International Nuclear Information System (INIS)
Lee, Young Woo; Lee, Hong Kyu; Koh, Chang Soon; Lee, Mun Ho
1972-01-01
The plasma HGH concentrations were assayed in total 138 cases by the radioimmunoassay. The groups of control, typhoid fever, epidemic hemorrhagic fever, tuberculous meningitis and other febrile diseases were studied, also were the groups of hyperthyroidism, acromegaly and hypopituitarism. Insulin stimulation test was performed in control, typhoid fever and hypopituitarism. In the control group, the plasma HGH concentration in fasting (early morning) was 2.06±1.183 mμg/ml and its upper limit was 4.5 mμg/ml. No sexual difference was observed. By the insulin stimulation, plasma HGH concentration had rised to the peak level of 24.1±15.71 mμg/ml, 60 min. after the intravenous insulin injection, then decreased to the normal level progressively. In typhoid fever, fasting HGH concentrations in febrile state and in defeverence were 2.5±1.35 mμg/ml and 2.2±3.32 mμg/ml respectively, showing no significant difference with the control group. However, the levels of individual cases ranged widely, compared with the control group. The response to the insulin stimulation test was similar to the control group. In epidemic hemorrhagic fever. the HGH concentrations in oliguric phase, in diuretic phase and in convalescence were 4.2±3.71 mμg/ml, 2.2±l.30 mμg/ml and 3.4±3.01 mμg/ml respectively. No significant differences were observe when compared to the control, but they showed wide range of plasma HGH levels. In tuberculous meningitis, the fasting HGH concentration was 2.9±51.42 mμg/ml. In the other febrile diseases, the value was 2.5±2.23 mμg/ml. In 4 cases of hypopituitarism, the fasting HGH concentration was 2.3±0.42 mμg/ml and ranged normally. However, the response to the insulin stimulation test was not observed. Very high plasma HGH concentrations were observed in acromegalic patients.
Energy Technology Data Exchange (ETDEWEB)
Lee, Young Woo; Lee, Hong Kyu; Koh, Chang Soon; Lee, Mun Ho [Seoul National University College of Medicine, Seoul (Korea, Republic of)
1972-03-15
The plasma HGH concentrations were assayed in total 138 cases by the radioimmunoassay. The groups of control, typhoid fever, epidemic hemorrhagic fever, tuberculous meningitis and other febrile diseases were studied, also were the groups of hyperthyroidism, acromegaly and hypopituitarism. Insulin stimulation test was performed in control, typhoid fever and hypopituitarism. In the control group, the plasma HGH concentration in fasting (early morning) was 2.06+-1.183 m{mu}g/ml and its upper limit was 4.5 m{mu}g/ml. No sexual difference was observed. By the insulin stimulation, plasma HGH concentration had rised to the peak level of 24.1+-15.71 m{mu}g/ml, 60 min. after the intravenous insulin injection, then decreased to the normal level progressively. In typhoid fever, fasting HGH concentrations in febrile state and in defeverence were 2.5+-1.35 m{mu}g/ml and 2.2+-3.32 m{mu}g/ml respectively, showing no significant difference with the control group. However, the levels of individual cases ranged widely, compared with the control group. The response to the insulin stimulation test was similar to the control group. In epidemic hemorrhagic fever. the HGH concentrations in oliguric phase, in diuretic phase and in convalescence were 4.2+-3.71 m{mu}g/ml, 2.2+-l.30 m{mu}g/ml and 3.4+-3.01 m{mu}g/ml respectively. No significant differences were observe when compared to the control, but they showed wide range of plasma HGH levels. In tuberculous meningitis, the fasting HGH concentration was 2.9+-51.42 m{mu}g/ml. In the other febrile diseases, the value was 2.5+-2.23 m{mu}g/ml. In 4 cases of hypopituitarism, the fasting HGH concentration was 2.3+-0.42 m{mu}g/ml and ranged normally. However, the response to the insulin stimulation test was not observed. Very high plasma HGH concentrations were observed in acromegalic patients.
Differential effects of hGH and IGF-I on body proportions.
Laron, Zvi; Silbergeld, Aviva; Kauli, Rivka
2012-07-01
The differential growth effects of hGH and IGF-I on the upper/lower (U/L) body segment in relation to height (Ht) were analyzed in 15 patients with isolated Growth hormone deficiency (IGHD,:7M, 8F) mean age 5.0 +/- 3.2 (SD) years treated with hGH; 21 patients with multiple pituitary hormone deficiency including growth hormone (MPHD: 14M, 7F) aged 10.0 +/- 3.8, treated with hGH; 9 patients with Laron Syndrome (LS) (4M,5F) aged 6.9 +/- 5.6 years treated with IGF-I; 9 boys with intrauterine growth retardation (IUGR) aged 6.3 +/- 1.25 years treated by hGH; and 22 boys with idiopathic short stature (ISS) aged 8.0 +/- 1.55 years treated by hGH. The dose of hGH was 33 microg/kg/day, that of IGF-I 180-200 microg/kg/day. the U/L body segment ratio in IGHD patients decreased from 2.3 +/- 0.7 to 1.1 +/- 0.7 (p <0.001), and the Ht SDS increased from -4.9 +/- 1.3 to 2.3 +/- 1 (p < 0.001) following treatment. In MPHD patients the U/L body segment decreased from 1.1 +/- 1.1 to -0.6 +/- 1.0 (p < 0.001), and the Ht SDS increased from -3.3 +/- 1.4 to -2.5 +/- 1.0 (p < 0.009). In the LS group the U/L body segment ratio did not change with IGF-I treatment but Ht improved from -6.1 +/- 1.3 to -4.6 +/- 1.2 (p < 0.001), The differential growth response of the children with IUGR and with ISS resembled that of the children with LS. hGH and IGF-I act differentially on the spine and limbs.
Quantum close coupling calculation of transport and relaxation properties for Hg-H_2 system
International Nuclear Information System (INIS)
Nemati-Kande, Ebrahim; Maghari, Ali
2016-01-01
Highlights: • Several relaxation cross sections are calculated for Hg-H_2 van der Waals complex. • These cross sections are calculated from exact close-coupling method. • Energy-dependent SBE cross sections are calculated for ortho- and para-H_2 + Hg systems. • Viscosity and diffusion coefficients are calculated using Mason-Monchick approximation. • The results obtained by Mason-Monchick approximation are compared to the exact close-coupling results. - Abstract: Quantum mechanical close coupling calculation of the state-to-state transport and relaxation cross sections have been done for Hg-H_2 molecular system using a high-level ab initio potential energy surface. Rotationally averaged cross sections were also calculated to obtain the energy dependent Senftleben-Beenakker cross sections at the energy range of 0.005–25,000 cm"−"1. Boltzmann averaging of the energy dependent Senftleben-Beenakker cross sections showed the temperature dependency over a wide temperature range of 50–2500 K. Interaction viscosity and diffusion coefficients were also calculated using close coupling cross sections and full classical Mason-Monchick approximation. The results were compared with each other and with the available experimental data. It was found that Mason-Monchick approximation for viscosity is more reliable than diffusion coefficient. Furthermore, from the comparison of the experimental diffusion coefficients with the result of the close coupling and Mason-Monchick approximation, it was found that the Hg-H_2 potential energy surface used in this work can reliably predict diffusion coefficient data.
Health Alert: Adrenal Crisis Causes Death in Some People Who Were Treated with hGH
... Were Treated with hGH Health Alert: Adrenal Crisis Causes Death in Some People Who Were Treated with hGH ... Adrenal crisis is a serious condition that can cause death in people who lack the pituitary hormone ACTH. ...
Human Growth Hormone (HGH): Does It Slow Aging?
Healthy Lifestyle Healthy aging Human growth hormone is described by some as the key to slowing the aging process. Before you sign up, get the ... slowdown has triggered an interest in using synthetic human growth hormone (HGH) as a way to stave ...
Linear algebraic approach to electron-molecule collisions
International Nuclear Information System (INIS)
Schneider, B.I.; Collins, L.A.
1983-01-01
The various levels of sophistication of the linear algebraic method are discussed and its application to electron-molecule collisions of H 2 , N 2 LiH, LiF and HCl is described. 13 references, 2 tables
Dispersion interaction between an atom and linear molecule
International Nuclear Information System (INIS)
Carvalho, I.L. de
1987-01-01
The Jacobi-Csanak method is adapted to the calculation of the dipole-dipole, dipole-quadrupole, quadrupole-dipole, and quadrupole-quadrupole terms of the dispersion energy of an atom-linear molecule system. The angle-dependent parts of the Born amplitudes for the linear molecule are represented by real spherical harmonics. The dispersion energy is finite at all distances and reproduces the usual expression in the asymptotic region (R≥4.7 (angstrom)). In the intermediary region (2.4(angstrom) ≤ R [pt
DEFF Research Database (Denmark)
Laursen, Torben; Mindeholm, Linda; Haemmerle, Sibylle
2007-01-01
) as carrier has recently been developed. The aim of this study was to determine if this oral formulation of hGH could be absorbed and be bioactive. Eight GHD men (mean age 50 years) receiving sc hGH therapy were withdrawn from therapy for 7 days and then treated for 7 days orally with tablets of HGH191...
Bisker-Kassif, Orly; Kauli, Rivka; Lilos, Pearl; Laron, Zvi
2014-01-01
To evaluate changes in adiposity in congenital GH/IGF-1 deficient children during hGH or IGF-1 treatment. 27 children with congenital isolated growth hormone deficiency (cIGHD) treated with hGH for 2.5-15.2 years (mean 10.0 ± 3.4), 18 children with congenital multiple pituitary hormone deficiency (cMPHD), treated with hGH for 2.3-17.9 years (mean 6.1 ± 4.3), and 14 children with Laron syndrome (LS) treated with IGF-1 for 1.2-12 years (mean 5.5 ± 3.7) were studied. Changes in the degree of adiposity were evaluated by subscapular skinfold thickness (SSFT), before, during and up to 2 years after treatment. All the children had various degrees of obesity. During the pretreatment period, cIGHD patients showed little changes in SSFT (P = 0.45), cMPHD and LS patients showed an increase in SSFT (P = 0.01, P = 0.06 respectively). During the initial 0.6-1.1 years of hGH/IGF-1 treatment, the SSFT decreased in all 3 groups (P < 0.001), while during subsequent years a significant increase in SSFT (P < 0.001) was observed, in all types of patients, notably in females. Only the cIGHD patients demonstrated a significant correlation between the degree of SSFT decrease and height SDS gain (R = -0.56, P = 0.002) in the first period of treatment. Short term replacement therapy of 0.6-1.1 years with either hGH or IGF-1, induced a reduction in subscapular subcutaneous fat whereas prolongation of therapy led to an increase in the subcutaneous fat. © 2014 Asian Oceanian Association for the Study of Obesity . Published by Elsevier Ltd. All rights reserved.
Symmetry Adaptation of the Rotation-Vibration Theory for Linear Molecules
Directory of Open Access Journals (Sweden)
Katy L. Chubb
2018-04-01
Full Text Available A numerical application of linear-molecule symmetry properties, described by the D ∞ h point group, is formulated in terms of lower-order symmetry groups D n h with finite n. Character tables and irreducible representation transformation matrices are presented for D n h groups with arbitrary n-values. These groups can subsequently be used in the construction of symmetry-adapted ro-vibrational basis functions for solving the Schrödinger equations of linear molecules. Their implementation into the symmetrisation procedure based on a set of “reduced” vibrational eigenvalue problems with simplified Hamiltonians is used as a practical example. It is shown how the solutions of these eigenvalue problems can also be extended to include the classification of basis-set functions using ℓ, the eigenvalue (in units of ℏ of the vibrational angular momentum operator L ^ z . This facilitates the symmetry adaptation of the basis set functions in terms of the irreducible representations of D n h . 12 C 2 H 2 is used as an example of a linear molecule of D ∞ h point group symmetry to illustrate the symmetrisation procedure of the variational nuclear motion program Theoretical ROVibrational Energies (TROVE.
Electron re-scattering from aligned linear molecules using the R-matrix method
International Nuclear Information System (INIS)
Harvey, A G; Tennyson, J
2009-01-01
Electron re-scattering in a strong laser field provides an important probe of molecular structure and processes. The laser field drives the ionization of the molecule, followed by acceleration and subsequent recollision of the electron with the parent molecular ion, the scattered electrons carry information about the nuclear geometry and electronic states of the molecular ion. It is advantageous in strong field experiments to work with aligned molecules, which introduces extra physics compared to the standard gas-phase, electron-molecule scattering problem. The formalism for scattering from oriented linear molecules is presented and applied to H 2 and CO 2 . Differential cross sections are presented for (re-)scattering by these systems concentrating on the most common, linear alignment. In H 2 these cross sections show significant angular structure which, particularly for a scattering angle of 90 deg., are predicted to vary significantly between re-collisions stimulated by an even or an odd number of photons. In CO 2 these cross sections are zero indicating the necessity of using non-parallel alignment with this molecule.
de Juan-Franco, Elena; Rodríguez-Frade, J M; Mellado, M; Lechuga, Laura M
2013-09-30
We have implemented a Surface Plasmon Resonance (SPR) immunosensor based on a sandwich assay for the simultaneous detection of the two main hGH isoforms, of 22 kDa (22K) and 20 kDa (20K). An oriented-antibody sensor surface specific for both hormone isoforms was assembled by using the biotin-streptavidin system. The immunosensor functionality was checked for the direct detection of the 22K hGH isoform in buffer, which gave high specificity and reproducibility (intra and inter-assay mean coefficients of variation of 8.23% and 9% respectively). The selective determination of the 22K and 20K hGH isoforms in human serum samples in a single assay was possible by using two specific anti-hGH monoclonal antibodies. The detection limit for both hormone isoforms was 0.9 ng mL(-1) and the mean coefficient of variation was below 7.2%. The excellent reproducibility and sensitivity obtained indicate the high performance of this immunosensor for implementing an anti-doping test. Copyright © 2013 Elsevier B.V. All rights reserved.
Conserved linear dynamics of single-molecule Brownian motion
Serag, Maged F.
2017-06-06
Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.
Conserved linear dynamics of single-molecule Brownian motion
Serag, Maged F.; Habuchi, Satoshi
2017-06-01
Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.
Conserved linear dynamics of single-molecule Brownian motion
Serag, Maged F.; Habuchi, Satoshi
2017-01-01
Macromolecular diffusion in homogeneous fluid at length scales greater than the size of the molecule is regarded as a random process. The mean-squared displacement (MSD) of molecules in this regime increases linearly with time. Here we show that non-random motion of DNA molecules in this regime that is undetectable by the MSD analysis can be quantified by characterizing the molecular motion relative to a latticed frame of reference. Our lattice occupancy analysis reveals unexpected sub-modes of motion of DNA that deviate from expected random motion in the linear, diffusive regime. We demonstrate that a subtle interplay between these sub-modes causes the overall diffusive motion of DNA to appear to conform to the linear regime. Our results show that apparently random motion of macromolecules could be governed by non-random dynamics that are detectable only by their relative motion. Our analytical approach should advance broad understanding of diffusion processes of fundamental relevance.
A linear algebraic approach to electron-molecule collisions
International Nuclear Information System (INIS)
Collins, L.A.; Schnieder, B.I.
1982-01-01
The linear algebraic approach to electron-molecule collisions is examined by firstly deriving the general set of coupled integrodifferential equations that describe electron collisional processes and then describing the linear algebraic approach for obtaining a solution to the coupled equations. Application of the linear algebraic method to static-exchange, separable exchange and effective optical potential, is examined. (U.K.)
Linear-algebraic approach to electron-molecule collisions: General formulation
International Nuclear Information System (INIS)
Collins, L.A.; Schneider, B.I.
1981-01-01
We present a linear-algebraic approach to electron-molecule collisions based on an integral equations form with either logarithmic or asymptotic boundary conditions. The introduction of exchange effects does not alter the basic form or order of the linear-algebraic equations for a local potential. In addition to the standard procedure of directly evaluating the exchange integrals by numerical quadrature, we also incorporate exchange effects through a separable-potential approximation. Efficient schemes are developed for reducing the number of points and channels that must be included. The method is applied at the static-exchange level to a number of molecular systems including H 2 , N 2 , LiH, and CO 2
Rotational partition functions for linear molecules
International Nuclear Information System (INIS)
McDowell, R.S.
1988-01-01
An accurate closed-form expression for the rotational partition function of linear polyatomic molecules in 1 summation electronic states is derived, including the effect of nuclear spin (significant at very low temperatures) and of quartic and sextic centrifugal distortion terms (significant at moderate and high temperatures). The proper first-order quantum correction to the classical rigid-rotator partition function is shown to yield Q/sub r/ ≅β -1 exp(β/3), where βequivalenthcB/kT and B is the rotational constant in cm -1 ; for β≥0.2 additional power-series terms in β are necessary. Comparison between the results of this treatment and exact summations are made for HCN and C 2 H 2 at temperatures from 2 to 5000 K, including separate evaluation of the contributions of nuclear spin and centrifugal distortion
Rotational and vibrational synthetic spectra of linear parent molecules in comets
International Nuclear Information System (INIS)
Crovisier, J.
1987-01-01
We evaluate and model the excitation conditions of linear parent molecules in cometary atmospheres. The model is valid for most linear molecules without electronic angular momentum. It takes into account collisions and infrared excitation. The molecule rotational population distribution is computed as a function of distance to nucleus. The line intensities of the strongest parallel and perpendicular fundamental vibrational bands, as well as the pure rotational lines, can then be evaluated. This model is applied to several candidate parent molecules, for observing conditions corresponding to available or planned instruments, either ground-based or aboard aircrafts, satellites or space probes
Strong-field ionization of linear molecules by a bicircular laser field: Symmetry considerations
Gazibegović-Busuladžić, A.; Busuladžić, M.; Hasović, E.; Becker, W.; Milošević, D. B.
2018-04-01
Using the improved molecular strong-field approximation, we investigate (high-order) above-threshold ionization [(H)ATI] of various linear polyatomic molecules by a two-color laser field of frequencies r ω and s ω (with integer numbers r and s ) having coplanar counter-rotating circularly polarized components (a so-called bicircular field). Reflection and rotational symmetries for molecules aligned in the laser-field polarization plane, analyzed for diatomic homonuclear molecules in Phys. Rev. A 95, 033411 (2017), 10.1103/PhysRevA.95.033411, are now considered for diatomic heteronuclear molecules and symmetric and asymmetric linear triatomic molecules. There are additional rotational symmetries for (H)ATI spectra of symmetric linear molecules compared to (H)ATI spectra of the asymmetric ones. It is shown that these symmetries manifest themselves differently for r +s odd and r +s even. For example, HATI spectra for symmetric molecules with r +s even obey inversion symmetry. For ATI spectra of linear molecules, reflection symmetry appears only for certain molecular orientation angles ±90∘-j r 180∘/(r +s ) (j integer). For symmetric linear molecules, reflection symmetry appears also for the angles -j r 180∘/(r +s ) . For perpendicular orientation of molecules with respect to the laser-field polarization plane, the HATI spectra are very similar to those of the atomic targets, i.e., both spectra are characterized by the same type of the (r +s )-fold symmetry.
Dong, Fulong; Tian, Yiqun; Yu, Shujuan; Wang, Shang; Yang, Shiping; Chen, Yanjun
2015-07-13
We investigate the polarization properties of below-threshold harmonics from aligned molecules in linearly polarized laser fields numerically and analytically. We focus on lower-order harmonics (LOHs). Our simulations show that the ellipticity of below-threshold LOHs depends strongly on the orientation angle and differs significantly for different harmonic orders. Our analysis reveals that this LOH ellipticity is closely associated with resonance effects and the axis symmetry of the molecule. These results shed light on the complex generation mechanism of below-threshold harmonics from aligned molecules.
Ohkura, K; Hori, H
2000-07-01
We analyzed the structural features of insulin-potentiating fragments of human growth hormone by computative simulations. The peptides were designated from the N-terminus sequences of the hormone positions at 1-15 (hGH(1-15); H2N-Phe1-Pro2-Thr3-Ile4-Pro5-Leu6-Ser7-Arg8-L eu9-Phe10-Asp11-Asn12-Ala13-Met14-Leu15 -COOH), 6-13 (hGH(6-13)), 7-13 (hGH(7-13)) and 8-13 (hGH(8-13)), which enhanced insulin-producing hypoglycemia. In these peptide molecules, ionic bonds were predicted to form between 8th-arginyl residue and 11th-aspartic residue, and this intramolecular interaction caused the formation of a macrocyclic structure containing a tetrapeptide Arg8-Leu9-Phe10-Asp11. The peptide positions at 6-10 (hGH(6-10)), 9-13 (hGH(9-13)) and 10-13 (hGH(10-13)) did not lead to a macrocyclic formation in the molecules, and had no effect on the insulin action. Although beta-Ala13hGH(1-15), in which the 13th-alanine was replaced by a beta-alanyl residue, had no effect on insulin-producing hypoglycemia, the macrocyclic region (Arg8-Leu9-Phe10-Asp11) was observed by the computative simulation. An isothermal vibration analysis of both of beta-Ala13hGH(1-15) and hGH(1-15) peptide suggested that beta-Ala13hGH(1-15) is molecule was more flexible than hGH(1-15); C-terminal carboxyl group of Leu15 easily accessed to Arg8 and inhibited the ionic bond formation between Arg8 and Asp11 in beta-Ala13hGH(1-15). The peptide of hGH(8-13) dose-dependently enhanced the insulin-involved fatty acid synthesis in rat white adipocytes, and stabilized the C6-NBD-PC (1-acyl-2-[6-[(7-nitro-2,1,3benzoxadiazol-4-yl)amino]-caproyl]-sn- glycero-3-phosphatidylcholine) model membranes. In contrast, hGH(9-13) had no effect both on the fatty acid synthesis and the membrane stability. In the same culture conditions as the fatty acid synthesis assay, hGH(8-13) had no effect on the transcript levels of glucose transporter isoforms (GLUT 1, 4) and hexokinase isozymes (HK I, II) in rat white adipocytes. Judging from
International Nuclear Information System (INIS)
Salem, M.A.M.; Phares, C.K.
1986-01-01
The metabolic actions of GH can be divided into acute (insulin-like) and chronic (lipolytic/anti-insulin). The insulin-like actions of GH are most readily elicited in GH-deficient animals as GH induces resistance to its own insulin-like action. Like GH, PGF stimulates growth and cross-reacts with anti-hGH antibodies. Independent experiments were conducted comparing the direct actions of PGF to insulin or hGH in vitro. Insulin-like effects were determined by the ability of PGF, insulin or hGH to stimulate [U- 14 C]glucose metabolism in epidydimal fat pads from normal rats and by inhibition of epinephrine-stimulated lipolysis. Direct stimulation of lipolysis was used as anti-insulin activity. To determine if PGF competes for insulin or GH receptors, adipocytes (3 x 10 5 cells/ml) were incubated with either [ 125 I]insulin or [ 125 I]hGH +/- PGF, +/- insulin or +/- hGH. PGF stimulated glucose oxidation and 14 C-incorporation into lipids. Insulin, hGH and PGF inhibited lipolysis (33%, 29% and 34%, respectively). Adipose tissue was very sensitive to the lipolytic effect of hGH but PGF was neither lipolytic nor did it confer refractoriness to its insulin-like action. PGF bound to GH but not to insulin receptors. Therefore, PGF had direct insulin-like effects but did not stimulate lipolysis in tissue from normal rats in vitro
International Nuclear Information System (INIS)
Purtov, K V; Burakova, L P; Puzyr, A P; Bondar, V S
2008-01-01
Nanodiamonds synthesized by detonation have been found not to immobilize the ring form of pUC19 plasmid DNA. Linear pUC19 molecules with blunt ends, prepared by restriction of the initial ring form of pUC19 DNA, and linear 0.25-10 kb DNA fragments are adsorbed on nanodiamonds. The amount of adsorbed linear DNA molecules depends on the size of the molecules and the size of the nanodiamond clusters
Superradiance Effects in the Linear and Nonlinear Optical Response of Quantum Dot Molecules
Sitek, A.; Machnikowski, P.
2008-11-01
We calculate the linear optical response from a single quantum dot molecule and the nonlinear, four-wave-mixing response from an inhomogeneously broadened ensemble of such molecules. We show that both optical signals are affected by the coupling-dependent superradiance effect and by optical interference between the two polarizations. As a result, the linear and nonlinear responses are not identical.
A national quality control scheme for serum HGH assays
International Nuclear Information System (INIS)
Hunter, W.M.; McKenzie, I.
1979-01-01
In the autumn of 1975 the Supraregional Assay Service established a Quality Control Sub-Committee and the intra-laboratory QC Scheme for Growth Hormone (HGH) assays which is described here has served, in many respects, as a pilot scheme for protein RIA. Major improvements in accuracy, precision and between-laboratory agreement can be brought about by intensively interactive quality control schemes. A common standard is essential and should consist of ampoules used for one or only a small number of assays. Accuracy and agreement were not good enough to allow the overall means to serve as target values but a group of 11 laboratories were sufficiently accurate to provide a 'reference group mean' to so serve. Gross non-specificity was related to poor assay design and was quickly eliminated. Within-laboratory between-batch variability was much worse than that normally claimed for simple protein hormone RIA. A full report on this Scheme will appear shortly in Annals of Clinical Biochemistry. (Auth.)
The production of high affinity monoclonal antibodies to human growth hormone
International Nuclear Information System (INIS)
Stuart, M.C.; Walichnowski, C.M.; Hussain, S.; Underwood, P.A.; Harman, D.F.; Rathjen, D.A.; Sturmer, S.R. von
1983-01-01
The primary aim of this work was to produce specific monoclonal antibodies to human growth hormone (hGH) for use in a diagnostic RIA of hGH levels in serum. Three different schedules were used for immunization of BALB/c mice and the splenocytes from each mouse were fused with myeloma cells Sp 2/0 Ag 14. Each fusion resulted in the production of hundreds of hybridomas secreting hGH-directed antibodies. Six antibodies have been fully characterized and have been grouped into pairs which recognize 3 different epitopes on the hGH molecule. One pair exhibits no cross reaction with the structurally related placental hormone, human placental lactogen (hPL), a second pair has low cross reaction with hPL (1.6-3%) and a third pair reacts equally well with hGH and hPL indicating binding to a common epitope in the 2 molecules. The highest affinity antibody, 74/6, which has an affinity constant of 4.4x10 10 l/mol and 3% cross-reactivity with hPL, has been used to establish a RIA for serum hGH measurements. Evidence is provided that hGH levels measured in this assay correlate well with those obtained in a conventional rabbit antiserum assay. (Auth.)
Yumura, Takashi; Yamamoto, Wataru
2017-09-20
We employed density functional theory (DFT) calculations with dispersion corrections to investigate energetically preferred alignments of certain p,p'-dimethylaminonitrostilbene (DANS) molecules inside an armchair (m,m) carbon nanotube (n × DANS@(m,m)), where the number of inner molecules (n) is no greater than 3. Here, three types of alignments of DANS are considered: a linear alignment in a parallel fashion and stacking alignments in parallel and antiparallel fashions. According to DFT calculations, a threshold tube diameter for containing DANS molecules in linear or stacking alignments was found to be approximately 1.0 nm. Nanotubes with diameters smaller than 1.0 nm result in the selective formation of linearly aligned DANS molecules due to strong confinement effects within the nanotubes. By contrast, larger diameter nanotubes allow DANS molecules to align in a stacking and linear fashion. The type of alignment adopted by the DANS molecules inside a nanotube is responsible for their second-order non-linear optical properties represented by their static hyperpolarizability (β 0 values). In fact, we computed β 0 values of DANS assemblies taken from optimized n × DANS@(m,m) structures, and their values were compared with those of a single DANS molecule. DFT calculations showed that β 0 values of DANS molecules depend on their alignment, which decrease in the following order: linear alignment > parallel stacking alignment > antiparallel stacking alignment. In particular, a linear alignment has a β 0 value more significant than that of the same number of isolated molecules. Therefore, the linear alignment of DANS molecules, which is only allowed inside smaller diameter nanotubes, can strongly enhance their second-order non-linear optical properties. Since the nanotube confinement determines the alignment of DANS molecules, a restricted nanospace can be utilized to control their second-order non-linear optical properties. These DFT findings can assist in the
Yoo, Hyejin
2012-10-25
Perylenediimide (PDI) molecules are promising building blocks for photophysical studies of electronic interactions within multichromophore arrays. Such PDI arrays are important materials for fabrication of molecular nanodevices such as organic light-emitting diodes, organic semiconductors, and biosensors because of their high photostability, chemical and physical inertness, electron affinity, and high tinctorial strength over the entire visible spectrum. In this work, PDIs have been organized into linear (L3) and trefoil (T3) trimer molecules and investigated by single-molecule fluorescence microscopy to probe the relationship between molecular structures and interchromophoric electronic interactions. We found a broad distribution of coupling strengths in both L3 and T3 and hence strong/weak coupling between PDI units by monitoring spectral peak shifts in single-molecule fluorescence spectra upon sequential photobleaching of each constituent chromophore. In addition, we used a wide-field defocused imaging technique to resolve heterogeneities in molecular structures of L3 and T3 embedded in a PMMA polymer matrix. A systematic comparison between the two sets of experimental results allowed us to infer the correlation between intermolecular interactions and molecular structures. Our results show control of the PDI intermolecular interactions using suitable multichromophoric structures. © 2012 American Chemical Society.
Yoo, Hyejin; Furumaki, Shu; Yang, Jaesung; Lee, Ji-Eun; Chung, Heejae; Oba, Tatsuya; Kobayashi, Hiroyuki; Rybtchinski, Boris; Wilson, Thea M.; Wasielewski, Michael R.; Vacha, Martin; Kim, Dongho
2012-01-01
Perylenediimide (PDI) molecules are promising building blocks for photophysical studies of electronic interactions within multichromophore arrays. Such PDI arrays are important materials for fabrication of molecular nanodevices such as organic light-emitting diodes, organic semiconductors, and biosensors because of their high photostability, chemical and physical inertness, electron affinity, and high tinctorial strength over the entire visible spectrum. In this work, PDIs have been organized into linear (L3) and trefoil (T3) trimer molecules and investigated by single-molecule fluorescence microscopy to probe the relationship between molecular structures and interchromophoric electronic interactions. We found a broad distribution of coupling strengths in both L3 and T3 and hence strong/weak coupling between PDI units by monitoring spectral peak shifts in single-molecule fluorescence spectra upon sequential photobleaching of each constituent chromophore. In addition, we used a wide-field defocused imaging technique to resolve heterogeneities in molecular structures of L3 and T3 embedded in a PMMA polymer matrix. A systematic comparison between the two sets of experimental results allowed us to infer the correlation between intermolecular interactions and molecular structures. Our results show control of the PDI intermolecular interactions using suitable multichromophoric structures. © 2012 American Chemical Society.
Application of the method of continued fractions for electron scattering by linear molecules
International Nuclear Information System (INIS)
Lee, M.-T.; Iga, I.; Fujimoto, M.M.; Lara, O.; Brasilia Univ., DF
1995-01-01
The method of continued fractions (MCF) of Horacek and Sasakawa is adapted for the first time to study low-energy electron scattering by linear molecules. Particularly, we have calculated the reactance K-matrices for an electron scattered by hydrogen molecule and hydrogen molecular ion as well as by a polar LiH molecule in the static-exchange level. For all the applications studied herein. the calculated physical quantities converge rapidly, even for a strongly polar molecule such as LiH, to the correct values and in most cases the convergence is monotonic. Our study suggests that the MCF could be an efficient method for studying electron-molecule scattering and also photoionization of molecules. (Author)
DEFF Research Database (Denmark)
Madsen, Lars Bojer; Tolstikhin, Oleg I.; Morishita, Toru
2012-01-01
The recently developed weak-field asymptotic theory [ Phys. Rev. A 84 053423 (2011)] is applied to the analysis of tunneling ionization of a molecular ion (H2+), several homonuclear (H2, N2, O2) and heteronuclear (CO, HF) diatomic molecules, and a linear triatomic molecule (CO2) in a static...... electric field. The dependence of the ionization rate on the angle between the molecular axis and the field is determined by a structure factor for the highest occupied molecular orbital. This factor is calculated using a virtually exact discrete variable representation wave function for H2+, very accurate...... Hartree-Fock wave functions for the diatomics, and a Hartree-Fock quantum chemistry wave function for CO2. The structure factors are expanded in terms of standard functions and the associated structure coefficients, allowing the determination of the ionization rate for any orientation of the molecule...
International Nuclear Information System (INIS)
Lee, G. H.; Kim, H. T.; Park, J. Y.; Nam, C. H.; Kim, T. K.; Lee, J. H.; Ihee, H.
2006-01-01
Revival structures (rotational coherence) of three linear molecules (N 2 , O 2 , and CO 2 ) in a field free alignment condition have been investigated using high-order harmonic generation. The harmonic yields of these molecules were measured in a pump-probe manner by using a weak femtosecond (fs) laser pulse for field-free alignment of molecules and another intense fs laser pulse for harmonic generation. The harmonic intensities from 23rd to 29th order with respect to the time delay between the pump and the probe pulses showed revival structures in the condition of a field-free alignment of molecules. While the revival structure of a N 2 molecule had one-fourth the period of the full revival time and different degrees of modulation among different fractional revival times, the revival structures of O 2 and CO 2 molecules showed one-eighth the periods of the full revival time and similar degrees of modulation among all fractional revival times. The revival structures could be interpreted in terms of the nature of the highest occupied molecular orbital and the total nuclear spin.
International Nuclear Information System (INIS)
Feng, H.; Zheng, Y.; Ding, S.
2007-01-01
Infrared multiphoton vibrational excitation of the linear triatomic molecule has been studied using the quadratic anharmonic Lie-algebra model, unitary transformations, and Magnus approximation. An explicit Lie-algebra expression for the vibrational transition probability is obtained by using a Lie-algebra approach. This explicit Lie-algebra expressions for time-evolution operator and vibrational transition probabilities make the computation clearer and easier. The infrared multiphoton vibrational excitation of the DCN linear tri-atomic molecule is discussed as an example
International Nuclear Information System (INIS)
Le, Anh-Thu; Lin, C. D.; Lucchese, R. R.
2010-01-01
We present theoretical calculations for polarization and ellipticity of high-order harmonics from aligned N 2 , CO 2 , and O 2 molecules generated by linearly polarized lasers. Within the rescattering model, the two polarization amplitudes of the harmonics are determined by the photo-recombination amplitudes for photons emitted with polarization parallel or perpendicular to the direction of the same returning electron wave packet. Our results show clear species-dependent polarization states, in excellent agreement with experiments. We further note that the measured polarization ellipse of the harmonic furnishes the needed parameters for a 'complete' experiment in molecules.
Developing Density of Laser-Cooled Neutral Atoms and Molecules in a Linear Magnetic Trap
Velasquez, Joe, III; Walstrom, Peter; di Rosa, Michael
2013-05-01
In this poster we show that neutral particle injection and accumulation using laser-induced spin flips may be used to form dense ensembles of ultracold magnetic particles, i.e., laser-cooled paramagnetic atoms and molecules. Particles are injected in a field-seeking state, are switched by optical pumping to a field-repelled state, and are stored in the minimum-B trap. The analogous process in high-energy charged-particle accumulator rings is charge-exchange injection using stripper foils. The trap is a linear array of sextupoles capped by solenoids. Particle-tracking calculations and design of our linear accumulator along with related experiments involving 7Li will be presented. We test these concepts first with atoms in preparation for later work with selected molecules. Finally, we present our preliminary results with CaH, our candidate molecule for laser cooling. This project is funded by the LDRD program of Los Alamos National Laboratory.
Linear-algebraic approach to electronic excitation of atoms and molecules by electron impact
International Nuclear Information System (INIS)
Collins, L.A.; Schneider, B.I.
1983-01-01
A linear-algebraic method, based on an integral equations formulation, is applied to the excitation of atoms and molecules by electron impact. Various schemes are devised for treating the one-electron terms that sometimes cause instabilities when directly incorporated into the solution matrix. These include introducing Lagrange undetermined multipliers and correlation terms. Good agreement between the method and other computational techniques is obtained for electron scattering for hydrogenic and Li-like atomic ions and for H 2 + in two- to five-state close-coupling calculations
Directory of Open Access Journals (Sweden)
Alexey Lyulin
2012-01-01
Full Text Available We report results from Brownian dynamics computer simulations of systems comprised by two terminally charged hyperbranched molecules preferentially branched in the periphery, with an oppositely charged linear chain of varying length. Comparison of the findings from the present study to stoichiometric counterparts and to analogous dendrimer-based complexes, reveal that the presence of the second hyperbranched molecule incurs significant changes in the conformational characteristics of both components of the complex. Instead of step-like changes in the average size and shape of the hyperbranched component that were noted in the previously studied stoichiometric systems, a rather smooth change is observed upon increase of the length of the linear component. In addition, a markedly different behavior is also noticed in the conformational characteristics of the linear chain when compared to that in similar dendrimer-based systems. The above findings are consistent with the higher degree of deformability of the peripherally branched molecules which allow appropriate rearrangements in shape in order to accommodate the favorable Coulombic interactions between the two components of the complex. This behavior offers new insight towards the design of more efficient hyperbranched-based systems which can take advantage of the multifunctionality and the structural properties of the highly branched polymer components.
Study of the In2O3 molecule in the free state and in the crystal
Kaplan, Ilya G.; Miranda, Ulises; Trakhtenberg, Leonid I.
2018-03-01
The nanomaterials based on the In2O3 molecule are widely used as catalysts and sensors among other applications. In the present study, we discuss the possibility of using nanoclusters of In2O3 as molecular photomotors. A comparative analysis of the electronic structure of the In2O3 molecule in the free state and in the crystal is performed. For the free In2O3 molecule the geometry of its lowest structures, V-shape and linear, was optimised at the CCSD(T) level, which is the most precise computational method applied up to date to study In2O3. Using experimental crystallographic data, we determined the geometry of In2O3 in the crystal. It has a zigzag, not symmetric structure and possesses a dipole moment with magnitude slightly smaller than that of the V-structure of the free molecule (the linear structure due to its symmetry has no dipole moment). According to the Natural Atomic population analysis, the chemical structure of the linear In2O3 can be represented as O = In-O-In = O; the V-shaped molecule has the similar double- and single-bond structure. The construction of nanoclusters from ´bricksʼ of In2O3 with geometry extracted from crystal (or nanoclusters extracted directly from crystal) and their use as photo-driven molecular motors are discussed.
Directory of Open Access Journals (Sweden)
Arun K Upadhyay
Full Text Available The objective of the research was to understand the structural determinants governing protein aggregation into inclusion bodies during expression of recombinant proteins in Escherichia coli. Recombinant human growth hormone (hGH and asparaginase were expressed as inclusion bodies in E.coli and the kinetics of aggregate formation was analyzed in details. Asparaginase inclusion bodies were of smaller size (200 nm and the size of the aggregates did not increase with induction time. In contrast, the seeding and growth behavior of hGH inclusion bodies were found to be sequential, kinetically stable and the aggregate size increased from 200 to 800 nm with induction time. Human growth hormone inclusion bodies showed higher resistance to denaturants and proteinase K degradation in comparison to those of asparaginase inclusion bodies. Asparaginase inclusion bodies were completely solubilized at 2-3 M urea concentration and could be refolded into active protein, whereas 7 M urea was required for complete solubilization of hGH inclusion bodies. Both hGH and asparaginase inclusion bodies showed binding with amyloid specific dyes. In spite of its low β-sheet content, binding with dyes was more prominent in case of hGH inclusion bodies than that of asparaginase. Arrangements of protein molecules present in the surface as well as in the core of inclusion bodies were similar. Hydrophobic interactions between partially folded amphiphillic and hydrophobic alpha-helices were found to be one of the main determinants of hGH inclusion body formation. Aggregation behavior of the protein molecules decides the nature and properties of inclusion bodies.
Upadhyay, Arun K.; Murmu, Aruna; Singh, Anupam; Panda, Amulya K.
2012-01-01
The objective of the research was to understand the structural determinants governing protein aggregation into inclusion bodies during expression of recombinant proteins in Escherichia coli. Recombinant human growth hormone (hGH) and asparaginase were expressed as inclusion bodies in E.coli and the kinetics of aggregate formation was analyzed in details. Asparaginase inclusion bodies were of smaller size (200 nm) and the size of the aggregates did not increase with induction time. In contrast, the seeding and growth behavior of hGH inclusion bodies were found to be sequential, kinetically stable and the aggregate size increased from 200 to 800 nm with induction time. Human growth hormone inclusion bodies showed higher resistance to denaturants and proteinase K degradation in comparison to those of asparaginase inclusion bodies. Asparaginase inclusion bodies were completely solubilized at 2–3 M urea concentration and could be refolded into active protein, whereas 7 M urea was required for complete solubilization of hGH inclusion bodies. Both hGH and asparaginase inclusion bodies showed binding with amyloid specific dyes. In spite of its low β-sheet content, binding with dyes was more prominent in case of hGH inclusion bodies than that of asparaginase. Arrangements of protein molecules present in the surface as well as in the core of inclusion bodies were similar. Hydrophobic interactions between partially folded amphiphillic and hydrophobic alpha-helices were found to be one of the main determinants of hGH inclusion body formation. Aggregation behavior of the protein molecules decides the nature and properties of inclusion bodies. PMID:22479486
International Nuclear Information System (INIS)
Damskin, B.B.; Baturina, O.A.; Vasil'ev, S.Yu.; Emets, V.V.; Kazarinov, V.E.
1999-01-01
Curves of differential capacitance in the interfaces Hg/H 2 O, Ga/H 2 O, (In-Ga)/H 2 O and (Tl-Ga)H 2 O in 0.05 M Na 2 SO 4 solutions with different additions of n-butanol have been obtained by the bridge method at a frequency of 420 Hz and temperature of 32 deg C. The method of regression analysis of the curves permitted ascertaining the adsorption parameters of n-butanol for the range of charges q, where there is no chemisorption of H 2 O dipoles. The data obtained suggested that the difference in the adsorption behaviour of organic molecules on the metals studied in the range of higher negative charges is largely determined by different electron electrochemical work functions, the definition being given by S. Trasatti [ru
Evaluation of synthetic linear motor-molecule actuation energetics
Brough, Branden; Northrop, Brian H.; Schmidt, Jacob J.; Tseng, Hsian-Rong; Houk, Kendall N.; Stoddart, J. Fraser; Ho, Chih-Ming
2006-01-01
By applying atomic force microscope (AFM)-based force spectroscopy together with computational modeling in the form of molecular force-field simulations, we have determined quantitatively the actuation energetics of a synthetic motor-molecule. This multidisciplinary approach was performed on specifically designed, bistable, redox-controllable [2]rotaxanes to probe the steric and electrostatic interactions that dictate their mechanical switching at the single-molecule level. The fusion of expe...
International Nuclear Information System (INIS)
Cardoso, A.I.; Llera, A.S.; Iacono, R.F.
1993-01-01
The existence of homologous anti-human growth hormone (anti-hGH) and heterologous anti-bovine growth hormone (anti-bGH) humoral immune responses in hypopituitary patients under hGH therapy has been reported previously. In order to study the influence of the hormone source, both responses were compared by radiobinding assays performed with [ 125 I]hGH or [ 125 I]bGH as tracers. 57 hypopituitary patients treated with extractive hGH, recombinant methionyl hGH or authentic recombinant hGH were studied. A very low incidence of heterologous antibodies was found in patients under recombinant hGH therapy, contrary to the high incidence observed in patients treated with extractive hGH preparations. In addition, immunochemical studies performed with a synthetic peptide (hGH 44-128) indicated that this peptide exhibited, in the anti-bGH/[ 125 I]bGH radioimmunoassay system, higher reactivity than the native hGH, suggesting that such fragment resembled an altered conformation of the hormone. The high heterologous response elicited only by the extractive hGH along with the behaviour of the hGH 44-128 fragment supports the fact that the extraction and purification procedures in extractive preparations may alter slightly the structure of the hGH molecule and trigger a heterologous immune response. 16 refs., 4 figs., 1 tab
Energy Technology Data Exchange (ETDEWEB)
Cardoso, A.I.; Llera, A.S.; Iacono, R.F. (and others) (Inst. de Estudios de la Inmunidad Humoral, Buenos Aires (Argentina))
1993-07-01
The existence of homologous anti-human growth hormone (anti-hGH) and heterologous anti-bovine growth hormone (anti-bGH) humoral immune responses in hypopituitary patients under hGH therapy has been reported previously. In order to study the influence of the hormone source, both responses were compared by radiobinding assays performed with [[sup 125]I]hGH or [[sup 125]I]bGH as tracers. 57 hypopituitary patients treated with extractive hGH, recombinant methionyl hGH or authentic recombinant hGH were studied. A very low incidence of heterologous antibodies was found in patients under recombinant hGH therapy, contrary to the high incidence observed in patients treated with extractive hGH preparations. In addition, immunochemical studies performed with a synthetic peptide (hGH 44-128) indicated that this peptide exhibited, in the anti-bGH/[[sup 125]I]bGH radioimmunoassay system, higher reactivity than the native hGH, suggesting that such fragment resembled an altered conformation of the hormone. The high heterologous response elicited only by the extractive hGH along with the behaviour of the hGH 44-128 fragment supports the fact that the extraction and purification procedures in extractive preparations may alter slightly the structure of the hGH molecule and trigger a heterologous immune response. 16 refs., 4 figs., 1 tab.
Detection of kinetic change points in piece-wise linear single molecule motion
Hill, Flynn R.; van Oijen, Antoine M.; Duderstadt, Karl E.
2018-03-01
Single-molecule approaches present a powerful way to obtain detailed kinetic information at the molecular level. However, the identification of small rate changes is often hindered by the considerable noise present in such single-molecule kinetic data. We present a general method to detect such kinetic change points in trajectories of motion of processive single molecules having Gaussian noise, with a minimum number of parameters and without the need of an assumed kinetic model beyond piece-wise linearity of motion. Kinetic change points are detected using a likelihood ratio test in which the probability of no change is compared to the probability of a change occurring, given the experimental noise. A predetermined confidence interval minimizes the occurrence of false detections. Applying the method recursively to all sub-regions of a single molecule trajectory ensures that all kinetic change points are located. The algorithm presented allows rigorous and quantitative determination of kinetic change points in noisy single molecule observations without the need for filtering or binning, which reduce temporal resolution and obscure dynamics. The statistical framework for the approach and implementation details are discussed. The detection power of the algorithm is assessed using simulations with both single kinetic changes and multiple kinetic changes that typically arise in observations of single-molecule DNA-replication reactions. Implementations of the algorithm are provided in ImageJ plugin format written in Java and in the Julia language for numeric computing, with accompanying Jupyter Notebooks to allow reproduction of the analysis presented here.
Investigation into interaction of CO/sub 2/ molecules with zeolites by infrared spectroscopy
Energy Technology Data Exchange (ETDEWEB)
Ignat' eva, L A; Levshin, L V; Chukin, G D; Efimenko, L V; Kozlova, T I [Moskovskij Gosudarstvennyj Univ. (USSR). Kafedra Optiki
1975-07-01
Interaction of CO/sub 2/ molecules with zeolites, particularly with SrNaJ was studied by infrared-spectroscopy. To obtain infrared-spectra the zeolites were pressed into tablets and were calcinated at 500 deg. In the spectra the bands of chemisorbed CO/sub 2/ absorption were found in the range 1300 - 1600 cm/sup -1/. The CO/sub 2/ molecule was found to be strongly deformed due to chemisorption. In terms of electronic structure of the zeolite crystalline skeleton several types of CO/sub 2/ molecules interaction with different active zeolites were found. The position of the high-frequency band of CO/sub 2/ absorption in zeolites spectra was found to be a linear function of electrostatic field of the cations.
International Nuclear Information System (INIS)
Kozlov, D N; Kobtsev, V D; Stel'makh, O M; Smirnov, Valery V; Stepanov, E V
2013-01-01
Employing the methods of linear absorption spectroscopy and nonlinear four-wave mixing spectroscopy using laserinduced gratings we have simultaneously measured the local concentrations of H 2 O molecules and the gas temperature in the process of the H 2 – O 2 mixture heating. During the measurements of the deactivation rates of pulsed-laser excited singlet oxygen O 2 (b 1 Σ + g ) in collisions with H 2 in the range 294 – 850 K, the joint use of the two methods made it possible to determine the degree of hydrogen oxidation at a given temperature. As the mixture is heated, H 2 O molecules are formed by 'dark' reactions of H 2 with O 2 in the ground state. The experiments have shown that the measurements of tunable diode laser radiation absorption along an optical path through the inhomogeneously heated gas mixture in a cell allows high-accuracy determination of the local H 2 O concentration in the O 2 laser excitation volume, if the gas temperature in this volume is known. When studying the collisional deactivation of O 2 (b 1 Σ + g ) molecules, the necessary measurements of the local temperature can be implemented using laser-induced gratings, arising due to spatially periodic excitation of O 2 (X 3 Σ - g ) molecules to the b 1 Σ + g state by radiation of the pump laser of the four-wave mixing spectrometer. (laser spectroscopy)
Giant Magnetoresistance in Carbon Nanotubes with Single-Molecule Magnets TbPc2.
Krainov, Igor V; Klier, Janina; Dmitriev, Alexander P; Klyatskaya, Svetlana; Ruben, Mario; Wernsdorfer, Wolfgang; Gornyi, Igor V
2017-07-25
We present experimental results and a theoretical model for the gate-controlled spin-valve effect in carbon nanotubes with side-attached single-molecule magnets TbPc 2 (Terbium(III) bis-phthalocyanine). These structures show a giant magnetoresistance up to 1000% in experiments on single-wall nanotubes that are tunnel-coupled to the leads. The proposed theoretical model combines the spin-dependent Fano effect with Coulomb blockade and predicts a spin-spin interaction between the TbPc 2 molecules, mediated by conducting electrons via the charging effect. This gate-tuned interaction is responsible for the stable magnetic ordering of the inner spins of the molecules in the absence of magnetic field. In the case of antiferromagnetic arrangement, electrons with either spin experience the scattering by the molecules, which results in blocking the linear transport. In strong magnetic fields, the Zeeman energy exceeds the effective antiferromagnetic coupling and one species of electrons is not scattered by molecules, which leads to a much lower total resistance at the resonant values of gate voltage, and hence to a supramolecular spin-valve effect.
Nonsequential double ionization of D2 molecules with intense 20-fs pulses
DEFF Research Database (Denmark)
Sakai, H.; Larsen, J.J.; Wendt-Larsen, I.
2003-01-01
The kinetic-energy distribution of D+ fragments obtained from the ionization of D2 molecules with intense 20-fs pulses includes a high-energy component extending up to ˜10 eV. These fragments are only present for linearly, or slightly elliptically, polarized light. Both the maximum kinetic...
International Nuclear Information System (INIS)
Collins, L.A.; Schneider, B.I.
1984-01-01
The linear algebraic, separable potential approach is applied to the electronic excitation of atoms and molecules by electron impact. By representing the exchange and off-diagonal direct terms on a basis, the standard set of coupled inelastic equations is reduced to a set of elastic inhomogeneous equations. The procedure greatly simplifies the formulation by allowing a large portion of the problem to be handled by standard bound-state techniques and by greatly reducing the order of the scattering equations that must be solved. Application is made to the excitation of atomic hydrogen in the three-state close-coupling (1s, 2s, 2p) approximation. (author)
Directory of Open Access Journals (Sweden)
Felipe Simon
2017-06-01
Full Text Available Chronic peritoneal dialysis (PD therapy is equally efficient as hemodialysis while providing greater patient comfort and mobility. Therefore, PD is the treatment of choice for several types of renal patients. During PD, a high-glucose hyperosmotic (HGH solution is administered into the peritoneal cavity to generate an osmotic gradient that promotes water and solutes transport from peritoneal blood to the dialysis solution. Unfortunately, PD has been associated with a loss of peritoneal viability and function through the generation of a severe inflammatory state that induces human peritoneal mesothelial cell (HPMC death. Despite this deleterious effect, the precise molecular mechanism of HPMC death as induced by HGH solutions is far from being understood. Therefore, the aim of this study was to explore the pathways involved in HGH solution-induced HPMC death. HGH-induced HPMC death included influxes of intracellular Ca2+ and Na+. Furthermore, HGH-induced HPMC death was inhibited by antioxidant and reducing agents. In line with this, HPMC death was induced solely by increased oxidative stress. In addition to this, the cPKC/NOX2 and PI3K/Akt intracellular signaling pathways also participated in HGH-induced HPMC death. The participation of PI3K/Akt intracellular is in agreement with previously shown in rat PMC apoptosis. These findings contribute toward fully elucidating the underlying molecular mechanism mediating peritoneal mesothelial cell death induced by high-glucose solutions during peritoneal dialysis.
DEFF Research Database (Denmark)
List, Nanna Holmgaard; Coriani, Sonia; Kongsted, Jacob
2014-01-01
are specifically motivated by a twofold aim: (i) computation of core excitations in realistic surroundings and (ii) examination of the effect of the differential response of the environment upon excitation solely related to the CC multipliers (herein denoted the J matrix) in computations of excitation energies......We present an extension of a previously reported implementation of a Lanczos-driven coupled-cluster (CC) damped linear response approach to molecules in condensed phases, where the effects of a surrounding environment are incorporated by means of the polarizable embedding formalism. We...... and transition moments of polarizable-embedded molecules. Numerical calculations demonstrate that the differential polarization of the environment due to the first-order CC multipliers provides only minor contributions to the solvatochromic shift for all transitions considered. We thus complement previous works...
Directory of Open Access Journals (Sweden)
Nuri ÖZTÜRK
2018-02-01
Full Text Available The experimental spectroscopic investigation of N-benzyloxycarbonyloxy-5-norbornene-2,3-dicarboximide (C17H15NO5 molecule has been done using 1H and 13C NMR chemical shifts, FT-IR and Raman spectroscopies. Conformational forms have been determined depending on orientation of N-benzyloxycarbonyloxy and 5-norbornene-2,3-dicarboximide (NDI groups of the title compound. The structural geometric optimizations, vibrational wavenumbers, NMR chemical shifts (in vacuum and chloroform and HOMO-LUMO analyses for all conformers of the title molecule have been done with DFT/CAM-B3LYP method at the 6-311++G(d,p basis set. Additionally, based on the calculated HOMO and LUMO energy values, some molecular properties such as ionization potential (I, electron affinity (A, electronegativity (χ, chemical hardness (h, chemical softness (z, chemical potential (μ and electrophilicity index (w parameters are determined for all conformers. The non-linear optical (NLO properties have been studied for the title molecule. We can say that the experimental spectral data are in accordance with calculated values.
Tiruneh, Sintayehu Nibret; Kang, Bong Kyun; Kwag, Sung Hoon; Lee, YoungHun; Kim, MinSeob; Yoon, Dae Ho
2018-03-02
Nickel cobalt sulfide nanoparticles embedded in holey defect graphene hydrogel (HGH) that exhibit highly porous structures and uniform nickel cobalt sulfide nanoparticle sizes are successfully prepared by a facile solvothermal-hydrothermal method. As an electrode material for supercapacitors, the as-prepared NiCo 2 S 4 @HGH shows ultra-high specific capacitances of 1000 F g -1 and 800 F g -1 at 0.5 and 6 A g -1 , respectively, owing to the outstanding electrical conductivity of HGH and high specific capacitance of NiCo 2 S 4 . After 2100 charge/discharge cycles at a current density of 6 A g -1 , 96.6 % of the specific capacitance was retained, signifying the superb durability of NiCo 2 S 4 @HGH. Moreover, remarkable specific capacitance (312.6 F g -1 ) and capacity retention (87 % after 5000 cycles) at 6 A g -1 were displayed by the symmetric solid-state supercapacitor fabricated by using NiCo 2 S 4 @HGH electrodes. These auspicious supercapacitor performances demonstrate that the as-developed solvothermal-hydrothermal approach can be widely used to prepare graphene-coupled binary metal sulfides for high-performance supercapacitor applications. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Zhang, Shanshan; Niu, Qingfen; Sun, Tao; Li, Yang; Li, Tianduo; Liu, Haixia
2017-08-01
A novel linear A-π-D-π-A-type organic small molecule Ph2(PDPP)2 consisting diketopyrrolopyrrole (DPP) as acceptor unit, biphenylene as donor unit and acetylene unit as π-linkage has been successfully designed and synthesized. Its corresponding thermal, photophysical and electrochemical properties as well as the photoinduced charge-separation process were investigated. Ph2(PDPP)2 exhibits high thermal stability and it can be soluble in common organic solvents such as chloroform and tetrahydrofuran. The photophysical properties show that DPP2Ph2 harvests sunlight over the entire visible spectrum range in the thin-film state (300-800 nm). DPP2Ph2 has lower band gaps and appropriate energy levels to satisfy the requirement of solution-processable organic solar cells. The efficient photoinduced charge separation process was clearly observed between DPP2Ph2 with PC61BM and the Ksv value was found to be as high as 2.13 × 104 M- 1. Therefore, these excellent properties demonstrate that the designed A-π-D-π-A-type small molecule Ph2(PDPP)2 is the prospective candidate as donor material for organic photovoltaic material.
International Nuclear Information System (INIS)
Oliveira, Joao Paulo Cavalcante; Mota, F. de Brito; Rivelino, Roberto
2011-01-01
Full text. Carbon nano wires made of long linear atomic chains have attracted considerable interest due to their potential applications in nano electronics. We report a density-functional-theory study of the nuclear spin-spin coupling constants for nano assemblies made of two coronene molecules bridged by carbon linear chains, considering distinct sizes and spin multiplicities. Also, we examine the effects of two terminal conformations (syn and anti) of the terminal anchor pieces on the magnetic properties of the carbon chains via 13 C NMR calculations. Our results reveal that simplified chemical models such as those based on cumulenes or polyynes are not appropriate to describe the linear chains with sp 2 terminations. For these types of atomic chains, the electronic ground state of the even-numbered chains can be singlet or triplet, whereas the ground state of the odd-numbered chains can be doublet or quartet. We discuss how the 13 C NMR chemical shift absorption is affected by increasing the size and changing the parity of the linear carbon chains. We have found that the J coupling constants between the carbon atoms in the linear chains present a well-defined pattern, in good accordance with our electronic structure calculations. For example, in the -C 4 - units we obtain couplings of 43.8, 114.5, 84.6, 114.5, and 43.8 Hz from one end to the other
Linear Ion Traps in Space: The Mars Organic Molecule Analyzer (MOMA) Instrument and Beyond
Arevalo, Ricardo; Brinckerhoff, William; Mahaffy, Paul; van Amerom, Friso; Danell, Ryan; Pinnick, Veronica; Li, Xiang; Hovmand, Lars; Getty, Stephanie; Grubisic, Andrej; Goesmann, Fred; Cottin, Hervé
2015-11-01
Historically, quadrupole mass spectrometer (QMS) instruments have been used to explore a wide survey of planetary targets in our solar system, from Venus (Pioneer Venus) to Saturn (Cassini-Huygens). However, linear ion trap (LIT) mass spectrometers have found a niche as smaller, versatile alternatives to traditional quadrupole analyzers.The core astrobiological experiment of ESA’s ExoMars Program is the Mars Organic Molecule Analyzer (MOMA) onboard the ExoMars 2018 rover. The MOMA instrument is centered on a linear (or 2-D) ion trap mass spectrometer. As opposed to 3-D traps, LIT-based instruments accommodate two symmetrical ion injection pathways, enabling two complementary ion sources to be used. In the case of MOMA, these two analytical approaches are laser desorption mass spectrometry (LDMS) at Mars ambient pressures, and traditional gas chromatography mass spectrometry (GCMS). The LIT analyzer employed by MOMA also offers: higher ion capacity compared to a 3-D trap of the same volume; redundant detection subassemblies for extended lifetime; and, a link to heritage QMS designs and assembly logistics. The MOMA engineering test unit (ETU) has demonstrated the detection of organics in the presence of wt.%-levels of perchlorate, effective ion enhancement via stored waveform inverse Fourier transform (SWIFT), and derivation of structural information through tandem mass spectrometry (MS/MS).A more progressive linear ion trap mass spectrometer (LITMS), funded by the NASA ROSES MatISSE Program, is being developed at NASA GSFC and promises to augment the capabilities of the MOMA instrument by way of: an expanded mass range (i.e., 20 - 2000 Da); detection of both positive and negative ions; spatially resolved (<1 mm) characterization of individual rock core layers; and, evolved gas analysis and GCMS with pyrolysis up to 1300° C (enabling breakdown of refractory phases). The Advanced Resolution Organic Molecule Analyzer (AROMA) instrument, being developed through NASA
Mineo, Hirobumi; Fujimura, Yuichi
2015-06-01
We propose an ultrafast quantum switching method of π-electron rotations, which are switched among four rotational patterns in a nonplanar chiral aromatic molecule (P)-2,2’- biphenol and perform the sequential switching among four rotational patterns which are performed by the overlapped pump-dump laser pulses. Coherent π-electron dynamics are generated by applying the linearly polarized UV pulse laser to create a pair of coherent quasidegenerated excited states. We also plot the time-dependent π-electron ring current, and discussed ring current transfer between two aromatic rings.
Establishment and clinical application of immunoradiometric assay for human growth hormone in serum
International Nuclear Information System (INIS)
Ji Jinfeng; Wu Congyuan; Niu Zhanpo; Zhang Kui; Song Ailing; Deng Jieying; Shi Mifan
1992-01-01
An immunoradiometric assay (IRMA) for human growth hormone (hGH) in serum is developed based on two high specific monoclonal antibodies against hGh. It can specifically detect the levels of serum bioactive hGh and had no cross-reaction with human prolactin (hPRL) and hGh oligmeric forms. The sensitivity was 0.2 ng/ml and the recovery for different concentrations of hGh was 92.0% ∼ 103.2%. The coefficients of variation for intra and inter-assay were<9.1% and <14.2%, respectively. Integral analysis of the results of RIA and IRMA with the patients' clinical manifestations revealed that hGh IRMA is better than hGh RIA in reflecting the clinical states of different acromegalic patients
Kang, Hyeon-Ju; Kim, Hye-Jin; Jung, Mun-Sik; Han, Jae-Kyu; Cha, Sang-Hoon
2017-04-01
Development of novel bi-functional or even tri-functional Fab-effector fusion proteins would have a great potential in the biomedical sciences. However, the expression of Fab-effector fusion proteins in Escherichia coli is problematic especially when a eukaryotic effector moiety is genetically linked to a Fab due to the lack of proper chaperone proteins and an inappropriate physicochemical environment intrinsic to the microbial hosts. We previously reported that a human Fab molecule, referred to as SL335, reactive to human serum albumin has a prolonged in vivo serum half-life in rats. We, herein, tested six discrete SL335-human growth hormone (hGH) fusion constructs as a model system to define an optimal Fab-effector fusion format for E. coli expression. We found that one variant, referred to as HserG/Lser, outperformed the others in terms of a soluble expression yield and functionality in that HserG/Lser has a functional hGH bioactivity and possesses an serum albumin-binding affinity comparable to SL335. Our results clearly demonstrated that the genetic linkage of an effector domain to the C-terminus of Fd (V H +C H1 ) and the removal of cysteine (Cys) residues responsible for an interchain disulfide bond (IDB) ina Fab molecule optimize the periplasmic expression of a Fab-effector fusion protein in E. coli. We believe that our approach can contribute the development of diverse bi-functional Fab-effector fusion proteins by providing a simple strategy that enables the reliable expression of a functional fusion proteins in E. coli. Copyright © 2017 European Federation of Immunological Societies. Published by Elsevier B.V. All rights reserved.
Aligning molecules with intense nonresonant laser fields
DEFF Research Database (Denmark)
Larsen, J.J.; Safvan, C.P.; Sakai, H.
1999-01-01
Molecules in a seeded supersonic beam are aligned by the interaction between an intense nonresonant linearly polarized laser field and the molecular polarizability. We demonstrate the general applicability of the scheme by aligning I2, ICl, CS2, CH3I, and C6H5I molecules. The alignment is probed...... by mass selective two dimensional imaging of the photofragment ions produced by femtosecond laser pulses. Calculations on the degree of alignment of I2 are in good agreement with the experiments. We discuss some future applications of laser aligned molecules....
Zhang, Xiao-Long; Ma, Yong-Tao; Zhai, Yu; Li, Hui
2018-03-01
A first effective six-dimensional ab initio potential energy surface (PES) for CH3F-H2 which explicitly includes the intramolecular Q3 stretching normal mode of the CH3F monomer is presented. The electronic structure computations have been carried out at the explicitly correlated coupled cluster level of theory [CCSD(T)-F12a] with an augmented correlation-consistent triple zeta basis set. Five-dimensional analytical intermolecular PESs for ν3(CH3F) = 0 and 1 are then obtained by fitting the vibrationally averaged potentials to the Morse/Long-Range (MLR) potential function form. The MLR function form is applied to the nonlinear molecule-linear molecule case for the first time. These fits to 25 015 points have root-mean-square deviations of 0.74 cm-1 and 0.082 cm-1 for interaction energies less than 0.0 cm-1. Using the adiabatic hindered-rotor approximation, three-dimensional PESs for CH3F-paraH2 are generated from the 5D PESs over all possible orientations of the hydrogen monomer. The infrared and microwave spectra for CH3F-paraH2 dimer are predicted for the first time. These analytic PESs can be used for modeling the dynamical behavior in CH3F-(H2)N clusters, including the possible appearance of microscopic superfluidity.
Positron-Electron Annihilation Process in (2,2)-Difluoropropane Molecule
Liu, Yang; Ma, Xiao-Guang; Zhu, Ying-Hao
2016-04-01
The positron-electron annihilation process in (2,2)-difluoropropane molecule and the corresponding gamma-ray spectra are studied by quantum chemistry method. The positrophilic electrons in (2,2)-difluoropropane molecule are found for the first time. The theoretical predictions show that the outermost 2s electrons of fluoride atoms play an important role in positron-electron annihilation process of (2,2)-difiuoropropane. In the present scheme, the correlation coefficient between the theoretical gamma-ray spectra and the experiments can be 99%. The present study gives an alternative annihilation model for positron-electron pair in larger molecules. Supported by the National Natural Science Foundation of China under Grant No. 11347011 and the Natural Science Foundation Project of Shandong Province under Grant No. ZR2011AM010 and 2014 Technology Innovation Fund of Ludong University under Grant Nos. 1d151007 and ld15l016
Growth hormone (GH) binding and effects of GH analogs in transgenic mice
Energy Technology Data Exchange (ETDEWEB)
Bartke, A.; Steger, R.W. [Southern Illinois Univ., Carbondale, IL (United States); Turyn, D. [UBA-CONICET, Buenos Aires (Argentina)] [and others
1994-12-31
Overexpression of human (h) or bovine (b) growth hormone (GH) in transgenic mice is associated with marked (2- to 12-fold) and significant increase in hepatic binding of GH and prolactin (PRL). This is due to an increase in the number of GH and PRL receptors (GHR, PRLR) per mg of microsomal protein without changes in binding affinity. Comparison of results obtained in transgenic animals expressing bGH with a mouse metallothionein (MT) or a rat phosphoenolpyruvate carboxykinase (PEPCK) promoter suggests that effects of bGH on hepatic GHR and PRLR do not require GH overexpression during fetal life and, within the dose range tested, the effects on PRLR are not dose dependent. The increase in hepatic GHR was accompanied by significant increases in plasma GH-binding protein (GHBP) and in mean residence time of injected GH. Thus life-long elevation of peripheral GH levels alters the availability of both free GH and GHR. Site-directed in vitro mutagenesis was used to produce hGH and bGH analogs mutated within one of the sites involved in binding to GHR and PRLR. Mutating hGH to produce amino acid identity with bGH at Position 11, 18 (within Helix 1), 57, or 60 (within the loop between Helix 1 and 2) did not affect binding to GHR in vitro, or somatotropic activity in transgenic mice in vivo but reduced lactogenic activity in Nb{sub 2} cells by 22%-45%. Mutations of bGH designed to produce amino acid identity with hGH at one to four of the corresponding positions in the bGH molecule did not interfere with binding to GHR or somatotropic activity in vivo, and failed to produce significant binding to PRLR but resulted in alterations in the effects on the hypothalamic and anterior pituitary function in transgenic mice. Apparently region(s) outside the domains examined are essential for lactogenic activity of hGH, and different portions of the GH molecule are responsible for its diverse actions in vivo. 35 refs.
