WorldWideScience

Sample records for length ordered restriction

  1. Identifying product order with restricted Boltzmann machines

    Science.gov (United States)

    Rao, Wen-Jia; Li, Zhenyu; Zhu, Qiong; Luo, Mingxing; Wan, Xin

    2018-03-01

    Unsupervised machine learning via a restricted Boltzmann machine is a useful tool in distinguishing an ordered phase from a disordered phase. Here we study its application on the two-dimensional Ashkin-Teller model, which features a partially ordered product phase. We train the neural network with spin configuration data generated by Monte Carlo simulations and show that distinct features of the product phase can be learned from nonergodic samples resulting from symmetry breaking. Careful analysis of the weight matrices inspires us to define a nontrivial machine-learning motivated quantity of the product form, which resembles the conventional product order parameter.

  2. A theoretical analysis of season length restrictions in fisheries management

    Directory of Open Access Journals (Sweden)

    Qing Xu

    2002-01-01

    Full Text Available This paper studies season length restrictions in fisheries management from an ecological-economic perspective. We first construct a model of a stylized fishery in which season length restrictions are used to manage the fishery. We then show how the dynamic and the stochastic properties of this fishery can be used to construct two managerial criteria that are meaningful from an ecological standpoint. Finally, using these two criteria, we discuss a probabilistic approach to fisheries management in which the principal focus of a manager is on moving the fishery away from the least desirable state of existence.

  3. 76 FR 75950 - Hazardous Materials: Emergency Restriction/Prohibition Order

    Science.gov (United States)

    2011-12-05

    .... PHMSA-2011-0303; Notice No. 11-14] Hazardous Materials: Emergency Restriction/Prohibition Order AGENCY.../Prohibition Order. SUMMARY: This notice publishes Emergency Restriction/Prohibition Order 2011-001 (DOT Docket... Emergency Restriction/ Prohibition Order 2011-001 is as follows: This notice constitutes an Emergency...

  4. Identification of beef using restriction fragment length polymorphism–

    Directory of Open Access Journals (Sweden)

    R. A. Al-Sanjary

    2009-01-01

    Full Text Available To differentiate the beef from other types of meat consumed by human, DNA markers based on polymerase chain reaction restriction fragment length polymorphism technique is performed by using universal primers designed on mitochondrial cytochrome b gene to obtain amplified band 359 bp, then digested with some of restriction enzymes like Tru91, RsaI, Hinf I, Hae III, Alu I, Taq I, Mob I. The result revealed that, the Hinf I enzyme produce three bands 198, 117, 44 bp and the Hae III enzyme revealed two band 285, 74 bp, the Alu I enzyme also produced two band but the molecular weight are 190, 169 bp. The other enzymes did not reveal any digestion of the amplified bands and this result is a characteristic unique to beef compared with other types of meat when using same enzymes.

  5. Amplified restriction fragment length polymorphism in parasite genetics.

    Science.gov (United States)

    Masiga, D K; Tait, A; Turner, C M

    2000-08-01

    The amplified restriction fragment length polymorphism (AFLP) technique is a relatively new method for the analysis of polymorphism that has not yet been widely used in parasitology. In this article, Dan Masiga, Andy Tait and Mike Turner provide a brief introduction to AFLP and illustrate how it can be used in the investigation of marker inheritance in genetic crosses and in the analysis of polymorphism of field populations. They also briefly highlight the strengths and weaknesses of AFLP in comparison with other methods for detecting polymorphism and conclude that AFLP is a very useful addition to the range of techniques available.

  6. New restriction fragment length polymorphism (RFLP) markers for Aspergillus fumigatus.

    Science.gov (United States)

    Semighini, C P; Delmas, G; Park, S; Amstrong, D; Perlin, D; Goldman, G H

    2001-07-01

    In this study, we isolated and tested restriction fragment length polymorphism (RFLP) markers for Aspergillus fumigatus based on PCR products amplified by the random amplified polymorphic DNA (RAPD) primer R108. Four DNA fragments, Afd, Af5, Af4, and Af4A, were amplified. Fragments Afd and Af5 were 85% and 88% identical at the DNA level to part of the Afut1 retrotransposon from A. fumigatus. Fragment Af4A is a duplication of fragment Af4 and both showed similarity at the amino acid level with endonucleases from other fungal retrotransposons. We used both RAPD with primer R108 and RFLP assays with Afut1, Afd, and Af4A, to determine the genetic relatedness of clinical isolates of A. fumigatus isolated sequentially from four patients colonized with A. fumigatus. The combination of these different methods suggested that the isolates infecting the four patients were not identical.

  7. Ordered Restriction Maps of Saccharomyces cerevisiae Chromosomes Constructed by Optical Mapping

    Science.gov (United States)

    Schwartz, David C.; Li, Xiaojun; Hernandez, Luis I.; Ramnarain, Satyadarshan P.; Huff, Edward J.; Wang, Yu-Ker

    1993-10-01

    A light microscope-based technique for rapidly constructing ordered physical maps of chromosomes has been developed. Restriction enzyme digestion of elongated individual DNA molecules (about 0.2 to 1.0 megabases in size) was imaged by fluorescence microscopy after fixation in agarose gel. The size of the resulting individual restriction fragments was determined by relative fluorescence intensity and apparent molecular contour length. Ordered restriction maps were then created from genomic DNA without reliance on cloned or amplified sequences for hybridization or analytical gel electrophoresis. Initial application of optical mapping is described for Saccharomyces cerevisiae chromosomes.

  8. Identification of fungemia agents using the polymerase chain reaction and restriction fragment length polymorphism analysis

    Directory of Open Access Journals (Sweden)

    M.S. Santos

    2010-08-01

    Full Text Available Prompt and specific identification of fungemia agents is important in order to define clinical treatment. However, in most cases conventional culture identification can be considered to be time-consuming and not without errors. The aim of the present study was to identify the following fungemia agents: Candida albicans, Candida parapsilosis, Candida tropicalis, Candida glabrata, Cryptococcus neoformans, Cryptococcus gattii, and Histoplasma capsulatum using the polymerase chain reaction and restriction fragment length polymorphism analysis (PCR/RFLP. More specifically: a to evaluate 3 different amplification regions, b to investigate 3 different restriction enzymes, and c to use the best PCR/RFLP procedure to indentify 60 fungemia agents from a culture collection. All 3 pairs of primers (ITS1/ITS4, NL4/ITS5 and Primer1/Primer2 were able to amplify DNA from the reference strains. However, the size of these PCR products did not permit the identification of all the species studied. Three restriction enzymes were used to digest the PCR products: HaeIII, Ddel and Bfal. Among the combinations of pairs of primers and restriction enzymes, only one (primer pair NL4/ITS5 and restriction enzyme Ddel produced a specific RFLP pattern for each microorganism studied. Sixty cultures of fungemia agents (selected from the culture collection of Fundação de Medicina Tropical do Amazonas - FMTAM were correctly identified by PCR/RFLP using the prime pair NL4/ITS5 and Ddel. We conclude that the method proved to be both simple and reproducible, and may offer potential advantages over phenotyping methods.

