Cardiac-specific catalase overexpression rescues anthrax lethal toxin-induced cardiac contractile dysfunction: role of oxidative stress and autophagy

OpenAIRE

Kandadi, Machender R; Yu, Xuejun; Frankel, Arthur E; Ren, Jun

2012-01-01

Abstract Background Lethal and edema toxins secreted by Bacillus anthracis during anthrax infection were found to incite serious cardiovascular complications. However, the underlying mechanisms in anthrax lethal toxin-induced cardiac anomalies remain unknown. This study was designed to evaluate the impact of antioxidant enzyme catalase in anthrax lethal toxin-induced cardiomyocyte contractile dysfunction. Methods Wild type (WT) and cardiac-specific catalase overexpression mice were challenged...

Stable Skin-specific Overexpression of Human CTLA4-Ig in Transgenic Mice through Seven Generations

Institute of Scientific and Technical Information of China (English)

Yong WANG; Yong NI; Hong WEI; Feng-Chao WANG; Liang-Peng GE; Xiang GAO

2006-01-01

Skin graft rejection is a typical cellular immune response, mainly mediated by T cells. Cytotoxic T lymphocyte associated antigen 4-immunoglobin (CTLA4-Ig) extends graft survival by blocking the T cell co-stimulation pathway and inhibiting T cell activation. To investigate the efficacy of CTLA4-Ig in prolonging skin graft survival, human CTLA4-Ig (hCTLA4-Ig) was engineered to overexpress in mouse skin by transgenesis using the K14 promoter. Reverse transcription-polymerase chain reaction (RT-PCR) and Western blot assay indicated that the expression of CTLA4-Ig remained skin-specific and relatively constant compared to the internal control protein, AKT, through seven generations. The presence and concentration of the hCTLA4-Ig protein in transgenic mouse sera was determined by enzyme-linked immunosorbent assay (ELISA), and the results indicated that the serum CTLA4-Ig concentration also remained constant through generations. Survival of transgenic mouse skins grafted onto rat wounds was remarkably prolonged compared to that of wild-type skins from the same mouse strain, and remained comparable among all seven generations. This suggested that the bioactive hCTLA4-Ig protein was stably expressed in transgenical mice through at least seven generations, which was consistent with the stable skin-specific CTLA4-Ig expression.The results demonstrated that the transgenic expression of hCTLA4-Ig in skin driven by the K14 promoter remained constant through generations, and a transgenic line can be established to provide transgenic skin with extended survival reproducibly.

Silencing Agrobacterium oncogenes in transgenic grapevine results in strain-specific crown gall resistance.

Science.gov (United States)

Galambos, A; Zok, A; Kuczmog, A; Oláh, R; Putnoky, P; Ream, W; Szegedi, E

2013-11-01

Grapevine rootstock transformed with an Agrobacterium oncogene-silencing transgene was resistant to certain Agrobacterium strains but sensitive to others. Thus, genetic diversity of Agrobacterium oncogenes may limit engineering crown gall resistance. Crown gall disease of grapevine induced by Agrobacterium vitis or Agrobacterium tumefaciens causes serious economic losses in viticulture. To establish crown gall-resistant lines, somatic proembryos of Vitis berlandieri × V. rupestris cv. 'Richter 110' rootstock were transformed with an oncogene-silencing transgene based on iaaM and ipt oncogene sequences from octopine-type, tumor-inducing (Ti) plasmid pTiA6. Twenty-one transgenic lines were selected, and their transgenic nature was confirmed by polymerase chain reaction (PCR). These lines were inoculated with two A. tumefaciens and three A. vitis strains. Eight lines showed resistance to octopine-type A. tumefaciens A348. Resistance correlated with the expression of the silencing genes. However, oncogene silencing was mostly sequence specific because these lines did not abolish tumorigenesis by A. vitis strains or nopaline-type A. tumefaciens C58.

Rapid expression of transgenes driven by seed-specific constructs in leaf tissue: DHA production

Directory of Open Access Journals (Sweden)

Zhou Xue-Rong

2010-03-01

Full Text Available Abstract Background Metabolic engineering of seed biosynthetic pathways to diversify and improve crop product quality is a highly active research area. The validation of genes driven by seed-specific promoters is time-consuming since the transformed plants must be grown to maturity before the gene function can be analysed. Results In this study we demonstrate that genes driven by seed-specific promoters contained within complex constructs can be transiently-expressed in the Nicotiana benthamiana leaf-assay system by co-infiltrating the Arabidopsis thaliana LEAFY COTYLEDON2 (LEC2 gene. A real-world case study is described in which we first assembled an efficient transgenic DHA synthesis pathway using a traditional N. benthamiana Cauliflower Mosaic Virus (CaMV 35S-driven leaf assay before using the LEC2-extended assay to rapidly validate a complex seed-specific construct containing the same genes before stable transformation in Arabidopsis. Conclusions The LEC2-extended N. benthamiana assay allows the transient activation of seed-specific promoters in leaf tissue. In this study we have used the assay as a rapid preliminary screen of a complex seed-specific transgenic construct prior to stable transformation, a feature that will become increasingly useful as genetic engineering moves from the manipulation of single genes to the engineering of complex pathways. We propose that the assay will prove useful for other applications wherein rapid expression of transgenes driven by seed-specific constructs in leaf tissue are sought.

Generation of FGF reporter transgenic zebrafish and their utility in chemical screens

Directory of Open Access Journals (Sweden)

Tsang Michael

2007-06-01

Full Text Available Abstract Background Fibroblast Growth Factors (FGFs represent a large family of secreted proteins that are required for proper development and physiological processes. Mutations in mouse and zebrafish FGFs result in abnormal embryogenesis and lethality. A key to understanding the precise role for these factors is to determine their spatial and temporal activity during embryogenesis. Results Expression of Dual Specificity Phosphatase 6 (dusp6, also known as Mkp3 is controlled by FGF signalling throughout development. The Dusp6 promoter was isolated from zebrafish and used to drive expression of destabilized green fluorescent protein (d2EGFP in transgenic embryos (Tg(Dusp6:d2EGFP. Expression of d2EGFP is initiated as early as 4 hours post-fertilization (hpf within the future dorsal region of the embryo, where fgf3 and fgf8 are initially expressed. At later stages, d2EGFP is detected within structures that correlate with the expression of Fgf ligands and their receptors. This includes the mid-hindbrain boundary (MHB, pharyngeal endoderm, otic vesicle, hindbrain, and Kupffer's vesicle. The expression of d2EGFP is under the control of FGF signalling as treatment with FGF Receptor (FGFR inhibitors results in the suppression of d2EGFP expression. In a pilot screen of commercially available small molecules we have evaluated the effectiveness of the transgenic lines to identify specific FGF inhibitors within the class of indolinones. These compounds were counter screened with the transgenic line Tg(Fli1:EGFPy1, that serves as an indirect read-out for Vascular Endothelial Growth Factor (VEGF signalling in order to determine the specificity between related receptor tyrosine kinases (RTKs. From these assays it is possible to determine the specificity of these indolinones towards specific RTK signalling pathways. This has enabled the identification of compounds that can block specifically the VEGFR or the FGFR signalling pathway. Conclusion The generation of

Cardiomyocyte-Specific Ablation of Med1 Subunit of the Mediator Complex Causes Lethal Dilated Cardiomyopathy in Mice.

Science.gov (United States)

Jia, Yuzhi; Chang, Hsiang-Chun; Schipma, Matthew J; Liu, Jing; Shete, Varsha; Liu, Ning; Sato, Tatsuya; Thorp, Edward B; Barger, Philip M; Zhu, Yi-Jun; Viswakarma, Navin; Kanwar, Yashpal S; Ardehali, Hossein; Thimmapaya, Bayar; Reddy, Janardan K

2016-01-01

Mediator, an evolutionarily conserved multi-protein complex consisting of about 30 subunits, is a key component of the polymerase II mediated gene transcription. Germline deletion of the Mediator subunit 1 (Med1) of the Mediator in mice results in mid-gestational embryonic lethality with developmental impairment of multiple organs including heart. Here we show that cardiomyocyte-specific deletion of Med1 in mice (csMed1-/-) during late gestational and early postnatal development by intercrossing Med1fl/fl mice to α-MyHC-Cre transgenic mice results in lethality within 10 days after weaning due to dilated cardiomyopathy-related ventricular dilation and heart failure. The csMed1-/- mouse heart manifests mitochondrial damage, increased apoptosis and interstitial fibrosis. Global gene expression analysis revealed that loss of Med1 in heart down-regulates more than 200 genes including Acadm, Cacna1s, Atp2a2, Ryr2, Pde1c, Pln, PGC1α, and PGC1β that are critical for calcium signaling, cardiac muscle contraction, arrhythmogenic right ventricular cardiomyopathy, dilated cardiomyopathy and peroxisome proliferator-activated receptor regulated energy metabolism. Many genes essential for oxidative phosphorylation and proper mitochondrial function such as genes coding for the succinate dehydrogenase subunits of the mitochondrial complex II are also down-regulated in csMed1-/- heart contributing to myocardial injury. Data also showed up-regulation of about 180 genes including Tgfb2, Ace, Atf3, Ctgf, Angpt14, Col9a2, Wisp2, Nppa, Nppb, and Actn1 that are linked to cardiac muscle contraction, cardiac hypertrophy, cardiac fibrosis and myocardial injury. Furthermore, we demonstrate that cardiac specific deletion of Med1 in adult mice using tamoxifen-inducible Cre approach (TmcsMed1-/-), results in rapid development of cardiomyopathy and death within 4 weeks. We found that the key findings of the csMed1-/- studies described above are highly reproducible in TmcsMed1-/- mouse heart

Development of transgenic rats producing human β-amyloid precursor protein as a model for Alzheimer's disease: Transgene and endogenous APP genes are regulated tissue-specifically

Directory of Open Access Journals (Sweden)

Chan Anthony WS

2008-02-01

Full Text Available Abstract Background Alzheimer's disease (AD is a devastating neurodegenerative disorder that affects a large and growing number of elderly individuals. In addition to idiopathic disease, AD is also associated with autosomal dominant inheritance, which causes a familial form of AD (FAD. Some instances of FAD have been linked to mutations in the β-amyloid protein precursor (APP. Although there are numerous mouse AD models available, few rat AD models, which have several advantages over mice, have been generated. Results Fischer 344 rats expressing human APP driven by the ubiquitin-C promoter were generated via lentiviral vector infection of Fischer 344 zygotes. We generated two separate APP-transgenic rat lines, APP21 and APP31. Serum levels of human amyloid-beta (Aβ40 were 298 pg/ml for hemizygous and 486 pg/ml for homozygous APP21 animals. Serum Aβ42 levels in APP21 homozygous rats were 135 pg/ml. Immunohistochemistry in brain showed that the human APP transgene was expressed in neurons, but not in glial cells. These findings were consistent with independent examination of enhanced green fluorescent protein (eGFP in the brains of eGFP-transgenic rats. APP21 and APP31 rats expressed 7.5- and 3-times more APP mRNA, respectively, than did wild-type rats. Northern blots showed that the human APP transgene, driven by the ubiquitin-C promoter, is expressed significantly more in brain, kidney and lung compared to heart and liver. A similar expression pattern was also seen for the endogenous rat APP. The unexpected similarity in the tissue-specific expression patterns of endogenous rat APP and transgenic human APP mRNAs suggests regulatory elements within the cDNA sequence of APP. Conclusion This manuscript describes the generation of APP-transgenic inbred Fischer 344 rats. These are the first human AD model rat lines generated by lentiviral infection. The APP21 rat line expresses high levels of human APP and could be a useful model for AD. Tissue-specific

PCR Primer Specific CaMV 35S Promoter to Detect Transgenic Soybean in Indonesia Commercial Soy Bean and Tempeh

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2017-11-01

Full Text Available In the framework of the supervision and enforcement of the regulation regarding the content of soybean transgenic in food and processed foods such as tempeh, a reliable testing method is indispensable. Performance specific primer PCR amplification with promoter of CaMV 35S tested to detect the presence of GMOs. The parameters tested were specificity, precision and cut off detection using CRM transgenic soybean. The method is reliable to detect transgenic soybean specifically and has the annealing temperature at 59 °C during the 30 cycle standard PCR condition. The method did not show any false positive and false negative results meaning good precision. The cut off the methods is up to 2 copies total DNA of soybean or less than 104 copies of the CaMV 35S promoter. Observation to the commercial soybeans and tempeh found that most of the commercially available soybean in Indonesia are transgenic (8 of 10 sample while all tested tempeh sample were detected have been fermented from transgenic soybeans.

Feasible introgression of an anti-pathogen transgene into an urban mosquito population without using gene-drive.

Directory of Open Access Journals (Sweden)

Kenichi W Okamoto

2014-07-01

Full Text Available Introgressing anti-pathogen constructs into wild vector populations could reduce disease transmission. It is generally assumed that such introgression would require linking an anti-pathogen gene with a selfish genetic element or similar technologies. Yet none of the proposed transgenic anti-pathogen gene-drive mechanisms are likely to be implemented as public health measures in the near future. Thus, much attention now focuses instead on transgenic strategies aimed at mosquito population suppression, an approach generally perceived to be practical. By contrast, aiming to replace vector competent mosquito populations with vector incompetent populations by releasing mosquitoes carrying a single anti-pathogen gene without a gene-drive mechanism is widely considered impractical.Here we use Skeeter Buster, a previously published stochastic, spatially explicit model of Aedes aegypti to investigate whether a number of approaches for releasing mosquitoes with only an anti-pathogen construct would be efficient and effective in the tropical city of Iquitos, Peru. To assess the performance of such releases using realistic release numbers, we compare the transient and long-term effects of this strategy with two other genetic control strategies that have been developed in Ae. aegypti: release of a strain with female-specific lethality, and a strain with both female-specific lethality and an anti-pathogen gene. We find that releasing mosquitoes carrying only an anti-pathogen construct can substantially decrease vector competence of a natural population, even at release ratios well below that required for the two currently feasible alternatives that rely on population reduction. Finally, although current genetic control strategies based on population reduction are compromised by immigration of wild-type mosquitoes, releasing mosquitoes carrying only an anti-pathogen gene is considerably more robust to such immigration.Contrary to the widely held view that

Characterization of conditionally expressed mutants affecting age-specific Drosophila melanogaster : Lethal conditions and temperature-sensitive periods

NARCIS (Netherlands)

Vermeulen, CJ; Bijlsma, R

The specific genetic basis of inbreeding depression is poorly understood. To address this question, two conditionally expressed lethal effects that were found to cause line-specific life span reductions in two separate inbred lines of Drosophila melanogaster. were characterized phenotypically and

Transgenic plants over-expressing insect-specific microRNA acquire insecticidal activity against Helicoverpa armigera: an alternative to Bt-toxin technology.

Science.gov (United States)

Agrawal, Aditi; Rajamani, Vijayalakshmi; Reddy, Vanga Siva; Mukherjee, Sunil Kumar; Bhatnagar, Raj K

2015-10-01

The success of Bt transgenics in controlling predation of crops has been tempered by sporadic emergence of resistance in targeted insect larvae. Such emerging threats have prompted the search for novel insecticidal molecules that are specific and could be expressed through plants. We have resorted to small RNA-based technology for an investigative search and focused our attention to an insect-specific miRNA that interferes with the insect molting process resulting in the death of the larvae. In this study, we report the designing of a vector that produces artificial microRNA (amiR), namely amiR-24, which targets the chitinase gene of Helicoverpa armigera. This vector was used as transgene in tobacco. Northern blot and real-time analysis revealed the high level expression of amiR-24 in transgenic tobacco plants. Larvae feeding on the transgenic plants ceased to molt further and eventually died. Our results demonstrate that transgenic tobacco plants can express amiR-24 insectice specific to H. armigera.

A non-specific effect associated with conditional transgene expression based on Cre-loxP strategy in mice.

Directory of Open Access Journals (Sweden)

Linghua Qiu

Full Text Available Transgenes flanked by loxP sites have been widely used to generate transgenic mice where the transgene expression can be controlled spatially and temporally by Cre recombinase. Data from this approach has led to important conclusions in cancer, neurodevelopment and neurodegeneration. Using this approach to conditionally express micro RNAs (miRNAs in mice, we found that Cre-mediated recombination in neural progenitor cells caused microcephaly in five of our ten independent transgenic lines. This effect was not associated with the types or the quantity of miRNAs being expressed, nor was it associated with specific target knockdown. Rather, it was correlated with the presence of multiple tandem transgene copies and inverted (head-to-head or tail-to-tail transgene repeats. The presence of these inverted repeats caused a high level of cell death in the ventricular zone of the embryonic brain, where Cre was expressed. Therefore, results from this Cre-loxP approach to generate inducible transgenic alleles must be interpreted with caution and conclusions drawn in previous reports may need reexamination.

Cardiac-specific catalase overexpression rescues anthrax lethal toxin-induced cardiac contractile dysfunction: role of oxidative stress and autophagy.

Science.gov (United States)

Kandadi, Machender R; Yu, Xuejun; Frankel, Arthur E; Ren, Jun

2012-11-07

Lethal and edema toxins secreted by Bacillus anthracis during anthrax infection were found to incite serious cardiovascular complications. However, the underlying mechanisms in anthrax lethal toxin-induced cardiac anomalies remain unknown. This study was designed to evaluate the impact of antioxidant enzyme catalase in anthrax lethal toxin-induced cardiomyocyte contractile dysfunction. Wild type (WT) and cardiac-specific catalase overexpression mice were challenged with lethal toxin (2 μg/g, intraperotineally (i.p.)). Cardiomyocyte contractile and intracellular Ca(2+) properties were assessed 18 h later using an IonOptix edge-detection system. Proteasome function was assessed using chymotrypsin-like and caspase-like activities. GFP-LC3 puncta and Western blot analysis were used to evaluate autophagy and protein ubiquitination. Lethal toxin exposure suppressed cardiomyocyte contractile function (suppressed peak shortening, maximal velocity of shortening/re-lengthening, prolonged duration of shortening/re-lengthening, and impaired intracellular Ca(2+) handling), the effects of which were alleviated by catalase. In addition, lethal toxin triggered autophagy, mitochondrial and ubiquitin-proteasome defects, the effects of which were mitigated by catalase. Pretreatment of cardiomyocytes from catalase mice with the autophagy inducer rapamycin significantly attenuated or ablated catalase-offered protection against lethal toxin-induced cardiomyocyte dysfunction. On the other hand, the autophagy inhibitor 3-MA ablated or significantly attenuated lethal toxin-induced cardiomyocyte contractile anomalies. Our results suggest that catalase is protective against anthrax lethal toxin-induced cardiomyocyte contractile and intracellular Ca(2+) anomalies, possibly through regulation of autophagy and mitochondrial function.

Cardiac-specific catalase overexpression rescues anthrax lethal toxin-induced cardiac contractile dysfunction: role of oxidative stress and autophagy

Directory of Open Access Journals (Sweden)

Kandadi Machender R

2012-11-01

Full Text Available Abstract Background Lethal and edema toxins secreted by Bacillus anthracis during anthrax infection were found to incite serious cardiovascular complications. However, the underlying mechanisms in anthrax lethal toxin-induced cardiac anomalies remain unknown. This study was designed to evaluate the impact of antioxidant enzyme catalase in anthrax lethal toxin-induced cardiomyocyte contractile dysfunction. Methods Wild type (WT and cardiac-specific catalase overexpression mice were challenged with lethal toxin (2 μg/g, intraperotineally (i.p.. Cardiomyocyte contractile and intracellular Ca2+ properties were assessed 18 h later using an IonOptix edge-detection system. Proteasome function was assessed using chymotrypsin-like and caspase-like activities. GFP-LC3 puncta and Western blot analysis were used to evaluate autophagy and protein ubiquitination. Results Lethal toxin exposure suppressed cardiomyocyte contractile function (suppressed peak shortening, maximal velocity of shortening/re-lengthening, prolonged duration of shortening/re-lengthening, and impaired intracellular Ca2+ handling, the effects of which were alleviated by catalase. In addition, lethal toxin triggered autophagy, mitochondrial and ubiquitin-proteasome defects, the effects of which were mitigated by catalase. Pretreatment of cardiomyocytes from catalase mice with the autophagy inducer rapamycin significantly attenuated or ablated catalase-offered protection against lethal toxin-induced cardiomyocyte dysfunction. On the other hand, the autophagy inhibitor 3-MA ablated or significantly attenuated lethal toxin-induced cardiomyocyte contractile anomalies. Conclusions Our results suggest that catalase is protective against anthrax lethal toxin-induced cardiomyocyte contractile and intracellular Ca2+ anomalies, possibly through regulation of autophagy and mitochondrial function.

Decreased nuclear β-catenin, tau hyperphosphorylation and neurodegeneration in GSK-3β conditional transgenic mice

OpenAIRE

Lucas, José J.; Hernández, Félix; Gómez-Ramos, Pilar; Morán, María A.; Hen, René; Avila, Jesús

2001-01-01

Glycogen synthase kinase-3β (GSK-3β) has been postulated to mediate Alzheimer’s disease tau hyperphosphorylation, β-amyloid-induced neurotoxicity and presenilin-1 mutation pathogenic effects. By using the tet-regulated system we have produced conditional transgenic mice overexpressing GSK-3β in the brain during adulthood while avoiding perinatal lethality due to embryonic transgene expression. These mice show decreased levels of nuclear β-catenin and hyperphosphorylation of tau in hippocampal...

Enhanced virus resistance in transgenic maize expressing a dsRNA-specific endoribonuclease gene from E. coli.

Directory of Open Access Journals (Sweden)

Xiuling Cao

Full Text Available Maize rough dwarf disease (MRDD, caused by several Fijiviruses in the family Reoviridae, is a global disease that is responsible for substantial yield losses in maize. Although some maize germplasm have low levels of polygenic resistance to MRDD, highly resistant cultivated varieties are not available for agronomic field production in China. In this work, we have generated transgenic maize lines that constitutively express rnc70, a mutant E. coli dsRNA-specific endoribonuclease gene. Transgenic lines were propagated and screened under field conditions for 12 generations. During three years of evaluations, two transgenic lines and their progeny were challenged with Rice black-streaked dwarf virus (RBSDV, the causal agent of MRDD in China, and these plants exhibited reduced levels of disease severity. In two normal years of MRDD abundance, both lines were more resistant than non-transgenic plants. Even in the most serious MRDD year, six out of seven progeny from one line were resistant, whereas non-transgenic plants were highly susceptible. Molecular approaches in the T12 generation revealed that the rnc70 transgene was integrated and expressed stably in transgenic lines. Under artificial conditions permitting heavy virus inoculation, the T12 progeny of two highly resistant lines had a reduced incidence of MRDD and accumulation of RBSDV in infected plants. In addition, we confirmed that the RNC70 protein could bind directly to RBSDV dsRNA in vitro. Overall, our data show that RNC70-mediated resistance in transgenic maize can provide efficient protection against dsRNA virus infection.

Transgenic potatoes for potato cyst nematode control can replace pesticide use without impact on soil quality.

Science.gov (United States)

Green, Jayne; Wang, Dong; Lilley, Catherine J; Urwin, Peter E; Atkinson, Howard J

2012-01-01

Current and future global crop yields depend upon soil quality to which soil organisms make an important contribution. The European Union seeks to protect European soils and their biodiversity for instance by amending its Directive on pesticide usage. This poses a challenge for control of Globodera pallida (a potato cyst nematode) for which both natural resistance and rotational control are inadequate. One approach of high potential is transgenically based resistance. This work demonstrates the potential in the field of a new transgenic trait for control of G. pallida that suppresses root invasion. It also investigates its impact and that of a second transgenic trait on the non-target soil nematode community. We establish that a peptide that disrupts chemoreception of nematodes without a lethal effect provides resistance to G. pallida in both a containment and a field trial when precisely targeted under control of a root tip-specific promoter. In addition we combine DNA barcoding and quantitative PCR to recognise nematode genera from soil samples without microscope-based observation and use the method for nematode faunal analysis. This approach establishes that the peptide and a cysteine proteinase inhibitor that offer distinct bases for transgenic plant resistance to G. pallida do so without impact on the non-target nematode soil community.

Transgenic potatoes for potato cyst nematode control can replace pesticide use without impact on soil quality.

Directory of Open Access Journals (Sweden)

Jayne Green

Full Text Available Current and future global crop yields depend upon soil quality to which soil organisms make an important contribution. The European Union seeks to protect European soils and their biodiversity for instance by amending its Directive on pesticide usage. This poses a challenge for control of Globodera pallida (a potato cyst nematode for which both natural resistance and rotational control are inadequate. One approach of high potential is transgenically based resistance. This work demonstrates the potential in the field of a new transgenic trait for control of G. pallida that suppresses root invasion. It also investigates its impact and that of a second transgenic trait on the non-target soil nematode community. We establish that a peptide that disrupts chemoreception of nematodes without a lethal effect provides resistance to G. pallida in both a containment and a field trial when precisely targeted under control of a root tip-specific promoter. In addition we combine DNA barcoding and quantitative PCR to recognise nematode genera from soil samples without microscope-based observation and use the method for nematode faunal analysis. This approach establishes that the peptide and a cysteine proteinase inhibitor that offer distinct bases for transgenic plant resistance to G. pallida do so without impact on the non-target nematode soil community.

Optimal barrier zones for stopping the invasion of Aedes aegypti mosquitoes via transgenic or sterile insect techniques

KAUST Repository

Lee, S. Seirin

2013-03-27

Biological invasions have dramatically altered the natural world by threatening native species and their communities. Moreover, when the invading species is a vector for human disease, there are further substantive public health and economic impacts. The development of transgenic technologies is being explored in relation to new approaches for the biological control of insect pests. We investigate the use of two control strategies, classical sterile insect techniques and transgenic late-acting bisex lethality (Release of Insects carrying a Dominant Lethal), for controlling invasion of the mosquito Aedes aegypti using a spatial stage-structured mathematical model. In particular, we explore the use of a barrier zone of sterile/transgenic insects to prevent or impede the invasion of mosquitoes. We show that the level of control required is not only highly sensitive to the rate at which the sterile/transgenic males are released in the barrier zone but also to the spatial range of release. Our models characterise how the distribution of sterile/transgenic mosquitoes in the barrier zone can be controlled so as to minimise the number of mass-produced insects required for the arrest of species invasion. We predict that, given unknown rates of mosquito dispersal, management strategies should concentrate on larger release areas rather than more intense release rates for optimal control. © 2013 Springer Science+Business Media Dordrecht.

Transgenic mice for a tamoxifen-induced, conditional expression of the Cre recombinase in osteoclasts.

Directory of Open Access Journals (Sweden)

Maria Arantzazu Sanchez-Fernandez

Full Text Available BACKGROUND: Studies on osteoclasts, the bone resorbing cells, have remained limited due to the lack of transgenic mice allowing the conditional knockout of genes in osteoclasts at any time during development or adulthood. METHODOLOGY/PRINCIPAL FINDING: We report here on the generation of transgenic mice which specifically express a tamoxifen-inducible Cre recombinase in osteoclasts. These mice, generated on C57BL/6 and FVB background, express a fusion Cre recombinase-ERT2 protein whose expression is driven by the promoter of cathepsin K (CtsK, a gene highly expressed in osteoclasts. We tested the cellular specificity of Cre activity in CtsKCreERT2 strains by breeding with Rosa26LacZ reporter mice. PCR and histological analyses of the CtsKCreERT2LacZ positive adult mice and E17.5 embryos show that Cre activity is restricted largely to bone tissue. In vitro, primary osteoclasts derived from the bone marrow of CtsKCreERT2+/-LacZ+/- adult mice show a Cre-dependent β-galactosidase activity after tamoxifen stimulation. CONCLUSIONS/SIGNIFICANCE: We have generated transgenic lines that enable the tamoxifen-induced, conditional deletion of loxP-flanked genes in osteoclasts, thus circumventing embryonic and postnatal gene lethality and avoiding gene deletion in other cell types. Such CtsKCreERT2 mice provide a convenient tool to study in vivo the different facets of osteoclast function in bone physiology during different developmental stages and adulthood of mice.

Generation of NSE-MerCreMer transgenic mice with tamoxifen inducible Cre activity in neurons.

Directory of Open Access Journals (Sweden)

Mandy Ka Man Kam

Full Text Available To establish a genetic tool for conditional deletion or expression of gene in neurons in a temporally controlled manner, we generated a transgenic mouse (NSE-MerCreMer, which expressed a tamoxifen inducible type of Cre recombinase specifically in neurons. The tamoxifen inducible Cre recombinase (MerCreMer is a fusion protein containing Cre recombinase with two modified estrogen receptor ligand binding domains at both ends, and is driven by the neural-specific rat neural specific enolase (NSE promoter. A total of two transgenic lines were established, and expression of MerCreMer in neurons of the central and enteric nervous systems was confirmed. Transcript of MerCreMer was detected in several non-neural tissues such as heart, liver, and kidney in these lines. In the background of the Cre reporter mouse strain Rosa26R, Cre recombinase activity was inducible in neurons of adult NSE-MerCreMer mice treated with tamoxifen by intragastric gavage, but not in those fed with corn oil only. We conclude that NSE-MerCreMer lines will be useful for studying gene functions in neurons for the conditions that Cre-mediated recombination resulting in embryonic lethality, which precludes investigation of gene functions in neurons through later stages of development and in adult.

Optimal barrier zones for stopping the invasion of Aedes aegypti mosquitoes via transgenic or sterile insect techniques

KAUST Repository

Lee, S. Seirin; Baker, Ruth E.; Gaffney, Eamonn A.; White, Steven M.

2013-01-01

(Release of Insects carrying a Dominant Lethal), for controlling invasion of the mosquito Aedes aegypti using a spatial stage-structured mathematical model. In particular, we explore the use of a barrier zone of sterile/transgenic insects to prevent

Transgenic engineering of male-specific muscular hypertrophy

DEFF Research Database (Denmark)

Pirottin, D.; Grobet, L.; Adamantidis, A.

2005-01-01

Using a two-step procedure involving insertional gene targeting and recombinase-mediated cassette exchange in ES cells, we have produced two lines of transgenic mice expressing a dominant-negative latency-associated myostatin propeptide under control of the myosin light chain 1F promoter and 1/3 ...

Human cathepsin L rescues the neurodegeneration and lethality incathepsin B/L double deficient mice

Energy Technology Data Exchange (ETDEWEB)

Sevenich, Lisa; Pennacchio, Len A.; Peters, Christoph; Reinheckel, Thomas

2006-01-09

Cathepsin B (CTSB) and cathepsin L (CTSL) are two widelyexpressed cysteine proteases thought to predominantly reside withinlysosomes. Functional analysis of CTSL in humans is complicated by theexistence of two CTSL-like homologues (CTSL and CTSL2), in contrast tomice which contain only one CTSL enzyme. Thus transgenic expression ofhuman CTSL in CTSL deficient mice provides an opportunity to study the invivo functions of this human protease without interference by its highlyrelated homologue. While mice with single gene deficiencies for murineCTSB or CTSL survive without apparent neuromuscular impairment, murineCTSB/CTSL double deficient mice display degeneration of cerebellarPurkinje cells and neurons of the cerebral cortex, resulting in severehypotrophy, motility defects, and lethality during their third to fourthweek of life. Here we show that expression of human CTSL through agenomic transgene results in widespread expression of human CTSL in themouse which is capable of rescuing the lethality found in CTSB/CTSLdouble-deficient animals. Human CTSL is expressed in the brain of thesecompound mutants predominantly in neurons of the cerebral cortex and inPurkinje cells of the cerebellum, where it appears to prevent neuronalcell death.

Excision of Nucleopolyhedrovirus Form Transgenic Silkworm Using the CRISPR/Cas9 System

Directory of Open Access Journals (Sweden)

Zhanqi Dong

2018-02-01

Full Text Available The CRISPR/Cas9-mediated genome engineering has been shown to efficiently suppress infection by disrupting genes of the pathogen. We recently constructed transgenic lines expressing CRISPR/Cas9 and the double sgRNA target Bombyx mori nucleopolyhedrovirus (BmNPV immediate early-1 (ie-1 gene in the silkworm, respectively, and obtained four transgenic hybrid lines by G1 generation hybridization: Cas9(-/sgRNA(-, Cas9(+/sgRNA(-, Cas9(-/sgRNA(+, and Cas9(+/sgRNA(+. We demonstrated that the Cas9(+/sgRNA(+ transgenic lines effectively edited the target site of the BmNPV genome, and large fragment deletion was observed after BmNPV infection. Further antiviral analysis of the Cas9(+/sgRNA(+ transgenic lines shows that the median lethal dose (LD50 is 1,000-fold higher than the normal lines after inoculation with occlusion bodies. The analysis of economic characters and off-target efficiency of Cas9(+/sgRNA(+ transgenic hybrid line showed no significant difference compared with the normal lines. Our findings indicate that CRISPR/Cas9-mediated genome engineering more effectively targets the BmNPV genomes and could be utilized as an insect antiviral treatment.

Excision of Nucleopolyhedrovirus Form Transgenic Silkworm Using the CRISPR/Cas9 System.

Science.gov (United States)

Dong, Zhanqi; Dong, Feifan; Yu, Xinbo; Huang, Liang; Jiang, Yaming; Hu, Zhigang; Chen, Peng; Lu, Cheng; Pan, Minhui

2018-01-01

The CRISPR/Cas9-mediated genome engineering has been shown to efficiently suppress infection by disrupting genes of the pathogen. We recently constructed transgenic lines expressing CRISPR/Cas9 and the double sgRNA target Bombyx mori nucleopolyhedrovirus (BmNPV) immediate early-1 ( ie-1 ) gene in the silkworm, respectively, and obtained four transgenic hybrid lines by G1 generation hybridization: Cas9(-)/sgRNA(-), Cas9(+)/sgRNA(-), Cas9(-)/sgRNA(+), and Cas9(+)/sgRNA(+). We demonstrated that the Cas9(+)/sgRNA(+) transgenic lines effectively edited the target site of the BmNPV genome, and large fragment deletion was observed after BmNPV infection. Further antiviral analysis of the Cas9(+)/sgRNA(+) transgenic lines shows that the median lethal dose (LD50) is 1,000-fold higher than the normal lines after inoculation with occlusion bodies. The analysis of economic characters and off-target efficiency of Cas9(+)/sgRNA(+) transgenic hybrid line showed no significant difference compared with the normal lines. Our findings indicate that CRISPR/Cas9-mediated genome engineering more effectively targets the BmNPV genomes and could be utilized as an insect antiviral treatment.

Expression of a maize Myb transcription factor driven by a putative silk-specific promoter significantly enhances resistance to Helicoverpa zea in transgenic maize.

Science.gov (United States)

Johnson, Eric T; Berhow, Mark A; Dowd, Patrick F

2007-04-18

Hi II maize (Zea mays) plants were engineered to express maize p1 cDNA, a Myb transcription factor, controlled by a putative silk specific promoter, for secondary metabolite production and corn earworm resistance. Transgene expression did not enhance silk color, but about half of the transformed plant silks displayed browning when cut, which indicated the presence of p1-produced secondary metabolites. Levels of maysin, a secondary metabolite with insect toxicity, were highest in newly emerged browning silks. The insect resistance of transgenic silks was also highest at emergence, regardless of maysin levels, which suggests that other unidentified p1-induced molecules likely contributed to larval mortality. Mean survivor weights of corn earworm larvae fed mature browning transgenic silks were significantly lower than weights of those fed mature nonbrowning transgenic silks. Some transgenic pericarps browned with drying and contained similar molecules found in pericarps expressing a dominant p1 allele, suggesting that the promoter may not be silk-specific.

Development of marker-free transgenic Jatropha curcas producing curcin-deficient seeds through endosperm-specific RNAi-mediated gene silencing.

Science.gov (United States)

Gu, Keyu; Tian, Dongsheng; Mao, Huizhu; Wu, Lifang; Yin, Zhongchao

2015-10-08

Jatropha curcas L. is a potential biofuel plant and its seed oil is suitable for biodiesel production. Despite this promising application, jatropha seeds contain two major toxic components, namely phorbol esters and curcins. These compounds would reduce commercial value of seed cake and raise safety and environment concerns on jatropha plantation and processing. Curcins are Type I ribosome inactivating proteins. Several curcin genes have been identified in the jatropha genome. Among which, the Curcin 1 (C1) gene is identified to be specifically expressed in endosperm, whereas the Curcin 2A (C2A) is mainly expressed in young leaves. A marker-free RNAi construct carrying a β-estradiol-regulated Cre/loxP system and a C1 promoter-driven RNAi cassette for C1 gene was made and used to generate marker-free transgenic RNAi plants to specifically silence the C1 gene in the endosperm of J. curcas. Plants of transgenic line L1, derived from T0-1, carry two copies of marker-free RNAi cassette, whereas plants of L35, derived from T0-35, harbored one copy of marker-free RNAi cassette and three copies of closely linked and yet truncated Hpt genes. The C1 protein content in endosperm of L1 and L35 seeds was greatly reduced or undetectable, while the C2A proteins in young leaves of T0-1 and T0-35 plants were unaffected. In addition, the C1 mRNA transcripts were undetectable in the endosperm of T3 seeds of L1 and L35. The results demonstrated that the expression of the C1 gene was specifically down-regulated or silenced by the double-stranded RNA-mediated RNA interference generated from the RNAi cassette. The C1 promoter-driven RNAi cassette for the C1 gene in transgenic plants was functional and heritable. Both C1 transcripts and C1 proteins were greatly down-regulated or silenced in the endosperm of transgenic J. curcas. The marker-free transgenic plants and curcin-deficient seeds developed in this study provided a solution for the toxicity of curcins in jatropha seeds and

CD4 T cell-mediated protection from lethal influenza: perforin and antibody-mediated mechanisms give a one-two punch.

Science.gov (United States)

Brown, Deborah M; Dilzer, Allison M; Meents, Dana L; Swain, Susan L

2006-09-01

The mechanisms whereby CD4 T cells contribute to the protective response against lethal influenza infection remain poorly characterized. To define the role of CD4 cells in protection against a highly pathogenic strain of influenza, virus-specific TCR transgenic CD4 effectors were generated in vitro and transferred into mice given lethal influenza infection. Primed CD4 effectors conferred protection against lethal infection over a broad range of viral dose. The protection mediated by CD4 effectors did not require IFN-gamma or host T cells, but did result in increased anti-influenza Ab titers compared with untreated controls. Further studies indicated that CD4-mediated protection at high doses of influenza required B cells, and that passive transfer of anti-influenza immune serum was therapeutic in B cell-deficient mice, but only when CD4 effectors were present. Primed CD4 cells also acquired perforin (Pfn)-mediated cytolytic activity during effector generation, suggesting a second mechanism used by CD4 cells to confer protection. Pfn-deficient CD4 effectors were less able to promote survival in intact BALB/c mice and were unable to provide protection in B cell-deficient mice, indicating that Ab-independent protection by CD4 effectors requires Pfn. Therefore, CD4 effectors mediate protection to lethal influenza through at least two mechanisms: Pfn-mediated cytotoxicity early in the response promoted survival independently of Ab production, whereas CD4-driven B cell responses resulted in high titer Abs that neutralized remaining virus.

Genetic load and transgenic mitigating genes in transgenic Brassica rapa (field mustard × Brassica napus (oilseed rape hybrid populations

Directory of Open Access Journals (Sweden)

Warwick Suzanne I

2009-10-01

Full Text Available Abstract Background One theoretical explanation for the relatively poor performance of Brassica rapa (weed × Brassica napus (crop transgenic hybrids suggests that hybridization imparts a negative genetic load. Consequently, in hybrids genetic load could overshadow any benefits of fitness enhancing transgenes and become the limiting factor in transgenic hybrid persistence. Two types of genetic load were analyzed in this study: random/linkage-derived genetic load, and directly incorporated genetic load using a transgenic mitigation (TM strategy. In order to measure the effects of random genetic load, hybrid productivity (seed yield and biomass was correlated with crop- and weed-specific AFLP genomic markers. This portion of the study was designed to answer whether or not weed × transgenic crop hybrids possessing more crop genes were less competitive than hybrids containing fewer crop genes. The effects of directly incorporated genetic load (TM were analyzed through transgene persistence data. TM strategies are proposed to decrease transgene persistence if gene flow and subsequent transgene introgression to a wild host were to occur. Results In the absence of interspecific competition, transgenic weed × crop hybrids benefited from having more crop-specific alleles. There was a positive correlation between performance and number of B. napus crop-specific AFLP markers [seed yield vs. marker number (r = 0.54, P = 0.0003 and vegetative dry biomass vs. marker number (r = 0.44, P = 0.005]. However under interspecific competition with wheat or more weed-like conditions (i.e. representing a situation where hybrid plants emerge as volunteer weeds in subsequent cropping systems, there was a positive correlation between the number of B. rapa weed-specific AFLP markers and seed yield (r = 0.70, P = 0.0001, although no such correlation was detected for vegetative biomass. When genetic load was directly incorporated into the hybrid genome, by inserting a

Suppression of F1 Male-Specific Lethality in Caenorhabditis Hybrids by cbr-him-8.

Science.gov (United States)

Ragavapuram, Vaishnavi; Hill, Emily Elaine; Baird, Scott Everet

2015-12-31

Haldane's Rule and Darwin's Corollary to Haldane's Rule are the observations that heterogametic F1 hybrids are frequently less fit than their homogametic siblings, and that asymmetric results are often obtained from reciprocal hybrid crosses. In Caenorhabditis, Haldane's Rule and Darwin's Corollary have been observed in several hybrid crosses, including crosses of Caenorhabditis briggsae and C. nigoni. Fertile F1 females are obtained from reciprocal crosses. However, F1 males obtained from C. nigoni mothers are sterile and F1 males obtained from C. briggsae die during embryogenesis. We have identified cbr-him-8 as a recessive maternal-effect suppressor of F1 hybrid male-specific lethality in this combination of species. This result implicates epigenetic meiotic silencing in the suppression of F1 male-specific lethality. It is also shown that F1 males bearing a C. briggsae X chromosome are fertile. When crossed to C. briggsae hermaphrodites or F1 females derived from C. briggsae hermaphrodites, viable F2 and backcross (B2) progeny were obtained. Sibling males that possessed a C. nigoni X chromosome were sterile. Therefore, the sterility of F1 males bearing a C. nigoni X chromosome must result from dysgenic interactions between the X chromosome of C. nigoni and the autosomes of C. briggsae. The fertility of F1 males bearing a C. briggsae X chromosome provides an opportunity to identify C. nigoni loci that prevent spermatogenesis, and hence hermaphroditic reproduction, in diplo-X hybrids. Copyright © 2016 Ragavapuram et al.

Dynamics of antigen presentation to transgene product-specific CD4+ T cells and of Treg induction upon hepatic AAV gene transfer

Directory of Open Access Journals (Sweden)

George Q Perrin

2016-01-01

Full Text Available The tolerogenic hepatic microenvironment impedes clearance of viral infections but is an advantage in viral vector gene transfer, which often results in immune tolerance induction to transgene products. Although the underlying tolerance mechanism has been extensively studied, our understanding of antigen presentation to transgene product-specific CD4+ T cells remains limited. To address this, we administered hepatotropic adeno-associated virus (AAV8 vector expressing cytoplasmic ovalbumin (OVA into wt mice followed by adoptive transfer of transgenic OVA-specific T cells. We find that that the liver-draining lymph nodes (celiac and portal are the major sites of MHC II presentation of the virally encoded antigen, as judged by in vivo proliferation of DO11.10 CD4+ T cells (requiring professional antigen-presenting cells, e.g., macrophages and CD4+CD25+FoxP3+ Treg induction. Antigen presentation in the liver itself contributes to activation of CD4+ T cells egressing from the liver. Hepatic-induced Treg rapidly disseminate through the systemic circulation. By contrast, a secreted OVA transgene product is presented in multiple organs, and OVA-specific Treg emerge in both the thymus and periphery. In summary, liver draining lymph nodes play an integral role in hepatic antigen presentation and peripheral Treg induction, which results in systemic regulation of the response to viral gene products.

Embryo-specific expression of soybean oleosin altered oil body morphogenesis and increased lipid content in transgenic rice seeds.

Science.gov (United States)

Liu, Wen Xian; Liu, Hua Liang; Qu, Le Qing

2013-09-01

Oleosin is the most abundant protein in the oil bodies of plant seeds, playing an important role in regulating oil body formation and lipid accumulation. To investigate whether lipid accumulation in transgenic rice seeds depends on the expression level of oleosin, we introduced two soybean oleosin genes encoding 24 kDa proteins into rice under the control of an embryo-specific rice promoter REG-2. Overexpression of soybean oleosin in transgenic rice leads to an increase of seed lipid content up to 36.93 and 46.06 % higher than that of the non-transgenic control, respectively, while the overall fatty acid profiles of triacylglycerols remained unchanged. The overexpression of soybean oleosin in transgenic rice seeds resulted in more numerous and smaller oil bodies compared with wild type, suggesting that an inverse relationship exists between oil body size and the total oleosin level. The increase in lipid content is accompanied by a reduction in the accumulation of total seed protein. Our results suggest that it is possible to increase rice seed oil content for food use and for use as a low-cost feedstock for biodiesel by overexpressing oleosin in rice seeds.

Inactivation of CDK2 is synthetically lethal to MYCN over-expressing cancer cells

Science.gov (United States)

Molenaar, Jan J.; Ebus, Marli E.; Geerts, Dirk; Koster, Jan; Lamers, Fieke; Valentijn, Linda J.; Westerhout, Ellen M.; Versteeg, Rogier; Caron, Huib N.

2009-01-01

Two genes have a synthetically lethal relationship when the silencing or inhibiting of 1 gene is only lethal in the context of a mutation or activation of the second gene. This situation offers an attractive therapeutic strategy, as inhibition of such a gene will only trigger cell death in tumor cells with an activated second oncogene but spare normal cells without activation of the second oncogene. Here we present evidence that CDK2 is synthetically lethal to neuroblastoma cells with MYCN amplification and over-expression. Neuroblastomas are childhood tumors with an often lethal outcome. Twenty percent of the tumors have MYCN amplification, and these tumors are ultimately refractory to any therapy. Targeted silencing of CDK2 by 3 RNA interference techniques induced apoptosis in MYCN-amplified neuroblastoma cell lines, but not in MYCN single copy cells. Silencing of MYCN abrogated this apoptotic response in MYCN-amplified cells. Inversely, silencing of CDK2 in MYCN single copy cells did not trigger apoptosis, unless a MYCN transgene was activated. The MYCN induced apoptosis after CDK2 silencing was accompanied by nuclear stabilization of P53, and mRNA profiling showed up-regulation of P53 target genes. Silencing of P53 rescued the cells from MYCN-driven apoptosis. The synthetic lethality of CDK2 silencing in MYCN activated neuroblastoma cells can also be triggered by inhibition of CDK2 with a small molecule drug. Treatment of neuroblastoma cells with roscovitine, a CDK inhibitor, at clinically achievable concentrations induced MYCN-dependent apoptosis. The synthetically lethal relationship between CDK2 and MYCN indicates CDK2 inhibitors as potential MYCN-selective cancer therapeutics. PMID:19525400

Suppression of F1 Male-Specific Lethality in Caenorhabditis Hybrids by cbr-him-8

Directory of Open Access Journals (Sweden)

Vaishnavi Ragavapuram

2016-03-01

Full Text Available Haldane’s Rule and Darwin’s Corollary to Haldane’s Rule are the observations that heterogametic F1 hybrids are frequently less fit than their homogametic siblings, and that asymmetric results are often obtained from reciprocal hybrid crosses. In Caenorhabditis, Haldane’s Rule and Darwin’s Corollary have been observed in several hybrid crosses, including crosses of Caenorhabditis briggsae and C. nigoni. Fertile F1 females are obtained from reciprocal crosses. However, F1 males obtained from C. nigoni mothers are sterile and F1 males obtained from C. briggsae die during embryogenesis. We have identified cbr-him-8 as a recessive maternal-effect suppressor of F1 hybrid male-specific lethality in this combination of species. This result implicates epigenetic meiotic silencing in the suppression of F1 male-specific lethality. It is also shown that F1 males bearing a C. briggsae X chromosome are fertile. When crossed to C. briggsae hermaphrodites or F1 females derived from C. briggsae hermaphrodites, viable F2 and backcross (B2 progeny were obtained. Sibling males that possessed a C. nigoni X chromosome were sterile. Therefore, the sterility of F1 males bearing a C. nigoni X chromosome must result from dysgenic interactions between the X chromosome of C. nigoni and the autosomes of C. briggsae. The fertility of F1 males bearing a C. briggsae X chromosome provides an opportunity to identify C. nigoni loci that prevent spermatogenesis, and hence hermaphroditic reproduction, in diplo-X hybrids.

Cancer-specific transgene expression mediated by systemic injection of nanoparticles.

Science.gov (United States)

Chisholm, Edward J; Vassaux, Georges; Martin-Duque, Pilar; Chevre, Raphael; Lambert, Olivier; Pitard, Bruno; Merron, Andrew; Weeks, Mark; Burnet, Jerome; Peerlinck, Inge; Dai, Ming-Shen; Alusi, Ghassan; Mather, Stephen J; Bolton, Katherine; Uchegbu, Ijeoma F; Schatzlein, Andreas G; Baril, Patrick

2009-03-15

The lack of safe and efficient systemic gene delivery vectors has largely reduced the potential of gene therapy in the clinic. Previously, we have reported that polypropylenimine dendrimer PPIG3/DNA nanoparticles are capable of tumor transfection upon systemic administration in tumor-bearing mice. To be safely applicable in the clinic, it is crucial to investigate the colloidal stability of nanoparticles and to monitor the exact biodistribution of gene transfer in the whole body of the live subject. Our biophysical characterization shows that dendrimers, when complexed with DNA, are capable of forming spontaneously in solution a supramolecular assembly that possesses all the features required to diffuse in experimental tumors through the enhanced permeability and retention effect. We show that these nanoparticles are of sizes ranging from 33 to 286 nm depending on the DNA concentration, with a colloidal stable and well-organized fingerprint-like structure in which DNA molecules are condensed with an even periodicity of 2.8 nm. Whole-body nuclear imaging using small-animal nano-single-photon emission computed tomography/computer tomography scanner and the human Na/I symporter (NIS) as reporter gene shows unique and highly specific tumor targeting with no detection of gene transfer in any of the other tissues of tumor-bearing mice. Tumor-selective transgene expression was confirmed by quantitative reverse transcription-PCR at autopsy of scanned animals, whereas genomic PCR showed that the tumor sites are the predominant sites of nanoparticle accumulation. Considering that NIS imaging of transgene expression has been recently validated in humans, our data highlight the potential of these nanoparticles as a new formulation for cancer gene therapy.

Identification of NY-BR-1-specific CD4(+) T cell epitopes using HLA-transgenic mice.

Science.gov (United States)

Gardyan, Adriane; Osen, Wolfram; Zörnig, Inka; Podola, Lilli; Agarwal, Maria; Aulmann, Sebastian; Ruggiero, Eliana; Schmidt, Manfred; Halama, Niels; Leuchs, Barbara; von Kalle, Christof; Beckhove, Philipp; Schneeweiss, Andreas; Jäger, Dirk; Eichmüller, Stefan B

2015-06-01

Breast cancer represents the second most common cancer type worldwide and has remained the leading cause of cancer-related deaths among women. The differentiation antigen NY-BR-1 appears overexpressed in invasive mammary carcinomas compared to healthy breast tissue, thus representing a promising target antigen for T cell based tumor immunotherapy approaches. Since efficient immune attack of tumors depends on the activity of tumor antigen-specific CD4(+) effector T cells, NY-BR-1 was screened for the presence of HLA-restricted CD4(+) T cell epitopes that could be included in immunological treatment approaches. Upon NY-BR-1-specific DNA immunization of HLA-transgenic mice and functional ex vivo analysis, a panel of NY-BR-1-derived library peptides was determined that specifically stimulated IFNγ secretion among splenocytes of immunized mice. Following in silico analyses, four candidate epitopes were determined which were successfully used for peptide immunization to establish NY-BR-1-specific, HLA-DRB1*0301- or HLA-DRB1*0401-restricted CD4(+) T cell lines from splenocytes of peptide immunized HLA-transgenic mice. Notably, all four CD4(+) T cell lines recognized human HLA-DR-matched dendritic cells (DC) pulsed with lysates of NY-BR-1 expressing human tumor cells, demonstrating natural processing of these epitopes also within the human system. Finally, CD4(+) T cells specific for all four CD4(+) T cell epitopes were detectable among PBMC of breast cancer patients, showing that CD4(+) T cell responses against the new epitopes are not deleted nor inactivated by self-tolerance mechanisms. Our results present the first NY-BR-1-specific HLA-DRB1*0301- and HLA-DRB1*0401-restricted T cell epitopes that could be exploited for therapeutic intervention against breast cancer. © 2014 UICC.

The effect of high concentrations of glufosinate ammonium on the yield components of transgenic spring wheat (Triticum aestivum L.) constitutively expressing the bar gene.

Science.gov (United States)

Áy, Zoltán; Mihály, Róbert; Cserháti, Mátyás; Kótai, Éva; Pauk, János

2012-01-01

We present an experiment done on a bar(+) wheat line treated with 14 different concentrations of glufosinate ammonium-an effective component of nonselective herbicides-during seed germination in a closed experimental system. Yield components as number of spikes per plant, number of grains per spike, thousand kernel weight, and yield per plant were thoroughly analysed and statistically evaluated after harvesting. We found that a concentration of glufosinate ammonium 5000 times the lethal dose was not enough to inhibit the germination of transgenic plants expressing the bar gene. Extremely high concentrations of glufosinate ammonium caused a bushy phenotype, significantly lower numbers of grains per spike, and thousand kernel weights. Concerning the productivity, we observed that concentrations of glufosinate ammonium 64 times the lethal dose did not lead to yield depression. Our results draw attention to the possibilities implied in the transgenic approaches.

Selectivity and Efficiency of Late Transgene Expression by Transcriptionally Targeted Oncolytic Adenoviruses Are Dependent on the Transgene Insertion Strategy

Science.gov (United States)

Quirin, Christina; Rohmer, Stanimira; Fernández-Ulibarri, Inés; Behr, Michael; Hesse, Andrea; Engelhardt, Sarah; Erbs, Philippe; Enk, Alexander H.

2011-01-01

Abstract Key challenges facing cancer therapy are the development of tumor-specific drugs and potent multimodal regimens. Oncolytic adenoviruses possess the potential to realize both aims by restricting virus replication to tumors and inserting therapeutic genes into the virus genome, respectively. A major effort in this regard is to express transgenes in a tumor-specific manner without affecting virus replication. Using both luciferase as a sensitive reporter and genetic prodrug activation, we show that promoter control of E1A facilitates highly selective expression of transgenes inserted into the late transcription unit. This, however, required multistep optimization of late transgene expression. Transgene insertion via internal ribosome entry site (IRES), splice acceptor (SA), or viral 2A sequences resulted in replication-dependent expression. Unexpectedly, analyses in appropriate substrates and with matching control viruses revealed that IRES and SA, but not 2A, facilitated indirect transgene targeting via tyrosinase promoter control of E1A. Transgene expression via SA was more selective (up to 1,500-fold) but less effective than via IRES. Notably, we also revealed transgene-dependent interference with splicing. Hence, the prodrug convertase FCU1 (a cytosine deaminase–uracil phosphoribosyltransferase fusion protein) was expressed only after optimizing the sequence surrounding the SA site and mutating a cryptic splice site within the transgene. The resulting tyrosinase promoter-regulated and FCU1-encoding adenovirus combined effective oncolysis with targeted prodrug activation therapy of melanoma. Thus, prodrug activation showed potent bystander killing and increased cytotoxicity of the virus up to 10-fold. We conclude that armed oncolytic viruses can be improved substantially by comparing and optimizing strategies for targeted transgene expression, thereby implementing selective and multimodal cancer therapies. PMID:20939692

Chimeric anti-staphylococcal enterotoxin B antibodies and lovastatin act synergistically to provide in vivo protection against lethal doses of SEB.

Directory of Open Access Journals (Sweden)

Mulualem E Tilahun

Full Text Available Staphylococcal enterotoxin B (SEB is one of a family of toxins secreted by Staphylococcus aureus that act as superantigens, activating a large fraction of the T-cell population and inducing production of high levels of inflammatory cytokines that can cause toxic shock syndrome (TSS and death. Extracellular engagement of the TCR of T-cells and class II MHC of antigen presenting cells by SEB triggers the activation of many intracellular signaling processes. We engineered chimeric antibodies to block the extracellular engagement of cellular receptors by SEB and used a statin to inhibit intracellular signaling. Chimeric human-mouse antibodies directed against different neutralizing epitopes of SEB synergistically inhibited its activation of human T-cells in vitro. In the in vivo model of lethal toxic shock syndrome (TSS in HLA-DR3 transgenic mice, two of these antibodies conferred significant partial protection when administered individually, but offered complete protection in a synergistic manner when given together. Similarly, in vivo, lovastatin alone conferred only partial protection from TSS similar to single anti-SEB antibodies. However, used in combination with one chimeric neutralizing anti-SEB antibody, lovastatin provided complete protection against lethal TSS in HLA-DR3 transgenic mice. These experiments demonstrate that in vivo protection against lethal doses of SEB can be achieved by a statin of proven clinical safety and chimeric human-mouse antibodies, agents now widely used and known to be of low immunogenicity in human hosts.

Event-specific qualitative and quantitative PCR detection of the GMO carnation (Dianthus caryophyllus) variety Moonlite based upon the 5'-transgene integration sequence.

Science.gov (United States)

Li, P; Jia, J W; Jiang, L X; Zhu, H; Bai, L; Wang, J B; Tang, X M; Pan, A H

2012-04-27

To ensure the implementation of genetically modified organism (GMO)-labeling regulations, an event-specific detection method was developed based on the junction sequence of an exogenous integrant in the transgenic carnation variety Moonlite. The 5'-transgene integration sequence was isolated by thermal asymmetric interlaced PCR. Based upon the 5'-transgene integration sequence, the event-specific primers and TaqMan probe were designed to amplify the fragments, which spanned the exogenous DNA and carnation genomic DNA. Qualitative and quantitative PCR assays were developed employing the designed primers and probe. The detection limit of the qualitative PCR assay was 0.05% for Moonlite in 100 ng total carnation genomic DNA, corresponding to about 79 copies of the carnation haploid genome; the limit of detection and quantification of the quantitative PCR assay were estimated to be 38 and 190 copies of haploid carnation genomic DNA, respectively. Carnation samples with different contents of genetically modified components were quantified and the bias between the observed and true values of three samples were lower than the acceptance criterion (GMO detection method. These results indicated that these event-specific methods would be useful for the identification and quantification of the GMO carnation Moonlite.

HLA-B27-Homodimer-Specific Antibody Modulates the Expansion of Pro-Inflammatory T-Cells in HLA-B27 Transgenic Rats.

Directory of Open Access Journals (Sweden)

Osiris Marroquin Belaunzaran

Full Text Available HLA-B27 is a common genetic risk factor for the development of Spondyloarthritides (SpA. HLA-B27 can misfold to form cell-surface heavy chain homodimers (B272 and induce pro-inflammatory responses that may lead to SpA pathogenesis. The presence of B272 can be detected on leukocytes of HLA-B27+ Ankylosing spondylitis (AS patients and HLA-B27 transgenic rats. We characterized a novel B272-specific monoclonal antibody to study its therapeutic use in HLA-B27 associated disorders.The monoclonal HD5 antibody was selected from a phage library to target cell-surface B272 homodimers and characterized for affinity, specificity and ligand binding. The immune modulating effect of HD5 was tested in HLA-B27 transgenic rats. Onset and progression of disease profiles were monitored during therapy. Cell-surface B272 and expansion of pro-inflammatory cells from blood, spleen and draining lymph nodes were assessed by flow cytometry.HD5 bound B272 with high specificity and affinity (Kd = 0.32 nM. HD5 blocked cell-surface interaction of B272 with immune regulatory receptors KIR3DL2, LILRB2 and Pirb. In addition, HD5 modulated the production of TNF from CD4+ T-cells by limiting B272 interactions in vitro. In an HLA-B27 transgenic rat model repetitive dosing of HD5 reduced the expansion of pro-inflammatory CD4+ T-cells, and decreased the levels of soluble TNF and number of cell-surface B272 molecules.HD5 predominantly inhibits early TNF production and expansion of pro-inflammatory CD4+ T-cells in HLA-B27 transgenic rats. Monoclonal antibodies targeting cell-surface B272 propose a new concept for the modulation of inflammatory responses in HLA-B27 related disorders.

HLA-B27-Homodimer-Specific Antibody Modulates the Expansion of Pro-Inflammatory T-Cells in HLA-B27 Transgenic Rats

Science.gov (United States)

Marroquin Belaunzaran, Osiris; Kleber, Sascha; Schauer, Stefan; Hausmann, Martin; Nicholls, Flora; Van den Broek, Maries; Payeli, Sravan; Ciurea, Adrian; Milling, Simon; Stenner, Frank; Shaw, Jackie; Kollnberger, Simon; Bowness, Paul; Petrausch, Ulf; Renner, Christoph

2015-01-01

Objectives HLA-B27 is a common genetic risk factor for the development of Spondyloarthritides (SpA). HLA-B27 can misfold to form cell-surface heavy chain homodimers (B272) and induce pro-inflammatory responses that may lead to SpA pathogenesis. The presence of B272 can be detected on leukocytes of HLA-B27+ Ankylosing spondylitis (AS) patients and HLA-B27 transgenic rats. We characterized a novel B272–specific monoclonal antibody to study its therapeutic use in HLA-B27 associated disorders. Methods The monoclonal HD5 antibody was selected from a phage library to target cell-surface B272 homodimers and characterized for affinity, specificity and ligand binding. The immune modulating effect of HD5 was tested in HLA-B27 transgenic rats. Onset and progression of disease profiles were monitored during therapy. Cell-surface B272 and expansion of pro-inflammatory cells from blood, spleen and draining lymph nodes were assessed by flow cytometry. Results HD5 bound B272 with high specificity and affinity (Kd = 0.32 nM). HD5 blocked cell-surface interaction of B272 with immune regulatory receptors KIR3DL2, LILRB2 and Pirb. In addition, HD5 modulated the production of TNF from CD4+ T-cells by limiting B272 interactions in vitro. In an HLA-B27 transgenic rat model repetitive dosing of HD5 reduced the expansion of pro-inflammatory CD4+ T-cells, and decreased the levels of soluble TNF and number of cell-surface B272 molecules. Conclusion HD5 predominantly inhibits early TNF production and expansion of pro-inflammatory CD4+ T-cells in HLA-B27 transgenic rats. Monoclonal antibodies targeting cell-surface B272 propose a new concept for the modulation of inflammatory responses in HLA-B27 related disorders. PMID:26125554

A proteomic study to identify soya allergens--the human response to transgenic versus non-transgenic soya samples.

Science.gov (United States)

Batista, Rita; Martins, Isabel; Jeno, Paul; Ricardo, Cândido Pinto; Oliveira, Maria Margarida

2007-01-01

In spite of being among the main foods responsible for allergic reactions worldwide, soybean (Glycine max)-derived products continue to be increasingly widespread in a variety of food products due to their well-documented health benefits. Soybean also continues to be one of the elected target crops for genetic modification. The aim of this study was to characterize the soya proteome and, specifically, IgE-reactive proteins as well as to compare the IgE response in soya-allergic individuals to genetically modified Roundup Ready soya versus its non-transgenic control. We performed two-dimensional gel electrophoresis of protein extracts from a 5% genetically modified Roundup Ready flour sample and its non-transgenic control followed by Western blotting with plasma from 5 soya-sensitive individuals. We used peptide tandem mass spectrometry to identify soya proteins (55 protein matches), specifically IgE-binding ones, and to evaluate differences between transgenic and non-transgenic samples. We identified 2 new potential soybean allergens--one is maturation associated and seems to be part of the late embryogenesis abundant proteins group and the other is a cysteine proteinase inhibitor. None of the individuals tested reacted differentially to the transgenic versus non-transgenic samples under study. Soybean endogenous allergen expression does not seem to be altered after genetic modification. Proteomics should be considered a powerful tool for functional characterization of plants and for food safety assessment. Copyright (c) 2007 S. Karger AG, Basel.

Bypass of lethality with mosaic mice generated by Cre-loxP-mediated recombination.

Science.gov (United States)

Betz, U A; Vosshenrich, C A; Rajewsky, K; Müller, W

1996-10-01

The analysis of gene function based on the generation of mutant mice by homologous recombination in embryonic stem cells is limited if gene disruption results in embryonic lethality. Mosaic mice, which contain a certain proportion of mutant cells in all organs, allow lethality to be circumvented and the potential of mutant cells to contribute to different cell lineages to be analyzed. To generate mosaic animals, we used the bacteriophage P1-derived Cre-loxP recombination system, which allows gene alteration by Cre-mediated deletion of loxP-flanked gene segments. We generated nestin-cre transgenic mouse lines, which expressed the Cre recombinase under the control of the rat nestin promoter and its second intron enhancer. In crosses to animals carrying a loxP-flanked target gene, partial deletion of the loxP-flanked allele occurred before day 10.5 post coitum and was detectable in all adult organs examined, including germ-line cells. Using this approach, we generated mosaic mice containing cells deficient in the gamma-chain of the interleukin-2 receptor (IL-2R gamma); in these animals, the IL-2R gamma-deficient cells were underrepresented in the thymus and spleen. Because mice deficient in DNA polymerase beta die perinatally, we studied the effects of DNA polymerase beta deficiency in mosaic animals. We found that some of the mosaic polymerase beta-deficient animals were viable, but were often reduced in size and weight. The fraction of DNA polymerase beta-deficient cells in mosaic embryos decreased during embryonic development, presumably because wild-type cells had a competitive advantage. The nestin-cre transgenic mice can be used to generate mosaic animals in which target genes are mutated by Cre-mediated recombination of loxP-flanked target genes. By using mosaic animals, embryonic lethality can be bypassed and cell lineages for whose development a given target gene is critical can be identified. In the case of DNA polymerase beta, deficient cells are already

Analyses of pancreas development by generation of gfp transgenic zebrafish using an exocrine pancreas-specific elastaseA gene promoter

International Nuclear Information System (INIS)

Wan Haiyan; Korzh, Svitlana; Li Zhen; Mudumana, Sudha Puttur; Korzh, Vladimir; Jiang Yunjin; Lin Shuo; Gong Zhiyuan

2006-01-01

In contrast to what we know on development of endocrine pancreas, the formation of exocrine pancreas remains poorly understood. To create an animal model that allows observation of exocrine cell differentiation, proliferation, and morphogenesis in living animals, we used the zebrafish elastaseA (elaA) regulatory sequence to develop transgenic zebrafish that display highly specific exocrine pancreas expression of GFP in both larvae and adult. By following GFP expression, we found that the pancreas in early development was a relatively compact organ and later extended posterior along the intestine. By transferring the elaA:gfp transgene into slow muscle omitted mutant that is deficient in receiving Hedgehog signals, we further showed that Hedgehog signaling is required for exocrine morphogenesis but not for cell differentiation. We also applied the morpholino knockdown and toxin-mediated cell ablation approaches to this transgenic line. We showed that the development of exocrine pancreas is Islet-1 dependent. Injection of the diphtheria toxin A (DTA) construct under the elastaseA promoter resulted in selective ablation of exocrine cells while the endocrine cells and other endodermal derivatives (liver and intestine) were not affected. Thus, our works demonstrated the new transgenic line provided a useful experimental tool in analyzing exocrine pancreas development

Effect of lethal and sub-lethal concentrations of tobacco (Nicotiana ...

African Journals Online (AJOL)

Lethal and sub-lethal bioassays on Clarias gariepinus were conducted to evaluate the toxicity of tobacco (Nicotiana tobaccum) leaf dust on weight gain and haematological indices of Clarias gariepinus (mean weight 10.5±0.70g) in glass aquaria with aeration system. The concentrations used during the lethal exposure are: ...