Arokiyanathan, Agnes Lincy; Lakshmipathi, Senthilkumar
2017-11-18
A computational study of metal difluorides (MF 2 ; M = Ca to Zn) and their interactions with carbon dioxide and water molecules was performed. The structural parameter values obtained and the results of AIM analysis and energy decomposition analysis indicated that the Ca-F bond is weaker and less ionic than the bonds in the transition metal difluorides. A deformation density plot revealed the stablizing influence of the Jahn-Teller effect in nonlinear MF 2 molecules (e.g., where M= Sc, Ti, Cr). An anaysis of the metal K-edge peaks of the difluorides showed that shifts in the edge energy were due to the combined effects of the ionicity, effective nuclear charge, and the spin state of the metal. The interactions of CO 2 with ScF 2 (Scc3 geometry) and TiF 2 (Tic2 geometry) caused CO 2 to shift from its usual linear geometry to a bent geometry (η 2 (C=O) binding mode), while it retained its linear geometry (η 1 (O) binding mode) when it interacted with the other metal difluorides. Energy decomposition analysis showed that, among the various geometries considered, the Scc3 and Tic2 geometries possessed the highest interaction energies and orbital interaction energies. Heavier transition metal difluorides showed stronger affinities for H 2 O, whereas the lighter transition metal (Sc and Ti) difluorides preferred CO 2 . Overall, the results of this study suggest that fluorides of lighter transition metals with partially filled d orbitals (e.g., Sc and Ti) could be used for CO 2 capture under moist conditions. Graphical abstract Interaction of metal difluorides with carbon dioxide and water.
Molecules in strong laser fields. In depth study of H2 molecule
International Nuclear Information System (INIS)
Awasthi, Manohar
2009-01-01
A method for solving the time-dependent Schroedinger equation (TDSE) describing the electronic motion of the molecules exposed to very short intense laser pulses has been developed. The time-dependent electronic wavefunction is expanded in terms of a superposition of field-free eigenstates. The field-free eigenstates are calculated in two ways. In the first approach, which is applicable to two electron systems like H 2 , fully correlated field-free eigenstates are obtained in complete dimensionality using configuration-interaction calculation where the one-electron basis functions are built from B splines. In the second approach, which is even applicable to larger molecules, the field-free eigenstates are calculated within the single-active-electron (SAE) approximation using density functional theory. In general, the method can be divided into two parts, in the first part the field-free eigenstates are calculated and then in the second part a time propagation for the laser pulse parameters is performed. The H 2 molecule is the testing ground for the implementation of both the methods. The reliability of the configuration interaction (CI) based method for the solution of TDSE (CI-TDSE) is tested by comparing results in the low-intensity regime to the prediction of lowest-order perturbation theory. Another test for the CI-TDSE method is in the united atom limit for the H 2 molecule. By selecting a very small value of the internuclear distance close to zero for the H 2 molecule, Helium atom is obtained. Once the functionality and the reliability of the method is established, it is used for obtaining accurate results for molecular hydrogen exposed to intense laser fields. The results for the standard 800 nm Titanium-Sapphire laser and its harmonics at 400 nm and 266 nm are shown. The results for a scan over a wide range of incident photon energies as well as dependence on the internuclear distance are presented. The photoelectron spectra including above
International Nuclear Information System (INIS)
Gaudry, Jean-Baptiste
2000-01-01
This research thesis reports the study of two mechanisms of non linear interaction of a laser wave with matter. More particularly, it reports the experimental investigation of non linear optical properties of organometallic molecules in solution, as well as the damage of perfect silica under laser irradiation by using simulation codes. As far as optical properties are concerned, the author highlights the influence of the electronic configuration of the metal present in the organometallic compound, and the influence of the ligand on the second-order non-linear response. As far as the simulation is concerned, some experimental results have been reproduced. This work can be useful for the investigation of the extrinsic damage of imperfect materials, and for the design of experiments of transient measurements of excited silica [fr
How does relativity affect magnetically induced currents?
Berger, R J F; Repisky, M; Komorovsky, S
2015-09-21
Magnetically induced probability currents in molecules are studied in relativistic theory. Spin-orbit coupling (SOC) enhances the curvature and gives rise to a previously unobserved current cusp in AuH or small bulge-like distortions in HgH2 at the proton positions. The origin of this curvature is magnetically induced spin-density arising from SOC in the relativistic description.
Effects of collisions on linear and non-linear spectroscopic line shapes
International Nuclear Information System (INIS)
Berman, P.R.
1978-01-01
A fundamental physical problem is the determination of atom-atom, atom-molecule and molecule-molecule differential and total scattering cross sections. In this work, a technique for studying atomic and molecular collisions using spectroscopic line shape analysis is discussed. Collisions occurring within an atomic or molecular sample influence the sample's absorptive or emissive properties. Consequently the line shapes associated with the linear or non-linear absorption of external fields by an atomic system reflect the collisional processes occurring in the gas. Explicit line shape expressions are derived characterizing linear or saturated absorption by two-or three-level 'active' atoms which are undergoing collisions with perturber atoms. The line shapes may be broadened, shifted, narrowed, or distorted as a result of collisions which may be 'phase-interrupting' or 'velocity-changing' in nature. Systematic line shape studies can be used to obtain information on both the differential and total active atom-perturber scattering cross sections. (Auth.)
Anomalous absorption in H2CN and CH2CN molecules
Indian Academy of Sciences (India)
Abstract. Structures of H2CN and CH2CN molecules are similar to that of H2CO mole- cule. The H2CO has shown anomalous absorption for its transition 111 − 110 at 4.8 GHz in a number of cool molecular clouds. Though the molecules H2CN and CH2CN have been identified in TMC-1 and Sgr B2 through some ...
H2 molecules and the intercloud medium
International Nuclear Information System (INIS)
Hill, J.K.; Hollenbach, D.J.
1976-01-01
We discuss expected column of densities of H 2 in the intercloud medium and the possible use of molecules as indicators of intercloud physical conditions. We treat molecule formation by the H - process and on graphite grains and show that the Barlow-Silk hypothesis of a 1 eV semichemical hydrogen-graphite bond leads to a large enhancement of the intercloud molecule formation rate. Rotational excitation calculations are presented for both cloud and intercloud conditions which show, in agreement with Jura, that the presently observed optically thin H 2 absorption components are more likely to originate in cold clouds than in the intercloud medium
Hijas, K. M.; Madan Kumar, S.; Byrappa, K.; Geethakrishnan, T.; Jeyaram, S.; Nagalakshmi, R.
2018-03-01
Single crystals of 2-methoxy-4(phenyliminomethyl)phenol were grown from ethanol by slow evaporation solution growth technique. Single crystal X-ray diffraction experiment reveals the crystallization in orthorhombic system having non-centrosymmetric space group C2221. Geometrical optimization by density functional theory method was carried out using Gaussian program and compared with experimental results. Detailed experimental and theoretical vibrational analyses were carried out and the results were correlated to find close agreement. Thermal analyses show the material is thermally stable with a melting point of 159 °C. Natural bond orbital analysis was carried out to explain charge transfer interactions through hydrogen bonding. Relatively smaller HOMO-LUMO band gap favors the non linear optical activity of the molecule. Natural population analysis and molecular electrostatic potential calculations visualize the charge distribution in an isolated molecule. Calculated first-order molecular hyperpolarizability and preliminary second harmonic generation test carried out using Kurtz-Perry technique establish 2-methoxy-4(phenyliminomethyl)phenol crystal as a good non linear optical material. Z-scan proposes the material for reverse saturable absorption.
Molecules in strong laser fields. In depth study of H{sub 2} molecule
Energy Technology Data Exchange (ETDEWEB)
Awasthi, Manohar
2009-10-29
A method for solving the time-dependent Schroedinger equation (TDSE) describing the electronic motion of the molecules exposed to very short intense laser pulses has been developed. The time-dependent electronic wavefunction is expanded in terms of a superposition of field-free eigenstates. The field-free eigenstates are calculated in two ways. In the first approach, which is applicable to two electron systems like H{sub 2}, fully correlated field-free eigenstates are obtained in complete dimensionality using configuration-interaction calculation where the one-electron basis functions are built from B splines. In the second approach, which is even applicable to larger molecules, the field-free eigenstates are calculated within the single-active-electron (SAE) approximation using density functional theory. In general, the method can be divided into two parts, in the first part the field-free eigenstates are calculated and then in the second part a time propagation for the laser pulse parameters is performed. The H{sub 2} molecule is the testing ground for the implementation of both the methods. The reliability of the configuration interaction (CI) based method for the solution of TDSE (CI-TDSE) is tested by comparing results in the low-intensity regime to the prediction of lowest-order perturbation theory. Another test for the CI-TDSE method is in the united atom limit for the H{sub 2} molecule. By selecting a very small value of the internuclear distance close to zero for the H{sub 2} molecule, Helium atom is obtained. Once the functionality and the reliability of the method is established, it is used for obtaining accurate results for molecular hydrogen exposed to intense laser fields. The results for the standard 800 nm Titanium-Sapphire laser and its harmonics at 400 nm and 266 nm are shown. The results for a scan over a wide range of incident photon energies as well as dependence on the internuclear distance are presented. The photoelectron spectra including
Cold guided beams of polar molecules
International Nuclear Information System (INIS)
Motsch, Michael
2010-01-01
This thesis reports on experiments characterizing cold guided beams of polar molecules which are produced by electrostatic velocity filtering. This filtering method exploits the interaction between the polar molecules and the electric field provided by an electrostatic quadrupole guide to extract efficiently the slow molecules from a thermal reservoir. For molecules with large and linear Stark shifts such as deuterated ammonia (ND 3 ) or formaldehyde (H 2 CO), fluxes of guided molecules of 10 10 -10 11 molecules/s are produced. The velocities of the molecules in these beams are in the range of 10-200 m/s and correspond to typical translational temperatures of a few Kelvin. The maximum velocity of the guided molecules depends on the Stark shift, the molecular mass, the geometry of the guide, and the applied electrode voltage. Although the source is operated in the near-effusive regime, the number density of the slowest molecules is sensitive to collisions. A theoretical model, taking into account this velocity-dependent collisional loss of molecules in the vicinity of the nozzle, reproduces the density of the guided molecules over a wide pressure range. A careful adjustment of pressure allows an increase in the total number of molecules, whilst yet minimizing losses due to collisions of the sought-for slow molecules. This is an important issue for future applications. Electrostatic velocity filtering is suited for different molecular species. This is demonstrated by producing cold guided beams of the water isotopologs H 2 O, D 2 O, and HDO. Although these are chemically similar, they show linear and quadratic Stark shifts, respectively, when exposed to external electric fields. As a result, the flux of HDO is larger by one order of magnitude, and the flux of the individual isotopologs shows a characteristic dependence on the guiding electric field. The internal-state distribution of guided molecules is studied with a newly developed diagnostic method: depletion
Hansen, J S; Daivis, Peter J; Todd, B D
2009-10-01
In this paper we present equilibrium molecular-dynamics results for the shear, rotational, and spin viscosities for fluids composed of linear molecules. The density dependence of the shear viscosity follows a stretched exponential function, whereas the rotational viscosity and the spin viscosities show approximately power-law dependencies. The frequency-dependent shear and spin viscosities are also studied. It is found that viscoelastic behavior is first manifested in the shear viscosity and that the real part of the spin viscosities features a maximum for nonzero frequency. The calculated transport coefficients are used together with the extended Navier-Stokes equations to investigate the effect of the coupling between the intrinsic angular momentum and linear momentum for highly confined fluids. Both steady and oscillatory flows are studied. It is shown, for example, that the fluid flow rate for Poiseuille flow is reduced by up to 10% in a 2 nm channel for a buta-triene fluid at density 236 kg m(-3) and temperature 306 K. The coupling effect may, therefore, become very important for nanofluidic applications.
Study the multi-photon absorption process in two types of molecules
International Nuclear Information System (INIS)
Al-azawi, H.R.
1986-01-01
The aim of the present work was to study the multi-photon absorption process in two types of molecules; spherical top such as SF 6 molecules and assymetric top such as CHOOH and C 2 H 4 molecules. This work also aimed to study the effect of buffer gas pressure (Ar), which is transparent to the infrared (IR) laser on the multiphoton absorption of both types of molecules. A pulsed (TEA) CO 2 laser was used as a source which generates multi-lines in the IR-region of the spectrum and an optoacoustic detector was used to detect the energy absorbed by the molecules. In this study, the relaxation process was found to be faster in the heavy molecules than that in the light ones. A limit in the Ar pressure was observed. Below this limit, the gas acted as an active buffer gas and above it, the multi-photon absorption process was quenched. This work also aimed to study the multi-photon absorption spectrum for the CHOOH molecules in the range (1067-1090 cm -1 ). This spectrum was found to be consistent with the linear absorption spectrum obtained for the same range. The density of the vibrational states as a function of the vibrational energy was studied for the molecules SF 6 , CHOOH and C 2 H 4 . The results were used to interpret (i) the difference in the energy absorbed by difference molecules at the same energy density and (ii) the non-linearity in the multi-photon absorption for CHOOH molecules. 1 tab.; 40 figs.; 70 refs
17AAG-induced internalisation of HER2-specific Affibody molecules.
Göstring, Lovisa; Lindegren, Sture; Gedda, Lars
2016-10-01
The geldanamycin derivative 17-allylamino-17-demethoxygeldanamycin (17-AAG) is known to induce internalisation and degradation of the otherwise internalisation-resistant human epidermal growth factor receptor 2 (HER2) receptor. In the present study, 17-AAG was used to increase internalisation of the HER2-specific Affibody molecule ABY-025. The cellular redistribution of halogen-labelled 211 At-ABY-025 and radiometal-labelled 111 In-ABY-025 following treatment with 17-AAG was studied. 17-AAG treatment of SKOV-3 human ovarian carcinoma and SKBR-3 human breast carcinoma cells to some extent shifted the localisation of 111 In-ABY-025 from the cell surface to intracellular compartments in the two cell lines. ABY-025 labelled with the high-linear energy transfer α emitter 211 At was also internalised to a higher degree; however, due to its physiological properties, this nuclide was excreted faster. The results indicate that 17-AAG may be used to facilitate cell-specific intracellular localisation of a suitable cytotoxic or radioactive agent coupled to ABY-025 in HER2-overexpressing cells.
Circulating growth hormone (GH)-binding protein complex: a major constituent of plasma GH in man
International Nuclear Information System (INIS)
Baumann, G.; Amburn, K.; Shaw, M.A.
1988-01-01
The recent discovery of a specific binding protein for human GH (hGH) in human plasma suggests that hGH circulates in part as a complex in association with the binding protein(s). However, the magnitude of the complexed fraction prevailing under physiological conditions is unknown because of 1) dissociation of the complex during analysis and 2) potential differences in the binding characteristics of radiolabeled and native hGH. We conducted experiments designed to minimize dissociation during analysis (gel filtration in prelabeled columns, frontal analysis, and batch molecular sieving) with both native and radioiodinated hGH. All three methods yielded similar estimates for the complexed fraction. In normal plasma the bound fraction for 22 K hGH averaged 50.1% (range, 39-59%), that for 20 K hGH averaged 28.5% (range, 26-31%). Above a hGH level of about 20 ng/ml the bound fraction declines in concentration-dependent manner due to saturation of the binding protein. We conclude that a substantial part of circulating hGH is complexed with carrier proteins. This concept has important implications for the metabolism, distribution, and biological activity of hGH
Berg, Matthias; Accardi, Antonio; Paulus, Beate; Schmidt, Burkhard
2014-08-21
The present work is concerned with the weak interactions between hydrogen and halogen molecules, i.e., the interactions of pairs H2-X2 with X = F, Cl, Br, which are dominated by dispersion and quadrupole-quadrupole forces. The global minimum of the four-dimensional (4D) coupled cluster with singles and doubles and perturbative triples (CCSD(T)) pair potentials is always a T shaped structure where H2 acts as the hat of the T, with well depths (De) of 1.3, 2.4, and 3.1 kJ/mol for F2, Cl2, and Br2, respectively. MP2/AVQZ results, in reasonable agreement with CCSD(T) results extrapolated to the basis set limit, are used for detailed scans of the potentials. Due to the large difference in the rotational constants of the monomers, in the adiabatic approximation, one can solve the rotational Schrödinger equation for H2 in the potential of the X2 molecule. This yields effective two-dimensional rotationally adiabatic potential energy surfaces where pH2 and oH2 are point-like particles. These potentials for the H2-X2 complexes have global and local minima for effective linear and T-shaped complexes, respectively, which are separated by 0.4-1.0 kJ/mol, where oH2 binds stronger than pH2 to X2, due to higher alignment to minima structures of the 4D-pair potential. Further, we provide fits of an analytical function to the rotationally adiabatic potentials.
Linear electric field time-of-flight ion mass spectrometer
Funsten, Herbert O [Los Alamos, NM; Feldman, William C [Los Alamos, NM
2008-06-10
A linear electric field ion mass spectrometer having an evacuated enclosure with means for generating a linear electric field located in the evacuated enclosure and means for injecting a sample material into the linear electric field. A source of pulsed ionizing radiation injects ionizing radiation into the linear electric field to ionize atoms or molecules of the sample material, and timing means determine the time elapsed between ionization of atoms or molecules and arrival of an ion out of the ionized atoms or molecules at a predetermined position.
Control of π-Electron Rotations in Chiral Aromatic Molecules Using Intense Laser Pulses
Kanno, Manabu; Kono, Hirohiko; Fujimura, Yuichi
Our recent theoretical studies on laser-induced π-electron rotations in chiral aromatic molecules are reviewed. π electrons of a chiral aromatic molecule can be rotated along its aromatic ring by a nonhelical, linearly polarized laser pulse. An ansa aromatic molecule with a six-membered ring, 2,5-dichloro[n](3,6) pyrazinophane, which belongs to a planar-chiral molecule group, and its simplified molecule 2,5-dichloropyrazine are taken as model molecules. Electron wavepacket simulations in the frozen-molecular-vibration approximation show that the initial direction of π-electron rotation depends on the polarization direction of a linearly polarized laser pulse applied. Consecutive unidirectional rotation can be achieved by applying a sequence of linearly polarized pump and dump pulses to prevent reverse rotation. Optimal control simulations of π-electron rotation show that another controlling factor for unidirectional rotation is the relative optical phase between the different frequency components of an incident pulse in addition to photon polarization direction. Effects of nonadiabatic coupling between π-electron rotation and molecular vibrations are also presented, where the constraints of the frozen approximation are removed. The angular momentum gradually decays mainly owing to nonadiabatic coupling, while the vibrational amplitudes greatly depend on their rotation direction. This suggests that the direction of π-electron rotation on an attosecond timescale can be identified by detecting femtosecond molecular vibrations.
Multiple ionization dynamics of molecules in intense laser fields
International Nuclear Information System (INIS)
Ichimura, Atsushi; Ohyama-Yamaguchi, Tomoko
2005-01-01
A classical field-ionization model is developed for sequential multiple ionization of diatomic and linear triatomic molecules exposed to intense (∼ 10 15 W/cm 2 ) laser fields. The distance R ion of Coulomb explosion is calculated for a combination of fragment charges, by considering nonadiabatic excitation followed by field ionization associated with the inner and outer saddle points. For diatomic molecules (N 2 , NO, and I 2 ), the model explains behaviors observed in experiments, as R ion (21→31) ion (21→22) between competing charge-asymmetric and symmetric channels, and even-odd fluctuation along a principal pathway. For a triatomic molecule CO 2 , a comparison of the model with an experiment suggests that charge-symmetric (or nearly symmetric) channels are dominantly populated. (author)
Ab initio study of isomerism of Li2AB2 molecules and Li2AB2+ ions with 16 valent electrons
International Nuclear Information System (INIS)
Charkin, O.P.; Klimenko, N.M.; MakKi, M.L.
2000-01-01
In the framework of MP2(6-31*//HF/6-31G + ZPE(HF/6-31G*) and MP4SDTQ/6-31G*//MP2/6-31G* + ZPE(MP2/6-31G*) approximations ab initio calculations of surfaces of potential energy of molecules of lithium salts of Li 2 AB 2 (Li 2 BeO 2 , L 2 MgO 2 , Li 2 BeS 2 , Li 2 MgS 2 , Li 2 CN 2 , Li 2 SiN 2 , Li 2 CP 2 ) type and ions of Li 2 AB 2 + (Li 2 BO 2 + , Li 2 AlO 2 + , Li 2 BS 2 + , Li 2 AlS 2 + , Li 2 N 3 + , Li 2 PN 2 + , Li 2 P 3 + ) type with 16 valent electrons are done. For oxide and nitride systems global minimum corresponds to symmetric linear structure D ∞h and for their sulfide and phosphorus analogues curved plane or unplane (C 2 ) structure with bond angle φ(LBA)=90-110 Deg are preferable. Equilibrium geometric parameters, relative energies and energies of isomer decomposition, frequencies and IR-intensities of normal vibrations are determined [ru
Directory of Open Access Journals (Sweden)
Rajani Thanissery
2018-06-01
Full Text Available Antibiotics are considered to be the first line of treatment for mild to moderately severe Clostridium difficile infection (CDI in humans. However, antibiotics are also risk factors for CDI as they decrease colonization resistance against C. difficile by altering the gut microbiota and metabolome. Finding compounds that selectively inhibit different stages of the C. difficile life cycle, while sparing the indigenous gut microbiota is important for the development of alternatives to standard antibiotic treatment. 2-aminoimidazole (2-AI molecules are known to disrupt bacterial protection mechanisms in antibiotic resistant bacteria such as Pseudomonas aeruginosa, Acinetobacter baumannii, and Staphylococcus aureus, but are yet to be evaluated against C. difficile. A comprehensive small molecule-screening pipeline was developed to investigate how novel small molecules affect different stages of the C. difficile life cycle (growth, toxin, and sporulation in vitro, and a library of commensal bacteria that are associated with colonization resistance against C. difficile. The initial screening tested the efficacy of eleven 2-AI molecules (compound 1 through 11 against C. difficile R20291 compared to a vancomycin (2 μg/ml control. Molecules were selected for their ability to inhibit C. difficile growth, toxin activity, and sporulation. Further testing included growth inhibition of other C. difficile strains (CD196, M68, CF5, 630, BI9, M120 belonging to distinct PCR ribotypes, and a commensal panel (Bacteroides fragilis, B. thetaiotaomicron, C. scindens, C. hylemonae, Lactobacillus acidophilus, L. gasseri, Escherichia coli, B. longum subsp. infantis. Three molecules compound 1 and 2, and 3 were microbicidal, whereas compounds 4, 7, 9, and 11 inhibited toxin activity without affecting the growth of C. difficile strains and the commensal microbiota. The antimicrobial and anti-toxin effects of 2-AI molecules need to be further characterized for mode of
The dipole moments of the linear polycarbon monosulfides
International Nuclear Information System (INIS)
Murakami, Akinori
1989-01-01
The dipole moments of the linear polycarbon monosulfides, CS, C 2 S and C 3 S molecule (radical)s were calculated by ab initio SCF-CI method. The equilibrium geometries of the C n S molecules were obtained by MP3 method using the 6-31G** basis set. From the split balencetype (MIDI-4) to the Huzinaga's well tempered extended type(WT) were used to evaluate dipole moments. Final results were obtained using the WT+2d basis set and CI calculation. The calculated dipole moment of the CS molecule, 1.96 debye, is in good agreement with experimental one. The dipole moment of the C 2 S radical is calculated to be 2.81 debye and 3.66 debye for C 3 S molecule. The calculated dipole moments of the C n S will be accurate with in 0.1 debye(5%)
Retrieval of interatomic separations of molecules from laser-induced high-order harmonic spectra
International Nuclear Information System (INIS)
Le, Van-Hoang; Nguyen, Ngoc-Ty; Jin, C; Le, Anh-Thu; Lin, C D
2008-01-01
We illustrate an iterative method for retrieving the internuclear separations of N 2 , O 2 and CO 2 molecules using the high-order harmonics generated from these molecules by intense infrared laser pulses. We show that accurate results can be retrieved with a small set of harmonics and with one or few alignment angles of the molecules. For linear molecules the internuclear separations can also be retrieved from harmonics generated using isotropically distributed molecules. By extracting the transition dipole moment from the high-order harmonic spectra, we further demonstrated that it is preferable to retrieve the interatomic separation iteratively by fitting the extracted dipole moment. Our results show that time-resolved chemical imaging of molecules using infrared laser pulses with femtosecond temporal resolutions is possible
Serafín, V; Martínez-García, G; Agüí, L; Yáñez-Sedeño, P; Pingarrón, J M
2014-09-21
A label-free dual electrochemical immunosensor was constructed for the multiplexed determination of human growth (hGH) and prolactin (PRL) hormones. The immunosensor used an electrochemical platform composed of carbon nanotube-screen printed carbon electrodes (CNT/SPCEs) modified with poly(ethylene-dioxythiophene) (PEDOT) and gold nanoparticles, on which the corresponding hGH and PRL antibodies were immobilized. The affinity reactions were monitored by measuring the decrease in the differential pulse voltammetric oxidation response of the redox probe dopamine. The experimental variables involved in the preparation of both AuNP/PEDOT/CNT/SPC modified electrodes and the dual immunosensor were optimized. The immunosensor exhibited an improved analytical performance for hGH and PRL with respect to other electrochemical immunosensor designs, showing wide ranges of linearity and low detection limits of 4.4 and 0.22 pg mL(-1), respectively. An excellent selectivity against other hormones and in the presence of ascorbic and uric acids was found. The usefulness of the dual immunosensor for the simultaneous analysis of hGH and PRL was demonstrated by analyzing human serum and saliva samples spiked with the hormones at different concentration levels.
DEFF Research Database (Denmark)
Friedrichsen, Birgitte N; Richter, Henrijette E; Hansen, Johnny A
2003-01-01
in a time-dependent manner by hGH in INS-1 cells. Inhibition of protein synthesis by coincubation with cycloheximide did not affect the hGH-induced increase of cyclin D2 mRNA levels at 4 h. Expression of a dominant negative STAT5 mutant, STAT5aDelta749, partially inhibited cyclin D2 protein levels. INS-1...... cells transiently transfected with a cyclin D2 promoter-reporter construct revealed a 3- to 5-fold increase of transcriptional activity in response to hGH stimulation. Furthermore, coexpression of a constitutive active STAT5 mutant (either CA-STAT5a or CA-STAT5b) was sufficient to drive transactivation...
Energy Technology Data Exchange (ETDEWEB)
Calvo, F., E-mail: florent.calvo@univ-grenoble-alpes.fr [Univ. Grenoble Alpes, LIPHY, F-38000 Grenoble, France and CNRS, LIPHY, F-38000 Grenoble (France); Yurtsever, E. [Koç University, Rumelifeneriyolu, Sariyer, Istanbul 34450 (Turkey)
2016-06-14
This work theoretically examines the progressive coating of planar polycyclic aromatic hydrocarbon (PAH) molecules ranging from benzene to circumcoronene (C{sub 54}H{sub 18}) by para-hydrogen and ortho-deuterium. The coarse-grained Silvera-Goldman potential has been extended to model the interactions between hydrogen molecules and individual atoms of the PAH and parametrized against quantum chemical calculations for benzene-H{sub 2}. Path-integral molecular dynamics simulations at 2 K were performed for increasingly large amounts of hydrogen coating the PAH up to the first solvation shell and beyond. From the simulations, various properties were determined such as the size of the first shell and its thickness as well as the solvation energy. The degree of delocalization was notably quantified from an energy landscape perspective, by monitoring the fluctuations among inherent structures sampled by the trajectories. Our results generally demonstrate a high degree of localization owing to relatively strong interactions between hydrogen and the PAH, and qualitatively minor isotopic effects. In the limit of large hydrogen amounts, the shell size and solvation energy both follow approximate linear relations with the numbers of carbon and hydrogen in the PAH.
International Nuclear Information System (INIS)
Schneider, B.I.; Collins, L.A.
1983-01-01
We propose a method for constructing an effective optical potential through which correlation effects can be introduced into the electron-molecule scattering formulation. The optical potential is based on a nonperturbative, Feshbach projection-operator procedure and is evaluated on an L 2 basis. The optical potential is incorporated into the scattering equations by means of a separable expansion, and the resulting scattering equations are solved by a linear-algebraic method based on the integral-equation formulation. We report the results of scattering calculations, which include polarization effects, for low-energy e-H 2 and e-N 2 collisions. The agreement with other theoretical and with experimental results is quite good
Semenov, Alexander; Babikov, Dmitri
2015-12-17
The mixed quantum classical theory, MQCT, for inelastic scattering of two molecules is developed, in which the internal (rotational, vibrational) motion of both collision partners is treated with quantum mechanics, and the molecule-molecule scattering (translational motion) is described by classical trajectories. The resultant MQCT formalism includes a system of coupled differential equations for quantum probability amplitudes, and the classical equations of motion in the mean-field potential. Numerical tests of this theory are carried out for several most important rotational state-to-state transitions in the N2 + H2 system, in a broad range of collision energies. Besides scattering resonances (at low collision energies) excellent agreement with full-quantum results is obtained, including the excitation thresholds, the maxima of cross sections, and even some smaller features, such as slight oscillations of energy dependencies. Most importantly, at higher energies the results of MQCT are nearly identical to the full quantum results, which makes this approach a good alternative to the full-quantum calculations that become computationally expensive at higher collision energies and for heavier collision partners. Extensions of this theory to include vibrational transitions or general asymmetric-top rotor (polyatomic) molecules are relatively straightforward.
Retrieval of interatomic separations of molecules from laser-induced high-order harmonic spectra
Energy Technology Data Exchange (ETDEWEB)
Le, Van-Hoang; Nguyen, Ngoc-Ty [Department of Physics, University of Pedagogy, 280 An Duong Vuong, Ward 5, Ho Chi Minh City (Viet Nam); Jin, C; Le, Anh-Thu; Lin, C D [J. R. Macdonald Laboratory, Department of Physics, Kansas State University, Manhattan, KS 66506 (United States)
2008-04-28
We illustrate an iterative method for retrieving the internuclear separations of N{sub 2}, O{sub 2} and CO{sub 2} molecules using the high-order harmonics generated from these molecules by intense infrared laser pulses. We show that accurate results can be retrieved with a small set of harmonics and with one or few alignment angles of the molecules. For linear molecules the internuclear separations can also be retrieved from harmonics generated using isotropically distributed molecules. By extracting the transition dipole moment from the high-order harmonic spectra, we further demonstrated that it is preferable to retrieve the interatomic separation iteratively by fitting the extracted dipole moment. Our results show that time-resolved chemical imaging of molecules using infrared laser pulses with femtosecond temporal resolutions is possible.
Zhou, Hui; Wuest, James D
2013-06-18
Linear D2h-symmetric bisisophthalic acids 1 and 2 and related substances have well-defined flattened structures, high affinities for graphite, and strong abilities to engage in specific intermolecular interactions. Their adsorption produces characteristic nanopatterns that reveal how 2D molecular organization can be controlled by reliable interadsorbate interactions such as hydrogen bonds when properly oriented by molecular geometry. In addition, the behavior of these compounds shows how large-scale organization can be obstructed by programming molecules to associate strongly according to competing motifs that have similar stability and can coexist smoothly without creating significant defects. Analogous new bisisophthalic acids 3a and 4a have similar associative properties, and their unique C2h-symmetric crankshaft geometry gives them the added ability to probe the poorly understood effect of chirality on molecular organization. Their adsorption shows how nanopatterns composed predictably of a single enantiomer can be obtained by depositing molecules that can respect established rules of association only by accepting neighbors of the same configuration. In addition, an analysis of the adsorption of crankshaft compounds 3a and 4a and their derivatives by STM reveals directly on the molecular level how kinetics and thermodynamics compete to control the crystallization of chiral compounds. In such ways, detailed studies of the adsorption of properly designed compounds on surfaces are proving to be a powerful way to discover and test rules that broadly govern molecular organization in both 2D and 3D.
Stabilizing photoassociated Cs2 molecules by optimal control
International Nuclear Information System (INIS)
Zhang Wei; Xie Ting; Huang Yin; Wang Gao-Ren; Cong Shu-Lin
2013-01-01
We demonstrate theoretically that photoassociated molecules can be stabilized to deeply bound states. This process is achieved by transferring the population from the outer well to the inner well using the optimal control theory, the Cs 2 molecule is taken as an example. Numerical calculations show that weakly bound molecules formed in the outer well by a pump pulse can be compressed to the inner well via a vibrational level of the ground electronic state as an intermediary by an additionally optimized laser pulse. The positively chirped pulse can enhance the population of the target state. With a transform-limited dump pulse, nearly all the photoassociated molecules in the inner well of the excited electronic state can be transferred to the deeply vibrational level of the ground electronic state. (atomic and molecular physics)
Stabilizing photoassociated Cs2 molecules by optimal control
Zhang, Wei; Xie, Ting; Huang, Yin; Wang, Gao-Ren; Cong, Shu-Lin
2013-01-01
We demonstrate theoretically that photoassociated molecules can be stabilized to deeply bound states. This process is achieved by transferring the population from the outer well to the inner well using the optimal control theory, the Cs2 molecule is taken as an example. Numerical calculations show that weakly bound molecules formed in the outer well by a pump pulse can be compressed to the inner well via a vibrational level of the ground electronic state as an intermediary by an additionally optimized laser pulse. The positively chirped pulse can enhance the population of the target state. With a transform-limited dump pulse, nearly all the photoassociated molecules in the inner well of the excited electronic state can be transferred to the deeply vibrational level of the ground electronic state.
Marrero-Ponce, Yovani; Martínez-Albelo, Eugenio R; Casañola-Martín, Gerardo M; Castillo-Garit, Juan A; Echevería-Díaz, Yunaimy; Zaldivar, Vicente Romero; Tygat, Jan; Borges, José E Rodriguez; García-Domenech, Ramón; Torrens, Francisco; Pérez-Giménez, Facundo
2010-11-01
Novel bond-level molecular descriptors are proposed, based on linear maps similar to the ones defined in algebra theory. The kth edge-adjacency matrix (E(k)) denotes the matrix of bond linear indices (non-stochastic) with regard to canonical basis set. The kth stochastic edge-adjacency matrix, ES(k), is here proposed as a new molecular representation easily calculated from E(k). Then, the kth stochastic bond linear indices are calculated using ES(k) as operators of linear transformations. In both cases, the bond-type formalism is developed. The kth non-stochastic and stochastic total linear indices are calculated by adding the kth non-stochastic and stochastic bond linear indices, respectively, of all bonds in molecule. First, the new bond-based molecular descriptors (MDs) are tested for suitability, for the QSPRs, by analyzing regressions of novel indices for selected physicochemical properties of octane isomers (first round). General performance of the new descriptors in this QSPR studies is evaluated with regard to the well-known sets of 2D/3D MDs. From the analysis, we can conclude that the non-stochastic and stochastic bond-based linear indices have an overall good modeling capability proving their usefulness in QSPR studies. Later, the novel bond-level MDs are also used for the description and prediction of the boiling point of 28 alkyl-alcohols (second round), and to the modeling of the specific rate constant (log k), partition coefficient (log P), as well as the antibacterial activity of 34 derivatives of 2-furylethylenes (third round). The comparison with other approaches (edge- and vertices-based connectivity indices, total and local spectral moments, and quantum chemical descriptors as well as E-state/biomolecular encounter parameters) exposes a good behavior of our method in this QSPR studies. Finally, the approach described in this study appears to be a very promising structural invariant, useful not only for QSPR studies but also for similarity
McDonald, Mickey
2017-04-01
Over the past several decades, rapid progress has been made toward the accurate characterization and control of atoms, epitomized by the ever-increasing accuracy and precision of optical atomic lattice clocks. Extending this progress to molecules will have exciting implications for chemistry, condensed matter physics, and precision tests of physics beyond the Standard Model. My thesis describes work performed over the past six years to establish the state of the art in manipulation and quantum control of ultracold molecules. We describe a thorough set of measurements characterizing the rovibrational structure of weakly bound 88Sr2 molecules from several different perspectives, including determinations of binding energies; linear, quadratic, and higher order Zeeman shifts; transition strengths between bound states; and lifetimes of narrow subradiant states. Finally, we discuss measurements of photofragment angular distributions produced by photodissociation of molecules in single quantum states, leading to an exploration of quantum-state-resolved ultracold chemistry. The images of exploding photofragments produced in these studies exhibit dramatic interference effects and strongly violate semiclassical predictions, instead requiring a fully quantum mechanical description.
Granger, Devin Benjamin
Polycyclic aromatic hydrocarbons composed of benzenoid rings fused in a linear fashion comprise the class of compounds known as acenes. The structures containing three to six ring fusions are brightly colored and possess band gaps and charge transport efficiencies sufficient for semiconductor applications. These molecules have been investigated throughout the past several decades to assess their optoelectronic properties. The absorption, emission and charge transport properties of this series of molecules has been studied extensively to elucidate structure-property relationships. A wide variety of analogous molecules, incorporating heterocycles in place of benzenoid rings, demonstrate similar properties to the parent compounds and have likewise been investigated. Functionalization of acene compounds by placement of groups around the molecule affects the way in which molecules interact in the solid state, in addition to the energetics of the molecule. The use of electron donating or electron withdrawing groups affects the frontier molecular orbitals and thus affects the optical and electronic gaps of the molecules. The use of bulky side groups such as alkylsilylethynyl groups allows for crystal engineering of molecular aggregates, and changing the volume and dimensions of the alkylsilyl groups affects the intermolecular interactions and thus changes the packing motif. In chapter 2, a series of tetracene and pentacene molecules with strongly electron withdrawing groups is described. The investigation focuses on the change in energetics of the frontier molecular orbitals between the base acene and the nitrile and dicyanovinyl derivatives as well as the differences between the pentacene and tetracene molecules. The differences in close packing motifs through use of bulky alkylsilylethynyl groups is also discussed in relation to electron acceptor material design and bulk heterojunction organic photovoltaic characteristics. Chapter 3 focuses on molecular acceptor and
Energy Technology Data Exchange (ETDEWEB)
Tolmachev, Vladimir [Uppsala University, Biomedical Radiation Sciences, Rudbeck Laboratory, Uppsala (Sweden); Uppsala University, Department of Medical Sciences, Nuclear Medicine, Uppsala (Sweden); Waallberg, Helena [Royal Institute of Technology, School of Biotechnology, Stockholm (Sweden); Sandstroem, Mattias [Uppsala University Hospital, Section of Hospital Physics, Department of Oncology, Uppsala (Sweden); Hansson, Monika; Wennborg, Anders [Affibody AB, Stockholm (Sweden); Orlova, Anna [Uppsala University, Biomedical Radiation Sciences, Rudbeck Laboratory, Uppsala (Sweden)
2011-03-15
Overexpression of the HER2 receptor is a biomarker for predicting those patients who may benefit from trastuzumab therapy. Radiolabelled Affibody molecules can be used to visualize HER2 expression in tumour xenografts with high sensitivity. However, previous studies demonstrated that the difference in uptake in xenografts with high and low HER2 expression levels is not proportional to the difference in expression levels. We hypothesized that discrimination between tumours with high and low HER2 expression may be improved by increasing the injected dose (reducing the specific activity) of the tracer. The influence of injected dose of anti-HER2 {sup 111}In-DOTA-Z{sub HER2} {sub 342} Affibody molecule on uptake in SKOV-3 (high HER2 expression) and LS174T (low expression) xenografts was investigated. The optimal range of injected doses enabling discrimination between xenografts with high and low expression was determined. To verify this, tumour uptake was measured in mice carrying both SKOV-3 and LS174T xenografts after injection of either 1 or 15 {mu}g {sup 111}In-DOTA-Z{sub HER2:342}. An increase in the injected dose caused a linear decrease in the radioactivity accumulation in the LS174T xenografts (low HER2 expression). For SKOV-3 xenografts, the dependence of the tumour uptake on the injected dose was less dramatic. The injection of 10-30 {mu}g {sup 111}In-DOTA-Z{sub HER2:342} per mouse led to the largest difference in uptake between the two types of tumour. Experiments in mice bearing two xenografts confirmed that the optimized injected dose enabled better discrimination of expression levels. Careful optimization of the injected dose of Affibody molecules is required for maximum discrimination between xenografts with high and low levels of HER2 expression. This information has potential relevance for clinical imaging applications. (orig.)
International Nuclear Information System (INIS)
Larriba-Andaluz, Carlos; Hogan, Christopher J.
2014-01-01
Structural characterization of ions in the gas phase is facilitated by measurement of ion collision cross sections (CCS) using techniques such as ion mobility spectrometry. Further information is gained from CCS measurement when comparison is made between measurements and accurately predicted CCSs for model ion structures and the gas in which measurements are made. While diatomic gases, namely molecular nitrogen and air, are being used in CCS measurement with increasingly prevalency, the majority of studies in which measurements are compared to predictions use models in which gas molecules are spherical or non-rotating, which is not necessarily appropriate for diatomic gases. Here, we adapt a momentum transfer based CCS calculation approach to consider rotating, diatomic gas molecule collisions with polyatomic ions, and compare CCS predictions with a diatomic gas molecule to those made with a spherical gas molecular for model spherical ions, tetra-alkylammonium ions, and multiply charged polyethylene glycol ions. CCS calculations are performed using both specular-elastic and diffuse-inelastic collisions rules, which mimic negligible internal energy exchange and complete thermal accommodation, respectively, between gas molecule and ion. The influence of the long range ion-induced dipole potential on calculations is also examined with both gas molecule models. In large part we find that CCSs calculated with specular-elastic collision rules decrease, while they increase with diffuse-inelastic collision rules when using diatomic gas molecules. Results clearly show the structural model of both the ion and gas molecule, the potential energy field between ion and gas molecule, and finally the modeled degree of kinetic energy exchange between ion and gas molecule internal energy are coupled to one another in CCS calculations, and must be considered carefully to obtain results which agree with measurements
Quantum Monte Carlo for vibrating molecules
International Nuclear Information System (INIS)
Brown, W.R.; Lawrence Berkeley National Lab., CA
1996-08-01
Quantum Monte Carlo (QMC) has successfully computed the total electronic energies of atoms and molecules. The main goal of this work is to use correlation function quantum Monte Carlo (CFQMC) to compute the vibrational state energies of molecules given a potential energy surface (PES). In CFQMC, an ensemble of random walkers simulate the diffusion and branching processes of the imaginary-time time dependent Schroedinger equation in order to evaluate the matrix elements. The program QMCVIB was written to perform multi-state VMC and CFQMC calculations and employed for several calculations of the H 2 O and C 3 vibrational states, using 7 PES's, 3 trial wavefunction forms, two methods of non-linear basis function parameter optimization, and on both serial and parallel computers. In order to construct accurate trial wavefunctions different wavefunctions forms were required for H 2 O and C 3 . In order to construct accurate trial wavefunctions for C 3 , the non-linear parameters were optimized with respect to the sum of the energies of several low-lying vibrational states. In order to stabilize the statistical error estimates for C 3 the Monte Carlo data was collected into blocks. Accurate vibrational state energies were computed using both serial and parallel QMCVIB programs. Comparison of vibrational state energies computed from the three C 3 PES's suggested that a non-linear equilibrium geometry PES is the most accurate and that discrete potential representations may be used to conveniently determine vibrational state energies
Adiabatic Field-Free Alignment of Asymmetric Top Molecules with an Optical Centrifuge.
Korobenko, A; Milner, V
2016-05-06
We use an optical centrifuge to align asymmetric top SO_{2} molecules by adiabatically spinning their most polarizable O-O axis. The effective centrifugal potential in the rotating frame confines the sulfur atoms to the plane of the laser-induced rotation, leading to the planar molecular alignment that persists after the molecules are released from the centrifuge. The periodic appearance of the full three-dimensional alignment, typically observed only with linear and symmetric top molecules, is also detected. Together with strong in-plane centrifugal forces, which bend the molecules by up to 10 deg, permanent field-free alignment offers new ways of controlling molecules with laser light.
Jacobson, Daniel; Stratt, Richard M.
2014-05-01
Because the geodesic pathways that a liquid follows through its potential energy landscape govern its slow, diffusive motion, we suggest that these pathways are logical candidates for the title of a liquid's "inherent dynamics." Like their namesake "inherent structures," these objects are simply features of the system's potential energy surface and thus provide views of the system's structural evolution unobstructed by thermal kinetic energy. This paper shows how these geodesic pathways can be computed for a liquid of linear molecules, allowing us to see precisely how such molecular liquids mix rotational and translational degrees of freedom into their dynamics. The ratio of translational to rotational components of the geodesic path lengths, for example, is significantly larger than would be expected on equipartition grounds, with a value that scales with the molecular aspect ratio. These and other features of the geodesics are consistent with a picture in which molecular reorientation adiabatically follows translation—molecules largely thread their way through narrow channels available in the potential energy landscape.
Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.
Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J
2003-10-01
Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.
Directory of Open Access Journals (Sweden)
Minh Tan Nguyen
Full Text Available Human growth hormone (hGH is synthesized by somatotroph cells of the anterior pituitary gland and induces cell proliferation and growth. This protein has been approved for the treatment of various conditions, including hGH deficiency, chronic renal failure, and Turner syndrome. Efficient production of hGH in Escherichia coli (E. coli has proven difficult because the E. coli-expressed hormone tends to aggregate and form inclusion bodies, resulting in poor solubility. In this study, seven N-terminal fusion partners, hexahistidine (His6, thioredoxin (Trx, glutathione S-transferase (GST, maltose-binding protein (MBP, N-utilization substance protein A (NusA, protein disulfide bond isomerase (PDI, and the b'a' domain of PDI (PDIb'a', were tested for soluble overexpression of codon-optimized hGH in E. coli. We found that MBP and hPDI tags significantly increased the solubility of the hormone. In addition, lowering the expression temperature to 18°C also dramatically increased the solubility of all the fusion proteins. We purified hGH from MBP-, PDIb'a'-, or Trx-tagged hGH expressed at 18°C in E. coli using simple chromatographic techniques and compared the final purity, yield, and activity of hGH to assess the impact of each partner protein. Purified hGH was highly pure on silver-stained gel and contained very low levels of endotoxin. On average, ∼37 mg, ∼12 mg, and ∼7 mg of hGH were obtained from 500 mL-cell cultures of Trx-hGH, MBP-hGH, and PDIb'a'-hGH, respectively. Subsequently, hGH was analyzed using mass spectroscopy to confirm the presence of two intra-molecular disulfide bonds. The bioactivity of purified hGHs was demonstrated using Nb2-11 cell.
Søndergaard, Anders Aspegren; Shepperson, Benjamin; Stapelfeldt, Henrik
2017-07-07
We present an efficient, noise-robust method based on Fourier analysis for reconstructing the three-dimensional measure of the alignment degree, ⟨cos 2 θ⟩, directly from its two-dimensional counterpart, ⟨cos 2 θ 2D ⟩. The method applies to nonadiabatic alignment of linear molecules induced by a linearly polarized, nonresonant laser pulse. Our theoretical analysis shows that the Fourier transform of the time-dependent ⟨cos 2 θ 2D ⟩ trace over one molecular rotational period contains additional frequency components compared to the Fourier transform of ⟨cos 2 θ⟩. These additional frequency components can be identified and removed from the Fourier spectrum of ⟨cos 2 θ 2D ⟩. By rescaling of the remaining frequency components, the Fourier spectrum of ⟨cos 2 θ⟩ is obtained and, finally, ⟨cos 2 θ⟩ is reconstructed through inverse Fourier transformation. The method allows the reconstruction of the ⟨cos 2 θ⟩ trace from a measured ⟨cos 2 θ 2D ⟩ trace, which is the typical observable of many experiments, and thereby provides direct comparison to calculated ⟨cos 2 θ⟩ traces, which is the commonly used alignment metric in theoretical descriptions. We illustrate our method by applying it to the measurement of nonadiabatic alignment of I 2 molecules. In addition, we present an efficient algorithm for calculating the matrix elements of cos 2 θ 2D and any other observable in the symmetric top basis. These matrix elements are required in the rescaling step, and they allow for highly efficient numerical calculation of ⟨cos 2 θ 2D ⟩ and ⟨cos 2 θ⟩ in general.
Trapping and interactions of an ultracold gas of Cs2 molecules
International Nuclear Information System (INIS)
Mark, M.; Kraemer, T.; Herbig, J.; Waldburger, P.; Naegerl, H.C.; Chin, C.; Grimm, R.
2005-01-01
Full text: We investigate dynamics and interactions of Cs 2 dimers in a CO2-laser dipole trap. Starting with a Bose-Einstein condensate (BEC) of 2.2 x 10 5 Cs atoms, we create ultracold molecules in a single, weakly bound quantum state by sweeping the magnetic field across a narrow Feshbach resonance. When the molecules are created in free space, the conversion efficiency exceeds 30 %, yielding up to 50000 molecules. In our trapping experiments, about 6000 ultracold Cs 2 dimers are prepared in the optical trap at a temperature of 200 nK. We transfer the trapped molecules from the initial molecular state to other molecular states by following avoided crossings. We find two magnetically tunable resonances in collisions between the molecules for one of the molecular states. We interpret these Feshbach-liKEX resonances as being induced by Cs 4 bound states near the molecular scattering continuum. Further, we have discovered a new molecular state with very large orbital angular momentum of l = 8. This state is very weakly coupled to one of the initial molecular states. We use the associated avoided crossing as a molecular beam splitter to realize a molecular Ramsey-type interferometer. Refs. 2 (author)
Decomposition of 2-((2-methoxyphenyl)diazenyl)benzene-1,3,5-triol molecule by an argon plasma jet
Tanışlı, Murat; Taşal, Erol
2018-05-01
In this study, we have presented the effects of the argon plasma on a 2-((2-methoxyphenyl)diazenyl)benzene-1,3,5-triol molecule—AZO compound (abbreviated as 2MDB)—under atmospheric pressure. In order to do this, the validated molecule has been considered and plasma has been used to modify it. The atmospheric pressure plasma jet system was specially designed for performing decomposing processes of the 2MDB molecule. The characterizations before and after the application of plasma—which takes only 3 minutes under atmospheric pressure conditions, to dissolve the 2MDB molecule in ethanol and methanol solutions—were examined using the Fourier transform infrared and Ultraviolet-Visible (UV-Vis) spectroscopies. After the plasma treatment, the molecule was broken at -C-N=N-C-C bond. Accurate and important changes are seen clearly from the results. In addition, according to UV-Vis spectra, π-π* electronic transitions related to -N=N- AZO bridge for the 2MDB molecule in polar-aprotic solvents such as ethanol and methanol were recorded as strong transitions. The new photoproducts such as -C-N-N=C and C=O were obtained from the 2MDB molecule.
Molecules with linear pi-conjugated pathways between all substituents : Omniconjugation
van der Veen, M.H.; Rispens, M.T; Jonkman, H.T.; Hummelen, J.C.
In this paper, omniconjugation is introduced as a topological phenomenon in pi-conjugated systems. Omniconjugated molecules are defined by the fact that they provide direct and fully pi-conjugated pathways between all subdstituents attached to them. Surprisingly, until now such topologies have never
Molecules with Linear π-Conjugated Pathways between All Substituents : Omniconjugation
Veen, Marleen H. van der; Rispens, Minze T.; Jonkman, Harry T.; Hummelen, Jan C.
2004-01-01
In this paper, omniconjugation is introduced as a topological phenomenon in π-conjugated systems. Omniconjugated molecules are defined by the fact that they provide direct and fully π-conjugated pathways between all substituents attached to them. Surprisingly, until now such topologies have never
Directory of Open Access Journals (Sweden)
Juliane Léger
2017-11-01
Full Text Available Background/Aims: Growth failure is a difficult but key aspect of care in children with anorexia nervosa (AN. The effects of hGH therapy have not been studied. The aim was to investigate the effect of hGH treatment on height velocity (HV in children with AN. Methods: We carried out a retrospective observational study. Ten girls diagnosed with AN at 10.0 ± 1.9 years, with prolonged severe growth failure (HV < 2.5 cm/year for at least 18 months at the age of 13.3 ± 1.1 years and delayed puberty after nutritional rehabilitation, were treated with hGH (0.040 mg/kg/day from a bone age of 10.9 ± 1.7 years until they reached adult height. Height and HV were measured before treatment and at 12-month intervals during treatment. Results: Mean body mass index SDS remained unchanged, but HV increased significantly, from a median of 1.0 (0.7–2.1 to 7.1 (6.0–9.5 cm/year after one year (P < 0.002 and 5.6 (4.8–6.2 cm/year after two years of treatment. Height SDS increased from −2.2 ± 1.3 to −1.6 ± 1.3 after one year (P < 0.002 and −1.1 ± 1.5 after two years of GH treatment. Adult height (−0.1 ± 1.0 SDS was close to target height after 3.6 ± 1.4 years of GH treatment. Serum IGF-I levels increased significantly during treatment (P < 0.01. The treatment was well tolerated. Conclusions: This proof-of-concept study shows that hGH treatment is associated with significant improvements in linear growth in adolescents with AN and severe growth failure. A randomized placebo-controlled trial is required to determine the ultimate impact of GH treatment in patients with this severe, rare condition.
Penocchio, Emanuele; Piccardo, Matteo; Barone, Vincenzo
2015-10-13
The B2PLYP double hybrid functional, coupled with the correlation-consistent triple-ζ cc-pVTZ (VTZ) basis set, has been validated in the framework of the semiexperimental (SE) approach for deriving accurate equilibrium structures of molecules containing up to 15 atoms. A systematic comparison between new B2PLYP/VTZ results and several equilibrium SE structures previously determined at other levels, in particular B3LYP/SNSD and CCSD(T) with various basis sets, has put in evidence the accuracy and the remarkable stability of such model chemistry for both equilibrium structures and vibrational corrections. New SE equilibrium structures for phenylacetylene, pyruvic acid, peroxyformic acid, and phenyl radical are discussed and compared with literature data. Particular attention has been devoted to the discussion of systems for which lack of sufficient experimental data prevents a complete SE determination. In order to obtain an accurate equilibrium SE structure for these situations, the so-called templating molecule approach is discussed and generalized with respect to our previous work. Important applications are those involving biological building blocks, like uracil and thiouracil. In addition, for more general situations the linear regression approach has been proposed and validated.
Hu, Yiwei; Long, Linbo; Mao, Yuliang; Zhong, Jianxin
2018-06-01
Using first-principles methods, we have studied the adsorption of gas molecules (CO2, CH4, H2S, H2 and NH3) on two dimensional Ge2Li2 monolayer. The adsorption geometries, adsorption energies, charge transfer, and band structures of above mentioned gas molecules adsorption on Ge2Li2 monolayer are analyzed. It is found that the adsorption of CO2 on Ge2Li2 monolayer is a kind of strong chemisorption, while other gas molecules such as CH4, H2S, H2 and NH3 are physisorption. The strong covalent binding is formed between the CO2 molecule and the nearest Ge atom in Ge2Li2 monolayer. This adsorption of CO2 molecule on Ge2Li2 monolayer leads to a direct energy gap of 0.304 eV. Other gas molecules exhibit mainly ionic binding to the nearest Li atoms in Ge2Li2 monolayer, which leads to indirect energy gap after adsorptions. Furthermore, it is found that the work function of Ge2Li2 monolayer is sensitive with the variation of adsorbents. Our results reveal that the Ge2Li2 monolayer can be used as a kind of nano device for gas molecules sensor.
International Nuclear Information System (INIS)
Dietz, A.
1982-01-01
Human growth hormone (hGH) was measured by means of the radioimmunoassay (RIA) and the radioreceptor assay (RRA). The receptors were liver plasma membranes (LPM) of pregnant rabbits. In the RIA, no cross-reaction was found with hPRL, whereas in the RRA the cross-reaction was 3 p.c. The Scatchard analysis revealed two binding sites for hGH at the receptor. Pre-treatment with hGH and Cortisol brought about an enhanced affinity without change of the specific bonding, whereas pre-treatment with bromocriptin showed no significant effect. Hypophyseal hGH was separated by means of gel chromatography into big-big and big-little hGH and a reduced receptor activity of the higher molecular hGH fraction was shown. The Scatchard analysis indicated a more unspecific bonding characteristic of the big hGH. Stimulation of hGH secretion by insulin hypoglycemia provoked an overproportional increase in big hGH in healthy persons, whereas in patients with acromegaly the secretion of little hGH was enhanced. The suppression of hGH secretion by long-term bromocriptin treatment led to a significant rise of the RIA/RRA quotient in patients with post-operative florid acromegaly. Acute administration of BC was shown to induce a stronger hGH drop in the RRA of responders than in their RIA, as compared to non-responders. By chromatographic separation it was found that in responders the secretion of little hGH is selectively inhibited, but no in non-responders. (orig.) [de
The development of radioimmunoassay systems for the human pituitary gland
International Nuclear Information System (INIS)
Simionescu, L.
1983-11-01
The aim of the study was the preparation of 1. Human Growth Hormone (HGH), 2. The glycoprotein hormones: Luteinizing Hormone (LH), Follicle Stimulating Hormone (FSH) and Thyroid Stimulating Hormone (TSH), 3. The Prolactin. 1. A standardised procedure for the preparation of HGH ''clinical grade'' was developed. This HGH can be applied for the treatment of children diagnosed as hypophyseal dwarfism; the preliminary results are encouraging. The final ethanol-soluble fraction is used also for the prolactin preparation. As shown by exclusion chromatography, the lyophilized HGH ''clinical grade'' contains mainly its monomeric form. The purified HGH obtained by processing of frozen glands is suitable as antigen for the preparation of antisera in rabbits. Large quantities of purified HGH were prepared, used as preparation for radioiodination, and proposed as a national reference preparation for immunoassay. The double antibody HGH-RIA system using author's procedure seems to be adequate for the HGH measurements in biological fluids. 2. Using two chromatographic steps (Sephadex G-150, DEAE-cellulose) followed by a preparative electrophoresis (P-PAGE) purified LH was obtained. The measurement of the β-TSH in the P-PAGE eluates showed concentrations lower than the sensitivity limit of the β-TSH RIA system (5microU/ml). The three chromatographic steps (Sephadex G-150, DEAE-cellulose and Sephadex G-100) allowed to separate the FSH from TSH during the third step, FSH being eluted faster than TSH, as resulted from the RIA measurements of the FSH and of β-TSH: Some overlapping of the concentrations of these hormones was observed only in eluates on the descending arm of the FSH peak. 3. The procedure for the isolation and purification of prolactin was developed according to Hwang's method. The extraction procedure started with the discarded step during the HSH ''clinical grade'' preparation and included three chromatographic steps for purification. However, the final product
Efficient production of long-lived ultracold Sr2 molecules
Ciamei, Alessio; Bayerle, Alex; Chen, Chun-Chia; Pasquiou, Benjamin; Schreck, Florian
2017-07-01
We associate Sr atom pairs on sites of a Mott insulator optically and coherently into weakly bound ground-state molecules, achieving an efficiency above 80%. This efficiency is 2.5 times higher than in our previous work [S. Stellmer, B. Pasquiou, R. Grimm, and F. Schreck, Phys. Rev. Lett. 109, 115302 (2012), 10.1103/PhysRevLett.109.115302] and obtained through two improvements. First, the lifetime of the molecules is increased beyond one minute by using an optical lattice wavelength that is further detuned from molecular transitions. Second, we compensate undesired dynamic light shifts that occur during the stimulated Raman adiabatic passage (STIRAP) used for molecule association. We also characterize and model STIRAP, providing insights into its limitations. Our work shows that significant molecule association efficiencies can be achieved even for atomic species or mixtures that lack Feshbach resonances suitable for magnetoassociation.
Directory of Open Access Journals (Sweden)
Arindam Chakraborty
2006-03-01
orbital in almost all conformations. One more important result of the present study is that, with the physical process of structural evolution from close angular shape to the linear transition state, the length of the à (O–H decreases and its strength increases as a monotone function of reaction coordinates. The bond length is shortest and the strength is largest at the transition state of structural inversion. Result of structural effect of the present study during the evolution of molecular conformations is quite consistent with the result of a very refined calculation that one physically significant feature of force field that the stretching force constants at the linear geometry are considerably larger than their equilibrium counter parts. The variation of bond strength and the hybridization of s and p orbitals on O atom center to form the à (O–H bond as a function of evolution of conformations is in accordance with Coulson’s prediction. The total dipole moment of all conformations is partitioned into the contribution from bonds and lone pairs and correlated in terms of the computed hybridization in lone pairs. The analysis of the variation of dipole moment as a function of angular to linear structural evolution reveals that the dipole moment of H2O molecule is not due to the bond moments only but a significant contribution comes from a lone pair. It is strongly established that the dipole moment of water molecule at and around the equilibrium geometry is not due to the bond moments only and the major part of the molecular dipole comes from the contribution of lone pair electrons. This necessitates the accommodation of a lone pair of electrons in a hybrid orbital on O atom. The computed LMO’s webbed with partitioned molecular dipole reveal that one lone pair is in a pure p- type orbital and the other lone pair is in a hybrid of s and p, and not in a pure s type orbital as suggested on the basis of
Rotational excitation of linear triatomic molecules: Ar, Kr + N2O, CO2
International Nuclear Information System (INIS)
Farrar, J.M.; Parson, J.M.; Lee, Y.T.
1974-01-01
Rotational excitation of N 2 O and CO 2 in collisions with Ar and Kr has been studied by crossing two supersonic molecular beams and detecting scattered products with a mass spectrometer. Measurement of the time of flight spectrum of the products as a function of laboratory scattering angle theta indicates that the inelasticity is concentrated in the forward direction in the center of mass system. Difference between CO 2 and N 2 O are discussed briefly
Controlling translational motion of neutral molecules in inhomogeneous electric fields
International Nuclear Information System (INIS)
Yamakita, Yoshihiro
2006-01-01
Hydrogen molecules are excited to Rydberg states with n=16, 17 in the presence of inhomogeneous field of an electric dipole by a vacuum ultraviolet-ultraviolet double resonance scheme. The large dipole moment produced in Stark eigenstates leads to strong forces on the molecules in the inhomogeneous electric field. Deflection and deceleration are demonstrated for a pulsed supersonic beam containing the H 2 molecules in the n=16, 17, N + =2, M J =0 Rydberg states. The Rydberg states are found to survive for over 100 μs after the dipole field is switched off. The Rydberg states have a special stability with respect to decay by predissociation. Complete deceleration to the zero mean velocity is numerically demonstrated for H 2 molecules in the higher linear low-field-seeking n=16, M J =0 Rydberg states by using a symplectic integrator of the fourth order. The calculations show that the initial velocity of 900 ms -1 with translational temperature 1 K is decelerated to 0 ms -1 with 13 mK. (author)
International Nuclear Information System (INIS)
Quail, J.A.; Jellinck, P.H.
1987-01-01
The ability of GH from various mammalian species, administered to normal mature male rats by constant infusion, to decrease the hepatic 2-hydroxylation of estradiol (E2) to female levels, as measured by the release of 3 H 2 O from [2-3H]E2, was determined. Rat and human GH (hGH) showed the highest activity while ovine GH was inactive. PRL (0.6 IU/h X kg) administered together with hGH (0.02 IU/h X kg) did not antagonize the feminizing action of GH. Infusion of hGH into male rats decreased the affinity of estradiol 2-hydroxylase for its steroid substrate and altered the linear Lineweaver-Burk plot towards a nonlinear hyperbolic plot characteristic of the female. The apparent Michaelis-Menten constant (Km) for the reaction was 1.69 microM for males and 2.75 microM for testosterone-treated ovariectomized females. An equal mixture of liver microsomes from male and female rats gave kinetic values similar to those observed with males alone. Neonatal imprinting with androgen did not alter the magnitude of the response of female rats to treatment with testosterone and/or GH at maturity and the androgen effect could only be shown in ovariectomized animals. The results with rats of different endocrine status were corroborated by the kinetic data and by the pattern of metabolites obtained with [4- 14 C]E2 when examined by TLC and autoradiography. The hormonal control of estradiol 2-hydroxylase, the key enzyme in catechol estrogen formation, and the contribution of sex-specific multiple forms of the enzyme to this reaction are discussed
International Nuclear Information System (INIS)
Damaskin, B.B.; Polyanovskaya, N.S.
1988-01-01
Electrocapillary measurements were used to obtain isotherms of specific adsorption of I - anions on the Hg/H 2 O boundary from KI+0.05 M of thiourea (TU) solutions. Is is shown that these data can be described by a simple varial isotherm, but disagree with Grahame-Parsons model. It follows from the suggested model interpretation of obtained results that electric centers of specifically adsorbed anions are displaced during coadsorption of TU molecules to the side of Helmholtz external plane, leading to disappearance of Esin-Markov effect
Water molecule-enhanced CO2 insertion in lanthanide coordination polymers
International Nuclear Information System (INIS)
Luo Liushan; Huang Xiaoyuan; Wang Ning; Wu Hongyan; Chen Wenbin; Feng Zihao; Zhu Huiping; Peng Xiaoling; Li Yongxian; Huang Ling; Yue Shantang; Liu Yingliang
2009-01-01
Two new lanthanide coordination polymers H 2 N(CH 3 ) 2 .[Eu III 2 (L 1 ) 3 (L 2 )] (1, L 1 =isophthalic acid dianion, L 2 =formic acid anion) and [La III (2,5-PDC)(L 2 )](2, 2,5-PDC=2,5-pyridinedicarboxylate dianion) were synthesized under solvothermal conditions. It is of interest that the formic ligand (L 2 ) is not contained in the stating materials, but arises from the water molecule-enhanced CO 2 insertion during the solvothermal process. Both of the two compounds exhibit complicated three dimensional sandwich-like frameworks. - Graphical abstract: Two new lanthanide coordination polymers involving water molecule-enhanced CO 2 insertion resulting in the formation of formic anion and dimethylammonium cation were synthesized under solvothermal conditions.
Electron distributions of the first-row homonuclear diatomic molecules, A2
International Nuclear Information System (INIS)
Ramirez, B.I.; Bielefeld Univ.