  9. First order normalization in the perturbed restricted three–body ...

    African Journals Online (AJOL)

    This paper performs the first order normalization that will be employed in the study of the nonlinear stability of triangular points of the perturbed restricted three – body problem with variable mass. The problem is perturbed in the sense that small perturbations are given in the coriolis and centrifugal forces. It is with variable ...

  10. Instantaneous equations for multiphase flow in porous media without length-scale restrictions using a non-local averaging volume

    International Nuclear Information System (INIS)

    Espinosa-Paredes, Gilberto

    2010-01-01

    The aim of this paper is to propose a framework to obtain a new formulation for multiphase flow conservation equations without length-scale restrictions, based on the non-local form of the averaged volume conservation equations. The simplification of the local averaging volume of the conservation equations to obtain practical equations is subject to the following length-scale restrictions: d << l << L, where d is the characteristic length of the dispersed phases, l is the characteristic length of the averaging volume, and L is the characteristic length of the physical system. If the foregoing inequality does not hold, or if the scale of the problem of interest is of the order of l, the averaging technique and therefore, the macroscopic theories of multiphase flow should be modified in order to include appropriate considerations and terms in the corresponding equations. In these cases the local form of the averaged volume conservation equations are not appropriate to describe the multiphase system. As an example of the conservation equations without length-scale restrictions, the natural circulation boiling water reactor was consider to study the non-local effects on the thermal-hydraulic core performance during steady-state and transient behaviors, and the results were compared with the classic local averaging volume conservation equations.

  11. Mutagenicity Assessment of Organophosphates using Polymerase Chain Reaction-Restriction Fragment Length Polymorphism Assay

    OpenAIRE

    Bhinder, Preety; Chaudhry, Asha

    2013-01-01

    Objectives: In this study we have evaluated the mutagenicity of organophosphate pesticides acephate, chlorpyrifos, and profenofos using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) assay with the mosquito Culex quinquefasciatus taken as an experimental model. Materials and Methods: Second instar larvae were treated with LC20 of each pesticide for 24 h and mutations induced in the sequence of mitochondrial COII gene (690bp) were studied from restriction pattern...

  12. Restriction fragment length polymorphisms of the DNA of selected Naegleria and Acanthamoeba amebae.

    Science.gov (United States)

    McLaughlin, G L; Brandt, F H; Visvesvara, G S

    1988-09-01

    Fourteen strains of Naegleria fowleri, two strains of N. gruberi, and one strain each of N. australiensis, N. jadini, N. lovaniensis, Acanthamoeba sp., A. castellanii, A. polyphaga, and A. comandoni isolated from patients, soil, or water were characterized by restriction fragment length polymorphisms. Total cellular DNA (1 microgram) was digested with either HindIII, BglII, or EcoRI; separated on agarose gels; and stained with ethidium bromide. From 2 to 15 unusually prominent repetitive restriction fragment bands, totaling 15 to 50 kilobases in length and constituting probably more than 30% of the total DNA, were detected for all ameba strains. Each species displayed a characteristic pattern of repetitive restriction fragments. Digests of the four Acanthamoeba spp. displayed fewer, less intensely staining repetitive fragments than those of the Naegleria spp. All N. fowleri strains, whether isolated from the cerebrospinal fluid of patients from different parts of the world or from hot springs, had repetitive restriction fragment bands of similar total lengths (ca. 45 kilobases), and most repetitive bands displayed identical mobilities. However, polymorphic bands were useful in identifying particular isolates. Restriction fragment length polymorphism analysis generally was consistent with taxonomy based on studies of infectivity, morphology, isoenzyme patterns, and antibody reactivity and suggests that this technique may help classify amebae isolated from clinical specimens or from the environment.

  13. Detecting Violations of Unidimensionality by Order-Restricted Inference Methods

    Directory of Open Access Journals (Sweden)

    Moritz eHeene

    2016-03-01

    Full Text Available The assumption of unidimensionality and quantitative measurement represents one of the key concepts underlying most of the commonly applied of item response models. The assumption of unidimensionality is frequently tested although most commonly applied methods have been shown having low power against violations of unidimensionality whereas the assumption of quantitative measurement remains in most of the cases only an (implicit assumption. On the basis of a simulation study it is shown that order restricted inference methods within a Markov Chain Monte Carlo framework can successfully be used to test both assumptions.

  14. Restriction fragment length polymorphism of two HLA-B-associated transcripts genes in five autoimmune diseases

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1991-01-01

    The restriction fragment length polymorphism of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, identifying polymorphic bands of 12, 8, 2.5, and 1.1 kb, and at 3.3, 2.7, 2.3, and 0.9 kb, respectively, was investigated in patients with primary biliary cirrhosis (PBC...

  15. Transposition rates of Mycobacterium tuberculosis IS6110 restriction fragment length polymorphism patterns

    NARCIS (Netherlands)

    Eilers, Paul H. C.; van Soolingen, Dick; Thi Ngoc Lan, Nguyen; Warren, Rob M.; Borgdorff, Martien W.

    2004-01-01

    To determine the rate at which IS6110 restriction fragment length polymorphism (RFLP) patterns in Mycobacterium tuberculosis change over time, we applied a smooth nonparametric survival model to several data sets, including data from previous publications on the rate of change. The results strongly

  16. Use of Restriction Fragment Length Polymorphism of 18S rRNA ...

    African Journals Online (AJOL)

    The restriction fragment length polymorphism (RFLP) pattern of PCR products obtained was the same for T. brucei subspecies: T.b. brucei and T.b. gambiense but different for other trypanosome species and L. donovani. RFLP analysis was also done with genomic DNA from different trypanosome species, subspecies and ...

  17. Differential diagnosis of genetic disease by DNA restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Bolhuis, P. A.; Defesche, J. C.; van der Helm, H. J.