The Effect of High Concentrations of Glufosinate Ammonium on the Yield Components of Transgenic Spring Wheat (Triticum aestivum L. Constitutively Expressing the bar Gene

Directory of Open Access Journals (Sweden)

Zoltán Áy

2012-01-01

Full Text Available We present an experiment done on a bar+ wheat line treated with 14 different concentrations of glufosinate ammonium—an effective component of nonselective herbicides—during seed germination in a closed experimental system. Yield components as number of spikes per plant, number of grains per spike, thousand kernel weight, and yield per plant were thoroughly analysed and statistically evaluated after harvesting. We found that a concentration of glufosinate ammonium 5000 times the lethal dose was not enough to inhibit the germination of transgenic plants expressing the bar gene. Extremely high concentrations of glufosinate ammonium caused a bushy phenotype, significantly lower numbers of grains per spike, and thousand kernel weights. Concerning the productivity, we observed that concentrations of glufosinate ammonium 64 times the lethal dose did not lead to yield depression. Our results draw attention to the possibilities implied in the transgenic approaches.

Comparison of the antiviral potential among soluble forms of herpes simplex virus type-2 glycoprotein D receptors, herpes virus entry mediator A, nectin-1 and nectin-2, in transgenic mice.

Science.gov (United States)

Fujimoto, Yoshikazu; Tomioka, Yukiko; Ozaki, Kinuyo; Takeda, Keiko; Suyama, Haruka; Yamamoto, Sayo; Takakuwa, Hiroki; Morimatsu, Masami; Uede, Toshimitsu; Ono, Etsuro

2017-07-01

Herpesvirus entry mediator A (HVEM), nectin-1 and nectin-2 are cellular receptors of glycoprotein D (gD) of herpes simplex virus type-2 (HSV-2). It has been shown that soluble forms of HSV gD receptors have the antiviral potential in cultured cells and transgenic mice. Here, to compare antiviral potential of soluble forms of HVEM, nectin-1 and nectin-2 against HSV-2 infections in vivo, transgenic mice expressing fusion proteins consisting of the entire ectodomain of HVEM, nectin-1 or nectin-2 and the Fc portion of human IgG (HVEMIg, nectin-1Ig and nectin-2Ig, respectively) were intraperitoneally infected with HSV-2. In the infection with 3 MLD50 (50 % mouse lethal dose), effective resistance was not observed in transgenic mice expressing nectin-2Ig. In a transgenic mouse line with high expression of nectin-1Ig, significant protection from the infection with 30 and 300 MLD50 was observed (survival rate of 100 and 71 %, respectively). On the other hand, transgenic mice expressing HVEMIg showed a complete resistance to the lethal infection even with 300 MLD50 (survival rate of 100 %). These results demonstrated that HVEMIg could exert effective antiviral activities against HSV-2 infections in vivo as compared with other soluble forms of HSV gD receptors.

A transgenic Plasmodium falciparum NF54 strain that expresses GFP-luciferase throughout the parasite life cycle.

Science.gov (United States)

Vaughan, Ashley M; Mikolajczak, Sebastian A; Camargo, Nelly; Lakshmanan, Viswanathan; Kennedy, Mark; Lindner, Scott E; Miller, Jessica L; Hume, Jen C C; Kappe, Stefan H I

2012-12-01

Plasmodium falciparum is the pathogenic agent of the most lethal of human malarias. Transgenic P. falciparum parasites expressing luciferase have been created to study drug interventions of both asexual and sexual blood stages but luciferase-expressing mosquito stage and liver stage parasites have not been created which has prevented the easy quantification of mosquito stage development (e.g. for transmission blocking interventions) and liver stage development (for interventions that prevent infection). To overcome this obstacle, we have created a transgenic P. falciparum NF54 parasite that expresses a GFP-luciferase transgene throughout the life cycle. Luciferase expression is robust and measurable at all life cycle stages, including midgut oocyst, salivary gland sporozoites and liver stages, where in vivo development is easily measurable using humanized mouse infections in conjunction with an in vivo imaging system. This parasite reporter strain will accelerate testing of interventions against pre-erythrocytic life cycle stages. Copyright © 2012 Elsevier B.V. All rights reserved.

A BAC-based transgenic mouse specifically expresses an inducible Cre in the urothelium.

Directory of Open Access Journals (Sweden)

Tian Huai Shen

Full Text Available Cre-loxp mediated conditional knockout strategy has played critical roles for revealing functions of many genes essential for development, as well as the causal relationships between gene mutations and diseases in the postnatal adult mice. One key factor of this strategy is the availability of mice with tissue- or cell type-specific Cre expression. However, the success of the traditional molecular cloning approach to generate mice with tissue specific Cre expression often depends on luck. Here we provide a better alternative by using bacterial artificial chromosome (BAC-based recombineering to insert iCreERT2 cDNA at the ATG start of the Upk2 gene. The BAC-based transgenic mice express the inducible Cre specifically in the urothelium as demonstrated by mRNA expression and staining for LacZ expression after crossing with a Rosa26 reporter mouse. Taking into consideration the size of the gene of interest and neighboring genes included in a BAC, this method should be widely applicable for generation of mice with tissue specific gene expression or deletions in a more specific manner than previously reported.

A high level of liver-specific expression of oncogenic KrasV12 drives robust liver tumorigenesis in transgenic zebrafish

Directory of Open Access Journals (Sweden)

Anh Tuan Nguyen

2011-11-01

Human liver cancer is one of the deadliest cancers worldwide, with hepatocellular carcinoma (HCC being the most common type. Aberrant Ras signaling has been implicated in the development and progression of human HCC, but a complete understanding of the molecular mechanisms of this protein in hepatocarcinogenesis remains elusive. In this study, a stable in vivo liver cancer model using transgenic zebrafish was generated to elucidate Ras-driven tumorigenesis in HCC. Using the liver-specific fabp10 (fatty acid binding protein 10 promoter, we overexpressed oncogenic krasV12 specifically in the transgenic zebrafish liver. Only a high level of krasV12 expression initiated liver tumorigenesis, which progressed from hyperplasia to benign and malignant tumors with activation of the Ras-Raf-MEK-ERK and Wnt–β-catenin pathways. Histological diagnosis of zebrafish tumors identified HCC as the main lesion. The tumors were invasive and transplantable, indicating malignancy of these HCC cells. Oncogenic krasV12 was also found to trigger p53-dependent senescence as a tumor suppressive barrier in the pre-neoplastic stage. Microarray analysis of zebrafish liver hyperplasia and HCC uncovered the deregulation of several stage-specific and common biological processes and signaling pathways responsible for krasV12-driven liver tumorigenesis that recapitulated the molecular hallmarks of human liver cancer. Cross-species comparisons of cancer transcriptomes further defined a HCC-specific gene signature as well as a liver cancer progression gene signature that are evolutionarily conserved between human and zebrafish. Collectively, our study presents a comprehensive portrait of molecular mechanisms during progressive Ras-induced HCC. These observations indicate the validity of our transgenic zebrafish to model human liver cancer, and this model might act as a useful platform for drug screening and identifying new therapeutic targets.

Passive therapy with humanized anti-staphylococcal enterotoxin B antibodies attenuates systemic inflammatory response and protects from lethal pneumonia caused by staphylococcal enterotoxin B-producing Staphylococcus aureus.

Science.gov (United States)

Karau, Melissa J; Tilahun, Mulualem E; Krogman, Ashton; Osborne, Barbara A; Goldsby, Richard A; David, Chella S; Mandrekar, Jayawant N; Patel, Robin; Rajagopalan, Govindarajan

2017-10-03

Drugs such as linezolid that inhibit bacterial protein synthesis may be beneficial in treating infections caused by toxigenic Staphylococcus aureus. As protein synthesis inhibitors have no effect on preformed toxins, neutralization of pathogenic exotoxins with anti-toxin antibodies may be beneficial in conjunction with antibacterial therapy. Herein, we evaluated the efficacy of human-mouse chimeric high-affinity neutralizing anti-staphylococcal enterotoxin B (SEB) antibodies in the treatment of experimental pneumonia caused by SEB-producing S. aureus. Since HLA class II transgenic mice mount a stronger systemic immune response following challenge with SEB and are more susceptible to SEB-induced lethal toxic shock than conventional mice strains, HLA-DR3 transgenic mice were used. Lethal pneumonia caused by SEB-producing S. aureus in HLA-DR3 transgenic mice was characterized by robust T cell activation and elevated systemic levels of several pro-inflammatory cytokines and chemokines. Prophylactic administration of a single dose of linezolid 30 min prior to the onset of infection attenuated the systemic inflammatory response and protected from mortality whereas linezolid administered 60 min after the onset of infection failed to confer significant protection. Human-mouse chimeric high-affinity neutralizing anti-SEB antibodies alone, but not polyclonal human IgG, mitigated this response and protected from death when administered immediately after initiation of infection. Further, anti-SEB antibodies as well as intact polyclonal human IgG, but not its Fab or Fc fragments, protected from lethal pneumonia when followed with linezolid therapy 60 min later. In conclusion, neutralization of superantigens with high-affinity antibodies may have beneficial effects in pneumonia.

A multivariate model of stakeholder preference for lethal cat management.

Science.gov (United States)

Wald, Dara M; Jacobson, Susan K

2014-01-01

Identifying stakeholder beliefs and attitudes is critical for resolving management conflicts. Debate over outdoor cat management is often described as a conflict between two groups, environmental advocates and animal welfare advocates, but little is known about the variables predicting differences among these critical stakeholder groups. We administered a mail survey to randomly selected stakeholders representing both of these groups (n=1,596) in Florida, where contention over the management of outdoor cats has been widespread. We used a structural equation model to evaluate stakeholder intention to support non-lethal management. The cognitive hierarchy model predicted that values influenced beliefs, which predicted general and specific attitudes, which in turn, influenced behavioral intentions. We posited that specific attitudes would mediate the effect of general attitudes, beliefs, and values on management support. Model fit statistics suggested that the final model fit the data well (CFI=0.94, RMSEA=0.062). The final model explained 74% of the variance in management support, and positive attitudes toward lethal management (humaneness) had the largest direct effect on management support. Specific attitudes toward lethal management and general attitudes toward outdoor cats mediated the relationship between positive (pstakeholder intention to support non-lethal cat management. Our findings suggest that stakeholders can simultaneously perceive both positive and negative beliefs about outdoor cats, which influence attitudes toward and support for non-lethal management.

Proteomic identification of an embryo-specific 1Cys-Prx promoter and analysis of its activity in transgenic rice.

Science.gov (United States)

Kim, Je Hein; Jung, In Jung; Kim, Dool Yi; Fanata, Wahyu Indra; Son, Bo Hwa; Yoo, Jae Yong; Harmoko, Rikno; Ko, Ki Seong; Moon, Jeong Chan; Jang, Ho Hee; Kim, Woe Yeon; Kim, Jae-Yean; Lim, Chae Oh; Lee, Sang Yeol; Lee, Kyun Oh

2011-04-29

Proteomic analysis of a rice callus led to the identification of 10 abscisic acid (ABA)-induced proteins as putative products of the embryo-specific promoter candidates. 5'-flanking sequence of 1 Cys-Prx, a highly-induced protein gene, was cloned and analyzed. The transcription initiation site of 1 Cys-Prx maps 96 nucleotides upstream of the translation initiation codon and a TATA-box and putative seed-specific cis-acting elements, RYE and ABRE, are located 26, 115 and 124 bp upstream of the transcription site, respectively. β-glucuronidase (GUS) expression driven by the 1 Cys-Prx promoters was strong in the embryo and aleurone layer and the activity reached up to 24.9 ± 3.3 and 40.5 ± 2.1 pmol (4 MU/min/μg protein) in transgenic rice seeds and calluses, respectively. The activity of the 1 Cys-Prx promoters is much higher than that of the previously-identified embryo-specific promoters, and comparable to that of strong endosperm-specific promoters in rice. GUS expression driven by the 1 Cys-Prx promoters has been increased by ABA treatment and rapidly induced by wounding in callus and at the leaf of the transgenic plants, respectively. Furthermore, ectopic expression of the GUS construct in Arabidopsis suggested that the 1 Cys-Prx promoter also has strong activity in seeds of dicot plants. Copyright © 2011 Elsevier Inc. All rights reserved.

Lethality Index 2008-2014: Less shootings, same lethality, more opacity

Directory of Open Access Journals (Sweden)

Carlos Silva Forné

2017-11-01

Full Text Available This article evaluates the use of lethal force by Mexican federal security forces during shootings with presumed members of organized crime from 2008-2014. The authors use official data and press reports on deaths and wounded in shootings to construct indicators such as the number of dead civilians over the number of dead officials from the federal security forces and the number of dead civilians over the number of wounded civilians. In a context where certain factors that contribute to an excessive use of force become more common, the results of the study show a growing use of lethal force. This raises questions over the possible excessive use of lethal force as a normal or systematic practice. The study also shows a growing context of opacity in the information available to evaluate the use of lethal force and the general lack of a legal framework to regulate the use of lethal force in Mexico.

Engineering arsenic tolerance and hyperaccumulation in plants for phytoremediation by a PvACR3 transgenic approach.

Science.gov (United States)

Chen, Yanshan; Xu, Wenzhong; Shen, Hongling; Yan, Huili; Xu, Wenxiu; He, Zhenyan; Ma, Mi

2013-08-20

Arsenic (As) pollution is a global problem, and the plant-based cleanup of contaminated soils, called phytoremediation, is therefore of great interest. Recently, transgenic approaches have been designed to develop As phytoremediation technologies. Here, we used a one-gene transgenic approach for As tolerance and accumulation in Arabidopsis thaliana . PvACR3, a key arsenite [As(III)] antiporter in the As hyperaccumulator fern Pteris vittata , was expressed in Arabidopsis , driven by the CaMV 35S promoter. In response to As treatment, PvACR3 transgenic plants showed greatly enhanced tolerance. PvACR3 transgenic seeds could even germinate and grow in the presence of 80 μM As(III) or 1200 μM arsenate [As(V)] treatments that were lethal to wild-type seeds. PvACR3 localizes to the plasma membrane in Arabidopsis and increases arsenite efflux into external medium in short-term experiments. Arsenic determination showed that PvACR3 substantially reduced As concentrations in roots and simultaneously increased shoot As under 150 μM As(V). When cultivated in As(V)-containing soil (10 ppm As), transgenic plants accumulated approximately 7.5-fold more As in above-ground tissues than wild-type plants. This study provides important insights into the behavior of PvACR3 and the physiology of As metabolism in plants. Our work also provides a simple and practical PvACR3 transgenic approach for engineering As-tolerant and -hyperaccumulating plants for phytoremediation.

Sepsis reveals compartment-specific responses in intestinal proliferation and apoptosis in transgenic mice whose enterocytes re-enter the cell cycle.

Science.gov (United States)

Lyons, John D; Klingensmith, Nathan J; Otani, Shunsuke; Mittal, Rohit; Liang, Zhe; Ford, Mandy L; Coopersmith, Craig M

2017-12-01

Cell production and death are tightly regulated in the rapidly renewing gut epithelium, with proliferation confined to crypts and apoptosis occurring in villi and crypts. This study sought to determine how stress alters these compartmentalized processes. Wild-type mice made septic via cecal ligation and puncture had decreased crypt proliferation and increased crypt and villus apoptosis. Fabpi -TAg mice expressing large T-antigen solely in villi had ectopic enterocyte proliferation with increased villus apoptosis in unmanipulated animals. Septic fabpi -TAg mice had an unexpected increase in villus proliferation compared with unmanipulated littermates, whereas crypt proliferation was decreased. Cell cycle regulators cyclin D1 and cyclin D2 were decreased in jejunal tissue in septic transgenic mice. In contrast, villus and crypt apoptosis were increased in septic fabpi -TAg mice. To examine the relationship between apoptosis and proliferation in a compartment-specific manner, fabpi -TAg mice were crossed with fabpl -Bcl-2 mice, resulting in expression of both genes in the villus but Bcl-2 alone in the crypt. Septic bi-transgenic animals had decreased crypt apoptosis but had a paradoxical increase in villus apoptosis compared with septic fabpi -TAg mice, associated with decreased proliferation in both compartments. Thus, sepsis unmasks compartment-specific proliferative and apoptotic regulation that is not present under homeostatic conditions.-Lyons, J. D., Klingensmith, N. J., Otani, S., Mittal, R., Liang, Z., Ford, M. L., Coopersmith, C. M. Sepsis reveals compartment-specific responses in intestinal proliferation and apoptosis in transgenic mice whose enterocytes re-enter the cell cycle. © FASEB.

Interpreting a sequenced genome: toward a cosmid transgenic library of Caenorhabditis elegans.

Science.gov (United States)

Janke, D L; Schein, J E; Ha, T; Franz, N W; O'Neil, N J; Vatcher, G P; Stewart, H I; Kuervers, L M; Baillie, D L; Rose, A M

1997-10-01

We have generated a library of transgenic Caenorhabditis elegans strains that carry sequenced cosmids from the genome of the nematode. Each strain carries an extrachromosomal array containing a single cosmid, sequenced by the C. elegans Genome Sequencing Consortium, and a dominate Rol-6 marker. More than 500 transgenic strains representing 250 cosmids have been constructed. Collectively, these strains contain approximately 8 Mb of sequence data, or approximately 8% of the C. elegans genome. The transgenic strains are being used to rescue mutant phenotypes, resulting in a high-resolution map alignment of the genetic, physical, and DNA sequence maps of the nematode. We have chosen the region of chromosome III deleted by sDf127 and not covered by the duplication sDp8(III;I) as a starting point for a systematic correlation of mutant phenotypes with nucleotide sequence. In this defined region, we have identified 10 new essential genes whose mutant phenotypes range from developmental arrest at early larva, to maternal effect lethal. To date, 8 of these 10 essential genes have been rescued. In this region, these rescues represent approximately 10% of the genes predicted by GENEFINDER and considerably enhance the map alignment. Furthermore, this alignment facilitates future efforts to physically position and clone other genes in the region. [Updated information about the Transgenic Library is available via the Internet at http://darwin.mbb.sfu.ca/imbb/dbaillie/cos mid.html.

Transgenic plants expressing GLK1 and CCA1 having increased nitrogen assimilation capacity

Science.gov (United States)

Coruzzi, Gloria [New York, NY; Gutierrez, Rodrigo A [Santiago, CL; Nero, Damion C [Woodside, NY

2012-04-10

Provided herein are compositions and methods for producing transgenic plants. In specific embodiments, transgenic plants comprise a construct comprising a polynucleotide encoding CCA1, GLK1 or bZIP1, operably linked to a plant-specific promote, wherein the CCA1, GLK1 or bZIP1 is ectopically overexpressed in the transgenic plants, and wherein the promoter is optionally a constitutive or inducible promoter. In other embodiments, transgenic plants in which express a lower level of CCA1, GLK1 or bZIP1 are provided. Also provided herein are commercial products (e.g., pulp, paper, paper products, or lumber) derived from the transgenic plants (e.g., transgenic trees) produced using the methods provided herein.

The commonly used eye-specific sev-GAL4 and GMR-GAL4 drivers ...

Indian Academy of Sciences (India)

GAL4 and GMR-GAL4 drivers are most widely used since they are believed to be expressed exclusively in the developing eye cells. However, several reports have noted lethality following expression of certain transgenes under these GAL4 ...

Design and Management of Field Trials of Transgenic Cereals

Science.gov (United States)

Bedő, Zoltán; Rakszegi, Mariann; Láng, László

The development of gene transformation systems has allowed the introgression of alien genes into plant genomes, thus providing a mechanism for broadening the genetic resources available to plant breeders. The design and the management of field trials vary according to the purpose for which transgenic cereals are developed. Breeders study the phenotypic and genotypic stability of transgenic plants, monitor the increase in homozygosity of transgenic genotypes under field conditions, and develop backcross generations to transfer the introduced genes into secondary transgenic cereal genotypes. For practical purposes, they may also multiply seed of the transgenic lines to produce sufficient amounts of grain for the detailed analysis of trait(s) of interest, to determine the field performance of transgenic lines, and to compare them with the non-transformed parental genotypes. Prior to variety registration, the Distinctness, Uniformity and Stability (DUS) tests and Value for Cultivation and Use (VCU) experiments are carried out in field trials. Field testing includes specific requirements for transgenic cereals to assess potential environmental risks. The capacity of the pollen to survive, establish and disseminate in the field test environment, the potential for gene transfer, the effects of products expressed by the introduced sequences and phenotypic and genotypic instability that might cause deleterious effects must all be specifically monitored, as required by EU Directives 2003/701/EC (1) on the release of genetically modified higher plants in the environment.

Complex genomic rearrangement in CCS-LacZ transgenic mice.

Science.gov (United States)

Stroud, Dina Myers; Darrow, Bruce J; Kim, Sang Do; Zhang, Jie; Jongbloed, Monique R M; Rentschler, Stacey; Moskowitz, Ivan P G; Seidman, Jonathan; Fishman, Glenn I

2007-02-01

The cardiac conduction system (CCS)-lacZ insertional mouse mutant strain genetically labels the developing and mature CCS. This pattern of expression is presumed to reflect the site of transgene integration rather than regulatory elements within the transgene proper. We sought to characterize the genomic structure of the integration locus and identify nearby gene(s) that might potentially confer the observed CCS-specific transcription. We found rearrangement of chromosome 7 between regions D1 and E1 with altered transcription of multiple genes in the D1 region. Several lines of evidence suggested that regulatory elements from at least one gene, Slco3A1, influenced CCS-restricted reporter gene expression. In embryonic hearts, Slco3A1 was expressed in a spatial pattern similar to the CCS-lacZ transgene and was similarly neuregulin-responsive. At later stages, however, expression patterns of the transgene and Slco3A1 diverged, suggesting that the Slco3A1 locus may be necessary, but not sufficient to confer CCS-specific transgene expression in the CCS-lacZ line. (c) 2007 Wiley-Liss, Inc.

Histopathological effects of lethal and sub-lethal concentrations of ...

African Journals Online (AJOL)

The histopathological effects of lethal and sub-lethal concentrations of glyphosate on African catfish Clarias gariepinus were investigated. C. gariepinus juveniles were assessed in a static renewal bioassay for 96 hours (acute toxicity) and 28 days (chronic toxicity) using varying concentrations (0.0 mg/l 20.0 mg/l, 30.0 mg/l, ...

Improvement of heavy metal stress and toxicity assays by coupling a transgenic reporter in a mutant nematode strain

Energy Technology Data Exchange (ETDEWEB)

Chu, K.-W. [Department of Biology, Hong Kong University of Science and Technology, Clear Water Bay, Kowloon, Hong Kong (China); Chan, Shirley K.W. [Atmospheric, Marine and Coastal Environment Program, Hong Kong University of Science and Technology, Clear Water Bay, Kowloon, Hong Kong (China); Chow, King L. [Department of Biology, Hong Kong University of Science and Technology, Clear Water Bay, Kowloon, Hong Kong (China) and Atmospheric, Marine and Coastal Environment Program, Hong Kong University of Science and Technology, Clear Water Bay, Kowloon, Hong Kong (China)]. E-mail: bokchow@ust.hk

2005-09-30

Previous studies have demonstrated that wild type Caenorhabditis elegans displays high sensitivity to heavy metals in a lethality test at a level comparable to that of other bioindicator organisms. Taking advantage of the genetics of this model organism, we have tested a number of mutant strains for enhanced sensitivity in heavy metal induced lethality and stress response. These mutants are defective in genes controlling dauer formation, longevity or response to reactive oxygen species (ROS). Among the tested mutants, a double mutant daf-16 unc-75 strain was identified to have superior sensitivity. It has a 6-, 3- and 2-fold increase in sensitivity to cadmium, copper and zinc, respectively, as compared with that of wild type animals. When a fluorescent reporter transgene was coupled with this double mutant for stress detection, a 10-fold enhancement of sensitivity to cadmium over the wild type strain was observed. These transgenic animals, superior to most of the model organisms currently used in bioassays for environmental pollutants, offer a fast and economic approach to reveal the bioavailability of toxic substance in field samples. This study also demonstrates that combination of genetic mutations and transgenesis is a viable approach to identify sensitive indicator animals for environmental monitoring.

Improvement of heavy metal stress and toxicity assays by coupling a transgenic reporter in a mutant nematode strain

International Nuclear Information System (INIS)

Chu, K.-W.; Chan, Shirley K.W.; Chow, King L.

2005-01-01

Previous studies have demonstrated that wild type Caenorhabditis elegans displays high sensitivity to heavy metals in a lethality test at a level comparable to that of other bioindicator organisms. Taking advantage of the genetics of this model organism, we have tested a number of mutant strains for enhanced sensitivity in heavy metal induced lethality and stress response. These mutants are defective in genes controlling dauer formation, longevity or response to reactive oxygen species (ROS). Among the tested mutants, a double mutant daf-16 unc-75 strain was identified to have superior sensitivity. It has a 6-, 3- and 2-fold increase in sensitivity to cadmium, copper and zinc, respectively, as compared with that of wild type animals. When a fluorescent reporter transgene was coupled with this double mutant for stress detection, a 10-fold enhancement of sensitivity to cadmium over the wild type strain was observed. These transgenic animals, superior to most of the model organisms currently used in bioassays for environmental pollutants, offer a fast and economic approach to reveal the bioavailability of toxic substance in field samples. This study also demonstrates that combination of genetic mutations and transgenesis is a viable approach to identify sensitive indicator animals for environmental monitoring

Development of transgenic watermelon resistant to Cucumber mosaic virus and Watermelon mosaic virus by using a single chimeric transgene construct.

Science.gov (United States)

Lin, Ching-Yi; Ku, Hsin-Mei; Chiang, Yi-Hua; Ho, Hsiu-Yin; Yu, Tsong-Ann; Jan, Fuh-Jyh

2012-10-01

Watermelon, an important fruit crop worldwide, is prone to attack by several viruses that often results in destructive yield loss. To develop a transgenic watermelon resistant to multiple virus infection, a single chimeric transgene comprising a silencer DNA from the partial N gene of Watermelon silver mottle virus (WSMoV) fused to the partial coat protein (CP) gene sequences of Cucumber mosaic virus (CMV), Cucumber green mottle mosaic virus (CGMMV) and Watermelon mosaic virus (WMV) was constructed and transformed into watermelon (cv. Feeling) via Agrobacterium-mediated transformation. Single or multiple transgene copies randomly inserted into various locations in the genome were confirmed by Southern blot analysis. Transgenic watermelon R(0) plants were individually challenged with CMV, CGMMV or WMV, or with a mixture of these three viruses for resistance evaluation. Two lines were identified to exhibit resistance to CMV, CGMMV, WMV individually, and a mixed inoculation of the three viruses. The R(1) progeny of the two resistant R(0) lines showed resistance to CMV and WMV, but not to CGMMV. Low level accumulation of transgene transcripts in resistant plants and small interfering (si) RNAs specific to CMV and WMV were readily detected in the resistant R(1) plants by northern blot analysis, indicating that the resistance was established via RNA-mediated post-transcriptional gene silencing (PTGS). Loss of the CGMMV CP-transgene fragment in R1 progeny might be the reason for the failure to resistant CGMMV infection, as shown by the absence of a hybridization signal and no detectable siRNA specific to CGMMV in Southern and northern blot analyses. In summary, this study demonstrated that fusion of different viral CP gene fragments in transgenic watermelon contributed to multiple virus resistance via PTGS. The construct and resistant watermelon lines developed in this study could be used in a watermelon breeding program for resistance to multiple viruses.

Experimental chronic Pseudomonas aeruginosa lung infection in rats. Non-specific stimulation with LPS reduces lethality as efficiently as specific immunization

DEFF Research Database (Denmark)

Lange, K H; Hougen, H P; Høiby, N

1995-01-01

In a rat model of chronic Pseudomonas aeruginosa lung infection mimicking cystic fibrosis, we investigated the possibility of preventing chronic lung inflammation or decreasing the progression of the infection. We compared the lethality, pathology, bacterial clearance, and immunogenicity after...... with either E. coli LPS or P. aeruginosa sonicate. Four and two weeks prior to challenge other rats were vaccinated with either E. coli LPS or P. aeruginosa sonicate. Controls did not receive any stimulation or vaccination. The lethality after challenge was lower in rats stimulated with E. coli LPS (p = 0...... but not to prevent the chronic P. aeruginosa lung infection and inflammation caused by alginate-embedded bacteria....

Cathepsin B as a potential cystatin M/E target in the mouse hair follicle

NARCIS (Netherlands)

Oortveld, M.A.W.; Vlijmen-Willems, I.M.J.J. van; Kersten, F.F.J.; Cheng, T.; Verdoes, M.; Erp, P.E.J. van; Verbeek, S.; Reinheckel, T.; Hendriks, W.J.A.J.; Schalkwijk, J.; Zeeuwen, P.L.J.M.

2017-01-01

Deficiency of the cysteine protease inhibitor cystatin M/E (Cst6) in mice leads to disturbed epidermal cornification, impaired barrier function, and neonatal lethality. We report the rescue of the lethal skin phenotype of ichq (Cst6-deficient; Cst6-/-) mice by transgenic, epidermis-specific,

The growth performance of F1 transgenic mutiara catfish

Science.gov (United States)

Iskandar; Buwono, I. D.; Agung, M. U. K.

2018-04-01

The growth of catfish (African or Sangkuriang strain) these days is tend to decreased. One of the solutions due to this problem is to improve the genetics of growth using transgenesis technology, toward more profitable. The specific objective of the research is to detect the transmission of exogenous GH (African catfish GH inserts) inside the F1 transgenic Mutiara catfish using PCR (Polymerase Chain Reaction) method and to evaluate the growth performance of transgenic Mutiara catfish made using the parameters of feed conversion (FCR = Feed Conversion Ratio). Transgenic catfish (strain mutiara) F0 and F1 carried African catfish GH (600 bp) can be produced. Superiority characters of transgenic catfish represented heritability (h2 ) and heterosis (H), indicating that the offspring of hybrid F1 transgenic mutiara catfish had phenotypes rapid growth (h2 = 17.55 % and H = 42.83 %) compared to non-transgenic catfish (h 2 = 10.07 % and H = 18.56 %). Evaluation of the efficiency of feed use parameters feed conversion ratio, shows that F1 transgenic mutiara catfish (FCR = 0.85) more efficient in converting feed into meat.

Analysis of transgenic wheat (Triticum aestivum L.) harboring a maize (Zea mays L.) gene for plastid EF-Tu: segregation pattern, expression and effects of the transgene.

Science.gov (United States)

Fu, Jianming; Ristic, Zoran

2010-06-01

We previously reported that transgenic wheat (Triticum aestivum L.) carrying a maize (Zea mays L.) gene (Zmeftu1) for chloroplast protein synthesis elongation factor, EF-Tu, displays reduced thermal aggregation of leaf proteins, reduced injury to photosynthetic membranes (thylakoids), and enhanced rate of CO(2) fixation following exposure to heat stress (18 h at 45 degrees C) [Fu et al. in Plant Mol Biol 68:277-288, 2008]. In the current study, we investigated the segregation pattern and expression of the transgene Zmeftu1 and determined the grain yield of transgenic plants after exposure to a brief heat stress (18 h at 45 degrees C). We also assessed thermal aggregation of soluble leaf proteins in transgenic plants, testing the hypothesis that increased levels of EF-Tu will lead to a non-specific protection of leaf proteins against thermal aggregation. The transgenic wheat displayed a single-gene pattern of segregation of Zmeftu1. Zmeftu1 was expressed, and the transgenic plants synthesized and accumulated three anti-EF-Tu cross-reacting polypeptides of similar molecular mass but different pI, suggesting the possibility of posttranslational modification of this protein. The transgenic plants also showed better grain yield after exposure to heat stress compared with their non-transgenic counterparts. Soluble leaf proteins of various molecular masses displayed lower thermal aggregation in transgenic than in non-transgenic wheat. The results suggest that overexpression of chloroplast EF-Tu can be beneficial to wheat tolerance to heat stress. Moreover, the results also support the hypothesis that EF-Tu contributes to heat tolerance by acting as a molecular chaperone and protecting heat-labile proteins from thermal aggregation in a non-specific manner.

New genetic tools for improving SIT in Ceratitis capitata: embryonic lethality and sperm marking

International Nuclear Information System (INIS)

Schetelig, Marc F.; Wimmer, Ernst A.; Scolari, Francesca; Gasperi, Giuliano; Handler, Ernst A.

2006-01-01

Environment friendly sterile insect technique (SIT) is being applied effectively as a component of area-wide integrated pest management (AW-IPM) for Ceratitis capitata since 1970s. Nevertheless improved biological strategies are needed to increase the efficacy of AW-IPM. Transgenic approaches should increase and widen the applicability of such programmes to different pest species. In this respect two major strategies are followed: First an approach to cause sterility was designed without interfering with spermatogenesis to maintain males and their sperm as competitive as possible. We followed a strategy, which is based on the expression of a lethal factor under the control of a promoter that is active at early blastoderm stages. The system employs the ectopic expression of a hyperactive pro apoptotic gene that causes embryo-specific lethality when driven by the tetracycline-controlled trans activator tTA under the regulation of a cellularization gene enhancer/promoter. The system has been tested successfully in Drosophila melanogaster (Horn and Wimmer 2003). We tried the direct transfer of the Drosophila system to Ceratitis capitata by injecting the respective constructs that carry Drosophila-derived promoters. Unfortunately, the cellularization specific promoters from Drosophila seem not functional in Ceratitis. Therefore, the corresponding enhancers/promoters from Ceratitis were isolated and subsequently the tTA was brought independently under the control of each enhancer/promoter region. These constructs were injected in Ceratitis for further evaluation. Second, we have engineered a medfly strain carrying a sperm marking system. This strain carries two fluorescent markers. One (turboGFP) marker is under the control of the spermatogenesis specific b2-tubulin promoter from Ceratitis and is therefore sperm specifically expressed. The second (DsRed) is under the control of the poly ubiquitin promoter of Drosophila. Released males from this strain could be

New genetic tools for improving SIT in Ceratitis capitata: embryonic lethality and sperm marking

Energy Technology Data Exchange (ETDEWEB)

Schetelig, Marc F; Wimmer, Ernst A [Georg-August-University, Gottingen (Germany). Johann-Friedrich Blumenbach Institute of Zoology and Anthropology. Gottingen Center for Molecular Biosciences; Scolari, Francesca; Gasperi, Giuliano [Universita di Pavia (Italy). Dipt. di Biologia Animale; Handler, Ernst A [U.S. Department of Agriculture (USDA/ARS), Gainesville, FL (United States). Agricultural Research Service. Center for Medical, Agricultural and Veterinary Entomology

2006-07-01

Environment friendly sterile insect technique (SIT) is being applied effectively as a component of area-wide integrated pest management (AW-IPM) for Ceratitis capitata since 1970s. Nevertheless improved biological strategies are needed to increase the efficacy of AW-IPM. Transgenic approaches should increase and widen the applicability of such programmes to different pest species. In this respect two major strategies are followed: First an approach to cause sterility was designed without interfering with spermatogenesis to maintain males and their sperm as competitive as possible. We followed a strategy, which is based on the expression of a lethal factor under the control of a promoter that is active at early blastoderm stages. The system employs the ectopic expression of a hyperactive pro apoptotic gene that causes embryo-specific lethality when driven by the tetracycline-controlled trans activator tTA under the regulation of a cellularization gene enhancer/promoter. The system has been tested successfully in Drosophila melanogaster (Horn and Wimmer 2003). We tried the direct transfer of the Drosophila system to Ceratitis capitata by injecting the respective constructs that carry Drosophila-derived promoters. Unfortunately, the cellularization specific promoters from Drosophila seem not functional in Ceratitis. Therefore, the corresponding enhancers/promoters from Ceratitis were isolated and subsequently the tTA was brought independently under the control of each enhancer/promoter region. These constructs were injected in Ceratitis for further evaluation. Second, we have engineered a medfly strain carrying a sperm marking system. This strain carries two fluorescent markers. One (turboGFP) marker is under the control of the spermatogenesis specific b2-tubulin promoter from Ceratitis and is therefore sperm specifically expressed. The second (DsRed) is under the control of the poly ubiquitin promoter of Drosophila. Released males from this strain could be

Advancing environmental risk assessment for transgenic biofeedstock crops

Directory of Open Access Journals (Sweden)

Wolt Jeffrey D

2009-11-01

Full Text Available Abstract Transgenic modification of plants is a key enabling technology for developing sustainable biofeedstocks for biofuels production. Regulatory decisions and the wider acceptance and development of transgenic biofeedstock crops are considered from the context of science-based risk assessment. The risk assessment paradigm for transgenic biofeedstock crops is fundamentally no different from that of current generation transgenic crops, except that the focus of the assessment must consider the unique attributes of a given biofeedstock crop and its environmental release. For currently envisioned biofeedstock crops, particular emphasis in risk assessment will be given to characterization of altered metabolic profiles and their implications relative to non-target environmental effects and food safety; weediness and invasiveness when plants are modified for abiotic stress tolerance or are domesticated; and aggregate risk when plants are platforms for multi-product production. Robust risk assessments for transgenic biofeedstock crops are case-specific, initiated through problem formulation, and use tiered approaches for risk characterization.

Transgenic animals and their application in medicine

OpenAIRE

Bagle TR, Kunkulol RR, Baig MS, More SY

2013-01-01

Transgenic animals are animals that are genetically altered to have traits that mimic symptoms of specific human pathologies. They provide genetic models of various human diseases which are important in understanding disease and developing new targets. In early 1980 Gordon and co-workers described the first gene addition experiment using the microinjection technology and since then the impact of transgenic technology on basic research has been significant. Within 20 years of its inception, AT...

Disruption of the Sec24d gene results in early embryonic lethality in the mouse.

Directory of Open Access Journals (Sweden)

Andrea C Baines

Full Text Available Transport of newly synthesized proteins from the endoplasmic reticulum (ER to the Golgi is mediated by the coat protein complex COPII. The inner coat of COPII is assembled from heterodimers of SEC23 and SEC24. Though mice with mutations in one of the four Sec24 paralogs, Sec24b, exhibit a neural tube closure defect, deficiency in humans or mice has not yet been described for any of the other Sec24 paralogs. We now report characterization of mice with targeted disruption of Sec24d. Early embryonic lethality is observed in mice completely deficient in SEC24D, while a hypomorphic Sec24d allele permits survival to mid-embryogenesis. Mice haploinsufficient for Sec24d exhibit no phenotypic abnormality. A BAC transgene containing Sec24d rescues the embryonic lethality observed in Sec24d-null mice. These results demonstrate an absolute requirement for SEC24D expression in early mammalian development that is not compensated by the other three Sec24 paralogs. The early embryonic lethality resulting from loss of SEC24D in mice contrasts with the previously reported mild skeletal phenotype of SEC24D deficiency in zebrafish and restricted neural tube phenotype of SEC24B deficiency in mice. Taken together, these observations suggest that the multiple Sec24 paralogs have developed distinct functions over the course of vertebrate evolution.

Tissue- and agonist-specific regulation of human and murine plasminogen activator inhibitor-1 promoters in transgenic mice.

Science.gov (United States)

Eren, M; Painter, C A; Gleaves, L A; Schoenhard, J A; Atkinson, J B; Brown, N J; Vaughan, D E

2003-11-01

Numerous studies have described regulatory factors and sequences that control transcriptional responses in vitro. However, there is a paucity of information on the qualitative and quantitative regulation of heterologous promoters using transgenic strategies. In order to investigate the physiological regulation of human plasminogen activator inhibitor type-1 (hPAI-1) expression in vivo compared to murine PAI-1 (mPAI-1) and to test the physiological relevance of regulatory mechanisms described in vitro, we generated transgenic mice expressing enhanced green fluorescent protein (EGFP) driven by the proximal -2.9 kb of the hPAI-1 promoter. Transgenic animals were treated with Ang II, TGF-beta1 and lipopolysaccharide (LPS) to compare the relative activation of the human and murine PAI-1 promoters. Ang II increased EGFP expression most effectively in brain, kidney and spleen, while mPAI-1 expression was quantitatively enhanced most prominently in heart and spleen. TGF-beta1 failed to induce activation of the hPAI-1 promoter but potently stimulated mPAI-1 in kidney and spleen. LPS administration triggered robust expression of mPAI-1 in liver, kidney, pancreas, spleen and lung, while EGFP was induced only modestly in heart and kidney. These results indicate that the transcriptional response of the endogenous mPAI-1 promoter varies widely in terms of location and magnitude of response to specific stimuli. Moreover, the physiological regulation of PAI-1 expression likely involves a complex interaction of transcription factors and DNA sequences that are not adequately replicated by in vitro functional studies focused on the proximal -2.9 kb promoter.

Cis-acting sequences from a human surfactant protein gene confer pulmonary-specific gene expression in transgenic mice

Energy Technology Data Exchange (ETDEWEB)

Korfhagen, T.R.; Glasser, S.W.; Wert, S.E.; Bruno, M.D.; Daugherty, C.C.; McNeish, J.D.; Stock, J.L.; Potter, S.S.; Whitsett, J.A. (Cincinnati College of Medicine, OH (USA))

1990-08-01

Pulmonary surfactant is produced in late gestation by developing type II epithelial cells lining the alveolar epithelium of the lung. Lack of surfactant at birth is associated with respiratory distress syndrome in premature infants. Surfactant protein C (SP-C) is a highly hydrophobic peptide isolated from pulmonary tissue that enhances the biophysical activity of surfactant phospholipids. Like surfactant phospholipid, SP-C is produced by epithelial cells in the distal respiratory epithelium, and its expression increases during the latter part of gestation. A chimeric gene containing 3.6 kilobases of the promoter and 5{prime}-flanking sequences of the human SP-C gene was used to express diphtheria toxin A. The SP-C-diphtheria toxin A fusion gene was injected into fertilized mouse eggs to produce transgenic mice. Affected mice developed respiratory failure in the immediate postnatal period. Morphologic analysis of lungs from affected pups showed variable but severe cellular injury confined to pulmonary tissues. Ultrastructural changes consistent with cell death and injury were prominent in the distal respiratory epithelium. Proximal components of the tracheobronchial tree were not severely affected. Transgenic animals were of normal size at birth, and structural abnormalities were not detected in nonpulmonary tissues. Lung-specific diphtheria toxin A expression controlled by the human SP-C gene injured type II epithelial cells and caused extensive necrosis of the distal respiratory epithelium. The absence of type I epithelial cells in the most severely affected transgenic animals supports the concept that developing type II cells serve as precursors to type I epithelial cells.

Theories of Lethal Mutagenesis: From Error Catastrophe to Lethal Defection.

Science.gov (United States)

Tejero, Héctor; Montero, Francisco; Nuño, Juan Carlos

2016-01-01

RNA viruses get extinct in a process called lethal mutagenesis when subjected to an increase in their mutation rate, for instance, by the action of mutagenic drugs. Several approaches have been proposed to understand this phenomenon. The extinction of RNA viruses by increased mutational pressure was inspired by the concept of the error threshold. The now classic quasispecies model predicts the existence of a limit to the mutation rate beyond which the genetic information of the wild type could not be efficiently transmitted to the next generation. This limit was called the error threshold, and for mutation rates larger than this threshold, the quasispecies was said to enter into error catastrophe. This transition has been assumed to foster the extinction of the whole population. Alternative explanations of lethal mutagenesis have been proposed recently. In the first place, a distinction is made between the error threshold and the extinction threshold, the mutation rate beyond which a population gets extinct. Extinction is explained from the effect the mutation rate has, throughout the mutational load, on the reproductive ability of the whole population. Secondly, lethal defection takes also into account the effect of interactions within mutant spectra, which have been shown to be determinant for the understanding the extinction of RNA virus due to an augmented mutational pressure. Nonetheless, some relevant issues concerning lethal mutagenesis are not completely understood yet, as so survival of the flattest, i.e. the development of resistance to lethal mutagenesis by evolving towards mutationally more robust regions of sequence space, or sublethal mutagenesis, i.e., the increase of the mutation rate below the extinction threshold which may boost the adaptability of RNA virus, increasing their ability to develop resistance to drugs (including mutagens). A better design of antiviral therapies will still require an improvement of our knowledge about lethal

Keeping the genie in the bottle: transgene biocontainment by excision in pollen.

Science.gov (United States)

Moon, Hong S; Li, Yi; Stewart, C Neal

2010-01-01

Gene flow from transgenic plants is an environmental and regulatory concern. While biocontainment might be achieved using male sterility or transgenic mitigation tools, we believe that perhaps the optimal solution might be simply to remove transgenes from pollen. Male sterility might not be ideal for many pollinators, and might not be implementable using standardized genes. Transgenic mitigation might not be useful to control conspecific gene flow (e.g. crop to crop), and relies on competition and not biocontainment per se. Site-specific recombination systems could allow highly efficient excision of transgenes in pollen to eliminate, or at least minimize, unwanted transgene movement via pollen dispersal. There are other potential biotechnologies, such as zinc finger nucleases, that could be also used for transgene excision.

Evaluating Human T-Cell Therapy of Cytomegalovirus Organ Disease in HLA-Transgenic Mice.

Directory of Open Access Journals (Sweden)

Simone Thomas

2015-07-01

Full Text Available Reactivation of human cytomegalovirus (HCMV can cause severe disease in recipients of hematopoietic stem cell transplantation. Although preclinical research in murine models as well as clinical trials have provided 'proof of concept' for infection control by pre-emptive CD8 T-cell immunotherapy, there exists no predictive model to experimentally evaluate parameters that determine antiviral efficacy of human T cells in terms of virus control in functional organs, prevention of organ disease, and host survival benefit. We here introduce a novel mouse model for testing HCMV epitope-specific human T cells. The HCMV UL83/pp65-derived NLV-peptide was presented by transgenic HLA-A2.1 in the context of a lethal infection of NOD/SCID/IL-2rg-/- mice with a chimeric murine CMV, mCMV-NLV. Scenarios of HCMV-seropositive and -seronegative human T-cell donors were modeled by testing peptide-restimulated and T-cell receptor-transduced human T cells, respectively. Upon transfer, the T cells infiltrated host tissues in an epitope-specific manner, confining the infection to nodular inflammatory foci. This resulted in a significant reduction of viral load, diminished organ pathology, and prolonged survival. The model has thus proven its potential for a preclinical testing of the protective antiviral efficacy of HCMV epitope-specific human T cells in the evaluation of new approaches to an immunotherapy of CMV disease.

Hepatic steatosis in transgenic mice overexpressing human histone deacetylase 1

International Nuclear Information System (INIS)

Wang, Ai-Guo; Seo, Sang-Beom; Moon, Hyung-Bae; Shin, Hye-Jun; Kim, Dong Hoon; Kim, Jin-Man; Lee, Tae-Hoon; Kwon, Ho Jeong; Yu, Dae-Yeul; Lee, Dong-Seok

2005-01-01

It is generally thought that histone deacetylases (HDACs) play important roles in the transcriptional regulation of genes. However, little information is available concerning the specific functions of individual HDACs in disease states. In this study, two transgenic mice lines were established which harbored the human HDAC1 gene. Overexpressed HDAC1 was detected in the nuclei of transgenic liver cells, and HDAC1 enzymatic activity was significantly higher in the transgenic mice than in control littermates. The HDAC1 transgenic mice exhibited a high incidence of hepatic steatosis and nuclear pleomorphism. Molecular studies showed that HDAC1 may contribute to nuclear pleomorphism through the p53/p21 signaling pathway

Resistance to organophosphorus agent toxicity in transgenic mice expressing the G117H mutant of human butyrylcholinesterase

International Nuclear Information System (INIS)

Wang Yuxia; Ticu Boeck, Andreea; Duysen, Ellen G.; Van Keuren, Margaret; Saunders, Thomas L.; Lockridge, Oksana

2004-01-01

Organophosphorus toxicants (OP) include chemical nerve agents and pesticides. The goal of this work was to find out whether an animal could be made resistant to OP toxicity by genetic engineering. The human butyrylcholinesterase (BChE) mutant G117H was chosen for study because it has the unusual ability to hydrolyze OP as well as acetylcholine, and it is resistant to inhibition by OP. Human G117H BChE, under the control of the ROSA26 promoter, was expressed in all tissues of transgenic mice. A stable transgenic mouse line expressed 0.5 μg/ml of human G117H BChE in plasma as well as 2 μg/ml of wild-type mouse BChE. Intestine, kidneys, stomach, lungs, heart, spleen, liver, brain, and muscle expressed 0.6-0.15 μg/g of G117H BChE. Transgenic mice were normal in behavior and fertility. The LD50 dose of echothiophate for wild-type mice was 0.1 mg/kg sc. This dose caused severe cholinergic signs of toxicity and lethality in wild-type mice, but caused no deaths and only mild toxicity in transgenic animals. The mechanism of protection was investigated by measuring acetylcholinesterase (AChE) and BChE activity. It was found that AChE and endogenous BChE were inhibited to the same extent in echothiophate-treated wild type and transgenic mice. This led to the hypothesis that protection against echothiophate toxicity was not explained by hydrolysis of echothiophate. In conclusion, the transgenic G117H BChE mouse demonstrates the factors required to achieve protection from OP toxicity in a vertebrate animal

Identification of choriogenin cis-regulatory elements and production of estrogen-inducible, liver-specific transgenic Medaka.

Science.gov (United States)

Ueno, Tetsuro; Yasumasu, Shigeki; Hayashi, Shinji; Iuchi, Ichiro

2004-07-01

Choriogenins (chg-H, chg-L) are precursor proteins of egg envelope of medaka and synthesized in the spawning female liver in response to estrogen. We linked a gene construct chg-L1.5 kb/GFP (a 1.5 kb 5'-upstream region of the chg-L gene fused with a green fluorescence protein (GFP) gene) to another construct emgb/RFP (a cis-regulatory region of embryonic globin gene fused with an RFP gene), injected the double fusion gene construct into 1- or 2-cell-stage embryos, and selected embryos expressing the RFP in erythroid cells. From the embryos, we established two lines of chg-L1.5 kb/GFP-emgb/RFP-transgenic medaka. The 3-month-old spawning females and estradiol-17beta (E2)-exposed males displayed the liver-specific GFP expression. The E2-dependent GFP expression was detected in the differentiating liver of the stage 37-38 embryos. In addition, RT-PCR and whole-mount in situ hybridization showed that the E2-dependent chg expression was found in the liver of the stage 34 embryos of wild medaka, suggesting that such E2-dependency is achieved shortly after differentiation of the liver. Analysis using serial deletion mutants fused with GFP showed that the region -426 to -284 of the chg-L gene or the region -364 to -265 of the chg-H gene had the ability to promote the E2-dependent liver-specific GFP expression of its downstream gene. Further analyses suggested that an estrogen response element (ERE) at -309, an ERE half-site at -330 and a binding site for C/EBP at -363 of the chg-L gene played important roles in its downstream chg-L gene expression. In addition, this transgenic medaka may be useful as one of the test animals for detecting environmental estrogenic steroids.

Creating Transgenic shRNA Mice by Recombinase-Mediated Cassette Exchange

Science.gov (United States)

Premsrirut, Prem K.; Dow, Lukas E.; Park, Youngkyu; Hannon, Gregory J.; Lowe, Scott W.

2014-01-01

RNA interference (RNAi) enables sequence-specific, experimentally induced silencing of virtually any gene by tapping into innate regulatory mechanisms that are conserved among most eukaryotes. The principles that enable transgenic RNAi in cell lines can also be used to create transgenic animals, which express short-hairpin RNAs (shRNAs) in a regulated or tissue-specific fashion. However, RNAi in transgenic animals is somewhat more challenging than RNAi in cultured cells. The activities of promoters that are commonly used for shRNA expression in cell culture can vary enormously in different tissues, and founder lines also typically vary in transgene expression due to the effects of their single integration sites. There are many ways to produce mice carrying shRNA transgenes and the method described here uses recombinase-mediated cassette exchange (RMCE). RMCE permits insertion of the shRNA transgene into a well-characterized locus that gives reproducible and predictable expression in each founder and enhances the probability of potent expression in many cell types. This procedure is more involved and complex than simple pronuclear injection, but if even a few shRNA mice are envisioned, for example, to probe the functions of several genes, the effort of setting up the processes outlined below are well worthwhile. Note that when creating a transgenic mouse, one should take care to use the most potent shRNA possible. As a rule of thumb, the sequence chosen should provide >90% knockdown when introduced into cultured cells at single copy (e.g., on retroviral infection at a multiplicity of ≤0.3). PMID:24003198

Ectopic expression of the agouti gene in transgenic mice causes obesity, features of type II diabetes, and yellow fur

Energy Technology Data Exchange (ETDEWEB)

Klebig, M.L.; Woychik, R.P. [Oak Ridge National Laboratory, Oak Ridge, TN (United States); Wilkinson, J.E. [Univ. of Tennessee, Knoxville, TN (United States); Geisler, J.G. [Oak Ridge National Laboratory, Oak Ridge, TN (United States)]|[Univ. of Tennessee, Knoxville, TN (United States)

1995-05-23

Mice that carry the lethal yellow (A{sup y}) or viable yellow (A{sup vy}) mutation, two dominant mutations of the agouti (a) gene in mouse chromosome 2, exhibit a phenotype that includes yellow fur, marked obesity, a form of type II diabetes associated with insulin resistance, and an increased susceptibility to tumor development. Molecular analyses of these and several other dominant {open_quotes}obese yellow{close_quotes} a-locus mutations suggested that ectopic expression of the normal agouti protein gives rise to this complex pleiotropic phenotype. We have now tested this hypothesis directly by generating transgenic mice that ectopically express an agouti cDNA clone encoding the normal agouti protein in all tissues examined. Transgenic mice of both sexes have yellow fur, become obese, and develop hyperinsulinemia. In addition, male transgenic mice develop hyperglycemia by 12-20 weeks of age. These results demonstrate conclusively that the ectopic agouti expression is responsible for most, if not all, of the phenotypic traits of the dominant, obese yellow mutants. 42 refs., 5 figs.

Protective Effect of Phillyrin on Lethal LPS-Induced Neutrophil Inflammation in Zebrafish

Directory of Open Access Journals (Sweden)

Liling Yang

2017-10-01

Full Text Available Background/Aims: Forsythia suspensa Vahl. (Oleaceae fruits are widely used in traditional Chinese medicine to treat pneumonia, typhoid, dysentery, ulcers and oedema. Antibacterial and anti-inflammatory activities have been reported for phillyrin (PHN, the main ingredient in Forsythia suspensa Vahl fruits, in vitro. However, the underlying mechanisms in vivo remain poorly defined. In this study, we discovered that PHN exerted potent anti-inflammatory effects in lethal LPS-induced neutrophil inflammation by suppressing the MyD88-dependent signalling pathway in zebrafish. Methods: LPS-yolk microinjection was used to induce a lethal LPS-infected zebrafish model. The effect of PHN on the survival of zebrafish challenged with lethal LPS was evaluated using survival analysis. The effect of PHN on neutrophil inflammation grading in vivo was assessed by tracking neutrophils with a transgenic line. The effects of PHN on neutrophil production and migration were analysed by SB+ cell counts during consecutive hours after modelling. Additionally, key cytokines and members of the MyD88 signalling pathway that are involved in inflammatory response were detected using quantitative RT-PCR. To assess gene expression changes during consecutive hours after modelling, the IL-1β, IL-6, TNF-α, MyD88, TRIF, ERK1/2, JNK, IκBa and NF-κB expression levels were measured. Results: PHN could protect zebrafish against a lethal LPS challenge in a dose-dependent manner, as indicated by decreased neutrophil infltration, reduced tissue necrosis and increased survival rates. Up-regulated IL-1β, IL-6 and TNF-α expression also showed the same tendencies of depression by PHN. Critically, PHN significantly inhibited the LPS-induced activation of MyD88, IκBa, and NF-κB but did not affect the expression of ERK1/2 MAPKs or JNK MAPKs in LPS-stimulated zebrafish. Additionally, PHN regulated the MyD88/IκBα/NF-κB signalling pathway by controlling IκBα, IL-1β, IL-6, and TNF

Recombineering strategies for developing next generation BAC transgenic tools for optogenetics and beyond.

Science.gov (United States)

Ting, Jonathan T; Feng, Guoping

2014-01-01

The development and application of diverse BAC transgenic rodent lines has enabled rapid progress for precise molecular targeting of genetically-defined cell types in the mammalian central nervous system. These transgenic tools have played a central role in the optogenetic revolution in neuroscience. Indeed, an overwhelming proportion of studies in this field have made use of BAC transgenic Cre driver lines to achieve targeted expression of optogenetic probes in the brain. In addition, several BAC transgenic mouse lines have been established for direct cell-type specific expression of Channelrhodopsin-2 (ChR2). While the benefits of these new tools largely outweigh any accompanying challenges, many available BAC transgenic lines may suffer from confounds due in part to increased gene dosage of one or more "extra" genes contained within the large BAC DNA sequences. Here we discuss this under-appreciated issue and propose strategies for developing the next generation of BAC transgenic lines that are devoid of extra genes. Furthermore, we provide evidence that these strategies are simple, reproducible, and do not disrupt the intended cell-type specific transgene expression patterns for several distinct BAC clones. These strategies may be widely implemented for improved BAC transgenesis across diverse disciplines.

Suicide Lethality: A Concept Analysis.

Science.gov (United States)

DeBastiani, Summer; De Santis, Joseph P

2018-02-01

Suicide is a significant health problem internationally. Those who complete suicide may have different behaviors and risk factors than those who attempt a non-fatal suicide. The purpose of this article is to analyze the concept of suicide lethality and propose a clear definition of the concept through the identification of antecedents, attributes, and consequences. A literature search for articles published in the English language between 1970 and 2016 was conducted using MEDLINE, the Cochrane Library, Pubmed, Psychlit, Ovid, PsycINFO, and Proquest. The bibliographies of all included studies were also reviewed to identify additional relevant citations. A concept analysis was conducted on the literature findings using six stages of Walker and Avant's method. The concept analysis differentiated between suicide, lethality, suicidal behavior, and suicide lethality. Presence of a suicide plan or a written suicide note was not found to be associated with the majority of completed suicides included in the definition of suicide lethality. There are a few scales that measure the lethality of a suicide attempt, but none that attempt to measure the concept of suicide lethality as described in this analysis. Clarifying the concept of suicide lethality encourages awareness of the possibility of different suicidal behaviors associated with different suicide outcomes and will inform the development of future nursing interventions. A clearer definition of the concept of suicide lethality will guide clinical practice, research, and policy development aimed at suicide prevention.

Designer proton-channel transgenic algae for photobiological hydrogen production

Science.gov (United States)

Lee, James Weifu [Knoxville, TN

2011-04-26

A designer proton-channel transgenic alga for photobiological hydrogen production that is specifically designed for production of molecular hydrogen (H.sub.2) through photosynthetic water splitting. The designer transgenic alga includes proton-conductive channels that are expressed to produce such uncoupler proteins in an amount sufficient to increase the algal H.sub.2 productivity. In one embodiment the designer proton-channel transgene is a nucleic acid construct (300) including a PCR forward primer (302), an externally inducible promoter (304), a transit targeting sequence (306), a designer proton-channel encoding sequence (308), a transcription and translation terminator (310), and a PCR reverse primer (312). In various embodiments, the designer proton-channel transgenic algae are used with a gas-separation system (500) and a gas-products-separation and utilization system (600) for photobiological H.sub.2 production.

[TSA improve transgenic porcine cloned embryo development and transgene expression].

Science.gov (United States)

Kong, Qing-Ran; Zhu, Jiang; Huang, Bo; Huan, Yan-Jun; Wang, Feng; Shi, Yong-Qian; Liu, Zhong-Feng; Wu, Mei-Ling; Liu, Zhong-Hua

2011-07-01

Uncompleted epigenetic reprogramming is attributed to the low efficiency of producing transgenic cloned animals. Histone modification associated with epigenetics can directly influence the embryo development and transgene expression. Trichostatin A (TSA), as an inhibitor of histone deacetylase, can change the status of histone acetylation, improve somatic cell reprogramming, and enhance cloning efficiency. TSA prevents the chromatin structure from being condensed, so that transcription factor could binds to DNA sequence easily and enhance transgene expression. Our study established the optimal TSA treatment on porcine donor cells and cloned embryos, 250 nmol/L, 24 h and 40 nmol/L, 24 h, respectively. Furthermore, we found that both the cloned embryo and the donor cell treated by TSA resulted in the highest development efficiency. Meanwhile, TSA can improve transgene expression in donor cell and cloned embryo. In summary, TSA can significantly improve porcine reconstructed embryo development and transgene expression.

Identification of Secretory Odontoblasts Using DMP1-GFP Transgenic Mice

Science.gov (United States)

Balic, Anamaria; Mina, Mina

2011-01-01

Terminal differentiation of odontoblasts from dental papilla is a long process involving several intermediate steps and changes in the transcriptional profile and expression of proteins secreted by cells in the odontoblast lineage. Transgenic mouse lines in which GFP expression is under the control of tissue-and stage specific promoters have provided powerful experimental tools for identification and isolation of cells at specific stages of differentiation along a lineage. Our previous studies showed utilization of pOBCol3.6GFP and pOBCol2.3GFP animals for identification of odontoblasts at early and late stages of polarization respectively. In the present study we used the DMP1-GFP transgenic animal as an experimental model to examine its expression during the differentiation of odontoblasts from progenitor cells in vivo and in vitro. Our observations showed that DMP1-GFP transgene is first activated in secretory/functional odontoblasts engaged in secretion of predentin and then transiently expressed at high levels in newly differentiated odontoblasts. Expression of DMP1-GFP was down-regulated in highly differentiated odontoblasts. The temporal and spatial pattern of expression of DMP1-GFP transgene closely mimics the expression of endogenous DMP1. This transgenic animal will facilitate studies of gene expression and biological functions in secretory/functional odontoblasts. PMID:21172466

Formulation of the bivalent prostate cancer vaccine with surgifoam elicits antigen-specific effector T cells in PSA-transgenic mice.

Science.gov (United States)

Karan, Dev

2017-10-13

We previously developed and characterized an adenoviral-based prostate cancer vaccine for simultaneous targeting of prostate-specific antigen (PSA) and prostate stem cell antigen (PSCA). We also demonstrated that immunization of mice with the bivalent vaccine (Ad 5 -PSA+PSCA) inhibited the growth of established prostate tumors. However, there are multiple challenges hindering the success of immunological therapies in the clinic. One of the prime concerns has been to overcome the immunological tolerance and maintenance of long-term effector T cells. In this study, we further characterized the use of the bivalent vaccine (Ad 5 -PSA+PSCA) in a transgenic mouse model expressing human PSA in the mouse prostate. We demonstrated the expression of PSA analyzed at the mRNA level (by RT-PCR) and protein level (by immunohistochemistry) in the prostate lobes harvested from the PSA-transgenic (PSA-Tg) mice. We established that the administration of the bivalent vaccine in surgifoam to the PSA-Tg mice induces strong PSA-specific effector CD8 + T cells as measured by IFN-γ secretion and in vitro cytotoxic T-cell assay. Furthermore, the use of surgifoam with Ad 5 -PSA+PSCA vaccine allows multiple boosting vaccinations with a significant increase in antigen-specific CD8 + T cells. These observations suggest that the formulation of the bivalent prostate cancer vaccine (Ad 5 -PSA+PSCA) with surgifoam bypasses the neutralizing antibody response, thus allowing multiple boosting. This formulation is also helpful for inducing an antigen-specific immune response in the presence of self-antigen, and maintains long-term effector CD8 + T cells. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.

Overexpression of host plant urease in transgenic silkworms.

Science.gov (United States)

Jiang, Liang; Huang, Chunlin; Sun, Qiang; Guo, Huizhen; Peng, Zhengwen; Dang, Yinghui; Liu, Weiqiang; Xing, Dongxu; Xu, Guowen; Zhao, Ping; Xia, Qingyou

2015-06-01

Bombyx mori and mulberry constitute a model of insect-host plant interactions. Urease hydrolyzes urea to ammonia and is important for the nitrogen metabolism of silkworms because ammonia is assimilated into silk protein. Silkworms do not synthesize urease and acquire it from mulberry leaves. We synthesized the artificial DNA sequence ureas using the codon bias of B. mori to encode the signal peptide and mulberry urease protein. A transgenic vector that overexpresses ure-as under control of the silkworm midgut-specific P2 promoter was constructed. Transgenic silkworms were created via embryo microinjection. RT-PCR results showed that urease was expressed during the larval stage and qPCR revealed the expression only in the midgut of transgenic lines. Urea concentration in the midgut and hemolymph of transgenic silkworms was significantly lower than in a nontransgenic line when silkworms were fed an artificial diet. Analysis of the daily body weight and food conversion efficiency of the fourth and fifth instar larvae and economic characteristics indicated no differences between transgenic silkworms and the nontransgenic line. These results suggested that overexpression of host plant urease promoted nitrogen metabolism in silkworms.

Rapid characterization of transgenic and non-transgenic soybean oils by chemometric methods using NIR spectroscopy

Science.gov (United States)

Luna, Aderval S.; da Silva, Arnaldo P.; Pinho, Jéssica S. A.; Ferré, Joan; Boqué, Ricard

Near infrared (NIR) spectroscopy and multivariate classification were applied to discriminate soybean oil samples into non-transgenic and transgenic. Principal Component Analysis (PCA) was applied to extract relevant features from the spectral data and to remove the anomalous samples. The best results were obtained when with Support Vectors Machine-Discriminant Analysis (SVM-DA) and Partial Least Squares-Discriminant Analysis (PLS-DA) after mean centering plus multiplicative scatter correction. For SVM-DA the percentage of successful classification was 100% for the training group and 100% and 90% in validation group for non transgenic and transgenic soybean oil samples respectively. For PLS-DA the percentage of successful classification was 95% and 100% in training group for non transgenic and transgenic soybean oil samples respectively and 100% and 80% in validation group for non transgenic and transgenic respectively. The results demonstrate that NIR spectroscopy can provide a rapid, nondestructive and reliable method to distinguish non-transgenic and transgenic soybean oils.

The food additive vanillic acid controls transgene expression in mammalian cells and mice.

Science.gov (United States)

Gitzinger, Marc; Kemmer, Christian; Fluri, David A; El-Baba, Marie Daoud; Weber, Wilfried; Fussenegger, Martin

2012-03-01

Trigger-inducible transcription-control devices that reversibly fine-tune transgene expression in response to molecular cues have significantly advanced the rational reprogramming of mammalian cells. When designed for use in future gene- and cell-based therapies the trigger molecules have to be carefully chosen in order to provide maximum specificity, minimal side-effects and optimal pharmacokinetics in a mammalian organism. Capitalizing on control components that enable Caulobacter crescentus to metabolize vanillic acid originating from lignin degradation that occurs in its oligotrophic freshwater habitat, we have designed synthetic devices that specifically adjust transgene expression in mammalian cells when exposed to vanillic acid. Even in mice transgene expression was robust, precise and tunable in response to vanillic acid. As a licensed food additive that is regularly consumed by humans via flavoured convenience food and specific fresh vegetable and fruits, vanillic acid can be considered as a safe trigger molecule that could be used for diet-controlled transgene expression in future gene- and cell-based therapies.

Biosafety assessment of transgenic Bt cotton on model animals

Directory of Open Access Journals (Sweden)

Sadia Bano

2016-05-01

Full Text Available Abstract Background: To know the effects of transgenic crops on soil microorganisms, animals and other expected hazards due to the introduction of GM crops into the environment is critical both scientifically and environmentally. The work was conducted to study the effect of insecticidal Bt protein on Rats and Earthworms. Methods: For this purpose, animals like rat and soil organisms like Earthworm were selected. Rats were selected on the basis of its 95% homology on genomic, cellular and enzymatic level with human while earthworm were preferred on the basis of their direct contact with soil to evaluate the impact of Bt (Cry1AC crop field soil on earthworm, secreted by root exudates of Bt cotton. Several physical, molecular, biochemical and histological analyses were performed on both Rats/Earthworms fed on standard diet (control group as well containing Bt protein (experimental group. Results: Molecular analyses such as immune Dot blot, SDS-PAGE, ELISA and PCR, confirmed the absence of Cry1Ac protein in blood and urine samples of rats, which were fed with Bt protein in their diet. Furthermore, histological studies showed that there was no difference in cellular architecture in liver, heart, kidney and intestine of Bt and non-Bt diet fed rats. To see the effect of Bt on earthworm two different groups were studied, one with transgenic plant field soil supplemented with grinded leaves of cotton and second group with non-Bt field soil. Conclusions: No lethal effects of transgenic Bt protein on the survival of earthworm and rats were observed. Bradford assay, Dipstick assay ELISA demonstrated the absence of Cry1Ac protein in the mid-gut epithelial tissue of earthworm. The results of present study will be helpful in successful deployment and commercial release of genetically modified crop in Pakistan.

