elements of the Liouville operator iS1 - S2 introduced in the formalism. When one considers the line coupling for isotropic Raman Q lines where their initial and final rotational quantum numbers are identical, the derivations of off-diagonal elements do not require extra correlation functions of the ^S operator and their Fourier transforms except for those used in deriving diagonal elements. In contrast, the derivations for infrared P and R lines become more difficult because they require a lot of new correlation functions and their Fourier transforms. By introducing two dimensional correlation functions labeled by two tensor ranks and making variable changes to become even functions, the derivations only require the latters' two dimensional Fourier transforms evaluated at two modulation frequencies characterizing the averaged energy gap and the frequency detuning between the two coupled transitions. With the coordinate representation, it is easy to accurately derive these two dimensional correlation functions. Meanwhile, by using the sampling theory one is able to effectively evaluate their two dimensional Fourier transforms. Thus, the obstacles in considering the line coupling for P and R lines have been overcome. Numerical calculations have been carried out for the half-widths of both the isotropic Raman Q lines and the infrared P and R lines of C2H2 broadened by N2. In comparison with values derived from the RB formalism, new calculated values are significantly reduced and become closer to measurements.

  18. Adsorption behavior of n-butanol molecules on negatively charged surfaces of electrodes of mercury, gallium, and alloys In-Ga and Tl-Ga

    International Nuclear Information System (INIS)

    Damskin, B.B.; Baturina, O.A.; Vasil'ev, S.Yu.; Emets, V.V.; Kazarinov, V.E.


    Curves of differential capacitance in the interfaces Hg/H 2 O, Ga/H 2 O, (In-Ga)/H 2 O and (Tl-Ga)H 2 O in 0.05 M Na 2 SO 4 solutions with different additions of n-butanol have been obtained by the bridge method at a frequency of 420 Hz and temperature of 32 deg C. The method of regression analysis of the curves permitted ascertaining the adsorption parameters of n-butanol for the range of charges q, where there is no chemisorption of H 2 O dipoles. The data obtained suggested that the difference in the adsorption behaviour of organic molecules on the metals studied in the range of higher negative charges is largely determined by different electron electrochemical work functions, the definition being given by S. Trasatti [ru

  19. The HIFI spectral survey of AFGL 2591 (CHESS). I. Highly excited linear rotor molecules in the high-mass protostellar envelope (United States)

    van der Wiel, M. H. D.; Pagani, L.; van der Tak, F. F. S.; Kaźmierczak, M.; Ceccarelli, C.


    Context. Linear rotor molecules such as CO, HCO+ and HCN are important probes of star-forming gas. For these species, temperatures of ≲ 50 K are sufficient to produce emission lines that are observable from the ground at (sub)millimeter wavelengths. Molecular gas in the environment of massive protostellar objects, however, is known to reach temperatures of several hundred K. To probe this, space-based far-infrared observations are required. Aims: We aim to reveal the gas energetics in the circumstellar environment of the prototypical high-mass protostellar object AFGL 2591. Methods: Rotational spectral line signatures of CO species, HCO+, CS, HCN and HNC from a 490-1240 GHz survey with Herschel/HIFI, complemented by ground-based JCMT and IRAM 30 m spectra, cover transitions in the energy range (Eup/k) between 5 K and ~ 300 K. Selected frequency settings in the highest frequency HIFI bands (up to 1850 GHz) extend this range to 750 K for 12C16O. The resolved spectral line profiles are used to separate and study various kinematic components. Observed line intensities are compared with a numerical model that calculates excitation balance and radiative transfer based on spherical geometry. Results: The line profiles show two emission components, the widest and bluest of which is attributed to an approaching outflow and the other to the envelope. We find evidence for progressively more redshifted and wider line profiles from the envelope gas with increasing energy level. This trend is qualitatively explained by residual outflow contribution picked up in the systematically decreasing beam size. Integrated line intensities for each species decrease as Eup/k increases from ≲ 50 to ~700 K. The H2 density and temperature of the outflow gas are constrained to ~105-106 cm-3 and 60-200 K. In addition, we derive a temperature between 9 and 17 K and N(H2) ~ 3 × 1021 cm-2 for a known foreground cloud seen in absorption, and N(H2) ≲ 1019 cm-2 for a second foreground component

  20. Determination of local concentration of H2O molecules and gas temperature in the process of hydrogen – oxygen gas mixture heating by means of linear and nonlinear laser spectroscopy

    International Nuclear Information System (INIS)

    Kozlov, D N; Kobtsev, V D; Stel'makh, O M; Smirnov, Valery V; Stepanov, E V


    Employing the methods of linear absorption spectroscopy and nonlinear four-wave mixing spectroscopy using laserinduced gratings we have simultaneously measured the local concentrations of H 2 O molecules and the gas temperature in the process of the H 2 – O 2 mixture heating. During the measurements of the deactivation rates of pulsed-laser excited singlet oxygen O 2 (b 1 Σ + g ) in collisions with H 2 in the range 294 – 850 K, the joint use of the two methods made it possible to determine the degree of hydrogen oxidation at a given temperature. As the mixture is heated, H 2 O molecules are formed by 'dark' reactions of H 2 with O 2 in the ground state. The experiments have shown that the measurements of tunable diode laser radiation absorption along an optical path through the inhomogeneously heated gas mixture in a cell allows high-accuracy determination of the local H 2 O concentration in the O 2 laser excitation volume, if the gas temperature in this volume is known. When studying the collisional deactivation of O 2 (b 1 Σ + g ) molecules, the necessary measurements of the local temperature can be implemented using laser-induced gratings, arising due to spatially periodic excitation of O 2 (X 3 Σ - g ) molecules to the b 1 Σ + g state by radiation of the pump laser of the four-wave mixing spectrometer. (laser spectroscopy)

  1. Comparison of Linear and Cyclic His-Ala-Val Peptides in Modulating the Blood-Brain Barrier Permeability: Impact on Delivery of Molecules to the Brain. (United States)

    Alaofi, Ahmed; On, Ngoc; Kiptoo, Paul; Williams, Todd D; Miller, Donald W; Siahaan, Teruna J


    The aim of this study is to evaluate the effect of peptide cyclization on the blood-brain barrier (BBB) modulatory activity and plasma stability of His-Ala-Val peptides, which are derived from the extracellular 1 domain of human E-cadherin. The activities to modulate the intercellular junctions by linear HAV4 (Ac-SHAVAS-NH2), cyclic cHAVc1 (Cyclo(1,8)Ac-CSHAVASC-NH2), and cyclic cHAVc3 (Cyclo(1,6)Ac-CSHAVC-NH2) were compared in in vitro and in vivo BBB models. Linear HAV4 and cyclic cHAVc1 have the same junction modulatory activities as assessed by in vitro MDCK monolayer model and in situ rat brain perfusion model. In contrast, cyclic cHAVc3 was more effective than linear HAV4 in modulating MDCK cell monolayers and in improving in vivo brain delivery of Gd-DTPA on i.v. administration in Balb/c mice. Cyclic cHAVc3 (t1/2 = 12.95 h) has better plasma stability compared with linear HAV4 (t1/2 = 2.4 h). The duration of the BBB modulation was longer using cHAVc3 (2-4 h) compared with HAV4 (brain delivery of IRdye800cw-PEG (25 kDa) as detected by near IR imaging. The result showed that cyclic cHAVc3 peptide had better activity and plasma stability than linear HAV4 peptide. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

  2. Geometric phase effects in excited state dynamics through a conical intersection in large molecules: N-dimensional linear vibronic coupling model study (United States)

    Li, Jiaru; Joubert-Doriol, Loïc; Izmaylov, Artur F.


    We investigate geometric phase (GP) effects in nonadiabatic transitions through a conical intersection (CI) in an N-dimensional linear vibronic coupling (ND-LVC) model. This model allows for the coordinate transformation encompassing all nonadiabatic effects within a two-dimensional (2D) subsystem, while the other N - 2 dimensions form a system of uncoupled harmonic oscillators identical for both electronic states and coupled bi-linearly with the subsystem coordinates. The 2D subsystem governs ultra-fast nonadiabatic dynamics through the CI and provides a convenient model for studying GP effects. Parameters of the original ND-LVC model define the Hamiltonian of the transformed 2D subsystem and thus influence GP effects directly. Our analysis reveals what values of ND-LVC parameters can introduce symmetry breaking in the 2D subsystem that diminishes GP effects.

  3. Excited-state potential-energy surfaces of metal-adsorbed organic molecules from linear expansion Δ-self-consistent field density-functional theory (ΔSCF-DFT). (United States)

    Maurer, Reinhard J; Reuter, Karsten


    Accurate and efficient simulation of excited state properties is an important and much aspired cornerstone in the study of adsorbate dynamics on metal surfaces. To this end, the recently proposed linear expansion Δ-self-consistent field method by Gavnholt et al. [Phys. Rev. B 78, 075441 (2008)] presents an efficient alternative to time consuming quasi-particle calculations. In this method, the standard Kohn-Sham equations of density-functional theory are solved with the constraint of a non-equilibrium occupation in a region of Hilbert-space resembling gas-phase orbitals of the adsorbate. In this work, we discuss the applicability of this method for the excited-state dynamics of metal-surface mounted organic adsorbates, specifically in the context of molecular switching. We present necessary advancements to allow for a consistent quality description of excited-state potential-energy surfaces (PESs), and illustrate the concept with the application to Azobenzene adsorbed on Ag(111) and Au(111) surfaces. We find that the explicit inclusion of substrate electronic states modifies the topologies of intra-molecular excited-state PESs of the molecule due to image charge and hybridization effects. While the molecule in gas phase shows a clear energetic separation of resonances that induce isomerization and backreaction, the surface-adsorbed molecule does not. The concomitant possibly simultaneous induction of both processes would lead to a significantly reduced switching efficiency of such a mechanism.

  4. Structural, Spectroscopic (FT-IR, Raman and NMR, Non-linear Optical (NLO, HOMO-LUMO and Theoretical (DFT/CAM-B3LYP Analyses of N-Benzyloxycarbonyloxy-5-Norbornene-2,3-Dicarboximide Molecule

    Directory of Open Access Journals (Sweden)

    Nuri ÖZTÜRK


    Full Text Available The experimental spectroscopic investigation of N-benzyloxycarbonyloxy-5-norbornene-2,3-dicarboximide (C17H15NO5 molecule has been done using 1H and 13C NMR chemical shifts, FT-IR and Raman spectroscopies. Conformational forms have been determined depending on orientation of N-benzyloxycarbonyloxy and 5-norbornene-2,3-dicarboximide (NDI groups of the title compound. The structural geometric optimizations, vibrational wavenumbers, NMR chemical shifts (in vacuum and chloroform and HOMO-LUMO analyses for all conformers of the title molecule have been done with DFT/CAM-B3LYP method at the 6-311++G(d,p basis set. Additionally, based on the calculated HOMO and LUMO energy values, some molecular properties such as ionization potential (I, electron affinity (A, electronegativity (χ, chemical hardness (h, chemical softness (z, chemical potential (μ and electrophilicity index (w parameters are determined for all conformers. The non-linear optical (NLO properties have been studied for the title molecule. We can say that the experimental spectral data are in accordance with calculated values.

  5. Autoimmune responses in patients with linear IgA bullous dermatosis: both autoantibodies and T lymphocytes recognize the NC16A domain of the BP180 molecule. (United States)

    Lin, Mong-Shang; Fu, Chang-Ling; Olague-Marchan, Monica; Hacker, Mary K; Zillikens, Detlef; Giudice, George J; Fairley, Janet A


    Linear IgA bullous disease (LABD) is an autoimmune skin disease characterized by subepidermal blisters and IgA autoantibodies directed against the epidermal basement membrane zone (BMZ) of the skin. Various antigens have been identified as targets of IgA autoantibodies including BP180, a type II glycoprotein that spans the BMZ and lamina lucida. Previously, we have identified a subset of LABD patients whose sera contained IgA antibodies against the 16th noncollagenous (NC16A) domain of BP180. NC16A was previously shown to harbor epitopes that are recognized by both autoantibodies and T cells from patients with bullous pemphigoid and herpes gestationis and is thought to be associated with the development of these immunobullous diseases. The aim of this study was to determine whether T lymphocytes from LABD patients with anti-NC16A IgA autoantibodies respond to epitopes in the same region of the BP180 protein. Indeed, of the four LABD patients in our study, all had T cells that specifically proliferated in response to NC16A. Moreover, two subfragments of NC16A were identified as the predominant targets of LABD T cells. Further analysis of T cell lines and clones derived from these patients revealed that these cells express a CD4 memory T cell phenotype and secrete a Th1/Th2 mixed-cytokine profile, characteristics similar to those of T cells in bullous pemphigoid patients. Our data suggest that the BP180 protein, typically the NC16A region, is the common target of both cellular and humoral immune responses in some LABD patients. This information helps to further elucidate the autoimmune mechanisms in this disease.

  6. Analytic Morse/long-range potential energy surfaces and "adiabatic-hindered-rotor" treatment for a symmetric top-linear molecule dimer: A case study of CH3F-H2 (United States)

    Zhang, Xiao-Long; Ma, Yong-Tao; Zhai, Yu; Li, Hui


    A first effective six-dimensional ab initio potential energy surface (PES) for CH3F-H2 which explicitly includes the intramolecular Q3 stretching normal mode of the CH3F monomer is presented. The electronic structure computations have been carried out at the explicitly correlated coupled cluster level of theory [CCSD(T)-F12a] with an augmented correlation-consistent triple zeta basis set. Five-dimensional analytical intermolecular PESs for ν3(CH3F) = 0 and 1 are then obtained by fitting the vibrationally averaged potentials to the Morse/Long-Range (MLR) potential function form. The MLR function form is applied to the nonlinear molecule-linear molecule case for the first time. These fits to 25 015 points have root-mean-square deviations of 0.74 cm-1 and 0.082 cm-1 for interaction energies less than 0.0 cm-1. Using the adiabatic hindered-rotor approximation, three-dimensional PESs for CH3F-paraH2 are generated from the 5D PESs over all possible orientations of the hydrogen monomer. The infrared and microwave spectra for CH3F-paraH2 dimer are predicted for the first time. These analytic PESs can be used for modeling the dynamical behavior in CH3F-(H2)N clusters, including the possible appearance of microscopic superfluidity.

  7. Molecule nanoweaver (United States)

    Gerald, II; Rex, E [Brookfield, IL; Klingler, Robert J [Glenview, IL; Rathke, Jerome W [Homer Glen, IL; Diaz, Rocio [Chicago, IL; Vukovic, Lela [Westchester, IL


    A method, apparatus, and system for constructing uniform macroscopic films with tailored geometric assemblies of molecules on the nanometer scale. The method, apparatus, and system include providing starting molecules of selected character, applying one or more force fields to the molecules to cause them to order and condense with NMR spectra and images being used to monitor progress in creating the desired geometrical assembly and functionality of molecules that comprise the films.

  8. Dipole Correlation of the Electronic Structures of theConformations of Water Molecule Evolving Through theNormal Modes of Vibrations Between Angular (C2v to Linear(D∝h Shapes

    Directory of Open Access Journals (Sweden)

    Arindam Chakraborty


    orbital in almost all conformations. One more important result of the present study is that, with the physical process of structural evolution from close angular shape to the linear transition state, the length of the σ (O–H decreases and its strength increases as a monotone function of reaction coordinates. The bond length is shortest and the strength is largest at the transition state of structural inversion. Result of structural effect of the present study during the evolution of molecular conformations is quite consistent with the result of a very refined calculation that one physically significant feature of force field that the stretching force constants at the linear geometry are considerably larger than their equilibrium counter parts. The variation of bond strength and the hybridization of s and p orbitals on O atom center to form the σ (O–H bond as a function of evolution of conformations is in accordance with Coulson’s prediction. The total dipole moment of all conformations is partitioned into the contribution from bonds and lone pairs and correlated in terms of the computed hybridization in lone pairs. The analysis of the variation of dipole moment as a function of angular to linear structural evolution reveals that the dipole moment of H2O molecule is not due to the bond moments only but a significant contribution comes from a lone pair. It is strongly established that the dipole moment of water molecule at and around the equilibrium geometry is not due to the bond moments only and the major part of the molecular dipole comes from the contribution of lone pair electrons. This necessitates the accommodation of a lone pair of electrons in a hybrid orbital on O atom. The computed LMO’s webbed with partitioned molecular dipole reveal that one lone pair is in a pure p- type orbital and the other lone pair is in a hybrid of s and p, and not in a pure s type orbital as suggested on the basis of

  9. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 4. Molecule Matters – van der Waals Molecules - History and Some Perspectives on Intermolecular Forces. E Arunan. Feature Article Volume 14 Issue 4 April 2009 pp 346-356 ...

  10. Atkins' molecules

    CERN Document Server

    Atkins, Peters


    Originally published in 2003, this is the second edition of a title that was called 'the most beautiful chemistry book ever written'. In it, we see the molecules responsible for the experiences of our everyday life - including fabrics, drugs, plastics, explosives, detergents, fragrances, tastes, and sex. With engaging prose Peter Atkins gives a non-technical account of an incredible range of aspects of the world around us, showing unexpected connections, and giving an insight into how this amazing world can be understood in terms of the atoms and molecules from which it is built. The second edition includes dozens of extra molecules, graphical presentation, and an even more accessible and enthralling account of the molecules themselves.

  11. Interstellar Molecules (United States)

    Solomon, Philip M.


    Radioastronomy reveals that clouds between the stars, once believed to consist of simple atoms, contain molecules as complex as seven atoms and may be the most massive objects in our Galaxy. (Author/DF)

  12. Adhesion molecules

    CERN Document Server

    Preedy, Victor R


    This book covers the structure and classification of adhesion molecules in relation to signaling pathways and gene expression. It discusses immunohistochemical localization, neutrophil migration, and junctional, functional, and inflammatory adhesion molecules in pathologies such as leukocyte decompression sickness and ischemia reperfusion injury. Highlighting the medical applications of current research, chapters cover diabetes, obesity, and metabolic syndrome; hypoxia; kidney disease; smoking, atrial fibrillation, and heart disease, the brain and dementia; and tumor proliferation. Finally, it looks at molecular imaging and bioinformatics, high-throughput technologies, and chemotherapy.

  13. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 16; Issue 12. Molecule Matters - Dinitrogen. A G Samuelson J Jabadurai. Volume 16 Issue 12 ... Author Affiliations. A G Samuelson1 J Jabadurai1. Department of Inroganic and Physical Chemistry, Indian Institute of Science, Bangalore 560 012, India.

  14. Molecule Matters

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 11; Issue 9. Molecule Matters - A Chromium Compound with a Quintuple Bond. K C Kumara Swamy. Feature Article Volume 11 Issue 9 September 2006 pp 72-75. Fulltext. Click here to view fulltext PDF. Permanent link:

  15. A new family of 1D exchange biased heterometal single-molecule magnets: observation of pronounced quantum tunneling steps in the hysteresis loops of quasi-linear {Mn2Ni3} clusters. (United States)

    Das, Animesh; Gieb, Klaus; Krupskaya, Yulia; Demeshko, Serhiy; Dechert, Sebastian; Klingeler, Rüdiger; Kataev, Vladislav; Büchner, Bernd; Müller, Paul; Meyer, Franc


    First members of a new family of heterometallic Mn/Ni complexes [Mn(2)Ni(3)X(2)L(4)(LH)(2)(H(2)O)(2)] (X = Cl: 1; X = Br: 2) with the new ligand 2-{3-(2-hydroxyphenyl)-1H-pyrazol-1-yl}ethanol (H(2)L) have been synthesized, and single crystals obtained from CH(2)Cl(2) solutions have been characterized crystallographically. The molecular structures feature a quasi-linear Mn(III)-Ni(II)-Ni(II)-Ni(II)-Mn(III) core with six-coordinate metal ions, where elongated axes of all the distorted octahedral coordination polyhedra are aligned parallel and are fixed with respect to each other by intramolecular hydrogen bonds. 1 and 2 exhibit quite strong ferromagnetic exchange interactions throughout (J(Mn-Ni) ≈ 40 K (1) or 42 K (2); J(Ni-Ni) ≈ 22 K (1) or 18 K (2)) that lead to an S(tot) = 7 ground state, and a sizable uniaxial magnetoanisotropy with D(mol) values -0.55 K (1) and -0.45 K (2). These values are directly derived also from frequency- and temperature-dependent high-field EPR spectra. Slow relaxation of the magnetization at low temperatures and single-molecule magnet (SMM) behavior are evident from frequency-dependent peaks in the out-of-phase ac susceptibilities and magnetization versus dc field measurements, with significant energy barriers to spin reversal U(eff) = 27 K (1) and 22 K (2). Pronounced quantum tunnelling steps are observed in the hysteresis loops of the temperature- and scan rate-dependent magnetization data, but with the first relaxation step shifted above (1) or below (2) the zero crossing of the magnetic field, despite the very similar molecular structures. The different behavior of 1 and 2 is interpreted in terms of antiferromagnetic (1) or ferromagnetic (2) intermolecular interactions, which are discussed in view of the subtle differences of intermolecular contacts within the crystal lattice.

  16. Linear algebra

    CERN Document Server

    Shilov, Georgi E


    Covers determinants, linear spaces, systems of linear equations, linear functions of a vector argument, coordinate transformations, the canonical form of the matrix of a linear operator, bilinear and quadratic forms, Euclidean spaces, unitary spaces, quadratic forms in Euclidean and unitary spaces, finite-dimensional space. Problems with hints and answers.

  17. Systematic studies of molecular vibrational anharmonicity and vibration-rotation interaction by self-consistent-field higher derivative methods: Applications to asymmetric and symmetric top and linear polyatomic molecules

    Energy Technology Data Exchange (ETDEWEB)

    Clabo, D.A. Jr.


    Inclusion of the anharmonicity normal mode vibrations (i.e., the third and fourth (and higher) derivatives of a molecular Born-Oppenheimer potential energy surface) is necessary in order to theoretically reproduce experimental fundamental vibrational frequencies of a molecule. Although ab initio determinations of harmonic vibrational frequencies may give errors of only a few percent by the inclusion of electron correlation within a large basis set for small molecules, in general, molecular fundamental vibrational frequencies are more often available from high resolution vibration-rotation spectra. Recently developed analytic third derivatives methods for self-consistent-field (SCF) wavefunctions have made it possible to examine with previously unavailable accuracy and computational efficiency the anharmonic force fields of small molecules.

  18. Systematic studies of molecular vibrational anharmonicity and vibration-rotation interaction by self-consistent-field higher derivative methods: Applications to asymmetric and symmetric top and linear polyatomic molecules

    International Nuclear Information System (INIS)

    Clabo, D.A. Jr.


    Inclusion of the anharmonicity normal mode vibrations [i.e., the third and fourth (and higher) derivatives of a molecular Born-Oppenheimer potential energy surface] is necessary in order to theoretically reproduce experimental fundamental vibrational frequencies of a molecule. Although ab initio determinations of harmonic vibrational frequencies may give errors of only a few percent by the inclusion of electron correlation within a large basis set for small molecules, in general, molecular fundamental vibrational frequencies are more often available from high resolution vibration-rotation spectra. Recently developed analytic third derivatives methods for self-consistent-field (SCF) wavefunctions have made it possible to examine with previously unavailable accuracy and computational efficiency the anharmonic force fields of small molecules

  19. Molecule Matters van der Waals Molecules

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 12. Molecule Matters van der Waals Molecules - Noble Gas Clusters are London Molecules! E Arunan. Feature Article Volume 14 Issue 12 December 2009 pp 1210-1222 ...

  20. Linear gate

    International Nuclear Information System (INIS)



    A linear gate providing a variable gate duration from 0,40μsec to 4μsec was developed. The electronic circuity consists of a linear circuit and an enable circuit. The input signal can be either unipolar or bipolar. If the input signal is bipolar, the negative portion will be filtered. The operation of the linear gate is controlled by the application of a positive enable pulse. (author)

  1. Linear Accelerators

    International Nuclear Information System (INIS)

    Vretenar, M


    The main features of radio-frequency linear accelerators are introduced, reviewing the different types of accelerating structures and presenting the main characteristics aspects of linac beam dynamics

  2. Linearization Method and Linear Complexity (United States)

    Tanaka, Hidema

    We focus on the relationship between the linearization method and linear complexity and show that the linearization method is another effective technique for calculating linear complexity. We analyze its effectiveness by comparing with the logic circuit method. We compare the relevant conditions and necessary computational cost with those of the Berlekamp-Massey algorithm and the Games-Chan algorithm. The significant property of a linearization method is that it needs no output sequence from a pseudo-random number generator (PRNG) because it calculates linear complexity using the algebraic expression of its algorithm. When a PRNG has n [bit] stages (registers or internal states), the necessary computational cost is smaller than O(2n). On the other hand, the Berlekamp-Massey algorithm needs O(N2) where N(≅2n) denotes period. Since existing methods calculate using the output sequence, an initial value of PRNG influences a resultant value of linear complexity. Therefore, a linear complexity is generally given as an estimate value. On the other hand, a linearization method calculates from an algorithm of PRNG, it can determine the lower bound of linear complexity.

  3. Linear algebra

    CERN Document Server

    Said-Houari, Belkacem


    This self-contained, clearly written textbook on linear algebra is easily accessible for students. It begins with the simple linear equation and generalizes several notions from this equation for the system of linear equations and introduces the main ideas using matrices. It then offers a detailed chapter on determinants and introduces the main ideas with detailed proofs. The third chapter introduces the Euclidean spaces using very simple geometric ideas and discusses various major inequalities and identities. These ideas offer a solid basis for understanding general Hilbert spaces in functional analysis. The following two chapters address general vector spaces, including some rigorous proofs to all the main results, and linear transformation: areas that are ignored or are poorly explained in many textbooks. Chapter 6 introduces the idea of matrices using linear transformation, which is easier to understand than the usual theory of matrices approach. The final two chapters are more advanced, introducing t...

  4. Linear algebra

    CERN Document Server

    Stoll, R R


    Linear Algebra is intended to be used as a text for a one-semester course in linear algebra at the undergraduate level. The treatment of the subject will be both useful to students of mathematics and those interested primarily in applications of the theory. The major prerequisite for mastering the material is the readiness of the student to reason abstractly. Specifically, this calls for an understanding of the fact that axioms are assumptions and that theorems are logical consequences of one or more axioms. Familiarity with calculus and linear differential equations is required for understand

  5. Linear programming

    CERN Document Server

    Solow, Daniel


    This text covers the basic theory and computation for a first course in linear programming, including substantial material on mathematical proof techniques and sophisticated computation methods. Includes Appendix on using Excel. 1984 edition.

  6. Linear algebra

    CERN Document Server

    Liesen, Jörg


    This self-contained textbook takes a matrix-oriented approach to linear algebra and presents a complete theory, including all details and proofs, culminating in the Jordan canonical form and its proof. Throughout the development, the applicability of the results is highlighted. Additionally, the book presents special topics from applied linear algebra including matrix functions, the singular value decomposition, the Kronecker product and linear matrix equations. The matrix-oriented approach to linear algebra leads to a better intuition and a deeper understanding of the abstract concepts, and therefore simplifies their use in real world applications. Some of these applications are presented in detailed examples. In several ‘MATLAB-Minutes’ students can comprehend the concepts and results using computational experiments. Necessary basics for the use of MATLAB are presented in a short introduction. Students can also actively work with the material and practice their mathematical skills in more than 300 exerc...

  7. Linear algebra

    CERN Document Server

    Berberian, Sterling K


    Introductory treatment covers basic theory of vector spaces and linear maps - dimension, determinants, eigenvalues, and eigenvectors - plus more advanced topics such as the study of canonical forms for matrices. 1992 edition.

  8. Linear Models

    CERN Document Server

    Searle, Shayle R


    This 1971 classic on linear models is once again available--as a Wiley Classics Library Edition. It features material that can be understood by any statistician who understands matrix algebra and basic statistical methods.

  9. LINEAR ACCELERATOR (United States)

    Christofilos, N.C.; Polk, I.J.


    Improvements in linear particle accelerators are described. A drift tube system for a linear ion accelerator reduces gap capacity between adjacent drift tube ends. This is accomplished by reducing the ratio of the diameter of the drift tube to the diameter of the resonant cavity. Concentration of magnetic field intensity at the longitudinal midpoint of the external sunface of each drift tube is reduced by increasing the external drift tube diameter at the longitudinal center region.

  10. Molecule Matters van der Waals Molecules

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 7. Molecule Matters van der Waals Molecules - Rg•••HF Complexes are Debye Molecules! E Arunan. Feature Article Volume 15 Issue 7 July 2010 pp 667-674. Fulltext. Click here to view fulltext PDF. Permanent link:

  11. Linear regression

    CERN Document Server

    Olive, David J


    This text covers both multiple linear regression and some experimental design models. The text uses the response plot to visualize the model and to detect outliers, does not assume that the error distribution has a known parametric distribution, develops prediction intervals that work when the error distribution is unknown, suggests bootstrap hypothesis tests that may be useful for inference after variable selection, and develops prediction regions and large sample theory for the multivariate linear regression model that has m response variables. A relationship between multivariate prediction regions and confidence regions provides a simple way to bootstrap confidence regions. These confidence regions often provide a practical method for testing hypotheses. There is also a chapter on generalized linear models and generalized additive models. There are many R functions to produce response and residual plots, to simulate prediction intervals and hypothesis tests, to detect outliers, and to choose response trans...

  12. Linear Colliders

    International Nuclear Information System (INIS)

    Alcaraz, J.


    After several years of study e''+ e''- linear colliders in the TeV range have emerged as the major and optimal high-energy physics projects for the post-LHC era. These notes summarize the present status form the main accelerator and detector features to their physics potential. The LHC era. These notes summarize the present status, from the main accelerator and detector features to their physics potential. The LHC is expected to provide first discoveries in the new energy domain, whereas an e''+ e''- linear collider in the 500 GeV-1 TeV will be able to complement it to an unprecedented level of precision in any possible areas: Higgs, signals beyond the SM and electroweak measurements. It is evident that the Linear Collider program will constitute a major step in the understanding of the nature of the new physics beyond the Standard Model. (Author) 22 refs

  13. Linear algebra

    CERN Document Server

    Edwards, Harold M


    In his new undergraduate textbook, Harold M Edwards proposes a radically new and thoroughly algorithmic approach to linear algebra Originally inspired by the constructive philosophy of mathematics championed in the 19th century by Leopold Kronecker, the approach is well suited to students in the computer-dominated late 20th century Each proof is an algorithm described in English that can be translated into the computer language the class is using and put to work solving problems and generating new examples, making the study of linear algebra a truly interactive experience Designed for a one-semester course, this text adopts an algorithmic approach to linear algebra giving the student many examples to work through and copious exercises to test their skills and extend their knowledge of the subject Students at all levels will find much interactive instruction in this text while teachers will find stimulating examples and methods of approach to the subject

  14. Thermodynamic and structural study of two-dimensional phase transitions and orientational order in films of linear molecules with a large quadrupole moment, physi-sorbed on lamellar substrates

    International Nuclear Information System (INIS)

    Terlain, Anne


    The 2D (two-dimensional) phase transitions and orientational order in N 2 O, CO 2 , C 2 N 2 and C 2 D 2 films physi-sorbed on the (0001) face of graphite or lamellar halides, were studied experimentally by adsorption isotherm measurements and neutron diffraction. The thermodynamic functions derived from sets of isotherms suggest that crystal monolayers of N 2 O, CO 2 , and C 2 N 2 adsorbed on graphite are orientationally ordered and that the quadrupolar interaction stabilizes the 2D crystal with respect to the 2D liquid. This stabilization leads to an increase in the 2D triple point temperature, T 2t as compared with the 2D critical temperature T 2c . For C 2 N 2 this stabilization is so pronounced that T 2t becomes virtually higher than T 2c , and the phase diagram qualitatively different, having no gas-liquid coexistence domain. From a neutron diffraction experiment we have determined the crystal structure of the C 2 N 2 monolayer. It supports our interpretation of the monolayer phase diagram. In N 2 O, CO 2 , C 2 N 2 films adsorbed on graphite the molecules lie flat on the surface and their orientational order hence differs from that in the bulk crystals resulting in a loss of adsorbate-adsorbate interaction energy. Beyond a given film thickness this loss will not be compensated by the adsorbate-substrate interaction and the film will stop growing. For most of the films studied a partial wetting transition is observed at which the film thickness increases discontinuously with temperature. Although C 2 N 2 and C 2 D 2 monolayers on graphite have comparable adsorption energies, only C 2 D 2 is adsorbed on lamellar halides. This adsorption is possible only because the monolayer has a large entropy due to orientational disorder. For C 2 N 2 , which has a higher moment of inertia, such an orientational disorder cannot exist. (author) [fr

  15. Linear programming

    CERN Document Server

    Karloff, Howard


    To this reviewer’s knowledge, this is the first book accessible to the upper division undergraduate or beginning graduate student that surveys linear programming from the Simplex Method…via the Ellipsoid algorithm to Karmarkar’s algorithm. Moreover, its point of view is algorithmic and thus it provides both a history and a case history of work in complexity theory. The presentation is admirable; Karloff's style is informal (even humorous at times) without sacrificing anything necessary for understanding. Diagrams (including horizontal brackets that group terms) aid in providing clarity. The end-of-chapter notes are helpful...Recommended highly for acquisition, since it is not only a textbook, but can also be used for independent reading and study. —Choice Reviews The reader will be well served by reading the monograph from cover to cover. The author succeeds in providing a concise, readable, understandable introduction to modern linear programming. —Mathematics of Computing This is a textbook intend...

  16. Reduction of Linear Programming to Linear Approximation


    Vaserstein, Leonid N.


    It is well known that every Chebyshev linear approximation problem can be reduced to a linear program. In this paper we show that conversely every linear program can be reduced to a Chebyshev linear approximation problem.

  17. linear-quadratic-linear model

    Directory of Open Access Journals (Sweden)

    Tanwiwat Jaikuna


    Full Text Available Purpose: To develop an in-house software program that is able to calculate and generate the biological dose distribution and biological dose volume histogram by physical dose conversion using the linear-quadratic-linear (LQL model. Material and methods : The Isobio software was developed using MATLAB version 2014b to calculate and generate the biological dose distribution and biological dose volume histograms. The physical dose from each voxel in treatment planning was extracted through Computational Environment for Radiotherapy Research (CERR, and the accuracy was verified by the differentiation between the dose volume histogram from CERR and the treatment planning system. An equivalent dose in 2 Gy fraction (EQD2 was calculated using biological effective dose (BED based on the LQL model. The software calculation and the manual calculation were compared for EQD2 verification with pair t-test statistical analysis using IBM SPSS Statistics version 22 (64-bit. Results: Two and three-dimensional biological dose distribution and biological dose volume histogram were displayed correctly by the Isobio software. Different physical doses were found between CERR and treatment planning system (TPS in Oncentra, with 3.33% in high-risk clinical target volume (HR-CTV determined by D90%, 0.56% in the bladder, 1.74% in the rectum when determined by D2cc, and less than 1% in Pinnacle. The difference in the EQD2 between the software calculation and the manual calculation was not significantly different with 0.00% at p-values 0.820, 0.095, and 0.593 for external beam radiation therapy (EBRT and 0.240, 0.320, and 0.849 for brachytherapy (BT in HR-CTV, bladder, and rectum, respectively. Conclusions : The Isobio software is a feasible tool to generate the biological dose distribution and biological dose volume histogram for treatment plan evaluation in both EBRT and BT.

  18. Aligning molecules with intense nonresonant laser fields

    DEFF Research Database (Denmark)

    Larsen, J.J.; Safvan, C.P.; Sakai, H.


    Molecules in a seeded supersonic beam are aligned by the interaction between an intense nonresonant linearly polarized laser field and the molecular polarizability. We demonstrate the general applicability of the scheme by aligning I2, ICl, CS2, CH3I, and C6H5I molecules. The alignment is probed...... by mass selective two dimensional imaging of the photofragment ions produced by femtosecond laser pulses. Calculations on the degree of alignment of I2 are in good agreement with the experiments. We discuss some future applications of laser aligned molecules....

  19. Do Identical Polar Diatomic Molecules Form Stacked or Linear ...

    Indian Academy of Sciences (India)


    tractive and repulsive Coulomb interactions balance and cancel. Of course ... life, carbon (group 14), i.e., carbon bonding, has been proposed based ... Medical Institute EXROP program. ..... Hughes Medical Institute for support of this work. CW.

  20. Non-linear osmosis (United States)

    Diamond, Jared M.


    1. The relation between osmotic gradient and rate of osmotic water flow has been measured in rabbit gall-bladder by a gravimetric procedure and by a rapid method based on streaming potentials. Streaming potentials were directly proportional to gravimetrically measured water fluxes. 2. As in many other tissues, water flow was found to vary with gradient in a markedly non-linear fashion. There was no consistent relation between the water permeability and either the direction or the rate of water flow. 3. Water flow in response to a given gradient decreased at higher osmolarities. The resistance to water flow increased linearly with osmolarity over the range 186-825 m-osM. 4. The resistance to water flow was the same when the gall-bladder separated any two bathing solutions with the same average osmolarity, regardless of the magnitude of the gradient. In other words, the rate of water flow is given by the expression (Om — Os)/[Ro′ + ½k′ (Om + Os)], where Ro′ and k′ are constants and Om and Os are the bathing solution osmolarities. 5. Of the theories advanced to explain non-linear osmosis in other tissues, flow-induced membrane deformations, unstirred layers, asymmetrical series-membrane effects, and non-osmotic effects of solutes could not explain the results. However, experimental measurements of water permeability as a function of osmolarity permitted quantitative reconstruction of the observed water flow—osmotic gradient curves. Hence non-linear osmosis in rabbit gall-bladder is due to a decrease in water permeability with increasing osmolarity. 6. The results suggest that aqueous channels in the cell membrane behave as osmometers, shrinking in concentrated solutions of impermeant molecules and thereby increasing membrane resistance to water flow. A mathematical formulation of such a membrane structure is offered. PMID:5945254

  1. Formation of Ultracold Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Cote, Robin [Univ. of Connecticut, Storrs, CT (United States)


    Advances in our ability to slow down and cool atoms and molecules to ultracold temperatures have paved the way to a revolution in basic research on molecules. Ultracold molecules are sensitive of very weak interactions, even when separated by large distances, which allow studies of the effect of those interactions on the behavior of molecules. In this program, we have explored ways to form ultracold molecules starting from pairs of atoms that have already reached the ultracold regime. We devised methods that enhance the efficiency of ultracold molecule production, for example by tuning external magnetic fields and using appropriate laser excitations. We also investigates the properties of those ultracold molecules, especially their de-excitation into stable molecules. We studied the possibility of creating new classes of ultra-long range molecules, named macrodimers, thousand times more extended than regular molecules. Again, such objects are possible because ultra low temperatures prevent their breakup by collision. Finally, we carried out calculations on how chemical reactions are affected and modified at ultracold temperatures. Normally, reactions become less effective as the temperature decreases, but at ultracold temperatures, they can become very effective. We studied this counter-intuitive behavior for benchmark chemical reactions involving molecular hydrogen.

  2. Linear electric field time-of-flight ion mass spectrometer (United States)

    Funsten, Herbert O [Los Alamos, NM; Feldman, William C [Los Alamos, NM


    A linear electric field ion mass spectrometer having an evacuated enclosure with means for generating a linear electric field located in the evacuated enclosure and means for injecting a sample material into the linear electric field. A source of pulsed ionizing radiation injects ionizing radiation into the linear electric field to ionize atoms or molecules of the sample material, and timing means determine the time elapsed between ionization of atoms or molecules and arrival of an ion out of the ionized atoms or molecules at a predetermined position.

  3. The status of molecules

    International Nuclear Information System (INIS)

    Barnes, T.; Oak Ridge National Lab., TN; Tennessee Univ., Knoxville, TN


    This report summarizes the experimental and theoretical status of hadronic molecules, which are weakly-bound states of two or more hadrons. We begin with a brief history of the subject and discuss a few good candidates, and then abstract some signatures for molecules which may be of interest in the classification of possible molecule states. Next we argue that a more general understanding of 2 → 2 hadron-hadron scattering amplitudes will be crucial for molecule searches, and discuss some of our recent work in this area. We conclude with a discussion of a few more recent molecule candidates (notably the f o (1710)) which are not well established as molecules but satisfy some of the expected signatures. (Author)

  4. Cold Rydberg molecules (United States)

    Raithel, Georg; Zhao, Jianming


    Cold atomic systems have opened new frontiers at the interface of atomic and molecular physics. These include research on novel types of Rydberg molecules. Three types of molecules will be reviewed. Long-range, homonuclear Rydberg molecules, first predicted in [1] and observed in [2], are formed via low-energy electron scattering of the Rydberg electron from a ground-state atom within the Rydberg atom's volume. The binding mostly arises from S- and P-wave triplet scattering. We use a Fermi model that includes S-wave and P-wave singlet and triplet scattering, the fine structure coupling of the Rydberg atom and the hyperfine structure coupling of the 5S1/2 atom (in rubidium [3]). The hyperfine structure gives rise to mixed singlet-triplet potentials for both low-L and high-L Rydberg molecules [3]. A classification into Hund's cases [3, 4, 5] will be discussed. The talk further includes results on adiabatic potentials and adiabatic states of Rydberg-Rydberg molecules in Rb and Cs. These molecules, which have even larger bonding length than Rydberg-ground molecules, are formed via electrostatic multipole interactions. The leading interaction term of neutral Rydberg-Rydberg molecules is between two dipoles, while for ionic Rydberg molecules it is between a dipole and a monopole. NSF (PHY-1506093), NNSF of China (61475123).