1982-08-01
Electron momentum density contour maps of the first-row homonuclear diatomic molecules, A 2 , are obtained from near Hartree-Fock wave functions. Both the total momentum density and momentum density difference (molecule - isolated atoms) maps present trends that may be related to the binding in the molecules. These results are compared with the corresponding charge density maps in position space (Bader, Henneker and Cade 1967). (author)
Smuel, Keren; Kauli, Rivka; Lilos, Pearl; Laron, Zvi
2015-08-01
To describe the growth, development and puberty in children with congenital IGHD before and during hGH treatment. Patients with cIGHD treated by hGH between the years 1958-1992. All patients were diagnosed, treated and followed in our clinic. Data were found in 37/41 patients (21 m, 16 f). 34 had hGH-1A deletions, 7 GHRH-R mutations. Patients, referred after age 25, were excluded. The birth length of 10/37 neonates was 48.29±2.26 (44-50) cm. Birth weight of 28/37 neonates was 3380±370 g (m), 3230±409 g (f). Neuromotor milestones were variable. Age at referral was 5.7±4.2 y (m) and 5.6±3.8 y (f). Initiation of hGH treatment (35μg/kg/d) was 7.5±4.8, (0.8-15.08) y (m) and 6.8±4.36 (0.8-16.5) y (f). Height SDS increased from -4.3 to -1.8 (m) and from -4.5 to -2.6 (f). Head circumference increased from -2.6 to -1.3 (m) and from -2.7 to -2.3 (f). BMI increased from 15.8 to 20.6 (m) and from 15.5 to 20.4 (f). There was a negative correlation between age of hGH initiation and change in height SDS (r=-0.66; ρPuberty was delayed in boys, less so in girls. Mean age of 1st ejaculation (14 m) was 17.6±2.2 y and of menarche (14 f. was 13.7±1.2 y. In both genders there was a positive correlation between age at start of hGH and age at onset of puberty (r=0.57; ρpuberty. Copyright © 2015 Elsevier Ltd. All rights reserved.
Systematic comparison of different techniques to measure hippocampal subfield volumes in ADNI2
Directory of Open Access Journals (Sweden)
Susanne G. Mueller
2018-01-01
Conclusions: T2-HighRes subfield approaches outperformed whole hippocampus and T1 subfield approaches. None of the different T2-HghRes methods tested had a clear advantage over the other methods. Each has strengths and weaknesses that need to be taken into account when deciding which one to use to get the best results from subfield volumetry.
Linear optical response of finite systems using multishift linear system solvers
Energy Technology Data Exchange (ETDEWEB)
Hübener, Hannes; Giustino, Feliciano [Department of Materials, University of Oxford, Oxford OX1 3PH (United Kingdom)
2014-07-28
We discuss the application of multishift linear system solvers to linear-response time-dependent density functional theory. Using this technique the complete frequency-dependent electronic density response of finite systems to an external perturbation can be calculated at the cost of a single solution of a linear system via conjugate gradients. We show that multishift time-dependent density functional theory yields excitation energies and oscillator strengths in perfect agreement with the standard diagonalization of the response matrix (Casida's method), while being computationally advantageous. We present test calculations for benzene, porphin, and chlorophyll molecules. We argue that multishift solvers may find broad applicability in the context of excited-state calculations within density-functional theory and beyond.
Full Alignment of Molecules Using Elliptically Polarized Light
DEFF Research Database (Denmark)
Larsen, Jakob Juul; Hald, Kasper; Seideman, Tamar
When a molecule with an anisotropic polarizability is placed in a strong nonresonant laser field the interaction occurs through the induced dipole moment. The outcome is that the molecule experiences an angular dependent potential energy. It is now well established that a linearly polarized laser...... field can be used to align molecules along their axis of highest polarizability. Here we demonstrate, theoretically and experimentally, that an elliptically polarized laser field can be used to simultaneously force two axes of a molecule into alignment through the same mechanism. Due to the rigidity...
Directory of Open Access Journals (Sweden)
Limei Huang
2017-04-01
Full Text Available The environmental pollution of 2,4,6-tribromophenol (TBP has attracted attention. Based on an urgent need for the better provision of clean water, in situ determination of TBP is of great importance. Here, a facile and effective approach for detecting TBP is developed, based on coupling molecular imprinting technique with electrodeposition of chitosan (CS on the gold electrode. The TBP imprinting CS film was fabricated by using CS as functional material and TBP as template molecule. The experiments show that the morphologies and electrochemical properties of the imprinted film sensor was different from non-imprinted film electrode. The current of the imprinted film was linearly proportional to the TBP concentration, with a wide linear range of 1.0 × 10−7 mol•L−1 to 1.0 × 10−3 mol•L−1. By selecting drop-coating method as a reference for controlled trials with the same functional material, the results illustrated that the electrodeposition enjoyed a widely linear range advantage.
The (e,2e) reaction in molecules
International Nuclear Information System (INIS)
Dey, S.; Dixon, A.; Teubner, P.J.O.; Weigold, E.
1975-01-01
The aplication of the (e,2e) technique is discussed in the framework of (e,2e) on molecular hydrogen. It is shown that the technique is sufficiently sensitive to distinguish between simple wavefunctions and those containing configuration interactions. By comparing the data on H 2 and D 2 is shown that the Born-Oppenheimer approximation is confirmed to an accuracy of about 3 per cent. The data is also used to contrast other methods of determining electron momentum distributions in molecules. Data on methane, carbon monoxide and molecular nitrogen is also presented. (author)
Response to growth hormone treatment and final height after cranial or craniospinal irradiation
International Nuclear Information System (INIS)
Sulmont, V.; Brauner, R.; Fontoura, M.; Rappaport, R.
1990-01-01
Growth hormone (GH) deficiency (GHD) induced by cranial irradiation has become a frequent indication of hGH substitutive therapy. This study analyses the growth response to hGH therapy and the factors involved in the decrease in growth velocity observed after cranial irradiation. One hundred children given cranial radiation for pathology distant from the hypothalamo-pituitary area were studied. Fifty-six of them received hGH therapy for GHD resulting in decreased growth velocity. The initial annual height gain in the cranial-irradiated group was comparable to that of patients treated for idiopathic GHD; additional spinal irradiation significantly reduced the growth response. Twenty-eight hGH-treated patients reached final heights which were compared to those of 2 untreated irradiated groups, one with GHD (n=27) and the other with normal GH secretion (n=17). The height SD score changes observed in hGH therapy were +0.3 in the cranial (n=10) and -1.2 SD in the craniospinal (n=18) groups. GH deficiency had contributed to a mean height loss of 1 SD and spinal irradiation to a loss of 1.4SD. The small effect of hGH therapy on final height is probably linked to the small bone age retardation at onset of hGH therapy and to the fact that irradiated children entered puberty at a younger age in terms of chronological age and bone age than the idiopathic GHD patients. These data suggest that the results of gGH therapy in irradiated children might be improved with higher and more fractionated hGH doses and, in some patients, by delaying puberty using luteinizing hormone releasing hormone analogs
Response to growth hormone treatment and final height after cranial or craniospinal irradiation
Energy Technology Data Exchange (ETDEWEB)
Sulmont, V.; Brauner, R.; Fontoura, M.; Rappaport, R. (Hospital des Enfants Malades, Paris (France). Pediatric Endocrinology Unit and INSERM U30)
1990-01-01
Growth hormone (GH) deficiency (GHD) induced by cranial irradiation has become a frequent indication of hGH substitutive therapy. This study analyses the growth response to hGH therapy and the factors involved in the decrease in growth velocity observed after cranial irradiation. One hundred children given cranial radiation for pathology distant from the hypothalamo-pituitary area were studied. Fifty-six of them received hGH therapy for GHD resulting in decreased growth velocity. The initial annual height gain in the cranial-irradiated group was comparable to that of patients treated for idiopathic GHD; additional spinal irradiation significantly reduced the growth response. Twenty-eight hGH-treated patients reached final heights which were compared to those of 2 untreated irradiated groups, one with GHD (n=27) and the other with normal GH secretion (n=17). The height SD score changes observed in hGH therapy were +0.3 in the cranial (n=10) and -1.2 SD in the craniospinal (n=18) groups. GH deficiency had contributed to a mean height loss of 1 SD and spinal irradiation to a loss of 1.4SD. The small effect of hGH therapy on final height is probably linked to the small bone age retardation at onset of hGH therapy and to the fact that irradiated children entered puberty at a younger age in terms of chronological age and bone age than the idiopathic GHD patients. These data suggest that the results of gGH therapy in irradiated children might be improved with higher and more fractionated hGH doses and, in some patients, by delaying puberty using luteinizing hormone releasing hormone analogs.
Detecting high-density ultracold molecules using atom–molecule collision
International Nuclear Information System (INIS)
Chen, Jun-Ren; Kao, Cheng-Yang; Chen, Hung-Bin; Liu, Yi-Wei
2013-01-01
Utilizing single-photon photoassociation, we have achieved ultracold rubidium molecules with a high number density that provides a new efficient approach toward molecular quantum degeneracy. A new detection mechanism for ultracold molecules utilizing inelastic atom–molecule collision is demonstrated. The resonant coupling effect on the formation of the X 1 Σ + g ground state 85 Rb 2 allows for a sufficient number of more deeply bound ultracold molecules, which induced an additional trap loss and heating of the co-existing atoms owing to the inelastic atom–molecule collision. Therefore, after the photoassociation process, the ultracold molecules can be investigated using the absorption image of the ultracold rubidium atoms mixed with the molecules in a crossed optical dipole trap. The existence of the ultracold molecules was then verified, and the amount of accumulated molecules was measured. This method detects the final produced ultracold molecules, and hence is distinct from the conventional trap loss experiment, which is used to study the association resonance. It is composed of measurements of the time evolution of an atomic cloud and a decay model, by which the number density of the ultracold 85 Rb 2 molecules in the optical trap was estimated to be >5.2 × 10 11 cm −3 . (paper)
Molecular-beam electric-resonance studies of linear triatomic molecules
International Nuclear Information System (INIS)
Reinartz, J.M.L.J.
1976-01-01
In the present work, the MBER technique has been employed to investigate the spectra of the high temperature species KCN and CsOH and at low temperatures the spectra of five different isotopic species of OCS in natural mixture and the most abundant isotopic species of N 2 O and ClCN. For the low temperature species, spectra in the ground state and in the first excited state of the bending mode have been obtained. Bending vibrational effects on hyperfine constants and on electric and magnetic constants have been deduced from these spectra. The introduction of nozzle beam sources has been a factor of great importance for this study. For the ground states, high resolution spectra have been obtained both in external electric and in combined parallel electric and magnetic fields. These spectra could well be explained by the known theories for molecules in a 1 Σ state to within an experimental accuracy of about 50-150 Hz. Extension of the theory needed for the interpretation of the spectra for excited bending states is given. Hyperfine properties and electric and magnetic constants have been obtained with very high accuracy from the analysis of the frequencies of the observed transitions within one rotational state (ΔJ = 0 transitions)
DEFF Research Database (Denmark)
Seger, Signe T; Breinholt, Jens; Faber, Johan H
2015-01-01
Human growth hormone (hGH), and its receptor interaction, is essential for cell growth. To stabilize a flexible loop between helices 3 and 4, while retaining affinity for the hGH receptor, we have engineered a new hGH variant (Q84C/Y143C). Here, we employ hydrogen-deuterium exchange mass spectrom......Human growth hormone (hGH), and its receptor interaction, is essential for cell growth. To stabilize a flexible loop between helices 3 and 4, while retaining affinity for the hGH receptor, we have engineered a new hGH variant (Q84C/Y143C). Here, we employ hydrogen-deuterium exchange mass...
The Tunable Bandgap of AB-Stacked Bilayer Graphene on SiO2 with H2O Molecule Adsorption
International Nuclear Information System (INIS)
Wang Tao; Guo Qing; Liu Yan; Wang Wen-Bo; Sheng Kuang; Ao Zhi-Min; Yu Bin
2011-01-01
The atomic and electronic structures of AB-stacking bilayer graphene (BLG) in the presence of H 2 O molecules are investigated by density functional theory calculations. For free-standing BLG, the bandgap is opened to 0.101 eV with a single H 2 O molecule adsorbed on its surface. The perfectly suspended BLG is sensitive to H 2 O adsorbates, which break the BLG lattice symmetry and open an energy gap. While a single H 2 O molecule is adsorbed on the BLG surface with a SiO 2 substrate, the bandgap widens to 0.363 eV. Both the H 2 O molecule adsorption and the oxide substrate contribute to the BLG bandgap opening. The phenomenon is interpreted with the charge transfer process in 2D carbon nanostructures. (condensed matter: electronic structure, electrical, magnetic, and optical properties)
Energy transfers between N_2(A"3Σ) nitrogen metastable molecules and oxygen atoms and molecules
International Nuclear Information System (INIS)
De Souza, Antonio Rogerio
1985-01-01
This research thesis aims at determining reaction coefficients for energy transfers between nitrogen in its metastable status and oxygen atoms and molecules, the variation of these coefficients with respect to temperature (mainly in the 200-400 K range), products formed and more particularly branching rates of O("1S) oxygen and of NO_2. Reaction coefficients are experimentally determined by using the technique of post-discharge in flow. The experimental set-up is described and the study of the best operating conditions is reported. In the next part, the author reports the study of the energy transfer between nitrogen in its metastable status N_2(A) and oxygen molecules. Reaction coefficients are determined for the first three vibrational levels. The author then reports the study of the transfer of N_2(A) molecules on oxygen atoms in their fundamental status. Reactions coefficients and their variations are determined for the three first vibrational levels. The author describes the dissociation method and the method of detection of atomic oxygen. A kinetic model is proposed for the analysis of formed products during a post-discharge in flow, and the branching rate for the formation of O("1S) oxygen between 190 and 365 K is determined. The author finally discusses publications on the role of these reactions in the interpretation of some atmospheric phenomena
A fitting program for potential energy surfaces of bent triatomic molecules
International Nuclear Information System (INIS)
Searles, D.J.; Nagy-Felsobuki, E.I. von
1992-01-01
A program has been developed in order to fit analytical power series expansions (Dunham, Simon-Parr-Finlan, Ogilvie and their exponential variants) and Pade approximants to discrete ab initio potential energy surfaces of non-linear triatomic molecules. The program employs standard least-squares fitting techniques using the singular decomposition method in order to dampen the higher-order coefficients (if deemed necessary) without significantly degrading the fit. The program makes full use of the symmetry of a triatomic molecule and so addresses the D 3h , C 2v and C S cases. (orig.)
TiO2/Gold nanocomposite as an extremely sensitive molecule sensor for NO2 detection: A DFT study
Directory of Open Access Journals (Sweden)
Amirali Abbasi
2016-07-01
Full Text Available First-principles calculations within density functional theory (DFT have been performed to investigate the interactions of NO2 molecules with TiO2/Gold nanocomposites in order to completely exploit the adsorption properties of these nanostructures. Given the need to further comprehend the behavior of the NO2 molecules positioned between the TiO2 nanoparticle and Au monolayer, we have geometrically optimized the complex systems consisting of the NO2 molecule oriented at appropriate positions between the nanoparticle and Au monolayer. The structural properties such as bond lengths, bond angles, adsorption energies and Mulliken population analysis and the electronic properties including the density of states and molecular orbitals have been also analyzed in detail. The results indicate that the interaction between NO2 and undoped TiO2-N/Gold nanocomposites is stronger than that between gas molecules and N-doped TiO2/Gold nanocomposites, which reveals that the pristine nanocomposite can react with NO2 molecule more efficiently. Therefore, the obtained results also suggest a theoretical basis for the potential applications of TiO2/Gold nanocomposites in gas sensing, which could help in the developing of novel TiO2 based advanced sensor devices.
Linear ubiquitination signals in adaptive immune responses.
Ikeda, Fumiyo
2015-07-01
Ubiquitin can form eight different linkage types of chains using the intrinsic Met 1 residue or one of the seven intrinsic Lys residues. Each linkage type of ubiquitin chain has a distinct three-dimensional topology, functioning as a tag to attract specific signaling molecules, which are so-called ubiquitin readers, and regulates various biological functions. Ubiquitin chains linked via Met 1 in a head-to-tail manner are called linear ubiquitin chains. Linear ubiquitination plays an important role in the regulation of cellular signaling, including the best-characterized tumor necrosis factor (TNF)-induced canonical nuclear factor-κB (NF-κB) pathway. Linear ubiquitin chains are specifically generated by an E3 ligase complex called the linear ubiquitin chain assembly complex (LUBAC) and hydrolyzed by a deubiquitinase (DUB) called ovarian tumor (OTU) DUB with linear linkage specificity (OTULIN). LUBAC linearly ubiquitinates critical molecules in the TNF pathway, such as NEMO and RIPK1. The linear ubiquitin chains are then recognized by the ubiquitin readers, including NEMO, which control the TNF pathway. Accumulating evidence indicates an importance of the LUBAC complex in the regulation of apoptosis, development, and inflammation in mice. In this article, I focus on the role of linear ubiquitin chains in adaptive immune responses with an emphasis on the TNF-induced signaling pathways. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Single NdPc2 molecules on surfaces. Adsorption, interaction, and molecular magnetism
International Nuclear Information System (INIS)
Fahrendorf, Sarah
2013-01-01
They have huge potential for application in molecular-spin-transistors, molecular-spinvalves, and molecular quantum computing. SMMs are characterized by high spin ground states with zero-field splitting leading to high relaxation barriers and long relaxation times. A relevant class of molecules are the lanthanide double-decker phthalocyanines (LaPc 2 ) with only one metal atom sandwiched between two organic phthalocyanine (Pc) ligands. For envisaged spintronic applications it is important to understand the interaction between the molecules and the substrate and its influence on the electronic and magnetic properties. The subject of this thesis is the investigation of the adsorbed neodymium double-decker phthalocyanine (NdPc 2 ) by means of low temperature scanning tunneling microscopy and spectroscopy (STM and STS). The molecules are deposited by sublimation onto different substrates. It is observed that a large fraction of the double-decker molecules decomposes during deposition. The decomposition probability strongly depends on the chosen substrate. Therefore it is concluded that the substrate modifies the electronic structure of the molecule leading to a stabilization or destabilization of the molecular entity. Charge transfer from the surface to the molecule is identified as a potential stabilizing mechanism. The electronic and magnetic properties are investigated in detail for adsorbed NdPc 2 molecules on Cu(100). The results of the experimental study are compared to state-of-the-art density functional theory calculations performed by our colleagues from the Peter Gruenberg Institute (PGI-1) at the Forschungszentrum Juelich. Interestingly, the lower Pc ring of the molecule hybridizes intensely with the substrate leading to strong chemisorption of the molecule, while the upper Pc ring keeps its molecular type electronic states, which can be energetically shifted by an external electric field. Importantly, it is possible to get direct access to the spin
Energy Technology Data Exchange (ETDEWEB)
Grohmann, Thomas
2012-05-31
In this thesis the wave packet dynamics of nuclear spin isomers of polyatomic molecules after interaction with static and time-dependent magnetic fields and moderate intense nonresonant laser pulses is investigated. In particular, the process of inducing (internal) molecular rotation as well as alignment of molecules by manipulating their rotational or rotational-torsional degrees of freedom is studied. In the first part of the thesis all theoretical concepts for identifying nuclear spin isomers and for describing their quantum dynamics will be discussed. Especially the symmetrization postulate and themolecular symmetry group will be introduced and illustrated for some examples of molecules. These concepts will be extended to the case of identifying nuclear spin isomers in the presence of an external field. In the second part it is shown for nitromethane that magnetic fields are able to induce unidirectional rotations in opposite directions for different nuclear spin isomers of molecules containing methyl groups if the dipolar interaction is included. Additionally, it is demonstrated that different nuclear spin isomers of a chemical compound may show different alignment after the interaction with a moderate intense laser pulse. As shown for the rigid symmetric top propadien and the rigid asymmetric tops ethene and analogues, distinct pairs of nuclear spin isomers show at certain points in time a complementary behavior: while one isomer is showing alignment the partner isomer is showing anti-alignment. Moreover, it is illustrated that not every nuclear spin isomer can be aligned equally efficient. The alignment of non-rigid molecules is considered as well. As an example for a molecule with feasible torsion in the electronic ground state, the alignment of diboron tetrafluoride is investigated. It becomes apparent that not only rotational but also the torsional dynamics of the molecules is nuclear spin selective; different nuclear spin isomers have at distinct points
Bacteroides species produce Vibrio harveyi autoinducer 2-related molecules.
Antunes, Luis Caetano Martha; Ferreira, Lívia Queiroz; Ferreira, Eliane Oliveira; Miranda, Karla Rodrigues; Avelar, Kátia Eliane Santos; Domingues, Regina Maria Cavalcanti Pilotto; Ferreira, Maria Candida de Souza
2005-10-01
Quorum sensing is a density-dependent gene regulation mechanism that has been described in many bacterial species in the last decades. Bacteria that use quorum sensing as part of their gene regulation circuits produce molecules called autoinducers that accumulate in the environment and activate target genes in a quorum-dependent way. Some specific clues led us to hypothesize that Bacteroides species can produce autoinducers and possess a quorum sensing system. First, Bacteroides are anaerobic bacteria that are frequently involved in polymicrobial infections. These infections often involve Pseudomonas aeruginosa and Staphylococcus aureus, two of the best understood examples of bacteria that employ quorum sensing systems as part of their pathogenesis. Also, studies have detected the presence of a quorum sensing gene involved in the production of autoinducers in Porphyromonas gingivalis, a species closely related to the Bacteroides genus. These and other evidences prompted us to investigate if Bacteroides strains could produce autoinducer molecules that could be detected by a Vibrio harveyi reporter system. In this paper, we show that supernatants of B. fragilis, B. vulgatus and B. distasonis strains are able to stimulate the V. harveyi quorum sensing system 2. Also, we were able to demonstrate that the stimulation detected is due to the production of autoinducer molecules and not the growth of reporter strains after addition of supernatant. Moreover, the phenomenon observed does not seem to represent the degradation of repressors possibly present in the culture medium used. We could also amplify bands from some of the strains tested using primers designed to the luxS gene of Escherichia coli. Altogether, our results show that B. fragilis, B. vulgatus and B. distasonis (but possibly some other species) can produce V. harveyi autoinducer 2-related molecules. However, the role of such molecules in the biology of these organisms remains unknown.
Time-dependent local-to-normal mode transition in triatomic molecules
Cruz, Hans; Bermúdez-Montaña, Marisol; Lemus, Renato
2018-01-01
Time-evolution of the vibrational states of two interacting harmonic oscillators in the local mode scheme is presented. A local-to-normal mode transition (LNT) is identified and studied from temporal perspective through time-dependent frequencies of the oscillators. The LNT is established as a polyad-breaking phenomenon from the local standpoint for the stretching degrees of freedom in a triatomic molecule. This study is carried out in the algebraic representation of bosonic operators. The dynamics of the states are determined via the solutions of the corresponding nonlinear Ermakov equation and a local time-dependent polyad is obtained as a tool to identify the LNT. Applications of this formalism to H2O, CO2, O3 and NO2 molecules in the adiabatic, sudden and linear regime are considered.
Electroluminescence from completely horizontally oriented dye molecules
Energy Technology Data Exchange (ETDEWEB)
Komino, Takeshi [Education Center for Global Leaders in Molecular System for Devices, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Japan Science and Technology Agency, ERATO, Adachi Molecular Exciton Engineering Project, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Sagara, Yuta [Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Tanaka, Hiroyuki [Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Department of Chemistry, Graduate School of Science, Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8601 (Japan); Oki, Yuji [Japan Science and Technology Agency, ERATO, Adachi Molecular Exciton Engineering Project, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Department of Electronics, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Nakamura, Nozomi [Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); International Institute for Carbon Neutral Energy Research (WPI-I2CNER), Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Fujimoto, Hiroshi [Center for Organic Photonics and Electronics Research, Kyushu University, 744 Motooka, Nishi, Fukuoka 819-0395 (Japan); Fukuoka i" 3-Center for Organic Photonics and Electronics Research (i3-OPERA), Fukuoka 819-0388 (Japan); and others
2016-06-13
A complete horizontal molecular orientation of a linear-shaped thermally activated delayed fluorescent guest emitter 2,6-bis(4-(10Hphenoxazin-10-yl)phenyl)benzo[1,2-d:5,4-d′] bis(oxazole) (cis-BOX2) was obtained in a glassy host matrix by vapor deposition. The orientational order of cis-BOX2 depended on the combination of deposition temperature and the type of host matrix. Complete horizontal orientation was obtained when a thin film with cis-BOX2 doped in a 4,4′-bis(N-carbazolyl)-1,1′-biphenyl (CBP) host matrix was fabricated at 200 K. The ultimate orientation of guest molecules originates from not only the kinetic relaxation but also the kinetic stability of the deposited guest molecules on the film surface during film growth. Utilizing the ultimate orientation, a highly efficient organic light-emitting diode with the external quantum efficiency of 33.4 ± 2.0% was realized. The thermal stability of the horizontal orientation of cis-BOX2 was governed by the glass transition temperature (T{sub g}) of the CBP host matrix; the horizontal orientation was stable unless the film was annealed above T{sub g}.
Precision spectroscopy with ultracold 87Rb2 triplet molecules
International Nuclear Information System (INIS)
Strauss, Christoph
2011-01-01
In this thesis I report precision spectroscopy with ultracold 87 Rb 2 triplet molecules where we use lasers to couple the states in different molecular potentials. We study in detail states of the a 3 sum + u and (1) 3 sum + g potentials. These states are of great importance for transferring weakly bound molecules to the ro-vibrational triplet ground state via states of the excited potential. As most experiments start from molecules in their X 1 sum + g ground state, the triplet states were hard to access via dipole transitions and remained largely unexplored. The measurements presented in this thesis are the first detailed study of diatomic 87 Rb 2 molecules in these states. Our experiments start with an ultracold cloud of 87 Rb atoms. We then load this cloud into an optical lattice where we use a magnetic Feshbach resonance at 1007.4 G to perform a Feshbach association. After we have removed all unbound atoms, we end up with a pure sample of weakly bound Feshbach molecules inside the optical lattice. The optical lattice prevents these molecules from colliding with each other which results in molecular lifetimes on the order of a few hundred milliseconds. In the first set of experiments, we use a laser coupling the Feshbach state to the excited (1) 3 sum + g triplet state to map out its low-lying vibrational (v = 0.. 15), rotational, hyperfine, and Zeeman structure. The experimental results are in good agreement with calculations done by Marius Lysebo and Prof. Leif Veseth. We then map out in detail the vibrational, rotational, hyperfine, and Zeeman structure of the a 3 sum + u triplet ground state using dark state spectroscopy with levels in the (1) 3 sum + g potential as an intermediate state. In this scheme we are able to access molecules in triplet states because our Feshbach state has strong triplet character. Interestingly, it happens that some deeply bound states which belong to the X 1 sum + g potential are close to levels in the a 3 sum + u potential. In
Dependence of energy per molecule on sputtering yields with reactive gas cluster ions
International Nuclear Information System (INIS)
Toyoda, Noriaki; Yamada, Isao
2010-01-01
Gas cluster ions show dense energy deposition on a target surface, which result in the enhancement of chemical reactions. In reactive sputtering with gas cluster ions, the energy per atom or molecule plays an important role. In this study, the average cluster size (N, the number of atoms or molecules in a cluster ion) was controlled; thereby the dependences of the energy per molecule on the sputtering yields of carbon by CO 2 cluster ions and that of Si by SF 6 /Ar mixed gas cluster ions were investigated. Large CO 2 cluster ions with energy per molecule of 1 eV showed high reactive sputtering yield of an amorphous carbon film. However, these ions did not cause the formation of large craters on a graphite surface. It is possible to achieve very low damage etching by controlling the energy per molecule of reactive cluster ions. Further, in the case of SF 6 /Ar mixed cluster ions, it was found that reactive sputtering was enhanced when a small amount of SF 6 gas (∼10%) was mixed with Ar. The reactive sputtering yield of Si by one SF 6 molecule linearly increased with the energy per molecule.
Generalization of the linear algebraic method to three dimensions
International Nuclear Information System (INIS)
Lynch, D.L.; Schneider, B.I.
1991-01-01
We present a numerical method for the solution of the Lippmann-Schwinger equation for electron-molecule collisions. By performing a three-dimensional numerical quadrature, this approach avoids both a basis-set representation of the wave function and a partial-wave expansion of the scattering potential. The resulting linear equations, analogous in form to the one-dimensional linear algebraic method, are solved with the direct iteration-variation method. Several numerical examples are presented. The prospect for using this numerical quadrature scheme for electron-polyatomic molecules is discussed
Search for an interstellar Si2C molecule: A theoretical prediction
Indian Academy of Sciences (India)
63, No. 3. — journal of. September 2004 physics pp. 627–631. Search for an interstellar Si2C molecule: A theoretical prediction. SURESH CHANDRA. School of ... top molecule as its electric dipole moment µ lies along the axis of intermediate moment of inertia. Because of differences between the molecular parameters of.
Impulsive Laser Induced Alignment of Molecules Dissolved in Helium Nanodroplets
DEFF Research Database (Denmark)
Pentlehner, Dominik; H. Nielsen, Jens; Slenczka, Alkwin
2013-01-01
We show that a 450 fs nonresonant, moderately intense, linearly polarized laser pulse can induce field-free molecular axis alignment of methyliodide (CH3I) molecules dissolved in a helium nanodroplet. Time-resolved measurements reveal rotational dynamics much slower than that of isolated molecules...
Analysis of the Fourier Spectrum of the ν2 Inversion Band of the 15NHD2 Molecule
Fomchenko, A. L.; Belova, A. S.; Bekhtereva, E. S.; Kwabia Tchana, F.
2018-06-01
To determine high-resolution rovibrational levels of the inversion vibrational (v2 = 1) state of the 15NHD2 molecule, the Fourier spectrum in the range from 650 to 1150 cm-1 is studied. The data obtained are used to determine the parameters of the effective Hamiltonian of the examined molecule.
Mechanical response of collagen molecule under hydrostatic compression
International Nuclear Information System (INIS)
Saini, Karanvir; Kumar, Navin
2015-01-01
Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials.
Mechanical response of collagen molecule under hydrostatic compression.
Saini, Karanvir; Kumar, Navin
2015-04-01
Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials. Copyright © 2015 Elsevier B.V. All rights
Mechanical response of collagen molecule under hydrostatic compression
Energy Technology Data Exchange (ETDEWEB)
Saini, Karanvir, E-mail: karans@iitrpr.ac.in; Kumar, Navin
2015-04-01
Proteins like collagen are the basic building blocks of various body tissues (soft and hard). Collagen molecules find their presence in the skeletal system of the body where they bear mechanical loads from different directions, either individually or along with hydroxy-apatite crystals. Therefore, it is very important to understand the mechanical behavior of the collagen molecule which is subjected to multi-axial state of loading. The estimation of strains of collagen molecule along different directions resulting from the changes in hydrostatic pressure magnitude, can provide us new insights into its mechanical behavior. In the present work, full atomistic simulations have been used to study global (volumetric) as well as local (along different directions) mechanical properties of the hydrated collagen molecule which is subjected to different hydrostatic pressure magnitudes. To estimate the local mechanical properties, the strains of collagen molecule along its longitudinal and transverse directions have been acquired at different hydrostatic pressure magnitudes. In spite of non-homogeneous distribution of atoms within the collagen molecule, the calculated values of local mechanical properties have been found to carry the same order of magnitude along the longitudinal and transverse directions. It has been demonstrated that the values of global mechanical properties like compressibility, bulk modulus, etc. as well as local mechanical properties like linear compressibility, linear elastic modulus, etc. are functions of magnitudes of applied hydrostatic pressures. The mechanical characteristics of collagen molecule based on the atomistic model have also been compared with that of the continuum model in the present work. The comparison showed up orthotropic material behavior for the collagen molecule. The information on collagen molecule provided in the present study can be very helpful in designing the future bio-materials.
International Nuclear Information System (INIS)
Joshi, Jayadev; Shrivastava, Nitisha; Dimri, Manali; Ghosh, Subhajit; Mandal, Rahul Shubhra; Prem Kumar, I.; Barik, Tapan Kumar
2012-01-01
COX-2 is well established for its role in inflammation and cancer, and has also been reported to play a significant role in radiation induced inflammation and by standard effect. It's already reported to have a role in protection against radiation induced damage suggesting it to be an important target for identifying novel radiation countermeasure agents. Present study aims at identifying novel small molecules from pharmacopoeia using COX-2 as target in-silico. Systematic search of the reported molecules exhibiting radiation protection revealed lat around 29 % (40 in 138) of them have a role in inflammation and a small percentage of these molecules (20 %; 8 in 40) are reported to as non steroidal anti-inflammatory drugs (NSAIDS). Docking studies performed further clarified that all these 8 radioprotective molecules shows high binding affinity and inhibit COX-2. Further Johns Hopkins clinical compound library (JHCCL), a collection of small molecule clinical compounds, were screened virtually for COX-2 inhibition by docking approach. Docking of around 1400 small molecules against COX-2 lead to identification of a number of previously unreported molecules which are likely to act as radioprotectors. (author)
Energy Technology Data Exchange (ETDEWEB)
Joshi, Jayadev; Shrivastava, Nitisha; Dimri, Manali; Ghosh, Subhajit; Mandal, Rahul Shubhra; Prem Kumar, I., E-mail: prem_indra@yahoo.co.in [Radiation Biosciences Division, Institute of Nuclear Medicine and Allied Sciences, Delhi (India); Barik, Tapan Kumar [P.G. Department of Zoology, Berhampur University, Berhampur (India)
2012-07-01
COX-2 is well established for its role in inflammation and cancer, and has also been reported to play a significant role in radiation induced inflammation and by standard effect. It's already reported to have a role in protection against radiation induced damage suggesting it to be an important target for identifying novel radiation countermeasure agents. Present study aims at identifying novel small molecules from pharmacopoeia using COX-2 as target in-silico. Systematic search of the reported molecules exhibiting radiation protection revealed lat around 29 % (40 in 138) of them have a role in inflammation and a small percentage of these molecules (20 %; 8 in 40) are reported to as non steroidal anti-inflammatory drugs (NSAIDS). Docking studies performed further clarified that all these 8 radioprotective molecules shows high binding affinity and inhibit COX-2. Further Johns Hopkins clinical compound library (JHCCL), a collection of small molecule clinical compounds, were screened virtually for COX-2 inhibition by docking approach. Docking of around 1400 small molecules against COX-2 lead to identification of a number of previously unreported molecules which are likely to act as radioprotectors. (author)
Studies of muonium-substituted molecules in 2-propanone and in aqueous solutions of 2-propanone
International Nuclear Information System (INIS)
Cox, S.F.J.; Renzi, R. De; Scott, C.A.; Hill, A.; Symons, M.C.R.; Bucci, C.; Vecli, A.
1984-04-01
The paper deals with muonium substituted molecules, which are formed when positive muons are implanted in pure 2-propanone and in binary aqueous systems; and are studied by the muon spin rotation technique. Studies of muonium substituted molecules are discussed under five topic headings: hyperfine interaction, influence of the solvent, radical formation, diamagnetic fraction and linewidths. (U.K.)
Theoretical study of molecular vibration and Application to linear triatomic molecules: case of OCS
International Nuclear Information System (INIS)
Andrianavalomahefa, A.
2014-01-01
Our aim is to give a theoretical approach to the calculation of vibrational energy levels of polyatomic molecules. By using matrix calculation, we have to solve an eigenvalue equation that gives normal vibration frequencies of the system. A basis change introduces normal coordinates of vibration, which diagonalize the Hamiltonian. The harmonic approximation gives a rough evaluation of parameters which describe the system. Then, we introduce nonlinear terms to take into account the anharmonicity of interatomic bounds. Morse oscillator gives good approximation for diatomic molecules. We consider cubic and quartic potential terms for polyatomic molecules. We treat the problem both in classical and quantum approach. The results thus obtained are applied to study longitudinal vibration of carbonyl sulfide. [fr
Human growth hormone. Its use and abuse.
Bradley, C A; Sodeman, T M
1990-09-01
The use of hGH may become a significant challenge to the sports world. Scientific and ethical questions regarding its use may become more pressing if synthetic hGH becomes available to the public. The potential appeal of hGH to athletic competitors is obvious, but at present no benefits of this hormone as an ergogenic aid have been clearly demonstrated. Indeed, clinical experience with acromegalics suggests that prolonged exposure to elevated doses of hGH produces detrimental neuromuscular responses. Perhaps an even more intense ethical issue concerns the use of hGH in children and adolescents. The use of hGH to increase height and thereby increase chances for athletic success may be tempting to both coaches and parents. Athletes, parents, coaches, and team physicians must be aware that hGH has not been shown to enhance athletic performance and that its potential long-term side effects are irreversible and even may be life threatening.
Adsorption of H2S molecule on TiO2/Au nanocomposites: A density functional theory study
Directory of Open Access Journals (Sweden)
Amirali Abbasi
2017-01-01
Full Text Available The adsorption of hydrogen sulfide molecule on undoped and N-doped TiO2/Au nanocomposites was investigated by density functional theory (DFT calculations. The results showed that the adsorption energies of H2S on the nanocomposites follow the order of 2N doped (Ti site>N-doped (Ti site>Undoped (Ti site. The structural properties including bond lengths, angles and adsorption energies and electronic properties in view of the projected density of states (PDOSs and molecular orbitals (MOs were analyzed in detail. The results indicated that the interaction between H2S molecule and N-doped TiO2/Au nanocomposite is stronger than that between H2S and undoped nanocomposite, suggesting that N-doping helps to strengthen the interaction of H2S with TiO2/Au nanocomposite. Mulliken population analysis was conducted to analyze the charge transfer between the nanocomposite and H2S molecule. Although H2S molecule has no significant interaction with undoped nanocomposite, it tends to be strongly adsorbed on the N-doped nanocomposite. The results also suggest that the two doped nitrogen atoms in TiO2 greatly strengthen the adsorption process, being a helpful procedure to help in the design and development of improved sensor devices for H2S detection.
DEFF Research Database (Denmark)
Etches, Adam; Madsen, Christian Bruun; Madsen, Lars Bojer
2010-01-01
A recent paper reported elliptically polarized high-order harmonics from aligned N2 using a linearly polarized driving field [X. Zhou et al., Phys. Rev. Lett. 102, 073902 (2009)]. This observation cannot be explained in the standard treatment of the Lewenstein model and has been ascribed to many...
Hat das humane Wachtumshormon (hGH eine Relevanz in der Kontrolle der penilen Erektion?
Directory of Open Access Journals (Sweden)
Ückert St
2003-01-01
Full Text Available Allgemeines: Schon seit langem wird die Frage einer Beteiligung des Hypophysenhormons Human Growth Hormone (Wachstumshormon, hGH, GH an der Kontrolle der sexuellen Maturation und der Reproduktionsfunktion des Menschen diskutiert. Die Symptome eines GH-Defizits beim Mann sind u. a. allgemeine Antriebslosigkeit, Oligo- oder Azoospermie, eine Verminderung der Libido sowie eine Beeinträchtigung der normalen Erektionsfähigkeit. Es wird vermutet, daß die biologischen Effekte des GH eine durch das Somatomedin Insulin-like Growth Factor 1 (IGF-1 vermittelte Stimulation der Produktion von Stickoxid (NO durch die endotheliale und neuronale Form des Enzyms NO-Synthase einschließen. So konnte gezeigt werden, daß physiologische Konzentrationen von GH den adrenergen Tonus isolierter Streifenpräparate humaner Schwellkörpermuskulatur antagonisieren und den Gewebegehalt des Second Messengers cGMP erhöhen. Im Rahmen dieser Studie haben wir in einem Kollektiv gesunder Männer und in einer Gruppe von Patienten mit erektiler Dysfunktion (ED die systemischen und cavernösen Serumkonzentrationen von GH während verschiedener peniler Funktionszustände, d. h. verschiedener Stadien der sexuellen Erregung, untersucht. Methoden: 35 gesunden männlichen Probanden und 45 Patienten mit einer ED organogener oder psychogener Genese wurden während der penilen Flakzidität, Tumeszenz, Rigidität - dieses Stadium wurde nur von den Gesunden erreicht - und Detumeszenz zeitgleich Blutproben aus einer Cubitalvene und dem Corpus cavernosum penis entnommen. Tumeszenz und Rigidität wurden durch visuelle und taktile Stimulation ausgelöst. Die Quantifizierung von GH in Aliquots der Serumfraktionen erfolgte mit immunradiometrischen Methoden (IRMA. Ergebnisse: In der Gruppe der gesunden Männer stieg die mittlere systemische und cavernöse Serumkonzentration von GH während der Tumeszenz an, während in den Phasen der Rigidität und Detumeszenz eine Abnahme registriert wurde
Ground state of a hydrogen ion molecule immersed in an inhomogeneous electron gas
International Nuclear Information System (INIS)
Diaz-Valdes, J.; Gutierrez, F.A.; Matamala, A.R.; Denton, C.D.; Vargas, P.; Valdes, J.E.
2007-01-01
In this work we have calculated the ground state energy of the hydrogen molecule, H 2 + , immersed in the highly inhomogeneous electron gas around a metallic surface within the local density approximation. The molecule is perturbed by the electron density of a crystalline surface of Au with the internuclear axis parallel to the surface. The surface spatial electron density is calculated through a linearized band structure method (LMTO-DFT). The ground state of the molecule-ion was calculated using the Born-Oppenheimer approximation for a fixed-ion while the screening effects of the inhomogeneous electron gas are depicted by a Thomas-Fermi like electrostatic potential. We found that within our model the molecular ion dissociates at the critical distance of 2.35a.u. from the first atomic layer of the solid
Bernard, François; Papanastasiou, Dimitrios K; Papadimitriou, Vassileios C; Burkholder, James B
2018-04-19
Permethylsiloxanes are emitted into the atmosphere during production and use as personal care products, lubricants, and cleaning agents. The predominate atmospheric loss process for permethylsiloxanes is expected to be via gas-phase reaction with the OH radical. In this study, rate coefficients, k(T), for the OH radical gas-phase reaction with the two simplest linear and cyclic permethylsiloxanes were measured using a pulsed laser photolysis-laser induced fluorescence technique over the temperature range of 240-370 K and a relative rate method at 294 K: hexamethyldisiloxane ((CH 3 ) 3 SiOSi(CH 3 ) 3 , L 2 ), k 1 ; octamethyltrisiloxane ([(CH 3 ) 3 SiO] 2 Si(CH 3 ) 2 , L 3 ), k 2 ; hexamethylcyclotrisiloxane ([-Si(CH 3 ) 2 O-] 3 , D 3 ), k 3 ; and octamethylcyclotetrasiloxane ([-Si(CH 3 ) 2 O-] 4 , D 4 ), k 4 . The obtained k(294 K) values and temperature-dependence expressions for the 240-370 K temperature range are (cm 3 molecule -1 s -1 , 2σ absolute uncertainties): k 1 (294 K) = (1.28 ± 0.08) × 10 -12 , k 1 ( T) = (1.87 ± 0.18) × 10 -11 exp(-(791 ± 27)/ T); k 2 (294 K) = (1.72 ± 0.10) × 10 -12 , k 2 ( T) = 1.96 × 10 -13 (T/298) 4.34 exp(657/ T); k 3 (294 K) = (0.82 ± 0.05) × 10 -12 , k 3 ( T) = (1.29 ± 0.19) × 10 -11 exp(-(805 ± 43)/ T); and k 4 (294 K) = (1.12 ± 0.10) × 10 -12 , k 4 ( T) = (1.80 ± 0.26) × 10 -11 exp(-(816 ± 43)/ T). The cyclic molecules were found to be less reactive than the analogous linear molecule with the same number of -CH 3 groups, while the linear and cyclic permethylsiloxane reactivity both increase with the increasing number of CH 3 - groups. The present results are compared with previous rate coefficient determinations where available. The permethylsiloxanes included in this study are atmospherically short-lived compounds with estimated atmospheric lifetimes of 11, 8, 17, and 13 days, respectively.
Surface-enhanced resonance Raman scattering spectroscopy of single R6G molecules
Institute of Scientific and Technical Information of China (English)
Zhou Zeng-Hui; Liu Li; Wang Gui-Ying; Xu Zhi-Zhan
2006-01-01
Surface-enhanced resonance Raman scattering (SERRS) of Rhodamine 6G (R6G) adsorbed on colloidal silver clusters has been studied. Based on the great enhancement of the Raman signal and the quench of the fluorescence, the SERRS spectra of R6G were recorded for the samples of dye colloidal solution with different concentrations. Spectral inhomogeneity behaviours from single molecules in the dried sample films were observed with complementary evidences, such as spectral polarization, spectral diffusion, intensity fluctuation of vibrational lines and even "breathing" of the molecules. Sequential spectra observed from a liquid sample with an average of 0.3 dye molecules in the probed volume exhibited the expected Poisson distribution for actually measuring 0, 1 or 2 molecules. Difference between the SERRS spectra of R6G excited by linearly and circularly polarized light were experimentally measured.
Wang, Fei; Yang, Fan; Tian, Yang; Liu, Jiawei; Shen, Jiwei; Bai, Quan
2018-01-01
A stoichiometric displacement model for retention (SDM-R) of small solutes and proteins based on hydrophilic interaction chromatography (HILIC) was presented. A linear equation that related the logarithm of the capacity factor of the solute to the logarithm of the concentration of water in the mobile phase was derived. The stoichiometric displacement parameters, Z (the number of water molecules required to displace a solute from ligands) and lgI (containing a number of constants that relate to the affinity of solute to the ligands) could be obtained from the slope and the intercept of the linear plots of lgk' vs. lg[H 2 O]. The retention behaviors and retention mechanism of 15 kinds of small solutes and 6 kinds of proteins on 5 kinds HILIC columns with different ligands were investigated with SDM-R in typical range of water concentration in mobile phase. A good linear relationship between lgk' and lg[H 2 O] demonstrated that the most rational retention mechanism of solute in HILIC was a stoichiometric displacement process between solute and solvent molecules with water as displacing agents, which was not only valid for small solutes, but also could be used to explain the retention mechanism of biopolymers in HILIC. Comparing with the partition and adsorption models in HILIC, SDM-R was superior to them. Copyright © 2017 Elsevier B.V. All rights reserved.
The [Fe(III)[Fe(III)(L1)2]3] star-type single-molecule magnet.
Saalfrank, Rolf W; Scheurer, Andreas; Bernt, Ingo; Heinemann, Frank W; Postnikov, Andrei V; Schünemann, Volker; Trautwein, Alfred X; Alam, Mohammad S; Rupp, Holger; Müller, Paul
2006-06-21
Star-shaped complex [Fe(III)[Fe(III)(L1)2]3] (3) was synthesized starting from N-methyldiethanolamine H2L1 (1) and ferric chloride in the presence of sodium hydride. For 3, two different high-spin iron(III) ion sites were confirmed by Mössbauer spectroscopy at 77 K. Single-crystal X-ray structure determination revealed that 3 crystallizes with four molecules of chloroform, but, with only three molecules of dichloromethane. The unit cell of 3.4CHCl3 contains the enantiomers (delta)-[(S,S)(R,R)(R,R)] and (lambda)-[(R,R)(S,S)(S,S)], whereas in case of 3.3CH2Cl2 four independent molecules, forming pairs of the enantiomers [lambda-(R,R)(R,R)(R,R)]-3 and [lambda-(S,S)(S,S)(S,S)]-3, were observed in the unit cell. According to SQUID measurements, the antiferromagnetic intramolecular coupling of the iron(III) ions in 3 results in a S = 10/2 ground state multiplet. The anisotropy is of the easy-axis type. EPR measurements enabled an accurate determination of the ligand-field splitting parameters. The ferric star 3 is a single-molecule magnet (SMM) and shows hysteretic magnetization characteristics below a blocking temperature of about 1.2 K. However, weak intermolecular couplings, mediated in a chainlike fashion via solvent molecules, have a strong influence on the magnetic properties. Scanning tunneling microscopy (STM) and scanning tunneling spectroscopy (STS) were used to determine the structural and electronic properties of star-type tetranuclear iron(III) complex 3. The molecules were deposited onto highly ordered pyrolytic graphite (HOPG). Small, regular molecule clusters, two-dimensional monolayers as well as separated single molecules were observed. In our STS measurements we found a rather large contrast at the expected locations of the metal centers of the molecules. This direct addressing of the metal centers was confirmed by DFT calculations.
Belloche, A.; Müller, H. S. P.; Garrod, R. T.; Menten, K. M.
2016-03-01
Context. Deuteration is a powerful tracer of the history of the cold prestellar phase in star-forming regions. Apart from methanol, little is known about deuterium fractionation of complex organic molecules in the interstellar medium, especially in regions forming high-mass stars. Aims: Our goal is to detect deuterated complex organic molecules toward the high mass star-forming region Sagittarius B2 (Sgr B2) and derive the level of deuteration for these molecules. Methods: We use a complete 3-mm spectral line survey performed with the Atacama Large Millimeter/submillimeter Array (ALMA) to search for deuterated complex organic molecules toward the hot molecular core Sgr B2(N2). We constructed population diagrams and integrated intensity maps to fit rotational temperatures and emission sizes for each molecule. Column densities are derived by modeling the full spectrum under the assumption of local thermodynamic equilibrium. We compare the results to predictions of two astrochemical models that treat the deuteration process. Results: We report the detection of CH2DCN toward Sgr B2(N2) with a deuteration level of 0.4%, and tentative detections of CH2DOH, CH2DCH2CN, the chiral molecule CH3CHDCN, and DC3N with levels in the range 0.05%-0.12%. A stringent deuteration upper limit is obtained for CH3OD (cyanide, the four deuterated species of ethanol, and CH2DOCHO. Ethyl cyanide is less deuterated than methyl cyanide by at least a factor five. The [CH2DOH]/[CH3OD] abundance ratio is higher than 1.8. It may still be consistent with the value obtained in Orion KL. Except for methyl cyanide, the measured deuteration levels lie at least a factor four below the predictions of current astrochemical models. The deuteration levels in Sgr B2(N2) are also lower than in Orion KL by a factor of a few up to a factor ten. Conclusions: The discrepancy between the deuteration levels of Sgr B2(N2) and the predictions of chemical models, and the difference between Sgr B2(N2) and Orion KL may
Single NdPc{sub 2} molecules on surfaces. Adsorption, interaction, and molecular magnetism
Energy Technology Data Exchange (ETDEWEB)
Fahrendorf, Sarah
2013-01-24
They have huge potential for application in molecular-spin-transistors, molecular-spinvalves, and molecular quantum computing. SMMs are characterized by high spin ground states with zero-field splitting leading to high relaxation barriers and long relaxation times. A relevant class of molecules are the lanthanide double-decker phthalocyanines (LaPc{sub 2}) with only one metal atom sandwiched between two organic phthalocyanine (Pc) ligands. For envisaged spintronic applications it is important to understand the interaction between the molecules and the substrate and its influence on the electronic and magnetic properties. The subject of this thesis is the investigation of the adsorbed neodymium double-decker phthalocyanine (NdPc{sub 2}) by means of low temperature scanning tunneling microscopy and spectroscopy (STM and STS). The molecules are deposited by sublimation onto different substrates. It is observed that a large fraction of the double-decker molecules decomposes during deposition. The decomposition probability strongly depends on the chosen substrate. Therefore it is concluded that the substrate modifies the electronic structure of the molecule leading to a stabilization or destabilization of the molecular entity. Charge transfer from the surface to the molecule is identified as a potential stabilizing mechanism. The electronic and magnetic properties are investigated in detail for adsorbed NdPc{sub 2} molecules on Cu(100). The results of the experimental study are compared to state-of-the-art density functional theory calculations performed by our colleagues from the Peter Gruenberg Institute (PGI-1) at the Forschungszentrum Juelich. Interestingly, the lower Pc ring of the molecule hybridizes intensely with the substrate leading to strong chemisorption of the molecule, while the upper Pc ring keeps its molecular type electronic states, which can be energetically shifted by an external electric field. Importantly, it is possible to get direct access to the
Mode selectivity in cluster-molecule interactions: Ni13 + D2
International Nuclear Information System (INIS)
Jellinek, J.; Guevenc, Z.B.
1991-01-01
Results of a detailed quasiclassical simulation study of the Ni 13 + D 2 collision system are presented. The dissociative adsorption of the molecule as well as its scattering from the cluster are analyzed as functions of the initial rovibrational molecular state, collision energy and structure of the cluster. Mode-specific features of the reactive and nonreactive channels of the cluster-molecule interaction are displayed and discussed. Evidence for resonances and for a strong cluster structure-reactivity correlation is presented. 13 refs., 6 figs
Maurer, Reinhard J; Reuter, Karsten
2013-07-07
Accurate and efficient simulation of excited state properties is an important and much aspired cornerstone in the study of adsorbate dynamics on metal surfaces. To this end, the recently proposed linear expansion Δ-self-consistent field method by Gavnholt et al. [Phys. Rev. B 78, 075441 (2008)] presents an efficient alternative to time consuming quasi-particle calculations. In this method, the standard Kohn-Sham equations of density-functional theory are solved with the constraint of a non-equilibrium occupation in a region of Hilbert-space resembling gas-phase orbitals of the adsorbate. In this work, we discuss the applicability of this method for the excited-state dynamics of metal-surface mounted organic adsorbates, specifically in the context of molecular switching. We present necessary advancements to allow for a consistent quality description of excited-state potential-energy surfaces (PESs), and illustrate the concept with the application to Azobenzene adsorbed on Ag(111) and Au(111) surfaces. We find that the explicit inclusion of substrate electronic states modifies the topologies of intra-molecular excited-state PESs of the molecule due to image charge and hybridization effects. While the molecule in gas phase shows a clear energetic separation of resonances that induce isomerization and backreaction, the surface-adsorbed molecule does not. The concomitant possibly simultaneous induction of both processes would lead to a significantly reduced switching efficiency of such a mechanism.
Adsorption of polar organic molecules on sediments: Case-study on Callovian-Oxfordian claystone.
Rasamimanana, S; Lefèvre, G; Dagnelie, R V H
2017-08-01
The release and transport of anthropogenic organic matter through the geosphere is often an environmental criterion of safety. Sedimentary rocks are widely studied in this context as geological barriers for waste management. It is the case of Callovian-Oxfordian claystone (COx), for which several studies report adsorption of anthropogenic organic molecules. In this study, we evaluated and reviewed adsorption data of polar organic molecules on COx claystone. Experiments were performed on raw claystone, decarbonated and clay fractions. Adsorption isotherms were measured with adsorbates of various polarities: adipate, benzoate, ortho-phthalate, succinate, gluconate, oxalate, EDTA, citrate. A significant adsorption was observed for multidentate polycarboxylic acids as evidenced with phthalate, succinate, oxalate, gluconate, EDTA and citrate (R d = 1.53, 3.52, 8.4, 8.8, 12.4, 54.7 L kg -1 respectively). Multiple linear regression were performed as a statistical analysis to determine the predictors from these adsorption data. A linear correlation between adsorption data (R d ) and dipole moment (μ) of adsorbates was evidenced (R 2 = 0.91). Molecules with a high dipole moment, μ(D) > 2.5, displayed a significant adsorption, R d ≫1 L kg -1 . A qualitative correlation can be easily estimated using the water/octanol partition coefficient, P ow , of adsorbates (R 2 = 0.77). In this case, two opposite trends were distinguished for polar and apolar molecules. The use of organic carbon content in sediments is relevant for predicting adsorption of apolar compounds, log (P ow )>+1. The oxides/clays contents may be relevant regarding polar molecules, log ( apparent P ow )<-1. The proposed scheme offers a general methodology for investigation of geo-barriers towards heterogeneous organic plumes. Copyright © 2017 Elsevier Ltd. All rights reserved.
Exotic helium molecules; Molecules exotiques d'helium
Energy Technology Data Exchange (ETDEWEB)
Portier, M
2007-12-15
We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}P{sub 0}) molecule, or a {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 {+-} 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime {tau} = (1.4 {+-} 0.3) {mu}s is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)
MHC2NNZ: A novel peptide binding prediction approach for HLA DQ molecules
Xie, Jiang; Zeng, Xu; Lu, Dongfang; Liu, Zhixiang; Wang, Jiao
2017-07-01
The major histocompatibility complex class II (MHC-II) molecule plays a crucial role in immunology. Computational prediction of MHC-II binding peptides can help researchers understand the mechanism of immune systems and design vaccines. Most of the prediction algorithms for MHC-II to date have made large efforts in human leukocyte antigen (HLA, the name of MHC in Human) molecules encoded in the DR locus. However, HLA DQ molecules are equally important and have only been made less progress because it is more difficult to handle them experimentally. In this study, we propose an artificial neural network-based approach called MHC2NNZ to predict peptides binding to HLA DQ molecules. Unlike previous artificial neural network-based methods, MHC2NNZ not only considers sequence similarity features but also captures the chemical and physical properties, and a novel method incorporating these properties is proposed to represent peptide flanking regions (PFR). Furthermore, MHC2NNZ improves the prediction accuracy by combining with amino acid preference at more specific positions of the peptides binding core. By evaluating on 3549 peptides binding to six most frequent HLA DQ molecules, MHC2NNZ is demonstrated to outperform other state-of-the-art MHC-II prediction methods.
Dynamics of elliptic breathers in saturable nonlinear media with linear anisotropy
International Nuclear Information System (INIS)
Liang, Guo; Guo, Qi; Shou, Qian; Ren, Zhanmei
2014-01-01
We have introduced a class of dynamic elliptic breathers in saturable nonlinear media with linear anisotropy. Two kinds of evolution behavior for the dynamic breathers, rotations and molecule-like librations, are both predicted by the variational approach, and confirmed in numerical simulations. The dynamic elliptic breathers can rotate even though they have no initial orbital angular momentum (OAM). As the media are linear anisotropic, OAM is no longer conserved, and hence the angular velocity is not constant but a periodic function of the propagation distance. When the linear anisotropy is large enough, the dynamic elliptic breathers librate like molecules. The dynamic elliptic breathers are present in media with not only saturable nonlinearity but also nonlocal nonlinearity; indeed, they are universal in nonlinear media with linear anisotropy. (paper)
Das, Animesh; Gieb, Klaus; Krupskaya, Yulia; Demeshko, Serhiy; Dechert, Sebastian; Klingeler, Rüdiger; Kataev, Vladislav; Büchner, Bernd; Müller, Paul; Meyer, Franc
2011-03-16
First members of a new family of heterometallic Mn/Ni complexes [Mn(2)Ni(3)X(2)L(4)(LH)(2)(H(2)O)(2)] (X = Cl: 1; X = Br: 2) with the new ligand 2-{3-(2-hydroxyphenyl)-1H-pyrazol-1-yl}ethanol (H(2)L) have been synthesized, and single crystals obtained from CH(2)Cl(2) solutions have been characterized crystallographically. The molecular structures feature a quasi-linear Mn(III)-Ni(II)-Ni(II)-Ni(II)-Mn(III) core with six-coordinate metal ions, where elongated axes of all the distorted octahedral coordination polyhedra are aligned parallel and are fixed with respect to each other by intramolecular hydrogen bonds. 1 and 2 exhibit quite strong ferromagnetic exchange interactions throughout (J(Mn-Ni) ≈ 40 K (1) or 42 K (2); J(Ni-Ni) ≈ 22 K (1) or 18 K (2)) that lead to an S(tot) = 7 ground state, and a sizable uniaxial magnetoanisotropy with D(mol) values -0.55 K (1) and -0.45 K (2). These values are directly derived also from frequency- and temperature-dependent high-field EPR spectra. Slow relaxation of the magnetization at low temperatures and single-molecule magnet (SMM) behavior are evident from frequency-dependent peaks in the out-of-phase ac susceptibilities and magnetization versus dc field measurements, with significant energy barriers to spin reversal U(eff) = 27 K (1) and 22 K (2). Pronounced quantum tunnelling steps are observed in the hysteresis loops of the temperature- and scan rate-dependent magnetization data, but with the first relaxation step shifted above (1) or below (2) the zero crossing of the magnetic field, despite the very similar molecular structures. The different behavior of 1 and 2 is interpreted in terms of antiferromagnetic (1) or ferromagnetic (2) intermolecular interactions, which are discussed in view of the subtle differences of intermolecular contacts within the crystal lattice.
Aligned deposition and electrical measurements on single DNA molecules
International Nuclear Information System (INIS)
Eidelshtein, Gennady; Kotlyar, Alexander; Hashemi, Mohtadin; Gurevich, Leonid
2015-01-01
A reliable method of deposition of aligned individual dsDNA molecules on mica, silicon, and micro/nanofabricated circuits is presented. Complexes of biotinylated double stranded poly(dG)–poly(dC) DNA with avidin were prepared and deposited on mica and silicon surfaces in the absence of Mg 2+ ions. Due to its positive charge, the avidin attached to one end of the DNA anchors the complex to negatively charged substrates. Subsequent drying with a directional gas flow yields DNA molecules perfectly aligned on the surface. In the avidin–DNA complex only the avidin moiety is strongly and irreversibly bound to the surface, while the DNA counterpart interacts with the substrates much more weakly and can be lifted from the surface and realigned in any direction. Using this technique, avidin–DNA complexes were deposited across platinum electrodes on a silicon substrate. Electrical measurements on the deposited DNA molecules revealed linear IV-characteristics and exponential dependence on relative humidity. (paper)
Design and synthesis of small molecule agonists of EphA2 receptor.
Petty, Aaron; Idippily, Nethrie; Bobba, Viharika; Geldenhuys, Werner J; Zhong, Bo; Su, Bin; Wang, Bingcheng
2018-01-01
Ligand-independent activation of EphA2 receptor kinase promotes cancer metastasis and invasion. Activating EphA2 receptor tyrosine kinase with small molecule agonist is a novel strategy to treat EphA2 overexpressing cancer. In this study, we performed a lead optimization of a small molecule Doxazosin that was identified as an EphA2 receptor agonist. 33 new analogs were developed and evaluated; a structure-activity relationship was summarized based on the EphA2 activation of these derivatives. Two new derivative compounds 24 and 27 showed much improved activity compared to Doxazosin. Compound 24 possesses a bulky amide moiety, and compound 27 has a dimeric structure that is very different to the parental compound. Compound 27 with a twelve-carbon linker of the dimer activated the kinase and induced receptor internalization and cell death with the best potency. Another dimer with a six-carbon linker has significantly reduced potency compared to the dimer with a longer linker, suggesting that the length of the linker is critical for the activity of the dimeric agonist. To explore the receptor binding characteristics of the new molecules, we applied a docking study to examine how the small molecule binds to the EphA2 receptor. The results reveal that compounds 24 and 27 form more hydrogen bonds to EphA2 than Doxazosin, suggesting that they may have higher binding affinity to the receptor. Published by Elsevier Masson SAS.
Capillary condensation of short-chain molecules.
Bryk, Paweł; Pizio, Orest; Sokolowski, Stefan
2005-05-15
A density-functional study of capillary condensation of fluids of short-chain molecules confined to slitlike pores is presented. The molecules are modeled as freely jointed tangent spherical segments with a hard core and with short-range attractive interaction between all the segments. We investigate how the critical parameters of capillary condensation of the fluid change when the pore width decreases and eventually becomes smaller than the nominal linear dimension of the single-chain molecule. We find that the dependence of critical parameters for a fluid of dimers and of tetramers on pore width is similar to that of the monomer fluid. On the other hand, for a fluid of chains consisting of a larger number of segments we observe an inversion effect. Namely, the critical temperature of capillary condensation decreases with increasing pore width for a certain interval of values of the pore width. This anomalous behavior is also influenced by the interaction between molecules and pore walls. We attribute this behavior to the effect of conformational changes of molecules upon confinement.
Energy Technology Data Exchange (ETDEWEB)
Guelseven, Yadigar; Tasal, Erol; Sidir, Isa [Department of Physics, Faculty of Arts and Sciences, Eskisehir Osmangazi University, Eskisehir 26480 (Turkey); Guengoer, Tayyar [Department of Physics, Faculty of Arts and Sciences, Akdeniz University, Antalya (Turkey); Berber, Halil [Department of Chemistry, Faculty of Sciences, Anadolu University, Eskisehir (Turkey); Oegretir, Cemil [Department of Chemistry, Faculty of Arts and Sciences, Eskisehir Osmangazi University, Eskisehir (Turkey)
2009-06-15
The electronic absorption spectra of 4-((2-ethylphenyl)diazenyl)benzene-1,3-diol and 2-((2-ethylphenyl)diazenyl)benzene-1,3,5-triol molecules in the nine different solvent variable electronic characters have been recorded. The solvent dependent maximum absorption band ({pi}-{pi}* transitions) shifts, {nu}{sub max}, were analyzed using a wide range of parameters such as refractive index, dielectric constant and Kamlet-Taft parameters [hydrogen bond donating ability ({alpha}) and hydrogen bond accepting ability ({beta})]. The electronic transitions are assigned and the solvent-induced spectral shifts have been analyzed in relation to the different solute-solvent interaction mechanism using computational chemistry. The intermolecular interaction types in the azobenzene derivatives solutions have been established on the basis of a multiple linear regression analysis. The fitting coefficients obtained from this analysis allowed us to estimate the contribution of each type of interactions to the total spectral shifts in the studied solutions. (author)
Small-molecule AT2 receptor agonists
DEFF Research Database (Denmark)
Hallberg, Mathias; Sumners, Colin; Steckelings, U Muscha
2018-01-01
The discovery of the first selective, small-molecule ATR receptor (AT2R) agonist compound 21 (C21) (8) that is now extensively studied in a large variety of in vitro and in vivo models is described. The sulfonylcarbamate derivative 8, encompassing a phenylthiofen scaffold is the drug-like agonist...... with the highest affinity for the AT2R reported to date (Ki = 0.4 nM). Structure-activity relationships (SAR), regarding different biaryl scaffolds and functional groups attached to these scaffolds and with a particular focus on the impact of various para substituents displacing the methylene imidazole group of 8......, are discussed. Furthermore, the consequences of migration of the methylene imidazole group and presumed structural requirements for ligands that are aimed as AT2R agonists (e.g. 8) or AT2R antagonists (e.g. 9), respectively, are briefly addressed. A summary of the pharmacological actions of C21 (8) is also...
Growth hormone and prolactin radioimmunoassay in early diagnosis of pituitary tumors
International Nuclear Information System (INIS)
Gembicki, M.; Kosowicz, J.