Sexy transgenes: the impact of gene transfer and gene inactivation technologies on the understanding of mammalian sex determination.

Science.gov (United States)

Vaiman, Daniel

2003-06-01

Amongst the various developmental pathways ending in a sound mammal, sex determination presents the peculiarity of a choice between two equally viable options: female or male. Therefore, destroying a 'male-determining gene' or a 'female-determining gene' should generally not be lethal. Genetic sex determination is divided into two consecutive steps: construction of the bipotential gonad, and then sex determination per se. The genes involved in the first step are in fact involved in the development of various body compartments, and their mutation is generally far from innocuous. From transgenic and inactivation studies carried out on the laboratory mouse, a complete picture of the two steps is beginning to emerge, where the gonad itself and the necessary ducts are shown to evolve in a very coordinate way, with well-defined sex-specificities. Compared with testis determination, the ovarian side of the picture is still relatively empty, but this situation can change rapidly as candidate ovarian genes for inactivation studies are beginning to be identified.

The immunodominant influenza matrix t cell epitope recognized in human induces influenza protection in HLA-A2/Kb transgenic mice

International Nuclear Information System (INIS)

Plotnicky, H.; Cyblat-Chanal, D.; Aubry, J.-P.; Derouet, F.; Klinguer-Hamour, C.; Beck, A.; Bonnefoy, J.-Y.; Corvaiea, N.

2003-01-01

The protective efficacy of the influenza matrix protein epitope 58-66 (called M1), recognized in the context of human HLA-A2 molecules, was evaluated in a HLA-A2/K b transgenic mouse model of lethal influenza infection. Repeated subcutaneous immunizations with M1 increased the percentage of survival. This effect was mediated by T cells since protection was abolished following in vivo depletion of all T lymphocytes, CD8 + , or CD4 + T cells. The survival correlated with the detection of memory CD8 + splenocytes able to proliferate in vitro upon stimulation with M1 and to bind M1-loaded HLA-A2 dimers, as well as with M1-specific T cells in the lungs, which were directly cytotoxic to influenza-infected cells following influenza challenge. These results demonstrated for the first time that HLA-A2-restricted cytotoxic T cells specific for the major immunodominant influenza matrix epitope are protective against the infection. They encourage further in vivo evaluation of T cell epitopes recognized in the context of human MHC molecules

RNAi-derived transgenic resistance to Mungbean yellow mosaic India virus in cowpea.

Science.gov (United States)

Kumar, Sanjeev; Tanti, Bhaben; Patil, Basavaprabhu L; Mukherjee, Sunil Kumar; Sahoo, Lingaraj

2017-01-01

Cowpea is an important grain legume crop of Africa, Latin America, and Southeast Asia. Leaf curl and golden mosaic diseases caused by Mungbean yellow mosaic India virus (MYMIV) have emerged as most devastating viral diseases of cowpea in Southeast Asia. In this study, we employed RNA interference (RNAi) strategy to control cowpea-infecting MYMIV. For this, we generated transgenic cowpea plants harbouring three different intron hairpin RNAi constructs, containing the AC2, AC4 and fusion of AC2 and AC4 (AC2+AC4) of seven cowpea-infecting begomoviruses. The T0 and T1 transgenic cowpea lines of all the three constructs accumulated transgene-specific siRNAs. Transgenic plants were further assayed up to T1 generations, for resistance to MYMIV using agro-infectious clones. Nearly 100% resistance against MYMIV infection was observed in transgenic lines, expressing AC2-hp and AC2+AC4-hp RNA, when compared with untransformed controls and plants transformed with empty vectors, which developed severe viral disease symptoms within 3 weeks. The AC4-hp RNA expressing lines displayed appearance of milder symptoms after 5 weeks of MYMIV-inoculation. Northern blots revealed a positive correlation between the level of transgene-specific siRNAs accumulation and virus resistance. The MYMIV-resistant transgenic lines accumulated nearly zero or very low titres of viral DNA. The transgenic cowpea plants had normal phenotype with no yield penalty in greenhouse conditions. This is the first demonstration of RNAi-derived resistance to MYMIV in cowpea.

Metal resistance sequences and transgenic plants

Science.gov (United States)

Meagher, Richard Brian; Summers, Anne O.; Rugh, Clayton L.

1999-10-12

The present invention provides nucleic acid sequences encoding a metal ion resistance protein, which are expressible in plant cells. The metal resistance protein provides for the enzymatic reduction of metal ions including but not limited to divalent Cu, divalent mercury, trivalent gold, divalent cadmium, lead ions and monovalent silver ions. Transgenic plants which express these coding sequences exhibit increased resistance to metal ions in the environment as compared with plants which have not been so genetically modified. Transgenic plants with improved resistance to organometals including alkylmercury compounds, among others, are provided by the further inclusion of plant-expressible organometal lyase coding sequences, as specifically exemplified by the plant-expressible merB coding sequence. Furthermore, these transgenic plants which have been genetically modified to express the metal resistance coding sequences of the present invention can participate in the bioremediation of metal contamination via the enzymatic reduction of metal ions. Transgenic plants resistant to organometals can further mediate remediation of organic metal compounds, for example, alkylmetal compounds including but not limited to methyl mercury, methyl lead compounds, methyl cadmium and methyl arsenic compounds, in the environment by causing the freeing of mercuric or other metal ions and the reduction of the ionic mercury or other metal ions to the less toxic elemental mercury or other metals.

Putative storage root specific promoters from cassava and yam: cloning and evaluation in transgenic carrots as a model system.

Science.gov (United States)

Arango, Jacobo; Salazar, Bertha; Welsch, Ralf; Sarmiento, Felipe; Beyer, Peter; Al-Babili, Salim

2010-06-01

A prerequisite for biotechnological improvements of storage roots is the availability of tissue-specific promoters enabling high expression of transgenes. In this work, we cloned two genomic fragments, pMe1 and pDJ3S, controlling the expression of a gene with unknown function from cassava (Manihot esculenta) and of the storage protein dioscorin 3 small subunit gene from yam (Dioscorea japonica), respectively. Using beta-glucuronidase as a reporter, the activities of pMe1 and pDJ3S were evaluated in independent transgenic carrot lines and compared to the constitutive CaMV35S and the previously described cassava p15 promoters. Activities of pMe1 and pDJ3S in storage roots were assessed using quantitative GUS assays that showed pDJ3S as the most active one. To determine organ specificities, uidA transcript levels in leaves, stems and roots were measured by real-time RT-PCR analyses showing highest storage root specificity for pDJ3S. Root cross sections revealed that pMe1 was highly active in secondary xylem. In contrast, pDJ3S was active in all root tissues except for the central xylem. The expression patterns caused by the cassava p15 promoter in carrot storage roots were consistent with its previously described activities for the original storage organ. Our data demonstrate that the pDJ3S and, to a lesser extent, the pMe1 regulatory sequences represent feasible candidates to drive high and preferential expression of genes in carrot storage roots.

Beyond the bolus: transgenic tools for investigating the neurophysiology of learning and memory.

Science.gov (United States)

Lykken, Christine; Kentros, Clifford G

2014-10-01

Understanding the neural mechanisms underlying learning and memory in the entorhinal-hippocampal circuit is a central challenge of systems neuroscience. For more than 40 years, electrophysiological recordings in awake, behaving animals have been used to relate the receptive fields of neurons in this circuit to learning and memory. However, the vast majority of such studies are purely observational, as electrical, surgical, and pharmacological circuit manipulations are both challenging and relatively coarse, being unable to distinguish between specific classes of neurons. Recent advances in molecular genetic tools can overcome many of these limitations, enabling unprecedented control over neural activity in behaving animals. Expression of pharmaco- or optogenetic transgenes in cell-type-specific "driver" lines provides unparalleled anatomical and cell-type specificity, especially when delivered by viral complementation. Pharmacogenetic transgenes are specially designed neurotransmitter receptors exclusively activated by otherwise inactive synthetic ligands and have kinetics similar to traditional pharmacology. Optogenetic transgenes use light to control the membrane potential, and thereby operate at the millisecond timescale. Thus, activation of pharmacogenetic transgenes in specific neuronal cell types while recording from other parts of the circuit allows investigation of the role of those neurons in the steady state, whereas optogenetic transgenes allow one to determine the immediate network response. © 2014 Lykken and Kentros; Published by Cold Spring Harbor Laboratory Press.

Long-term gene therapy causes transgene-specific changes in the morphology of regenerating retinal ganglion cells.

Directory of Open Access Journals (Sweden)

Jennifer Rodger

Full Text Available Recombinant adeno-associated viral (rAAV vectors can be used to introduce neurotrophic genes into injured CNS neurons, promoting survival and axonal regeneration. Gene therapy holds much promise for the treatment of neurotrauma and neurodegenerative diseases; however, neurotrophic factors are known to alter dendritic architecture, and thus we set out to determine whether such transgenes also change the morphology of transduced neurons. We compared changes in dendritic morphology of regenerating adult rat retinal ganglion cells (RGCs after long-term transduction with rAAV2 encoding: (i green fluorescent protein (GFP, or (ii bi-cistronic vectors encoding GFP and ciliary neurotrophic factor (CNTF, brain-derived neurotrophic factor (BDNF or growth-associated protein-43 (GAP43. To enhance regeneration, rats received an autologous peripheral nerve graft onto the cut optic nerve of each rAAV2 injected eye. After 5-8 months, RGCs with regenerated axons were retrogradely labeled with fluorogold (FG. Live retinal wholemounts were prepared and GFP positive (transduced or GFP negative (non-transduced RGCs injected iontophoretically with 2% lucifer yellow. Dendritic morphology was analyzed using Neurolucida software. Significant changes in dendritic architecture were found, in both transduced and non-transduced populations. Multivariate analysis revealed that transgenic BDNF increased dendritic field area whereas GAP43 increased dendritic complexity. CNTF decreased complexity but only in a subset of RGCs. Sholl analysis showed changes in dendritic branching in rAAV2-BDNF-GFP and rAAV2-CNTF-GFP groups and the proportion of FG positive RGCs with aberrant morphology tripled in these groups compared to controls. RGCs in all transgene groups displayed abnormal stratification. Thus in addition to promoting cell survival and axonal regeneration, vector-mediated expression of neurotrophic factors has measurable, gene-specific effects on the morphology of injured

A bacterial cocaine esterase protects against cocaine-induced epileptogenic activity and lethality.

Science.gov (United States)

Jutkiewicz, Emily M; Baladi, Michelle G; Cooper, Ziva D; Narasimhan, Diwahar; Sunahara, Roger K; Woods, James H

2009-09-01

Cocaine toxicity results in cardiovascular complications, seizures, and death and accounts for approximately 20% of drug-related emergency department visits every year. Presently, there are no treatments to eliminate the toxic effects of cocaine. The present study hypothesizes that a bacterial cocaine esterase with high catalytic efficiency would provide rapid and robust protection from cocaine-induced convulsions, epileptogenic activity, and lethality. Cocaine-induced paroxysmal activity and convulsions were evaluated in rats surgically implanted with radiotelemetry devices (N=6 per treatment group). Cocaine esterase was administered 1 minute after a lethal dose of cocaine or after cocaine-induced convulsions to determine the ability of the enzyme to prevent or reverse, respectively, the effects of cocaine. The cocaine esterase prevented all cocaine-induced electroencephalographic changes and lethality. This effect was specific for cocaine because the esterase did not prevent convulsions and death induced by a cocaine analog, (-)-2beta-carbomethoxy-3beta-phenyltropane. The esterase prevented lethality even after cocaine-induced convulsions occurred. In contrast, the short-acting benzodiazepine, midazolam, prevented cocaine-induced convulsions but not the lethal effects of cocaine. The data showed that cocaine esterase successfully degraded circulating cocaine to prevent lethality and that cocaine-induced convulsions alone are not responsible for the lethal effects of cocaine in this model. Therefore, further investigation into the use of cocaine esterase for treating cocaine overdose and its toxic effects is warranted.

Specific roles of tocopherols and tocotrienols in seed longevity and germination tolerance to abiotic stress in transgenic rice.

Science.gov (United States)

Chen, Defu; Li, Yanlan; Fang, Tao; Shi, Xiaoli; Chen, Xiwen

2016-03-01

Tocopherols and tocotrienols are lipophilic antioxidants that are abundant in plant seeds. Although their roles have been extensively studied, our understanding of their functions in rice seeds is still limited. In this study, on the basis of available RNAi rice plants constitutively silenced for homogentisate phytyltransferase (HPT) and tocopherol cyclase (TC), we developed transgenic plants that silenced homogentisate geranylgeranyl transferase (HGGT). All the RNAi plants showed significantly reduced germination percentages and a higher proportion of abnormal seedlings than the control plants, with HGGT transgenics showing the most severe phenotype. The accelerated aging phenotype corresponded well with the amount of H2O2 accumulated in the embryo, glucose level, and ion leakage, but not with the amount of O(2-) accumulated in the embryo and lipid hydroperoxides levels in these genotypes. Under abiotic stress conditions, HPT and TC transgenics showed lower germination percentage and seedling growth than HGGT transgenics, while HGGT transgenics showed almost the same status as the wild type. Therefore, we proposed that tocopherols in the germ may protect the embryo from reactive oxygen species under both accelerated aging and stress conditions, whereas tocotrienols in the pericarp may exclusively help in reducing the metabolic activity of the seed during accelerated aging. Copyright © 2015 Elsevier Ireland Ltd. All rights reserved.

ZyFISH: a simple, rapid and reliable zygosity assay for transgenic mice.

Directory of Open Access Journals (Sweden)

Donal McHugh

Full Text Available Microinjection of DNA constructs into fertilized mouse oocytes typically results in random transgene integration at a single genomic locus. The resulting transgenic founders can be used to establish hemizygous transgenic mouse lines. However, practical and experimental reasons often require that such lines be bred to homozygosity. Transgene zygosity can be determined by progeny testing assays which are expensive and time-consuming, by quantitative Southern blotting which is labor-intensive, or by quantitative PCR (qPCR which requires transgene-specific design. Here, we describe a zygosity assessment procedure based on fluorescent in situ hybridization (zyFISH. The zyFISH protocol entails the detection of transgenic loci by FISH and the concomitant assignment of homozygosity using a concise and unbiased scoring system. The method requires small volumes of blood, is scalable to at least 40 determinations per assay, and produces results entirely consistent with the progeny testing assay. This combination of reliability, simplicity and cost-effectiveness makes zyFISH a method of choice for transgenic mouse zygosity determinations.

Transgenic algae engineered for higher performance

Science.gov (United States)

Unkefer, Pat J; Anderson, Penelope S; Knight, Thomas J

2014-10-21

The present disclosure relates to transgenic algae having increased growth characteristics, and methods of increasing growth characteristics of algae. In particular, the disclosure relates to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and to transgenic algae comprising a glutamine phenylpyruvate transaminase transgene and a glutamine synthetase.

Experimental evaluation of the relationship between lethal or non-lethal virulence and transmission success in malaria parasite infections

Directory of Open Access Journals (Sweden)

Nithiuthai S

2004-09-01

Full Text Available Abstract Background Evolutionary theory suggests that the selection pressure on parasites to maximize their transmission determines their optimal host exploitation strategies and thus their virulence. Establishing the adaptive basis to parasite life history traits has important consequences for predicting parasite responses to public health interventions. In this study we examine the extent to which malaria parasites conform to the predicted adaptive trade-off between transmission and virulence, as defined by mortality. The majority of natural infections, however, result in sub-lethal virulent effects (e.g. anaemia and are often composed of many strains. Both sub-lethal effects and pathogen population structure have been theoretically shown to have important consequences for virulence evolution. Thus, we additionally examine the relationship between anaemia and transmission in single and mixed clone infections. Results Whereas there was a trade-off between transmission success and virulence as defined by host mortality, contradictory clone-specific patterns occurred when defining virulence by anaemia. A negative relationship between anaemia and transmission success was found for one of the parasite clones, whereas there was no relationship for the other. Notably the two parasite clones also differed in a transmission phenotype (gametocyte sex ratio that has previously been shown to respond adaptively to a changing blood environment. In addition, as predicted by evolutionary theory, mixed infections resulted in increased anaemia. The increased anaemia was, however, not correlated with any discernable parasite trait (e.g. parasite density or with increased transmission. Conclusions We found some evidence supporting the hypothesis that there is an adaptive basis correlating virulence (as defined by host mortality and transmission success in malaria parasites. This confirms the validity of applying evolutionary virulence theory to biomedical

Pyramiding of transgenic Pm3 alleles in wheat results in improved powdery mildew resistance in the field.

Science.gov (United States)

Koller, Teresa; Brunner, Susanne; Herren, Gerhard; Hurni, Severine; Keller, Beat

2018-04-01

The combined effects of enhanced total transgene expression level and allele-specificity combination in transgenic allele-pyramided Pm3 wheat lines result in improved powdery mildew field resistance without negative pleiotropic effects. Allelic Pm3 resistance genes of wheat confer race-specific resistance to powdery mildew (Blumeria graminis f. sp. tritici, Bgt) and encode nucleotide-binding domain, leucine-rich repeat (NLR) receptors. Transgenic wheat lines overexpressing alleles Pm3a, b, c, d, f, and g have previously been generated by transformation of cultivar Bobwhite and tested in field trials, revealing varying degrees of powdery mildew resistance conferred by the transgenes. Here, we tested four transgenic lines each carrying two pyramided Pm3 alleles, which were generated by crossbreeding of lines transformed with single Pm3 alleles. All four allele-pyramided lines showed strongly improved powdery mildew resistance in the field compared to their parental lines. The improved resistance results from the two effects of enhanced total transgene expression levels and allele-specificity combinations. In contrast to leaf segment tests on greenhouse-grown seedlings, no allelic suppression was observed in the field. Plant development and yield scores of the pyramided lines were similar to the mean scores of the corresponding parental lines, and thus, the allele pyramiding did not cause any negative effects. On the contrary, in pyramided line, Pm3b × Pm3f normal plant development was restored compared to the delayed development and reduced seed set of parental line Pm3f. Allele-specific RT qPCR revealed additive transgene expression levels of the two Pm3 alleles in the pyramided lines. A positive correlation between total transgene expression level and powdery mildew field resistance was observed. In summary, allele pyramiding of Pm3 transgenes proved to be successful in enhancing powdery mildew field resistance.

Empirical complexities in the genetic foundations of lethal mutagenesis.

Science.gov (United States)

Bull, James J; Joyce, Paul; Gladstone, Eric; Molineux, Ian J

2013-10-01

From population genetics theory, elevating the mutation rate of a large population should progressively reduce average fitness. If the fitness decline is large enough, the population will go extinct in a process known as lethal mutagenesis. Lethal mutagenesis has been endorsed in the virology literature as a promising approach to viral treatment, and several in vitro studies have forced viral extinction with high doses of mutagenic drugs. Yet only one empirical study has tested the genetic models underlying lethal mutagenesis, and the theory failed on even a qualitative level. Here we provide a new level of analysis of lethal mutagenesis by developing and evaluating models specifically tailored to empirical systems that may be used to test the theory. We first quantify a bias in the estimation of a critical parameter and consider whether that bias underlies the previously observed lack of concordance between theory and experiment. We then consider a seemingly ideal protocol that avoids this bias-mutagenesis of virions-but find that it is hampered by other problems. Finally, results that reveal difficulties in the mere interpretation of mutations assayed from double-strand genomes are derived. Our analyses expose unanticipated complexities in testing the theory. Nevertheless, the previous failure of the theory to predict experimental outcomes appears to reside in evolutionary mechanisms neglected by the theory (e.g., beneficial mutations) rather than from a mismatch between the empirical setup and model assumptions. This interpretation raises the specter that naive attempts at lethal mutagenesis may augment adaptation rather than retard it.

Prion protein protects mice from lethal infection with influenza A viruses.

Directory of Open Access Journals (Sweden)

Junji Chida

2018-05-01

Full Text Available The cellular prion protein, designated PrPC, is a membrane glycoprotein expressed abundantly in brains and to a lesser extent in other tissues. Conformational conversion of PrPC into the amyloidogenic isoform is a key pathogenic event in prion diseases. However, the physiological functions of PrPC remain largely unknown, particularly in non-neuronal tissues. Here, we show that PrPC is expressed in lung epithelial cells, including alveolar type 1 and 2 cells and bronchiolar Clara cells. Compared with wild-type (WT mice, PrPC-null mice (Prnp0/0 were highly susceptible to influenza A viruses (IAVs, with higher mortality. Infected Prnp0/0 lungs were severely injured, with higher inflammation and higher apoptosis of epithelial cells, and contained higher reactive oxygen species (ROS than control WT lungs. Treatment with a ROS scavenger or an inhibitor of xanthine oxidase (XO, a major ROS-generating enzyme in IAV-infected lungs, rescued Prnp0/0 mice from the lethal infection with IAV. Moreover, Prnp0/0 mice transgenic for PrP with a deletion of the Cu-binding octapeptide repeat (OR region, Tg(PrPΔOR/Prnp0/0 mice, were also highly susceptible to IAV infection. These results indicate that PrPC has a protective role against lethal infection with IAVs through the Cu-binding OR region by reducing ROS in infected lungs. Cu content and the activity of anti-oxidant enzyme Cu/Zn-dependent superoxide dismutase, SOD1, were lower in Prnp0/0 and Tg(PrPΔOR/Prnp0/0 lungs than in WT lungs. It is thus conceivable that PrPC functions to maintain Cu content and regulate SOD1 through the OR region in lungs, thereby reducing ROS in IAV-infected lungs and eventually protecting them from lethal infection with IAVs. Our current results highlight the role of PrPC in protection against IAV infection, and suggest that PrPC might be a novel target molecule for anti-influenza therapeutics.

Transgene Expression and Repression in Transgenic Rats Bearing the Phosphoenolpyruvate Carboxykinase-Simian Virus 40 T Antigen or the Phosphoenolpyruvate Carboxykinase-Transforming Growth Factor-α Constructs

Science.gov (United States)

Haas, Michael J.; Dragan, Yvonne P.; Hikita, Hiroshi; Shimel, Randee; Takimoto, Koichi; Heath, Susan; Vaughan, Jennifer; Pitot, Henry C.

1999-01-01

Transgenic Sprague-Dawley rats expressing either human transforming growth factor-α (TGFα) or simian virus 40 large and small T antigen (TAg), each under the control of the phosphoenolpyruvate carboxykinase (PEPCK) promoter, were developed as an approach to the study of the promotion of hepatocarcinogenesis in the presence of a transgene regulatable by diet and/or hormones. Five lines of PEPCK-TGFα transgenic rats were established, each genetic line containing from one to several copies of the transgene per haploid genome. Two PEPCK-TAg transgenic founder rats were obtained, each with multiple copies of the transgene. Expression of the transgene was undetectable in the TGFα transgenic rats and could not be induced when the animals were placed on a high-protein, low-carbohydrate diet. The transgene was found to be highly methylated in all of these lines. No pathological alterations in the liver and intestine were observed at any time (up to 2 years) during the lives of these rats. One line of transgenic rats expressing the PEPCK-TAg transgene developed pancreatic islet cell hyperplasias and carcinomas, with few normal islets evident in the pancreas. This transgene is integrated as a hypomethylated tandem array of 10 to 12 copies on chromosome 8q11. Expression of large T antigen is highest in pancreatic neoplasms, but is also detectable in the normal brain, kidney, and liver. Mortality is most rapid in males, starting at 5 months of age and reaching 100% by 8 months. Morphologically, islet cell differentiation in the tumors ranges from poor to well differentiated, with regions of necrosis and fibrosis. Spontaneous metastasis of TAg-positive tumor cells to regional lymph nodes was observed. These studies indicate the importance of DNA methylation in the repression of specific transgenes in the rat. However, the expression of the PEPCK-TAg induces neoplastic transformation in islet cells, probably late in neuroendocrine cell differentiation. T antigen expression

Accurate measurement of transgene copy number in crop plants using droplet digital PCR.

Science.gov (United States)

Collier, Ray; Dasgupta, Kasturi; Xing, Yan-Ping; Hernandez, Bryan Tarape; Shao, Min; Rohozinski, Dominica; Kovak, Emma; Lin, Jeanie; de Oliveira, Maria Luiza P; Stover, Ed; McCue, Kent F; Harmon, Frank G; Blechl, Ann; Thomson, James G; Thilmony, Roger

2017-06-01

Genetic transformation is a powerful means for the improvement of crop plants, but requires labor- and resource-intensive methods. An efficient method for identifying single-copy transgene insertion events from a population of independent transgenic lines is desirable. Currently, transgene copy number is estimated by either Southern blot hybridization analyses or quantitative polymerase chain reaction (qPCR) experiments. Southern hybridization is a convincing and reliable method, but it also is expensive, time-consuming and often requires a large amount of genomic DNA and radioactively labeled probes. Alternatively, qPCR requires less DNA and is potentially simpler to perform, but its results can lack the accuracy and precision needed to confidently distinguish between one- and two-copy events in transgenic plants with large genomes. To address this need, we developed a droplet digital PCR-based method for transgene copy number measurement in an array of crops: rice, citrus, potato, maize, tomato and wheat. The method utilizes specific primers to amplify target transgenes, and endogenous reference genes in a single duplexed reaction containing thousands of droplets. Endpoint amplicon production in the droplets is detected and quantified using sequence-specific fluorescently labeled probes. The results demonstrate that this approach can generate confident copy number measurements in independent transgenic lines in these crop species. This method and the compendium of probes and primers will be a useful resource for the plant research community, enabling the simple and accurate determination of transgene copy number in these six important crop species. Published 2017. This article is a U.S. Government work and is in the public domain in the USA.

Calcium-Sensing Receptor Tumor Expression and Lethal Prostate Cancer Progression.

Science.gov (United States)

Ahearn, Thomas U; Tchrakian, Nairi; Wilson, Kathryn M; Lis, Rosina; Nuttall, Elizabeth; Sesso, Howard D; Loda, Massimo; Giovannucci, Edward; Mucci, Lorelei A; Finn, Stephen; Shui, Irene M

2016-06-01

Prostate cancer metastases preferentially target bone, and the calcium-sensing receptor (CaSR) may play a role in promoting this metastatic progression. We evaluated the association of prostate tumor CaSR expression with lethal prostate cancer. A validated CaSR immunohistochemistry assay was performed on tumor tissue microarrays. Vitamin D receptor (VDR) expression and phosphatase and tensin homolog tumor status were previously assessed in a subset of cases by immunohistochemistry. Cox proportional hazards models adjusting for age and body mass index at diagnosis, Gleason grade, and pathological tumor node metastasis stage were used to estimate hazard ratios (HR) and 95% confidence intervals (CI) for the association of CaSR expression with lethal prostate cancer. The investigation was conducted in the Health Professionals Follow-up Study and Physicians' Health Study. We studied 1241 incident prostate cancer cases diagnosed between 1983 and 2009. Participants were followed up or cancer-specific mortality or development of metastatic disease. On average, men were followed up 13.6 years, during which there were 83 lethal events. High CaSR expression was associated with lethal prostate cancer independent of clinical and pathological variables (HR 2.0; 95% CI 1.2-3.3). Additionally, there was evidence of effect modification by VDR expression; CaSR was associated with lethal progression among men with low tumor VDR expression (HR 3.2; 95% CI 1.4-7.3) but not in cases with high tumor VDR expression (HR 0.8; 95% CI 0.2-3.0). Tumor CaSR expression is associated with an increased risk of lethal prostate cancer, particularly in tumors with low VDR expression. These results support further investigating the mechanism linking CaSR with metastases.

Comparison of nutrition composition of transgenic maize (chitinase gene) with its non-transgenic counterpart

OpenAIRE

Ping-mei, Yan; Yu-kui, Rui; Xiao-yan, Yan; Zheng, Chai; Qing, Wang; Jian-zhong, Du; Yi, Sun

2011-01-01

In order to compare the nutrition components of transgenic maize seeds (chitinase gene), achieved by the pollen-mediated approach, with its non-transgenic counterpart, Vitamin B1, vitamin B2, fatty acids and essential amino acids of transgenic maize seeds and their counterparts were analyzed by the Chinese national standard methods or AOAC methods. The results showed that the contents of all the six kinds of fatty acids detected in transgenic maize seeds were significantly higher than those i...

HIV-1 transgenic rats develop T cell abnormalities

International Nuclear Information System (INIS)

Reid, William; Abdelwahab, Sayed; Sadowska, Mariola; Huso, David; Neal, Ashley; Ahearn, Aaron; Bryant, Joseph; Gallo, Robert C.; Lewis, George K.; Reitz, Marvin

2004-01-01

HIV-1 infection leads to impaired antigen-specific T cell proliferation, increased susceptibility of T cells to apoptosis, progressive impairment of T-helper 1 (Th1) responses, and altered maturation of HIV-1-specific memory cells. We have identified similar impairments in HIV-1 transgenic (Tg) rats. Tg rats developed an absolute reduction in CD4 + and CD8 + T cells able to produce IFN-γ following activation and an increased susceptibility of T cells to activation-induced apoptosis. CD4 + and CD8 + effector/memory (CD45RC - CD62L - ) pools were significantly smaller in Tg rats compared to non-Tg controls, although the converse was true for the naieve (CD45RC + CD62L + ) T cell pool. Our interpretation is that the HIV transgene causes defects in the development of T cell effector function and generation of specific effector/memory T cell subsets, and that activation-induced apoptosis may be an essential factor in this process

Comparison of nutritional value of transgenic peanut expressing bar and rcg3 genes with non-transgenic counterparts

International Nuclear Information System (INIS)

Robab, U.E.; )

2014-01-01

The transgenic peanut plants expressing bar and rcg3 genes were subjected to assessment of any change in nutritional value of the crop at various locations. The protein and fat contents of transgenic lines were compared with the non-transgenic parent varieties. Protein content in the transgenic lines was higher as compared to that in non-transgenic counterparts and differences among locations for fat and protein content were significant. No differences among fatty acids were recorded for genes, events and locations. Irrespective of small differences, all the values were in range described for this crop and transgenic lines appeared to be substantially equivalent to non-transgenic parent varieties. (author)

Comparison of Model Predictions and Laboratory Observations of Transgene Frequencies in Continuously-Breeding Mosquito Populations

Science.gov (United States)

Valerio, Laura; North, Ace; Collins, C. Matilda; Mumford, John D.; Facchinelli, Luca; Spaccapelo, Roberta; Benedict, Mark Q.

2016-01-01

The persistence of transgenes in the environment is a consideration in risk assessments of transgenic organisms. Combining mathematical models that predict the frequency of transgenes and experimental demonstrations can validate the model predictions, or can detect significant biological deviations that were neither apparent nor included as model parameters. In order to assess the correlation between predictions and observations, models were constructed to estimate the frequency of a transgene causing male sexual sterility in simulated populations of a malaria mosquito Anopheles gambiae that were seeded with transgenic females at various proportions. Concurrently, overlapping-generation laboratory populations similar to those being modeled were initialized with various starting transgene proportions, and the subsequent proportions of transgenic individuals in populations were determined weekly until the transgene disappeared. The specific transgene being tested contained a homing endonuclease gene expressed in testes, I-PpoI, that cleaves the ribosomal DNA and results in complete male sexual sterility with no effect on female fertility. The transgene was observed to disappear more rapidly than the model predicted in all cases. The period before ovipositions that contained no transgenic progeny ranged from as little as three weeks after cage initiation to as long as 11 weeks. PMID:27669312

Plant biotechnology: transgenic crops.

Science.gov (United States)

Shewry, Peter R; Jones, Huw D; Halford, Nigel G

2008-01-01

Transgenesis is an important adjunct to classical plant breeding, in that it allows the targeted manipulation of specific characters using genes from a range of sources. The current status of crop transformation is reviewed, including methods of gene transfer, the selection of transformed plants and control of transgene expression. The application of genetic modification technology to specific traits is then discussed, including input traits relating to crop production (herbicide tolerance and resistance to insects, pathogens and abiotic stresses) and output traits relating to the composition and quality of the harvested organs. The latter include improving the nutritional quality for consumers as well as the improvement of functional properties for food processing.

The Effects of Anthrax Lethal Toxin on Host Barrier Function

Directory of Open Access Journals (Sweden)

David M. Frucht

2011-06-01

Full Text Available The pathological actions of anthrax toxin require the activities of its edema factor (EF and lethal factor (LF enzyme components, which gain intracellular access via its receptor-binding component, protective antigen (PA. LF is a metalloproteinase with specificity for selected mitogen-activated protein kinase kinases (MKKs, but its activity is not directly lethal to many types of primary and transformed cells in vitro. Nevertheless, in vivo treatment of several animal species with the combination of LF and PA (termed lethal toxin or LT leads to morbidity and mortality, suggesting that LT-dependent toxicity is mediated by cellular interactions between host cells. Decades of research have revealed that a central hallmark of this toxicity is the disruption of key cellular barriers required to maintain homeostasis. This review will focus on the current understanding of the effects of LT on barrier function, highlighting recent progress in establishing the molecular mechanisms underlying these effects.

Immunoglobulin gene expression and regulation of rearrangement in kappa transgenic mice

International Nuclear Information System (INIS)

Ritchie, K.A.

1986-01-01

Transgenic mice were produced by microinjection of the functionally rearranged immunoglobulin kappa gene from the myeloma MOPC-21 into the male pronucleus of fertilized mouse eggs, and implantation of the microinjected embryos into foster mothers. Mice that integrated the injected gene were detected by hybridizing tail DNA dots with radioactively labelled pBR322 plasmid DNA, which detects pBR322 sequences left as a tag on the microinjected DNA. Mice that integrated the injected gene (six males) were mated and the DNA, RNA and serum kappa chains of their offspring were analyzed. A rabbit anti-mouse kappa chain antiserum was also produced for use in detection of mouse kappa chains on protein blots. Hybridomas were produced from the spleen cells of these kappa transgenic mice to immortalize representative B cells and to investigate expression of the transgenic kappa gene, its effect on allelic exclusion, and its effect on the control of light chain gene rearrangement and expression. The results show that the microinjected DNA is integrated as concatamers in unique single or, rarely, two separate sites in the genome. The concatamers are composed of several copies (16 to 64) of injected DNA arranged in a head to tail fashion. The transgene is expressed into protein normally and in a tissue specific fashion. For the first time in these transgenic mice, all tissues contain a functionally rearranged and potentially expressible immunoglobulin gene. The transgene is expressed only in B cells and not in hepatocytes, for example. This indicates that rearrangement of immunoglobulin genes is necessary but not sufficient for the tissue specific expression of these genes by B cells

Lethality of patients with rheumatoid arthritis depending on adalimumab administration: imitation modeling

Directory of Open Access Journals (Sweden)

D V Goryachev

2009-01-01

Full Text Available Lethality of pts with rheumatoid arthritis (RA exceeds mortality values in general population. Possibility of disease modifying anti-rheumatic drugs (DMARD influence on RA pts lethality has been widely discussed lately in scientific works. Objective. To determine possible lethality diminishment in Russian population of RA pts with one of biological drugs TNFα antagonist adalimumab. Material and methods. Model construction is based on the fact of lethality dependence on pt functional state assessed by HAQ. Model simulating progression of functional disability in pts with RA visiting medical institutions of Russia was made (RAISER study. 3 model variants for imitation of consecutive change of DMARDs including adalimumab were done. First consecution assessed DMARD change in the next chain: adalimumab-methotrexate-sulfasalazine-leflunomide-azathioprine-cyclosporine-palliative therapy. Second consecution: adalimumab administration after failure of first 3 DMARDs. Third consecution considered only change of synthetic DMARDs without adalimumab inclusion. Model imitated participation of 3000 pts in every consecution. Prognosis horizon was 12 years. Age of pts and initial HAQ distribution were get from results of epidemiological RAISER study. Calculation was done on the base of elevation of standardized lethality level (SLL in population of RA pts in average from 135% to 300%. SLL values from 80 to 320% were used depending on functional disability degree with converting to Russian values of age-specific lethality coefficient for 1999. Results. Lethality in treatment consecutions including adalimumab was significantly lower. To the end of 12th year in group not using adalimumab, using it at once and using it after 376 DMARDs respectively 65,1%, 71,6% and 71,1% of pts were still alive. Conclusion. Significant decrease of lethality with adalimumab inclusion in consecution of DMARD change during treatment of RA pts was demonstrated with imitation modeling

Effects of PSAG12-IPT gene expression on development and senescence in transgenic Lettuce

NARCIS (Netherlands)

McCabe, M.S.; Garratt, L.C.; Schepers, F.; Jordi, W.J.R.M.; Stoopen, G.M.; Davelaar, E.; Rhijn, van J.H.A.; Power, J.B.; Davey, M.R.

2001-01-01

An ipt gene under control of the senescence-specific SAG12 promoter from Arabidopsis (PSAG12-IPT) significantly delayed developmental and postharvest leaf senescence in mature heads of transgenic lettuce (Lactuca sativa L. cv Evola) homozygous for the transgene. Apart from retardation of leaf

Early events of lethal action by tobramycin in Pseudomonas aeruginosa

International Nuclear Information System (INIS)

Raulston, J.E.

1988-01-01

The immediate activities of the aminoglycoside antibiotic, tobramycin, were investigated in Pseudomonas aeruginosa PAO1. The influence of carbon growth substate and the antibiotic exposure environment in the magnitude of activity were examined. Lethality by 8 μg/ml tobramycin occurred rapidly (1 to 3 minutes). The release of specific cellular components into the supernatant was associated with lethality. This material was initially detected as an increase in UV-absorbance. Magnesium in the reaction mixture provided protection against lethality and leakage, but did not reverse lethal damage after a 3 minute tobramycin treatment. Also, uptake of 3 H-tobramycin was reduced in the presence of magnesium. Cells grown with glucose as a carbon source were more susceptible than organic acid grown cells as was the rapidity and amount of cell damage. Analyses of the leakage material revealed a 2-fold increase of protein in the supernatant after a 1-3 minute treatment which paralleled lethality. A prominent 29 kDa protein was observed by SDS-PAGE in the released material, which has been identified as the periplasmic enzyme, β-lactamase. The immediate activities of tobramycin did not involve (i) release of overall cell protein, (ii) massive loss of total pool amino acids, (iii) cell lysis, (iv) inhibition of proline uptake, (v) release of lipopolysaccharide, or (vi) leakage of ATP. Electron microscopy showed no apparent damage after a 3 minute exposure. 40% inhibition of protein synthesis had occurred by 3 minutes of exposure, while release of UV-absorbing material and lethality were detectable after only 1 minute. Resistant cystic fibrosis isolates of P. aeruginosa did not leak under the same experimental conditions, but one of two susceptible strains examined did show increased UV-absorbance following treatment

Characterization of transgenic tobacco plants containing bacterial bphC gene and study of their phytoremediation ability.

Science.gov (United States)

Viktorovtá, Jitka; Novakova, Martina; Trbolova, Ladislava; Vrchotova, Blanka; Lovecka, Petra; Mackova, Martina; Macek, Tomas

2014-01-01

Genetically modified plants can serve as an efficient tool for remediation of diverse dangerous pollutants of the environment such as pesticides, heavy metals, explosives and persistent organic compounds. Transgenic lines of Nicotiana tabacum containing bacterial bphC gene from the degradation pathway of polychlorinated biphenyls (PCBs) were tested. The product of the bphC gene - enzyme 2,3-dihydroxybiphenyl-1,2-dioxygenase is responsible for cleaving of the biphenyl ring. The presence of bphC gene in transgenic plants was detected on DNA, RNA and protein level. The expression of the bphC/His gene was verified afterpurification of the enzyme from plants by affinity chromatography followed by a Western blot and immunochemical assay. The enzyme activity of isolated protein was detected. Efficient transformation of 2,3-DHB by transgenic plants was achieved and the lines also exhibited high production of biomass. The transgenic plants were more tolerant to the commercial PCBs mixture Delor 103 than non-transgenic tobacco. And finally, the higher decrease of total PCB content and especially congener 28 in real contaminated soil from a dumpsite was determined after cultivation of transgenic plant in comparison with nontransgenic tobacco. The substrate specificity of transgenic plants was the same as substrate specificity of BphC enzyme.

Comparison of Model Predictions and Laboratory Observations of Transgene Frequencies in Continuously-Breeding Mosquito Populations

Directory of Open Access Journals (Sweden)

Laura Valerio

2016-09-01

Full Text Available The persistence of transgenes in the environment is a consideration in risk assessments of transgenic organisms. Combining mathematical models that predict the frequency of transgenes and experimental demonstrations can validate the model predictions, or can detect significant biological deviations that were neither apparent nor included as model parameters. In order to assess the correlation between predictions and observations, models were constructed to estimate the frequency of a transgene causing male sexual sterility in simulated populations of a malaria mosquito Anopheles gambiae that were seeded with transgenic females at various proportions. Concurrently, overlapping-generation laboratory populations similar to those being modeled were initialized with various starting transgene proportions, and the subsequent proportions of transgenic individuals in populations were determined weekly until the transgene disappeared. The specific transgene being tested contained a homing endonuclease gene expressed in testes, I-PpoI, that cleaves the ribosomal DNA and results in complete male sexual sterility with no effect on female fertility. The transgene was observed to disappear more rapidly than the model predicted in all cases. The period before ovipositions that contained no transgenic progeny ranged from as little as three weeks after cage initiation to as long as 11 weeks.

A transgenic mouse model for trilateral retinoblastoma

NARCIS (Netherlands)

O'Brien, J.M.; Marcus, D.M.; Bernards, R.A.; Carpenter, J.L.; Windle, J.J.; Mellon, P.; Albert, D.M.

1990-01-01

We present a murine model of trilateral retinoblastoma. Ocular retinoblastoma and central nervous system tumors are observed in a line of mice formed by the transgenic expression of SV40 T-antigen. An oncogenic protein known to bind to the retinoblastoma gene product (p105-Rb) is specifically

Effect of 5'-flanking sequence deletions on expression of the human insulin gene in transgenic mice

DEFF Research Database (Denmark)

Fromont-Racine, M; Bucchini, D; Madsen, O

1990-01-01

Expression of the human insulin gene was examined in transgenic mouse lines carrying the gene with various lengths of DNA sequences 5' to the transcription start site (+1). Expression of the transgene was demonstrated by 1) the presence of human C-peptide in urine, 2) the presence of specific...... of the transgene was observed in cell types other than beta-islet cells....

Goss’s wilt incidence in sweet corn is independent of transgenic traits and glyphosate

Science.gov (United States)

Recently claims have been made that the use of glyphosate and transgenic crop traits increases the risk of plant diseases. Transgenic traits used widely for years in dent corn are now available in commercial sweet corn cultivars, specifically, the combination of glyphosate resistance (GR) and Lepid...

Mushroom body miscellanea: transgenic Drosophila strains expressing anatomical and physiological sensor proteins in Kenyon cells

Science.gov (United States)

Pech, Ulrike; Dipt, Shubham; Barth, Jonas; Singh, Priyanka; Jauch, Mandy; Thum, Andreas S.; Fiala, André; Riemensperger, Thomas

2013-01-01

The fruit fly Drosophila melanogaster represents a key model organism for analyzing how neuronal circuits regulate behavior. The mushroom body in the central brain is a particularly prominent brain region that has been intensely studied in several insect species and been implicated in a variety of behaviors, e.g., associative learning, locomotor activity, and sleep. Drosophila melanogaster offers the advantage that transgenes can be easily expressed in neuronal subpopulations, e.g., in intrinsic mushroom body neurons (Kenyon cells). A number of transgenes has been described and engineered to visualize the anatomy of neurons, to monitor physiological parameters of neuronal activity, and to manipulate neuronal function artificially. To target the expression of these transgenes selectively to specific neurons several sophisticated bi- or even multipartite transcription systems have been invented. However, the number of transgenes that can be combined in the genome of an individual fly is limited in practice. To facilitate the analysis of the mushroom body we provide a compilation of transgenic fruit flies that express transgenes under direct control of the Kenyon-cell specific promoter, mb247. The transgenes expressed are fluorescence reporters to analyze neuroanatomical aspects of the mushroom body, proteins to restrict ectopic gene expression to mushroom bodies, or fluorescent sensors to monitor physiological parameters of neuronal activity of Kenyon cells. Some of the transgenic animals compiled here have been published already, whereas others are novel and characterized here for the first time. Overall, the collection of transgenic flies expressing sensor and reporter genes in Kenyon cells facilitates combinations with binary transcription systems and might, ultimately, advance the physiological analysis of mushroom body function. PMID:24065891

Combining M-FISH and Quantum Dot technology for fast chromosomal assignment of transgenic insertions

Directory of Open Access Journals (Sweden)

Yusuf Mohammed

2011-12-01

Full Text Available Abstract Background Physical mapping of transgenic insertions by Fluorescence in situ Hybridization (FISH is a reliable and cost-effective technique. Chromosomal assignment is commonly achieved either by concurrent G-banding or by a multi-color FISH approach consisting of iteratively co-hybridizing the transgenic sequence of interest with one or more chromosome-specific probes at a time, until the location of the transgenic insertion is identified. Results Here we report a technical development for fast chromosomal assignment of transgenic insertions at the single cell level in mouse and rat models. This comprises a simplified 'single denaturation mixed hybridization' procedure that combines multi-color karyotyping by Multiplex FISH (M-FISH, for simultaneous and unambiguous identification of all chromosomes at once, and the use of a Quantum Dot (QD conjugate for the transgene detection. Conclusions Although the exploitation of the unique optical properties of QD nanocrystals, such as photo-stability and brightness, to improve FISH performance generally has been previously investigated, to our knowledge this is the first report of a purpose-designed molecular cytogenetic protocol in which the combined use of QDs and standard organic fluorophores is specifically tailored to assist gene transfer technology.

Non-motor and motor features in LRRK2 transgenic mice.

Directory of Open Access Journals (Sweden)

Zoë Bichler

Full Text Available Non-motor symptoms are increasingly recognized as important features of Parkinson's disease (PD. LRRK2 mutations are common causes of familial and sporadic PD. Non-motor features have not been yet comprehensively evaluated in LRRK2 transgenic mouse models.Using a transgenic mouse model overexpressing the R1441G mutation of the human LRRK2 gene, we have investigated the longitudinal correlation between motor and non-motor symptoms and determined if specific non-motor phenotypes precede motor symptoms.We investigated the onset of motor and non-motor phenotypes on the LRRK2(R1441G BAC transgenic mice and their littermate controls from 4 to 21 month-old using a battery of behavioral tests. The transgenic mutant mice displayed mild hypokinesia in the open field from 16 months old, with gastrointestinal dysfunctions beginning at 6 months old. Non-motor features such as depression and anxiety-like behaviors, sensorial functions (pain sensitivity and olfaction, and learning and memory abilities in the passive avoidance test were similar in the transgenic animals compared to littermate controls.LRRK2(R1441G BAC transgenic mice displayed gastrointestinal dysfunction at an early stage but did not have abnormalities in fine behaviors, olfaction, pain sensitivity, mood disorders and learning and memory compared to non-transgenic littermate controls. The observations on olfaction and gastrointestinal dysfunction in this model validate findings in human carriers. These mice did recapitulate mild Parkinsonian motor features at late stages but compensatory mechanisms modulating the progression of PD in these models should be further evaluated.

Transgenic tools to characterize neuronal properties of discrete populations of zebrafish neurons.

Science.gov (United States)

Satou, Chie; Kimura, Yukiko; Hirata, Hiromi; Suster, Maximiliano L; Kawakami, Koichi; Higashijima, Shin-ichi

2013-09-01

The developing nervous system consists of a variety of cell types. Transgenic animals expressing reporter genes in specific classes of neuronal cells are powerful tools for the study of neuronal network formation. We generated a wide variety of transgenic zebrafish that expressed reporter genes in specific classes of neurons or neuronal progenitors. These include lines in which neurons of specific neurotransmitter phenotypes expressed fluorescent proteins or Gal4, and lines in which specific subsets of the dorsal progenitor domain in the spinal cord expressed fluorescent proteins. Using these, we examined domain organization in the developing dorsal spinal cord, and found that there are six progenitor domains in zebrafish, which is similar to the domain organization in mice. We also systematically characterized neurotransmitter properties of the neurons that are produced from each domain. Given that reporter gene expressions occurs in a wide area of the nervous system in the lines generated, these transgenic fish should serve as powerful tools for the investigation of not only the neurons in the dorsal spinal cord but also neuronal structures and functions in many other regions of the nervous system.

Factors influencing circadian rhythms in acetaminophen lethality.

Science.gov (United States)

Schnell, R C; Bozigian, H P; Davies, M H; Merrick, B A; Park, K S; McMillan, D A

1984-01-01

Experiments were conducted to examine the effects of changes in lighting schedules and food consumption on circadian rhythms in acetaminophen lethality and hepatic glutathione levels in male mice. Under a normal lighting schedule (light: 06.00-18.00 h), male mice exhibited a circadian rhythm in acetaminophen lethality (peak: 18.00 h; nadir: 06.00, 10.00 h) and an inverse rhythm in hepatic glutathione concentrations (peak: 06.00, 10.00 h; nadir: 18.00 h). Under a reversed lighting schedule (light: 18.00-06.00 h) the glutathione rhythm was reversed and the rhythm in acetaminophen lethality was altered showing greater sensitivity to the drug. Under continuous light, there was a shift in the acetaminophen lethality and the hepatic glutathione rhythms. Under continuous dark, both rhythms were abolished. Under a normal lighting regimen, hepatic glutathione levels were closely correlated with food consumption; i.e., both were increased during the dark phase and decreased during the light phase. Fasting the mice for 12 h abolished the rhythms in acetaminophen lethality and hepatic glutathione levels; moreover, the lethality was increased and the hepatic glutathione levels were decreased. These experiments show that both lighting schedules and feeding can alter the circadian rhythms in acetaminophen lethality and hepatic glutathione levels in male mice.

Impulsivity, aggression and brain structure in high and low lethality suicide attempters with borderline personality disorder.

Science.gov (United States)

Soloff, Paul; White, Richard; Diwadkar, Vaibhav A

2014-06-30

Impulsivity and aggressiveness are trait dispositions associated with the vulnerability to suicidal behavior across diagnoses. They are associated with structural and functional abnormalities in brain networks involved in regulation of mood, impulse and behavior. They are also core characteristics of borderline personality disorder (BPD), a disorder defined, in part, by recurrent suicidal behavior. We assessed the relationships between personality traits, brain structure and lethality of suicide attempts in 51 BPD attempters using multiple regression analyses on structural MRI data. BPD was diagnosed by the Diagnostic Interview for Borderline Patients-revised, impulsivity by the Barratt Impulsiveness Scale (BIS), aggression by the Brown-Goodwin Lifetime History of Aggression (LHA), and high lethality by a score of 4 or more on the Lethality Rating Scale (LRS). Sixteen High Lethality attempters were compared to 35 Low Lethality attempters, with no significant differences noted in gender, co-morbidity, childhood abuse, BIS or LHA scores. Degree of medical lethality (LRS) was negatively related to gray matter volumes across multiple fronto-temporal-limbic regions. Effects of impulsivity and aggression on gray matter volumes discriminated High from Low Lethality attempters and differed markedly within lethality groups. Lethality of suicide attempts in BPD may be related to the mediation of these personality traits by specific neural networks. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Glyphostate-drift but not herbivory alters the rate of transgene flow from single and stacked trait transgenic canola (Brassica napus L.) to non-transgenic B. napus and B. rapa

Science.gov (United States)

While transgenic plants can offer agricultural benefits, the escape of transgenes out of crop fields is a major environmental concern. Escape of transgenic herbicide resistance has occurred between transgenic Brassica napus (canola) and weedy species in numerous locations. In t...

Muscle-directed gene therapy for phenylketonuria (PKU): Development of transgenic mice with muscle-specific phenylalanine hydroxylase expression

Energy Technology Data Exchange (ETDEWEB)

Harding, C.O.; Messing, A.; Wolff, J.A. [Univ. of Wisconsin, Madison, WI (United States)

1994-09-01

Phenylketonuria (PKU) is an attractive target for gene therapy because of shortcomings in current therapy including lifelong commitment to a difficult and expensive diet, persistent mild cognitive deficits in some children despite adequate dietary therapy, and maternal PKU syndrome. Phenylalanine hydroxylase (PAH) is normally expressed only in liver, but we propose to treat PKU by introducing the gene for PAH into muscle. In order to evaluate both the safety and efficacy of this approach, we have a developed a trangenic mouse which expresses PAH in both cardiac and skeletal muscle. The transgene includes promoter and enhancer sequences from the mouse muscle creatine kinase (MCK) gene fused to the mouse liver PAH cDNA. Mice which have inherited the transgene are healthy, active, and do not exhibit any signs of muscle weakness or wasting. Ectopic PAH expression in muscle is not detrimental to the health, neurologic function, or reproduction of the mice. Pah{sup enu2} hyperphenylalaninemic mice, a model of human PAH deficiency, bred to carry the transgene have substantial PAH expression in cardiac and skeletal muscle but none in liver. Muscle PAH expression alone does not complement the hyperphenylalaninemic phenotype of Pah{sup enu2} mice. However, administration of reduced tetrahydrobiopterin to transgenic Pah{sup enu2} mice is associated with a 25% mean decrease in serum phenylalanine levels. We predict that ectopic expression of PAH in muscle along with adequate muscle supplies of reduced biopterin cofactor will decrease hyperphenylalaninemia in PKU.

Creation of transgenic rice plants producing small interfering RNA of Rice tungro spherical virus.

Science.gov (United States)

Le, Dung Tien; Chu, Ha Duc; Sasaya, Takahide

2015-01-01

Rice tungro spherical virus (RTSV), also known as Rice waika virus, does not cause visible symptoms in infected rice plants. However, the virus plays a critical role in spreading Rice tungro bacilliform virus (RTBV), which is the major cause of severe symptoms of rice tungro disease. Recent studies showed that RNA interference (RNAi) can be used to develop virus-resistance transgenic rice plants. In this report, we presented simple procedures and protocols needed for the creation of transgenic rice plants capable of producing small interfering RNA specific against RTSV sequences. Notably, our study showed that 60 out of 64 individual hygromycin-resistant lines (putative transgenic lines) obtained through transformation carried transgenes designed for producing hairpin double-stranded RNA. Northern blot analyses revealed the presence of small interfering RNA of 21- to 24-mer in 46 out of 56 confirmed transgenic lines. Taken together, our study indicated that transgenic rice plants carrying an inverted repeat of 500-bp fragments encoding various proteins of RTSV can produce small interfering RNA from the hairpin RNA transcribed from that transgene. In light of recent studies with other viruses, it is possible that some of these transgenic rice lines might be resistant to RTSV.

Rapid and Sensitive Detection of sFAT-1 Transgenic Pigs by Visual Loop-Mediated Isothermal Amplification.

Science.gov (United States)

Tao, Chenyu; Yang, Yalan; Li, Xunbi; Zheng, Xinmin; Ren, Hongyan; Li, Kui; Zhou, Rong

2016-07-01

Genetically modified (GM) livestock have the potential to contribute to improving the environment and human health, with consumption of fewer resources and reduced waste production. However, the transgene process also poses risks. The safety assessment and control of transgenic animal products have drawn wide attention, and the relevant regulations and technology are being developed. Quick testing technology plays a significant role in on-site and customs sampling. Nowadays, loop-mediated isothermal amplification (LAMP) was widely applied in nucleic acid analysis because of its simplicity, rapidity, high efficiency and specificity. In this study, a specific, sensitive detection system for detecting sFAT-1 transgenic pigs was designed. A set of six primers including two loop primers was designed for the target sequence. The DNA samples were amplified in less than 1 h at the optimized temperature and detecting by both Nephelometer LA-320c and unaided eyes directly adding calcein. The detection limit of sFAT-1 LAMP was as low as 1.26 ng/μL. Furthermore, blind tests of transgenic and non-transgenic DNA samples were all correctly detected. Hence, the results in this study demonstrated that LAMP is a very useful tool for transgenic detection.

Insect resistance to Nilaparvata lugens and Cnaphalocrocis medinalis in transgenic indica rice and the inheritance of gna+sbti transgenes.

Science.gov (United States)

Li, Guiying; Xu, Xinping; Xing, Hengtai; Zhu, Huachen; Fan, Qin

2005-04-01

Molecular genetic analysis and insect bioassay of transgenic indica rice 'Zhuxian B' plants carrying snowdrop lectin gene (gna) and soybean trypsin inhibitor gene (sbti) were investigated in detail. PCR, 'dot' blot and PCR-Southern blot analysis showed that both transgenes had been incorporated into the rice genome and transmitted up to R3 progeny in most lines tested. Some transgenic lines exhibited Mendelian segregation, but the other showed either 1:1 (positive: negative for the transgenes) or other aberrant segregation patterns. The segregation patterns of gna gene crossed between R2 and R3 progeny. In half of transgenic R3 lines, gna and sbti transgenes co-segregated. Two independent homozygous lines expressing double transgenes were identified in R3 progeny. Southern blot analysis demonstrated that the copy numbers of integrated gna and sbti transgenes varied from one to ten in different lines. Insect bioassay data showed that most transgenic plants had better resistance to both Nilaparvata lugens (Stahl) and Cnaphalocrocis medinalis (Guenee) than wild-type plants. The insect resistance of transgenic lines increased with the increase in transgene positive ratio in most of the transgenic lines. In all, we obtained nine lines of R3 transgenic plants, including one pure line, which had better resistance to both N lugens and C medinalis than wild-type plants. Copyright 2005 Society of Chemical Industry.

Cloning of two individual cDNAS encoding 9-cis-epoxycarotenoid dioxygenase from Gentiana lutea, their tissue-specific expression and physiological effect in transgenic tobacco.

Science.gov (United States)

Zhu, Changfu; Kauder, Friedrich; Römer, Susanne; Sandmann, Gerhard

2007-02-01

Two 9-cis-epoxycarotenoid dioxygenase (NCED) cDNAs have been cloned from a petal library of Gentiana lutea. Both cDNAs carry a putative transit sequence for chloroplast import and differ mainly in their length and the 5'-flanking regions. GlNCED1 was evolutionary closely related to Arabidopsis thaliana NCED6 whereas GlNCED2 showed highest homology to tomato NCED1 and A. thaliana NCED3. The amounts of GlNCED2 transcript were below Northern detection in G. lutea. In contrast, GlNCED1 was specifically expressed at higher levels in developing flowers when petals start appearing. By genetic engineering of tobacco with coding regions of either gene under a constitutive promoter, their function was further analyzed. Although mRNA of both genes was detectable in the corresponding transgenic plants, a physiological effect was only found for GlNCED1 but not for GlNCED2. In germination experiments of GlNCED1 transgenic lines, delayed radicle formation and cotyledon appearance were observed. However, the transformants exhibited no improved tolerance against desiccation stress. In contrast to other plants with over-expressed NCEDs, prolonged delay of seed germination is the only abscisic-acid-related phenotypic effect in the GlNCED1 transgenic lines.

Trans-specific gene silencing of acetyl-CoA carboxylase in a root-parasitic plant.

Science.gov (United States)

Bandaranayake, Pradeepa C G; Yoder, John I

2013-05-01

Parasitic species of the family Orobanchaceae are devastating agricultural pests in many parts of the world. The control of weedy Orobanchaceae spp. is challenging, particularly due to the highly coordinated life cycles of the parasite and host plants. Although host genetic resistance often provides the foundation of plant pathogen management, few genes that confer resistance to root parasites have been identified and incorporated into crop species. Members of the family Orobanchaceae acquire water, nutrients, macromolecules, and oligonucleotides from host plants through haustoria that connect parasite and host plant roots. We are evaluating a resistance strategy based on using interfering RNA (RNAi) that is made in the host but inhibitory in the parasite as a parasite-derived oligonucleotide toxin. Sequences from the cytosolic acetyl-CoA carboxylase (ACCase) gene from Triphysaria versicolor were cloned in hairpin conformation and introduced into Medicago truncatula roots by Agrobacterium rhizogenes transformation. Transgenic roots were recovered for four of five ACCase constructions and infected with T. versicolor against parasitic weeds. In all cases, Triphysaria root viability was reduced up to 80% when parasitizing a host root bearing the hairpin ACCase. Triphysaria root growth was recovered by exogenous application of malonate. Reverse-transcriptase polymerase chain reaction (RT-PCR) showed that ACCase transcript levels were dramatically decreased in Triphysaria spp. parasitizing transgenic Medicago roots. Northern blot analysis identified a 21-nucleotide, ACCase-specific RNA in transgenic M. truncatula and in T. versicolor attached to them. One hairpin ACCase construction was lethal to Medicago spp. unless grown in media supplemented with malonate. Quantitative RT-PCR showed that the Medicago ACCase was inhibited by the Triphysaria ACCase RNAi. This work shows that ACCase is an effective target for inactivation in parasitic plants by trans-specific gene

Selectivity and Efficiency of Late Transgene Expression by Transcriptionally Targeted Oncolytic Adenoviruses Are Dependent on the Transgene Insertion Strategy

OpenAIRE

Quirin, Christina; Rohmer, Stanimira; Fernández-Ulibarri, Inés; Behr, Michael; Hesse, Andrea; Engelhardt, Sarah; Erbs, Philippe; Enk, Alexander H.; Nettelbeck, Dirk M.

2010-01-01

Key challenges facing cancer therapy are the development of tumor-specific drugs and potent multimodal regimens. Oncolytic adenoviruses possess the potential to realize both aims by restricting virus replication to tumors and inserting therapeutic genes into the virus genome, respectively. A major effort in this regard is to express transgenes in a tumor-specific manner without affecting virus replication. Using both luciferase as a sensitive reporter and genetic prodrug activation, we show t...

Reduced Position Effect in Mature Transgenic Plants Conferred by the Chicken Lysozyme Matrix-Associated Region

NARCIS (Netherlands)

Mlynárová, Ľudmila; Loonen, Annelies; Heldens, Jos; Jansen, Ritsert C.; Keizer, Paul; Stiekema, Willem J.; Nap, Jan-Peter

1994-01-01

Matrix-associated regions may be useful for studying the role of chromatin architecture in transgene activity of transformed plants. The chicken lysozyme A element was shown to have specific affinity for tobacco nuclear matrices, and its influence on the variability of transgene expression in

[New advances in animal transgenic technology].

Science.gov (United States)

Sun, Zhen-Hong; Miao, Xiang-Yang; Zhu, Rui-Liang

2010-06-01

Animal transgenic technology is one of the fastest growing biotechnology in the 21st century. It is used to integrate foreign genes into the animal genome by genetic engineering technology so that foreign genes can be expressed and inherited to the offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors on preparation of transgenic animals. A variety of transgenic techniques are available, each of which has its own advantages and disadvantages and still needs further study because of unresolved technical and safety issues. With the in-depth research, the transgenic technology will have broad application prospects in the fields of exploration of gene function, animal genetic improvement, bioreactor, animal disease models, organ transplantation and so on. This article reviews the recently developed animal gene transfer techniques, including germline stem cell mediated method to improve the efficiency, gene targeting to improve the accuracy, RNA interference (RNAi)-mediated gene silencing technology, and the induced pluripotent stem cells (iPS) transgenic technology. The new transgenic techniques can provide a better platform for the study of trans-genic animals and promote the development of medical sciences, livestock production, and other fields.

Investigating the application of a nitroreductase-expressing transgenic zebrafish line for high-throughput toxicity testing

Directory of Open Access Journals (Sweden)

Anna C. Chlebowski

Full Text Available Nitroreductase enzymes are responsible for the reduction of nitro functional groups to amino functional groups, and are found in a range of animal models, zebrafish (Danio rerio excluded. Transgenic zebrafish models have been developed for tissue-specific cell ablation, which use nitroreductase to ablate specific tissues or cell types following exposure to the non-toxic pro-drug metronidazole (MTZ. When metabolized by nitroreductase, MTZ produces a potent cytotoxin, which specifically ablates the tissue in which metabolism occurs. Uses, beyond tissue-specific cell ablation, are possible for the hepatocyte-specific Tg(l-fabp:CFP-NTRs891 zebrafish line, including investigations of the role of nitroreductase in the toxicity of nitrated compounds. The hepatic ablation characteristics of this transgenic line were explored, in order to expand its potential uses. Embryos were exposed at 48, 72, or 96 h post fertilization (hpf to a range of MTZ concentrations, and the ablation profiles were compared. Ablation occurred at a 10-fold lower concentration than previously reported. Embryos were exposed to a selection of other compounds, with and without MTZ, in order to investigate alternative uses for this transgenic line. Test compounds were selected based on: their ability to undergo nitroreduction, known importance of hepatic metabolism to toxicity, and known pharmaceutical hepatotoxins. Selected compounds included nitrated polycyclic aromatic hydrocarbons (nitro-PAHs, the PAHs retene and benzo[a]pyrene, and the pharmaceuticals acetaminophen and flutamide. The results suggest a range of potential roles of the liver in the toxicity of these compounds, and highlight the additional uses of this transgenic model in toxicity testing. Keywords: Zebrafish, Transgenic, Nitroreductase, Nitrated polycyclic aromatic hydrocarbon, Tissue ablation, Pharmaceuticals

Transgenic Mice Expressing Yeast CUP1 Exhibit Increased Copper Utilization from Feeds

Science.gov (United States)

Chen, Zhenliang; Liao, Rongrong; Zhang, Xiangzhe; Wang, Qishan; Pan, Yuchun

2014-01-01

Copper is required for structural and catalytic properties of a variety of enzymes participating in many vital biological processes for growth and development. Feeds provide most of the copper as an essential micronutrient consumed by animals, but inorganic copper could not be utilized effectively. In the present study, we aimed to develop transgenic mouse models to test if copper utilization will be increased by providing the animals with an exogenous gene for generation of copper chelatin in saliva. Considering that the S. cerevisiae CUP1 gene encodes a Cys-rich protein that can bind copper as specifically as copper chelatin in yeast, we therefore constructed a transgene plasmid containing the CUP1 gene regulated for specific expression in the salivary glands by a promoter of gene coding pig parotid secretory protein. Transgenic CUP1 was highly expressed in the parotid and submandibular salivary glands and secreted in saliva as a 9-kDa copper-chelating protein. Expression of salivary copper-chelating proteins reduced fecal copper contents by 21.61% and increased body-weight by 12.97%, suggesting that chelating proteins improve the utilization and absorbed efficacy of copper. No negative effects on the health of the transgenic mice were found by blood biochemistry and histology analysis. These results demonstrate that the introduction of the salivary CUP1 transgene into animals offers a possible approach to increase the utilization efficiency of copper and decrease the fecal copper contents. PMID:25265503

Genomic localization of the Z/EG transgene in the mouse genome.

Science.gov (United States)

Colombo, Sophie; Kumasaka, Mayuko; Lobe, Corrinne; Larue, Lionel

2010-02-01

The Z/EG transgenic mouse line, produced by Novak et al., displays tissue-specific EGFP expression after Cre-mediated recombination. The autofluorescence of EGFP allows the visualization of cells of interest displaying Cre recombination. The initial construct was designed such that cells without Cre recombination express the beta-galactosidase marker, facilitating counterselection. We used inverse PCR to identify the site of integration of the Z/EG transgene, to improve the efficiency of homozygous Z/EG mouse production. Recombined cells produced large amounts of EGFP protein, resulting in higher levels of fluorescence and therefore greater contrast with nonrecombined cells. We mapped the transgene to the G1 region of chromosome 5. This random insertion was found to have occurred 230-bp upstream from the start codon of the Rasa4 gene. The insertion of the Z/EG transgene in the C57BL/6 genetic background had no effect on Rasa4 expression. Homozygous Z/EG mice therefore had no obvious phenotype. (c) 2009 Wiley-Liss, Inc.

Nrl-Cre transgenic mouse mediates loxP recombination in developing rod photoreceptors.

Science.gov (United States)

Brightman, Diana S; Razafsky, David; Potter, Chloe; Hodzic, Didier; Chen, Shiming

2016-03-01

The developing mouse retina is a tractable model for studying neurogenesis and differentiation. Although transgenic Cre mouse lines exist to mediate conditional genetic manipulations in developing mouse retinas, none of them act specifically in early developing rods. For conditional genetic manipulations of developing retinas, a Nrl-Cre mouse line in which the Nrl promoter drives expression of Cre in rod precursors was created. The results showed that Nrl-Cre expression was specific to the retina where it drives rod-specific recombination with a temporal pattern similar to endogenous Nrl expression during retinal development. This Nrl-Cre transgene does not negatively impact retinal structure and function. Taken together, the data suggested that the Nrl-Cre mouse line was a valuable tool to drive Cre-mediated recombination specifically in developing rods. © 2016 Wiley Periodicals, Inc.