  5. Linear Algebra and Smarandache Linear Algebra


    Vasantha, Kandasamy


    The present book, on Smarandache linear algebra, not only studies the Smarandache analogues of linear algebra and its applications, it also aims to bridge the need for new research topics pertaining to linear algebra, purely in the algebraic sense. We have introduced Smarandache semilinear algebra, Smarandache bilinear algebra and Smarandache anti-linear algebra and their fuzzy equivalents. Moreover, in this book, we have brought out the study of linear algebra and vector spaces over finite p...

  6. Molecule of the Month

    Indian Academy of Sciences (India)

    Atoms in a molecule generally prefer, particularly among the neighbouring ones, certain optimmn geometrical relationships. These are manifested in specific ranges of bond lengths, bond angles, torsion angles etc. As it always happens, chemists are interested in making molecules where these 'standard relationships' are ...

  7. Molecule of the Month

    Indian Academy of Sciences (India)

    Cyclo bu tadiene (1) has been one of the most popular molecules for experimentalists and theoreticians. This molecule is unstable as . it is antiaromatic ( 4,n electrons in a cyclic array). Even though some highly substituted cyclobutadienes, for example, compound 2 and the Fe(CO)3 complex of cyclobutadiene (3) are ...

  8. Single-Molecule Spectroscopy

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 20; Issue 2. Single-Molecule Spectroscopy: Every Molecule is Different! Kankan Bhattacharyya. General Article Volume 20 Issue 2 February 2015 pp 151-164. Fulltext. Click here to view fulltext PDF. Permanent link:

  9. Single molecule conductance

    NARCIS (Netherlands)

    Willems, R.


    This thesis represents an excursion into the world of molecular electronics, i.e. the field of research trying to use individual (organic) molecules as electronic components; in this work various experimental methods have been explored to connect individual molecules to metallic contacts and

  10. Molecules in stars

    International Nuclear Information System (INIS)

    Tsuji, T.


    Recently, research related to molecules in stars has rapidly expanded because of progress in related fields. For this reason, it is almost impossible to cover all the topics related to molecules in stars. Thus, here the authors focus their attention on molecules in the atmospheres of cool stars and do not cover in any detail topics related to circumstellar molecules originating from expanding envelopes located far from the stellar surface. However, the authors do discuss molecules in quasi-static circumstellar envelopes (a recently discovered new component of circumstellar envelopes) located near the stellar surface, since molecular lines originating from such envelopes show little velocity shift relative to photospheric lines, and hence they directly affect the interpretation and analysis of stellar spectra

  11. Impulsive Laser Induced Alignment of Molecules Dissolved in Helium Nanodroplets

    DEFF Research Database (Denmark)

    Pentlehner, Dominik; H. Nielsen, Jens; Slenczka, Alkwin


    We show that a 450 fs nonresonant, moderately intense, linearly polarized laser pulse can induce field-free molecular axis alignment of methyliodide (CH3I) molecules dissolved in a helium nanodroplet. Time-resolved measurements reveal rotational dynamics much slower than that of isolated molecules...

  12. Dynamics of Activated Molecules

    Energy Technology Data Exchange (ETDEWEB)

    Mullin, Amy S. [Univ. of Maryland, College Park, MD (United States)


    Experimental studies have been performed to investigate the collisional energy transfer processes of gas-phase molecules that contain large amounts of internal energy. Such molecules are prototypes for molecules under high temperature conditions relevant in combustion and information about their energy transfer mechanisms is needed for a detailed understanding and modeling of the chemistry. We use high resolution transient IR absorption spectroscopy to measure the full, nascent product distributions for collisions of small bath molecules that relax highly vibrationally excited pyrazine molecules with E=38000 cm-1 of vibrational energy. To perform these studies, we developed new instrumentation based on modern IR light sources to expand our experimental capabilities to investigate new molecules as collision partners. This final report describes our research in four areas: the characterization of a new transient absorption spectrometer and the results of state-resolved collision studies of pyrazine(E) with HCl, methane and ammonia. Through this research we have gained fundamental new insights into the microscopic details of relatively large complex molecules at high energy as they undergo quenching collisions and redistribute their energy.

  13. Dissociation in small molecules

    International Nuclear Information System (INIS)

    Dehmer, P.M.


    The study of molecular dissociation processes is one of the most interesting areas of modern spectroscopy owing to the challenges presented bt even the simplest of diatomic molecules. This paper reviews the commonly used descriptions of molecular dissociation processes for diatomic molecules, the selection rules for predissociation, and a few of the principles to be remembered when one is forced to speculate about dissociation mechanisms in a new molecule. Some of these points will be illustrated by the example of dissociative ionization in O 2

  14. Cold guided beams of polar molecules

    International Nuclear Information System (INIS)

    Motsch, Michael


    This thesis reports on experiments characterizing cold guided beams of polar molecules which are produced by electrostatic velocity filtering. This filtering method exploits the interaction between the polar molecules and the electric field provided by an electrostatic quadrupole guide to extract efficiently the slow molecules from a thermal reservoir. For molecules with large and linear Stark shifts such as deuterated ammonia (ND 3 ) or formaldehyde (H 2 CO), fluxes of guided molecules of 10 10 -10 11 molecules/s are produced. The velocities of the molecules in these beams are in the range of 10-200 m/s and correspond to typical translational temperatures of a few Kelvin. The maximum velocity of the guided molecules depends on the Stark shift, the molecular mass, the geometry of the guide, and the applied electrode voltage. Although the source is operated in the near-effusive regime, the number density of the slowest molecules is sensitive to collisions. A theoretical model, taking into account this velocity-dependent collisional loss of molecules in the vicinity of the nozzle, reproduces the density of the guided molecules over a wide pressure range. A careful adjustment of pressure allows an increase in the total number of molecules, whilst yet minimizing losses due to collisions of the sought-for slow molecules. This is an important issue for future applications. Electrostatic velocity filtering is suited for different molecular species. This is demonstrated by producing cold guided beams of the water isotopologs H 2 O, D 2 O, and HDO. Although these are chemically similar, they show linear and quadratic Stark shifts, respectively, when exposed to external electric fields. As a result, the flux of HDO is larger by one order of magnitude, and the flux of the individual isotopologs shows a characteristic dependence on the guiding electric field. The internal-state distribution of guided molecules is studied with a newly developed diagnostic method: depletion

  15. Single molecules and nanotechnology

    CERN Document Server

    Vogel, Horst


    This book focuses on recent advances in the rapidly evolving field of single molecule research. These advances are of importance for the investigation of biopolymers and cellular biochemical reactions, and are essential to the development of quantitative biology. Written by leading experts in the field, the articles cover a broad range of topics, including: quantum photonics of organic dyes and inorganic nanoparticles their use in detecting properties of single molecules the monitoring of single molecule (enzymatic) reactions single protein (un)folding in nanometer-sized confined volumes the dynamics of molecular interactions in biological cells The book is written for advanced students and scientists who wish to survey the concepts, techniques and results of single molecule research and assess them for their own scientific activities.

  16. Electron-molecule collisions

    CERN Document Server

    Takayanagi, Kazuo


    Scattering phenomena play an important role in modern physics. Many significant discoveries have been made through collision experiments. Amongst diverse kinds of collision systems, this book sheds light on the collision of an electron with a molecule. The electron-molecule collision provides a basic scattering problem. It is scattering by a nonspherical, multicentered composite particle with its centers having degrees of freedom of motion. The molecule can even disintegrate, Le., dissociate or ionize into fragments, some or all of which may also be molecules. Although it is a difficult problem, the recent theoretical, experimental, and computational progress has been so significant as to warrant publication of a book that specializes in this field. The progress owes partly to technical develop­ ments in measurements and computations. No less important has been the great and continuing stimulus from such fields of application as astrophysics, the physics of the earth's upper atmosphere, laser physics, radiat...

  17. Molecules to Materials

    Indian Academy of Sciences (India)

    evolved as a new line of thinking wherein a single molecule or perhaps a collection .... In photonic communication processes, laser light has to be modulated and .... The author wishes to thank G Rajaram for a critical reading of the manuscript.

  18. Single-Molecule Spectroscopy

    Indian Academy of Sciences (India)

    IAS Admin

    overall absorption spectrum of a molecule is a superposition of many such sharp lines .... dilute solution of the enzyme and the substrate over few drops of silicone oil placed ..... Near-field Scanning Optical Microscopy (NSOM): Development.

  19. Quantum dot molecules

    CERN Document Server

    Wu, Jiang


    This book reviews recent advances in the exciting and rapidly growing field of quantum dot molecules (QDMs). It offers state-of-the-art coverage of novel techniques and connects fundamental physical properties with device design.

  20. Molecule of the Month

    Indian Academy of Sciences (India)

    Molecule of the Month - Adamantane - A Plastic Piece of Diamond. J Chandrasekhar. Volume 16 Issue 12 ... Keywords. Adamantane; diamondoid systems; plastic crystals. ... Resonance – Journal of Science Education | News. © 2017 Indian ...

  1. Linear ubiquitination signals in adaptive immune responses. (United States)

    Ikeda, Fumiyo


    Ubiquitin can form eight different linkage types of chains using the intrinsic Met 1 residue or one of the seven intrinsic Lys residues. Each linkage type of ubiquitin chain has a distinct three-dimensional topology, functioning as a tag to attract specific signaling molecules, which are so-called ubiquitin readers, and regulates various biological functions. Ubiquitin chains linked via Met 1 in a head-to-tail manner are called linear ubiquitin chains. Linear ubiquitination plays an important role in the regulation of cellular signaling, including the best-characterized tumor necrosis factor (TNF)-induced canonical nuclear factor-κB (NF-κB) pathway. Linear ubiquitin chains are specifically generated by an E3 ligase complex called the linear ubiquitin chain assembly complex (LUBAC) and hydrolyzed by a deubiquitinase (DUB) called ovarian tumor (OTU) DUB with linear linkage specificity (OTULIN). LUBAC linearly ubiquitinates critical molecules in the TNF pathway, such as NEMO and RIPK1. The linear ubiquitin chains are then recognized by the ubiquitin readers, including NEMO, which control the TNF pathway. Accumulating evidence indicates an importance of the LUBAC complex in the regulation of apoptosis, development, and inflammation in mice. In this article, I focus on the role of linear ubiquitin chains in adaptive immune responses with an emphasis on the TNF-induced signaling pathways. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  2. Linearly constrained minimax optimization

    DEFF Research Database (Denmark)

    Madsen, Kaj; Schjær-Jacobsen, Hans


    We present an algorithm for nonlinear minimax optimization subject to linear equality and inequality constraints which requires first order partial derivatives. The algorithm is based on successive linear approximations to the functions defining the problem. The resulting linear subproblems...

  3. Electron-molecule collisions

    International Nuclear Information System (INIS)

    Shimamura, I.; Takayanagi, K.


    The study of collision processes plays an important research role in modern physics. Many significant discoveries have been made by means of collision experiments. Based on theoretical, experimental, and computational studies, this volume presents an overview detailing the basic processes of electron-molecule collisions. The editors have collected papers-written by a group of international experts-that consider a diverse range of phenomena occurring in electronmolecule collisions. The volume discusses first the basic formulation for scattering problems and then gives an outline of the physics of electron-molecule collisions. The main topics covered are rotational transitions, vibrational transitions, dissociation of molecules in slow collisions, the electron-molecule collision as a spectroscopic tool for studying molecular electronic structures, and experimental and computational techniques for determining the cross sections. These well-referenced chapters are self-contained and can be read independently or consecutively. Authoritative and up-to-date, Electron-Molecule Collisions is a useful addition to the libraries of students and researchers in the fields of atomic, molecular, and chemical physics, and physical chemistry

  4. Full Alignment of Molecules Using Elliptically Polarized Light

    DEFF Research Database (Denmark)

    Larsen, Jakob Juul; Hald, Kasper; Seideman, Tamar

    When a molecule with an anisotropic polarizability is placed in a strong nonresonant laser field the interaction occurs through the induced dipole moment. The outcome is that the molecule experiences an angular dependent potential energy. It is now well established that a linearly polarized laser...... field can be used to align molecules along their axis of highest polarizability. Here we demonstrate, theoretically and experimentally, that an elliptically polarized laser field can be used to simultaneously force two axes of a molecule into alignment through the same mechanism. Due to the rigidity...

  5. Foundations of linear and generalized linear models

    CERN Document Server

    Agresti, Alan


    A valuable overview of the most important ideas and results in statistical analysis Written by a highly-experienced author, Foundations of Linear and Generalized Linear Models is a clear and comprehensive guide to the key concepts and results of linear statistical models. The book presents a broad, in-depth overview of the most commonly used statistical models by discussing the theory underlying the models, R software applications, and examples with crafted models to elucidate key ideas and promote practical model building. The book begins by illustrating the fundamentals of linear models,


    International Nuclear Information System (INIS)

    Loinard, Laurent; Menten, Karl M.; Güsten, Rolf; Zapata, Luis A.; Rodríguez, Luis F.


    We report the detection toward η Carinae of six new molecules, CO, CN, HCO + , HCN, HNC, and N 2 H + , and of two of their less abundant isotopic counterparts, 13 CO and H 13 CN. The line profiles are moderately broad (∼100 km s –1 ), indicating that the emission originates in the dense, possibly clumpy, central arcsecond of the Homunculus Nebula. Contrary to previous claims, CO and HCO + do not appear to be underabundant in η Carinae. On the other hand, molecules containing nitrogen or the 13 C isotope of carbon are overabundant by about one order of magnitude. This demonstrates that, together with the dust responsible for the dimming of η Carinae following the Great Eruption, the molecules detected here must have formed in situ out of CNO-processed stellar material.

  7. Effects of collisions on linear and non-linear spectroscopic line shapes

    International Nuclear Information System (INIS)

    Berman, P.R.


    A fundamental physical problem is the determination of atom-atom, atom-molecule and molecule-molecule differential and total scattering cross sections. In this work, a technique for studying atomic and molecular collisions using spectroscopic line shape analysis is discussed. Collisions occurring within an atomic or molecular sample influence the sample's absorptive or emissive properties. Consequently the line shapes associated with the linear or non-linear absorption of external fields by an atomic system reflect the collisional processes occurring in the gas. Explicit line shape expressions are derived characterizing linear or saturated absorption by two-or three-level 'active' atoms which are undergoing collisions with perturber atoms. The line shapes may be broadened, shifted, narrowed, or distorted as a result of collisions which may be 'phase-interrupting' or 'velocity-changing' in nature. Systematic line shape studies can be used to obtain information on both the differential and total active atom-perturber scattering cross sections. (Auth.)

  8. Electron Accumulative Molecules. (United States)

    Buades, Ana B; Sanchez Arderiu, Víctor; Olid-Britos, David; Viñas, Clara; Sillanpää, Reijo; Haukka, Matti; Fontrodona, Xavier; Paradinas, Markos; Ocal, Carmen; Teixidor, Francesc


    With the goal to produce molecules with high electron accepting capacity and low reorganization energy upon gaining one or more electrons, a synthesis procedure leading to the formation of a B-N(aromatic) bond in a cluster has been developed. The research was focused on the development of a molecular structure able to accept and release a specific number of electrons without decomposing or change in its structural arrangement. The synthetic procedure consists of a parallel decomposition reaction to generate a reactive electrophile and a synthesis reaction to generate the B-N(aromatic) bond. This procedure has paved the way to produce the metallacarboranylviologen [M(C 2 B 9 H 11 )(C 2 B 9 H 10 )-NC 5 H 4 -C 5 H 4 N-M'(C 2 B 9 H 11 )(C 2 B 9 H 10 )] (M = M' = Co, Fe and M = Co and M' = Fe) and semi(metallacarboranyl)viologen [3,3'-M(8-(NC 5 H 4 -C 5 H 4 N-1,2-C 2 B 9 H 10 )(1',2'-C 2 B 9 H 11 )] (M = Co, Fe) electron cumulative molecules. These molecules are able to accept up to five electrons and to donate one in single electron steps at accessible potentials and in a reversible way. By targeted synthesis and corresponding electrochemical tests each electron transfer (ET) step has been assigned to specific fragments of the molecules. The molecules have been carefully characterized, and the electronic communication between both metal centers (when this situation applies) has been definitely observed through the coplanarity of both pyridine fragments. The structural characteristics of these molecules imply a low reorganization energy that is a necessary requirement for low energy ET processes. This makes them electronically comparable to fullerenes, but on their side, they have a wide range of possible solvents. The ET from one molecule to another has been clearly demonstrated as well as their self-organizing capacity. We consider that these molecules, thanks to their easy synthesis, ET, self-organizing capacity, wide range of solubility, and easy processability, can

  9. Molecule of the Month

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 1; Issue 2. Molecule of the Month Isomers of Benzene - Still Pursuing Dreams. J Chandrasekhar. Feature Article Volume 1 Issue 2 February 1996 pp 80-83. Fulltext. Click here to view fulltext PDF. Permanent link:

  10. Atoms, Molecules, and Compounds

    CERN Document Server

    Manning, Phillip


    Explores the atoms that govern chemical processes. This book shows how the interactions between simple substances such as salt and water are crucial to life on Earth and how those interactions are predestined by the atoms that make up the molecules.

  11. Electrons in Molecules

    Indian Academy of Sciences (India)

    structure and properties (includingreactivt'ty) - both static (independent of time) and ... Furthermore, since the energy of H2 + in the ground state must be lower than that of .... (Figure 2b); note also that dp is positive in parts of the antibinding regions behind the two ... But, now both the sizes and shapes of molecules enter into.

  12. Molecule of the Month

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 16; Issue 12. Molecule of the Month - A Stable Dibismuthene - A Compound with a Bi-Bi Double Bond. V Chandrasekhar. Volume 16 ... Author Affiliations. V Chandrasekhar1. Department of Chemistry, Indian Institute of Technology, Kanpur 208 016, India.

  13. OMG: Open molecule generator

    NARCIS (Netherlands)

    Peironcely, J.E.; Rojas-Chertó, M.; Fichera, D.; Reijmers, T.; Coulier, L.; Faulon, J.-L.; Hankemeier, T.


    Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG), which for a given elemental composition produces all non-isomorphic chemical

  14. Molecule-based magnets

    Indian Academy of Sciences (India)


    Employing self-assembly methods, it is possible to engineer a bulk molecular material ... synthesis of molecular magnets in 1986, a large variety of them have been synthesized, which can be catego- ... maintained stably per organic molecule, stabilization of a ..... rotating freely under an applied field because it is a magne-.

  15. Molecule of the Month

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 2; Issue 5. Molecule of the Month Molecular–Chameleon: Solvatochromism at its Iridescent Best! Photon Rao. Feature Article Volume 2 Issue 5 May 1997 pp 69-72. Fulltext. Click here to view fulltext PDF. Permanent link:

  16. Exotic helium molecules

    International Nuclear Information System (INIS)

    Portier, M.


    We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range 4 He 2 (2 3 S 1 -2 3 P 0 ) molecule, or a 4 He 2 (2 3 S 1 -2 3 S 1 ) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 ± 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range 4 He 2 (2 3 S 1 -2 3 S 1 ) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime τ = (1.4 ± 0.3) μs is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)

  17. OMG: Open Molecule Generator. (United States)

    Peironcely, Julio E; Rojas-Chertó, Miguel; Fichera, Davide; Reijmers, Theo; Coulier, Leon; Faulon, Jean-Loup; Hankemeier, Thomas


    Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG), which for a given elemental composition produces all non-isomorphic chemical structures that match that elemental composition. Furthermore, this structure generator can accept as additional input one or multiple non-overlapping prescribed substructures to drastically reduce the number of possible chemical structures. Being open source allows for customization and future extension of its functionality. OMG relies on a modified version of the Canonical Augmentation Path, which grows intermediate chemical structures by adding bonds and checks that at each step only unique molecules are produced. In order to benchmark the tool, we generated chemical structures for the elemental formulas and substructures of different metabolites and compared the results with a commercially available structure generator. The results obtained, i.e. the number of molecules generated, were identical for elemental compositions having only C, O and H. For elemental compositions containing C, O, H, N, P and S, OMG produces all the chemically valid molecules while the other generator produces more, yet chemically impossible, molecules. The chemical completeness of the OMG results comes at the expense of being slower than the commercial generator. In addition to being open source, OMG clearly showed the added value of constraining the solution space by using multiple prescribed substructures as input. We expect this structure generator to be useful in many fields, but to be especially of great importance for metabolomics, where identifying unknown metabolites is still a major bottleneck.

  18. OMG: Open Molecule Generator

    Directory of Open Access Journals (Sweden)

    Peironcely Julio E


    Full Text Available Abstract Computer Assisted Structure Elucidation has been used for decades to discover the chemical structure of unknown compounds. In this work we introduce the first open source structure generator, Open Molecule Generator (OMG, which for a given elemental composition produces all non-isomorphic chemical structures that match that elemental composition. Furthermore, this structure generator can accept as additional input one or multiple non-overlapping prescribed substructures to drastically reduce the number of possible chemical structures. Being open source allows for customization and future extension of its functionality. OMG relies on a modified version of the Canonical Augmentation Path, which grows intermediate chemical structures by adding bonds and checks that at each step only unique molecules are produced. In order to benchmark the tool, we generated chemical structures for the elemental formulas and substructures of different metabolites and compared the results with a commercially available structure generator. The results obtained, i.e. the number of molecules generated, were identical for elemental compositions having only C, O and H. For elemental compositions containing C, O, H, N, P and S, OMG produces all the chemically valid molecules while the other generator produces more, yet chemically impossible, molecules. The chemical completeness of the OMG results comes at the expense of being slower than the commercial generator. In addition to being open source, OMG clearly showed the added value of constraining the solution space by using multiple prescribed substructures as input. We expect this structure generator to be useful in many fields, but to be especially of great importance for metabolomics, where identifying unknown metabolites is still a major bottleneck.

  19. Capillary condensation of short-chain molecules. (United States)

    Bryk, Paweł; Pizio, Orest; Sokolowski, Stefan


    A density-functional study of capillary condensation of fluids of short-chain molecules confined to slitlike pores is presented. The molecules are modeled as freely jointed tangent spherical segments with a hard core and with short-range attractive interaction between all the segments. We investigate how the critical parameters of capillary condensation of the fluid change when the pore width decreases and eventually becomes smaller than the nominal linear dimension of the single-chain molecule. We find that the dependence of critical parameters for a fluid of dimers and of tetramers on pore width is similar to that of the monomer fluid. On the other hand, for a fluid of chains consisting of a larger number of segments we observe an inversion effect. Namely, the critical temperature of capillary condensation decreases with increasing pore width for a certain interval of values of the pore width. This anomalous behavior is also influenced by the interaction between molecules and pore walls. We attribute this behavior to the effect of conformational changes of molecules upon confinement.

  20. Single-Molecule Nanomagnets (United States)

    Friedman, Jonathan R.; Sarachik, Myriam P.


    Single-molecule magnets straddle the classical and quantum mechanical worlds, displaying many fascinating phenomena. They may have important technological applications in information storage and quantum computation. We review the physical properties of two prototypical molecular nanomagnets, Mn12-acetate and Fe8: Each behaves as a rigid, spin-10 object and exhibits tunneling between up and down directions. As temperature is lowered, the spin-reversal process evolves from thermal activation to pure quantum tunneling. At low temperatures, magnetic avalanches occur in which the magnetization of an entire sample rapidly reverses. We discuss the important role that symmetry-breaking fields play in driving tunneling and in producing Berry-phase interference. Recent experimental advances indicate that quantum coherence can be maintained on timescales sufficient to allow a meaningful number of quantum computing operations to be performed. Efforts are under way to create monolayers and to address and manipulate individual molecules.

  1. Superexcited states of molecules

    International Nuclear Information System (INIS)

    Nakamura, Hiroki; Takagi, Hidekazu.


    The report addresses the nature and major features of molecule's superexcited states, focusing on their involvement in dynamic processes. It also outlines the quantum defect theory which allows various processes involving these states to be treated in a unified way. The Rydberg state has close relation with an ionized state with a positive energy. The quantum defect theory interprets such relation. Specifically, the report first describes the quantum defect theory focusing on its basic principle. The multi-channel quantum defect theory is then outlined centering on how to describe a Rydberg-type superexcited state. Description of a dissociative double-electron excited state is also discussed. The quantum defect theory is based on the fact that the physics of the motion of a Rydberg electron vary with the region in the electron's coordinate space. Finally, various molecular processes that involve a superexcited state are addressed focusing on autoionization, photoionization, dissociative recombination and bonding ionization of diatomic molecules. (N.K.)

  2. Atoms, molecules & elements

    CERN Document Server

    Graybill, George


    Young scientists will be thrilled to explore the invisible world of atoms, molecules and elements. Our resource provides ready-to-use information and activities for remedial students using simplified language and vocabulary. Students will label each part of the atom, learn what compounds are, and explore the patterns in the periodic table of elements to find calcium (Ca), chlorine (Cl), and helium (He) through hands-on activities.

  3. Photonic Molecule Lasers Revisited (United States)

    Gagnon, Denis; Dumont, Joey; Déziel, Jean-Luc; Dubé, Louis J.


    Photonic molecules (PMs) formed by coupling two or more optical resonators are ideal candidates for the fabrication of integrated microlasers, photonic molecule lasers. Whereas most calculations on PM lasers have been based on cold-cavity (passive) modes, i.e. quasi-bound states, a recently formulated steady-state ab initio laser theory (SALT) offers the possibility to take into account the spectral properties of the underlying gain transition, its position and linewidth, as well as incorporating an arbitrary pump profile. We will combine two theoretical approaches to characterize the lasing properties of PM lasers: for two-dimensional systems, the generalized Lorenz-Mie theory will obtain the resonant modes of the coupled molecules in an active medium described by SALT. Not only is then the theoretical description more complete, the use of an active medium provides additional parameters to control, engineer and harness the lasing properties of PM lasers for ultra-low threshold and directional single-mode emission. We will extend our recent study and present new results for a number of promising geometries. The authors acknowledge financial support from NSERC (Canada) and the CERC in Photonic Innovations of Y. Messaddeq.

  4. Interstellar molecules and masers

    International Nuclear Information System (INIS)

    Nguyen-Q-Rieu; Guibert, J.


    The study of dense and dark clouds, in which hydrogen is mostly in molecular form, became possible since the discovery of interstellar molecules, emitting in the centimeter and millimeter wavelengths. The molecular lines are generally not in local thermal equilibrium (LTE). Their intensity can often be explained by invoking a population inversion mechanism. Maser emission lines due to OH, H 2 O and SiO molecules are among the most intense molecular lines. The H 2 CO molecule, detected in absorption in front of the cold cosmic background radiation of 2.7 K, illustrates the inverse phenomenon, the antimaser absorption. For a radio transition of frequency v, the inversion rate Δn (relative population difference between the upper and lower level) as well as the maser gain can be determined from the radio observations. In the case of the OH lines in the 2 PIsub(3/2), J=3/2 state, the inversion rates approximately 1 to 2% derived from the observations, are comparable with those obtained in the laboratory. The determination of the excitation mechanisms of the masers, through the statistical equilibrium and radiative transfer equations, implies the knowledge of collisional and radiative transition probabilities. A pumping model, which can satisfactorily explain the radio observations of some interstellar OH clouds, will be discussed [fr

  5. A linear programming manual (United States)

    Tuey, R. C.


    Computer solutions of linear programming problems are outlined. Information covers vector spaces, convex sets, and matrix algebra elements for solving simultaneous linear equations. Dual problems, reduced cost analysis, ranges, and error analysis are illustrated.

  6. Linear shaped charge

    Energy Technology Data Exchange (ETDEWEB)

    Peterson, David; Stofleth, Jerome H.; Saul, Venner W.


    Linear shaped charges are described herein. In a general embodiment, the linear shaped charge has an explosive with an elongated arrowhead-shaped profile. The linear shaped charge also has and an elongated v-shaped liner that is inset into a recess of the explosive. Another linear shaped charge includes an explosive that is shaped as a star-shaped prism. Liners are inset into crevices of the explosive, where the explosive acts as a tamper.

  7. Classifying Linear Canonical Relations


    Lorand, Jonathan


    In this Master's thesis, we consider the problem of classifying, up to conjugation by linear symplectomorphisms, linear canonical relations (lagrangian correspondences) from a finite-dimensional symplectic vector space to itself. We give an elementary introduction to the theory of linear canonical relations and present partial results toward the classification problem. This exposition should be accessible to undergraduate students with a basic familiarity with linear algebra.

  8. Linear-Algebra Programs (United States)

    Lawson, C. L.; Krogh, F. T.; Gold, S. S.; Kincaid, D. R.; Sullivan, J.; Williams, E.; Hanson, R. J.; Haskell, K.; Dongarra, J.; Moler, C. B.


    The Basic Linear Algebra Subprograms (BLAS) library is a collection of 38 FORTRAN-callable routines for performing basic operations of numerical linear algebra. BLAS library is portable and efficient source of basic operations for designers of programs involving linear algebriac computations. BLAS library is supplied in portable FORTRAN and Assembler code versions for IBM 370, UNIVAC 1100 and CDC 6000 series computers.

  9. About the correlation between atomic charge fluctuations in a molecule

    International Nuclear Information System (INIS)

    Pitanga, P.; Giambiagi, M.S. de; Giambiagi, M.


    In this note, the features of the correlation between the electronic charge fluctuations of a pair of atoms within a molecule are analised. Through Schwarz's inequality for random operators in the Hilbert space, the softness of an atom in a molecule is related to its valence and to the softness of the other atoms. It is concluded that in the general case this correlation (from which in turn stems the chemical bond) in non-linear. (author) [pt

  10. Quark chemistry: charmonium molecules

    International Nuclear Information System (INIS)

    De Rujula, A.; Jaffe, R.L.


    The theoretical and experimental evidence for two quark-two antiquark hadrons is reviewed. Concentration is placed on predictions for S-wave ''charmonium molecules,'' built of a c anti c charmonium pair and a light quark-antiquark pair. Their spectrum and quantum numbers are predicted and an estimate of their decay couplings and their prediction in monochromatic pion decays from charmonium resonances produced in e + e - -annihilation is given. Some S-wave charmonium resonances should be detectable in these decays, but typical branching ratios are only at the 1% level. 19 references

  11. Quantum Monte Carlo for vibrating molecules

    International Nuclear Information System (INIS)

    Brown, W.R.; Lawrence Berkeley National Lab., CA


    Quantum Monte Carlo (QMC) has successfully computed the total electronic energies of atoms and molecules. The main goal of this work is to use correlation function quantum Monte Carlo (CFQMC) to compute the vibrational state energies of molecules given a potential energy surface (PES). In CFQMC, an ensemble of random walkers simulate the diffusion and branching processes of the imaginary-time time dependent Schroedinger equation in order to evaluate the matrix elements. The program QMCVIB was written to perform multi-state VMC and CFQMC calculations and employed for several calculations of the H 2 O and C 3 vibrational states, using 7 PES's, 3 trial wavefunction forms, two methods of non-linear basis function parameter optimization, and on both serial and parallel computers. In order to construct accurate trial wavefunctions different wavefunctions forms were required for H 2 O and C 3 . In order to construct accurate trial wavefunctions for C 3 , the non-linear parameters were optimized with respect to the sum of the energies of several low-lying vibrational states. In order to stabilize the statistical error estimates for C 3 the Monte Carlo data was collected into blocks. Accurate vibrational state energies were computed using both serial and parallel QMCVIB programs. Comparison of vibrational state energies computed from the three C 3 PES's suggested that a non-linear equilibrium geometry PES is the most accurate and that discrete potential representations may be used to conveniently determine vibrational state energies

  12. Ultra-cold molecule production

    International Nuclear Information System (INIS)

    Ramirez-Serrano, Jamie; Chandler, David W.; Strecker, Kevin; Rahn, Larry A.


    The production of Ultra-cold molecules is a goal of many laboratories through out the world. Here we are pursuing a unique technique that utilizes the kinematics of atomic and molecular collisions to achieve the goal of producing substantial numbers of sub Kelvin molecules confined in a trap. Here a trap is defined as an apparatus that spatially localizes, in a known location in the laboratory, a sample of molecules whose temperature is below one degree absolute Kelvin. Further, the storage time for the molecules must be sufficient to measure and possibly further cool the molecules. We utilize a technique unique to Sandia to form cold molecules from near mass degenerate collisions between atoms and molecules. This report describes the progress we have made using this novel technique and the further progress towards trapping molecules we have cooled

  13. Passing Current through Touching Molecules

    DEFF Research Database (Denmark)

    Schull, G.; Frederiksen, Thomas; Brandbyge, Mads


    The charge flow from a single C-60 molecule to another one has been probed. The conformation and electronic states of both molecules on the contacting electrodes have been characterized using a cryogenic scanning tunneling microscope. While the contact conductance of a single molecule between two...

  14. Non linear system become linear system

    Directory of Open Access Journals (Sweden)

    Petre Bucur


    Full Text Available The present paper refers to the theory and the practice of the systems regarding non-linear systems and their applications. We aimed the integration of these systems to elaborate their response as well as to highlight some outstanding features.

  15. Linear motor coil assembly and linear motor

    NARCIS (Netherlands)


    An ironless linear motor (5) comprising a magnet track (53) and a coil assembly (50) operating in cooperation with said magnet track (53) and having a plurality of concentrated multi-turn coils (31 a-f, 41 a-d, 51 a-k), wherein the end windings (31E) of the coils (31 a-f, 41 a-e) are substantially

  16. Linear collider: a preview

    Energy Technology Data Exchange (ETDEWEB)

    Wiedemann, H.


    Since no linear colliders have been built yet it is difficult to know at what energy the linear cost scaling of linear colliders drops below the quadratic scaling of storage rings. There is, however, no doubt that a linear collider facility for a center of mass energy above say 500 GeV is significantly cheaper than an equivalent storage ring. In order to make the linear collider principle feasible at very high energies a number of problems have to be solved. There are two kinds of problems: one which is related to the feasibility of the principle and the other kind of problems is associated with minimizing the cost of constructing and operating such a facility. This lecture series describes the problems and possible solutions. Since the real test of a principle requires the construction of a prototype I will in the last chapter describe the SLC project at the Stanford Linear Accelerator Center.

  17. Basic linear algebra

    CERN Document Server

    Blyth, T S


    Basic Linear Algebra is a text for first year students leading from concrete examples to abstract theorems, via tutorial-type exercises. More exercises (of the kind a student may expect in examination papers) are grouped at the end of each section. The book covers the most important basics of any first course on linear algebra, explaining the algebra of matrices with applications to analytic geometry, systems of linear equations, difference equations and complex numbers. Linear equations are treated via Hermite normal forms which provides a successful and concrete explanation of the notion of linear independence. Another important highlight is the connection between linear mappings and matrices leading to the change of basis theorem which opens the door to the notion of similarity. This new and revised edition features additional exercises and coverage of Cramer's rule (omitted from the first edition). However, it is the new, extra chapter on computer assistance that will be of particular interest to readers:...

  18. Linear collider: a preview

    International Nuclear Information System (INIS)

    Wiedemann, H.


    Since no linear colliders have been built yet it is difficult to know at what energy the linear cost scaling of linear colliders drops below the quadratic scaling of storage rings. There is, however, no doubt that a linear collider facility for a center of mass energy above say 500 GeV is significantly cheaper than an equivalent storage ring. In order to make the linear collider principle feasible at very high energies a number of problems have to be solved. There are two kinds of problems: one which is related to the feasibility of the principle and the other kind of problems is associated with minimizing the cost of constructing and operating such a facility. This lecture series describes the problems and possible solutions. Since the real test of a principle requires the construction of a prototype I will in the last chapter describe the SLC project at the Stanford Linear Accelerator Center

  19. Matrices and linear transformations

    CERN Document Server

    Cullen, Charles G


    ""Comprehensive . . . an excellent introduction to the subject."" - Electronic Engineer's Design Magazine.This introductory textbook, aimed at sophomore- and junior-level undergraduates in mathematics, engineering, and the physical sciences, offers a smooth, in-depth treatment of linear algebra and matrix theory. The major objects of study are matrices over an arbitrary field. Contents include Matrices and Linear Systems; Vector Spaces; Determinants; Linear Transformations; Similarity: Part I and Part II; Polynomials and Polynomial Matrices; Matrix Analysis; and Numerical Methods. The first

  20. Efficient Non Linear Loudspeakers

    DEFF Research Database (Denmark)

    Petersen, Bo R.; Agerkvist, Finn T.


    Loudspeakers have traditionally been designed to be as linear as possible. However, as techniques for compensating non linearities are emerging, it becomes possible to use other design criteria. This paper present and examines a new idea for improving the efficiency of loudspeakers at high levels...... by changing the voice coil layout. This deliberate non-linear design has the benefit that a smaller amplifier can be used, which has the benefit of reducing system cost as well as reducing power consumption....

  1. Thermally induced charge current through long molecules (United States)

    Zimbovskaya, Natalya A.; Nitzan, Abraham


    In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.

  2. Lanthanide single molecule magnets

    Energy Technology Data Exchange (ETDEWEB)

    Tang, Jinkui; Zhang, Peng [Chinese Academy of Sciences, Changchun (China). Changchun Inst. of Applied Chemistry


    This book begins by providing basic information on single-molecule magnets (SMMs), covering the magnetism of lanthanide, the characterization and relaxation dynamics of SMMs and advanced means of studying lanthanide SMMs. It then systematically introduces lanthanide SMMs ranging from mononuclear and dinuclear to polynuclear complexes, classifying them and highlighting those SMMs with high barrier and blocking temperatures - an approach that provides some very valuable indicators for the structural features needed to optimize the contribution of an Ising type spin to a molecular magnet. The final chapter presents some of the newest developments in the lanthanide SMM field, such as the design of multifunctional and stimuli-responsive magnetic materials as well as the anchoring and organization of the SMMs on surfaces. In addition, the crystal structure and magnetic data are clearly presented with a wealth of illustrations in each chapter, helping newcomers and experts alike to better grasp ongoing trends and explore new directions.

  3. Lanthanide single molecule magnets

    CERN Document Server

    Tang, Jinkui


    This book begins by providing basic information on single-molecule magnets (SMMs), covering the magnetism of lanthanide, the characterization and relaxation dynamics of SMMs, and advanced means of studying lanthanide SMMs. It then systematically introduces lanthanide SMMs ranging from mononuclear and dinuclear to polynuclear complexes, classifying them and highlighting those SMMs with high barrier and blocking temperatures – an approach that provides some very valuable indicators for the structural features needed to optimize the contribution of an Ising type spin to a molecular magnet. The final chapter presents some of the newest developments in the lanthanide SMM field, such as the design of multifunctional and stimuli-responsive magnetic materials as well as the anchoring and organization of the SMMs on surfaces. In addition, the crystal structure and magnetic data are clearly presented with a wealth of illustrations in each chapter, helping newcomers and experts alike to better grasp ongoing trends and...

  4. Molecules in the Spotlight

    Energy Technology Data Exchange (ETDEWEB)

    Cryan, James


    SLAC has just unveiled the world's first X-ray laser, the LCLS. This machine produces pulses of X-rays that are ten billion times brighter than those from conventional sources. One of the goals of this machine is to make movies of chemical reactions, including reactions necessary for life and reactions that might power new energy technologies. This public lecture will show the first results from the LCLS. As a first target, we have chosen nitrogen gas, the main component of the air we breathe. Using the unprecedented power of the LCLS X-rays as a blasting torch, we have created new forms of this molecule and with unique electronic arrangements. Please share with us the first insights from this new technology.

  5. Linear models with R

    CERN Document Server

    Faraway, Julian J


    A Hands-On Way to Learning Data AnalysisPart of the core of statistics, linear models are used to make predictions and explain the relationship between the response and the predictors. Understanding linear models is crucial to a broader competence in the practice of statistics. Linear Models with R, Second Edition explains how to use linear models in physical science, engineering, social science, and business applications. The book incorporates several improvements that reflect how the world of R has greatly expanded since the publication of the first edition.New to the Second EditionReorganiz

  6. Linear integrated circuits

    CERN Document Server

    Carr, Joseph


    The linear IC market is large and growing, as is the demand for well trained technicians and engineers who understand how these devices work and how to apply them. Linear Integrated Circuits provides in-depth coverage of the devices and their operation, but not at the expense of practical applications in which linear devices figure prominently. This book is written for a wide readership from FE and first degree students, to hobbyists and professionals.Chapter 1 offers a general introduction that will provide students with the foundations of linear IC technology. From chapter 2 onwa

  7. Fault tolerant linear actuator (United States)

    Tesar, Delbert


    In varying embodiments, the fault tolerant linear actuator of the present invention is a new and improved linear actuator with fault tolerance and positional control that may incorporate velocity summing, force summing, or a combination of the two. In one embodiment, the invention offers a velocity summing arrangement with a differential gear between two prime movers driving a cage, which then drives a linear spindle screw transmission. Other embodiments feature two prime movers driving separate linear spindle screw transmissions, one internal and one external, in a totally concentric and compact integrated module.