1978-01-01
Results of prolactin and HGH determination in basal conditions and following stimulation tests in the group of 68 patients with pituitary or suprasellar tumors are presented. In acromegaly elevated level of HGH in fasting state, lack of supression after glucose loading and parodoxical drop of HGH after L-dopa administration were observed. In pituitary tumors without acromegaly determinations of HGH during insulin induced hypoglycemia revealed lack of HGH response to such stimulation in 25 cases which indicated hypopituitarism. In 10 cases elevated prolactin levels (48 - 1000 ng/ml) were observed, this indicates that some of so-called inactive tumors are in fact hormonally active. (author)
High linearity 5.2-GHz power amplifier MMIC using CPW structure technology with a linearizer circuit
International Nuclear Information System (INIS)
Wu Chiasong; Lin Tah-Yeong; Wu Hsien-Ming
2010-01-01
A built-in linearizer was applied to improve the linearity in a 5.2-GHz power amplifier microwave monolithic integrated circuit (MMIC), which was undertaken with 0.15-μm AlGaAs/InGaAs D-mode PHEMT technology. The power amplifier (PA) was studied taking into account the linearizer circuit and the coplanar waveguide (CPW) structures. Based on these technologies, the power amplifier, which has a chip size of 1.44 x 1.10 mm 2 , obtained an output power of 13.3 dBm and a power gain of 14 dB in the saturation region. An input third-order intercept point (HP 3 ) of -3 dBm, an output third-order intercept point (OIP 3 ) of 21.1 dBm and a power added efficiency (PAE) of 22% were attained, respectively. Finally, the overall power characterization exhibited high gain and high linearity, which illustrates that the power amplifier has a compact circuit size and exhibits favorable RF characteristics. This power circuit demonstrated high RF characterization and could be used for microwave power circuit applications at 5.2 GHz. (semiconductor integrated circuits)
Evolution of linear chromosomes and multipartite genomes in yeast mitochondria
Valach, Matus; Farkas, Zoltan; Fricova, Dominika; Kovac, Jakub; Brejova, Brona; Vinar, Tomas; Pfeiffer, Ilona; Kucsera, Judit; Tomaska, Lubomir; Lang, B. Franz; Nosek, Jozef
2011-01-01
Mitochondrial genome diversity in closely related species provides an excellent platform for investigation of chromosome architecture and its evolution by means of comparative genomics. In this study, we determined the complete mitochondrial DNA sequences of eight Candida species and analyzed their molecular architectures. Our survey revealed a puzzling variability of genome architecture, including circular- and linear-mapping and multipartite linear forms. We propose that the arrangement of large inverted repeats identified in these genomes plays a crucial role in alterations of their molecular architectures. In specific arrangements, the inverted repeats appear to function as resolution elements, allowing genome conversion among different topologies, eventually leading to genome fragmentation into multiple linear DNA molecules. We suggest that molecular transactions generating linear mitochondrial DNA molecules with defined telomeric structures may parallel the evolutionary emergence of linear chromosomes and multipartite genomes in general and may provide clues for the origin of telomeres and pathways implicated in their maintenance. PMID:21266473
Josephs, S F; Loudovaris, T; Dixit, A; Young, S K; Johnson, R C
1999-01-01
Continuous delivery of therapeutic peptide to the systemic circulation would be the optimal treatment for a variety of diseases. The Baxter TheraCyte system is a membrane encapsulation system developed for implantation of tissues, cells such as endocrine cells or cell lines genetically engineered for therapeutic peptide delivery in vivo. To demonstrate the utility of this system, cell lines were developed which expressed human growth hormone (hGH) at levels exceeding 1 microgram per million cells per day. These were loaded into devices which were then implanted into juvenile nude rats. Significant levels of hGH of up to 2.5 ng/ml were detected in plasma throughout the six month duration of the study. In contrast, animals implanted with free cells showed peak plasma levels of 0.5 to 1.2 ng four days after implantation with no detectable hGH beyond 10 days. Histological examination of explanted devices showed they were vascularized and contained cells that were viable and morphologically healthy. After removal of the implants, no hGH could be detected which confirmed that the source of hGH was from cells contained within the device. The long term expression of human growth hormone as a model peptide has implications for the peptide therapies for a variety of human diseases using membrane encapsulated cells.
The Neural Cell Adhesion Molecule NCAM2/OCAM/RNCAM, a Close Relative to NCAM
DEFF Research Database (Denmark)
Kulahin, Nikolaj; Walmod, Peter
2008-01-01
molecule (NCAM) is a well characterized, ubiquitously expressed CAM that is highly expressed in the nervous system. In addition to mediating cell adhesion, NCAM participates in a multitude of cellular events, including survival, migration, and differentiation of cells, outgrowth of neurites, and formation......Cell adhesion molecules (CAMs) constitute a large class of plasma membrane-anchored proteins that mediate attachment between neighboring cells and between cells and the surrounding extracellular matrix (ECM). However, CAMs are more than simple mediators of cell adhesion. The neural cell adhesion...... and plasticity of synapses. NCAM shares an overall sequence identity of approximately 44% with the neural cell adhesion molecule 2 (NCAM2), a protein also known as olfactory cell adhesion molecule (OCAM) and Rb-8 neural cell adhesion molecule (RNCAM), and the region-for-region sequence homology between the two...
Experimental and theoretical study of the B(2)2Σ+ → X(1)2Σ+ system in the KSr molecule
Szczepkowski, Jacek; Grochola, Anna; Kowalczyk, Paweł; Dulieu, Olivier; Guérout, Romain; Żuchowski, Piotr S.; Jastrzebski, Włodzimierz
2018-05-01
Spectral bands for the B(2)2Σ+ → X(1)2Σ+ electronic transition in the doubly-polar open-shell KSr molecule are recorded at moderate resolution using the thermoluminescence technique. The spectra are simulated using three kinds of advanced electronic structure calculations, allowing for an assessment of their accuracy on one hand, and for the derivation of fundamental spectroscopic constants of the X(1)2Σ+ KSr ground state and the excited electronic state B(2)2Σ+ , on the other hand. These results should facilitate further studies aiming at creating ultracold bosonic or fermionic KSr molecules.
Linearization Method and Linear Complexity
Tanaka, Hidema
We focus on the relationship between the linearization method and linear complexity and show that the linearization method is another effective technique for calculating linear complexity. We analyze its effectiveness by comparing with the logic circuit method. We compare the relevant conditions and necessary computational cost with those of the Berlekamp-Massey algorithm and the Games-Chan algorithm. The significant property of a linearization method is that it needs no output sequence from a pseudo-random number generator (PRNG) because it calculates linear complexity using the algebraic expression of its algorithm. When a PRNG has n [bit] stages (registers or internal states), the necessary computational cost is smaller than O(2n). On the other hand, the Berlekamp-Massey algorithm needs O(N2) where N(≅2n) denotes period. Since existing methods calculate using the output sequence, an initial value of PRNG influences a resultant value of linear complexity. Therefore, a linear complexity is generally given as an estimate value. On the other hand, a linearization method calculates from an algorithm of PRNG, it can determine the lower bound of linear complexity.
Hocaoglu-Emre, F Sinem; Saribal, Devrim; Yenmis, Guven; Guvenen, Guvenc
2017-03-01
Type 2 diabetes mellitus (T2DM) is a multisystemic, chronic disease accompanied by microvascular complications involving various complicated mechanisms. Intercellular adhesion molecule 1 (ICAM-1), vascular cell adhesion molecule 1 (VCAM-1), and cluster of differentiation-146 (CD146) are mainly expressed by endothelial cells, and facilitate the adhesion and transmigration of immune cells, leading to inflammation. In the present study, we evaluated the levels of soluble adhesion molecules in patients with microvascular complications of T2DM. Serum and whole blood samples were collected from 58 T2DM patients with microvascular complications and 20 age-matched healthy subjects. Levels of soluble ICAM-1 (sICAM-1) and soluble VCAM-1 (sVCAM-1) were assessed using enzyme-linked immunosorbent assay, while flow cytometry was used to determine CD146 levels. Serum sICAM-1 levels were lower in T2DM patients with microvascular complications than in healthy controls (Pmolecule levels were not correlated with the complication type. In the study group, most of the patients were on insulin therapy (76%), and 95% of them were receiving angiotensin-converting enzyme (ACE)-inhibitor agents. Insulin and ACE-inhibitors have been shown to decrease soluble adhesion molecule levels via various mechanisms, so we suggest that the decreased or unchanged levels of soluble forms of cellular adhesion molecules in our study group may have resulted from insulin and ACE-inhibitor therapy, as well as tissue-localized inflammation in patients with T2DM. Copyright © 2017 Korean Endocrine Society
On index-2 linear implicit difference equations
Nguyen Huu Du, [No Value; Le Cong Loi, [No Value; Trinh Khanh Duy, [No Value; Vu Tien Viet, [No Value
2011-01-01
This paper deals with an index-2 notion for linear implicit difference equations (LIDEs) and with the solvability of initial value problems (IVPs) for index-2 LIDEs. Besides, the cocycle property as well as the multiplicative ergodic theorem of Oseledets type are also proved. (C) 2010 Elsevier Inc.
Knudsen cell mass spectrometric study of the Cs2IOH(g) molecule thermodynamics
International Nuclear Information System (INIS)
Roki, F-Z.; Ohnet, M-N.; Fillet, S.; Chatillon, C.; Nuta, I.
2013-01-01
Highlights: • The pronounced ionic character leads to only dissociative ionization processes. • Ions formed are same as those coming from pure dimmers. • De-convolution of the ions origin needs accurate thermodynamic values for the pure gas phase. • Mass spectrometric interpretation has to be performed gradually and as a function of suitable condensed compositions. • Thermal functions have to be fully estimated. -- Abstract: The gas phase of the CsI + CsOH system is analyzed by high temperature Knudsen cell mass spectrometry in order to confirm the existence of the Cs 2 IOH(g) complex molecule. The mass spectrometric analysis is quite complex since such molecules undergo dissociative ionization into fragment ions that mix with the same ions from dimers of the pure compounds in the same vapor phase. Varying the chemical conditions for vaporization by using different CsI + CsOH mixture contents showed that the ionization of the Cs 2 IOH(g) molecule led to five different fragment ions, Cs 2 OH + , Cs 2 I + , Cs + , CsOH + and CsI + . This complex ionization pattern was studied in relation with previous assessed values for the vaporization of CsOH and CsI pure compounds in which monomer and dimer molecules are predominant. The equilibrium constant for the reaction CsI(g) + CsOH(g) = Cs 2 IOH(g) was determined and, after modeling the structure of the Cs 2 IOH molecule, the enthalpy of formation was determined using the third law of thermodynamics, as follows: Δ f H°(Cs 2 IOH, g, 298.15 K) = −578 ± 14.7 kJ · mole −1
Observing electron localization in a dissociating H2+ molecule in real time.
Xu, H; Li, Zhichao; He, Feng; Wang, X; Atia-Tul-Noor, A; Kielpinski, D; Sang, R T; Litvinyuk, I V
2017-06-16
Dissociation of diatomic molecules with odd number of electrons always causes the unpaired electron to localize on one of the two resulting atomic fragments. In the simplest diatomic molecule H 2 + dissociation yields a hydrogen atom and a proton with the sole electron ending up on one of the two nuclei. That is equivalent to breaking of a chemical bond-the most fundamental chemical process. Here we observe such electron localization in real time by performing a pump-probe experiment. We demonstrate that in H 2 + electron localization is complete in just 15 fs when the molecule's internuclear distance reaches 8 atomic units. The measurement is supported by a theoretical simulation based on numerical solution of the time-dependent Schrödinger equation. This observation advances our understanding of detailed dynamics of molecular dissociation.
Exotic helium molecules; Molecules exotiques d'helium
Energy Technology Data Exchange (ETDEWEB)
Portier, M
2007-12-15
We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}P{sub 0}) molecule, or a {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 {+-} 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range {sup 4}He{sub 2}(2{sup 3}S{sub 1}-2{sup 3}S{sub 1}) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime {tau} = (1.4 {+-} 0.3) {mu}s is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)
Chacon-Madrid, Heber J; Murphy, Benjamin N; Pandis, Spyros N; Donahue, Neil M
2012-10-16
We use a two-dimensional volatility basis set (2D-VBS) box model to simulate secondary organic aerosol (SOA) mass yields of linear oxygenated molecules: n-tridecanal, 2- and 7-tridecanone, 2- and 7-tridecanol, and n-pentadecane. A hybrid model with explicit, a priori treatment of the first-generation products for each precursor molecule, followed by a generic 2D-VBS mechanism for later-generation chemistry, results in excellent model-measurement agreement. This strongly confirms that the 2D-VBS mechanism is a predictive tool for SOA modeling but also suggests that certain important first-generation products for major primary SOA precursors should be treated explicitly for optimal SOA predictions.
Ethanol oxidation reactions catalyzed by water molecules: CH3CH2OH+n H2O→ CH3CHO+ H2+n H2O (n=0,1,2)
Takahashi, H.; Hisaoka, S.; Nitta, T.
2002-09-01
Ab initio density functional theory calculations have been performed to investigate the catalytic role of water molecules in the oxidation reaction of ethanol: CH3CH2OH+n H2O→ CH3CHO+ H2+n H2O (n=0,1,2) . The results show that the potential energy barrier for the reaction is 88.0 kcal/mol in case of n=0, while it is reduced by ˜34 kcal/mol when two water molecules are involved ( n=2) in the reaction. As a result, the rate constant increases to 3.31×10 -4 s-1, which shows a significant catalytic role of water molecules in the ethanol oxidation reactions.
Intercalation of organic molecules into SnS2 single crystals
International Nuclear Information System (INIS)
Toh, M.L.; Tan, K.J.; Wei, F.X.; Zhang, K.K.; Jiang, H.; Kloc, C.
2013-01-01
SnS 2 is a layered semiconductor with a van der Waals gap separating the covalently bonded layers. In this study, post-synthesis intercalation of donor organic amine molecules, such as ethylenediamine (en), into tin disulfide and secondary intercalation of p-phenylenediamine (PPD) and 1, 5-naphthalenediamine (NDA) into SnS 2e n have been verified with X-ray diffraction. PPD and NDA did not intercalate directly even during prolonged annealing but replaced en readily if en was already present in the van der Waals gap. The c-lattice dilation is proportional to the intercalant size. Unit cell lattices of intercalated products were determined from the positions of the X-ray diffraction peaks. Optical images taken during the intercalation showed that intercalation progressed from the periphery towards the interior of the crystal. TEM diffraction patterns in the [0 0 1] direction of SnS 2 after intercalation revealed defects and stacking mismatches among the SnS 2 layers caused by the intercalation. UV–Vis absorption studies showed a red shift in the band edge of the SnS 2 material after intercalation. The band edge was 2.2 eV for pristine SnS 2 ; after intercalation with en or PPD, the absorbance spectra band edges shifted to approximately 0.7 eV or 0.5 eV, respectively. - Graphical Abstract: SnS 2 single crystals were intercalated with organic amine molecules such as ethylenediamine, phenylenediamine and naphthalenediamine. Absorption studies showed red shift of band edge after intercalation, which was consistent with optical observations. X-ray diffraction indicated lattice dilation in the c-lattice of SnS 2 after intercalation. Highlights: ► Organic molecules intercalated inhomogenously between covalently bonded SnS 2 layers. ► Ethylenediamine (en) intercalate directly into SnS 2 . ► Phenylenediamine (PPD) and naphthalenediamine (NDA) can be intercalated into SnS 2 secondary. ► In a secondary intercalation the bonds between layers are weakened by direct
Magnetic field modification of ultracold molecule-molecule collisions
International Nuclear Information System (INIS)
Tscherbul, T V; Suleimanov, Yu V; Aquilanti, V; Krems, R V
2009-01-01
We present an accurate quantum mechanical study of molecule-molecule collisions in the presence of a magnetic field. The work focuses on the analysis of elastic scattering and spin relaxation in collisions of O 2 ( 3 Σ g - ) molecules at cold (∼0.1 K) and ultracold (∼10 -6 K) temperatures. Our calculations show that magnetic spin relaxation in molecule-molecule collisions is extremely efficient except at magnetic fields below 1 mT. The rate constant for spin relaxation at T=0.1 K and a magnetic field of 0.1 T is found to be as large as 6.1x10 -11 cm -3 s -1 . The magnetic field dependence of elastic and inelastic scattering cross sections at ultracold temperatures is dominated by a manifold of Feshbach resonances with the density of ∼100 resonances per Tesla for collisions of molecules in the absolute ground state. This suggests that the scattering length of ultracold molecules in the absolute ground state can be effectively tuned in a very wide range of magnetic fields. Our calculations demonstrate that the number and properties of the magnetic Feshbach resonances are dramatically different for molecules in the absolute ground and excited spin states. The density of Feshbach resonances for molecule-molecule scattering in the low-field-seeking Zeeman state is reduced by a factor of 10.
Cross Talk between H2O2 and Interacting Signal Molecules under Plant Stress Response
Saxena, Ina; Srikanth, Sandhya; Chen, Zhong
2016-01-01
It is well established that oxidative stress is an important cause of cellular damage. During stress conditions, plants have evolved regulatory mechanisms to adapt to various environmental stresses. One of the consequences of stress is an increase in the cellular concentration of reactive oxygen species, which is subsequently converted to H2O2. H2O2 is continuously produced as the byproduct of oxidative plant aerobic metabolism. Organelles with a high oxidizing metabolic activity or with an intense rate of electron flow, such as chloroplasts, mitochondria, or peroxisomes are major sources of H2O2 production. H2O2 acts as a versatile molecule because of its dual role in cells. Under normal conditions, H2O2 immerges as an important factor during many biological processes. It has been established that it acts as a secondary messenger in signal transduction networks. In this review, we discuss potential roles of H2O2 and other signaling molecules during various stress responses. PMID:27200043
2D nanomaterials assembled from sequence-defined molecules
International Nuclear Information System (INIS)
Mu, Peng; State University of New York; Zhou, Guangwen; Chen, Chun-Long
2017-01-01
Two dimensional (2D) nanomaterials have attracted broad interest owing to their unique physical and chemical properties with potential applications in electronics, chemistry, biology, medicine and pharmaceutics. Due to the current limitations of traditional 2D nanomaterials (e.g., graphene and graphene oxide) in tuning surface chemistry and compositions, 2D nanomaterials assembled from sequence-defined molecules (e.g., DNAs, proteins, peptides and peptoids) have recently been developed. They represent an emerging class of 2D nanomaterials with attractive physical and chemical properties. Here, we summarize the recent progress in the synthesis and applications of this type of sequence-defined 2D nanomaterials. We also discuss the challenges and opportunities in this new field.
Energy Technology Data Exchange (ETDEWEB)
Zhao, B.; Li, C.Y. [Hubei Nuclear Solid Physics Key Laboratory, Department of Physics, Wuhan University, Wuhan 430072 (China); Liu, L.L. [Key Lab for Special Functional Materials of Ministry of Eduaction, Henan Province, Henan University, Kaifeng 475004 (China); Zhou, B.; Zhang, Q.K. [Hubei Nuclear Solid Physics Key Laboratory, Department of Physics, Wuhan University, Wuhan 430072 (China); Chen, Z.Q., E-mail: chenzq@whu.edu.cn [Hubei Nuclear Solid Physics Key Laboratory, Department of Physics, Wuhan University, Wuhan 430072 (China); Tang, Z., E-mail: ztang@ee.ecnu.edu.cn [Key Laboratory of Polar Materials and Devices, Ministry of Education of China, East China Normal University, Shanghai 200241 (China)
2016-09-30
Highlights: • Embedded Cu atom is strongly constrained on the sulfur vacancy of monolayer MoS{sub 2}. • Transition-metal Cu atom can break the chemical inactivation of MoS{sub 2} surface. • MoS{sub 2}-Cu system is a promising for future application in gas molecules sensing. - Abstract: Adsorption of small gas molecules (O{sub 2}, NO, NO{sub 2} and NH{sub 3}) on transition-metal Cu atom embedded monolayer MoS{sub 2} was investigated by first-principles calculations based on the density-functional theory (DFT). The embedded Cu atom is strongly constrained on the sulfur vacancy of monolayer MoS{sub 2} with a high diffusion barrier. The stable adsorption geometry, charge transfer and electronic structures of these gas molecules on monolayer MoS{sub 2} embedded with transition-metal Cu atom are discussed in detail. It is found that the monolayer MoS{sub 2} with embedded Cu atom can effectively capture these gas molecules with high adsorption energy. The NH{sub 3} molecule acts as electron donor after adsorption, which is different from the other gas molecules (O{sub 2}, NO, and NO{sub 2}). The results suggest that MoS{sub 2}-Cu system may be promising for future applications in gas molecules sensing and catalysis, which is similar to those of the transition-metal embedded graphene.
DEFF Research Database (Denmark)
Faissner, A; Kruse, J; Goridis, C
1984-01-01
The neural cell adhesion molecule L1 and the group of N-CAM related molecules, BSP-2 and D2 antigen, are immunochemically distinct molecular species. The two groups of surface molecules are also functionally distinct entities, since inhibition of Ca2+-independent adhesion among early post-natal m...
Yang, Xuejin
2016-06-07
Benzo[4,5]cyclohepta[1,2-b]fluorene (5a), a new π-conjugated polycyclic hydrocarbon containing linearly fused six-, five-, six-, seven- and six-membered rings (C6-C5-C6-C7-C6), was designed and its stable derivatives 5b and 5c were synthesized. With 22 π electrons, 5a is an isomer of pentacene with quinoidal, dipolar ionic and diradical resonance forms. Molecules 5b and 5c were experimentally investigated with cyclic voltammetry, electronic absorption spectroscopy and X-ray crystallographic analysis, and theoretically studied by calculating the NICS value, diradical character and dipole moment. A comparison of 5a–c with pentacene and other pentacene analogues containing linearly fused five- or seven- membered rings was also conducted and discussed. It was found that 5b behaved as a p-type organic semiconductor in solution-processed thin film transistors with field effect mobility of up to 0.025 cm2/Vs.
Yang, Xuejin; Shi, Xueliang; Aratani, Naoki; Goncalves, Theo; Huang, Kuo-Wei; Yamada, Hiroko; Chi, Chunyan; Miao, Qian
2016-01-01
Benzo[4,5]cyclohepta[1,2-b]fluorene (5a), a new π-conjugated polycyclic hydrocarbon containing linearly fused six-, five-, six-, seven- and six-membered rings (C6-C5-C6-C7-C6), was designed and its stable derivatives 5b and 5c were synthesized. With 22 π electrons, 5a is an isomer of pentacene with quinoidal, dipolar ionic and diradical resonance forms. Molecules 5b and 5c were experimentally investigated with cyclic voltammetry, electronic absorption spectroscopy and X-ray crystallographic analysis, and theoretically studied by calculating the NICS value, diradical character and dipole moment. A comparison of 5a–c with pentacene and other pentacene analogues containing linearly fused five- or seven- membered rings was also conducted and discussed. It was found that 5b behaved as a p-type organic semiconductor in solution-processed thin film transistors with field effect mobility of up to 0.025 cm2/Vs.
Adsorption studies of alcohol molecules on monolayer MoS_2 nanosheet—A first-principles insights
International Nuclear Information System (INIS)
Nagarajan, V.; Chandiramouli, R.
2017-01-01
Highlights: • The adsorption of methanol, ethanol & 1-propanol on MoS_2 nanosheet are studied. • The PDOS & band structure confirms adsorption of alcohol vapors on MoS_2 nanosheet. • The adsorption of 1-propanol vapor on MoS_2 nanosheet is more favorable. • The alcohol molecules adsorption on MoS_2 nanosheet is explored in atomistic level. - Abstract: The electronic and adsorption properties of three different alcohol molecules namely methanol, ethanol and 1-propanol vapors on MoS_2 nanosheet is investigated using DFT method. The structural stability of MoS_2 nanosheet is ascertained with formation energy. The adsorption properties of alcohol molecules on MoS_2 base material is discussed in terms of average energy gap variation, Mulliken charge transfer, energy band gap and adsorption energy. The prominent adsorption sites of methanol, ethanol and 1-propanol vapors on MoS_2 nanosheet are studied in atomistic level. The projected density of states (PDOS) spectrum gives the clear insights on the electronic properties of MoS_2 nanosheet. The PDOS and energy band structure confirmed the adsorption of alcohol vapors on MoS_2 nanosheet. The variation in the band structure and PDOS is noticed upon adsorption of methanol, ethanol and 1-propanol molecules on MoS_2 nanosheet. The PDOS spectrum also reveals the variation in peak maxima owing to transfer of electron between alcohol molecules and MoS_2 base material. The adsorption of 1-propanol vapor on MoS_2 nanosheet is observed to be more favorable than other alcohol molecules. The findings confirm that monolayer MoS_2 nanosheet can be used to detect the presence of alcohol vapors in the environment.
Ellipticity and the offset angle of high harmonics generated by homonuclear diatomic molecules
International Nuclear Information System (INIS)
Odzak, S; Milosevic, D B
2011-01-01
In our recent paper (2010 Phys. Rev. A 82 023412) we introduced a theory of high-order harmonic generation by diatomic molecules exposed to an elliptically polarized laser field and have shown that the nth harmonic emission rate has contributions of the components of the T-matrix element in the direction of the laser-field polarization and in the direction perpendicular to it. Using both components of the T-matrix element we now develop a theoretical approach for calculating ellipticity and the offset angle of high harmonics. We show that the emitted harmonics generated by aligned molecules are elliptically polarized even if the applied field is linearly polarized. Using examples of N 2 , O 2 and Ar 2 molecules we show the existence of extrema and sudden changes of the harmonic ellipticity and the offset angle for particular molecular alignment and explain them by the destructive two-centre interference. Taking into account that the aligned molecules are an anisotropic medium for high harmonic generation, we introduce elliptic dichroism as a measure of this anisotropy, for both components of the T-matrix element. We propose that the measurement of the elliptic dichroism may reveal further information about the molecular structure.
Fast metastable hydrogen atoms from H2 molecules: twin atoms
Directory of Open Access Journals (Sweden)
Trimèche A.
2015-01-01
Full Text Available It is a difficult task to obtain “twin atoms”, i.e. pairs of massive particles such that one can perform experiments in the same fashion that is routinely done with “twin photons”. One possible route to obtain such pairs is by dissociating homonuclear diatomic molecules. We address this possibility by investigating the production of metastable H(2s atoms coming from the dissociation of cold H2 molecules produced in a Campargue nozzle beam crossing an electron beam from a high intensity pulsed electron gun. Dissociation by electron impact was chosen to avoid limitations of target molecular excited states due to selection rules. Detectors placed several centimeters away from the collision center, and aligned with respect to possible common molecular dissociation channel, analyze the neutral fragments as a function of their time-of-flight (TOF through Lyman-α detection. Evidence for the first time observed coincidence of pairs of H(2s atoms obtained this way is presented.
International Nuclear Information System (INIS)
Da Silva Pinto, P.S.; Eustache, R.P.; Audenaert, M.; Bernassau, J.M.
1996-01-01
This work deals with carbon 13 nuclear magnetic resonance chemical shifts empiric calculations by multi linear regression and molecular modeling. The multi linear regression is indeed one way to obtain an equation able to describe the behaviour of the chemical shift for some molecules which are in the data base (rigid molecules with carbons). The methodology consists of structures describer parameters definition which can be bound to carbon 13 chemical shift known for these molecules. Then, the linear regression is used to determine the equation significant parameters. This one can be extrapolated to molecules which presents some resemblances with those of the data base. (O.L.). 20 refs., 4 figs., 1 tab
Metabolic clearance and production rates of human growth hormone
Taylor, Andrew L.; Finster, Joseph L.; Mintz, Daniel H.
1969-01-01
The metabolic clearance rate (MCR) of human growth hormone (HGH) was determined by the constant infusion to equilibrium technique utilizing HGH-125I. 22 control subjects had a MCR of 229 ±52 ml/min (mean ±SD). No difference was evident between sexes, or between various age groups. Patients with acromegaly demonstrated normal MCR's. Moreover, acute elevations of plasma growth hormone concentrations in normal subjects did not alter the MCR of HGH. The MCR was relatively constant from day to day and within the day when subjects were evaluated in the supine position. In contrast, the assumption of the upright position was associated with a mean 24% decrease in the MCR. These results were contrasted with the MCR of HGH observed in a small number of patients with altered thyroid function or diabetes mellitus. In six patients with hypothyroidism the MCR (131 ±36 ml/min) was significantly decreased (P < 0.001); whereas the MCR in eight patients with hyperthyroidism (240 ±57 ml/min) did not differ from control subjects. The MCR in eight patients with insulin-independent diabetes mellitus (IID) (185 ±41 ml/min) and in eight patients with insulin-dependent diabetes mellitus (IDD) (136 ±31 ml/min) were significantly different from control subjects (P = < 0.05 and P = < 0.001, respectively). These data were interpreted to indicate that the plasma HGH-removing mechanism(s) is not saturated at physiologic plasma HGH levels, that plasma HGH levels alone may not permit distinction between variations in pituitary release of the hormone and its rate of clearance from the plasma, and that the estimation of the MCR of HGH may help clarify the mechanism of abnormal plasma HGH responses to various stimuli. Production rates of HGH (PR) in control subjects (347 ±173 mμg/min) were contrasted with hyperthyroid patients (529 ±242 mμg/min, P < 0.05), hypothyroid patients (160 ±69 mμg/min, P < 0.02), IID (245 ±100 mμg/min, NS), and IDD (363 ±153 mμg/min, NS). Considerable
Evangelisti, Luca; Pate, Brooks
2017-06-01
A study of the minimally exciting topic of agreement between experimental and measured rotational constants of molecules was performed on a set of large molecules with 16-18 heavy atoms (carbon and oxygen). The molecules are: nootkatone (C_{15}H_{22}O), cedrol (C_{15}H_{26}O), ambroxide (C_{16}H_{28}O), sclareolide (C_{16}H_{22}O_{2}), and dihydroartemisinic acid (C_{15}H_{24}O_{2}). For this set of molecules we obtained 13C-subsitution structures for six molecules (this includes two conformers of nootkatone). A comparison of theoretical structures and experimental substitution structures was performed in the spirit of the recent work of Grimme and Steinmetz.[1] Our analysis focused the center-of-mass distance of the carbon atoms in the molecules. Four different computational methods were studied: standard DFT (B3LYP), dispersion corrected DFT (B3LYP-D3BJ), hybrid DFT with dispersion correction (B2PLYP-D3), and MP2. A significant difference in these theories is how they handle medium range correlation of electrons that produce dispersion forces. For larger molecules, these dispersion forces produce an overall contraction of the molecule around the center-of-mass. DFT poorly treats this effect and produces structures that are too expanded. MP2 calculations overestimate the correction and produce structures that are too compact. Both dispersion corrected DFT methods produce structures in excellent agreement with experiment. The analysis shows that the difference in computational methods can be described by a linear error in the center-of-mass distance. This makes it possible to correct poorer performing calculations with a single scale factor. We also reexamine the issue of the "Costain error" in substitution structures and show that it is significantly larger in these systems than in the smaller molecules used by Costain to establish the error limits. [1] Stefan Grimme and Marc Steinmetz, "Effects of London dispersion correction in density functional theory on
Photon-assisted tunneling in a Fe-8 single-molecule magnet
Sorace, L.; Wernsdorfer, W.; Thirion, C.; Barra, A. L.; Pacchioni, M.; Mailly, D.; Barbara, B.
2003-01-01
The low temperature spin dynamics of a Fe8 Single-Molecule Magnet was studied under circularly polarized electromagnetic radiation allowing us to establish clearly photon-assisted tunneling. This effect, while linear at low power, becomes highly non-linear above a relatively low power threshold. This non-linearity is attributed to the nature of the coupling of the sample to the thermostat.These results are of great importance if such systems are to be used as quantum computers.
Small molecule antagonism of oxysterol-induced Epstein-Barr virus induced gene 2 (EBI2) activation
DEFF Research Database (Denmark)
Benned-Jensen, Tau; Madsen, Christian M; Arfelt, Kristine N
2013-01-01
The Epstein-Barr virus induced gene 2 (EBI2) was recently identified as the first oxysterol-activated 7TM receptor. EBI2 is essential for B cell trafficking within lymphoid tissues and thus the humoral immune response in general. Here we characterize the antagonism of the non-peptide molecule GSK...
DEFF Research Database (Denmark)
Gessier, Francois; Preuss, Inga; Yin, Hong
2014-01-01
immune response and has been genetically linked to autoimmune diseases such as type I diabetes ( Nature 2010 , 467 , 460 ). Here we describe the isolation of a potent small molecule antagonist for the EBI2 receptor. First, we identified a small molecule agonist NIBR51 (1), which enabled identification...
Demircioğlu, Zeynep; Yeşil, Ahmet Emin; Altun, Mehmet; Bal-Demirci, Tülay; Özdemir, Namık
2018-06-01
The compound 4‧-(2,4-dimethoxyphenyl)-2,2‧:6‧,2″-terpyridine (Mtpyr) was synthesized and investigated using X-ray single crystal structure determination, combined with Hirshfeld topology analysis of the molecular packing. In addition, Mtpyr was characterized by experimental and theoretical FT-IR, UV-Vis, 1H NMR, 13C NMR and fluorescence emission spectra. The optimized molecular geometry (bond length, bond angle, torsion angle), the complete vibrational frequency and all other theoretical computations were calculated by using density functional theory (DFT) B3LYP method with the help of 6-311++G(d,p) basis set. From the recorded UV-Vis spectrum, the electronic properties such as excitation energies, wavelength and oscillator strength are evaluated by TD-DFT in chloroform solution. The 1H and 13C nuclear magnetic resonance (NMR) chemical shifts of the molecule were calculated by the gauge-independent atomic orbital (GIAO) method and compared with experimental results. The calculated HOMO-LUMO band gap energies confirmed that charge transfer and chemical stability within the molecule. The hyperconjugative interaction energy E(2) and electron densities of donor (i) and acceptor (j) bonds were calculated using natural bond orbital (NBO) analysis. Besides Mulliken and natural population charges (NPA), non-linear optic properties (NLO), Fukui Function analysis, molecular electrostatic potential (MEP) were also computed which helps to identifying the electrophilic/nucleophilic nature.
Antiferromagnetic coupling of TbPc2 molecules to ultrathin Ni and Co films
Directory of Open Access Journals (Sweden)
David Klar
2013-05-01
Full Text Available The magnetic and electronic properties of single-molecule magnets are studied by X-ray absorption spectroscopy and X-ray magnetic circular dichroism. We study the magnetic coupling of ultrathin Co and Ni films that are epitaxially grown onto a Cu(100 substrate, to an in situ deposited submonolayer of TbPc2 molecules. Because of the element specificity of the X-ray absorption spectroscopy we are able to individually determine the field dependence of the magnetization of the Tb ions and the Ni or Co film. On both substrates the TbPc2 molecules couple antiferromagnetically to the ferromagnetic films, which is possibly due to a superexchange interaction via the phthalocyanine ligand that contacts the magnetic surface.
Molecular electronics--resonant transport through single molecules.
Lörtscher, Emanuel; Riel, Heike
2010-01-01
The mechanically controllable break-junction technique (MCBJ) enables us to investigate charge transport through an individually contacted and addressed molecule in ultra-high vacuum (UHV) environment at variable temperature ranging from room temperature down to 4 K. Using a statistical measurement and analysis approach, we acquire current-voltage (I-V) characteristics during the repeated formation, manipulation, and breaking of a molecular junction. At low temperatures, voltages accessing the first molecular orbitals in resonance can be applied, providing spectroscopic information about the junction's energy landscape, in particular about the molecular level alignment in respect to the Fermi energy of the electrodes. Thereby, we can investigate the non-linear transport properties of various types of functional molecules and explore their potential use as functional building blocks for future nano-electronics. An example will be given by the reversible and controllable switching between two distinct conductive states of a single molecule. As a proof-of-principle for functional molecular devices, a single-molecule memory element will be demonstrated.
Experimental Charge Density Study of Trichromium Linear Metal String Complex – Cr3(dpa)4Cl2
DEFF Research Database (Denmark)
Wu, Lai-Chin; Cheng, Ming-Chuan; Thomsen, Maja Krüger
An experimental and theoretical charge density study, based on Bader’s Quantum Theory: Atoms in Molecule (QTAIM), on a trichromium metal string complex, Cr3(dpa)4Cl2(C2H5OC2H5)x(CH2Cl2)1-x (1, dpa- = bis(2-pyridyl)amido)) is performed. The structure and multipole model of 1 are performed by using...... experimental X-ray diffraction data which are collected at both 100 K using conventional X-ray source (DS1) and 15 K using synchrotron source (DS2). The three chromium metal string is bridged by four dpa- ligands. These tri-chromium metal ions are bonded to each other and terminated by two Cl- ions on the both...... ends, forming a [Cl(1)Cr(1)Cr(2)Cr(3)Cl(2)] linear string. Each Cr atoms are coordinated by four N atoms of each dpa- ligand. This metal string is slightly unsymmetrical at both data sets. The bond distance, from DS1 (DS2), of Cr(1)Cr(2), 2.3480(2) (2.3669(1)) Å, is 0.03 (0.003) Å shorter than Cr...
Chapman, Daniel C; Stocki, Pawel; Williams, David B
2015-01-01
Human cytomegalovirus uses a variety of mechanisms to evade immune recognition through major histocompatibility complex class I molecules. One mechanism mediated by the immunoevasin protein US2 causes rapid disposal of newly synthesized class I molecules by the endoplasmic reticulum-associated degradation pathway. Although several components of this degradation pathway have been identified, there are still questions concerning how US2 targets class I molecules for degradation. In this study we identify cyclophilin C, a peptidyl prolyl isomerase of the endoplasmic reticulum, as a component of US2-mediated immune evasion. Cyclophilin C could be co-isolated with US2 and with the class I molecule HLA-A2. Furthermore, it was required at a particular expression level since depletion or overexpression of cyclophilin C impaired the degradation of class I molecules. To better characterize the involvement of cyclophilin C in class I degradation, we used LC-MS/MS to detect US2-interacting proteins that were influenced by cyclophilin C expression levels. We identified malectin, PDIA6, and TMEM33 as proteins that increased in association with US2 upon cyclophilin C knockdown. In subsequent validation all were shown to play a functional role in US2 degradation of class I molecules. This was specific to US2 rather than general ER-associated degradation since depletion of these proteins did not impede the degradation of a misfolded substrate, the null Hong Kong variant of α1-antitrypsin.
International Nuclear Information System (INIS)
Kimmel, Anna V.; Sushko, Peter V.; Shluger, Alexander L.; Kuklja, Maija M.
2007-01-01
The authors have calculated the electronic structure of individual 1,1-diamino-2,2-dinitroethylene molecules (FOX-7) in the gas phase by means of density functional theory with the hybrid B3LYP functional and 6-31+G(d,p) basis set and considered their dissociation pathways. Positively and negatively charged states as well as the lowest excited states of the molecule were simulated. They found that charging and excitation can not only reduce the activation barriers for decomposition reactions but also change the dominating chemistry from endo- to exothermic type. In particular, they found that there are two competing primary initiation mechanisms of FOX-7 decomposition: C-NO 2 bond fission and C-NO 2 to CONO isomerization. Electronic excitation or charging of FOX-7 disfavors CONO formation and, thus, terminates this channel of decomposition. However, if CONO is formed from the neutral FOX-7 molecule, charge trapping and/or excitation results in spontaneous splitting of an NO group accompanied by the energy release. Intramolecular hydrogen transfer is found to be a rare event in FOX-7 unless free electrons are available in the vicinity of the molecule, in which case HONO formation is a feasible exothermic reaction with a relatively low energy barrier. The effect of charged and excited states on other possible reactions is also studied. Implications of the obtained results to FOX-7 decomposition in condensed state are discussed
Energy Technology Data Exchange (ETDEWEB)
Li, Juan [Physik Department and NIM, Walter Schottky Institute, Technische Universität München, Am Coulombwall 4, Garching D-85748 (Germany); Physik Department E20, Technische Universität München, James-Franck-St. 1, Garching D-85748 (Germany); Wierzbowski, Jakob; Ceylan, Özlem; Klein, Julian; Anh, Tuan Le; Meggendorfer, Felix; Finley, Jonathan J.; Margapoti, Emanuela, E-mail: emanuela.margapoti@wsi.tum.de [Physik Department and NIM, Walter Schottky Institute, Technische Universität München, Am Coulombwall 4, Garching D-85748 (Germany); Nisic, Filippo; Dragonetti, Claudia [Dipartimento di Chimica, Università degli Studi di Milano and UdR dell' INSTM di Milano, Via Golgi 19, I-20133 Milano (Italy); Palma, Carlos-Andres; Barth, Johannes V. [Physik Department E20, Technische Universität München, James-Franck-St. 1, Garching D-85748 (Germany)
2014-12-15
We report photoluminescence measurements performed on monolayer- and two-layer-MoS{sub 2} placed on two types of mixed self-assembled monolayers (mSAMs) of photoswitchable azobenzene molecules. The two mSAMs differ via the electronegative character of the azobenzene derivatives. Thin layers of a transition metal dichalcogenide—MoS{sub 2}—were mechanically exfoliated on mSAM to allow for direct interaction between the molecules and the MoS{sub 2} layers. When the MoS{sub 2} nanosheet is in contact with the electropositive azobenzene molecules in trans configuration, an emission side band at lower energies and at low excitation powers suggest n-type doping. The photoisomerization of the molecules from trans to cis configuration lowers the doping, quenching the side band and enhancing the overall PL efficiency by a factor of ∼3. Opposite results were observed with the chlorinated, more electronegative molecules, exhibiting a reversed trend in the PL efficiency between trans and cis, but with an overall larger intensity. The type of doping induced by the two types of mSAMs was determined by Kelvin probe force microscopy technique.
Structure and potential energy function investigation on UH and UH2 molecules
International Nuclear Information System (INIS)
Luo Deli; Liu Xiaoya; Jiang Gang; Meng Daqiao; Zhu Zhenghe
2001-01-01
Density functional (B3LYP) method with Relativistic Effective Core Potential (RECP) have been used to optimize the structures and to calculate the potential energy function both for the ground and excited states of UH and UH 2 molecules. Results show that the ground state of UH and UH 2 molecules are X 4 II and X 3 A 2 , which belongs to C2v symmetry, and the disassociation energies are 2.886 eV and 5.249 ev respectively, and the spectral data of UH and UH 2 have also been derived both for the ground and excited state. The potential energy function of UH and UH 2 have been derived based on normal equation fitting method and the many-body expansion theory. The information is useful to mechanism analysis of the aging effect of the hydrogen storage material
Liu, Xing; Wang, Xuefeng; Wang, Qiang; Andrews, Lester
2012-07-02
Infrared spectra of the matrix isolated OMS, OM(η(2)-SO), and OM(η(2)-SO)(η(2)-SO(2)) (M = Ti, Zr, Hf) molecules were observed following laser-ablated metal atom reactions with SO(2) during condensation in solid argon and neon. The assignments for the major vibrational modes were confirmed by appropriate S(18)O(2) and (34)SO(2) isotopic shifts, and density functional vibrational frequency calculations (B3LYP and BPW91). Bonding in the initial OM(η(2)-SO) reaction products and in the OM(η(2)-SO)(η(2)-SO(2)) adduct molecules with unusual chiral structures is discussed.
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 20; Issue 2. Single-Molecule Spectroscopy: Every Molecule is Different! Kankan Bhattacharyya. General Article Volume 20 Issue 2 February 2015 pp 151-164. Fulltext. Click here to view fulltext PDF. Permanent link:
International Nuclear Information System (INIS)
Barnes, T.; Oak Ridge National Lab., TN; Tennessee Univ., Knoxville, TN
1994-06-01
This report summarizes the experimental and theoretical status of hadronic molecules, which are weakly-bound states of two or more hadrons. We begin with a brief history of the subject and discuss a few good candidates, and then abstract some signatures for molecules which may be of interest in the classification of possible molecule states. Next we argue that a more general understanding of 2 → 2 hadron-hadron scattering amplitudes will be crucial for molecule searches, and discuss some of our recent work in this area. We conclude with a discussion of a few more recent molecule candidates (notably the f o (1710)) which are not well established as molecules but satisfy some of the expected signatures. (Author)
Raithel, Georg; Zhao, Jianming
2017-04-01
Cold atomic systems have opened new frontiers at the interface of atomic and molecular physics. These include research on novel types of Rydberg molecules. Three types of molecules will be reviewed. Long-range, homonuclear Rydberg molecules, first predicted in [1] and observed in [2], are formed via low-energy electron scattering of the Rydberg electron from a ground-state atom within the Rydberg atom's volume. The binding mostly arises from S- and P-wave triplet scattering. We use a Fermi model that includes S-wave and P-wave singlet and triplet scattering, the fine structure coupling of the Rydberg atom and the hyperfine structure coupling of the 5S1/2 atom (in rubidium [3]). The hyperfine structure gives rise to mixed singlet-triplet potentials for both low-L and high-L Rydberg molecules [3]. A classification into Hund's cases [3, 4, 5] will be discussed. The talk further includes results on adiabatic potentials and adiabatic states of Rydberg-Rydberg molecules in Rb and Cs. These molecules, which have even larger bonding length than Rydberg-ground molecules, are formed via electrostatic multipole interactions. The leading interaction term of neutral Rydberg-Rydberg molecules is between two dipoles, while for ionic Rydberg molecules it is between a dipole and a monopole. NSF (PHY-1506093), NNSF of China (61475123).
Xu, Sheng; Liu, Xingguang; Bao, Yan; Zhu, Xuhui; Han, Chaofeng; Zhang, Peng; Zhang, Xuemin; Li, Weihua; Cao, Xuetao
2012-04-22
The molecular mechanisms that fine-tune Toll-like receptor (TLR)-triggered innate inflammatory responses remain to be fully elucidated. Major histocompatibility complex (MHC) molecules can mediate reverse signaling and have nonclassical functions. Here we found that constitutively expressed membrane MHC class I molecules attenuated TLR-triggered innate inflammatory responses via reverse signaling, which protected mice from sepsis. The intracellular domain of MHC class I molecules was phosphorylated by the kinase Src after TLR activation, then the tyrosine kinase Fps was recruited via its Src homology 2 domain to phosphorylated MHC class I molecules. This led to enhanced Fps activity and recruitment of the phosphatase SHP-2, which interfered with TLR signaling mediated by the signaling molecule TRAF6. Thus, constitutive MHC class I molecules engage in crosstalk with TLR signaling via the Fps-SHP-2 pathway and control TLR-triggered innate inflammatory responses.
The UK Sport perspective on detecting growth hormone abuse.
Stow, M R; Wojek, N; Marshall, J
2009-08-01
Human growth hormone (hGH) is seen as a doping risk in sport because of its possible anabolic and lipolytic effects. As a result of this hGH is prohibited for athletes to use both in and out-of-competition by the World Anti-Doping Agency (WADA) requiring Anti-Doping Organisations to work with research teams in identifying ways to detect hGH abuse. This paper reviews and discusses the UK Sport perspective on the challenges faced in detecting hGH and in particular draws upon the experiences gained during the collaborative efforts with the GH-2004 research team in achieving the implementation of the Marker Method for hGH detection. In 2008 significant progress has been made; there is one test for detecting HGH approved for use in anti-doping and a second detection method pending. This is a strong reflection of the ongoing research efforts in anti-doping and the progress being made by the Anti-Doping Organisations in reducing the risk that doping poses to sport.
Large linear magnetoresistance from neutral defects in Bi$_2$Se$_3$
Kumar, Devendra; Lakhani, Archana
2016-01-01
The chalcogenide Bi$_2$Se$_3$ can attain the three dimensional (3D) Dirac semimetal state under the influence of strain and microstrain. Here we report the presnece of large linear magnetoresistance in such a Bi$_2$Se$_3$ crystal. The magnetoresistance has quadratic form at low fields which crossovers to linear above 4 T. The temperature dependence of magnetoresistance scales with carrier mobility and the crossover field scales with inverse of mobility. Our analysis suggest that the linear ma...
Diamond, Jared M.
1966-01-01
1. The relation between osmotic gradient and rate of osmotic water flow has been measured in rabbit gall-bladder by a gravimetric procedure and by a rapid method based on streaming potentials. Streaming potentials were directly proportional to gravimetrically measured water fluxes. 2. As in many other tissues, water flow was found to vary with gradient in a markedly non-linear fashion. There was no consistent relation between the water permeability and either the direction or the rate of water flow. 3. Water flow in response to a given gradient decreased at higher osmolarities. The resistance to water flow increased linearly with osmolarity over the range 186-825 m-osM. 4. The resistance to water flow was the same when the gall-bladder separated any two bathing solutions with the same average osmolarity, regardless of the magnitude of the gradient. In other words, the rate of water flow is given by the expression (Om — Os)/[Ro′ + ½k′ (Om + Os)], where Ro′ and k′ are constants and Om and Os are the bathing solution osmolarities. 5. Of the theories advanced to explain non-linear osmosis in other tissues, flow-induced membrane deformations, unstirred layers, asymmetrical series-membrane effects, and non-osmotic effects of solutes could not explain the results. However, experimental measurements of water permeability as a function of osmolarity permitted quantitative reconstruction of the observed water flow—osmotic gradient curves. Hence non-linear osmosis in rabbit gall-bladder is due to a decrease in water permeability with increasing osmolarity. 6. The results suggest that aqueous channels in the cell membrane behave as osmometers, shrinking in concentrated solutions of impermeant molecules and thereby increasing membrane resistance to water flow. A mathematical formulation of such a membrane structure is offered. PMID:5945254
A Linear Tetranuclear Dysprosium(III) Compound Showing Single-Molecule Magnet Behavior
Energy Technology Data Exchange (ETDEWEB)
Ke, Hongshan; Xu, Gong Feng; Guo, Yun-Nan; Gamez, Patrick; Beavers, Christine M; Teat, Simon J; Tang, Jinkui
2010-04-20
Although magnetic measurements reveal a single-relaxation time for a linear tetranuclear Dy(III) compound, the wide distribution of the relaxation time observed clearly suggests the presence of two slightly different anisotropic centres, therefore opening new avenues for investigating the relaxation dynamics of lanthanide aggregates.
Electron Accumulative Molecules.
Buades, Ana B; Sanchez Arderiu, Víctor; Olid-Britos, David; Viñas, Clara; Sillanpää, Reijo; Haukka, Matti; Fontrodona, Xavier; Paradinas, Markos; Ocal, Carmen; Teixidor, Francesc
2018-02-28
With the goal to produce molecules with high electron accepting capacity and low reorganization energy upon gaining one or more electrons, a synthesis procedure leading to the formation of a B-N(aromatic) bond in a cluster has been developed. The research was focused on the development of a molecular structure able to accept and release a specific number of electrons without decomposing or change in its structural arrangement. The synthetic procedure consists of a parallel decomposition reaction to generate a reactive electrophile and a synthesis reaction to generate the B-N(aromatic) bond. This procedure has paved the way to produce the metallacarboranylviologen [M(C 2 B 9 H 11 )(C 2 B 9 H 10 )-NC 5 H 4 -C 5 H 4 N-M'(C 2 B 9 H 11 )(C 2 B 9 H 10 )] (M = M' = Co, Fe and M = Co and M' = Fe) and semi(metallacarboranyl)viologen [3,3'-M(8-(NC 5 H 4 -C 5 H 4 N-1,2-C 2 B 9 H 10 )(1',2'-C 2 B 9 H 11 )] (M = Co, Fe) electron cumulative molecules. These molecules are able to accept up to five electrons and to donate one in single electron steps at accessible potentials and in a reversible way. By targeted synthesis and corresponding electrochemical tests each electron transfer (ET) step has been assigned to specific fragments of the molecules. The molecules have been carefully characterized, and the electronic communication between both metal centers (when this situation applies) has been definitely observed through the coplanarity of both pyridine fragments. The structural characteristics of these molecules imply a low reorganization energy that is a necessary requirement for low energy ET processes. This makes them electronically comparable to fullerenes, but on their side, they have a wide range of possible solvents. The ET from one molecule to another has been clearly demonstrated as well as their self-organizing capacity. We consider that these molecules, thanks to their easy synthesis, ET, self-organizing capacity, wide range of solubility, and easy processability, can
H 2 guaranteed cost control of discrete linear systems
Directory of Open Access Journals (Sweden)
Colmenares W.
2000-01-01
Full Text Available This paper presents necessary and sufficient conditions for the existence of a quadratically stabilizing output feedback controller which also assures H 2 guaranteed cost performance on a discrete linear uncertain system where the uncertainty is of the norm bounded type. The conditions are presented as a collection of linear matrix inequalities.The solution, however requires a search over a scalar parameter space.
Shepperson, Benjamin; Chatterley, Adam S.; Christiansen, Lars; Søndergaard, Anders A.; Stapelfeldt, Henrik
2018-01-01
A 160-ps near-Gaussian, linearly polarized laser pulse is used to align iodine (I2) molecules embedded in helium nanodroplets. The rise time of the laser pulse is sufficiently long and smooth that the alignment, characterized by , behaves adiabatically during the pulse turnon. However, after the laser pulse has turned off stays above 0.50 and a recurrence structure occurs ˜650 ps later. Measurements on isolated (I2) molecules with identical laser pulses are used to identify, through analysis of the observed half- and full-rotational revivals, that the nonadiabatic postpulse alignment dynamics results from a mild truncation of the trailing edge of the laser pulse. This truncation establishes a well-defined starting time for coherent rotation, which leads to the revival structures observed both for isolated molecules and molecules in He droplets. In the latter case the time-dependent trace recorded here is compared to that obtained previously for a 450-fs alignment pulse. It is found that the observed revivals are very similar.
WHIZARD 2.2 for linear colliders
International Nuclear Information System (INIS)
Kilian, W.; Ohl, T.
2014-03-01
We review the current status of the WHIZARD event generator. We discuss, in particular, recent improvements and features that are relevant for simulating the physics program at a future Linear Collider.
Nagarajan, V.; Chandiramouli, R.
2018-03-01
Using density functional theory method, we investigate the adsorption properties of NH3 and NO2 molecules on stanene and stanane nanosheets. The adsorption of molecules is explored based on the charge transfer, energetics, energy band gap and average energy gap variation. Moreover, the optimal adsorption sites of NH3 and NO2 molecules are identified on stanene and stanane nanosheets. Besides, the state-of-the-art provides the key features for the development of chemi-resistive nanosensor based on stanene and stanane nanosheets upon adsorption of NH3 and NO2 molecules. Furthermore, the study shows that adsorption of NO2 molecules is more prominent rather than NH3 molecules.
Energy Technology Data Exchange (ETDEWEB)
Verveer, P [Commissariat a l' Energie Atomique, Fontenay-aux-Roses (France). Centre d' Etudes Nucleaires
1966-07-01
Protons produced by collisional dissociation of H{sub 2}{sup +} ions have an energy spectrum with a narrow central peak. For a part the protons in this peak are produced by vibrational dissociation and for another part by a cascade of two collisions. For H{sub 2}{sup +} ions of 50 to 150 keV the cross section for vibrational dissociation is about 4.1 10{sup -19} cm{sup 2}/molecule in hydrogen and 1.1 10{sup -18} cm{sup 2}/molecule in argon. (author) [French] Les protons resultant de la dissociation par collisions d'ions H{sub 2}{sup +} dans un gaz ont un spectre d'energie qui presente un pic central tres etroit. Les protons dans ce pic proviennent, pour une part de la dissociation vibrationnelle et pour l'autre part d'une suite de deux collisions. Dans le domaine d'energie des ions H{sub 2}{sup +} de 50 a 150 keV la section efficace de dissociation vibrationnel vaut 4.1 10{sup -19} cm{sup 2}/molecule pour l'hydrogene et 1,1 10{sup -18} cm{sup 2}/molecule pour l'argon.
Thermal expansion of crystals of the N2 type
International Nuclear Information System (INIS)
Tolkachev, A.M.; Manzhelii, V.G.; Azarenkov, V.P.; Jezowski, A.; Kosobutskaya, E.A.
1981-01-01
Linear expansion coefficients of low temperature crystals with linear molecules and Pa3 lattice N 2 (2-21 K), CO(2-28 K), CO 2 (2-25 K), N 2 O(2-90 K) were measured. A version of the law of corresponding states to describe the translational component of the thermal expansion of the substances studied and other low temperature crystals with close-packed lattices is proposed. In the thermal properties of crystals consisting of molecules without inversion centre, we have found anomalies interpreted as the evidence of a partial dipole ordering. (orig.)
Bound states and Cooper pairs of molecules in 2D optical lattices bilayer
Energy Technology Data Exchange (ETDEWEB)
Camacho-Guardian, A.; Dominguez-Castro, G.A.; Paredes, R. [Instituto de Fisica, Universidad Nacional Autonoma de Mexico (Mexico)
2016-08-15
We investigate the formation of Cooper pairs, bound dimers and the dimer-dimer elastic scattering of ultracold dipolar Fermi molecules confined in a 2D optical lattice bilayer configuration. While the energy and their associated bound states are determined in a variational way, the correlated two-molecule pair is addressed as in the original Cooper formulation. We demonstrate that the 2D lattice confinement favors the formation of zero center mass momentum bound states. Regarding the Cooper pairs binding energy, this depends on the molecule populations in each layer. Maximum binding energies occur for non-zero (zero) pair momentum when the Fermi system is polarized (unpolarized). We find an analytic expression for the dimer-dimer effective interaction in the deep BEC regime. The present analysis represents a route for addressing the BCS-BEC crossover in dipolar Fermi gases confined in 2D optical lattices within the current experimental panorama. (copyright 2016 by WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Abbasi, Amirali; Sardroodi, Jaber Jahanbin
2018-04-01
The adsorption of O3 molecule on the undoped and N-doped TiO2/WSe2 nanocomposites was studied using first principles density functional theory calculations. O3 interaction with TiO2/WSe2 nanocomposites is considered so as to investigate WSe2 effects on the adsorption process. WSe2 favors the adsorption of O3 on TiO2 particles. In other words, WSe2 is conducive to the interaction of O3 molecule with fivefold coordinated titanium sites of TiO2. The effects of vdW interactions were taken into account in order to obtain equilibrium geometries of O3 molecules at TiO2/WSe2 interfaces. For all adsorption configurations, the binding site was positioned on the fivefold coordinated titanium atoms. The results show that the interactions between O3 and TiO2 in TiO2/WSe2 nanocomposites are stronger than those between O3 and bare TiO2, suggesting that WSe2 helps to strengthen the interaction of ozone molecule with TiO2 particles. The results also indicate that the adsorption of the O3 molecule on the N-doped TiO2/WSe2 nanocomposite is more energetically favorable than the adsorption of O3 on the pristine one, representing that the N-doped nanocomposites are more sensitive than the undoped ones. Our DFT results clearly show that the N-doped TiO2/WSe2 nanocomposite would be a promising O3 gas sensor. The electronic structure of the adsorption system was also investigated, including analysis of the total and projected density of states, and charge density differences of the TiO2/WSe2 with adsorbed O3 molecules. The charge density difference calculations indicate that the charges were accumulated over the adsorbed O3 molecule. Besides, the N-doped nanocomposites have better sensing response than the pristine ones. This work was devoted to provide the theory basis for the design and development of novel and advanced O3 sensors based on modified TiO2/WSe2 nanocomposites.
Tran, Ngoc Quang; Kang, Bong Kyun; Woo, Moo Hyun; Yoon, Dae Ho
2016-08-23
The effect of the doping configuration and concentration of nitrogen (N) and sulfur (S) on the electrochemical performance of 3 D N and S co-doped hole defect graphene hydrogel (NS-HGH) electrodes is investigated. Surprisingly, by introducing a hole defect on the graphene surface, the difference in the doping concentrations of N and S can be used to effectively modulate the electrochemical behavior of the NS-HGH. The hole defects provide a rapid ion diffusion path. Finally, we showed that the intriguing specific capacitance (536 F g(-1) ) of the NS-HGH could enhance the overall performance of the pseudocapacitance and electric double layer capacitance. The rational design of the NS-HGH-based flexible solid state supercapacitor results in not only outstanding electrochemical performance with a maximum energy density of 14.8 Wh kg(-1) and power density of 5.2 KW kg(-1) but also in extraordinary mechanical flexibility and excellent cycle stability. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bioactivity and immunoactivity of growth hormone during dynamic testing of patients with acromegaly
International Nuclear Information System (INIS)
Baldwin, A.L.; Norman, M.; Butler, J.; Aston, R.; Buchanan, C.
1988-01-01
We have used the Nb2 cell proliferation bioassay for lactogenic hormones to investigate the biological activity of hGH in sera of patients with acromegaly. The specificity of the assay has been improved by the use of monoclonal antibodies to block the activity of individual lactogenic hormones. Disease activity in patients was assessed by scoring signs and symptoms, and by measuring IGF-I concentrations in some patients. Patients with a wide spectrum of disease activity were studied using a TRH test. hGH concentrations were measured by bioassay, RIA and immunoradiometric assay (IRMA) at 0,20 and 60 min after injection of TRH. There was a high degree of correlation between log 10 of all hGH concentrations measured by bioassay and RIA (r = 0.995, P<0.0001), between bioassay and IRMA (r = 0.990, P<0.0001), and between RIA and IRMA (r = 0.995, P<0.0001). In contrast to previous reports, we found no evidence for changes in the bioactivity of hGH secreted after pituitary stimulation. (author)
DEFF Research Database (Denmark)
Sauer, Stephan P. A.; Ul Haq, Inam; Sabin, John R.
2014-01-01
by about 1%. For the two-electron systems He and H2, our CCSD results (for a Lanczos chain length equal to the full excitation space), I0 = 42:28 eV (Helium) and I0 = 19:62 eV (H2), correspond to full conguration interaction results and are therefore the exact, non-relativistic theoretical values......Using an asymmetric-Lanczos-chain algorithm for the calculation of the coupled cluster linear response functions at the CCSD and CC2 levels of approximation, we have calculated the mean excitation energies of the noble gases He, Ne and Ar, and of the hydrogen molecule H2. Convergence with respect...... for the mean excitation energy of these two systems within the Bethe theory for the chosen basis set and, in the case of H2, at the experimental equilibrium geometry....
International Nuclear Information System (INIS)
Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko
2010-01-01
Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C 2 H 2 molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C 2 H 2 molecules. The most stable site for C 2 H 2 on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C 2 H 2 molecule, the barrier height energies for the C atom, C 2 -dimer and CH as well as the C 2 H 2 molecule are estimated using the nudged elastic band method. The barrier height energy for C 2 H 2 is 0.71 eV and this indicates that the C 2 H 2 diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C 2 H 2 on Fe. The first step is the dissociation of C 2 H 2 into C 2 H and H, and the second step is that of C 2 H into C 2 and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C 2 H 2 into C 2 H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C 2 H 2 . The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C 2 H 2 which characterizes the beginning of the formation of the graphene.
Ikeda, Minoru; Yamasaki, Takahiro; Kaneta, Chioko
2010-09-29
Using the projector-augmented plane wave method, we study diffusion and dissociation processes of C(2)H(2) molecules on the ferromagnetic bcc-Fe(110) surface and investigate the formation process of graphene created by C(2)H(2) molecules. The most stable site for C(2)H(2) on the Fe surface is a hollow site and its adsorption energy is - 3.5 eV. In order to study the diffusion process of the C(2)H(2) molecule, the barrier height energies for the C atom, C(2)-dimer and CH as well as the C(2)H(2) molecule are estimated using the nudged elastic band method. The barrier height energy for C(2)H(2) is 0.71 eV and this indicates that the C(2)H(2) diffuses easily on this FM bcc-Fe(110) surface. We further investigate the two step dissociation process of C(2)H(2) on Fe. The first step is the dissociation of C(2)H(2) into C(2)H and H, and the second step is that of C(2)H into C(2) and H. Their dissociation energies are 0.9 and 1.2 eV, respectively. These energies are relatively small compared to the dissociation energy 7.5 eV of C(2)H(2) into C(2)H and H in the vacuum. Thus, the Fe surface shows catalytic effects. We further investigate the initial formation process of graphene by increasing the coverage of C(2)H(2). The formation process of the benzene molecule on the FM bcc(110) surface is also discussed. We find that there exists a critical coverage of C(2)H(2) which characterizes the beginning of the formation of the graphene.
Energy Technology Data Exchange (ETDEWEB)
Nagarajan, V.; Chandiramouli, R., E-mail: rcmoulii@gmail.com
2017-08-15
Highlights: • The adsorption of methanol, ethanol & 1-propanol on MoS{sub 2} nanosheet are studied. • The PDOS & band structure confirms adsorption of alcohol vapors on MoS{sub 2} nanosheet. • The adsorption of 1-propanol vapor on MoS{sub 2} nanosheet is more favorable. • The alcohol molecules adsorption on MoS{sub 2} nanosheet is explored in atomistic level. - Abstract: The electronic and adsorption properties of three different alcohol molecules namely methanol, ethanol and 1-propanol vapors on MoS{sub 2} nanosheet is investigated using DFT method. The structural stability of MoS{sub 2} nanosheet is ascertained with formation energy. The adsorption properties of alcohol molecules on MoS{sub 2} base material is discussed in terms of average energy gap variation, Mulliken charge transfer, energy band gap and adsorption energy. The prominent adsorption sites of methanol, ethanol and 1-propanol vapors on MoS{sub 2} nanosheet are studied in atomistic level. The projected density of states (PDOS) spectrum gives the clear insights on the electronic properties of MoS{sub 2} nanosheet. The PDOS and energy band structure confirmed the adsorption of alcohol vapors on MoS{sub 2} nanosheet. The variation in the band structure and PDOS is noticed upon adsorption of methanol, ethanol and 1-propanol molecules on MoS{sub 2} nanosheet. The PDOS spectrum also reveals the variation in peak maxima owing to transfer of electron between alcohol molecules and MoS{sub 2} base material. The adsorption of 1-propanol vapor on MoS{sub 2} nanosheet is observed to be more favorable than other alcohol molecules. The findings confirm that monolayer MoS{sub 2} nanosheet can be used to detect the presence of alcohol vapors in the environment.
Mineo, Hirobumi; Yamaki, Masahiro; Teranishi, Yoshiaki; Hayashi, Michitoshi; Lin, Sheng Hsien; Fujimura, Yuichi
2012-09-05
Nonplanar chiral aromatic molecules are candidates for use as building blocks of multidimensional switching devices because the π electrons can generate ring currents with a variety of directions. We employed (P)-2,2'-biphenol because four patterns of π-electron rotations along the two phenol rings are possible and theoretically determine how quantum switching of the π-electron rotations can be realized. We found that each rotational pattern can be driven by a coherent excitation of two electronic states under two conditions: one is the symmetry of the electronic states and the other is their relative phase. On the basis of the results of quantum dynamics simulations, we propose a quantum control method for sequential switching among the four rotational patterns that can be performed by using ultrashort overlapped pump and dump pulses with properly selected relative phases and photon polarization directions. The results serve as a theoretical basis for the design of confined ultrafast switching of ring currents of nonplanar molecules and further current-induced magnetic fluxes of more sophisticated systems.
International Nuclear Information System (INIS)
Celiberto, R.; Janev, R.K.; Wadehra, J.M.; Tennyson, J.
2012-01-01
Graphical abstract: Dissociative electron attachment cross sections as a function of the incident electron energy and for the initial vibration levels v i = 0–5, 10 of the H 2 molecule. Highlights: ► We calculated electron–hydrogen dissociative attachment cross sections and rates coefficients. ► Collision processes occurring through a resonant Rydberg state are considered. ► Cross sections and rates were obtained for vibrationally excited hydrogen molecules. ► The cross sections exhibit pronounced oscillatory structures. ► A comparison with the process involving the electron–hydrogen resonant ground state is discussed. - Abstract: Dissociative electron attachment cross sections (DEA) on vibrationally excited H 2 molecule taking place via the 2 Σ g + Rydberg-excited resonant state are studied using the local complex potential (LCP) model for resonant collisions. The cross sections are calculated for all initial vibrational levels (v i = 0–14) of the neutral molecule. In contrast to the previously noted dramatic increase in the DEA cross sections with increasing v i , when the process proceeds via the X 2 Σ u + shape resonance of H 2 , for the 2 Σ g + Rydberg resonance the cross sections increase only gradually up to v i = 3 and then decrease. Moreover, the cross sections for v i ⩾ 6 exhibit pronounced oscillatory structures. A discussion of the origin of the observed behavior of calculated cross sections is given. The DEA rate coefficients for all v i levels are also calculated in the 0.5–1000 eV temperature range.
Photoexcitation circular dichroism in chiral molecules
Beaulieu, S.; Comby, A.; Descamps, D.; Fabre, B.; Garcia, G. A.; Géneaux, R.; Harvey, A. G.; Légaré, F.; Mašín, Z.; Nahon, L.; Ordonez, A. F.; Petit, S.; Pons, B.; Mairesse, Y.; Smirnova, O.; Blanchet, V.