Secretion of a recombinant protein without a signal peptide by the exocrine glands of transgenic rabbits.

Directory of Open Access Journals (Sweden)

Andrea Kerekes

Full Text Available Transgenic rabbits carrying mammary gland specific gene constructs are extensively used for excreting recombinant proteins into the milk. Here, we report refined phenotyping of previously generated Venus transposon-carrying transgenic rabbits with particular emphasis on the secretion of the reporter protein by exocrine glands, such as mammary, salivary, tear and seminal glands. The Sleeping Beauty (SB transposon transgenic construct contains the Venus fluorophore cDNA, but without a signal peptide for the secretory pathway, driven by the ubiquitous CAGGS (CAG promoter. Despite the absence of a signal peptide, the fluorophore protein was readily detected in milk, tear, saliva and seminal fluids. The expression pattern was verified by Western blot analysis. Mammary gland epithelial cells of SB-CAG-Venus transgenic lactating does also showed Venus-specific expression by tissue histology and fluorescence microscopy. In summary, the SB-CAG-Venus transgenic rabbits secrete the recombinant protein by different glands. This finding has relevance not only for the understanding of the biological function of exocrine glands, but also for the design of constructs for expression of recombinant proteins in dairy animals.

Secretion of a recombinant protein without a signal peptide by the exocrine glands of transgenic rabbits.

Science.gov (United States)

Kerekes, Andrea; Hoffmann, Orsolya Ivett; Iski, Gergely; Lipták, Nándor; Gócza, Elen; Kues, Wilfried A; Bősze, Zsuzsanna; Hiripi, László

2017-01-01

Transgenic rabbits carrying mammary gland specific gene constructs are extensively used for excreting recombinant proteins into the milk. Here, we report refined phenotyping of previously generated Venus transposon-carrying transgenic rabbits with particular emphasis on the secretion of the reporter protein by exocrine glands, such as mammary, salivary, tear and seminal glands. The Sleeping Beauty (SB) transposon transgenic construct contains the Venus fluorophore cDNA, but without a signal peptide for the secretory pathway, driven by the ubiquitous CAGGS (CAG) promoter. Despite the absence of a signal peptide, the fluorophore protein was readily detected in milk, tear, saliva and seminal fluids. The expression pattern was verified by Western blot analysis. Mammary gland epithelial cells of SB-CAG-Venus transgenic lactating does also showed Venus-specific expression by tissue histology and fluorescence microscopy. In summary, the SB-CAG-Venus transgenic rabbits secrete the recombinant protein by different glands. This finding has relevance not only for the understanding of the biological function of exocrine glands, but also for the design of constructs for expression of recombinant proteins in dairy animals.

Tissue-type-specific transcriptome analysis identifies developing xylem-specific promoters in poplar.

Science.gov (United States)

Ko, Jae-Heung; Kim, Hyun-Tae; Hwang, Ildoo; Han, Kyung-Hwan

2012-06-01

Plant biotechnology offers a means to create novel phenotypes. However, commercial application of biotechnology in crop improvement programmes is severely hindered by the lack of utility promoters (or freedom to operate the existing ones) that can drive gene expression in a tissue-specific or temporally controlled manner. Woody biomass is gaining popularity as a source of fermentable sugars for liquid fuel production. To improve the quantity and quality of woody biomass, developing xylem (DX)-specific modification of the feedstock is highly desirable. To develop utility promoters that can drive transgene expression in a DX-specific manner, we used the Affymetrix Poplar Genome Arrays to obtain tissue-type-specific transcriptomes from poplar stems. Subsequent bioinformatics analysis identified 37 transcripts that are specifically or strongly expressed in DX cells of poplar. After further confirmation of their DX-specific expression using semi-quantitative PCR, we selected four genes (DX5, DX8, DX11 and DX15) for in vivo confirmation of their tissue-specific expression in transgenic poplars. The promoter regions of the selected DX genes were isolated and fused to a β-glucuronidase (GUS)-reported gene in a binary vector. This construct was used to produce transgenic poplars via Agrobacterium-mediated transformation. The GUS expression patterns of the resulting transgenic plants showed that these promoters were active in the xylem cells at early seedling growth and had strongest expression in the developing xylem cells at later growth stages of poplar. We conclude that these DX promoters can be used as a utility promoter for DX-specific biomass engineering. © 2012 The Authors. Plant Biotechnology Journal © 2012 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

Expression of transgenes targeted to the Gt(ROSA26Sor locus is orientation dependent.

Directory of Open Access Journals (Sweden)

Douglas Strathdee

2006-12-01

Full Text Available Targeting transgenes to a chosen location in the genome has a number of advantages. A single copy of the DNA construct can be inserted by targeting into regions of chromatin that allow the desired developmental and tissue-specific expression of the transgene.In order to develop a reliable system for reproducibly expressing transgenes it was decided to insert constructs at the Gt(ROSA26Sor locus. A cytomegalovirus (CMV promoter was used to drive expression of the Tetracycline (tet transcriptional activator, rtTA2(s-M2, and test the effectiveness of using the ROSA26 locus to allow transgene expression. The tet operator construct was inserted into one allele of ROSA26 and a tet responder construct controlling expression of EGFP was inserted into the other allele.Expression of the targeted transgenes was shown to be affected by both the presence of selectable marker cassettes and by the orientation of the transgenes with respect to the endogenous ROSA26 promoter. These results suggest that transcriptional interference from the endogenous gene promoter or from promoters in the selectable marker cassettes may be affecting transgene expression at the locus. Additionally we have been able to determine the optimal orientation for transgene expression at the ROSA26 locus.

QTL mapping of inbreeding-related cold sensitivity and conditional lethality in Drosophila melanogaster

DEFF Research Database (Denmark)

Vermeulen, Corneel J.; Bijlsma, R.; Loeschcke, Volker

2008-01-01

of inbreeding-related and conditionally expressed lethality in Drosophila melanogaster. The lethal effect was triggered by exposure to a cold shock. We used a North Carolina crossing Design 3 to establish the mapping population, as well as to estimate the average dominance ratio and heritability. We found two......Inbreeding depression is a central theme within genetics, and is of specific interest for researchers within evolutionary and conservation genetics and animal and plant breeding. Inbreeding effects are thought to be caused by the joint expression of conditional and unconditional deleterious alleles....... Whenever the expression of deleterious alleles is conditional, this can result in extreme environmental sensitivity in certain inbred lineages. Analysis of conditional lethal effects can reveal some of the loci that are sensitive to inbreeding. We performed a QTL (quantitative trait locus) mapping study...

Neuroanatomy and transgenic technologies

Science.gov (United States)

This is a short review that introduces recent advances of neuroanatomy and transgenic technologies. The anatomical complexity of the nervous system remains a subject of tremendous fascination among neuroscientists. In order to tackle this extraordinary complexity, powerful transgenic technologies a...

Lethal and sub-lethal effects of five pesticides used in rice farming on the earthworm Eisenia fetida

NARCIS (Netherlands)

Rico, Andreu; Sabater, Consuelo; Castillo, María Ángeles

2016-01-01

The toxicity of five pesticides typically used in rice farming (trichlorfon, dimethoate, carbendazim, tebuconazole and prochloraz) was evaluated on different lethal and sub-lethal endpoints of the earthworm Eisenia fetida. The evaluated endpoints included: avoidance behaviour after an exposure

Biotechnology network promotes knowledge of transgenics

International Nuclear Information System (INIS)

Blanco Picado, Patricia; Valdez Melara, Marta

2015-01-01

Red de Ingenieria Genetica Aplicada al Mejoramiento de Cultivos Tropicales (Rigatrop) integrated by a group of scientists from the Universidad de Costa Rica (UCR), Universidad Nacional (UNA) and of the Instituto Tecnologico de Costa Rica (TEC) have organized two forums on the topic of transgenics. The first forum has shown successful experiences of development of transgenic crops in Latin America, as for example: the transgenic bean, project realized in Brazil and transgenic eggplant in Bangladesh. The second forum has been about transgenics and environment effected at the UCR, on the occasion of World Environment Day. Rigatrop members are working currently in two projects applying biotechnological tools to coffee [es

Lethal Epistaxis.

Science.gov (United States)

Byard, Roger W

2016-09-01

Epistaxis or nosebleed refers to bleeding from the nostrils, nasal cavity, or nasopharynx. Occasional cases may present with torrential lethal hemorrhage. Three cases are reported to demonstrate particular features: Case 1: A 51-year-old woman with lethal epistaxis with no obvious bleeding source; Case 2: A 77-year-old man with treated nasopharyngeal carcinoma who died from epistaxis arising from a markedly neovascularized tumor bed; Case 3: A 2-year-old boy with hemophilia B who died from epistaxis with airway obstruction in addition to gastrointestinal bleeding. Epistaxis may be associated with trauma, tumors, vascular malformations, bleeding diatheses, infections, pregnancy, endometriosis, and a variety of different drugs. Careful dissection of the nasal cavity is required to locate the site of hemorrhage and to identify any predisposing conditions. This may be guided by postmortem computerized tomographic angiography (PCTA). Despite careful dissection, however, a source of bleeding may never be identified. © 2016 American Academy of Forensic Sciences.

Restoration of spermatogenesis and male fertility using an androgen receptor transgene.

Directory of Open Access Journals (Sweden)

William H Walker

Full Text Available Androgens signal through the androgen receptor (AR to regulate male secondary sexual characteristics, reproductive tract development, prostate function, sperm production, bone and muscle mass as well as body hair growth among other functions. We developed a transgenic mouse model in which endogenous AR expression was replaced by a functionally modified AR transgene. A bacterial artificial chromosome (BAC was constructed containing all AR exons and introns plus 40 kb each of 5' and 3' regulatory sequence. Insertion of an internal ribosome entry site and the EGFP gene 3' to AR allowed co-expression of AR and EGFP. Pronuclear injection of the BAC resulted in six founder mice that displayed EGFP production in appropriate AR expressing tissues. The six founder mice were mated into a Sertoli cell specific AR knockout (SCARKO background in which spermatogenesis is blocked at the meiosis stage of germ cell development. The AR-EGFP transgene was expressed in a cyclical manner similar to that of endogenous AR in Sertoli cells and fertility was restored as offspring were produced in the absence of Sertoli cell AR. Thus, the AR-EGFP transgene under the control of AR regulatory elements is capable of rescuing AR function in a cell selective, AR-null background. These initial studies provide proof of principle that a strategy employing the AR-EGFP transgene can be used to understand AR functions. Transgenic mice expressing selective modifications of the AR-EGFP transgene may provide crucial information needed to elicit the molecular mechanisms by which AR acts in the testis and other androgen responsive tissues.

In Vivo Monitoring of Pancreatic β-Cells in a Transgenic Mouse Model

Directory of Open Access Journals (Sweden)

Steven J. Smith

2006-04-01

Full Text Available We generated a transgenic mouse model (RIP-luc for the in vivo monitoring of pancreatic islet mass and function in response to metabolic disease. Using the rat insulin promoter fused to firefly luciferase, and noninvasive technology to detect luciferase activity, we tracked changes in reporter signal during metabolic disease states and correlated the changes in luciferase signal with metabolic status of the mouse. Transgene expression was found to be specific to the pancreatic islets in this transgenic model. Basal transgene expression was tracked in male and female mice fed either a chow or a high-fat diet and in response to treatment with streptozotocin. Pancreatic bioluminescent signal increased in mice fed a high-fat diet compared with chow-fed animals. In a model of chemically induced diabetes, the bioluminescent signal decreased in accordance with the onset of diabetes and reduction of islet β-cell number. Preliminary studies using islets transplanted from this transgenic model suggest that in vivo image analysis can also be used to monitor transplanted islet viability and survival in the host. This transgenic model is a useful tool for in vivo studies of pancreatic β-cells and as a donor for islet transplantation studies.

Nuclear receptor TLX stimulates hippocampal neurogenesis and enhances learning and memory in a transgenic mouse model.

Science.gov (United States)

Murai, Kiyohito; Qu, Qiuhao; Sun, GuoQiang; Ye, Peng; Li, Wendong; Asuelime, Grace; Sun, Emily; Tsai, Guochuan E; Shi, Yanhong

2014-06-24

The role of the nuclear receptor TLX in hippocampal neurogenesis and cognition has just begun to be explored. In this study, we generated a transgenic mouse model that expresses TLX under the control of the promoter of nestin, a neural precursor marker. Transgenic TLX expression led to mice with enlarged brains with an elongated hippocampal dentate gyrus and increased numbers of newborn neurons. Specific expression of TLX in adult hippocampal dentate gyrus via lentiviral transduction increased the numbers of BrdU(+) cells and BrdU(+)NeuN(+) neurons. Furthermore, the neural precursor-specific expression of the TLX transgene substantially rescued the neurogenic defects of TLX-null mice. Consistent with increased neurogenesis in the hippocampus, the TLX transgenic mice exhibited enhanced cognition with increased learning and memory. These results suggest a strong association between hippocampal neurogenesis and cognition, as well as significant contributions of TLX to hippocampal neurogenesis, learning, and memory.

Development of a convenient in vivo hepatotoxin assay using a transgenic zebrafish line with liver-specific DsRed expression.

Directory of Open Access Journals (Sweden)

Xiaoyan Zhang

Full Text Available Previously we have developed a transgenic zebrafish line (LiPan with liver-specific red fluorescent protein (DsRed expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine] caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics and chlorphenamine (pain killer did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry

Development of a Convenient In Vivo Hepatotoxin Assay Using a Transgenic Zebrafish Line with Liver-Specific DsRed Expression

Science.gov (United States)

Zhang, Xiaoyan; Li, Caixia; Gong, Zhiyuan

2014-01-01

Previously we have developed a transgenic zebrafish line (LiPan) with liver-specific red fluorescent protein (DsRed) expression under the fabp10a promoter. Since red fluorescence in the liver greatly facilitates the observation of liver in live LiPan fry, we envision that the LiPan zebrafish may provide a useful tool in analyses of hepatotoxicity based on changes of liver red fluorescence intensity and size. In this study, we first tested four well-established hepatotoxins (acetaminophen, aspirin, isoniazid and phenylbutazone) in LiPan fry and demonstrated that these hepatotoxins could significantly reduce both liver red fluorescence and liver size in a dosage-dependent manner, thus the two measurable parameters could be used as indicators of hepatotoxicity. We then tested the LiPan fry with nine other chemicals including environmental toxicants and human drugs. Three (mefenamic acid, lindane, and arsenate) behave like hepatotoxins in reduction of liver red fluorescence, while three others (17β-estradiol, TCDD [2,3,7,8-tetrachlorodibenzo-p-dioxin] and NDMA [N-nitrosodimethylamine]) caused increase of liver red fluorescence and the liver size. Ethanol and two other chemicals, amoxicillin (antibiotics) and chlorphenamine (pain killer) did not resulted in significant changes of liver red fluorescence and liver size. By quantitative RT-PCR analysis, we found that the changes of red fluorescence intensity caused by different chemicals correlated to the changes of endogenous fabp10a RNA expression, indicating that the measured hepatotoxicity was related to fatty acid transportation and metabolism. Finally we tested a mixture of four hepatotoxins and observed a significant reduction of red fluorescence in the liver at concentrations below the lowest effective concentrations of individual hepatotoxins, suggesting that the transgenic zebrafish assay is capable of reporting compound hepatotoxicity effect from chemical mixtures. Thus, the LiPan transgenic fry provide a rapid

Tissue-specific in vivo genetic toxicity of nine polycyclic aromatic hydrocarbons assessed using the Muta™Mouse transgenic rodent assay

Energy Technology Data Exchange (ETDEWEB)

Long, Alexandra S., E-mail: alexandra.long@hc-sc.gc.ca [Faculty of Graduate and Postdoctoral Studies, Department of Biology, University of Ottawa, Ottawa, ON (Canada); Mechanistic Studies Division, Environmental Health Science and Research Bureau, Health Canada, Ottawa, ON (Canada); Lemieux, Christine L. [Air Health Science Division, Water and Air Quality Bureau, Health Canada, Ottawa, ON (Canada); Arlt, Volker M. [Analytical and Environmental Sciences Division, MRC-PHE Centre for Environment and Health, King' s College London, London (United Kingdom); White, Paul A. [Faculty of Graduate and Postdoctoral Studies, Department of Biology, University of Ottawa, Ottawa, ON (Canada); Mechanistic Studies Division, Environmental Health Science and Research Bureau, Health Canada, Ottawa, ON (Canada)

2016-01-01

Test batteries to screen chemicals for mutagenic hazard include several endpoints regarded as effective for detecting genotoxic carcinogens. Traditional in vivo methods primarily examine clastogenic endpoints in haematopoietic tissues. Although this approach is effective for identifying systemically distributed clastogens, some mutagens may not induce clastogenic effects; moreover, genotoxic effects may be restricted to the site of contact and/or related tissues. An OECD test guideline for transgenic rodent (TGR) gene mutation assays was released in 2011, and the TGR assays permit assessment of mutagenicity in any tissue. This study assessed the responses of two genotoxicity endpoints following sub-chronic oral exposures of male Muta™Mouse to 9 carcinogenic polycyclic aromatic hydrocarbons (PAHs). Clastogenicity was assessed via induction of micronuclei in peripheral blood, and mutagenicity via induction of lacZ transgene mutations in bone marrow, glandular stomach, small intestine, liver, and lung. Additionally, the presence of bulky PAH-DNA adducts was examined. Five of the 9 PAHs elicited positive results across all endpoints in at least one tissue, and no PAHs were negative or equivocal across all endpoints. All PAHs were positive for lacZ mutations in at least one tissue (sensitivity = 100%), and for 8 PAHs, one or more initial sites of chemical contact (i.e., glandular stomach, liver, small intestine) yielded a greater response than bone marrow. Five PAHs were positive in the micronucleus assay (sensitivity = 56%). Furthermore, all PAHs produced DNA adducts in at least one tissue. The results demonstrate the utility of the TGR assay for mutagenicity assessment, especially for compounds that may not be systemically distributed. - Highlights: • The Muta™Mouse is a reliable tool for in vivo mutagenicity assessment of PAHs. • All 9 PAHs induced lacZ transgene mutations in small intestine. • Only 5 of 9 PAHs induced lacZ mutations and micronuclei in

Anxiety-like behavior in transgenic mice with brain expression of neuropeptide Y.

Science.gov (United States)

Inui, A; Okita, M; Nakajima, M; Momose, K; Ueno, N; Teranishi, A; Miura, M; Hirosue, Y; Sano, K; Sato, M; Watanabe, M; Sakai, T; Watanabe, T; Ishida, K; Silver, J; Baba, S; Kasuga, M

1998-01-01

Neuropeptide Y (NPY), one of the most abundant peptide transmitters in the mammalian brain, is assumed to play an important role in behavior and its disorders. To understand the long-term modulation of neuronal functions by NPY, we raised transgenic mice created with a novel central nervous system (CNS) neuron-specific expression vector of human Thy- gene fragment linked to mouse NPY cDNA. In situ hybridization analysis demonstrated transgene-derived NPY expression in neurons (e.g., in the hippocampus, cerebral cortex, and the arcuate nucleus of the hypothalamus) in the transgenic mice. The modest increase of NPY protein in the brain was demonstrated by semiquantitative immunohistochemical analysis and by radioreceptor assay (115% in transgenic mice compared to control littermates). Double-staining experiments indicated colocalization of the transgene-derived NPY message and NPY protein in the same neurons, such as in the arcuate nucleus. The transgenic mice displayed behavioral signs of anxiety and hypertrophy of adrenal zona fasciculata cells, but no change in food intake was observed. The anxiety-like behavior of transgenic mice was reversed, at least in part, by administration of corticotropin-releasing factor (CRF) antagonists, alpha-helical CRF9-41, into the third cerebral ventricle. These results suggest that NPY has a role in anxiety and behavioral responses to stress partly via the CRF neuronal system. This genetic model may provide a unique opportunity to study human anxiety and emotional disorders.

Expression of the double-stranded RNA of the soybean pod borer Leguminivora glycinivorella (Lepidoptera: Tortricidae) ribosomal protein P0 gene enhances the resistance of transgenic soybean plants.

Science.gov (United States)

Meng, Fanli; Li, Yang; Zang, Zhenyuan; Li, Na; Ran, Ruixue; Cao, Yingxue; Li, Tianyu; Zhou, Quan; Li, Wenbin

2017-12-01

The soybean pod borer [SPB; Leguminivora glycinivorella (Matsumura) (Lepidoptera: Tortricidae)] is the most important soybean pest in northeastern Asia. Silencing genes using plant-mediated RNA-interference is a promising strategy for controlling SPB infestations. The ribosomal protein P0 is important for protein translation and DNA repair in the SPB. Thus, transferring P0 double-stranded RNA (dsRNA) into plants may help prevent SPB-induced damage. We investigated the effects of SpbP0 dsRNA injections and SpbP0 dsRNA-expressing transgenic soybean plants on the SPB. Larval mortality rates were greater for SpbP0 dsRNA-injected larvae (96%) than for the control larvae (31%) at 14 days after injections. Transgenic T 2 soybean plants expressing SpbP0 dsRNA sustained less damage from SPB larvae than control plants. In addition, the expression level of the SpbP0 gene decreased and the mortality rate increased when SPB larvae were fed on T 3 transgenic soybean pods. Moreover, the surviving larvae were deformed and exhibited inhibited growth. Silencing SpbP0 expression is lethal to the SPB. Transgenic soybean plants expressing SpbP0 dsRNA are more resistant to the SPB than wild-type plants. Thus, SpbP0 dsRNA-expressing transgenic plants may be useful for controlling insect pests. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

Lethal congenital contracture syndrome (LCCS) and other lethal arthrogryposes in Finland--an epidemiological study.

Science.gov (United States)

Pakkasjärvi, Niklas; Ritvanen, Annukka; Herva, Riitta; Peltonen, Leena; Kestilä, Marjo; Ignatius, Jaakko

2006-09-01

Arthrogryposis multiplex congenita is a heterogeneous group of disorders characterized by multiple contractures with an estimated frequency of 1 in 3,000 births. With improving diagnostic methods, increasing numbers of fetuses with arthrogryposis are found. The pathogenetic mechanisms are relatively well known but the epidemiology and genetics of the prenatally lethal forms of arthrogryposis are less well known. In this study we collected all cases of a multiple contractures diagnosed in Finland during 1987-2002 including live born infants, stillbirths, and terminated pregnancies. Ninety-two cases of 214 suffered intrauterine demise (68 selective pregnancy terminations and 24 stillbirths) and 58 died in infancy. In 141 out of these cases the diagnosis could be included within lethal arthrogryposes, with a prevalence of 1 in 6,985 (1.43/10,000) births. Of these, 59 had spinal cord pathology at autopsy and thus were of neurogenic origin. Thirty-nine cases had lethal congenital contracture syndrome (LCCS) clinically characterized by total immobility of the fetus at all ultrasound examinations (12 weeks or later), multiple joint contractures in both upper and lower limbs, hydrops, and fetal death before the 32nd week of pregnancy. LCCS is noted as a unique Finnish disorder with a prevalence of 1 in 25,250 (0.40/10,000) births and is a major cause of lethal arthrogryposis in Finland.

Galactose-extended glycans of antibodies produced by transgenic plants

NARCIS (Netherlands)

Bakker, H.; Bardor, M.; Molthoff, J.W.; Gomord, V.; Elbers, I.; Stevens, L.H.; Jordi, W.; Lommen, A.; Faye, L.; Lerouge, P.; Bosch, D.

2001-01-01

Plant-specific N-glycosylation can represent an important limitation for the use of recombinant glycoproteins of mammalian origin produced by transgenic plants. Comparison of plant and mammalian N-glycan biosynthesis indicates that β1,4-galactosyltransferase is the most important enzyme that is

Annotating novel genes by integrating synthetic lethals and genomic information

Directory of Open Access Journals (Sweden)

Faty Mahamadou

2008-01-01

Full Text Available Abstract Background Large scale screening for synthetic lethality serves as a common tool in yeast genetics to systematically search for genes that play a role in specific biological processes. Often the amounts of data resulting from a single large scale screen far exceed the capacities of experimental characterization of every identified target. Thus, there is need for computational tools that select promising candidate genes in order to reduce the number of follow-up experiments to a manageable size. Results We analyze synthetic lethality data for arp1 and jnm1, two spindle migration genes, in order to identify novel members in this process. To this end, we use an unsupervised statistical method that integrates additional information from biological data sources, such as gene expression, phenotypic profiling, RNA degradation and sequence similarity. Different from existing methods that require large amounts of synthetic lethal data, our method merely relies on synthetic lethality information from two single screens. Using a Multivariate Gaussian Mixture Model, we determine the best subset of features that assign the target genes to two groups. The approach identifies a small group of genes as candidates involved in spindle migration. Experimental testing confirms the majority of our candidates and we present she1 (YBL031W as a novel gene involved in spindle migration. We applied the statistical methodology also to TOR2 signaling as another example. Conclusion We demonstrate the general use of Multivariate Gaussian Mixture Modeling for selecting candidate genes for experimental characterization from synthetic lethality data sets. For the given example, integration of different data sources contributes to the identification of genetic interaction partners of arp1 and jnm1 that play a role in the same biological process.

Modelling Aedes aegypti mosquito control via transgenic and sterile insect techniques: Endemics and emerging outbreaks

KAUST Repository

Seirin Lee, S.

2013-08-01

The invasion of pest insects often changes or destroys a native ecosystem, and can result in food shortages and disease endemics. Issues such as the environmental effects of chemical control methods, the economic burden of maintaining control strategies and the risk of pest resistance still remain, and mosquito-borne diseases such as malaria and dengue fever prevail in many countries, infecting over 100 million worldwide in 2010. One environmentally friendly method for mosquito control is the Sterile Insect Technique (SIT). This species-specific method of insect control relies on the mass rearing, sterilization and release of large numbers of sterile insects. An alternative transgenic method is the Release of Insects carrying a Dominant Lethal (RIDL). Our objective is to consider contrasting control strategies for two invasive scenarios via SIT and RIDL: an endemic case and an emerging outbreak. We investigate how the release rate and size of release region influence both the potential for control success and the resources needed to achieve it, under a range of conditions and control strategies, and we discuss advantageous strategies with respect to reducing the release resources and strategy costs (in terms of control mosquito numbers) required to achieve complete eradication of wild-type mosquitoes. © 2013 Elsevier Ltd.

Modelling Aedes aegypti mosquito control via transgenic and sterile insect techniques: Endemics and emerging outbreaks

KAUST Repository

Seirin Lee, S.; Baker, R.E.; Gaffney, E.A.; White, S.M.

2013-01-01

The invasion of pest insects often changes or destroys a native ecosystem, and can result in food shortages and disease endemics. Issues such as the environmental effects of chemical control methods, the economic burden of maintaining control strategies and the risk of pest resistance still remain, and mosquito-borne diseases such as malaria and dengue fever prevail in many countries, infecting over 100 million worldwide in 2010. One environmentally friendly method for mosquito control is the Sterile Insect Technique (SIT). This species-specific method of insect control relies on the mass rearing, sterilization and release of large numbers of sterile insects. An alternative transgenic method is the Release of Insects carrying a Dominant Lethal (RIDL). Our objective is to consider contrasting control strategies for two invasive scenarios via SIT and RIDL: an endemic case and an emerging outbreak. We investigate how the release rate and size of release region influence both the potential for control success and the resources needed to achieve it, under a range of conditions and control strategies, and we discuss advantageous strategies with respect to reducing the release resources and strategy costs (in terms of control mosquito numbers) required to achieve complete eradication of wild-type mosquitoes. © 2013 Elsevier Ltd.

Effective lethal mutagenesis of influenza virus by three nucleoside analogs.

Science.gov (United States)

Pauly, Matthew D; Lauring, Adam S

2015-04-01

Lethal mutagenesis is a broad-spectrum antiviral strategy that exploits the high mutation rate and low mutational tolerance of many RNA viruses. This approach uses mutagenic drugs to increase viral mutation rates and burden viral populations with mutations that reduce the number of infectious progeny. We investigated the effectiveness of lethal mutagenesis as a strategy against influenza virus using three nucleoside analogs, ribavirin, 5-azacytidine, and 5-fluorouracil. All three drugs were active against a panel of seasonal H3N2 and laboratory-adapted H1N1 strains. We found that each drug increased the frequency of mutations in influenza virus populations and decreased the virus' specific infectivity, indicating a mutagenic mode of action. We were able to drive viral populations to extinction by passaging influenza virus in the presence of each drug, indicating that complete lethal mutagenesis of influenza virus populations can be achieved when a sufficient mutational burden is applied. Population-wide resistance to these mutagenic agents did not arise after serial passage of influenza virus populations in sublethal concentrations of drug. Sequencing of these drug-passaged viral populations revealed genome-wide accumulation of mutations at low frequency. The replicative capacity of drug-passaged populations was reduced at higher multiplicities of infection, suggesting the presence of defective interfering particles and a possible barrier to the evolution of resistance. Together, our data suggest that lethal mutagenesis may be a particularly effective therapeutic approach with a high genetic barrier to resistance for influenza virus. Influenza virus is an RNA virus that causes significant morbidity and mortality during annual epidemics. Novel therapies for RNA viruses are needed due to the ease with which these viruses evolve resistance to existing therapeutics. Lethal mutagenesis is a broad-spectrum strategy that exploits the high mutation rate and the low

Transgene mobilization and regulatory uncertainty for non-GE fruit products of transgenic rootstocks.

Science.gov (United States)

Haroldsen, Victor M; Chi-Ham, Cecilia L; Bennett, Alan B

2012-10-31

Genetically engineered (GE) rootstocks may offer some advantages for biotechnology applications especially in woody perennial crops such as grape or walnut. Transgrafting combines horticultural grafting practices with modern GE methods for crop improvement. Here, a non-GE conventional scion (upper stem portion) is grafted onto a transgenic GE rootstock. Thus, the scion does not contain the genetic modification present in the rootstock genome. We examined transgene presence in walnut and tomato GE rootstocks and non-GE fruit-bearing scions. Mobilization of transgene DNA, protein, and mRNA across the graft was not detected. Though transgenic siRNA mobilization was not observed in grafted tomatoes or walnut scions, transgenic siRNA signal was detected in walnut kernels. Prospective benefits from transgrafted plants include minimized risk of GE pollen flow (Lev-Yadun and Sederoff, 2001), possible use of more than one scion per approved GE rootstock which could help curb the estimated US$136 million (CropLife International, 2011) cost to bring a GE crop to international markets, as well as potential for improved consumer and market acceptance since the consumable product is not itself GE. Thus, transgrafting provides an alternative option for agricultural industries wishing to expand their biotechnology portfolio. Copyright © 2012 Elsevier B.V. All rights reserved.

What Are Reasons for the Large Gender Differences in the Lethality of Suicidal Acts? An Epidemiological Analysis in Four European Countries.

Directory of Open Access Journals (Sweden)

Roland Mergl

Full Text Available In Europe, men have lower rates of attempted suicide compared to women and at the same time a higher rate of completed suicides, indicating major gender differences in lethality of suicidal behaviour. The aim of this study was to analyse the extent to which these gender differences in lethality can be explained by factors such as choice of more lethal methods or lethality differences within the same suicide method or age. In addition, we explored gender differences in the intentionality of suicide attempts.Methods. Design: Epidemiological study using a combination of self-report and official data. Setting: Mental health care services in four European countries: Germany, Hungary, Ireland, and Portugal. Data basis: Completed suicides derived from official statistics for each country (767 acts, 74.4% male and assessed suicide attempts excluding habitual intentional self-harm (8,175 acts, 43.2% male. Main Outcome Measures and Data Analysis. We collected data on suicidal acts in eight regions of four European countries participating in the EU-funded "OSPI-Europe"-project (www.ospi-europe.com. We calculated method-specific lethality using the number of completed suicides per method * 100 / (number of completed suicides per method + number of attempted suicides per method. We tested gender differences in the distribution of suicidal acts for significance by using the χ2-test for two-by-two tables. We assessed the effect sizes with phi coefficients (φ. We identified predictors of lethality with a binary logistic regression analysis. Poisson regression analysis examined the contribution of choice of methods and method-specific lethality to gender differences in the lethality of suicidal acts.Suicidal acts (fatal and non-fatal were 3.4 times more lethal in men than in women (lethality 13.91% (regarding 4106 suicidal acts versus 4.05% (regarding 4836 suicidal acts, the difference being significant for the methods hanging, jumping, moving objects, sharp

Condensation of chromatin in transcriptional regions of an inactivated plant transgene: evidence for an active role of transcription in gene silencing.

Science.gov (United States)

van Blokland, R; ten Lohuis, M; Meyer, P

1997-12-01

The chromatin structures of two epigenetic alleles of a transgene were investigated by measuring the local accessibility of transgene chromatin to endonucleases. The two epialleles represented the active, hypomethylated state of a transgene in line 17-I of Petunia hybrida, and a transcriptionally inactive, hypermethylated derivative of the same transgene in line 17-IV. In nuclear preparations the inactive epiallele was significantly less sensitive to DNasel digestion and nuclease S7 digestion than the transcriptionally active epiallele, whereas no significant differences in accessibility were observed between naked DNA samples of the two epialleles. Our data suggest that a condensed chromatin structure is specifically imposed on transcribed regions of the construct in line 17-IV. In contrast, in both epialleles the plasmid region of the transgene, which is not transcriptionally active in plants, retains the same accessibility to endonucleases as the chromosomal integration site. These data suggest that transcriptional inactivation is linked to the process of transcription, and imply that control of transgene expression via the use of inducible or tissue-specific promoters might prevent transgene silencing and conserve the active state of transgenes during sexual propagation.

Split-Cre complementation restores combination activity on transgene excision in hair roots of transgenic tobacco.

Directory of Open Access Journals (Sweden)

Mengling Wen

Full Text Available The Cre/loxP system is increasingly exploited for genetic manipulation of DNA in vitro and in vivo. It was previously reported that inactive ''split-Cre'' fragments could restore Cre activity in transgenic mice when overlapping co-expression was controlled by two different promoters. In this study, we analyzed recombination activities of split-Cre proteins, and found that no recombinase activity was detected in the in vitro recombination reaction in which only the N-terminal domain (NCre of split-Cre protein was expressed, whereas recombination activity was obtained when the C-terminal (CCre or both NCre and CCre fragments were supplied. We have also determined the recombination efficiency of split-Cre proteins which were co-expressed in hair roots of transgenic tobacco. No Cre recombination event was observed in hair roots of transgenic tobacco when the NCre or CCre genes were expressed alone. In contrast, an efficient recombination event was found in transgenic hairy roots co-expressing both inactive split-Cre genes. Moreover, the restored recombination efficiency of split-Cre proteins fused with the nuclear localization sequence (NLS was higher than that of intact Cre in transgenic lines. Thus, DNA recombination mediated by split-Cre proteins provides an alternative method for spatial and temporal regulation of gene expression in transgenic plants.

Selective loss of mouse embryos due to the expression of transgenic major histocompatibility class I molecules early in embryogenesis.

Science.gov (United States)

Aït-Azzouzene, D; Langkopf, A; Cohen, J; Bleux, C; Gendron, M C; Kanellopoulos-Langevin, C

1998-05-01

Among the numerous hypotheses proposed to explain the absence of fetal rejection by the mother in mammals, it has been suggested that regulation of expression of the polymorphic major histocompatibility complex (MHC) at the fetal-maternal interface plays a major role. In addition to a lack of MHC gene expression in the placenta throughout gestation, the absence of polymorphic MHC molecules on the early embryo, as well as their low level of expression after midgestation, could contribute to this important biologic phenomenon. In order to test this hypothesis, we have produced transgenic mice able to express polymorphic MHC class I molecules early in embryogenesis. We have placed the MHC class la gene H-2Kb under the control of a housekeeping gene promoter, the hydroxy-methyl-glutaryl coenzyme A reductase (HMG) gene minimal promoter. This construct has been tested for functionality after transfection into mouse fibroblast L cells. The analysis of three founder transgenic mice and their progeny suggested that fetoplacental units that could express the H-2Kb heavy chains are unable to survive in utero beyond midgestation. We have shown further that a much higher resorption rate, on days 11 to 13 of embryonic development, is observed among transgenic embryos developing from eggs microinjected at the one-cell stage with the pHMG-Kb construct than in control embryos. This lethality is not due to immune phenomena, since it is observed in histocompatible combinations between mother and fetus. These results are discussed in the context of what is currently known about the regulation of MHC expression at the fetal-maternal interface and in various transgenic mouse models.

Circumsporozoite Protein-Specific Kd-Restricted CD8+ T Cells Mediate Protective Antimalaria Immunity in Sporozoite-Immunized MHC-I-Kd Transgenic Mice

Directory of Open Access Journals (Sweden)

Jing Huang

2014-01-01

Full Text Available Although the roles of CD8+ T cells and a major preerythrocytic antigen, the circumsporozoite (CS protein, in contributing protective antimalaria immunity induced by radiation-attenuated sporozoites, have been shown by a number of studies, the extent to which these players contribute to antimalaria immunity is still unknown. To address this question, we have generated C57BL/6 (B6 transgenic (Tg mice, expressing Kd molecules under the MHC-I promoter, called MHC-I-Kd-Tg mice. In this study, we first determined that a single immunizing dose of IrPySpz induced a significant level of antimalaria protective immunity in MHC-I-Kd-Tg mice but not in B6 mice. Then, by depleting various T-cell subsets in vivo, we determined that CD8+ T cells are the main mediator of the protective immunity induced by IrPySpz. Furthermore, when we immunized (MHC-I-Kd-Tg × CS-Tg F1 mice with IrPySpz after crossing MHC-I-Kd-Tg mice with PyCS-transgenic mice (CS-Tg, which are unable to mount PyCS-specific immunity, we found that IrPySpz immunization failed to induce protective antimalaria immunity in (MHC-I-Kd-Tg × CS-Tg F1 mice, thus indicating the absence of PyCS antigen-dependent immunity in these mice. These results indicate that protective antimalaria immunity induced by IrPySpz in MHC-I-Kd-Tg mice is mediated by CS protein-specific, Kd-restricted CD8+ T cells.

Impacts of elevated CO2 on exogenous Bacillus thuringiensis toxins and transgene expression in transgenic rice under different levels of nitrogen.

Science.gov (United States)

Jiang, Shoulin; Lu, Yongqing; Dai, Yang; Qian, Lei; Muhammad, Adnan Bodlah; Li, Teng; Wan, Guijun; Parajulee, Megha N; Chen, Fajun

2017-11-07

Recent studies have highlighted great challenges of transgene silencing for transgenic plants facing climate change. In order to understand the impacts of elevated CO 2 on exogenous Bacillus thuringiensis (Bt) toxins and transgene expression in transgenic rice under different levels of N-fertilizer supply, we investigated the biomass, exogenous Bt toxins, Bt-transgene expression and methylation status in Bt rice exposed to two levels of CO 2 concentrations and nitrogen (N) supply (1/8, 1/4, 1/2, 1 and 2 N). It is elucidated that the increased levels of global atmospheric CO 2 concentration will trigger up-regulation of Bt toxin expression in transgenic rice, especially with appropriate increase of N fertilizer supply, while, to some extent, the exogenous Bt-transgene expression is reduced at sub-N levels (1/4 and 1/2N), even though the total protein of plant tissues is reduced and the plant growth is restricted. The unpredictable and stochastic occurrence of transgene silencing and epigenetic alternations remains unresolved for most transgenic plants. It is expected that N fertilization supply may promote the expression of transgenic Bt toxin in transgenic Bt rice, particularly under elevated CO 2 .

Conditional and inducible transgene expression in endothelial and hematopoietic cells using Cre/loxP and tetracycline-off systems.

Science.gov (United States)

Liu, Ju; Deutsch, Urban; Fung, Iris; Lobe, Corrinne G

2014-11-01

In the present study, the tetracycline-off and Cre/ loxP systems were combined to gain temporal and spatial control of transgene expression. Mice were generated that carried three transgenes: Tie2-tTA, tet-O-Cre and either the ZEG or ZAP reporter. Tie2-tTA directs expression of tetracycline-controlled transactivator (tTA) in endothelial and hematopoietic cells under the control of the Tie2 promoter. Tet-O-Cre produces Cre recombinase from a minimal promoter containing the tet-operator (tetO). ZEG or ZAP contains a strong promoter and a loxP -flanked stop sequence, followed by an enhanced green fluorescence protein (EGFP) or human placental alkaline phosphatase (hPLAP) reporter. In the presence of tetracycline, the tTA transactivator produced by Tie-2-tTA is disabled and Cre is not expressed. In the absence of tetracycline, the tTA binds tet-O-Cre to drive the expression of Cre, which recombines the loxP sites of the ZEG or ZAP transgene and results in reporter gene expression. In the present study, the expression of the ZEG or ZAP reporter genes in embryos and adult animals with and without tetracycline treatment was examined. In the presence of tetracycline, no reporter gene expression was observed. When tetracycline was withdrawn, Cre excision was activated and the reporter genes were detected in endothelial and hematopoietic cells. These results demonstrate that this system may be used to bypass embryonic lethality and access adult phenotypes.

T-Cell Mediated Immune Responses Induced in ret Transgenic Mouse Model of Malignant Melanoma

Energy Technology Data Exchange (ETDEWEB)

Abschuetz, Oliver [Skin Cancer Unit, German Cancer Research Center (DKFZ), Heidelberg and Department of Dermatology, Venereology and Allergology, University Medical Center Mannheim, Ruprecht-Karl University of Heidelberg, Mannheim , Heidelberg 69120 (Germany); Osen, Wolfram [Division of Translational Immunology, German Cancer Center, Heidelberg 69120 (Germany); Frank, Kathrin [Skin Cancer Unit, German Cancer Research Center (DKFZ), Heidelberg and Department of Dermatology, Venereology and Allergology, University Medical Center Mannheim, Ruprecht-Karl University of Heidelberg, Mannheim , Heidelberg 69120 (Germany); Kato, Masashi [Unit of Environmental Health Sciences, Department of Biomedical Sciences, College of Life and Health Sciences, Chubu University, Aichi 487-8501 (Japan); Schadendorf, Dirk [Department of Dermatology, University Hospital Essen, Essen 45122 (Germany); Umansky, Viktor, E-mail: v.umansky@dkfz.de [Skin Cancer Unit, German Cancer Research Center (DKFZ), Heidelberg and Department of Dermatology, Venereology and Allergology, University Medical Center Mannheim, Ruprecht-Karl University of Heidelberg, Mannheim , Heidelberg 69120 (Germany)

2012-04-26

Poor response of human malignant melanoma to currently available treatments requires a development of innovative therapeutic strategies. Their evaluation should be based on animal models that resemble human melanoma with respect to genetics, histopathology and clinical features. Here we used a transgenic mouse model of spontaneous skin melanoma, in which the ret transgene is expressed in melanocytes under the control of metallothionein-I promoter. After a short latency, around 25% mice develop macroscopic skin melanoma metastasizing to lymph nodes, bone marrow, lungs and brain, whereas other transgenic mice showed only metastatic lesions without visible skin tumors. We found that tumor lesions expressed melanoma associated antigens (MAA) tyrosinase, tyrosinase related protein (TRP)-1, TRP-2 and gp100, which could be applied as targets for the immunotherapy. Upon peptide vaccination, ret transgenic mice without macroscopic melanomas were able to generate T cell responses not only against a strong model antigen ovalbumin but also against typical MAA TRP-2. Although mice bearing macroscopic primary tumors could also display an antigen-specific T cell reactivity, it was significantly down-regulated as compared to tumor-free transgenic mice or non-transgenic littermates. We suggest that ret transgenic mice could be used as a pre-clinical model for the evaluation of novel strategies of melanoma immunotherapy.

A rabies vaccine adjuvanted with saponins from leaves of the soap tree (Quillaja brasiliensis) induces specific immune responses and protects against lethal challenge.

Science.gov (United States)

Yendo, Anna Carolina A; de Costa, Fernanda; Cibulski, Samuel P; Teixeira, Thais F; Colling, Luana C; Mastrogiovanni, Mauricio; Soulé, Silvia; Roehe, Paulo M; Gosmann, Grace; Ferreira, Fernando A; Fett-Neto, Arthur G

2016-04-29

Quillaja brasiliensis (Quillajaceae) is a saponin producing species native from southern Brazil and Uruguay. Its saponins are remarkably similar to those of Q. saponaria, which provides most of the saponins used as immunoadjuvants in vaccines. The immunostimulating capacities of aqueous extract (AE) and purified saponin fraction (QB-90) obtained from leaves of Q. brasiliensis were favorably comparable to those of a commercial saponin-based adjuvant preparation (Quil-A) in experimental vaccines against bovine herpesvirus type 1 and 5, poliovirus and bovine viral diarrhea virus in mice model. Herein, the immunogenicity and protection efficacy of rabies vaccines adjuvanted with Q. brasiliensis AE and its saponin fractions were compared with vaccines adjuvanted with either commercial Quil-A or Alum. Mice were vaccinated with one or two doses (on days 0 and 14) of one of the different vaccines and serum levels of total IgG, IgG1 and IgG2a were quantified over time. A challenge experiment with a lethal dose of rabies virus was carried out with the formulations. Viral RNA detection in the brain of mice was performed by qPCR, and RNA copy-numbers were quantified using a standard curve of in vitro transcribed RNA. All Q. brasiliensis saponin-adjuvanted vaccines significantly enhanced levels of specific IgG isotypes when compared with the no adjuvant group (P ≤ 0.05). Overall, one or two doses of saponin-based vaccine were efficient to protect against the lethal rabies exposure. Both AE and saponin fractions from Q. brasiliensis leaves proved potent immunological adjuvants in vaccines against a lethal challenge with a major livestock pathogen, hence confirming their value as competitive or complementary sustainable alternatives to saponins of Q. saponaria. Copyright © 2016 Elsevier Ltd. All rights reserved.

Transgenic plants as green factories for vaccine production | Vinod ...

African Journals Online (AJOL)

Edible vaccine technology represents an alternative to fermentation based vaccine production system. Transgenic plants are used for the production of plant derived specific vaccines with native immunogenic properties stimulating both humoral and mucosal immune responses. Keeping in view the practical need of new ...

Enhancer-promoter interference and its prevention in transgenic plants

Science.gov (United States)

Transcriptional enhancer elements have been shown to override the specificity of nearby promoters in a position- and orientation-independent manner. This is problematic when multiple enhancers/promoters co-exist within a single transgenic construct as it has the potential to cause the mis-expressio...

A transgenic mouse model for measles virus infection of the brain

Science.gov (United States)

Rall, Glenn F.; Manchester, Marianne; Daniels, Lia R.; Callahan, Eric M.; Belman, Alec R.; Oldstone, Michael B. A.

1997-01-01

In addition to the rash, fever, and upper respiratory tract congestion that are the hallmarks of acute measles virus (MV) infection, invasion of the central nervous system (CNS) can occur, establishing a persistent infection primarily in neurons. The recent identification of the human membrane glycoprotein, CD46, as the MV receptor allowed for the establishment of transgenic mice in which the CD46 gene was transcriptionally regulated by a neuron-specific promoter. Expression of the measles receptor rendered primary CD46-positive neurons permissive to infection with MV–Edmonston. Notably, viral transmission within these cultures occurred in the absence of extracellular virus, presumably via neuronal processes. No infection was seen in nontransgenic mice inoculated intracerebrally with MV–Edmonston. In contrast, scattered neurons were infected following inoculation of transgenic adults, and an impressive widespread neuronal infection was established in transgenic neonates. The neonatal infection resulted in severe CNS disease by 3–4 weeks after infection. Illness was characterized initially by awkward gait and a lack of mobility, and in later stages seizures leading to death. These results show that expression of the MV receptor on specific murine cells (neurons) in vivo is absolutely essential to confer both susceptibility to infection and neurologic disease by this human virus. The disparity in clinical findings between neonatal and adult transgenic mice indicates that differences exist between the developing and mature CNS with respect to MV infection and pathogenesis. PMID:9114047

Production of germline transgenic prairie voles (Microtus ochrogaster) using lentiviral vectors.

Science.gov (United States)

Donaldson, Zoe R; Yang, Shang-Hsun; Chan, Anthony W S; Young, Larry J

2009-12-01

The study of alternative model organisms has yielded tremendous insights into the regulation of behavioral and physiological traits not displayed by more widely used animal models, such as laboratory rats and mice. In particular, comparative approaches often exploit species ideally suited for investigating specific phenomenon. For instance, comparative studies of socially monogamous prairie voles and polygamous meadow voles have been instrumental toward gaining an understanding of the genetic and neurobiological basis of social bonding. However, laboratory studies of less commonly used organisms, such as prairie voles, have been limited by a lack of genetic tools, including the ability to manipulate the genome. Here, we show that lentiviral vector-mediated transgenesis is a rapid and efficient approach for creating germline transgenics in alternative laboratory rodents. Injection of a green fluorescent protein (GFP)-expressing lentiviral vector into the perivitelline space of 23 single-cell embryos yielded three live offspring (13 %), one of which (33%) contained germline integration of a GFP transgene driven by the human ubiquitin-C promoter. In comparison, transfer of 23 uninjected embryos yielded six live offspring (26%). Green fluorescent protein is present in all tissues examined and is expressed widely in the brain. The GFP transgene is heritable and stably expressed until at least the F(2) generation. This technology has the potential to allow investigation of specific gene candidates in prairie voles and provides a general protocol to pursue germline transgenic manipulation in many different rodent species.

DNMT 1 maintains hypermethylation of CAG promoter specific region and prevents expression of exogenous gene in fat-1 transgenic sheep.

Science.gov (United States)

Yang, Chunrong; Shang, Xueying; Cheng, Lei; Yang, Lei; Liu, Xuefei; Bai, Chunling; Wei, Zhuying; Hua, Jinlian; Li, Guangpeng

2017-01-01

Methylation is an important issue in gene expression regulation and also in the fields of genetics and reproduction. In this study, we created fat-1 transgenic sheep, investigated the fine-mapping and the modulatory mechanisms of promoter methylation. Sheep fetal fibroblasts were transfected by pCAG-fat1-IRES-EGFP. Monoclonal cell line was screened as nuclear donor and carried out nuclear transfer (441 transgenic cloned embryos, 52 synchronism recipient sheep). Six offsprings were obtained. Expressions of exogenous genes fat-1 and EGFP were detectable in 10 examined tissues and upregulated omega-3 fatty acid content. Interestingly, more or less EGFP negative cells were detectable in the positive transgenic fetal skin cells. EGFP negative and positive cells were sorted by flow cytometry, and their methylation status in the whole promoter region (1701 nt) were investigated by bisulphate sequencing. The fine-mapping of methylation in CAG promoter were proposed. The results suggested that exogenous gene expression was determined by the methylation status from 721-1346 nt and modulated by methylation levels at 101, 108 and 115 nt sites in CAG promoter. To clarify the regulatory mechanism of methylation, examination of four DNA methyltransferases (DNMTs) demonstrated that hypermethylation of CAG promoter is mainly maintained by DNMT 1 in EGFP negative cells. Furthermore, investigation of the cell surface antigen CD34, CD45 and CD166 indicated that EGFP positive and negative cells belong to different types. The present study systematically clarified methylation status of CAG promoter in transgenic sheep and regulatory mechanism, which will provide research strategies for gene expression regulation in transgenic animals.

What Are Reasons for the Large Gender Differences in the Lethality of Suicidal Acts? An Epidemiological Analysis in Four European Countries.

Science.gov (United States)

Mergl, Roland; Koburger, Nicole; Heinrichs, Katherina; Székely, András; Tóth, Mónika Ditta; Coyne, James; Quintão, Sónia; Arensman, Ella; Coffey, Claire; Maxwell, Margaret; Värnik, Airi; van Audenhove, Chantal; McDaid, David; Sarchiapone, Marco; Schmidtke, Armin; Genz, Axel; Gusmão, Ricardo; Hegerl, Ulrich

2015-01-01

In Europe, men have lower rates of attempted suicide compared to women and at the same time a higher rate of completed suicides, indicating major gender differences in lethality of suicidal behaviour. The aim of this study was to analyse the extent to which these gender differences in lethality can be explained by factors such as choice of more lethal methods or lethality differences within the same suicide method or age. In addition, we explored gender differences in the intentionality of suicide attempts. Methods. Design: Epidemiological study using a combination of self-report and official data. Setting: Mental health care services in four European countries: Germany, Hungary, Ireland, and Portugal. Data basis: Completed suicides derived from official statistics for each country (767 acts, 74.4% male) and assessed suicide attempts excluding habitual intentional self-harm (8,175 acts, 43.2% male). Main Outcome Measures and Data Analysis. We collected data on suicidal acts in eight regions of four European countries participating in the EU-funded "OSPI-Europe"-project (www.ospi-europe.com). We calculated method-specific lethality using the number of completed suicides per method * 100 / (number of completed suicides per method + number of attempted suicides per method). We tested gender differences in the distribution of suicidal acts for significance by using the χ2-test for two-by-two tables. We assessed the effect sizes with phi coefficients (φ). We identified predictors of lethality with a binary logistic regression analysis. Poisson regression analysis examined the contribution of choice of methods and method-specific lethality to gender differences in the lethality of suicidal acts. Suicidal acts (fatal and non-fatal) were 3.4 times more lethal in men than in women (lethality 13.91% (regarding 4106 suicidal acts) versus 4.05% (regarding 4836 suicidal acts)), the difference being significant for the methods hanging, jumping, moving objects, sharp objects

Chronic Exposure of Corals to Fine Sediments: Lethal and Sub-Lethal Impacts

Science.gov (United States)

Flores, Florita; Hoogenboom, Mia O.; Smith, Luke D.; Cooper, Timothy F.; Abrego, David; Negri, Andrew P.

2012-01-01

Understanding the sedimentation and turbidity thresholds for corals is critical in assessing the potential impacts of dredging projects in tropical marine systems. In this study, we exposed two species of coral sampled from offshore locations to six levels of total suspended solids (TSS) for 16 weeks in the laboratory, including a 4 week recovery period. Dose-response relationships were developed to quantify the lethal and sub-lethal thresholds of sedimentation and turbidity for the corals. The sediment treatments affected the horizontal foliaceous species (Montipora aequituberculata) more than the upright branching species (Acropora millepora). The lowest sediment treatments that caused full colony mortality were 30 mg l−1 TSS (25 mg cm−2 day−1) for M. aequituberculata and 100 mg l−1 TSS (83 mg cm−2 day−1) for A. millepora after 12 weeks. Coral mortality generally took longer than 4 weeks and was closely related to sediment accumulation on the surface of the corals. While measurements of damage to photosystem II in the symbionts and reductions in lipid content and growth indicated sub-lethal responses in surviving corals, the most reliable predictor of coral mortality in this experiment was long-term sediment accumulation on coral tissue. PMID:22662225

Chronic exposure of corals to fine sediments: lethal and sub-lethal impacts.

Directory of Open Access Journals (Sweden)

Florita Flores

Full Text Available Understanding the sedimentation and turbidity thresholds for corals is critical in assessing the potential impacts of dredging projects in tropical marine systems. In this study, we exposed two species of coral sampled from offshore locations to six levels of total suspended solids (TSS for 16 weeks in the laboratory, including a 4 week recovery period. Dose-response relationships were developed to quantify the lethal and sub-lethal thresholds of sedimentation and turbidity for the corals. The sediment treatments affected the horizontal foliaceous species (Montipora aequituberculata more than the upright branching species (Acropora millepora. The lowest sediment treatments that caused full colony mortality were 30 mg l(-1 TSS (25 mg cm(-2 day(-1 for M. aequituberculata and 100 mg l(-1 TSS (83 mg cm(-2 day(-1 for A. millepora after 12 weeks. Coral mortality generally took longer than 4 weeks and was closely related to sediment accumulation on the surface of the corals. While measurements of damage to photosystem II in the symbionts and reductions in lipid content and growth indicated sub-lethal responses in surviving corals, the most reliable predictor of coral mortality in this experiment was long-term sediment accumulation on coral tissue.

Vast potential for using the piggyBac transposon to engineer transgenic plants

Science.gov (United States)

The acceptance of bioengineered plants by some nations is hampered by a number of factors, including the random insertion of a transgene into the host genome. Emerging technologies, such as site-specific nucleases, are enabling plant scientists to promote recombination or mutations at specific plant...

Transgenic mice display hair loss and regrowth overexpressing mutant Hr gene.

Science.gov (United States)

Zhu, Kuicheng; Xu, Cunshuan; Zhang, Jintao; Chen, Yingying; Liu, Mengduan

2017-10-30

Mutations in the hairless (Hr) gene in both mice and humans have been implicated in the development of congenital atrichia, but the role of Hr in skin and hair follicle (HF) biology remains unknown. Here, we established transgenic mice (TG) overexpressing mutant Hr to investigate its specific role in the development of HF. Three transgenic lines were successfully constructed, and two of them (TG3 and TG8) displayed a pattern of hair loss and regrowth with alternation in the expression of HR protein. The mutant Hr gene inhibited the expression of the endogenous gene in transgenic individuals, which led to the development of alopecia. Interestingly, the hair regrew with the increase in the endogenous expression levels resulting from decreased mutant Hr expression. The findings of our study indicate that the changes in the expression of Hr result in hair loss or regrowth.

Targeting of Mesenchymal Stromal Cells by Cre-Recombinase Transgenes Commonly Used to Target Osteoblast Lineage Cells.

Science.gov (United States)

Zhang, Jingzhu; Link, Daniel C

2016-11-01

The targeting specificity of tissue-specific Cre-recombinase transgenes is a key to interpreting phenotypes associated with their use. The Ocn-Cre and Dmp1-Cre transgenes are widely used to target osteoblasts and osteocytes, respectively. Here, we used high-resolution microscopy of bone sections and flow cytometry to carefully define the targeting specificity of these transgenes. These transgenes were crossed with Cxcl12 gfp mice to identify Cxcl12-abundant reticular (CAR) cells, which are a perivascular mesenchymal stromal population implicated in hematopoietic stem/progenitor cell maintenance. We show that in addition to osteoblasts, Ocn-Cre targets a majority of CAR cells and arteriolar pericytes. Surprisingly, Dmp1-Cre also targets a subset of CAR cells, in which expression of osteoblast-lineage genes is enriched. Finally, we introduce a new tissue-specific Cre-recombinase, Tagln-Cre, which efficiently targets osteoblasts, a majority of CAR cells, and both venous sinusoidal and arteriolar pericytes. These data show that Ocn-Cre and Dmp1-Cre target broader stromal cell populations than previously appreciated and may aid in the design of future studies. Moreover, these data highlight the heterogeneity of mesenchymal stromal cells in the bone marrow and provide tools to interrogate this heterogeneity. © 2016 American Society for Bone and Mineral Research. © 2016 American Society for Bone and Mineral Research.

CD4+ T cells targeting dominant and cryptic epitopes from Bacillus anthracis Lethal Factor

Directory of Open Access Journals (Sweden)

Stephanie eAscough

2016-01-01

Full Text Available Anthrax is an endemic infection in many countries, particularly in the developing world. The causative agent, Bacillus anthracis, mediates disease through the secretion of binary exotoxins. Until recently, research into adaptive immunity targeting this bacterial pathogen has largely focused on the humoral response to these toxins. There is, however, growing recognition that cellular immune responses involving IFNγ producing CD4+ T cells also contribute significantly to a protective memory response. An established concept in adaptive immunity to infection is that during infection of host cells, new microbial epitopes may be revealed, leading to immune recognition of so called ‘cryptic’ or ‘subdominant’ epitopes. We analysed the response to both cryptic and immunodominant T cell epitopes derived from the toxin component lethal factor and presented by a range of HLA-DR alleles. Using IFNγ-ELISPOT assays we characterised epitopes that elicited a response following immunisation with synthetic peptide and the whole protein and tested their capacities to bind purified HLA-DR molecules in vitro. We found that DR1 transgenics demonstrated T cell responses to a greater number of domain III cryptic epitopes than other HLA-DR transgenics, and that this pattern was repeated with the immunodominant epitopes, a greater proportion of these epitopes induced a T cell response when presented within the context of the whole protein. Immunodominant epitopes LF457-476 and LF467-487 were found to induce a T cell response to the peptide, as well as to the whole native LF protein in DR1 and DR15, but not in DR4 trangenics. The analysis of Domain I revealed the presence of several unique cryptic epitopes all of which showed a strong to moderate relative binding affinity to HLA-DR4 molecules. However, none of the cryptic epitopes from either domain III or I displayed notably high binding affinities across all HLA-DR alleles assayed. These responses were

Progress on researches of transgenic alfalfa

International Nuclear Information System (INIS)

Guo Huiqin; Wang Mi; Ren Weibo; Xu Zhu; Chen Libo

2010-01-01

In this paper, the progress on the researches of transgenic alfalfa in the past two decades had been reviewed in the aspects of regeneration system, transformation, improvement of the important traits and so on. Moreover, such problems as variation of transgene expression and safety of transgenic plant had also been discussed and propose had been given for the future research work. (authors)

[Chromosomal localization of foreign genes in transgenic mice using dual-color fluorescence in situ hybridization].

Science.gov (United States)

Lin, Dan; Gong, Xiu-li; Li, Wei; Guo, Xin-bing; Zhu, Yi-wen; Huang, Ying

2008-02-01

To establish a highly sensitive and specific dual-color fluorescence in situ hybridization (D-FISH) method used for chromosomal localization of foreign genes in double transgenic mice. Two strains of double transgenic mice were used in this experiment, one was integrated with the herpes simplex virus thymidine kinase (HSV-tk) and the enhanced green fluorescence protein (eGFP), the other was with the short hairpin RNA interference(RNAi) and beta(654). Splenic cells cultured in vitro were arrested in metaphase by colchicine and hybridized with digoxigenin-labeled and biotinylated DNA probes, then detected by rhodamine-conjugated avidin and FITC-conjugated anti-digoxigenin. Dual-color fluorescence signals were detected on the same metaphase in both transgenic mice strains. In HSV-tk/eGFP double transgenic mice, strong green fluorescence for HSV-tk and red for eGFP were observed and localized at 2E5-G3 and 8A2-A4 respectively. In beta(654)/RNAi mice, beta(654) was detected as red fluorescence on chromosome 7D3-E2, and RNAi showed random integration on chromosomes. It was detected as green fluorescence on chromosome 12B1 in one mouse, while on 1E2.3-1F and 3A3 in the other. Highly sensitive and specific D-FISH method was established using the self-prepared DNA probes, and chromosomal localization of the foreign genes was also performed in combination with G-banding in double transgenic mice. This technology will facilitate the researches in transgenic animals and gene therapy models.

Molecular basis of the mutagenic and lethal effects of ultraviolet irradiation

International Nuclear Information System (INIS)

Grossman, L.

1982-01-01

Using bacteria as a model, the molecular basis of the mutagenic and lethal effects of uv radiation is being studied. Attention is focused on the mechanism of action of uv-1 specific endonucleases in the repair of damaged DNA. The isolation and identification of similar enzymes in human cells are being conducted concurrently

Transgenics, agroindustry and food sovereignty

Directory of Open Access Journals (Sweden)

Xavier Alejandro León Vega

2014-10-01

Full Text Available Food sovereignty has been implemented constitutionally in Ecuador; however, many of the actions and policies are designed to benefit the dominant model of food production, based in agroindustry, intensive monocultures, agrochemicals and transgenics. This article reflects upon the role of family farming as a generator of food sovereignty, and secondly the threat to them by agroindustry agriculture based in transgenic. The role played by food aid in the introduction of transgenic in Latin America and other regions of the world is also analyzed.

Effective generation of transgenic pigs and mice by linker based sperm-mediated gene transfer.

Directory of Open Access Journals (Sweden)

Shih Ping Yao

2002-04-01

Full Text Available Abstract Background Transgenic animals have become valuable tools for both research and applied purposes. The current method of gene transfer, microinjection, which is widely used in transgenic mouse production, has only had limited success in producing transgenic animals of larger or higher species. Here, we report a linker based sperm-mediated gene transfer method (LB-SMGT that greatly improves the production efficiency of large transgenic animals. Results The linker protein, a monoclonal antibody (mAb C, is reactive to a surface antigen on sperm of all tested species including pig, mouse, chicken, cow, goat, sheep, and human. mAb C is a basic protein that binds to DNA through ionic interaction allowing exogenous DNA to be linked specifically to sperm. After fertilization of the egg, the DNA is shown to be successfully integrated into the genome of viable pig and mouse offspring with germ-line transfer to the F1 generation at a highly efficient rate: 37.5% of pigs and 33% of mice. The integration is demonstrated again by FISH analysis and F2 transmission in pigs. Furthermore, expression of the transgene is demonstrated in 61% (35/57 of transgenic pigs (F0 generation. Conclusions Our data suggests that LB-SMGT could be used to generate transgenic animals efficiently in many different species.

α-Lipoic acid prevents lipotoxic cardiomyopathy in acyl CoA-synthase transgenic mice

International Nuclear Information System (INIS)

Lee, Young; Naseem, R. Haris; Park, Byung-Hyun; Garry, Daniel J.; Richardson, James A.; Schaffer, Jean E.; Unger, Roger H.

2006-01-01

α-Lipoic acid (α-LA) mimics the hypothalamic actions of leptin on food intake, energy expenditure, and activation of AMP-activated protein kinase (AMPK). To determine if, like leptin, α-LA protects against cardiac lipotoxicity, α-LA was fed to transgenic mice with cardiomyocyte-specific overexpression of the acyl CoA synthase (ACS) gene. Untreated ACS-transgenic mice died prematurely with increased triacylglycerol content and dilated cardiomyopathy, impaired systolic function and myofiber disorganization, apoptosis, and interstitial fibrosis on microscopy. In α-LA-treated ACS-transgenic mice heart size, echocardiogram and TG content were normal. Plasma TG fell 50%, hepatic-activated phospho-AMPK rose 6-fold, sterol regulatory element-binding protein-1c declined 50%, and peroxisome proliferator-activated receptor-γ cofactor-1α mRNA rose 4-fold. Since food restriction did not prevent lipotoxicity, we conclude that α-LA treatment, like hyperleptinemia, protects the heart of ACS-transgenic mice from lipotoxicity

Changes in oil content of transgenic soybeans expressing the yeast SLC1 gene.

Science.gov (United States)

Rao, Suryadevara S; Hildebrand, David

2009-10-01

The wild type (Wt) and mutant form of yeast (sphingolipid compensation) genes, SLC1 and SLC1-1, have been shown to have lysophosphatidic acid acyltransferase (LPAT) activities (Nageic et al. in J Biol Chem 269:22156-22163, 1993). Expression of these LPAT genes was reported to increase oil content in transgenic Arabidopsis and Brassica napus. It is of interest to determine if the TAG content increase would also be seen in soybeans. Therefore, the wild type SLC1 was expressed in soybean somatic embryos under the control of seed specific phaseolin promoter. Some transgenic somatic embryos and in both T2 and T3 transgenic seeds showed higher oil contents. Compared to controls, the average increase in triglyceride values went up by 1.5% in transgenic somatic embryos. A maximum of 3.2% increase in seed oil content was observed in a T3 line. Expression of the yeast Wt LPAT gene did not alter the fatty acid composition of the seed oil.

Diversity of arthropod community in transgenic poplar-cotton ecosystems.

Science.gov (United States)

Zhang, D J; Lu, Z Y; Liu, J X; Li, C L; Yang, M S

2015-12-02

Poplar-cotton agro-ecosystems are the main agricultural planting modes of plain cotton fields in China. Here, we performed a systematic survey of the diversity and population of arthropod communities in four different combination of poplar-cotton eco-systems, including I) non-transgenic poplar and non-transgenic cotton fields; II) non-transgenic poplar and transgenic cotton fields [Bacillus thuringiensis (Bt) cotton]; III) Bt transgenic poplar (high insect resistant strain Pb29) and non-transgenic cotton; and IV) transgenic poplar and transgenic cotton fields, over a period of 3 years. Based on the statistical methods used to investigate community ecology, the effects of transgenic ecosystems on the whole structure of the arthropod community, on the structure of arthropods in the nutritive layer, and on the similarity of arthropod communities were evaluated. The main results were as follows: the transgenic poplar-cotton ecosystem has a stronger inhibitory effect on insect pests and has no impact on the structure of the arthropod community, and therefore, maintains the diversity of the arthropod community. The character index of the community indicated that the structure of the arthropod community of the transgenic poplar-cotton ecosystem was better than that of the poplar-cotton ecosystem, and that system IV had the best structure. As for the abundance of nutritional classes, the transgenic poplar-cotton ecosystem was also better than that of the non-transgenic poplar-cotton ecosystem. The cluster analysis and similarity of arthropod communities between the four different transgenic poplar-cotton ecosystems illustrated that the structure of the arthropod community excelled in the small sample of the transgenic poplar-cotton ecosystems.