  8. Superconducting linear accelerator cryostat

    International Nuclear Information System (INIS)

    Ben-Zvi, I.; Elkonin, B.V.; Sokolowski, J.S.


    A large vertical cryostat for a superconducting linear accelerator using quarter wave resonators has been developed. The essential technical details, operational experience and performance are described. (author)

  9. Magnetic field modification of ultracold molecule-molecule collisions

    International Nuclear Information System (INIS)

    Tscherbul, T V; Suleimanov, Yu V; Aquilanti, V; Krems, R V


    We present an accurate quantum mechanical study of molecule-molecule collisions in the presence of a magnetic field. The work focuses on the analysis of elastic scattering and spin relaxation in collisions of O 2 ( 3 Σ g - ) molecules at cold (∼0.1 K) and ultracold (∼10 -6 K) temperatures. Our calculations show that magnetic spin relaxation in molecule-molecule collisions is extremely efficient except at magnetic fields below 1 mT. The rate constant for spin relaxation at T=0.1 K and a magnetic field of 0.1 T is found to be as large as 6.1x10 -11 cm -3 s -1 . The magnetic field dependence of elastic and inelastic scattering cross sections at ultracold temperatures is dominated by a manifold of Feshbach resonances with the density of ∼100 resonances per Tesla for collisions of molecules in the absolute ground state. This suggests that the scattering length of ultracold molecules in the absolute ground state can be effectively tuned in a very wide range of magnetic fields. Our calculations demonstrate that the number and properties of the magnetic Feshbach resonances are dramatically different for molecules in the absolute ground and excited spin states. The density of Feshbach resonances for molecule-molecule scattering in the low-field-seeking Zeeman state is reduced by a factor of 10.

  10. Linearity enigmas in ecology

    Energy Technology Data Exchange (ETDEWEB)

    Patten, B.C.


    Two issues concerning linearity or nonlinearity of natural systems are considered. Each is related to one of the two alternative defining properties of linear systems, superposition and decomposition. Superposition exists when a linear combination of inputs to a system results in the same linear combination of outputs that individually correspond to the original inputs. To demonstrate this property it is necessary that all initial states and inputs of the system which impinge on the output in question be included in the linear combination manipulation. As this is difficult or impossible to do with real systems of any complexity, nature appears nonlinear even though it may be linear. A linear system that displays nonlinear behavior for this reason is termed pseudononlinear. The decomposition property exists when the dynamic response of a system can be partitioned into an input-free portion due to state plus a state-free portion due to input. This is a characteristic of all linear systems, but not of nonlinear systems. Without the decomposition property, it is not possible to distinguish which portions of a system's behavior are due to innate characteristics (self) vs. outside conditions (environment), which is an important class of questions in biology and ecology. Some philosophical aspects of these findings are then considered. It is suggested that those ecologists who hold to the view that organisms and their environments are separate entities are in effect embracing a linear view of nature, even though their belief systems and mathematical models tend to be nonlinear. On the other hand, those who consider that organism-environment complex forms a single inseparable unit are implictly involved in non-linear thought, which may be in conflict with the linear modes and models that some of them use. The need to rectify these ambivalences on the part of both groups is indicated.

  11. Linear colliders - prospects 1985

    International Nuclear Information System (INIS)

    Rees, J.


    We discuss the scaling laws of linear colliders and their consequences for accelerator design. We then report on the SLAC Linear Collider project and comment on experience gained on that project and its application to future colliders. 9 refs., 2 figs

  12. The SLAC linear collider

    International Nuclear Information System (INIS)

    Richter, B.


    A report is given on the goals and progress of the SLAC Linear Collider. The author discusses the status of the machine and the detectors and give an overview of the physics which can be done at this new facility. He also gives some ideas on how (and why) large linear colliders of the future should be built

  13. Linear Programming (LP)

    International Nuclear Information System (INIS)

    Rogner, H.H.


    The submitted sections on linear programming are extracted from 'Theorie und Technik der Planung' (1978) by W. Blaas and P. Henseler and reformulated for presentation at the Workshop. They consider a brief introduction to the theory of linear programming and to some essential aspects of the SIMPLEX solution algorithm for the purposes of economic planning processes. 1 fig

  14. Racetrack linear accelerators

    International Nuclear Information System (INIS)

    Rowe, C.H.; Wilton, M.S. de.


    An improved recirculating electron beam linear accelerator of the racetrack type is described. The system comprises a beam path of four straight legs with four Pretzel bending magnets at the end of each leg to direct the beam into the next leg of the beam path. At least one of the beam path legs includes a linear accelerator. (UK)

  15. Electron-excited molecule interactions

    International Nuclear Information System (INIS)

    Christophorou, L.G.; Tennessee Univ., Knoxville, TN


    In this paper the limited but significant knowledge to date on electron scattering from vibrationally/rotationally excited molecules and electron scattering from and electron impact ionization of electronically excited molecules is briefly summarized and discussed. The profound effects of the internal energy content of a molecule on its electron attachment properties are highlighted focusing in particular on electron attachment to vibrationally/rotationally and to electronically excited molecules. The limited knowledge to date on electron-excited molecule interactions clearly shows that the cross sections for certain electron-molecule collision processes can be very different from those involving ground state molecules. For example, optically enhanced electron attachment studies have shown that electron attachment to electronically excited molecules can occur with cross sections 10 6 to 10 7 times larger compared to ground state molecules. The study of electron-excited molecule interactions offers many experimental and theoretical challenges and opportunities and is both of fundamental and technological significance. 54 refs., 15 figs

  16. Evolution of linear chromosomes and multipartite genomes in yeast mitochondria (United States)

    Valach, Matus; Farkas, Zoltan; Fricova, Dominika; Kovac, Jakub; Brejova, Brona; Vinar, Tomas; Pfeiffer, Ilona; Kucsera, Judit; Tomaska, Lubomir; Lang, B. Franz; Nosek, Jozef


    Mitochondrial genome diversity in closely related species provides an excellent platform for investigation of chromosome architecture and its evolution by means of comparative genomics. In this study, we determined the complete mitochondrial DNA sequences of eight Candida species and analyzed their molecular architectures. Our survey revealed a puzzling variability of genome architecture, including circular- and linear-mapping and multipartite linear forms. We propose that the arrangement of large inverted repeats identified in these genomes plays a crucial role in alterations of their molecular architectures. In specific arrangements, the inverted repeats appear to function as resolution elements, allowing genome conversion among different topologies, eventually leading to genome fragmentation into multiple linear DNA molecules. We suggest that molecular transactions generating linear mitochondrial DNA molecules with defined telomeric structures may parallel the evolutionary emergence of linear chromosomes and multipartite genomes in general and may provide clues for the origin of telomeres and pathways implicated in their maintenance. PMID:21266473

  17. Semidefinite linear complementarity problems

    International Nuclear Information System (INIS)

    Eckhardt, U.


    Semidefinite linear complementarity problems arise by discretization of variational inequalities describing e.g. elastic contact problems, free boundary value problems etc. In the present paper linear complementarity problems are introduced and the theory as well as the numerical treatment of them are described. In the special case of semidefinite linear complementarity problems a numerical method is presented which combines the advantages of elimination and iteration methods without suffering from their drawbacks. This new method has very attractive properties since it has a high degree of invariance with respect to the representation of the set of all feasible solutions of a linear complementarity problem by linear inequalities. By means of some practical applications the properties of the new method are demonstrated. (orig.) [de

  18. Linear algebra done right

    CERN Document Server

    Axler, Sheldon


    This best-selling textbook for a second course in linear algebra is aimed at undergrad math majors and graduate students. The novel approach taken here banishes determinants to the end of the book. The text focuses on the central goal of linear algebra: understanding the structure of linear operators on finite-dimensional vector spaces. The author has taken unusual care to motivate concepts and to simplify proofs. A variety of interesting exercises in each chapter helps students understand and manipulate the objects of linear algebra. The third edition contains major improvements and revisions throughout the book. More than 300 new exercises have been added since the previous edition. Many new examples have been added to illustrate the key ideas of linear algebra. New topics covered in the book include product spaces, quotient spaces, and dual spaces. Beautiful new formatting creates pages with an unusually pleasant appearance in both print and electronic versions. No prerequisites are assumed other than the ...

  19. Organic Molecules in Meteorites (United States)

    Martins, Zita


    Carbonaceous meteorites are primitive samples from the asteroid belt, containing 3-5wt% organic carbon. The exogenous delivery of organic matter by carbonaceous meteorites may have contributed to the organic inventory of the early Earth. The majority (>70%) of the meteoritic organic material consist of insoluble organic matter (IOM) [1]. The remaining meteoritic organic material (meteorites contain soluble organic molecules with different abundances and distributions, which may reflect the extension of aqueous alteration or thermal metamorphism on the meteorite parent bodies. Extensive aqueous alteration on the meteorite parent body may result on 1) the decomposition of α-amino acids [5, 6]; 2) synthesis of β- and γ-amino acids [2, 6-9]; 3) higher relative abundances of alkylated polycyclic aromatic hydrocarbons (PAHs) [6, 10]; and 4) higher L-enantiomer excess (Lee) value of isovaline [6, 11, 12].The soluble organic content of carbonaceous meteorites may also have a contribution from Fischer-Tropsch/Haber-Bosch type gas-grain reactions after the meteorite parent body cooled to lower temperatures [13, 14].The analysis of the abundances and distribution of the organic molecules present in meteorites helps to determine the physical and chemical conditions of the early solar system, and the prebiotic organic compounds available on the early Earth.[1] Cody and Alexander (2005) GCA 69, 1085. [2] Cronin and Chang (1993) in: The Chemistry of Life’s Origin. pp. 209-258. [3] Martins and Sephton (2009) in: Amino acids, peptides and proteins in organic chemistry. pp. 1-42. [4] Martins (2011) Elements 7, 35. [5] Botta et al. (2007) MAPS 42, 81. [6] Martins et al. (2015) MAPS, in press. [7] Cooper and Cronin (1995) GCA 59, 1003. [8] Glavin et al. (2006) MAPS. 41, 889. [9] Glavin et al. (2011) MAPS 45, 1948. [10] Elsila et al. (2005) GCA 5, 1349. [11] Glavin and Dworkin (2009) PNAS 106, 5487. [12] Pizzarello et al. (2003) GCA 67, 1589. [13] Chan et al. (2012) MAPS. 47, 1502

  20. Handbook on linear motor application

    International Nuclear Information System (INIS)


    This book guides the application for Linear motor. It lists classification and speciality of Linear Motor, terms of linear-induction motor, principle of the Motor, types on one-side linear-induction motor, bilateral linear-induction motor, linear-DC Motor on basic of the motor, linear-DC Motor for moving-coil type, linear-DC motor for permanent-magnet moving type, linear-DC motor for electricity non-utility type, linear-pulse motor for variable motor, linear-pulse motor for permanent magneto type, linear-vibration actuator, linear-vibration actuator for moving-coil type, linear synchronous motor, linear electromagnetic motor, linear electromagnetic solenoid, technical organization and magnetic levitation and linear motor and sensor.

  1. Mechanical response of collagen molecule under hydrostatic compression

    International Nuclear Information System (INIS)

    Saini, Karanvir; Kumar, Navin


    Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials.

  2. Mechanical response of collagen molecule under hydrostatic compression. (United States)

    Saini, Karanvir; Kumar, Navin


    Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials. Copyright © 2015 Elsevier B.V. All rights

  3. Mechanical response of collagen molecule under hydrostatic compression

    Energy Technology Data Exchange (ETDEWEB)

    Saini, Karanvir, E-mail:; Kumar, Navin


    Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials.

  4. Controlling the branching ratio of photodissociation using aligned molecules

    DEFF Research Database (Denmark)

    Larsen, J.J.; Wendt-Larsen, I.; Stapelfeldt, H.


    Using a sample of iodine molecules, aligned by a strong, linearly polarized laser pulse, we control the branching ratio of the I+I and I+I* photodissociation channels by a factor of 26. The control relies on selective photoexcitation of two potential curves that each correlate adiabatically...

  5. Tunnelling of a molecule

    International Nuclear Information System (INIS)

    Jarvis, P.D.; Bulte, D.P.


    A quantum-mechanical description of tunnelling is presented for a one-dimensional system with internal oscillator degrees of freedom. The 'charged diatomic molecule' is frustrated on encountering a barrier potential by its centre of charge not being coincident with its centre of mass, resulting in transitions amongst internal states. In an adiabatic limit, the tunnelling of semiclassical coherent-like oscillator states is shown to exhibit the Hartman and Bueuttiker-Landauer times t H and t BL , with the time dependence of the coherent state parameter for the tunnelled state given by α(t) = α e -iω(t+Δt) , Δt = t H - it BL . A perturbation formalism is developed, whereby the exact transfer matrix can be expanded to any desired accuracy in a suitable limit. An 'intrinsic' time, based on the oscillator transition rate during tunnelling, transmission or reflection, is introduced. In simple situations the resulting intrinsic tunnelling time is shown to vanish to lowest order. In the general case a particular (nonzero) parametrisation is inferred, and its properties discussed in comparison with the literature on tunnelling times for both wavepackets and internal clocks. Copyright (1998) CSIRO Australia

  6. Single molecule tracking (United States)

    Shera, E. Brooks


    A detection system is provided for identifying individual particles or molecules having characteristic emission in a flow train of the particles in a flow cell. A position sensitive sensor is located adjacent the flow cell in a position effective to detect the emissions from the particles within the flow cell and to assign spatial and temporal coordinates for the detected emissions. A computer is then enabled to predict spatial and temporal coordinates for the particle in the flow train as a function of a first detected emission. Comparison hardware or software then compares subsequent detected spatial and temporal coordinates with the predicted spatial and temporal coordinates to determine whether subsequently detected emissions originate from a particle in the train of particles. In one embodiment, the particles include fluorescent dyes which are excited to fluoresce a spectrum characteristic of the particular particle. Photones are emitted adjacent at least one microchannel plate sensor to enable spatial and temporal coordinates to be assigned. The effect of comparing detected coordinates with predicted coordinates is to define a moving sample volume which effectively precludes the effects of background emissions.

  7. Linear ubiquitination in immunity. (United States)

    Shimizu, Yutaka; Taraborrelli, Lucia; Walczak, Henning


    Linear ubiquitination is a post-translational protein modification recently discovered to be crucial for innate and adaptive immune signaling. The function of linear ubiquitin chains is regulated at multiple levels: generation, recognition, and removal. These chains are generated by the linear ubiquitin chain assembly complex (LUBAC), the only known ubiquitin E3 capable of forming the linear ubiquitin linkage de novo. LUBAC is not only relevant for activation of nuclear factor-κB (NF-κB) and mitogen-activated protein kinases (MAPKs) in various signaling pathways, but importantly, it also regulates cell death downstream of immune receptors capable of inducing this response. Recognition of the linear ubiquitin linkage is specifically mediated by certain ubiquitin receptors, which is crucial for translation into the intended signaling outputs. LUBAC deficiency results in attenuated gene activation and increased cell death, causing pathologic conditions in both, mice, and humans. Removal of ubiquitin chains is mediated by deubiquitinases (DUBs). Two of them, OTULIN and CYLD, are constitutively associated with LUBAC. Here, we review the current knowledge on linear ubiquitination in immune signaling pathways and the biochemical mechanisms as to how linear polyubiquitin exerts its functions distinctly from those of other ubiquitin linkage types. © 2015 The Authors. Immunological Reviews Published by John Wiley & Sons Ltd.

  8. Theoretical Investigations Regarding Single Molecules

    DEFF Research Database (Denmark)

    Pedersen, Kim Georg Lind

    Neoclassical Valence Bond Theory, Quantum Transport, Quantum Interference, Kondo Effect, and Electron Pumping. Trap a single organic molecule between two electrodes and apply a bias voltage across this "molecular junction". When electrons pass through the molecule, the different electron paths can...... interfere destructively or constructively. Destructive interference effects in electron transport could potentially improve thermo-electrics, organic logic circuits and energy harvesting. We have investigated destructive interference in off-resonant transport through organic molecules, and have found a set...

  9. Photoexcitation circular dichroism in chiral molecules (United States)

    Beaulieu, S.; Comby, A.; Descamps, D.; Fabre, B.; Garcia, G. A.; Géneaux, R.; Harvey, A. G.; Légaré, F.; Mašín, Z.; Nahon, L.; Ordonez, A. F.; Petit, S.; Pons, B.; Mairesse, Y.; Smirnova, O.; Blanchet, V.


    Chiral effects appear in a wide variety of natural phenomena and are of fundamental importance in science, from particle physics to metamaterials. The standard technique of chiral discrimination—photoabsorption circular dichroism—relies on the magnetic properties of a chiral medium and yields an extremely weak chiral response. Here, we propose and demonstrate an orders of magnitude more sensitive type of circular dichroism in neutral molecules: photoexcitation circular dichroism. This technique does not rely on weak magnetic effects, but takes advantage of the coherent helical motion of bound electrons excited by ultrashort circularly polarized light. It results in an ultrafast chiral response and the efficient excitation of a macroscopic chiral density in an initially isotropic ensemble of randomly oriented chiral molecules. We probe this excitation using linearly polarized laser pulses, without the aid of further chiral interactions. Our time-resolved study of vibronic chiral dynamics opens a way to the efficient initiation, control and monitoring of chiral chemical change in neutral molecules at the level of electrons.

  10. Biofuels: from microbes to molecules

    National Research Council Canada - National Science Library

    Lu, Xuefeng


    .... The production of different biofuel molecules including hydrogen, methane, ethanol, butanol, higher chain alcohols, isoprenoids and fatty acid derivatives, from genetically engineered microbes...

  11. Labelled molecules, modern research implements

    International Nuclear Information System (INIS)

    Pichat, L.; Langourieux, Y.


    Details of the synthesis of carbon 14- and tritium-labelled molecules are examined. Although the methods used are those of classical organic chemistry the preparation of carbon 14-labelled molecules differs in some respects, most noticeably in the use of 14 CO 2 which requires very special handling techniques. For the tritium labelling of organic molecules the methods are somewhat different, very often involving exchange reactions. The following are described in turn: the so-called Wilzbach exchange method; exchange by catalysis in solution; catalytic hydrogenation with tritium; reductions with borotritides. Some applications of labelled molecules in organic chemistry, biochemistry and pharmacology are listed [fr

  12. Linearizing W-algebras

    International Nuclear Information System (INIS)

    Krivonos, S.O.; Sorin, A.S.


    We show that the Zamolodchikov's and Polyakov-Bershadsky nonlinear algebras W 3 and W (2) 3 can be embedded as subalgebras into some linear algebras with finite set of currents. Using these linear algebras we find new field realizations of W (2) 3 and W 3 which could be a starting point for constructing new versions of W-string theories. We also reveal a number of hidden relationships between W 3 and W (2) 3 . We conjecture that similar linear algebras can exist for other W-algebra as well. (author). 10 refs

  13. Matrices and linear algebra

    CERN Document Server

    Schneider, Hans


    Linear algebra is one of the central disciplines in mathematics. A student of pure mathematics must know linear algebra if he is to continue with modern algebra or functional analysis. Much of the mathematics now taught to engineers and physicists requires it.This well-known and highly regarded text makes the subject accessible to undergraduates with little mathematical experience. Written mainly for students in physics, engineering, economics, and other fields outside mathematics, the book gives the theory of matrices and applications to systems of linear equations, as well as many related t

  14. Linearity in Process Languages

    DEFF Research Database (Denmark)

    Nygaard, Mikkel; Winskel, Glynn


    The meaning and mathematical consequences of linearity (managing without a presumed ability to copy) are studied for a path-based model of processes which is also a model of affine-linear logic. This connection yields an affine-linear language for processes, automatically respecting open......-map bisimulation, in which a range of process operations can be expressed. An operational semantics is provided for the tensor fragment of the language. Different ways to make assemblies of processes lead to different choices of exponential, some of which respect bisimulation....

  15. Elements of linear space

    CERN Document Server

    Amir-Moez, A R; Sneddon, I N


    Elements of Linear Space is a detailed treatment of the elements of linear spaces, including real spaces with no more than three dimensions and complex n-dimensional spaces. The geometry of conic sections and quadric surfaces is considered, along with algebraic structures, especially vector spaces and transformations. Problems drawn from various branches of geometry are given.Comprised of 12 chapters, this volume begins with an introduction to real Euclidean space, followed by a discussion on linear transformations and matrices. The addition and multiplication of transformations and matrices a

  16. Applied linear regression

    CERN Document Server

    Weisberg, Sanford


    Praise for the Third Edition ""...this is an excellent book which could easily be used as a course text...""-International Statistical Institute The Fourth Edition of Applied Linear Regression provides a thorough update of the basic theory and methodology of linear regression modeling. Demonstrating the practical applications of linear regression analysis techniques, the Fourth Edition uses interesting, real-world exercises and examples. Stressing central concepts such as model building, understanding parameters, assessing fit and reliability, and drawing conclusions, the new edition illus

  17. Growing interstellar molecules with ion-molecule reactions

    International Nuclear Information System (INIS)

    Bohme, D.K.


    Laboratory measurements of gas-phase ion-molecule reactions continue to provide important insights into the chemistry of molecular growth in interstellar environments. It is also true that the measurements are becoming more demanding as larger molecules capture our interest. While some of these measurements are motivated by current developments in chemical models of interstellar environments or by new molecular observations by astronomers, others explore novel chemistry which can lead to predictions of new interstellar molecules. Here the author views the results of some recent measurements, taken in the Ion Chemistry Laboratory at York University with the SIFT technique, which address some of the current needs of modellers and observers and which also provide some new fundamental insight into molecular growth, particularly when it occurs in the presence of large molecules such as PAH molecules which are now thought to have a major influence on the chemistry of interstellar environments in which they are present

  18. Linear system theory (United States)

    Callier, Frank M.; Desoer, Charles A.


    The aim of this book is to provide a systematic and rigorous access to the main topics of linear state-space system theory in both the continuous-time case and the discrete-time case; and the I/O description of linear systems. The main thrusts of the work are the analysis of system descriptions and derivations of their properties, LQ-optimal control, state feedback and state estimation, and MIMO unity-feedback systems.

  19. Enzyme Molecules in Solitary Confinement

    Directory of Open Access Journals (Sweden)

    Raphaela B. Liebherr


    Full Text Available Large arrays of homogeneous microwells each defining a femtoliter volume are a versatile platform for monitoring the substrate turnover of many individual enzyme molecules in parallel. The high degree of parallelization enables the analysis of a statistically representative enzyme population. Enclosing individual enzyme molecules in microwells does not require any surface immobilization step and enables the kinetic investigation of enzymes free in solution. This review describes various microwell array formats and explores their applications for the detection and investigation of single enzyme molecules. The development of new fabrication techniques and sensitive detection methods drives the field of single molecule enzymology. Here, we introduce recent progress in single enzyme molecule analysis in microwell arrays and discuss the challenges and opportunities.

  20. Organizing and addressing magnetic molecules. (United States)

    Gatteschi, Dante; Cornia, Andrea; Mannini, Matteo; Sessoli, Roberta


    Magnetic molecules ranging from simple organic radicals to single-molecule magnets (SMMs) are intensively investigated for their potential applications in molecule-based information storage and processing. The goal of this Article is to review recent achievements in the organization of magnetic molecules on surfaces and in their individual probing and manipulation. We stress that the inherent fragility and redox sensitivity of most SMM complexes, combined with the noninnocent role played by the substrate, ask for a careful evaluation of the structural and electronic properties of deposited molecules going beyond routine methods for surface analysis. Detailed magnetic information can be directly obtained using X-ray magnetic circular dichroism or newly emerging scanning probe techniques with magnetic detection capabilities.

  1. Ion-Molecule Reaction Dynamics. (United States)

    Meyer, Jennifer; Wester, Roland


    We review the recent advances in the investigation of the dynamics of ion-molecule reactions. During the past decade, the combination of single-collision experiments in crossed ion and neutral beams with the velocity map ion imaging detection technique has enabled a wealth of studies on ion-molecule reactions. These methods, in combination with chemical dynamics simulations, have uncovered new and unexpected reaction mechanisms, such as the roundabout mechanism and the subtle influence of the leaving group in anion-molecule nucleophilic substitution reactions. For this important class of reactions, as well as for many fundamental cation-molecule reactions, the information obtained with crossed-beam imaging is discussed. The first steps toward understanding micro-solvation of ion-molecule reaction dynamics are presented. We conclude with the presentation of several interesting directions for future research.

  2. Generalization of the linear algebraic method to three dimensions

    International Nuclear Information System (INIS)

    Lynch, D.L.; Schneider, B.I.


    We present a numerical method for the solution of the Lippmann-Schwinger equation for electron-molecule collisions. By performing a three-dimensional numerical quadrature, this approach avoids both a basis-set representation of the wave function and a partial-wave expansion of the scattering potential. The resulting linear equations, analogous in form to the one-dimensional linear algebraic method, are solved with the direct iteration-variation method. Several numerical examples are presented. The prospect for using this numerical quadrature scheme for electron-polyatomic molecules is discussed

  3. Further linear algebra

    CERN Document Server

    Blyth, T S


    Most of the introductory courses on linear algebra develop the basic theory of finite­ dimensional vector spaces, and in so doing relate the notion of a linear mapping to that of a matrix. Generally speaking, such courses culminate in the diagonalisation of certain matrices and the application of this process to various situations. Such is the case, for example, in our previous SUMS volume Basic Linear Algebra. The present text is a continuation of that volume, and has the objective of introducing the reader to more advanced properties of vector spaces and linear mappings, and consequently of matrices. For readers who are not familiar with the contents of Basic Linear Algebra we provide an introductory chapter that consists of a compact summary of the prerequisites for the present volume. In order to consolidate the student's understanding we have included a large num­ ber of illustrative and worked examples, as well as many exercises that are strategi­ cally placed throughout the text. Solutions to the ex...

  4. Linear mass reflectron

    International Nuclear Information System (INIS)

    Mamyrin, B.A.; Shmikk, D.V.


    A description and operating principle of a linear mass reflectron with V-form trajectory of ion motion -a new non-magnetic time-of-flight mass spectrometer with high resolution are presented. The ion-optical system of the device consists of an ion source with ionization by electron shock, of accelerating gaps, reflector gaps, a drift space and ion detector. Ions move in the linear mass refraction along the trajectories parallel to the axis of the analyzer chamber. The results of investigations into the experimental device are given. With an ion drift length of 0.6 m the device resolution is 1200 with respect to the peak width at half-height. Small-sized mass spectrometric transducers with high resolution and sensitivity may be designed on the base of the linear mass reflectron principle

  5. Applied linear algebra

    CERN Document Server

    Olver, Peter J


    This textbook develops the essential tools of linear algebra, with the goal of imparting technique alongside contextual understanding. Applications go hand-in-hand with theory, each reinforcing and explaining the other. This approach encourages students to develop not only the technical proficiency needed to go on to further study, but an appreciation for when, why, and how the tools of linear algebra can be used across modern applied mathematics. Providing an extensive treatment of essential topics such as Gaussian elimination, inner products and norms, and eigenvalues and singular values, this text can be used for an in-depth first course, or an application-driven second course in linear algebra. In this second edition, applications have been updated and expanded to include numerical methods, dynamical systems, data analysis, and signal processing, while the pedagogical flow of the core material has been improved. Throughout, the text emphasizes the conceptual connections between each application and the un...

  6. Theory of linear operations

    CERN Document Server

    Banach, S


    This classic work by the late Stefan Banach has been translated into English so as to reach a yet wider audience. It contains the basics of the algebra of operators, concentrating on the study of linear operators, which corresponds to that of the linear forms a1x1 + a2x2 + ... + anxn of algebra.The book gathers results concerning linear operators defined in general spaces of a certain kind, principally in Banach spaces, examples of which are: the space of continuous functions, that of the pth-power-summable functions, Hilbert space, etc. The general theorems are interpreted in various mathematical areas, such as group theory, differential equations, integral equations, equations with infinitely many unknowns, functions of a real variable, summation methods and orthogonal series.A new fifty-page section (``Some Aspects of the Present Theory of Banach Spaces'''') complements this important monograph.

  7. Dimension of linear models

    DEFF Research Database (Denmark)

    Høskuldsson, Agnar


    Determination of the proper dimension of a given linear model is one of the most important tasks in the applied modeling work. We consider here eight criteria that can be used to determine the dimension of the model, or equivalently, the number of components to use in the model. Four of these cri......Determination of the proper dimension of a given linear model is one of the most important tasks in the applied modeling work. We consider here eight criteria that can be used to determine the dimension of the model, or equivalently, the number of components to use in the model. Four...... the basic problems in determining the dimension of linear models. Then each of the eight measures are treated. The results are illustrated by examples....

  8. Linear programming using Matlab

    CERN Document Server

    Ploskas, Nikolaos


    This book offers a theoretical and computational presentation of a variety of linear programming algorithms and methods with an emphasis on the revised simplex method and its components. A theoretical background and mathematical formulation is included for each algorithm as well as comprehensive numerical examples and corresponding MATLAB® code. The MATLAB® implementations presented in this book  are sophisticated and allow users to find solutions to large-scale benchmark linear programs. Each algorithm is followed by a computational study on benchmark problems that analyze the computational behavior of the presented algorithms. As a solid companion to existing algorithmic-specific literature, this book will be useful to researchers, scientists, mathematical programmers, and students with a basic knowledge of linear algebra and calculus.  The clear presentation enables the reader to understand and utilize all components of simplex-type methods, such as presolve techniques, scaling techniques, pivoting ru...

  9. Linear Colliders TESLA

    International Nuclear Information System (INIS)



    The aim of the TESLA (TeV Superconducting Linear Accelerator) collaboration (at present 19 institutions from seven countries) is to establish the technology for a high energy electron-positron linear collider using superconducting radiofrequency cavities to accelerate its beams. Another basic goal is to demonstrate that such a collider can meet its performance goals in a cost effective manner. For this the TESLA collaboration is preparing a 500 MeV superconducting linear test accelerator at the DESY Laboratory in Hamburg. This TTF (TESLA Test Facility) consists of four cryomodules, each approximately 12 m long and containing eight 9-cell solid niobium cavities operating at a frequency of 1.3 GHz

  10. Single Molecule Electronics and Devices (United States)

    Tsutsui, Makusu; Taniguchi, Masateru


    The manufacture of integrated circuits with single-molecule building blocks is a goal of molecular electronics. While research in the past has been limited to bulk experiments on self-assembled monolayers, advances in technology have now enabled us to fabricate single-molecule junctions. This has led to significant progress in understanding electron transport in molecular systems at the single-molecule level and the concomitant emergence of new device concepts. Here, we review recent developments in this field. We summarize the methods currently used to form metal-molecule-metal structures and some single-molecule techniques essential for characterizing molecular junctions such as inelastic electron tunnelling spectroscopy. We then highlight several important achievements, including demonstration of single-molecule diodes, transistors, and switches that make use of electrical, photo, and mechanical stimulation to control the electron transport. We also discuss intriguing issues to be addressed further in the future such as heat and thermoelectric transport in an individual molecule. PMID:22969345

  11. Linearly Adjustable International Portfolios (United States)

    Fonseca, R. J.; Kuhn, D.; Rustem, B.


    We present an approach to multi-stage international portfolio optimization based on the imposition of a linear structure on the recourse decisions. Multiperiod decision problems are traditionally formulated as stochastic programs. Scenario tree based solutions however can become intractable as the number of stages increases. By restricting the space of decision policies to linear rules, we obtain a conservative tractable approximation to the original problem. Local asset prices and foreign exchange rates are modelled separately, which allows for a direct measure of their impact on the final portfolio value.

  12. Linearly Adjustable International Portfolios

    International Nuclear Information System (INIS)

    Fonseca, R. J.; Kuhn, D.; Rustem, B.


    We present an approach to multi-stage international portfolio optimization based on the imposition of a linear structure on the recourse decisions. Multiperiod decision problems are traditionally formulated as stochastic programs. Scenario tree based solutions however can become intractable as the number of stages increases. By restricting the space of decision policies to linear rules, we obtain a conservative tractable approximation to the original problem. Local asset prices and foreign exchange rates are modelled separately, which allows for a direct measure of their impact on the final portfolio value.

  13. Linear induction motor

    International Nuclear Information System (INIS)

    Barkman, W.E.; Adams, W.Q.; Berrier, B.R.


    A linear induction motor has been operated on a test bed with a feedback pulse resolution of 5 nm (0.2 μin). Slewing tests with this slide drive have shown positioning errors less than or equal to 33 nm (1.3 μin) at feedrates between 0 and 25.4 mm/min (0-1 ipm). A 0.86-m (34-in)-stroke linear motor is being investigated, using the SPACO machine as a test bed. Initial results were encouraging, and work is continuing to optimize the servosystem compensation

  14. Handbook of linear algebra

    CERN Document Server

    Hogben, Leslie


    With a substantial amount of new material, the Handbook of Linear Algebra, Second Edition provides comprehensive coverage of linear algebra concepts, applications, and computational software packages in an easy-to-use format. It guides you from the very elementary aspects of the subject to the frontiers of current research. Along with revisions and updates throughout, the second edition of this bestseller includes 20 new chapters.New to the Second EditionSeparate chapters on Schur complements, additional types of canonical forms, tensors, matrix polynomials, matrix equations, special types of

  15. Linear Algebra Thoroughly Explained

    CERN Document Server

    Vujičić, Milan


    Linear Algebra Thoroughly Explained provides a comprehensive introduction to the subject suitable for adoption as a self-contained text for courses at undergraduate and postgraduate level. The clear and comprehensive presentation of the basic theory is illustrated throughout with an abundance of worked examples. The book is written for teachers and students of linear algebra at all levels and across mathematics and the applied sciences, particularly physics and engineering. It will also be an invaluable addition to research libraries as a comprehensive resource book for the subject.

  16. America, Linearly Cyclical (United States)


    AND VICTIM- ~ vAP BLAMING 4. AMERICA, LINEARLY CYCUCAL AF IMT 1768, 19840901, V5 PREVIOUS EDITION WILL BE USED. C2C Jessica Adams Dr. Brissett...his desires, his failings, and his aspirations follow the same general trend throughout history and throughout cultures. The founding fathers sought

  17. Stanford's linear collider

    International Nuclear Information System (INIS)

    Southworth, B.


    The peak of the construction phase of the Stanford Linear Collider, SLC, to achieve 50 GeV electron-positron collisions has now been passed. The work remains on schedule to attempt colliding beams, initially at comparatively low luminosity, early in 1987. (orig./HSI).

  18. Dosimetry of linear sources

    International Nuclear Information System (INIS)

    Mafra Neto, F.


    The dose of gamma radiation from a linear source of cesium 137 is obtained, presenting two difficulties: oblique filtration of radiation when cross the platinum wall, in different directions, and dose connection due to the scattering by the material mean of propagation. (C.G.C.)

  19. Resistors Improve Ramp Linearity (United States)

    Kleinberg, L. L.


    Simple modification to bootstrap ramp generator gives more linear output over longer sweep times. New circuit adds just two resistors, one of which is adjustable. Modification cancels nonlinearities due to variations in load on charging capacitor and due to changes in charging current as the voltage across capacitor increases.

  20. LINEAR COLLIDERS: 1992 workshop

    International Nuclear Information System (INIS)

    Settles, Ron; Coignet, Guy


    As work on designs for future electron-positron linear colliders pushes ahead at major Laboratories throughout the world in a major international collaboration framework, the LC92 workshop held in Garmisch Partenkirchen this summer, attended by 200 machine and particle physicists, provided a timely focus

  1. Linear genetic programming

    CERN Document Server

    Brameier, Markus


    Presents a variant of Genetic Programming that evolves imperative computer programs as linear sequences of instructions, in contrast to the more traditional functional expressions or syntax trees. This book serves as a reference for researchers, but also contains sufficient introduction for students and those who are new to the field

  2. On Solving Linear Recurrences (United States)

    Dobbs, David E.


    A direct method is given for solving first-order linear recurrences with constant coefficients. The limiting value of that solution is studied as "n to infinity." This classroom note could serve as enrichment material for the typical introductory course on discrete mathematics that follows a calculus course.

  3. Review of linear colliders

    International Nuclear Information System (INIS)

    Takeda, Seishi


    The status of R and D of future e + e - linear colliders proposed by the institutions throughout the world is described including the JLC, NLC, VLEPP, CLIC, DESY/THD and TESLA projects. The parameters and RF sources are discussed. (G.P.) 36 refs.; 1 tab

  4. Spin tunneling in magnetic molecules (United States)

    Kececioglu, Ersin

    In this thesis, we will focus on spin tunneling in a family of systems called magnetic molecules such as Fe8 and Mn12. This is comparatively new, in relation to other tunneling problems. Many issues are not completely solved and/or understood yet. The magnetic molecule Fe 8 has been observed to have a rich pattern of degeneracies in its magnetic spectrum. We focus on these degeneracies from several points of view. We start with the simplest anisotropy Hamiltonian to describe the Fe 8 molecule and extend our discussion to include higher order anisotropy terms. We give analytical expressions as much as we can, for the degeneracies in the semi-classical limit in both cases. We reintroduce jump instantons to the instanton formalism. Finally, we discuss the effect of the environment on the molecule. Our results, for all different models and techniques, agree well with both experimental and numerical results.

  5. Experimental decoherence in molecule interferometry

    International Nuclear Information System (INIS)

    Hackermueller, L.; Hornberger, K.; Stibor, A.; Zeilinger, A.; Arndt, M.; Kiesewetter, G.


    Full text: We present three mechanisms of decoherence that occur quite naturally in matter wave interferometer with large molecules. One way molecules can lose coherence is through collision with background gas particles. We observe a loss of contrast with increasing background pressure for various types of gases. We can understand this phenomenon quantitatively with a new model for collisional decoherence which corrects older models by a factor of 2 π;. The second experiment studies the thermal emission of photons related to the high internal energy of the interfering molecules. When sufficiently many or sufficiently short photons are emitted inside the interferometer, the fringe contrast is lost. We can continuously vary the temperature of the molecules and compare the loss of contrast with a model based on decoherence theory. Again we find good quantitative agreement. A third mechanism that influences our interference pattern is dephasing due to vibrations of the interference gratings. By adding additional vibrations we study this effect in more detail. (author)

  6. Photoionization of atoms and molecules

    International Nuclear Information System (INIS)

    Samson, J.A.R.


    A literature review on the present state of knowledge in photoionization is presented. Various experimental techniques that have been developed to study photoionization, such as fluorescence and photoelectron spectroscopy, mass spectroscopy, are examined. Various atoms and molecules were chosen to illustrate these techniques, specifically helium and xenon atoms and hydrogen molecules. Specialized photoionization such as in positive and negative ions, excited states, and free radicals is also treated. Absorption cross sections and ionization potentials are also discussed

  7. Low pressure tritiation of molecules

    International Nuclear Information System (INIS)

    Moran, T.F.; Powers, J.C.; Lively, M.O.


    A method is described of tritiating sensitive biological molecules by depositing molecules of the substance to be tritiated on a supporting substrate in an evacuated vacuum chamber near, but not in the path of, an electron beam which traverses the chamber, admitting tritium gas into the chamber, and subjecting the tritium to the electron beam. Vibrationally excited tritium gas species are generated which collide and react with the substance thus incorporating tritium atoms into the substance. (U.K.)

  8. Ion transmission in a linear radiofrequency spectrometer

    International Nuclear Information System (INIS)

    Gomet, J.-C.


    A linear radiofrequency spectrometer is used for the purpose of experimental determination of the absolute ionization cross sections of various ions obtained by electron impact on polyatomic molecules. The transmission of the apparatus is studied: it does not only depend on the mass resolution of the spectrometer, but also on the nature of ions. It is affected by charge transfers, especially for the parent ions. An empiric way of correction of the apparatus function is given which allows the use at 10 -6 Torr [fr

  9. Theoretical studies of the C4 molecule

    International Nuclear Information System (INIS)

    Ritchie, J.P.; King, H.F.; Young, W.S.