    1987-01-01

    DNA restriction fragment length polymorphisms (RFLPs) are used for diagnosis of genetic disease in families known to be affected by specific disorders, but RFLPs can be also useful for the differential diagnosis of hereditary disease. An RFLP pattern represents the inheritance of chromosomal markers

  18. Modified Terminal Restriction Fragment Analysis for Quantifying Telomere Length Using In-gel Hybridization.

    Science.gov (United States)

    Jenkins, Frank J; Kerr, Charles M; Fouquerel, Elise; Bovbjerg, Dana H; Opresko, Patricia L

    2017-07-10

    There are several different techniques for measuring telomere length, each with their own advantages and disadvantages. The traditional approach, Telomere Restriction Fragment (TRF) analysis, utilizes a DNA hybridization technique whereby genomic DNA samples are digested with restriction enzymes, leaving behind telomere DNA repeats and some sub-telomeric DNA. These are separated by agarose gel electrophoresis, transferred to a filter membrane and hybridized to oligonucleotide probes tagged with either chemiluminescence or radioactivity to visualize telomere restriction fragments. This approach, while requiring a larger quantity of DNA than other techniques such as PCR, can measure the telomere length distribution of a population of cells and allows measurement expressed in absolute kilobases. This manuscript demonstrates a modified DNA hybridization procedure for determining telomere length. Genomic DNA is first digested with restriction enzymes (that do not cut telomeres) and separated by agarose gel electrophoresis. The gel is then dried and the DNA is denatured and hybridized in situ to a radiolabeled oligonucleotide probe. This in situ hybridization avoids loss of telomere DNA and improves signal intensity. Following hybridization, the gels are imaged utilizing phosphor screens and the telomere length is quantified using a graphing program. This procedure was developed by the laboratories of Drs. Woodring Wright and Jerry Shay at the University of Texas Southwestern 1 , 2 . Here, we present a detailed description of this procedure, with some modifications.

  19. Simple and rapid human papillomavirus genotyping method by restriction fragment length polymorphism analysis with two restriction enzymes.

    Science.gov (United States)

    Chen, Linghan; Watanabe, Ken; Haruyama, Takahiro; Kobayashi, Nobuyuki

    2013-07-01

    Cervical cancer, the third most common cancer that affects women worldwide, is caused by the human papillomavirus (HPV) and is treatable when detected at an early stage. To date, more than 100 different HPV types have been described, and the development of simple, low-cost, and accurate methods to distinguish HPV genotypes is highly warranted. In this study, an HPV genotyping assay based on polymerase chain reaction (PCR) was evaluated. This method involved the use of MY09/11 primers followed by restriction fragment length polymorphism (RFLP) analysis with the restriction enzymes HpyCH4V and NlaIII. Cervical specimens preserved using CytoRich Blue fluid were collected from 1,134 female volunteers for HPV detection, and 1,111 valid samples were amplified using PCR. The PCR method was sensitive enough to detect 25 copies of HPV18, and three copies of HPV16. Out of 202 PCR-positive samples, HPV genotypes were determined in 189 samples (93.6%) by this RFLP method. Results were then evaluated further by capillary sequencing method. Concordant results between the two tests were as high as 96.0%. Thirteen samples, which tested negative with RFLP, were verified as non-specific amplifications with PCR. In conclusion, this PCR-RFLP method using restriction enzymes HpyCH4V and NlaIII is simple, non-labor intensive, and is applicable for the inexpensive determination of HPV genotypes in clinical samples. Copyright © 2013 Wiley Periodicals, Inc.

  20. Genotyping of the fish rhabdovirus, viral haemorrhagic septicaemia virus, by restriction fragment length polymorphisms

    DEFF Research Database (Denmark)

    Einer-Jensen, Katja; Winton, J.; Lorenzen, Niels

    2005-01-01

    The aim of this study was to develop a standardized molecular assay that used limited resources and equipment for routine genotyping of isolates of the fish rhabdovirus, viral haemorrhagic septicaemia virus (VHSV). Computer generated restriction maps, based on 62 unique full-length (1524 nt......-gene by a set of three restriction enzymes was predicted to accurately enable the assignment of the VHSV isolates into the four major genotypes discovered to date. Further sub-typing of the isolates into the recently described sub-lineages of genotype I was possible by applying three additional enzymes...

  1. Association of restriction fragment length polymorphism in alcohol dehydrogenase 2 gene with alcohol induced liver damage.

    OpenAIRE

    Sherman, D I; Ward, R J; Warren-Perry, M; Williams, R; Peters, T J

    1993-01-01

    OBJECTIVE--To investigate the role of genetically determined differences in the enzymes of alcohol metabolism in susceptibility to liver damage from misusing alcohol. DESIGN--Use of pADH36 probe to study PVU II restriction length fragment polymorphism in alcohol dehydrogenase 2 gene in white alcohol misusers and controls. SETTING--Teaching hospital referral centres for liver disease and alcohol misuse. SUBJECTS--45 white alcohol misusers (38 with alcoholic liver disease) and 23 healthy contro...

  2. Restriction fragment length polymorphism in the 3' flanking region of the rabbit beta 1-globin gene.

    Science.gov (United States)

    Masina, P; Rando, A; Cocozza, S

    1984-10-01

    By Southern blot analysis, a restriction fragment length polymorphism in the 3' flanking region of the rabbit beta 1-globin gene was detected. Two alleles, characterized by 9.7- and 12.4-kb BamHI fragments and by 15.3- and 18.0-kb HindIII fragments, have been detected in a small population of White New Zealand rabbits. The long allele is the most frequent (about 70%). The simultaneous changes in the restriction patterns of the two endonucleases and the constant distance between BamHI and HindIII sites in short and long fragments suggest the possibility that the two alleles arise from a rearrangement phenomenon involving a DNA segment 2.7 kb long. In addition, the presence of the two alleles in individuals genetically unrelated to the White New Zealand breed suggests that this polymorphism is widespread.

  3. From the chromosome to DNA: Restriction fragment length polymorphism analysis and its clinical application.

    Science.gov (United States)

    Todd, R; Donoff, R B; Kim, Y; Wong, D T

    2001-06-01

    Understanding how chromosomal alterations contribute to acquired and inherited human disease requires the ability to manage the enormous physical and informational complexity of the deoxyribonucleic acid (DNA) packaged within. Important concepts and techniques involved in the analysis of DNA include restriction enzymes, Southern blotting, and restriction fragment length polymorphism/linkage analysis. These techniques have been essential in the understanding and diagnosis of several syndromes associated with the head and neck. The purpose of this article is to introduce DNA structure, describe some techniques fundamental to DNA analysis, and provide a brief overview of the clinical applications of this technology with respect to dentinogenesis imperfecta and oral field cancerization. Copyright 2001 American Association of Oral and Maxillofacial Surgeons.

  4. Characterization of six rat strains (Rattus norvegicus by mitochondrial DNA restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Hilsdorf A.W.

    1999-01-01

    Full Text Available Restriction fragment length polymorphism (RFLP was used to examine the extent of mtDNA polymorphism among six strains of rats (Rattus norvegicus - Wistar, Wistar Munich, Brown Norway, Wistar Kyoto, SHR and SHR-SP. A survey of 26 restriction enzymes has revealed a low level of genetic divergence among strains. The sites of cleavage by EcoRI, NcoI and XmnI were shown to be polymorphic. The use of these three enzymes allows the 6 strains to be classified into 4 haplotypes and identifies specific markers for each one. The percentage of sequence divergence among all pairs of haplotypes ranged from 0.035 to 0.33%, which is the result of a severe population constriction undergone by the strains. These haplotypes are easily demonstrable and therefore RFLP analysis can be employed for genetic monitoring of rats within animal facilities or among different laboratories.