2018-05-01
Chiral effects appear in a wide variety of natural phenomena and are of fundamental importance in science, from particle physics to metamaterials. The standard technique of chiral discrimination—photoabsorption circular dichroism—relies on the magnetic properties of a chiral medium and yields an extremely weak chiral response. Here, we propose and demonstrate an orders of magnitude more sensitive type of circular dichroism in neutral molecules: photoexcitation circular dichroism. This technique does not rely on weak magnetic effects, but takes advantage of the coherent helical motion of bound electrons excited by ultrashort circularly polarized light. It results in an ultrafast chiral response and the efficient excitation of a macroscopic chiral density in an initially isotropic ensemble of randomly oriented chiral molecules. We probe this excitation using linearly polarized laser pulses, without the aid of further chiral interactions. Our time-resolved study of vibronic chiral dynamics opens a way to the efficient initiation, control and monitoring of chiral chemical change in neutral molecules at the level of electrons.
Shepard, A R; Zhang, W; Eberhardt, N L
1994-01-21
We established the cis-acting elements which mediate cAMP responsiveness of the human growth hormone (hGH) gene in transiently transfected rat anterior pituitary tumor GC cells. Analysis of the intact hGH gene or hGH 5'-flanking DNA (5'-FR) coupled to the hGh cDNA or chloramphenicol acetyltransferase or luciferase genes, indicated that cAMP primarily stimulated hGH promoter activity. Cotransfection of a protein kinase A inhibitory protein cDNA demonstrated that the cAMP response was mediated by protein kinase A. Mutational analysis of the hGH promoter identified two core cAMP response element motifs (CGTCA) located at nucleotides -187/-183 (distal cAMP response element; dCRE) and -99/-95 (proximal cAMP response element; pCRE) and a pituitary-specific transcription factor (GHF1/Pit1) binding site at nucleotides -123/-112 (dGHF1) which were required for cAMP responsiveness. GHF1 was not a limiting factor, since overexpression of GHF1 in cotransfections increased basal but not forskolin induction levels. Gel shift analyses indicated that similar, ubiquitous, thermostable protein(s) specifically bound the pCRE and dCRE motifs. The CGTCA motif-binding factors were cAMP response element binding protein (CREB)/activating transcription factor-1 (ATF-1)-related, since the DNA-protein complex was competed by unlabeled CREB consensus oligonucleotide, specifically supershifted by antisera to CREB and ATF-1 but not ATF-2, and was bound by purified CREB with the same relative binding affinity (pCRE < dCRE < CREB) and mobility as the GC nuclear extract. UV cross-linking and Southwestern blot analyses revealed multiple DNA-protein interactions of which approximately 100- and approximately 45-kDa proteins were predominant; the approximately 45-kDa protein may represent CREB. These results indicate that CREB/ATF-1-related factors act coordinately with the cell-specific factor GHF1 to mediate cAMP-dependent regulation of hGH-1 gene transcription in anterior pituitary somatotrophs.
Huels, Michael A.; Bass Andrew, D.; Mirsaleh-Kohan, Nasrin; Sanche, Leon
The question of the origin for the building blocks of life, either synthesized here on earth, or in space [1], has been the subject of much debate, experimental investigation, or astronomical observation, much of it stimulated by the early experiments of Miller [2], and subsequent space radiation related variations thereof [3-5]. And while the precise details of the formation of even the simplest biomolecules that make up life on earth still remain shrouded inmystery, one of the notions that persist throughout the debate is that the building blocks of life, such as amino-acids, or even the cyclic components of RNA and DNA, or other cyclic hydrocarbons (e.g. PHAs), where synthesized via radiolysis [6] either in the earths proto-atmosphere, its early oceans, or in the near interstellar space surrounding the early earth. Here we provide experimental evidence for the hypothesis that interactions of low energy secondary electrons and ions, formed during the radiolysis of matter, with atoms and molecules in the medium, may have played, and may still play an important role in the chemical transformation of astrophysical or planetary surface ices [7], where they lead to the synthesis of more complex chemical species from less complex, naturally occurring components. We report the synthesis and desorption of new chemical species from simple molecular surface ices, containing CH4 / CD4 , C2 D2 , O2 , CO, CO2 , or N2 in various combination mixtures, irradiated by low energy (CO+ (n = 1-3), among others. The formation of all these linear, pre-biotic molecular species, produced here by electron initiated cation-reactions in simple molecular films, suggests that similar mechanisms likely precede the synthesis of life's most basic cyclic molecular components in planetary, or astrophysical surface ices that are continuously subjected to the types of space radiations (UV, X-or -ray, or heavy ions) that can generate such low energy secondary electrons. [Funded by NSERC and Canadian
QSPR Study of the Retention/release Property of Odorant Molecules in Water Using Statistical Methods
Directory of Open Access Journals (Sweden)
Assia Belhassan
2017-10-01
Full Text Available An integrated approach physicochemistry and structures property relationships has been carried out to study the odorant molecules retention/release phenomenon in the water. This study aimed to identify the molecular properties (molecular descriptors that govern this phenomenon assuming that modifying the structure leads automatically to a change in the retention/release property of odorant molecules. ACD/ChemSketch, MarvinSketch, and ChemOffice programs were used to calculate several molecular descriptors of 51 odorant molecules (15 alcohols, 11 aldehydes, 9 ketones and 16 esters. A total of 37 molecules (2/3 of the data set were placed in the training set to build the QSPR models, whereas the remaining, 14 molecules (1/3 of the data set constitute the test set. The best descriptors were selected to establish the quantitative structure property relationship (QSPR of the retention/release property of odorant molecules in water using multiple linear regression (MLR, multiple non-linear regression (MNLR and an artificial neural network (ANN methods. We propose a quantitative model according to these analyses. The models were used to predict the retention/release property of the test set compounds, and agreement between the experimental and predicted values was verified. The descriptors showed by QSPR study are used for study and designing of new compounds. The statistical results indicate that the predicted values are in good agreement with the experimental results. To validate the predictive power of the resulting models, external validation multiple correlation coefficient was calculated and has both in addition to a performant prediction power, a favorable estimation of stability. DOI: http://dx.doi.org/10.17807/orbital.v9i4.978
Precision spectroscopy with ultracold {sup 87}Rb{sub 2} triplet molecules
Energy Technology Data Exchange (ETDEWEB)
Strauss, Christoph
2011-10-19
In this thesis I report precision spectroscopy with ultracold {sup 87}Rb{sub 2} triplet molecules where we use lasers to couple the states in different molecular potentials. We study in detail states of the a {sup 3} sum {sup +}{sub u} and (1) {sup 3} sum {sup +}{sub g} potentials. These states are of great importance for transferring weakly bound molecules to the ro-vibrational triplet ground state via states of the excited potential. As most experiments start from molecules in their X {sup 1} sum {sup +}{sub g} ground state, the triplet states were hard to access via dipole transitions and remained largely unexplored. The measurements presented in this thesis are the first detailed study of diatomic {sup 87}Rb{sub 2} molecules in these states. Our experiments start with an ultracold cloud of {sup 87}Rb atoms. We then load this cloud into an optical lattice where we use a magnetic Feshbach resonance at 1007.4 G to perform a Feshbach association. After we have removed all unbound atoms, we end up with a pure sample of weakly bound Feshbach molecules inside the optical lattice. The optical lattice prevents these molecules from colliding with each other which results in molecular lifetimes on the order of a few hundred milliseconds. In the first set of experiments, we use a laser coupling the Feshbach state to the excited (1) {sup 3} sum {sup +}{sub g} triplet state to map out its low-lying vibrational (v = 0.. 15), rotational, hyperfine, and Zeeman structure. The experimental results are in good agreement with calculations done by Marius Lysebo and Prof. Leif Veseth. We then map out in detail the vibrational, rotational, hyperfine, and Zeeman structure of the a {sup 3} sum {sup +}{sub u} triplet ground state using dark state spectroscopy with levels in the (1) {sup 3} sum {sup +}{sub g} potential as an intermediate state. In this scheme we are able to access molecules in triplet states because our Feshbach state has strong triplet character. Interestingly, it
Precision spectroscopy with ultracold {sup 87}Rb{sub 2} triplet molecules
Energy Technology Data Exchange (ETDEWEB)
Strauss, Christoph
2011-10-19
In this thesis I report precision spectroscopy with ultracold {sup 87}Rb{sub 2} triplet molecules where we use lasers to couple the states in different molecular potentials. We study in detail states of the a {sup 3} sum {sup +}{sub u} and (1) {sup 3} sum {sup +}{sub g} potentials. These states are of great importance for transferring weakly bound molecules to the ro-vibrational triplet ground state via states of the excited potential. As most experiments start from molecules in their X {sup 1} sum {sup +}{sub g} ground state, the triplet states were hard to access via dipole transitions and remained largely unexplored. The measurements presented in this thesis are the first detailed study of diatomic {sup 87}Rb{sub 2} molecules in these states. Our experiments start with an ultracold cloud of {sup 87}Rb atoms. We then load this cloud into an optical lattice where we use a magnetic Feshbach resonance at 1007.4 G to perform a Feshbach association. After we have removed all unbound atoms, we end up with a pure sample of weakly bound Feshbach molecules inside the optical lattice. The optical lattice prevents these molecules from colliding with each other which results in molecular lifetimes on the order of a few hundred milliseconds. In the first set of experiments, we use a laser coupling the Feshbach state to the excited (1) {sup 3} sum {sup +}{sub g} triplet state to map out its low-lying vibrational (v = 0.. 15), rotational, hyperfine, and Zeeman structure. The experimental results are in good agreement with calculations done by Marius Lysebo and Prof. Leif Veseth. We then map out in detail the vibrational, rotational, hyperfine, and Zeeman structure of the a {sup 3} sum {sup +}{sub u} triplet ground state using dark state spectroscopy with levels in the (1) {sup 3} sum {sup +}{sub g} potential as an intermediate state. In this scheme we are able to access molecules in triplet states because our Feshbach state has strong triplet character. Interestingly, it
Directory of Open Access Journals (Sweden)
Scott Oh
2012-09-01
Full Text Available The title compound, C7H4BrNO, crystallizes with two molecules in the asymmetric unit. The two molecules exhibit nearly linear C—C[triple-bond]N nitrile bond angles of 179.1 (4 and 177.1 (4°. In the crystal, the molecules are linked into a one-dimensional hydrogen-bonded chain by interactions between the phenol H atom and the nitrile N atom [N...O = 2.805 (4 and 2.810 (4 Å].
Hypopituitarism following pituitary irradiation for acromegaly
Energy Technology Data Exchange (ETDEWEB)
Aloia, J.F.; Archambeau, J.O.
1978-01-01
Endocrine evaluation is reported in 8 acromegalic patients who received 5500 rad to the pituitary from a linear accelerator. There was a mean decrease in hGH levels of 72%. Plasma testosterone levels were low in 1 of the 6 male patients prior to pituitary irradiation and were below normal in all male patients on the final evaluation (3.1 +- 0.2 SD years postirradiation). Deficiency of TSH secretion developed in 2 patients following irradiation. This rather high incidence of postirradiation partial hypopituitarism was not anticipated and is thought to be related to radiation necrosis of the normal pituitary tissue which surrounds the adenoma.
International Nuclear Information System (INIS)
Portier, M.
2007-12-01
We study the photo-association of an ultracold cloud of magnetically trapped helium atoms: pairs of colliding atoms interact with one or two laser fields to produce a purely long range 4 He 2 (2 3 S 1 -2 3 P 0 ) molecule, or a 4 He 2 (2 3 S 1 -2 3 S 1 ) long range molecule. Light shifts in one photon photo-association spectra are measured and studied as a function of the laser polarization and intensity, and the vibrational state of the excited molecule. They result from the light-induced coupling between the excited molecule, and bound and scattering states of the interaction between two metastable atoms. Their analysis leads to the determination of the scattering length a = (7.2 ± 0.6) ruling collisions between spin polarized atoms. The two photon photo-association spectra show evidence of the production of polarized, long-range 4 He 2 (2 3 S 1 -2 3 S 1 ) molecules. They are said to be exotic as they are made of two metastable atoms, each one carrying a enough energy to ionize the other. The corresponding lineshapes are calculated and decomposed in sums and products of Breit-Wigner and Fano profiles associated to one and two photon processes. The experimental spectra are fit, and an intrinsic lifetime τ = (1.4 ± 0.3) μs is deduced. It is checked whether this lifetime could be limited by spin-dipole induced Penning autoionization. This interpretation requires that there is a quasi-bound state close to the dissociation threshold in the singlet interaction potential between metastable helium atoms for the theory to match the experiment. (author)
International Nuclear Information System (INIS)
Nikonorov, A.P.; Moskvitina, E.N.; Kuzyakov, Yu.Ya.; Stepanov, P.I.
1983-01-01
Luminescence in BCl 3 is investigated. The results of measurements of gas temperature, BCl molecules concentration, and luminescence absolute intensity at boron trichloride presure of 40 mm pH and density of laser pulse energy from 1.7 up to 4.0 J/cm 2 are obtained. Nature of uninterrupted spectrum is considered. It is established that luminescence appearing in the BCl 3 under action of pulse CO 2 -laser is caused by reaction of emitting recombination of BCl molecules with chlorine atoms. Rate constant of this reaction in the range of 2300-3100 K is determined
Deymier, P. A.; Runge, K.
2018-03-01
A Green's function-based numerical method is developed to calculate the phase of scattered elastic waves in a harmonic model of diatomic molecules adsorbed on the (001) surface of a simple cubic crystal. The phase properties of scattered waves depend on the configuration of the molecules. The configurations of adsorbed molecules on the crystal surface such as parallel chain-like arrays coupled via kinks are used to demonstrate not only linear but also non-linear dependency of the phase on the number of kinks along the chains. Non-linear behavior arises for scattered waves with frequencies in the vicinity of a diatomic molecule resonance. In the non-linear regime, the variation in phase with the number of kinks is formulated mathematically as unitary matrix operations leading to an analogy between phase-based elastic unitary operations and quantum gates. The advantage of elastic based unitary operations is that they are easily realizable physically and measurable.
About the correlation between atomic charge fluctuations in a molecule
International Nuclear Information System (INIS)
Pitanga, P.; Giambiagi, M.S. de; Giambiagi, M.
1987-01-01
In this note, the features of the correlation between the electronic charge fluctuations of a pair of atoms within a molecule are analised. Through Schwarz's inequality for random operators in the Hilbert space, the softness of an atom in a molecule is related to its valence and to the softness of the other atoms. It is concluded that in the general case this correlation (from which in turn stems the chemical bond) in non-linear. (author) [pt
An R2 statistic for fixed effects in the linear mixed model.
Edwards, Lloyd J; Muller, Keith E; Wolfinger, Russell D; Qaqish, Bahjat F; Schabenberger, Oliver
2008-12-20
Statisticians most often use the linear mixed model to analyze Gaussian longitudinal data. The value and familiarity of the R(2) statistic in the linear univariate model naturally creates great interest in extending it to the linear mixed model. We define and describe how to compute a model R(2) statistic for the linear mixed model by using only a single model. The proposed R(2) statistic measures multivariate association between the repeated outcomes and the fixed effects in the linear mixed model. The R(2) statistic arises as a 1-1 function of an appropriate F statistic for testing all fixed effects (except typically the intercept) in a full model. The statistic compares the full model with a null model with all fixed effects deleted (except typically the intercept) while retaining exactly the same covariance structure. Furthermore, the R(2) statistic leads immediately to a natural definition of a partial R(2) statistic. A mixed model in which ethnicity gives a very small p-value as a longitudinal predictor of blood pressure (BP) compellingly illustrates the value of the statistic. In sharp contrast to the extreme p-value, a very small R(2) , a measure of statistical and scientific importance, indicates that ethnicity has an almost negligible association with the repeated BP outcomes for the study.
(e, 2e) ionization-excitation experiment with fixed-in-space H2 molecules
International Nuclear Information System (INIS)
Takahashi, M.; Watanabe, N.; Khajuria, Y.; Udagawa, Y.; Eland, J.H.D.
2005-01-01
This report will introduce an electron-electron-fragment ion triple coincidence spectrometer to the readers with our recent collision dynamics study on ionization-excitation processes of the hydrogen molecule. Following a description of the working principle of the spectrometer, results of the study will be discussed; this includes molecular frame (e, 2e) cross sections that have been observed for the first time. (author)
Single-molecule magnet behavior in 2,2’-bipyrimidine-bridged dilanthanide complexes
Directory of Open Access Journals (Sweden)
Wen Yu
2016-01-01
Full Text Available A series of 2,2’-bipyrimidine-bridged dinuclear lanthanide complexes with the general formula [Ln(tmhd3]2bpm (tmhd = 2,2,6,6-tetramethyl-3,5-heptanedionate, bpm = 2,2’-bipyrimidine, Ln = Gd(III, 1; Tb(III, 2; Dy(III, 3; Ho(III, 4 and Er(III, 5 has been synthesized and characterized. Sublimation of [Tb(tmhd3]2bpm onto a Au(111 surface leads to the formation of a homogeneous film with hexagonal pattern, which was studied by scanning tunneling microscopy (STM. The bulk magnetic properties of all complexes have been studied comprehensively. The dynamic magnetic behavior of the Dy(III and Er(III compounds clearly exhibits single molecule magnet (SMM characteristics with an energy barrier of 97 and 25 K, respectively. Moreover, micro-SQUID measurements on single crystals confirm their SMM behavior with the presence of hysteresis loops.
Emision of Cl2* molecules in a barrier discharge
International Nuclear Information System (INIS)
Avdeev, S M; Erofeev, M V; Sosnin, E A; Tarasenko, V F
2008-01-01
The energy and spectral parameters of emission of a barrier discharge in chlorine and its mixtures with inert gases are studied experimentally. The barrier discharge in chlorine was homogeneous at pressures up to ∼9 Torr and its spectrum contained the 3 Π 2g → 3 Π 2u , 3 Π 2g → 3 Σ 2u + and 1 Σ u + → 1 Σ g + bands of Cl 2 * molecules. After the addition of an inert gas, the 257.8-nm 3 Π 2g → 3 Π 2u band made the main contribution to the spectrum. The maximum efficiency and power of the Cl 2 excilamp were obtained for the chlorine-argon mixture and amounted to 0.7% and 1.3 W, respectively. (laser applications and other topics in quantum electronics)
Supersonic molecular beam electric resonance spectroscopy and van der Waals molecules
International Nuclear Information System (INIS)
Luftman, H.S.
1982-09-01
A supersonic molecular beam electric resonance (MBER) spectrometer was built to study the radiofrequency spectra of weakly bound gas phase van der Waals molecules. The instrument and its operating characteristics are described in detail. Sample mass spectra of Ar-ClF gas mixtures are also presented as an illustration of the synthesis of van der Waals molecules. The Stark focusing process for linear polar molecules is discussed and computer-simulated using both second order perturbation and variational methods. Experimental refocusing spectra of OCS and ClF are studied and compared with these trajectory calculations. Though quantitative fitting is poor, there are strong qualitative indicators that the central part of a supersonic beam consists of molecules with a significantly greater population in the lowest energy rotational states than generally assumed. Flop in as opposed to flop out resonance signals for OCS are also numerically predicted and observed. The theoretical properties of the MBER spectrum for linear molecules are elaborated upon with special emphasis on line shape considerations. MBER spectra of OCS and ClF under a variety of conditions are presented and discussed in context to these predictions. There is some uncertainty expressed both in our own modeling and in the manner complex MBER spectra have been analyzed in the past. Finally, an electrostatic potential model is used to quantitatively describe the class of van der Waals molecules Ar-MX, where MX is an alkali halide. Energetics and equilibrium geometries are calculated. The validity of using an electrostatic model to predict van der Waals bond properties is critically discussed
Time resolved high frequency spectrum of Br2 molecules using pulsed photoacoustic technique.
Yehya, Fahem; Chaudhary, A K
2013-11-01
The paper reports the time resolved spectral distribution of higher order acoustic modes generated in Br2 molecules using pulsed Photoacoustic (PA) technique. New time resolved vibrational spectrum of Br2 molecules are recorded using a single 532nm, pulses of 7ns duration at 10Hz repetition rate obtained from Q-switched Nd:YAG laser. Frank-Condon principle based assignments confirms the presence of 12 numbers of (ν″-ν') vibrational transitions covered by a single 532+2nm pulse profile. Inclusions of higher order zeroth modes in Bassel's function expansion series shows the probability of overlapping of different types of acoustic modes in the designed PA cells. These modes appear in the form of clusters which occupies higher frequency range. The study of decay behavior of PA signal with respect to time confirms the photolysis of Br2 at 532nm wavelength. In addition, the shifting and clustering effect of cavity eigen modes in Br2 molecules have been studied between 1 and 10ms time scale. The estimated Q-factor of PA cell (l=16cm, R=1.4cm) is 145±4 at 27kHz frequency. Copyright © 2013 Elsevier B.V. All rights reserved.
Energy Technology Data Exchange (ETDEWEB)
Fernandez, Jorge; MartIn, Fernando [Departamento de Quimica C-9, Universidad Autonoma de Madrid, 28049 Madrid (Spain)], E-mail: fernando.martin@uam.es
2009-04-15
We have evaluated fully differential electron angular distributions in H{sub 2} and D{sub 2} dissociative photoionization by using linearly polarized light of 20, 27 and 33 eV. At 20 eV, the distributions exhibit simple p-wave patterns, which is the signature of direct ionization through the X{sup 2}{sigma}{sub g}{sup +}(1s{sigma}{sub g}) channel. At 27 eV, where the Q{sub 1} autoionizing states are populated, we observe a similar pattern, except when the molecule is oriented perpendicularly to the polarization direction and the energy of the ejected electron is small. In contrast, at 33 eV, autoionization from the Q{sub 1} and Q{sub 2} states leads to interferences between the X{sup 2}{sigma}{sub g}{sup +}(1s{sigma}{sub g}) and {sup 2}{sigma}{sub u}{sup +}(2p{sigma}{sub u}) ionization channels that result in a strong asymmetry of the electron angular distributions along the molecular axis. This asymmetry changes rapidly with the energy of the ejected electron. Electron angular distributions integrated over all possible molecular orientations or ion angular distributions integrated over electron emission angle show no reminiscence of the above phenomena, but the corresponding asymmetry parameters dramatically change with electron and ion energies in the region of autoionizing states.
Laser-induced breakdown spectra of Zn2 molecule in the violet region
Indian Academy of Sciences (India)
The study of excimer and van der Waals molecules such as Hg2, Cd2 and Zn2 are of current interest as they are potential candidates for the possible development of new high power excimer lasers. Group IIB metal dimers (Hg2, Cd2 and Zn2) have essentially repulsive ground states with very shallow van der Walls minima.
Directory of Open Access Journals (Sweden)
Elizabeth M. Horstman
2016-12-01
Full Text Available A new 2:1 co-crystal of piroxicam and gentisic acid [systematic name: 4-hydroxy-1,1-dioxo-N-(pyridin-2-yl-2H-1λ6,2-benzothiazine-3-carboxamide–2-(4-oxido-1,1-dioxo-2H-1λ6,2-benzothiazine-3-amidopyridin-1-ium–2,5-dihydroxybenzoic acid, 2C15H13N3O4S·C7H6O4] has been synthesized using a microfluidic platform and initially identified using Raman spectroscopy. In the co-crystal, one piroxicam molecule is in its neutral form and an intramolecular O—H...O hydrogen bond is observed. The other piroxicam molecule is zwitterionic (proton transfer from the OH group to the pyridine N atom and two intramolecular N—H...O hydrogen bonds occur. The gentisic acid molecule shows whole-molecule disorder over two sets of sites in a 0.809 (2:0.191 (2 ratio. In the crystal, extensive hydrogen bonding between the components forms layers propagating in the ab plane.
Orientation of pentacene molecules on SiO2: From a monolayer to the bulk
International Nuclear Information System (INIS)
Zheng, Fan; Park, Byoung-Nam; Seo, Soonjoo; Evans, Paul G.; Himpsel, F. J.
2007-01-01
Near edge x-ray absorption fine structure (NEXAFS) spectroscopy is used to study the orientation of pentacene molecules within thin films on SiO 2 for thicknesses ranging from monolayers to the bulk (150 nm). The spectra exhibit a strong polarization dependence of the π * orbitals for all films, which indicates that the pentacene molecules are highly oriented. At all film thicknesses the orientation varies with the rate at which pentacene molecules are deposited, with faster rates favoring a thin film phase with different tilt angles and slower rates leading to a more bulklike orientation. Our NEXAFS results extend previous structural observations to the monolayer regime and to lower deposition rates. The NEXAFS results match crystallographic data if a finite distribution of the molecular orientations is included. Damage to the molecules by hot electrons from soft x-ray irradiation eliminates the splitting between nonequivalent π * orbitals, indicating a breakup of the pentacene molecule
Borisenko, V. E.; Krekov, S. A.; Fomenko, M. Yu.; Koll, A.; Lipkovski, P.
2008-06-01
temperature interval are actually linear. Linear regression parameters Y = aT + b (where Y = M(0), M(1), 2( M(2)) 1/2) of free and H-bonded (1:1, with proton acceptors) molecules of 2-aminopyrimidines were determined. Vibrational and electro-optic tasks were solved for free and H-bonded molecules. Valence angles γ(HNH), force constants K(NH), electrooptic parameters ∂ μ/∂ qNH and ∂μ/∂qNH' were determined. Comparative analysis of the influence of methoxy- and nitro-substitution on the amino group spectral characteristics of aniline, 2-aminopyridine and 2-aminopyrimidine in CCl 4 was performed. It was shown that effect of hetero substitution and external substituents in the aromatic ring on spectral characteristics is not additive. Linear correlations were established between spectral, geometrical, force and electro-optical characteristics of the amino group in free and H-bonded (1:1 and 1:2) molecules of substituted 2-aminopyrimidines. Some of these correlations are universal, while most of them are sensitive to the kind, position and number of the substituents in the aromatic ring. During association of 2-aminopyrimidines with dioxane and tetrahydrofourane (1:1 complexes) the charge transfer through the hydrogen bond reveals quite considerable influence on complex formation. The temperature dependence of monomer-complex (1:1) equilibrium constants was studied and following thermodynamical characteristics were determined (using Vant-Hoff equation): enthalpy -Δ H1 and entropy Δ S1. Enthalpy -Δ H2 of 1:2 complexes was determined using the empirical "Intensity rule". It was shown that H-bond strength in 1:1 complexes is higher than in 1:2 complexes. This is also confirmed by the independent calculations of force constants K(NH) in complexes of different composition. The qualitative agreement was stated between experimental results and quantum-mechanical calculations (DFT-B3LYP/6-31G(d,p)) of the amino group spectral characteristics, valence angles γ(HNH) and force
2D non-separable linear canonical transform (2D-NS-LCT) based cryptography
Zhao, Liang; Muniraj, Inbarasan; Healy, John J.; Malallah, Ra'ed; Cui, Xiao-Guang; Ryle, James P.; Sheridan, John T.
2017-05-01
The 2D non-separable linear canonical transform (2D-NS-LCT) can describe a variety of paraxial optical systems. Digital algorithms to numerically evaluate the 2D-NS-LCTs are not only important in modeling the light field propagations but also of interest in various signal processing based applications, for instance optical encryption. Therefore, in this paper, for the first time, a 2D-NS-LCT based optical Double-random- Phase-Encryption (DRPE) system is proposed which offers encrypting information in multiple degrees of freedom. Compared with the traditional systems, i.e. (i) Fourier transform (FT); (ii) Fresnel transform (FST); (iii) Fractional Fourier transform (FRT); and (iv) Linear Canonical transform (LCT), based DRPE systems, the proposed system is more secure and robust as it encrypts the data with more degrees of freedom with an augmented key-space.
Rigatos, Gerasimos G
2016-06-01
It is proven that the model of the p53-mdm2 protein synthesis loop is a differentially flat one and using a diffeomorphism (change of state variables) that is proposed by differential flatness theory it is shown that the protein synthesis model can be transformed into the canonical (Brunovsky) form. This enables the design of a feedback control law that maintains the concentration of the p53 protein at the desirable levels. To estimate the non-measurable elements of the state vector describing the p53-mdm2 system dynamics, the derivative-free non-linear Kalman filter is used. Moreover, to compensate for modelling uncertainties and external disturbances that affect the p53-mdm2 system, the derivative-free non-linear Kalman filter is re-designed as a disturbance observer. The derivative-free non-linear Kalman filter consists of the Kalman filter recursion applied on the linearised equivalent of the protein synthesis model together with an inverse transformation based on differential flatness theory that enables to retrieve estimates for the state variables of the initial non-linear model. The proposed non-linear feedback control and perturbations compensation method for the p53-mdm2 system can result in more efficient chemotherapy schemes where the infusion of medication will be better administered.
Intercalation of organic molecules into SnS{sub 2} single crystals
Energy Technology Data Exchange (ETDEWEB)
Toh, M.L.; Tan, K.J.; Wei, F.X.; Zhang, K.K.; Jiang, H. [School of Materials Science and Engineering, Nanyang Technological University, 50 Nanyang Ave., Singapore 639798 (Singapore); Kloc, C., E-mail: ckloc@ntu.edu.sg [School of Materials Science and Engineering, Nanyang Technological University, 50 Nanyang Ave., Singapore 639798 (Singapore)
2013-02-15
SnS{sub 2} is a layered semiconductor with a van der Waals gap separating the covalently bonded layers. In this study, post-synthesis intercalation of donor organic amine molecules, such as ethylenediamine (en), into tin disulfide and secondary intercalation of p-phenylenediamine (PPD) and 1, 5-naphthalenediamine (NDA) into SnS{sub 2e}n have been verified with X-ray diffraction. PPD and NDA did not intercalate directly even during prolonged annealing but replaced en readily if en was already present in the van der Waals gap. The c-lattice dilation is proportional to the intercalant size. Unit cell lattices of intercalated products were determined from the positions of the X-ray diffraction peaks. Optical images taken during the intercalation showed that intercalation progressed from the periphery towards the interior of the crystal. TEM diffraction patterns in the [0 0 1] direction of SnS{sub 2} after intercalation revealed defects and stacking mismatches among the SnS{sub 2} layers caused by the intercalation. UV-Vis absorption studies showed a red shift in the band edge of the SnS{sub 2} material after intercalation. The band edge was 2.2 eV for pristine SnS{sub 2}; after intercalation with en or PPD, the absorbance spectra band edges shifted to approximately 0.7 eV or 0.5 eV, respectively. - Graphical Abstract: SnS{sub 2} single crystals were intercalated with organic amine molecules such as ethylenediamine, phenylenediamine and naphthalenediamine. Absorption studies showed red shift of band edge after intercalation, which was consistent with optical observations. X-ray diffraction indicated lattice dilation in the c-lattice of SnS{sub 2} after intercalation. Highlights: Black-Right-Pointing-Pointer Organic molecules intercalated inhomogenously between covalently bonded SnS{sub 2} layers. Black-Right-Pointing-Pointer Ethylenediamine (en) intercalate directly into SnS{sub 2}. Black-Right-Pointing-Pointer Phenylenediamine (PPD) and naphthalenediamine (NDA) can be
Petrov, E.G.; Marchenko, A.; Kapitanchuk, O.; Katsonis, Nathalie Hélène; Fichou, D.
2014-01-01
The conductance properties of 1,3-(trimethylsilyl)-1-tridecene-6,12-diyne, a non-conjugated trimethylsil-acetylene molecule have been investigated both experimentally and theoretically. Based on scanning tunnelling spectroscopy experiments, a discussion on the mechanisms controlling the charge
Single-Molecule Imaging Reveals Topology Dependent Mutual Relaxation of Polymer Chains
Abadi, Maram; Serag, Maged F.; Habuchi, Satoshi
2015-01-01
The motion and relaxation of linear and cyclic polymers under entangled conditions are investigated by means of a newly developed single-molecule tracking technique, cumulative-area (CA) tracking. CA tracking enables simultaneous quantitative characterization of the diffusion mode, diffusion rate, and relaxation time that have been impossible with a widely used conventional single-molecule localization and tracking method, by analyzing cumulative areas occupied by the moving molecule. Using the novel approach, we investigate the motion and relaxation of entangled cyclic polymers, which have been an important but poorly understood question. Fluorescently labeled 42 kbp linear or cyclic tracer dsDNAs in concentrated solutions of unlabeled linear or cyclic DNAs are used as model systems. We show that CA tracking can explicitly distinguish topology-dependent diffusion mode, rate, and relaxation time, demonstrating that the method provides an invaluable tool for characterizing topological interaction between the entangled chains. We further demonstrate that the current models proposed for the entanglement between cyclic polymers which are based on cyclic chains moving through an array of fixed obstacles cannot correctly describe the motion of the cyclic chain under the entangled conditions. Our results rather suggest the mutual relaxation of the cyclic chains, which underscore the necessity of developing a new model to describe the motion of cyclic polymer under the entangled conditions based on the mutual interaction of the chains.
Single-Molecule Imaging Reveals Topology Dependent Mutual Relaxation of Polymer Chains
Abadi, Maram
2015-08-24
The motion and relaxation of linear and cyclic polymers under entangled conditions are investigated by means of a newly developed single-molecule tracking technique, cumulative-area (CA) tracking. CA tracking enables simultaneous quantitative characterization of the diffusion mode, diffusion rate, and relaxation time that have been impossible with a widely used conventional single-molecule localization and tracking method, by analyzing cumulative areas occupied by the moving molecule. Using the novel approach, we investigate the motion and relaxation of entangled cyclic polymers, which have been an important but poorly understood question. Fluorescently labeled 42 kbp linear or cyclic tracer dsDNAs in concentrated solutions of unlabeled linear or cyclic DNAs are used as model systems. We show that CA tracking can explicitly distinguish topology-dependent diffusion mode, rate, and relaxation time, demonstrating that the method provides an invaluable tool for characterizing topological interaction between the entangled chains. We further demonstrate that the current models proposed for the entanglement between cyclic polymers which are based on cyclic chains moving through an array of fixed obstacles cannot correctly describe the motion of the cyclic chain under the entangled conditions. Our results rather suggest the mutual relaxation of the cyclic chains, which underscore the necessity of developing a new model to describe the motion of cyclic polymer under the entangled conditions based on the mutual interaction of the chains.
Problems in the radioimmunological determination of growth hormones
International Nuclear Information System (INIS)
Gottsmann, M.
1973-01-01
Four radioimmunological methods for the determination of serum HGH are compared with regard to sensitivity, precision, and specifity: the double-antibody method, the salt precipitation method, the coated-charcoal absorption method, and the solid phase method. The effects of serum proteins, complement fractions, haemolysis, and serum dilution on these methods are investigated. Furthermore, two HGH antibody preparations are investigated with regard to their cross reactions with LH, TSH, HCS, BPr, and HPr. In the HGH and HCS double-antibody systems, the serum dilution does not influence the test. In normal persons, no difference can be found between the serum HGH level of the cranial bulb of the jugular vein and that of a cubital vein, while patients with acromegaly exhibit a marked difference. In one patient who suffers from a Forbes-Albright syndrome with a prolactin-secreting tumour of the pituitary gland, the secretion of LH and HGH is reduced while the ACTH and TSH secretion is not affected. (BSC/AK) [de
Directory of Open Access Journals (Sweden)
JASMINA B. NIKOLIC
2007-12-01
Full Text Available The rate constants for the reaction of 2-substituted cyclohex-1-enylcarboxylic acids and the corresponding 2-substituted benzoic acids with diazodiphenyl methane were determined in various aprotic solvents at 30 ºC. In order to explain the kinetic results through solvent effects, the second order rate constants of the reaction of the examined acids were correlated using the Kamlet–Taft solvatechromic equation. The correlations of the kinetic data were carried out by means of multiple linear regression analysis and the solvent effects on the reaction rates were analyzed in terms of the contributions of the initial and transition state. The signs of the equation coefficients support the proposed reaction mechanism. The quantitative relationship between the molecular structure and the chemical reactivity is discussed, as well as the effect of geometry on the reactivity of the examined molecules.
International Nuclear Information System (INIS)
Leite, J.R.; Fazzio, A.; Lima, M.A.P.; Dias, A.M.; Rosato, A.; Segre, E.R.A.
1980-12-01
A self-consistent calculation based on the Variational Cellular Method is performed on the F 2 and Ne 2 molecules. The potential curve for the group state and for excited states of these molecules are determined. Spectroscopic constants related to the potential curves are also obtained. (Author) [pt
Energy Technology Data Exchange (ETDEWEB)
Scaglia, Barbara, E-mail: barbara.scaglia@unimi.it [Gruppo Ricicla Labs – DiSAA, Università degli Studi di Milano, Via Celoria 2 (Italy); Nunes, Ramom Rachide; Rezende, Maria Olímpia Oliveira [Laboratório de Química Ambiental, Universidade de São Paulo, Instituto de Química de São Carlos, Avenida Trabalhador São Carlense, 400, São Carlos (Brazil); Tambone, Fulvia [Gruppo Ricicla Labs – DiSAA, Università degli Studi di Milano, Via Celoria 2 (Italy); Adani, Fabrizio, E-mail: fabrizio.adani@unimi.it [Gruppo Ricicla Labs – DiSAA, Università degli Studi di Milano, Via Celoria 2 (Italy)
2016-08-15
This work studied the auxin-like activity of humic acids (HA) obtained from vermicomposts produced using leather wastes plus cattle dung at different maturation stages (fresh, stable and mature). Bioassays were performed by testing HA concentrations in the range of 100–6000 mg carbon L{sup −1}. {sup 13}C CPMAS-NMR and GC–MS instrumental methods were used to assess the effect of biological processes and starting organic mixtures on HA composition. Not all HAs showed IAA-like activity and in general, IAA-like activity increased with the length of the vermicomposting process. The presence of leather wastes was not necessary to produce the auxin-like activity of HA, since HA extracted from a mix of cattle manure and sawdust, where no leather waste was added, showed IAA-like activity as well. CPMAS {sup 13}CNMR revealed that HAs were similar independently of the mix used and that the humification process involved the increasing concentration of pre-existing alkali soluble fractions in the biomass. GC/MS allowed the identification of the molecules involved in IAA-like effects: carboxylic acids and amino acids. The concentration of active molecules, rather than their simple presence in HA, determined the bio-stimulating effect, and a good linear regression between auxin-like activity and active stimulating molecules concentration was found (R{sup 2} = − 0.85; p < 0.01, n = 6). - Highlights: • Vermicomposting converts waste into organic fertilizer. • Vermicomposts can have biostimulating effect for the presence of hormone-like molecules. • Auxine-like activity was associated to the vermicompost humic acid fraction (HA). • HA carboxylic acids and amino acids, were reported to act as auxin-like molecules. • A linear regression was found between molecules and auxin-like activity.
DEFF Research Database (Denmark)
Halberg, Kenneth Agerlin; Rainey, Stephanie M.; Veland, Iben Rønn
2016-01-01
Multicellular organisms rely on cell adhesion molecules to coordinate cell-cell interactions, and to provide navigational cues during tissue formation. In Drosophila, Fasciclin 2 (Fas2) has been intensively studied due to its role in nervous system development and maintenance; yet, Fas2 is most...... role for this well-known cell adhesion molecule, and propose that Fas2-mediated intermicrovillar homophilic adhesion complexes help stabilize the brush border....
Large linear magnetoresistance and magnetothermopower in layered SrZnSb$_2$
Wang, Kefeng; Petrovic, C.
2016-01-01
We report the large linear magnetoresistance ($\\sim 300\\%$ in 9 T field at 2 K) and magnetothermopower in layered SrZnSb$_2$ crystal with quasi-two-dimensional Sb layers. A crossover from the semiclassical parabolic field dependent magnetoresistance to linear field dependent magnetoresistance with increasing magnetic field is observed. The magnetoresistance behavior can be described very well by combining the semiclassical cyclotron contribution and the quantum limit magnetoresistance. Magnet...
Theoretical study of the interaction of N2 with water molecules. (H2O)/sub n/:N2, n = 1--8
International Nuclear Information System (INIS)
Curtiss, L.A.; Eisgruber, C.L.
1984-01-01
Ab initio molecular orbital calculations including correlation energy have been carried out on the interaction of a single H 2 O molecule with N 2 . The potential energy surface for H 2 O:N 2 is found to have a minimum corresponding to a HOH xxx N 2 structure with a weak ( -1 ) hydrogen bond. A second, less stable, configuration corresponding to a H 2 O xxx N 2 structure with N 2 bonded side on to the oxygen of H 2 O was found to be either a minimum or a saddle point in the potential energy surface depending on the level of calculation. The minimal STO-3G basis set was used to investigate the interaction of up to eight H 2 O molecules with N 2 . Two types of clusters, one containing only HOH xxx N 2 interactions and the other containing both HOH xxxN 2 and H 2 O xxx N 2 interactions, were investigated for [N 2 :(H 2 O)/sub n/, n = 2--8
Andrade, Carolina D.; Yanez, Ciceron O.; Rodriguez, Luis; Belfield, Kevin D.
2010-01-01
The synthesis, structural, and photophysical characterization of a series of new fluorescent donor–acceptor and acceptor-acceptor molecules, based on the fluorenyl ring system, with two-photon absorbing properties is described. These new compounds exhibited large Stokes shifts, high fluorescent quantum yields, and, significantly, high two-photon absorption cross sections, making them well suited for two-photon fluorescence microscopy (2PFM) imaging. Confocal and two-photon fluorescence microscopy imaging of COS-7 and HCT 116 cells incubated with probe I showed endosomal selectivity, demonstrating the potential of this class of fluorescent probes in multiphoton fluorescence microscopy. PMID:20481596
Controlling the branching ratio of photodissociation using aligned molecules
DEFF Research Database (Denmark)
Larsen, J.J.; Wendt-Larsen, I.; Stapelfeldt, H.
1999-01-01
Using a sample of iodine molecules, aligned by a strong, linearly polarized laser pulse, we control the branching ratio of the I+I and I+I* photodissociation channels by a factor of 26. The control relies on selective photoexcitation of two potential curves that each correlate adiabatically...
Goodwin, C J; Holt, S J; Downes, S; Marshall, N J
1996-01-01
We contrast the effects of three intermediate electron acceptors (IEAs) on the highly quantitative ESTA bioassay for human growth hormone. This is a microculture tetrazolium assay based upon the in vitro reduction of the tetrazolium salt MTT, by Nb2 cells which have been activated with hGH. Each of the IEAs influenced MTT-formazan production in a distinctive manner. The two quinonoids, namely menadione and co-enzyme Q0 markedly increased the MTT-formazan produced by hormone activated Nb2 cells and thereby amplified the response of our bioassay for human growth hormone (hGH). The exceptionally low bioassay baseline which is characteristic of the unstimulated Nb2 cells when only MTT is added was retained in the presence of CoQ0, but was greatly increased by menadione. Phenazine methosulphate, which is the most widely used redox intermediary in microculture tetrazolium assays, also increased the baseline, but had only a minimal additional effect on MTT reduction by activated Nb2 cells. We conclude that CoQ0 is the preferred IEA for this ESTA bioassay for hGH.
GROWTH HORMONE TREATMENT OF CHILDREN WITH SHORT STATURE LIVED IN SAMARA REGION
Directory of Open Access Journals (Sweden)
E.G. Mikhailova
2009-01-01
Full Text Available Growth inhibition in children is heterogeneous state, and it may accompany many endocrine, somatic, genetic and chromosome diseases. Generally recognized medications for treatment of somatotropic insufficiency in present times are biosynthetic analogs of human growth hormone (hGH, obtained with DNA-recombinant technology. This article presents the results of estimation of effectiveness of hGH in treatment of children with short stature (n=77 with isolated deficiency of growth hormone, panhypopituitarism, Turner's syndrome, treated with hGH during 3 years. All patients had significant positive dynamics of clinical status, the velocity of grouth increased from 1.9 cm (initial per year to 11.0 cm (the end of first year, with following decrease to 5.3 cm per year. SDS index of growth had stable tendency to increase: medium SDS index of growth initially was -3.9 SD, on the end of third year – -2.0 SD. It was shown, that treatment with hGH is effective in any types of short stature.Key words: children, short stature, treatment, human growth hormone.(Voprosy sovremennoi pediatrii — Current Pediatrics. 2009;8(1:108-113
Stability of matter-antimatter molecules
International Nuclear Information System (INIS)
Wong, Cheuk-Yin; Lee, Teck-Ghee
2011-01-01
Highlights: → We examine stability of matter-antimatter molecules with four constituents. → The binding of matter-antimatter molecules is a common phenomenon. → Molecules have bound states if ratio of constituent masses greater than ∼4. → We evaluate molecular binding energies and annihilation lifetimes. - Abstract: We examine the stability of matter-antimatter molecules by reducing the four-body problem into a simpler two-body problem with residual interactions. We find that matter-antimatter molecules with constituents (m 1 + ,m 2 - ,m-bar 2 + ,m-bar 1 - ) possess bound states if their constituent mass ratio m 1 /m 2 is greater than about 4. This stability condition suggests that the binding of matter-antimatter molecules is a rather common phenomenon. We evaluate the binding energies and eigenstates of matter-antimatter molecules (μ + e - )-(e + μ - ),(π + e - )-(e + π - ),(K + e - )-(e + K - ),(pe - )-(e + p-bar),(pμ - )-(μ + p-bar), and (K + μ - ) - (μ + K - ), which satisfy the stability condition. We estimate the molecular annihilation lifetimes in their s states.
Path-integral approach to resonant electron-molecule scattering
International Nuclear Information System (INIS)
Winterstetter, M.; Domcke, W.
1993-01-01
A path-integral formulation of resonant electron-molecule scattering is developed within the framework of the projection-operator formalism of scattering theory. The formation and decay of resonances is treated in real time as a quantum-mechanical electronic-tunneling process, modified by the coupling of the electronic motion with the nuclear degrees of freedom. It is shown that the electronic continuum can be summed over in the path-integral formulation, resulting formally in the path integral for an effective two-state system with coupling to vibrations. The harmonic-oscillator approximation is adopted for the vibrational motion in the present work. Approximation methods are introduced which render the numerical evaluation of the sum over paths feasible for up to ∼10 3 elementary time slices. The theory is numerically realized for simple but nontrivial models representing the 2 Π g d-wave shape resonance in e - +N 2 collisions and the 2 Σ u + p-wave shape resonance in e - +H 2 collisions, respectively. The accuracy of the path-integral results is assessed by comparison with exact numerical reference data for these models. The essential virtue of the path-integral approach is the fact that the computational effort scales at most linearly with the number of vibrational degrees of freedom. The path-integral method is thus well suited to treat electron collisions with polyatomic molecules and molecular aggregates
Laron, Zvi
2012-08-01
Constitutional tall stature can be anticipated from neonatal length (1) and measurement at age 4 and 8 years (2). Mainly of genetic origin (3) it has been shown that tall children and parents have high normal or higher than normal serum hGH and/or IGF-I levels. (4-6). Also in a healthy adult population a significant (pgigantism" due to excessive GHR-H or hGH secretion (8, 9) and other pathological conditions leading to tall stature (3).
Abbasi, Amirali; Sardroodi, Jaber Jahanbin
2018-06-01
Based on the density functional theory (DFT) calculations, we explored the sensing capabilities and electronic structures of TiO2/Stanene heterostructures as novel and highly efficient materials for detection of toxic NO2 and O3 molecules in the environment. Studied gas molecules were positioned at different sites and orientations towards the nanocomposite, and the adsorption process was examined based on the most stable structures. We found that both of these molecules are chemically adsorbed on the TiO2/Stanene heterostructures. The calculations of the adsorption energy indicate that the fivefold coordinated titanium sites of the TiO2/Stanene are the most stable sites for the adsorption of NO2 and O3 molecules. The side oxygen atoms of the gas molecules were found to be chemically bonded to these titanium atoms. The adsorption of gas molecules is an exothermic process, and the adsorption on the pristine nanocomposite is more favorable in energy than that on the nitrogen-doped nanocomposite. The effects of van der Waals interactions were taken into account, which indicate the adsorption energies were increased for the most sable configurations. The gas sensing response and charge transfers were analyzed in detail. The pristine nanocomposites have better sensing response than the doped ones. The spin density distribution plots indicate that the magnetization was mainly located over the adsorbed gas molecules. Mulliken charge analysis reveals that both NO2 and O3 molecules behave as charge acceptors, as evidenced by the accumulation of electronic charges on the adsorbed molecules predicted by charge density difference calculations. Our DFT results provide a theoretical basis for an innovative gas sensor system designed from a sensitive TiO2/Stanene heterostructures for efficient detection of harmful air pollutants such as NO2 and O3.
Detection of GH abuse in sport: Past, present and future.
Barroso, Osquel; Schamasch, Patrick; Rabin, Olivier
2009-08-01
Due to its considered performance enhancing effects, human growth hormone (hGH) is abused as a doping agent in sport. Its misuse also carries potentially serious side effects to a person's health. Consequently, hGH and its releasing factors are prohibited in sport, as established in the Prohibited List which is updated and published yearly by the World Anti-Doping Agency (WADA). In order to fight the menace that hGH doping poses to the spirit of sport and to the health of athletes, the sport movement and the anti-doping authorities, initially led by the International Olympic Committee (IOC) and later by WADA, have put substantial efforts into developing tests for its detection. Currently, a primary analytical approach, the isoform differential immunoassay, has been implemented in WADA-accredited laboratories. In parallel, a second, indirect approach for the detection of hGH abuse, based on the quantification of hGH-associated biological markers, has been developed. The final aim is to combine both methodologies to improve the sensitivity and expand the time window to detect doping with hGH. In addition, novel analytical procedures, based on proteomic and genomic technologies as well as the use of mass spectrometry-based methods of detection, are being investigated for future application in hGH anti-doping tests.
Energy Technology Data Exchange (ETDEWEB)
Horstman, Elizabeth M.; Bertke, Jeffery A.; Woods, Toby J.; Kenis, Paul J. A.
2016-11-04
A new 2:1 co-crystal of piroxicam and gentisic acid [systematic name: 4-hydroxy-1,1-dioxo-
International Nuclear Information System (INIS)
Zhao, X.; Soletsky, P.A.; Bryan, W.H.; Dunning, F.B.; Walters, G.K.
1993-01-01
The rate coefficients for mixing between He(2 3 P J, MJ) levels during collisions with ground-state helium atoms and for conversion of He(2 3 P J ) atoms to He 2 (b 3 Π g ) molecules via three-body reactions in helium gas have been investigated over the temperature range 1.6--300 K. The measured rate coefficients for collisionally induced P-state mixing decrease slowly with decreasing temperature, from (1.8±0.5)x10 -9 cm 3 s -1 at 300 K to (4.5±0.5)x10 -10 cm 3 s -1 at 4.2 K. The rate coefficients for the production of He 2 (b 3 Π g ) molecules via three-body reactions are observed to increase with decreasing temperature and are described by the relation k P congruent(2.5+267T -1 )x10 -32 cm 6 s -1 . This behavior, which is very different from that noted in earlier studies of the conversion of He(2 3 S 1 ) atoms to He 2 (a 3 Σ u + ) molecules through three-body reactions, suggests that the reaction is not thermally activated
Experimental study on pion capture by hydrogen bound in molecules
International Nuclear Information System (INIS)
Horvath, D.; Aniol, K.A.; Entezami, F.; Measday, D.F.; Noble, A.J.; Stanislaus, S.; Virtue, C.J.
1988-08-01
An experiment was performed at TRIUMF to study the formation of pionic hydrogen atoms and molecules in solids, particularly in groups of organic molecules of slightly different structure in order to help further clarify the problem. The nuclear capture of pions by hydrogen was measured using the charge exchange of stopped pions. The coincident photons emitted by the decaying π 0 mesons were detected by TRIUMF's two large NaI spectrometers. New experimental results were obtained for the capture probability of stopped π - mesons in the nuclei of hydrogen atoms, chemically bound in molecules of some simple hydrides, acid anhydrides, and sugar isomers. A linear relation was found between pion capture in hydrogen and melting point in sugar isomers. The pion capture probability in acid anhydrides is fairly well described by a simple atomic capture model in which the capture probability on the hydrogen dramatically increases as the hydrogen atom is separated from the strongly electronegative C 2 O 3 group. Both effects are consistent with a correlation between pion capture and electron density on hydrogen atoms. (Author) (38 refs., 4 tabs., 7 figs.)
Atoms, molecules and optical physics 2. Molecules and photons - Spectroscopy and collisions
Energy Technology Data Exchange (ETDEWEB)
Hertel, Ingolf V.; Schulz, Claus-Peter [Max-Born-Institut fuer Nichtlineare Optik und Kurzzeitspektroskopie im Forschungsverbund Berlin e.V. (Germany)
2015-09-01
This is the second volume of textbooks on atomic, molecular and optical physics, aiming at a comprehensive presentation of this highly productive branch of modern physics as an indispensable basis for many areas in physics and chemistry as well as in state of the art bio- and material-sciences. It primarily addresses advanced students (including PhD students), but in a number of selected subject areas the reader is lead up to the frontiers of present research. Thus even the active scientist is addressed. This volume 2 introduces lasers and quantum optics, while the main focus is on the structure of molecules and their spectroscopy, as well as on collision physics as the continuum counterpart to bound molecular states. The emphasis is always on the experiment and its interpretation, while the necessary theory is introduced from this perspective in a compact and occasionally somewhat heuristic manner, easy to follow even for beginners.
Fragmentation of small molecules induced by 46 keV/amu N+ and N2+ projectiles
International Nuclear Information System (INIS)
Kovacs, S.T.S.; Juhasz, Z.; Herczku, P.; Sulik, B.
2012-01-01
Complete text of publication follows. Collisional molecule fragmentation experiments has gain increasing attention in several research and applied fields. In order to understand the fundamental processes of molecule fragmentation one has to start with collisions of small few-atomic molecules. Moreover, fragments of small molecules such as water can cause damages of large molecules (DNA) very effectively in living tissues. In the last few years a new experimental setup was developed at Atomki. It was designed especially for molecule fragmentation experiments. Now the measurements using this system are running routinely. In 2012 the studied targets were water vapor, methane and nitrogen gases, injected into the collision area by an effusive molecular gas jet system. 650 keV N + and 1,3 MeV N 2 + ions were used as projectiles produced by the VdG-5 electrostatic accelerator. The velocity of the two types of projectiles was the same. Energy and angular distribution of the produced fragments was measured by an energy dispersive electrostatic spectrometer. For atomic ionization a symmetric, diatomic molecular projectile (e.g. N 2 + ) yields about twice more electrons compared to those of singly charged ion projectiles of the same atom (N + ) at the same velocity. In such cases the two atomic centers in the molecular ion can be considered as two individual atomic centers. For the fragmentation of molecular targets the picture is not so simple because in this case close collision of two extended systems is investigated. As figure 1 and 2 show, the measured yields for molecular projectile is not simply twice of the ones for atomic projectile. The shape of the energy spectra are different. The measured data are under evaluation. Acknowledgements. This work was supported by the Hungarian National Science Foundation OTKA (Grant: K73703) and by the TAMOP-4.2.2/B-10/1-2010-0024 project. The project is cofinanced by the European Union and the European Social Fund.
H∞ /H2 model reduction through dilated linear matrix inequalities
DEFF Research Database (Denmark)
Adegas, Fabiano Daher; Stoustrup, Jakob
2012-01-01
This paper presents sufficient dilated linear matrix inequalities (LMI) conditions to the $H_{infty}$ and $H_{2}$ model reduction problem. A special structure of the auxiliary (slack) variables allows the original model of order $n$ to be reduced to an order $r=n/s$ where $n,r,s in field{N}$. Arb......This paper presents sufficient dilated linear matrix inequalities (LMI) conditions to the $H_{infty}$ and $H_{2}$ model reduction problem. A special structure of the auxiliary (slack) variables allows the original model of order $n$ to be reduced to an order $r=n/s$ where $n,r,s in field...
Control of Biofilms with the Fatty Acid Signaling Molecule cis-2-Decenoic Acid
Directory of Open Access Journals (Sweden)
Cláudia N. H. Marques
2015-11-01
Full Text Available Biofilms are complex communities of microorganisms in organized structures attached to surfaces. Importantly, biofilms are a major cause of bacterial infections in humans, and remain one of the most significant challenges to modern medical practice. Unfortunately, conventional therapies have shown to be inadequate in the treatment of most chronic biofilm infections based on the extraordinary innate tolerance of biofilms to antibiotics. Antagonists of quorum sensing signaling molecules have been used as means to control biofilms. QS and other cell-cell communication molecules are able to revert biofilm tolerance, prevent biofilm formation and disrupt fully developed biofilms, albeit with restricted effectiveness. Recently however, it has been demonstrated that Pseudomonas aeruginosa produces a small messenger molecule cis-2-decenoic acid (cis-DA that shows significant promise as an effective adjunctive to antimicrobial treatment of biofilms. This molecule is responsible for induction of the native biofilm dispersion response in a range of Gram-negative and Gram-positive bacteria and in yeast, and has been shown to reverse persistence, increase microbial metabolic activity and significantly enhance the cidal effects of conventional antimicrobial agents. In this manuscript, the use of cis-2-decenoic acid as a novel agent for biofilm control is discussed. Stimulating the biofilm dispersion response as a novel antimicrobial strategy holds significant promise for enhanced treatment of infections and in the prevention of biofilm formation.
Effect of dipole polarizability on positron binding by strongly polar molecules
International Nuclear Information System (INIS)
Gribakin, G F; Swann, A R
2015-01-01
A model for positron binding to polar molecules is considered by combining the dipole potential outside the molecule with a strongly repulsive core of a given radius. Using existing experimental data on binding energies leads to unphysically small core radii for all of the molecules studied. This suggests that electron–positron correlations neglected in the simple model play a large role in determining the binding energy. We account for these by including the polarization potential via perturbation theory and non-perturbatively. The perturbative model makes reliable predictions of binding energies for a range of polar organic molecules and hydrogen cyanide. The model also agrees with the linear dependence of the binding energies on the polarizability inferred from the experimental data (Danielson et al 2009 J. Phys. B: At. Mol. Opt. Phys. 42 235203). The effective core radii, however, remain unphysically small for most molecules. Treating molecular polarization non-perturbatively leads to physically meaningful core radii for all of the molecules studied and enables even more accurate predictions of binding energies to be made for nearly all of the molecules considered. (paper)
International Nuclear Information System (INIS)
Machado, F.B.C.; Ornellas, F.R.
1988-10-01
An accurate potential energy curve for the BeF molecule in the X 2 Σ + state is calculated within the MRSDCI approach. Vibrational level spacings and the dissociation energy are reported. Agreement with the available experimental spacings is 15 cm -1 on the average. The theoretically computed D o , 5.92 eV, favors the experimental value of 5.85 eV over the higher value of 6.26 eV. Arguments are also presented that show why the value obtained by the Birge-Sponer linear extrapolation is accidentally a good one. (author) [pt
Sun, Kai; Li, Shunyao; Waigi, Michael Gatheru; Huang, Qingguo
2018-05-01
It has been shown that manganese dioxide (MnO 2 ) can mediate transformation of phenolic contaminants to form phenoxyl radical intermediates, and subsequently, these intermediates intercouple to form oligomers via covalent binding. However, the reaction kinetics and transformation mechanisms of phenolic contaminants with humic molecules present in nano-MnO 2 -mediated systems were still unclear. In this study, it was proven that nano-MnO 2 were effective in transforming triclosan under acidic conditions (pH 3.5-5.0) during manganese reduction, and the apparent pseudo first-order kinetics rate constants (k = 0.0599-1.5314 h -1 ) increased as the pH decreased. In particular, the transformation of triclosan by nano-MnO 2 was enhanced in the presence of low-concentration humic acid (1-10 mg L -1 ). The variation in the absorption of humic molecules at 275 nm supported possible covalent binding between humic molecules and triclosan in the nano-MnO 2 -mediated systems. A total of four main intermediate products were identified by high-resolution mass spectrometry (HRMS), regardless of humic molecules present in the systems or not. These products correspond to a suite of radical intercoupling reactions (dimers and trimers), ether cleavage (2,4-dichlorophenol), and oxidation to quinone-like products, triggered by electron transfer from triclosan molecules to nano-MnO 2 . A possible reaction pathway in humic acid solutions, including homo-coupling, decomposition, oxidation, and cross-coupling, was proposed. Our findings provide valuable information regarding the environmental fate and transformation mechanism of triclosan by nano-MnO 2 in complex water matrices.
Radioimmunoassay of human growth hormone and its application in pituitary dysfunction studies
International Nuclear Information System (INIS)
Asolkar, S.V.; Sivaprasad, N.; Shah, K.B.; Mani, R.S.; Deshpande, A.
1981-01-01
A simple, specific and sensitive Radioimmunoassay (RIA) has been developed for the measurement of Human Growth Hormone (HGH) in serum samples. 123 I-labelled HGH has been used as a tracer and dextran coated charcoal system has been employed to separate antibody bound hormone from the unbound one. The assay offers sensitivity of 0.16 ng/ml with a reproducibility of 7% intraassay and inter-assay variations. Serum HGH levels were measured at fasting-resting state and during insulin stimulation test in (1) 15 normal subjects (controls) and (2) 31 patients with stunted growth, whereas (3) in 7 acromegalic patients the same were measured at fasting-resting state and after oral glucose administration. This procedure has been used to distinguish dwarfs due to growth hormone deficiency from other conditions unrelated to pituitary disease and to confirm acromegaly. (author)
Jha, Omkant; Yadav, T K; Yadav, R A
2018-01-15
Structural and vibrational studies for the most stable conformer of dopamine {4-(2-Aminoethyl) benzene-1, 2-diol} have been carried out at the DFT/B3LYP/6-311++G** level using the Gaussian 09 software. The IR and Raman spectra have been recorded and analyzed in light of the computed vibrational parameters using the DFT and the PEDs computed with the help of the GAR2PED software. Some of the fundamentals have considerably changed frequencies in going from benzene to dopamine. Except the rocking and wagging modes of the NH 2 group the other four modes are pure group modes. The rocking and wagging modes of the NH 2 group show mixing with the other modes. The two OH stretching vibrations are highly localized modes. The Kekule phenyl ring stretching mode is found to remain almost unchanged. The HOMO-LUMO study suggests the existence of charge transfer within the molecule and the energy gap supports the pharmacological active property of the dopamine molecule. The NBO analysis has been carried out to understand the proper and improper hydrogen bonding. Copyright © 2017. Published by Elsevier B.V.
Zero-phonon-line emission of single molecules for applications in quantum information processing
Kiraz, Alper; Ehrl, M.; Mustecaplioglu, O. E.; Hellerer, T.; Brauchle, C.; Zumbusch, A.
2005-07-01
A single photon source which generates transform limited single photons is highly desirable for applications in quantum optics. Transform limited emission guarantees the indistinguishability of the emitted single photons. This, in turn brings groundbreaking applications in linear optics quantum information processing within an experimental reach. Recently, self-assembled InAs quantum dots and trapped atoms have successfully been demonstrated as such sources for highly indistinguishable single photons. Here, we demonstrate that nearly transform limited zero-phonon-line (ZPL) emission from single molecules can be obtained by using vibronic excitation. Furthermore we report the results of coincidence detection experiments at the output of a Michelson-type interferometer. These experiments reveal Hong-Ou-Mandel correlations as a proof of the indistinguishability of the single photons emitted consecutively from a single molecule. Therefore, single molecules constitute an attractive alternative to single InAs quantum dots and trapped atoms for applications in linear optics quantum information processing. Experiments were performed with a home-built confocal microscope keeping the sample in a superfluid liquid Helium bath at 1.4K. We investigated terrylenediimide (TDI) molecules highly diluted in hexadecane (Shpol'skii matrix). A continuous wave single mode dye laser was used for excitation of vibronic transitions of individual molecules. From the integral fluorescence, the ZPL of single molecules was selected with a spectrally narrow interference filter. The ZPL emission was then sent to a scanning Fabry-Perot interferometer for linewidth measurements or a Michelson-type interferometer for coincidence detection.
Guo, Min; Gamby, Sonja; Zheng, Yue; Sintim, Herman O.
2013-01-01
Bacteria respond to different small molecules that are produced by other neighboring bacteria. These molecules, called autoinducers, are classified as intraspecies (i.e., molecules produced and perceived by the same bacterial species) or interspecies (molecules that are produced and sensed between different bacterial species). AI-2 has been proposed as an interspecies autoinducer and has been shown to regulate different bacterial physiology as well as affect virulence factor production and biofilm formation in some bacteria, including bacteria of clinical relevance. Several groups have embarked on the development of small molecules that could be used to perturb AI-2 signaling in bacteria, with the ultimate goal that these molecules could be used to inhibit bacterial virulence and biofilm formation. Additionally, these molecules have the potential to be used in synthetic biology applications whereby these small molecules are used as inputs to switch on and off AI-2 receptors. In this review, we highlight the state-of-the-art in the development of small molecules that perturb AI-2 signaling in bacteria and offer our perspective on the future development and applications of these classes of molecules. PMID:23994835
LINEAR2007, Linear-Linear Interpolation of ENDF Format Cross-Sections
International Nuclear Information System (INIS)
2007-01-01
1 - Description of program or function: LINEAR converts evaluated cross sections in the ENDF/B format into a tabular form that is subject to linear-linear interpolation in energy and cross section. The code also thins tables of cross sections already in that form. Codes used subsequently need thus to consider only linear-linear data. IAEA1311/15: This version include the updates up to January 30, 2007. Changes in ENDF/B-VII Format and procedures, as well as the evaluations themselves, make it impossible for versions of the ENDF/B pre-processing codes earlier than PREPRO 2007 (2007 Version) to accurately process current ENDF/B-VII evaluations. The present code can handle all existing ENDF/B-VI evaluations through release 8, which will be the last release of ENDF/B-VI. Modifications from previous versions: - Linear VERS. 2007-1 (JAN. 2007): checked against all ENDF/B-VII; increased page size from 60,000 to 600,000 points 2 - Method of solution: Each section of data is considered separately. Each section of File 3, 23, and 27 data consists of a table of cross section versus energy with any of five interpolation laws. LINEAR will replace each section with a new table of energy versus cross section data in which the interpolation law is always linear in energy and cross section. The histogram (constant cross section between two energies) interpolation law is converted to linear-linear by substituting two points for each initial point. The linear-linear is not altered. For the log-linear, linear-log and log- log laws, the cross section data are converted to linear by an interval halving algorithm. Each interval is divided in half until the value at the middle of the interval can be approximated by linear-linear interpolation to within a given accuracy. The LINEAR program uses a multipoint fractional error thinning algorithm to minimize the size of each cross section table
Garcia-Caurel, Enric; Drevillon, Bernard; De Martino, Antonello; Schwartz, Laurent
2002-12-01
Spectroscopic ellipsometry is a noninvasive optical characterization technique mainly used in the semiconductor field to characterize bare substrates and thin films. In particular, it allows the gathering of information concerning the physical structure of the sample, such as roughness and film thickness, as well as its optical response. In the mid-infrared (IR) range each molecule exhibits a characteristic absorption fingerprint, which makes this technique chemically selective. Phase-modulated IR ellipsometry does not require a baseline correction procedure or suppression of atmospheric CO2 and water-vapor absorption bands, thus greatly reducing the subjectivity in data analysis. We have found that ellipsometric measurements of thin films, such as the solid residuals left on a plane surface after evaporation of a liquid drop containing a given compound in solution, are particularly favorable for dosing purposes because the intensity of IR absorptions shows a linear behavior along a wide range of solution concentrations of the given compound. Our aim is to illustrate with a concrete example and to justify theoretically the linearity experimentally found between radiation absorption and molecule concentration. For the example, we prepared aqueous solutions of glycogen, a molecule of huge biological importance currently tested in biochemical analyses, at concentrations ranging from 1 mg/l to 1 g/l, which correspond to those found in physiological conditions. The results of this example are promising for the application of ellipsometry for dosing purposes in biochemistry and biomedicine.