    Optimized geometries and relative energies for three states of the C 4 molecule have been obtained from single-reference configuration interaction (SRCI) calculations. At the SRCI level, a rhombic form is calculated to lie 1.1 kcal below the triplet form; consideration of the Davidson correction reduces this difference to 0.4 kcal, while more complete basis sets are expected to increase the difference only by about 0.2 kcal. Consideration of these effects and difference in zero-point energy leads to a final estimated splitting of 1.2 kcal, favoring the rhombus. To aid the determination of the ground state, preliminary estimates of the lowest optical transitions were obtained from SRCI calculations and vibrational frequencies were obtained from SCF calculations. Comparison of the calculated results with experimentally obtained spectra suggest the possibility that both the linear triplet and the rhombus may have already been observed. 19 refs., 4 figs., 4 tabs

  10. Carbon 13 nuclear magnetic resonance chemical shifts empiric calculations of polymers by multi linear regression and molecular modeling

    International Nuclear Information System (INIS)

    Da Silva Pinto, P.S.; Eustache, R.P.; Audenaert, M.; Bernassau, J.M.


    This work deals with carbon 13 nuclear magnetic resonance chemical shifts empiric calculations by multi linear regression and molecular modeling. The multi linear regression is indeed one way to obtain an equation able to describe the behaviour of the chemical shift for some molecules which are in the data base (rigid molecules with carbons). The methodology consists of structures describer parameters definition which can be bound to carbon 13 chemical shift known for these molecules. Then, the linear regression is used to determine the equation significant parameters. This one can be extrapolated to molecules which presents some resemblances with those of the data base. (O.L.). 20 refs., 4 figs., 1 tab

  11. Finite-dimensional linear algebra

    CERN Document Server

    Gockenbach, Mark S


    Some Problems Posed on Vector SpacesLinear equationsBest approximationDiagonalizationSummaryFields and Vector SpacesFields Vector spaces Subspaces Linear combinations and spanning sets Linear independence Basis and dimension Properties of bases Polynomial interpolation and the Lagrange basis Continuous piecewise polynomial functionsLinear OperatorsLinear operatorsMore properties of linear operatorsIsomorphic vector spaces Linear operator equations Existence and uniqueness of solutions The fundamental theorem; inverse operatorsGaussian elimination Newton's method Linear ordinary differential eq

  12. Thermal ion-molecule reactions in oxygen-containing molecules

    International Nuclear Information System (INIS)

    Kumakura, Minoru


    The energetics of ions and the thermal ion-molecule reactions in oxygen-containing molecules have been studied with a modified time-of-flight mass spectrometer. It was found that the translational energy of ion can be easily obtained from analysis of the decay curve using the time-of-flight mass spectrometer. The condensation-elimination reactions proceeded via cross- and homo-elimination mechanism in which the nature of intermediate-complex could be correlated with the nature of reactant ion. It was elucidated that behavior of poly-atomic oxygen-containing ions on the condensation-elimination reactions is considerably influenced by their oxonium ion structures having functional groups. In addition, the rate constants of the condensation-elimination reactions have affected with the energy state of reactant ion and the dipole moment and/or the polarizability of neutral molecule. It was clarified that the rate constants of the ion-molecule clustering reactions in poly-atomic oxygen-containing molecules such as cyclic ether of six member rings are very large and the cluster ions are stable owing to the large number of vibrational degree of freedom in the cluster ions. (author)

  13. Linear optical response of finite systems using multishift linear system solvers

    Energy Technology Data Exchange (ETDEWEB)

    Hübener, Hannes; Giustino, Feliciano [Department of Materials, University of Oxford, Oxford OX1 3PH (United Kingdom)


    We discuss the application of multishift linear system solvers to linear-response time-dependent density functional theory. Using this technique the complete frequency-dependent electronic density response of finite systems to an external perturbation can be calculated at the cost of a single solution of a linear system via conjugate gradients. We show that multishift time-dependent density functional theory yields excitation energies and oscillator strengths in perfect agreement with the standard diagonalization of the response matrix (Casida's method), while being computationally advantageous. We present test calculations for benzene, porphin, and chlorophyll molecules. We argue that multishift solvers may find broad applicability in the context of excited-state calculations within density-functional theory and beyond.

  14. Energy distribution in dissociations of polyatomic molecules

    International Nuclear Information System (INIS)

    Koernig, S.A.


    In this thesis studies are reported of fragmentation processes in polyatomic molecules. In order to find out which dessocaciation reactions take place, how they are brought about by the internal energy of the reactant, and to investigate the structure of the dissociating 'transition state', the fragment mass and the corresponding kinetic energy release (KER) are determined by differential translational spectroscopy using a position and time sensitive two-particle coincidence detector. The results are interpreted using the statistical theory of unimolecular dissociation. It turns out that the standard assumptions of the theory, especially in calculating KER-distributions, are not realistic in all molecules considered. Dissociation is induced by the neutralization with alkali metal vapour. In ch. 2 the experimental method and the analysis of the data (dissociation pathways, branching ratios and ε-d-distributions) are introduced and exemplified by measurements of cyclohexane, which represents the upper limit in precursor and fragment mass accessible in the apparatus. In ch. 3 a study is reported of the molecules methylchloride (CH 3 Cl) and the acetylradical (CH 3 CO). In spite of their similar geometric structures, completely different dissociation mechanisms have been found. Methylchloride dissociates via a repulsive state; acetyl radicals show energy scrambling. The energy distribution from dissociating acetyl exemplifies dynamical effects in the dissociation. In ch. 4 an investigation of a number of prototype hydrocarbons is presented. The dissociation pathways of several small linear alkanes indicate that neutralization takes place to unknown repulsive potentials, of which the position and steepness are determined from the kinetic energy release. (author). 118 refs.; 40 figs.; 5 tabs

  15. Electroluminescence from completely horizontally oriented dye molecules

    Energy Technology Data Exchange (ETDEWEB)

    Komino, Takeshi [Education Center for Global Leaders in Molecular System for Devices, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Japan Science and Technology Agency, ERATO, Adachi Molecular Exciton Engineering Project, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Sagara, Yuta [Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Tanaka, Hiroyuki [Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Department of Chemistry, Graduate School of Science, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601 (Japan); Oki, Yuji [Japan Science and Technology Agency, ERATO, Adachi Molecular Exciton Engineering Project, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Department of Electronics, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Nakamura, Nozomi [Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); International Institute for Carbon Neutral Energy Research (WPI-I2CNER), Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Fujimoto, Hiroshi [Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Fukuoka i" 3-Center for Organic Photonics and Electronics Research (i3-OPERA), Fukuoka 819-0388 (Japan); and others


    A complete horizontal molecular orientation of a linear-shaped thermally activated delayed fluorescent guest emitter 2,6-bis(4-(10Hphenoxazin-10-yl)phenyl)benzo[1,2-d:5,4-d′] bis(oxazole) (cis-BOX2) was obtained in a glassy host matrix by vapor deposition. The orientational order of cis-BOX2 depended on the combination of deposition temperature and the type of host matrix. Complete horizontal orientation was obtained when a thin film with cis-BOX2 doped in a 4,4′-bis(N-carbazolyl)-1,1′-biphenyl (CBP) host matrix was fabricated at 200 K. The ultimate orientation of guest molecules originates from not only the kinetic relaxation but also the kinetic stability of the deposited guest molecules on the film surface during film growth. Utilizing the ultimate orientation, a highly efficient organic light-emitting diode with the external quantum efficiency of 33.4 ± 2.0% was realized. The thermal stability of the horizontal orientation of cis-BOX2 was governed by the glass transition temperature (T{sub g}) of the CBP host matrix; the horizontal orientation was stable unless the film was annealed above T{sub g}.

  16. Linearity and Non-linearity of Photorefractive effect in Materials ...

    African Journals Online (AJOL)

    In this paper we have studied the Linearity and Non-linearity of Photorefractive effect in materials using the band transport model. For low light beam intensities the change in the refractive index is proportional to the electric field for linear optics while for non- linear optics the change in refractive index is directly proportional ...

  17. Linearly Refined Session Types

    Directory of Open Access Journals (Sweden)

    Pedro Baltazar


    Full Text Available Session types capture precise protocol structure in concurrent programming, but do not specify properties of the exchanged values beyond their basic type. Refinement types are a form of dependent types that can address this limitation, combining types with logical formulae that may refer to program values and can constrain types using arbitrary predicates. We present a pi calculus with assume and assert operations, typed using a session discipline that incorporates refinement formulae written in a fragment of Multiplicative Linear Logic. Our original combination of session and refinement types, together with the well established benefits of linearity, allows very fine-grained specifications of communication protocols in which refinement formulae are treated as logical resources rather than persistent truths.

  18. Linear Water Waves (United States)

    Kuznetsov, N.; Maz'ya, V.; Vainberg, B.


    This book gives a self-contained and up-to-date account of mathematical results in the linear theory of water waves. The study of waves has many applications, including the prediction of behavior of floating bodies (ships, submarines, tension-leg platforms etc.), the calculation of wave-making resistance in naval architecture, and the description of wave patterns over bottom topography in geophysical hydrodynamics. The first section deals with time-harmonic waves. Three linear boundary value problems serve as the approximate mathematical models for these types of water waves. The next section uses a plethora of mathematical techniques in the investigation of these three problems. The techniques used in the book include integral equations based on Green's functions, various inequalities between the kinetic and potential energy and integral identities which are indispensable for proving the uniqueness theorems. The so-called inverse procedure is applied to constructing examples of non-uniqueness, usually referred to as 'trapped nodes.'

  19. The International Linear Collider

    Directory of Open Access Journals (Sweden)

    List Benno


    Full Text Available The International Linear Collider (ILC is a proposed e+e− linear collider with a centre-of-mass energy of 200–500 GeV, based on superconducting RF cavities. The ILC would be an ideal machine for precision studies of a light Higgs boson and the top quark, and would have a discovery potential for new particles that is complementary to that of LHC. The clean experimental conditions would allow the operation of detectors with extremely good performance; two such detectors, ILD and SiD, are currently being designed. Both make use of novel concepts for tracking and calorimetry. The Japanese High Energy Physics community has recently recommended to build the ILC in Japan.

  20. The International Linear Collider (United States)

    List, Benno


    The International Linear Collider (ILC) is a proposed e+e- linear collider with a centre-of-mass energy of 200-500 GeV, based on superconducting RF cavities. The ILC would be an ideal machine for precision studies of a light Higgs boson and the top quark, and would have a discovery potential for new particles that is complementary to that of LHC. The clean experimental conditions would allow the operation of detectors with extremely good performance; two such detectors, ILD and SiD, are currently being designed. Both make use of novel concepts for tracking and calorimetry. The Japanese High Energy Physics community has recently recommended to build the ILC in Japan.

  1. Dimension of linear models

    DEFF Research Database (Denmark)

    Høskuldsson, Agnar


    Determination of the proper dimension of a given linear model is one of the most important tasks in the applied modeling work. We consider here eight criteria that can be used to determine the dimension of the model, or equivalently, the number of components to use in the model. Four...... the basic problems in determining the dimension of linear models. Then each of the eight measures are treated. The results are illustrated by examples....... of these criteria are widely used ones, while the remaining four are ones derived from the H-principle of mathematical modeling. Many examples from practice show that the criteria derived from the H-principle function better than the known and popular criteria for the number of components. We shall briefly review...

  2. Reciprocating linear motor (United States)

    Goldowsky, Michael P. (Inventor)


    A reciprocating linear motor is formed with a pair of ring-shaped permanent magnets having opposite radial polarizations, held axially apart by a nonmagnetic yoke, which serves as an axially displaceable armature assembly. A pair of annularly wound coils having axial lengths which differ from the axial lengths of the permanent magnets are serially coupled together in mutual opposition and positioned with an outer cylindrical core in axial symmetry about the armature assembly. One embodiment includes a second pair of annularly wound coils serially coupled together in mutual opposition and an inner cylindrical core positioned in axial symmetry inside the armature radially opposite to the first pair of coils. Application of a potential difference across a serial connection of the two pairs of coils creates a current flow perpendicular to the magnetic field created by the armature magnets, thereby causing limited linear displacement of the magnets relative to the coils.

  3. Duality in linearized gravity

    International Nuclear Information System (INIS)

    Henneaux, Marc; Teitelboim, Claudio


    We show that duality transformations of linearized gravity in four dimensions, i.e., rotations of the linearized Riemann tensor and its dual into each other, can be extended to the dynamical fields of the theory so as to be symmetries of the action and not just symmetries of the equations of motion. Our approach relies on the introduction of two superpotentials, one for the spatial components of the spin-2 field and the other for their canonically conjugate momenta. These superpotentials are two-index, symmetric tensors. They can be taken to be the basic dynamical fields and appear locally in the action. They are simply rotated into each other under duality. In terms of the superpotentials, the canonical generator of duality rotations is found to have a Chern-Simons-like structure, as in the Maxwell case

  4. The SLAC linear collider

    International Nuclear Information System (INIS)

    Phinney, N.


    The SLAC Linear Collider has begun a new era of operation with the SLD detector. During 1991 there was a first engineering run for the SLD in parallel with machine improvements to increase luminosity and reliability. For the 1992 run, a polarized electron source was added and more than 10,000 Zs with an average of 23% polarization have been logged by the SLD. This paper discusses the performance of the SLC in 1991 and 1992 and the technical advances that have produced higher luminosity. Emphasis will be placed on issues relevant to future linear colliders such as producing and maintaining high current, low emittance beams and focusing the beams to the micron scale for collisions. (Author) tab., 2 figs., 18 refs

  5. Linear waves and instabilities

    International Nuclear Information System (INIS)

    Bers, A.


    The electrodynamic equations for small-amplitude waves and their dispersion relation in a homogeneous plasma are outlined. For such waves, energy and momentum, and their flow and transformation, are described. Perturbation theory of waves is treated and applied to linear coupling of waves, and the resulting instabilities from such interactions between active and passive waves. Linear stability analysis in time and space is described where the time-asymptotic, time-space Green's function for an arbitrary dispersion relation is developed. The perturbation theory of waves is applied to nonlinear coupling, with particular emphasis on pump-driven interactions of waves. Details of the time--space evolution of instabilities due to coupling are given. (U.S.)

  6. Extended linear chain compounds

    CERN Document Server

    Linear chain substances span a large cross section of contemporary chemistry ranging from covalent polymers, to organic charge transfer com­ plexes to nonstoichiometric transition metal coordination complexes. Their commonality, which coalesced intense interest in the theoretical and exper­ imental solid state physics/chemistry communities, was based on the obser­ vation that these inorganic and organic polymeric substrates exhibit striking metal-like electrical and optical properties. Exploitation and extension of these systems has led to the systematic study of both the chemistry and physics of highly and poorly conducting linear chain substances. To gain a salient understanding of these complex materials rich in anomalous aniso­ tropic electrical, optical, magnetic, and mechanical properties, the conver­ gence of diverse skills and talents was required. The constructive blending of traditionally segregated disciplines such as synthetic and physical organic, inorganic, and polymer chemistry, crystallog...

  7. Fundamentals of linear algebra

    CERN Document Server

    Dash, Rajani Ballav


    FUNDAMENTALS OF LINEAR ALGEBRA is a comprehensive Text Book, which can be used by students and teachers of All Indian Universities. The Text has easy, understandable form and covers all topics of UGC Curriculum. There are lots of worked out examples which helps the students in solving the problems without anybody's help. The Problem sets have been designed keeping in view of the questions asked in different examinations.

  8. Linear network theory

    CERN Document Server

    Sander, K F


    Linear Network Theory covers the significant algebraic aspect of network theory, with minimal reference to practical circuits. The book begins the presentation of network analysis with the exposition of networks containing resistances only, and follows it up with a discussion of networks involving inductance and capacity by way of the differential equations. Classification and description of certain networks, equivalent networks, filter circuits, and network functions are also covered. Electrical engineers, technicians, electronics engineers, electricians, and students learning the intricacies

  9. Non linear viscoelastic models

    DEFF Research Database (Denmark)

    Agerkvist, Finn T.


    Viscoelastic eects are often present in loudspeaker suspensions, this can be seen in the displacement transfer function which often shows a frequency dependent value below the resonance frequency. In this paper nonlinear versions of the standard linear solid model (SLS) are investigated....... The simulations show that the nonlinear version of the Maxwell SLS model can result in a time dependent small signal stiness while the Kelvin Voight version does not....

  10. Relativistic Linear Restoring Force (United States)

    Clark, D.; Franklin, J.; Mann, N.


    We consider two different forms for a relativistic version of a linear restoring force. The pair comes from taking Hooke's law to be the force appearing on the right-hand side of the relativistic expressions: d"p"/d"t" or d"p"/d["tau"]. Either formulation recovers Hooke's law in the non-relativistic limit. In addition to these two forces, we…

  11. Superconducting linear colliders

    International Nuclear Information System (INIS)



    The advantages of superconducting radiofrequency (SRF) for particle accelerators have been demonstrated by successful operation of systems in the TRISTAN and LEP electron-positron collider rings respectively at the Japanese KEK Laboratory and at CERN. If performance continues to improve and costs can be lowered, this would open an attractive option for a high luminosity TeV (1000 GeV) linear collider

  12. Perturbed asymptotically linear problems


    Bartolo, R.; Candela, A. M.; Salvatore, A.


    The aim of this paper is investigating the existence of solutions of some semilinear elliptic problems on open bounded domains when the nonlinearity is subcritical and asymptotically linear at infinity and there is a perturbation term which is just continuous. Also in the case when the problem has not a variational structure, suitable procedures and estimates allow us to prove that the number of distinct crtitical levels of the functional associated to the unperturbed problem is "stable" unde...

  13. Miniature linear cooler development

    International Nuclear Information System (INIS)

    Pruitt, G.R.


    An overview is presented of the status of a family of miniature linear coolers currently under development by Hughes Aircraft Co. for use in hand held, volume limited or power limited infrared applications. These coolers, representing the latest additions to the Hughes family of TOP trademark [twin-opposed piston] linear coolers, have been fabricated and tested in three different configurations. Each configuration is designed to utilize a common compressor assembly resulting in reduced manufacturing costs. The baseline compressor has been integrated with two different expander configurations and has been operated with two different levels of input power. These various configuration combinations offer a wide range of performance and interface characteristics which may be tailored to applications requiring limited power and size without significantly compromising cooler capacity or cooldown characteristics. Key cooler characteristics and test data are summarized for three combinations of cooler configurations which are representative of the versatility of this linear cooler design. Configurations reviewed include the shortened coldfinger [1.50 to 1.75 inches long], limited input power [less than 17 Watts] for low power availability applications; the shortened coldfinger with higher input power for lightweight, higher performance applications; and coldfingers compatible with DoD 0.4 Watt Common Module coolers for wider range retrofit capability. Typical weight of these miniature linear coolers is less than 500 grams for the compressor, expander and interconnecting transfer line. Cooling capacity at 80K at room ambient conditions ranges from 400 mW to greater than 550 mW. Steady state power requirements for maintaining a heat load of 150 mW at 80K has been shown to be less than 8 Watts. Ongoing reliability growth testing is summarized including a review of the latest test article results

  14. Linear pneumatic actuator

    Directory of Open Access Journals (Sweden)

    Avram Mihai


    Full Text Available The paper presents a linear pneumatic actuator with short working stroke. It consists of a pneumatic motor (a simple stroke cylinder or a membrane chamber, two 2/2 pneumatic distributors “all or nothing” electrically commanded for controlling the intake/outtake flow to/from the active chamber of the motor, a position transducer and a microcontroller. There is also presented the theoretical analysis (mathematical modelling and numerical simulation accomplished.

  15. Linear pneumatic actuator


    Avram Mihai; Niţu Constantin; Bucşan Constantin; Grămescu Bogdan


    The paper presents a linear pneumatic actuator with short working stroke. It consists of a pneumatic motor (a simple stroke cylinder or a membrane chamber), two 2/2 pneumatic distributors “all or nothing” electrically commanded for controlling the intake/outtake flow to/from the active chamber of the motor, a position transducer and a microcontroller. There is also presented the theoretical analysis (mathematical modelling and numerical simulation) accomplished.

  16. Linear MHD equilibria

    International Nuclear Information System (INIS)

    Scheffel, J.


    The linear Grad-Shafranov equation for a toroidal, axisymmetric plasma is solved analytically. Exact solutions are given in terms of confluent hyper-geometric functions. As an alternative, simple and accurate WKBJ solutions are presented. With parabolic pressure profiles, both hollow and peaked toroidal current density profiles are obtained. As an example the equilibrium of a z-pinch with a square-shaped cross section is derived.(author)

  17. Linear induction accelerator (United States)

    Buttram, M.T.; Ginn, J.W.


    A linear induction accelerator includes a plurality of adder cavities arranged in a series and provided in a structure which is evacuated so that a vacuum inductance is provided between each adder cavity and the structure. An energy storage system for the adder cavities includes a pulsed current source and a respective plurality of bipolar converting networks connected thereto. The bipolar high-voltage, high-repetition-rate square pulse train sets and resets the cavities. 4 figs.

  18. Linear algebraic groups

    CERN Document Server

    Springer, T A


    "[The first] ten chapters...are an efficient, accessible, and self-contained introduction to affine algebraic groups over an algebraically closed field. The author includes exercises and the book is certainly usable by graduate students as a text or for self-study...the author [has a] student-friendly style… [The following] seven chapters... would also be a good introduction to rationality issues for algebraic groups. A number of results from the literature…appear for the first time in a text." –Mathematical Reviews (Review of the Second Edition) "This book is a completely new version of the first edition. The aim of the old book was to present the theory of linear algebraic groups over an algebraically closed field. Reading that book, many people entered the research field of linear algebraic groups. The present book has a wider scope. Its aim is to treat the theory of linear algebraic groups over arbitrary fields. Again, the author keeps the treatment of prerequisites self-contained. The material of t...

  19. Parametric Linear Dynamic Logic

    Directory of Open Access Journals (Sweden)

    Peter Faymonville


    Full Text Available We introduce Parametric Linear Dynamic Logic (PLDL, which extends Linear Dynamic Logic (LDL by temporal operators equipped with parameters that bound their scope. LDL was proposed as an extension of Linear Temporal Logic (LTL that is able to express all ω-regular specifications while still maintaining many of LTL's desirable properties like an intuitive syntax and a translation into non-deterministic Büchi automata of exponential size. But LDL lacks capabilities to express timing constraints. By adding parameterized operators to LDL, we obtain a logic that is able to express all ω-regular properties and that subsumes parameterized extensions of LTL like Parametric LTL and PROMPT-LTL. Our main technical contribution is a translation of PLDL formulas into non-deterministic Büchi word automata of exponential size via alternating automata. This yields a PSPACE model checking algorithm and a realizability algorithm with doubly-exponential running time. Furthermore, we give tight upper and lower bounds on optimal parameter values for both problems. These results show that PLDL model checking and realizability are not harder than LTL model checking and realizability.

  20. Quantum linear Boltzmann equation

    International Nuclear Information System (INIS)

    Vacchini, Bassano; Hornberger, Klaus


    We review the quantum version of the linear Boltzmann equation, which describes in a non-perturbative fashion, by means of scattering theory, how the quantum motion of a single test particle is affected by collisions with an ideal background gas. A heuristic derivation of this Lindblad master equation is presented, based on the requirement of translation-covariance and on the relation to the classical linear Boltzmann equation. After analyzing its general symmetry properties and the associated relaxation dynamics, we discuss a quantum Monte Carlo method for its numerical solution. We then review important limiting forms of the quantum linear Boltzmann equation, such as the case of quantum Brownian motion and pure collisional decoherence, as well as the application to matter wave optics. Finally, we point to the incorporation of quantum degeneracies and self-interactions in the gas by relating the equation to the dynamic structure factor of the ambient medium, and we provide an extension of the equation to include internal degrees of freedom.

  1. The Stanford Linear Collider

    International Nuclear Information System (INIS)

    Emma, P.


    The Stanford Linear Collider (SLC) is the first and only high-energy e + e - linear collider in the world. Its most remarkable features are high intensity, submicron sized, polarized (e - ) beams at a single interaction point. The main challenges posed by these unique characteristics include machine-wide emittance preservation, consistent high intensity operation, polarized electron production and transport, and the achievement of a high degree of beam stability on all time scales. In addition to serving as an important machine for the study of Z 0 boson production and decay using polarized beams, the SLC is also an indispensable source of hands-on experience for future linear colliders. Each new year of operation has been highlighted with a marked improvement in performance. The most significant improvements for the 1994-95 run include new low impedance vacuum chambers for the damping rings, an upgrade to the optics and diagnostics of the final focus systems, and a higher degree of polarization from the electron source. As a result, the average luminosity has nearly doubled over the previous year with peaks approaching 10 30 cm -2 s -1 and an 80% electron polarization at the interaction point. These developments as well as the remaining identifiable performance limitations will be discussed

  2. The Molecule Cloud - compact visualization of large collections of molecules

    Directory of Open Access Journals (Sweden)

    Ertl Peter


    Full Text Available Abstract Background Analysis and visualization of large collections of molecules is one of the most frequent challenges cheminformatics experts in pharmaceutical industry are facing. Various sophisticated methods are available to perform this task, including clustering, dimensionality reduction or scaffold frequency analysis. In any case, however, viewing and analyzing large tables with molecular structures is necessary. We present a new visualization technique, providing basic information about the composition of molecular data sets at a single glance. Summary A method is presented here allowing visual representation of the most common structural features of chemical databases in a form of a cloud diagram. The frequency of molecules containing particular substructure is indicated by the size of respective structural image. The method is useful to quickly perceive the most prominent structural features present in the data set. This approach was inspired by popular word cloud diagrams that are used to visualize textual information in a compact form. Therefore we call this approach “Molecule Cloud”. The method also supports visualization of additional information, for example biological activity of molecules containing this scaffold or the protein target class typical for particular scaffolds, by color coding. Detailed description of the algorithm is provided, allowing easy implementation of the method by any cheminformatics toolkit. The layout algorithm is available as open source Java code. Conclusions Visualization of large molecular data sets using the Molecule Cloud approach allows scientists to get information about the composition of molecular databases and their most frequent structural features easily. The method may be used in the areas where analysis of large molecular collections is needed, for example processing of high throughput screening results, virtual screening or compound purchasing. Several example visualizations of large

  3. Molecule-by-Molecule Writing Using a Focused Electron Beam

    DEFF Research Database (Denmark)

    Van Dorp, Willem F.; Zhang, Xiaoyan; Feringa, Ben L.


    atoms also be written with an electron beam? We verify this with focused electron-beam-induced deposition (FEBID), a direct-write technique that has the current record for the smallest feature written by (electron) optical lithography. We show that the deposition of an organometallic precursor...... on graphene can be followed molecule-by-molecule with FEBID. The results show that mechanisms that are inherent to the process inhibit a further increase in control over the process. Hence, our results present the resolution limit of (electron) optical lithography techniques. The writing of isolated...

  4. Physics of Complex Polymeric Molecules (United States)

    Kelly, Joshua Walter

    The statistical physics of complex polymers with branches and circuits is the topic of this dissertation. An important motivation are large, single-stranded (ss) RNA molecules. Such molecules form complex ``secondary" and ``tertiary" structures that can be represented as branched polymers with circuits. Such structures are in part directly determined by the nucleotide sequence and in part subject to thermal fluctuations. The polymer physics literature on molecules in this class has mostly focused on randomly branched polymers without circuits while there has been minimal research on polymers with specific structures and on polymers that contain circuits. The dissertation is composed of three parts: Part I studies branched polymers with thermally fluctuating structure confined to a potential well as a simple model for the encapsidation of viral RNA. Excluded volume interactions were ignored. In Part II, I apply Flory theory to the study of the encapsidation of viral ss RNA molecules with specific branched structures, but without circuits, in the presence of excluded volume interaction. In Part III, I expand on Part II and consider complex polymers with specific structure including both branching and circuits. I introduce a method based on the mathematics of Laplacian matrices that allows me to calculate density profiles for such molecules, which was not possible within Flory theory.

  5. Quantum transport through organic molecules

    International Nuclear Information System (INIS)

    Maiti, Santanu K.


    We investigate the electronic transport for the model of benzene-1, 4-dithiolate (BDT) molecule and some other geometric models of benzene molecule attached with two semi-infinite metallic electrodes by the use of Green's function technique. An analytic approach for the electronic transport through the molecular bridges is presented, based on the tight-binding model. Transport of electrons in such molecular bridges is strongly affected by the geometry of the molecules and their coupling strength with the electrodes. Conductance (g) shows resonance peaks associated with the molecular energy eigenstates. In the weak molecule-to-electrodes coupling limit current (I) passing through the molecules shows staircase-like behavior with sharp steps, while, it varies quite continuously in the limit of strong molecular coupling with the applied bias voltage (V). In presence of the transverse magnetic field conductance gives oscillatory behavior with flux φ, threaded by the molecular ring, showing φ 0 ( = ch/e) flux-quantum periodicity. Though conductance changes with the application of transverse magnetic field, but the current-voltage characteristics remain same in presence of this magnetic field for these molecular bridge systems

  6. Dissociation and decay of ultracold sodium molecules

    International Nuclear Information System (INIS)

    Mukaiyama, T.; Abo-Shaeer, J.R.; Xu, K.; Chin, J.K.; Ketterle, W.


    The dissociation of ultracold molecules was studied by ramping an external magnetic field through a Feshbach resonance. The observed dissociation energies directly yielded the strength of the atom-molecule coupling. They showed nonlinear dependence on the ramp speed. This was explained by a Wigner threshold law which predicts that the decay rate of the molecules above threshold increases with the density of states. In addition, inelastic molecule-molecule and molecule-atom collisions were characterized

  7. Multiple ionization dynamics of molecules in intense laser fields

    International Nuclear Information System (INIS)

    Ichimura, Atsushi; Ohyama-Yamaguchi, Tomoko


    A classical field-ionization model is developed for sequential multiple ionization of diatomic and linear triatomic molecules exposed to intense (∼ 10 15 W/cm 2 ) laser fields. The distance R ion of Coulomb explosion is calculated for a combination of fragment charges, by considering nonadiabatic excitation followed by field ionization associated with the inner and outer saddle points. For diatomic molecules (N 2 , NO, and I 2 ), the model explains behaviors observed in experiments, as R ion (21→31) ion (21→22) between competing charge-asymmetric and symmetric channels, and even-odd fluctuation along a principal pathway. For a triatomic molecule CO 2 , a comparison of the model with an experiment suggests that charge-symmetric (or nearly symmetric) channels are dominantly populated. (author)

  8. Small molecule fluoride toxicity agonists. (United States)

    Nelson, James W; Plummer, Mark S; Blount, Kenneth F; Ames, Tyler D; Breaker, Ronald R


    Fluoride is a ubiquitous anion that inhibits a wide variety of metabolic processes. Here, we report the identification of a series of compounds that enhance fluoride toxicity in Escherichia coli and Streptococcus mutans. These molecules were isolated by using a high-throughput screen (HTS) for compounds that increase intracellular fluoride levels as determined via a fluoride riboswitch reporter fusion construct. A series of derivatives were synthesized to examine structure-activity relationships, leading to the identification of compounds with improved activity. Thus, we demonstrate that small molecule fluoride toxicity agonists can be identified by HTS from existing chemical libraries by exploiting a natural fluoride riboswitch. In addition, our findings suggest that some molecules might be further optimized to function as binary antibacterial agents when combined with fluoride. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Double photoionisation spectra of molecules

    CERN Document Server

    Eland, John


    This book contains spectra of the doubly charged positive ions (dications) of some 75 molecules, including the major constituents of terrestrial and planetary atmospheres and prototypes of major chemical groups. It is intended to be a new resource for research in all areas of molecular spectroscopy involving high energy environments, both terrestrial and extra-terrestrial. All the spectra have been produced by photoionisation using laboratory lamps or synchrotron radiation and have been measured using the magnetic bottle time-of-flight technique by coincidence detection of correlated electron pairs. Full references to published work on the same species are given, though for several molecules these are the first published spectra. Double ionisation energies are listed and discussed in relation to the molecular electronic structure of the molecules. A full introduction to the field of molecular double ionisation is included and the mechanisms by which double photoionisation can occur are examined in detail. A p...

  10. Photon-assisted tunneling in a Fe-8 single-molecule magnet


    Sorace, L.; Wernsdorfer, W.; Thirion, C.; Barra, A. L.; Pacchioni, M.; Mailly, D.; Barbara, B.


    The low temperature spin dynamics of a Fe8 Single-Molecule Magnet was studied under circularly polarized electromagnetic radiation allowing us to establish clearly photon-assisted tunneling. This effect, while linear at low power, becomes highly non-linear above a relatively low power threshold. This non-linearity is attributed to the nature of the coupling of the sample to the thermostat.These results are of great importance if such systems are to be used as quantum computers.

  11. The dipole moments of the linear polycarbon monosulfides

    International Nuclear Information System (INIS)

    Murakami, Akinori


    The dipole moments of the linear polycarbon monosulfides, CS, C 2 S and C 3 S molecule (radical)s were calculated by ab initio SCF-CI method. The equilibrium geometries of the C n S molecules were obtained by MP3 method using the 6-31G** basis set. From the split balencetype (MIDI-4) to the Huzinaga's well tempered extended type(WT) were used to evaluate dipole moments. Final results were obtained using the WT+2d basis set and CI calculation. The calculated dipole moment of the CS molecule, 1.96 debye, is in good agreement with experimental one. The dipole moment of the C 2 S radical is calculated to be 2.81 debye and 3.66 debye for C 3 S molecule. The calculated dipole moments of the C n S will be accurate with in 0.1 debye(5%)

  12. Nonlinear vs. linear biasing in Trp-cage folding simulations

    Energy Technology Data Exchange (ETDEWEB)

    Spiwok, Vojtěch, E-mail:; Oborský, Pavel; Králová, Blanka [Department of Biochemistry and Microbiology, University of Chemistry and Technology, Prague, Technická 3, Prague 6 166 28 (Czech Republic); Pazúriková, Jana [Institute of Computer Science, Masaryk University, Botanická 554/68a, 602 00 Brno (Czech Republic); Křenek, Aleš [Institute of Computer Science, Masaryk University, Botanická 554/68a, 602 00 Brno (Czech Republic); Center CERIT-SC, Masaryk Univerzity, Šumavská 416/15, 602 00 Brno (Czech Republic)


    Biased simulations have great potential for the study of slow processes, including protein folding. Atomic motions in molecules are nonlinear, which suggests that simulations with enhanced sampling of collective motions traced by nonlinear dimensionality reduction methods may perform better than linear ones. In this study, we compare an unbiased folding simulation of the Trp-cage miniprotein with metadynamics simulations using both linear (principle component analysis) and nonlinear (Isomap) low dimensional embeddings as collective variables. Folding of the mini-protein was successfully simulated in 200 ns simulation with linear biasing and non-linear motion biasing. The folded state was correctly predicted as the free energy minimum in both simulations. We found that the advantage of linear motion biasing is that it can sample a larger conformational space, whereas the advantage of nonlinear motion biasing lies in slightly better resolution of the resulting free energy surface. In terms of sampling efficiency, both methods are comparable.

  13. Technetium-aspirin molecule complexes

    International Nuclear Information System (INIS)

    El-Shahawy, A.S.; Mahfouz, R.M.; Aly, A.A.M.; El-Zohry, M.


    Technetium-aspirin and technetium-aspirin-like molecule complexes were prepared. The structure of N-acetylanthranilic acid (NAA) has been decided through CNDO calculations. The ionization potential and electron affinity of the NAA molecule as well as the charge densities were calculated. The electronic absorption spectra of Tc(V)-Asp and Tc(V)-ATS complexes have two characteristic absorption bands at 450 and 600 nm, but the Tc(V)-NAA spectrum has one characteristic band at 450 nm. As a comparative study, Mo-ATS complex was prepared and its electronic absorption spectrum is comparable with the Tc-ATS complex spectrum. (author)

  14. Teaching lasers to control molecules

    International Nuclear Information System (INIS)

    Judson, R.S.; Rabitz, H.


    We simulate a method to teach a laser pulse sequences to excite specified molecular states. We use a learning procedure to direct the production of pulses based on ''fitness'' information provided by a laboratory measurement device. Over a series of pulses the algorithm learns an optimal sequence. The experimental apparatus, which consists of a laser, a sample of molecules and a measurement device, acts as an analog computer that solves Schroedinger's equation n/Iexactly, in real time. We simulate an apparatus that learns to excite specified rotational states in a diatomic molecule

  15. Non linear microtearing modes

    International Nuclear Information System (INIS)

    Garbet, X.; Mourgues, F.; Samain, A.


    Among the various instabilities which could explain the anomalous electron heat transport observed in tokamaks during additional heating, a microtearing turbulence is a reasonable candidate since it affects directly the magnetic topology. This turbulence may be described in a proper frame rotating around the majors axis by a static potential vector. In strong non linear regimes, the flow of electrons along the stochastic field lines induces a current. The point is to know whether this current can sustain the turbulence. The mechanisms of this self-consistency, involving the combined effects of the thermal diamagnetism and of the electric drift are presented here

  16. RF linear accelerators

    CERN Document Server

    Wangler, Thomas P


    Thomas P. Wangler received his B.S. degree in physics from Michigan State University, and his Ph.D. degree in physics and astronomy from the University of Wisconsin. After postdoctoral appointments at the University of Wisconsin and Brookhaven National Laboratory, he joined the staff of Argonne National Laboratory in 1966, working in the fields of experimental high-energy physics and accelerator physics. He joined the Accelerator Technology Division at Los Alamos National Laboratory in 1979, where he specialized in high-current beam physics and linear accelerator design and technology. In 2007

  17. SLAC linear collider

    International Nuclear Information System (INIS)

    Richter, B.; Bell, R.A.; Brown, K.L.


    The SLAC LINEAR COLLIDER is designed to achieve an energy of 100 GeV in the electron-positron center-of-mass system by accelerating intense bunches of particles in the SLAC linac and transporting the electron and positron bunches in a special magnet system to a point where they are focused to a radius of about 2 microns and made to collide head on. The rationale for this new type of colliding beam system is discussed, the project is described, some of the novel accelerator physics issues involved are discussed, and some of the critical technical components are described

  18. Matlab linear algebra

    CERN Document Server

    Lopez, Cesar


    MATLAB is a high-level language and environment for numerical computation, visualization, and programming. Using MATLAB, you can analyze data, develop algorithms, and create models and applications. The language, tools, and built-in math functions enable you to explore multiple approaches and reach a solution faster than with spreadsheets or traditional programming languages, such as C/C++ or Java. MATLAB Linear Algebra introduces you to the MATLAB language with practical hands-on instructions and results, allowing you to quickly achieve your goals. In addition to giving an introduction to

  19. Exotic helium molecules; Molecules exotiques d'helium

    Energy Technology Data Exchange (ETDEWEB)

    Portier, M


    We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}P{sub 0}) molecule, or a {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 {+-} 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime {tau} = (1.4 {+-} 0.3) {mu}s is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)

  20. Exotic helium molecules; Molecules exotiques d'helium

    Energy Technology Data Exchange (ETDEWEB)

    Portier, M


    We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}P{sub 0}) molecule, or a {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 {+-} 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime {tau} = (1.4 {+-} 0.3) {mu}s is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)

  1. Special set linear algebra and special set fuzzy linear algebra


    Kandasamy, W. B. Vasantha; Smarandache, Florentin; Ilanthenral, K.


    The authors in this book introduce the notion of special set linear algebra and special set fuzzy Linear algebra, which is an extension of the notion set linear algebra and set fuzzy linear algebra. These concepts are best suited in the application of multi expert models and cryptology. This book has five chapters. In chapter one the basic concepts about set linear algebra is given in order to make this book a self contained one. The notion of special set linear algebra and their fuzzy analog...

  2. Electrodynamic linear motor

    Energy Technology Data Exchange (ETDEWEB)

    Munehiro, H


    When driving the carriage of a printer through a rotating motor, there are problems regarding the limited accuracy of the carriage position due to rotation or contraction and ageing of the cable. In order to solve the problem, a direct drive system was proposed, in which the printer carriage is driven by a linear motor. If one wants to keep the motor circuit of such a motor compact, then the magnetic flux density in the air gap must be reduced or the motor travel must be reduced. It is the purpose of this invention to create an electrodynamic linear motor, which on the one hand is compact and light and on the other hand has a relatively high constant force over a large travel. The invention is characterised by the fact that magnetic fields of alternating polarity are generated at equal intervals in the magnetic field, and that the coil arrangement has 2 adjacent coils, whose size corresponds to half the length of each magnetic pole. A logic circuit is provided to select one of the two coils and to determine the direction of the current depending on the signals of a magnetic field sensor on the coil arrangement.

  3. Linear wind generator

    International Nuclear Information System (INIS)

    Kozarov, A.; Petrov, O.; Antonov, J.; Sotirova, S.; Petrova, B.