  5. Restriction fragment length polymorphism typing of infectious bursal disease virus field strains in Turkey.

    Science.gov (United States)

    Sareyyüpoğlu, B; Akan, M

    2006-12-01

    Infectious bursal disease (IBD), also known as Gumboro disease, is a highly contagious, immunosuppressive disease of immature chickens. It is caused by IBD virus (IBDV) and is responsible for major economic losses in the poultry industry worldwide. In this study, 280 bursa samples from 56 commercially reared chicken flocks in Turkey with clinical symptoms of IBD were examined for IBDVs using the reverse transcription (RT)-polymerase chain reaction (PCR)/restriction fragment length polymorphism (RFLP) assay. The assay was conducted on a 743-bp fragment of the VP2 gene with the restriction enzymes BstNI, MboI, and SspI. The results indicate the existence of field isolates with new molecular patterns different from those previously published that may well be unique and specific to geographical regions.

  6. Investigating of yeast species in wine fermentation using terminal restriction fragment length polymorphism method.

    Science.gov (United States)

    Sun, Yue; Liu, Yanlin

    2014-04-01

    The objective of this study was to examine the potential of terminal restriction fragment length polymorphism (T-RFLP) in monitoring yeast communities during wine fermentation and to reveal new information on yeast community of Chinese enology. Firstly, terminal restriction fragment (TRF) lengths database was constructed using 32 pure yeast species. Ten of these species were firstly documented. The species except for Candida vini, Issatchenkia orientalis/Candida krusei, Saccharomyces bayanus, Saccharomyces pastorianus, Saccharomyces cerevisiae, Saccharomyces kudriarzevii and Zygosaccharomyces bisporus could be distinguished by the T-RFLP targeting 5.8S-ITS rDNA. Moreover, the yeast communities in spontaneous fermentation of Chardonnay and Riesling were identified by T-RFLP and traditional methods, including colony morphology on Wallerstein Nutrient (WLN) medium and 5.8S-ITS-RFLP analysis. The result showed that T-RFLP profiles of the yeast community correlated well with that of the results identified by the traditional methods. The TRFs with the highest intensity and present in all the samples corresponded to Saccharomyces sp. Other species detected by both approaches were Hanseniaspora uvarum, Metschnikowia pulcherrima, Pichia minuta var. minuta, Saccharomycodes ludwigii/Torulaspora delbrueckii and Candida zemplinina. This study revealed that T-RFLP technique is a rapid and useful tool for monitoring the composition of yeast species during wine fermentation. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Restriction fragment length polymorphism catalog for molecular identification of Japanese Tetranychus spider mites (Acari: Tetranychidae).

    Science.gov (United States)

    Osakabe, Masahiro; Kotsubo, Yu; Tajima, Ryusen; Hinomoto, Norihide

    2008-08-01

    Species identification is a basic issue in biosecurity. Polymerase chain reaction (PCR) followed by restriction fragment length polymorphism (RFLP) is a useful molecular diagnostic tool for species identification. However, the lack of transferability of data has been a serious shortcoming of this method. A RFLP catalog, i.e., a graph of PCR-RFLP patterns expected from sequence data, was devised as a tool to facilitate PCR-RFLP data sharing among laboratories. Twelve species of Tetranychus spider mites have been recorded in Japan to date. In this study, we analyzed DNA sequences of the internal transcribed spacer (ITS) region in nuclear ribosomal DNA of 11 Tetranychus species. For the species identification using PCR-RFLP, we chose six candidates from 131 restriction endonucleases and developed an RFLP catalog of all known Japanese Tetranychus species except Tetranychus neocaledonicus André. The RFLP catalog revealed that most Tetranychus species had diagnostic restriction fragments. The RFLP catalog is transferable and simple molecular diagnostic tool, and it has the ability to add more species and newly found intraspecific variations. Therefore, we believe that the RFLP catalog will contribute to biosecurity as a practical diagnostic tool for species identification of spider mites.

  8. Direct endonuclease digestion and multi-analysis of restriction fragment length polymorphisms by microchip electrophoresis.

    Science.gov (United States)

    Akamine, Rie; Yatsushiro, Shouki; Yamamura, Shouhei; Kido, Jun-ichi; Shinohara, Yasuo; Baba, Yoshinobu; Kataoka, Masatoshi

    2009-12-05

    A high-performance multi-analysis system for genotypic mutation by means of restriction fragment length polymorphisms (RFLP) involving endonuclease treatment of PCR-amplified DNA on a microchip and subsequent analysis by microchip electrophoresis for DNA sizing was developed. A Hitachi SV1210 system, with which 12 samples can be analyzed on a plastic chip with good accuracy as to DNA sizing between 25 and 300 bp, was employed for RFLP analysis. We performed RFLP analysis of the ABO genotypes of blood donors for whom the ABO type was known. Six blood samples were analyzed by PCR to amplify two different regions of the genomic DNA, each of the amplified DNAs containing a different nucleotide polymorphism. To analyze the genes at polymorphic sites 261 and 526, restriction endonucleases Kpn I and Ban I were employed, respectively. When an amplified DNA was digested with each endonuclease on a microchip for 20 min, sequential analysis revealed the presence or absence of the respective restriction site. This analysis was performed within 7 min using a 1/10 volume of a DNA sample in comparison with the conventional method, and the estimated DNA size differed from the predicted size by less than 10 bp. The results indicate the potential of microchip electrophoresis for RFLP with on-chip direct endonuclease digestion and sequential analysis, offering high resolution in a short time.

  9. Model selection criteria : how to evaluate order restrictions

    NARCIS (Netherlands)

    Kuiper, R.M.

    2012-01-01

    Researchers often have ideas about the ordering of model parameters. They frequently have one or more theories about the ordering of the group means, in analysis of variance (ANOVA) models, or about the ordering of coefficients corresponding to the predictors, in regression models.A researcher might

  10. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, T V; Madsen, H O; Morling, N

    1992-01-01

    We have used the polymerase chain reaction (PCR) in combination with the restriction fragment length polymorphism (RFLP) technique for HLA-DBP1 typing. After PCR amplification of the polymorphic second exon of the HLA-DPB1 locus, the PCR product was digested with seven allele-specific restriction...

  11. Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...

  12. The isolation and localization of arbitrary restriction fragment length polymorphisms in Southern African populations

    International Nuclear Information System (INIS)

    Conn, V.