Steering dissociation of Br2 molecules with two femtosecond pulses via wave packet interference.
Han, Yong-Chang; Yuan, Kai-Jun; Hu, Wen-Hui; Yan, Tian-Min; Cong, Shu-Lin
2008-04-07
The dissociation dynamics of Br2 molecules induced by two femtosecond pump pulses are studied based on the calculation of time-dependent quantum wave packet. Perpendicular transition from X 1Sigma g+ to A 3Pi 1u+ and 1Pi 1u+ and parallel transition from X 1Sigma g+ to B 3Pi 0u+, involving two product channels Br (2P3/2)+Br (2P3/2) and Br (2P3/2)+Br* (2P1/2), respectively, are taken into account. Two pump pulses create dissociating wave packets interfering with each other. By varying laser parameters, the interference of dissociating wave packets can be controlled, and the dissociation probabilities of Br2 molecules on the three excited states can be changed to different degrees. The branching ratio of Br*/(Br+Br*) is calculated as a function of pulse delay time and phase difference.
Uni- and tridimensional alignment of molecules by femto-second laser pulse
International Nuclear Information System (INIS)
Rouzee, Arnaud
2007-01-01
This thesis is devoted to the study of the alignment of linear and asymmetric top molecules generated by an intense laser pulse. In the case of short pulses with respect to molecular rotation, periodic alignment appears in field-free conditions after the extinction of the field. We study theoretically and experimentally the effects of intensity, temperature and polarization of the electric field on produced alignment. If the field is linearly polarized, the interaction leads to the alignment of the most polarizable axis of the molecule. If the field is elliptically polarized, the pulse can generate a simultaneous alignment of the three principal axes of inertia of an asymmetric top molecule (3-D alignment). This alignment can be characterized experimentally using pump-probe techniques which exploit the optical properties of the medium. They require the use of a second pulse of low intensity temporally delayed. Three techniques were exploited during this thesis. The first technique measures a depolarization due to the birefringence of the medium when the molecules are aligned. The second is based on the defocusing of the pulse on a gradient of index created following the space variation of alignment with respect to the spatial profile of the field. The last involves the creation of a grading of index to the intersection of two intense pulses, which causes the diffraction of the probe. Finally, we show experimentally that the birefringence technique can be used to quantify the 3-D alignment of an asymmetric top molecule like ethylene. (author) [fr
Nonlinear to Linear Elastic Code Coupling in 2-D Axisymmetric Media.
Energy Technology Data Exchange (ETDEWEB)
Preston, Leiph [Sandia National Lab. (SNL-NM), Albuquerque, NM (United States)
2017-08-01
Explosions within the earth nonlinearly deform the local media, but at typical seismological observation distances, the seismic waves can be considered linear. Although nonlinear algorithms can simulate explosions in the very near field well, these codes are computationally expensive and inaccurate at propagating these signals to great distances. A linearized wave propagation code, coupled to a nonlinear code, provides an efficient mechanism to both accurately simulate the explosion itself and to propagate these signals to distant receivers. To this end we have coupled Sandia's nonlinear simulation algorithm CTH to a linearized elastic wave propagation code for 2-D axisymmetric media (axiElasti) by passing information from the nonlinear to the linear code via time-varying boundary conditions. In this report, we first develop the 2-D axisymmetric elastic wave equations in cylindrical coordinates. Next we show how we design the time-varying boundary conditions passing information from CTH to axiElasti, and finally we demonstrate the coupling code via a simple study of the elastic radius.
Adsorption and dissociation of Cl{sub 2} molecule on ZnO nanocluster
Energy Technology Data Exchange (ETDEWEB)
Beheshtian, Javad [Department of Chemistry, Shahid Rajaee Teacher Training University, P.O. Box: 16875-163, Tehran (Iran, Islamic Republic of); Peyghan, Ali Ahmadi, E-mail: ahmadi.iau@gmail.com [Young Researchers Club, Islamic Azad University, Islamshahr Branch, Tehran (Iran, Islamic Republic of); Bagheri, Zargham [Physics group, Science department, Islamic Azad University, Islamshahr Branch, P.O. Box: 33135-369, Islamshahr, Tehran (Iran, Islamic Republic of)
2012-08-01
Adsorption of chlorine molecule (Cl{sub 2}) on the Zn{sub 12}O{sub 12} nano-cage has been analyzed using density functional theory. It has been shown that the Cl{sub 2} molecule is strongly adsorbed on the cluster via two mechanisms including chemisorption and dissociation with Gibbs free energy changes in the range of -0.36 to -0.92 eV at 298 K and 1 atm. These processes also significantly change the electronic properties of cluster by decreasing its HOMO/LUMO energy gap and increasing the work function. The Fermi level shifts towards lower energies upon the interactions between Cl{sub 2} and the cluster, resulting in raised potential barrier of the electron emission for the cluster and hence avoiding the field emission. The Zn{sub 12}O{sub 12} cluster is transformed to a p-type semiconductor substance upon the Cl{sub 2} dissociation. We believe that the obtained results may be helpful in several fields of study such as sensors, catalysts, and field emission investigations.
Linear thermal expansion coefficient of MgAl2O4(s)
International Nuclear Information System (INIS)
Dash, A.; Samui, P.; Naik, Y.P.; Chaudhary, Z.S.
2011-01-01
The coefficient of linear thermal expansion (α av ) of MgAl 2 O 4 (s) has been determined using a Netzsch 402 PC dilatometer with Al 2 O 3 (s) as the push-rod. The change in length per unit length was recorded as a function of temperature between room temperature to 1273 K at a heating rate of 8 K.min /1 , in argon flowing atmosphere. The average of three measurements was quoted as the α av for MgAl 2 O 4 (s). The linear thermal expansion was measured to an accuracy of ±3%. (author)
DEFF Research Database (Denmark)
Rasmussen, Kim Krighaar; Kulahin, Nikolaj; Kristensen, Ole
2008-01-01
The crystal structure of the first immunoglobulin (Ig1) domain of neural cell adhesion molecule 2 (NCAM2/OCAM/RNCAM) is presented at a resolution of 2.7 A. NCAM2 is a member of the immunoglobulin superfamily of cell adhesion molecules (IgCAMs). In the structure, two Ig domains interact by domain...
Energy Technology Data Exchange (ETDEWEB)
Li, Wei; Lu, Xiao-Min; Li, Guo-Qing; Ma, Juan-Juan; Zeng, Peng-Yu; Chen, Jun-Fang; Pan, Zhong-Liang; He, Qing-Yu
2016-02-28
Graphical abstract: These two figures reflect the orbital bonding between SO{sub 2} molecule and the SV-2-CNT and Ni-SV-2-CNT. Which indicated the feasibility of making the sensors for SO{sub 2} molecule detecting with introducing vacancies, Ni atoms or combination of them. - Highlights: • The paper reports the effects of vacancy and Ni doping vacancy on CNT adsorbing SO{sub 2}. • Vacancies and Ni doping vacancies both can improve the sensitivity of CNT to SO{sub 2}. • Vacancies and Ni-doped vacancies CNTs are candidate material for SO{sub 2} detecting. - Abstract: To explore the possible way of detecting the poisonous gas SO{sub 2}, we have investigated the interactions between SO{sub 2} molecule and modified (8,0) single-walled carbon nanotubes by using the density functional theory (DFT) method. The adsorption energies, interaction distances, changes of geometric and electronic structures were all analyzed to investigate the sensitivity of variety of models of CNTs with Ni doping, vacancies, and a combination of them toward SO{sub 2} molecule. From our investigations, we found that SO{sub 2} molecule was more likely to be absorbed on vacancy-defected CNTs with relatively higher adsorption energy and shorter binding distance compared with the perfect CNTs. In addition, after doping Ni atom on the vacancies, the modified CNTs which were not very much sensitivity to SO{sub 2} molecule could become much sensitivity to it. In other words, the number of sensitive adsorption sites increased. The partial density of states (PDOS) and the electron concentration of the adsorption systems suggested the strong electrons interaction between SO{sub 2} molecule and defected or Ni-doped defected CNTs. Therefore the vacancies and Ni-doped vacancies CNTs had the potential capacities to make the sensors for SO{sub 2} molecule detecting.
Single-molecule study on polymer diffusion in a melt state: Effect of chain topology
Habuchi, Satoshi
2013-08-06
We report a new methodology for studying diffusion of individual polymer chains in a melt state, with special emphasis on the effect of chain topology. A perylene diimide fluorophore was incorporated into the linear and cyclic poly(THF)s, and real-time diffusion behavior of individual chains in a melt of linear poly(THF) was measured by means of a single-molecule fluorescence imaging technique. The combination of mean squared displacement (MSD) and cumulative distribution function (CDF) analysis demonstrated the broad distribution of diffusion coefficient of both the linear and cyclic polymer chains in the melt state. This indicates the presence of spatiotemporal heterogeneity of the polymer diffusion which occurs at much larger time and length scales than those expected from the current polymer physics theory. We further demonstrated that the cyclic chains showed marginally slower diffusion in comparison with the linear counterparts, to suggest the effective suppression of the translocation through the threading-entanglement with the linear matrix chains. This coincides with the higher activation energy for the diffusion of the cyclic chains than of the linear chains. These results suggest that the single-molecule imaging technique provides a powerful tool to analyze complicated polymer dynamics and contributes to the molecular level understanding of the chain interaction. © 2013 American Chemical Society.
Single-molecule study on polymer diffusion in a melt state: Effect of chain topology
Habuchi, Satoshi; Fujiwara, Susumu; Yamamoto, Takuya; Vá cha, Martin; Tezuka, Yasuyuki
2013-01-01
We report a new methodology for studying diffusion of individual polymer chains in a melt state, with special emphasis on the effect of chain topology. A perylene diimide fluorophore was incorporated into the linear and cyclic poly(THF)s, and real-time diffusion behavior of individual chains in a melt of linear poly(THF) was measured by means of a single-molecule fluorescence imaging technique. The combination of mean squared displacement (MSD) and cumulative distribution function (CDF) analysis demonstrated the broad distribution of diffusion coefficient of both the linear and cyclic polymer chains in the melt state. This indicates the presence of spatiotemporal heterogeneity of the polymer diffusion which occurs at much larger time and length scales than those expected from the current polymer physics theory. We further demonstrated that the cyclic chains showed marginally slower diffusion in comparison with the linear counterparts, to suggest the effective suppression of the translocation through the threading-entanglement with the linear matrix chains. This coincides with the higher activation energy for the diffusion of the cyclic chains than of the linear chains. These results suggest that the single-molecule imaging technique provides a powerful tool to analyze complicated polymer dynamics and contributes to the molecular level understanding of the chain interaction. © 2013 American Chemical Society.
Photoelectron angular distributions from strong-field ionization of oriented molecules
DEFF Research Database (Denmark)
Holmegaard, Lotte; Hansen, Jonas Lerche; Kalhøj, Line
2010-01-01
The combination of ultrafast light sources with detection of molecular-frame photoelectron angular distributions (MFPADs) is setting new standards for detailed interrogation of molecular dynamics. However, until recently measurement of MFPADs relied on determining the molecular orientation after...... ionization, which is limited to species and processes where ionization leads to fragmentation. An alternative is to fix the molecular frame before ionization. The only demonstrations of such spatial orientation involved aligned small linear nonpolar molecules. Here we extend these techniques to the general...... class of polar molecules. Carbonylsulphide and benzonitrile molecules, fixed in space by combined laser and electrostatic fields, are ionized with intense, circularly polarized 30-fs laser pulses. For carbonylsulphide and benzonitrile oriented in one dimension, the MFPADs exhibit pronounced anisotropies...
Directory of Open Access Journals (Sweden)
Saenger Paul
2012-05-01
Full Text Available Abstract The term small for gestational age (SGA refers to infants whose birth weights and/or lengths are at least two standard deviation (SD units less than the mean for gestational age. This condition affects approximately 3%–10% of newborns. Causes for SGA birth include environmental factors, placental factors such as abnormal uteroplacental blood flow, and inherited genetic mutations. In the past two decades, an enhanced understanding of genetics has identified several potential causes for SGA. These include mutations that affect the growth hormone (GH/insulin-like growth factor (IGF-1 axis, including mutations in the IGF-1 gene and acid-labile subunit (ALS deficiency. In addition, select polymorphisms observed in patients with SGA include those involved in genes associated with obesity, type 2 diabetes, hypertension, ischemic heart disease and deletion of exon 3 growth hormone receptor (d3-GHR polymorphism. Uniparental disomy (UPD and imprinting effects may also underlie some of the phenotypes observed in SGA individuals. The variety of genetic mutations associated with SGA births helps explain the diversity of phenotype characteristics, such as impaired motor or mental development, present in individuals with this disorder. Predicting the effectiveness of recombinant human GH (hGH therapy for each type of mutation remains challenging. Factors affecting response to hGH therapy include the dose and method of hGH administration as well as the age of initiation of hGH therapy. This article reviews the results of these studies and summarizes the success of hGH therapy in treating this difficult and genetically heterogenous disorder.
Fang, Rui; Grobelny, Pawel J; Bogner, Robin H; Pikal, Michael J
2016-11-01
Lyophilized proteins are generally stored below their glass transition temperature (T g ) to maintain long-term stability. Some proteins in the (pure) solid state showed a distinct endotherm at a temperature well below the glass transition, designated as a pre-T g endotherm. The pre-T g endothermic event has been linked with a transition in protein internal mobility. The aim of this study was to investigate the internal dynamics of 2 proteins, insulin and human growth hormone (hGH), both of which exhibit the pre-T g endothermic event with onsets at 50°C-60°C. Solid state hydrogen/deuterium (H/D) exchange of both proteins was characterized by Fourier transform infrared spectroscopy over a temperature range from 30°C to 80°C. A distinct sigmoidal transition in the extent of H/D exchange had a midpoint of 56.1 ± 1.2°C for insulin and 61.7 ± 0.9°C for hGH, suggesting a transition to greater mobility in the protein molecules at these temperatures. The data support the hypothesis that the pre-T g event is related to a transition in internal protein mobility associated with the protein dynamical temperature. Exceeding the protein dynamical temperature is expected to activate protein internal motion and therefore may have stability consequences. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
Laron, Zvi; Iluz, Moshe; Kauli, Rivka
2012-04-01
Head circumference (HC) is a simple and practical measure of brain size, development and longitudinal measurements of the HC in childhood are an index of brain growth. To determine the effects of long IGF-I deficiency and treatment on HC in patients with Laron syndrome (LS). 20 untreated adult LS patients, aged 48.4±11.2 years and 13 LS patients treated between ages of 5.6±4 to 11.3±3 years were studied. 15 patients with congenital IGHD treated between age 6.1±4 and 13±4 by hGH served as controls. HC was expressed as standard deviation (SD) and Ht as SDS. HC was measured and plotted on Nellhaus charts. Linear height (Ht) was measured by a Harpenden Stadiometer. The mean HC deficit of the adult untreated LS males was -2.9±0.6 SD compared to a Ht deficit of -7.0±1.7 SDS. The HC of the LS adult females was -3.6±1 SD compared to a Ht SDS of -6.9±1.5 (pdeficit decreased only by 1.5 SDS. hGH treatment of cIGHD children increased the HC from -2.0±1.8 to 0.3±1.2 SD and the Ht SDS from -4.8±1.6 to 1.6±1.0. Copyright © 2012 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Wang Lei; Xu Guang; Shi Zhikun; Jiang Wei; Jin Wenrui
2007-01-01
We developed a sensitive single-molecule imaging method for quantification of protein by total internal reflection fluorescence microscopy with adsorption equilibrium. In this method, the adsorption equilibrium of protein was achieved between solution and glass substrate. Then, fluorescence images of protein molecules in a evanescent wave field were taken by a highly sensitive electron multiplying charge coupled device. Finally, the number of fluorescent spots corresponding to the protein molecules in the images was counted. Alexa Fluor 488-labeled goat anti-rat IgG(H + L) was chosen as the model protein. The spot number showed an excellent linear relationship with protein concentration. The concentration linear range was 5.4 x 10 -11 to 8.1 x 10 -10 mol L -1
Hyperfine structure of 2Σ molecules containing alkaline-earth-metal atoms
Aldegunde, Jesus; Hutson, Jeremy M.
2018-04-01
Ultracold molecules with both electron spin and an electric dipole moment offer new possibilities in quantum science. We use density-functional theory to calculate hyperfine coupling constants for a selection of molecules important in this area, including RbSr, LiYb, RbYb, CaF, and SrF. We find substantial hyperfine coupling constants for the fermionic isotopes of the alkaline-earth-metal and Yb atoms. We discuss the hyperfine level patterns and Zeeman splittings expected for these molecules. The results will be important both to experiments aimed at forming ultracold open-shell molecules and to their applications.
Directory of Open Access Journals (Sweden)
Hossam Murad
2017-05-01
Full Text Available BackgroundMonitoring blood levels of human growth hormone (hGH in most children with short stature deficiencies is crucial for taking a decision of treatment with extended course of daily and expensive doses of recombinant hGH (rhGH or Somatropin®. Besides, misusing of rhGH by sportsmen is banned by the World Anti-Doping Agency and thus sensitive GH-detecting methods are highly welcome in this field. Nanobodies are the tiniest antigen-binding entity derived from camel heavy chain antibodies. They were successfully generated against numerous antigens including hormones.MethodsA fully nanobody-based sandwich ELISA method was developed in this work for direct measurement of GH in biological samples.ResultsTwo major characteristics of nanobody were exploited for this goal: the robust and stable structure of the nanobody (NbGH04 used to capture hGH from tested samples, and the great ability of tailoring, enabling the display of the anti-GH detector nanobody (NbGH07 on the tip of M13-phage. Such huge, stable, and easy-to-prepare phage-Nb was used in ELISA to provide an amplified signal. Previously, NbGH04 was retrieved on immobilized hGH by phage display from a wide “immune” cDNA library prepared from a hGH-immunized camel. Here, and in order to assure epitope heterogeneity, NbGH07 was isolated from the same library using NbGH04-captured hGH as bait. Interaction of both nanobodies with hGH was characterized and compared with different anti-GH nanobodies and antibodies. The sensitivity (~0.5 ng/ml and stability of the nanobody-base sandwich ELISA were assessed using rhGH before testing in the quantification of hGH in blood sera and cell culture supernatants.ConclusionIn regard to all advantages of nanobodies; stability, solubility, production affordability in Escherichia coli, and gene tailoring, nanobody-based phage sandwich ELISA developed here would provide a valuable method for hGH detection and quantification.
Hormonal interaction in diabetic pregnancy
International Nuclear Information System (INIS)
Hafiez, A.R.A.; Abdel-Hafez, M.A.; Osman, E.A.; Ibrahim, M.S.
1984-01-01
Serum glucose, human placental lactogen (HPL), prolactin (PRL), estradiol (E 2 ), progesterone (P), cortisol and human growth hormone (HGH) were determined in nondiabetic (19 cases) and diabetic (19 cases) pregnant women during the 32nd and 36th week of gestation. Significant elevation of HPL, PRL, HGH and cortisol was found in the diabetic pregnant women during the 32nd week while E 2 and P were not significantly changed from the corresponding levels in the nondiabetic group. One can conclude that the changes in the hormonal pattern during gestation may induce carbohydrate intolerance observed in diabetic pregnancies. (author)
Stigter, Dirk
2004-07-01
Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).
National Research Council Canada - National Science Library
Tam, Simon
2000-01-01
...), Ne, Ar, Kr, and Xe matrices, and of B2 molecules in Ne, Ar, Kr, and Xe matrices. The 2s(sup 2)3s((sup 2)S) left arrow 2s(sup 2)2p((sup 2)P) B atom Rydberg absorption suffers large gas-to-matrix blue shifts, increasing...
A dynamical theory for linearized massive superspin 3/2
International Nuclear Information System (INIS)
Gates, James S. Jr.; Koutrolikos, Konstantinos
2014-01-01
We present a new theory of free massive superspin Y=3/2 irreducible representation of the 4D, N=1 Super-Poincaré group, which has linearized non-minimal supergravity (superhelicity Y=3/2) as it’s massless limit. The new results will illuminate the underlying structure of auxiliary superfields required for the description of higher massive superspin systems
International Nuclear Information System (INIS)
Ogawa, Norio; Takahara, Jiro; Ofuji, Tadashi
1975-01-01
The development and application of the method for the ultramicromeasurement of human growth hormone (HGH) in plasma based on the solid-phase radioimmunoassay (RIA) by using antibody-coated disposable microtiter trays was reported. There was no statistical significance between the basal HGH level obtained from this method and that from the double-antibody RIA in normal subjects. On the other hand, the mean basal plasma HGH level after an overnight fasting in 21 hypopituitary patients was 484 pg/ml (+-282; 1 SD) by this method, and this was significantly lower (P<0.001) than 1376 pg/ml (+-498; 1 SD) by the double-antibody RIA. These data show that determination of basal plasma HGH levels by this method is of much value in the diagnosis of hypopituitarism. (JPN)
Molecule Matters van der Waals Molecules
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 14; Issue 12. Molecule Matters van der Waals Molecules - Noble Gas Clusters are London Molecules! E Arunan. Feature Article Volume 14 Issue 12 December 2009 pp 1210-1222 ...
Structural and Interfacial Properties of Hyperbranched-Linear Polymer Surfactant.
Qiang, Taotao; Bu, Qiaoqiao; Huang, Zhaofeng; Wang, Xuechuan
2014-01-01
With oleic acid grafting modification, a series of hyperbranched-linear polymer surfactants (HLPS) were prepared by hydroxyl-terminated hyperbranched polymer (HBP), which was gained through a step synthesis method using trimethylolpropane and AB 2 monomer. The AB 2 monomers were obtained through the Michael addition reaction of methyl acrylate and diethanol amine. The structures of HLPS were characterised by Fourier transform infrared spectrophotometer and nuclear magnetic resonance (NMR), which indicated that HBP was successfully modified by oleic acid. Furthermore, the properties of surface tension and critical micelle concentration of HLPS solution showed that HLPS can significantly reduce the surface tension of water. The morphology of the HLPS solution was characterised by dynamic light scattering, which revealed that HLPS exhibited a nonmonotonic appearance in particle size at different scattering angles owing to the different replaced linear portions. The relationships of the surface pressure to monolayer area and time were measured using the Langmuir-Blodgett instrument, which showed that the surface tension of monolayer molecules increased with the increasing of hydrophobic groups. In addition, the interface conditions of different replaced HLPS solutions were simulated.
International Nuclear Information System (INIS)
Vannikov, A.V.; Grishina, A.D.; Gorbunova, Yu.G.; Enakieva, Yu.Yu.; Krivenko, T.V.; Savel'ev, V.V.; Tsivadze, A.Yu.
2006-01-01
Photoelectric, non-linear optical, and photorefractive properties of aromatic polyimine doped with ruthenium(II) complex with tetra-15-crown-5-phthalocyanine and axially coordinated triethylenediamine molecules, (R 4 Pc)Ru(TED) 2 , where R 4 Pc 2- and TED denote 4,5,4',5',4'',5'',4''',5'''-tetrakis-(1,4,7,10,13- pentaoxatridecamethylene)phthalocyaninate ion and triethylenediamine molecule, respectively, were studied. It is established that supramolecular ensembles on the basis of the complex make an aromatic polyimide layer photoelectrically sensitive to 1064-nm Nd : YAG laser radiation, exhibit third-order susceptibility, and, consequently, impart photorefractive properties to the polymer layer at this wavelength [ru
Turner, Walter E; Agarwal, Jay; Schaefer, Henry F
2015-12-03
The recent discovery of PN in the oxygen-rich shell of the supergiant star VY Canis Majoris points to the formation of several triatomic molecules involving oxygen, nitrogen, and phosphorus; these are also intriguing targets for main-group synthetic inorganic chemistry. In this research, high-level ab initio electronic structure computations were conducted on the potential circumstellar molecule OPN and several of its heavier group 15 and 16 congeners (SPN, SePN, TePN, OPP, OPAs, and OPSb). For each congener, four isomers were examined. Optimized geometries were obtained with coupled cluster theory [CCSD(T)] using large Dunning basis sets [aug-cc-pVQZ, aug-cc-pV(Q+d)Z, and aug-cc-pVQZ-PP], and relative energies were determined at the complete basis set limit of CCSDT(Q) from focal point analyses. The linear phosphorus-centered molecules were consistently the lowest in energy of the group 15 congeners by at least 6 kcal mol(-1), resulting from double-triple and single-double bond resonances within the molecule. The linear nitrogen-centered molecules were consistently the lowest in energy of the group 16 congeners by at least 5 kcal mol(-1), due to the electronegative central nitrogen atom encouraging electron delocalization throughout the molecule. For OPN, OPP, and SPN, anharmonic vibrational frequencies and vibrationally corrected rotational constants are predicted; good agreement with available experimental data is observed.
Energy distribution in dissociations of polyatomic molecules
International Nuclear Information System (INIS)
Koernig, S.A.
1989-01-01
In this thesis studies are reported of fragmentation processes in polyatomic molecules. In order to find out which dessocaciation reactions take place, how they are brought about by the internal energy of the reactant, and to investigate the structure of the dissociating 'transition state', the fragment mass and the corresponding kinetic energy release (KER) are determined by differential translational spectroscopy using a position and time sensitive two-particle coincidence detector. The results are interpreted using the statistical theory of unimolecular dissociation. It turns out that the standard assumptions of the theory, especially in calculating KER-distributions, are not realistic in all molecules considered. Dissociation is induced by the neutralization with alkali metal vapour. In ch. 2 the experimental method and the analysis of the data (dissociation pathways, branching ratios and ε-d-distributions) are introduced and exemplified by measurements of cyclohexane, which represents the upper limit in precursor and fragment mass accessible in the apparatus. In ch. 3 a study is reported of the molecules methylchloride (CH 3 Cl) and the acetylradical (CH 3 CO). In spite of their similar geometric structures, completely different dissociation mechanisms have been found. Methylchloride dissociates via a repulsive state; acetyl radicals show energy scrambling. The energy distribution from dissociating acetyl exemplifies dynamical effects in the dissociation. In ch. 4 an investigation of a number of prototype hydrocarbons is presented. The dissociation pathways of several small linear alkanes indicate that neutralization takes place to unknown repulsive potentials, of which the position and steepness are determined from the kinetic energy release. (author). 118 refs.; 40 figs.; 5 tabs
Li, Jiaru; Joubert-Doriol, Loïc; Izmaylov, Artur F.
2017-08-01
We investigate geometric phase (GP) effects in nonadiabatic transitions through a conical intersection (CI) in an N-dimensional linear vibronic coupling (ND-LVC) model. This model allows for the coordinate transformation encompassing all nonadiabatic effects within a two-dimensional (2D) subsystem, while the other N - 2 dimensions form a system of uncoupled harmonic oscillators identical for both electronic states and coupled bi-linearly with the subsystem coordinates. The 2D subsystem governs ultra-fast nonadiabatic dynamics through the CI and provides a convenient model for studying GP effects. Parameters of the original ND-LVC model define the Hamiltonian of the transformed 2D subsystem and thus influence GP effects directly. Our analysis reveals what values of ND-LVC parameters can introduce symmetry breaking in the 2D subsystem that diminishes GP effects.
Design and Application of a High-Temperature Linear Ion Trap Reactor
Jiang, Li-Xue; Liu, Qing-Yu; Li, Xiao-Na; He, Sheng-Gui
2018-01-01
A high-temperature linear ion trap reactor with hexapole design was homemade to study ion-molecule reactions at variable temperatures. The highest temperature for the trapped ions is up to 773 K, which is much higher than those in available reports. The reaction between V2O6 - cluster anions and CO at different temperatures was investigated to evaluate the performance of this reactor. The apparent activation energy was determined to be 0.10 ± 0.02 eV, which is consistent with the barrier of 0.12 eV calculated by density functional theory. This indicates that the current experimental apparatus is prospective to study ion-molecule reactions at variable temperatures, and more kinetic details can be obtained to have a better understanding of chemical reactions that have overall barriers. [Figure not available: see fulltext.
Energy Technology Data Exchange (ETDEWEB)
Gerasimenko, Andrey V.; Gaivoronskaya, Kseniya A.; Slobodyuk, Arseny B.; Didenko, Nina A. [Institute of Chemistry, Russian Academy of Sciences, Vladivostok (Russian Federation)
2017-12-04
The MgZrF{sub 6}.nH{sub 2}O (n = 5, 2 and 0) compounds were studied by the methods of X-ray diffraction and {sup 19}F, MAS {sup 19}F, and {sup 1}H NMR spectroscopy. At room temperature, the compound MgZrF{sub 6}.5H{sub 2}O has a monoclinic C-centered unit cell and is composed of isolated chains of edge-sharing ZrF{sub 8} dodecahedra reinforced with MgF{sub 2}(H{sub 2}O){sub 4} octahedra and uncoordinated H{sub 2}O molecules and characterized by a disordered system of hydrogen bonds. In the temperature range 259 to 255 K, a reversible monoclinic <-> two-domain triclinic phase transition is observed. The phase transition is accompanied with ordering of hydrogen atoms positions and the system of hydrogen bonds. The structure of MgZrF{sub 6}.2H{sub 2}O comprises a three-dimensional framework consisting of chains of edge-sharing ZrF{sub 8} dodecahedra linked to each other through MgF{sub 4}(H{sub 2}O){sub 2} octahedra. The compound MgZrF{sub 6} belongs to the NaSbF{sub 6} type and is built from regular ZrF{sub 6} and MgF{sub 6} octahedra linked into a three-dimensional framework through linear Zr-F-Mg bridges. The peaks in {sup 19}F MAS spectra were attributed to the fluorine structural positions. The motions of structural water molecules were studied by variable-temperature {sup 1}H NMR spectroscopy. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Cho, Kyungjune; Pak, Jinsu; Kim, Jae-Keun; Kang, Keehoon; Kim, Tae-Young; Shin, Jiwon; Choi, Barbara Yuri; Chung, Seungjun; Lee, Takhee
2018-05-01
Although 2D molybdenum disulfide (MoS 2 ) has gained much attention due to its unique electrical and optical properties, the limited electrical contact to 2D semiconductors still impedes the realization of high-performance 2D MoS 2 -based devices. In this regard, many studies have been conducted to improve the carrier-injection properties by inserting functional paths, such as graphene or hexagonal boron nitride, between the electrodes and 2D semiconductors. The reported strategies, however, require relatively time-consuming and low-yield transfer processes on sub-micrometer MoS 2 flakes. Here, a simple contact-engineering method is suggested, introducing chemically adsorbed thiol-molecules as thin tunneling barriers between the metal electrodes and MoS 2 channels. The selectively deposited thiol-molecules via the vapor-deposition process provide additional tunneling paths at the contact regions, improving the carrier-injection properties with lower activation energies in MoS 2 field-effect transistors. Additionally, by inserting thiol-molecules at the only one contact region, asymmetric carrier-injection is feasible depending on the temperature and gate bias. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Comparative Evaluation of Anti-HER2 Affibody Molecules Labeled with 64Cu Using NOTA and NODAGA
Directory of Open Access Journals (Sweden)
Vladimir Tolmachev
2017-01-01
Full Text Available Imaging using affibody molecules enables discrimination between breast cancer metastases with high and low expression of HER2, making appropriate therapy selection possible. This study aimed to evaluate if the longer half-life of 64Cu (T1/2 = 12.7 h would make 64Cu a superior nuclide compared to 68Ga for PET imaging of HER2 expression using affibody molecules. The synthetic ZHER2:S1 affibody molecule was conjugated with the chelators NOTA or NODAGA and labeled with 64Cu. The tumor-targeting properties of 64Cu-NOTA-ZHER2:S1 and 64Cu-NODAGA-ZHER2:S1 were evaluated and compared with the targeting properties of 68Ga-NODAGA-ZHER2:S1 in mice. Both 64Cu-NOTA-ZHER2:S1 and 64Cu-NODAGA-ZHER2:S1 demonstrated specific targeting of HER2-expressing xenografts. At 2 h after injection of 64Cu-NOTA-ZHER2:S1, 64Cu-NODAGA-ZHER2:S1, and 68Ga-NODAGA-ZHER2:S1, tumor uptakes did not differ significantly. Renal uptake of 64Cu-labeled conjugates was dramatically reduced at 6 and 24 h after injection. Notably, radioactivity uptake concomitantly increased in blood, lung, liver, spleen, and intestines, which resulted in decreased tumor-to-organ ratios compared to 2 h postinjection. Organ uptake was lower for 64Cu-NODAGA-ZHER2:S1. The most probable explanation for this biodistribution pattern was the release and redistribution of renal radiometabolites. In conclusion, monoamide derivatives of NOTA and NODAGA may be suboptimal chelators for radiocopper labeling of anti-HER2 affibody molecules and, possibly, other scaffold proteins with high renal uptake.
Esrafili, Mehdi D.; Saeidi, Nasibeh
2018-06-01
We report for the first time, the catalytic activity of the experimentally available carbon-doped boron nitride nanosheet (C-BNNS) towards the reduction of N2O in the presence of CO or SO2 molecule. According to our density functional theory calculations, C-doping can introduce high spin density into BN monolayer which is mainly localized over the C and its neighboring N atoms. The Hirshfeld charge density analysis reveals that the electron-rich C-BNNS acts as an electron donating support to activate N2O molecule which is an important step in the reduction of N2O. The N2O reduction reaction starts with the dissociative adsorption of N2O over the C-BNNS surface, yielding the N2 molecule and an activated oxygen moiety (Oads) adsorbed over the C atom. The reaction then proceeds via the elimination of Oads by a CO or SO2 molecule. The obtained low activation energies clearly indicate that the metal-free C-BNNS surface can be regarded as a highly active catalyst for the reduction of N2O. The results of this study may open new avenues in searching low cost and highly active BN-based catalysts for low temperature reduction of N2O.
Spin-orbit-coupled Bose-Einstein condensates of rotating polar molecules
Deng, Y.; You, L.; Yi, S.
2018-05-01
An experimental proposal for realizing spin-orbit (SO) coupling of pseudospin 1 in the ground manifold 1Σ (υ =0 ) of (bosonic) bialkali polar molecules is presented. The three spin components are composed of the ground rotational state and two substates from the first excited rotational level. Using hyperfine resolved Raman processes through two select excited states resonantly coupled by a microwave, an effective coupling between the spin tensor and linear momentum is realized. The properties of Bose-Einstein condensates for such SO-coupled molecules exhibiting dipolar interactions are further explored. In addition to the SO-coupling-induced stripe structures, the singly and doubly quantized vortex phases are found to appear, implicating exciting opportunities for exploring novel quantum physics using SO-coupled rotating polar molecules with dipolar interactions.
2008-06-01
ng . Clinical scales Scale 1 – Hypochondriasis . hgh scores reflect ndvdu- als who have an excessve number of vague nonspecfic complants and...one reflects a general denal of physcal health and ncludes rather specfic somat c complants . The other group nvolves a general denal of
Electron collisions with F2CO molecules
Freitas, Thiago Corrêa; Barbosa, Alessandra Souza; Bettega, Márcio Henrique Franco
2017-07-01
In this paper we present elastic differential, integral, and momentum-transfer cross sections for electron collisions with carbonyl fluoride (F2CO ) molecules for the incident electron's energy from 0.5 eV to 20 eV. The Schwinger multichannel method with pseudopotentials was employed to obtain the cross sections in the static-exchange and static-exchange plus polarization approximations. The present results were compared with the available data in the literature, in particular, with the results of Kaur, Mason, and Antony [Phys. Rev. A 92, 052702 (2015), 10.1103/PhysRevA.92.052702] for the differential, total, and momentum-transfer cross sections. We have found a π* shape resonance centered at 2.6 eV in the B1 symmetry and other resonance, in the B2 symmetry, located at around 9.7 eV. A systematic study of the inclusion of polarization effects was performed in order to have a well balanced description of this negative-ion transient state. The effects of the long-range electric dipole potential were included by the Born closure scheme. Electronic structure calculations were also performed to help in the interpretation of the scattering results, and associate the transient states to the unoccupied orbitals.
Time-dependent quantum chemistry of laser driven many-electron molecules
International Nuclear Information System (INIS)
Nguyen-Dang, Thanh-Tung; Couture-Bienvenue, Étienne; Viau-Trudel, Jérémy; Sainjon, Amaury
2014-01-01
A Time-Dependent Configuration Interaction approach using multiple Feshbach partitionings, corresponding to multiple ionization stages of a laser-driven molecule, has recently been proposed [T.-T. Nguyen-Dang and J. Viau-Trudel, J. Chem. Phys. 139, 244102 (2013)]. To complete this development toward a fully ab-initio method for the calculation of time-dependent electronic wavefunctions of an N-electron molecule, we describe how tools of multiconfiguration quantum chemistry such as the management of the configuration expansion space using Graphical Unitary Group Approach concepts can be profitably adapted to the new context, that of time-resolved electronic dynamics, as opposed to stationary electronic structure. The method is applied to calculate the detailed, sub-cycle electronic dynamics of BeH 2 , treated in a 3–21G bound-orbital basis augmented by a set of orthogonalized plane-waves representing continuum-type orbitals, including its ionization under an intense λ = 800 nm or λ = 80 nm continuous-wave laser field. The dynamics is strongly non-linear at the field-intensity considered (I ≃ 10 15 W/cm 2 ), featuring important ionization of an inner-shell electron and strong post-ionization bound-electron dynamics
An improved theoretical value for Zsub(eff) for low-energy positron-hydrogen-molecule scattering
International Nuclear Information System (INIS)
Armour, E.A.G.; Baker, D.J.
1986-01-01
The value of Zsub(eff), the effective number of electrons per molecule available to the positron for annihilation, is calculated for low-energy positron-hydrogen-molecule scattering using a scattering wavefunction containing terms in which the positron-electron distance is included linearly as a factor. The results at very low energy are much closer to the experimental value than any that have been obtained previously. (author)
Evaluation of the first 44Sc-labeled Affibody molecule for imaging of HER2-expressing tumors
International Nuclear Information System (INIS)
Honarvar, Hadis; Müller, Cristina; Cohrs, Susan; Haller, Stephanie; Westerlund, Kristina; Karlström, Amelie Eriksson; Meulen, Nicholas P. van der; Schibli, Roger; Tolmachev, Vladimir
2017-01-01
Introduction: Affibody molecules are small (58 amino acids) high-affinity proteins based on a tri-helix non-immunoglobulin scaffold. A clinical study has demonstrated that PET imaging using Affibody molecules labeled with 68 Ga (T ½ = 68 min) can visualize metastases of breast cancer expressing human epidermal growth factor receptor type 2 (HER2) and provide discrimination between tumors with high and low expression level. This may help to identify breast cancer patients benefiting from HER2-targeting therapies. The best discrimination was at 4 h post injection. Due to longer half-life, a positron-emitting radionuclide 44 Sc (T ½ = 4.04 h) might be a preferable label for Affibody molecules for imaging at several hours after injection. Methods: A synthetic second-generation anti-HER2 Affibody molecule Z HER2:2891 was labeled with 44 Sc via a DOTA-chelator conjugated to the N-terminal amino group. Binding specificity, affinity and cellular processing 44 Sc-DOTA-Z HER2:2891 and 68 Ga-DOTA-Z HER2:2891 were compared in vitro using HER2-expressing cells. Biodistribution and imaging properties of 44 Sc-DOTA-Z HER2:2891 and 68 Ga-DOTA-Z HER2:2891 were evaluated in Balb/c nude mice bearing HER2-expression xenografts. Results: The labeling yield of 98 ± 2% and specific activity of 7.8 GBq/μmol were obtained. The conjugate demonstrated specific binding to HER2-expressing SKOV3.ip cells in vitro and to SKOV3.ip xenografts in nude mice. The distribution of radioactivity at 3 h post injection was similar for 44 Sc-DOTA-Z HER2:2891 and 68 Ga-DOTA-Z HER2:2891 , but the blood clearance of the 44 Sc-labeled variant was slower and the tumor-to-blood ratio was reduced (15 ± 2 for 44 Sc-DOTA-Z HER2:2891 vs 46 ± 9 for 68 Ga-DOTA-Z HER2:2891 ). At 6 h after injection of 44 Sc-DOTA-Z HER2:2891 the tumor uptake was 8 ± 2% IA/g and the tumor-to-blood ratio was 51 ± 8. Imaging using small-animal PET/CT demonstrated that 44 Sc-DOTA-Z HER2:2891 provides specific and high
Interstellar C2 molecules in a Taurus dark cloud
International Nuclear Information System (INIS)
Hobbs, L.M.; Black, J.H.; van Dishoeck, E.F.
1983-01-01
Five relatively strong interstellar absorption lines of the 2--0) Phillips band of C 2 near lambda8760 are detected in the spectrum of HD 29647, a late B star which lies behind a substantial part of the Taurus molecular cloud complex about 20triangle-solid from TMC-1. In combination with newly determined oscillator strengths, the observations yield a column density N(C 2 )roughly-equal9 x 10 13 cm -2 , which is comparable to those of widely distributed molecules like CH and H 2 O. Theoreticl models of the observed C 2 rotational level populations indicate a kinetic temperature T = 14 +8 /sub -/ 5 K and a mean density n 3 cm -3 . A narrow, anomalous strong, stellar Mn II line yields for HD 29647 a project rotational velocity v sin i -1 and is explained by previous identifications HD 29647 as a Hg-Mn peculiar star. Similar spectra of ν Cyg and omicron And give an upper limit W/sub lambda/ 2 lines in the 2--0) band, toward both stars
Institute of Scientific and Technical Information of China (English)
James R. Durig; Sarah Xiao-hua Zhou; Joshua Klaassen; Arindam Ganguly
2009-01-01
The utilization of the Raman spectra of the low frequency bending mode for three quasi-linear molecules, disiloxane, (SiH3)2 O; methylisocyanate, CH3NCO; and dimethy lisocyanate, (CH3)2SiHNCO for observing the low frequency anharmonic bending vibration is demonstrated which is superior to the corresponding far infrared spectra. From the observed frequencies from the Raman spectra the potential function governing the heavy atom motion to linearity has been obtained from which the barrier has been determined. These experimental values are compared to the ab ini-tio predicted values. Also low frequency Raman spectra of the ring puckering vibration of chlorocy-clobutane, c-C4H7Cl, bromocyclobutane, c-C4H7Br, and aminocyclobutane, c-C4H7NH2, have been utilized to obtain the potential function governing the ring inversion for these molecules. The deter-mined barriers to planarity are compared to those obtained from MP2 (full) ab initio and density functional theory B3LYP calculations by utilizing a variety of basis sets. For all of these studies it is shown that the Raman spectra are superior to the infrared spectra for determining the frequencies of the excited state transitions.
Study of the Cl2 molecule by the variational cellular method
International Nuclear Information System (INIS)
Rosato, A.; Lima, M.A.P.
1984-01-01
A self-consistent calculation based on the Variational Cellular Method is performed on the Cl 2 molecule. The results obtained for the ground state potential curve and the first excited state, the dissociation energy, the molecular orbital energies and other related parameters are compared with other methods of calculations and with available data and the agreement is satisfatory. (Author) [pt
DEFF Research Database (Denmark)
Bergseng, Elin; Dørum, Siri; Arntzen, Magnus Ø.
2014-01-01
Celiac disease is caused by intolerance to cereal gluten proteins, and HLA-DQ molecules are involved in the disease pathogenesis by presentation of gluten peptides to CD4+ T cells. The α- or β-chain sharing HLA molecules DQ2.5, DQ2.2, and DQ7.5 display different risks for the disease...... established binding motifs. The binding motif of DQ2.2 was strikingly different from that of DQ2.5 with position P3 being a major anchor having a preference for threonine and serine. This is notable as three recently identified epitopes of gluten recognized by T cells of DQ2.2 celiac patients harbor serine...... at position P3. This study demonstrates that relative quantitative comparison of endogenous peptides sampled from our protein metabolism by HLA molecules provides clues to understand HLA association with disease....
International Nuclear Information System (INIS)
Santos, A.J. dos.
1985-01-01
Non-destructive polyacrylamide gel electrophoretic (PAGE) tecnique, with direct UV-densitometry, was set up to permit both qualitative and quantitative studies of human growth hormone (hGH) isohormone purification is presented. This tecnique was used on a preparative scale to obtain milligram amounts of the fundamental form of hGH, isohormone B(Ih-B). Reversed electrophoresis was employed to elute the protein band form the gel. Retention of bio-and immunoactivity was demonstrated via two separate experiments. An 'in vivo' bioassay, based on the weight increase of hypophysectomized rats with a 2 x 2 factorial assay design, was used to compare the true somatotrophic activity of an hGH preparation submitted to the purification process with that of a single control preparation. Retention of immunoactivity was confirmed by studying the antibody binding properties of purified and radioiodinated Ih-B and by determination of its absolute immunopotency against a calibrated secondary standard. Radioimmuno assay curves, determined using Ih-B, as a standard and labelled preparation, showed its applicability in setting up assays based on more homogeneous reagents. (Author) [pt
Molecule Matters van der Waals Molecules
Indian Academy of Sciences (India)
Home; Journals; Resonance – Journal of Science Education; Volume 15; Issue 7. Molecule Matters van der Waals Molecules - Rg•••HF Complexes are Debye Molecules! E Arunan. Feature Article Volume 15 Issue 7 July 2010 pp 667-674. Fulltext. Click here to view fulltext PDF. Permanent link:
Electron-molecule interactions and their applications
Christophorou, L G
1984-01-01
Electron-Molecule Interactions and Their Applications, Volume 2 provides a balanced and comprehensive account of electron-molecule interactions in dilute and dense gases and liquid media. This book consists of six chapters. Chapter 1 deals with electron transfer reactions, while Chapter 2 discusses electron-molecular positive-ion recombination. The electron motion in high-pressure gases and electron-molecule interactions from single- to multiple-collision conditions is deliberated in Chapter 3. In Chapter 4, knowledge on electron-molecule interactions in gases is linked to that on similar proc
di Lauro, C.
2018-03-01
Transformations of vector or tensor properties from a space-fixed to a molecule-fixed axis system are often required in the study of rotating molecules. Spherical components λμ,ν of a first rank irreducible tensor can be obtained from the direction cosines between the two axis systems, and a second rank tensor with spherical components λμ,ν(2) can be built from the direct product λ × λ. It is shown that the treatment of the interaction between molecular rotation and the electric quadrupole of a nucleus is greatly simplified, if the coefficients in the axis-system transformation of the gradient of the electric field of the outer charges at the coupled nucleus are arranged as spherical components λμ,ν(2). Then the reduced matrix elements of the field gradient operators in a symmetric top eigenfunction basis, including their dependence on the molecule-fixed z-angular momentum component k, can be determined from the knowledge of those of λ(2) . The hyperfine structure Hamiltonian Hq is expressed as the sum of terms characterized each by a value of the molecule-fixed index ν, whose matrix elements obey the rule Δk = ν. Some of these terms may vanish because of molecular symmetry, and the specific cases of linear and symmetric top molecules, orthorhombic molecules, and molecules with symmetry lower than orthorhombic are considered. Each ν-term consists of a contraction of the rotational tensor λ(2) and the nuclear quadrupole tensor in the space-fixed frame, and its matrix elements in the rotation-nuclear spin coupled representation can be determined by the standard spherical tensor methods.
Ionization of molecules by electron impact: Differential and total cross sections
Energy Technology Data Exchange (ETDEWEB)
Rezkallah, Z. [Laboratoire de Physique Quantique et Systemes Dynamiques, Departement de physique, Faculte des sciences, Universite Ferhat Abbas, Setif 19000 (Algeria); Houamer, S., E-mail: hosalim@yahoo.com [Laboratoire de Physique Quantique et Systemes Dynamiques, Departement de physique, Faculte des sciences, Universite Ferhat Abbas, Setif 19000 (Algeria); Dal Cappello, C. [Laboratoire de Physique Moleculaire et des Collisions, Universite Paul Verlaine-Metz, Institut de Physique, 1 Boulevard Arago, 57078 Metz Cedex 3 (France); Charpentier, I. [Laboratoire de Physique et Mecanique des Materiaux, Universite Paul Verlaine-Metz UMR 7554, ile du Saulcy, 57045 Metz Cedex 1 (France); Roy, A.C. [School of Mathematical Sciences, Ramakrishna Mission Vivekananda University, Belur Math 711202, West Bengal (India)
2011-12-01
The first Born approximation is applied to calculate differential and total ionization cross sections of a set of small molecules, namely, HF, H{sub 2}O, NH{sub 3} and CH{sub 4} by electron impact. The molecular targets are described by single center molecular orbitals consisting of linear combinations of atomic orbitals (MO-LCAO). First, we have considered electron momentum spectroscopy experiments to check the accuracy of the wave functions. The triply, doubly, singly differential and total cross sections are then evaluated in a systematic way for a variety of kinematics. The results are discussed and compared with experiments.
Alaofi, Ahmed; On, Ngoc; Kiptoo, Paul; Williams, Todd D; Miller, Donald W; Siahaan, Teruna J
2016-02-01
The aim of this study is to evaluate the effect of peptide cyclization on the blood-brain barrier (BBB) modulatory activity and plasma stability of His-Ala-Val peptides, which are derived from the extracellular 1 domain of human E-cadherin. The activities to modulate the intercellular junctions by linear HAV4 (Ac-SHAVAS-NH2), cyclic cHAVc1 (Cyclo(1,8)Ac-CSHAVASC-NH2), and cyclic cHAVc3 (Cyclo(1,6)Ac-CSHAVC-NH2) were compared in in vitro and in vivo BBB models. Linear HAV4 and cyclic cHAVc1 have the same junction modulatory activities as assessed by in vitro MDCK monolayer model and in situ rat brain perfusion model. In contrast, cyclic cHAVc3 was more effective than linear HAV4 in modulating MDCK cell monolayers and in improving in vivo brain delivery of Gd-DTPA on i.v. administration in Balb/c mice. Cyclic cHAVc3 (t1/2 = 12.95 h) has better plasma stability compared with linear HAV4 (t1/2 = 2.4 h). The duration of the BBB modulation was longer using cHAVc3 (2-4 h) compared with HAV4 (brain delivery of IRdye800cw-PEG (25 kDa) as detected by near IR imaging. The result showed that cyclic cHAVc3 peptide had better activity and plasma stability than linear HAV4 peptide. Copyright © 2016 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.
Theoretical studies of the C4 molecule
International Nuclear Information System (INIS)
Ritchie, J.P.; King, H.F.; Young, W.S.
1985-01-01
Optimized geometries and relative energies for three states of the C 4 molecule have been obtained from single-reference configuration interaction (SRCI) calculations. At the SRCI level, a rhombic form is calculated to lie 1.1 kcal below the triplet form; consideration of the Davidson correction reduces this difference to 0.4 kcal, while more complete basis sets are expected to increase the difference only by about 0.2 kcal. Consideration of these effects and difference in zero-point energy leads to a final estimated splitting of 1.2 kcal, favoring the rhombus. To aid the determination of the ground state, preliminary estimates of the lowest optical transitions were obtained from SRCI calculations and vibrational frequencies were obtained from SCF calculations. Comparison of the calculated results with experimentally obtained spectra suggest the possibility that both the linear triplet and the rhombus may have already been observed. 19 refs., 4 figs., 4 tabs
Brotosudarmo, Tatas H P; Kunz, Ralf; Böhm, Paul; Gardiner, Alastair T; Moulisová, Vladimíra; Cogdell, Richard J; Köhler, Jürgen
2009-09-02
Rhodopseudomonas palustris belongs to the group of purple bacteria that have the ability to produce LH2 complexes with unusual absorption spectra when they are grown at low-light intensity. This ability is often related to the presence of multiple genes encoding the antenna apoproteins. Here we report, for the first time to our knowledge, direct evidence that individual low-light LH2 complexes have a heterogeneous alphabeta-apoprotein composition that modulates the site energies of Bchl a molecules, producing absorption bands at 800, 820, and 850 nm. The arrangement of the Bchl a molecules in the "tightly coupled ring" can be modeled by nine alphabeta-Bchls dimers, such that the Bchls bound to six alphabeta-pairs have B820-like site energies and the remaining Bchl a molecules have B850-like site energies. Furthermore, the experimental data can only be satisfactorily modeled when these six alphabeta-pairs with B820 Bchl a molecules are distributed such that the symmetry of the assembly is reduced to C(3). It is also clear from the measured single-molecule spectra that the energies of the electronically excited states in the mixed B820/850 ring are mainly influenced by diagonal disorder.
Single-Molecule Rotational Switch on a Dangling Bond Dimer Bearing.
Godlewski, Szymon; Kawai, Hiroyo; Kolmer, Marek; Zuzak, Rafał; Echavarren, Antonio M; Joachim, Christian; Szymonski, Marek; Saeys, Mark
2016-09-27
One of the key challenges in the construction of atomic-scale circuits and molecular machines is to design molecular rotors and switches by controlling the linear or rotational movement of a molecule while preserving its intrinsic electronic properties. Here, we demonstrate both the continuous rotational switching and the controlled step-by-step single switching of a trinaphthylene molecule adsorbed on a dangling bond dimer created on a hydrogen-passivated Ge(001):H surface. The molecular switch is on-surface assembled when the covalent bonds between the molecule and the dangling bond dimer are controllably broken, and the molecule is attached to the dimer by long-range van der Waals interactions. In this configuration, the molecule retains its intrinsic electronic properties, as confirmed by combined scanning tunneling microscopy/spectroscopy (STM/STS) measurements, density functional theory calculations, and advanced STM image calculations. Continuous switching of the molecule is initiated by vibronic excitations when the electrons are tunneling through the lowest unoccupied molecular orbital state of the molecule. The switching path is a combination of a sliding and rotation motion over the dangling bond dimer pivot. By carefully selecting the STM conditions, control over discrete single switching events is also achieved. Combined with the ability to create dangling bond dimers with atomic precision, the controlled rotational molecular switch is expected to be a crucial building block for more complex surface atomic-scale devices.
International Nuclear Information System (INIS)
Shirke, A.K.; Pode, R.B.; Deshmukh, B.T.
1996-01-01
Photodecomposition of pure and doped KI powder (KI:KOH; KI:KCN; Impurity concentration, 100, 300, 500, 700 and 1000 ppm) to produce free I 2 molecules during gamma irradiation is studied with the help of absorption and IR measurements. Large number of I 2 molecules are formed in pure KI as compared to the doped samples. Hydroxide impurity increases the rate of liberation of I 2 molecules whereas the cyanide impurity decreases the rate of liberation of I 2 molecules. (Author)
Decoupling Linear and Nonlinear Associations of Gene Expression
Itakura, Alan
2013-05-01
The FANTOM consortium has generated a large gene expression dataset of different cell lines and tissue cultures using the single-molecule sequencing technology of HeliscopeCAGE. This provides a unique opportunity to investigate novel associations between gene expression over time and different cell types. Here, we create a MatLab wrapper for a powerful and computationally intensive set of statistics known as Maximal Information Coefficient, and then calculate this statistic for a large, comprehensive dataset containing gene expression of a variety of differentiating tissues. We then distinguish between linear and nonlinear associations, and then create gene association networks. Following this analysis, we are then able to identify clusters of linear gene associations that then associate nonlinearly with other clusters of linearity, providing insight to much more complex connections between gene expression patterns than previously anticipated.
Decoupling Linear and Nonlinear Associations of Gene Expression
Itakura, Alan
2013-01-01
The FANTOM consortium has generated a large gene expression dataset of different cell lines and tissue cultures using the single-molecule sequencing technology of HeliscopeCAGE. This provides a unique opportunity to investigate novel associations between gene expression over time and different cell types. Here, we create a MatLab wrapper for a powerful and computationally intensive set of statistics known as Maximal Information Coefficient, and then calculate this statistic for a large, comprehensive dataset containing gene expression of a variety of differentiating tissues. We then distinguish between linear and nonlinear associations, and then create gene association networks. Following this analysis, we are then able to identify clusters of linear gene associations that then associate nonlinearly with other clusters of linearity, providing insight to much more complex connections between gene expression patterns than previously anticipated.
Growth failure, somatomedin and growth hormone levels in juvenile diabetes mellitus--a pilot study.
Nash, H
1979-06-01
Growth hormone (hGH) responsiveness to exercise and somatomedin C (SmC) activity were measured in ten children with insulin-deficient diabetes mellitus. Four of the ten children showed a significant degree of growth retardation. Normal SmC activity was found in association with elevated hGH levels. The hypothesis that growth-retarded diabetics have a failure of Sm production despite high hGH levels (analogous to malnutrition and Laron dwarfism) was not substantiated by this study. Chronic deficiency of insulin, itself a somatomedin, may play a major role in diabetic growth failure.
Ohta, Hiromichi; Watanabe, Takanobu; Ohdomari, Iwao
2008-10-01
Potential energy distribution of interstitial O2 molecule in the vicinity of SiO2/Si(001) interface is investigated by means of classical molecular simulation. A 4-nm-thick SiO2 film model is built by oxidizing a Si(001) substrate, and the potential energy of an O2 molecule is calculated at Cartesian grid points with an interval of 0.05 nm in the SiO2 film region. The result shows that the potential energy of the interstitial site gradually rises with approaching the interface. The potential gradient is localized in the region within about 1 nm from the interface, which coincides with the experimental thickness of the interfacial strained layer. The potential energy is increased by about 0.62 eV at the SiO2/Si interface. The result agrees with a recently proposed kinetic model for dry oxidation of silicon [Phys. Rev. Lett. 96, 196102 (2006)], which argues that the oxidation rate is fully limited by the oxidant diffusion.
Nonlinear vs. linear biasing in Trp-cage folding simulations
Energy Technology Data Exchange (ETDEWEB)
Spiwok, Vojtěch, E-mail: spiwokv@vscht.cz; Oborský, Pavel; Králová, Blanka [Department of Biochemistry and Microbiology, University of Chemistry and Technology, Prague, Technická 3, Prague 6 166 28 (Czech Republic); Pazúriková, Jana [Institute of Computer Science, Masaryk University, Botanická 554/68a, 602 00 Brno (Czech Republic); Křenek, Aleš [Institute of Computer Science, Masaryk University, Botanická 554/68a, 602 00 Brno (Czech Republic); Center CERIT-SC, Masaryk Univerzity, Šumavská 416/15, 602 00 Brno (Czech Republic)
2015-03-21
Biased simulations have great potential for the study of slow processes, including protein folding. Atomic motions in molecules are nonlinear, which suggests that simulations with enhanced sampling of collective motions traced by nonlinear dimensionality reduction methods may perform better than linear ones. In this study, we compare an unbiased folding simulation of the Trp-cage miniprotein with metadynamics simulations using both linear (principle component analysis) and nonlinear (Isomap) low dimensional embeddings as collective variables. Folding of the mini-protein was successfully simulated in 200 ns simulation with linear biasing and non-linear motion biasing. The folded state was correctly predicted as the free energy minimum in both simulations. We found that the advantage of linear motion biasing is that it can sample a larger conformational space, whereas the advantage of nonlinear motion biasing lies in slightly better resolution of the resulting free energy surface. In terms of sampling efficiency, both methods are comparable.
Energy Technology Data Exchange (ETDEWEB)
Nehrkorn, Joscha; Milazzo, Ruggero; Stuiber, Stefan; Waldmann, Oliver [Physikalisches Institut, Universitaet Freiburg (Germany); Akhtar, Muhammad Nadeem; Lan, Yanhua; Powell, Annie K. [Institut fuer Anorganische Chemie, Universitaet Karlsruhe, KIT (Germany); Mutka, Hannu [Institut Laue-Langevin, Grenoble (France)
2011-07-01
The discovery of slow relaxation and quantum tunneling of the magnetization in Mn{sub 1}2ac more than 15 years ago has inspired both physicists and chemists alike. This class of molecules, now called single-molecule magnets (SMMs), has very recently been expanded to heterometallic clusters incorporating transition metal and rare earth ions. The 4f ions were chosen because of their large angular momentum and magnetic anisotropy. Inelastic neutron scattering experiments were performed on the time-of-flight disk-chopper spectrometer IN5 at ILL on the SMM Mn{sub 2}Nd{sub 2}. A magnetic model was developed which perfectly describes all data, including the magnetic data. It was found that neither the large anisotropy nor the large angular momentum of the Nd{sup I}II ions is the main reason for the SMM behavior in this molecule. Our analysis of the data indicates that it is the weak coupling of the Nd{sup I}II ions to the Mn{sup I}II ions, usually considered as a drawback of rare earth ions, which enhances the relaxation time and therefore leads to SMM behavior.
Non-Linear MDT Drift Gases like Ar/CO2
Aleksa, Martin
1998-01-01
Detailed measurements and simulations have been performed, investigating the properties of Ar/CO2 mixtures as a MDT drift gas. This note presents these measurements and compares them to other drift gases that have been simulated using GARFIELD, HEED and MAGBOLTZ.This note also describes systematic errors to be considered in the operation of precision drift chambers using such gases. In particular we analyze effects of background rate variations, gas-density changes, variations of the gas composition, autocalibration, magnetic field differences and non-concentricity of the wire. Their impact on the reconstructed muon momentum resolution was simulated with DICE/ATRECON.The different properties of linear and non-linear drift gases and their relative advantages and disadvantages are discussed in detail.
Systematic comparison of different techniques to measure hippocampal subfield volumes in ADNI2
DEFF Research Database (Denmark)
Mueller, Susanne G.; Yushkevich, Paul A.; Das, Sandhitsu
2018-01-01
regression analyses were used to calculate effect sizes (ES) for group, amyloid positivity in controls, and associations with cognitive/memory performance for each approach. Results Subfield volumetry was better than whole hippocampal volumetry for the detection of the mild atrophy differences between...... and T1 subfield approaches. None of the different T2-HghRes methods tested had a clear advantage over the other methods. Each has strengths and weaknesses that need to be taken into account when deciding which one to use to get the best results from subfield volumetry....
International Nuclear Information System (INIS)
England, W.B.
1978-01-01
Uncorrelated and correlated potential energy curves and dipole moments are reported for linear KOH. The compound is found to be ionic, K + OH - . Minimum energy bond lengths are R/sub KO/=4.2913 au and R/sub OH/=1.7688 au, with an estimated accuracy of 2%. The corresponding dipole moment is 3.3 au (8.46 D) with a similar accuracy estimate. This is to our knowledge the first value ever reported for the KOH dipole moment, and the large value suggests that KOH will be an effective electron scatterer in MHD plasmas
Directory of Open Access Journals (Sweden)
Figarella K
2015-12-01
Full Text Available The protozoan parasite Leishmania causes a variety of sicknesses with different clinical manifestations known as leishmaniasis. The chemotherapy currently in use is not adequate because of their side effects, resistance occurrence, and recurrences. Investigations looking for new targets or new active molecules focus mainly on the disruption of parasite specific pathways. In this sense, ergosterol biosynthesis is one of the most attractive because it does not occur in mammals. Here, we report the synthesis of ergosterone coupled molecules and the characterization of their biological activity on Leishmania mexicana promastigotes. Molecule synthesis involved three steps: ergosterone formation using Jones oxidation, synthesis of Girard reagents, and coupling reaction. All compounds were obtained in good yield and high purity. Results show that ergosterone-triazol molecules (Erg-GTr and Erg-GTr2 exhibit an antiproliferative effect in low micromolar range with a selectivity index ~10 when compared to human dermic fibroblasts. Addition of Erg-GTr or Erg-GTr2 to parasites led to a rapid [Ca2+]cyt increase and acidocalcisomes alkalinization, indicating that Ca2+ was released from this organelle. Evaluation of cell death markers revealed some apoptosis-like indicators, as phosphatidylserine exposure, DNA damage, and cytosolic vacuolization and autophagy exacerbation. Furthermore, mitochondrion hyperpolarization and superoxide production increase were detected already 6 hours after drug addition, denoting that oxidative stress is implicated in triggering the observed phenotype. Taken together our results indicate that ergosterone-triazol coupled molecules induce a regulated cell death process in the parasite and may represent starting point molecules in the search of new chemotherapeutic agents to combat leishmaniasis.
Liquefaction of H2 molecules upon exterior surfaces of carbon nanotube bundles
International Nuclear Information System (INIS)
Han, Sang Soo; Kang, Jeung Ku; Lee, Hyuck Mo; Duin, Adri C.T. van; Goddard, William A. III
2005-01-01
We have used molecular dynamics simulations to investigate interaction of H 2 molecules on the exterior surfaces of carbon nanotubes (CNTs): single and bundle types. At 80 K and 10 MPa, it is found that charge transfer occurs from a low curvature region to a high curvature region of the deformed CNT bundle, which develops charge polarization only on the deformed structure. The long-range electrostatic interactions of polarized charges on the deformed CNT bundle with hydrogen molecules are observed to induce a high local-ordering of H 2 gas that results in hydrogen liquefaction. Our predicted heat of hydrogen liquefaction on the CNT bundle is 97.6 kcal kg -1 . On the other hand, hydrogen liquefaction is not observed in the CNT of a single type. This is because charge polarization is not developed on the single CNT as it is symmetrically deformed under the same pressure. Consequently, the hydrogen storage capacity on the CNT bundle is much higher due to liquefaction than that on the single CNT. Additionally, our results indicate that it would also be possible to liquefy H 2 gas on a more strongly polarized CNT bundle at temperatures higher than 80 K
Theoretical investigation of the Te4Br2 molecule in ionic liquids
International Nuclear Information System (INIS)
Elfgen, Roman; Holloczki, Oldamur; Ray, Promit; Kirchner, Barbara; Groh, Matthias F.; Ruck, Michael
2017-01-01
Material synthesis in ionic liquids, at or near room temperature, is currently a subject of immense academic interest. In order to illuminate molecular-level details and the underlying chemistry, we carried out molecular simulations of a single Te 4 Br 2 molecule dissolved in the ionic liquid 1-ethyl-3-methylimidazolium chloride, as well as in the ionic liquid mixed with aluminum chloride. Although the ethyl side chain is much too short to show detailed microheterogeneity, significant structuring with the small chloride anions is seen in case of the pure ionic liquid. In the case of the mixture, formation of larger anionic clusters is distinctly observed and analyzed. Due to the tendency of ionic liquids to dissociate, there is a pronounced shift to elongated Te-Br distances in both investigated solvents. However, only in the AlCl 3 -containing liquid, we observe the reaction of the open chain-like Te 4 Br 2 molecule to a closed square-like Te 4 Br + and AlCl 3 Br - ion. The molecular arrangement of the [Te 4 ] 2+ unit shows negligible deviation from that in the experimental crystal structure. (copyright 2017 WILEY-VCH Verlag GmbH and Co. KGaA, Weinheim)
Haldar, Soumyajyoti
2017-09-13
In this paper, we have done a comparative study of electronic and magnetic properties of iron phthalocyanine (FePc) and cobalt phthalocyanine (CoPc) molecules physisorbed on monolayer of MoS$_2$ and graphene by using density functional theory. Various different types of physisorption sites have been considered for both surfaces. Our calculations reveal that the $M$Pc molecules prefer the S-top position on MoS$_2$. However, on graphene, FePc molecule prefers the bridge position while CoPc molecule prefers the top position. The $M$Pc molecules are physisorbed strongly on the MoS$_2$ surface than the graphene ($\\\\sim$ 2.5 eV higher physisorption energy). Analysis of magnetic properties indicates the presence of strong spin dipole moment opposite to the spin moment and hence a huge reduction of effective spin moment can be observed. Our calculations of magnetic anisotropy energies using both variational approach and $2^{nd}$ order perturbation approach indicate no significant changes after physisorption. In case of FePc, an out-of-plane easy axis and in case of CoPc, an in-plane easy axis can be seen. Calculations of work function indicate a reduction of MoS$_2$ work function $\\\\sim$ 1 eV due to physisorption of $M$Pc molecules while it does not change significantly in case of graphene.