    The purpose of the linear wind-power generator described in this article is to decrease the following disadvantages of the common wind-powered turbine: 1) large bending and twisting moments to the blades and the shaft, especially when strong winds and turbulence exist; 2) significant values of the natural oscillation period of the construction result in the possibility of occurrence of destroying resonance oscillations; 3) high velocity of the peripheral parts of the rotor creating a danger for birds; 4) difficulties, connected with the installation and the operation on the mountain ridges and passages where the wind energy potential is the largest. The working surfaces of the generator in questions driven by the wind are not connected with a joint shaft but each moves along a railway track with few oscillations. So the sizes of each component are small and their number can be rather large. The mechanical trajectory is not a circle but a closed outline in a vertical plain, which consists of two rectilinear sectors, one above the other, connected in their ends by semi-circumferences. The mechanical energy of each component turns into electrical on the principle of the linear electrical generator. A regulation is provided when the direction of the wind is perpendicular to the route. A possibility of effectiveness is shown through aiming of additional quantities of air to the movable components by static barriers

  4. Nucleic Acids as Information Molecules. (United States)

    McInerney, Joseph D.


    Presents an activity that aims at enabling students to recognize that DNA and RNA are information molecules whose function is to store, copy, and make available the information in biological systems, without feeling overwhelmed by the specialized vocabulary and the minutia of the central dogma. (JRH)

  5. Small Molecule PET-Radiopharmaceuticals

    NARCIS (Netherlands)

    Elsinga, Philip H.; Dierckx, Rudi A. J. O.

    This review describes several aspects required for the development of small molecule PET-tracers. Design and selection criteria are important to consider before starting to develop novel PET-tracers. Principles and latest trends in C-11 and F-18-radiochemistry are summarized. In addition an update

  6. Hybrid molecule/superconductor assemblies

    International Nuclear Information System (INIS)

    McDevitt, J.T.; Haupt, S.G.; Riley, D.R.; Zhao, J.; Zhou, J.P., Jones, C.


    The fabrication of electronic devices from molecular materials has attracted much attention recently. Schottky diodes, molecular transistors, metal-insulator-semiconductor diodes, MIS field effect transistors and light emitting diodes have all been prepared utilizing such substances. The active elements in these devices have been constructed by depositing the molecular phase onto the surface of a metal, semiconductor or insulating substrate. With the recent discovery of high temperature superconductivity, new opportunities now exist for the study of molecule/superconductor interactions as well as for the construction of novel hybrid molecule/superconductor devices. In this paper, methods for preparing the initial two composite molecule/semiconductor devices will be reported. Consequently, light sensors based on dye-coated superconductor junctions as well as molecular switches fashioned from conductive polymer coated superconductor junctions as well as molecular switches fashioned from conductive polymer coated superconductor microbridges will be discussed. Moreover, molecule/superconductor energy and electron transfer phenomena will be illustrated also for the first time

  7. Mass spectrometry of large molecules

    International Nuclear Information System (INIS)

    Facchetti, S.


    The lectures in this volume were given at a course on mass spectrometry of large molecules, organized within the framework of the Training and Education programme of the Joint Research Centre of the European Communities. Although first presented in 1983, most of the lectures have since been updated by their authors. (orig.)


    African Journals Online (AJOL)


    University of the Witwatersrand, Johannesburg, South Africa ... [African Journal of Chemical Education—AJCE 6(2), July 2016] ... understand science concepts: in essence these are macroscopic (phenomena), microscopic .... than the simple freeing up of already-existing smaller molecules: this implies a high melting point.

  9. Fascinating Organic Molecules from Nature

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 18; Issue 5. Fascinating Organic Molecules from Nature - Using a Natural ... Road Banashankari 2nd Stage Bangalore 560 070, India. Department of Chemistry Sri Sathya Sai Institute of Higher Learning Brindavan Campus Bangalore 560 067, India.

  10. Fascinating Organic Molecules from Nature

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 18; Issue 7. Fascinating Organic Molecules from Nature - Sweet Stimulants of ... Road Banashankari 2nd Stage Bangalore 560 070, India. Department of Chemistry Sri Sathya Sai Institute of Higher Learning Brindavan Campus Bangalore 560 067, India.

  11. Multiphoton dissociation of polyatomic molecules

    International Nuclear Information System (INIS)

    Schulz, P.A.


    The dynamics of infrared multiphoton excitation and dissociation of SF 6 was investigated under collision free conditions by a crossed laser-molecular beam method. In order to understand the excitation mechanism and to elucidate the requirements of laser intensity and energy fluence, a series of experiments were carried out to measure the dissociation yield dependences on energy fluence, vibrational temperature of SF 6 , the pulse duration of the CO 2 laser and the frequency in both one and two laser experiments. Translational energy distributions of the SF 5 dissociation product measured by time of flight and angular distributions and the dissociation lifetime of excited SF 6 as inferred from the observation of secondary dissociation of SF 5 into SF 4 and F during the laser pulse suggest that the dynamics of dissociation of excited molecules is dominated by complete energy randomization and rapid intramolecular energy transfer on a nanosecond timescale, and can be adequately described by RRKM theory. An improved phenomenological model including the initial intensity dependent excitation, a rate equation describing the absorption and stimulated emission of single photons, and the unimolecular dissociation of excited molecules is constructed based on available experimental results. The model shows that the energy fluence of the laser determines the excitation of molecules in the quasi-continuum and the excess energy with which molecules dissociate after the laser pulse. The role played by the laser intensity in multiphoton dissociation is more significant than just that of overcoming the intensity dependent absorption in the lowest levels. 63 references

  12. Linearization of the Lorenz system

    International Nuclear Information System (INIS)

    Li, Chunbiao; Sprott, Julien Clinton; Thio, Wesley


    A partial and complete piecewise linearized version of the Lorenz system is proposed. The linearized versions have an independent total amplitude control parameter. Additional further linearization leads naturally to a piecewise linear version of the diffusionless Lorenz system. A chaotic circuit with a single amplitude controller is then implemented using a new switch element, producing a chaotic oscillation that agrees with the numerical calculation for the piecewise linear diffusionless Lorenz system. - Highlights: • A partial and complete piecewise linearized version of the Lorenz system are addressed. • The linearized versions have an independent total amplitude control parameter. • A piecewise linear version of the diffusionless Lorenz system is derived by further linearization. • A corresponding chaotic circuit without any multiplier is implemented for the chaotic oscillation

  13. Topics in computational linear optimization

    DEFF Research Database (Denmark)

    Hultberg, Tim Helge


    Linear optimization has been an active area of research ever since the pioneering work of G. Dantzig more than 50 years ago. This research has produced a long sequence of practical as well as theoretical improvements of the solution techniques avilable for solving linear optimization problems...... of high quality solvers and the use of algebraic modelling systems to handle the communication between the modeller and the solver. This dissertation features four topics in computational linear optimization: A) automatic reformulation of mixed 0/1 linear programs, B) direct solution of sparse unsymmetric...... systems of linear equations, C) reduction of linear programs and D) integration of algebraic modelling of linear optimization problems in C++. Each of these topics is treated in a separate paper included in this dissertation. The efficiency of solving mixed 0-1 linear programs by linear programming based...

  14. Linearization of the Lorenz system

    Energy Technology Data Exchange (ETDEWEB)

    Li, Chunbiao, E-mail: [School of Electronic & Information Engineering, Nanjing University of Information Science & Technology, Nanjing 210044 (China); Engineering Technology Research and Development Center of Jiangsu Circulation Modernization Sensor Network, Jiangsu Institute of Commerce, Nanjing 211168 (China); Sprott, Julien Clinton [Department of Physics, University of Wisconsin–Madison, Madison, WI 53706 (United States); Thio, Wesley [Department of Electrical and Computer Engineering, The Ohio State University, Columbus, OH 43210 (United States)


    A partial and complete piecewise linearized version of the Lorenz system is proposed. The linearized versions have an independent total amplitude control parameter. Additional further linearization leads naturally to a piecewise linear version of the diffusionless Lorenz system. A chaotic circuit with a single amplitude controller is then implemented using a new switch element, producing a chaotic oscillation that agrees with the numerical calculation for the piecewise linear diffusionless Lorenz system. - Highlights: • A partial and complete piecewise linearized version of the Lorenz system are addressed. • The linearized versions have an independent total amplitude control parameter. • A piecewise linear version of the diffusionless Lorenz system is derived by further linearization. • A corresponding chaotic circuit without any multiplier is implemented for the chaotic oscillation.

  15. On the linear programming bound for linear Lee codes. (United States)

    Astola, Helena; Tabus, Ioan


    Based on an invariance-type property of the Lee-compositions of a linear Lee code, additional equality constraints can be introduced to the linear programming problem of linear Lee codes. In this paper, we formulate this property in terms of an action of the multiplicative group of the field [Formula: see text] on the set of Lee-compositions. We show some useful properties of certain sums of Lee-numbers, which are the eigenvalues of the Lee association scheme, appearing in the linear programming problem of linear Lee codes. Using the additional equality constraints, we formulate the linear programming problem of linear Lee codes in a very compact form, leading to a fast execution, which allows to efficiently compute the bounds for large parameter values of the linear codes.

  16. Isotope separation using vibrationally excited molecules

    International Nuclear Information System (INIS)

    Woodroffe, J.A.; Keck, J.C.


    Vibrational excitation of molecules having components of a selected isotope type is used to produce a conversion from vibrational to translational excitation of the molecules by collision with the molecules of a heavy carrier gas. The resulting difference in translaton between the molecules of the selected isotope type and all other molecules of the same compound permits their separate collection. When applied to uranium enrichment, a subsonic cryogenic flow of molecules of uranium hexafluoride in combination with an argon carrier gas is directed through a cooled chamber that is illuminated by laser radiaton tuned to vibrationally excite the uranium hexafluoride molecules of a specific uranium isotope. The excited molecules collide with carrier gas molecules, causing a conversion of the excitation energy into a translation of the excited molecule, which results in a higher thermal energy or diffusivity than that of the other uranium hexafluoride molecules. The flowing molecules including the excited molecules directly enter a set of cryogenically cooled channels. The higher thermal velocity of the excited molecules increases the probability of their striking a collector surface. The molecules which strike this surface immediately condense. After a predetermined thickness of molecules is collected on the surface, the flow of uranium hexafluoride is interrupted and the chamber heated to the point of vaporization of the collected hexafluoride, permitting its removal. (LL)

  17. Retrieval of interatomic separations of molecules from laser-induced high-order harmonic spectra

    International Nuclear Information System (INIS)

    Le, Van-Hoang; Nguyen, Ngoc-Ty; Jin, C; Le, Anh-Thu; Lin, C D


    We illustrate an iterative method for retrieving the internuclear separations of N 2 , O 2 and CO 2 molecules using the high-order harmonics generated from these molecules by intense infrared laser pulses. We show that accurate results can be retrieved with a small set of harmonics and with one or few alignment angles of the molecules. For linear molecules the internuclear separations can also be retrieved from harmonics generated using isotropically distributed molecules. By extracting the transition dipole moment from the high-order harmonic spectra, we further demonstrated that it is preferable to retrieve the interatomic separation iteratively by fitting the extracted dipole moment. Our results show that time-resolved chemical imaging of molecules using infrared laser pulses with femtosecond temporal resolutions is possible

  18. Retrieval of interatomic separations of molecules from laser-induced high-order harmonic spectra

    Energy Technology Data Exchange (ETDEWEB)

    Le, Van-Hoang; Nguyen, Ngoc-Ty [Department of Physics, University of Pedagogy, 280 An Duong Vuong, Ward 5, Ho Chi Minh City (Viet Nam); Jin, C; Le, Anh-Thu; Lin, C D [J. R. Macdonald Laboratory, Department of Physics, Kansas State University, Manhattan, KS 66506 (United States)


    We illustrate an iterative method for retrieving the internuclear separations of N{sub 2}, O{sub 2} and CO{sub 2} molecules using the high-order harmonics generated from these molecules by intense infrared laser pulses. We show that accurate results can be retrieved with a small set of harmonics and with one or few alignment angles of the molecules. For linear molecules the internuclear separations can also be retrieved from harmonics generated using isotropically distributed molecules. By extracting the transition dipole moment from the high-order harmonic spectra, we further demonstrated that it is preferable to retrieve the interatomic separation iteratively by fitting the extracted dipole moment. Our results show that time-resolved chemical imaging of molecules using infrared laser pulses with femtosecond temporal resolutions is possible.

  19. Introduction to linear elasticity

    CERN Document Server

    Gould, Phillip L


    Introduction to Linear Elasticity, 3rd Edition, provides an applications-oriented grounding in the tensor-based theory of elasticity for students in mechanical, civil, aeronautical, and biomedical engineering, as well as materials and earth science. The book is distinct from the traditional text aimed at graduate students in solid mechanics by introducing the subject at a level appropriate for advanced undergraduate and beginning graduate students. The author's presentation allows students to apply the basic notions of stress analysis and move on to advanced work in continuum mechanics, plasticity, plate and shell theory, composite materials, viscoelasticity and finite method analysis. This book also:  Emphasizes tensor-based approach while still distilling down to explicit notation Provides introduction to theory of plates, theory of shells, wave propagation, viscoelasticity and plasticity accessible to advanced undergraduate students Appropriate for courses following emerging trend of teaching solid mechan...

  20. Linear step drive

    International Nuclear Information System (INIS)

    Haniger, L.; Elger, R.; Kocandrle, L.; Zdebor, J.


    A linear step drive is described developed in Czechoslovak-Soviet cooperation and intended for driving WWER-1000 control rods. The functional principle is explained of the motor and the mechanical and electrical parts of the drive, power control, and the indicator of position are described. The motor has latches situated in the reactor at a distance of 3 m from magnetic armatures, it has a low structural height above the reactor cover, which suggests its suitability for seismic localities. Its magnetic circuits use counterpoles; the mechanical shocks at the completion of each step are damped using special design features. The position indicator is of a special design and evaluates motor position within ±1% of total travel. A drive diagram and the flow chart of both the control electronics and the position indicator are presented. (author) 4 figs

  1. Linear pulse amplifier

    International Nuclear Information System (INIS)

    Tjutju, R.L.


    Pulse amplifier is standard significant part of spectrometer. Apart from other type of amplification, it's a combination of amplification and pulse shaping. Because of its special purpose the device should fulfill the following : High resolution is desired to gain a high yield comparable to its actual state of condition. High signal to noise is desired to nhν resolution. High linearity to facilitate calibration. A good overload recovery, in order to the device will capable of analizing a low energy radiation which appear joinly on the high energy fields. Other expections of the device are its economical and practical use its extentive application. For that reason it's built on a standard NIM principle. Taking also into account the above mentioned considerations. High quality component parts are used throughout, while its availability in the domestic market is secured. (author)

  2. Linear Accelerator Laboratory

    International Nuclear Information System (INIS)


    This report covers the activity of the Linear Accelerator Laboratory during the period June 1974-June 1976. The activity of the Laboratory is essentially centered on high energy physics. The main activities were: experiments performed with the colliding rings (ACO), construction of the new colliding rings and beginning of the work at higher energy (DCI), bubble chamber experiments with the CERN PS neutrino beam, counter experiments with CERN's PS and setting-up of equipment for new experiments with CERN's SPS. During this period a project has also been prepared for an experiment with the new PETRA colliding ring at Hamburg. On the other hand, intense collaboration with the LURE Laboratory, using the electron synchrotron radiation emitted by ACO and DCI, has been developed [fr


    Van Atta, C.M.; Beringer, R.; Smith, L.


    A linear accelerator of heavy ions is described. The basic contributions of the invention consist of a method and apparatus for obtaining high energy particles of an element with an increased charge-to-mass ratio. The method comprises the steps of ionizing the atoms of an element, accelerating the resultant ions to an energy substantially equal to one Mev per nucleon, stripping orbital electrons from the accelerated ions by passing the ions through a curtain of elemental vapor disposed transversely of the path of the ions to provide a second charge-to-mass ratio, and finally accelerating the resultant stripped ions to a final energy of at least ten Mev per nucleon.

  4. Linear absorptive dielectrics (United States)

    Tip, A.


    Starting from Maxwell's equations for a linear, nonconducting, absorptive, and dispersive medium, characterized by the constitutive equations D(x,t)=ɛ1(x)E(x,t)+∫t-∞dsχ(x,t-s)E(x,s) and H(x,t)=B(x,t), a unitary time evolution and canonical formalism is obtained. Given the complex, coordinate, and frequency-dependent, electric permeability ɛ(x,ω), no further assumptions are made. The procedure leads to a proper definition of band gaps in the periodic case and a new continuity equation for energy flow. An S-matrix formalism for scattering from lossy objects is presented in full detail. A quantized version of the formalism is derived and applied to the generation of Čerenkov and transition radiation as well as atomic decay. The last case suggests a useful generalization of the density of states to the absorptive situation.

  5. Preparation of translationally cold neutral molecules. (United States)

    Di Domenicantonio, Giulia; Bertsche, Benjamin; Osterwalder, Andreas


    Efforts at EPFL to obtain translationally cold neutral molecules are described. Active deceleration of polar molecules is performed by confining the molecules in moving three-dimensional electrostatic traps, and by appropriately choosing the velocity of those traps. Alternatively, cold molecules can be obtained by velocity filtering. Here, the velocity of the molecules is not changed, but instead the cold molecules are extracted from a thermal sample by using the competition between the electrostatic force and the centrifugal force inside a bent electrostatic guide for polar molecules.

  6. Tunnel current across linear homocatenated germanium chains

    International Nuclear Information System (INIS)

    Matsuura, Yukihito


    The electronic transport properties of germanium oligomers catenating into linear chains (linear Ge chains) have been theoretically studied using first principle methods. The conduction mechanism of a Ge chain sandwiched between gold electrodes was analyzed based on the density of states and the eigenstates of the molecule in a two-probe environment. Like that of silicon chains (Si chains), the highest occupied molecular orbital of Ge chains contains the extended σ-conjugation of Ge 4p orbitals at energy levels close to the Fermi level; this is in contrast to the electronic properties of linear carbon chains. Furthermore, the conductance of a Ge chain is expected to decrease exponentially with molecular length L. The decay constant β, which is defined as e −βL , of a Ge chain is similar to that of a Si chain, whereas the conductance of the Ge chains is higher than that of Si chains even though the Ge–Ge bond length is longer than the Si–Si bond length

  7. Computer Program For Linear Algebra (United States)

    Krogh, F. T.; Hanson, R. J.


    Collection of routines provided for basic vector operations. Basic Linear Algebra Subprogram (BLAS) library is collection from FORTRAN-callable routines for employing standard techniques to perform basic operations of numerical linear algebra.

  8. Quaternion Linear Canonical Transform Application


    Bahri, Mawardi


    Quaternion linear canonical transform (QLCT) is a generalization of the classical linear canonical transfom (LCT) using quaternion algebra. The focus of this paper is to introduce an application of the QLCT to study of generalized swept-frequency filter

  9. Recursive Algorithm For Linear Regression (United States)

    Varanasi, S. V.


    Order of model determined easily. Linear-regression algorithhm includes recursive equations for coefficients of model of increased order. Algorithm eliminates duplicative calculations, facilitates search for minimum order of linear-regression model fitting set of data satisfactory.

  10. Dynamical systems and linear algebra


    Colonius, Fritz (Prof.)


    Dynamical systems and linear algebra / F. Colonius, W. Kliemann. - In: Handbook of linear algebra / ed. by Leslie Hogben. - Boca Raton : Chapman & Hall/CRC, 2007. - S. 56,1-56,22. - (Discrete mathematics and its applications)

  11. Linear spaces: history and theory


    Albrecht Beutelspracher


    Linear spaces belong to the most fundamental geometric and combinatorial structures. In this paper I would like to give an onerview about the theory of embedding finite linear spaces in finite projective planes.

  12. Linear versus non-linear supersymmetry, in general

    Energy Technology Data Exchange (ETDEWEB)

    Ferrara, Sergio [Theoretical Physics Department, CERN,CH-1211 Geneva 23 (Switzerland); INFN - Laboratori Nazionali di Frascati,Via Enrico Fermi 40, I-00044 Frascati (Italy); Department of Physics and Astronomy, UniversityC.L.A.,Los Angeles, CA 90095-1547 (United States); Kallosh, Renata [SITP and Department of Physics, Stanford University,Stanford, California 94305 (United States); Proeyen, Antoine Van [Institute for Theoretical Physics, Katholieke Universiteit Leuven,Celestijnenlaan 200D, B-3001 Leuven (Belgium); Wrase, Timm [Institute for Theoretical Physics, Technische Universität Wien,Wiedner Hauptstr. 8-10, A-1040 Vienna (Austria)


    We study superconformal and supergravity models with constrained superfields. The underlying version of such models with all unconstrained superfields and linearly realized supersymmetry is presented here, in addition to the physical multiplets there are Lagrange multiplier (LM) superfields. Once the equations of motion for the LM superfields are solved, some of the physical superfields become constrained. The linear supersymmetry of the original models becomes non-linearly realized, its exact form can be deduced from the original linear supersymmetry. Known examples of constrained superfields are shown to require the following LM’s: chiral superfields, linear superfields, general complex superfields, some of them are multiplets with a spin.

  13. Linear versus non-linear supersymmetry, in general

    International Nuclear Information System (INIS)

    Ferrara, Sergio; Kallosh, Renata; Proeyen, Antoine Van; Wrase, Timm


    We study superconformal and supergravity models with constrained superfields. The underlying version of such models with all unconstrained superfields and linearly realized supersymmetry is presented here, in addition to the physical multiplets there are Lagrange multiplier (LM) superfields. Once the equations of motion for the LM superfields are solved, some of the physical superfields become constrained. The linear supersymmetry of the original models becomes non-linearly realized, its exact form can be deduced from the original linear supersymmetry. Known examples of constrained superfields are shown to require the following LM’s: chiral superfields, linear superfields, general complex superfields, some of them are multiplets with a spin.

  14. A primer on linear models

    CERN Document Server

    Monahan, John F


    Preface Examples of the General Linear Model Introduction One-Sample Problem Simple Linear Regression Multiple Regression One-Way ANOVA First Discussion The Two-Way Nested Model Two-Way Crossed Model Analysis of Covariance Autoregression Discussion The Linear Least Squares Problem The Normal Equations The Geometry of Least Squares Reparameterization Gram-Schmidt Orthonormalization Estimability and Least Squares Estimators Assumptions for the Linear Mean Model Confounding, Identifiability, and Estimability Estimability and Least Squares Estimators F

  15. Observing electron motion in molecules

    International Nuclear Information System (INIS)

    Chelkowski, S; Yudin, G L; Bandrauk, A D


    We study analytically the possibility for monitoring electron motion in a molecule using two ultrashort laser pulses. The first prepares a coherent superposition of two electronic molecular states whereas the second (attosecond pulse) photoionizes the molecule. We show that interesting information about electron dynamics can be obtained from measurement of the photoelectron spectra as a function of the time delay between two pulses. In particular, asymmetries in photoelectron angular distribution provide a simple signature of the electron motion within the initial time-dependent coherently coupled two molecular states. Both asymmetries and electron spectra show very strong two-centre interference patterns. We illustrate these effects using as an example a dissociating hydrogen molecular ion probed by the attosecond pulses

  16. Tunneling Ionization of Diatomic Molecules

    DEFF Research Database (Denmark)

    Svensmark, Jens Søren Sieg


    When a molecule is subject to a strong laser field, there is a probability that an electron can escape, even though the electrons are bound by a large potential barrier. This is possible because electrons are quantum mechanical in nature, and they are therefore able to tunnel through potential...... barriers, an ability classical particles do not possess. Tunnelling is a fundamental quantum mechanical process, a process that is distinctly non-classical, so solving this tunnelling problem is not only relevant for molecular physics, but also for quantum theory in general. In this dissertation the theory...... of tunneling ionizaion of molecules is presented and the results of numerical calculations are shown. One perhaps surprising result is, that the frequently used Born-Oppenheimer approximation breaks down for weak fields when describing tunneling ionization. An analytic theory applicable in the weak-field limit...

  17. Physics of atoms and molecules

    International Nuclear Information System (INIS)

    Bransden, B.H.; Joachain, C.J.


    This book presents a unified account of the physics of atoms and molecules at a level suitable for second- and third-year undergraduate students of physics and physical chemistry. Following a brief historical introduction to the subject the authors outline the ideas and approximation methods of quantum mechanics to be used later in the book. Six chapters look at the structure of atoms and the interactions between atoms and electromagnetic radiation. The authors then move on to describe the structure of molecules and molecular spectra. Three chapters deal with atomic collisions, the scattering of electrons by atoms and the scattering of atoms by atoms. The concluding chapter considers a few of the many important applications of atomic physics within astrophysics, laser technology, and nuclear fusion. Problems are given at the end of each chapter, with hints at the solutions in an appendix. Other appendices include various special topics and derivations together with useful tables of units. (author)

  18. Templates for Linear Algebra Problems

    NARCIS (Netherlands)

    Bai, Z.; Day, D.; Demmel, J.; Dongarra, J.; Gu, M.; Ruhe, A.; Vorst, H.A. van der


    The increasing availability of advanced-architecture computers is having a very signicant eect on all spheres of scientic computation, including algorithm research and software development in numerical linear algebra. Linear algebra {in particular, the solution of linear systems of equations and

  19. Linearization of CIF through SOS

    NARCIS (Netherlands)

    Nadales Agut, D.E.; Reniers, M.A.; Luttik, B.; Valencia, F.


    Linearization is the procedure of rewriting a process term into a linear form, which consist only of basic operators of the process language. This procedure is interesting both from a theoretical and a practical point of view. In particular, a linearization algorithm is needed for the Compositional

  20. Linear Logic on Petri Nets

    DEFF Research Database (Denmark)

    Engberg, Uffe Henrik; Winskel, Glynn

    This article shows how individual Petri nets form models of Girard's intuitionistic linear logic. It explores questions of expressiveness and completeness of linear logic with respect to this interpretation. An aim is to use Petri nets to give an understanding of linear logic and give some apprai...

  1. Electrondriven processes in polyatomic molecules

    Energy Technology Data Exchange (ETDEWEB)

    McKoy, Vincent [California Inst. of Technology (CalTech), Pasadena, CA (United States)


    This project developed and applied scalable computational methods to obtain information about low-energy electron collisions with larger polyatomic molecules. Such collisions are important in modeling radiation damage to living systems, in spark ignition and combustion, and in plasma processing of materials. The focus of the project was to develop efficient methods that could be used to obtain both fundamental scientific insights and data of practical value to applications.

  2. Intersystem crossing in complex molecules

    International Nuclear Information System (INIS)

    Pappalardo, R.G.


    The general question of singlet-triplet intersystem crossing is addressed in the context of large organic molecules, i.e., ''complex'' molecules capable of self-relaxation in the absence of collisions. Examples of spectral properties of such molecules in the vapor phase are discussed, relying on extensive Russian literature in this area. Formal expressions for the relaxation rate in the electronic excited states are derived on the basis of the formalism of collision theory, and are applied to the specific case of intersystem crossing. The derivation of the ''energy-gap'' law for triplet-singlet conversion in aromatic hydrocarbons is briefly outlined. The steep rise of internal conversion rates as a function of excess excitation energy, and its competition with the intersystem crossing process, are reviewed for the case of naphthalene vapor. A general expression for the spin-orbit interaction Hamiltonian in molecular systems is outlined. Experimental observations on singlet-triplet conversion rates and the factors that can drastically affect such rates are discussed, with emphasis on the ''in- ternal'' and ''external'' heavy-atom effects. Basic relations of ESR spectroscopy and magnetophotoselection are reviewed. Technological implications of the singlet-triplet crossing in complex molecules are discussed in the context of chelate lasers, dye lasers and luminescent displays. Effects related to singlet-triplet crossing, and generally to excited-state energy-transfer in biological systems, are exemplified by the role of aromatic amino-acids in the phosphorescence of proteins, by some recent studies of energy-transfer in models of biomembranes, and by the clustering of triplet-energy donor-acceptor pairs in micelles

  3. Cellular Adhesion and Adhesion Molecules


    SELLER, Zerrin


    In recent years, cell adhesion and cell adhesion molecules have been shown to be important for many normal biological processes, including embryonic cell migration, immune system functions and wound healing. It has also been shown that they contribute to the pathogenesis of a large number of common human disorders, such as rheumatoid arthritis and tumor cell metastasis in cancer. In this review, the basic mechanisms of cellular adhesion and the structural and functional features of adhes...

  4. Electron interactions with polar molecules

    International Nuclear Information System (INIS)

    Garrett, W.R.


    A description is given of a number of the features of discrete and continuous spectra of electrons interacting with polar molecules. Attention is focused on the extent to which theoretical predictions concerning cross sections, resonances, and bound states are strongly influenced by the various approximations that are so ubiquitous in the treatment of such problems. Similarly, threshold scattering and photodetachment processes are examined for the case of weakly bound dipole states whose higher members overlap the continuum

  5. A single-molecule diode (United States)

    Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B.; Mayor, Marcel


    We have designed and synthesized a molecular rod that consists of two weakly coupled electronic π -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current–voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur–gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current–voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical π -systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current–voltage characteristics, similar to the phenomena in a semiconductor diode. PMID:15956208

  6. The largest molecules in space

    International Nuclear Information System (INIS)

    Greenberg, J.M.


    The bulk of complex molecules in the space between the stars is shown to be in the small frozen particles of interstellar dust. Each dust grain typically contains some 10 9 atoms of oxygen, carbon and nitrogen in an amorphous molecular mixture. As a result of chemical processing of the particles by ultraviolet photons over times spanning proportional10 8 -10 9 years a substantial portion of each dust grain is converted into complex organic molecules whose maximum molecular weight is limited only by the size of the grain. Laboratory studies of evolution of analog grain materials shows that molecular weights of the order of 500 are readily created and that there is an excellent probability of much more complex molecules being produced. The organic dust component constitutes about one tenth of a percent of the total mass of the Milky Way and far outweighs any estimates of the total mass of all the planets. A planet like the earth is continually accreting matter from space and there was a high probability that in the first five hundred million years after its crust formed it passed through several dark clouds and accreted from a hundred million to ten thousand million tonnes of the organic material of the interstellar dust during each passage. It is suggested that this rain of material could have provided the molecular templates for the origin of life. (orig.)

  7. Electric moments in molecule interferometry

    International Nuclear Information System (INIS)

    Eibenberger, Sandra; Gerlich, Stefan; Arndt, Markus; Tuexen, Jens; Mayor, Marcel


    We investigate the influence of different electric moments on the shift and dephasing of molecules in a matter wave interferometer. Firstly, we provide a quantitative comparison of two molecules that are non-polar yet polarizable in their thermal ground state and that differ in their stiffness and response to thermal excitations. While C 25 H 20 is rather rigid, its larger derivative C 49 H 16 F 52 is additionally equipped with floppy side chains and vibrationally activated dipole moment variations. Secondly, we elucidate the role of a permanent electric dipole momentby contrasting the quantum interference pattern of a (nearly) non-polar and a polar porphyrin derivative. We find that a high molecular polarizability and even sizeable dipole moment fluctuations are still well compatible with high-contrast quantum interference fringes. The presence of permanent electric dipole moments, however, can lead to a dephasing and rapid degradation of the quantum fringe pattern already at moderate electric fields. This finding is of high relevance for coherence experiments with large organic molecules, which are generally equipped with strong electric moments.

  8. Linear particle accelerator

    International Nuclear Information System (INIS)

    Richards, J.A.


    A linear particle accelerator which provides a pulsed beam of charged particles of uniform energy is described. The accelerator is in the form of an evacuated dielectric tube, inside of which a particle source is located at one end of the tube, with a target or window located at the other end of the dielectric tube. Along the length of the tube are externally located pairs of metal plates, each insulated from each other in an insulated housing. Each of the plates of a pair are connected to an electrical source of voltage of opposed polarity, with the polarity of the voltage of the plates oriented so that the plate of a pair, nearer to the particle source, is of the opposed polarity to the charge of the particle emitted by the source. Thus, a first plate about the tube located nearest the particle source, attracts a particle which as it passes through the tube past the first plate is then repelled by the reverse polarity of the second plate of the pair to continue moving towards the target

  9. Generalized Linear Covariance Analysis (United States)

    Carpenter, James R.; Markley, F. Landis


    This talk presents a comprehensive approach to filter modeling for generalized covariance analysis of both batch least-squares and sequential estimators. We review and extend in two directions the results of prior work that allowed for partitioning of the state space into solve-for'' and consider'' parameters, accounted for differences between the formal values and the true values of the measurement noise, process noise, and textita priori solve-for and consider covariances, and explicitly partitioned the errors into subspaces containing only the influence of the measurement noise, process noise, and solve-for and consider covariances. In this work, we explicitly add sensitivity analysis to this prior work, and relax an implicit assumption that the batch estimator's epoch time occurs prior to the definitive span. We also apply the method to an integrated orbit and attitude problem, in which gyro and accelerometer errors, though not estimated, influence the orbit determination performance. We illustrate our results using two graphical presentations, which we call the variance sandpile'' and the sensitivity mosaic,'' and we compare the linear covariance results to confidence intervals associated with ensemble statistics from a Monte Carlo analysis.

  10. Equipartitioning in linear accelerators

    International Nuclear Information System (INIS)

    Jameson, R.A.


    Emittance growth has long been a concern in linear accelerators, as has the idea that some kind of energy balance, or equipartitioning, between the degrees of freedom, would ameliorate the growth. M. Prome observed that the average transverse and longitudinal velocity spreads tend to equalize as current in the channel is increased, while the sum of the energy in the system stays nearly constant. However, only recently have we shown that an equipartitioning requirement on a bunched injected beam can indeed produce remarkably small emittance growth. The simple set of equations leading to this condition are outlined. At the same time, Hofmann has investigated collective instabilities in transported beams and has identified thresholds and regions in parameter space where instabilities occur. Evidence is presented that shows transport system boundaries to be quite accurate in computer simulations of accelerating systems. Discussed are preliminary results of efforts to design accelerators that avoid parameter regions where emittance is affected by the instabilities identified by Hofmann. These efforts suggest that other mechanisms are present. The complicated behavior of the RFQ linac in this framework also is shown

  11. Equipartitioning in linear accelerators

    International Nuclear Information System (INIS)

    Jameson, R.A.


    Emittance growth has long been a concern in linear accelerators, as has the idea that some kind of energy balance, or equipartitioning, between the degrees of freedom, would ameliorate the growth. M. Prome observed that the average transverse and longitudinal velocity spreads tend to equalize as current in the channel is increased, while the sum of the energy in the system stays nearly constant. However, only recently have we shown that an equipartitioning requirement on a bunched injected beam can indeed produce remarkably small emittance growth. The simple set of equations leading to this condition are outlined below. At the same time, Hofmann, using powerful analytical and computational methods, has investigated collective instabilities in transported beams and has identified thresholds and regions in parameter space where instabilities occur. This is an important generalization. Work that he will present at this conference shows that the results are essentially the same in r-z coordinates for transport systems, and evidence is presented that shows transport system boundaries to be quite accurate in computer simulations of accelerating systems also. Discussed are preliminary results of efforts to design accelerators that avoid parameter regions where emittance is affected by the instabilities identified by Hofmann. These efforts suggest that other mechanisms are present. The complicated behavior of the RFQ linac in this framework also is shown

  12. Linear induction accelerators

    International Nuclear Information System (INIS)

    Briggs, R.J.


    The development of linear induction accelerators has been motivated by applications requiring high-pulsed currents of charged particles at voltages exceeding the capability of single-stage, diode-type accelerators and at currents too high for rf accelerators. In principle, one can accelerate charged particles to arbitrarily high voltages using a multi-stage induction machine, but the 50-MeV, 10-kA Advanced Test Accelerator (ATA) at LLNL is the highest voltage machine in existence at this time. The advent of magnetic pulse power systems makes sustained operation at high-repetition rates practical, and this capability for high-average power is very likely to open up many new applications of induction machines in the future. This paper surveys the US induction linac technology with primary emphasis on electron machines. A simplified description of how induction machines couple energy to the electron beam is given, to illustrate many of the general issues that bound the design space of induction linacs

  13. Berkeley Proton Linear Accelerator (United States)

    Alvarez, L. W.; Bradner, H.; Franck, J.; Gordon, H.; Gow, J. D.; Marshall, L. C.; Oppenheimer, F. F.; Panofsky, W. K. H.; Richman, C.; Woodyard, J. R.


    A linear accelerator, which increases the energy of protons from a 4 Mev Van de Graaff injector, to a final energy of 31.5 Mev, has been constructed. The accelerator consists of a cavity 40 feet long and 39 inches in diameter, excited at resonance in a longitudinal electric mode with a radio-frequency power of about 2.2 x 10{sup 6} watts peak at 202.5 mc. Acceleration is made possible by the introduction of 46 axial "drift tubes" into the cavity, which is designed such that the particles traverse the distance between the centers of successive tubes in one cycle of the r.f. power. The protons are longitudinally stable as in the synchrotron, and are stabilized transversely by the action of converging fields produced by focusing grids. The electrical cavity is constructed like an inverted airplane fuselage and is supported in a vacuum tank. Power is supplied by 9 high powered oscillators fed from a pulse generator of the artificial transmission line type.

  14. Random linear codes in steganography

    Directory of Open Access Journals (Sweden)

    Kamil Kaczyński


    Full Text Available Syndrome coding using linear codes is a technique that allows improvement in the steganographic algorithms parameters. The use of random linear codes gives a great flexibility in choosing the parameters of the linear code. In parallel, it offers easy generation of parity check matrix. In this paper, the modification of LSB algorithm is presented. A random linear code [8, 2] was used as a base for algorithm modification. The implementation of the proposed algorithm, along with practical evaluation of algorithms’ parameters based on the test images was made.[b]Keywords:[/b] steganography, random linear codes, RLC, LSB

  15. Linear Algebraic Method for Non-Linear Map Analysis

    International Nuclear Information System (INIS)

    Yu, L.; Nash, B.


    We present a newly developed method to analyze some non-linear dynamics problems such as the Henon map using a matrix analysis method from linear algebra. Choosing the Henon map as an example, we analyze the spectral structure, the tune-amplitude dependence, the variation of tune and amplitude during the particle motion, etc., using the method of Jordan decomposition which is widely used in conventional linear algebra.

  16. Effects of molecular orientation in the laser ionization of molecules

    International Nuclear Information System (INIS)

    Xinhua Xie; Gerald Jordan; Christopher Ede; Armin Scrinzi


    Complete test of publication follows. Time-dependent electron momentum distributions are calculated during ionization of linear molecules by a strong laser pulse and upon recollision. For typical experimental laser parameters, we find a strong influence of molecular orientation and initial state symmetry on the total ionization rates and also on momentum distributions, compared to which the effect of electron correlation is less important for simple molecules. The dynamics of electron release and subsequent recollision with the parent ion largely determines the time-frequency structure of harmonic radiation, which underlies the generation of attosecond XUV pulses and the time-resolved imaging techniques for the electronic structure of molecules. In the present work, the effects of orientation and initial orbital symmetry are investigated by solving the time-dependent Schroedinger equation for a two-dimensional diatomic molecule in the single-active electron approximation. As in the presence of strong external fields recolliding electrons cannot be easily separated from bound electrons, the electron wave packet is probed at some distance from where all electrons can be safety considered as detached. We find that momentum distributions strongly depend on molecular size, orientation of the molecular axis, and node structure of the initial state. In order to determine the momentum spectra at the time of electron release and upon recollision, we classically propagate the Wigner distributions of probed wavepackets backward and forward in time, respectively. We find that the times of peak recollision current can vary strongly with the orientation of the molecule. Moreover, correlation effects on the electron spectra are included using the multi-configuration time-dependent Hartree-Fock method. The calculations are performed in three spatial dimensions with the restriction to cylindrical symmetry, where the molecule is aligned with the laser field. Correlation is studied

  17. Permanent and induced dipole requirements in ab initio calculations of electron affinities of polar molecules

    International Nuclear Information System (INIS)

    Garrett, W.R.


    Through the use of a molecular pseudopotential method, we determine the a approximate magnitudes of errors that result when electron affinity determinations of polar negative ions are made through ab initio calculations in which the use of a given basis set yields inappropriate values for permanent and induced dipole moments of the neutral molecule. These results should prove useful in assessing the adequacy of basis sets in ab initio calculations of molecular electron affinities for simple linear polar molecules

  18. Linearly Polarized IR Spectroscopy Theory and Applications for Structural Analysis

    CERN Document Server

    Kolev, Tsonko


    A technique that is useful in the study of pharmaceutical products and biological molecules, polarization IR spectroscopy has undergone continuous development since it first emerged almost 100 years ago. Capturing the state of the science as it exists today, "Linearly Polarized IR Spectroscopy: Theory and Applications for Structural Analysis" demonstrates how the technique can be properly utilized to obtain important information about the structure and spectral properties of oriented compounds. The book starts with the theoretical basis of linear-dichroic infrared (IR-LD) spectroscop

  19. Single Molecule Nano-Metronome


    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip


    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule ...