    1987-01-01

    The main aim of this study was to contribute to the mapping of the human genome by searching for and characterizing a number of RFLPs (restriction fragment length polymorphisms) in the human genome. The more specific aims of this study were: 1. To isolate single-copy human DNA sequences from a human genomic library. 2. To use these single-copy sequences as DNA probes to search for polymorphic variation among Caucasoid individuals. 3. To show by means of family studies that the RFLPs were inherited in a co-dominant Mendelian fashion. 4. To determine the population frequencies of these RFLPs in Southern African Populations, namely the Bantu-speaking Negroids and the San. 5. To assign these RFLP-detecting DNA sequences to human chromosomes using somatic cell hybrid lines. In this study DNA was labelled with Phosphorus 32

  13. Heterogeneity among Dermatophilus congolensis isolates demonstrated by restriction fragment length polymorphisms.

    Science.gov (United States)

    Faibra, D T

    1993-01-01

    There is evidence of antigenic diversity and of differences in virulence in Dermatophilus congolensis. For the understanding of the epidemiology of dermatophilosis it is important to distinguish between strains of the organism. Twenty field isolates from cattle in Chad and Cameroon, and an American reference strain, have been examined on restriction fragment length polymorphisms. After restriction enzyme digestion of DNA by BamHI and Southern blotting, a rDNA probe consisting of plasmid pMC5 carrying a 4.8 kb insert of Mycoplasma capricolum DNA coding for the 5S, 23S and part of 16S rRNA allowed to distinguish 6 ribotypes of D. congolensis, based on their hybridized rDNA patterns. Particular ribotypes may be distributed over a wide geographical area. On the other hand, strains belonging to at least 5 different ribotypes may be found in one herd; this may partly explain the lack of success in immunization against dermatophilosis in the field.

  14. Identification of infectious agents in onychomycoses by PCR-terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Verrier, Julie; Pronina, Marina; Peter, Corinne; Bontems, Olympia; Fratti, Marina; Salamin, Karine; Schürch, Stéphanie; Gindro, Katia; Wolfender, Jean-Luc; Harshman, Keith; Monod, Michel

    2012-03-01

    A fast and reliable assay for the identification of dermatophyte fungi and nondermatophyte fungi (NDF) in onychomycosis is essential, since NDF are especially difficult to cure using standard treatment. Diagnosis is usually based on both direct microscopic examination of nail scrapings and macroscopic and microscopic identification of the infectious fungus in culture assays. In the last decade, PCR assays have been developed for the direct detection of fungi in nail samples. In this study, we describe a PCR-terminal restriction fragment length polymorphism (TRFLP) assay to directly and routinely identify the infecting fungi in nails. Fungal DNA was easily extracted using a commercial kit after dissolving nail fragments in an Na(2)S solution. Trichophyton spp., as well as 12 NDF, could be unambiguously identified by the specific restriction fragment size of 5'-end-labeled amplified 28S DNA. This assay enables the distinction of different fungal infectious agents and their identification in mixed infections. Infectious agents could be identified in 74% (162/219) of cases in which the culture results were negative. The PCR-TRFLP assay described here is simple and reliable. Furthermore, it has the possibility to be automated and thus routinely applied to the rapid diagnosis of a large number of clinical specimens in dermatology laboratories.

  15. Application of PCR-based restriction fragment length polymorphism for the identification of mycobacterial isolates.

    Science.gov (United States)

    Deepa, P; Therese, K L; Madhavan, H N

    2005-05-01

    Conventional identification of mycobacteria is achieved by standard biochemical tests that are time consuming, laborious and is not always conclusive. This study was thus undertaken to standardize a simple, rapid and cost-effective polymerase chain reaction based restriction fragment length polymorphism (PCR-RFLP) using primers coding for the 16S - 23S rRNA spacer region to identify the mycobacterial isolates to the species level. The PCR with primers targeting the 16S-23S rRNA spacer region was standardized using the standard mycobacterial strains and applied on 51 clinical isolates. The PCR amplified products were subjected to RFLP using the restriction enzymes, Hae III, MspI and BstXI. The results obtained were compared with those of conventional biochemical tests. PCR was sensitive to detect 2.5 pg of H37Rv DNA (370 bp for slow grower mycobacteria) and 1.5 pg of M. fortuitum DNA (450 bp for rapid grower mycobacteria). Based on the PCRRFLP products obtained the 51 mycobacterial isolates were classified into 41 slow growers and 10 rapid growers. Among the 41 slow growers, 40 were identified as M. tuberculosis, one as M. xenopi and 10 rapid growers as M. fortuitum. PCR using primers targeting the 16S-23S rRNA spacer region was a reliable tool for rapid identification of mycobacterial isolates into slow and rapid growers within 4 h of isolation and further speciation by PCR-RFLP within 6-8 h.

  16. Mycobacterium tuberculosis complex differentiation using gyrB-restriction fragment length polymorphism analysis

    Directory of Open Access Journals (Sweden)

    Erica Chimara

    2004-11-01

    Full Text Available Mycobacterium tuberculosis complex (MTBC members are causative agents of human and animal tuberculosis. Differentiation of MTBC members is required for appropriate treatment of individual patients and for epidemiological purposes. Strains from six MTBC species - M. tuberculosis, M. bovis subsp. bovis, M. bovis BCG, M. africanum, M. pinnipedii, and "M. canetti" - were studied using gyrB-restriction fragment length polymorphism (gyrB-RFLP analysis. A table was elaborated, based on observed restriction patterns and published gyrB sequences. To evaluate applicability of gyrB-RFLP at Instituto Adolfo Lutz, São Paulo, Mycobacterial Reference Laboratory, 311 MTBC clinical isolates, previously identified using traditional methods as M. tuberculosis (306, M. bovis (3, and M. bovis BCG (2, were analyzed by gyrB-RFLP. All isolates were correctly identified by the molecular method, but no distinction between M. bovis and M. bovis BCG was obtained. Differentiation of M. tuberculosis and M. bovis is of utmost importance, because they require different treatment schedules. In conclusion, gyrB-RFLP is accurate and easy-to-perform, with potential to reduce time needed for conventional differentiation methods. However, application for epidemiological studies remains limited, because it cannot differentiate M. tuberculosis from M. africanum subtype II, and "M. canetti", M. africanum subtype I from M. pinnipedii, and. M. bovis from M. bovis BCG.

  17. Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

    International Nuclear Information System (INIS)

    Williams, S.D.

    1989-01-01

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P 32 labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population

  18. Use of restriction fragment length polymorphisms to investigate strain variation within Neisseria meningitidis

    Energy Technology Data Exchange (ETDEWEB)

    Williams, S.D.

    1989-01-01

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty-six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P{sup 32} labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analyzed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population.