International Nuclear Information System (INIS)
Dagdigian, P.J.; Alexander, M.H.; Liu, K.; Department of Chemistry, University of Maryland, College Park, Maryland 20742; Gas Phase Chemical Dynamics Group, Chemistry Division, Argonne National Laboratory, 9700 South Cass Avenue, Argonne, Illinois 60439)
1989-01-01
The quantum formalism for the scattering of a diatomic molecule in a 2 Pi electronic state which is well described by Hund's case (b) limit is investigated here. For a particular JF/sub i/ yields J'F'/sub 1/ transition, quantum interference effects will lead to preferential population of one of the final state Λ doublet levels. The nonstatistical population of final state Λ doublet levels arises from an interference between terms in the expansion of the two electrostatic potential energy surfaces, of A' and A'' reflection symmetry, which describe the interaction between a molecule in a Pi electronic state and a closed-shell partner. The particular Λ doublet level preferred is opposite for molecules of π 1 vs π 3 electron occupancy. The physical origin of this reversal in the Λ doublet propensity is a direct reflection of the fact that for the former the A' potential surface is more repulsive since the sole π electron lies in the triatomic plane in this case, whereas for molecules of π 3 electron occupancy the A' surface is less repulsive than the A'' surface since for the A' surface only one of the three π electrons lies in the triatomic plane. The magnitude of these Λ doublet propensities is illustrated by calculated cross sections for the CH(X 2 Pi)--He system using the ab initio potential energy surfaces calculated by the Argonne theoretical group, and these cross sections are compared to those of the crossed molecular study of Liu and Macdonald [J. Chem. Phys. 61, xxxx (1989)]. A similar analysis is carried out for collisions of a molecule of π 3 electron occupancy and is illustrated by inelastic collisions of OH(X 2 Pi)
Ion-molecule reactions in the binary mixture of ethylene oxide and trioxane, 2
International Nuclear Information System (INIS)
Kumakura, Minoru; Arakawa, Kazuo; Sugiura, Toshio.
1978-01-01
The ion-molecule reactions in the binary mixture of ethylene oxide and trioxane have been studied with use of a modified time-of-flight mass spectrometer. As cross-reaction product ions, C 3 H 5 O 2 + , C 3 H 6 O 2 +sup(, and C**3**H**7**O**2**)+sup( were observed under the conditions of long delay times and elevated pressure. It was found that these ions are formed by the dissociation of unstable intermediate-complex resulting from the reaction of ethylene oxide molecular ion with trioxane. It was proposed that the complex is of cyclic structure in which positive charge is delocalized. From the consideration of isotopic distribution of the product ions in ethylene-d**4** oxide-trioxane mixtures, the skeletal structures of the product ions were investigated. The rate constants of the formation reactions of C**3**H**5**O**2**)+sup(, C**3**H**6**O**2**)+sup(, and C**3**H**7**O**2**)+sup( in ethylene oxide-trioxane mixtures were found to be 2.20 x 10)-10sup(, 2.61 x 10)-10sup(, and 1.74 x 10)-10sup( cm)3sup( molecule)-1sup(s)-1 , respectively. (auth.)
International Nuclear Information System (INIS)
Handa, Makoto; Yamada, Kori; Nakao, Tadahiro; Matsumoto, Hiroki; Kasuga, Kuninobu; Mikuriya, Masahiro; Kotera, Takanori.
1995-01-01
A series of linear-chain complexes of molybdenum (II) acetate linked by bidentate bridging ligands, [Mo 2 (O 2 CCH 3 ) 4 L] n (L=pyrazine (pyz), 4,4'-bipyridine (4,4'-bpy), and 1,4-diazabicyclo[2.2.2]octane (dabco)), have been prepared, and their crystal structures determined by an X-ray diffraction method. It has been shown that the relatively weak coordinations of the bridging ligands at the axial positions of Mo 2 (O 2 CCH 3 ) 4 (Mo-N=2.619 (8)-2.658(6) A) can effectively control the arrangement of the dimer units to give chain structures with good linearities. No significant interactions between the dimer units have been observed. (author)
Selected ion flow tube studies of S2+ reactions with a series of organic molecules
Decker, Brian K.; Adams, Nigel G.
1997-11-01
A selected ion flow tube (SIFT) has been used to study the reactions of S2+ with a series of organic molecules (as well as H2, CO, NH3, NO and NO2). These include the hydrocarbons, C2H4, C2H6, CH2CCH2, CH3CHCH2 and C3H8; alcohols and thiols, CH3OH, C2H5OH, CH3SH and C2H5SH; ethers (CH3)2O and (C2H5)2O; aldehydes and ketones, CH3CHO, C2H5CHO and (CH3)2CO; and carboxylic acids and esters, HCO2H, HCO2CH3, HCO2C2H5, CH3CO2H, CH3CO2CH3, CH3CO2C2H5, C2H5CO2H, C2H5CO2CH3 and C2H5CO2C2H5. The rate coefficients are generally close to the collisional values, with exceptions among the reactions involving the smaller molecules. Most prevalent are abstraction reactions leading to formation of the thiosulfeno radical, HS2, or its protonated form; three-body associations; and channels leading to formation of the acetyl and propionyl cations, CH3CO+ and C2H5CO+, respectively. Only in reactions involving the alkenes is cleavage of the S---S bond of S2+ observed. The isomeric molecules in the data set generally react very differently, as would be expected from reactivity controlled by the position and complexity of the functional groups. The data are discussed in terms of reaction mechanisms, thermodynamics, and implications for interstellar chemistry.
Pre-clinical evaluation of small molecule LOXL2 inhibitors in breast cancer
DEFF Research Database (Denmark)
Chang, Joan; Lucas, Morghan C; Leonte, Lidia Elena
2017-01-01
inhibitor in the MDA-MB-231 human model of breast cancer. We confirmed a functional role for LOXL2 activity in the progression of primary breast cancer. Inhibition of LOXL2 activity inhibited the growth of primary tumors and reduced primary tumor angiogenesis. Dual inhibition of LOXL2 and LOX showed...... a greater effect and also led to a lower overall metastatic burden in the lung and liver. Our data provides the first evidence to support a role for LOXL2 specific small molecule inhibitors as a potential therapy in breast cancer....
Dissociation in small molecules
International Nuclear Information System (INIS)
Dehmer, P.M.
1982-01-01
The study of molecular dissociation processes is one of the most interesting areas of modern spectroscopy owing to the challenges presented bt even the simplest of diatomic molecules. This paper reviews the commonly used descriptions of molecular dissociation processes for diatomic molecules, the selection rules for predissociation, and a few of the principles to be remembered when one is forced to speculate about dissociation mechanisms in a new molecule. Some of these points will be illustrated by the example of dissociative ionization in O 2
Linearly Polarized IR Spectroscopy Theory and Applications for Structural Analysis
Kolev, Tsonko
2011-01-01
A technique that is useful in the study of pharmaceutical products and biological molecules, polarization IR spectroscopy has undergone continuous development since it first emerged almost 100 years ago. Capturing the state of the science as it exists today, "Linearly Polarized IR Spectroscopy: Theory and Applications for Structural Analysis" demonstrates how the technique can be properly utilized to obtain important information about the structure and spectral properties of oriented compounds. The book starts with the theoretical basis of linear-dichroic infrared (IR-LD) spectroscop
Energy storage and redistribution in molecules
International Nuclear Information System (INIS)
Hinze, J.
1983-01-01
This book presents information on the following topics: chemistry and spectroscopy of molecules at high levels of excitation; energy and phase randomization in large molecules as probed by laser spectroscopy; intramolecular processes in isolated polyatomic molecules; pulse-probe measurements in low-temperature, low-pressure SF 6 ; the photodissociation dynamics of H 2 S and CF 3 NO; photofragment spectroscopy of the NO 2 dissociation; preparation, laser spectroscopy and predissociation of alkali dimers in supersonic nozzle beams; excited states of small molecules - collisional quenching and photodissociation; quantum-state-resolved scattering of lithium hydride; and molecular negative ions
International Nuclear Information System (INIS)
Kudin, L.S.; Balduchchi, Dzh.; Dzhil'i, G.; Gvido, M.
1982-01-01
During the mass spectrometric investigation of BaCrO 4 evaporation Cr + , Ba + , BaO + main ions are recorded as well as BaMoO 4 + , BaMoO 3 + , BaMoO 2 + , BaMoO + , BaMoO 4 + , Ba 2 MoO 5 + , BaMo 2 O 8 + ions - the products of ionization of three-component (Ba, Mo, M) molecules, forming as a result of substance chemical interaction with the material of an effusion cell (Mo). Heats of formation of BaMoO 2 , Ba 2 MoO 4 , Ba 2 MoO 5 and Ba 2 Mo 2 O 8 molecules which constituted - 577+-70, -1343+-115, -1464+-70, -2393+-90 k J/mol respectively are determined on the base of the analysis of curves of ionisation efficiency and of reaction heats Ba 2 MoO 5 =BaO+BaMoO 4 , ΔH 0 0 =322+-60 kJ/mol Ba 2 Mo 2 O 8 =2BaMoO 4 , ΔH 0 0 =351+-80 kJ/mol calculated with the use of third low of thermodynamics [ru
Linear Collider Physics Resource Book for Snowmass 2001, 2 Higgs and Supersymmetry Studies
Abe, T.; Asner, David Mark; Baer, H.; Bagger, Jonathan A.; Balazs, Csaba; Baltay, C.; Barker, T.; Barklow, T.; Barron, J.; Baur, Ulrich J.; Beach, R.; Bellwied, R.; Bigi, Ikaros I.Y.; Blochinger, C.; Boege, S.; Bolton, T.; Bower, G.; Brau, James E.; Breidenbach, Martin; Brodsky, Stanley J.; Burke, David L.; Burrows, Philip N.; Butler, Joel N.; Chakraborty, Dhiman; Cheng, Hsin-Chia; Chertok, Maxwell Benjamin; Choi, Seong-Youl; Cinabro, David; Corcella, Gennaro; Cordero, R.K.; Danielson, N.; Davoudiasl, Hooman; Dawson, S.; Denner, Ansgar; Derwent, P.; Diaz, Marco Aurelio; Dima, M.; Dittmaier, Stefan; Dixit, M.; Dixon, Lance J.; Dobrescu, Bogdan A.; Doncheski, M.A.; Duckwitz, M.; Dunn, J.; Early, J.; Erler, Jens; Feng, Jonathan L.; Ferretti, C.; Fisk, H.Eugene; Fraas, H.; Freitas, A.; Frey, R.; Gerdes, David W.; Gibbons, L.; Godbole, R.; Godfrey, S.; Goodman, E.; Gopalakrishna, Shrihari; Graf, N.; Grannis, Paul D.; Gronberg, Jeffrey Baton; Gunion, John F.; Haber, Howard E.; Han, Tao; Hawkings, Richard; Hearty, Christopher; Heinemeyer, Sven; Hertzbach, Stanley S.; Heusch, Clemens A.; Hewett, JoAnne L.; Hikasa, K.; Hiller, G.; Hoang, Andre H.; Hollebeek, Robert; Iwasaki, M.; Jacobsen, Robert Gibbs; Jaros, John Alan; Juste, A.; Kadyk, John A.; Kalinowski, J.; Kalyniak, P.; Kamon, Teruki; Karlen, Dean; Keller, L; Koltick, D.; Kribs, Graham D.; Kronfeld, Andreas Samuel; Leike, A.; Logan, Heather E.; Lykken, Joseph D.; Macesanu, Cosmin; Magill, Stephen R.; Marciano, William Joseph; Markiewicz, Thomas W.; Martin, S.; Maruyama, T.; Matchev, Konstantin Tzvetanov; Monig, Klaus; Montgomery, Hugh E.; Moortgat-Pick, Gudrid A.; Moreau, G.; Mrenna, Stephen; Murakami, Brandon; Murayama, Hitoshi; Nauenberg, Uriel; Neal, H.; Newman, B.; Nojiri, Mihoko M.; Orr, Lynne H.; Paige, F.; Para, A.; Pathak, S.; Peskin, Michael E.; Plehn, Tilman; Porter, F.; Potter, C.; Prescott, C.; Rainwater, David Landry; Raubenheimer, Tor O.; Repond, J.; Riles, Keith; Rizzo, Thomas Gerard; Ronan, Michael T.; Rosenberg, L.; Rosner, Jonathan L.; Roth, M.; Rowson, Peter C.; Schumm, Bruce Andrew; Seppala, L.; Seryi, Andrei; Siegrist, J.; Sinev, N.; Skulina, K.; Sterner, K.L.; Stewart, I.; Su, S.; Tata, Xerxes Ramyar; Telnov, Valery I.; Teubner, Thomas; Tkaczyk, S.; Turcot, Andre S.; van Bibber, Karl A.; Van Kooten, Rick J.; Vega, R.; Wackeroth, Doreen; Wagner, D.; Waite, Anthony P.; Walkowiak, Wolfgang; Weiglein, Georg; Wells, James Daniel; Wester, William Carl, III; Williams, B.; Wilson, G.; Wilson, R.; Winn, D.; Woods, M.; Wudka, J.; Yakovlev, Oleg I.; Yamamoto, H.; Yang, Hai Jun
2001-01-01
This Resource Book reviews the physics opportunities of a next-generation e+e- linear collider and discusses options for the experimental program. Part 2 reviews the possible experiments on Higgs bosons and supersymmetric particles that can be done at a linear collider.
Wavelet-based linear-response time-dependent density-functional theory
International Nuclear Information System (INIS)
Natarajan, Bhaarathi; Genovese, Luigi; Casida, Mark E.; Deutsch, Thierry; Burchak, Olga N.
2012-01-01
Highlights: ► We has been implemented LR-TD-DFT in the pseudopotential wavelet-based program. ► We have compared the results against all-electron Gaussian-type program. ► Orbital energies converges significantly faster for BigDFT than for DEMON2K. ► We report the X-ray crystal structure of the small organic molecule flugi6. ► Measured and calculated absorption spectrum of flugi6 is also reported. - Abstract: Linear-response time-dependent (TD) density-functional theory (DFT) has been implemented in the pseudopotential wavelet-based electronic structure program BIGDFT and results are compared against those obtained with the all-electron Gaussian-type orbital program DEMON2K for the calculation of electronic absorption spectra of N 2 using the TD local density approximation (LDA). The two programs give comparable excitation energies and absorption spectra once suitably extensive basis sets are used. Convergence of LDA density orbitals and orbital energies to the basis-set limit is significantly faster for BIGDFT than for DEMON2K. However the number of virtual orbitals used in TD-DFT calculations is a parameter in BIGDFT, while all virtual orbitals are included in TD-DFT calculations in DEMON2K. As a reality check, we report the X-ray crystal structure and the measured and calculated absorption spectrum (excitation energies and oscillator strengths) of the small organic molecule N-cyclohexyl-2-(4-methoxyphenyl)imidazo[1, 2-a]pyridin-3-amine.
Off-shell N=2 linear multiplets in five dimensions
Energy Technology Data Exchange (ETDEWEB)
Ozkan, Mehmet [Department of Physics, Istanbul Technical University,Maslak 34469 Istanbul (Turkey)
2016-11-25
We present a superconformal tensor calculus for an arbitrary number of five dimensional N=2 linear multiplets. We also demonstrate how to construct higher derivative invariants, and produce higher order supersymmetric off-diagonal models. Finally, we show the procedure required for the derivation of the supersymmetric completion of the non-Abelian F{sup 4} action.
A barrier-free atomic radical-molecule reaction: N (2D) NO2 (2A1) mechanistic study
Zuo, Ming-Hui; Liu, Hui-Ling; Huang, Xu-Ri; Zhan, Jin-Hui; Sun, Chia-Chung
The reaction of N (2D) radical with NO2 molecule has been studied theoretically using density functional theory and ab initio quantum chemistry method. Singlet electronic state [N2O2] potential energy surfaces (PES) are calculated at the CCSD(T)/aug-cc-pVDZ//B3LYP/6-311+G(d) + ZPE and G3B3 levels of theory. All the involved transition states for generation of (2NO) and (O2 + N2) lie much lower than the reactants. Thus, the novel reaction N + NO2 can proceed effectively even at low temperatures and it is expected to play a role in both combustion and interstellar processes. On the basis of the analysis of the kinetics of all pathways through which the reactions proceed, we expect that the competitive power of reaction pathways may vary with experimental conditions for the title reaction.
Interaction of multicharged ions with molecules (CO2, C60) by coincident electron spectroscopy
International Nuclear Information System (INIS)
Moretto-Capelle, P.; Bordenave-Montesquieu, D.; Bordenave-Montesquieu, A.
2001-01-01
First results for the investigation of electron capture processes in collisions between multicharged ions and molecule targets using electron spectroscopy in coincidence with charged fragments, are presented. It is shown that a much more detailed investigation of the capture reaction can be achieved using molecular instead of heavy atomic targets provided that an analysis of the target dissociation is made. The collisional systems 18 O 8+ +Ar, CO 2 and C 60 have been studied at 80 keV. Non coincident electron spectra as well as first results of double or triple coincidence experiments are discussed. Kinetic energy distributions of the C n + fragments (n=1 to 8) produced in multiple capture processes from C 60 target are given. A detailed investigation of the double capture process with CO 2 molecule allows the measurement of kinetic energy release distributions (KERD) which characterize the dissociation of CO 2 2+ molecular ions; our results are found to be very similar to those measured in double photoionisation experiments. (orig.)
The Dangers of Estimating V˙O2max Using Linear, Nonexercise Prediction Models.
Nevill, Alan M; Cooke, Carlton B
2017-05-01
This study aimed to compare the accuracy and goodness of fit of two competing models (linear vs allometric) when estimating V˙O2max (mL·kg·min) using nonexercise prediction models. The two competing models were fitted to the V˙O2max (mL·kg·min) data taken from two previously published studies. Study 1 (the Allied Dunbar National Fitness Survey) recruited 1732 randomly selected healthy participants, 16 yr and older, from 30 English parliamentary constituencies. Estimates of V˙O2max were obtained using a progressive incremental test on a motorized treadmill. In study 2, maximal oxygen uptake was measured directly during a fatigue limited treadmill test in older men (n = 152) and women (n = 146) 55 to 86 yr old. In both studies, the quality of fit associated with estimating V˙O2max (mL·kg·min) was superior using allometric rather than linear (additive) models based on all criteria (R, maximum log-likelihood, and Akaike information criteria). Results suggest that linear models will systematically overestimate V˙O2max for participants in their 20s and underestimate V˙O2max for participants in their 60s and older. The residuals saved from the linear models were neither normally distributed nor independent of the predicted values nor age. This will probably explain the absence of a key quadratic age term in the linear models, crucially identified using allometric models. Not only does the curvilinear age decline within an exponential function follow a more realistic age decline (the right-hand side of a bell-shaped curve), but the allometric models identified either a stature-to-body mass ratio (study 1) or a fat-free mass-to-body mass ratio (study 2), both associated with leanness when estimating V˙O2max. Adopting allometric models will provide more accurate predictions of V˙O2max (mL·kg·min) using plausible, biologically sound, and interpretable models.
Novel linear polymers able to inhibit bacterial quorum sensing.
Cavaleiro, Eliana; Duarte, Ana Sofia; Esteves, Ana Cristina; Correia, António; Whitcombe, Michael J; Piletska, Elena V; Piletsky, Sergey A; Chianella, Iva
2015-05-01
Bacterial phenotypes, such as biofilm formation, antibiotic resistance and virulence expression, are associated with quorum sensing. Quorum sensing is a density-dependent regulatory system of gene expression controlled by specific signal molecules, such as N-acyl homoserine lactones (AHLs), produced and released by bacteria. This study reports the development of linear polymers capable to attenuate quorum sensing by adsorption of AHLs. Linear polymers were synthesized using MMA as backbone monomer and methacrylic acid and itaconic acid as functional monomers. Two different quorum sensing-controlled phenotypes, Vibrio fischeri bioluminescence and Aeromonas hydrophila biofilm formation, were evaluated to test the polymers' efficiency. Results showed that both phenotypes were significantly affected by the polymers, with the itaconic acid-containing material being more effective than the methacrylic acid one. The polymer inhibitory effects were reverted by the addition of lactones, confirming attenuation of quorum sensing through sequestration of signal molecules. The polymers also showed no cytotoxicity when tested using a mammalian cell line. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Habuchi, Satoshi
2015-04-21
Diffusion dynamics of topological isomers of polymer molecules was investigated at the single-molecule level in a melt state by employing the fluorophore-incorporated 4-armed star and the corresponding doubly-cyclized, 8-shaped poly(THF) chains. While the single-molecule fluorescence imaging experiment revealed that the diffusion of the 4-armed star polymer was described by a single Gaussian distribution, the diffusion of the 8-shaped polymer exhibited a double Gaussian distribution behaviour. We reasoned that the two 8-shaped polymeric isomers have distinct diffusion modes in the melt state, although ensemble-averaged experimental methods cannot detect differences in overall conformational state of the isomers. The single-molecule experiments suggested that one of the 8-shaped polymeric isomer, having the horizontally oriented form, causes an efficient threading with the linear matrix chains which leads to the slower diffusion compared with the corresponding 4-armed star polymer, while the other 8-shaped polymeric isomer, having the vertically oriented form, displayed faster diffusion by the suppression of effective threading with the linear matrix chains due to its contracted chain conformation.
Temperature dependence of third order ion molecule reactions. The reaction H+3 + 2H2 = H+5 + H2
International Nuclear Information System (INIS)
Hiraoka, K.; Kebarle, P.
1975-01-01
The rate constants k 1 for Reaction (1): H + 3 +2H 2 = H + 5 +H 2 were measured in the temperature range 100--300 degreeK. The temperature dependence of k 1 has the form k 1 proportionalT - /subn/, where n=2.3. Pierce and Porter have reported a much stronger negative temperature dependence with n=4.6. The difference arises from a determination of k 1 at 300 degreeK obtained by Arifov and used by Porter. The present k 1 (300 degreeK) =9times10 -30 (cm 6 molecules -2 center-dotsec -1 ). This is more than an order of magnitude larger than the Arifov value. The temperature dependence of third body dependent association reactions like (1) is examined on the basis of the energy transfer theory and the recently proposed trimolecular complex transition state theory by Meot-Ner, Solomon, Field, and Gershinowitz. The temperature dependence of the rate constant for the reverse reaction (-1) is obtained from k 1 and the previously determined temperature dependence of the equilibria (1). k/sub -//sub 1/ gives a good straight line Arrhenius plot leading to k/sub -//sub 1/ =8.7times10 -6 exp(-8.4/RT) cm 3 molecules -1 center-dotsec -1 . The activation energy is in kcal/mole. The preexponential factor is much larger than the rate constant for Langevin collisions. This is typical for pyrolysis of ions involving second order activation
Indian Academy of Sciences (India)
Cyclo bu tadiene (1) has been one of the most popular molecules for experimentalists and theoreticians. This molecule is unstable as . it is antiaromatic ( 4,n electrons in a cyclic array). Even though some highly substituted cyclobutadienes, for example, compound 2 and the Fe(CO)3 complex of cyclobutadiene (3) are ...
Shake-up transitions in S 2p, S 2s and F 1s photoionization of the SF6 molecule
International Nuclear Information System (INIS)
Decleva, P; Fronzoni, G; Kivimaeki, A; Alvarez Ruiz, J; Svensson, S
2009-01-01
Shake-up transitions occurring upon core photoionization in the SF 6 molecule have been studied experimentally and theoretically. The S 2p, S 2s and F 1s shake-up satellite photoelectron spectra were measured using Al Ka radiation at 1487 eV photon energy. They have been interpreted with the aid of ab initio configuration interaction calculations in the sudden-limit approximation. For the S 2p spectrum, conjugate shake-up transitions were also calculated. Clear evidence of conjugate processes is observed in the S 2p shake-up spectrum measured at 230 eV photon energy. The experimental and theoretical S 2p and S 2s shake-up spectra show very similar structures mainly due to orbital relaxation involving S 3s and 3p participation. For the calculation of the F 1s shake-up spectrum, the symmetry lowering of the molecule in the final states was considered, resulting in a good agreement with the experiment.
2-D linear motion system. Innovative technology summary report
International Nuclear Information System (INIS)
1998-11-01
The US Department of Energy's (DOE's) nuclear facility decontamination and decommissioning (D and D) program requires buildings to be decontaminated, decommissioned, and surveyed for radiological contamination in an expeditious and cost-effective manner. Simultaneously, the health and safety of personnel involved in the D and D activities is of primary concern. D and D workers must perform duties high off the ground, requiring the use of manlifts or scaffolding, often, in radiologically or chemically contaminated areas or in areas with limited access. Survey and decontamination instruments that are used are sometimes heavy or awkward to use, particularly when the worker is operating from a manlift or scaffolding. Finding alternative methods of performing such work on manlifts or scaffolding is important. The 2-D Linear Motion System (2-D LMS), also known as the Wall Walker trademark, is designed to remotely position tools and instruments on walls for use in such activities as radiation surveys, decontamination, and painting. Traditional (baseline) methods for operating equipment for these tasks require workers to perform duties on elevated platforms, sometimes several meters above the ground surface and near potential sources of contamination. The Wall Walker 2-D LMS significantly improves health and safety conditions by facilitating remote operation of equipment. The Wall Walker 2-D LMS performed well in a demonstration of its precision, accuracy, maneuverability, payload capacity, and ease of use. Thus, this innovative technology is demonstrated to be a viable alternative to standard methods of performing work on large, high walls, especially those that have potential contamination concerns. The Wall Walker was used to perform a final release radiological survey on over 167 m 2 of walls. In this application, surveying using a traditional (baseline) method that employs an aerial lift for manual access was 64% of the total cost of the improved technology. However
International Nuclear Information System (INIS)
Tian, Si-Cong; Tong, Cun-Zhu; Ning, Yong-Qiang; Qin, Li; Liu, Yun; Wan, Ren-Gang
2014-01-01
Optical spectroscopy, a powerful tool for probing and manipulating quantum dots (QDs), has been used to investigate the resonance fluorescence spectrum from linear triple quantum dot molecules controlled by tunneling, using atomic physics methods. Interesting features such as quenching and narrowing of the fluorescence are observed. In such molecules the tunneling between the quantum dots can also induce a dark state. The results are explained by the transition properties of the dressed states generated by the coupling of the laser and the tunneling. Unlike the atomic system, in such quantum dot molecules quantum coherence can be induced using tunneling, requiring no coupling lasers, which will allow tunneling controllable quantum dot molecules to be applied to quantum optics and photonics. (paper)
Fast Arc-Annotated Subsequence Matching in Linear Space
DEFF Research Database (Denmark)
Bille, Philip; Gørtz, Inge Li
2010-01-01
is deleted any arc with an endpoint in that base is also deleted. Arc-annotated strings where the arcs are "nested" are a natural model of RNA molecules that captures both the primary and secondary structure of these. The arc-preserving subsequence problem for nested arc-annotated strings is basic primitive...... for investigating the function of RNA molecules. Gramm et al. [ACM Trans. Algorithms 2006] gave an algorithm for this problem using O(nm) time and space, where m and n are the lengths of P and Q, respectively. In this paper we present; a new algorithm using O(nm) time and O(n+m,) space, thereby matching...... the previous time bound while significantly reducing the space from a quadratic term to linear. This is essential to process large RNA molecules where the space is a likely to be a bottleneck. To obtain our result we introduce several novel ideas which may be of independent interest for related problems on arc...
Carbon chain molecules in interstellar clouds
International Nuclear Information System (INIS)
Winnewisser, G.; Walmsley, C.M.
1979-01-01
A survey of the distribution of long carbon chain molecules in interstellar clouds shows that their abundance is correlated. The various formation schemes for these molecules are discussed. It is concluded that the ion-molecule type formation mechanisms are more promising than their competitors. They have also the advantage of allowing predictions which can be tested by observations. Acetylene C 2 H 2 and diacetylene HCCCCH, may be very abundant in interstellar clouds. (Auth.)
Growth hormone therapy: emerging dilemmas.
Laron, Zvi
2011-06-01
The history of pituitary growth hormone (GH) started 100 years ago but the isolation purification and determination of the chemical structure of the human GH (hGH) took another 50 years. Starting in 1957 hGH was extracted from cadaver pituitaries and its clinical use was restricted to severe GH deficient patient. With the invention of recombinant biosynthetic hGH in 1985; the indications for its use were extended. The major approved medications are GH deficiency and short statured children of various etiologies. This is a critical review of present and future use of human GH. To evaluate the effectiveness of the hGH treatment several pharmaceutical companies established postmarketing follow-up programs which are based on the reliability and cooperation of the treating physicians. Unfortunately they stop when the treatment is terminated and most studies refer to growth stimulation effectiveness during initial years but do not follow the children until final height. The long-term experience enabled to evaluate adverse effects (AE), the majority being due to large dosage. The most serious AE reported are increases in malignancies and early or late mortality in adult age. There is consensus that GH deficient children need replacement therapy. As long-term hGH treatment is expensive and the final height gains in non-GH deficient children small the cost-benefit indications to treat short children without a disease has been questioned. To avoid the need of daily injections, long-acting hGH preparations undergo clinical trials. The future will show their effectiveness and eventual adverse effects.
Pandey, Urmila; Srivastava, Mayuri; Singh, R P; Yadav, R A
2014-08-14
The conformational and IR and Raman spectral studies of 2-(2-hydroxyphenyl)benzothiazole have been carried out by using the DFT method at the B3LYP/6-311++G(**) level. The detailed vibrational assignments have been done on the basis of calculated potential energy distributions. Comparative studies of molecular geometries, atomic charges and vibrational fundamentals of all the conformers have been made. There are four possible conformers for this molecule. The optimized geometrical parameters obtained by B3LYP/6-311++G(**) method showed good agreement with the experimental X-ray data. The atomic polar tensor (APT) charges, Mulliken atomic charges, natural bond orbital (NBO) analysis and HOMO-LUMO energy gap of HBT and its conformers were also computed. Copyright © 2014 Elsevier B.V. All rights reserved.
A 4Σ1/2-X2Π1/2 transition in the electronic spectrum of the CuS molecule
International Nuclear Information System (INIS)
Lefebvre, Y.; Delaval, J.M.; Schamps, J.
1991-01-01
The (0-0) band of a new 4 Σ 1/2 -X 2 Π 1/2 transition has been observed in the hollow cathode emission spectra of the CuS molecule. Rotational analysis provides the following molecular constants (in cm -1 ) for the D 4 Σ 1/2 state: T 0 = 23112.88; B 0 = 0.17453; p 0 = 0.858; p 0j = 3.3x10 -6 ; D 0 = 0.11x10 -6 . Pulsed dye laser fluorescence experiments confirm the general diagram of the observed CuS electronic states. (orig.)
Single-Molecule Interfacial Electron Transfer
Energy Technology Data Exchange (ETDEWEB)
Lu, H. Peter [Bowling Green State Univ., Bowling Green, OH (United States). Dept. of Chemistry and Center for Photochemical Sciences
2017-11-28
This project is focused on the use of single-molecule high spatial and temporal resolved techniques to study molecular dynamics in condensed phase and at interfaces, especially, the complex reaction dynamics associated with electron and energy transfer rate processes. The complexity and inhomogeneity of the interfacial ET dynamics often present a major challenge for a molecular level comprehension of the intrinsically complex systems, which calls for both higher spatial and temporal resolutions at ultimate single-molecule and single-particle sensitivities. Combined single-molecule spectroscopy and electrochemical atomic force microscopy approaches are unique for heterogeneous and complex interfacial electron transfer systems because the static and dynamic inhomogeneities can be identified and characterized by studying one molecule at a specific nanoscale surface site at a time. The goal of our project is to integrate and apply these spectroscopic imaging and topographic scanning techniques to measure the energy flow and electron flow between molecules and substrate surfaces as a function of surface site geometry and molecular structure. We have been primarily focusing on studying interfacial electron transfer under ambient condition and electrolyte solution involving both single crystal and colloidal TiO2 and related substrates. The resulting molecular level understanding of the fundamental interfacial electron transfer processes will be important for developing efficient light harvesting systems and broadly applicable to problems in fundamental chemistry and physics. We have made significant advancement on deciphering the underlying mechanism of the complex and inhomogeneous interfacial electron transfer dynamics in dyesensitized TiO2 nanoparticle systems that strongly involves with and regulated by molecule-surface interactions. We have studied interfacial electron transfer on TiO2 nanoparticle surfaces by using ultrafast single-molecule
PCR-based detection of a rare linear DNA in cell culture
Directory of Open Access Journals (Sweden)
Saveliev Sergei V.
2002-01-01
Full Text Available The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 107 or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.
PCR-based detection of a rare linear DNA in cell culture.
Saveliev, Sergei V.
2002-11-11
The described method allows for detection of rare linear DNA fragments generated during genomic deletions. The predicted limit of the detection is one DNA molecule per 10(7) or more cells. The method is based on anchor PCR and involves gel separation of the linear DNA fragment and chromosomal DNA before amplification. The detailed chemical structure of the ends of the linear DNA can be defined with the use of additional PCR-based protocols. The method was applied to study the short-lived linear DNA generated during programmed genomic deletions in a ciliate. It can be useful in studies of spontaneous DNA deletions in cell culture or for tracking intracellular modifications at the ends of transfected DNA during gene therapy trials.
Yi, Jun; Yang, Wenhong; Sun, Wen-Hua; Nomura, Kotohiro; Hada, Masahiko
2017-11-30
The NMR chemical shifts of vanadium ( 51 V) in (imido)vanadium(V) dichloride complexes with imidazolin-2-iminato and imidazolidin-2-iminato ligands were calculated by the density functional theory (DFT) method with GIAO. The calculated 51 V NMR chemical shifts were analyzed by the multiple linear regression (MLR) analysis (MLRA) method with a series of calculated molecular properties. Some of calculated NMR chemical shifts were incorrect using the optimized molecular geometries of the X-ray structures. After the global minimum geometries of all of the molecules were determined, the trend of the observed chemical shifts was well reproduced by the present DFT method. The MLRA method was performed to investigate the correlation between the 51 V NMR chemical shift and the natural charge, band energy gap, and Wiberg bond index of the V═N bond. The 51 V NMR chemical shifts obtained with the present MLR model were well reproduced with a correlation coefficient of 0.97.
Tunnel current across linear homocatenated germanium chains
International Nuclear Information System (INIS)
Matsuura, Yukihito
2014-01-01
The electronic transport properties of germanium oligomers catenating into linear chains (linear Ge chains) have been theoretically studied using first principle methods. The conduction mechanism of a Ge chain sandwiched between gold electrodes was analyzed based on the density of states and the eigenstates of the molecule in a two-probe environment. Like that of silicon chains (Si chains), the highest occupied molecular orbital of Ge chains contains the extended σ-conjugation of Ge 4p orbitals at energy levels close to the Fermi level; this is in contrast to the electronic properties of linear carbon chains. Furthermore, the conductance of a Ge chain is expected to decrease exponentially with molecular length L. The decay constant β, which is defined as e −βL , of a Ge chain is similar to that of a Si chain, whereas the conductance of the Ge chains is higher than that of Si chains even though the Ge–Ge bond length is longer than the Si–Si bond length
Hyperfine-Structure-Induced Depolarization of Impulsively Aligned I2 Molecules
Thomas, Esben F.; Søndergaard, Anders A.; Shepperson, Benjamin; Henriksen, Niels E.; Stapelfeldt, Henrik
2018-04-01
A moderately intense 450 fs laser pulse is used to create rotational wave packets in gas phase I2 molecules. The ensuing time-dependent alignment, measured by Coulomb explosion imaging with a delayed probe pulse, exhibits the characteristic revival structures expected for rotational wave packets but also a complex nonperiodic substructure and decreasing mean alignment not observed before. A quantum mechanical model attributes the phenomena to coupling between the rotational angular momenta and the nuclear spins through the electric quadrupole interaction. The calculated alignment trace agrees very well with the experimental results.
International Nuclear Information System (INIS)
Zyubina, T.S.; Charkin, O.P.
1991-01-01
Using several basic sets and taking into consideration electron correlation in the framework of MP3 approximation, non-empiric calculations of the structure and stability of HAO 2 , HAS 2 , HOAS, HSAO molecules and ions with 16 valent electrons (A = B, Al, C + , Si + ) were made. Similarity of OAS, AO 2 , AS 2 (A = B - , Al - , C, Si) molecules and ions to proton was ascertained
A SIFT study of the reactions of H2ONO+ ions with several types of organic molecules
Smith, David; Wang, Tianshu; Spanel, Patrik
2003-11-01
A selected ion flow tube (SIFT) study has been carried out of the reactions of hydrated nitrosonium ions, NO+H2O, which theory has equated to protonated nitrous acid ions, H2ONO+. One objective of this study was to investigate if this ion exhibits the properties of both a cluster ion and a protonated acid in their reactions with a variety of organic molecules. The chosen reactant molecules comprise two each of the following types--amines, terpenes, aromatic hydrocarbons, esters, carboxylic acids, ketones, aldehydes and alcohols. The reactant H2ONO+ (NO+H2O) ions are formed in a discharge ion source and injected into helium carrier gas where they are partially vibrationally excited and partially dissociated to NO+ ions. Hence, the reactions of the H2ONO+ ions had to be studies simultaneously with NO+ ions, the reactions of the latter ions readily being studied by selectively injecting NO+ ions into the carrier gas. The results of this study indicate that the H2ONO+ ions undergo a wide variety of reaction processes that depend on the properties of the reactant molecules such as their ionisation energies and proton affinities. These processes include charge transfer with compounds, M, that have low ionisation energies (producing M+), proton transfer with compounds possessing large proton affinities (MH+), hydride ion transfer (M---H+), alkyl radical (M---R+), alkoxide radical transfer (M---OR+), ion-molecule association (NO+H2OM) and ligand switching (NO+M), producing the ions given in parentheses.
Poor glycemic control impacts linear and non-linear dynamics of heart rate in DM type 2
Directory of Open Access Journals (Sweden)
Daniela Bassi
2015-08-01
Full Text Available INTRODUCTION: It is well known that type 2 diabetes mellitus (T2DM produces cardiovascular autonomic neuropathy (CAN, which may affect the cardiac autonomic modulation. However, it is unclear whether the lack of glycemic control in T2DM without CAN could impact negatively on cardiac autonomic modulation. Objective: To evaluate the relationship between glycemic control and cardiac autonomic modulation in individuals with T2DM without CAN. Descriptive, prospective and cross sectional study.METHODS: Forty-nine patients with T2DM (51±7 years were divided into two groups according to glycosylated hemoglobin (HbA1c: G1≤7% and G2>7.0%. Resting heart rate (HR and RR interval (RRi were obtained and calculated by linear (Mean iRR; Mean HR; rMSSD; STD RR; LF; HF; LF/HF, TINN and RR Tri, and non-linear (SD1; SD2; DFα1; DFα2, Shannon entropy; ApEn; SampEn and CD methods of heart rate variability (HRV. Insulin, HOMA-IR, fasting glucose and HbA1c were obtained by blood tests.RESULTS: G2 (HbA1c≤7% showed lower values for the mean of iRR; STD RR; RR Tri, TINN, SD2, CD and higher mean HR when compared with G1 (HbA1c > 7%. Additionally, HbA1c correlated negatively with mean RRi (r=0.28, p=0.044; STD RR (r=0.33, p=0.017; RR Tri (r=-0.35, p=0.013, SD2 (r=-0.39, p=0.004 and positively with mean HR (r=0.28, p=0.045. Finally, fasting glucose correlated negatively with STD RR (r=-0.36, p=0.010; RR Tri (r=-0.36, p=0.010; TINN (r=-0.33, p=0.019 and SD2 (r=-0.42, p=0.002.CONCLUSION: We concluded that poor glycemic control is related to cardiac autonomic modulation indices in individuals with T2DM even if they do not present cardiovascular autonomic neuropathy.
Nematollahi, Parisa; Esrafili, Mehdi D.; Neyts, Erik C.
2018-06-01
In this study, the healing of N-vacancy boron carbonitride nanosheet (NV-BC2NNS) and nanotube (NV-BC2NNT) by NO molecule is studied by means of density functional theory calculations. Two different N-vacancies are considered in each of these structures in which the vacancy site is surrounded by either three B-atoms (NB) or by two B- and one C-atom (NBC). By means of the healed BC2NNS and BC2NNT as a support, the removal of two toxic gas molecules (NO and CO) are applicable. It should be noted that the obtained energy barriers of both healing and oxidizing processes are significantly lower than those of graphene, carbon nanotubes or boron nitride nanostructures. Also, at the end of the oxidation process, the pure BC2NNS or BC2NNT is obtained without any additional defects. Therefore, by using this method, we can considerably purify the defective BC2NNS/BC2NNT. Moreover, according to the thermochemistry calculations we can further confirm that the healing process of the NV-BC2NNS and NV-BC2NNT by NO are feasible at room temperature. So, we can claim that this study could be very helpful in both purifying the defective BC2NNS/BC2NNT while in the same effort removing toxic NO and CO gases.
Demonstration of lactogenic receptors in rat endocrine pancreases by quantitative autoradiography
International Nuclear Information System (INIS)
Polak, M.; Scharfmann, R.; Ban, E.; Haour, F.; Postel-Vinay, M.C.; Czernichow, P.
1990-01-01
A direct effect of growth hormone and/or prolactin on the growth of the pancreatic beta-cell has been proposed. This study assessed the presence of human growth hormone (hGH)-binding sites in male adult rat endocrine pancreas via quantitative autoradiography. The binding of 125I-labeled hGH was evaluated by receptor autoradiography on frozen-pancreas cryostat cut sections. The sections were incubated with 125I-hGH (10(-10) M) for 75 min at room temperature, and nonspecific binding was determined in the presence of excess native hGH (5 X 10(-7) M). The specificity of the binding was assessed in competition experiments with bovine GH and ovine prolactin. The autoradiograms were quantified with a computer-assisted image-processing system. The sections were then stained to visualize the endocrine islets. Nondiabetic control and streptozocin (STZ)-injected rats were used. Our results show that (1) there is specific binding of iodinated hGH in small areas of the pancreas, which appear as the Langerhans islets when the autoradiogram and the stained sections are superimposed; (2) the specificity of hGH binding in rat islets is lactogenic; (3) the density of the hGH-binding sites in the endocrine pancreas is estimated at 4.8 fmol/mg protein, with IC50 ranging from 0.98 to 2.50 nM; and (4) binding sites may be present on the beta-cell, because specific binding disappears in STZ-injected rats. In conclusion, by use of a quantitative autoradiographic technique, we provide evidence for the presence of lactogenic receptors on rat beta-cells
International Nuclear Information System (INIS)
Schwarz, I.
1979-01-01
Twelve human growth hormone (hGH) preparations were studied on analytical polyacrilamide gel electrophoresis with the purpose of evaluating degree of homogeneity of the extracts, the geometric mean radius (R) sup(-) and the molecular weight (MW) of the protein hormone. A standard curve was used for ten proteins of known molecular weight, where the square root of the retardation coefficient (K sub(R)) was plotted against R sup(-). Five isohormones were identified and defined as charge isomers, based on their different relative free mobility and on their similar R sup(-)(1.81-1.97 nm) and MW (20300-26000 d) values. The heterogeneity of all preparations was due to the presence in general of three isohormones. In five preparations, isohormones B, C 1 and C 2 , were predominant. In recent hGH (IEA) preparations by the method of ROOS, the isohormones C 2 , D and E were identified while in an older one, isohormones E and E 1 were detected. From two to five minor components were found in all samples. Moreover the same type of analysis was carried out on several fractions from protein peaks II and III eluting from Sephadex G 100 purification of three hGH (IEA) extracts. The isohormones start to appear in peak II and their relative concentration is in agreement with the peak III profile read at 280 nm. Practically all secondary components were present in peak II and in most of peak III, showing a type of heterogeneity due to hGH polymeric forms and a relatively small presence of contaminants. (Author) [pt
DEFF Research Database (Denmark)
Röpke, C; Gladstone, P; Nielsen, M
1996-01-01
, these findings suggest that CD18 molecules (beta 2-integrins) play a regulatory role in the apoptotic response following cytokine withdrawal, and that the regulation is mediated, at least partly, through T-T cell interactions. Thus, apoptotic death following IL-2 deprivation appears to be under "social" control...... activated T cells. Thus, removal of IL-2 from proliferating T cells not only induces growth arrest, but triggers a massive cell death due to apoptosis. While the apoptotic response involves a series of well-described events, it remains less clear how apoptosis is regulated following IL-2 withdrawal. Here...... molecules (CD28, CD29, CD49d, CD80, CD86) did not. Secondly, IL-2 withdrawal resulted in a retarded apoptotic response in LFA-1 (CD11a/CD18) negative T cells obtained from a leukocyte adhesion deficiency (LAD) patient, as compared to LFA-1 positive T cell lines. Thirdly, co-culture of LFA-1 positive...
Spectroscopy and Chemistry of Cold Molecules
Momose, Takamasa
2012-06-01
Molecules at low temperatures are expected to behave quite differently from those at high temperatures because pronounced quantum effects emerge from thermal averages. Even at 10 K, a significant enhancement of reaction cross section is expected due to tunneling and resonance effects. Chemistry at this temperature is very important in order to understand chemical reactions in interstellar molecular clouds. At temperatures lower than 1 K, collisions and intermolecular interactions become qualitatively different from those at high temperatures because of the large thermal de Broglie wavelength of molecules. Collisions at these temperatures must be treated as the interference of molecular matter waves, but not as hard sphere collisions. A Bose-Einstein condensate is a significant state of matter as a result of coherent matter wave interaction. Especially, dense para-H_2 molecules are predicted to become a condensate even around 1 K. A convenient method to investigate molecules around 1 K is to dope molecules in cold matrices. Among various matrices, quantum hosts such as solid para-H_2 and superfluid He nano-droplets have been proven to be an excellent host for high-resolution spectroscopy. Rovibrational motion of molecules in these quantum hosts is well quantized on account of the weak interactions and the softness of quantum environment. The linewidths of infrared spectra of molecules in the quantum hosts are extremely narrow compared with those in other matrices. The sharp linewidths allow us to resolve fine spectral structures originated in subtle interactions between guest and host molecules. In this talk, I will describe how the splitting and lineshape of high-resolution spectra of molecules in quantum hosts give us new information on the static and dynamical interactions of molecules in quantum medium. The topics include dynamical response of superfluid environment upon rotational excitation, and possible superfluid phase of para-H_2 clusters. I will also
Study of the electronic properties of organic molecules within a metal-molecule-metal junction
International Nuclear Information System (INIS)
Lambert, Mathieu
2003-01-01
This ph-D thesis is about electronic transport through organic molecules inserted in a metal molecule-metal junction. We describe first a simple process to prepare sub-3 nm gaps by controllable breakage (under an electrical stress) of gold wires lithographed on a SiO 2 Si substrate at low temperature (4.2 K). We show that the involved mechanism is thermally assisted electromigration. We observe that current-voltage (I-V) characteristics of resulting electrodes are stable up to ∼5 V. which gives access to the well-known Fowler-Nordheim regime in the I-V, allowing an accurate characterisation of the gap size. The average gap is found lo be between 1.5 nm in width and 2.5 eV in height. Molecules and nanoparticles have then been inserted in the junction in the case of nanoparticles for example. The resulting IV clearly shows the suppression of electrical current at low bias known as Coulomb blockade. Characteristic of single-electron tunnelling through nanometer-sized structures, finally we fabricated a single-electron tunneling device based on Au nanoparticles connected to the electrodes via terthiophene (T3) molecule. We use the silicon substrate, separated from the planar structure by a silicon oxide of 200 nm, as an electrostatic gate and observed clear current modulation with possible signature of the transport properties of the terthiophene molecules. (author) [fr
Linear and non-linear optics of condensed matter
International Nuclear Information System (INIS)
McLean, T.P.
1977-01-01
Part I - Linear optics: 1. General introduction. 2. Frequency dependence of epsilon(ω, k vector). 3. Wave-vector dependence of epsilon(ω, k vector). 4. Tensor character of epsilon(ω, k vector). Part II - Non-linear optics: 5. Introduction. 6. A classical theory of non-linear response in one dimension. 7. The generalization to three dimensions. 8. General properties of the polarizability tensors. 9. The phase-matching condition. 10. Propagation in a non-linear dielectric. 11. Second harmonic generation. 12. Coupling of three waves. 13. Materials and their non-linearities. 14. Processes involving energy exchange with the medium. 15. Two-photon absorption. 16. Stimulated Raman effect. 17. Electro-optic effects. 18. Limitations of the approach presented here. (author)
Busman-Sahay, Kathleen; Sargent, Elizabeth; Harton, Jonathan A.; Drake, James R.
2016-01-01
Previous work has established that binding of the 11-5.2 anti-I-Ak mAb, which recognizes the Ia.2 epitope on I-Ak class II molecules, elicits MHC class II signaling, whereas binding of two other anti-I-Ak mAb that recognize the Ia.17 epitope fail to elicit signaling. Using a biochemical approach, we establish that the Ia.2 epitope recognized by the widely used 11-5.2 mAb defines a subset of cell surface I-Ak molecules predominantly found within membrane lipid rafts. Functional studies demonstrate that the Ia.2 bearing subset of I-Ak class II molecules is critically necessary for effective B cell–T cell interactions especially at low antigen doses, a finding consistent with published studies on the role of raft-resident class II molecules in CD4 T cell activation. Interestingly, B cells expressing recombinant I-Ak class II molecules possessing a β chain-tethered HEL peptide lack the Ia.2 epitope and fail to partition into lipid rafts. Moreover, cells expressing Ia.2 negative tethered peptide-class II molecules are severely impaired in their ability to present both tethered peptide or peptide derived from exogenous antigen to CD4 T cells. These results establish the Ia.2 epitope as defining a lipid raft-resident MHC class II confomer vital to the initiation of MHC class II restricted B cell–T cell interactions. PMID:21543648
Fabrication of Low Noise Borosilicate Glass Nanopores for Single Molecule Sensing.
Directory of Open Access Journals (Sweden)
Jayesh A Bafna
Full Text Available We show low-cost fabrication and characterization of borosilicate glass nanopores for single molecule sensing. Nanopores with diameters of ~100 nm were fabricated in borosilicate glass capillaries using laser assisted glass puller. We further achieve controlled reduction and nanometer-size control in pore diameter by sculpting them under constant electron beam exposure. We successfully fabricate pore diameters down to 6 nm. We next show electrical characterization and low-noise behavior of these borosilicate nanopores and compare their taper geometries. We show, for the first time, a comprehensive characterization of glass nanopore conductance across six-orders of magnitude (1M-1μM of salt conditions, highlighting the role of buffer conditions. Finally, we demonstrate single molecule sensing capabilities of these devices with real-time translocation experiments of individual λ-DNA molecules. We observe distinct current blockage signatures of linear as well as folded DNA molecules as they undergo voltage-driven translocation through the glass nanopores. We find increased signal to noise for single molecule detection for higher trans-nanopore driving voltages. We propose these nanopores will expand the realm of applications for nanopore platform.
Wavelet-based linear-response time-dependent density-functional theory
Natarajan, Bhaarathi; Genovese, Luigi; Casida, Mark E.; Deutsch, Thierry; Burchak, Olga N.; Philouze, Christian; Balakirev, Maxim Y.
2012-06-01
Linear-response time-dependent (TD) density-functional theory (DFT) has been implemented in the pseudopotential wavelet-based electronic structure program BIGDFT and results are compared against those obtained with the all-electron Gaussian-type orbital program DEMON2K for the calculation of electronic absorption spectra of N2 using the TD local density approximation (LDA). The two programs give comparable excitation energies and absorption spectra once suitably extensive basis sets are used. Convergence of LDA density orbitals and orbital energies to the basis-set limit is significantly faster for BIGDFT than for DEMON2K. However the number of virtual orbitals used in TD-DFT calculations is a parameter in BIGDFT, while all virtual orbitals are included in TD-DFT calculations in DEMON2K. As a reality check, we report the X-ray crystal structure and the measured and calculated absorption spectrum (excitation energies and oscillator strengths) of the small organic molecule N-cyclohexyl-2-(4-methoxyphenyl)imidazo[1, 2-a]pyridin-3-amine.
International Nuclear Information System (INIS)
Moehlman, G.R.; Heer, F.J. de
1977-01-01
Absolute emission cross sections of Ly-α (H,D(2p → 1s)) radiation have been determined for 0 - 2000 eV electrons incident on H 2 , HD, HCl, H 2 O, NH 3 and CH 4 . By means of the application of electric quenching, the excitation cross sections of H,D(2s) could be obtained from the increase of the resulting Ly-α radiation for these molecules. Only in the case of electrons on H 2 , D 2 and HD was excitation of H,D(2s) found
International Nuclear Information System (INIS)
Abdolsalami, F.; Abdolsalami, M.; Perez, L.; Gomez, P.
1995-01-01
The authors have applied the finite-element method to electron-molecule collision with the exchange effect implemented rigorously. All the calculations are done in the body-frame within the fixed-nuclei approximation, where the exact treatment of exchange as a nonlocal effect results in a set of coupled integro-differential equations. The method is applied to e-H 2 and e-N 2 scatterings and the cross sections obtained are in very good agreement with the corresponding results the authors have generated from the linear-algebraic approach. This confirms the significant difference observed between their results generated by linear-algebraic method and the previously published e-N 2 cross sections. Their studies show that the finite-element method is clearly superior to the linear-algebraic approach in both memory usage and CPU time especially for large systems such as e-N 2 . The system coefficient matrix obtained from the finite-element method is often sparse and smaller in size by a factor of 12 to 16, compared to the linear-algebraic technique. Moreover, the CPU time required to obtain stable results with the finite-element method is significantly smaller than the linear-algebraic approach for one incident electron energy. The usage of computer resources in the finite-element method can even be reduced much further when (1) scattering calculations involving multiple electron energies are performed in one computer run and (2) exchange, which is a short range effect, is approximated by a sparse matrix. 17 refs., 7 figs., 5 tabs
Zheng, C.; Voutetakis, A.; Kok, M. R.; Goldsmith, C. M.; Smith, G. B. J.; Elmore, S.; Nyska, A.; Vallant, M.; Irwin, R. D.; Baum, B. J.
2006-01-01
We examined the toxicity and biodistribution associated with a single administration of a first-generation, serotype 5, adenoviral vector encoding human growth hormone (hGH; AdCMVhGH) to a single rat submandibular gland in the presence of hydroxychloroquine (HCQ). Previously, we showed that hGH is
International Nuclear Information System (INIS)
Hayashi, Makoto
2003-12-01
A bibliographies of original and review reports of experiments or theories of electron and photon cross sections and also electron swarm data are presented for atomic or molecular species with specified targets. These works covered 17 atoms and 51 molecules. The present bibliography is only for halogen molecules (F 2 , Cl 2 , Br 2 , I 2 ). About 190(F 2 ), 360(Cl 2 ), 140(Br 2 ) and 240(I 2 ) papers were compiled respectively. A comprehensive author indexes for each molecule are included. The bibliography covers the period 1901 through 2000 for F 2 -I 2 . Finally, author's comments for F 2 -I 2 electron collision cross sections are given. (author)
Rutigliano, Maria; Pirani, Fernando
2018-03-01
The inelastic scattering of D2 and HD molecules impinging on a graphite surface in well-defined initial roto-vibrational states has been studied by using the computational setup recently developed to characterize important selectivities in the molecular dynamics occurring at the gas-surface interface. In order to make an immediate comparison of determined elastic and inelastic scattering probabilities, we considered for D2 and HD molecules the same initial states, as well as the same collision energy range, previously selected for the investigation of H2 behaviour. The analysis of the back-scattered molecules shows that, while low-lying initial vibrational states are preserved, the medium-high initial ones give rise to final states covering the complete ladder of vibrational levels, although with different probability for the various cases investigated. Moreover, propensities in the formation of the final rotational states are found to depend strongly on the initial ones, on the collision energy, and on the isotopologue species.
Lascols, O; Cherqui, G; Munier, A; Picard, J; Capeau, J
1994-05-01
To investigate whether glycanic chains of prolactin receptors (PRL-R) play a role in hormone binding activity, comparison was made of rat and mouse liver solubilized receptors with respect to both their affinity for the hormone and their glycosylation properties. As compared with rat receptors, mouse receptors exhibited a 2-fold higher affinity for human growth hormone (hGH), the hormone being bound by both tissues with a lactogenic specificity. Along with this increased affinity, mouse receptors had a 2 lower M(r) relative to rat receptors (62 kDa versus 64 kDa as measured on hGH cross-linked receptors). These differences could be ascribed to different glycosylation properties of the receptors from the two species, as supported by the followings. 1) After treatment with endoglycosidase F (endo F), rat and mouse PRL-R no longer exhibited any difference in their M(r) (54 kDa for both cross-linked receptors). 2) Neuraminidase treatment increased by 37% the binding of hGH to mouse receptors, but was ineffective on the hormone-binding to rat receptors. Conversely, wheat germ agglutinin (WGA), another sialic acid specific probe, decreased hGH binding to rat receptors by 25%, but had no effect on this process for mouse ones. 3) Marked differences were observed in the recoveries of rat and mouse hormone-receptor (HR) complexes from ricin-1- (RCA1-), concanavalin A- (ConA-) and WGA-immobilized lectins. These differences were reduced (RCA1 and ConA) or abolished (WGA) after rat and mouse receptor desialylation by neuraminidase, a treatment which decreased the M(r) of both receptors by 2 kDa. Taken together, these results strongly suggest that the PRL-R from rat and mouse liver contain biantennary N-linked oligosaccharidic chains with distinct type of sialylation, which may account for their differential hormone-binding affinities.
On Nuclear Molecules Built up from sup 1 sup 3 sup 2 Sn Components
Swiatecki, W J
2003-01-01
The possible existence of nuclear quasi-molecules built up from sup 1 sup 3 sup 2 Sn components is investigated. The crucial question is whether the extra stability of the doubly magic sup 1 sup 3 sup 2 Sn nuclei makes them sufficiently rigid to be able to withstand the strains imposed by their mutual interactions. It is argued that if the simplest quasi-molecular dumbbell configuration were found to be (meta-)stable, then triangular and even tetrahedral structures might have comparable barriers against disintegration and comparable spontaneous fission lifetimes. These are estimated using simplifying assumptions. As regards the dumbbell's stability, one may relate this to the existence of a potential energy pocket in the deformation energy landscape of a fissioning sup 2 sup 6 sup 4 Fm nucleus, and to the presence of ''bimodal'' fission in heavy Fm isotopes. Further experimental and theoretical studies of such systems may be relevant for answering the question concerning nuclear quasi-molecules.
International Nuclear Information System (INIS)
Abdolsalami, F.; Abdolsalami, M.; Gomez, P.
1994-01-01
We have applied the finite-element method to electron-molecule collisions. All the calculations are done in the body frame within the fixed-nuclei approximation. A model potential, which is added to the static and polarization potential, has been used to represent the exchange effect. The method is applied to electron-H 2 scattering and the eigenphase sums and the cross sections obtained are in very good agreement with the corresponding results from the linear-algebraic approach. Finite-element calculations of the R matrix in the region where the static and exchange interactions are strong, however, has about one-half to one-fourth of the memory requirement of the linear-algebraic technique
Exploring Charge Transport in Guest Molecule Infiltrated Cu3(BTC)2 Metal Organic Framework
Energy Technology Data Exchange (ETDEWEB)
Leonard, Francois Leonard [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Stavila, Vitalie [Sandia National Lab. (SNL-CA), Livermore, CA (United States); Allendorf, Mark D. [Sandia National Lab. (SNL-CA), Livermore, CA (United States)
2014-09-01
The goal of this Exploratory Express project was to expand the understanding of the physical properties of our recently discovered class of materials consisting of metal-organic frameworks with electroactive ‘guest’ molecules that together form an electrically conducting charge-transfer complex (molecule@MOF). Thin films of Cu3(BTC)2 were grown on fused silica using solution step-by-step growth and were infiltrated with the molecule tetracyanoquinodimethane (TCNQ). The infiltrated MOF films were extensively characterized using optical microscopy, scanning electron microscopy, Raman spectroscopy, electrical conductivity, and thermoelectric properties. Thermopower measurements on TCNQ@Cu3(BTC)2 revealed a positive Seebeck coefficient of ~400 μV/k, indicating that holes are the primary carriers in this material. The high value of the Seebeck coefficient and the expected low thermal conductivity suggest that molecule@MOF materials may be attractive for thermoelectric power conversion applications requiring low cost, solution-processable, and non-toxic active materials.
Linear and nonlinear properties of chalcogenide glasses in the terahertz frequency
DEFF Research Database (Denmark)
Zalkovskij, Maksim; Malureanu, Radu; Popescu, A.
2014-01-01
Terahertz (THz) waves have the potential to improve a wide range of devices in the space, defense and semiconductor industries as well as offering the possibility of investigating various molecules of interest in biology, medicine, art etc. For this reason, THz sources, detectors and passive linear...
International Nuclear Information System (INIS)
Liao, Liqiong; Fu, Yizheng; Liang, Ziaoyan; Mei, Linyu; Liu, Yaqing
2013-01-01
Molecular dynamics (MD) simulations have been used to study the diffusion behavior of small gas molecules (CO 2 ) in polyethylene terephthalate (PET)/polylactide (PLA) blends. The Flory-Huggins interaction parameters (χ) determined from the cohesive energy densities are smaller than the critical value of Flory-Huggins interaction parameters (χ critical ), and that indicates the good compatibility of PET/PLA blends. The diffusion coefficients of CO 2 are determined via MD simulations at 298 K. That the order of diffusion coefficients is correlated with the availably fractional free volume (FFV) of CO 2 in the PET/PLA blends means that the FFV plays a vital role in the diffusion behavior of CO 2 molecules in PET/PLA blends. The slopes of the log (MSD) as a function of log (t) are close to unity over the entire composition range of PET/PLA blends, which confirms the feasibility of MD approach reaches the normal diffusion regime of CO 2 in PET/PLA blends
Kinetics of highly vibrationally excited O2(X) molecules in inductively-coupled oxygen plasmas
Annušová, Adriana; Marinov, Daniil; Booth, Jean-Paul; Sirse, Nishant; Lino da Silva, Mário; Lopez, Bruno; Guerra, Vasco
2018-04-01
The high degree of vibrational excitation of O2 ground state molecules recently observed in inductively coupled plasma discharges is investigated experimentally in more detail and interpreted using a detailed self-consistent 0D global kinetic model for oxygen plasmas. Additional experimental results are presented and used to validate the model. The vibrational kinetics considers vibrational levels up to v = 41 and accounts for electron impact excitation and de-excitation (e-V), vibration-to-translation relaxation (V-T) in collisions with O2 molecules and O atoms, vibration-to-vibration energy exchanges (V-V), excitation of electronically excited states, dissociative electron attachment, and electron impact dissociation. Measurements were performed at pressures of 10–80 mTorr (1.33 and 10.67 Pa) and radio frequency (13.56 MHz) powers up to 500 W. The simulation results are compared with the absolute densities in each O2 vibrational level obtained by high sensitivity absorption spectroscopy measurements of the Schumann–Runge bands for O2(X, v = 4–18), O(3 P) atom density measurements by two-photon absorption laser induced fluorescence (TALIF) calibrated against Xe, and laser photodetachment measurements of the O‑ negative ions. The highly excited O2(X, v) distribution exhibits a shape similar to a Treanor-Gordiets distribution, but its origin lies in electron impact e-V collisions and not in V-V up-pumping, in contrast to what happens in all other molecular gases known to date. The relaxation of vibrational quanta is mainly due to V-T energy-transfer collisions with O atoms and to electron impact dissociation of vibrationally excited molecules, e+O2(X, v)→O(3P)+O(3P).
Capacitive Sensing of Intercalated H2O Molecules Using Graphene.
Olson, Eric J; Ma, Rui; Sun, Tao; Ebrish, Mona A; Haratipour, Nazila; Min, Kyoungmin; Aluru, Narayana R; Koester, Steven J
2015-11-25
Understanding the interactions of ambient molecules with graphene and adjacent dielectrics is of fundamental importance for a range of graphene-based devices, particularly sensors, where such interactions could influence the operation of the device. It is well-known that water can be trapped underneath graphene and its host substrate; however, the electrical effect of water beneath graphene and the dynamics of how the interfacial water changes with different ambient conditions has not been quantified. Here, using a metal-oxide-graphene variable-capacitor (varactor) structure, we show that graphene can be used to capacitively sense the intercalation of water between graphene and HfO2 and that this process is reversible on a fast time scale. Atomic force microscopy is used to confirm the intercalation and quantify the displacement of graphene as a function of humidity. Density functional theory simulations are used to quantify the displacement of graphene induced by intercalated water and also explain the observed Dirac point shifts as being due to the combined effect of water and oxygen on the carrier concentration in the graphene. Finally, molecular dynamics simulations indicate that a likely mechanism for the intercalation involves adsorption and lateral diffusion of water molecules beneath the graphene.
Arevalo, Ricardo, Jr.; Brinckerhoff, William B.; Pinnick, Veronica T.; van Amerom, Friso H. W.; Danell, Ryan M.; Li, Xiang; Getty, Stephanie; Hovmand, Lars; Atanassova, Martina; Mahaffy, Paul R.;
2014-01-01
The 2018 ExoMars rover mission includes the Mars Organic Molecule Analyzer (MOMA) investigation. MOMA will examine the chemical composition of samples acquired from depths of up to two meters below the martian surface, where organics may be protected from degradation derived from cosmic radiation and/or oxidative chemical reactions. When combined with the complement of instruments in the rover's Pasteur Payload, MOMA has the potential to reveal the presence of a wide range of organics preserved in a variety of mineralogical environments, and to begin to understand the structural character and potential origin of those compounds. The MOMA investigation is led by the Max Planck Institute for Solar System Research (MPS) with the mass spectrometer subsystem provided by NASA GSFC. MOMA's linear ion trap mass spectrometer (ITMS) is designed to analyze molecular composition of: (i) gas evolved from pyrolyzed powder samples and separated in a gas chromatograph; and, (ii) ions directly desorbed from crushed solid samples at Mars ambient pressure, as enabled by a pulsed UV laser system, fast-actuating aperture valve and capillary ion inlet. Breadboard ITMS and associated electronics have been advanced to high end-to-end fidelity in preparation for flight hardware delivery to Germany in 2015.