  20. Single Molecule Nano-Metronome (United States)

    Buranachai, Chittanon; McKinney, Sean A.; Ha, Taekjip


    We constructed a DNA-based nano-mechanical device called the nano-metronome. Our device is made by introducing complementary single stranded overhangs at the two arms of the DNA four-way junction. The ticking rates of this stochastic metronome depend on ion concentrations and can be changed by a set of DNA-based switches to deactivate/reactivate the sticky end. Since the device displays clearly distinguishable responses even with a single basepair difference, it may lead to a single molecule sensor of minute sequence differences of a target DNA. PMID:16522050

  1. XUV ionization of aligned molecules

    Energy Technology Data Exchange (ETDEWEB)

    Kelkensberg, F.; Siu, W.; Gademann, G. [FOM Institute AMOLF, Science Park 104, NL-1098 XG Amsterdam (Netherlands); Rouzee, A.; Vrakking, M. J. J. [FOM Institute AMOLF, Science Park 104, NL-1098 XG Amsterdam (Netherlands); Max-Born-Institut, Max-Born Strasse 2A, D-12489 Berlin (Germany); Johnsson, P. [FOM Institute AMOLF, Science Park 104, NL-1098 XG Amsterdam (Netherlands); Department of Physics, Lund University, Post Office Box 118, SE-221 00 Lund (Sweden); Lucchini, M. [Department of Physics, Politecnico di Milano, Istituto di Fotonica e Nanotecnologie CNR-IFN, Piazza Leonardo da Vinci 32, 20133 Milano (Italy); Lucchese, R. R. [Department of Chemistry, Texas A and M University, College Station, Texas 77843-3255 (United States)


    New extreme-ultraviolet (XUV) light sources such as high-order-harmonic generation (HHG) and free-electron lasers (FELs), combined with laser-induced alignment techniques, enable novel methods for making molecular movies based on measuring molecular frame photoelectron angular distributions. Experiments are presented where CO{sub 2} molecules were impulsively aligned using a near-infrared laser and ionized using femtosecond XUV pulses obtained by HHG. Measured electron angular distributions reveal contributions from four orbitals and the onset of the influence of the molecular structure.

  2. ''Crown molecules'' for separating cesium

    International Nuclear Information System (INIS)

    Dozol, J.F.; Lamare, V.


    After the minor actinides, the second category of radionuclides that must be isolated to optimize nuclear waste management concerns fission products, especially two cesium isotopes. If the cesium-135 isotope could be extracted, it could subsequently be transmuted or conditioned using a tailor-made process. Eliminating the 137 isotope from reprocessing and nuclear facility-dismantling waste would allow to dispose of most of this waste in near-surface facilities, and simply process the small remaining quantity containing long-lived elements. CEA research teams and their international partners have thought up crown molecules that could be used to pick out the cesium and meet these objectives. (authors)

  3. XUV ionization of aligned molecules

    International Nuclear Information System (INIS)

    Kelkensberg, F.; Siu, W.; Gademann, G.; Rouzee, A.; Vrakking, M. J. J.; Johnsson, P.; Lucchini, M.; Lucchese, R. R.


    New extreme-ultraviolet (XUV) light sources such as high-order-harmonic generation (HHG) and free-electron lasers (FELs), combined with laser-induced alignment techniques, enable novel methods for making molecular movies based on measuring molecular frame photoelectron angular distributions. Experiments are presented where CO 2 molecules were impulsively aligned using a near-infrared laser and ionized using femtosecond XUV pulses obtained by HHG. Measured electron angular distributions reveal contributions from four orbitals and the onset of the influence of the molecular structure.

  4. The neural cell adhesion molecule

    DEFF Research Database (Denmark)

    Berezin, V; Bock, E; Poulsen, F M


    During the past year, the understanding of the structure and function of neural cell adhesion has advanced considerably. The three-dimensional structures of several of the individual modules of the neural cell adhesion molecule (NCAM) have been determined, as well as the structure of the complex...... between two identical fragments of the NCAM. Also during the past year, a link between homophilic cell adhesion and several signal transduction pathways has been proposed, connecting the event of cell surface adhesion to cellular responses such as neurite outgrowth. Finally, the stimulation of neurite...

  5. The molecule-metal interface

    CERN Document Server

    Koch, Norbert; Wee, Andrew Thye Shen


    Reviewing recent progress in the fundamental understanding of the molecule-metal interface, this useful addition to the literature focuses on experimental studies and introduces the latest analytical techniques as applied to this interface.The first part covers basic theory and initial principle studies, while the second part introduces readers to photoemission, STM, and synchrotron techniques to examine the atomic structure of the interfaces. The third part presents photoelectron spectroscopy, high-resolution UV photoelectron spectroscopy and electron spin resonance to study the electroni

  6. Rotational excitation of linear triatomic molecules: Ar, Kr + N2O, CO2

    International Nuclear Information System (INIS)

    Farrar, J.M.; Parson, J.M.; Lee, Y.T.


    Rotational excitation of N 2 O and CO 2 in collisions with Ar and Kr has been studied by crossing two supersonic molecular beams and detecting scattered products with a mass spectrometer. Measurement of the time of flight spectrum of the products as a function of laboratory scattering angle theta indicates that the inelasticity is concentrated in the forward direction in the center of mass system. Difference between CO 2 and N 2 O are discussed briefly

  7. Control of π-Electron Rotations in Chiral Aromatic Molecules Using Intense Laser Pulses (United States)

    Kanno, Manabu; Kono, Hirohiko; Fujimura, Yuichi

    Our recent theoretical studies on laser-induced π-electron rotations in chiral aromatic molecules are reviewed. π electrons of a chiral aromatic molecule can be rotated along its aromatic ring by a nonhelical, linearly polarized laser pulse. An ansa aromatic molecule with a six-membered ring, 2,5-dichloro[n](3,6) pyrazinophane, which belongs to a planar-chiral molecule group, and its simplified molecule 2,5-dichloropyrazine are taken as model molecules. Electron wavepacket simulations in the frozen-molecular-vibration approximation show that the initial direction of π-electron rotation depends on the polarization direction of a linearly polarized laser pulse applied. Consecutive unidirectional rotation can be achieved by applying a sequence of linearly polarized pump and dump pulses to prevent reverse rotation. Optimal control simulations of π-electron rotation show that another controlling factor for unidirectional rotation is the relative optical phase between the different frequency components of an incident pulse in addition to photon polarization direction. Effects of nonadiabatic coupling between π-electron rotation and molecular vibrations are also presented, where the constraints of the frozen approximation are removed. The angular momentum gradually decays mainly owing to nonadiabatic coupling, while the vibrational amplitudes greatly depend on their rotation direction. This suggests that the direction of π-electron rotation on an attosecond timescale can be identified by detecting femtosecond molecular vibrations.

  8. Molecular electronics--resonant transport through single molecules. (United States)

    Lörtscher, Emanuel; Riel, Heike


    The mechanically controllable break-junction technique (MCBJ) enables us to investigate charge transport through an individually contacted and addressed molecule in ultra-high vacuum (UHV) environment at variable temperature ranging from room temperature down to 4 K. Using a statistical measurement and analysis approach, we acquire current-voltage (I-V) characteristics during the repeated formation, manipulation, and breaking of a molecular junction. At low temperatures, voltages accessing the first molecular orbitals in resonance can be applied, providing spectroscopic information about the junction's energy landscape, in particular about the molecular level alignment in respect to the Fermi energy of the electrodes. Thereby, we can investigate the non-linear transport properties of various types of functional molecules and explore their potential use as functional building blocks for future nano-electronics. An example will be given by the reversible and controllable switching between two distinct conductive states of a single molecule. As a proof-of-principle for functional molecular devices, a single-molecule memory element will be demonstrated.

  9. Controlling translational motion of neutral molecules in inhomogeneous electric fields

    International Nuclear Information System (INIS)

    Yamakita, Yoshihiro


    Hydrogen molecules are excited to Rydberg states with n=16, 17 in the presence of inhomogeneous field of an electric dipole by a vacuum ultraviolet-ultraviolet double resonance scheme. The large dipole moment produced in Stark eigenstates leads to strong forces on the molecules in the inhomogeneous electric field. Deflection and deceleration are demonstrated for a pulsed supersonic beam containing the H 2 molecules in the n=16, 17, N + =2, M J =0 Rydberg states. The Rydberg states are found to survive for over 100 μs after the dipole field is switched off. The Rydberg states have a special stability with respect to decay by predissociation. Complete deceleration to the zero mean velocity is numerically demonstrated for H 2 molecules in the higher linear low-field-seeking n=16, M J =0 Rydberg states by using a symplectic integrator of the fourth order. The calculations show that the initial velocity of 900 ms -1 with translational temperature 1 K is decelerated to 0 ms -1 with 13 mK. (author)

  10. Positron creation in superheavy quasi-molecules

    International Nuclear Information System (INIS)

    Mueller, B.


    The review of positron creation in superheavy quasi-molecules includes spontaneous positron emission from superheavy atoms, supercritical quasi-molecules, background effects, and some implications of the new ground state. 66 references

  11. Linear Programming and Network Flows

    CERN Document Server

    Bazaraa, Mokhtar S; Sherali, Hanif D


    The authoritative guide to modeling and solving complex problems with linear programming-extensively revised, expanded, and updated The only book to treat both linear programming techniques and network flows under one cover, Linear Programming and Network Flows, Fourth Edition has been completely updated with the latest developments on the topic. This new edition continues to successfully emphasize modeling concepts, the design and analysis of algorithms, and implementation strategies for problems in a variety of fields, including industrial engineering, management science, operations research

  12. Characterization of Interstellar Organic Molecules

    International Nuclear Information System (INIS)

    Gencaga, Deniz; Knuth, Kevin H.; Carbon, Duane F.


    Understanding the origins of life has been one of the greatest dreams throughout history. It is now known that star-forming regions contain complex organic molecules, known as Polycyclic Aromatic Hydrocarbons (PAHs), each of which has particular infrared spectral characteristics. By understanding which PAH species are found in specific star-forming regions, we can better understand the biochemistry that takes place in interstellar clouds. Identifying and classifying PAHs is not an easy task: we can only observe a single superposition of PAH spectra at any given astrophysical site, with the PAH species perhaps numbering in the hundreds or even thousands. This is a challenging source separation problem since we have only one observation composed of numerous mixed sources. However, it is made easier with the help of a library of hundreds of PAH spectra. In order to separate PAH molecules from their mixture, we need to identify the specific species and their unique concentrations that would provide the given mixture. We develop a Bayesian approach for this problem where sources are separated from their mixture by Metropolis Hastings algorithm. Separated PAH concentrations are provided with their error bars, illustrating the uncertainties involved in the estimation process. The approach is demonstrated on synthetic spectral mixtures using spectral resolutions from the Infrared Space Observatory (ISO). Performance of the method is tested for different noise levels.

  13. Voltage dependency of transmission probability of aperiodic DNA molecule (United States)

    Wiliyanti, V.; Yudiarsah, E.


    Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

  14. LINEAR2007, Linear-Linear Interpolation of ENDF Format Cross-Sections

    International Nuclear Information System (INIS)


    1 - Description of program or function: LINEAR converts evaluated cross sections in the ENDF/B format into a tabular form that is subject to linear-linear interpolation in energy and cross section. The code also thins tables of cross sections already in that form. Codes used subsequently need thus to consider only linear-linear data. IAEA1311/15: This version include the updates up to January 30, 2007. Changes in ENDF/B-VII Format and procedures, as well as the evaluations themselves, make it impossible for versions of the ENDF/B pre-processing codes earlier than PREPRO 2007 (2007 Version) to accurately process current ENDF/B-VII evaluations. The present code can handle all existing ENDF/B-VI evaluations through release 8, which will be the last release of ENDF/B-VI. Modifications from previous versions: - Linear VERS. 2007-1 (JAN. 2007): checked against all ENDF/B-VII; increased page size from 60,000 to 600,000 points 2 - Method of solution: Each section of data is considered separately. Each section of File 3, 23, and 27 data consists of a table of cross section versus energy with any of five interpolation laws. LINEAR will replace each section with a new table of energy versus cross section data in which the interpolation law is always linear in energy and cross section. The histogram (constant cross section between two energies) interpolation law is converted to linear-linear by substituting two points for each initial point. The linear-linear is not altered. For the log-linear, linear-log and log- log laws, the cross section data are converted to linear by an interval halving algorithm. Each interval is divided in half until the value at the middle of the interval can be approximated by linear-linear interpolation to within a given accuracy. The LINEAR program uses a multipoint fractional error thinning algorithm to minimize the size of each cross section table

  15. Double-valence-fluctuating molecules and superconductivity

    International Nuclear Information System (INIS)

    Hirsch, J.E.; Scalapino, D.J.


    We discuss the possibility of ''double-valence-fluctuating'' molecules, having two ground-state configurations differing by two electrons. We propose a possible realization of such a molecule, and experimental ways to look for it. We argue that a weakly coupled array of such molecules should give rise to a strong-coupling Shafroth-Blatt-Butler superconductor, with a high transition temperature

  16. Trapping molecules in two and three dimensions

    International Nuclear Information System (INIS)

    Pinkse, PW.H.; Junglen, T.; Rieger, T.; Rangwala, S.A.; Windpassinger, P.; Rempe, G.


    Full text: Cold molecules offer a new testing ground for quantum-physical effects in nature. For example, producing slow beams of large molecules could push experiments studying the boundary between quantum interference and classical particles up towards ever heavier particles. Moreover, cold molecules, in particular YbF, seem an attractive way to narrow down the constraints on the value of the electron dipole moment and finally, quantum information processing using chains of cold polar molecules or vibrational states in molecules have been proposed. All these proposals rely on advanced production and trapping techniques, most of which are still under development. Therefore, novel production and trapping techniques for cold molecules could offer new possibilities not found in previous methods. Electric traps hold promise for deep trap potentials for neutral molecules. Recently we have demonstrated two-dimensional trapping of polar molecules in a four-wire guide using electrostatic and electrodynamic trapping techniques. Filled from a thermal effusive source, such a guide will deliver a beam of slow molecules, which is an ideal source for interferometry experiments with large molecules, for instance. Here we report about the extension of this work to three-dimensional trapping. Polar molecules with a positive Stark shift can be trapped in the minimum of an electrostatic field. We have successfully tested a large volume electrostatic trap for ND3 molecules. A special feature of this trap is that it can be loaded continuously from an electrostatic guide, at a temperature of a few hundred mK. (author)

  17. Elementary linear programming with applications

    CERN Document Server

    Kolman, Bernard


    Linear programming finds the least expensive way to meet given needs with available resources. Its results are used in every area of engineering and commerce: agriculture, oil refining, banking, and air transport. Authors Kolman and Beck present the basic notions of linear programming and illustrate how they are used to solve important common problems. The software on the included disk leads students step-by-step through the calculations. The Second Edition is completely revised and provides additional review material on linear algebra as well as complete coverage of elementary linear program

  18. The art of linear electronics

    CERN Document Server

    Hood, John Linsley


    The Art of Linear Electronics presents the principal aspects of linear electronics and techniques in linear electronic circuit design. The book provides a wide range of information on the elucidation of the methods and techniques in the design of linear electronic circuits. The text discusses such topics as electronic component symbols and circuit drawing; passive and active semiconductor components; DC and low frequency amplifiers; and the basic effects of feedback. Subjects on frequency response modifying circuits and filters; audio amplifiers; low frequency oscillators and waveform generato

  19. Linearity and Non-linearity of Photorefractive effect in Materials ...

    African Journals Online (AJOL)

    Linearity and Non-linearity of Photorefractive effect in Materials using the Band transport ... For low light beam intensities the change in the refractive index is ... field is spatially phase shifted by /2 relative to the interference fringe pattern, which ...

  20. The linear programming bound for binary linear codes

    NARCIS (Netherlands)

    Brouwer, A.E.


    Combining Delsarte's (1973) linear programming bound with the information that certain weights cannot occur, new upper bounds for dmin (n,k), the maximum possible minimum distance of a binary linear code with given word length n and dimension k, are derived.

  1. Linear operator inequalities for strongly stable weakly regular linear systems

    NARCIS (Netherlands)

    Curtain, RF


    We consider the question of the existence of solutions to certain linear operator inequalities (Lur'e equations) for strongly stable, weakly regular linear systems with generating operators A, B, C, 0. These operator inequalities are related to the spectral factorization of an associated Popov

  2. Adiabatic Field-Free Alignment of Asymmetric Top Molecules with an Optical Centrifuge. (United States)

    Korobenko, A; Milner, V


    We use an optical centrifuge to align asymmetric top SO_{2} molecules by adiabatically spinning their most polarizable O-O axis. The effective centrifugal potential in the rotating frame confines the sulfur atoms to the plane of the laser-induced rotation, leading to the planar molecular alignment that persists after the molecules are released from the centrifuge. The periodic appearance of the full three-dimensional alignment, typically observed only with linear and symmetric top molecules, is also detected. Together with strong in-plane centrifugal forces, which bend the molecules by up to 10 deg, permanent field-free alignment offers new ways of controlling molecules with laser light.

  3. Linear and non-linear optics of condensed matter

    International Nuclear Information System (INIS)

    McLean, T.P.


    Part I - Linear optics: 1. General introduction. 2. Frequency dependence of epsilon(ω, k vector). 3. Wave-vector dependence of epsilon(ω, k vector). 4. Tensor character of epsilon(ω, k vector). Part II - Non-linear optics: 5. Introduction. 6. A classical theory of non-linear response in one dimension. 7. The generalization to three dimensions. 8. General properties of the polarizability tensors. 9. The phase-matching condition. 10. Propagation in a non-linear dielectric. 11. Second harmonic generation. 12. Coupling of three waves. 13. Materials and their non-linearities. 14. Processes involving energy exchange with the medium. 15. Two-photon absorption. 16. Stimulated Raman effect. 17. Electro-optic effects. 18. Limitations of the approach presented here. (author)

  4. Advanced statistics: linear regression, part I: simple linear regression. (United States)

    Marill, Keith A


    Simple linear regression is a mathematical technique used to model the relationship between a single independent predictor variable and a single dependent outcome variable. In this, the first of a two-part series exploring concepts in linear regression analysis, the four fundamental assumptions and the mechanics of simple linear regression are reviewed. The most common technique used to derive the regression line, the method of least squares, is described. The reader will be acquainted with other important concepts in simple linear regression, including: variable transformations, dummy variables, relationship to inference testing, and leverage. Simplified clinical examples with small datasets and graphic models are used to illustrate the points. This will provide a foundation for the second article in this series: a discussion of multiple linear regression, in which there are multiple predictor variables.

  5. Study the multi-photon absorption process in two types of molecules

    International Nuclear Information System (INIS)

    Al-azawi, H.R.


    The aim of the present work was to study the multi-photon absorption process in two types of molecules; spherical top such as SF 6 molecules and assymetric top such as CHOOH and C 2 H 4 molecules. This work also aimed to study the effect of buffer gas pressure (Ar), which is transparent to the infrared (IR) laser on the multiphoton absorption of both types of molecules. A pulsed (TEA) CO 2 laser was used as a source which generates multi-lines in the IR-region of the spectrum and an optoacoustic detector was used to detect the energy absorbed by the molecules. In this study, the relaxation process was found to be faster in the heavy molecules than that in the light ones. A limit in the Ar pressure was observed. Below this limit, the gas acted as an active buffer gas and above it, the multi-photon absorption process was quenched. This work also aimed to study the multi-photon absorption spectrum for the CHOOH molecules in the range (1067-1090 cm -1 ). This spectrum was found to be consistent with the linear absorption spectrum obtained for the same range. The density of the vibrational states as a function of the vibrational energy was studied for the molecules SF 6 , CHOOH and C 2 H 4 . The results were used to interpret (i) the difference in the energy absorbed by difference molecules at the same energy density and (ii) the non-linearity in the multi-photon absorption for CHOOH molecules. 1 tab.; 40 figs.; 70 refs

  6. In Situ Detection of Organic Molecules on the Martian Surface With the Mars Organic Molecule Analyzer (MOMA) on Exomars 2018 (United States)

    Li, Xiang; Brinckerhoff, William B.; Pinnick, Veronica T; van Amerom, Friso H. W.; Danell, Ryan M.; Arevalo, Ricardo D., Jr.; Getty, Stephanie; Mahaffy, Paul R.


    The Mars Organic Molecule Analyzer (MOMA) investigation on the 2018 ExoMars rover will examine the chemical composition of samples acquired from depths of up to two meters below the martian surface, where organics may be protected from radiative and oxidative degradation. The MOMA instrument is centered around a miniaturized linear ion trap (LIT) that facilitates two modes of operation: i) pyrolysisgas chromatography mass spectrometry (pyrGC-MS); and, ii) laser desorptionionization mass spectrometry (LDI-MS) at ambient Mars pressures. The LIT also enables the structural characterization of complex molecules via complementary analytical capabilities, such as multi-frequency waveforms (i.e., SWIFT) and tandem mass spectrometry (MSMS). When combined with the complement of instruments in the rovers Pasteur Payload, MOMA has the potential to reveal the presence of a wide range of organics preserved in a variety of mineralogical environments, and to begin to understand the structural character and potential origin of those compounds.

  7. A single-molecule diode (United States)

    Elbing, Mark; Ochs, Rolf; Koentopp, Max; Fischer, Matthias; von Hänisch, Carsten; Weigend, Florian; Evers, Ferdinand; Weber, Heiko B.; Mayor, Marcel


    We have designed and synthesized a molecular rod that consists of two weakly coupled electronic π -systems with mutually shifted energy levels. The asymmetry thus implied manifests itself in a current-voltage characteristic with pronounced dependence on the sign of the bias voltage, which makes the molecule a prototype for a molecular diode. The individual molecules were immobilized by sulfur-gold bonds between both electrodes of a mechanically controlled break junction, and their electronic transport properties have been investigated. The results indeed show diode-like current-voltage characteristics. In contrast to that, control experiments with symmetric molecular rods consisting of two identical π -systems did not show significant asymmetries in the transport properties. To investigate the underlying transport mechanism, phenomenological arguments are combined with calculations based on density functional theory. The theoretical analysis suggests that the bias dependence of the polarizability of the molecule feeds back into the current leading to an asymmetric shape of the current-voltage characteristics, similar to the phenomena in a semiconductor diode. Author contributions: F.E., H.B.W., and M.M. designed research; M.E., R.O., M.K., M.F., F.E., H.B.W., and M.M. performed research; M.E., R.O., M.K., M.F., C.v.H., F.W., F.E., H.B.W., and M.M. contributed new reagents/analytic tools; M.E., R.O., M.K., C.v.H., F.E., H.B.W., and M.M. analyzed data; and F.E., H.B.W., and M.M. wrote the paper.This paper was submitted directly (Track II) to the PNAS office.Abbreviations: A, acceptor; D, donor; MCB, mechanically controlled break junction.Data deposition: The atomic coordinates have been deposited in the Cambridge Structural Database, Cambridge Crystallographic Data Centre, Cambridge CB2 1EZ, United Kingdom (CSD reference no. 241632).

  8. Alignment of symmetric top molecules by short laser pulses

    DEFF Research Database (Denmark)

    Hamilton, Edward; Seideman, Tamar; Ejdrup, Tine


    -resolved photofragment imaging. Using methyliodide and tert-butyliodide as examples, we calculate and measure the alignment dynamics, focusing on the temporal structure and intensity of the revival patterns, including their dependence on the pulse duration, and their behavior at long times, where centrifugal distortion......Nonadiabatic alignment of symmetric top molecules induced by a linearly polarized, moderately intense picosecond laser pulse is studied theoretically and experimentally. Our studies are based on the combination of a nonperturbative solution of the Schrodinger equation with femtosecond time...

  9. Para-mixed linear spaces

    Directory of Open Access Journals (Sweden)

    Crasmareanu Mircea


    Full Text Available We consider the paracomplex version of the notion of mixed linear spaces introduced by M. Jurchescu in [4] by replacing the complex unit i with the paracomplex unit j, j2 = 1. The linear algebra of these spaces is studied with a special view towards their morphisms.

  10. Linear Algebra and Image Processing (United States)

    Allali, Mohamed


    We use the computing technology digital image processing (DIP) to enhance the teaching of linear algebra so as to make the course more visual and interesting. Certainly, this visual approach by using technology to link linear algebra to DIP is interesting and unexpected to both students as well as many faculty. (Contains 2 tables and 11 figures.)

  11. Efficient Searching with Linear Constraints

    DEFF Research Database (Denmark)

    Agarwal, Pankaj K.; Arge, Lars Allan; Erickson, Jeff


    We show how to preprocess a set S of points in d into an external memory data structure that efficiently supports linear-constraint queries. Each query is in the form of a linear constraint xd a0+∑d−1i=1 aixi; the data structure must report all the points of S that satisfy the constraint. This pr...

  12. Linear Motor With Air Slide (United States)

    Johnson, Bruce G.; Gerver, Michael J.; Hawkey, Timothy J.; Fenn, Ralph C.


    Improved linear actuator comprises air slide and linear electric motor. Unit exhibits low friction, low backlash, and more nearly even acceleration. Used in machinery in which positions, velocities, and accelerations must be carefully controlled and/or vibrations must be suppressed.

  13. Linear morphoea follows Blaschko's lines. (United States)

    Weibel, L; Harper, J I


    The aetiology of morphoea (or localized scleroderma) remains unknown. It has previously been suggested that lesions of linear morphoea may follow Blaschko's lines and thus reflect an embryological development. However, the distribution of linear morphoea has never been accurately evaluated. We aimed to identify common patterns of clinical presentation in children with linear morphoea and to establish whether linear morphoea follows the lines of Blaschko. A retrospective chart review of 65 children with linear morphoea was performed. According to clinical photographs the skin lesions of these patients were plotted on to standardized head and body charts. With the aid of Adobe Illustrator a final figure was produced including an overlay of all individual lesions which was used for comparison with the published lines of Blaschko. Thirty-four (53%) patients had the en coup de sabre subtype, 27 (41%) presented with linear morphoea on the trunk and/or limbs and four (6%) children had a combination of the two. In 55 (85%) children the skin lesions were confined to one side of the body, showing no preference for either left or right side. On comparing the overlays of all body and head lesions with the original lines of Blaschko there was an excellent correlation. Our data indicate that linear morphoea follows the lines of Blaschko. We hypothesize that in patients with linear morphoea susceptible cells are present in a mosaic state and that exposure to some trigger factor may result in the development of this condition.

  14. Dynamic Linear Models with R

    CERN Document Server

    Campagnoli, Patrizia; Petris, Giovanni


    State space models have gained tremendous popularity in as disparate fields as engineering, economics, genetics and ecology. Introducing general state space models, this book focuses on dynamic linear models, emphasizing their Bayesian analysis. It illustrates the fundamental steps needed to use dynamic linear models in practice, using R package.

  15. Linear Programming across the Curriculum (United States)

    Yoder, S. Elizabeth; Kurz, M. Elizabeth


    Linear programming (LP) is taught in different departments across college campuses with engineering and management curricula. Modeling an LP problem is taught in every linear programming class. As faculty teaching in Engineering and Management departments, the depth to which teachers should expect students to master this particular type of…

  16. Introduction to RF linear accelerators

    International Nuclear Information System (INIS)

    Weiss, M.


    The basic features of RF linear accelerators are described. The concept of the 'loaded cavity', essential for the synchronism wave-particle, is introduced, and formulae describing the action of electromagnetic fields on the beam are given. The treatment of intense beams is mentioned, and various existing linear accelerators are presented as examples. (orig.)

  17. Spatial Processes in Linear Ordering (United States)

    von Hecker, Ulrich; Klauer, Karl Christoph; Wolf, Lukas; Fazilat-Pour, Masoud


    Memory performance in linear order reasoning tasks (A > B, B > C, C > D, etc.) shows quicker, and more accurate responses to queries on wider (AD) than narrower (AB) pairs on a hypothetical linear mental model (A -- B -- C -- D). While indicative of an analogue representation, research so far did not provide positive evidence for spatial…

  18. Linear methods in band theory

    DEFF Research Database (Denmark)

    Andersen, O. Krogh


    of Korringa-Kohn-Rostoker, linear-combination-of-atomic-orbitals, and cellular methods; the secular matrix is linear in energy, the overlap integrals factorize as potential parameters and structure constants, the latter are canonical in the sense that they neither depend on the energy nor the cell volume...

  19. Dissociation Energies of Diatomic Molecules

    International Nuclear Information System (INIS)

    Qun-Chao, Fan; Wei-Guo, Sun


    Molecular dissociation energies of 10 electronic states of alkali molecules of KH, 7 LiD, 7 LiH, 6 LiH, NaK, NaLi and NaRb are studied using the highest three accurate vibrational energies of each electronic state, and an improved parameter-free analytical formula which is obtained starting from the LeRoy–Bernstein vibrational energy expression near the dissociation limit. The results show that as long as the highest three vibrational energies are accurate, the current analytical formula will give accurate theoretical dissociation energies D e theory , which are in excellent agreement with the experimental dissociation energies D e expt . (atomic and molecular physics)

  20. Generalizations of the Toda molecule (United States)

    Van Velthoven, W. P. G.; Bais, F. A.


    Finite-energy monopole solutions are constructed for the self-dual equations with spherical symmetry in an arbitrary integer graded Lie algebra. The constraint of spherical symmetry in a complex noncoordinate basis leads to a dimensional reduction. The resulting two-dimensional ( r, t) equations are of second order and furnish new generalizations of the Toda molecule equations. These are then solved by a technique which is due to Leznov and Saveliev. For time-independent solutions a further reduction is made, leading to an ansatz for all SU(2) embeddings of the Lie algebra. The regularity condition at the origin for the solutions, needed to ensure finite energy, is also solved for a special class of nonmaximal embeddings. Explicit solutions are given for the groups SU(2), SO(4), Sp(4) and SU(4).

  1. Optoelectronics of Molecules and Polymers

    CERN Document Server

    Moliton, André


    Optoelectronic devices are being developed at an extraordinary rate. Organic light emitting diodes, photovoltaic devices and electro-optical modulators are pivotal to the future of displays, photosensors and solar cells, and communication technologies. This book details the theories underlying the relevant mechanisms in organic materials and covers, at a basic level, how the organic components are made. The first part of this book introduces the fundamental theories used to detail ordered solids and localised energy levels. The methods used to determine energy levels in perfectly ordered molecular and macromolecular systems are discussed, making sure that the effects of quasi-particles are not missed. The function of excitons and their transfer between two molecules are studied, and the problems associated with interfaces and charge injection into resistive media are presented. The second part details technological aspects such as the fabrication of devices based on organic materials by dry etching. The princ...

  2. Anti-cancer Lead Molecule

    KAUST Repository

    Sagar, Sunil


    Derivatives of plumbagin can be selectively cytotoxic to breast cancer cells. Derivative `A` (Acetyl Plumbagin) has emerged as a lead molecule for testing against estrogen positive breast cancer and has shown low hepatotoxicity as well as overall lower toxicity in nude mice model. The toxicity of derivative `A` was determined to be even lower than vehicle control (ALT and AST markers). The possible mechanism of action identified based on the microarray experiments and pathway mapping shows that derivative `A` could be acting by altering the cholesterol-related mechanisms. The low toxicity profile of derivative `A` highlights its possible role as future anti-cancer drug and/or as an adjuvant drug to reduce the toxicity of highly toxic chemotherapeutic drugs

  3. Anti-cancer Lead Molecule

    KAUST Repository

    Sagar, Sunil; Kaur, Mandeep; Esau, Luke E.


    Derivatives of plumbagin can be selectively cytotoxic to breast cancer cells. Derivative `A` (Acetyl Plumbagin) has emerged as a lead molecule for testing against estrogen positive breast cancer and has shown low hepatotoxicity as well as overall lower toxicity in nude mice model. The toxicity of derivative `A` was determined to be even lower than vehicle control (ALT and AST markers). The possible mechanism of action identified based on the microarray experiments and pathway mapping shows that derivative `A` could be acting by altering the cholesterol-related mechanisms. The low toxicity profile of derivative `A` highlights its possible role as future anti-cancer drug and/or as an adjuvant drug to reduce the toxicity of highly toxic chemotherapeutic drugs

  4. Hydride Molecules towards Nearby Galaxies (United States)

    Monje, Raquel R.; La, Ngoc; Goldsmith, Paul


    Observations carried out by the Herschel Space Observatory revealed strong spectroscopic signatures from light hydride molecules within the Milky Way and nearby active galaxies. To better understand the chemical and physical conditions of the interstellar medium, we conducted the first comprehensive survey of hydrogen fluoride (HF) and water molecular lines observed through the SPIRE Fourier Transform Spectrometer. By collecting and analyzing the sub-millimeter spectra of over two hundred sources, we found that the HF J = 1 - 0 rotational transition which occurs at approximately 1232 GHz was detected in a total of 39 nearby galaxies both in absorption and emission. The analysis will determine the main excitation mechanism of HF in nearby galaxies and provide steady templates of the chemistry and physical conditions of the ISM to be used in the early universe, where observations of hydrides are more scarce.

  5. Modelling of energetic molecule-surface interactions

    International Nuclear Information System (INIS)

    Kerford, M.


    This thesis contains the results of molecular dynamics simulations of molecule-surface interactions, looking particularly at fullerene molecules and carbon surfaces. Energetic impacts of fullerene molecules on graphite create defect craters. The relationship between the parameters of the impacting molecule and the parameters of the crater axe examined and found to be a function of the energy and velocity of the impacting molecule. Less energetic fullerene molecules can be scattered from a graphite surface and the partitioning of energy after a scattering event is investigated. It is found that a large fraction of the kinetic energy retained after impact is translational energy, with a small fraction of rotational energy and a number of vibrational modes. At impact energies where the surface is not broken and at normal incidence, surface waves axe seen to occur. These waves axe used to develop a method of desorbing molecules from a graphite surface without damage to either the surface or the molecules being desorbed. A number of fullerene molecules are investigated and ways to increase the desorption yield are examined. It is found that this is a successful technique for desorbing large numbers of intact molecules from graphite. This technique could be used for desorbing intact molecules into a gas phase for mass spectrometric analysis. (author)

  6. Hydration thermodynamics beyond the linear response approximation. (United States)

    Raineri, Fernando O


    The solvation energetics associated with the transformation of a solute molecule at infinite dilution in water from an initial state A to a final state B is reconsidered. The two solute states have different potentials energies of interaction, [Formula: see text] and [Formula: see text], with the solvent environment. Throughout the A [Formula: see text] B transformation of the solute, the solvation system is described by a Hamiltonian [Formula: see text] that changes linearly with the coupling parameter ξ. By focusing on the characterization of the probability density [Formula: see text] that the dimensionless perturbational solute-solvent interaction energy [Formula: see text] has numerical value y when the coupling parameter is ξ, we derive a hierarchy of differential equation relations between the ξ-dependent cumulant functions of various orders in the expansion of the appropriate cumulant generating function. On the basis of this theoretical framework we then introduce an inherently nonlinear solvation model for which we are able to find analytical results for both [Formula: see text] and for the solvation thermodynamic functions. The solvation model is based on the premise that there is an upper or a lower bound (depending on the nature of the interactions considered) to the amplitude of the fluctuations of Y in the solution system at equilibrium. The results reveal essential differences in behavior for the model when compared with the linear response approximation to solvation, particularly with regards to the probability density [Formula: see text]. The analytical expressions for the solvation properties show, however, that the linear response behavior is recovered from the new model when the room for the thermal fluctuations in Y is not restricted by the existence of a nearby bound. We compare the predictions of the model with the results from molecular dynamics computer simulations for aqueous solvation, in which either (1) the solute

  7. Observation of pendular butterfly Rydberg molecules (United States)

    Niederprüm, Thomas; Thomas, Oliver; Eichert, Tanita; Lippe, Carsten; Pérez-Ríos, Jesús; Greene, Chris H.; Ott, Herwig


    Engineering molecules with a tunable bond length and defined quantum states lies at the heart of quantum chemistry. The unconventional binding mechanism of Rydberg molecules makes them a promising candidate to implement such tunable molecules. A very peculiar type of Rydberg molecules are the so-called butterfly molecules, which are bound by a shape resonance in the electron–perturber scattering. Here we report the observation of these exotic molecules and employ their exceptional properties to engineer their bond length, vibrational state, angular momentum and orientation in a small electric field. Combining the variable bond length with their giant dipole moment of several hundred Debye, we observe counter-intuitive molecules which locate the average electron position beyond the internuclear distance. PMID:27703143

  8. A Mott-like State of Molecules

    International Nuclear Information System (INIS)

    Duerr, S.; Volz, T.; Syassen, N.; Bauer, D. M.; Hansis, E.; Rempe, G.


    We prepare a quantum state where each site of an optical lattice is occupied by exactly one molecule. This is the same quantum state as in a Mott insulator of molecules in the limit of negligible tunneling. Unlike previous Mott insulators, our system consists of molecules which can collide inelastically. In the absence of the optical lattice these collisions would lead to fast loss of the molecules from the sample. To prepare the state, we start from a Mott insulator of atomic 87Rb with a central region, where each lattice site is occupied by exactly two atoms. We then associate molecules using a Feshbach resonance. Remaining atoms can be removed using blast light. Our method does not rely on the molecule-molecule interaction properties and is therefore applicable to many systems

  9. Introduction to generalized linear models

    CERN Document Server

    Dobson, Annette J


    Introduction Background Scope Notation Distributions Related to the Normal Distribution Quadratic Forms Estimation Model Fitting Introduction Examples Some Principles of Statistical Modeling Notation and Coding for Explanatory Variables Exponential Family and Generalized Linear Models Introduction Exponential Family of Distributions Properties of Distributions in the Exponential Family Generalized Linear Models Examples Estimation Introduction Example: Failure Times for Pressure Vessels Maximum Likelihood Estimation Poisson Regression Example Inference Introduction Sampling Distribution for Score Statistics Taylor Series Approximations Sampling Distribution for MLEs Log-Likelihood Ratio Statistic Sampling Distribution for the Deviance Hypothesis Testing Normal Linear Models Introduction Basic Results Multiple Linear Regression Analysis of Variance Analysis of Covariance General Linear Models Binary Variables and Logistic Regression Probability Distributions ...

  10. Acoustic emission linear pulse holography

    International Nuclear Information System (INIS)

    Collins, H.D.; Busse, L.J.; Lemon, D.K.


    This paper describes the emission linear pulse holography which produces a chronological linear holographic image of a flaw by utilizing the acoustic energy emitted during crack growth. A thirty two point sampling array is used to construct phase-only linear holograms of simulated acoustic emission sources on large metal plates. The concept behind the AE linear pulse holography is illustrated, and a block diagram of a data acquisition system to implement the concept is given. Array element spacing, synthetic frequency criteria, and lateral depth resolution are specified. A reference timing transducer positioned between the array and the inspection zone and which inititates the time-of-flight measurements is described. The results graphically illustrate the technique using a one-dimensional FFT computer algorithm (ie. linear backward wave) for an AE image reconstruction

  11. Linear and Generalized Linear Mixed Models and Their Applications

    CERN Document Server

    Jiang, Jiming


    This book covers two major classes of mixed effects models, linear mixed models and generalized linear mixed models, and it presents an up-to-date account of theory and methods in analysis of these models as well as their applications in various fields. The book offers a systematic approach to inference about non-Gaussian linear mixed models. Furthermore, it has included recently developed methods, such as mixed model diagnostics, mixed model selection, and jackknife method in the context of mixed models. The book is aimed at students, researchers and other practitioners who are interested

  12. Transport behavior of water molecules through two-dimensional nanopores

    International Nuclear Information System (INIS)

    Zhu, Chongqin; Li, Hui; Meng, Sheng


    Water transport through a two-dimensional nanoporous membrane has attracted increasing attention in recent years thanks to great demands in water purification and desalination applications. However, few studies have been reported on the microscopic mechanisms of water transport through structured nanopores, especially at the atomistic scale. Here we investigate the microstructure of water flow through two-dimensional model graphene membrane containing a variety of nanopores of different size by using molecular dynamics simulations. Our results clearly indicate that the continuum flow transits to discrete molecular flow patterns with decreasing pore sizes. While for pores with a diameter ≥15 Å water flux exhibits a linear dependence on the pore area, a nonlinear relationship between water flux and pore area has been identified for smaller pores. We attribute this deviation from linear behavior to the presence of discrete water flow, which is strongly influenced by the water-membrane interaction and hydrogen bonding between water molecules

  13. Decoupling Linear and Nonlinear Associations of Gene Expression

    KAUST Repository

    Itakura, Alan


    The FANTOM consortium has generated a large gene expression dataset of different cell lines and tissue cultures using the single-molecule sequencing technology of HeliscopeCAGE. This provides a unique opportunity to investigate novel associations between gene expression over time and different cell types. Here, we create a MatLab wrapper for a powerful and computationally intensive set of statistics known as Maximal Information Coefficient, and then calculate this statistic for a large, comprehensive dataset containing gene expression of a variety of differentiating tissues. We then distinguish between linear and nonlinear associations, and then create gene association networks. Following this analysis, we are then able to identify clusters of linear gene associations that then associate nonlinearly with other clusters of linearity, providing insight to much more complex connections between gene expression patterns than previously anticipated.