  19. Use of Restriction Fragment Length Polymorphisms to Investigate Strain Variation Within Neisseria Meningitidis.

    Science.gov (United States)

    Williams, Shelley Diane

    Similarity within bacterial populations is difficult to assess due to the limited number of characters available for evaluation and the heterogeneity of bacterial species. Currently, the preferred method used to evaluate the structure of bacterial populations is multilocus enzyme electrophoresis. However, this method is extremely cumbersome and only offers an indirect measure of genetic similarities. The development of a more direct and less cumbersome method for this purpose is warranted. Restriction fragment length polymorphism analysis was evaluated as a tool for use in the study of bacterial population structures and in the epidemiology and surveillance of infectious disease. A collection of Neisseria meningitidis was available for use in the investigation of this technique. Neisseria meningitidis is the causative agent of epidemic cerebrospinal meningitis and septicemia as well as a variety of other clinical manifestations. Each isolate in the collection was defined in terms of serogroup specificity, clinical history, geographic source, and date of isolation. Forty -six strains were chosen for this study. The DNA from each strain was restricted with Pst1 and EcoR1 and electrophoresed on agarose gels. The DNA was transferred to nylon filters and hybridized with P ^{32} labeled DNA probes. Two randomly generated probes and a gene-specific probe were used to estimate the genetic similarities between and among the strains in the study population. A total of 28 different restriction fragment migration types were detected by the probes used. Data obtained from the RFLP analysis was analysed by cluster analysis and multivariate statistical methods. A total of 7 clones groups were detected. Two of these appear to be major clones that comprise 35% of the population. This analysis demonstrates the lack of structure within Neisseria meningitidis due primarily to a heterogenous population and the lack of geographic segregation. The potential utility of this technique as a

  20. A Restriction Fragment Length Polymorphism Map and Electrophoretic Karyotype of the Fungal Maize Pathogen Cochliobolus Heterostrophus

    Science.gov (United States)

    Tzeng, T. H.; Lyngholm, L. K.; Ford, C. F.; Bronson, C. R.

    1992-01-01

    A restriction fragment length polymorphism (RFLP) map has been constructed of the nuclear genome of the plant pathogenic ascomycete Cochliobolus heterostrophus. The segregation of 128 RFLP and 4 phenotypic markers was analyzed among 91 random progeny of a single cross; linkages were detected among 126 of the markers. The intact chromosomal DNAs of the parents and certain progeny were separated using pulsed field gel electrophoresis and hybridized with probes used to detect the RFLPs. In this way, 125 markers were assigned to specific chromosomes and linkages among 120 of the markers were confirmed. These linkages totalled 941 centimorgans (cM). Several RFLPs and a reciprocal translocation were identified tightly linked to Tox1, a locus controlling host-specific virulence. Other differences in chromosome arrangement between the parents were also detected. Fourteen gaps of at least 40 cM were identified between linkage groups on the same chromosomes; the total map length was therefore estimated to be, at a minimum, 1501 cM. Fifteen A chromosomes ranging from about 1.3 megabases (Mb) to about 3.7 Mb were identified; one of the strains also has an apparent B chromosome. This chromosome appears to be completely dispensable; in some progeny, all of 15 markers that mapped to this chromosome were absent. The total genome size was estimated to be roughly 35 Mb. Based on these estimates of map length and physical genome size, the average kb/cM ratio in this cross was calculated to be approximately 23. This low ratio of physical to map distance should make this RFLP map a useful tool for cloning genes. PMID:1346261

  1. Molecular differentiation of Angiostrongylus costaricensis, A. cantonensis, and A. vasorum by polymerase chain reaction- restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2003-01-01

    Full Text Available Angiostrongylus cantonensis, A. costaricensis, and A. vasorum are etiologic agents of human parasitic diseases. Their identification, at present, is only possible by examining the adult worm after a 40-day period following infection of vertebrate hosts with the third-stage larvae. In order to obtain a diagnostic tool to differentiate larvae and adult worm from the three referred species, polymerase chain reaction-restriction fragment length polymorphism was carried out. The rDNA second internal transcribed spacer (ITS2 and mtDNA cytochrome oxidase I regions were amplified, followed by digestion of fragments with the restriction enzymes RsaI, HapII, AluI, HaeIII, DdeI and ClaI. The enzymes RsaI and ClaI exhibited the most discriminating profiles for the differentiation of the regions COI of mtDNA and ITS2 of rDNA respectively. The methodology using such regions proved to be efficient for the specific differentiation of the three species of Angiostrongylus under study.

  2. Molecular Characterization of Yeast Strains Isolated from Different Sources by Restriction Fragment Length Polymorphism

    International Nuclear Information System (INIS)

    Ali, M. S.; Latif, Z.

    2016-01-01

    Various molecular techniques like analysis of the amplified rDNA internal transcribed spacers (ITS), intragenic spacers and total ITS region analysis by restriction fragment length polymorphism (RFLP) has been introduced for yeast identification but there are limited databases to identify yeast species on the basis of 5.8S rDNA. In this study, twenty nine yeast strains from various sources including spoiled fruits, vegetables, foodstuffs, and concentrated juices were characterized by PCR-RFLP. PCR-RFLP has been used to characterize yeasts present in different spoiled food samples after isolation of the yeasts. By using this technique, the isolated yeast strains were characterized by direct 5.8S-ITS rDNA region amplification. RFLP analysis was applied to each of the amplification products (varied from 400bp to 800bp) detected, and the corresponding yeast identifications were made according to each specific restriction patterns obtained after treatment with two endonucleases TaqI and HaeIII which yielded a specific banding pattern for each species. For further confirmation amplified products of eleven selected isolates were sequenced and blast on NCBI. Both RFLP and sequence analyses of the strains with accession nos. KF472163, KF472164, KF472165, KF472166, KF472167, KF472168, KF472169, KF472170, KF472171, KF472172, KF472173 gave significantly similar results. The isolates were found to belong five different yeast species including; Candida spp., Pichia spp., Kluyveromyces spp., Clavispora spp. and Hanseniaspora spp. This method provides a fast, easy, reliable and authentic way for determining yeast population present in different type of samples, as compared to traditional characterization technique. (author)

  3. Criminal Protection Orders for Women Victims of Domestic Violence: Explicating Predictors of Level of Restrictions Among Orders Issued.

    Science.gov (United States)

    Sullivan, Tami P; Weiss, Nicole H; Price, Carolina; Pugh, Nicole E

    2017-10-01

    Criminal protection orders (POs), with varying degrees of restrictions, are issued by the criminal justice system to enhance the safety of victims of domestic violence (DV). Limited research exists to elucidate factors associated with their issuance. Therefore, the purpose of this study was to investigate how demographic, relationship, parenting, and court-process-related factors are related to the level of restriction the PO places on the offender. Two-hundred ninety-eight women who were victims in a criminal DV case ( M age 36.4, 50.0% African American) participated in a structured interview approximately 12 to 15 months following the offenders' arraignment. Results revealed that psychological DV severity and fear of the offender in the 30 days prior to arraignment significantly predicted PO level of restriction issued. In addition, level of restriction requested by the victim significantly predicted level of restriction issued by the judge (though closer examination of the data revealed that many orders were issued at a different level of restriction than the victim requested). Other demographic, relationship, parenting, and court-process-related factors did not predict PO level of restriction issued. Findings are discussed with respect to practice and policy in the criminal justice system.