International Nuclear Information System (INIS)
Luo Jiao; Liu Meiling; Zhao Qiangqin; Zhao Jie; Zhang Youyu; Tan Liang; Tang Hao; Xie Qingji; Li Haitao; Yao Shouzhuo
2010-01-01
A novel symmetric conjugated oligo(phenylene-ethynylene) (OPE) linear molecule (1,4-bis(4-aminophenylethynyl)benzene); BAB) was synthesized by Sonogashira cross-coupling reactions. The structure and purity of the compound were confirmed by 1 H NMR, 13 C NMR and infrared (IR) and mass spectrometry (MS). The electrochemical oxidation process and mechanism of BAB were investigated via in situ Fourier transform infrared (FTIR) spectroelectrochemistry and electrochemical quartz crystal microbalance (EQCM). The electrochemical oxidation mechanism of BAB was proposed. The studies revealed that the BAB concentration and oxidation potential had a significant influence on the growth of the polymer film. A densely packed polymer film, which exhibited nonelectroactivity, was formed when a high monomer concentration and a high oxidation potential were used. When the electropolymerization of BAB was conducted at a lower concentration, a new pair of redox peaks appeared, and the resultant thin film had better electroactivity. The in situ FTIR studies confirmed that BAB could be electro-oxidized into radical cations and then electropolymerized via para (N-N) and/or ortho (N-C) coupling reactions to form polymers with a larger conjugated π-electron system. The surface morphology of the poly-BAB was also investigated with atomic force microscopy (AFM) and scanning electron microscopy (SEM).
Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography
Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan
2013-03-01
The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.
Directory of Open Access Journals (Sweden)
Tae-Hyun Kim
2012-01-01
Full Text Available We have successfully intercalated 2-aminoethanesulfonate, a well-known biomolecule taurine, into calcium-containing layered double hydroxides via optimized solid phase intercalation. According to X-ray diffraction patterns and infrared spectroscopy, it was revealed that the intercalated taurine molecules were each directly coordinated to other calcium cation and arranged in a zig-zag pattern. Scanning electron microscopy showed that the particle size and morphology of the LDHs were not affected by the solid phase intercalation, and the surface of intercalates was covered by organic moieties. From ninhydrin amine detection tests, we confirmed that most of the taurine molecules were well stabilized between the calcium-containing LDH layers.
Labelled molecules, modern research implements
International Nuclear Information System (INIS)
Pichat, L.; Langourieux, Y.
1974-01-01
Details of the synthesis of carbon 14- and tritium-labelled molecules are examined. Although the methods used are those of classical organic chemistry the preparation of carbon 14-labelled molecules differs in some respects, most noticeably in the use of 14 CO 2 which requires very special handling techniques. For the tritium labelling of organic molecules the methods are somewhat different, very often involving exchange reactions. The following are described in turn: the so-called Wilzbach exchange method; exchange by catalysis in solution; catalytic hydrogenation with tritium; reductions with borotritides. Some applications of labelled molecules in organic chemistry, biochemistry and pharmacology are listed [fr
Interstellar molecules and masers
International Nuclear Information System (INIS)
Nguyen-Q-Rieu; Guibert, J.
1978-01-01
The study of dense and dark clouds, in which hydrogen is mostly in molecular form, became possible since the discovery of interstellar molecules, emitting in the centimeter and millimeter wavelengths. The molecular lines are generally not in local thermal equilibrium (LTE). Their intensity can often be explained by invoking a population inversion mechanism. Maser emission lines due to OH, H 2 O and SiO molecules are among the most intense molecular lines. The H 2 CO molecule, detected in absorption in front of the cold cosmic background radiation of 2.7 K, illustrates the inverse phenomenon, the antimaser absorption. For a radio transition of frequency v, the inversion rate Δn (relative population difference between the upper and lower level) as well as the maser gain can be determined from the radio observations. In the case of the OH lines in the 2 PIsub(3/2), J=3/2 state, the inversion rates approximately 1 to 2% derived from the observations, are comparable with those obtained in the laboratory. The determination of the excitation mechanisms of the masers, through the statistical equilibrium and radiative transfer equations, implies the knowledge of collisional and radiative transition probabilities. A pumping model, which can satisfactorily explain the radio observations of some interstellar OH clouds, will be discussed [fr
Directory of Open Access Journals (Sweden)
Laura C Zanetti-Domingues
Full Text Available Single-molecule techniques are being increasingly applied to biomedical investigation, notwithstanding the numerous challenges they pose in terms of signal-to-noise ratio issues. Non-specific binding of probes to glass substrates, in particular, can produce experimental artifacts due to spurious molecules on glass, which can be particularly deleterious in live-cell tracking experiments. In order to resolve the issue of non-specific probe binding to substrates, we performed systematic testing of a range of available surface coatings, using three different proteins, and then extended our assessment to the ability of these coatings to foster cell growth and retain non-adhesive properties. Linear PEG, a passivating agent commonly used both in immobilized-molecule single-molecule techniques and in tissue engineering, is able to both successfully repel non-specific adhesion of fluorescent probes and to foster cell growth when functionalized with appropriate adhesive peptides. Linear PEG treatment results in a significant reduction of tracking artifacts in EGFR tracking with Affibody ligands on a cell line expressing EGFR-eGFP. The findings reported herein could be beneficial to a large number of experimental situations where single-molecule or single-particle precision is required.
Rydberg excitation of neutral nitric oxide molecules in strong UV and near-IR laser fields
International Nuclear Information System (INIS)
Lv Hang; Zhang Jun-Feng; Zuo Wan-Long; Xu Hai-Feng; Jin Ming-Xing; Ding Da-Jun
2015-01-01
Rydberg state excitations of neutral nitric oxide molecules are studied in strong ultraviolet (UV) and near-infra-red (IR) laser fields using a linear time-of-flight (TOF) mass spectrometer with the pulsed electronic field ionization method. The yield of Rydberg molecules is measured as a function of laser intensity and ellipticity, and the results in UV laser fields are compared with those in near-IR laser fields. The present study provides the first experimental evidence of neutral Rydberg molecules surviving in a strong laser field. The results indicate that a rescattering-after-tunneling process is the main contribution to the formation of Rydberg molecules in strong near-IR laser fields, while multi-photon excitation may play an important role in the strong UV laser fields. (paper)
Directory of Open Access Journals (Sweden)
Olivier Renaudet
2010-06-01
Full Text Available Glyco-lipopeptides, a form of lipid-tailed glyco-peptide, are currently under intense investigation as B- and T-cell based vaccine immunotherapy for many cancers. However, the cellular and molecular mechanisms of glyco-lipopeptides (GLPs immunogenicity and the position of the lipid moiety on immunogenicity and protective efficacy of GLPs remain to be determined.We have constructed two structural analogues of HER-2 glyco-lipopeptide (HER-GLP by synthesizing a chimeric peptide made of one universal CD4(+ epitope (PADRE and one HER-2 CD8(+ T-cell epitope (HER(420-429. The C-terminal end of the resulting CD4-CD8 chimeric peptide was coupled to a tumor carbohydrate B-cell epitope, based on a regioselectively addressable functionalized templates (RAFT, made of four alpha-GalNAc molecules. The resulting HER glyco-peptide (HER-GP was then linked to a palmitic acid moiety, attached either at the N-terminal end (linear HER-GLP-1 or in the middle between the CD4+ and CD8+ T cell epitopes (branched HER-GLP-2. We have investigated the uptake, processing and cross-presentation pathways of the two HER-GLP vaccine constructs, and assessed whether the position of linkage of the lipid moiety would affect the B- and T-cell immunogenicity and protective efficacy. Immunization of mice revealed that the linear HER-GLP-1 induced a stronger and longer lasting HER(420-429-specific IFN-gamma producing CD8(+ T cell response, while the branched HER-GLP-2 induced a stronger tumor-specific IgG response. The linear HER-GLP-1 was taken up easily by dendritic cells (DCs, induced stronger DCs maturation and produced a potent TLR- 2-dependent T-cell activation. The linear and branched HER-GLP molecules appeared to follow two different cross-presentation pathways. While regression of established tumors was induced by both linear HER-GLP-1 and branched HER-GLP-2, the inhibition of tumor growth was significantly higher in HER-GLP-1 immunized mice (p<0.005.These findings have
I{sub 2}: a pedagogical molecule; I{sub 2} - uma molecula didatica
Energy Technology Data Exchange (ETDEWEB)
Sala, Oswaldo [Universidade de Sao Paulo (USP), Sao Paulo, SP (Brazil). Dept. de Quimica Fundamental]. E-mail: oswsala@iq.usp.br
2008-07-01
Iodine vapor is a very suitable substance to learn about molecular energy levels and transitions, and to introduce spectroscopic techniques. As a diatomic molecule its spectra are relatively simple and allow straightforward treatment of the data leading to the potential energy curves and to quantum mechanics concepts. The overtone bands, in the resonance Raman scattering, and the band progressions, in the electronic spectra, play an important role in the calculation of the Morse potential curves for the fundamental and excited electronic state. A weaker chemical bond in the electronic excited state, compared to the fundamental state, is evidenced by the increase in the equilibrium interatomic distance. The resonance Raman scattering of I{sub 2} is highlighted due to its importance for obtaining the anharmonicity constant in the fundamental electronic state. (author)
International Nuclear Information System (INIS)
Jiang Dafeng; Liu Chunxia; Wang Lei; Jiang Wei
2010-01-01
A single-molecule counting approach for quantifying the antibody affixed to a surface using quantum dots and epi-fluorescence microscopy is presented. Modifying the glass substrates with carboxyl groups provides a hydrophilic surface that reacts with amine groups of an antibody to allow covalent immobilization of the antibody. Nonspecific adsorption of single molecules on the modified surfaces was first investigated. Then, quantum dots were employed to form complexes with surface-immobilized antibody molecules and used as fluorescent probes for single-molecule imaging. Epi-fluorescence microscopy was chosen as the tool for single-molecule fluorescence detection here. The generated fluorescence signals were taken by an electron multiplying charge-coupled device and were found to be proportional to the sample concentrations. Under optimal conditions, a linear response range of 5.0 x 10 -14 -3.0 x 10 -12 mol L -1 was obtained between the number of single molecules and sample concentration via a single-molecule counting approach.
NEAR-INFRARED CIRCULAR AND LINEAR POLARIMETRY OF MONOCEROS R2
Energy Technology Data Exchange (ETDEWEB)
Kwon, Jungmi; Tamura, Motohide [Department of Astronomy, Graduate School of Science, The University of Tokyo, 113-0033 (Japan); Hough, James H. [University of Hertfordshire, Hatfield, Herts AL10 9AB (United Kingdom); Nagata, Tetsuya [Kyoto University, Sakyo-ku, Kyoto 606-8502 (Japan); Kusakabe, Nobuhiko [National Astronomical Observatory of Japan, 2-21-1 Osawa, Mitaka, Tokyo 181-8588 (Japan)
2016-09-01
We have conducted simultaneous JHK{sub s}-band imaging circular and linear polarimetry of the Monoceros R2 (Mon R2) cluster. We present results from deep and wide near-infrared linear polarimetry of the Mon R2 region. Prominent and extended polarized nebulosities over the Mon R2 field are revisited, and an infrared reflection nebula associated with the Mon R2 cluster and two local reflection nebulae, vdB 67 and vdB 69, is detected. We also present results from deep imaging circular polarimetry in the same region. For the first time, the observations show relatively high degrees of circular polarization (CP) in Mon R2, with as much as approximately 10% in the K{sub s} band. The maximum CP extent of a ring-like nebula around the Mon R2 cluster is approximately 0.60 pc, while that of a western nebula, around vdB 67, is approximately 0.24 pc. The extended size of the CP is larger than those seen in the Orion region around IRc2, while the maximum degree of CP of ∼10% is smaller than those of ∼17% seen in the Orion region. Nonetheless, both the CP size and degree of this region are among the largest in our infrared CP survey of star-forming regions. We have also investigated the time variability of the degree of the polarization of several infrared sources and found possible variations in three sources.
Ara, Ferdous; Qi, Zhi Kun; Hou, Jie; Komeda, Tadahiro; Katoh, Keiichi; Yamashita, Masahiro
2016-10-25
In this article, we investigate a single molecule magnet bis(phthalocyaninato)terbium(iii) (TbPc 2 ) molecule film by using low temperature STM. In order to investigate the effect of molecule-substrate interaction on the electronic and spin properties of the adsorbed molecule, we tune the molecule-substrate coupling by switching the substrate between Au(111) and Ag(111), the latter of which provides stronger interaction with the molecule than the former. Despite the enhanced chemical reactivity of the Ag(111) surface compared with Au(111), a well-organized pseudo-square film is formed. In addition, a checker-board type contrast variation is identified, which is well explained by the existence of two types of molecules whose rotational angle between the top and bottom Pc is θ = 45° (bright molecule) and θ = 30° (dark molecule). The expected stronger molecule-substrate interaction, however, appears as an intriguing dI/dV mapping image which reveals the spatial distribution of the density of states (DOS). We identify the contrast reversal in the dI/dV mapping for the molecules of θ = 45° and θ = 30° at the sample voltages of V = 0.7 eV and 1.1 eV. Combined with the density functional theory (DFT) calculation, we attribute this change to the shift of an electronic state due to the rotation of the mutual angle between the top and bottom Pc. For the spin behavior, we previously observed a Kondo resonance for the TbPc 2 molecule adsorbed on the Au(111) surface. On the Ag(111) surface, the Kondo resonance is hardly observed, which is due to the annihilation of the π radical spin by the charge transfer from the substrate to the molecule. Instead we observe a Kondo peak for the molecule on the second layer, for which the spin recovers due to the reduction of the coupling with the substrate. In addition, when a magnetic field of 2 T normal to the surface is applied, the second layer molecule shows a sharp dip at the Fermi level. We attribute this to the inelastic
Checking the foundation: recent radiobiology and the linear no-threshold theory.
Ulsh, Brant A
2010-12-01
The linear no-threshold (LNT) theory has been adopted as the foundation of radiation protection standards and risk estimation for several decades. The "microdosimetric argument" has been offered in support of the LNT theory. This argument postulates that energy is deposited in critical cellular targets by radiation in a linear fashion across all doses down to zero, and that this in turn implies a linear relationship between dose and biological effect across all doses. This paper examines whether the microdosimetric argument holds at the lowest levels of biological organization following low dose, low dose-rate exposures to ionizing radiation. The assumptions of the microdosimetric argument are evaluated in light of recent radiobiological studies on radiation damage in biological molecules and cellular and tissue level responses to radiation damage. There is strong evidence that radiation initially deposits energy in biological molecules (e.g., DNA) in a linear fashion, and that this energy deposition results in various forms of prompt DNA damage that may be produced in a pattern that is distinct from endogenous (e.g., oxidative) damage. However, a large and rapidly growing body of radiobiological evidence indicates that cell and tissue level responses to this damage, particularly at low doses and/or dose-rates, are nonlinear and may exhibit thresholds. To the extent that responses observed at lower levels of biological organization in vitro are predictive of carcinogenesis observed in vivo, this evidence directly contradicts the assumptions upon which the microdosimetric argument is based.
Differential and total cross sections for the ionization of water molecule by electron impact
International Nuclear Information System (INIS)
Houamer, S.; Dal Cappello, C.; Mansouri, A.
2007-01-01
A theoretical approach is presented to calculate multiply differential and total cross sections of the ionization of H 2 O molecule in the vapour phase. The wave function of the target is described by molecular orbitals consisting of a linear combination of slater type atomic orbitals centered on the heaviest atom which is the oxygen atom in this case. The calculations are carried out in the first Born approximation where the projectile is described by a plane wave while the ejected electron is described by a coulomb wave taking into account its interaction with the residual ion. The spherical average over the Euler solid angle due to the randomly oriented gaseous target molecule is carried out analytically using the rotation matrix properties. The differential and total cross sections are thus evaluated without any special difficulty and compared with experiments and distorted wave calculations. Fair agreements are observed
Coherent Bichromatic Force Deflection of Molecules
Kozyryev, Ivan; Baum, Louis; Aldridge, Leland; Yu, Phelan; Eyler, Edward E.; Doyle, John M.
2018-02-01
We demonstrate the effect of the coherent optical bichromatic force on a molecule, the polar free radical strontium monohydroxide (SrOH). A dual-frequency retroreflected laser beam addressing the X˜2Σ+↔A˜2Π1 /2 electronic transition coherently imparts momentum onto a cryogenic beam of SrOH. This directional photon exchange creates a bichromatic force that transversely deflects the molecules. By adjusting the relative phase between the forward and counterpropagating laser beams we reverse the direction of the applied force. A momentum transfer of 70 ℏk is achieved with minimal loss of molecules to dark states. Modeling of the bichromatic force is performed via direct numerical solution of the time-dependent density matrix and is compared with experimental observations. Our results open the door to further coherent manipulation of molecular motion, including the efficient optical deceleration of diatomic and polyatomic molecules with complex level structures.
Spin dynamics in SiGe quantum dot lines and ring molecules
Zinovieva, A. F.; Nenashev, A. V.; Dvurechenskii, A. V.
2016-04-01
Semiconductor quantum dot (QD) structures can be used as a model for understanding the effect of the microscopic structure, symmetry of crystals, and molecules on their macroscopic properties. In this work, the results of two theoretical approaches demonstrate that the spin dynamics in ordered QD structures depends on the size, spatial configuration, and topology of the object built of QDs. It was shown that the spin dynamics in QD structures with the hopping regime of conductivity significantly differs from the spin dynamics in two-dimensional (2D) and three-dimensional (3D) structures being at the other side of the metal-insulator transition. The special character of the effective magnetic field δ H fluctuations appearing only during tunneling between quantum dots is responsible for the insensitivity of spin relaxation times to the magnitude of the external magnetic field in infinite QD structures (2D square lattice and 1D linear QD chain). In finite QD structures (QD rings and linear chains), an external magnetic field H0 is directly involved in the spin relaxation process and spin is lost due to interaction with a special combination of fields Δ H ˜[H0×δ H ]/δ H that leads to an unusual orientation dependence of ESR linewidth, recently observed for QD chains. It was shown that the ordering of QD structures can be used for the conservation of spin orientation. For 1D finite quantum dot chains, the ordering can provide the stabilization of all spin components Sx,Sy, and Sz, while for ringlike molecules only Sz polarization can be stabilized. The results obtained in this work can be useful for development of novel semiconductor devices and in quantum information processing.
Polarization dependent effects in photo-fragmentation dynamics of free molecules
International Nuclear Information System (INIS)
Mocellin, A.; Marinho, R.R.T.; Coutinho, L.H.; Burmeister, F.; Wiesner, K.; Naves de Brito, A.
2003-01-01
We present multicoincidence spectra of nitrogen, formic acid and methyl methacrylate. We demonstrate how to probe the local symmetry of molecular orbitals from molecules core excited with linearly polarized synchrotron radiation. The intensity distribution of the photoelectron photo-ion photo-ion coincidence (PEPIPICO) spectrum reflects the selectivity and localization of core excitation by polarized light. By simulating the spectra the angular dependence of the fragmentation is determined
Polarization dependent effects in photo-fragmentation dynamics of free molecules
Energy Technology Data Exchange (ETDEWEB)
Mocellin, A.; Marinho, R.R.T.; Coutinho, L.H.; Burmeister, F.; Wiesner, K.; Naves de Brito, A
2003-04-01
We present multicoincidence spectra of nitrogen, formic acid and methyl methacrylate. We demonstrate how to probe the local symmetry of molecular orbitals from molecules core excited with linearly polarized synchrotron radiation. The intensity distribution of the photoelectron photo-ion photo-ion coincidence (PEPIPICO) spectrum reflects the selectivity and localization of core excitation by polarized light. By simulating the spectra the angular dependence of the fragmentation is determined.
Growing interstellar molecules with ion-molecule reactions
International Nuclear Information System (INIS)
Bohme, D.K.
1989-01-01
Laboratory measurements of gas-phase ion-molecule reactions continue to provide important insights into the chemistry of molecular growth in interstellar environments. It is also true that the measurements are becoming more demanding as larger molecules capture our interest. While some of these measurements are motivated by current developments in chemical models of interstellar environments or by new molecular observations by astronomers, others explore novel chemistry which can lead to predictions of new interstellar molecules. Here the author views the results of some recent measurements, taken in the Ion Chemistry Laboratory at York University with the SIFT technique, which address some of the current needs of modellers and observers and which also provide some new fundamental insight into molecular growth, particularly when it occurs in the presence of large molecules such as PAH molecules which are now thought to have a major influence on the chemistry of interstellar environments in which they are present
International Nuclear Information System (INIS)
Lin Humao; Qing Caixiao; Qian Miao; Ping Xiaohong
2005-01-01
A novel europium(III) coordination polymer [Eu(Sip)(H 2 O) 5 ] n · nH 2 O · 1.5 n(Bipy) (I) (Sip is 5-sulfoisophthalate trivalent anion and Bipy is 4,4'-bipyridine) is hydrothermally synthesized and determined by the single crystal X-ray diffraction method. Polymer I crystallizes in the monoclinic system, space group C2/c with a = 30.7515(6), b = 10.9577(2), c = 17.5545(4) A, β = 112.040(1) deg, Z = 4. In I, each Eu 3+ ion is coordinated by four oxygen atoms from two carboxylate groups of two different Sip anions and five oxygen atoms from five coordinated water molecules to complete a deformed mono-cap square antiprism. Moreover, each Sip anion acts as a tetradentate ligand to connect two adjacent Eu 3+ ions through its two chelating carboxylate groups, resulting in one-dimensional linear chains. In addition, fifteen different kinds of hydrogen-bonding interactions link the chains, lattice water molecules, and free Bipy molecules to engender a complicated hydrogen-bonding network [ru
International Nuclear Information System (INIS)
Garrett, W.R.
1979-01-01
Through the use of a molecular pseudopotential method, we determine the a approximate magnitudes of errors that result when electron affinity determinations of polar negative ions are made through ab initio calculations in which the use of a given basis set yields inappropriate values for permanent and induced dipole moments of the neutral molecule. These results should prove useful in assessing the adequacy of basis sets in ab initio calculations of molecular electron affinities for simple linear polar molecules
Electron capture in collisions between O6+ ions and H2O molecules
Bodewits, D.; Hoekstra, R.
By means of photon emission spectroscopy, state selective electron capture cross section for low energy (0.1-7.5 keV/amu) collisions of O6+ on H2O molecules have been measured. Over the range of interaction energies the state selective cross sections change strongly, i.e., by factors up to 5, while
Behavior of ro-vibrationally excited H2 molecules and H atoms in a plasma expansion
International Nuclear Information System (INIS)
Vankan, P.; Schram, D.C.; Engeln, R.
2005-01-01
The behavior in a supersonic plasma expansion of H atom and H2 molecules, both ground-state and ro-vibrationally excited, is studied using various laser spectroscopic techniques. The ground-state H2 molecules expand like a normal gas. The behavior of H atoms and H 2 rv molecules, on the other hand, is considerably influenced, and to some extend even determined, by their reactivity. The H atoms diffuse out of the expansion due to surface association at the walls of the vacuum vessel. Moreover, by reducing the surface area of the nozzle by a factor of two, the amount of H atoms leaving the source is increased by one order of magnitude, due to a decreased surface association of H atoms in the nozzle. The evolution of the ro-vibrational distributions along the expansion axis shows the relaxation of the molecular hydrogen from the high temperature in the up-stream region to the low ambient temperature in the down-stream region. Whereas the vibrational distribution resembles a Boltzmann distribution, the rotational distribution is a non-equilibrium one, in which the high rotational levels (J > 7) are much more populated than what is expected from the low rotational levels (J <5). We observed overpopulations of up to seven orders of magnitude. The production of the high rotational levels is very probably connected to the surface association in the nozzle
Yu, Donghai; Du, Ruobing; Xiao, Ji-Chang
2016-07-05
Ninety-six acidic phosphorus-containing molecules with pKa 1.88 to 6.26 were collected and divided into training and test sets by random sampling. Structural parameters were obtained by density functional theory calculation of the molecules. The relationship between the experimental pKa values and structural parameters was obtained by multiple linear regression fitting for the training set, and tested with the test set; the R(2) values were 0.974 and 0.966 for the training and test sets, respectively. This regression equation, which quantitatively describes the influence of structural parameters on pKa , and can be used to predict pKa values of similar structures, is significant for the design of new acidic phosphorus-containing extractants. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Steric hindrances create a discrete linear Dy4 complex exhibiting SMM behaviour.
Lin, Shuang-Yan; Zhao, Lang; Ke, Hongshan; Guo, Yun-Nan; Tang, Jinkui; Guo, Yang; Dou, Jianmin
2012-03-21
Two linear tetranuclear lanthanide complexes of general formula [Ln(4)(L)(2)(C(6)H(5)COO)(12)(MeOH)(4)], where HL = 2,6-bis((furan-2-ylmethylimino)methyl)-4-methylphenol, () and Ln(III) = Dy(III) (1) and Gd(III) (2), have been synthesized and characterized. The crystal structural analysis demonstrates that two Schiff-base ligands inhibit the growth of benzoate bridged 1D chains, leading to the isolation of discrete tetranuclear complexes due to their steric hindrances. Every Ln(III) ion is coordinated by eight donor atoms in a distorted bicapped trigonal-prismatic arrangement. Alternating current (ac) susceptibility measurements of complex 1 reveal a frequency- and temperature-dependent out-of-phase signal under zero dc field, typical of single-molecule magnet (SMM) behaviour with an anisotropic barrier Δ(eff) = 17.2 K.
A Novel Small-molecule WNT Inhibitor, IC-2, Has the Potential to Suppress Liver Cancer Stem Cells.
Seto, Kenzo; Sakabe, Tomohiko; Itaba, Noriko; Azumi, Junya; Oka, Hiroyuki; Morimoto, Minoru; Umekita, Yoshihisa; Shiota, Goshi
2017-07-01
The presence of cancer stem cells (CSCs) contributes to metastasis, recurrence, and resistance to chemo/radiotherapy in hepatocellular carcinoma (HCC). The WNT signaling pathway is reportedly linked to the maintenance of stemness of CSCs. In the present study, in order to eliminate liver CSCs and improve the prognosis of patients with HCC, we explored whether small-molecule compounds targeting WNT signaling pathway suppress liver CSCs. The screening was performed using cell proliferation assay and reporter assay. We next investigated whether these compounds suppress liver CSC properties by using flow cytometric analysis and sphere-formation assays. A mouse xenograft model transplanted with CD44-positive HuH7 cells was used to examine the in vivo antitumor effect of IC-2. In HuH7 human HCC cells, 10 small-molecule compounds including novel derivatives, IC-2 and PN-3-13, suppressed cell viability and WNT signaling activity. Among them, IC-2 significantly reduced the CD44-positive population, also known as liver CSCs, and dramatically reduced the sphere-forming ability of both CD44-positive and CD44-negative HuH7 cells. Moreover, CSC marker-positive populations, namely CD90-positive HLF cells, CD133-positive HepG2 cells, and epithelial cell adhesion molecule-positive cells, were also reduced by IC-2 treatment. Finally, suppressive effects of IC-2 on liver CSCs were also observed in a xenograft model using CD44-positive HuH7 cells. The novel derivative of small-molecule WNT inhibitor, IC-2, has the potential to suppress liver CSCs and can serve as a promising therapeutic agent to improve the prognosis of patients with HCC. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
International Nuclear Information System (INIS)
Krivonos, S.O.; Sorin, A.S.
1994-06-01
We show that the Zamolodchikov's and Polyakov-Bershadsky nonlinear algebras W 3 and W (2) 3 can be embedded as subalgebras into some linear algebras with finite set of currents. Using these linear algebras we find new field realizations of W (2) 3 and W 3 which could be a starting point for constructing new versions of W-string theories. We also reveal a number of hidden relationships between W 3 and W (2) 3 . We conjecture that similar linear algebras can exist for other W-algebra as well. (author). 10 refs
International Nuclear Information System (INIS)
Kuppermann, Aron; Gordon, R.J.; Coggiola, M.J.
1974-01-01
Differential elastic scattering cross sections for the systems H 2 +O 2 , SF 6 , NH 3 , CO, and CH 4 and for D 2 +O 2 , SF 6 , and NH 3 have been obtained from crossed beam studies. In all cases, rapid quantum oscillations have been resolved which permit the determination of intermolecular potentiel parameters if a central-field assumption is adopted. These potentials were found to be independent of both the isotopic form of the hydrogen molecule, and the relative collision energy. As a result of this, and the ability of these spherical potentials to quantitatively describe the measured scattering, it is concluded that anisotropy effects do not seem important in these H 2 (D 2 ) systems
Non linear realizations of SU(2) x U(1) in the MSSM model independent analysis and g - 2 of W bosons
Ferrara, Sergio; Porrati, Massimo; Ferrara, Sergio; Masiero, Antonio; Porrati, Massimo
1993-01-01
We perform a model-independent analysis of the spontaneously broken phase of an $SU(2)\\times U(1)$ supersymmetric gauge theory, by using a non-linear parametrization of the Goldstone sector of the theory. The non-linear variables correspond to an $SL(2,C)$ superfield matrix in terms of which a non-linear Lagrangian can be constructed, and the pattern of supersymmetry breaking investigated. The supersymmetric order parameter is the V.E.V. of the neutral pseudo-Goldstone boson. Some applications of this technique are considered, in relation to the minimal supersymmetric standard model, and to determine the $g-2$ of the $W$-bosons in the limit of large top mass.
Bitter and sweet tasting molecules: It's complicated.
Di Pizio, Antonella; Ben Shoshan-Galeczki, Yaron; Hayes, John E; Niv, Masha Y
2018-04-19
"Bitter" and "sweet" are frequently framed in opposition, both functionally and metaphorically, in regard to affective responses, emotion, and nutrition. This oppositional relationship is complicated by the fact that some molecules are simultaneously bitter and sweet. In some cases, a small chemical modification, or a chirality switch, flips the taste from sweet to bitter. Molecules humans describe as bitter are recognized by a 25-member subfamily of class A G-protein coupled receptors (GPCRs) known as TAS2Rs. Molecules humans describe as sweet are recognized by a TAS1R2/TAS1R3 heterodimer of class C GPCRs. Here we characterize the chemical space of bitter and sweet molecules: the majority of bitter compounds show higher hydrophobicity compared to sweet compounds, while sweet molecules have a wider range of sizes. Importantly, recent evidence indicates that TAS1Rs and TAS2Rs are not limited to the oral cavity; moreover, some bitterants are pharmacologically promiscuous, with the hERG potassium channel, cytochrome P450 enzymes, and carbonic anhydrases as common off-targets. Further focus on polypharmacology may unravel new physiological roles for tastant molecules. Copyright © 2018 Elsevier B.V. All rights reserved.
The mechanism of 2-dimensional manipulation of DNA molecules by water and ethanol flows
International Nuclear Information System (INIS)
Shen Zigang; Huang Yibo; Li Bin; Zhang Yi
2007-01-01
Due to its unique physical and chemical properties, DNA has recently become a promising material for building blocks in nanofabrication. Many researches focus on how to use DNA molecules as a template for nanowires. Molecular Combing technique is one of important methods to manipulate DNA molecules by using a water meniscus and form specific DNA nano-structures on surfaces. In this paper, by employing a modified molecular combing technique, special patterns of DNA molecules was formed, and the interaction between liquid flows or meniscus and DNA molecules was analyzed, and the mechanism of manipulating DNA molecules by liquid was studied. (authors)
DEFF Research Database (Denmark)
Lyles, J M; Linnemann, D; Bock, E
1984-01-01
Posttranslational modifications and intracellular transport of the D2-cell adhesion molecule (D2-CAM) were examined in cultured fetal rat neuronal cells. Developmental changes in biosynthesis were studied in rat forebrain explant cultures. Two D2-CAM polypeptides with Mr of 187,000-210,000 (A...
Gerald, II; Rex, E [Brookfield, IL; Klingler, Robert J [Glenview, IL; Rathke, Jerome W [Homer Glen, IL; Diaz, Rocio [Chicago, IL; Vukovic, Lela [Westchester, IL
2009-03-10
A method, apparatus, and system for constructing uniform macroscopic films with tailored geometric assemblies of molecules on the nanometer scale. The method, apparatus, and system include providing starting molecules of selected character, applying one or more force fields to the molecules to cause them to order and condense with NMR spectra and images being used to monitor progress in creating the desired geometrical assembly and functionality of molecules that comprise the films.
Belloche, A.; Müller, H. S. P.; Menten, K. M.; Schilke, P.; Comito, C.
2013-11-01
Context. The discovery of amino acids in meteorites fallen to Earth and the detection of glycine, the simplest of them, in samples returned from a comet to Earth strongly suggest that the chemistry of the interstellar medium is capable of producing such complex organic molecules and that they may be widespread in our Galaxy. Aims: Our goal is to investigate the degree of chemical complexity that can be reached in the interstellar medium, in particular in dense star-forming regions. Methods: We performed an unbiased, spectral line survey toward Sgr B2(N) and (M), two regions where high-mass stars are formed, with the IRAM 30 m telescope in the 3 mm atmospheric transmission window. Partial surveys at 2 and 1.3 mm were performed in parallel. The spectra were analyzed with a simple radiative transfer model that assumes local thermodynamic equilibrium but takes optical depth effects into account. Results: About 3675 and 945 spectral lines with a peak signal-to-noise ratio higher than 4 are detected at 3 mm toward Sgr B2(N) and (M), i.e. about 102 and 26 lines per GHz, respectively. This represents an increase by about a factor of two over previous surveys of Sgr B2. About 70% and 47% of the lines detected toward Sgr B2(N) and (M) are identified and assigned to 56 and 46 distinct molecules as well as to 66 and 54 less abundant isotopologues of these molecules, respectively. In addition, we report the detection of transitions from 59 and 24 catalog entries corresponding to vibrationally or torsionally excited states of some of these molecules, respectively, up to a vibration energy of 1400 cm-1 (2000 K). Excitation temperatures and column densities were derived for each species but should be used with caution. The rotation temperatures of the detected complex molecules typically range from ~50 to 200 K. Among the detected molecules, aminoacetonitrile, n-propyl cyanide, and ethyl formate were reported for the first time in space based on this survey, as were five rare
Jiang, Zhuoling; Wang, Hao; Shen, Ziyong; Sanvito, Stefano; Hou, Shimin
2016-07-28
The atomic structure and electronic transport properties of a single hydrogen molecule connected to both symmetric and asymmetric Cu electrodes are investigated by using the non-equilibrium Green's function formalism combined with the density functional theory. Our calculations show that in symmetric Cu-H2-Cu junctions, the low-bias conductance drops rapidly upon stretching, while asymmetric ones present a low-bias conductance spanning the 0.2-0.3 G0 interval for a wide range of electrode separations. This is in good agreement with experiments on Cu atomic contacts in a hydrogen environment. Furthermore, the distribution of the calculated vibrational energies of the two hydrogen atoms in the asymmetric Cu-H2-Cu junction is also consistent with experiments. These findings provide clear evidence for the formation of asymmetric Cu-H2-Cu molecular junctions in breaking Cu atomic contacts in the presence of hydrogen and are also helpful for the design of molecular devices with Cu electrodes.
Wang, Wen-Min; Zhao, Xiao-Yu; Qiao, Hui; Bai, Li; Han, Hong-Fei; Fang, Ming; Wu, Zhi-Lei; Zou, Ji-Yong
2017-09-01
In search of simple approaches to rationally modulate the single-molecule magnet behaviour in polynuclear lanthanide compound, a new system containing two structurally closely related dinuclear dysprosium complexes, namely [Dy2(hfac)4L2] (1) and [Dy2(hfac)4L‧2] (2) (hfac = hexafluoroacetylacetonate, HL = 2-[4-methylaniline-imino]methyl]-8-hydroxyquinoline and HL' = 2-[(3,4-dimethylaniline)-imino]methyl]-8-hydroxyquinoline), are successfully synthesized and the structure-dependent magnetic properties are investigated. The two Dy2 compounds display only slight variations in the coordination geometries of the center Dy(III) ion but display remarkably different single-molecule magnet behaviors with the anisotropic barriers (ΔE/kB) of 9.91 K for 1 and 20.57 K for 2. The different magnetic relaxation behaviors of the two Dy2 complexes mainly originate from the different chemical environments of the central DyIII ions.
Linearity and Non-linearity of Photorefractive effect in Materials ...
African Journals Online (AJOL)
Linearity and Non-linearity of Photorefractive effect in Materials using the Band transport ... For low light beam intensities the change in the refractive index is ... field is spatially phase shifted by /2 relative to the interference fringe pattern, which ...
Adsorption behavior of Co anchored on graphene sheets toward NO, SO2, NH3, CO and HCN molecules
International Nuclear Information System (INIS)
Tang, Yanan; Chen, Weiguang; Li, Chenggang; Pan, Lijun; Dai, Xianqi; Ma, Dongwei
2015-01-01
Graphical abstract: - Highlights: • In contrast to the pristine graphene, a vacancy defect in graphene strongly stabilizes the Co atom. • The positively charged of Co atom on graphene can regulate the stability of gas molecules. • Different gas molecules can modulate the electronic structure of Co–graphene systems. • The adsorbed NO on Co–graphene can effectively regulate the magnetic properties of systems. - Abstract: Based on the first-principles of density-functional theory (DFT), the effects of gas adsorption on the change in geometric stability, electronic structure and magnetic properties of graphene with anchored Co (Co–graphene) systems were investigated. A single Co adatom interacts much weaker with pristine graphene (Co/pri–graphene) than with the graphene containing a single vacancy (Co/SV–graphene). The Co dopant provides more electrons to the dangling bonds of carbon atom at defective site and exhibits more positive charges, which makes Co/SV–graphene less prone to be adsorbed by gas molecules in comparison to Co/pri–graphene. It is found that the electronic structure and magnetic properties of Co–graphene systems can be modulated by adsorbing gas molecules. Except the NH 3 molecule, the adsorbed NO, SO 2 , CO or HCN as electron acceptors on the Co/pri–graphene can exhibit semiconducting properties. Among the gas molecules, the strong adsorption of NO molecule can effectively regulate the magnetic properties of Co–graphene systems. Moreover, the stable configuration of Co/SV–graphene is more likely to be the gas sensor for detecting NO and SO 2 . The results validate that the reactivity of atomic-scale catalyst is supported on graphene sheets, which is expected to be potentially efficient in the gas sensors and electronic device
International Nuclear Information System (INIS)
Zhao, B.; Shang, C.; Qi, N.; Chen, Z.Y.; Chen, Z.Q.
2017-01-01
Highlights: • Defects can exist steadily in monolayer MoS_2 and break surface chemical inertness. • Activated surfaces are beneficial to the adsorption of O_2 through the introduction of defect levels. • Adsorbed O_2 on defective surface can dissociate with low activation energy barrier. • Defective system may be a potential substrate to design MoS_2-based gas sensor or catalysts. - Abstract: The stability of various defects in monolayer MoS_2, as well as their interactions with free O_2 molecules were investigated by density functional theory (DFT) calculations coupled with the nudged elastic band (NEB) method. The defects including S vacancy (monosulfur and disulfue vacancies), antisite defect (Mo_S) and external Mo atom can exist steadily in monolayer MoS_2, and introduce defect levels in these defective systems, which breaks the surface chemical inertness and significantly enhances the adsorption capacity for free O_2. The adsorption energy calculations and electronic properties analysis suggest that there is a strong interaction between O_2 molecule and defective system. The adsorbed O_2 on the defective surface can dissociate with a lower activation energy barrier, which produce two active oxygen atoms. Especially, two Mo atoms can occupy one Mo lattice site, and adsorbed O_2 on the top of the Mo atom can then dissociate directly with the lowest activation energy barrier. Hence, our work may provide useful information to design MoS_2-based gas sensor or catalysts.
Li, Xiang; Brinckerhoff, William B.; Pinnick, Veronica T; van Amerom, Friso H. W.; Danell, Ryan M.; Arevalo, Ricardo D., Jr.; Getty, Stephanie; Mahaffy, Paul R.
2015-01-01
The Mars Organic Molecule Analyzer (MOMA) investigation on the 2018 ExoMars rover will examine the chemical composition of samples acquired from depths of up to two meters below the martian surface, where organics may be protected from radiative and oxidative degradation. The MOMA instrument is centered around a miniaturized linear ion trap (LIT) that facilitates two modes of operation: i) pyrolysisgas chromatography mass spectrometry (pyrGC-MS); and, ii) laser desorptionionization mass spectrometry (LDI-MS) at ambient Mars pressures. The LIT also enables the structural characterization of complex molecules via complementary analytical capabilities, such as multi-frequency waveforms (i.e., SWIFT) and tandem mass spectrometry (MSMS). When combined with the complement of instruments in the rovers Pasteur Payload, MOMA has the potential to reveal the presence of a wide range of organics preserved in a variety of mineralogical environments, and to begin to understand the structural character and potential origin of those compounds.
Ma, Q.; Boulet, C.; Tipping, R. H.
2014-01-01
The refinement of the Robert-Bonamy (RB) formalism by considering the line coupling for isotropic Raman Q lines of linear molecules developed in our previous study [Q. Ma, C. Boulet, and R. H. Tipping, J. Chem. Phys. 139, 034305 (2013)] has been extended to infrared P and R lines. In these calculations, the main task is to derive diagonal and off-diagonal matrix elements of the Liouville operator iS1 - S2 introduced in the formalism. When one considers the line coupling for isotropic Raman Q lines where their initial and final rotational quantum numbers are identical, the derivations of off-diagonal elements do not require extra correlation functions of the ^S operator and their Fourier transforms except for those used in deriving diagonal elements. In contrast, the derivations for infrared P and R lines become more difficult because they require a lot of new correlation functions and their Fourier transforms. By introducing two dimensional correlation functions labeled by two tensor ranks and making variable changes to become even functions, the derivations only require the latters' two dimensional Fourier transforms evaluated at two modulation frequencies characterizing the averaged energy gap and the frequency detuning between the two coupled transitions. With the coordinate representation, it is easy to accurately derive these two dimensional correlation functions. Meanwhile, by using the sampling theory one is able to effectively evaluate their two dimensional Fourier transforms. Thus, the obstacles in considering the line coupling for P and R lines have been overcome. Numerical calculations have been carried out for the half-widths of both the isotropic Raman Q lines and the infrared P and R lines of C2H2 broadened by N2. In comparison with values derived from the RB formalism, new calculated values are significantly reduced and become closer to measurements.
Interaction of He+2 ions with hydrogen molecules
International Nuclear Information System (INIS)
Afrosimov, V.V.; Leiko, G.A.; Panov, M.N.
1980-01-01
Cross sections for all elementary reactions involving a change in charge state in He +2 -H 2 collisions have been measured for He +2 kinetic energies in the range E=1.2--100 keV. Measurements were carried out by distinguishing an individual collision by a coincidence method and by simultaneously analyzing the charge states of the fast and slow particles. Furthermore, in the same event, the electronic states of the particles after the collision were determined by analyzing the kinetic energies of the resulting ions. The elementary reactions involving the formation of He + ions in the ground and excited states were studied. The reactions involving transitions in the hydrogen molecule to the 1ssigma/sub g/ and 2psigma/sub u/ states of H 2 + ions, and reactions in which wto protons are formed, were also studied. At E>15 keV, the largest cross section is that corresponding to one-electron capture: He +2 +H 2 →He + +H 2 + (this cross section is sigma=8.3 x 10 -16 cm 2 at E=50 keV). In this reaction, 90--98% of the He + ions are formed in excited states with principal quantum number n=2. At E + ion predominates, accompanied by the simultaneous dissociation of the H 2 + ion: He +2 +H 2 →He + (1s)+H + H+H0+e - . The cross section for this exothermic capture with dissociation (the energy released is ΔEapprox. =+36.3--3.8 eV) increases with decreasing energy E. At E>15 keV, an endothermic pathway is predominant: →He + (2s,2p)+H + +H+0+e - (the energy expended, ΔE, is more than 3.2 eV). The existence of two capture reactions with dissociation - exothermic and endothermic - leads to a minimum in the cross section for this reaction, at Eapprox. =15 keV. Ionization reactions and ionization with dissociation have the smallest cross sections
GARN2: coarse-grained prediction of 3D structure of large RNA molecules by regret minimization.
Boudard, Mélanie; Barth, Dominique; Bernauer, Julie; Denise, Alain; Cohen, Johanne
2017-08-15
Predicting the 3D structure of RNA molecules is a key feature towards predicting their functions. Methods which work at atomic or nucleotide level are not suitable for large molecules. In these cases, coarse-grained prediction methods aim to predict a shape which could be refined later by using more precise methods on smaller parts of the molecule. We developed a complete method for sampling 3D RNA structure at a coarse-grained model, taking a secondary structure as input. One of the novelties of our method is that a second step extracts two best possible structures close to the native, from a set of possible structures. Although our method benefits from the first version of GARN, some of the main features on GARN2 are very different. GARN2 is much faster than the previous version and than the well-known methods of the state-of-art. Our experiments show that GARN2 can also provide better structures than the other state-of-the-art methods. GARN2 is written in Java. It is freely distributed and available at http://garn.lri.fr/. melanie.boudard@lri.fr or johanne.cohen@lri.fr. Supplementary data are available at Bioinformatics online. © The Author (2017). Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com
Single Molecule Screening of Disease DNA Without Amplification
Energy Technology Data Exchange (ETDEWEB)
Lee, Ji-Young [Iowa State Univ., Ames, IA (United States)
2006-01-01
was probed with fluorescently-labeled probe molecules and imaged. When only the probes were stained and hybridized in a vial, it had 6 orders of magnitude dynamic range with a detection limit of ~0.7 copy/cell. A second dye was added to lower the false positive levels. Although there was a sacrifice of two orders of magnitude in detection limit, the number of false positives was reduced to zero. HPV-16 DNA was also hybridized and detected on surface-tethered probes. When the entire human genomic DNA and HPV was labeled and hybridized, the detection limit was similar to that of one-color assay detected in capillary. However, non-specific adsorption was high, and the dynamic range was narrow because of saturation of the surface and electrostatic repulsion between hybridized targets on the surface. The second probe was introduced to lower non-specific adsorption, and the strategy succeeded in 4 orders of magnitude linear dynamic range in a log-log plot, along with 2.4 copies/cell detection limit. DNA extracts of cell lines that contained a known copy number of HPV-16 DNA were tested with the four strategies described above. The calculated numbers from observed molecule counts matched the known values. Results from the Pap test sample with added HPV DNA were similar to those of purified DNA, suggesting our method is compatible with the conventional Pap test sample collection method. Further optimization will be needed before this single molecule level detection and identification can actually be used in a real clinical lab, but it has good potential and applicability. Improvement such as automated imaging and scanning, more accurate data processing software as well as sensitive camera, should help increase the efficiency and throughput.
Controlling the interparticle distance in a 2D molecule-nanoparticle network
Energy Technology Data Exchange (ETDEWEB)
Guedon, C M; Zonneveld, J; Van der Molen, S J [Kamerlingh Onnes Laboratorium, Leiden University, PO Box 9504, 2300 RA Leiden (Netherlands); Valkenier, H; Hummelen, J C [Stratingh Institute for Chemistry, University of Groningen, Nijenborgh 4, 9747 AG Groningen (Netherlands)
2011-03-25
Mechanically controllable break junctions allow for an impressive level of control over the distance between two electrodes, but lack stability at room temperature. On the other hand, two-dimensional (2D) networks of nanoparticles bridged by molecules form a stable device structure for investigating molecular conductance properties. Here, we combine both techniques to create a robust platform for molecular charge transport with control over the inter-electrode distance on the picometer scale. The resistance change due to bending of our structures is dependent on the molecular species present between the nanoparticles.
Controlling the interparticle distance in a 2D molecule-nanoparticle network
International Nuclear Information System (INIS)
Guedon, C M; Zonneveld, J; Van der Molen, S J; Valkenier, H; Hummelen, J C
2011-01-01
Mechanically controllable break junctions allow for an impressive level of control over the distance between two electrodes, but lack stability at room temperature. On the other hand, two-dimensional (2D) networks of nanoparticles bridged by molecules form a stable device structure for investigating molecular conductance properties. Here, we combine both techniques to create a robust platform for molecular charge transport with control over the inter-electrode distance on the picometer scale. The resistance change due to bending of our structures is dependent on the molecular species present between the nanoparticles.
Energy Technology Data Exchange (ETDEWEB)
Lim, Jaewook; Kang, Ikjoong [Gachon Univ., Seongnam (Korea, Republic of)
2014-01-15
This research was aimed to fabricate an optical fiber-based SERS substrate which can detect dopamine neurotransmitters. Chitosan nanoparticles (NPs) were firstly anchored on the surface of optical fiber, and then gold layer was subseque N{sub T}ly deposited on the anchored chitosan NPs via electroless plating method. Finally, chitosan-gold nanocomposites combined with optical fiber reacted with dopamine molecules of 100-1500 mg/ day which is a standard daily dose for Parkinson's disease patientss. The amplified Raman signal at 1348 cm{sup -1} obtained from optical fiber-based SERS substrate was plotted versus dopamine concentrations (1-10 mM), demonstrating an approximate linearity of Y = 303.03X + 2385.8 (R{sup 2} = 0.97) with narrow margin errors. The optical fiber-based Raman system can be potentially applicable to in-vitro (or in-vivo) detection of probe molecules.
DETECTION OF NONPOLAR IONS IN 2Π3/2 STATES BY RADIOASTRONOMY VIA MAGNETIC DIPOLE TRANSITIONS
International Nuclear Information System (INIS)
Morse, Michael D.; Maier, John P.
2011-01-01
The possibility of magnetic dipole-induced pure rotational transitions in the interstellar medium is investi- gated for symmetric Hund's case (a) linear molecules, such as H-C≡C-H + (X-tilde 2 Π 3/2u ), CO 2 + (X-tilde 2 Π 3/2g ), H-C≡C-C≡C-H + (X-tilde 2 Π 3/2g ), and N 3 (X-tilde 2 Π 3/2g ). These species lack an electric dipole moment and therefore cannot undergo pure rotational electric dipole transitions. These species can undergo pure rotational transitions via the parallel component of the magnetic dipole operator, however. The transition moments and Einstein A coefficients for the allowed pure rotational transitions are derived for a general Hund's case (a) linear molecule, and tabulated for the examples of H-C≡C-H + ( 2 Π 3/2u ) and H-C≡C-C≡C-H + ( 2 Π 3/2g ). It is found that the rates of emission are comparable to collision rates in interstellar clouds, suggesting that this decay mechanism may be important in simulating rotational population distributions in diffuse clouds and for detecting these molecules by radioastronomy. Expected line positions for the magnetic dipole-allowed R ef (J) and R fe (J) transitions of H-C≡C-H + ( 2 Π 3/2u ), H-C≡C-C≡C-H + ( 2 Π 3/2g ), CO 2 + ( 2 Π 3/2g ), and N 3 ( 2 Π 3/2g ) are tabulated to assist in their observation by radioastronomy or in the laboratory.
su(1,2) Algebraic Structure of XYZ Antiferromagnetic Model in Linear Spin-Wave Frame
International Nuclear Information System (INIS)
Jin Shuo; Xie Binghao; Yu Zhaoxian; Hou Jingmin
2008-01-01
The XYZ antiferromagnetic model in linear spin-wave frame is shown explicitly to have an su(1,2) algebraic structure: the Hamiltonian can be written as a linear function of the su(1,2) algebra generators. Based on it, the energy eigenvalues are obtained by making use of the similar transformations, and the algebraic diagonalization method is investigated. Some numerical solutions are given, and the results indicate that only one group solution could be accepted in physics
Ion transmission in a linear radiofrequency spectrometer
International Nuclear Information System (INIS)
Gomet, J.-C.
1975-01-01
A linear radiofrequency spectrometer is used for the purpose of experimental determination of the absolute ionization cross sections of various ions obtained by electron impact on polyatomic molecules. The transmission of the apparatus is studied: it does not only depend on the mass resolution of the spectrometer, but also on the nature of ions. It is affected by charge transfers, especially for the parent ions. An empiric way of correction of the apparatus function is given which allows the use at 10 -6 Torr [fr
Ghost field realizations of the spinor $W_{2,s}$ strings based on the linear W(1,2,s) algebras
Liu, Yu-Xiao; Zhang, Li-Jie; Ren, Ji-Rong
2005-01-01
It has been shown that certain W algebras can be linearized by the inclusion of a spin-1 current. This Provides a way of obtaining new realizations of the W algebras. In this paper, we investigate the new ghost field realizations of the W(2,s)(s=3,4) algebras, making use of the fact that these two algebras can be linearized. We then construct the nilpotent BRST charges of the spinor non-critical W(2,s) strings with these new realizations.
Ghost field realizations of the spinor W2,s strings based on the linear W1,2,s algebras
International Nuclear Information System (INIS)
Liu Yuxiao; Ren Jirong; Zhang Lijie
2005-01-01
It has been shown that certain W algebras can be linearized by the inclusion of a spin-1 current. This provides a way of obtaining new realizations of the W algebras. In this paper, we investigate the new ghost field realizations of the W 2,s (s=3,4) algebras, making use of the fact that these two algebras can be linearized. We then construct the nilpotent BRST charges of the spinor non-critical W 2,s strings with these new realizations. (author)
Thermally induced charge current through long molecules
Zimbovskaya, Natalya A.; Nitzan, Abraham
2018-01-01
In this work, we theoretically study steady state thermoelectric transport through a single-molecule junction with a long chain-like bridge. Electron transmission through the system is computed using a tight-binding model for the bridge. We analyze dependences of thermocurrent on the bridge length in unbiased and biased systems operating within and beyond the linear response regime. It is shown that the length-dependent thermocurrent is controlled by the lineshape of electron transmission in the interval corresponding to the HOMO/LUMO transport channel. Also, it is demonstrated that electron interactions with molecular vibrations may significantly affect the length-dependent thermocurrent.
Voss, S C; Giraud, S; Alsayrafi, M; Bourdon, P C; Schumacher, Y O; Saugy, M; Robinson, N
2013-08-01
The major objective of this study was to investigate the effects of several days of intense exercise on growth hormone (hGH) testing using the World Anti-Doping Agencies hGH isoform differential immunoassays. Additionally the effects of circadian variation and exercise type on the isoform ratios were also investigated. 15 male athletes performed a simulated nine day cycling stage race. Blood samples were collected twice daily over a period of 15 days (stage race+three days before and after). hGH isoforms were analysed by the official WADA immunoassays (CMZ Assay GmbH). All measured isoform ratios were far below the WADA decision limits for an adverse analytical finding. Changes in the isoform ratios could not be clearly connected to circadian variation, exercise duration or intensity. The present study demonstrates that the hGH isoform ratios are not significantly affected by exercise or circadian variation. We demonstrated that heavy, long term exercise does not interfere with the decision limits for an adverse analytical finding. Copyright © 2013 Elsevier Ltd. All rights reserved.
Dissolving Microneedle Patch for Transdermal Delivery of Human Growth Hormone
Lee, Jeong Woo; Choi, Seong-O; Felner, Eric I.
2014-01-01
Clinical impact of biotechnology has been constrained by the limitations of traditional hypodermic injection of biopharmaceuticals. Microneedle patches have been proposed as a minimally invasive alternative. In this study, we assess the translation of a dissolving microneedle patch designed for simple, painless self-administration of biopharmacetucials that generates no sharp biohazardous waste. To study pharmacokinetics and safety of this approach, human growth hormone (hGH) was encapsulated in 600 μm long dissolving microneedles composed of carboxymethylcellulose and trehalose using an aqueous, moderate-temperature process that maintained complete hGH activity after encapsulation and retained most activity after storage for up to 15 months at room temperature and humidity. After manual insertion into the skin of hairless rats, hGH pharmacokinetics were similar to conventional subcutaneous injection. After patch removal, the microneedles had almost completely dissolved, leaving behind only blunt stubs. The dissolving microneedle patch was well tolerated, causing only slight, transient erythema. This study suggests that a dissolving microneedle patch can deliver hGH and other biopharmaceuticals in a manner suitable for self-administration without sharp biohazardous waste. PMID:21360810
An abnormal carbohydrate tolerance in acromegaly
International Nuclear Information System (INIS)
Qi Jinwu
1988-01-01
An abnormal secretion of plasma human growth hormore (hGH) and insulin in 67 acromegalic patients had been previously treated by external pituitary radiation were studied. All subjects, following an overnight fast, a standard 100 g oral glucose tolerance test, were performed and venous blood samples were taken at 0, 30, 60, 120 and 180 min. They were measured for blood glucose, plasma insulin and hGH. The results of this study have shown that, of the 67 subjects, 23 cases had an abnormal glucose tolerance(34.32%). Diabetes was detected in 17 cases (23.37%) and 6 patients had decreased glucose tolerance(8.69%). In all, hGH levels were consistantly above 5 ng/ml and were not suppressed after an oral glucose load. In these patients, however, about one-third had abnormal glucose tolerance. Low plasma insulin response to glucose and that of the releasing were evident in them than the normal glucose tolerance and a healthy control group. In addition, the mechanism of the abnormal secretion of hGH and insulin were disscussed
Voltage dependency of transmission probability of aperiodic DNA molecule
Wiliyanti, V.; Yudiarsah, E.
2017-07-01
Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.
Gall, Andrew; Gardiner, Alastair T; Cogdell, Richard J; Robert, Bruno
2006-07-10
In this work we have investigated the carotenoid-protein interactions in LH2 complexes of Rhodopseudomonas acidophila both in "free in solution" mixed-micelles and in three-dimensional crystals by Raman spectroscopy in resonance with the carotenoid (Car) molecules. We show that the Car molecules when bound to their binding pockets show no significant differences when the complexes are "free in solution" or packed in crystalline arrays. Furthermore, there is no significant wavelength dependence in the Raman spectrum of the Car molecules of LH2. This indicates that there is only one Car configuration in LH2 and thus only one molecule per alpha/beta-heterodimer.
Linearized analysis of (2+1)-dimensional Einstein-Maxwell theory
International Nuclear Information System (INIS)
Soda, Jiro.
1989-08-01
On the basis of previous result by Hosoya and Nakao that (2+1)-dimensional gravity reduces the geodesic motion in moduli space, we investigate the effects of matter fields on the geodesic motion using the linearized theory. It is shown that the transverse-traceless parts of energy-momentum tensor make the deviation from the geodesic motion. This result is important for the Einstein-Maxwell theory due to the existence of global modes of Maxwell fields on torus. (author)
International Nuclear Information System (INIS)
Oueslati, W.; Meftah, M.; Ben Rhaiem, H.; Ben Haj Amara, A.
2010-01-01
Document available in extended abstract form only. Several theoretical models are proposed to describe hydration process for Wyoming-montmorillonite clay exchanged Na + or Cu 2+ . They propose some theoretical distribution and disposition for water molecule in the inter-lamellar space in the case of homogeneous and inter-stratified hydration states. For example, Ben Brahim et al. (1983a) studied the interlayer structure (atomic positions of interlayer cations) and associated H 2 O molecules of Na-saturated montmorillonite and beidellite samples. Moore and Hower (1986) studied ordered structures composed of mono-hydrated and collapsed interlayers in montmorillonite, and Cuadros (1996) estimated the H 2 O content of smectite as a function of the interlayer cation. Using similar approach, Ferrage et al (2005b) proposed a discreet distribution of water molecule layer in the same z coordinate of the exchangeable cation with inhomogeneous distribution. This heterogeneity was attributed to the surface charge. The main objective of this study is to characterize the structural changes in the theoretical XRD profile, induced by different water molecule distribution, used to simulate experimental XRD patterns in the case of Na-montmorillonite exchanged Cu 2+ . This problem was achieved by quantitative XRD analysis using an indirect method based on the comparison of the experimental 001 reflections obtained from oriented films patterns with those calculated from structural models. The starting materials were Ca-montmorillonite originated from bentonites of Wyoming (USA). The XRD patterns were obtained by reflection setting with a D8 ADVANCE Bruker installation using Cu-Kα radiation and equipped with solid state detector. Intensities were measured at an interval of 2Θ 0.04 deg. and 40-50 s counting time per step. The diffracted intensity was calculated according to the matrix formalism detailed by Drits and Tchoubar, (1990). The fitting strategies was detailed by Ferrage et
Zakharchenko, K V; Kuznetsov, M B; Chistyakov, A A; Karavanskij, V A
2001-01-01
One studies the effect of resonance radiation-free transfer of electronic excitation between silicon nanocrystals and iodine molecules sorbed in pores. The experiment procedure includes laser-induced luminescence and laser desorption mass spectrometry. One analyzes photoluminescence spectra prior to and upon iodine sorption. Excitation of iodine through the mechanism of resonance transfer is determined to result in desorption of the iodine sorbed molecules with relatively high kinetic energies (3-1 eV). One evaluated the peculiar distance of resonance transfer the approximate value of which was equal to 2 nm
International Nuclear Information System (INIS)
Ehvarestov, R.A.; Panin, A.I.; Bandura, A.V.
2008-01-01
Account of relativistic effects on the properties of uranium hexafluoride is testified. Detailed comparison of single electron energies spectrum revealed in nonrelativistic (by Hartree-Fock method), relativistic (by Dirac-Fock method), and scalar-relativistic (using relativistic potential of atomic uranium frame) has been conducted. Optimization procedures of atomic basis in LCAO calculations of molecules and crystals permissive taking into account distortion of atomic orbitals when chemical bonding are discussed, and optimization effect of atomic basis on the results of scalar-relativistic calculations of UF 6 molecule properties is analyzed. Calculations of electronic structure and properties of UO 2 crystal having relativistic and nonrelativistic pseudopotentials have been realized [ru
Generation and quenching of NF(a) and NF(b) molecules
International Nuclear Information System (INIS)
Setser, D.W.; Cha, H.; Quinones, E.; Du, K.
1987-01-01
The Ar( 3 Po,2) + NF 2 and 2F + HN 3 reactions have been developed as sources of NF(b 1 Σ + ) and NF(a 1 Δ) molecules, respectively, in a flow reactor. The decay kinetics for these molecules in the presence of added reagent can be studied using standard flow reactor techniques. Room temperature quenching rate constants for both molecules are reported for several reagents and compared to results for the isoelectronic O 2 (a) and O 2 (b) molecules
Polarization effects on the electric properties of urea and thiourea molecules in solid phase
International Nuclear Information System (INIS)
Santos, O. L.; Fonseca, T. L.; Sabino, J. R.; Georg, H. C.; Castro, M. A.
2015-01-01
We present theoretical results for the dipole moment, linear polarizability, and first hyperpolarizability of the urea and thiourea molecules in solid phase. The in-crystal electric properties were determined by applying a supermolecule approach in combination with an iterative electrostatic scheme, in which the surrounding molecules are represented by point charges. It is found for both urea and thiourea molecules that the influence of the polarization effects is mild for the linear polarizability, but it is marked for the dipole moment and first hyperpolarizability. The replacement of oxygen atoms by sulfur atoms increases, in general, the electric responses. Our second-order Møller–Plesset perturbation theory based iterative scheme predicts for the in-crystal dipole moment of urea and thiourea the values of 7.54 and 9.19 D which are, respectively, increased by 61% and 58%, in comparison with the corresponding isolated values. The result for urea is in agreement with the available experimental result of 6.56 D. In addition, we present an estimate of macroscopic quantities considering explicit unit cells of urea and thiourea crystals including environment polarization effects. These supermolecule calculations take into account partially the exchange and dispersion effects. The results illustrate the role played by the electrostatic interactions on the static second-order nonlinear susceptibility of the urea crystal
Mandapalli, Praveen K; Labala, Suman; Vanamala, Deekshith; Koranglekar, Manali P; Sakimalla, Lakshmi A; Venuganti, Venkata Vamsi K
2014-12-01
The objective of this study is to investigate the influence of charge of model small molecules on their encapsulation and release behavior in layer-by-layer microcapsules (LbL-MC). Poly(styrene sulfonate) and poly(ethylene imine) were sequentially adsorbed on calcium carbonate sacrificial templates to prepare LbL-MC. Model molecules with varying charge, anionic - ascorbic acid, cationic - imatinib mesylate (IM) and neutral - 5-fluorouracil were encapsulated in LbL-MC. Free and encapsulated LbL-MC were characterized using zetasizer, FTIR spectroscope and differential scanning calorimeter. The influence of IM-loaded LbL-MC on cell viability was studied in B16F10 murine melanoma cells. Furthermore, biodistribution of IM-loaded LbL-MC with and without PEGylation was studied in BALB/c mice. Results showed spherical LbL-MC of 3.0 ± 0.4 μm diameter. Encapsulation efficiency of LbL-MC increased linearly (R(2 )= 0.89-0.99) with the increase in solute concentration. Increase in pH from 2 to 6 increased the encapsulation of charged molecules in LbL-MC. Charged molecules showed greater encapsulation efficiency in LbL-MC compared with neutral molecule. In vitro release kinetics showed Fickian and non-Fickian diffusion of small molecules, depending on the nature of molecular interactions with LbL-MC. At 50 μM concentration, free IM showed significantly (p < 0.05) more cytotoxicity compared with IM-loaded LbL-MC. Biodistribution studies showed that PEGylation of LbL-MC decreased the liver and spleen uptake of IM-encapsulated LbL-MC. In conclusion, LbL-MC can be developed as a potential carrier for small molecules depending on their physical and chemical properties.
Phase space structure of triatomic molecules
International Nuclear Information System (INIS)
Lu, Z.; Kellman, M.E.
1997-01-01
The bifurcation structure is investigated for a Hamiltonian for the three coupled nonlinear vibrations of a highly excited triatomic molecule. The starting point is a quantum Hamiltonian used to fit experimental spectra. This Hamiltonian includes 1:1 Darling endash Dennison resonance coupling between the stretches, and 2:1 Fermi resonance coupling between the stretches and bend. A classical Hamiltonian is obtained using the Heisenberg correspondence principle. Surfaces of section show a pronounced degree of chaos at high energies, with a mixture of chaotic and regular dynamics. The large-scale bifurcation structure is found semianalytically, without recourse to numerical solution of Hamilton close-quote s equations, by taking advantage of the fact that the spectroscopic Hamiltonian has a conserved polyad quantum number, corresponding to an approximate constant of the motion of the molecule. Bifurcation diagrams are analyzed for a number of molecules including H 2 O, D 2 O, NO 2 , ClO 2 , O 3 , and H 2 S. copyright 1997 American Institute of Physics
The non-linear coupled spin 2-spin 3 Cotton equation in three dimensions
Energy Technology Data Exchange (ETDEWEB)
Linander, Hampus; Nilsson, Bengt E.W. [Department of Physics, Theoretical PhysicsChalmers University of Technology, S-412 96 Göteborg (Sweden)
2016-07-05
In the context of three-dimensional conformal higher spin theory we derive, in the frame field formulation, the full non-linear spin 3 Cotton equation coupled to spin 2. This is done by solving the corresponding Chern-Simons gauge theory system of equations, that is, using F=0 to eliminate all auxiliary fields and thus expressing the Cotton equation in terms of just the spin 3 frame field and spin 2 covariant derivatives and tensors (Schouten). In this derivation we neglect the spin 4 and higher spin sectors and approximate the star product commutator by a Poisson bracket. The resulting spin 3 Cotton equation is complicated but can be related to linearized versions in the metric formulation obtained previously by other authors. The expected symmetry (spin 3 “translation”, “Lorentz” and “dilatation”) properties are verified for Cotton and other relevant tensors but some perhaps unexpected features emerge in the process, in particular in relation to the non-linear equations. We discuss the structure of this non-linear spin 3 Cotton equation but its explicit form is only presented here, in an exact but not completely refined version, in appended files obtained by computer algebra methods. Both the frame field and metric formulations are provided.