  14. Decoupling Linear and Nonlinear Associations of Gene Expression

    KAUST Repository

    Itakura, Alan


    The FANTOM consortium has generated a large gene expression dataset of different cell lines and tissue cultures using the single-molecule sequencing technology of HeliscopeCAGE. This provides a unique opportunity to investigate novel associations between gene expression over time and different cell types. Here, we create a MatLab wrapper for a powerful and computationally intensive set of statistics known as Maximal Information Coefficient, and then calculate this statistic for a large, comprehensive dataset containing gene expression of a variety of differentiating tissues. We then distinguish between linear and nonlinear associations, and then create gene association networks. Following this analysis, we are then able to identify clusters of linear gene associations that then associate nonlinearly with other clusters of linearity, providing insight to much more complex connections between gene expression patterns than previously anticipated.

  15. ALPS: A Linear Program Solver (United States)

    Ferencz, Donald C.; Viterna, Larry A.


    ALPS is a computer program which can be used to solve general linear program (optimization) problems. ALPS was designed for those who have minimal linear programming (LP) knowledge and features a menu-driven scheme to guide the user through the process of creating and solving LP formulations. Once created, the problems can be edited and stored in standard DOS ASCII files to provide portability to various word processors or even other linear programming packages. Unlike many math-oriented LP solvers, ALPS contains an LP parser that reads through the LP formulation and reports several types of errors to the user. ALPS provides a large amount of solution data which is often useful in problem solving. In addition to pure linear programs, ALPS can solve for integer, mixed integer, and binary type problems. Pure linear programs are solved with the revised simplex method. Integer or mixed integer programs are solved initially with the revised simplex, and the completed using the branch-and-bound technique. Binary programs are solved with the method of implicit enumeration. This manual describes how to use ALPS to create, edit, and solve linear programming problems. Instructions for installing ALPS on a PC compatible computer are included in the appendices along with a general introduction to linear programming. A programmers guide is also included for assistance in modifying and maintaining the program.

  16. Linear and quasi-linear equations of parabolic type

    CERN Document Server

    Ladyženskaja, O A; Ural′ceva, N N; Uralceva, N N


    Equations of parabolic type are encountered in many areas of mathematics and mathematical physics, and those encountered most frequently are linear and quasi-linear parabolic equations of the second order. In this volume, boundary value problems for such equations are studied from two points of view: solvability, unique or otherwise, and the effect of smoothness properties of the functions entering the initial and boundary conditions on the smoothness of the solutions.

  17. Single-molecule dynamics in nanofabricated traps (United States)

    Cohen, Adam


    The Anti-Brownian Electrokinetic trap (ABEL trap) provides a means to immobilize a single fluorescent molecule in solution, without surface attachment chemistry. The ABEL trap works by tracking the Brownian motion of a single molecule, and applying feedback electric fields to induce an electrokinetic motion that approximately cancels the Brownian motion. We present a new design for the ABEL trap that allows smaller molecules to be trapped and more information to be extracted from the dynamics of a single molecule than was previously possible. In particular, we present strategies for extracting dynamically fluctuating mobilities and diffusion coefficients, as a means to probe dynamic changes in molecular charge and shape. If one trapped molecule is good, many trapped molecules are better. An array of single molecules in solution, each immobilized without surface attachment chemistry, provides an ideal test-bed for single-molecule analyses of intramolecular dynamics and intermolecular interactions. We present a technology for creating such an array, using a fused silica plate with nanofabricated dimples and a removable cover for sealing single molecules within the dimples. With this device one can watch the shape fluctuations of single molecules of DNA or study cooperative interactions in weakly associating protein complexes.

  18. Electron attachment to indole and related molecules

    Energy Technology Data Exchange (ETDEWEB)

    Modelli, Alberto, E-mail: [Dipartimento di Chimica “G. Ciamician”, Universitá di Bologna, via Selmi 2, 40126 Bologna (Italy); Centro Interdipartimentale di Ricerca in Scienze Ambientali (CIRSA), Universitá di Bologna, via S. Alberto 163, 48123 Ravenna (Italy); Jones, Derek, E-mail: [ISOF, Istituto per la Sintesi Organica e la Fotoreattività, C.N.R., via Gobetti 101, 40129 Bologna (Italy); Pshenichnyuk, Stanislav A., E-mail: [Institute of Molecule and Crystal Physics, Ufa Research Centre, Russian Academy of Sciences, Prospekt Oktyabrya 151, 450075 Ufa (Russian Federation)


    Gas-phase formation of temporary negative ion states via resonance attachment of low-energy (0–6 eV) electrons into vacant molecular orbitals of indoline (I), indene (II), indole (III), 2-methylen-1,3,3-trimethylindoline (IV), and 2,3,3-trimethyl-indolenine (V) was investigated for the first time by electron transmission spectroscopy (ETS). The description of their empty-level structures was supported by density functional theory and Hartree-Fock calculations, using empirically calibrated linear equations to scale the calculated virtual orbital energies. Dissociative electron attachment spectroscopy (DEAS) was used to measure the fragment anion yields generated through dissociative decay channels of the parent molecular anions of compounds I-V, detected with a mass filter as a function of the incident electron energy in the 0–14 eV energy range. The vertical and adiabatic electron affinities were evaluated at the B3LYP/6-31+G(d) level as the anion/neutral total energy difference. The same theoretical method is also used for evaluation of the thermodynamic energy thresholds for production of the negative fragments observed in the DEA spectra. The loss of a hydrogen atom from the parent molecular anion ([M-H]{sup −}) provides the most intense signal in compounds I-IV. The gas-phase DEAS data can provide support for biochemical reaction mechanisms in vivo involving initial hydrogen abstraction from the nitrogen atom of the indole moiety, present in a variety of biologically important molecules.

  19. The Theory of Linear Prediction

    CERN Document Server

    Vaidyanathan, PP


    Linear prediction theory has had a profound impact in the field of digital signal processing. Although the theory dates back to the early 1940s, its influence can still be seen in applications today. The theory is based on very elegant mathematics and leads to many beautiful insights into statistical signal processing. Although prediction is only a part of the more general topics of linear estimation, filtering, and smoothing, this book focuses on linear prediction. This has enabled detailed discussion of a number of issues that are normally not found in texts. For example, the theory of vecto

  20. Correlation and simple linear regression. (United States)

    Zou, Kelly H; Tuncali, Kemal; Silverman, Stuart G


    In this tutorial article, the concepts of correlation and regression are reviewed and demonstrated. The authors review and compare two correlation coefficients, the Pearson correlation coefficient and the Spearman rho, for measuring linear and nonlinear relationships between two continuous variables. In the case of measuring the linear relationship between a predictor and an outcome variable, simple linear regression analysis is conducted. These statistical concepts are illustrated by using a data set from published literature to assess a computed tomography-guided interventional technique. These statistical methods are important for exploring the relationships between variables and can be applied to many radiologic studies.

  1. Non-linear optical materials

    CERN Document Server

    Saravanan, R


    Non-linear optical materials have widespread and promising applications, but the efforts to understand the local structure, electron density distribution and bonding is still lacking. The present work explores the structural details, the electron density distribution and the local bond length distribution of some non-linear optical materials. It also gives estimation of the optical band gap, the particle size, crystallite size, and the elemental composition from UV-Visible analysis, SEM, XRD and EDS of some non-linear optical materials respectively.

  2. Optimal control linear quadratic methods

    CERN Document Server

    Anderson, Brian D O


    This augmented edition of a respected text teaches the reader how to use linear quadratic Gaussian methods effectively for the design of control systems. It explores linear optimal control theory from an engineering viewpoint, with step-by-step explanations that show clearly how to make practical use of the material.The three-part treatment begins with the basic theory of the linear regulator/tracker for time-invariant and time-varying systems. The Hamilton-Jacobi equation is introduced using the Principle of Optimality, and the infinite-time problem is considered. The second part outlines the

  3. Study of the In2O3 molecule in the free state and in the crystal (United States)

    Kaplan, Ilya G.; Miranda, Ulises; Trakhtenberg, Leonid I.


    The nanomaterials based on the In2O3 molecule are widely used as catalysts and sensors among other applications. In the present study, we discuss the possibility of using nanoclusters of In2O3 as molecular photomotors. A comparative analysis of the electronic structure of the In2O3 molecule in the free state and in the crystal is performed. For the free In2O3 molecule the geometry of its lowest structures, V-shape and linear, was optimised at the CCSD(T) level, which is the most precise computational method applied up to date to study In2O3. Using experimental crystallographic data, we determined the geometry of In2O3 in the crystal. It has a zigzag, not symmetric structure and possesses a dipole moment with magnitude slightly smaller than that of the V-structure of the free molecule (the linear structure due to its symmetry has no dipole moment). According to the Natural Atomic population analysis, the chemical structure of the linear In2O3 can be represented as O = In-O-In = O; the V-shaped molecule has the similar double- and single-bond structure. The construction of nanoclusters from ´bricksʼ of In2O3 with geometry extracted from crystal (or nanoclusters extracted directly from crystal) and their use as photo-driven molecular motors are discussed.

  4. Model Hamiltonian Calculations of the Nonlinear Polarizabilities of Conjugated Molecules. (United States)

    Risser, Steven Michael

    This dissertation advances the theoretical knowledge of the nonlinear polarizabilities of conjugated molecules. The unifying feature of these molecules is an extended delocalized pi electron structure. The pi electrons dominate the electronic properties of the molecules, allowing prediction of molecular properties based on the treatment of just the pi electrons. Two separate pi electron Hamiltonians are used in the research. The principal Hamiltonian used is the non-interacting single-particle Huckel Hamiltonian, which replaces the Coulomb interaction among the pi electrons with a mean field interaction. The simplification allows for exact solution of the Hamiltonian for large molecules. The second Hamiltonian used for this research is the interacting multi-particle Pariser-Parr-Pople (PPP) Hamiltonian, which retains explicit Coulomb interactions. This limits exact solutions to molecules containing at most eight electrons. The molecular properties being investigated are the linear polarizability, and the second and third order hyperpolarizabilities. The hyperpolarizabilities determine the nonlinear optical response of materials. These molecular parameters are determined by two independent approaches. The results from the Huckel Hamiltonian are obtained through first, second and third order perturbation theory. The results from the PPP Hamiltonian are obtained by including the applied field directly in the Hamiltonian and determining the ground state energy at a series of field strengths. By fitting the energy to a polynomial in field strength, the polarizability and hyperpolarizabilities are determined. The Huckel Hamiltonian is used to calculate the third order hyperpolarizability of polyenes. These calculations were the first to show the average hyperpolarizability of the polyenes to be positive, and also to show the saturation of the hyperpolarizability. Comparison of these Huckel results to those from the PPP Hamiltonian shows the lack of explicit Coulomb

  5. Single Molecule Screening of Disease DNA Without Amplification

    Energy Technology Data Exchange (ETDEWEB)

    Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)


    was probed with fluorescently-labeled probe molecules and imaged. When only the probes were stained and hybridized in a vial, it had 6 orders of magnitude dynamic range with a detection limit of ~0.7 copy/cell. A second dye was added to lower the false positive levels. Although there was a sacrifice of two orders of magnitude in detection limit, the number of false positives was reduced to zero. HPV-16 DNA was also hybridized and detected on surface-tethered probes. When the entire human genomic DNA and HPV was labeled and hybridized, the detection limit was similar to that of one-color assay detected in capillary. However, non-specific adsorption was high, and the dynamic range was narrow because of saturation of the surface and electrostatic repulsion between hybridized targets on the surface. The second probe was introduced to lower non-specific adsorption, and the strategy succeeded in 4 orders of magnitude linear dynamic range in a log-log plot, along with 2.4 copies/cell detection limit. DNA extracts of cell lines that contained a known copy number of HPV-16 DNA were tested with the four strategies described above. The calculated numbers from observed molecule counts matched the known values. Results from the Pap test sample with added HPV DNA were similar to those of purified DNA, suggesting our method is compatible with the conventional Pap test sample collection method. Further optimization will be needed before this single molecule level detection and identification can actually be used in a real clinical lab, but it has good potential and applicability. Improvement such as automated imaging and scanning, more accurate data processing software as well as sensitive camera, should help increase the efficiency and throughput.

  6. Nonsequential double ionization of D2 molecules with intense 20-fs pulses

    DEFF Research Database (Denmark)

    Sakai, H.; Larsen, J.J.; Wendt-Larsen, I.


    The kinetic-energy distribution of D+ fragments obtained from the ionization of D2 molecules with intense 20-fs pulses includes a high-energy component extending up to ˜10 eV. These fragments are only present for linearly, or slightly elliptically, polarized light. Both the maximum kinetic...

  7. Global bending quantum number and the absence of monodromy in the HCN-CNH molecule

    NARCIS (Netherlands)

    Efstathiou, K; Joyeux, M; Sadovskií, D. A.

    We introduce and analyze a model system based on a deformation of a spherical pendulum that can be used to reproduce large amplitude bending vibrations of flexible triatomic molecules with two stable linear equilibria. On the basis of our model and the recent vibrational potential [ J. Chem. Phys.

  8. On the identification techniques for ionizing radiation structure breaks in the DNA molecule

    International Nuclear Information System (INIS)

    Kamluk, A.N.; Shirko, A.V.; Zhavarankau, I.S.


    In this paper, we propose a theoretical method for evaluation of the number and locations of single-strand breaks in DNA using a change in the passage of a longitudinal wave along the double helix. A linear chain of n interacting particles connected by a pair of springs is taken as a model of the DNA molecule. (authors)

  9. NMR of dielectrically oriented molecules

    International Nuclear Information System (INIS)

    Ruessink, B.H.


    General information on experimental aspects of EFNMR is given. It is shown that the complete 14 N quadrupole tensor (qct) of pyridine and pyrimidine in the liquid state is accessible to EFNMR. Information obtained about 17 O qct in liquid nitromethane, is compared with results from other techniques. The 33 S qct in liquid sulfolane is investigated. The EFNMR results, combined with those from spin-lattice relaxation time measurements and from Hartree-Fock-Slater MO calculations, allowed the complete assignment of the 33 S qct. The quadrupole coupling of both 10 B and 11 B in a carborane compound is investigated and, together with the results of spin-lattice relaxation time measurements, detailed information about the assignment of the boron qct's could be derived. EFNMR studies of apolar molecules are described. A limitation in EFNMR is the inhomogeneity (delta B) of the magnetic field, which is introduced by the use of non-spinning sample cells. A way out is the detection of zero quantum transitions, their widths being independent of delta B. The results and prospectives of this approach are shown for the simple three spin 1/2 system of acrylonitrile in which the small dipolar proton-proton couplings could be revealed via zero quantum transitions. (Auth.)

  10. Single-Molecule Stochastic Resonance

    Directory of Open Access Journals (Sweden)

    K. Hayashi


    Full Text Available Stochastic resonance (SR is a well-known phenomenon in dynamical systems. It consists of the amplification and optimization of the response of a system assisted by stochastic (random or probabilistic noise. Here we carry out the first experimental study of SR in single DNA hairpins which exhibit cooperatively transitions from folded to unfolded configurations under the action of an oscillating mechanical force applied with optical tweezers. By varying the frequency of the force oscillation, we investigate the folding and unfolding kinetics of DNA hairpins in a periodically driven bistable free-energy potential. We measure several SR quantifiers under varied conditions of the experimental setup such as trap stiffness and length of the molecular handles used for single-molecule manipulation. We find that a good quantifier of the SR is the signal-to-noise ratio (SNR of the spectral density of measured fluctuations in molecular extension of the DNA hairpins. The frequency dependence of the SNR exhibits a peak at a frequency value given by the resonance-matching condition. Finally, we carry out experiments on short hairpins that show how SR might be useful for enhancing the detection of conformational molecular transitions of low SNR.

  11. Laser spectroscopy on organic molecules. (United States)

    Imasaka, T


    Various laser spectrometric methods have been developed until now. Especially, laser fluorometry is most sensitive and is frequently combined with a separation technique such as capillary electrophoresis. For non-fluorescent compounds, photothermal spectrometry may be used instead. A diode laser is potentially useful for practical trace analysis, because of its low cost and long-term trouble-free operation. On the other hand, monochromaticity of the laser is essential in high-resolution spectrometry, e.g. in low temperature spectrometry providing a very sharp spectral feature. Closely-related compounds such as isomers can easily be differentiated, and information for assignment is obtained from the spectrum. Multiphoton ionization mass spectrometry is useful for soft ionization, providing additional information concerned with molecular weight and chemical structure. A short laser pulse with a sufficient energy is suitable for rapid heating of the solid surface. A matrix-assisted laser desorption/ion-ization technique is recently employed for introduction of a large biological molecule into a vacuum for mass analysis. In the future, laser spectrometry will be developed by a combination with state-of-the-art laser technology. In the 21st century, new laser spectrometry will be developed, which may be based on revolutionary ideas or unexpected discoveries. Such studies will open new frontiers in analytical laser spectroscopy.

  12. Cellular Automata Rules and Linear Numbers


    Nayak, Birendra Kumar; Sahoo, Sudhakar; Biswal, Sagarika


    In this paper, linear Cellular Automta (CA) rules are recursively generated using a binary tree rooted at "0". Some mathematical results on linear as well as non-linear CA rules are derived. Integers associated with linear CA rules are defined as linear numbers and the properties of these linear numbers are studied.

  13. Isotope separation using vibrationally excited molecules

    International Nuclear Information System (INIS)

    Woodroffe, J.A.; Keck, J.C.


    A system for isotope separation or enrichment wherein molecules of a selected isotope type in a flow of molecules of plural isotope types are vibrationally excited and collided with a background gas to provide enhanced diffusivity for the molecules of the selected isotope type permitting their separate collection. The system typically is for the enrichment of uranium using a uranium hexafluoride gas in combination with a noble gas such as argon. The uranium hexafluoride molecules having a specific isotope of uranium are vibrationally excited by laser radiation. The vibrational energy is converted to a translation energy upon collision with a particle of the background gas and the added translation energy enhances the diffusivity of the selected hexafluoride molecules facilitating its condensation on collection surfaces provided for that purpose. This process is periodically interrupted and the cryogenic flow halted to permit evaporation of the collected molecules to provide a distinct, enriched flow

  14. Individual Magnetic Molecules on Ultrathin Insulating Surfaces (United States)

    El Hallak, Fadi; Warner, Ben; Hirjibehedin, Cyrus


    Single molecule magnets have attracted ample interest because of their exciting magnetic and quantum properties. Recent studies have demonstrated that some of these molecules can be evaporated on surfaces without losing their magnetic properties [M. Mannini et al., Nature 468, 417, (2010)]. This remarkable progress enhances the chances of real world applications for these molecules. We present STM imaging and spectroscopy data on iron phthalocyanine molecules deposited on Cu(100) and on a Cu2N ultrathin insulating surface. These molecules have been shown to display a large magnetic anisotropy on another thin insulating surface, oxidized Cu(110) [N. Tsukahara et al., Phys. Rev. Lett. 102, 167203 (2009)]. By using a combination of elastic and inelastic electron tunnelling spectroscopy, we investigate the binding of the molecules to the surface and the impact that the surface has on their electronic and magnetic properties.

  15. Feedback systems for linear colliders

    CERN Document Server

    Hendrickson, L; Himel, Thomas M; Minty, Michiko G; Phinney, N; Raimondi, Pantaleo; Raubenheimer, T O; Shoaee, H; Tenenbaum, P G


    Feedback systems are essential for stable operation of a linear collider, providing a cost-effective method for relaxing tight tolerances. In the Stanford Linear Collider (SLC), feedback controls beam parameters such as trajectory, energy, and intensity throughout the accelerator. A novel dithering optimization system which adjusts final focus parameters to maximize luminosity contributed to achieving record performance in the 1997-98 run. Performance limitations of the steering feedback have been investigated, and improvements have been made. For the Next Linear Collider (NLC), extensive feedback systems are planned as an intregal part of the design. Feedback requiremetns for JLC (the Japanese Linear Collider) are essentially identical to NLC; some of the TESLA requirements are similar but there are significant differences. For NLC, algorithms which incorporate improvements upon the SLC implementation are being prototyped. Specialized systems for the damping rings, rf and interaction point will operate at hi...

  16. An introduction to linear algebra

    CERN Document Server

    Mirsky, L


    Rigorous, self-contained coverage of determinants, vectors, matrices and linear equations, quadratic forms, more. Elementary, easily readable account with numerous examples and problems at the end of each chapter.

  17. CLIC: developing a linear collider

    CERN Multimedia

    Laurent Guiraud


    Compact Linear Collider (CLIC) is a CERN project to provide high-energy electron-positron collisions. Instead of conventional radio-frequency klystrons, CLIC will use a low-energy, high-intensity primary beam to produce acceleration.

  18. 1988 linear accelerator conference proceedings

    International Nuclear Information System (INIS)


    This report contains papers presented at the 1988 Linear Accelerator Conference. A few topics covered are beam dynamics; beam transport; superconducting components; free electron lasers; ion sources; and klystron research

  19. CERN balances linear collider studies

    CERN Multimedia

    ILC Newsline


    The forces behind the two most mature proposals for a next-generation collider, the International Linear Collider (ILC) and the Compact Linear Collider (CLIC) study, have been steadily coming together, with scientists from both communities sharing ideas and information across the technology divide. In a support of cooperation between the two, CERN in Switzerland, where most CLIC research takes place, recently converted the project-specific position of CLIC Study Leader to the concept-based Linear Collider Study Leader.   The scientist who now holds this position, Steinar Stapnes, is charged with making the linear collider a viable option for CERN’s future, one that could include either CLIC or the ILC. The transition to more involve the ILC must be gradual, he said, and the redefinition of his post is a good start. Though not very much involved with superconducting radiofrequency (SRF) technology, where ILC researchers have made significant advances, CERN participates in many aspect...

  20. Linear Methods for Image Interpolation


    Pascal Getreuer


    We discuss linear methods for interpolation, including nearest neighbor, bilinear, bicubic, splines, and sinc interpolation. We focus on separable interpolation, so most of what is said applies to one-dimensional interpolation as well as N-dimensional separable interpolation.

  1. Ada Linear-Algebra Program (United States)

    Klumpp, A. R.; Lawson, C. L.


    Routines provided for common scalar, vector, matrix, and quaternion operations. Computer program extends Ada programming language to include linear-algebra capabilities similar to HAS/S programming language. Designed for such avionics applications as software for Space Station.

  2. Acoustic emission linear pulse holography (United States)

    Collins, H.D.; Busse, L.J.; Lemon, D.K.


    This device relates to the concept of and means for performing Acoustic Emission Linear Pulse Holography, which combines the advantages of linear holographic imaging and Acoustic Emission into a single non-destructive inspection system. This unique system produces a chronological, linear holographic image of a flaw by utilizing the acoustic energy emitted during crack growth. The innovation is the concept of utilizing the crack-generated acoustic emission energy to generate a chronological series of images of a growing crack by applying linear, pulse holographic processing to the acoustic emission data. The process is implemented by placing on a structure an array of piezoelectric sensors (typically 16 or 32 of them) near the defect location. A reference sensor is placed between the defect and the array.

  3. Functionalized linear and cyclic polyolefins

    Energy Technology Data Exchange (ETDEWEB)

    Tuba, Robert; Grubbs, Robert H.


    This invention relates to methods and compositions for preparing linear and cyclic polyolefins. More particularly, the invention relates to methods and compositions for preparing functionalized linear and cyclic polyolefins via olefin metathesis reactions. Polymer products produced via the olefin metathesis reactions of the invention may be utilized for a wide range of materials applications. The invention has utility in the fields of polymer and materials chemistry and manufacture.

  4. Some new ternary linear codes

    Directory of Open Access Journals (Sweden)

    Rumen Daskalov


    Full Text Available Let an $[n,k,d]_q$ code be a linear code of length $n$, dimension $k$ and minimum Hamming distance $d$ over $GF(q$. One of the most important problems in coding theory is to construct codes with optimal minimum distances. In this paper 22 new ternary linear codes are presented. Two of them are optimal. All new codes improve the respective lower bounds in [11].

  5. Explorative methods in linear models

    DEFF Research Database (Denmark)

    Høskuldsson, Agnar


    The author has developed the H-method of mathematical modeling that builds up the model by parts, where each part is optimized with respect to prediction. Besides providing with better predictions than traditional methods, these methods provide with graphic procedures for analyzing different feat...... features in data. These graphic methods extend the well-known methods and results of Principal Component Analysis to any linear model. Here the graphic procedures are applied to linear regression and Ridge Regression....

  6. Polarized Electrons for Linear Colliders

    International Nuclear Information System (INIS)

    Clendenin, J.


    Future electron-positron linear colliders require a highly polarized electron beam with a pulse structure that depends primarily on whether the acceleration utilizes warm or superconducting rf structures. The International Linear Collider (ILC) will use cold structures for the main linac. It is shown that a dc-biased polarized photoelectron source such as successfully used for the SLC can meet the charge requirements for the ILC micropulse with a polarization approaching 90%

  7. Structures, Bonding, and Energetics of Potential Triatomic Circumstellar Molecules Containing Group 15 and 16 Elements. (United States)

    Turner, Walter E; Agarwal, Jay; Schaefer, Henry F


    The recent discovery of PN in the oxygen-rich shell of the supergiant star VY Canis Majoris points to the formation of several triatomic molecules involving oxygen, nitrogen, and phosphorus; these are also intriguing targets for main-group synthetic inorganic chemistry. In this research, high-level ab initio electronic structure computations were conducted on the potential circumstellar molecule OPN and several of its heavier group 15 and 16 congeners (SPN, SePN, TePN, OPP, OPAs, and OPSb). For each congener, four isomers were examined. Optimized geometries were obtained with coupled cluster theory [CCSD(T)] using large Dunning basis sets [aug-cc-pVQZ, aug-cc-pV(Q+d)Z, and aug-cc-pVQZ-PP], and relative energies were determined at the complete basis set limit of CCSDT(Q) from focal point analyses. The linear phosphorus-centered molecules were consistently the lowest in energy of the group 15 congeners by at least 6 kcal mol(-1), resulting from double-triple and single-double bond resonances within the molecule. The linear nitrogen-centered molecules were consistently the lowest in energy of the group 16 congeners by at least 5 kcal mol(-1), due to the electronegative central nitrogen atom encouraging electron delocalization throughout the molecule. For OPN, OPP, and SPN, anharmonic vibrational frequencies and vibrationally corrected rotational constants are predicted; good agreement with available experimental data is observed.

  8. Zero-phonon-line emission of single molecules for applications in quantum information processing (United States)

    Kiraz, Alper; Ehrl, M.; Mustecaplioglu, O. E.; Hellerer, T.; Brauchle, C.; Zumbusch, A.


    A single photon source which generates transform limited single photons is highly desirable for applications in quantum optics. Transform limited emission guarantees the indistinguishability of the emitted single photons. This, in turn brings groundbreaking applications in linear optics quantum information processing within an experimental reach. Recently, self-assembled InAs quantum dots and trapped atoms have successfully been demonstrated as such sources for highly indistinguishable single photons. Here, we demonstrate that nearly transform limited zero-phonon-line (ZPL) emission from single molecules can be obtained by using vibronic excitation. Furthermore we report the results of coincidence detection experiments at the output of a Michelson-type interferometer. These experiments reveal Hong-Ou-Mandel correlations as a proof of the indistinguishability of the single photons emitted consecutively from a single molecule. Therefore, single molecules constitute an attractive alternative to single InAs quantum dots and trapped atoms for applications in linear optics quantum information processing. Experiments were performed with a home-built confocal microscope keeping the sample in a superfluid liquid Helium bath at 1.4K. We investigated terrylenediimide (TDI) molecules highly diluted in hexadecane (Shpol'skii matrix). A continuous wave single mode dye laser was used for excitation of vibronic transitions of individual molecules. From the integral fluorescence, the ZPL of single molecules was selected with a spectrally narrow interference filter. The ZPL emission was then sent to a scanning Fabry-Perot interferometer for linewidth measurements or a Michelson-type interferometer for coincidence detection.

  9. Single molecule detection, thermal fluctuation and life (United States)

    YANAGIDA, Toshio; ISHII, Yoshiharu


    Single molecule detection has contributed to our understanding of the unique mechanisms of life. Unlike artificial man-made machines, biological molecular machines integrate thermal noises rather than avoid them. For example, single molecule detection has demonstrated that myosin motors undergo biased Brownian motion for stepwise movement and that single protein molecules spontaneously change their conformation, for switching to interactions with other proteins, in response to thermal fluctuation. Thus, molecular machines have flexibility and efficiency not seen in artificial machines. PMID:28190869

  10. Nuclei quadrupole coupling constants in diatomic molecule

    International Nuclear Information System (INIS)

    Ivanov, A.I.; Rebane, T.K.


    An approximate relationship between the constants of quadrupole interaction of nuclei in a two-atom molecule is found. It enabled to establish proportionality of oscillatory-rotation corrections to these constants for both nuclei in the molecule. Similar results were obtained for the factors of electrical dipole-quadrupole screening of nuclei. Applicability of these relationships is proven by the example of lithium deuteride molecule. 4 refs., 1 tab

  11. Carbon chain molecules in interstellar clouds

    International Nuclear Information System (INIS)

    Winnewisser, G.; Walmsley, C.M.


    A survey of the distribution of long carbon chain molecules in interstellar clouds shows that their abundance is correlated. The various formation schemes for these molecules are discussed. It is concluded that the ion-molecule type formation mechanisms are more promising than their competitors. They have also the advantage of allowing predictions which can be tested by observations. Acetylene C 2 H 2 and diacetylene HCCCCH, may be very abundant in interstellar clouds. (Auth.)

  12. Aligned deposition and electrical measurements on single DNA molecules

    International Nuclear Information System (INIS)

    Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid


    A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)

  13. Experimental study on pion capture by hydrogen bound in molecules

    International Nuclear Information System (INIS)

    Horvath, D.; Aniol, K.A.; Entezami, F.; Measday, D.F.; Noble, A.J.; Stanislaus, S.; Virtue, C.J.


    An experiment was performed at TRIUMF to study the formation of pionic hydrogen atoms and molecules in solids, particularly in groups of organic molecules of slightly different structure in order to help further clarify the problem. The nuclear capture of pions by hydrogen was measured using the charge exchange of stopped pions. The coincident photons emitted by the decaying π 0 mesons were detected by TRIUMF's two large NaI spectrometers. New experimental results were obtained for the capture probability of stopped π - mesons in the nuclei of hydrogen atoms, chemically bound in molecules of some simple hydrides, acid anhydrides, and sugar isomers. A linear relation was found between pion capture in hydrogen and melting point in sugar isomers. The pion capture probability in acid anhydrides is fairly well described by a simple atomic capture model in which the capture probability on the hydrogen dramatically increases as the hydrogen atom is separated from the strongly electronegative C 2 O 3 group. Both effects are consistent with a correlation between pion capture and electron density on hydrogen atoms. (Author) (38 refs., 4 tabs., 7 figs.)

  14. Electron-molecule interactions and their applications

    CERN Document Server

    Christophorou, L G


    Electron-Molecule Interactions and Their Applications, Volume 2 provides a balanced and comprehensive account of electron-molecule interactions in dilute and dense gases and liquid media. This book consists of six chapters. Chapter 1 deals with electron transfer reactions, while Chapter 2 discusses electron-molecular positive-ion recombination. The electron motion in high-pressure gases and electron-molecule interactions from single- to multiple-collision conditions is deliberated in Chapter 3. In Chapter 4, knowledge on electron-molecule interactions in gases is linked to that on similar proc

  15. Conserved water molecules in bacterial serine hydroxymethyltransferases. (United States)

    Milano, Teresa; Di Salvo, Martino Luigi; Angelaccio, Sebastiana; Pascarella, Stefano


    Water molecules occurring in the interior of protein structures often are endowed with key structural and functional roles. We report the results of a systematic analysis of conserved water molecules in bacterial serine hydroxymethyltransferases (SHMTs). SHMTs are an important group of pyridoxal-5'-phosphate-dependent enzymes that catalyze the reversible conversion of l-serine and tetrahydropteroylglutamate to glycine and 5,10-methylenetetrahydropteroylglutamate. The approach utilized in this study relies on two programs, ProACT2 and WatCH. The first software is able to categorize water molecules in a protein crystallographic structure as buried, positioned in clefts or at the surface. The other program finds, in a set of superposed homologous proteins, water molecules that occur approximately in equivalent position in each of the considered structures. These groups of molecules are referred to as 'clusters' and represent structurally conserved water molecules. Several conserved clusters of buried or cleft water molecules were found in the set of 11 bacterial SHMTs we took into account for this work. The majority of these clusters were not described previously. Possible structural and functional roles for the conserved water molecules are envisaged. This work provides a map of the conserved water molecules helpful for deciphering SHMT mechanism and for rational design of molecular engineering experiments. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  16. Energy storage and redistribution in molecules

    International Nuclear Information System (INIS)

    Hinze, J.


    This book presents information on the following topics: chemistry and spectroscopy of molecules at high levels of excitation; energy and phase randomization in large molecules as probed by laser spectroscopy; intramolecular processes in isolated polyatomic molecules; pulse-probe measurements in low-temperature, low-pressure SF 6 ; the photodissociation dynamics of H 2 S and CF 3 NO; photofragment spectroscopy of the NO 2 dissociation; preparation, laser spectroscopy and predissociation of alkali dimers in supersonic nozzle beams; excited states of small molecules - collisional quenching and photodissociation; quantum-state-resolved scattering of lithium hydride; and molecular negative ions

  17. Structure formation in bis(terpyridine) derivative adlayers: molecule-substrate versus molecule-molecule interactions. (United States)

    Hoster, Harry E; Roos, Matthias; Breitruck, Achim; Meier, Christoph; Tonigold, Katrin; Waldmann, Thomas; Ziener, Ulrich; Landfester, Katharina; Behm, R Jürgen


    The influence of the substrate and the deposition conditions-vapor deposition versus deposition from solution-on the structures formed upon self-assembly of deposited bis(terpyridine) derivative (2,4'-BTP) monolayers on different hexagonal substrates, including highly oriented pyrolytic graphite (HOPG), Au(111), and (111)-oriented Ag thin films, was investigated by high-resolution scanning tunneling microscopy and by model calculations of the intermolecular energies and the lateral corrugation of the substrate-adsorbate interaction. Similar quasi-quadratic network structures with almost the same lattice constants obtained on all substrates are essentially identical to the optimum configuration expected from an optimization of the adlayer structure with C-H...N-type bridging bonds as a structure-determining factor, which underlines a key role of the intermolecular interactions in adlayer order. Slight distortions from the optimum values to form commensurate adlayer structures on the metal substrates and the preferential orientation of the adlayer with respect to the substrate are attributed to the substrate-adsorbate interactions, specifically, the lateral corrugation in the substrate-adsorbate interaction upon lateral displacement and rotation of the adsorbed BTP molecules. The fact that similar adlayer structures are obtained on HOPG under ultrahigh vacuum conditions (solid|gas interface) and on HOPG in trichlorobenzene (solid|liquid interface) indicates that the intermolecular interactions are not severely affected by the solvent.

  18. Primordial black holes in linear and non-linear regimes

    Energy Technology Data Exchange (ETDEWEB)

    Allahyari, Alireza; Abolhasani, Ali Akbar [Department of Physics, Sharif University of Technology, Tehran (Iran, Islamic Republic of); Firouzjaee, Javad T., E-mail:, E-mail: [School of Astronomy, Institute for Research in Fundamental Sciences (IPM), P.O. Box 19395-5531, Tehran (Iran, Islamic Republic of)


    We revisit the formation of primordial black holes (PBHs) in the radiation-dominated era for both linear and non-linear regimes, elaborating on the concept of an apparent horizon. Contrary to the expectation from vacuum models, we argue that in a cosmological setting a density fluctuation with a high density does not always collapse to a black hole. To this end, we first elaborate on the perturbation theory for spherically symmetric space times in the linear regime. Thereby, we introduce two gauges. This allows to introduce a well defined gauge-invariant quantity for the expansion of null geodesics. Using this quantity, we argue that PBHs do not form in the linear regime irrespective of the density of the background. Finally, we consider the formation of PBHs in non-linear regimes, adopting the spherical collapse picture. In this picture, over-densities are modeled by closed FRW models in the radiation-dominated era. The difference of our approach is that we start by finding an exact solution for a closed radiation-dominated universe. This yields exact results for turn-around time and radius. It is important that we take the initial conditions from the linear perturbation theory. Additionally, instead of using uniform Hubble gauge condition, both density and velocity perturbations are admitted in this approach. Thereby, the matching condition will impose an important constraint on the initial velocity perturbations δ {sup h} {sub 0} = −δ{sub 0}/2. This can be extended to higher orders. Using this constraint, we find that the apparent horizon of a PBH forms when δ > 3 at turn-around time. The corrections also appear from the third order. Moreover, a PBH forms when its apparent horizon is outside the sound horizon at the re-entry time. Applying this condition, we infer that the threshold value of the density perturbations at horizon re-entry should be larger than δ {sub th} > 0.7.

  19. Spectroscopy and Chemistry of Cold Molecules (United States)

    Momose, Takamasa


    Molecules at low temperatures are expected to behave quite differently from those at high temperatures because pronounced quantum effects emerge from thermal averages. Even at 10 K, a significant enhancement of reaction cross section is expected due to tunneling and resonance effects. Chemistry at this temperature is very important in order to understand chemical reactions in interstellar molecular clouds. At temperatures lower than 1 K, collisions and intermolecular interactions become qualitatively different from those at high temperatures because of the large thermal de Broglie wavelength of molecules. Collisions at these temperatures must be treated as the interference of molecular matter waves, but not as hard sphere collisions. A Bose-Einstein condensate is a significant state of matter as a result of coherent matter wave interaction. Especially, dense para-H_2 molecules are predicted to become a condensate even around 1 K. A convenient method to investigate molecules around 1 K is to dope molecules in cold matrices. Among various matrices, quantum hosts such as solid para-H_2 and superfluid He nano-droplets have been proven to be an excellent host for high-resolution spectroscopy. Rovibrational motion of molecules in these quantum hosts is well quantized on account of the weak interactions and the softness of quantum environment. The linewidths of infrared spectra of molecules in the quantum hosts are extremely narrow compared with those in other matrices. The sharp linewidths allow us to resolve fine spectral structures originated in subtle interactions between guest and host molecules. In this talk, I will describe how the splitting and lineshape of high-resolution spectra of molecules in quantum hosts give us new information on the static and dynamical interactions of molecules in quantum medium. The topics include dynamical response of superfluid environment upon rotational excitation, and possible superfluid phase of para-H_2 clusters. I will also

  20. Rydberg excitation of neutral nitric oxide molecules in strong UV and near-IR laser fields

    International Nuclear Information System (INIS)

    Lv Hang; Zhang Jun-Feng; Zuo Wan-Long; Xu Hai-Feng; Jin Ming-Xing; Ding Da-Jun


    Rydberg state excitations of neutral nitric oxide molecules are studied in strong ultraviolet (UV) and near-infra-red (IR) laser fields using a linear time-of-flight (TOF) mass spectrometer with the pulsed electronic field ionization method. The yield of Rydberg molecules is measured as a function of laser intensity and ellipticity, and the results in UV laser fields are compared with those in near-IR laser fields. The present study provides the first experimental evidence of neutral Rydberg molecules surviving in a strong laser field. The results indicate that a rescattering-after-tunneling process is the main contribution to the formation of Rydberg molecules in strong near-IR laser fields, while multi-photon excitation may play an important role in the strong UV laser fields. (paper)

  1. Surface-enhanced resonance Raman scattering spectroscopy of single R6G molecules

    Institute of Scientific and Technical Information of China (English)

    Zhou Zeng-Hui; Liu Li; Wang Gui-Ying; Xu Zhi-Zhan


    Surface-enhanced resonance Raman scattering (SERRS) of Rhodamine 6G (R6G) adsorbed on colloidal silver clusters has been studied. Based on the great enhancement of the Raman signal and the quench of the fluorescence, the SERRS spectra of R6G were recorded for the samples of dye colloidal solution with different concentrations. Spectral inhomogeneity behaviours from single molecules in the dried sample films were observed with complementary evidences, such as spectral polarization, spectral diffusion, intensity fluctuation of vibrational lines and even "breathing" of the molecules. Sequential spectra observed from a liquid sample with an average of 0.3 dye molecules in the probed volume exhibited the expected Poisson distribution for actually measuring 0, 1 or 2 molecules. Difference between the SERRS spectra of R6G excited by linearly and circularly polarized light were experimentally measured.