  4. Coccidioides species determination: does sequence analysis agree with restriction fragment length polymorphism?

    Science.gov (United States)

    Johnson, Suzanne M; Carlson, Erin L; Pappagianis, Demosthenes

    2015-06-01

    Fifteen Coccidioides isolates were previously examined for genetic diversity using restriction fragment length polymorphism (RFLP); two fragment patterns were observed. Two isolates demonstrated one banding pattern (designated RFLP group I), while the remaining 13 isolates demonstrated a second pattern (designated RFLP group II). Recently, molecular studies supported the division of the genera Coccidioides into two species: Coccidioides posadasii and Coccidioides immitis. It has been assumed that the species division corresponds to the RFLP grouping. We tested this hypothesis by amplifying the ribosomal DNA internal transcribed spacer region as well as the dioxygenase, serine proteinase, and urease genes from 13 isolates previously examined by RFLP and then sequencing the PCR products. The appropriate species for each isolate was assigned using phylogenetically informative sites. The RFLP grouping agreed with the Coccidioides species assignment for all but one isolate, which may represent a hybrid. In addition, polymorphic sites among the four genes examined were in agreement for species assignment such that analysis of a single gene may be sufficient for species assignment.

  5. Molecular identification of Giardia duodenalis in Ecuador by polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Richard Atherton

    2013-06-01

    Full Text Available The aim of this study was to determine the genetic diversity of Giardia duodenalis present in a human population living in a northern Ecuadorian rain forest. All Giardia positive samples (based on an ELISA assay were analysed using a semi-nested polymerase chain reaction-restriction fragment length polymorphism assay that targets the glutamate dehydrogenase (gdh gene; those amplified were subsequently genotyped using NlaIV and RsaI enzymes. The gdh gene was successfully amplified in 74 of 154 ELISA positive samples; 69 of the 74 samples were subsequently genotyped. Of these 69 samples, 42 (61% were classified as assemblage B (26 as BIII and 16 as BIV, 22 (32% as assemblage A (3 as AI and 19 as AII and five (7% as mixed AII and BIII types. In this study site we observe similar diversity in genotypes to other regions in Latin America, though in contrast to some previous studies, we found similar levels of diarrheal symptoms in those individuals infected with assemblage B compared with those infected with assemblage A.

  6. Using terminal restriction fragment length polymorphism (T-RFLP) to identify mycorrhizal fungi: a methods review.

    Science.gov (United States)

    Dickie, I A; FitzJohn, R G

    2007-06-01

    Terminal restriction fragment length polymorphism (T-RFLP) is an increasingly widely used technique in mycorrhizal ecology. In this paper, we review the technique as it is used to identify species of mycorrhizal fungi and distinguish two different versions of the technique: peak-profile T-RFLP (the original version) and database T-RFLP. We define database T-RFLP as the use of T-RFLP to identify individual species within samples by comparison of unknown data with a database of known T-RFLP patterns. This application of T-RFLP avoids some of the pitfalls of peak-profile T-RFLP and allows T-RFLP to be applied to polyphyletic functional groups such as ectomycorrhizal fungi. The identification of species using database T-RFLP is subject to several sources of potential error, including (1) random erroneous matches of peaks to species, (2) shared T-RFLP profiles across species, and (3) multiple T-RFLP profiles within a species. A mathematical approximation of the risk of the first type of error as a function of experimental parameters is discussed. Although potentially less accurate than some other methods such as clone libraries, the high throughput of database T-RFLP permits much greater replication and may, therefore, be preferable for many ecological questions, particularly when combined with other techniques such as cloning.

  7. Genetic diversity for restriction fragment length polymorphisms and heterosis for two diallel sets of maize inbreds.

    Science.gov (United States)

    Melchinger, A E; Lee, M; Lamkey, K R; Hallauer, A R; Woodman, W L

    1990-10-01

    Changes that may have occurred over the past 50 years of hybrid breeding in maize (Zea maize L.) with respect to heterosis for yield and heterozygosity at the molecular level are of interest to both maize breeders and quantitative geneticists. The objectives of this study were twofold: The first, to compare two diallels produced from six older maize inbreds released in the 1950's and earlier and six newer inbreds released during the 1970's with respect to (a) genetic variation for restriction fragment length polymorphisms (RFLPs) and (b) the size of heterosis and epistatic effects, and the second, to evaluate the usefulness of RFLP-based genetic distance measures in predicting heterosis and performance of single-cross hybrids. Five generations (parents, F1; F2, and backcrosses) from the 15 crosses in each diallel were evaluated for grain yield and yield components in four Iowa environments. Genetic effects were estimated from generation means by ordinary diallel analyses and by the Eberhart-Gardner model. Newer lines showed significantly greater yield for inbred generations than did older lines but smaller heterosis estimates. In most cases, estimates of additive x additive epistatic effects for yield and yield components were significantly positive for both groups of lines. RFLP analyses of inbred lines included two restriction enzymes and 82 genomic DNA clones distributed over the maize genome. Eighty-one clones revealed polymorphisms with at least one enzyme. In each set, about three different RFLP variants were typically found per RFLP locus. Genetic distances between inbred lines were estimated from RFLP data as Rogers' distance (RD), which was subdivided into general (GRD) and specific (SRD) Rogers' distances within each diallel. The mean and range of RDs were similar for the older and newer lines, suggesting that the level of heterozygosity at the molecular level had not changed. GRD explained about 50% of the variation among RD values in both sets. Cluster

  8. Haplotyping the human T-cell receptor β-chain gene complex by use of restriction fragment length polymorphisms

    International Nuclear Information System (INIS)

    Charmley, P.; Chao, A.; Gatti, R.A.; Concannon, P.; Hood, L.

    1990-01-01

    The authors have studied the genetic segregation of human T-cell receptor β-chain (TCRβ) genes on chromosome 7q in 40 CEPH (Centre d'Etude du Polymorphisme Humain) families by using restriction fragment length polymorphisms (RFLPs). They constructed haplotypes from eight RFLPs by using variable- and constant-region cDNA probes, which detect polymorphisms that span more than 600 kilobases of the TCRβ gene complex. Analysis of allele distributions between TCRβ genes revealed significant linkage disequilibrium between only 6 of the 28 different pairs of RFLPs. This linkage disequilibrium strongly influences the most efficient order to proceed for typing of these RFLPs in order to achieve maximum genetic informativeness, which in this study revealed a 97.3% level of heterozygosity within the TCRβ gene complex. The results should provide new insight into recent reports of disease associations with the TCRβ gene complex and should assist in designing future experiments to detect or confirm the existence of disease-susceptibility loci in this region of the human genome

  9. Non-Crystallographic Layer Lattice Restrictions in Order-Disorder (OD Structures

    Directory of Open Access Journals (Sweden)

    Berthold Stöger

    2014-07-01

    Full Text Available Symmetry operations of layers periodic in two dimensions restrict the geometry the lattice according to the five two-dimensional Bravais types of lattices. In order-disorder (OD structures, the operations relating equivalent layers generally leave invariant only a sublattice of the layers. The thus resulting restrictions can be expressed in terms of linear relations of the a2, b2 and a · b scalar products of the lattice basis vectors with rational coefficients. To characterize OD families and to check their validity, these lattice restrictions are expressed in the bases of different layers and combined. For a more familiar notation, they can be expressed in terms of the lattice parameters a, b and . Alternatively, the description of the lattice restrictions may be simplified by using centered lattices. The representation of the lattice restrictions in terms of scalar products is dependent on the chosen basis. A basis-independent classification of the lattice restrictions is outlined.