Generation of transgenic goats by pronuclear microinjection: a retrospective analysis of a commercial operation (1995-2012).

Science.gov (United States)

Gavin, W; Blash, S; Buzzell, N; Pollock, D; Chen, L; Hawkins, N; Howe, J; Miner, K; Pollock, J; Porter, C; Schofield, M; Echelard, Y; Meade, H

2018-02-01

Production of transgenic founder goats involves introducing and stably integrating an engineered piece of DNA into the genome of the animal. At LFB USA, the ultimate use of these transgenic goats is for the production of recombinant human protein therapeutics in the milk of these dairy animals. The transgene or construct typically links a milk protein specific promoter sequence, the coding sequence for the gene of interest, and the necessary downstream regulatory sequences thereby directing expression of the recombinant protein in the milk during the lactation period. Over the time period indicated (1995-2012), pronuclear microinjection was used in a number of programs to insert transgenes into 18,120, 1- or 2- cell stage fertilized embryos. These embryos were transferred into 4180 synchronized recipient females with 1934 (47%) recipients becoming pregnant, 2594 offspring generated, and a 109 (4.2%) of those offspring determined to be transgenic. Even with new and improving genome editing tools now available, pronuclear microinjection is still the predominant and proven technology used in this commercial setting supporting regulatory filings and market authorizations when producing founder transgenic animals with large transgenes (> 10 kb) such as those necessary for directing monoclonal antibody production in milk.

A screen for F1 hybrid male rescue reveals no major-effect hybrid lethality loci in the Drosophila melanogaster autosomal genome.

Science.gov (United States)

Cuykendall, Tawny N; Satyaki, P; Ji, Shuqing; Clay, Derek M; Edelman, Nathaniel B; Kimchy, Alexandra; Li, Ling-Hei; Nuzzo, Erin A; Parekh, Neil; Park, Suna; Barbash, Daniel A

2014-10-27

Hybrid sons between Drosophila melanogaster females and D. simulans males die as 3rd instar larvae. Two genes, D. melanogaster Hybrid male rescue (Hmr) on the X chromosome, and D. simulans Lethal hybrid rescue (Lhr) on chromosome II, interact to cause this lethality. Loss-of-function mutations in either gene suppress lethality, but several pieces of evidence suggest that additional factors are required for hybrid lethality. Here we screen the D. melanogaster autosomal genome by using the Bloomington Stock Center Deficiency kit to search for additional regions that can rescue hybrid male lethality. Our screen is designed to identify putative hybrid incompatibility (HI) genes similar to Hmr and Lhr which, when removed, are dominant suppressors of lethality. After screening 89% of the autosomal genome, we found no regions that rescue males to the adult stage. We did, however, identify several regions that rescue up to 13% of males to the pharate adult stage. This weak rescue suggests the presence of multiple minor-effect HI loci, but we were unable to map these loci to high resolution, presumably because weak rescue can be masked by genetic background effects. We attempted to test one candidate, the dosage compensation gene male specific lethal-3 (msl-3), by using RNA interference with short hairpin microRNA constructs targeted specifically against D. simulans msl-3 but failed to achieve knockdown, in part due to off-target effects. We conclude that the D. melanogaster autosomal genome likely does not contain additional major-effect HI loci. We also show that Hmr is insufficient to fully account for the lethality associated with the D. melanogaster X chromosome, suggesting that additional X-linked genes contribute to hybrid lethality. Copyright © 2014 Cuykendall et al.

Proteomic characterization of a temperature-sensitive conditional lethal in Drosophila melanogaster

DEFF Research Database (Denmark)

Pedersen, Kamilla Sofie; Codrea, M.C; Vermeulen, Corneel

2010-01-01

Genetic variation that is expressed only under specific environmental conditions can contribute to additional adverse effects of inbreeding if environmental conditions change. We present a proteomic characterization of a conditional lethal found in an inbred line of Drosophila melanogaster. The l...

When Suicide Kills: An Empirical Analysis of the Lethality of Suicide Terrorism

Directory of Open Access Journals (Sweden)

Burcu Pinar Alakoc

2017-12-01

Full Text Available Why are some suicide terrorist attacks deadlier than others? Suicide bombers, unlike stationary bombs, are self-guided human weapons; they can deliver and detonate explosives at a specific time and place with precision. Coding and analyzing new data on over four hundred suicide terrorist incidents from all around the world between 1998 and 2015, this paper argues that the number of fatalities resulting from suicide attacks is a function of strategic choices made by the perpetrators, such as where to attack and whom to target. Results of this analysis show that suicide attacks that seize targets of opportunity are the most lethal. Specifically, suicide attacks that target civilians in enclosed and easily accessible places, and that are undertaken by multiple perpetrators result in the highest numbers of fatalities. Understanding these strategic tactical attributes of suicide terrorism is fundamental to devising effective counterterrorism strategies that aim at hardening soft targets and minimizing the lethal impact of these attacks.

THE POTENTIAL ROLE OF REMOTE SENSING IN TRANSGENIC CROP MONITORING PROGRAMS

Science.gov (United States)

Sustainable agriculture combines efficient production with wise stewardship of the earth's resources. Development of environmentally benign production techniques is one focus of sustainable agriculture. The new transgenic crops producing toxic proteins that target specific crop p...

An Empirical Assessment of Transgene Flow from a Bt Transgenic Poplar Plantation.

Directory of Open Access Journals (Sweden)

Jianjun Hu

Full Text Available To assess the possible impact of transgenic poplar plantations on the ecosystem, we analyzed the frequency and distance of gene flow from a mature male transgenic Populus nigra plantation carrying the Bacillus thuringiensis toxin gene (Bt poplar and the survival of Bt poplar seeds. The resultant Bt poplar seeds occurred at a frequency of ~0.15% at 0 m to ~0.02% at 500 m from the Bt poplar plantation. The germination of Bt poplar seeds diminished within three weeks in the field (germination rate from 68% to 0% compared to 48% after three weeks of storage at 4°C. The survival rate of seedlings in the field was 0% without any treatment but increased to 1.7% under the addition of four treatments (cleaning and trimming, watering, weeding, and covering with plastic film to maintain moisture after being seeded in the field for eight weeks. The results of this study indicate that gene flow originating from the Bt poplar plantation occurred at an extremely low level through pollen or seeds under natural conditions. This study provides first-hand field data on the extent of transgene flow in poplar plantations and offers guidance for the risk assessment of transgenic poplar plantations.

Impacts of elevated CO2 on exogenous Bacillus thuringiensis toxins and transgene expression in transgenic rice under different levels of nitrogen

OpenAIRE

Jiang, Shoulin; Lu, Yongqing; Dai, Yang; Qian, Lei; Muhammad, Adnan Bodlah; Li, Teng; Wan, Guijun; Parajulee, Megha N.; Chen, Fajun

2017-01-01

Recent studies have highlighted great challenges of transgene silencing for transgenic plants facing climate change. In order to understand the impacts of elevated CO2 on exogenous Bacillus thuringiensis (Bt) toxins and transgene expression in transgenic rice under different levels of N-fertilizer supply, we investigated the biomass, exogenous Bt toxins, Bt-transgene expression and methylation status in Bt rice exposed to two levels of CO2 concentrations and nitrogen (N) supply (1/8, 1/4, 1/2...

Isogenic transgenic homozygous fish induced by artificial parthenogenesis.

Science.gov (United States)

Nam, Y K; Cho, Y S; Kim, D S

2000-12-01

As a model system for vertebrate transgenesis, fish have many attractive advantages, especially with respect to the characteristics of eggs, allowing us to produce isogenic, transgenic, homozygous vertebrates by combining with chromosome-set manipulation. Here, we describe the large-scale production of isogenic transgenic homozygous animals using our experimental organism, the mud loach Misgurnus mizolepis, by the simple process of artificial parthenogenesis in a single generation. These isogenic fish have retained transgenic homozygous status in a stable manner during the subsequent 5 years, and exhibited increased levels of transgene expression. Furthermore, their isogenic nature was confirmed by cloned transgenic homozygous offspring produced via another step of parthenogenic reproduction of the isogenic homozygous transgenic fish. These results demonstrate that a combination of transgenesis and artificial parthenogenesis will make the rapid utilization of genetically pure homozygous transgenic system in vertebrate transgenesis possible.

Myxoma virus M130R is a novel virulence factor required for lethal myxomatosis in rabbits.

Science.gov (United States)

Barrett, John W; Werden, Steven J; Wang, Fuan; McKillop, William M; Jimenez, June; Villeneuve, Danielle; McFadden, Grant; Dekaban, Gregory A

2009-09-01

Myxoma virus (MV) is a highly lethal, rabbit-specific poxvirus that induces a disease called myxomatosis in European rabbits. In an effort to understand the function of predicted immunomodulatory genes we have deleted various viral genes from MV and tested the ability of these knockout viruses to induce lethal myxomatosis. MV encodes a unique 15 kD cytoplasmic protein (M130R) that is expressed late (12h post infection) during infection. M130R is a non-essential gene for MV replication in rabbit, monkey or human cell lines. Construction of a targeted gene knockout virus (vMyx130KO) and infection of susceptible rabbits demonstrate that the M130R knockout virus is attenuated and that loss of M130R expression allows the rabbit host immune system to effectively respond to and control the lethal effects of MV. M130R expression is a bona fide poxviral virulence factor necessary for full and lethal development of myxomatosis.

A bioinformatics approach for identifying transgene insertion sites using whole genome sequencing data.

Science.gov (United States)

Park, Doori; Park, Su-Hyun; Ban, Yong Wook; Kim, Youn Shic; Park, Kyoung-Cheul; Kim, Nam-Soo; Kim, Ju-Kon; Choi, Ik-Young

2017-08-15

Genetically modified crops (GM crops) have been developed to improve the agricultural traits of modern crop cultivars. Safety assessments of GM crops are of paramount importance in research at developmental stages and before releasing transgenic plants into the marketplace. Sequencing technology is developing rapidly, with higher output and labor efficiencies, and will eventually replace existing methods for the molecular characterization of genetically modified organisms. To detect the transgenic insertion locations in the three GM rice gnomes, Illumina sequencing reads are mapped and classified to the rice genome and plasmid sequence. The both mapped reads are classified to characterize the junction site between plant and transgene sequence by sequence alignment. Herein, we present a next generation sequencing (NGS)-based molecular characterization method, using transgenic rice plants SNU-Bt9-5, SNU-Bt9-30, and SNU-Bt9-109. Specifically, using bioinformatics tools, we detected the precise insertion locations and copy numbers of transfer DNA, genetic rearrangements, and the absence of backbone sequences, which were equivalent to results obtained from Southern blot analyses. NGS methods have been suggested as an effective means of characterizing and detecting transgenic insertion locations in genomes. Our results demonstrate the use of a combination of NGS technology and bioinformatics approaches that offers cost- and time-effective methods for assessing the safety of transgenic plants.

The effects of Fe2O3 nanoparticles on physiology and insecticide activity in non-transgenic and Bt-transgenic cotton

Directory of Open Access Journals (Sweden)

Nhan eLe Van

2016-01-01

Full Text Available As the demands for nanotechnology and nanoparticle (NP applications in agriculture increase, the ecological risk has drawn more attention because of the unpredictable results of interactions between NPs and transgenic crops. In this study, we investigated the effects of various concentrations of Fe2O3 NPs on Bt-transgenic cotton in comparison with conventional cotton for 10 days. Each treatment was conducted in triplicate, and each experiment was repeated three times. Results demonstrated that Fe2O3 nanoparticles (NPs inhibited the plant height and root length of Bt-transgenic cotton and promoted root hairs and biomass of non-transgenic cotton. Nutrients such as Na and K in Bt-transgenic cotton roots increased, while Zn contents decreased with Fe2O3 NPs. Most hormones in the roots of Bt-transgenic cotton increased at low Fe2O3 NP exposure (100 mg·L−1 but decreased at high concentrations of Fe2O3 NPs (1000 mg·L−1. Fe2O3 NPs increased the Bt-toxin in leaves and roots of Bt-transgenic cotton. Fe2O3 NPs were absorbed into roots, then transported to the shoots of both Bt-transgenic and non-transgenic cottons. The bioaccumulation of Fe2O3 NPs in plants might be a potential risk for agricultural crops and affect the environment and human health.

Focal glomerulosclerosis in proviral and c-fms transgenic mice links Vpr expression to HIV-associated nephropathy

International Nuclear Information System (INIS)

Dickie, Peter; Roberts, Amanda; Uwiera, Richard; Witmer, Jennifer; Sharma, Kirti; Kopp, Jeffrey B.

2004-01-01

Clinical and morphologic features of human immunodeficiency virus (HIV)-associated nephropathy (HIVAN), such as proteinuria, sclerosing glomerulopathy, tubular degeneration, and interstitial disease, have been modeled in mice bearing an HIV proviral transgene rendered noninfectious through a deletion in gag/pol. Exploring the genetic basis of HIVAN, HIV transgenic mice bearing mutations in either or both of the accessory genes nef and vpr were created. Proteinuria and focal glomerulosclerosis (FGS) only developed in mice with an intact vpr gene. Transgenic mice bearing a simplified proviral DNA (encoding only Tat and Vpr) developed renal disease characterized by FGS in which Vpr protein was localized to glomerular and tubular epithelia by immunohistochemistry. The dual transgenic progeny of HIV[Tat/Vpr] mice bred to HIV[ΔVpr] proviral transgenic mice displayed a more severe nephropathy with no apparent increase in Vpr expression, implying that multiple viral genes contribute to HIVAN. However, the unique contribution of macrophage-specific Vpr expression in the development of glomerular disease was underscored by the induction of FGS in multiple murine lines bearing a c-fms/vpr transgene

Transgene flow: Facts, speculations and possible countermeasures

Science.gov (United States)

Ryffel, Gerhart U

2014-01-01

Convincing evidence has accumulated that unintended transgene escape occurs in oilseed rape, maize, cotton and creeping bentgrass. The escaped transgenes are found in variant cultivars, in wild type plants as well as in hybrids of sexually compatible species. The fact that in some cases stacked events are present that have not been planted commercially, implies unintended recombination of transgenic traits. As the consequences of this continuous transgene escape for the ecosystem cannot be reliably predicted, I propose to use more sophisticated approaches of gene technology in future. If possible GM plants should be constructed using either site-directed mutagenesis or cisgenic strategies to avoid the problem of transgene escape. In cases where a transgenic trait is needed, efficient containment should be the standard approach. Various strategies available or in development are discussed. Such a cautious approach in developing novel types of GM crops will enhance the sustainable potential of GM crops and thus increase the public trust in green gene technology. PMID:25523171

Transgenic Epigenetics: Using Transgenic Organisms to Examine Epigenetic Phenomena

Directory of Open Access Journals (Sweden)

Lori A. McEachern

2012-01-01

Full Text Available Non-model organisms are generally more difficult and/or time consuming to work with than model organisms. In addition, epigenetic analysis of model organisms is facilitated by well-established protocols, and commercially-available reagents and kits that may not be available for, or previously tested on, non-model organisms. Given the evolutionary conservation and widespread nature of many epigenetic mechanisms, a powerful method to analyze epigenetic phenomena from non-model organisms would be to use transgenic model organisms containing an epigenetic region of interest from the non-model. Interestingly, while transgenic Drosophila and mice have provided significant insight into the molecular mechanisms and evolutionary conservation of the epigenetic processes that target epigenetic control regions in other model organisms, this method has so far been under-exploited for non-model organism epigenetic analysis. This paper details several experiments that have examined the epigenetic processes of genomic imprinting and paramutation, by transferring an epigenetic control region from one model organism to another. These cross-species experiments demonstrate that valuable insight into both the molecular mechanisms and evolutionary conservation of epigenetic processes may be obtained via transgenic experiments, which can then be used to guide further investigations and experiments in the species of interest.

Disruption of murine mp29/Syf2/Ntc31 gene results in embryonic lethality with aberrant checkpoint response.

Directory of Open Access Journals (Sweden)

Chia-Hsin Chen

Full Text Available Human p29 is a putative component of spliceosomes, but its role in pre-mRNA is elusive. By siRNA knockdown and stable overexpression, we demonstrated that human p29 is involved in DNA damage response and Fanconi anemia pathway in cultured cells. In this study, we generated p29 knockout mice (mp29(GT/GT using the mp29 gene trap embryonic stem cells to study the role of mp29 in DNA damage response in vivo. Interruption of mp29 at both alleles resulted in embryonic lethality. Embryonic abnormality occurred as early as E6.5 in mp29(GT/GT mice accompanied with decreased mRNA levels of α-tubulin and Chk1. The reduction of α-tubulin and Chk1 mRNAs is likely due to an impaired post-transcriptional event. An aberrant G2/M checkpoint was found in mp29 gene trap embryos when exposed to aphidicolin and UV light. This embryonic lethality was rescued by crossing with mp29 transgenic mice. Additionally, the knockdown of zfp29 in zebrafish resulted in embryonic death at 72 hours of development postfertilization (hpf. A lower level of acetylated α-tubulin was also observed in zfp29 morphants. Together, these results illustrate an indispensable role of mp29 in DNA checkpoint response during embryonic development.

Age and lesion-induced increases of GDNF transgene expression in brain following intracerebral injections of DNA nanoparticles.

Science.gov (United States)

Yurek, D M; Hasselrot, U; Cass, W A; Sesenoglu-Laird, O; Padegimas, L; Cooper, M J

2015-01-22

In previous studies that used compacted DNA nanoparticles (DNP) to transfect cells in the brain, we observed higher transgene expression in the denervated striatum when compared to transgene expression in the intact striatum. We also observed that long-term transgene expression occurred in astrocytes as well as neurons. Based on these findings, we hypothesized that the higher transgene expression observed in the denervated striatum may be a function of increased gliosis. Several aging studies have also reported an increase of gliosis as a function of normal aging. In this study we used DNPs that encoded for human glial cell line-derived neurotrophic factor (hGDNF) and either a non-specific human polyubiquitin C (UbC) or an astrocyte-specific human glial fibrillary acidic protein (GFAP) promoter. The DNPs were injected intracerebrally into the denervated or intact striatum of young, middle-aged or aged rats, and glial cell line-derived neurotrophic factor (GDNF) transgene expression was subsequently quantified in brain tissue samples. The results of our studies confirmed our earlier finding that transgene expression was higher in the denervated striatum when compared to intact striatum for DNPs incorporating either promoter. In addition, we observed significantly higher transgene expression in the denervated striatum of old rats when compared to young rats following injections of both types of DNPs. Stereological analysis of GFAP+ cells in the striatum confirmed an increase of GFAP+ cells in the denervated striatum when compared to the intact striatum and also an age-related increase; importantly, increases in GFAP+ cells closely matched the increases in GDNF transgene levels. Thus neurodegeneration and aging may lay a foundation that is actually beneficial for this particular type of gene therapy while other gene therapy techniques that target neurons are actually targeting cells that are decreasing as the disease progresses. Copyright © 2014 IBRO. Published by

[Gunshot wounds caused by non-lethal ammunition on the porcine model post-mortem].

Science.gov (United States)

Jabrocký, Peter; Pivko, Juraj; Vondráková, Mária; Tažký, Boris

2013-10-01

In this article we focus on the effects of so called non-lethal ammunition. We studied possible mechanism of firearm injury formation as a consequence of using firearm on the body, to present a more comprehensive material in wound ballistics. We pointed out possible actions of a projectile causes on human, respectively other animal organisms, as well as to a manner in which an injury is caused by rifles or shotguns using non-lethal ammunition with rubber projectiles. In the experiment, we have focused on macroscopic analysis of the tissue penetrated by a rubber projectile fired from a long firearm and pump-action shotgun while focusing on the anatomical-morphological analysis of entry wounds to determine the effectiveness respectively, the wounding potential of the projectile. The results of the experiment based on the macroscopic analysis of entry wounds, cavities and exit wounds, show that when a rubber projectile penetrates the body it causes loss of the tissue (i.e. the minus effect) and mechanical disruption of the tissue similar to lethal projectile. Based on the measures and ballistic computations we concluded that in specific cases, like for example in a close range hit, a penetration of vital organs can cause serious or even lethal injuries.

Transgenic Pm3 multilines of wheat show increased powdery mildew resistance in the field.

Science.gov (United States)

Brunner, Susanne; Stirnweis, Daniel; Diaz Quijano, Carolina; Buesing, Gabriele; Herren, Gerhard; Parlange, Francis; Barret, Pierre; Tassy, Caroline; Sautter, Christof; Winzeler, Michael; Keller, Beat

2012-05-01

Resistance (R) genes protect plants very effectively from disease, but many of them are rapidly overcome when present in widely grown cultivars. To overcome this lack of durability, strategies that increase host resistance diversity have been proposed. Among them is the use of multilines composed of near-isogenic lines (NILs) containing different disease resistance genes. In contrast to classical R-gene introgression by recurrent backcrossing, a transgenic approach allows the development of lines with identical genetic background, differing only in a single R gene. We have used alleles of the resistance locus Pm3 in wheat, conferring race-specific resistance to wheat powdery mildew (Blumeria graminis f. sp. tritici), to develop transgenic wheat lines overexpressing Pm3a, Pm3c, Pm3d, Pm3f or Pm3g. In field experiments, all tested transgenic lines were significantly more resistant than their respective nontransformed sister lines. The resistance level of the transgenic Pm3 lines was determined mainly by the frequency of virulence to the particular Pm3 allele in the powdery mildew population, Pm3 expression levels and most likely also allele-specific properties. We created six two-way multilines by mixing seeds of the parental line Bobwhite and transgenic Pm3a, Pm3b and Pm3d lines. The Pm3 multilines were more resistant than their components when tested in the field. This demonstrates that the difference in a single R gene is sufficient to cause host-diversity effects and that multilines of transgenic Pm3 wheat lines represent a promising strategy for an effective and sustainable use of Pm3 alleles. © 2011 The Authors. Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell Publishing Ltd.

Mining of lethal recessive genetic variation in Danish cattle

DEFF Research Database (Denmark)

Das, Ashutosh

2015-01-01

in fertility. The primary objective of this PhD projekt was to identify recessive lethal gentic variants in the main Danish dairy cattle breed. Holstein-Friesian utilzing next generation sequencing (NGS) data. This study shows a potential for the use of the NGS-based reverse genetic approach in identifying...... lethal or semi-lethal recessive gentic variation...

[Progress in transgenic fish techniques and application].

Science.gov (United States)

Ye, Xing; Tian, Yuan-Yuan; Gao, Feng-Ying

2011-05-01

Transgenic technique provides a new way for fish breeding. Stable lines of growth hormone gene transfer carps, salmon and tilapia, as well as fluorescence protein gene transfer zebra fish and white cloud mountain minnow have been produced. The fast growth characteristic of GH gene transgenic fish will be of great importance to promote aquaculture production and economic efficiency. This paper summarized the progress in transgenic fish research and ecological assessments. Microinjection is still the most common used method, but often resulted in multi-site and multi-copies integration. Co-injection of transposon or meganuclease will greatly improve the efficiency of gene transfer and integration. "All fish" gene or "auto gene" should be considered to produce transgenic fish in order to eliminate misgiving on food safety and to benefit expression of the transferred gene. Environmental risk is the biggest obstacle for transgenic fish to be commercially applied. Data indicates that transgenic fish have inferior fitness compared with the traditional domestic fish. However, be-cause of the genotype-by-environment effects, it is difficult to extrapolate simple phenotypes to the complex ecological interactions that occur in nature based on the ecological consequences of the transgenic fish determined in the laboratory. It is critical to establish highly naturalized environments for acquiring reliable data that can be used to evaluate the environ-mental risk. Efficacious physical and biological containment strategies remain to be crucial approaches to ensure the safe application of transgenic fish technology.

Glycoprotein-Specific Antibodies Produced by DNA Vaccination Protect Guinea Pigs from Lethal Argentine and Venezuelan Hemorrhagic Fever

Science.gov (United States)

Golden, Joseph W.; Maes, Piet; Kwilas, Steven A.; Ballantyne, John

2016-01-01

ABSTRACT Several members of the Arenaviridae can cause acute febrile diseases in humans, often resulting in lethality. The use of convalescent-phase human plasma is an effective treatment in humans infected with arenaviruses, particularly species found in South America. Despite this, little work has focused on developing potent and defined immunotherapeutics against arenaviruses. In the present study, we produced arenavirus neutralizing antibodies by DNA vaccination of rabbits with plasmids encoding the full-length glycoprotein precursors of Junín virus (JUNV), Machupo virus (MACV), and Guanarito virus (GTOV). Geometric mean neutralizing antibody titers, as measured by the 50% plaque reduction neutralization test (PRNT50), exceeded 5,000 against homologous viruses. Antisera against each targeted virus exhibited limited cross-species binding and, to a lesser extent, cross-neutralization. Anti-JUNV glycoprotein rabbit antiserum protected Hartley guinea pigs from lethal intraperitoneal infection with JUNV strain Romero when the antiserum was administered 2 days after challenge and provided some protection (∼30%) when administered 4 days after challenge. Treatment starting on day 6 did not protect animals. We further formulated an IgG antibody cocktail by combining anti-JUNV, -MACV, and -GTOV antibodies produced in DNA-vaccinated rabbits. This cocktail protected 100% of guinea pigs against JUNV and GTOV lethal disease. We then expanded on this cocktail approach by simultaneously vaccinating rabbits with a combination of plasmids encoding glycoproteins from JUNV, MACV, GTOV, and Sabia virus (SABV). Sera collected from rabbits vaccinated with the combination vaccine neutralized all four targets. These findings support the concept of using a DNA vaccine approach to generate a potent pan-arenavirus immunotherapeutic. IMPORTANCE Arenaviruses are an important family of emerging viruses. In infected humans, convalescent-phase plasma containing neutralizing antibodies can

Transgenic plants with enhanced growth characteristics

Energy Technology Data Exchange (ETDEWEB)

Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

2018-01-09

The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

Transgenic plants with enhanced growth characteristics

Energy Technology Data Exchange (ETDEWEB)

Unkefer, Pat J.; Anderson, Penelope S.; Knight, Thomas J.

2016-09-06

The invention relates to transgenic plants exhibiting dramatically enhanced growth rates, greater seed and fruit/pod yields, earlier and more productive flowering, more efficient nitrogen utilization, increased tolerance to high salt conditions, and increased biomass yields. In one embodiment, transgenic plants engineered to over-express both glutamine phenylpyruvate transaminase (GPT) and glutamine synthetase (GS) are provided. The GPT+GS double-transgenic plants of the invention consistently exhibit enhanced growth characteristics, with T0 generation lines showing an increase in biomass over wild type counterparts of between 50% and 300%. Generations that result from sexual crosses and/or selfing typically perform even better, with some of the double-transgenic plants achieving an astounding four-fold biomass increase over wild type plants.

Recent progress on technologies and applications of transgenic ...

African Journals Online (AJOL)

USER

2010-06-14

Jun 14, 2010 ... this, the methods for producing transgenic poultry must become routine. ... and spermatogonial stem cells (SSCs) have been developed to generate transgenic chickens. ... any procedure aimed at generating transgenic birds.

The Macrophage-Specific Promoter mfap4 Allows Live, Long-Term Analysis of Macrophage Behavior during Mycobacterial Infection in Zebrafish.

Directory of Open Access Journals (Sweden)

Eric M Walton

Full Text Available Transgenic labeling of innate immune cell lineages within the larval zebrafish allows for real-time, in vivo analyses of microbial pathogenesis within a vertebrate host. To date, labeling of zebrafish macrophages has been relatively limited, with the most specific expression coming from the mpeg1 promoter. However, mpeg1 transcription at both endogenous and transgenic loci becomes attenuated in the presence of intracellular pathogens, including Salmonella typhimurium and Mycobacterium marinum. Here, we describe mfap4 as a macrophage-specific promoter capable of producing transgenic lines in which transgene expression within larval macrophages remains stable throughout several days of infection. Additionally, we have developed a novel macrophage-specific Cre transgenic line under the control of mfap4, enabling macrophage-specific expression using existing floxed transgenic lines. These tools enrich the repertoire of transgenic lines and promoters available for studying zebrafish macrophage dynamics during infection and inflammation and add flexibility to the design of future macrophage-specific transgenic lines.

MR Microimaging of amyloid plaques in Alzheimer's disease transgenic mice

International Nuclear Information System (INIS)

Wengenack, Thomas M.; Poduslo, Joseph F.; Jack, Clifford R.; Garwood, Michael

2008-01-01

Alzheimer's disease (AD) is the most prevalent neurological condition affecting industrialized nations and will rapidly become a healthcare crisis as the population ages. Currently, the post-mortem histological observation of amyloid plaques and neurofibrillary tangles is the only definitive diagnosis available for AD. A pre-mortem biological or physiological marker specific for AD used in conjunction with current neurological and memory testing could add a great deal of confidence to the diagnosis of AD and potentially allow therapeutic intervention much earlier in the disease process. Our group has developed MRI techniques to detect individual amyloid plaques in AD transgenic mouse brain in vivo. We are also developing contrast-enhancing agents to increase the specificity of detection of amyloid plaques. Such in vivo imaging of amyloid plaques will also allow the evaluation of anti-amyloid therapies being developed by the pharmaceutical industry in pre-clinical trials of AD transgenic mice. This short review briefly discusses our progress in these areas. (orig.)

Germline excision of transgenes in Aedes aegypti by homing endonucleases.

Science.gov (United States)

Aryan, Azadeh; Anderson, Michelle A E; Myles, Kevin M; Adelman, Zach N

2013-01-01

Aedes (Ae.) aegypti is the primary vector for dengue viruses (serotypes1-4) and chikungunya virus. Homing endonucleases (HEs) are ancient selfish elements that catalyze double-stranded DNA breaks (DSB) in a highly specific manner. In this report, we show that the HEs Y2-I-AniI, I-CreI and I-SceI are all capable of catalyzing the excision of genomic segments from the Ae. aegypti genome in a heritable manner. Y2-I-AniI demonstrated the highest efficiency at two independent genomic targets, with 20-40% of Y2-I-AniI-treated individuals producing offspring that had lost the target transgene. HE-induced DSBs were found to be repaired via the single-strand annealing (SSA) and non-homologous end-joining (NHEJ) pathways in a manner dependent on the availability of direct repeat sequences in the transgene. These results support the development of HE-based gene editing and gene drive strategies in Ae. aegypti, and confirm the utility of HEs in the manipulation and modification of transgenes in this important vector.

Rapid development of stable transgene CHO cell lines by CRISPR/Cas9-mediated site-specific integration into C12orf35.

Science.gov (United States)

Zhao, Menglin; Wang, Jiaxian; Luo, Manyu; Luo, Han; Zhao, Meiqi; Han, Lei; Zhang, Mengxiao; Yang, Hui; Xie, Yueqing; Jiang, Hua; Feng, Lei; Lu, Huili; Zhu, Jianwei

2018-07-01

Chinese hamster ovary (CHO) cells are the most widely used mammalian hosts for recombinant protein production. However, by conventional random integration strategy, development of a high-expressing and stable recombinant CHO cell line has always been a difficult task due to the heterogenic insertion and its caused requirement of multiple rounds of selection. Site-specific integration of transgenes into CHO hot spots is an ideal strategy to overcome these challenges since it can generate isogenic cell lines with consistent productivity and stability. In this study, we investigated three sites with potential high transcriptional activities: C12orf35, HPRT, and GRIK1, to determine the possible transcriptional hot spots in CHO cells, and further construct a reliable site-specific integration strategy to develop recombinant cell lines efficiently. Genes encoding representative proteins mCherry and anti-PD1 monoclonal antibody were targeted into these three loci respectively through CRISPR/Cas9 technology. Stable cell lines were generated successfully after a single round of selection. In comparison with a random integration control, all the targeted integration cell lines showed higher productivity, among which C12orf35 locus was the most advantageous in both productivity and cell line stability. Binding affinity and N-glycan analysis of the antibody revealed that all batches of product were of similar quality independent on integrated sites. Deep sequencing demonstrated that there was low level of off-target mutations caused by CRISPR/Cas9, but none of them contributed to the development process of transgene cell lines. Our results demonstrated the feasibility of C12orf35 as the target site for exogenous gene integration, and strongly suggested that C12orf35 targeted integration mediated by CRISPR/Cas9 is a reliable strategy for the rapid development of recombinant CHO cell lines.

Isolation of the endosperm-specific LPAAT gene promoter from coconut (Cocos nucifera L.) and its functional analysis in transgenic rice plants.

Science.gov (United States)

Xu, Li; Ye, Rongjian; Zheng, Yusheng; Wang, Zhekui; Zhou, Peng; Lin, Yongjun; Li, Dongdong

2010-09-01

As one of the key tropical crops, coconut (Cocos nucifera L.) is a member of the monocotyledonous family Aracaceae (Palmaceae). In this study, we amplified the upstream region of an endosperm-specific expression gene, Lysophosphatidyl acyltransferase (LPAAT), from the coconut genomic DNA by chromosome walking. In this sequence, we found several types of promoter-related elements including TATA-box, CAAT-box and Skn1-motif. In order to further examine its function, three different 5'-deletion fragments were inserted into pBI101.3, a plant expression vector harboring the LPAAT upstream sequence, leading to pBI101.3-L1, pBI101.3-L2 and pBI101.3-L3, respectively. We obtained transgenic plants of rice by Agrobacterium-mediated callus transformation and plant regeneration and detected the expression of gus gene by histochemical staining and fluorometric determination. We found that gus gene driven by the three deletion fragments was specifically expressed in the endosperm of rice seeds, but not in the empty vector of pBI101.3 and other tissues. The highest expression level of GUS was at 15 DAF in pBI101.3-L3 and pBI101.3-L2 transgenic lines, while the same level was detected at 10 DAF in pBI101.3-L1. The expression driven by the whole fragment was up to 1.76- and 2.8-fold higher than those driven by the -817 bp and -453 bp upstream fragments, and 10.7-fold higher than that driven by the vector without the promoter. Taken together, our results strongly suggest that these promoter fragments from coconut have a significant potential in genetically improving endosperm in main crops.

Transgenic potato plants expressing cry3A gene confer resistance to Colorado potato beetle.

Science.gov (United States)

Mi, Xiaoxiao; Ji, Xiangzhuo; Yang, Jiangwei; Liang, Lina; Si, Huaijun; Wu, Jiahe; Zhang, Ning; Wang, Di

2015-07-01

The Colorado potato beetle (Leptinotarsa decemlineata Say, CPB) is a fatal pest, which is a quarantine pest in China. The CPB has now invaded the Xinjiang Uygur Autonomous Region and is constantly spreading eastward in China. In this study, we developed transgenic potato plants expressing cry3A gene. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the cry3A gene expressed in leaves, stems and roots of the transgenic plants under the control of CaMV 35S promoter, while they expressed only in leaves and stems under the control of potato leaf and stem-specific promoter ST-LS1. The mortality of the larvae was higher (28% and 36%) on the transgenic plant line 35S1 on the 3rd and 4th days, and on ST3 (48%) on the 5th day after inoculation with instar larvae. Insect biomass accumulation on the foliage of the transgenic plant lines 35S1, 35S2 and ST3 was significantly lower (0.42%, 0.43% and 0.42%). Foliage consumption was lowest on transgenic lines 35S8 and ST2 among all plant foliage (7.47 mg/larvae/day and 12.46 mg/larvae/day). The different transgenic plant foliages had varied inhibition to larval growth. The survivors on the transgenic lines obviously were smaller than their original size and extremely weak. The transgenic potato plants with CPB resistance could be used to develop germplasms or varieties for controlling CPB damage and halting its spread in China. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.

Radiation injuries of plasmatic membrane and lethal action of radiation on cells

Energy Technology Data Exchange (ETDEWEB)

Fomenko, B S; Akoev, I G [AN SSSR, Pushchino-na-Oke. Inst. Biologicheskoj Fiziki

1984-01-01

Data on modification of procaryotes and eukaryotes cell injuries using preparations not penetrating into cells and also membrane-specific drugs localized in cells in a lipid phase are generalized. A conclusion is drawn that radiation injuries of plasmatic membrane of prokaryotes and eukaryotes contribute considerably to lethal action of radiation on cells.

Radiation injuries of plasmatic membrane and lethal action of radiation on cells

International Nuclear Information System (INIS)

Fomenko, B.S.; Akoev, I.G.

1984-01-01

Data on modification of procaryotes and eukaryotes cell injuries using preparations not penetrating into cells and also membrane-specific drugs localized in cells in a lipid phase are generalized. A conclusion is drawn that radiation injuries of plasmatic membrane of prokaryotes and eukaryotes contribute considerably to lethal action of radiation on cells

The X-linked 1.688 Satellite in Drosophila melanogaster Promotes Specific Targeting by Painting of Fourth.

Science.gov (United States)

Kim, Maria; Ekhteraei-Tousi, Samaneh; Lewerentz, Jacob; Larsson, Jan

2018-02-01

Repetitive DNA, represented by transposons and satellite DNA, constitutes a large portion of eukaryotic genomes, being the major component of constitutive heterochromatin. There is a growing body of evidence that it regulates several nuclear functions including chromatin state and the proper functioning of centromeres and telomeres. The 1.688 satellite is one of the most abundant repetitive sequences in Drosophila melanogaster , with the longest array being located in the pericentromeric region of the X-chromosome. Short arrays of 1.688 repeats are widespread within the euchromatic part of the X-chromosome, and these arrays were recently suggested to assist in recognition of the X-chromosome by the dosage compensation male-specific lethal complex. We discovered that a short array of 1.688 satellite repeats is essential for recruitment of the protein POF to a previously described site on the X-chromosome ( PoX2 ) and to various transgenic constructs. On an isolated target, i.e. , an autosomic transgene consisting of a gene upstream of 1.688 satellite repeats, POF is recruited to the transgene in both males and females. The sequence of the satellite, as well as its length and position within the recruitment element, are the major determinants of targeting. Moreover, the 1.688 array promotes POF targeting to the roX1 -proximal PoX1 site in trans Finally, binding of POF to the 1.688-related satellite-enriched sequences is conserved in evolution. We hypothesize that the 1.688 satellite functioned in an ancient dosage compensation system involving POF targeting to the X-chromosome. Copyright © 2018 by the Genetics Society of America.

A R2R3-MYB transcription factor that is specifically expressed in cotton (Gossypium hirsutum) fibers affects secondary cell wall biosynthesis and deposition in transgenic Arabidopsis.

Science.gov (United States)

Sun, Xiang; Gong, Si-Ying; Nie, Xiao-Ying; Li, Yang; Li, Wen; Huang, Geng-Qing; Li, Xue-Bao

2015-07-01

Secondary cell wall (SCW) is an important industrial raw material for pulping, papermaking, construction, lumbering, textiles and potentially for biofuel production. The process of SCW thickening of cotton fibers lays down the cellulose that will constitute the bulk (up to 96%) of the fiber at maturity. In this study, a gene encoding a MYB-domain protein was identified in cotton (Gossypium hirsutum) and designated as GhMYBL1. Quantitative real-time polymerase chain reaction (RT-PCR) analysis revealed that GhMYBL1 was specifically expressed in cotton fibers at the stage of secondary wall deposition. Further analysis indicated that this protein is a R2R3-MYB transcription factor, and is targeted to the cell nucleus. Overexpression of GhMYBL1 in Arabidopsis affected the formation of SCW in the stem xylem of the transgenic plants. The enhanced SCW thickening also occurred in the interfascicular fibers, xylary fibers and vessels of the GhMYBL1-overexpression transgenic plants. The expression of secondary wall-associated genes, such as CesA4, CesA7, CesA8, PAL1, F5H and 4CL1, were upregulated, and consequently, cellulose and lignin biosynthesis were enhanced in the GhMYBL1 transgenic plants. These data suggested that GhMYBL1 may participate in modulating the process of secondary wall biosynthesis and deposition of cotton fibers. © 2014 Scandinavian Plant Physiology Society.

Regulation of Expression of the prb-1b / ACC Deaminase gene by UV-B in Transgenic tomatoes

International Nuclear Information System (INIS)

Tamot, B.K.; Pauls, K.P.; Glick, R.

2003-01-01

Transgenic tomato plants with 1-aminocyclopropane-1-carboxylic acid (ACC) deaminase gene from Enterobacter cloacae UWA4 under the control of a pathogenesis-related promoter (prb-1b) from tobacco were challenged by abiotic stresses to determine the expression patterns of the transgene. No ACC deaminase RNA or protein was detected bu RT-PCR and in western blots prepared from leaf proteins of transgenic plants after wounding or treatment with alpha-amino butyric acid, xylanase, ethephon, salicylic acid, jasmonic acid , ethylene, or ethylene plus jasmonic acid. However, expression of the ACC deaminase transgene was observed in leaves and roots of transformed tomato lines exposed to UV light. The UV response required a minimum of 48 h of exposure and was specific to UV-B light

Some characteristics of neoplastic cell transformation in transgenic mice.

Science.gov (United States)

Shvemberger, I N; Ermilov, A N

1996-01-01

The role of the expression of different cellular genes and viral oncogenes in malignant cell transformation is discussed. We pay special attention to the role of the genes for growth factors and their receptors and homeobox genes in oncogenesis. Based on both the literature and our own data, specific features of tumors developed in transgenic mice are discussed. All of these data are used to analyze current theories of multistep oncogenesis and the stochastic component in this process. We suggest that all known evidence about the mechanisms of oncogenesis be used in studying the problem at various structural and functional levels in an organism. The chapter shows that transgenic mice are a most suitable model for studying various aspects of malignant transformation from the molecular to the organismal and populational levels.

Transgene traceability in transgenic mice: a bioanalytical approach for potential gene-doping analysis.

Science.gov (United States)

Bogani, Patrizia; Spiriti, Maria Michela; Lazzarano, Stefano; Arcangeli, Annarosa; Buiatti, Marcello; Minunni, Maria

2011-11-01

The World Anti-Doping Agency fears the use of gene doping to enhance athletic performances. Thus, a bioanalytical approach based on end point PCR for detecting markers' of transgenesis traceability was developed. A few sequences from two different vectors using an animal model were selected and traced in different tissues and at different times. In particular, enhanced green fluorescent protein gene and a construct-specific new marker were targeted in the analysis. To make the developed detection approach open to future routine doping analysis, matrices such as urine and tears as well blood were also tested. This study will have impact in evaluating the vector transgenes traceability for the detection of a gene doping event by non-invasive sampling.

Lethality of Rendang packaged in multilayer retortable pouch with sterilization process

Science.gov (United States)

Praharasti, A. S.; Kusumaningrum, A.; Frediansyah, A.; Nurhikmat, A.; Khasanah, Y.; Suprapedi

2017-01-01

Retort Pouch had become a choice to preserve foods nowadays, besides the used of the can. Both had their own advantages, and Retort Pouch became more popular for the reason of cheaper and easier to recycle. General Method usually used to estimate the lethality of commercial heat sterilization process. Lethality value wa s used for evaluating the efficacy of the thermal process. This study aimed to find whether different layers of pouch materials affect the lethality value and to find differences lethality in two types of multilayer retort pouch, PET/Aluminum Foil/Nylon/RCPP and PET/Nylon/Modified Aluminum/CPP. The result showed that the different layer arrangement was resulted different Sterilization Value (SV). PET/Nylon/Modified Aluminum/CPP had better heat penetration, implied by the higher value of lethality. PET/Nylon/Modified Aluminum/CPP had the lethality value of 6,24 minutes, whereas the lethality value of PET/Aluminum Foil/Nylon/RCPP was 3,54 minutes.

IDENTIFICATION OF ESCAPED TRANSGENIC CREEPING BENTGRASS IN OREGON

Science.gov (United States)

When transgenic plants are cultivated near wild species that are sexually compatible with the crop, gene flow between the crop and wild plants is possible. A resultant concern is that transgene flow and transgene introgression within wild populations could have unintended ecologi...

Ectopic over-expression of peroxisomal ascorbate peroxidase (SbpAPX) gene confers salt stress tolerance in transgenic peanut (Arachis hypogaea).

Science.gov (United States)

Singh, Natwar; Mishra, Avinash; Jha, Bhavanath

2014-08-15

Peroxisomal ascorbate peroxidase gene (SbpAPX) of an extreme halophyte Salicornia brachiata imparts abiotic stress endurance and plays a key role in the protection against oxidative stress. The cloned SbpAPX gene was transformed to local variety of peanut and about 100 transgenic plants were developed using optimized in vitro regeneration and Agrobacterium mediated genetic transformation method. The T0 transgenic plants were confirmed for the gene integration; grown under controlled condition in containment green house facility; seeds were harvested and T1 plants were raised. Transgenic plants (T1) were further confirmed by PCR using gene specific primers and histochemical GUS assay. About 40 transgenic plants (T1) were selected randomly and subjected for salt stress tolerance study. Transgenic plants remained green however non-transgenic plants showed bleaching and yellowish leaves under salt stress conditions. Under stress condition, transgenic plants continued normal growth and completed their life cycle. Transgenic peanut plants exhibited adequate tolerance under salt stress condition and thus could be explored for the cultivation in salt affected areas for the sustainable agriculture. Copyright © 2014 Elsevier B.V. All rights reserved.

Chemical and radiation induced late dominant lethal effects in mice

International Nuclear Information System (INIS)

Favor, J.; Crenshaw, J.W. Jr.; Soares, E.R.

1978-01-01

Although theoretically expected, experimental data to date have not shown dominant lethal expression to occur throughout the developmental period. Specifically, late post-implantation effects have not been demonstrated. The authors routinely use an experimental technique in which parental females mated to mutagenically treated males are allowed to give birth and wean their litter, and their uterine horns are then inspected for uterine scars indicative of live and dead embryos. In a number of experiments in which males were mutagenically treated with either chemicals or X-irradiation, a discrepancy was observed between the number of live embryos as determined by the scar technique and the number of live observed at birth, suggesting the possibility of embryonic losses at a late stage in development. Initial analyses showed that mutagenic treatment increased the percentage of these late losses. These differences were statistically significant in 2 of 3 analyses. Factors affecting statistical significance and an understanding of dominant lethal mutations are discussed. (Auth.)

Accumulation of nickel in transgenic tobacco

Science.gov (United States)

Sidik, Nik Marzuki; Othman, Noor Farhan

2013-11-01

The accumulation of heavy metal Ni in the roots and leaves of four T1 transgenic lines of tobacco (T(1)20E, T(1)24C, T(1)18B1 and T(1)20B) expressing eiMT1 from E.indica was assessed. The aim of the study was to investigate the level of Ni accumulation in the leaves and roots of each transgenic lines and to evaluate the eligibility of the plants to be classified as a phytoremediation agent. All of the transgenic lines showed different ability in accumulating different metals and has translocation factor (TF) less than 1 (TFtransgenic lines, transgenic line T(1)24C showed the highest accumulation of Ni (251.9 ± 0.014 mg/kg) and the lowest TF value (TFT(1)24C=0.0875) at 60 ppm Ni.

A transgenic approach to study argininosuccinate synthetase gene expression

Science.gov (United States)

2014-01-01

Background Argininosuccinate synthetase (ASS) participates in urea, nitric oxide and arginine production. Besides transcriptional regulation, a post-transcriptional regulation affecting nuclear precursor RNA stability has been reported. To study whether such post-transcriptional regulation underlines particular temporal and spatial ASS expression, and to investigate how human ASS gene behaves in a mouse background, a transgenic mouse system using a modified bacterial artificial chromosome carrying the human ASS gene tagged with EGFP was employed. Results Two lines of ASS-EGFP transgenic mice were generated: one with EGFP under transcriptional control similar to that of the endogenous ASS gene, another with EGFP under both transcriptional and post-transcriptional regulation as that of the endogenous ASS mRNA. EGFP expression in the liver, the organ for urea production, and in the intestine and kidney that are responsible for arginine biosynthesis, was examined. Organs taken from embryos E14.5 stage to young adult were examined under a fluorescence microscope either directly or after cryosectioning. The levels of EGFP and endogenous mouse Ass mRNAs were also quantified by S1 nuclease mapping. EGFP fluorescence and EGFP mRNA levels in both the liver and kidney were found to increase progressively from embryonic stage toward birth. In contrast, EGFP expression in the intestine was higher in neonates and started to decline at about 3 weeks after birth. Comparison between the EGFP profiles of the two transgenic lines indicated the developmental and tissue-specific regulation was mainly controlled at the transcriptional level. The ASS transgene was of human origin. EGFP expression in the liver followed essentially the mouse Ass pattern as evidenced by zonation distribution of fluorescence and the level of EGFP mRNA at birth. However, in the small intestine, Ass mRNA level declined sharply at 3 week of age, and yet substantial EGFP mRNA was still detectable at this stage

Role of Human Na,K-ATPase alpha 4 in Sperm Function, Derived from Studies in Transgenic Mice

Science.gov (United States)

McDermott, Jeffrey; Sánchez, Gladis; Nangia, Ajay K.; Blanco, Gustavo

2014-01-01

SUMMARY Most of our knowledge on the biological role of the testis-specific Na,K-ATPase alpha 4 isoform derives from studies performed in non-human species. Here, we studied the function of human Na,K-ATPase alpha 4 after its expression in transgenic mice. Using a bacterial artificial chromosome (BAC) construct, containing the human ATP1A4 gene locus, we obtained expression of the human α4 transgene specifically in mouse sperm, enriched in the sperm flagellum. The expressed, human alpha 4 was active, and compared to wild-type sperm, those from transgenic mice displayed higher Na,K-ATPase alpha 4 activity and greater binding of fluorescently labeled ouabain, which is typical of the alpha 4 isoform. The expression and activity of endogenous alpha 4 and the other Na,K-ATPase alpha isoform present in sperm, alpha 1, remained unchanged. Male mice expressing the human ATP1A4 transgene exhibited similar testis size and morphology, normal sperm number and shape, and no changes in overall fertility compared to wild-type mice. Sperm carrying the human transgene exhibited enhanced total motility and an increase in multiple parameters of sperm movement, including higher sperm hyperactive motility. In contrast, no statistically significant changes in sperm membrane potential, protein tyrosine phosphorylation, or spontaneous acrosome reaction were found between wild-type and transgenic mice. Altogether, these results provide new genetic evidence for an important role of human Na,K-ATPase alpha 4 in sperm motility and hyperactivation, and establishes a new animal model for future studies of this isoform. PMID:25640246

Glycoprotein-Specific Antibodies Produced by DNA Vaccination Protect Guinea Pigs from Lethal Argentine and Venezuelan Hemorrhagic Fever.

Science.gov (United States)

Golden, Joseph W; Maes, Piet; Kwilas, Steven A; Ballantyne, John; Hooper, Jay W

2016-01-20

Several members of the Arenaviridae can cause acute febrile diseases in humans, often resulting in lethality. The use of convalescent-phase human plasma is an effective treatment in humans infected with arenaviruses, particularly species found in South America. Despite this, little work has focused on developing potent and defined immunotherapeutics against arenaviruses. In the present study, we produced arenavirus neutralizing antibodies by DNA vaccination of rabbits with plasmids encoding the full-length glycoprotein precursors of Junín virus (JUNV), Machupo virus (MACV), and Guanarito virus (GTOV). Geometric mean neutralizing antibody titers, as measured by the 50% plaque reduction neutralization test (PRNT(50)), exceeded 5,000 against homologous viruses. Antisera against each targeted virus exhibited limited cross-species binding and, to a lesser extent, cross-neutralization. Anti-JUNV glycoprotein rabbit antiserum protected Hartley guinea pigs from lethal intraperitoneal infection with JUNV strain Romero when the antiserum was administered 2 days after challenge and provided some protection (∼30%) when administered 4 days after challenge. Treatment starting on day 6 did not protect animals. We further formulated an IgG antibody cocktail by combining anti-JUNV, -MACV, and -GTOV antibodies produced in DNA-vaccinated rabbits. This cocktail protected 100% of guinea pigs against JUNV and GTOV lethal disease. We then expanded on this cocktail approach by simultaneously vaccinating rabbits with a combination of plasmids encoding glycoproteins from JUNV, MACV, GTOV, and Sabia virus (SABV). Sera collected from rabbits vaccinated with the combination vaccine neutralized all four targets. These findings support the concept of using a DNA vaccine approach to generate a potent pan-arenavirus immunotherapeutic. Arenaviruses are an important family of emerging viruses. In infected humans, convalescent-phase plasma containing neutralizing antibodies can mitigate the

USP22 regulates oncogenic signaling pathways to drive lethal cancer progression.

Science.gov (United States)

Schrecengost, Randy S; Dean, Jeffry L; Goodwin, Jonathan F; Schiewer, Matthew J; Urban, Mark W; Stanek, Timothy J; Sussman, Robyn T; Hicks, Jessica L; Birbe, Ruth C; Draganova-Tacheva, Rossitza A; Visakorpi, Tapio; DeMarzo, Angelo M; McMahon, Steven B; Knudsen, Karen E

2014-01-01

Increasing evidence links deregulation of the ubiquitin-specific proteases 22 (USP22) deubitiquitylase to cancer development and progression in a select group of tumor types, but its specificity and underlying mechanisms of action are not well defined. Here we show that USP22 is a critical promoter of lethal tumor phenotypes that acts by modulating nuclear receptor and oncogenic signaling. In multiple xenograft models of human cancer, modeling of tumor-associated USP22 deregulation demonstrated that USP22 controls androgen receptor accumulation and signaling, and that it enhances expression of critical target genes coregulated by androgen receptor and MYC. USP22 not only reprogrammed androgen receptor function, but was sufficient to induce the transition to therapeutic resistance. Notably, in vivo depletion experiments revealed that USP22 is critical to maintain phenotypes associated with end-stage disease. This was a significant finding given clinical evidence that USP22 is highly deregulated in tumors, which have achieved therapeutic resistance. Taken together, our findings define USP22 as a critical effector of tumor progression, which drives lethal phenotypes, rationalizing this enzyme as an appealing therapeutic target to treat advanced disease.

[Bladder tumor lethality. Results in the autonomous community of Rioja between 1975-1991].

Science.gov (United States)

Fernández Fernández, A; Gil Fabra, J; Fernández Ruíz, M; Angulo Castellanos, M G; Blanco Martín, E; Otero Mauricio, G

1998-01-01

Between 1975-1991, a total of 557 cases of bladder carcinoma were identified in the Autonomous Community of La Rioja (CAR) which were followed up to December 1994. The overall lethality was 21.9%. 492 cases with 22.35% lethality were identified in males. In females, however, there was 65 cases with 18.46% lethality. The comparison of males and females lethality resulted in p = 0.525. Lethality between cases diagnosed within each 5-year period analyzed is: 1975-1981: 177 cases, lethality 23.72%. 1982-1986: 168 cases, lethality 30.95%. 1987-1991: 212 cases, lethality 13.20%. Between the first and the second 5-year periods, p = 0.132; between the first and third 5-year periods p = 0.007 and between the second and third 5-year periods p CAR for a 22.35% lethality. Lethality is higher in males that in females but the difference is not statistically significant. In the last 5-year period assessed, 1987-1991, a reduction of lethality from bladder neoplasms has been documented.

Arrest of irradiated G1, S, or G2 cells at mitosis using nocodazole promotes repair of potentially lethal damage

International Nuclear Information System (INIS)

Iliakis, G.; Nuesse, M.

1984-01-01

The ability of synchronized Ehrlich ascites tumor cells, irradiated in G1, S, and G2 phases, to repair potentially lethal damage when arrested at mitosis by using 0.4 μg/ml nocodazole, a specific inhibitor of microtubule polymerization, has been studied. Cells irradiated in these phases were found to repair potentially lethal damage at mitosis. The extent of this repair was similar to that observed for cells irradiated at the same stages in the cell cycle but allowed to repair potentially lethal damage by incubating in balanced salt solution for 6 hr after X irradiation

Successful adaptation to ketosis by mice with tissue-specific deficiency of ketone body oxidation.

Science.gov (United States)

Cotter, David G; Schugar, Rebecca C; Wentz, Anna E; d'Avignon, D André; Crawford, Peter A

2013-02-15

During states of low carbohydrate intake, mammalian ketone body metabolism transfers energy substrates originally derived from fatty acyl chains within the liver to extrahepatic organs. We previously demonstrated that the mitochondrial enzyme coenzyme A (CoA) transferase [succinyl-CoA:3-oxoacid CoA transferase (SCOT), encoded by nuclear Oxct1] is required for oxidation of ketone bodies and that germline SCOT-knockout (KO) mice die within 48 h of birth because of hyperketonemic hypoglycemia. Here, we use novel transgenic and tissue-specific SCOT-KO mice to demonstrate that ketone bodies do not serve an obligate energetic role within highly ketolytic tissues during the ketogenic neonatal period or during starvation in the adult. Although transgene-mediated restoration of myocardial CoA transferase in germline SCOT-KO mice is insufficient to prevent lethal hyperketonemic hypoglycemia in the neonatal period, mice lacking CoA transferase selectively within neurons, cardiomyocytes, or skeletal myocytes are all viable as neonates. Like germline SCOT-KO neonatal mice, neonatal mice with neuronal CoA transferase deficiency exhibit increased cerebral glycolysis and glucose oxidation, and, while these neonatal mice exhibit modest hyperketonemia, they do not develop hypoglycemia. As adults, tissue-specific SCOT-KO mice tolerate starvation, exhibiting only modestly increased hyperketonemia. Finally, metabolic analysis of adult germline Oxct1(+/-) mice demonstrates that global diminution of ketone body oxidation yields hyperketonemia, but hypoglycemia emerges only during a protracted state of low carbohydrate intake. Together, these data suggest that, at the tissue level, ketone bodies are not a required energy substrate in the newborn period or during starvation, but rather that integrated ketone body metabolism mediates adaptation to ketogenic nutrient states.

Mice orally immunized with a transgenic plant expressing the glycoprotein of Crimean-Congo hemorrhagic fever virus

DEFF Research Database (Denmark)

Ghiasi, Seyed Mojtaba; Salmanian, A H; Chinikar, S

2011-01-01

in their serum and feces, respectively. The mice in the fed/boosted group showed a significant rise in specific IgG antibodies after a single boost. Our results imply that oral immunization of animals with edible materials from transgenic plants is feasible, and further assessments are under way. In addition......While Crimean-Congo hemorrhagic fever (CCHF) has a high mortality rate in humans, the associated virus (CCHFV) does not induce clinical symptoms in animals, but animals play an important role in disease transmission to humans. Our aim in this study was to examine the immunogenicity of the CCHFV...... glycoprotein when expressed in the root and leaf of transgenic plants via hairy roots and stable transformation of tobacco plants, respectively. After confirmatory analyses of transgenic plant lines and quantification of the expressed glycoprotein, mice were either fed with the transgenic leaves or roots, fed...

Expression of artificial microRNAs in transgenic Arabidopsis thaliana confers virus resistance.

Science.gov (United States)

Niu, Qi-Wen; Lin, Shih-Shun; Reyes, Jose Luis; Chen, Kuan-Chun; Wu, Hui-Wen; Yeh, Shyi-Dong; Chua, Nam-Hai

2006-11-01

Plant microRNAs (miRNAs) regulate the abundance of target mRNAs by guiding their cleavage at the sequence complementary region. We have modified an Arabidopsis thaliana miR159 precursor to express artificial miRNAs (amiRNAs) targeting viral mRNA sequences encoding two gene silencing suppressors, P69 of turnip yellow mosaic virus (TYMV) and HC-Pro of turnip mosaic virus (TuMV). Production of these amiRNAs requires A. thaliana DICER-like protein 1. Transgenic A. thaliana plants expressing amiR-P69(159) and amiR-HC-Pro(159) are specifically resistant to TYMV and TuMV, respectively. Expression of amiR-TuCP(159) targeting TuMV coat protein sequences also confers specific TuMV resistance. However, transgenic plants that express both amiR-P69(159) and amiR-HC-Pro(159) from a dimeric pre-amiR-P69(159)/amiR-HC-Pro(159) transgene are resistant to both viruses. The virus resistance trait is displayed at the cell level and is hereditable. More important, the resistance trait is maintained at 15 degrees C, a temperature that compromises small interfering RNA-mediated gene silencing. The amiRNA-mediated approach should have broad applicability for engineering multiple virus resistance in crop plants.

Transgene mus som sygdomsmodeller

DEFF Research Database (Denmark)

Schuster, Mikkel Bruhn; Porse, Bo Torben

2003-01-01

Transgenic animal models have proven to be useful tools in understanding both basic biology and the events associated with disease. Recent technical advances in the area of genomic manipulation in combination with the availability of the human and murine genomic sequences now allow the precise...... tailoring of the mouse genome. In this review we describe a few systems in which transgenic animal models have been employed for the purpose of studying the etiology of human diseases. Udgivelsesdato: 2003-Feb-17...

Testing of candidate non-lethal sampling methods for detection of Renibacterium salmoninarum in juvenile Chinook salmon Oncorhynchus tshawytscha

Science.gov (United States)

Elliott, Diane G.; McKibben, Constance L.; Conway, Carla M.; Purcell, Maureen K.; Chase, Dorothy M.; Applegate, Lynn M.

2015-01-01

Non-lethal pathogen testing can be a useful tool for fish disease research and management. Our research objectives were to determine if (1) fin clips, gill snips, surface mucus scrapings, blood draws, or kidney biopsies could be obtained non-lethally from 3 to 15 g Chinook salmon Oncorhynchus tshawytscha, (2) non-lethal samples could accurately discriminate between fish exposed to the bacterial kidney disease agent Renibacterium salmoninarum and non-exposed fish, and (3) non-lethal samples could serve as proxies for lethal kidney samples to assess infection intensity. Blood draws and kidney biopsies caused ≥5% post-sampling mortality (Objective 1) and may be appropriate only for larger fish, but the other sample types were non-lethal. Sampling was performed over 21 wk following R. salmoninarum immersion challenge of fish from 2 stocks (Objectives 2 and 3), and nested PCR (nPCR) and real-time quantitative PCR (qPCR) results from candidate non-lethal samples were compared with kidney tissue analysis by nPCR, qPCR, bacteriological culture, enzyme-linked immunosorbent assay (ELISA), fluorescent antibody test (FAT) and histopathology/immunohistochemistry. R. salmoninarum was detected by PCR in >50% of fin, gill, and mucus samples from challenged fish. Mucus qPCR was the only non-lethal assay exhibiting both diagnostic sensitivity and specificity estimates >90% for distinguishing between R. salmoninarum-exposed and non-exposed fish and was the best candidate for use as an alternative to lethal kidney sample testing. Mucus qPCR R. salmoninarum quantity estimates reflected changes in kidney bacterial load estimates, as evidenced by significant positive correlations with kidney R. salmoninaruminfection intensity scores at all sample times and in both fish stocks, and were not significantly impacted by environmentalR. salmoninarum concentrations.

Overexpression of a specific soybean GmGSTU4 isoenzyme improves diphenyl ether and chloroacetanilide herbicide tolerance of transgenic tobacco plants.

Science.gov (United States)

Benekos, Kostantinos; Kissoudis, Christos; Nianiou-Obeidat, Irini; Labrou, Nikolaos; Madesis, Panagiotis; Kalamaki, Mary; Makris, Antonis; Tsaftaris, Athanasios

2010-10-01

Plant glutathione transferases (GSTs) superfamily consists of multifunctional enzymes and forms a major part of the plants herbicide detoxification enzyme network. The tau class GST isoenzyme GmGSTU4 from soybean, exhibits catalytic activity towards the diphenyl ether herbicide fluorodifen and is active as glutathione-dependent peroxidase (GPOX). Transgenic tobacco plants of Basmas cultivar were generated via Agrobacterium transformation. The aim was to evaluate in planta, GmGSTU4's role in detoxifying the diphenyl ether herbicides fluorodifen and oxyfluorfen and the chloroacetanilides alachlor and metolachlor. Transgenic tobacco plants were verified by PCR and Southern blot hybridization and expression of GmGSTU4 was determined by RT-PCR. Leaf extracts from transgenic plants showed moderate increase in GST activity towards CDNB and a significant increase towards fluorodifen and alachlor, and at the same time an increased GPOX activity towards cumene hydroperoxide. GmGSTU4 overexpressing plants when treated with 200 μM fluorodifen or oxyfluorfen exhibited reduced relative electrolyte leakage compared to wild type plants. Moreover all GmGSTU4 overexpressing lines exhibited significantly increased tolerance towards alachlor when grown in vitro at 7.5 mg/L alachlor compared to wild type plants. No significant increased tolerance was observed to metolachlor. These results confirm the contribution of this particular GmGSTU4 isoenzyme from soybean in the detoxification of fluorodifen and alachlor, and provide the basis towards the development of transgenic plants with improved phytoremediation capabilities for future use in environmental cleanup of herbicides. Copyright © 2010 Elsevier B.V. All rights reserved.

Humanitarian Algorithms : A Codified Key Safety Switch Protocol for Lethal Autonomy

OpenAIRE

Nyagudi, Nyagudi Musandu

2014-01-01

With the deployment of lethal autonomous weapons, there is the requirement that any such platform complies with the precepts of International Humanitarian Law. Humanitarian Algorithms[9: p. 9] ensure that lethal autonomous weapon systems perform military/security operations, within the confines of International Humanitarian Law. Unlike other existing techniques of regulating lethal autonomy this scheme advocates for an approach that enables Machine Learning. Lethal autonomous weapons must be ...

Cloning and functional analysis in transgenic tobacco of a tapetum ...

African Journals Online (AJOL)

The 5'-flanking region of 1174 bp upstream of the translation start point (TSP) of a reported Arabidopsis anther-specific gene, Anther7 gene (ATA7), which putatively encodes a protein related to lipid transfer protein, was cloned and functionally analyzed in transgenic tobacco after been fused with β- glucuronidase (GUS) ...

Enhanced human papillomavirus type 8 oncogene expression levels are crucial for skin tumorigenesis in transgenic mice

International Nuclear Information System (INIS)

Hufbauer, M.; Lazic, D.; Akguel, B.; Brandsma, J.L.; Pfister, H.; Weissenborn, S.J.

2010-01-01

Human papillomavirus 8 (HPV8) is involved in skin cancer development in epidermodysplasia verruciformis patients. Transgenic mice expressing HPV8 early genes (HPV8-CER) developed papillomas, dysplasias and squamous cell carcinomas. UVA/B-irradiation and mechanical wounding of HPV8-CER mouse skin led to prompt papilloma induction in about 3 weeks. The aim of this study was to analyze the kinetics and level of transgene expression in response to skin irritations. Transgene expression was already enhanced 1 to 2 days after UVA/B-irradiation or tape-stripping and maintained during papilloma development. The enhanced transgene expression could be assigned to UVB and not to UVA. Papilloma development was thus always paralleled by an increased transgene expression irrespective of the type of skin irritation. A knock-down of E6 mRNA by tattooing HPV8-E6-specific siRNA led to a delay and a lower incidence of papilloma development. This indicates that the early increase of viral oncogene expression is crucial for induction of papillomatosis.

Non-Lethal Weapons Program

Science.gov (United States)

Sheets Frequently Asked Questions Non-Lethal Weapons FAQs Active Denial System FAQs Human Electro -Muscular Incapacitation FAQs Related Links Business Opportunities Contact JNLWD Congressional Engagement , Wednesday, Sept 20, 2017. The Active Denial System, blunt-impact munitions, dazzling lasers, LRAD 100X

An Efficient Method for Generation of Transgenic Rats Avoiding Embryo Manipulation

Directory of Open Access Journals (Sweden)

Bhola Shankar Pradhan

2016-01-01

Full Text Available Although rats are preferred over mice as an animal model, transgenic animals are generated predominantly using mouse embryos. There are limitations in the generation of transgenic rat by embryo manipulation. Unlike mouse embryos, most of the rat embryos do not survive after male pronuclear DNA injection which reduces the efficiency of generation of transgenic rat by this method. More importantly, this method requires hundreds of eggs collected by killing several females for insertion of transgene to generate transgenic rat. To this end, we developed a noninvasive and deathless technique for generation of transgenic rats by integrating transgene into the genome of the spermatogonial cells by testicular injection of DNA followed by electroporation. After standardization of this technique using EGFP as a transgene, a transgenic disease model displaying alpha thalassemia was successfully generated using rats. This efficient method will ease the generation of transgenic rats without killing the lives of rats while simultaneously reducing the number of rats used for generation of transgenic animal.

Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots.

Science.gov (United States)

Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke; Hühns, Maja; Broer, Inge; Valkonen, Jari P T

2014-12-01

Composite potato plants offer an extremely fast, effective and reliable system for studies on gene functions in roots using antisense or inverted-repeat but not sense constructs for gene inactivation. Composite plants, with transgenic roots on a non-transgenic shoot, can be obtained by shoot explant transformation with Agrobacterium rhizogenes. The aim of this study was to generate composite potato plants (Solanum tuberosum) to be used as a model system in future studies on root-pathogen interactions and gene silencing in the roots. The proportion of transgenic roots among the roots induced was high (80-100%) in the four potato cultivars tested (Albatros, Desirée, Sabina and Saturna). No wild-type adventitious roots were formed at mock inoculation site. All strains of A. rhizogenes tested induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots of composite potato plants expressed significantly higher amounts of β-glucuronidase (GUS) than the roots of a GUS-transgenic potato line event. Silencing of the uidA transgene (GUS) was tested by inducing roots on the GUS-transgenic cv. Albatros event with strains of A. rhizogenes over-expressing either the uidA sense or antisense transcripts, or inverted-repeat or hairpin uidA RNA. The three last mentioned constructs caused 2.5-4.0 fold reduction in the uidA mRNA expression. In contrast, over-expression of uidA resulted in over 3-fold increase in the uidA mRNA and GUS expression, indicating that sense-mediated silencing (co-suppression) was not functional in roots. The results suggest that composite plants offer a useful experimental system for potato research, which has gained little previous attention.

Intein-mediated Cre protein assembly for transgene excision in hybrid progeny of transgenic Arabidopsis.

Science.gov (United States)

Ge, Jia; Wang, Lijun; Yang, Chen; Ran, Lingyu; Wen, Mengling; Fu, Xianan; Fan, Di; Luo, Keming

2016-10-01

An approach for restoring recombination activity of complementation split-Cre was developed to excise the transgene in hybrid progeny of GM crops. Growing concerns about the biosafety of genetically modified (GM) crops has currently become a limited factor affecting the public acceptance. Several approaches have been developed to generate selectable-marker-gene-free GM crops. However, no strategy was reported to be broadly applicable to hybrid crops. Previous studies have demonstrated that complementation split-Cre recombinase restored recombination activity in transgenic plants. In this study, we found that split-Cre mediated by split-intein Synechocystis sp. DnaE had high recombination efficiency when Cre recombinase was split at Asp232/Asp233 (866 bp). Furthermore, we constructed two plant expression vectors, pCA-NCre-In and pCA-Ic-CCre, containing NCre866-In and Ic-CCre866 fragments, respectively. After transformation, parent lines of transgenic Arabidopsis with one single copy were generated and used for hybridization. The results of GUS staining demonstrated that the recombination activity of split-Cre could be reassembled in these hybrid progeny of transgenic plants through hybridization and the foreign genes flanked by two loxP sites were efficiently excised. Our strategy may provide an effective approach for generating the next generation of GM hybrid crops without biosafety concerns.

Lethal domestic violence in eastern North Carolina.

Science.gov (United States)

Gilliland, M G; Spence, P R; Spence, R L

2000-01-01

Strategies for preventing domestic violence can be tailored to a particular geographic or socioeconomic area if the patterns of domestic violence in the area are known. National statistics, although widely available, may not be applicable to a specific region. We reviewed homicide deaths in Eastern North Carolina between 1978 and 1999 to identify patterns in this rural area. Approximately 20% of the homicide deaths in eastern North Carolina are caused by intimate partners. Women accounted for 53% of the victims in 1976, similar to national figures but not rising to 72% as seen nationally in 1998. Latinos are an increasing presence in the area, but had only one recorded episode of lethal violence against an intimate partner. Gunshots accounted for most of the deaths (59% in men, 72% in women). Knowledge of such patterns can assist in selecting prevention strategies for this particular area. Over the last 25 years increasing attention has been devoted to domestic violence (DV), initially defined as abuse committed against a spouse, former spouse, fiancée, boy- or girlfriend, or cohabitant. As time has passed, the definition has been broadened to include other family members--elders, children, and siblings. The Centers for Disease Control and Prevention (CDC) now uses the term "intimate partner violence" for intentional emotional or physical abuse inflicted by a spouse, ex-spouse, a present or former boy- or girlfriend, or date. For the purposes of this paper, we consider DV interchangeable with intimate partner violence. There has been a national concern that abusive events are under-reported. The National Crime Victimization Survey, an anonymous household survey, indicated nearly 1 million incidents of non-lethal intimate partner violence per year between 1992 and 1996. The number decreased from 1.1 million in 1993 to 840,000 in 1996. Attempts to validate such data for a given geographic area often require subjects to violate anonymity--this may account for lower

Inhibition of N-type Ca2+ channels ameliorates an imbalance in cardiac autonomic nerve activity and prevents lethal arrhythmias in mice with heart failure.

Science.gov (United States)

Yamada, Yuko; Kinoshita, Hideyuki; Kuwahara, Koichiro; Nakagawa, Yasuaki; Kuwabara, Yoshihiro; Minami, Takeya; Yamada, Chinatsu; Shibata, Junko; Nakao, Kazuhiro; Cho, Kosai; Arai, Yuji; Yasuno, Shinji; Nishikimi, Toshio; Ueshima, Kenji; Kamakura, Shiro; Nishida, Motohiro; Kiyonaka, Shigeki; Mori, Yasuo; Kimura, Takeshi; Kangawa, Kenji; Nakao, Kazuwa

2014-10-01

Dysregulation of autonomic nervous system activity can trigger ventricular arrhythmias and sudden death in patients with heart failure. N-type Ca(2+) channels (NCCs) play an important role in sympathetic nervous system activation by regulating the calcium entry that triggers release of neurotransmitters from peripheral sympathetic nerve terminals. We have investigated the ability of NCC blockade to prevent lethal arrhythmias associated with heart failure. We compared the effects of cilnidipine, a dual N- and L-type Ca(2+) channel blocker, with those of nitrendipine, a selective L-type Ca(2+) channel blocker, in transgenic mice expressing a cardiac-specific, dominant-negative form of neuron-restrictive silencer factor (dnNRSF-Tg). In this mouse model of dilated cardiomyopathy leading to sudden arrhythmic death, cardiac structure and function did not significantly differ among the control, cilnidipine, and nitrendipine groups. However, cilnidipine dramatically reduced arrhythmias in dnNRSF-Tg mice, significantly improving their survival rate and correcting the imbalance between cardiac sympathetic and parasympathetic nervous system activity. A β-blocker, bisoprolol, showed similar effects in these mice. Genetic titration of NCCs, achieved by crossing dnNRSF-Tg mice with mice lacking CACNA1B, which encodes the α1 subunit of NCCs, improved the survival rate. With restoration of cardiac autonomic balance, dnNRSF-Tg;CACNA1B(+/-) mice showed fewer malignant arrhythmias than dnNRSF-Tg;CACNA1B(+/+) mice. Both pharmacological blockade of NCCs and their genetic titration improved cardiac autonomic balance and prevented lethal arrhythmias in a mouse model of dilated cardiomyopathy and sudden arrhythmic death. Our findings suggest that NCC blockade is a potentially useful approach to preventing sudden death in patients with heart failure. Published on behalf of the European Society of Cardiology. All rights reserved. © The Author 2014. For permissions please email: journals.permissions@oup.com.

Establishment and characterization of CAG/EGFP transgenic rabbit line.

Science.gov (United States)

Takahashi, Ri-ichi; Kuramochi, Takashi; Aoyagi, Kazuki; Hashimoto, Shu; Miyoshi, Ichiro; Kasai, Noriyuki; Hakamata, Yoji; Kobayashi, Eiji; Ueda, Masatsugu

2007-02-01

Cell marking is a very important procedure for identifying donor cells after cell and/or organ transplantation in vivo. Transgenic animals expressing marker proteins such as enhanced green fluorescent protein (EGFP) in their tissues are a powerful tool for research in fields of tissue engineering and regenerative medicine. The purpose of this study was to establish transgenic rabbit lines that ubiquitously express EGFP under the control of the cytomegalovirus immediate early enhancer/beta-actin promoter (CAG) to provide a fluorescent transgenic animal as a bioresource. We microinjected the EGFP expression vector into 945 rabbit eggs and 4 independent transgenic candidate pups were obtained. Two of them died before sexual maturation and one was infertile. One transgenic male candidate founder rabbit was obtained and could be bred by artificial insemination. The rabbit transmitted the transgene in a Mendelian manner. Using fluorescence in situ hybridization analysis, we detected the transgene at 7q11 on chromosome 7 as a large centromeric region in two F1 offspring (one female and one male). Eventually, one transgenic line was established. Ubiquitous EGFP fluorescence was confirmed in all examined organs. There were no gender-related differences in fluorescence. The established CAG/EGFP transgenic rabbit will be an important bioresource and a useful tool for various studies in tissue engineering and regenerative medicine.

Non-Lethal Weapons: Opportunities for R&D

Science.gov (United States)

2004-12-01

during the Vietnam War. US; emulsifying agents are used in food processing, drilling fluids, cosmetics , pharmaceuticals, heavy- duty cleaners, textile...conducted in a professional manner, with no threat to public safety or the environment. 11 References [1] Fenton , G., (2001). NLW Technology Taxonomy...W.A., Mason, R.L., Collins, K.R., (2000). Non-Lethal Applicants of Slippery Substances. NDIA Non-Lethal Defense IV. [24] Fenton , G., (2000). Overview

Production of transgenic pigs over-expressing the antiviral gene Mx1

Directory of Open Access Journals (Sweden)

Quanmei Yan

2014-01-01

Full Text Available The myxovirus resistance gene (Mx1 has a broad spectrum of antiviral activities. It is therefore an interesting candidate gene to improve disease resistance in farm animals. In this study, we report the use of somatic cell nuclear transfer (SCNT to produce transgenic pigs over-expressing the Mx1 gene. These transgenic pigs express approximately 15–25 times more Mx1 mRNA than non-transgenic pigs, and the protein level of Mx1 was also markedly enhanced. We challenged fibroblast cells isolated from the ear skin of transgenic and control pigs with influenza A virus and classical swine fever virus (CFSV. Indirect immunofluorescence assay (IFA revealed a profound decrease of influenza A proliferation in Mx1 transgenic cells. Growth kinetics showed an approximately 10-fold reduction of viral copies in the transgenic cells compared to non-transgenic controls. Additionally, we found that the Mx1 transgenic cells were more resistant to CSFV infection in comparison to non-transgenic cells. These results demonstrate that the Mx1 transgene can protect against viral infection in cells of transgenic pigs and indicate that the Mx1 transgene can be harnessed to develop disease-resistant pigs.

The status of RNAi-based transgenic research in plant nematology

Directory of Open Access Journals (Sweden)

Tushar Kanti Dutta

2015-01-01

Full Text Available With the understanding of nematode-plant interactions at the molecular level, new avenues for engineering resistance have opened up, with RNA interference being one of them. Induction of RNAi by delivering double-stranded RNA (dsRNA has been very successful in the model non-parasitic nematode, Caenorhabditis elegans, while in plant nematodes, dsRNA delivery has been accomplished by soaking nematodes with dsRNA solution mixed with synthetic neurostimulants. The success of in vitro RNAi of target genes has inspired the use of in planta delivery of dsRNA to feeding nematodes. The most convincing success of host-delivered RNAi has been achieved against root-knot nematodes. Plant-mediated RNAi has been shown to lead to the specific down-regulation of target genes in invading nematodes, which had a profound effect on nematode development. RNAi-based transgenics are advantageous as they do not produce any functional foreign proteins and target organisms in a sequence-specific manner. Although the development of RNAi-based transgenics against plant nematodes is still in the preliminary stage, they offer novel management strategy for the future.

Early correlation of microglial activation with enhanced tumor necrosis factor-alpha and monocyte chemoattractant protein-1 expression specifically within the entorhinal cortex of triple transgenic Alzheimer's disease mice

Directory of Open Access Journals (Sweden)

LaFerla Frank M

2005-10-01

Full Text Available Abstract Background Alzheimer's disease is a complex neurodegenerative disorder characterized pathologically by a temporal and spatial progression of beta-amyloid (Aβ deposition, neurofibrillary tangle formation, and synaptic degeneration. Inflammatory processes have been implicated in initiating and/or propagating AD-associated pathology within the brain, as inflammatory cytokine expression and other markers of inflammation are pronounced in individuals with AD pathology. The current study examines whether inflammatory processes are evident early in the disease process in the 3xTg-AD mouse model and if regional differences in inflammatory profiles exist. Methods Coronal brain sections were used to identify Aβ in 2, 3, and 6-month 3xTg-AD and non-transgenic control mice. Quantitative real-time RT-PCR was performed on microdissected entorhinal cortex and hippocampus tissue of 2, 3, and 6-month 3xTg-AD and non-transgenic mice. Microglial/macrophage cell numbers were quantified using unbiased stereology in 3xTg-AD and non-transgenic entorhinal cortex and hippocampus containing sections. Results We observed human Aβ deposition at 3 months in 3xTg-AD mice which is enhanced by 6 months of age. Interestingly, we observed a 14.8-fold up-regulation of TNF-α and 10.8-fold up-regulation of MCP-1 in the entorhinal cortex of 3xTg-AD mice but no change was detected over time in the hippocampus or in either region of non-transgenic mice. Additionally, this increase correlated with a specific increase in F4/80-positive microglia and macrophages in 3xTg-AD entorhinal cortex. Conclusion Our data provide evidence for early induction of inflammatory processes in a model that develops amyloid and neurofibrillary tangle pathology. Additionally, our results link inflammatory processes within the entorhinal cortex, which represents one of the earliest AD-affected brain regions.

Human anti-rhesus D IgG1 antibody produced in transgenic plants

DEFF Research Database (Denmark)

Bouquin, Thomas; Thomsen, Mads; Nielsen, Leif Kofoed

2002-01-01

antigen, which is responsible for alloimmunization of RhD- mothers carrying an RhD+ fetus. Anti-RhD extracted from plants specifically reacted with RhD+ cells in antiglobulin technique, and elicited a respiratory burst in human peripheral blood mononuclear cells. Plant-derived antibody had equivalent......Transgenic plants represent an alternative to cell culture systems for producing cheap and safe antibodies for diagnostic and therapeutic use. To evaluate the functional properties of a 'plantibody', we generated transgenic Arabidopsis plants expressing full-length human IgG1 against the Rhesus D...... properties to CHO cell-produced anti-RhD antibody, indicating its potential usefulness in diagnostic and therapeutic programs....

Investigating the Role of FIP200 in Mammary Carcinogenesis Using a Transgenic Mouse Model

National Research Council Canada - National Science Library

Nagy, Tamas

2007-01-01

...) deletion in mammary-specific polyoma middle-T transgenic mice. We monitored mammary carcinogenesis in positive control (FAKFlox/Flox; MMTV-PyVT) and target (FAKFlox/Flox; MMTV-Cre; MMTV-PyVT) females...

Lethal synergy involving bicyclomycin: an approach for reviving old antibiotics.

Science.gov (United States)

Malik, Muhammad; Li, Liping; Zhao, Xilin; Kerns, Robert J; Berger, James M; Drlica, Karl

2014-12-01

One way to address the growing problem of antimicrobial resistance is to revive old compounds that may have intrinsic lethal activity that is obscured by protective factors. Bicyclomycin is an old inhibitor of the Rho transcription terminator that by itself shows little rapid lethal activity. However, bicyclomycin participates in bacteriostatic synergy, which raises the possibility that conditions for lethal synergy may exist, perhaps through a suppression of protective factors. Bicyclomycin was combined with bacteriostatic inhibitors of gene expression, and bactericidal activity was measured with several cultured Gram-negative pathogens. When used alone, bicyclomycin failed to rapidly kill growing cultures of Escherichia coli; however, the additional presence of bacteriostatic concentrations of tetracycline, chloramphenicol or rifampicin led to rapid killing. Four other pathogen species, Acinetobacter baumannii, Klebsiella pneumoniae, Salmonella enterica serotype Typhimurium and Shigella dysenteriae, also exhibited enhanced killing when bicyclomycin was combined with tetracycline or rifampicin. This lethal synergy was achieved at low concentrations (slightly above the MIC) for all agents tested in combinations. Follow-up work with E. coli indicated that lethal synergy arose from a blockage of transcription elongation. Moreover, lethal synergy was reduced when bicyclomycin was added 60 min before tetracycline, suggesting that bicyclomycin induces a protective factor. The action of bicyclomycin illustrates the potential present in a largely abandoned antibacterial agent; it exhibits lethal synergy when coadministered with known, bacteriostatic inhibitors of gene expression. The identification of protective factors, which are currently uncharacterized, may reveal new ways to promote the lethal action of some old antibiotics. © The Author 2014. Published by Oxford University Press on behalf of the British Society for Antimicrobial Chemotherapy. All rights reserved

Comparative proteomics of milk fat globule membrane proteins from transgenic cloned cattle.

Directory of Open Access Journals (Sweden)

Shunchao Sui

Full Text Available The use of transgenic livestock is providing new methods for obtaining pharmaceutically useful proteins. However, the protein expression profiles of the transgenic animals, including expression of milk fat globule membrane (MFGM proteins, have not been well characterized. In this study, we compared the MFGM protein expression profile of the colostrum and mature milk from three lines of transgenic cloned (TC cattle, i.e., expressing recombinant human α-lactalbumin (TC-LA, lactoferrin (TC-LF or lysozyme (TC-LZ in the mammary gland, with those from cloned non-transgenic (C and conventionally bred normal animals (N. We identified 1, 225 proteins in milk MFGM, 166 of which were specifically expressed only in the TC-LA group, 265 only in the TC-LF group, and 184 only in the TC-LZ group. There were 43 proteins expressed only in the transgenic cloned animals, but the concentrations of these proteins were below the detection limit of silver staining. Functional analysis also showed that the 43 proteins had no obvious influence on the bovine mammary gland. Quantitative comparison revealed that MFGM proteins were up- or down-regulated more than twofold in the TC and C groups compared to N group: 126 in colostrum and 77 in mature milk of the TC-LA group; 157 in colostrum and 222 in mature milk of the TC-LF group; 49 in colostrum and 98 in mature milk of the TC-LZ group; 98 in colostrum and 132 in mature milk in the C group. These up- and down-regulated proteins in the transgenic animals were not associated with a particular biological function or pathway, which appears that expression of certain exogenous proteins has no general deleterious effects on the cattle mammary gland.

Characterization of gastric adenocarcinoma cell lines established from CEA424/SV40 T antigen-transgenic mice with or without a human CEA transgene

International Nuclear Information System (INIS)

Nöckel, Jessica; Engel, Natasja K van den; Winter, Hauke; Hatz, Rudolf A; Zimmermann, Wolfgang; Kammerer, Robert

2006-01-01

Gastric carcinoma is one of the most frequent cancers worldwide. Patients with gastric cancer at an advanced disease stage have a poor prognosis, due to the limited efficacy of available therapies. Therefore, the development of new therapies, like immunotherapy for the treatment of gastric cancer is of utmost importance. Since the usability of existing preclinical models for the evaluation of immunotherapies for gastric adenocarcinomas is limited, the goal of the present study was to establish murine in vivo models which allow the stepwise improvement of immunotherapies for gastric cancer. Since no murine gastric adenocarcinoma cell lines are available we established four cell lines (424GC, mGC3, mGC5, mGC8) from spontaneously developing tumors of CEA424/SV40 T antigen (CEA424/Tag) mice and three cell lines derived from double-transgenic offsprings of CEA424/Tag mice mated with human carcinoembryonic antigen (CEA)-transgenic (CEA424/Tag-CEA) mice (mGC2 CEA , mGC4 CEA , mGC11 CEA ). CEA424/Tag is a transgenic C57BL/6 mouse strain harboring the Tag under the control of a -424/-8 bp CEA gene promoter which leads to the development of invasive adenocarcinoma in the glandular stomach. Tumor cell lines established from CEA424/Tag-CEA mice express the well defined tumor antigen CEA under the control of its natural regulatory elements. The epithelial origin of the tumor cells was proven by morphological criteria including the presence of mucin within the cells and the expression of the cell adhesion molecules EpCAM and CEACAM1. All cell lines consistently express the transgenes CEA and/or Tag and MHC class I molecules leading to their susceptibility to lysis by Tag-specific CTL in vitro. Despite the presentation of CTL-epitopes derived from the transgene products the tumor cell lines were tumorigenic when grafted into C57BL/6, CEA424/Tag or CEA424/Tag-CEA-transgenic hosts and no significant differences in tumor take and tumor growth were observed in the different hosts

A powerful transgenic tool for fate mapping and functional analysis of newly generated neurons

Directory of Open Access Journals (Sweden)

Vogt Weisenhorn Daniela M

2010-12-01

Full Text Available Abstract Background Lack of appropriate tools and techniques to study fate and functional integration of newly generated neurons has so far hindered understanding of neurogenesis' relevance under physiological and pathological conditions. Current analyses are either dependent on mitotic labeling, for example BrdU-incorporation or retroviral infection, or on the detection of transient immature neuronal markers. Here, we report a transgenic mouse model (DCX-CreERT2 for time-resolved fate analysis of newly generated neurons. This model is based on the expression of a tamoxifen-inducible Cre recombinase under the control of a doublecortin (DCX promoter, which is specific for immature neuronal cells in the CNS. Results In the DCX-CreERT2 transgenic mice, expression of CreERT2 was restricted to DCX+ cells. In the CNS of transgenic embryos and adult DCX-CreERT2 mice, tamoxifen administration caused the transient translocation of CreERT2 to the nucleus, allowing for the recombination of loxP-flanked sequences. In our system, tamoxifen administration at E14.5 resulted in reporter gene activation throughout the developing CNS of transgenic embryos. In the adult CNS, neurogenic regions were the primary sites of tamoxifen-induced reporter gene activation. In addition, reporter expression could also be detected outside of neurogenic regions in cells physiologically expressing DCX (e.g. piriform cortex, corpus callosum, hypothalamus. Four weeks after recombination, the vast majority of reporter-expressing cells were found to co-express NeuN, revealing the neuronal fate of DCX+ cells upon maturation. Conclusions This first validation demonstrates that our new DCX-CreERT2 transgenic mouse model constitutes a powerful tool to investigate neurogenesis, migration and their long-term fate of neuronal precursors. Moreover, it allows for a targeted activation or deletion of specific genes in neuronal precursors and will thereby contribute to unravel the molecular

Detection and copy number estimation of the transgenic nucleotide sequences in an unknown GM event of Oryza sativa

Directory of Open Access Journals (Sweden)

Ali M. Sajjad

2016-12-01

Full Text Available The present study was designed to establish a qualitative detection method based on conventional and real time PCR assay to screen the commonly grown rice varieties for the presence of the cry1Ac gene. The detection of genetically modified rice in the screening process would necessitate accurate assay development and precise qualitative PCR tests complying with established procedures for the detection and characterization of transgenes in food grains. Such assay would not only enable the monitoring of transgene flow in local agricultural environment but also the characterization of different plant species produced with this transgene and its regulatory components. Thus, a reliable and quick screening assay was established for the qualitative detection of the transgene along with the promoter and selectable marker gene in genetically modified rice. By conventional PCR, a fragment of 215 bp was amplified with gene specific primers of cry1Ac. Primers for other transgenes such as gna and bar were also employed; however, no amplification was detected. The presence of the p35s, sps, and nptII genes was confirmed by qualitative real-time PCR. The specificity of the respective PCR products was checked through melt peak curve analysis. Sharp and precise melting temperatures indicated the presence of a single kind of PCR product in correspondence to each of the primers used. Moreover, the copy number of cry1Ac was estimated by ∆∆CT method. It is proposed that the primer sets and experimental conditions used in this study will be sufficient to meet the requirements for molecular detection and characterization of the cry1Ac transgene and affiliated sequences in sorting out conventional rice varieties from the ones which are genetically modified. It will also help to monitor the ecological flow of these transgenes and other biosafety factors.

Acute lethal toxicity following passive immunization for treatment of murine cryptococcosis.

OpenAIRE

Savoy, A C; Lupan, D M; Manalo, P B; Roberts, J S; Schlageter, A M; Weinhold, L C; Kozel, T R

1997-01-01

Passive immunization with monoclonal antibodies (MAbs) specific for the major capsular polysaccharide of Cryptococcus neoformans alters the course of murine cryptococcosis. During studies of passive immunization for treatment of murine cryptococcosis, we noted the occurrence of an acute, lethal toxicity. Toxicity was characterized by scratching, lethargy, respiratory distress, collapse, and death within 20 to 60 min after injection of antibody. The toxic effect was observed only in mice with ...

Functional diversity of non-lethal effects, chemical camouflage, and variation in fish avoidance in colonizing beetles.

Science.gov (United States)

Resetarits, William J; Pintar, Matthew R

2016-12-01

Predators play an extremely important role in natural communities. In freshwater systems, fish can dominate sorting both at the colonization and post-colonization stage. Specifically, for many colonizing species, fish can have non-lethal, direct effects that exceed the lethal direct effects of predation. Functionally diverse fish species with a range of predatory capabilities have previously been observed to elicit functionally equivalent responses on oviposition in tree frogs. We tested this hypothesis of functional equivalence of non-lethal effects for four predatory fish species, using naturally colonizing populations of aquatic beetles. Among taxa other than mosquitoes, and with the exception of the chemically camouflaged pirate perch, Aphredoderus sayanus, we provide the first evidence of variation in colonization or oviposition responses to different fish species. Focusing on total abundance, Fundulus chrysotus, a gape-limited, surface-feeding fish, elicited unique responses among colonizing Hydrophilidae, with the exception of the smallest and most abundant taxa, Paracymus, while Dytiscidae responded similarly to all avoided fish. Neither family responded to A. sayanus. Analysis of species richness and multivariate characterization of the beetle assemblages for the four fish species and controls revealed additional variation among the three avoided species and confirmed that chemical camouflage in A. sayanus results in assemblages essentially identical to fishless controls. The origin of this variation in beetle responses to different fish is unknown, but may involve variation in cue sensitivity, different behavioral algorithms, or differential responses to species-specific fish cues. The identity of fish species occupying aquatic habitats is crucial to understanding community structure, as varying strengths of lethal and non-lethal effects, as well as their interaction, create complex landscapes of predator effects and challenge the notion of functional

How To Produce and Characterize Transgenic Plants.

Science.gov (United States)

Savka, Michael A.; Wang, Shu-Yi; Wilson, Mark

2002-01-01

Explains the process of establishing transgenic plants which is a very important tool in plant biology and modern agriculture. Produces transgenic plants with the ability to synthesize opines. (Contains 17 references.) (YDS)

A novel transgenic mouse model of lysosomal storage disorder.

Science.gov (United States)

Ortiz-Miranda, Sonia; Ji, Rui; Jurczyk, Agata; Aryee, Ken-Edwin; Mo, Shunyan; Fletcher, Terry; Shaffer, Scott A; Greiner, Dale L; Bortell, Rita; Gregg, Ronald G; Cheng, Alan; Hennings, Leah J; Rittenhouse, Ann R

2016-11-01

Knockout technology has proven useful for delineating functional roles of specific genes. Here we describe and provide an explanation for striking pathology that occurs in a subset of genetically engineered mice expressing a rat Ca V β2a transgene under control of the cardiac α-myosin heavy chain promoter. Lesions were limited to mice homozygous for transgene and independent of native Cacnb2 genomic copy number. Gross findings included an atrophied pancreas; decreased adipose tissue; thickened, orange intestines; and enlarged liver, spleen, and abdominal lymph nodes. Immune cell infiltration and cell engulfment by macrophages were associated with loss of pancreatic acinar cells. Foamy macrophages diffusely infiltrated the small intestine's lamina propria, while similar macrophage aggregates packed liver and splenic red pulp sinusoids. Periodic acid-Schiff-positive, diastase-resistant, iron-negative, Oil Red O-positive, and autofluorescent cytoplasm was indicative of a lipid storage disorder. Electron microscopic analysis revealed liver sinusoids distended by clusters of macrophages containing intracellular myelin "swirls" and hepatocytes with enlarged lysosomes. Additionally, build up of cholesterol, cholesterol esters, and triglycerides, along with changes in liver metabolic enzyme levels, were consistent with a lipid processing defect. Because of this complex pathology, we examined the transgene insertion site. Multiple transgene copies inserted into chromosome 19; at this same site, an approximate 180,000 base pair deletion occurred, ablating cholesterol 25-hydroxylase and partially deleting lysosomal acid lipase and CD95 Loss of gene function can account for the altered lipid processing, along with hypertrophy of the immune system, which define this phenotype, and serendipitously provides a novel mouse model of lysosomal storage disorder. Copyright © 2016 the American Physiological Society.

Expression of a complete soybean leghemoglobin gene in root nodules of transgenic Lotus corniculatus

DEFF Research Database (Denmark)

Stougaard, J; Petersen, T E; Marcker, K A

1987-01-01

The complete soybean leghemoglobin lbc(3) gene was transferred into the legume Lotus corniculatus using an Agrobacterium rhizogenes vector system. Organ-specific expression of the soybean gene was observed in root nodules formed on regenerated transgenic plants after infection with Rhizobium loti....... The primary transcript was processed in the same way as in soybean nodules and the resulting mRNA was translated into Lbc(3) protein. Quantitative determination of the Lbc(3) protein in nodules of transgenic plants indicated that the steady-state level of the soybean protein is comparable...

Expression of bgt gene in transgenic birch (Betula platyphylla Suk.)

African Journals Online (AJOL)

STORAGESEVER

2009-08-04

Aug 4, 2009 ... Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch.

Expression of Recombinant Human Alpha-Lactalbumin in the Milk of Transgenic Goats Using a Hybrid Pomoter/Enhancer

Directory of Open Access Journals (Sweden)

Yu-Guo Yuan

2014-01-01

Full Text Available To improve nutrient content of goat milk, we describe the construction of a vector (pBLAC containing a hybrid goat β-lactoglobulin (BLG promoter/cytomegalovirus (CMV enhancer. We also describe the generation of transgenic goats expressing rhLA by somatic cell nuclear transfer (SCNT. Of 334 one-cell stage embryos derived from three transgenic cell lines and 99 embryos derived from non-transgenic (NT cells surgically transferred to the oviducts of 37 recipients, two recipients delivered two kids (2% from the non-transfected line and five recipients delivered six kids (1.8% from transgenic cell lines, three of which died within 2 days. Compared to the NT donor cells, transfection of donor cells does not negatively affect the development of nuclear transfer embryos into viable transgenic offspring. However, the clone efficiency in cell line number 1 was lower than that in numbers 2 and 3, and in the NT lines (0.9% versus 1.9% 2.4% and 2%; P<0.05. Two transgenic cloned goats expressed rhLA in the milk at 0.1–0.9 mg/mL. The mammary gland-specific expression vector pBLAC with hybrid BLG/CMV can drive the hLA gene to express in vitro and in vivo. These data establish the basis for use of a hybrid promoter/enhancer strategy to produce rhLA transgenic goats.

Expression of bgt gene in transgenic birch (Betula platyphylla Suk ...

African Journals Online (AJOL)

Study on the characteristics of integration and expression is the basis of genetic stability of foreign genes in transgenic trees. To obtain insight into the relationship of transgene copy number and expression level, we screened 22 transgenic birch lines. Southern blot analysis of the transgenic birch plants indicated that the ...

Pharmacodynamic study of Bay41-4109 in HBV transgenic mouse model

Directory of Open Access Journals (Sweden)

Xiu-mei LI

2011-09-01

Full Text Available Objective To study the pharmacodynamics of Bay41-4109,a novel anti-HBV compound,in HBV transgenic mouse model.Methods specific pathogen frce(SPF level TgM(HBV D1.3mice were divided into 3 groups: Bay41-4109 group [30mg/(kg·d],lamivudine group [30mg/(kg·d] and vehicle group(0.5% sodium carboxymethycellulose,with 32 in each.Antiviral effect of Bay41-4109 was tested in HBV transgenic mice including the analysis of HBcAg changes in liver tissue by immunohistochemistry,and changes in HBV DNA in liver and serum by quantitative real time PCR analysis.Serum transaminase(ALT and AST and body weight were assayed to evaluate the safety of the compound.Results Oral Bay41-4109 significantly reduced the number of HBV core antigen(HBcAg positive cell nucleus,average area of HBcAg positive cell nucleus and the rate of OD compared with vehicle group after 50 days treatment(P 0.05.However,Bay41-4109 could not significantly reduce HBV-specific DNA in HBV transgenic mice,both in liver and plasma.No significant impact was found on ALT,AST and body weigh of Bay41-4109-treated mice.Conclusions Bay41-4109 can more effectively reduce cytoplasmic HBcAg in liver sections than lamivudine.It is suggested that Bay41-4109,a different mode of action from lamivudine,represents a promising anti-HBV drug candidate with good antiviral effect and safety.

The Dmp1-SOST Transgene Interacts With and Downregulates the Dmp1-Cre Transgene and the Rosa(Notch) Allele.

Science.gov (United States)

Zanotti, Stefano; Canalis, Ernesto

2016-05-01

Activation of Notch1 in osteocytes of Rosa(Notch) mice, where a loxP-flanked STOP cassette and the Nicd coding sequence were targeted to the reverse orientation splice acceptor (Rosa)26 locus, causes osteopetrosis associated with suppressed Sost expression and enhanced Wnt signaling. To determine whether Sost downregulation mediates the effects of Notch activation in osteocytes, Rosa(Notch) mice were crossed with transgenics expressing Cre recombinase or SOST under the control of the dentin matrix protein (Dmp)1 promoter. Dmp1-SOST transgenics displayed vertebral osteopenia and a modest femoral cancellous and cortical bone phenotype, whereas hemizygous Dmp1-Cre transgenics heterozygous for the Rosa(Notch) allele (Dmp1-Cre;Rosa(Notch)) exhibited osteopetrosis. The phenotype of Notch activation in osteocytes was prevented in Dmp1-Cre;Rosa(Notch) mice hemizygous for the Dmp1-SOST transgene. The effect was associated with downregulated Notch signaling and suppressed Dmp1 and Rosa26 expression. To test whether SOST regulates Notch expression in osteocytes, cortical bone cultures from Dmp1-Cre;Rosa(Notch) mice or from Rosa(Notch) control littermates were exposed to recombinant human SOST. The addition of SOST had only modest effects on Notch target gene mRNA levels and suppressed Dmp1, but not Cre or Rosa26, expression. These findings suggest that prevention of the Dmp1-Cre;Rosa(Notch) skeletal phenotype by Dmp1-SOST is not secondary to SOST expression but to interactions among the Dmp1-SOST and Dmp1-Cre transgenes and the Rosa26 locus. In conclusion, the Dmp1-SOST transgene suppresses the expression of the Dmp1-Cre transgene and of Rosa26. © 2015 Wiley Periodicals, Inc.

Transgene inheritances and genetic similarities of near isogenic lines of genetically modified common beans Herança de transgenes e similaridade genética de linhagens quase isogênicas de feijoeiro-comum geneticamente modificado

Directory of Open Access Journals (Sweden)

Patrícia Valle Pinheiro

2009-09-01

Full Text Available The objective of the present work was to determine the inheritance and stability of transgenes of a transgenic bean line expressing the genes rep-trap-ren from Bean golden mosaic virus and the bar gene. Crosses were done between the transgenic line and four commercial bean cultivars, followed by four backcrosses to the commercial cultivars. Progenies from each cross were evaluated for the presence of the transgenes by brushing the leaves with glufosinate ammonium and by polymerase chain reaction using specific oligonucleotides. Advanced generations were rub-inoculated with an isolate of Bean common mosaic necrosis virus (BCMNV. The transgenes were inherited consistently in a Mendelian pattern in the four crosses studied. The analyzed lines recovered close to 80% of the characteristics of the recurrent parent, as determined by the random amplified DNA markers used, besides maintaining important traits such as resistance to BCMNV. The presence of the transgene did not cause any detectable undesirable effect in the evaluated progenies.O objetivo do presente trabalho foi determinar a herança e a estabilidade de transgenes de uma linhagem de feijoeiro-comum com expressão dos genes rep-trap-ren, do Bean golden mosaic virus, e do gene bar. Foram realizados cruzamentos entre a linhagem transgênica e quatro cultivares comerciais de feijão, seguidos de quatro retrocruzamentos. As progênies de cada cruzamento foram avaliadas quanto à presença dos transgenes, com aplicação do glifosinato de amônia nas folhas e por meio da reação da polimerase em cadeia com uso de oligonucleotídeos específicos. O vírus do mosaico comum necrótico do feijoeiro, Bean common mosaic necrosis virus (BCMNV, foi inoculado mecanicamente nas gerações avançadas. Os transgenes foram herdados em padrão mendeliano nos quatro cruzamentos estudados. As linhagens analisadas apresentaram cerca de 80% das características do parental recorrente, conforme determinado por an

EVIDENCE THAT INTESTINAL IGA PLASMA-CELLS IN MU,CHI TRANSGENIC MICE ARE DERIVED FROM B-1 (LY-1 B) CELLS

NARCIS (Netherlands)

KROESE, FGM; AMMERLAAN, WAM; KANTOR, AB

1993-01-01

B6-Sp6 transgenic mice carry fully rearranged (BALB/c-derived. Igh-C(a) allotype) mu heavy chain and kappa light chain transgenes, specific for trinitrophenyl, on a C57BL background (Igh-C(b) allotype). FACS analyses show that the majority of B cells in peripheral lymphoid organs and bone marrow

Transgene teknikker erstatter problematisk avl

DEFF Research Database (Denmark)

Alstrup, Aage Kristian Olsen; Hansen, Axel Kornerup

2016-01-01

Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder.......Dyremodeller har ofte været baseret på avl, der ud fra et alment velfærdsmæssigt synspunkt var problematisk. Transgene teknikker kan ofte forbedre dyrevelfærden ved at erstatte disse traditionelle avlsmetoder....

Dengue virus specific IgY provides protection following lethal dengue virus challenge and is neutralizing in the absence of inducing antibody dependent enhancement.

Science.gov (United States)

Fink, Ashley L; Williams, Katherine L; Harris, Eva; Alvine, Travis D; Henderson, Thomas; Schiltz, James; Nilles, Matthew L; Bradley, David S

2017-07-01

Dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS) are severe disease manifestations that can occur following sequential infection with different dengue virus serotypes (DENV1-4). At present, there are no licensed therapies to treat DENV-induced disease. DHF and DSS are thought to be mediated by serotype cross-reactive antibodies that facilitate antibody-dependent enhancement (ADE) by binding to viral antigens and then Fcγ receptors (FcγR) on target myeloid cells. Using genetically engineered DENV-specific antibodies, it has been shown that the interaction between the Fc portion of serotype cross-reactive antibodies and FcγR is required to induce ADE. Additionally, it was demonstrated that these antibodies were as neutralizing as their non-modified variants, were incapable of inducing ADE, and were therapeutic following a lethal, antibody-enhanced infection. Therefore, we hypothesized that avian IgY, which do not interact with mammalian FcγR, would provide a novel therapy for DENV-induced disease. We demonstrate here that goose-derived anti-DENV2 IgY neutralized DENV2 and did not induce ADE in vitro. Anti-DENV2 IgY was also protective in vivo when administered 24 hours following a lethal DENV2 infection. We were also able to demonstrate via epitope mapping that both full-length and alternatively spliced anti-DENV2 IgY recognized different epitopes, including epitopes that have not been previously identified. These observations provide evidence for the potential therapeutic applications of goose-derived anti-DENV2 IgY.

Dengue virus specific IgY provides protection following lethal dengue virus challenge and is neutralizing in the absence of inducing antibody dependent enhancement.

Directory of Open Access Journals (Sweden)

Ashley L Fink

2017-07-01

Full Text Available Dengue hemorrhagic fever (DHF and dengue shock syndrome (DSS are severe disease manifestations that can occur following sequential infection with different dengue virus serotypes (DENV1-4. At present, there are no licensed therapies to treat DENV-induced disease. DHF and DSS are thought to be mediated by serotype cross-reactive antibodies that facilitate antibody-dependent enhancement (ADE by binding to viral antigens and then Fcγ receptors (FcγR on target myeloid cells. Using genetically engineered DENV-specific antibodies, it has been shown that the interaction between the Fc portion of serotype cross-reactive antibodies and FcγR is required to induce ADE. Additionally, it was demonstrated that these antibodies were as neutralizing as their non-modified variants, were incapable of inducing ADE, and were therapeutic following a lethal, antibody-enhanced infection. Therefore, we hypothesized that avian IgY, which do not interact with mammalian FcγR, would provide a novel therapy for DENV-induced disease. We demonstrate here that goose-derived anti-DENV2 IgY neutralized DENV2 and did not induce ADE in vitro. Anti-DENV2 IgY was also protective in vivo when administered 24 hours following a lethal DENV2 infection. We were also able to demonstrate via epitope mapping that both full-length and alternatively spliced anti-DENV2 IgY recognized different epitopes, including epitopes that have not been previously identified. These observations provide evidence for the potential therapeutic applications of goose-derived anti-DENV2 IgY.

Efficiency to Discovery Transgenic Loci in GM Rice Using Next Generation Sequencing Whole Genome Re-sequencing

Directory of Open Access Journals (Sweden)

Doori Park

2015-09-01

Full Text Available Molecular characterization technology in genetically modified organisms, in addition to how transgenic biotechnologies are developed now require full transparency to assess the risk to living modified and non-modified organisms. Next generation sequencing (NGS methodology is suggested as an effective means in genome characterization and detection of transgenic insertion locations. In the present study, we applied NGS to insert transgenic loci, specifically the epidermal growth factor (EGF in genetically modified rice cells. A total of 29.3 Gb (~72× coverage was sequenced with a 2 × 150 bp paired end method by Illumina HiSeq2500, which was consecutively mapped to the rice genome and T-vector sequence. The compatible pairs of reads were successfully mapped to 10 loci on the rice chromosome and vector sequences were validated to the insertion location by polymerase chain reaction (PCR amplification. The EGF transgenic site was confirmed only on chromosome 4 by PCR. Results of this study demonstrated the success of NGS data to characterize the rice genome. Bioinformatics analyses must be developed in association with NGS data to identify highly accurate transgenic sites.

Novel Strategy to Control Transgene Expression Mediated by a Sendai Virus-Based Vector Using a Nonstructural C Protein and Endogenous MicroRNAs.

Directory of Open Access Journals (Sweden)

Masayuki Sano

Full Text Available Tissue-specific control of gene expression is an invaluable tool for studying various biological processes and medical applications. Efficient regulatory systems have been utilized to control transgene expression in various types of DNA viral or integrating viral vectors. However, existing regulatory systems are difficult to transfer into negative-strand RNA virus vector platforms because of significant differences in their transcriptional machineries. In this study, we developed a novel strategy for regulating transgene expression mediated by a cytoplasmic RNA vector based on a replication-defective and persistent Sendai virus (SeVdp. Because of the capacity of Sendai virus (SeV nonstructural C proteins to specifically inhibit viral RNA synthesis, overexpression of C protein significantly reduced transgene expression mediated by SeVdp vectors. We found that SeV C overexpression concomitantly reduced SeVdp mRNA levels and genomic RNA synthesis. To control C expression, target sequences for an endogenous microRNA were incorporated into the 3' untranslated region of the C genes. Incorporation of target sequences for miR-21 into the SeVdp vector restored transgene expression in HeLa cells by decreasing C expression. Furthermore, the SeVdp vector containing target sequences for let-7a enabled cell-specific control of transgene expression in human fibroblasts and induced pluripotent stem cells. Our findings demonstrate that SeV C can be used as an effective regulator for controlling transgene expression. This strategy will contribute to efficient and less toxic SeVdp-mediated gene transfer in various biological applications.

Recent advances in the development of new transgenic animal technology.

Science.gov (United States)

Miao, Xiangyang

2013-03-01

Transgenic animal technology is one of the fastest growing biotechnology areas. It is used to integrate exogenous genes into the animal genome by genetic engineering technology so that these genes can be inherited and expressed by offspring. The transgenic efficiency and precise control of gene expression are the key limiting factors in the production of transgenic animals. A variety of transgenic technologies are available. Each has its own advantages and disadvantages and needs further study because of unresolved technical and safety issues. Further studies will allow transgenic technology to explore gene function, animal genetic improvement, bioreactors, animal disease models, and organ transplantation. This article reviews the recently developed animal transgenic technologies, including the germ line stem cell-mediated method to improve efficiency, gene targeting to improve accuracy, RNA interference-mediated gene silencing technology, zinc-finger nuclease gene targeting technology and induced pluripotent stem cell technology. These new transgenic techniques can provide a better platform to develop transgenic animals for breeding new animal varieties and promote the development of medical sciences, livestock production, and other fields.

Influence Analysis of Shell Material and Charge on Shrapnel Lethal Power

Directory of Open Access Journals (Sweden)

Wang Lin

2015-01-01

Full Text Available To compare the shrapnel lethal power with different shell material and charge, LS-DYNA was used to numerically simulate four kinds of shrapnel lethal power. The shell material was 58SiMn, 50SiMnVB or 40Cr, whereas the charge was RL-F. And the shell material was 58SiMn, whereas the charge was TNT. The shell rupture process and lethal power test were analyzed. The results show that, the lethal power of RL-F charge increase by 25%, 45%, 14% compared with the TNT charge, whereas the shell material was 58SiMn, 50SiMnVB, 40Cr. And then the guarantee range and lethal power can be improved by using the high explosive and changing shell material, whereas the projectile shape coefficient is invariable.

Fat-specific transgenic expression of resistin in the spontaneously hypertensive rat impairs fatty acid re-esterification

Czech Academy of Sciences Publication Activity Database

Pravenec, Michal; Kazdová, L.; Cahová, M.; Landa, Vladimír; Zídek, Václav; Mlejnek, Petr; Šimáková, Miroslava; Wang, J.; Qi, N.; Kurtz, T. W.

2006-01-01

Roč. 30, č. 7 (2006), s. 1157-1159 ISSN 0307-0565 R&D Projects: GA ČR(CZ) GA301/03/0751; GA MZd(CZ) NB7403; GA MŠk(CZ) 1M0520 Grant - others:HHMI(US) 55005624 Institutional research plan: CEZ:AV0Z50110509 Keywords : spontaneously hypertensive rat * transgenic resistin * fatty acid reesterification Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 4.055, year: 2006

Extracellular Secretion of Phytase from Transgenic Wheat Roots Allows Utilization of Phytate for Enhanced Phosphorus Uptake.

Science.gov (United States)

Mohsin, Samreen; Maqbool, Asma; Ashraf, Mehwish; Malik, Kauser Abdulla

2017-08-01

A significant portion of organic phosphorus comprises of phytates which are not available to wheat for uptake. Hence for enabling wheat to utilize organic phosphorus in form of phytate, transgenic wheat expressing phytase from Aspergillus japonicus under barley root-specific promoter was developed. Transgenic events were initially screened via selection media containing BASTA, followed by PCR and BASTA leaf paint assay after hardening. Out of 138 successfully regenerated T o events, only 12 had complete constructs and thus further analyzed. Positive T1 transgenic plants, grown in sand, exhibited 0.08-1.77, 0.02-0.67 and 0.44-2.14 fold increase in phytase activity in root extracts, intact roots and external root solution, respectively, after 4 weeks of phosphorus stress. Based on these results, T2 generation of four best transgenic events was further analyzed which showed up to 1.32, 56.89, and 15.40 fold increase in phytase activity in root extracts, intact roots and external root solution, respectively, while in case of real-time PCR, maximum fold increase of 19.8 in gene expression was observed. Transgenic lines showed 0.01-1.18 fold increase in phosphorus efficiency along with higher phosphorus content when supplied phytate or inorganic phosphorus than control plants. Thus, this transgenic wheat may aid in reducing fertilizer utilization and enhancing wheat yield.

Increased Expression of the Na,K-ATPase alpha4 Isoform Enhances Sperm Motility in Transgenic Mice1

Science.gov (United States)

Jimenez, Tamara; Sanchez, Gladis; McDermott, Jeffrey P.; Nguyen, Anh-Nguyet; Kumar, T. Rajendra; Blanco, Gustavo

2010-01-01

The Na,K-ATPase alpha4 (ATP1A4) isoform is specifically expressed in male germ cells and is highly prevalent in spermatozoa. Although selective inhibition of alpha4 activity with ouabain has been shown to affect sperm motility, a more direct analysis of the role of this isoform in sperm movement has not yet been demonstrated. To establish this, we engineered transgenic mice that express the rat alpha4 isoform fused to green fluorescent protein in male germ cells, under the control of the mouse protamine 1 promoter. We showed that the rat Atp1a4 transgene is expressed in mouse spermatozoa and that it is localized to the sperm flagellum. In agreement with increased expression of the alpha4 isoform, sperm from transgenic mice displayed higher alpha4-specific Na,K-ATPase activity and binding of fluorescently labeled ouabain than wild-type mice. In contrast, expression and activity of ATP1A1 (alpha1), the other Na,K-ATPase alpha isoform present in sperm, remained unchanged. Similar to wild-type mice, mice expressing the alpha4 transgene exhibited normal testis and sperm morphology and no differences in fertility. However, compared to wild-type mice, sperm from transgenic mice displayed plasma membrane hyperpolarization and higher total and progressive motility. Other parameters of motility also increased, including straight-line, curvilinear, and average path velocities and amplitude of lateral head displacement. In addition, sperm from the transgenic mice showed enhanced sperm hyperactive motility, but no changes in progesterone-induced acrosome reaction. Altogether, these results provide new genetic evidence for the role of the ATP1A4 isoform in sperm motility, under both noncapacitating and capacitating conditions. PMID:20826726

Transgenic fluorescent zebrafish Tg(fli1:EGFP)y¹ for the identification of vasotoxicity within the zFET.

Science.gov (United States)

Delov, Vera; Muth-Köhne, Elke; Schäfers, Christoph; Fenske, Martina

2014-05-01

The fish embryo toxicity test (FET) is currently one of the most advocated animal alternative tests in ecotoxicology. To date, the application of the FET with zebrafish (zFET) has focused on acute toxicity assessment, where only lethal morphological effects are accounted for. An application of the zFET beyond acute toxicity, however, necessitates the establishment of more refined and quantifiable toxicological endpoints. A valuable tool in this context is the use of gene expression-dependent fluorescent markers that can even be measured in vivo. We investigated the application of embryos of Tg(fli1:EGFP)(y1) for the identification of vasotoxic substances within the zFET. Tg(fli1:EGFP)(y1) fish express enhanced GFP in the entire vasculature under the control of the fli1 promoter, and thus enable the visualization of vascular defects in live zebrafish embryos. We assessed the fli1 driven EGFP-expression in the intersegmental blood vessels (ISVs) qualitatively and quantitatively, and found an exposure concentration related increase in vascular damage for chemicals like triclosan, cartap and genistein. The fluorescence endpoint ISV-length allowed an earlier and more sensitive detection of vasotoxins than the bright field assessment method. In combination with the standard bright field morphological effect assessment, an increase in significance and value of the zFET for a mechanism-specific toxicity evaluation was achieved. This study highlights the benefits of using transgenic zebrafish as convenient tools for identifying toxicity in vivo and to increase sensitivity and specificity of the zFET. Copyright © 2014 Elsevier B.V. All rights reserved.

Inhibitory action of chlorophyllin of autosome recessive lethals induced by irradiation

International Nuclear Information System (INIS)

Salceda, V.M.; Pimentel, P.A.E.; Cruces, M.P.

2006-01-01

The chlorophyllin is a sodium salt of the chlorophyll that has a strong protective action of the damage induced by different agents so much physical as chemical. In Drosophila there is reported this effect in somatic cells. In contrast, in germinal cells using tests with the sexual chromosomes has not been found such inhibitory action. For this reason, in this occasion we will refer to the effect of the lethality induced in autosome chromosomes, in particular to the chromosome II of this species. For such effect groups of males of the line Canton-S its were pre-treated for 24h with or without 69 mm of CCS and later on treaties with or without 40 Gy of gamma irradiation. The males were then subjected to the technical Cy L / Pm for the detection of recessive lethals. In the third generation the respective counts of the descendant of each one of them to determine the corresponding categories for each extracted chromosome were made. To be mendelian crosses it is expected for a normal chromosome a proportion 2:1 of individuals with genotype Cy L / +: +/+. The absence of individuals +/+ it is indicative of a lethal gene, until 10% of these individuals of each male's total descendant, it is considered that is carrying of a semi lethal gene. The sum of lethal and semi lethals constitutes the category detrimental. The obtained results indicated that the pre-treatment with CCS reduces in a significant way the frequency of induced lethals by 40 Gy of gamma rays. The fact that an effect inhibitor has not been observed in the test of recessive lethal bound to the sex obtained previously, it contrasts with the effect observed in the chromosome II, results of this study and with the one observed in the chromosome III in somatic cells. The above-mentioned shows a differential action of the CCS between sexual chromosomes and autosomal before the effect of the gamma radiation. At the moment we don't have an explanation to these evidences. To evaluate the action of the chlorophyllin

Lethal and Sub-lethal Effects of Four Insecticides on the Aphidophagous Coccinellid Adalia bipunctata (Coleoptera: Coccinellidae).

Science.gov (United States)

Depalo, Laura; Lanzoni, Alberto; Masetti, Antonio; Pasqualini, Edison; Burgio, Giovanni

2017-12-05

Conventional insecticide assays, which measure the effects of insecticide exposure on short-term mortality, overlook important traits, including persistence of toxicity or sub-lethal effects. Therefore, such approaches are especially inadequate for prediction of the overall impact of insecticides on beneficial arthropods. In this study, the side effects of four modern insecticides (chlorantraniliprole, emamectin benzoate, spinosad, and spirotetramat) on Adalia bipunctata (L.) (Coleoptera: Coccinellidae) were evaluated under laboratory conditions by exposition on treated potted plants. In addition to investigation of acute toxicity and persistence of harmful activity in both larvae and adults of A. bipunctata, demographic parameters were evaluated, to provide a comprehensive picture of the nontarget effects of these products. Field doses of the four insecticides caused detrimental effects to A. bipunctata; but in different ways. Overall, spinosad showed the best toxicological profile among the products tested. Emamectin benzoate could be considered a low-risk insecticide, but had high persistence. Chlorantraniliprole exhibited lethal effects on early instar larvae and adults, along with a long-lasting activity, instead spirotetramat showed a low impact on larval and adult mortality and can be considered a short-lived insecticide. However, demographic analysis demonstrated that chlorantraniliprole and spirotetramat caused sub-lethal effects. Our findings highlight that sole assessment of mortality can lead to underestimation of the full impact of pesticides on nontarget insects. Demographic analysis was demonstrated to be a sensitive method for detection of the sub-lethal effects of insecticides on A. bipunctata, and this approach should be considered for evaluation of insecticide selectivity. © The Author(s) 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

An active role for endogenous beta-1,3-glucanase genes in transgene-mediated co-suppression in tobacco.

Science.gov (United States)

Sanders, Matthew; Maddelein, Wendy; Depicker, Anna; Van Montagu, Marc; Cornelissen, Marc; Jacobs, John

2002-11-01

Post-transcriptional gene silencing (PTGS) is characterized by the accumulation of short interfering RNAs that are proposed to mediate sequence-specific degradation of cognate and secondary target mRNAs. In plants, it is unclear to what extent endogenous genes contribute to this process. Here, we address the role of the endogenous target genes in transgene-mediated PTGS of beta-1,3-glucanases in tobacco. We found that mRNA sequences of the endogenous glucanase glb gene with varying degrees of homology to the Nicotiana plumbaginifolia gn1 transgene are targeted by the silencing machinery, although less efficiently than corresponding transgene regions. Importantly, we show that endogene-specific nucleotides in the glb sequence provide specificity to the silencing process. Consistent with this finding, small sense and antisense 21- to 23-nucleotide RNAs homologous to the endogenous glb gene were detected. Combined, these data demonstrate that a co-suppressed endogenous glucan ase gene is involved in signal amplification and selection of homologous targets, and show that endogenous genes can actively participate in PTGS in plants. The findings are introduced as a further sophistication of the post-transciptional silencing model.

MR Microimaging of amyloid plaques in Alzheimer's disease transgenic mice

Energy Technology Data Exchange (ETDEWEB)

Wengenack, Thomas M.; Poduslo, Joseph F. [Mayo Clinic, Molecular Neurobiology Laboratory, Departments of Neurology, Neuroscience, and Biochemistry/Molecular Biology, Rochester, MN (United States); Jack, Clifford R. [Mayo Clinic, Department of Radiology, Rochester, MN (United States); Garwood, Michael [University of Minnesota Medical School, Center for Magnetic Resonance Research, Minneapolis, MN (United States); University of Minnesota Medical School, Department of Radiology, Minneapolis, MN (United States)

2008-03-15

Alzheimer's disease (AD) is the most prevalent neurological condition affecting industrialized nations and will rapidly become a healthcare crisis as the population ages. Currently, the post-mortem histological observation of amyloid plaques and neurofibrillary tangles is the only definitive diagnosis available for AD. A pre-mortem biological or physiological marker specific for AD used in conjunction with current neurological and memory testing could add a great deal of confidence to the diagnosis of AD and potentially allow therapeutic intervention much earlier in the disease process. Our group has developed MRI techniques to detect individual amyloid plaques in AD transgenic mouse brain in vivo. We are also developing contrast-enhancing agents to increase the specificity of detection of amyloid plaques. Such in vivo imaging of amyloid plaques will also allow the evaluation of anti-amyloid therapies being developed by the pharmaceutical industry in pre-clinical trials of AD transgenic mice. This short review briefly discusses our progress in these areas. (orig.)

Experiences in therapy for lethal midline granuloma

International Nuclear Information System (INIS)

Tosaka, Kaoru; Ishikawa, Takeru

1982-01-01

Four cases of the lethal midline granuloma or malignant granuloma of the nose were treated by irradiation and chemotherapy, which are generally prescribed for malignant lymphomas. Clinical, histological and laboratory examination indicated that they were the lethal midline granuloma and clearly differentiated from Wegener's granulomatosis or malignant lymphoma. All of the cases exhibited primary remission. The four cases were observed up to 38, 22, 14, and 10 months since the beginning of the therapy, showing no local or general recurrence. (author)

Male bovine GH transgenic mice have decreased adiposity with an adipose depot-specific increase in immune cell populations.

Science.gov (United States)

Benencia, Fabian; Harshman, Stephanie; Duran-Ortiz, Silvana; Lubbers, Ellen R; List, Edward O; Householder, Lara; Al-Naeeli, Mawadda; Liang, Xiaoyu; Welch, Lonnie; Kopchick, John J; Berryman, Darlene E

2015-05-01

White adipose tissue (WAT) is composed of mature adipocytes and a stromal vascular fraction (SVF), which contains a variety of cells, including immune cells that vary among the different WAT depots. Growth hormone (GH) impacts immune function and adiposity in an adipose depot-specific manner. However, its effects on WAT immune cell populations remain unstudied. Bovine GH transgenic (bGH) mice are commonly used to study the in vivo effects of GH. These giant mice have an excess of GH action, impaired glucose metabolism, decreased adiposity, increased lean mass, and a shortened lifespan. Therefore, the purpose of this study was to characterize the WAT depot-specific differences in immune cell populations in the presence of excess GH in vivo. Three WAT depots were assessed: inguinal (sc), epididymal (EPI), and mesenteric (MES). Subcutaneous and MES bGH WAT depots showed a significantly higher number of total SVF cells, yet only MES bGH WAT had higher leukocyte counts compared with control samples. By means of flow cytometry analysis of the SVF, we detected greater macrophage and regulatory T-cell infiltration in sc and MES bGH WAT depots compared with controls. However, no differences were observed in the EPI WAT depot. RNA-sequencing confirmed significant alterations in pathways related to T-cell infiltration and activation in the sc depot with fewer significant changes in the EPI bGH WAT depot. These findings collectively point to a previously unrecognized role for GH in influencing the distribution of WAT immune cell populations in a depot-specific manner.

in transgenic cucumber

African Journals Online (AJOL)

Jane

2011-07-18

Jul 18, 2011 ... College of Horticulture, South China Agriculture University, Guangzhou 510642, Guangdong ... The pattern of expression vector pBI-PacPAP. ..... Disease scale ... These transgenic T0 plants were self-pollinated and the.

Tyloses and phenolic deposits in xylem vessels impede water transport in low-lignin transgenic poplars: a study by cryo-fluorescence microscopy

Science.gov (United States)

Peter Kitin; Steven L. Voelker; Frederick C. Meinzer; Hans Beekman; Steven H. Strauss; Barbara. Lachenbruch

2010-01-01

Of 14 transgenic poplar genotypes (Populus tremula x Populus alba) with antisense 4-coumarate:coenzynle A ligase that were grown in the field for 2 years, five that had substantial lignin reductions also had greatly reduced xylem-specific conductivity compared with that of control trees and those transgenic events with small...

The ecological risks of transgenic plants.

Science.gov (United States)

Giovannetti, Manuela

2003-01-01

Biotechnologies have been utilized "ante litteram" for thousands of years to produce food and drink and genetic engineering techniques have been widely applied to produce many compounds for human use, from insulin to other medicines. The debate on genetically modified (GM) organisms broke out all over the world only when GM crops were released into the field. Plant ecologists, microbiologists and population geneticists carried out experiments aimed at evaluating the environmental impact of GM crops. The most significant findings concern: the spread of transgenes through GM pollen diffusion and its environmental impact after hybridisation with closely related wild species or subspecies; horizontal gene transfer from transgenic plants to soil microbes; the impact of insecticide proteins released into the soil by transformed plants on non-target microbial soil communities. Recent developments in genetic engineering produced a technology, dubbed "Terminator", which protects patented genes introduced in transgenic plants by killing the seeds in the second generation. This genetic construct, which interferes so heavily with fundamental life processes, is considered dangerous and should be ex-ante evaluated taking into account the data on "unexpected events", as here discussed, instead of relying on the "safe until proven otherwise" claim. Awareness that scientists, biotechnologists and genetic engineers cannot answer the fundamental question "how likely is that transgenes will be transferred from cultivated plants into the natural environment?" should foster long-term studies on the ecological risks and benefits of transgenic crops.

[Induced expression of Serratia marcescens ribonuclease III gene in transgenic Nicotiana tabacum L. cv. SR1 tobacco plants].

Science.gov (United States)

Zhirnov, I V; Trifonova, E A; Romanova, A V; Filipenko, E A; Sapotsky, M V; Malinovsky, V I; Kochetov, A V; Shumny, V K

2016-11-01

Transgenic Nicotiana tabacum L. cv. SR1 plants, characterized by an increase in the level of dsRNA-specific hydrolytic activity after induction by wounding, were obtained. The Solanum lycopersicum anionic peroxidase gene promoter (new for plant genetic engineering) was for the first time used for the induced expression of the target Serratia marcescens RNase III gene. Upon infection with the tobacco mosaic virus (TMV), the transgenic plants of the obtained lines did not differ significantly from the control group in the level of TMV capsid protein accumulation. In general, no delay in the development of the infection symptoms was observed in transgenic plants as compared with the control group. The obtained transgenic plants represent a new model for the study of the biological role of endoribonucleases from the RNase III family, including in molecular mechanisms of resistance to pathogens.

Expression of Pinellia pedatisecta Lectin Gene in Transgenic Wheat Enhances Resistance to Wheat Aphids

Directory of Open Access Journals (Sweden)

Xiaoliang Duan

2018-03-01

Full Text Available Wheat aphids are major pests during the seed filling stage of wheat. Plant lectins are toxic to sap-sucking pests such as wheat aphids. In this study, Pinellia pedatisecta agglutinin (ppa, a gene encoding mannose binding lectin, was cloned, and it shared 92.69% nucleotide similarity and 94% amino acid similarity with Pinellia ternata agglutinin (pta. The ppa gene, driven by the constitutive and phloem-specific ribulose bisphosphate carboxylase small subunit gene (rbcs promoter in pBAC-rbcs-ppa expression vector, was transferred into the wheat cultivar Baofeng104 (BF104 by particle bombardment transformation. Fifty-four T0 transgenic plants were generated. The inheritance and expression of the ppa gene were confirmed by PCR and RT-PCR analysis respectively, and seven homozygous transgenic lines were obtained. An aphid bioassay on detached leaf segments revealed that seven ppa transgenic wheat lines had lower aphid growth rates and higher inhibition rates than BF104. Furthermore, two-year aphid bioassays in isolated fields showed that aphid numbers per tiller of transgenic lines were significantly decreased, compared with wild type BF104. Therefore, ppa could be a strong biotechnological candidate to produce aphid-resistant wheat.

CaMV-35S promoter sequence-specific DNA methylation in lettuce.

Science.gov (United States)

Okumura, Azusa; Shimada, Asahi; Yamasaki, Satoshi; Horino, Takuya; Iwata, Yuji; Koizumi, Nozomu; Nishihara, Masahiro; Mishiba, Kei-ichiro

2016-01-01

We found 35S promoter sequence-specific DNA methylation in lettuce. Additionally, transgenic lettuce plants having a modified 35S promoter lost methylation, suggesting the modified sequence is subjected to the methylation machinery. We previously reported that cauliflower mosaic virus 35S promoter-specific DNA methylation in transgenic gentian (Gentiana triflora × G. scabra) plants occurs irrespective of the copy number and the genomic location of T-DNA, and causes strong gene silencing. To confirm whether 35S-specific methylation can occur in other plant species, transgenic lettuce (Lactuca sativa L.) plants with a single copy of the 35S promoter-driven sGFP gene were produced and analyzed. Among 10 lines of transgenic plants, 3, 4, and 3 lines showed strong, weak, and no expression of sGFP mRNA, respectively. Bisulfite genomic sequencing of the 35S promoter region showed hypermethylation at CpG and CpWpG (where W is A or T) sites in 9 of 10 lines. Gentian-type de novo methylation pattern, consisting of methylated cytosines at CpHpH (where H is A, C, or T) sites, was also observed in the transgenic lettuce lines, suggesting that lettuce and gentian share similar methylation machinery. Four of five transgenic lettuce lines having a single copy of a modified 35S promoter, which was modified in the proposed core target of de novo methylation in gentian, exhibited 35S hypomethylation, indicating that the modified sequence may be the target of the 35S-specific methylation machinery.

Back to the future: revisiting HIV-1 lethal mutagenesis

Science.gov (United States)

Dapp, Michael J.; Patterson, Steven E.; Mansky, Louis M.

2012-01-01

The concept of eliminating HIV-1 infectivity by elevating the viral mutation rate was first proposed over a decade ago, even though the general concept had been conceived earlier for RNA viruses. Lethal mutagenesis was originally viewed as a novel chemotherapeutic approach for treating HIV-1 infection in which use of a viral mutagen would over multiple rounds of replication lead to the lethal accumulation of mutations, rendering the virus population non infectious – known as the slow mutation accumulation model. There have been limitations in obtaining good efficacy data with drug leads, leaving some doubt into clinical translation. More recent studies of the APOBEC3 proteins as well as new progress in the use of nucleoside analogs for inducing lethal mutagenesis have helped to refocus attention on rapid induction of HIV-1 lethal mutagenesis in a single or limited number of replication cycles leading to a rapid mutation accumulation model. PMID:23195922

Less is more: strategies to remove marker genes from transgenic plants

Science.gov (United States)

2013-01-01

Selectable marker genes (SMGs) and selection agents are useful tools in the production of transgenic plants by selecting transformed cells from a matrix consisting of mostly untransformed cells. Most SMGs express protein products that confer antibiotic- or herbicide resistance traits, and typically reside in the end product of genetically-modified (GM) plants. The presence of these genes in GM plants, and subsequently in food, feed and the environment, are of concern and subject to special government regulation in many countries. The presence of SMGs in GM plants might also, in some cases, result in a metabolic burden for the host plants. Their use also prevents the re-use of the same SMG when a second transformation scheme is needed to be performed on the transgenic host. In recent years, several strategies have been developed to remove SMGs from GM products while retaining the transgenes of interest. This review describes the existing strategies for SMG removal, including the implementation of site specific recombination systems, TALENs and ZFNs. This review discusses the advantages and disadvantages of existing SMG-removal strategies and explores possible future research directions for SMG removal including emerging technologies for increased precision for genome modification. PMID:23617583

Less is more: strategies to remove marker genes from transgenic plants.