  2. Tunneling induced dark states and the controllable resonance fluorescence spectrum in quantum dot molecules

    International Nuclear Information System (INIS)

    Tian, Si-Cong; Tong, Cun-Zhu; Ning, Yong-Qiang; Qin, Li; Liu, Yun; Wan, Ren-Gang


    Optical spectroscopy, a powerful tool for probing and manipulating quantum dots (QDs), has been used to investigate the resonance fluorescence spectrum from linear triple quantum dot molecules controlled by tunneling, using atomic physics methods. Interesting features such as quenching and narrowing of the fluorescence are observed. In such molecules the tunneling between the quantum dots can also induce a dark state. The results are explained by the transition properties of the dressed states generated by the coupling of the laser and the tunneling. Unlike the atomic system, in such quantum dot molecules quantum coherence can be induced using tunneling, requiring no coupling lasers, which will allow tunneling controllable quantum dot molecules to be applied to quantum optics and photonics. (paper)

  3. Nanoscale contacts to organic molecules based on layered semiconductor substrates

    Energy Technology Data Exchange (ETDEWEB)

    Strobel, Sebastian


    This work reports on the integration of organic molecules as nanoelectronic device units on semiconductor substrates. Two novel preparation methods for sub-10-nm separated metal electrodes are presented using current microelectronics process technology. The first method utilises AlGaAs/GaAs heterostructures grown by molecular beam epitaxy (MBE) as mold to create planar metal electrodes employing a newly developed, high resolution nanotransfer printing (nTP) process. The second method uses commercially available Silicon-on-Insulator (SOI) substrates as base material for the fabrication of nanogap electrode devices. This sandwich-like material stack consists of a silicon substrate, a thin silicon oxide layer, and a capping silicon layer on top. Electronic transport measurements verified their excellent electrical properties at liquid helium temperatures. Specifically tailored nanogap devices featured an electrode insulation in the GW range even up to room temperature as well as within aqueous electrolyte solution. Finally, the well defined layer architecture facilitated the fabrication of electrodes with gap separations below-10-nm to be directly bridged by molecules. Approximately 12-nm-long conjugated molecules with extended -electron system were assembled onto the devices from solution. A large conductance gap was observed with a steep increase in current at a bias voltage of V{sub T}{approx}{+-}1.5 V. Theoretical calculations based on density functional theory and non-equilibrium Green's function formalism confirmed the measured non-linear IV-characteristics qualitatively and lead to the conclusion that the conductance gap mainly originates from the oxygen containing linker. Temperature dependent investigations of the conductance indicated a hopping charge transport mechanism through the central part of the molecule for bias voltages near but below V{sub T}. (orig.)

  4. Dynamics of elliptic breathers in saturable nonlinear media with linear anisotropy

    International Nuclear Information System (INIS)

    Liang, Guo; Guo, Qi; Shou, Qian; Ren, Zhanmei


    We have introduced a class of dynamic elliptic breathers in saturable nonlinear media with linear anisotropy. Two kinds of evolution behavior for the dynamic breathers, rotations and molecule-like librations, are both predicted by the variational approach, and confirmed in numerical simulations. The dynamic elliptic breathers can rotate even though they have no initial orbital angular momentum (OAM). As the media are linear anisotropic, OAM is no longer conserved, and hence the angular velocity is not constant but a periodic function of the propagation distance. When the linear anisotropy is large enough, the dynamic elliptic breathers librate like molecules. The dynamic elliptic breathers are present in media with not only saturable nonlinearity but also nonlocal nonlinearity; indeed, they are universal in nonlinear media with linear anisotropy. (paper)

  5. Cavity sideband cooling of trapped molecules

    NARCIS (Netherlands)

    Kowalewski, Markus; Morigi, Giovanna; Pinkse, Pepijn Willemszoon Harry; de Vivie-Riedle, Regina


    The efficiency of cavity sideband cooling of trapped molecules is theoretically investigated for the case in which the infrared transition between two rovibrational states is used as a cycling transition. The molecules are assumed to be trapped either by a radiofrequency or optical trapping

  6. Hydrogen storage by polylithiated molecules and nanostructures

    NARCIS (Netherlands)

    Er, S.; de Wijs, Gilles A.; Brocks, G.


    We study polylithiated molecules as building blocks for hydrogen storage materials, using first-principles calculations. CLi4 and OLi2 bind 12 and 10 hydrogen molecules, respectively, with an average binding energy of 0.10 and 0.13 eV, leading to gravimetric densities of 37.8 and 40.3 wt % of H2.

  7. Transport through a Single Octanethiol Molecule

    NARCIS (Netherlands)

    Kockmann, D.; Poelsema, Bene; Zandvliet, Henricus J.W.


    Octanethiol molecules adsorbed on Pt chains are studied with scanning tunneling microscopy and spectroscopy at 77 K. The head of the octanethiol binds to a Pt atom and the tail is lying flat down on the chain. Open-loop current time traces reveal that the molecule wags its tail and attaches to the

  8. The First Quantum Theory of Molecules

    Indian Academy of Sciences (India)

    IAS Admin

    rotational energies of diatomic molecules. That theory was ... resent the intensity of light emitted by a black body as a function of ... by the vibrational motion of its parts”. Bjerrum was .... −1/4; despite the fact that no molecule is a rigid rotor,.

  9. The MHC molecules of nonmammalian vertebrates

    DEFF Research Database (Denmark)

    Kaufman, J; Skjoedt, K; Salomonsen, J


    class II distribution. The axolotl has a very poor immune response (as though there are no helper T cells), a wide class II distribution and, for most animals, no cell surface class I molecule. It would be enlightening to understand both the mechanisms for the regulation of the MHC molecules during...

  10. Controlled contact to a C-60 molecule

    DEFF Research Database (Denmark)

    Neel, N.; Kröger, J.; Limot, L.


    The tip of a low-temperature scanning tunneling microscope is approached towards a C-60 molecule adsorbed at a pentagon-hexagon bond on Cu(100) to form a tip-molecule contact. The conductance rapidly increases to approximate to 0.25 conductance quanta in the transition region from tunneling to co...

  11. Multiple photon infrared processes in polyatomic molecules

    International Nuclear Information System (INIS)

    Harrison, R.G.; Butcher, S.R.


    This paper reviews current understanding of the process of multiple photon excitation and dissociation of polyatomic molecules, whereby in the presence of an intense infrared laser field a molecule may absorb upwards of 30 photons. The application of this process to new photochemistry and in particular laser isotope separation is also discussed. (author)

  12. Molecule-oriented programming in Java

    NARCIS (Netherlands)

    Bergstra, J.A.


    Molecule-oriented programming is introduced as a programming style carrying some perspective for Java. A sequence of examples is provided. Supporting the development of the molecule-oriented programming style several matters are introduced and developed: profile classes allowing the representation

  13. A prototype storage ring for neutral molecules

    NARCIS (Netherlands)

    Crompvoets, F. M. H.; Bethlem, H. L.; Jongma, R.T.; Meijer, G.


    The ability to cool and manipulate atoms with light has yielded atom interferometry, precision spectroscopy, Bose-Einstein condensates and atom lasers. The extension of controlled manipulation to molecules is expected to be similarly rewarding, but molecules are not as amenable to manipulation by

  14. A storage ring for neutral molecules

    NARCIS (Netherlands)

    Crompvoets, F.M.H.


    Time-varying inhomogeneous electric fields can be used to manipulate the motion of neutral molecules in phase-space, i.e., position-momentum space, via their electric dipole moment. A theoretical background is given on the motion of the molecules in phase-space. As the forces exerted on the

  15. Phase properties of elastic waves in systems constituted of adsorbed diatomic molecules on the (001) surface of a simple cubic crystal (United States)

    Deymier, P. A.; Runge, K.


    A Green's function-based numerical method is developed to calculate the phase of scattered elastic waves in a harmonic model of diatomic molecules adsorbed on the (001) surface of a simple cubic crystal. The phase properties of scattered waves depend on the configuration of the molecules. The configurations of adsorbed molecules on the crystal surface such as parallel chain-like arrays coupled via kinks are used to demonstrate not only linear but also non-linear dependency of the phase on the number of kinks along the chains. Non-linear behavior arises for scattered waves with frequencies in the vicinity of a diatomic molecule resonance. In the non-linear regime, the variation in phase with the number of kinks is formulated mathematically as unitary matrix operations leading to an analogy between phase-based elastic unitary operations and quantum gates. The advantage of elastic based unitary operations is that they are easily realizable physically and measurable.

  16. The linear-non-linear frontier for the Goldstone Higgs

    International Nuclear Information System (INIS)

    Gavela, M.B.; Saa, S.; Kanshin, K.; Machado, P.A.N.


    The minimal SO(5)/SO(4) σ-model is used as a template for the ultraviolet completion of scenarios in which the Higgs particle is a low-energy remnant of some high-energy dynamics, enjoying a (pseudo) Nambu-Goldstone-boson ancestry. Varying the σ mass allows one to sweep from the perturbative regime to the customary non-linear implementations. The low-energy benchmark effective non-linear Lagrangian for bosons and fermions is obtained, determining as well the operator coefficients including linear corrections. At first order in the latter, three effective bosonic operators emerge which are independent of the explicit soft breaking assumed. The Higgs couplings to vector bosons and fermions turn out to be quite universal: the linear corrections are proportional to the explicit symmetry-breaking parameters. Furthermore, we define an effective Yukawa operator which allows a simple parametrization and comparison of different heavy-fermion ultraviolet completions. In addition, one particular fermionic completion is explored in detail, obtaining the corresponding leading low-energy fermionic operators. (orig.)

  17. Advanced statistics: linear regression, part II: multiple linear regression. (United States)

    Marill, Keith A


    The applications of simple linear regression in medical research are limited, because in most situations, there are multiple relevant predictor variables. Univariate statistical techniques such as simple linear regression use a single predictor variable, and they often may be mathematically correct but clinically misleading. Multiple linear regression is a mathematical technique used to model the relationship between multiple independent predictor variables and a single dependent outcome variable. It is used in medical research to model observational data, as well as in diagnostic and therapeutic studies in which the outcome is dependent on more than one factor. Although the technique generally is limited to data that can be expressed with a linear function, it benefits from a well-developed mathematical framework that yields unique solutions and exact confidence intervals for regression coefficients. Building on Part I of this series, this article acquaints the reader with some of the important concepts in multiple regression analysis. These include multicollinearity, interaction effects, and an expansion of the discussion of inference testing, leverage, and variable transformations to multivariate models. Examples from the first article in this series are expanded on using a primarily graphic, rather than mathematical, approach. The importance of the relationships among the predictor variables and the dependence of the multivariate model coefficients on the choice of these variables are stressed. Finally, concepts in regression model building are discussed.

  18. The linear-non-linear frontier for the Goldstone Higgs

    Energy Technology Data Exchange (ETDEWEB)

    Gavela, M.B.; Saa, S. [IFT-UAM/CSIC, Universidad Autonoma de Madrid, Departamento de Fisica Teorica y Instituto de Fisica Teorica, Madrid (Spain); Kanshin, K. [Universita di Padova, Dipartimento di Fisica e Astronomia ' G. Galilei' , Padua (Italy); INFN, Padova (Italy); Machado, P.A.N. [IFT-UAM/CSIC, Universidad Autonoma de Madrid, Departamento de Fisica Teorica y Instituto de Fisica Teorica, Madrid (Spain); Fermi National Accelerator Laboratory, Theoretical Physics Department, Batavia, IL (United States)


    The minimal SO(5)/SO(4) σ-model is used as a template for the ultraviolet completion of scenarios in which the Higgs particle is a low-energy remnant of some high-energy dynamics, enjoying a (pseudo) Nambu-Goldstone-boson ancestry. Varying the σ mass allows one to sweep from the perturbative regime to the customary non-linear implementations. The low-energy benchmark effective non-linear Lagrangian for bosons and fermions is obtained, determining as well the operator coefficients including linear corrections. At first order in the latter, three effective bosonic operators emerge which are independent of the explicit soft breaking assumed. The Higgs couplings to vector bosons and fermions turn out to be quite universal: the linear corrections are proportional to the explicit symmetry-breaking parameters. Furthermore, we define an effective Yukawa operator which allows a simple parametrization and comparison of different heavy-fermion ultraviolet completions. In addition, one particular fermionic completion is explored in detail, obtaining the corresponding leading low-energy fermionic operators. (orig.)

  19. Extracting Models in Single Molecule Experiments (United States)

    Presse, Steve


    Single molecule experiments can now monitor the journey of a protein from its assembly near a ribosome to its proteolytic demise. Ideally all single molecule data should be self-explanatory. However data originating from single molecule experiments is particularly challenging to interpret on account of fluctuations and noise at such small scales. Realistically, basic understanding comes from models carefully extracted from the noisy data. Statistical mechanics, and maximum entropy in particular, provide a powerful framework for accomplishing this task in a principled fashion. Here I will discuss our work in extracting conformational memory from single molecule force spectroscopy experiments on large biomolecules. One clear advantage of this method is that we let the data tend towards the correct model, we do not fit the data. I will show that the dynamical model of the single molecule dynamics which emerges from this analysis is often more textured and complex than could otherwise come from fitting the data to a pre-conceived model.

  20. Molecules cooled below the Doppler limit (United States)

    Truppe, S.; Williams, H. J.; Hambach, M.; Caldwell, L.; Fitch, N. J.; Hinds, E. A.; Sauer, B. E.; Tarbutt, M. R.


    Magneto-optical trapping and sub-Doppler cooling have been essential to most experiments with quantum degenerate gases, optical lattices, atomic fountains and many other applications. A broad set of new applications await ultracold molecules, and the extension of laser cooling to molecules has begun. A magneto-optical trap (MOT) has been demonstrated for a single molecular species, SrF, but the sub-Doppler temperatures required for many applications have not yet been reached. Here we demonstrate a MOT of a second species, CaF, and we show how to cool these molecules to 50 μK, well below the Doppler limit, using a three-dimensional optical molasses. These ultracold molecules could be loaded into optical tweezers to trap arbitrary arrays for quantum simulation, launched into a molecular fountain for testing fundamental physics, and used to study collisions and chemistry between atoms and molecules at ultracold temperatures.

  1. Linearization: Geometric, Complex, and Conditional

    Directory of Open Access Journals (Sweden)

    Asghar Qadir


    Full Text Available Lie symmetry analysis provides a systematic method of obtaining exact solutions of nonlinear (systems of differential equations, whether partial or ordinary. Of special interest is the procedure that Lie developed to transform scalar nonlinear second-order ordinary differential equations to linear form. Not much work was done in this direction to start with, but recently there have been various developments. Here, first the original work of Lie (and the early developments on it, and then more recent developments based on geometry and complex analysis, apart from Lie’s own method of algebra (namely, Lie group theory, are reviewed. It is relevant to mention that much of the work is not linearization but uses the base of linearization.

  2. Window observers for linear systems

    Directory of Open Access Journals (Sweden)

    Utkin Vadim


    Full Text Available Given a linear system x ˙ = A x + B u with output y = C x and a window function ω ( t , i.e., ∀ t , ω ( t ∈ {0,1 }, and assuming that the window function is Lebesgue measurable, we refer to the following observer, x ˆ = A x + B u + ω ( t L C ( x − x ˆ as a window observer. The stability issue is treated in this paper. It is proven that for linear time-invariant systems, the window observer can be stabilized by an appropriate design under a very mild condition on the window functions, albeit for linear time-varying system, some regularity of the window functions is required to achieve observer designs with the asymptotic stability. The corresponding design methods are developed. An example is included to illustrate the possible applications

  3. Topics in quaternion linear algebra

    CERN Document Server

    Rodman, Leiba


    Quaternions are a number system that has become increasingly useful for representing the rotations of objects in three-dimensional space and has important applications in theoretical and applied mathematics, physics, computer science, and engineering. This is the first book to provide a systematic, accessible, and self-contained exposition of quaternion linear algebra. It features previously unpublished research results with complete proofs and many open problems at various levels, as well as more than 200 exercises to facilitate use by students and instructors. Applications presented in the book include numerical ranges, invariant semidefinite subspaces, differential equations with symmetries, and matrix equations. Designed for researchers and students across a variety of disciplines, the book can be read by anyone with a background in linear algebra, rudimentary complex analysis, and some multivariable calculus. Instructors will find it useful as a complementary text for undergraduate linear algebra courses...

  4. Towards the International Linear Collider

    International Nuclear Information System (INIS)

    Lopez-Fernandez, Ricardo


    The broad physics potential of e+e- linear colliders was recognized by the high energy physics community right after the end of LEP in 2000. In 2007, the Large Hadron Collider (LHC) now under construction at CERN will obtain its first collisions. The LHC, colliding protons with protons at 14 TeV, will discover a standard model Higgs boson over the full potential mass range, and should be sensitive to new physics into the several TeV range. The program for the Linear Collider (LC) will be set in the context of the discoveries made at the LHC. All the proposals for a Linear Collider will extend the discoveries and provide a wealth of measurements that are essential for giving deeper understanding of their meaning, and pointing the way to further evolution of particle physics in the future. For the mexican groups is the right time to join such an effort

  5. Linear Synchronous Motor Repeatability Tests

    International Nuclear Information System (INIS)

    Ward, C.R.


    A cart system using linear synchronous motors was being considered for the Plutonium Immobilization Plant (PIP). One of the applications in the PIP was the movement of a stack of furnace trays, filled with the waste form (pucks) from a stacking/unstacking station to several bottom loaded furnaces. A system was ordered to perform this function in the PIP Ceramic Prototype Test Facility (CPTF). This system was installed and started up in SRTC prior to being installed in the CPTF. The PIP was suspended and then canceled after the linear synchronous motor system was started up. This system was used to determine repeatability of a linear synchronous motor cart system for the Modern Pit Facility

  6. Linearly polarized photons at ELSA

    Energy Technology Data Exchange (ETDEWEB)

    Eberhardt, Holger [Physikalisches Institut, Universitaet Bonn (Germany)


    To investigate the nucleon resonance regime in meson photoproduction, double polarization experiments are currently performed at the electron accelerator ELSA in Bonn. The experiments make use of a polarized target and circularly or linearly polarized photon beams. Linearly polarized photons are produced by coherent bremsstrahlung from an accurately aligned diamond crystal. The orientation of the crystal with respect to the electron beam is measured using the Stonehenge-Technique. Both, the energy of maximum polarization and the plane of polarization, can be deliberately chosen for the experiment. The linearly polarized beam provides the basis for the measurement of azimuthal beam asymmetries, such as {sigma} (unpolarized target) and G (polarized target). These observables are extracted in various single and multiple meson photoproduction channels.

  7. Linear programming foundations and extensions

    CERN Document Server

    Vanderbei, Robert J


    Linear Programming: Foundations and Extensions is an introduction to the field of optimization. The book emphasizes constrained optimization, beginning with a substantial treatment of linear programming, and proceeding to convex analysis, network flows, integer programming, quadratic programming, and convex optimization. The book is carefully written. Specific examples and concrete algorithms precede more abstract topics. Topics are clearly developed with a large number of numerical examples worked out in detail. Moreover, Linear Programming: Foundations and Extensions underscores the purpose of optimization: to solve practical problems on a computer. Accordingly, the book is coordinated with free efficient C programs that implement the major algorithms studied: -The two-phase simplex method; -The primal-dual simplex method; -The path-following interior-point method; -The homogeneous self-dual methods. In addition, there are online JAVA applets that illustrate various pivot rules and variants of the simplex m...

  8. Uniqueness theorems in linear elasticity

    CERN Document Server

    Knops, Robin John


    The classical result for uniqueness in elasticity theory is due to Kirchhoff. It states that the standard mixed boundary value problem for a homogeneous isotropic linear elastic material in equilibrium and occupying a bounded three-dimensional region of space possesses at most one solution in the classical sense, provided the Lame and shear moduli, A and J1 respectively, obey the inequalities (3 A + 2 J1) > 0 and J1>O. In linear elastodynamics the analogous result, due to Neumann, is that the initial-mixed boundary value problem possesses at most one solution provided the elastic moduli satisfy the same set of inequalities as in Kirchhoffs theorem. Most standard textbooks on the linear theory of elasticity mention only these two classical criteria for uniqueness and neglect altogether the abundant literature which has appeared since the original publications of Kirchhoff. To remedy this deficiency it seems appropriate to attempt a coherent description ofthe various contributions made to the study of uniquenes...

  9. Bayes linear statistics, theory & methods

    CERN Document Server

    Goldstein, Michael


    Bayesian methods combine information available from data with any prior information available from expert knowledge. The Bayes linear approach follows this path, offering a quantitative structure for expressing beliefs, and systematic methods for adjusting these beliefs, given observational data. The methodology differs from the full Bayesian methodology in that it establishes simpler approaches to belief specification and analysis based around expectation judgements. Bayes Linear Statistics presents an authoritative account of this approach, explaining the foundations, theory, methodology, and practicalities of this important field. The text provides a thorough coverage of Bayes linear analysis, from the development of the basic language to the collection of algebraic results needed for efficient implementation, with detailed practical examples. The book covers:The importance of partial prior specifications for complex problems where it is difficult to supply a meaningful full prior probability specification...

  10. Scalar-tensor linear inflation

    Energy Technology Data Exchange (ETDEWEB)

    Artymowski, Michał [Institute of Physics, Jagiellonian University, Łojasiewicza 11, 30-348 Kraków (Poland); Racioppi, Antonio, E-mail:, E-mail: [National Institute of Chemical Physics and Biophysics, Rävala 10, 10143 Tallinn (Estonia)


    We investigate two approaches to non-minimally coupled gravity theories which present linear inflation as attractor solution: a) the scalar-tensor theory approach, where we look for a scalar-tensor theory that would restore results of linear inflation in the strong coupling limit for a non-minimal coupling to gravity of the form of f (φ) R /2; b) the particle physics approach, where we motivate the form of the Jordan frame potential by loop corrections to the inflaton field. In both cases the Jordan frame potentials are modifications of the induced gravity inflationary scenario, but instead of the Starobinsky attractor they lead to linear inflation in the strong coupling limit.

  11. Permafrost Hazards and Linear Infrastructure (United States)

    Stanilovskaya, Julia; Sergeev, Dmitry


    The international experience of linear infrastructure planning, construction and exploitation in permafrost zone is being directly tied to the permafrost hazard assessment. That procedure should also consider the factors of climate impact and infrastructure protection. The current global climate change hotspots are currently polar and mountain areas. Temperature rise, precipitation and land ice conditions change, early springs occur more often. The big linear infrastructure objects cross the territories with different permafrost conditions which are sensitive to the changes in air temperature, hydrology, and snow accumulation which are connected to climatic dynamics. One of the most extensive linear structures built on permafrost worldwide are Trans Alaskan Pipeline (USA), Alaska Highway (Canada), Qinghai-Xizang Railway (China) and Eastern Siberia - Pacific Ocean Oil Pipeline (Russia). Those are currently being influenced by the regional climate change and permafrost impact which may act differently from place to place. Thermokarst is deemed to be the most dangerous process for linear engineering structures. Its formation and development depend on the linear structure type: road or pipeline, elevated or buried one. Zonal climate and geocryological conditions are also of the determining importance here. All the projects are of the different age and some of them were implemented under different climatic conditions. The effects of permafrost thawing have been recorded every year since then. The exploration and transportation companies from different countries maintain the linear infrastructure from permafrost degradation in different ways. The highways in Alaska are in a good condition due to governmental expenses on annual reconstructions. The Chara-China Railroad in Russia is under non-standard condition due to intensive permafrost response. Standards for engineering and construction should be reviewed and updated to account for permafrost hazards caused by the

  12. A Linear Electromagnetic Piston Pump (United States)

    Hogan, Paul H.

    Advancements in mobile hydraulics for human-scale applications have increased demand for a compact hydraulic power supply. Conventional designs couple a rotating electric motor to a hydraulic pump, which increases the package volume and requires several energy conversions. This thesis investigates the use of a free piston as the moving element in a linear motor to eliminate multiple energy conversions and decrease the overall package volume. A coupled model used a quasi-static magnetic equivalent circuit to calculate the motor inductance and the electromagnetic force acting on the piston. The force was an input to a time domain model to evaluate the mechanical and pressure dynamics. The magnetic circuit model was validated with finite element analysis and an experimental prototype linear motor. The coupled model was optimized using a multi-objective genetic algorithm to explore the parameter space and maximize power density and efficiency. An experimental prototype linear pump coupled pistons to an off-the-shelf linear motor to validate the mechanical and pressure dynamics models. The magnetic circuit force calculation agreed within 3% of finite element analysis, and within 8% of experimental data from the unoptimized prototype linear motor. The optimized motor geometry also had good agreement with FEA; at zero piston displacement, the magnetic circuit calculates optimized motor force within 10% of FEA in less than 1/1000 the computational time. This makes it well suited to genetic optimization algorithms. The mechanical model agrees very well with the experimental piston pump position data when tuned for additional unmodeled mechanical friction. Optimized results suggest that an improvement of 400% of the state of the art power density is attainable with as high as 85% net efficiency. This demonstrates that a linear electromagnetic piston pump has potential to serve as a more compact and efficient supply of fluid power for the human scale.

  13. Single-Molecule Rotational Switch on a Dangling Bond Dimer Bearing. (United States)

    Godlewski, Szymon; Kawai, Hiroyo; Kolmer, Marek; Zuzak, Rafał; Echavarren, Antonio M; Joachim, Christian; Szymonski, Marek; Saeys, Mark


    One of the key challenges in the construction of atomic-scale circuits and molecular machines is to design molecular rotors and switches by controlling the linear or rotational movement of a molecule while preserving its intrinsic electronic properties. Here, we demonstrate both the continuous rotational switching and the controlled step-by-step single switching of a trinaphthylene molecule adsorbed on a dangling bond dimer created on a hydrogen-passivated Ge(001):H surface. The molecular switch is on-surface assembled when the covalent bonds between the molecule and the dangling bond dimer are controllably broken, and the molecule is attached to the dimer by long-range van der Waals interactions. In this configuration, the molecule retains its intrinsic electronic properties, as confirmed by combined scanning tunneling microscopy/spectroscopy (STM/STS) measurements, density functional theory calculations, and advanced STM image calculations. Continuous switching of the molecule is initiated by vibronic excitations when the electrons are tunneling through the lowest unoccupied molecular orbital state of the molecule. The switching path is a combination of a sliding and rotation motion over the dangling bond dimer pivot. By carefully selecting the STM conditions, control over discrete single switching events is also achieved. Combined with the ability to create dangling bond dimers with atomic precision, the controlled rotational molecular switch is expected to be a crucial building block for more complex surface atomic-scale devices.

  14. Effect of dipole polarizability on positron binding by strongly polar molecules

    International Nuclear Information System (INIS)

    Gribakin, G F; Swann, A R


    A model for positron binding to polar molecules is considered by combining the dipole potential outside the molecule with a strongly repulsive core of a given radius. Using existing experimental data on binding energies leads to unphysically small core radii for all of the molecules studied. This suggests that electron–positron correlations neglected in the simple model play a large role in determining the binding energy. We account for these by including the polarization potential via perturbation theory and non-perturbatively. The perturbative model makes reliable predictions of binding energies for a range of polar organic molecules and hydrogen cyanide. The model also agrees with the linear dependence of the binding energies on the polarizability inferred from the experimental data (Danielson et al 2009 J. Phys. B: At. Mol. Opt. Phys. 42 235203). The effective core radii, however, remain unphysically small for most molecules. Treating molecular polarization non-perturbatively leads to physically meaningful core radii for all of the molecules studied and enables even more accurate predictions of binding energies to be made for nearly all of the molecules considered. (paper)

  15. Dependence of energy per molecule on sputtering yields with reactive gas cluster ions

    International Nuclear Information System (INIS)

    Toyoda, Noriaki; Yamada, Isao


    Gas cluster ions show dense energy deposition on a target surface, which result in the enhancement of chemical reactions. In reactive sputtering with gas cluster ions, the energy per atom or molecule plays an important role. In this study, the average cluster size (N, the number of atoms or molecules in a cluster ion) was controlled; thereby the dependences of the energy per molecule on the sputtering yields of carbon by CO 2 cluster ions and that of Si by SF 6 /Ar mixed gas cluster ions were investigated. Large CO 2 cluster ions with energy per molecule of 1 eV showed high reactive sputtering yield of an amorphous carbon film. However, these ions did not cause the formation of large craters on a graphite surface. It is possible to achieve very low damage etching by controlling the energy per molecule of reactive cluster ions. Further, in the case of SF 6 /Ar mixed cluster ions, it was found that reactive sputtering was enhanced when a small amount of SF 6 gas (∼10%) was mixed with Ar. The reactive sputtering yield of Si by one SF 6 molecule linearly increased with the energy per molecule.

  16. Sparse Linear Identifiable Multivariate Modeling

    DEFF Research Database (Denmark)

    Henao, Ricardo; Winther, Ole


    and bench-marked on artificial and real biological data sets. SLIM is closest in spirit to LiNGAM (Shimizu et al., 2006), but differs substantially in inference, Bayesian network structure learning and model comparison. Experimentally, SLIM performs equally well or better than LiNGAM with comparable......In this paper we consider sparse and identifiable linear latent variable (factor) and linear Bayesian network models for parsimonious analysis of multivariate data. We propose a computationally efficient method for joint parameter and model inference, and model comparison. It consists of a fully...

  17. Quantized, piecewise linear filter network

    DEFF Research Database (Denmark)

    Sørensen, John Aasted


    A quantization based piecewise linear filter network is defined. A method for the training of this network based on local approximation in the input space is devised. The training is carried out by repeatedly alternating between vector quantization of the training set into quantization classes...... and equalization of the quantization classes linear filter mean square training errors. The equalization of the mean square training errors is carried out by adapting the boundaries between neighbor quantization classes such that the differences in mean square training errors are reduced...

  18. Correct Linearization of Einstein's Equations

    Directory of Open Access Journals (Sweden)

    Rabounski D.


    Full Text Available Regularly Einstein's equations can be reduced to a wave form (linearly dependent from the second derivatives of the space metric in the absence of gravitation, the space rotation and Christoffel's symbols. As shown here, the origin of the problem is that one uses the general covariant theory of measurement. Here the wave form of Einstein's equations is obtained in the terms of Zelmanov's chronometric invariants (physically observable projections on the observer's time line and spatial section. The obtained equations depend on solely the second derivatives even if gravitation, the space rotation and Christoffel's symbols. The correct linearization proves: the Einstein equations are completely compatible with weak waves of the metric.

  19. Basic linear partial differential equations

    CERN Document Server

    Treves, Francois


    Focusing on the archetypes of linear partial differential equations, this text for upper-level undergraduates and graduate students features most of the basic classical results. The methods, however, are decidedly nontraditional: in practically every instance, they tend toward a high level of abstraction. This approach recalls classical material to contemporary analysts in a language they can understand, as well as exploiting the field's wealth of examples as an introduction to modern theories.The four-part treatment covers the basic examples of linear partial differential equations and their

  20. Introduction to computational linear algebra

    CERN Document Server

    Nassif, Nabil; Erhel, Jocelyne


    Introduction to Computational Linear Algebra introduces the reader with a background in basic mathematics and computer programming to the fundamentals of dense and sparse matrix computations with illustrating examples. The textbook is a synthesis of conceptual and practical topics in ""Matrix Computations."" The book's learning outcomes are twofold: to understand state-of-the-art computational tools to solve matrix computations problems (BLAS primitives, MATLAB® programming) as well as essential mathematical concepts needed to master the topics of numerical linear algebra. It is suitable for s

  1. Linear feedback controls the essentials

    CERN Document Server

    Haidekker, Mark A


    The design of control systems is at the very core of engineering. Feedback controls are ubiquitous, ranging from simple room thermostats to airplane engine control. Helping to make sense of this wide-ranging field, this book provides a new approach by keeping a tight focus on the essentials with a limited, yet consistent set of examples. Analysis and design methods are explained in terms of theory and practice. The book covers classical, linear feedback controls, and linear approximations are used when needed. In parallel, the book covers time-discrete (digital) control systems and juxtapos

  2. Passive longitudinal phase space linearizer

    Directory of Open Access Journals (Sweden)

    P. Craievich


    Full Text Available We report on the possibility to passively linearize the bunch compression process in electron linacs for the next generation x-ray free electron lasers. This can be done by using the monopole wakefields in a dielectric-lined waveguide. The optimum longitudinal voltage loss over the length of the bunch is calculated in order to compensate both the second-order rf time curvature and the second-order momentum compaction terms. Thus, the longitudinal phase space after the compression process is linearized up to a fourth-order term introduced by the convolution between the bunch and the monopole wake function.

  3. Generalized, Linear, and Mixed Models

    CERN Document Server

    McCulloch, Charles E; Neuhaus, John M


    An accessible and self-contained introduction to statistical models-now in a modernized new editionGeneralized, Linear, and Mixed Models, Second Edition provides an up-to-date treatment of the essential techniques for developing and applying a wide variety of statistical models. The book presents thorough and unified coverage of the theory behind generalized, linear, and mixed models and highlights their similarities and differences in various construction, application, and computational aspects.A clear introduction to the basic ideas of fixed effects models, random effects models, and mixed m

  4. Emittance control in linear colliders

    International Nuclear Information System (INIS)

    Ruth, R.D.


    Before completing a realistic design of a next-generation linear collider, the authors must first learn the lessons taught by the first generation, the SLC. Given that, they must make designs fault tolerant by including correction and compensation in the basic design. They must also try to eliminate these faults by improved alignment and stability of components. When these two efforts cross, they have a realistic design. The techniques of generation and control of emittance reviewed here provide a foundation for a design which can obtain the necessary luminosity in a next-generation linear collider

  5. Linear contextual modal type theory

    DEFF Research Database (Denmark)

    Schack-Nielsen, Anders; Schürmann, Carsten

    Abstract. When one implements a logical framework based on linear type theory, for example the Celf system [?], one is immediately con- fronted with questions about their equational theory and how to deal with logic variables. In this paper, we propose linear contextual modal type theory that gives...... a mathematical account of the nature of logic variables. Our type theory is conservative over intuitionistic contextual modal type theory proposed by Nanevski, Pfenning, and Pientka. Our main contributions include a mechanically checked proof of soundness and a working implementation....

  6. Vanilla Technicolor at Linear Colliders

    DEFF Research Database (Denmark)

    T. Frandsen, Mads; Jarvinen, Matti; Sannino, Francesco


    We analyze the reach of Linear Colliders (LC)s for models of dynamical electroweak symmetry breaking. We show that LCs can efficiently test the compositeness scale, identified with the mass of the new spin-one resonances, till the maximum energy in the center-of-mass of the colliding leptons. In ...

  7. Variational linear algebraic equations method

    International Nuclear Information System (INIS)

    Moiseiwitsch, B.L.


    A modification of the linear algebraic equations method is described which ensures a variational bound on the phaseshifts for potentials having a definite sign at all points. The method is illustrated by the elastic scattering of s-wave electrons by the static field of atomic hydrogen. (author)

  8. Feedback Systems for Linear Colliders

    International Nuclear Information System (INIS)


    Feedback systems are essential for stable operation of a linear collider, providing a cost-effective method for relaxing tight tolerances. In the Stanford Linear Collider (SLC), feedback controls beam parameters such as trajectory, energy, and intensity throughout the accelerator. A novel dithering optimization system which adjusts final focus parameters to maximize luminosity contributed to achieving record performance in the 1997-98 run. Performance limitations of the steering feedback have been investigated, and improvements have been made. For the Next Linear Collider (NLC), extensive feedback systems are planned as an integral part of the design. Feedback requirements for JLC (the Japanese Linear Collider) are essentially identical to NLC; some of the TESLA requirements are similar but there are significant differences. For NLC, algorithms which incorporate improvements upon the SLC implementation are being prototyped. Specialized systems for the damping rings, rf and interaction point will operate at high bandwidth and fast response. To correct for the motion of individual bunches within a train, both feedforward and feedback systems are planned. SLC experience has shown that feedback systems are an invaluable operational tool for decoupling systems, allowing precision tuning, and providing pulse-to-pulse diagnostics. Feedback systems for the NLC will incorporate the key SLC features and the benefits of advancing technologies

  9. Aspects of robust linear regression

    NARCIS (Netherlands)

    Davies, P.L.


    Section 1 of the paper contains a general discussion of robustness. In Section 2 the influence function of the Hampel-Rousseeuw least median of squares estimator is derived. Linearly invariant weak metrics are constructed in Section 3. It is shown in Section 4 that $S$-estimators satisfy an exact

  10. Periodic linear differential stochastic processes

    NARCIS (Netherlands)

    Kwakernaak, H.


    Periodic linear differential processes are defined and their properties are analyzed. Equivalent representations are discussed, and the solutions of related optimal estimation problems are given. An extension is presented of Kailath and Geesey’s [1] results concerning the innovations representation

  11. Linear colliders for photon collisions

    International Nuclear Information System (INIS)



    The enthusiasm of the first international workshop on photonphoton colliders and associated physics, held at the Lawrence Berkeley Laboratory from 28 March - 1 April, could have set a ball rolling. According to proponents of this physics, the particle physics one can study with a high energy linear collider is special and complements that of a hadron supercollider

  12. Saturation and linear transport equation

    International Nuclear Information System (INIS)

    Kutak, K.


    We show that the GBW saturation model provides an exact solution to the one dimensional linear transport equation. We also show that it is motivated by the BK equation considered in the saturated regime when the diffusion and the splitting term in the diffusive approximation are balanced by the nonlinear term. (orig.)

  13. Parameterized Linear Longitudinal Airship Model (United States)

    Kulczycki, Eric; Elfes, Alberto; Bayard, David; Quadrelli, Marco; Johnson, Joseph


    A parameterized linear mathematical model of the longitudinal dynamics of an airship is undergoing development. This model is intended to be used in designing control systems for future airships that would operate in the atmospheres of Earth and remote planets. Heretofore, the development of linearized models of the longitudinal dynamics of airships has been costly in that it has been necessary to perform extensive flight testing and to use system-identification techniques to construct models that fit the flight-test data. The present model is a generic one that can be relatively easily specialized to approximate the dynamics of specific airships at specific operating points, without need for further system identification, and with significantly less flight testing. The approach taken in the present development is to merge the linearized dynamical equations of an airship with techniques for estimation of aircraft stability derivatives, and to thereby make it possible to construct a linearized dynamical model of the longitudinal dynamics of a specific airship from geometric and aerodynamic data pertaining to that airship. (It is also planned to develop a model of the lateral dynamics by use of the same methods.) All of the aerodynamic data needed to construct the model of a specific airship can be obtained from wind-tunnel testing and computational fluid dynamics

  14. Linear Methods for Image Interpolation

    Directory of Open Access Journals (Sweden)

    Pascal Getreuer


    Full Text Available We discuss linear methods for interpolation, including nearest neighbor, bilinear, bicubic, splines, and sinc interpolation. We focus on separable interpolation, so most of what is said applies to one-dimensional interpolation as well as N-dimensional separable interpolation.

  15. Directivity of basic linear arrays

    DEFF Research Database (Denmark)

    Bach, Henning


    For a linear uniform array ofnelements, an expression is derived for the directivity as a function of the spacing and the phase constants. The cases of isotropic elements, collinear short dipoles, and parallel short dipoles are included. The formula obtained is discussed in some detail and contour...

  16. Data Compression with Linear Algebra


    Etler, David


    A presentation on the applications of linear algebra to image compression. Covers entropy, the discrete cosine transform, thresholding, quantization, and examples of images compressed with DCT. Given in Spring 2015 at Ocean County College as part of the honors program.

  17. 175 Years of Linear Programming

    Indian Academy of Sciences (India)

    polynomial-time solvability of linear programming, that is, testing if a polyhedron Q E ~ ... Q is rational, i.e. all extreme points and rays of Q are ra- tional vectors or ..... rithrll terminates with an interior solution, a post-processing step is usually ...

  18. 175 Years of Linear Programming

    Indian Academy of Sciences (India)

    Home; Journals; Resonance – Journal of Science Education; Volume 4; Issue 10. 175 Years of Linear Programming - Max Flow = Min Cut. Vijay Chandru M R Rao. Series Article Volume 4 Issue 10 October 1999 pp 22-39. Fulltext. Click here to view fulltext PDF. Permanent link:

  19. Linear collider systems and costs

    International Nuclear Information System (INIS)

    Loew, G.A.


    The purpose of this paper is to examine some of the systems and sub-systems involved in so-called ''conventional'' e + e - linear colliders and to study how their design affects the overall cost of these machines. There are presently a total of at least six 500 GeV c. of m. linear collider projects under study in the world. Aside from TESLA (superconducting linac at 1.3 GHz) and CLIC (two-beam accelerator with main linac at 30GHz), the other four proposed e + e - linear colliders can be considered ''conventional'' in that their main linacs use the proven technique of driving room temperature accelerator sections with pulsed klystrons and modulators. The centrally distinguishing feature between these projects is their main linac rf frequency: 3 GHz for the DESY machine, 11.424 GHz for the SLAC and JLC machines, and 14 GHz for the VLEPP machine. The other systems, namely the electron and positron sources, preaccelerators, compressors, damping rings and final foci, are fairly similar from project to project. Probably more than 80% of the cost of these linear colliders will be incurred in the two main linacs facing each other and it is therefore in their design and construction that major savings or extra costs may be found

  20. Linear accelerators of the future

    International Nuclear Information System (INIS)

    Loew, G.A.


    Some of the requirements imposed on future linear accelerators to be used in electron-positron colliders are reviewed, as well as some approaches presently being examined for meeting those requirements. RF sources for use in these linacs are described, as well as wakefields, single bunches, and multiple-bunch trains