Science.gov (United States)

Yau, Yuan-Yeu; Stewart, C Neal

2013-04-23

Selectable marker genes (SMGs) and selection agents are useful tools in the production of transgenic plants by selecting transformed cells from a matrix consisting of mostly untransformed cells. Most SMGs express protein products that confer antibiotic- or herbicide resistance traits, and typically reside in the end product of genetically-modified (GM) plants. The presence of these genes in GM plants, and subsequently in food, feed and the environment, are of concern and subject to special government regulation in many countries. The presence of SMGs in GM plants might also, in some cases, result in a metabolic burden for the host plants. Their use also prevents the re-use of the same SMG when a second transformation scheme is needed to be performed on the transgenic host. In recent years, several strategies have been developed to remove SMGs from GM products while retaining the transgenes of interest. This review describes the existing strategies for SMG removal, including the implementation of site specific recombination systems, TALENs and ZFNs. This review discusses the advantages and disadvantages of existing SMG-removal strategies and explores possible future research directions for SMG removal including emerging technologies for increased precision for genome modification.

Perinatal-lethal Gaucher disease presenting as hydrops fetalis.

Science.gov (United States)

BenHamida, Emira; Ayadi, Imene; Ouertani, Ines; Chammem, Maroua; Bezzine, Ahlem; BenTmime, Riadh; Attia, Leila; Mrad, Ridha; Marrakchi, Zahra

2015-01-01

Perinatal-lethal Gaucher disease is very rare and is considered a variant of type 2 Gaucher disease that occurs in the neonatal period. The most distinct features of perinatal-lethal Gaucher disease are non-immune hydrops fetalis. Less common signs of the disease are hepatosplenomegaly, ichthyosis and arthrogryposis. We report a case of Gaucher's disease (type 2) diagnosed in a newborn who presented with Hydrops Fetalis.

Preliminarily study on the maximum handling size, prey size and species selectivity of growth hormone transgenic and non-transgenic common carp Cyprinus carpio when foraging on gastropods

Science.gov (United States)

Zhu, Tingbing; Zhang, Lihong; Zhang, Tanglin; Wang, Yaping; Hu, Wei; Olsen, Rolf Eric; Zhu, Zuoyan

2017-10-01

The present study preliminarily examined the differences in maximum handling size, prey size and species selectivity of growth hormone transgenic and non-transgenic common carp Cyprinus carpio when foraging on four gastropods species (Bellamya aeruginosa, Radix auricularia, Parafossarulus sinensis and Alocinma longicornis) under laboratory conditions. In the maximum handling size trial, five fish from each age group (1-year-old and 2-year-old) and each genotype (transgenic and non-transgenic) of common carp were individually allowed to feed on B. aeruginosa with wide shell height range. The results showed that maximum handling size increased linearly with fish length, and there was no significant difference in maximum handling size between the two genotypes. In the size selection trial, three pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on three size groups of B. aeruginosa. The results show that the two genotypes of C. carpio favored the small-sized group over the large-sized group. In the species selection trial, three pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on thin-shelled B. aeruginosa and thick-shelled R. auricularia, and five pairs of 2-year-old transgenic and non-transgenic carp were individually allowed to feed on two gastropods species (P. sinensis and A. longicornis) with similar size and shell strength. The results showed that both genotypes preferred thin-shelled Radix auricularia rather than thick-shelled B. aeruginosa, but there were no significant difference in selectivity between the two genotypes when fed on P. sinensis and A. longicornis. The present study indicates that transgenic and non-transgenic C. carpio show similar selectivity of predation on the size- and species-limited gastropods. While this information may be useful for assessing the environmental risk of transgenic carp, it does not necessarily demonstrate that transgenic common carp might

Optimisation of transgene action at the post-transcriptional level: high quality parthenocarpic fruits in industrial tomatoes

Directory of Open Access Journals (Sweden)

Defez Roberto

2002-01-01

Full Text Available Abstract Background Genetic engineering of parthenocarpy confers to horticultural plants the ability to produce fruits under environmental conditions that curtail fruit productivity and quality. The DefH9-iaaM transgene, whose predicted action is to confer auxin synthesis specifically in the placenta, ovules and derived tissues, has been shown to confer parthenocarpy to several plant species (tobacco, eggplant, tomato and varieties. Results UC82 tomato plants, a typical cultivar used by the processing industry, transgenic for the DefH9-iaaM gene produce parthenocarpic fruits that are malformed. UC82 plants transgenic for the DefH9-RI-iaaM, a DefH9-iaaM derivative gene modified in its 5'ULR by replacing 53 nucleotides immediately upstream of the AUG initiation codon with an 87 nucleotides-long sequence derived from the rolA intron sequence, produce parthenocarpic fruits of high quality. In an in vitro translation system, the iaaM mRNA, modified in its 5'ULR is translated 3–4 times less efficiently than the original transcript. An optimal expressivity of parthenocarpy correlates with a reduced transgene mRNA steady state level in DefH9-RI-iaaM flower buds in comparison to DefH9-iaaM flower buds. Consistent with the known function of the iaaM gene, flower buds transgenic for the DefH9-RI-iaaM gene contain ten times more IAA than control untransformed flower buds, but five times less than DefH9-iaaM flower buds. Conclusions By using an auxin biosynthesis transgene downregulated at the post-transcriptional level, an optimal expressivity of parthenocarpy has been achieved in a genetic background not suitable for the original transgene. Thus, the method allows the generation of a wider range of expressivity of the desired trait in transgenic plants.

5-Azacytidine mediated reactivation of silenced transgenes in potato (Solanum tuberosum) at the whole plant level.

Science.gov (United States)

Tyč, Dimitrij; Nocarová, Eva; Sikorová, Lenka; Fischer, Lukáš

2017-08-01

Transient 5-azacytidine treatment of leaf explants from potato plants with transcriptionally silenced transgenes allows de novo regeneration of plants with restored transgene expression at the whole plant level. Transgenes introduced into plant genomes frequently become silenced either at the transcriptional or the posttranscriptional level. Transcriptional silencing is usually associated with DNA methylation in the promoter region. Treatments with inhibitors of maintenance DNA methylation were previously shown to allow reactivation of transcriptionally silenced transgenes in single cells or tissues, but not at the whole plant level. Here we analyzed the effect of DNA methylation inhibitor 5-azacytidine (AzaC) on the expression of two silenced reporter genes encoding green fluorescent protein (GFP) and neomycin phosphotransferase (NPTII) in potato plants. Whereas no obvious reactivation was observed in AzaC-treated stem cuttings, transient treatment of leaf segments with 10 μM AzaC and subsequent de novo regeneration of shoots on the selective medium with kanamycin resulted in the production of whole plants with clearly reactivated expression of previously silenced transgenes. Reactivation of nptII expression was accompanied by a decrease in cytosine methylation in the promoter region of the gene. Using the plants with reactivated GFP expression, we found that re-silencing of this transgene can be accidentally triggered by de novo regeneration. Thus, testing the incidence of transgene silencing during de novo regeneration could be a suitable procedure for negative selection of transgenic lines (insertion events) which have an inclination to be silenced. Based on our analysis of non-specific inhibitory effects of AzaC on growth of potato shoots in vitro, we estimated that AzaC half-life in the culture media is approximately 2 days.

Welfare assessment in transgenic pigs expressing green fluorescent protein (GFP)

DEFF Research Database (Denmark)

Huber, Reinhard C.; Remuge, Liliana; Carlisle, Ailsa

2012-01-01

Since large animal transgenesis has been successfully attempted for the first time about 25 years ago, the technology has been applied in various lines of transgenic pigs. Nevertheless one of the concerns with the technology—animal welfare—has not been approached through systematic assessment...... and statements regarding the welfare of transgenic pigs have been based on anecdotal observations during early stages of transgenic programs. The main aim of the present study was therefore to perform an extensive welfare assessment comparing heterozygous transgenic animals expressing GFP with wildtype animals...... months. The absence of significant differences between GFP and wildtype animals in the parameters observed suggests that the transgenic animals in question are unlikely to suffer from deleterious effects of transgene expression on their welfare and thus support existing anecdotal observations of pigs...

Composite potato plants with transgenic roots on non-transgenic shoots: a model system for studying gene silencing in roots

DEFF Research Database (Denmark)

Horn, Patricia; Santala, Johanna; Nielsen, Steen Lykke

2014-01-01

induced phenotypically normal roots which, however, showed a reduced response to cytokinin as compared with non-transgenic roots. Nevertheless, both types of roots were infected to a similar high rate with the zoospores of Spongospora subterranea, a soilborne potato pathogen. The transgenic roots...

Homeostasis and function of regulatory T cells (Tregs) in vivo: lessons from TCR-transgenic Tregs

Science.gov (United States)

Attridge, Kesley; Walker, Lucy S K

2014-01-01

The identification of CD25 and subsequently Forkhead box protein 3 (Foxp3) as markers for regulatory T cells (Tregs) has revolutionized our ability to explore this population experimentally. In a similar vein, our understanding of antigen-specific Treg responses in vivo owes much to the fortuitous generation of T-cell receptor (TCR)-transgenic Tregs. This has permitted tracking of Tregs with a defined specificity in vivo, facilitating analysis of how encounter with cognate antigen shapes Treg homeostasis and function. Here, we review the key lessons learned from a decade of analysis of TCR-transgenic Tregs and set this in the broader context of general progress in the field. Use of TCR-transgenic Tregs has led to an appreciation that Tregs are a highly dynamic proliferative population in vivo, rather than an anergic population as they were initially portrayed. It is now clear that Treg homeostasis is positively regulated by encounter with self-antigen expressed on peripheral tissues, which is likely to be relevant to the phenomenon of peripheral repertoire reshaping that has been described for Tregs and the observation that the Treg TCR specificities vary by anatomical location. Substantial evidence has also accumulated to support the role of CD28 costimulation and interleukin-2 in Treg homeostasis. The availability of TCR-transgenic Tregs has enabled analysis of Treg populations that are sufficient or deficient in particular genes, without the comparison being confounded by repertoire alterations. This approach has yielded insights into genes required for Treg function in vivo, with particular progress being made on the role of ctla-4 in this context. As the prospect of manipulating Treg populations in the clinic becomes reality, a full appreciation of the rules governing their homeostasis will prove increasingly important. PMID:24712457

Systemic and oral immunogenicity of hemagglutinin protein of rinderpest virus expressed by transgenic peanut plants in a mouse model

International Nuclear Information System (INIS)

Khandelwal, Abha; Renukaradhya, G.J.; Rajasekhar, M.; Sita, G. Lakshmi; Shaila, M.S.

2004-01-01

Rinderpest causes a devastating disease, often fatal, in wild and domestic ruminants. It has been eradicated successfully using a live, attenuated vaccine from most part of the world leaving a few foci of disease in parts of Africa, the Middle East, and South Asia. We have developed transgenic peanut (Arachis hypogaea L.) plants expressing hemagglutinin (H) protein of rinderpest virus (RPV), which is antigenically authentic. In this work, we have evaluated the immunogenicity of peanut-expressed H protein using mouse model, administered parenterally as well as orally. Intraperitoneal immunization of mice with the transgenic peanut extract elicited antibody response specific to H. These antibodies neutralized virus infectivity in vitro. Oral immunization of mice with transgenic peanut induced H-specific serum IgG and IgA antibodies. The systemic and oral immunogenicity of plant-derived H in absence of any adjuvant indicates the potential of edible vaccine for rinderpest

Lethal neonatal short-limbed dwarfism

International Nuclear Information System (INIS)

Kim, Ok Hwa; Yim, Chung Ik; Bahk, Yong Whee

1986-01-01

We have detailed our experiences on 6 cases of neonatal lethal short-limbed dwarfism and reviewed the articles. They include, achondrogenesis, thanatophoric dysplasia, asphyxiating thoracic dysplasia, osteogenesis imperfect a congenita, and hypophosphatasia lethals. Five babies were born alive but died soon after birth and one was a stillbirth. The main cause of failure to thrive was respiratory insufficiency. Each case was having quite characteristic radiologic findings, even if the general appearances were similar to the achondroplasts clinically. Precise diagnosis is very important for genetic counselling of the parents and alarm to them the possibility of bone dysplasias to the next offsprings. For this purpose, the radiologists play major role for the correct diagnosis. We stress that when the baby is born with short-limbed dwarfism, whole body radiogram should be taken including lateral view and postmortem radiogram is also very precious.

Lethal neonatal short-limbed dwarfism

Energy Technology Data Exchange (ETDEWEB)

Kim, Ok Hwa; Yim, Chung Ik; Bahk, Yong Whee [Catholic Medical College, Seoul (Korea, Republic of)

1986-02-15

We have detailed our experiences on 6 cases of neonatal lethal short-limbed dwarfism and reviewed the articles. They include, achondrogenesis, thanatophoric dysplasia, asphyxiating thoracic dysplasia, osteogenesis imperfect a congenita, and hypophosphatasia lethals. Five babies were born alive but died soon after birth and one was a stillbirth. The main cause of failure to thrive was respiratory insufficiency. Each case was having quite characteristic radiologic findings, even if the general appearances were similar to the achondroplasts clinically. Precise diagnosis is very important for genetic counselling of the parents and alarm to them the possibility of bone dysplasias to the next offsprings. For this purpose, the radiologists play major role for the correct diagnosis. We stress that when the baby is born with short-limbed dwarfism, whole body radiogram should be taken including lateral view and postmortem radiogram is also very precious.

Integrating Transgenic Vector Manipulation with Clinical Interventions to Manage Vector-Borne Diseases.

Directory of Open Access Journals (Sweden)

Kenichi W Okamoto

2016-03-01

Full Text Available Many vector-borne diseases lack effective vaccines and medications, and the limitations of traditional vector control have inspired novel approaches based on using genetic engineering to manipulate vector populations and thereby reduce transmission. Yet both the short- and long-term epidemiological effects of these transgenic strategies are highly uncertain. If neither vaccines, medications, nor transgenic strategies can by themselves suffice for managing vector-borne diseases, integrating these approaches becomes key. Here we develop a framework to evaluate how clinical interventions (i.e., vaccination and medication can be integrated with transgenic vector manipulation strategies to prevent disease invasion and reduce disease incidence. We show that the ability of clinical interventions to accelerate disease suppression can depend on the nature of the transgenic manipulation deployed (e.g., whether vector population reduction or replacement is attempted. We find that making a specific, individual strategy highly effective may not be necessary for attaining public-health objectives, provided suitable combinations can be adopted. However, we show how combining only partially effective antimicrobial drugs or vaccination with transgenic vector manipulations that merely temporarily lower vector competence can amplify disease resurgence following transient suppression. Thus, transgenic vector manipulation that cannot be sustained can have adverse consequences-consequences which ineffective clinical interventions can at best only mitigate, and at worst temporarily exacerbate. This result, which arises from differences between the time scale on which the interventions affect disease dynamics and the time scale of host population dynamics, highlights the importance of accounting for the potential delay in the effects of deploying public health strategies on long-term disease incidence. We find that for systems at the disease-endemic equilibrium, even

Reproductive fitness of outcrossed hybrids between transgenic broccoli (brassica oleracea) carrying the ipt transgene and conventional varieties of kale, broccoli and cauliflower

International Nuclear Information System (INIS)

Ting, P.; Tu, Y.; Lin, C.; Chang, H.; Chen, L.; Litfu, A

2014-01-01

Pollens are potential carriers for genetically modified crops to transfer genetic materials horizontally to other plants. For phanerogams, pollen viability and cross-compatibility are critical factors for successful outcross hybridization. To evaluate this possibility, this project investigated pollen viability and pod setting rate by comparing broccoli (Brassica oleracea L. var. italica Planck) and broccoli transformed with the isopentenyl transferase (ipt) gene. Both served as pollen donors and four other varieties as pollen receptors to determine outcross rates. For pollen viability, F1 progeny was higher (p?0.05) for the cross of transgenic ipt broccoli with Li Syue significantly by FDA (fluorescein diacetate) assay. Higher successful hybrids were observed for transgenic ipt broccoli with Fu Yue, Li Syue and Green King. As pollen properties, number and grain diameter were significantly larger (p?0.05) in hybrid combinations of transgenic ipt broccoli with Li Syue and Green King significantly (p?0.05). The pod setting rates were higher while transgenic ipt broccoli served as donor plant. These results analyzing pollen properties between transgenic crops with possible outcross candidates would serve as one of those critical strategies for evaluating environmental biosafety issues for transgenic crops. (author)

Chemical mutagens, transposons, and transgenes to interrogate gene function in Drosophila melanogaster.

Science.gov (United States)

Venken, Koen J T; Bellen, Hugo J

2014-06-15

The study of genetics, genes, and chromosomal inheritance was initiated by Thomas Morgan in 1910, when the first visible mutations were identified in fruit flies. The field expanded upon the work initiated by Herman Muller in 1926 when he used X-rays to develop the first balancer chromosomes. Today, balancers are still invaluable to maintain mutations and transgenes but the arsenal of tools has expanded vastly and numerous new methods have been developed, many relying on the availability of the genome sequence and transposable elements. Forward genetic screens based on chemical mutagenesis or transposable elements have resulted in the unbiased identification of many novel players involved in processes probed by specific phenotypic assays. Reverse genetic approaches have relied on the availability of a carefully selected set of transposon insertions spread throughout the genome to allow the manipulation of the region in the vicinity of each insertion. Lastly, the ability to transform Drosophila with single copy transgenes using transposons or site-specific integration using the ΦC31 integrase has allowed numerous manipulations, including the ability to create and integrate genomic rescue constructs, generate duplications, RNAi knock-out technology, binary expression systems like the GAL4/UAS system as well as other methods. Here, we will discuss the most useful methodologies to interrogate the fruit fly genome in vivo focusing on chemical mutagenesis, transposons and transgenes. Genome engineering approaches based on nucleases and RNAi technology are discussed in following chapters. Copyright © 2014 Elsevier Inc. All rights reserved.

GH/IGF-I Transgene Expression on Muscle Homeostasis

Science.gov (United States)

Schwartz, Robert J.

1999-01-01

We propose to test the hypothesis that the growth hormone/ insulin like growth factor-I axis through autocrine/paracrine mechanisms may provide long term muscle homeostasis under conditions of prolonged weightlessness. As a key alternative to hormone replacement therapy, ectopic production of hGH, growth hormone releasing hormone (GHRH), and IGF-I will be studied for its potential on muscle mass impact in transgenic mice under simulated microgravity. Expression of either hGH or IGF-I would provide a chronic source of a growth-promoting protein whose biosynthesis or secretion is shut down in space. Muscle expression of the IGF-I transgene has demonstrated about a 20% increase in hind limb muscle mass over control nontransgenic litter mates. These recent experiments, also establish the utility of hind-limb suspension in mice as a workable model to study atrophy in weight bearing muscles. Thus, transgenic mice will be used in hind-limb suspension models to determine the role of GH/IGF-I on maintenance of muscle mass and whether concentric exercises might act in synergy with hormone treatment. As a means to engineer and ensure long-term protein production that would be workable in humans, gene therapy technology will be used by to monitor muscle mass preservation during hind-limb suspension, after direct intramuscular injection of a genetically engineered muscle-specific vector expressing GHRH. Effects of this gene-based therapy will be assessed in both fast twitch (medial gastrocnemius) and slow twitch muscle (soleus). End-points include muscle size, ultrastructure, fiber type, and contractile function, in normal animals, hind limb suspension, and reambutation.

Increased yield of heterologous viral glycoprotein in the seeds of homozygous transgenic tobacco plants cultivated underground.

Science.gov (United States)

Tackaberry, Eilleen S; Prior, Fiona; Bell, Margaret; Tocchi, Monika; Porter, Suzanne; Mehic, Jelica; Ganz, Peter R; Sardana, Ravinder; Altosaar, Illimar; Dudani, Anil

2003-06-01

The use of transgenic plants in the production of recombinant proteins for human therapy, including subunit vaccines, is being investigated to evaluate the efficacy and safety of these emerging biopharmaceutical products. We have previously shown that synthesis of recombinant glycoprotein B (gB) of human cytomegalovirus can be targeted to seeds of transgenic tobacco when directed by the rice glutelin 3 promoter, with gB retaining critical features of immunological reactivity (E.S. Tackaberry et al. 1999. Vaccine, 17: 3020-3029). Here, we report development of second generation transgenic plant lines (T1) homozygous for the transgene. Twenty progeny plants from two lines (A23T(1)-2 and A24T(1)-3) were grown underground in an environmentally contained mine shaft. Based on yields of gB in their seeds, the A23T(1)-2 line was then selected for scale-up in the same facility. Analyses of mature seeds by ELISA showedthat gB specific activity in A23T(1)-2 seeds was over 30-fold greater than the best T0 plants from the same transformation series, representing 1.07% total seed protein. These data demonstrate stable inheritance, an absence of transgene inactivation, and enhanced levels of gB expression in a homozygous second generation plant line. They also provide evidence for the suitability of using this environmentally secure facility to grow transgenic plants producing therapeutic biopharmaceuticals.

Glufosinate ammonium-induced pathogen inhibition and defense responses culminate in disease protection in bar-transgenic rice.

Science.gov (United States)

Ahn, Il-Pyung

2008-01-01

Glufosinate ammonium diminished developments of rice (Oryza sativa) blast and brown leaf spot in 35S:bar-transgenic rice. Pre- and postinoculation treatments of this herbicide reduced disease development. Glufosinate ammonium specifically impeded appressorium formation of the pathogens Magnaporthe grisea and Cochliobolus miyabeanus on hydrophobic surface and on transgenic rice. In contrast, conidial germination remained unaffected. Glufosinate ammonium diminished mycelial growth of two pathogens; however, this inhibitory effect was attenuated in malnutrition conditions. Glufosinate ammonium caused slight chlorosis and diminished chlorophyll content; however, these alterations were almost completely restored in transgenic rice within 7 d. Glufosinate ammonium triggered transcriptions of PATHOGENESIS-RELATED (PR) genes and hydrogen peroxide accumulation in transgenic rice and PR1 transcription in Arabidopsis (Arabidopsis thaliana) wild-type ecotype Columbia harboring 35S:bar construct. All transgenic Arabidopsis showed robust hydrogen peroxide accumulation by glufosinate ammonium. This herbicide also induced PR1 transcription in etr1 and jar1 expressing bar; however, no expression was observed in NahG and npr1. Fungal infection did not alter transcriptions of PR genes and hydrogen peroxide accumulation induced by glufosinate ammonium. Infiltration of glufosinate ammonium did not affect appressorium formation of M. grisea in vivo but inhibited blast disease development. Hydrogen peroxide scavengers nullified blast protection and transcriptions of PR genes by glufosinate ammonium; however, they did not affect brown leaf spot progression. In sum, both direct inhibition of pathogen infection and activation of defense systems were responsible for disease protection in bar-transgenic rice.

Immune Protection against Lethal Fungal-Bacterial Intra-Abdominal Infections.

Science.gov (United States)

Lilly, Elizabeth A; Ikeh, Melanie; Nash, Evelyn E; Fidel, Paul L; Noverr, Mairi C

2018-01-16

trained innate immunity. IMPORTANCE Polymicrobial intra-abdominal infections are clinically devastating infections with high mortality rates, particularly those involving fungal pathogens, including Candida species. Even in patients receiving aggressive antimicrobial therapy, mortality rates remain unacceptably high. There are no available vaccines against IAI, which is complicated by the polymicrobial nature of the infection. IAI leads to lethal systemic inflammation (sepsis), which is difficult to target pharmacologically, as components of the inflammatory response are also needed to control the infection. Our studies demonstrate that prior inoculation with low-virulence Candida species provides strong protection against subsequent lethal infection with C. albicans and S. aureus Surprisingly, protection is long-lived but not mediated by adaptive (specific) immunity. Instead, protection is dependent on cells of the innate immune system (nonspecific immunity) and provides protection against other virulent Candida species. This discovery implies that a form of trained innate immunity may be clinically effective against polymicrobial IAI. Copyright © 2018 Lilly et al.

Differential transgene expression in brain cells in vivo and in vitro from AAV-2 vectors with small transcriptional control units

International Nuclear Information System (INIS)

Kuegler, S.; Lingor, P.; Schoell, U.; Zolotukhin, S.; Baehr, M.

2003-01-01

Adeno-associated- (AAV) based vectors are promising tools for gene therapy applications in several organs, including the brain, but are limited by their small genome size. Two short promoters, the human synapsin 1 gene promoter (hSYN) and the murine cytomegalovirus immediate early promoter (mCMV), were evaluated in bicistronic AAV-2 vectors for their expression profiles in cultured primary brain cells and in the rat brain. Whereas transgene expression from the hSYN promoter was exclusively neuronal, the murine CMV promoter targeted expression mainly to astrocytes in vitro and showed weak transgene expression in vivo in retinal and cortical neurons, but strong expression in thalamic neurons. We propose that neuron specific transgene expression in combination with enhanced transgene capacity will further substantially improve AAV based vector technology

Structure and novel functional mechanism of Drosophila SNF in sex-lethal splicing.

Directory of Open Access Journals (Sweden)

Jicheng Hu

Full Text Available Sans-fille (SNF is the Drosophila homologue of mammalian general splicing factors U1A and U2B'', and it is essential in Drosophila sex determination. We found that, besides its ability to bind U1 snRNA, SNF can also bind polyuridine RNA tracts flanking the male-specific exon of the master switch gene Sex-lethal (Sxl pre-mRNA specifically, similar to Sex-lethal protein (SXL. The polyuridine RNA binding enables SNF directly inhibit Sxl exon 3 splicing, as the dominant negative mutant SNF(1621 binds U1 snRNA but not polyuridine RNA. Unlike U1A, both RNA recognition motifs (RRMs of SNF can recognize polyuridine RNA tracts independently, even though SNF and U1A share very high sequence identity and overall structure similarity. As SNF RRM1 tends to self-associate on the opposite side of the RNA binding surface, it is possible for SNF to bridge the formation of super-complexes between two introns flanking Sxl exon 3 or between a intron and U1 snRNP, which serves the molecular basis for SNF to directly regulate Sxl splicing. Taken together, a new functional model for SNF in Drosophila sex determination is proposed. The key of the new model is that SXL and SNF function similarly in promoting Sxl male-specific exon skipping with SNF being an auxiliary or backup to SXL, and it is the combined dose of SXL and SNF governs Drosophila sex determination.

Heterologous human/rat HER2-specific exosome-targeted T cell vaccine stimulates potent humoral and CTL responses leading to enhanced circumvention of HER2 tolerance in double transgenic HLA-A2/HER2 mice.

Science.gov (United States)

Xie, Yufeng; Wu, Jie; Xu, Aizhang; Ahmeqd, Shahid; Sami, Amer; Chibbar, Rajni; Freywald, Andrew; Zheng, Changyu; Xiang, Jim

2018-03-07

DNA vaccines composed of heterologous human HER2 and rat neu sequences induce stronger antibody response and protective antitumor immunity than either HER2 or neu DNA vaccines in transgenic mice. We previously developed HER2-specific exosome-targeted T-cell vaccine HER2-T EXO capable of stimulating HER2-specific CD8 + T-cell responses, but only leading to partial protective immunity in double-transgenic HLA-A2/HER2 mice with self-immune tolerance to HER2. Here, we constructed an adenoviral vector AdV HuRt expressing HuRt fusion protein composed of NH 2 -HER2 1-407 (Hu) and COOH-neu 408-690 (Rt) fragments, and developed a heterologous human/rat HER2-specific exosome-targeted T-cell vaccine HuRt-T EXO using polyclonal CD4 + T-cells uptaking exosomes released by AdV HuRt -transfected dendritic cells. We found that the HuRt-T EXO vaccine stimulates enhanced CD4 + T-cell responses leading to increased induction of HER2-specific antibody (∼70 µg/ml) compared to that (∼40 µg/ml) triggered by the homologous HER2-T EXO vaccine. By using PE-H-2K d /HER2 23-71 tetramer, we determined that HuRt-T EXO stimulates stronger HER2-specific CD8 + T-cell responses eradicating 90% of HER2-specific target cells, while HER2-T EXO -induced CD8 + T-cell responses only eliminating 53% targets. Furthermore, HuRt-T EXO , but not HER2-T EXO vaccination, is capable of suppressing early stage-established HER2-expressing 4T1 HER2 breast cancer in its lung metastasis or subcutaneous form in BALB/c mice, and of completely protecting transgenic HLA-A2/HER2 mice from growth of HLA-A2/HER2-expressing BL6-10 A2/HER2 melanoma. HuRt-T EXO -stimulated HER2-specific CD8 + T-cells not only are cytolytic to trastuzumab-resistant HLA-A2/HER2-expressing BT474/A2 breast tumor cells in vitro but also eradicates pre-established BT474/A2 tumors in athymic nude mice. Therefore, our novel heterologous human/rat HER2-specific T-cell vaccine HuRt-T EXO, circumventing HER2 tolerance, may provide a new

Expression of multiple proteins in transgenic plants

Science.gov (United States)

Vierstra, Richard D.; Walker, Joseph M.

2002-01-01

A method is disclosed for the production of multiple proteins in transgenic plants. A DNA construct for introduction into plants includes a provision to express a fusion protein of two proteins of interest joined by a linking domain including plant ubiquitin. When the fusion protein is produced in the cells of a transgenic plant transformed with the DNA construction, native enzymes present in plant cells cleave the fusion protein to release both proteins of interest into the cells of the transgenic plant. Since the proteins are produced from the same fusion protein, the initial quantities of the proteins in the cells of the plant are approximately equal.

Lethal interpersonal violence in the Middle Pleistocene.

Directory of Open Access Journals (Sweden)

Nohemi Sala

Full Text Available Evidence of interpersonal violence has been documented previously in Pleistocene members of the genus Homo, but only very rarely has this been posited as the possible manner of death. Here we report the earliest evidence of lethal interpersonal violence in the hominin fossil record. Cranium 17 recovered from the Sima de los Huesos Middle Pleistocene site shows two clear perimortem depression fractures on the frontal bone, interpreted as being produced by two episodes of localized blunt force trauma. The type of injuries, their location, the strong similarity of the fractures in shape and size, and the different orientations and implied trajectories of the two fractures suggest they were produced with the same object in face-to-face interpersonal conflict. Given that either of the two traumatic events was likely lethal, the presence of multiple blows implies an intention to kill. This finding shows that the lethal interpersonal violence is an ancient human behavior and has important implications for the accumulation of bodies at the site, supporting an anthropic origin.

Lethal interpersonal violence in the Middle Pleistocene.

Science.gov (United States)

Sala, Nohemi; Arsuaga, Juan Luis; Pantoja-Pérez, Ana; Pablos, Adrián; Martínez, Ignacio; Quam, Rolf M; Gómez-Olivencia, Asier; Bermúdez de Castro, José María; Carbonell, Eudald

2015-01-01

Evidence of interpersonal violence has been documented previously in Pleistocene members of the genus Homo, but only very rarely has this been posited as the possible manner of death. Here we report the earliest evidence of lethal interpersonal violence in the hominin fossil record. Cranium 17 recovered from the Sima de los Huesos Middle Pleistocene site shows two clear perimortem depression fractures on the frontal bone, interpreted as being produced by two episodes of localized blunt force trauma. The type of injuries, their location, the strong similarity of the fractures in shape and size, and the different orientations and implied trajectories of the two fractures suggest they were produced with the same object in face-to-face interpersonal conflict. Given that either of the two traumatic events was likely lethal, the presence of multiple blows implies an intention to kill. This finding shows that the lethal interpersonal violence is an ancient human behavior and has important implications for the accumulation of bodies at the site, supporting an anthropic origin.

Postmortem findings in cloned and transgenic piglets dead before weaning

DEFF Research Database (Denmark)

Schmidt, Mette; Winther, K.D.; Secher, Jan Ole Bertelsen

2015-01-01

Important factors contributing to the well-known high mortality of piglets produced by SCNT are gross malformations of vital organs. The aim of the present retrospective study was to describe malformations found in cloned piglets, transgenic or not, dying or culled before weaning on Day 28. Large...... White (LW) embryos were transferred to 78 LW recipients, while 72 recipients received Göttingen embryos (67 transgenic and five not transgenic) and 56 received Yucatan embryos (43 transgenic and 13 not transgenic). Overall pregnancy rate was 76%, and there were more abortions in recipients with minipig...... in 152 piglets, but several piglets showed two (n = 58) or more (n = 23) malformations (7.4% and 2.8% of all born, respectively). A significantly higher malformation rate was found in transgenic Göttingen and Yucatan piglets (32% and 46% of all born, respectively) than in nontransgenic LW (17...

Single molecule Raman spectroscopic assay to detect transgene from GM plants.

Science.gov (United States)

Kadam, Ulhas S; Chavhan, Rahul L; Schulz, Burkhard; Irudayaraj, Joseph

2017-09-01

Substantial concerns have been raised for the safety of transgenics on human health and environment. Many organizations, consumer groups, and environmental agencies advocate for stringent regulations to avoid transgene products' contamination in food cycle or in nature. Here we demonstrate a novel approach using surface enhanced Raman spectroscopy (SERS) to detect and quantify transgene from GM plants. We show a highly sensitive and accurate quantification of transgene DNA from multiple transgenic lines of Arabidopsis. The assay allows us to detect and quantify the transgenes as low as 0.10 pg without need for PCR-amplification. This technology is relatively cheap, quick, simple, and suitable for detection at low target concentration. Copyright © 2017 Elsevier Inc. All rights reserved.

Illegal gene flow from transgenic creeping bentgrass: the saga continues.

Science.gov (United States)

Snow, Allison A

2012-10-01

Ecologists have paid close attention to environmental effects that fitness-enhancing transgenes might have following crop-to-wild gene flow (e.g. Snow et al. 2003). For some crops, gene flow also can lead to legal problems,especially when government agencies have not approved transgenic events for unrestricted environmental release.Creeping bentgrass (Agrostis stolonifera), a common turf grass used in golf courses, is the focus of both areas of concern. In 2002, prior to expected deregulation (still pending), The Scotts Company planted creeping bentgrass with transgenic resistance to the herbicide glyphosate,also known as RoundUp, on 162 ha in a designated control area in central Oregon (Fig. 1).Despite efforts to restrict gene flow, wind-dispersed pollen carried transgenes to florets of local A. stolonifera and A. gigantea as far as 14 km away, and to sentinel plants placed as far as 21 km away (Watrud et al. 2004).Then, in August 2003, a strong wind event moved transgenic seeds from wind rows of cut bentgrass into nearby areas. The company’s efforts to kill all transgenic survivors in the area failed: feral glyphosate-resistant populations of A. stolonifera were found by Reichman et al.(2006), and 62% of 585 bentgrass plants had the telltale CP4 EPSPS transgene in 2006 (Zapiola et al. 2008; Fig. 2).Now, in this issue, the story gets even more interesting as Zapiola & Mallory-Smith (2012) describe a transgenic,intergeneric hybrid produced on a feral, transgenic creeping bentgrass plant that received pollen from Polypogon monspeliensis (rabbitfoot grass). Their finding raises a host of new questions about the prevalence and fitness of intergeneric hybrids, as well as how to evaluate the full extent of gene flow from transgenic crops.

Male mating strategy and the introgression of a growth hormone transgene.

Science.gov (United States)

Valosaari, Kata-Riina; Aikio, Sami; Kaitala, Veijo

2008-11-01

Escaped transgenic organisms (GMO's) may threaten the populations of their wild relatives if able to hybridize with each other. The introgression of a growth enhancement transgene into a wild Atlantic salmon population may be affected by the transgene's effects not only on fitness parameters, but also on mating behaviour. Large anadromous GMO males are most preferred in mating, but a transgene can also give the large sneakers a reproductive advantage over the smaller wild individuals. With a simulation model, we studied whether the increase in the proportion and mating success of sneakers in transgenic and hybrid genotypes could facilitate the introgression of a transgene into wild population after the release of GMOs. The model combines population dynamics and Mendelian inheritance of a transgenic trait. We found that the introgression of the transgene is strongly affected by the greater mating preference of large GMO males. Furthermore, the difference in reproductive success between the anadromous versus sneaker strategy defines how much GMO's have to be preferred to be able to invade. These results emphasize the importance of detailed knowledge of reproductive systems and the effect of a transgene on the phenotype and behaviour of GMOs when assessing the consequences of their release or escape to the wild.

Detection of Bar Transgenic Sugarcane with a Rapid and Visual Loop-Mediated Isothermal Amplification Assay.

Science.gov (United States)

Zhou, Dinggang; Wang, Chunfeng; Li, Zhu; Chen, Yun; Gao, Shiwu; Guo, Jinlong; Lu, Wenying; Su, Yachun; Xu, Liping; Que, Youxiong

2016-01-01

Genetic engineering offers an attractive alternative in sugarcane breeding for increasing cane and sugar yields as well as disease and insect resistance. Bar transgenic sugarcane employing the herbicide tolerance is a useful agronomical trait in weed control. In this study, a loop-mediated isothermal amplification (LAMP) assay for rapid detection of the bar gene in transgenic sugarcane has been developed and evaluated. A set of six primers was designed for LAMP-based amplification of the bar gene. The LAMP reaction conditions were optimized as follows: 5.25 mM of Mg(2+), 6:1 ratio of inner vs. outer primer, and 6.0 U of Bst DNA polymerase in a reaction volume of 25.0 μL. The detection limit of the recombinant plasmid 1Ac0229 was as low as 10 copies in the developed LAMP, which was 10-fold higher sensitive than that of conventional PCR. In 100 putative transgenic lines, the bar gene was detected in 100/100 cases (100%) by LAMP and 97/100 cases (97%) by conventional PCR, respectively. In conclusion, the developed LAMP assay is visual, rapid, sensitive, reliable, and cost-effective for detection of the bar specific transgenic sugarcane.

Expression of a cystatin transgene in eggplant provides resistance to root-knot nematode, Meloidogyne incognita

Directory of Open Access Journals (Sweden)

Pradeep Kumar Papolu

2016-07-01

Full Text Available Root-knot nematodes (RKN cause substantial yield decline in eggplant and sustainable management options to minimize crop damage due to nematodes are still limited. A number of genetic engineering strategies have been developed to disrupt the successful plant-nematode interactions. Among them, delivery of proteinase inhibitors from the plant to perturb nematode development and reproduction is arguably the most effective strategy. In the present study, transgenic eggplant expressing a modified rice cystatin (OC-IΔD86 gene under the control of the root-specific promoter, TUB-1, was generated to evaluate the genetically modified nematode resistance. Five putative transformants were selected through PCR and genomic Southern blot analysis. Expression of the cystatin transgene was confirmed in all the events using western blotting, ELISA and qPCR assay. Upon challenge inoculation, all the transgenic events exhibited a detrimental effect on RKN development and reproduction. The best transgenic line (a single copy event showed 78.3% inhibition in reproductive success of RKN. Our results suggest that cystatins can play an important role for improving nematode resistance in eggplant and their deployment in gene pyramiding strategies with other proteinase inhibitors could ultimately enhance crop yield.

Detection of bar transgenic sugarcane with a rapid and visual loop-mediated isothermal amplification assay

Directory of Open Access Journals (Sweden)

Dinggang eZhou

2016-03-01

Full Text Available Genetic engineering offers an attractive alternative in sugarcane breeding for increasing cane and sugar yields as well as disease and insect resistance. Bar transgenic sugarcane employing the herbicide tolerance is a useful agronomical trait in weed control. In this study, a loop-mediated isothermal amplification (LAMP assay for rapid detection of the bar gene in transgenic sugarcane has been developed and evaluated. A set of six primers was designed for LAMP-based amplification of the bar gene. The LAMP reaction conditions were optimized as follows: 5.25 mM of Mg2+, 6:1 ratio of inner vs outer primer, and 6.0 U of Bst DNA polymerase in a reaction volume of 25.0 μL. The detection limit of the recombinant plasmid 1Ac0229 was as low as 10 copies in the developed LAMP, which was ten-fold higher sensitive than that of conventional PCR. In 100 putative transgenic lines, the bar gene was detected in 100/100 cases (100% by LAMP and 97/100 cases (97% by conventional PCR, respectively. In conclusion, the developed LAMP assay is visual, rapid, sensitive, reliable and cost-effective for detection of the bar specific transgenic sugarcane.

Transgenic neuronal expression of proopiomelanocortin attenuates hyperphagic response to fasting and reverses metabolic impairments in leptin-deficient obese mice.

Science.gov (United States)

Mizuno, Tooru M; Kelley, Kevin A; Pasinetti, Giulio M; Roberts, James L; Mobbs, Charles V

2003-11-01

Hypothalamic proopiomelanocortin (POMC) gene expression is reduced in many forms of obesity and diabetes, particularly in those attributable to deficiencies in leptin or its receptor. To assess the functional significance of POMC in mediating metabolic phenotypes associated with leptin deficiency, leptin-deficient mice bearing a transgene expressing the POMC gene under control of the neuron-specific enolase promoter were produced. The POMC transgene attenuated fasting-induced hyperphagia in wild-type mice. Furthermore, the POMC transgene partially reversed obesity, hyperphagia, and hypothermia and effectively normalized hyperglycemia, glucosuria, glucose intolerance, and insulin resistance in leptin-deficient mice. Effects of the POMC transgene on glucose homeostasis were independent of the partial correction of hyperphagia and obesity. Furthermore, the POMC transgene normalized the profile of hepatic and adipose gene expression associated with gluconeogenesis, glucose output, and insulin sensitivity. These results indicate that central POMC is a key modulator of glucose homeostasis and that agonists of POMC products may provide effective therapy in treating impairments in glucose homeostasis when hypothalamic POMC expression is reduced, as occurs with leptin deficiency, hypothalamic damage, and aging.

A rice chloroplast transit peptide sequence does not alter the cytoplasmic localization of sheep serotonin N-acetyltransferase expressed in transgenic rice plants.

Science.gov (United States)

Byeon, Yeong; Lee, Hyoung Yool; Lee, Kyungjin; Back, Kyoungwhan

2014-09-01

Ectopic overexpression of melatonin biosynthetic genes of animal origin has been used to generate melatonin-rich transgenic plants to examine the functional roles of melatonin in plants. However, the subcellular localization of these proteins expressed in the transgenic plants remains unknown. We studied the localization of sheep (Ovis aries) serotonin N-acetyltransferase (OaSNAT) and a translational fusion of a rice SNAT transit peptide to OaSNAT (TS:OaSNAT) in plants. Laser confocal microscopy analysis revealed that both OaSNAT and TS:OaSNAT proteins were localized to the cytoplasm even with the addition of the transit sequence to OaSNAT. Transgenic rice plants overexpressing the TS:OaSNAT fusion transgene exhibited high SNAT enzyme activity relative to untransformed wild-type plants, but lower activity than transgenic rice plants expressing the wild-type OaSNAT gene. Melatonin levels in both types of transgenic rice plant corresponded well with SNAT enzyme activity levels. The TS:OaSNAT transgenic lines exhibited increased seminal root growth relative to wild-type plants, but less than in the OaSNAT transgenic lines, confirming that melatonin promotes root growth. Seed-specific OaSNAT expression under the control of a rice prolamin promoter did not confer high levels of melatonin production in transgenic rice seeds compared with seeds from transgenic plants expressing OaSNAT under the control of the constitutive maize ubiquitin promoter. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Expression of a complete soybean leghemoglobin gene in root nodules of transgenic Lotus corniculatus

DEFF Research Database (Denmark)

Stougaard, J; Petersen, T E; Marcker, K A

1987-01-01

The complete soybean leghemoglobin lbc(3) gene was transferred into the legume Lotus corniculatus using an Agrobacterium rhizogenes vector system. Organ-specific expression of the soybean gene was observed in root nodules formed on regenerated transgenic plants after infection with Rhizobium loti...

A Mutation of the Prdm9 Mouse Hybrid Sterility Gene Carried by a Transgene.

Science.gov (United States)

Mihola, O; Trachtulec, Z

2017-01-01

PRDM9 is a protein with histone-3-methyltransferase activity, which specifies the sites of meiotic recombination in mammals. Deficiency of the Prdm9 gene in the laboratory mouse results in complete arrest of the meiotic prophase of both sexes. Moreover, the combination of certain PRDM9 alleles from different mouse subspecies causes hybrid sterility, e.g., the male-specific meiotic arrest found in the (PWD/Ph × C57BL/6J)F1 animals. The fertility of all these mice can be rescued using a Prdm9-containing transgene. Here we characterized a transgene made from the clone RP24-346I22 that was expected to encompass the entire Prdm9 gene. Both (PWD/Ph × C57BL/6J)F1 intersubspecific hybrid males and Prdm9-deficient laboratory mice of both sexes carrying this transgene remained sterile, suggesting that Prdm9 inactivation occurred in the Tg(RP24-346I22) transgenics. Indeed, comparative qRT-PCR analysis of testicular RNAs from transgene-positive versus negative animals revealed similar expression levels of Prdm9 mRNAs from the exons encoding the C-terminal part of the protein but elevated expression from the regions coding for the N-terminus of PRDM9, indicating that the transgenic carries a new null Prdm9 allele. Two naturally occurring alternative Prdm9 mRNA isoforms were overexpressed in Tg(RP24-346I22), one formed via splicing to a 3'-terminal exon consisting of short interspersed element B2 and one isoform including an alternative internal exon of 28 base pairs. However, the overexpression of these alternative transcripts was apparently insufficient for Prdm9 function or for increasing the fertility of the hybrid males.

Assessing the value of transgenic crops.

Science.gov (United States)

Lacey, Hugh

2002-10-01

In the current controversy about the value of transgenic crops, matters open to empirical inquiry are centrally at issue. One such matter is a key premise in a common argument (that I summarize) that transgenic crops should be considered to have universal value. The premise is that there are no alternative forms of agriculture available to enable the production of sufficient food to feed the world. The proponents of agroecology challenge it, claiming that agroecology provides an alternative, and they deny the claim that it is well founded on empirical evidence. It is, therefore, a matter of both social and scientific importance that this premise and the criticisms of it be investigated rigorously and empirically, so that the benefits and disadvantages of transgenic-intensive agriculture and agroecology can be compared in a reliable way. Conducting adequate investigation about the potential contribution of agroecology requires that the cultural conditions of its practice (and, thus, of the practices and movements of small-scale farmers in the "third world") be strengthened--and this puts the interests of investigation into tension with the socio-economic interests driving the development of transgenics. General issues about relationship between ethical argument and empirical (scientific) investigation are raised throughout the article.

Transgenic plants with increased calcium stores

Science.gov (United States)

Wyatt, Sarah (Inventor); Tsou, Pei-Lan (Inventor); Robertson, Dominique (Inventor); Boss, Wendy (Inventor)

2004-01-01

The present invention provides transgenic plants over-expressing a transgene encoding a calcium-binding protein or peptide (CaBP). Preferably, the CaBP is a calcium storage protein and over-expression thereof does not have undue adverse effects on calcium homeostasis or biochemical pathways that are regulated by calcium. In preferred embodiments, the CaBP is calreticulin (CRT) or calsequestrin. In more preferred embodiments, the CaBP is the C-domain of CRT, a fragment of the C-domain, or multimers of the foregoing. In other preferred embodiments, the CaBP is localized to the endoplasmic reticulum by operatively associating the transgene encoding the CaBP with an endoplasmic reticulum localization peptide. Alternatively, the CaBP is targeted to any other sub-cellular compartment that permits the calcium to be stored in a form that is biologically available to the plant. Also provided are methods of producing plants with desirable phenotypic traits by transformation of the plant with a transgene encoding a CaBP. Such phenotypic traits include increased calcium storage, enhanced resistance to calcium-limiting conditions, enhanced growth and viability, increased disease and stress resistance, enhanced flower and fruit production, reduced senescence, and a decreased need for fertilizer production. Further provided are plants with enhanced nutritional value as human food or animal feed.

Disruption of NBS1 gene leads to early embryonic lethality in homozygous null mice and induces specific cancer in heterozygous mice

Energy Technology Data Exchange (ETDEWEB)

Kurimasa, Akihiro; Burma, Sandeep; Henrie, Melinda; Ouyang, Honghai; Osaki, Mitsuhiko; Ito, Hisao; Nagasawa, Hatsumi; Little, John B.; Oshimura, Mitsuo; Li, Gloria C.; Chen, David J.

2002-04-15

Nijmegen breakage syndrome (NBS) is a rare autosomal recessive chromosome instability syndrome characterized by microcephaly, growth retardation, immunodeficiency, and cancer predisposition, with cellular features similar to that of ataxia telangiectasia (AT). NBS results from mutations in the mammalian gene Nbs1 that codes for a 95-kDa protein called nibrin, NBS1, or p95. To establish an animal model for NBS, we attempted to generate NBS1 knockout mice. However, NBS1 gene knockouts were lethal at an early embryonic stage. NBS1 homozygous(-/-) blastocyst cells cultured in vitro showed retarded growth and subsequently underwent growth arrest within 5 days of culture. Apoptosis, assayed by TUNEL staining, was observed in NBSI homozygous(-/-) blastocyst cells cultured for four days. NBSI heterozygous(+/-) mice were normal, and exhibited no specific phenotype for at least one year. However, fibroblast cells from NBSI heterozygous(+/-) mice displayed an enhanced frequency of spontaneous transformation to anchorage-independent growth as compared to NBS1 wild-type(+/+) cells. Furthermore, heterozygous(+/-) mice exhibited a high incidence of hepatocellular carcinoma after one year compared to wild-type mice, even though no significant differences in the incidence of other tumors such as lung adenocarcinoma and lymphoma were observed. Taken together, these results strongly suggest that NBS1 heterozygosity and reduced NBSI expression induces formation of specific tumors in mice.

Lectin cDNA and transgenic plants derived therefrom

Science.gov (United States)

Raikhel, Natasha V.

2000-10-03

Transgenic plants containing cDNA encoding Gramineae lectin are described. The plants preferably contain cDNA coding for barley lectin and store the lectin in the leaves. The transgenic plants, particularly the leaves exhibit insecticidal and fungicidal properties.

Transporting Patients with Lethal Contagious Infections

National Research Council Canada - National Science Library

Swartz, Colleen

2002-01-01

.... The AIT is a unique military medical team capable of worldwide air evacuation and management of a limited number of patients who are potentially exposed to known and unknown lethal communicable...

Lentiviral-Mediated Transgene Expression Can Potentiate Intestinal Mesenchymal-Epithelial Signaling

Directory of Open Access Journals (Sweden)

Kohn Aimee

2009-01-01

Full Text Available Abstract Mesenchymal-epithelial signaling is essential for the development of many organs and is often disrupted in disease. In this study, we demonstrate the use of lentiviral-mediated transgene delivery as an effective approach for ectopic transgene expression and an alternative to generation of transgenic animals. One benefit to this approach is that it can be used independently or in conjunction with established transgenic or knockout animals for studying modulation of mesenchymal-epithelial interactions. To display the power of this approach, we explored ectopic expression of a Wnt ligand in the mouse intestinal mesenchyme and demonstrate its functional influence on the adjacent epithelium. Our findings highlight the efficient use of lentiviral-mediated transgene expression for modulating mesenchymal-epithelial interactions in vivo.

Lentiviral-Mediated Transgene Expression Can Potentiate Intestinal Mesenchymal-Epithelial Signaling

Directory of Open Access Journals (Sweden)

Dismuke Adria D

2009-07-01

Full Text Available Abstract Mesenchymal-epithelial signaling is essential for the development of many organs and is often disrupted in disease. In this study, we demonstrate the use of lentiviral-mediated transgene delivery as an effective approach for ectopic transgene expression and an alternative to generation of transgenic animals. One benefit to this approach is that it can be used independently or in conjunction with established transgenic or knockout animals for studying modulation of mesenchymal-epithelial interactions. To display the power of this approach, we explored ectopic expression of a Wnt ligand in the mouse intestinal mesenchyme and demonstrate its functional influence on the adjacent epithelium. Our findings highlight the efficient use of lentiviral-mediated transgene expression for modulating mesenchymal-epithelial interactions in vivo.

Tissue-specific and pathogen-inducible expression of a fusion protein containing a Fusarium-specific antibody and a fungal chitinase protects wheat against Fusarium pathogens and mycotoxins.

Science.gov (United States)

Cheng, Wei; Li, He-Ping; Zhang, Jing-Bo; Du, Hong-Jie; Wei, Qi-Yong; Huang, Tao; Yang, Peng; Kong, Xian-Wei; Liao, Yu-Cai

2015-06-01

Fusarium head blight (FHB) in wheat and other small grain cereals is a globally devastating disease caused by toxigenic Fusarium pathogens. Controlling FHB is a challenge because germplasm that is naturally resistant against these pathogens is inadequate. Current control measures rely on fungicides. Here, an antibody fusion comprised of the Fusarium spp.-specific recombinant antibody gene CWP2 derived from chicken, and the endochitinase gene Ech42 from the biocontrol fungus Trichoderma atroviride was introduced into the elite wheat cultivar Zhengmai9023 by particle bombardment. Expression of this fusion gene was regulated by the lemma/palea-specific promoter Lem2 derived from barley; its expression was confirmed as lemma/palea-specific in transgenic wheat. Single-floret inoculation of independent transgenic wheat lines of the T3 to T6 generations revealed significant resistance (type II) to fungal spreading, and natural infection assays in the field showed significant resistance (type I) to initial infection. Gas chromatography-mass spectrometry analysis revealed marked reduction of mycotoxins in the grains of the transgenic wheat lines. Progenies of crosses between the transgenic lines and the FHB-susceptible cultivar Huamai13 also showed significantly enhanced FHB resistance. Quantitative real-time PCR analysis revealed that the tissue-specific expression of the antibody fusion was induced by salicylic acid drenching and induced to a greater extent by F. graminearum infection. Histochemical analysis showed substantial restriction of mycelial growth in the lemma tissues of the transgenic plants. Thus, the combined tissue-specific and pathogen-inducible expression of this Fusarium-specific antibody fusion can effectively protect wheat against Fusarium pathogens and reduce mycotoxin content in grain. © 2014 Society for Experimental Biology, Association of Applied Biologists and John Wiley & Sons Ltd.

Dominant-lethal mutations and heritable translocations in mice

Energy Technology Data Exchange (ETDEWEB)

Generoso, W.M.

1983-01-01

Chromosome aberrations are a major component of radiation or chemically induced genetic damage in mammalian germ cells. The types of aberration produced are dependent upon the mutagen used and the germ-cell stage treated. For example, in male meiotic and postmeiotic germ cells certain alkylating chemicals induce both dominant-lethal mutations and heritable translocations while others induce primarily dominant-lethal mutations. Production of these two endpoints appears to be determined by the stability of alkylation products with the chromosomes. If the reaction products are intact in the male chromosomes at the time of sperm entry, they may be repaired in fertilized eggs. If repair is not effected and the alkylation products persist to the time of pronuclear chromosome replication, they lead to chromatid-type aberrations and eventually to dominant-lethality. The production of heritable translocations, on the other hand, requires a transformation of unstable alkylation products into suitable intermediate lesions. The process by which these lesions are converted into chromosome exchange within the male genome takes place after sperm enters the egg but prior to the time of pronuclear chromosome replication (i.e., chromosome-type). Thus, dominant-lethal mutations result from both chromatid- and chromosome-type aberrations while heritable translocations result primarily from the latter type. DNA target sites associated with the production of these two endpoints are discussed.

Dominant-lethal mutations and heritable translocations in mice

International Nuclear Information System (INIS)

Generoso, W.M.

1983-01-01

Chromosome aberrations are a major component of radiation or chemically induced genetic damage in mammalian germ cells. The types of aberration produced are dependent upon the mutagen used and the germ-cell stage treated. For example, in male meiotic and postmeiotic germ cells certain alkylating chemicals induce both dominant-lethal mutations and heritable translocations while others induce primarily dominant-lethal mutations. Production of these two endpoints appears to be determined by the stability of alkylation products with the chromosomes. If the reaction products are intact in the male chromosomes at the time of sperm entry, they may be repaired in fertilized eggs. If repair is not effected and the alkylation products persist to the time of pronuclear chromosome replication, they lead to chromatid-type aberrations and eventually to dominant-lethality. The production of heritable translocations, on the other hand, requires a transformation of unstable alkylation products into suitable intermediate lesions. The process by which these lesions are converted into chromosome exchange within the male genome takes place after sperm enters the egg but prior to the time of pronuclear chromosome replication (i.e., chromosome-type). Thus, dominant-lethal mutations result from both chromatid- and chromosome-type aberrations while heritable translocations result primarily from the latter type. DNA target sites associated with the production of these two endpoints are discussed

Dose-Dependent Rescue of KO Amelogenin Enamel by Transgenes in Vivo.

Science.gov (United States)

Bidlack, Felicitas B; Xia, Yan; Pugach, Megan K

2017-01-01

Mice lacking amelogenin (KO) have hypoplastic enamel. Overexpression of the most abundant amelogenin splice variant M180 and LRAP transgenes can substantially improve KO enamel, but only ~40% of the incisor thickness is recovered and the prisms are not as tightly woven as in WT enamel. This implies that the compositional complexity of the enamel matrix is required for different aspects of enamel formation, such as organizational structure and thickness. The question arises, therefore, how important the ratio of different matrix components, and in particular amelogenin splice products, is in enamel formation. Can optimal expression levels of amelogenin transgenes representing both the most abundant splice variants and cleavage product at protein levels similar to that of WT improve the enamel phenotype of KO mice? Addressing this question, our objective was here to understand dosage effects of amelogenin transgenes ( Tg ) representing the major splice variants M180 and LRAP and cleavage product CTRNC on enamel properties. Amelogenin KO mice were mated with M180 Tg , CTRNC Tg and LRAP Tg mice to generate M180 Tg and CTRNC Tg double transgene and M180 Tg , CTRNC Tg , LRAP Tg triple transgene mice with transgene hemizygosity (on one allelle) or homozygosity (on both alleles). Transgene homo- vs. hemizygosity was determined by qPCR and relative transgene expression confirmed by Western blot. Enamel volume and mineral density were analyzed by microCT, thickness and structure by SEM, and mechanical properties by Vickers microhardness testing. There were no differences in incisor enamel thickness between amelogenin KO mice with three or two different transgenes, but mice homozygous for a given transgene had significantly thinner enamel than mice hemizygous for the transgene ( p structure, but only up to a maximum of ~80% that of molar and ~40% that of incisor wild-type enamel.

Structural specificity in the lethal and mutagenic activity of furocoumarins in yeast cells

International Nuclear Information System (INIS)

Averbeck, D.; Chandra, P.; Biswas, R.K.; Gesellschaft fuer Strahlen- und Umweltforschung m.b.H., Frankfurt am Main

1975-01-01

Using monofunctional (Angelicin) and bifunctional furocoumarins (Psoralen and 8 Methoxypsoralen) plus 365 nm light it is shown that both kinds of damage, the induced monoadducts and/or crosslinks in DNA, provoke lethal and mutagenic effects in haploid and diploid cells of Saccharomyces cerevisiae. Bifunctional furocoumarins are about 20 times more effective in cell killing than Angelicin. Diploid cells are always more resistant than haploid cells. Dark repair (agar holding) increases survival. This effect can be at least in part correlated to the release of bound material from DNA in dark repair conditions. Bifunctional psoralens (10 μg/ml) are at least 10-fold more effective in inducing nuclear gene back mutations (his - to HIS + ) than Angelicin (10 μg/ml) plus 365 nm light or 254 nm ultraviolet light. In contrast cytoplasmic 'petite' (rho-) mutations are about as frequently induced by Angelicin plus 365 nm light as by 254 nm UV light. Bifunctional furocoumarins are less effective. The frequency of cytoplasmic 'petite' mutations per survivors decreases during dark repair conditions more efficiently after Angelicin than after Psoralen plus 365 nm light treatment. (orig.) [de

Dose-Dependent Rescue of KO Amelogenin Enamel by Transgenes in Vivo

Directory of Open Access Journals (Sweden)

Felicitas B. Bidlack

2017-11-01

Full Text Available Mice lacking amelogenin (KO have hypoplastic enamel. Overexpression of the most abundant amelogenin splice variant M180 and LRAP transgenes can substantially improve KO enamel, but only ~40% of the incisor thickness is recovered and the prisms are not as tightly woven as in WT enamel. This implies that the compositional complexity of the enamel matrix is required for different aspects of enamel formation, such as organizational structure and thickness. The question arises, therefore, how important the ratio of different matrix components, and in particular amelogenin splice products, is in enamel formation. Can optimal expression levels of amelogenin transgenes representing both the most abundant splice variants and cleavage product at protein levels similar to that of WT improve the enamel phenotype of KO mice? Addressing this question, our objective was here to understand dosage effects of amelogenin transgenes (Tg representing the major splice variants M180 and LRAP and cleavage product CTRNC on enamel properties. Amelogenin KO mice were mated with M180Tg, CTRNCTg and LRAPTg mice to generate M180Tg and CTRNCTg double transgene and M180Tg, CTRNCTg, LRAPTg triple transgene mice with transgene hemizygosity (on one allelle or homozygosity (on both alleles. Transgene homo- vs. hemizygosity was determined by qPCR and relative transgene expression confirmed by Western blot. Enamel volume and mineral density were analyzed by microCT, thickness and structure by SEM, and mechanical properties by Vickers microhardness testing. There were no differences in incisor enamel thickness between amelogenin KO mice with three or two different transgenes, but mice homozygous for a given transgene had significantly thinner enamel than mice hemizygous for the transgene (p < 0.05. The presence of the LRAPTg did not improve the phenotype of M180Tg/CTRNCTg/KO enamel. In the absence of endogenous amelogenin, the addition of amelogenin transgenes representing the most

A lethal ovitrap-based mass trapping scheme for dengue control in Australia: I. Public acceptability and performance of lethal ovitraps.

Science.gov (United States)

Ritchie, S A; Rapley, L P; Williams, C; Johnson, P H; Larkman, M; Silcock, R M; Long, S A; Russell, R C

2009-12-01

We report on the first field evaluation of the public acceptability and performance of two types of lethal ovitrap (LO) in three separate trials in Cairns, Australia. Health workers were able to set standard lethal ovitraps (SLOs) in 75 and 71% of premise yards in the wet and dry season, respectively, and biodegradable lethal ovitraps (BLOs) in 93% of yards. Public acceptance, measured as retention of traps by residents, was high for both trap types, with porous (grass, soil and mulch) versus solid (tiles, concrete, wood and stone) substrates. The SLOs and the BLOs were readily acceptable to ovipositing Aedes aegypti L. (Diptera: Culicidae); the mean number of eggs/trap was 6 and 15, for the dry season and wet season SLO trial, respectively, and 15 for the BLO wet season trial. Indeed, 84-94% of premise yards had egg positive SLOs or BLOs. A high percentage of both wet and dry season SLOs (29 and 70%, respectively) and BLOs (62%) that were dry after 4 weeks were egg positive, indicating the traps had functioned. Lethal strips from SLOs and BLOs that had been exposed for 4 weeks killed 83 and 74%, respectively, of gravid Ae. aegypti in laboratory assays. These results indicate that mass trapping schemes using SLOs and BLOs are not rejected by the public and effectively target gravid Ae. aegypti. The impact of the interventions on mosquito populations is described in a companion paper.

Bean Yellow Dwarf Virus replicons for high-level transgene expression in transgenic plants and cell cultures.

Science.gov (United States)

Zhang, Xiuren; Mason, Hugh

2006-02-05

A novel stable transgenic plant expression system was developed using elements of the replication machinery of Bean Yellow Dwarf Virus (BeYDV). The system contains two transgenes: 1) The BeYDV replicon vector with an expression cassette flanked by cis-acting DNA elements of BeYDV, and 2) The viral replication initiator protein (Rep) controlled by an alcohol-inducible promoter. When Rep expression was triggered by treatment with ethanol, it induced release of the BeYDV replicon from stably integrated T-DNA and episomal replication to high copy number. Replicon amplification resulted in substantially increased transgene mRNA levels (up to 80-fold) and translation products (up to 10-fold) after induction of Rep expression by ethanol treatment in tobacco NT1 cells and leaves of whole potato plants. Thus, the BeYDV stable transformant replicon system is a powerful tool for plant-based production of recombinant proteins. (c) 2005 Wiley Periodicals, Inc.

Transgenic cassava lines carrying heterologous alternative oxidase ...

African Journals Online (AJOL)

Afuape

2013-07-03

Jul 3, 2013 ... production of flowers, apomixis (Nassar et al., 2000; ... In order to increase the stress tolerance capacity of ... stress-related procedure due to the activities of auxin ... the evaluation of the transgenic lines for rate of OES .... Some transgenic lines carrying the 35S-AOX fragment amplified using 35S303F1 and.

Intestine-specific overexpression of IL-10 improves survival in polymicrobial sepsis.

Science.gov (United States)

Rajan, Saju; Vyas, Dinesh; Clark, Andrew T; Woolsey, Cheryl A; Clark, Jessica A; Hotchkiss, Richard S; Buchman, Timothy G; Coopersmith, Craig M

2008-04-01

Targeted IL-10 therapy improves survival in preclinical models of critical illness, and intestine-specific IL-10 decreases inflammation in models of chronic Inflammatory disease. We therefore sought to determine whether intestine-specific overexpression of IL-10 would improve survival in sepsis. Transgenic mice that overexpress IL-10 in their gut epithelium (Fabpi-IL-10 mice) and wild-type (WT) littermates (n = 127) were subjected to cecal ligation and puncture with a 27-gauge needle. The 7-day survival rate was 45% in transgenic animals and 30% in WT animals (P < or = 0.05). Systemic levels of IL-10 were undetectable in both groups of animals under basal conditions and were elevated to a similar degree in septic animals regardless of whether they expressed the transgene. Local parameter of injury, including gut epithelial apoptosis, intestinal permeability, peritoneal lavage cytokines, and stimulated cytokines from intraepithelial lymphocytes, were similar between transgenic and WT mice. However, in stimulated splenocytes, proinflammatory cytokines monocyte chemoattractant protein 1 (189 +/- 43 vs. 40 +/- 8 pg/mL) and IL-6 (116 +/- 28 vs. 34 +/- 9 pg/mL) were lower in Fabpi-IL-10 mice than WT littermates despite the intestine-specific nature of the transgene (P < 0.05). Cytokine levels were similar in blood and bronchoalveolar lavage fluid between the 2 groups, as were circulating LPS levels. Transgenic mice also had lower white blood cell counts associated with lower absolute neutrophil counts (0.5 +/- 0.1 vs. 1.0 +/- 0.2 10(3)/mm3; P < 0.05). These results indicate that gut-specific overexpression of IL-10 improves survival in a murine model of sepsis, and interactions between the intestinal epithelium and the systemic immune system may play a role in conferring this survival advantage.

Lethal mechanisms in gastric volvulus.

Science.gov (United States)

Omond, Kimberley J; Byard, Roger W

2017-01-01

A 55-year-old wheelchair-bound woman with severe cerebral palsy was found at autopsy to have marked distention of the stomach due to a volvulus. The stomach was viable, and filled with air and fluid and had pushed the left dome of the diaphragm upwards causing marked compression of the left lung with a mediastinal shift to the right (including the heart). There was no evidence of gastric perforation, ischaemic necrosis or peritonitis. Removal of the organ block revealed marked kyphoscoliosis. Histology confirmed the viability of the stomach and biochemistry showed no dehydration. Death in cases of acute gastric volvulus usually occurs because of compromise of the gastric blood supply resulting in ischaemic necrosis with distention from swallowed air and fluid resulting in perforation with lethal peritonitis. Hypovolaemic shock may also occur. However, the current case demonstrates an alternative lethal mechanism, that of respiratory compromise due to marked thoracic organ compression.

Nestin Reporter Transgene Labels Multiple Central Nervous System Precursor Cells

Directory of Open Access Journals (Sweden)

Avery S. Walker

2010-01-01

Full Text Available Embryonic neuroepithelia and adult subventricular zone (SVZ stem and progenitor cells express nestin. We characterized a transgenic line that expresses enhanced green fluorescent protein (eGFP specified to neural tissue by the second intronic enhancer of the nestin promoter that had several novel features. During embryogenesis, the dorsal telencephalon contained many and the ventral telencephalon few eGFP+ cells. eGFP+ cells were found in postnatal and adult neurogenic regions. eGFP+ cells in the SVZ expressed multiple phenotype markers, glial fibrillary acidic protein, Dlx, and neuroblast-specific molecules suggesting the transgene is expressed through the lineage. eGFP+ cell numbers increased in the SVZ after cortical injury, suggesting this line will be useful in probing postinjury neurogenesis. In non-neurogenic regions, eGFP was strongly expressed in oligodendrocyte progenitors, but not in astrocytes, even when they were reactive. This eGFP+ mouse will facilitate studies of proliferative neuroepithelia and adult neurogenesis, as well as of parenchymal oligodendrocytes.

The lethal injection quandary: how medicine has dismantled the death penalty.

Science.gov (United States)

Denno, Deborah W

2007-10-01

On February 20, 2006, Michael Morales was hours away from execution in California when two anesthesiologists declined to participate in his lethal injection procedure, thereby halting all state executions. The events brought to the surface the long-running schism between law and medicine, raising the question of whether any beneficial connection between the professions ever existed in the execution context. History shows it seldom did. Decades of botched executions prove it. This Article examines how states ended up with such constitutionally vulnerable lethal injection procedures, suggesting that physician participation in executions, though looked upon with disdain, is more prevalent--and perhaps more necessary--than many would like to believe. The Article also reports the results of this author's unique nationwide study of lethal injection protocols and medical participation. The study demonstrates that states have continued to produce grossly inadequate protocols that severely restrict sufficient understanding of how executions are performed and heighten the likelihood of unconstitutionality. The analysis emphasizes in particular the utter lack of medical or scientific testing of lethal injection despite the early and continuous involvement of doctors but ongoing detachment of medical societies. Lastly, the Article discusses the legal developments that led up to the current rush of lethal injection lawsuits as well as the strong and rapid reverberations that followed, particularly with respect to medical involvement. This Article concludes with two recommendations. First, much like what occurred in this country when the first state switched to electrocution, there should be a nationwide study of proper lethal injection protocols. An independent commission consisting of a diverse group of qualified individuals, including medical personnel, should conduct a thorough assessment of lethal injection, especially the extent of physician participation. Second, this

Cloning of transgenic tobacco BY-2 cells; an efficient method to analyse and reduce high natural heterogeneity of transgene expression.

Science.gov (United States)

Nocarova, Eva; Fischer, Lukas

2009-04-22

Phenotypic characterization of transgenic cell lines, frequently used in plant biology studies, is complicated because transgene expression in individual cells is often heterogeneous and unstable. To identify the sources and to reduce this heterogeneity, we transformed tobacco (Nicotiana tabacum L.) BY-2 cells with a gene encoding green fluorescent protein (GFP) using Agrobacterium tumefaciens, and then introduced a simple cloning procedure to generate cell lines derived from the individual transformed cells. Expression of the transgene was monitored by analysing GFP fluorescence in the cloned lines and also in lines obtained directly after transformation. The majority ( approximately 90%) of suspension culture lines derived from calli that were obtained directly from transformation consisted of cells with various levels of GFP fluorescence. In contrast, nearly 50% of lines generated by cloning cells from the primary heterogeneous suspensions consisted of cells with homogenous GFP fluorescence. The rest of the lines exhibited "permanent heterogeneity" that could not be resolved by cloning. The extent of fluorescence heterogeneity often varied, even among genetically identical clones derived from the primary transformed lines. In contrast, the offspring of subsequent cloning of the cloned lines was uniform, showing GFP fluorescence intensity and heterogeneity that corresponded to the original clone. The results demonstrate that, besides genetic heterogeneity detected in some lines, the primary lines often contained a mixture of epigenetically different cells that could be separated by cloning. This indicates that a single integration event frequently results in various heritable expression patterns, which are probably accidental and become stabilized in the offspring of the primary transformed cells early after the integration event. Because heterogeneity in transgene expression has proven to be a serious problem, it is highly advisable to use transgenes tagged with

Pregnancy continuation and organizational religious activity following prenatal diagnosis of a lethal fetal defect are associated with improved psychological outcome.

Science.gov (United States)

Cope, Heidi; Garrett, Melanie E; Gregory, Simon; Ashley-Koch, Allison

2015-08-01

The aim of the article is to examine the psychological impact, specifically symptoms of grief, post-traumatic stress and depression, in women and men who either terminated or continued a pregnancy following prenatal diagnosis of a lethal fetal defect. This project investigated a diagnostically homogeneous group composed of 158 women and 109 men who lost a pregnancy to anencephaly, a lethal neural tube defect. Participants completed the Perinatal Grief Scale, Impact of Event Scale - Revised and Beck Depression Inventory-II, which measure symptoms of grief, post-traumatic stress and depression, respectively. Demographics, religiosity and pregnancy choices were also collected. Gender-specific analysis of variance was performed for instrument total scores and subscales. Women who terminated reported significantly more despair (p = 0.02), avoidance (p = 0.008) and depression (p = 0.04) than women who continued the pregnancy. Organizational religious activity was associated with a reduction in grief (Perinatal Grief Scale subscales) in both women (p = 0.02, p = 0.04 and p = 0.03) and men (p = 0.047). There appears to be a psychological benefit to women to continue the pregnancy following a lethal fetal diagnosis. Following a lethal fetal diagnosis, the risks and benefits, including psychological effects, of termination and continuation of pregnancy should be discussed in detail with an effort to be as nondirective as possible. © 2015 John Wiley & Sons, Ltd.

Ethics and Transgenic Crops: a Review

OpenAIRE

Robinson, Jonathan

1999-01-01

This article represents a review of some of the ethical dilemmas that have arisen as a result of the development and deployment of transgenic crop plants. The potential for transgenic crops to alleviate human hunger and the possible effects on human health are discussed. Risks and benefits to the environment resulting from genetic engineering of crops for resistance to biotic and abiotic stresses are considered, in addition to effects on biodiversity. The socio-economic impacts and distributi...

A Transgenic Tri-Modality Reporter Mouse

OpenAIRE

Yan, Xinrui; Ray, Pritha; Paulmurugan, Ramasamy; Tong, Ricky; Gong, Yongquan; Sathirachinda, Ataya; Wu, Joseph C.; Gambhir, Sanjiv S.

2013-01-01

Transgenic mouse with a stably integrated reporter gene(s) can be a valuable resource for obtaining uniformly labeled stem cells, tissues, and organs for various applications. We have generated a transgenic mouse model that ubiquitously expresses a tri-fusion reporter gene (fluc2-tdTomato-ttk) driven by a constitutive chicken β-actin promoter. This "Tri-Modality Reporter Mouse" system allows one to isolate most cells from this donor mouse and image them for bioluminescent (fluc2), fluorescent...

Field performance of transgenic citrus trees: assessment of the long-term expression of uidA and nptII transgenes and its impact on relevant agronomic and phenotypic characteristics.

Science.gov (United States)

Pons, Elsa; Peris, Josep E; Peña, Leandro

2012-07-15

The future of genetic transformation as a tool for the improvement of fruit trees depends on the development of proper systems for the assessment of unintended effects in field-grown GM lines. In this study, we used eight transgenic lines of two different citrus types (sweet orange and citrange) transformed with the marker genes β-glucuronidase (uidA) and neomycin phosphotransferase II (nptII) as model systems to study for the first time in citrus the long-term stability of transgene expression and whether transgene-derived pleiotropic effects occur with regard to the morphology, development and fruit quality of orchard-grown GM citrus trees. The stability of the integration and expression of the transgenes was confirmed in 7-year-old, orchard-grown transgenic lines by Southern blot analysis and enzymatic assays (GUS and ELISA NPTII), respectively. Little seasonal variation was detected in the expression levels between plants of the same transgenic line in different organs and over the 3 years of analysis, confirming the absence of rearrangements and/or silencing of the transgenes after transferring the plants to field conditions. Comparisons between the GM citrus lines with their non-GM counterparts across the study years showed that the expression of these transgenes did not cause alterations of the main phenotypic and agronomic plant and fruit characteristics. However, when comparisons were performed between diploid and tetraploid transgenic citrange trees and/or between juvenile and mature transgenic sweet orange trees, significant and consistent differences were detected, indicating that factors other than their transgenic nature induced a much higher phenotypic variability. Our results indicate that transgene expression in GM citrus remains stable during long-term agricultural cultivation, without causing unexpected effects on crop characteristics. This study also shows that the transgenic citrus trees expressing the selectable marker genes that are most

Generation and characterization of human heme oxygenase-1 transgenic pigs.

Directory of Open Access Journals (Sweden)

Hye-Jung Yeom

Full Text Available Xenotransplantation using transgenic pigs as an organ source is a promising strategy to overcome shortage of human organ for transplantation. Various genetic modifications have been tried to ameliorate xenograft rejection. In the present study we assessed effect of transgenic expression of human heme oxygenase-1 (hHO-1, an inducible protein capable of cytoprotection by scavenging reactive oxygen species and preventing apoptosis caused by cellular stress during inflammatory processes, in neonatal porcine islet-like cluster cells (NPCCs. Transduction of NPCCs with adenovirus containing hHO-1 gene significantly reduced apoptosis compared with the GFP-expressing adenovirus control after treatment with either hydrogen peroxide or hTNF-α and cycloheximide. These protective effects were diminished by co-treatment of hHO-1 antagonist, Zinc protoporphyrin IX. We also generated transgenic pigs expressing hHO-1 and analyzed expression and function of the transgene. Human HO-1 was expressed in most tissues, including the heart, kidney, lung, pancreas, spleen and skin, however, expression levels and patterns of the hHO-1 gene are not consistent in each organ. We isolate fibroblast from transgenic pigs to analyze protective effect of the hHO-1. As expected, fibroblasts derived from the hHO-1 transgenic pigs were significantly resistant to both hydrogen peroxide damage and hTNF-α and cycloheximide-mediated apoptosis when compared with wild-type fibroblasts. Furthermore, induction of RANTES in response to hTNF-α or LPS was significantly decreased in fibroblasts obtained from the hHO-1 transgenic pigs. These findings suggest that transgenic expression of hHO-1 can protect xenografts when exposed to oxidative stresses, especially from ischemia/reperfusion injury, and/or acute rejection mediated by cytokines. Accordingly, hHO-1 could be an important candidate molecule in a multi-transgenic pig strategy for xenotransplantation.

Generation and characterization of human heme oxygenase-1 transgenic pigs.

Science.gov (United States)

Yeom, Hye-Jung; Koo, Ok Jae; Yang, Jaeseok; Cho, Bumrae; Hwang, Jong-Ik; Park, Sol Ji; Hurh, Sunghoon; Kim, Hwajung; Lee, Eun Mi; Ro, Han; Kang, Jung Taek; Kim, Su Jin; Won, Jae-Kyung; O'Connell, Philip J; Kim, Hyunil; Surh, Charles D; Lee, Byeong-Chun; Ahn, Curie

2012-01-01

Xenotransplantation using transgenic pigs as an organ source is a promising strategy to overcome shortage of human organ for transplantation. Various genetic modifications have been tried to ameliorate xenograft rejection. In the present study we assessed effect of transgenic expression of human heme oxygenase-1 (hHO-1), an inducible protein capable of cytoprotection by scavenging reactive oxygen species and preventing apoptosis caused by cellular stress during inflammatory processes, in neonatal porcine islet-like cluster cells (NPCCs). Transduction of NPCCs with adenovirus containing hHO-1 gene significantly reduced apoptosis compared with the GFP-expressing adenovirus control after treatment with either hydrogen peroxide or hTNF-α and cycloheximide. These protective effects were diminished by co-treatment of hHO-1 antagonist, Zinc protoporphyrin IX. We also generated transgenic pigs expressing hHO-1 and analyzed expression and function of the transgene. Human HO-1 was expressed in most tissues, including the heart, kidney, lung, pancreas, spleen and skin, however, expression levels and patterns of the hHO-1 gene are not consistent in each organ. We isolate fibroblast from transgenic pigs to analyze protective effect of the hHO-1. As expected, fibroblasts derived from the hHO-1 transgenic pigs were significantly resistant to both hydrogen peroxide damage and hTNF-α and cycloheximide-mediated apoptosis when compared with wild-type fibroblasts. Furthermore, induction of RANTES in response to hTNF-α or LPS was significantly decreased in fibroblasts obtained from the hHO-1 transgenic pigs. These findings suggest that transgenic expression of hHO-1 can protect xenografts when exposed to oxidative stresses, especially from ischemia/reperfusion injury, and/or acute rejection mediated by cytokines. Accordingly, hHO-1 could be an important candidate molecule in a multi-transgenic pig strategy for xenotransplantation.

Transgenic fertile Scoparia dulcis L., a folk medicinal plant, conferred with a herbicide-resistant trait using an Ri binary vector.

Science.gov (United States)

Yamazaki, M; Son, L; Hayashi, T; Morita, N; Asamizu, T; Mourakoshi, I; Saito, K

1996-01-01

Transgenic herbicide-resistant Scoparia dulcis plants were obtained by using an Ri binary vector system. The chimeric bar gene encoding phosphinothricin acetyltransferase flanked by the promoter for cauliflower mosaic virus 35S RNA and the terminal sequence for nopaline synthase was introduced in the plant genome by Agrobacterium-mediated transformation by means of scratching young plants. Hairy roots resistant to bialaphos were selected and plantlets (R0) were regenerated. Progenies (S1) were obtained by self-fertilization. The transgenic state was confirmed by DNA-blot hybridization and assaying of neomycin phosphotransferase II. Expression of the bar gene in the transgenic R0 and S1 progenies was indicated by the activity of phosphinothricin acetyltransferase. Transgenic plants accumulated scopadulcic acid B, a specific secondary metabolite of S. dulcis, in amounts of 15-60% compared with that in normal plants. The transgenic plants and progenies showed resistant trait towards bialaphos and phosphinothricin. These results suggest that an Ri binary system is one of the useful tools for the transformation of medicinal plants for which a regeneration protocol has not been established.

In Vivo Screening Using Transgenic Zebrafish Embryos Reveals New Effects of HDAC Inhibitors Trichostatin A and Valproic Acid on Organogenesis.

Directory of Open Access Journals (Sweden)

Ling Li

Full Text Available The effects of endocrine disrupting chemicals (EDCs on reproduction are well known, whereas their developmental effects are much less characterized. However, exposure to endocrine disruptors during organogenesis may lead to deleterious and permanent problems later in life. Zebrafish (Danio rerio transgenic lines expressing the green fluorescent protein (GFP in specific organs and tissues are powerful tools to uncover developmental defects elicited by EDCs. Here, we used seven transgenic lines to visualize in vivo whether a series of EDCs and other pharmaceutical compounds can alter organogenesis in zebrafish. We used transgenic lines expressing GFP in pancreas, liver, blood vessels, inner ear, nervous system, pharyngeal tooth and pectoral fins. This screen revealed that four of the tested chemicals have detectable effects on different organs, which shows that the range of effects elicited by EDCs is wider than anticipated. The endocrine disruptor tetrabromobisphenol-A (TBBPA, as well as the three drugs diclofenac, trichostatin A (TSA and valproic acid (VPA induced abnormalities in the embryonic vascular system of zebrafish. Moreover, TSA and VPA induced specific alterations during the development of pancreas, an observation that was confirmed by in situ hybridization with specific markers. Developmental delays were also induced by TSA and VPA in the liver and in pharyngeal teeth, resulting in smaller organ size. Our results show that EDCs can induce a large range of developmental alterations during embryogenesis of zebrafish and establish GFP transgenic lines as powerful tools to screen for EDCs effects in vivo.

Effect of lethality on the extinction and on the error threshold of quasispecies.

Science.gov (United States)

Tejero, Hector; Marín, Arturo; Montero, Francisco

2010-02-21

In this paper the effect of lethality on error threshold and extinction has been studied in a population of error-prone self-replicating molecules. For given lethality and a simple fitness landscape, three dynamic regimes can be obtained: quasispecies, error catastrophe, and extinction. Using a simple model in which molecules are classified as master, lethal and non-lethal mutants, it is possible to obtain the mutation rates of the transitions between the three regimes analytically. The numerical resolution of the extended model, in which molecules are classified depending on their Hamming distance to the master sequence, confirms the results obtained in the simple model and shows how an error catastrophe regime changes when lethality is taken in account. (c) 2009 Elsevier Ltd. All rights reserved.

Overexpression of ZmIRT1 and ZmZIP3 Enhances Iron and Zinc Accumulation in Transgenic Arabidopsis.

Directory of Open Access Journals (Sweden)

Suzhen Li

Full Text Available Iron and zinc are important micronutrients for both the growth and nutrient availability of crop plants, and their absorption is tightly controlled by a metal uptake system. Zinc-regulated transporters, iron-regulated transporter-like proteins (ZIP, is considered an essential metal transporter for the acquisition of Fe and Zn in graminaceous plants. Several ZIPs have been identified in maize, although their physiological function remains unclear. In this report, ZmIRT1 was shown to be specifically expressed in silk and embryo, whereas ZmZIP3 was a leaf-specific gene. Both ZmIRT1 and ZmZIP3 were shown to be localized to the plasma membrane and endoplasmic reticulum. In addition, transgenic Arabidopsis plants overexpressing ZmIRT1 or ZmZIP3 were generated, and the metal contents in various tissues of transgenic and wild-type plants were examined based on ICP-OES and Zinpyr-1 staining. The Fe and Zn concentration increased in roots and seeds of ZmIRT1-overexpressing plants, while the Fe content in shoots decreased. Overexpressing ZmZIP3 enhanced Zn accumulation in the roots of transgenic plants, while that in shoots was repressed. In addition, the transgenic plants showed altered tolerance to various Fe and Zn conditions compared with wild-type plants. Furthermore, the genes associated with metal uptake were stimulated in ZmIRT1 transgenic plants, while those involved in intra- and inter- cellular translocation were suppressed. In conclusion, ZmIRT1 and ZmZIP3 are functional metal transporters with different ion selectivities. Ectopic overexpression of ZmIRT1 may stimulate endogenous Fe uptake mechanisms, which may facilitate metal uptake and homeostasis. Our results increase our understanding of the functions of ZIP family transporters in maize.

Single-copy insertion of transgenes in Caenorhabditis elegans

DEFF Research Database (Denmark)

Frøkjaer-Jensen, Christian; Davis, M Wayne; Hopkins, Christopher E

2008-01-01

developed a method that inserts a single copy of a transgene into a defined site. Mobilization of a Mos1 transposon generates a double-strand break in noncoding DNA. The break is repaired by copying DNA from an extrachromosomal template into the chromosomal site. Homozygous single-copy insertions can...... be obtained in less than 2 weeks by injecting approximately 20 worms. We have successfully inserted transgenes as long as 9 kb and verified that single copies are inserted at the targeted site. Single-copy transgenes are expressed at endogenous levels and can be expressed in the female and male germlines....

Detailed characterization of Mirafiori lettuce virus-resistant transgenic lettuce.

Science.gov (United States)

Kawazu, Yoichi; Fujiyama, Ryoi; Noguchi, Yuji; Kubota, Masaharu; Ito, Hidekazu; Fukuoka, Hiroyuki

2010-04-01

Lettuce big-vein disease is caused by Mirafiori lettuce virus (MiLV), which is vectored by the soil-borne fungus Olpidium brassicae. A MiLV-resistant transgenic lettuce line was developed through introducing inverted repeats of the MiLV coat protein (CP) gene. Here, a detailed characterization study of this lettuce line was conducted by comparing it with the parental, non-transformed 'Kaiser' cultivar. There were no significant differences between transgenic and non-transgenic lettuce in terms of pollen fertility, pollen dispersal, seed production, seed dispersal, dormancy, germination, growth of seedlings under low or high temperature, chromatographic patterns of leaf extracts, or effects of lettuce on the growth of broccoli or soil microflora. A significant difference in pollen size was noted, but the difference was small. The length of the cotyledons of the transgenic lettuce was shorter than that of 'Kaiser,' but there were no differences in other morphological characteristics. Agrobacterium tumefaciens used for the production of transgenic lettuce was not detected in transgenic seeds. The transgenic T(3), T(4), and T(5) generations showed higher resistance to MiLV and big-vein symptoms expression than the resistant 'Pacific' cultivar, indicating that high resistance to lettuce big-vein disease is stably inherited. PCR analysis showed that segregation of the CP gene was nearly 3:1 in the T(1) and T(2) generations, and that the transgenic T(3) generation was homozygous for the CP gene. Segregation of the neomycin phosphotransferase II (npt II) gene was about 3:1 in the T(1) generation, but the full length npt II gene was not detected in the T(2) or T(3) generation. The segregation pattern of the CP and npt II genes in the T(1) generation showed the expected 9:3:3:1 ratio. These results suggest that the fragment including the CP gene and that including the npt II gene have been integrated into two unlinked loci, and that the T(1) plant selected in our study did

Acute and sub-lethal response to mercury in Arctic and boreal calanoid copepods.

Science.gov (United States)

Overjordet, Ida Beathe; Altin, Dag; Berg, Torunn; Jenssen, Bjørn Munro; Gabrielsen, Geir Wing; Hansen, Bjørn Henrik

2014-10-01

Acute lethal toxicity, expressed as LC50 values, is a widely used parameter in risk assessment of chemicals, and has been proposed as a tool to assess differences in species sensitivities to chemicals between climatic regions. Arctic Calanus glacialis and boreal Calanus finmarchicus were exposed to mercury (Hg(2+)) under natural environmental conditions including sea temperatures of 2° and 10°C, respectively. Acute lethal toxicity (96 h LC50) and sub-lethal molecular response (GST expression; in this article gene expression is used as a synonym of gene transcription, although it is acknowledged that gene expression is also regulated, e.g., at translation and protein stability level) were studied. The acute lethal toxicity was monitored for 96 h using seven different Hg concentrations. The sub-lethal experiment was set up on the basis of nominal LC50 values for each species using concentrations equivalent to 50, 5 and 0.5% of their 96 h LC50 value. No significant differences were found in acute lethal toxicity between the two species. The sub-lethal molecular response revealed large differences both in response time and the fold induction of GST, where the Arctic species responded both faster and with higher mRNA levels of GST after 48 h exposure. Under the natural exposure conditions applied in the present study, the Arctic species C. glacialis may potentially be more susceptible to mercury exposure on the sub-lethal level. Copyright © 2014 Elsevier B.V. All rights reserved.

Glycinebetaine synthesizing transgenic potato plants exhibit enhanced tolerance to salt and cold stresses

International Nuclear Information System (INIS)

Ahmad, R.; Hussain, J.

2014-01-01

Abiotic stresses are the most important contributors towards low productivity of major food crops. Various attempts have been made to enhance abiotic stress tolerance of crop plants by classical breeding and genetic transformation. Genetic transformation with glycinebetaine (GB) synthesizing enzymes' gene(s) in naturally non accumulating plants has resulted in enhanced tolerance against variety of abiotic stresses. Present study was aimed to evaluate the performance of GB synthesizing transgenic potato plants against salt and cold stresses. Transgenic potato plants were challenged against salt and cold stresses at whole plant level. Transgenic lines were characterized to determine the transgene copy number. Different parameters like integrity, chlorophyll contents, tuber yield and vegetative biomass were studied to monitor the stress tolerance of transgenic potato plants. The results were compared with Non-transgenic (NT) plants and statistically analyzed to evaluate significant differences. Multi-copy insertion of expression cassette was found in both transgenic lines. Upon salt stress, transgenic plants maintained better growth as compared to NT plants. The tuber yield of transgenic plants was significantly greater than NT plants in salt stress. Transgenic plants showed improved membrane integrity against cold stress by depicting appreciably reduced ion leakage as compared to NT plants. Moreover, transgenic plants showed significantly less chlorophyll bleaching than NT plants upon cold stress. In addition, NT plants accumulated significantly less biomass, and yielded fewer tubers as compared to transgenic plants after cold stress treatment. The study will be a committed step for field evaluation of transgenic plants with the aim of commercialization. (author)

Suicide Intent and Accurate Expectations of Lethality: Predictors of Medical Lethality of Suicide Attempts

Science.gov (United States)

Brown, Gregory K.; Henriques, Gregg R.; Sosdjan, Daniella; Beck, Aaron T.

2004-01-01

The degree of intent to commit suicide and the severity of self-injury were examined in individuals (N = 180) who had recently attempted suicide. Although a minimal association was found between the degree of suicide intent and the degree of lethality of the attempt, the accuracy of expectations about the likelihood of dying was found to moderate…

Generation of the bovine viral diarrhea virus e0 protein in transgenic astragalus and its immunogenicity in sika deer.

Science.gov (United States)

Gao, Yugang; Zhao, Xueliang; Zang, Pu; Liu, Qun; Wei, Gongqing; Zhang, Lianxue

2014-01-01

The bovine viral diarrhea virus (BVDV), a single-stranded RNA virus, can cause fatal diarrhea syndrome, respiratory problems, and reproductive disorders in herds. Over the past few years, it has become clear that the BVDV infection rates are increasing and it is likely that an effective vaccine for BVDV will be needed. In this study, transgenic Astragalus was used as an alternative productive platform for the expression of glycoprotein E0. The immunogenicity of glycoprotein E0 expressed in transgenic Astragalus was detected in deer. The presence of pBI121-E0 was confirmed by polymerase chain reaction (PCR), transcription was verified by reverse transcription- (RT-) PCR, and recombinant protein expression was confirmed by ELISA and Western blot analyses. Deer that were immunized subcutaneously with the transgenic plant vaccine developed specific humoral and cell-mediated immune responses against BVDV. This study provides a new method for a protein with weak immunogenicity to be used as part of a transgenic plant vaccine.

Generation of the Bovine Viral Diarrhea Virus E0 Protein in Transgenic Astragalus and Its Immunogenicity in Sika Deer

Directory of Open Access Journals (Sweden)

Yugang Gao

2014-01-01

Full Text Available The bovine viral diarrhea virus (BVDV, a single-stranded RNA virus, can cause fatal diarrhea syndrome, respiratory problems, and reproductive disorders in herds. Over the past few years, it has become clear that the BVDV infection rates are increasing and it is likely that an effective vaccine for BVDV will be needed. In this study, transgenic Astragalus was used as an alternative productive platform for the expression of glycoprotein E0. The immunogenicity of glycoprotein E0 expressed in transgenic Astragalus was detected in deer. The presence of pBI121-E0 was confirmed by polymerase chain reaction (PCR, transcription was verified by reverse transcription- (RT- PCR, and recombinant protein expression was confirmed by ELISA and Western blot analyses. Deer that were immunized subcutaneously with the transgenic plant vaccine developed specific humoral and cell-mediated immune responses against BVDV. This study provides a new method for a protein with weak immunogenicity to be used as part of a transgenic plant vaccine.

Field Trial and Molecular Characterization of RNAi-Transgenic Tomato Plants That Exhibit Resistance to Tomato Yellow Leaf Curl Geminivirus.

Science.gov (United States)

Fuentes, Alejandro; Carlos, Natacha; Ruiz, Yoslaine; Callard, Danay; Sánchez, Yadira; Ochagavía, María Elena; Seguin, Jonathan; Malpica-López, Nachelli; Hohn, Thomas; Lecca, Maria Rita; Pérez, Rosabel; Doreste, Vivian; Rehrauer, Hubert; Farinelli, Laurent; Pujol, Merardo; Pooggin, Mikhail M

2016-03-01

RNA interference (RNAi) is a widely used approach to generate virus-resistant transgenic crops. However, issues of agricultural importance like the long-term durability of RNAi-mediated resistance under field conditions and the potential side effects provoked in the plant by the stable RNAi expression remain poorly investigated. Here, we performed field trials and molecular characterization studies of two homozygous transgenic tomato lines, with different selection markers, expressing an intron-hairpin RNA cognate to the Tomato yellow leaf curl virus (TYLCV) C1 gene. The tested F6 and F4 progenies of the respective kanamycin- and basta-resistant plants exhibited unchanged field resistance to TYLCV and stably expressed the transgene-derived short interfering RNA (siRNAs) to represent 6 to 8% of the total plant small RNAs. This value outnumbered the average percentage of viral siRNAs in the nontransformed plants exposed to TYLCV-infested whiteflies. As a result of the RNAi transgene expression, a common set of up- and downregulated genes was revealed in the transcriptome profile of the plants selected from either of the two transgenic events. A previously unidentified geminivirus causing no symptoms of viral disease was detected in some of the transgenic plants. The novel virus acquired V1 and V2 genes from TYLCV and C1, C2, C3, and C4 genes from a distantly related geminivirus and, thereby, it could evade the repressive sequence-specific action of transgene-derived siRNAs. Our findings shed light on the mechanisms of siRNA-directed antiviral silencing in transgenic plants and highlight the applicability limitations of this technology as it may alter the transcriptional pattern of nontarget genes.

Conflict Without Casualties: Non-Lethal Weapons in Irregular Warfare

Science.gov (United States)

2007-09-01

the body,” and the Geneva Protocol of 1925, bans the use of chemical and biological weapons .11 On 8 April 1975, President Ford issued Executive...E Funding – PE 63851M) (accessed 15 December 2006). The American Journal of Bioethics . “Medical Ethics and Non-Lethal Weapons .” Bioethics.net...CASUALTIES: NON-LETHAL WEAPONS IN IRREGULAR WARFARE by Richard L. Scott September 2007 Thesis Advisor: Robert McNab Second Reader

Gene flow from transgenic common beans expressing the bar gene.

Science.gov (United States)

Faria, Josias C; Carneiro, Geraldo E S; Aragão, Francisco J L

2010-01-01

Gene flow is a common phenomenon even in self-pollinated plant species. With the advent of genetically modified plants this subject has become of the utmost importance due to the need for controlling the spread of transgenes. This study was conducted to determine the occurrence and intensity of outcrossing in transgenic common beans. In order to evaluate the outcross rates, four experiments were conducted in Santo Antonio de Goiás (GO, Brazil) and one in Londrina (PR, Brazil), using transgenic cultivars resistant to the herbicide glufosinate ammonium and their conventional counterparts as recipients of the transgene. Experiments with cv. Olathe Pinto and the transgenic line Olathe M1/4 were conducted in a completely randomized design with ten replications for three years in one location, whereas the experiments with cv. Pérola and the transgenic line Pérola M1/4 were conducted at two locations for one year, with the transgenic cultivar surrounded on all sides by the conventional counterpart. The outcross occurred at a negligible rate of 0.00741% in cv. Pérola, while none was observed (0.0%) in cv. Olathe Pinto. The frequency of gene flow was cultivar dependent and most of the observed outcross was within 2.5 m from the edge of the pollen source. Index terms: Phaseolus vulgaris, outcross, glufosinate ammonium.

Ectopically expressing MdPIP1;3, an aquaporin gene, increased fruit size and enhanced drought tolerance of transgenic tomatoes.

Science.gov (United States)

Wang, Lin; Li, Qing-Tian; Lei, Qiong; Feng, Chao; Zheng, Xiaodong; Zhou, Fangfang; Li, Lingzi; Liu, Xuan; Wang, Zhi; Kong, Jin

2017-12-19

Water deficit severely reduces apple growth and production, is detrimental to fruit quality and size. This problem is exacerbated as global warming is implicated in producing more severe drought stress. Thus water-efficiency has becomes the major target for apple breeding. A desired apple tree can absorb and transport water efficiently, which not only confers improved drought tolerance, but also guarantees fruit size for higher income returns. Aquaporins, as water channels, control water transportation across membranes and can regulate water flow by changing their amount and activity. The exploration of molecular mechanism of water efficiency and the gene wealth will pave a way for molecular breeding of drought tolerant apple tree. In the current study, we screened out a drought inducible aquaporin gene MdPIP1;3, which specifically enhanced its expression during fruit expansion in 'Fuji' apple (Malus domestica Borkh. cv. Red Fuji). It localized on plasma membranes and belonged to PIP1 subfamily. The tolerance to drought stress enhanced in transgenic tomato plants ectopically expressing MdPIP1;3, showing that the rate of losing water in isolated transgenic leaves was slower than wild type, and stomata of transgenic plants closed sensitively to respond to drought compared with wild type. Besides, length and diameter of transgenic tomato fruits increased faster than wild type, and in final, fruit sizes and fresh weights of transgenic tomatoes were bigger than wild type. Specially, in cell levels, fruit cell size from transgenic tomatoes was larger than wild type, showing that cell number per mm 2 in transgenic fruits was less than wild type. Altogether, ectopically expressing MdPIP1;3 enhanced drought tolerance of transgenic tomatoes partially via reduced water loss controlled by stomata closure in leaves. In addition, the transgenic tomato fruits are larger and heavier with larger cells via more efficient water transportation across membranes. Our research will

Tissue-specific posttranscriptional downregulation of expression of the S100A4(mts1) gene in transgenic animals

DEFF Research Database (Denmark)

Ambartsumian, N; Klingelhöfer, Jörg; Grigorian, M

1998-01-01

The S100A4(mts1) is a gene associated with generation of metastatic disease. In order to analyze the consequences of alteration of the pattern of expression of the S100A4(mts1) gene we obtained strains of transgenic mice bearing the S100A4(mts1) gene under the control of a ubiquitous and constitu....../or posttranslational degradation....

THE ABILITY OF FAST-GROWING TRANSGENIC AFRICAN CATFISH (Clarias gariepinus ON PREDATOR AVOIDANCE

Directory of Open Access Journals (Sweden)

Huria Marnis

2016-12-01

Full Text Available Research Institute for Fish Breeding has produced transgenic African catfish (Clarias gariepinus containing stripped catfish growth hormone gene (PccBA-PhGH with growth 19.86% faster than that of non-transgenic fish. This fish has high potential to be released and utilized for fish farming sector to increase national production. However, there is not yet information about environmental risk of this fish. One of the major fitness traits determining potential environmental risk is predator avoidance. This study aimed to determine the predator avoidance ability of transgenic African catfish in an experimental laboratory condition. In this study, thirty five individuals each of transgenic and non-transgenic with body weight of about 0.1 ± 0.019 g were communally stocked in 60 cm x 40 cm x 40 cm aquarium with limited feeding frequency (ad libitum twice a day. One day after the fish were stocked, the predators were added to each aquarium. The non-transgenic and transgenic with body weight of 1.0 ± 0.024 g were stocked as predators as many as five individual in each aquarium. After approximately two weeks of predation, all remaining fish were collected for transgenic verification by PCR method. Genomic DNA was isolated from fin tissue of individually survivors. The results of this study showed that the transgenic fish had worse predator avoidance and lower cannibal than non-transgenic (P0.05 in limited food. The transgenic fish may have lower fitness than non-transgenic.

Chrysanthemum WRKY gene DgWRKY5 enhances tolerance to salt stress in transgenic chrysanthemum.

Science.gov (United States)

Liang, Qian-Yu; Wu, Yin-Huan; Wang, Ke; Bai, Zhen-Yu; Liu, Qing-Lin; Pan, Yuan-Zhi; Zhang, Lei; Jiang, Bei-Bei

2017-07-06

WRKY transcription factors play important roles in plant growth development, resistance and substance metabolism regulation. However, the exact function of the response to salt stress in plants with specific WRKY transcription factors remains unclear. In this research, we isolated a new WRKY transcription factor DgWRKY5 from chrysanthemum. DgWRKY5 contains two WRKY domains of WKKYGQK and two C 2 H 2 zinc fingers. The expression of DgWRKY5 in chrysanthemum was up-regulated under various treatments. Meanwhile, we observed higher expression levels in the leaves contrasted with other tissues. Under salt stress, the activities of superoxide dismutase (SOD), peroxidase (POD) and catalase (CAT) enzymes in transgenic chrysanthemum were significantly higher than those in WT, whereas the accumulation of H 2 O 2 , O 2 - and malondialdehyde (MDA) was reduced in transgenic chrysanthemum. Several parameters including root length, root length, fresh weight, chlorophyll content and leaf gas exchange parameters in transgenic chrysanthemum were much better compared with WT under salt stress. Moreover, the expression of stress-related genes DgAPX, DgCAT, DgNCED3A, DgNCED3B, DgCuZnSOD, DgP5CS, DgCSD1 and DgCSD2 was up-regulated in DgWRKY5 transgenic chrysanthemum compared with that in WT. These results suggested that DgWRKY5 could function as a positive regulator of salt stress in chrysanthemum.

ChR2 transgenic animals in peripheral sensory system: Sensing light as various sensations.

Science.gov (United States)

Ji, Zhi-Gang; Wang, Hongxia

2016-04-01

Since the introduction of Channelrhodopsin-2 (ChR2) to neuroscience, optogenetics technology was developed, making it possible to activate specific neurons or circuits with spatial and temporal precision. Various ChR2 transgenic animal models have been generated and are playing important roles in revealing the mechanisms of neural activities, mapping neural circuits, controlling the behaviors of animals as well as exploring new strategy for treating the neurological diseases in both central and peripheral nervous system. An animal including humans senses environments through Aristotle's five senses (sight, hearing, smell, taste and touch). Usually, each sense is associated with a kind of sensory organ (eyes, ears, nose, tongue and skin). Is it possible that one could hear light, smell light, taste light and touch light? When ChR2 is targeted to different peripheral sensory neurons by viral vectors or generating ChR2 transgenic animals, the animals can sense the light as various sensations such as hearing, touch, pain, smell and taste. In this review, we focus on ChR2 transgenic animals in the peripheral nervous system. Firstly the working principle of ChR2 as an optogenetic actuator is simply described. Then the current transgenic animal lines where ChR2 was expressed in peripheral sensory neurons are presented and the findings obtained by these animal models are reviewed. Copyright © 2016 Elsevier Inc. All rights reserved.

Radiation arteriopathy in the transgenic arteriovenous fistula model.

Science.gov (United States)

Lawton, Michael T; Arnold, Christine M; Kim, Yung J; Bogarin, Ernesto A; Stewart, Campbell L; Wulfstat, Amanda A; Derugin, Nikita; Deen, Dennis; Young, William L

2008-05-01

The transgenic arteriovenous fistula model, surgically constructed with transgenic mouse aorta interposed in common carotid artery-to-external jugular vein fistulae in nude rats, has a 4-month experimental window because patency and transgenic phenotype are lost over time. We adapted this model to investigate occlusive arteriopathy in brain arteriovenous malformations after radiosurgery by radiating grafted aorta before insertion in the fistula. We hypothesized that high-dose radiation would reproduce the arteriopathy observed clinically within the experimental time window and that deletions of endoglin (ENG) and endothelial nitric oxide synthase (eNOS) genes would modify the radiation response. Radiation arteriopathy in the common carotid arteries of 171 wild-type mice was examined with doses of 25, 80, 120, or 200 Gy (Experiment 1). Radiation arteriopathy in 68 wild-type arteriovenous fistulae was examined histologically and morphometrically with preoperative radiation doses of 0, 25, or 200 Gy (Experiment 2). Radiation arteriopathy in 51 transgenic arteriovenous fistulae (36 ENG and 15 eNOS knock-out fistulae) was examined using preoperative radiation doses of 0, 25, or 200 Gy (Experiment 3). High-dose radiation (200 Gy) of mouse common carotid arteries induced only mild arteriopathy (mean score, 0.66) without intimal hyperplasia and with high mortality (68%). Radiation arteriopathy in wild-type arteriovenous fistulae was severe (mean score, 3.5 at 200 Gy), with intimal hyperplasia and medial disruption at 3 months, decreasing luminal areas with increasing dose, and no mortality. Arteriopathy was robust in transgenic arteriovenous fistulae with ENG +/- and with eNOS +/-, with thick intimal hyperplasia in the former and distinct smooth muscle cell proliferation in the latter. The transgenic arteriovenous fistula model can be adapted to rapidly reproduce radiation arteriopathy observed in resected brain arteriovenous malformations after radiosurgery. High

Overexpression of a flower-specific aerolysin-like protein from the dioecious plant Rumex acetosa alters flower development and induces male sterility in transgenic tobacco.

Science.gov (United States)

Manzano, Susana; Megías, Zoraida; Martínez, Cecilia; García, Alicia; Aguado, Encarnación; Chileh, Tarik; López-Alonso, Diego; García-Maroto, Federico; Kejnovský, Eduard; Široký, Jiří; Kubát, Zdeněk; Králová, Tereza; Vyskot, Boris; Jamilena, Manuel

2017-01-01

Sex determination in Rumex acetosa, a dioecious plant with a complex XY 1 Y 2 sex chromosome system (females are XX and males are XY 1 Y 2 ), is not controlled by an active Y chromosome but depends on the ratio between the number of X chromosomes and autosomes. To gain insight into the molecular mechanisms of sex determination, we generated a subtracted cDNA library enriched in genes specifically or predominantly expressed in female floral buds in early stages of development, when sex determination mechanisms come into play. In the present paper, we report the molecular and functional characterization of FEM32, a gene encoding a protein that shares a common architecture with proteins in different plants, animals, bacteria and fungi of the aerolysin superfamily; many of these function as β pore-forming toxins. The expression analysis, assessed by northern blot, RT-PCR and in situ hybridization, demonstrates that this gene is specifically expressed in flowers in both early and late stages of development, although its transcripts accumulate much more in female flowers than in male flowers. The ectopic expression of FEM32 under both the constitutive promoter 35S and the flower-specific promoter AP3 in transgenic tobacco showed no obvious alteration in vegetative development but was able to alter floral organ growth and pollen fertility. The 35S::FEM32 and AP3::FEM32 transgenic lines showed a reduction in stamen development and pollen viability, as well as a diminution in fruit set, fruit development and seed production. Compared with other floral organs, pistil development was, however, enhanced in plants overexpressing FEM32. According to these effects, it is likely that FEM32 functions in Rumex by arresting stamen and pollen development during female flower development. The aerolysin-like pore-forming proteins of eukaryotes are mainly involved in defence mechanisms against bacteria, fungi and insects and are also involved in apoptosis and programmed cell death (PCD

Impact of acute alcohol consumption on lethality of suicide methods.

Science.gov (United States)

Park, C Hyung Keun; Yoo, Seong Ho; Lee, Jaewon; Cho, Sung Joon; Shin, Min-Sup; Kim, Eun Young; Kim, Se Hyun; Ham, Keunsoo; Ahn, Yong Min

2017-05-01

The influence of acute alcohol consumption on the factors related to suicide remains understudied. Thus, the present study investigated the relationship between blood alcohol content (BAC) and the lethality of suicide methods. Autopsy data on 315 South Korean suicide completers with a positive BAC were collected from a nationwide pool between May 2015 and November 2015, and the methods were dichotomised as suicide methods of low lethality (SMLL; drug/chemical overdose and sharp objects, n=67) and suicide methods of high lethality (SMHL; everything else, n=243). BAC at the time of autopsy and various suicide-related factors of these two groups were compared with logistic regression analyses. Compared to suicide completers with a BAC in the lowest range of 0.011-0.049%, suicide completers with a BAC in the range of 0.150-0.199% were more likely to use SMHL (odds ratio [OR]: 3.644, 95% confidence interval [CI]: 1.221-10.874). Additionally, the adoption of SMHL was significantly associated with the absence of a psychiatric illness (OR: 0.433, 95% CI: 0.222-0.843) and a younger age; the OR for high BAC among subjects in their 40s was 0.266 (95% CI: 0.083-0.856); in their 50s, 0.183 (95% CI: 0.055-0.615); and in their 60s, 0.057 (95% CI: 0.015-0.216). The relationship between BAC and suicide method lethality was represented by a bell-shaped pattern in which suicide methods of high lethality were more likely to be used by suicide completers with mid-range BAC levels. The increased impulsivity and impairments in particular executive functions, including planning and organization, associated with acute alcohol use may influence the selection of a particular suicide method based on its lethality. Copyright © 2017 Elsevier Inc. All rights reserved.

Plant mitochondrial genome: “A sweet and safe home'' for transgene ...

African Journals Online (AJOL)

Transfer of transgene through pollens to related plant species is a big environmental concern. Mitochondrion is also a superb and putative aspirant for transgene containment like plastids. Having its own transcription and translation machinery, and maternal inheritance gives assurance of transgene containment with high ...

The effect of ethylene on transgenic melon ripening and fruit quality ...

African Journals Online (AJOL)

In cell wall expression analysis, MPG1 increased when fruits of transgenic melons were exposed to ethylene; showing they are ethylene- dependent. MPG2 decreased ... Ethylene productions in transgenic fruits were reestablished when ethylene was applied, exhibiting the same behavior as transgenic fruits. Antioxidant ...

Reproductive-phase and interphase lethal cell damage after irradiation and treatment with cytostatics

International Nuclear Information System (INIS)

Hagemann, G.

1979-01-01

After X-ray irradiation of manual cells, two lethal fractions occur due to reproductive and interphase death under low and high radiation doses. The damage kinetics on which this fact is based is compared with hypothetical tumour frequencies and leucemia induction caused in experiments. The reproductive-lethal damage can be manifested by means of colony size spectrometry, with the median colony size class differences (MCD) serving as measure for the damage found. The simultaneous effects of the cytostatics BLEOMYCIN or ICRF 159 and X-rays on reproductive lethal and interphase-lethal damage are measured by means of MCD and survival fraction, and the additive and intensifying effect' is judged with the help of suitably defined terms. This shows that the clinically used ICRF 159 has an additive effect on interphase-lethal and a sub-additive effect on reproductive-lethal cell damage. Thus, favourable results may be expected for the electivity factor in fractionated irradiation and with regard to delayed damage in healthy tissue. (orig.) 891 MG/orig. 892 RDG [de

Castor phospholipid:diacylglycerol acyltransferase facilitates efficient metabolism of hydroxy fatty acids in transgenic Arabidopsis

Science.gov (United States)

Producing unusual fatty acids (FAs) in crop plants has been a long-standing goal of green chemistry. However, expression of the enzymes that catalyze the primary synthesis of these unusual FAs in transgenic plants typically results in low levels of the desired FA. For example, seed-specific expressi...

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression.

Science.gov (United States)

Trinh, Alice T; Ball, Bret G; Weber, Erin; Gallaher, Timothy K; Gluzman-Poltorak, Zoya; Anderson, French; Basile, Lena A

2009-12-30

Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Vectors that contained the ADA LCR were preferentially expressed in T-cell lines. Further improvements

Retroviral vectors encoding ADA regulatory locus control region provide enhanced T-cell-specific transgene expression

Science.gov (United States)

2009-01-01

Background Murine retroviral vectors have been used in several hundred gene therapy clinical trials, but have fallen out of favor for a number of reasons. One issue is that gene expression from viral or internal promoters is highly variable and essentially unregulated. Moreover, with retroviral vectors, gene expression is usually silenced over time. Mammalian genes, in contrast, are characterized by highly regulated, precise levels of expression in both a temporal and a cell-specific manner. To ascertain if recapitulation of endogenous adenosine deaminase (ADA) expression can be achieved in a vector construct we created a new series of Moloney murine leukemia virus (MuLV) based retroviral vector that carry human regulatory elements including combinations of the ADA promoter, the ADA locus control region (LCR), ADA introns and human polyadenylation sequences in a self-inactivating vector backbone. Methods A MuLV-based retroviral vector with a self-inactivating (SIN) backbone, the phosphoglycerate kinase promoter (PGK) and the enhanced green fluorescent protein (eGFP), as a reporter gene, was generated. Subsequent vectors were constructed from this basic vector by deletion or addition of certain elements. The added elements that were assessed are the human ADA promoter, human ADA locus control region (LCR), introns 7, 8, and 11 from the human ADA gene, and human growth hormone polyadenylation signal. Retroviral vector particles were produced by transient three-plasmid transfection of 293T cells. Retroviral vectors encoding eGFP were titered by transducing 293A cells, and then the proportion of GFP-positive cells was determined using fluorescence-activated cell sorting (FACS). Non T-cell and T-cell lines were transduced at a multiplicity of infection (MOI) of 0.1 and the yield of eGFP transgene expression was evaluated by FACS analysis using mean fluorescent intensity (MFI) detection. Results Vectors that contained the ADA LCR were preferentially expressed in T

Antigen-specific and non-specific CD4+ T cell recruitment and proliferation during influenza infection

International Nuclear Information System (INIS)

Chapman, Timothy J.; Castrucci, Maria R.; Padrick, Ryan C.; Bradley, Linda M.; Topham, David J.

2005-01-01

To track epitope-specific CD4 + T cells at a single-cell level during influenza infection, the MHC class II-restricted OVA 323-339 epitope was engineered into the neuraminidase stalk of influenza/A/WSN, creating a surrogate viral antigen. The recombinant virus, influenza A/WSN/OVA II , replicated well, was cleared normally, and stimulated both wild-type and DO11.10 or OT-II TCR transgenic OVA-specific CD4 + T cells. OVA-specific CD4 T cells proliferated during infection only when the OVA epitope was present. However, previously primed (but not naive) transgenic CD4 + T cells were recruited to the infected lung both in the presence and absence of the OVA 323-339 epitope. These data show that, when primed, CD4 + T cells may traffic to the lung in the absence of antigen, but do not proliferate. These results also document a useful tool for the study of CD4 T cells in influenza infection

Transgenics in Agriculture

Indian Academy of Sciences (India)

Home; Journals; Resonance – Journal of Science Education; Volume 6; Issue 2. Transgenics in Agriculture. D Rex Arunraj B Gajendra Babu. Classroom Volume 6 Issue 2 February 2001 pp 83-92. Fulltext. Click here to view fulltext PDF. Permanent link: https://www.ias.ac.in/article/fulltext/reso/006/02/0083-0092 ...

Sex determination in Medfly: A molecular approach

International Nuclear Information System (INIS)

Saccone, G.; Pane, A.; Testa, G.; Santoro, M.; De Martino, G.; Di Paola, F.; Polito, L.C.; Louis, C.

2000-01-01

With the aim of developing new strategies of control to limit the damages inflicted on fruit crops by Ceratitis capitata (Wied.) (Medfly), a biotechnological approach is undertaken whereby female viability would be impaired or male viability would be improved following the introduction of specific genes into the genome of C. capitata. Only males will then be mass produced and released in the infested areas after sterilisation (Louis et al. 1987). Such conditional lethal or 'advantageous' genes could be expressed in transgenic flies either female-specifically or male-specifically by using cis regulative sequences obtained from previously isolated endogenous Ceratitis genes (Saccone et al. 1996, 1998). By using molecular strategies based on a subtractive technique, we have recently isolated male-specifically expressed genes in the Medfly. Furthermore, we present the current status of the research on the Ceratitis dsx gene, showing sex-specific alternative splicing as in Drosophila, and on the tra-inaZ strategy to induce in Drosophila flies female-specific conditional lethality

Structure of Exogenous Gene Integration and Event-Specific Detection in the Glyphosate-Tolerant Transgenic Cotton Line BG2-7.

Science.gov (United States)

Zhang, Xiaobing; Tang, Qiaoling; Wang, Xujing; Wang, Zhixing

2016-01-01

In this study, the flanking sequence of an inserted fragment conferring glyphosate tolerance on transgenic cotton line BG2-7 was analyzed by thermal asymmetric interlaced polymerase chain reaction (TAIL-PCR) and standard PCR. The results showed apparent insertion of the exogenous gene into chromosome D10 of the Gossypium hirsutum L. genome, as the left and right borders of the inserted fragment are nucleotides 61,962,952 and 61,962,921 of chromosome D10, respectively. In addition, a 31-bp cotton microsatellite sequence was noted between the genome sequence and the 5' end of the exogenous gene. In total, 84 and 298 bp were deleted from the left and right borders of the exogenous gene, respectively, with 30 bp deleted from the cotton chromosome at the insertion site. According to the flanking sequence obtained, several pairs of event-specific detection primers were designed to amplify sequence between the 5' end of the exogenous gene and the cotton genome junction region as well as between the 3' end and the cotton genome junction region. Based on screening tests, the 5'-end primers GTCATAACGTGACTCCCTTAATTCTCC/CCTATTACACGGCTATGC and 3'-end primers TCCTTTCGCTTTCTTCCCTT/ACACTTACATGGCGTCTTCT were used to detect the respective BG2-7 event-specific primers. The limit of detection of the former primers reached 44 copies, and that of the latter primers reached 88 copies. The results of this study provide useful data for assessment of BG2-7 safety and for accelerating its industrialization.

Normal proliferation and differentiation of Hoxc-8 transgenic chondrocytes in vitro

Directory of Open Access Journals (Sweden)

Mello Maria

2003-04-01

Full Text Available Abstract Background Hox genes encode transcription factors that are involved in pattern formation in the skeleton, and recent evidence suggests that they also play a role in the regulation of endochondral ossification. To analyze the role of Hoxc-8 in this process in more detail, we applied in vitro culture systems, using high density cultures of primary chondrocytes from neonatal mouse ribs. Results Cultured cells were characterized on the basis of morphology (light microscopy and production of cartilage-specific extracellular matrix (sulfated proteoglycans and type II Collagen. Hypertrophy was demonstrated by increase in cell size, alkaline phosphatase activity and type X Collagen immunohistochemistry. Proliferation was assessed by BrdU uptake and flow cytometry. Unexpectedly, chondrocytes from Hoxc-8 transgenic mice, which exhibit delayed cartilage maturation in vivo 1, were able to proliferate and differentiate normally in our culture systems. This was the case even though freshly isolated Hoxc-8 transgenic chondrocytes exhibited significant molecular differences as measured by real-time quantitative PCR. Conclusions The results demonstrate that primary rib chondrocytes behave similar to published reports for chondrocytes from other sources, validating in vitro approaches for studies of Hox genes in the regulation of endochondral ossification. Our analysis of cartilage-producing cells from Hoxc-8 transgenic mice provides evidence that the cellular phenotype induced by Hoxc-8 overexpression in vivo is reversible in vitro.

Utrophin up-regulation by an artificial transcription factor in transgenic mice.

Directory of Open Access Journals (Sweden)

Elisabetta Mattei

2007-08-01

Full Text Available Duchenne Muscular Dystrophy (DMD is a severe muscle degenerative disease, due to absence of dystrophin. There is currently no effective treatment for DMD. Our aim is to up-regulate the expression level of the dystrophin related gene utrophin in DMD, complementing in this way the lack of dystrophin functions. To this end we designed and engineered several synthetic zinc finger based transcription factors. In particular, we have previously shown that the artificial three zinc finger protein named Jazz, fused with the appropriate effector domain, is able to drive the transcription of a test gene from the utrophin promoter "A". Here we report on the characterization of Vp16-Jazz-transgenic mice that specifically over-express the utrophin gene at the muscular level. A Chromatin Immunoprecipitation assay (ChIP demonstrated the effective access/binding of the Jazz protein to active chromatin in mouse muscle and Vp16-Jazz was shown to be able to up-regulate endogenous utrophin gene expression by immunohistochemistry, western blot analyses and real-time PCR. To our knowledge, this is the first example of a transgenic mouse expressing an artificial gene coding for a zinc finger based transcription factor. The achievement of Vp16-Jazz transgenic mice validates the strategy of transcriptional targeting of endogenous genes and could represent an exclusive animal model for use in drug discovery and therapeutics.

Metagenomic-based impact study of transgenic grapevine rootstock on its associated virome and soil microbiome

Science.gov (United States)

For some crops, the only possible approach to gain a specific trait requires genome modification. The development of virus-resistant transgenic plants based on the pathogen-derived resistance strategy has been a success story for over three decades. However, potential risks associated with the techn...

The wheat NHX antiporter gene TaNHX2 confers salt tolerance in transgenic alfalfa by increasing the retention capacity of intracellular potassium.

Science.gov (United States)

Zhang, Yan-Min; Zhang, Hong-Mei; Liu, Zi-Hui; Li, Hui-Cong; Guo, Xiu-Lin; Li, Guo-Liang

2015-02-01

Previous studies have shown that TaNHX2 transgenic alfalfa (Medicago sativa L.) accumulated more K(+) and less Na(+) in leaves than did the wild-type plants. To investigate whether the increased K(+) accumulation in transgenic plants is attributed to TaNHX2 gene expression and whether the compartmentalization of Na(+) into vacuoles or the intracellular compartmentalization of potassium is the critical mechanism for TaNHX2-dependent salt tolerance in transgenic alfalfa, aerated hydroponic culture was performed under three different stress conditions: control condition (0.1 mM Na(+) and 6 mM K(+) inside culture solution), K(+)-sufficient salt stress (100 mM NaCl and 6 mM K(+)) and K(+)-insufficient salt stress (100 mM NaCl and 0.1 mM K(+)). The transgenic alfalfa plants had lower K(+) efflux through specific K(+) channels and higher K(+) absorption through high-affinity K(+) transporters than did the wild-type plants. Therefore, the transgenic plants had greater K(+) contents and [K(+)]/[Na(+)] ratios in leaf tissue and cell sap. The intracellular compartmentalization of potassium is critical for TaNHX2-induced salt tolerance in transgenic alfalfa.

PHLOEM PROMOTERS IN TRANSGENIC SWEET ORANGE ARE DIFFERENTIALLY TRIGGERED BY Candidatus Liberibacter asiaticus

Directory of Open Access Journals (Sweden)

LUZIA YURIKO MIYATA

Full Text Available ABSTRACT The use of promoters preferentially expressed in specific plant tissues is a desirable strategy to search for resistance for pathogens that colonize these tissues. The bacterium Candidatus Liberibacter asiaticus (Las, associated with huanglongbing disease (HLB of citrus, colonizes phloem vessels. Some promoters, besides conferring tissue-specific expression, can also respond to the presence of the pathogen. The objective of the present study was to verify if the presence of Las could modulate the activation of the phloem-specific promoters AtPP2 (Arabidopsis thaliana phloem protein 2, AtSUC2 (A. thaliana sucrose transporter 2 and CsPP2 ( pCitrus phloemrotein 2, known to be expressed in Citrus sinensis phloem. ‘Hamlin’ sweet orange plants (Citrus sinensis L. Osbeck transformed with the uidA (GUS reporter gene under the control of AtPP2, AtSUC2 and CsPP2 promoters were infected to evaluate the interdependence between transgene expression and the concentration of Las. Plants were inoculated with Las by Diaphorina citri and eighteen months later, bacterial concentration and uidA expression were determined by qPCR and RT-qPCR, respectively. Reporter gene expression driven by AtSUC2 promoter was strongly and positively correlated with Las concentration. Therefore, this promoter combines desirable features of both tissue-specificity and pathogen-inducibility for the production of transgenic plants tolerant to Las.

First molecular identification of the transgene red fluorescent protein (RFP in transgenic ornamental zebrafish (Danio rerio introduced in Peru

Directory of Open Access Journals (Sweden)

Carlos Scotto

2013-09-01

Full Text Available In this paper the transgenic fluorescent red, orange and pink zebra fish (Danio rerio, found in local aquariums in Peru, were identified using the PCR technique to amplify the transgene RFP sea anemone belonging to Discosoma spp. The gene expression of the red fluorescent protein (RFP transgene was found to determine different gradients-of-bioluminescence (shades in color in each GMO fish analyzed. We performed sequence analysis of the two variants of the RFP along with six variants of the existing fluorescent protein GFP from the Genbank, this could help identify quickly if they are new genes or variants thereof as these novel fluorescent proteins may be introduced in aquatic GMO in the future. Thus, developing and improving biosecurity measures through its timely detection at the molecular genetic level.

Some biochemical characteristics of a toxic substance isolated from organs of lethally irradiated animals in the course of the intestinal syndrome

Energy Technology Data Exchange (ETDEWEB)

Meter, J D; Sirota, N S [Tsentral' nyj Nauchno-Issledovatel' skij Rentgeno-Radiologicheskij Inst., Leningrad (USSR)

1976-05-01

A toxic substance isolated from organs of lethally irradiated (1300 rads) animals in the period when intestinal syndrome has developed is classified according to the parameters under study (namely, the molecular weight, UV-absorption curve, extinction coefficient, specific monosaccharides, the presence and percentage of KDA, etc.) as lipopolysaccharide of Escherichia coli, the main inhabitant of the gastroenteric tract of mice. That endotoxins (sensitivity to which is increased in this period of radiation sickness) are detected in the blood and organs of lethally irradiated animals, might indicate their participation in the pathogenesis of the intestinal syndrome.

Some biochemical characteristics of a toxic substance isolated from organs of lethally irradiated animals in the course of the intestinal syndrome

International Nuclear Information System (INIS)

Meter, J.D.; Sirota, N.S.

1976-01-01

A toxic substance isolated from organs of lethally irradiated (1300 rads) animals in the period when intestinal syndrome has developed is classified according to the parameters under study (namely, the molecular weight, UV-absorption curve, extinction coefficient, specific monosaccharides, the presence and percentage of KDA, etc.) as lipopolysaccharide of Escherichia coli, the main inhabitant of the gastroenteric tract of mice. That endotoxins (sensitivity to which is increased in this period of radiation sickness) are detected in the blood and organs of lethally irradiated animals, might indicate their participation in the pathogenesis of the intestinal syndrome

Function and anatomy of plant siRNA pools derived from hairpin transgenes

Directory of Open Access Journals (Sweden)

Lee Kevin AW

2007-11-01

Full Text Available Abstract Background RNA interference results in specific gene silencing by small-interfering RNAs (siRNAs. Synthetic siRNAs provide a powerful tool for manipulating gene expression but high cost suggests that novel siRNA production methods are desirable. Strong evolutionary conservation of siRNA structure suggested that siRNAs will retain cross-species function and that transgenic plants expressing heterologous siRNAs might serve as useful siRNA bioreactors. Here we report a detailed evaluation of the above proposition and present evidence regarding structural features of siRNAs extracted from plants. Results Testing the gene silencing capacity of plant-derived siRNAs in mammalian cells proved to be very challenging and required partial siRNA purification and design of a highly sensitive assay. Using the above assay we found that plant-derived siRNAs are ineffective for gene silencing in mammalian cells. Plant-derived siRNAs are almost exclusively double-stranded and most likely comprise a mixture of bona fide siRNAs and aberrant partially complementary duplexes. We also provide indirect evidence that plant-derived siRNAs may contain a hitherto undetected physiological modification, distinct from 3' terminal 2-O-methylation. Conclusion siRNAs produced from plant hairpin transgenes and extracted from plants are ineffective for gene silencing in mammalian cells. Thus our findings establish that a previous claim that transgenic plants offer a cost-effective, scalable and sustainable source of siRNAs is unwarranted. Our results also indicate that the presence of aberrant siRNA duplexes and possibly a plant-specific siRNA modification, compromises the gene silencing capacity of plant-derived siRNAs in mammalian cells.

Multiplex Conditional Mutagenesis Using Transgenic Expression of Cas9 and sgRNAs.

Science.gov (United States)

Yin, Linlin; Maddison, Lisette A; Li, Mingyu; Kara, Nergis; LaFave, Matthew C; Varshney, Gaurav K; Burgess, Shawn M; Patton, James G; Chen, Wenbiao

2015-06-01

Determining the mechanism of gene function is greatly enhanced using conditional mutagenesis. However, generating engineered conditional alleles is inefficient and has only been widely used in mice. Importantly, multiplex conditional mutagenesis requires extensive breeding. Here we demonstrate a system for one-generation multiplex conditional mutagenesis in zebrafish (Danio rerio) using transgenic expression of both cas9 and multiple single guide RNAs (sgRNAs). We describe five distinct zebrafish U6 promoters for sgRNA expression and demonstrate efficient multiplex biallelic inactivation of tyrosinase and insulin receptor a and b, resulting in defects in pigmentation and glucose homeostasis. Furthermore, we demonstrate temporal and tissue-specific mutagenesis using transgenic expression of Cas9. Heat-shock-inducible expression of cas9 allows temporal control of tyr mutagenesis. Liver-specific expression of cas9 disrupts insulin receptor a and b, causing fasting hypoglycemia and postprandial hyperglycemia. We also show that delivery of sgRNAs targeting ascl1a into the eye leads to impaired damage-induced photoreceptor regeneration. Our findings suggest that CRISPR/Cas9-based conditional mutagenesis in zebrafish is not only feasible but rapid and straightforward. Copyright © 2015 by the Genetics Society of America.

Photoreactivable sector of lethal damage in ultraviolet-irradiated Escherichia coli cells

International Nuclear Information System (INIS)

Balgavy, P.

1976-01-01

The photoreactivable sector of lethal damage in Escherichia coli Bsub(s-1), Escherichia coli B/r Hcr - and Escherichia coli B/r Hcr + cells after ultraviolet irradiation at 254 nm is 0.823 +- 0.004, 0.70 +- 0.01 and 0.53 +- 0.06, respectively, at 99% confidence limits. For the low values of the photoreactivable sector in the B/r Hcr - and B/r Hcr + strains are likely to be responsible dark repair processes which eliminate lethal damage, brought about by pyrimidine dimers, preferably in comparison with lethal damage caused by photoproducts of another type. (author)

Gene expression profiling of prostate tissue identifies chromatin regulation as a potential link between obesity and lethal prostate cancer.

Science.gov (United States)

Ebot, Ericka M; Gerke, Travis; Labbé, David P; Sinnott, Jennifer A; Zadra, Giorgia; Rider, Jennifer R; Tyekucheva, Svitlana; Wilson, Kathryn M; Kelly, Rachel S; Shui, Irene M; Loda, Massimo; Kantoff, Philip W; Finn, Stephen; Vander Heiden, Matthew G; Brown, Myles; Giovannucci, Edward L; Mucci, Lorelei A

2017-11-01

Obese men are at higher risk of advanced prostate cancer and cancer-specific mortality; however, the biology underlying this association remains unclear. This study examined gene expression profiles of prostate tissue to identify biological processes differentially expressed by obesity status and lethal prostate cancer. Gene expression profiling was performed on tumor (n = 402) and adjacent normal (n = 200) prostate tissue from participants in 2 prospective cohorts who had been diagnosed with prostate cancer from 1982 to 2005. Body mass index (BMI) was calculated from the questionnaire immediately preceding cancer diagnosis. Men were followed for metastases or prostate cancer-specific death (lethal disease) through 2011. Gene Ontology biological processes differentially expressed by BMI were identified using gene set enrichment analysis. Pathway scores were computed by averaging the signal intensities of member genes. Odds ratios (ORs) for lethal prostate cancer were estimated with logistic regression. Among 402 men, 48% were healthy weight, 31% were overweight, and 21% were very overweight/obese. Fifteen gene sets were enriched in tumor tissue, but not normal tissue, of very overweight/obese men versus healthy-weight men; 5 of these were related to chromatin modification and remodeling (false-discovery rate 7, 41% vs 17%; P = 2 × 10 -4 ) and an increased risk of lethal disease that was independent of grade and stage (OR, 5.26; 95% confidence interval, 2.37-12.25). This study improves our understanding of the biology of aggressive prostate cancer and identifies a potential mechanistic link between obesity and prostate cancer death that warrants further study. Cancer 2017;123:4130-4138. © 2017 American Cancer Society. © 2017 American Cancer Society.

Heterochromatin position effects on circularized sex chromosomes cause filicidal embryonic lethality in Drosophila melanogaster.

Science.gov (United States)

Ferree, Patrick M; Gomez, Karina; Rominger, Peter; Howard, Dagnie; Kornfeld, Hannah; Barbash, Daniel A

2014-04-01

Some circularized X-Y chromosomes in Drosophila melanogaster are mitotically unstable and induce early embryonic lethality, but the genetic basis is unknown. Our experiments suggest that a large region of X-linked satellite DNA causes anaphase bridges and lethality when placed into a new heterochromatic environment within certain circularized X-Y chromosomes. These results reveal that repetitive sequences can be incompatible with one another in cis. The lethal phenotype also bears a remarkable resemblance to a case of interspecific hybrid lethality.

Calcium electrotransfer for termination of transgene expression in muscle

DEFF Research Database (Denmark)

Hojman, Pernille; Spanggaard, Iben; Olsen, Caroline Holkman

2011-01-01

Gene electrotransfer is expanding in clinical use, thus we have searched for an emergency procedure to stop transgene expression in case of serious adverse events. Calcium is cytotoxic at high intracellular levels, so we tested effects of calcium electrotransfer on transgene expression in muscle....... A clinical grade calcium solution (20 μl, 168 mM) was injected into transfected mouse or rat tibialis cranialis muscle. Ca(2+) uptake was quantified using calcium 45 ((45)Ca), and voltage and time between injection and pulsation were varied. Extinction of transgene expression was investigated by using both...... voltage pulses of 1000 V/cm. Using these parameters, in vivo imaging showed that transgene expression significantly decreased 4 hr after Ca(2+) electrotransfer and was eliminated within 24 hr. Similarly, serum erythropoietin was reduced by 46% at 4 hr and to control levels at 2 days. Histological analyses...