  10. Genotypic lineages and restriction fragment length polymorphism of canine distemper virus isolates in Thailand.

    Science.gov (United States)

    Radtanakatikanon, Araya; Keawcharoen, Juthatip; Charoenvisal, Na Taya; Poovorawan, Yong; Prompetchara, Eakachai; Yamaguchi, Ryoji; Techangamsuwan, Somporn

    2013-09-27

    Canine distemper virus (CDV) is known to cause multisystemic disease in all families of terrestrial carnivores. Attenuated live vaccines have been used to control CDV in a variety of species for many decades, yet a number of CDV infections in vaccinated dogs are still observed. The aims of this study were to investigate the genetic diversity of CDV lineages based on phosphoprotein (P), hemagglutinin (H) and fusion protein (F) genes and to develop the restriction fragment length polymorphism (RFLP) technique for effective differentiation among individual wild-type and vaccine lineages in Thailand. Four commercial vaccine products, thirteen conjunctival swabs and various tissues from 9 necropsied dogs suspected of having CDV infections were included. Virus isolation was performed using Vero cell expressing canine signaling lymphocyte activation molecules (Vero-DST cells). Reverse-transcription polymerase chain reaction (RT-PCR) on 3 gene regions from the dog derived specimens and the vaccines were carried out, then RFLP analysis upon F-gene amplified fragments was developed. Nucleotide sequence and phylogenetic analysis were compared with other CDV lineages in Genbank. Phylogenetic relationships revealed that CDV field isolates were separated from the vaccine lineage and could be divided into two clusters; one of which belonged to the Asia-1 lineage and another, not related to any previous recognized lineages was proposed as 'Asia-4'. RFLP patterns demonstrating concordance with phylogenetic trees of the distemper virus allowed for differentiation between the Asia-1, Asia-4 and vaccine lineages. Thus, RFLP technique is able to effectively distinguish individual wild-type canine distemper virus from vaccine lineages in Thailand. Copyright © 2013 Elsevier B.V. All rights reserved.

  11. Discrimination among individuals using terminal restriction fragment length polymorphism profiling of bacteria derived from forensic evidence.

    Science.gov (United States)

    Nishi, Eiji; Tashiro, Yukihiro; Sakai, Kenji

    2015-05-01

    DNA typing from forensic evidence is commonly used to identify individuals. However, when the quantity of the forensic evidence is insufficient, successful identification using DNA typing is impossible. Such evidence may also contain DNA from bacteria that occur naturally on the skin. In this study, we aimed to establish a profiling method using terminal restriction fragment length polymorphisms (T-RFLPs) of the amplified bacterial 16S ribosomal RNA (rRNA) gene. First, the extraction and digestion processes were investigated, and the T-RFLP profiling method using the 16S rRNA gene amplicon was optimized. We then used this method to compare the profiles of bacterial flora from the hands of 12 different individuals. We found that the T-RFLP profiles from one person on different days displayed higher similarity than those between individuals. In a principal component analysis (PCA), T-RFLPs from each individual were closely clustered in 11 out of 12 cases. The clusters could be distinguished from each other, even when the samples were collected from different conditions. No major change of the profile was observed after six months except in two cases. When handprints on glass plates were compared, 11 of 12 individuals were assigned to a few clusters including the cluster corresponding to the correct individual. In conclusion, a method for reproducible T-RFLP profiling of bacteria from trace amounts of handprints was established. The profiles were obtained for particular individuals clustered in PCA and were experimentally separable from other individuals in most cases. This technique could provide useful information for narrowing down a suspect in a criminal investigation.

  12. Rapid detection of dihydropteroate polymorphism in AIDS-related Pneumocystis carinii pneumonia by restriction fragment length polymorphism

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Eugen-Olsen, J; Lundgren, B

    2000-01-01

    are associated with failure of sulpha prophylaxis and increased mortality in HIV-1 positive patients with PCP, suggesting that DHPS mutations may cause sulpha resistance. To facilitate detection of DHPS mutations we developed a restriction fragment length polymorphism (RFLP) assay, detecting mutations at codon...

  13. Mapped DNA probes from Ioblolly pine can be used for restriction fragment length polymorphism mapping in other conifers

    Science.gov (United States)

    M.R. Ahuja; M.E. Devey; A.T. Groover; K.D. Jermstad; D.B Neale

    1994-01-01

    A high-density genetic map based on restriction fragment length polymorphisms (RFLPs) is being constructed for loblolly pine (Pinus taeda L.). Consequently, a large number of DNA probes from loblolly pine are potentially available for use in other species. We have used some of these DNA probes to detect RFLPs in 12 conifers and an angiosperm....

  14. Analysis of mutation/rearrangement frequencies and methylation patterns at a given DNA locus using restriction fragment length polymorphism.

    Science.gov (United States)

    Boyko, Alex; Kovalchuk, Igor

    2010-01-01

    Restriction fragment length polymorphism (RFLP) is a difference in DNA sequences of organisms belonging to the same species. RFLPs are typically detected as DNA fragments of different lengths after digestion with various restriction endonucleases. The comparison of RFLPs allows investigators to analyze the frequency of occurrence of mutations, such as point mutations, deletions, insertions, and gross chromosomal rearrangements, in the progeny of stressed plants. The assay involves restriction enzyme digestion of DNA followed by hybridization of digested DNA using a radioactively or enzymatically labeled probe. Since DNA can be digested with methylation sensitive enzymes, the assay can also be used to analyze a methylation pattern of a particular locus. Here, we describe RFLP analysis using methylation-insensitive and methylation-sensitive enzymes.

  15. Restriction fragment length polymorphism pattern of Mycobacterium isolates from rodents in infected cattle farms.

    Science.gov (United States)

    Alizadeh, Khatereh; Mosavari, Nader; Nazari, Razieh

    2016-12-01

    Mycobacterium tuberculosis, the etiologic agent of tuberculosis, causes large-scale morbidity and mortality, particularly in developing countries. In recent years, there has been a significant increase in the drug-resistant ability of M. tuberculosis, triggering a major public health crisis. A detailed analysis of the evolution of the mycobacterial genome helps to better understand the genotype-phenotype relationship in this bacterium. Different strain typing methods have already revealed the worldwide diversity of mycobacterial isolates. Therefore, DNA-fingerprinting tools have been developed to improve tuberculosis case detection and control. Molecular typing techniques allow to detect and follow the spread of individual strains of the M. tuberculosis complex (MTC), complementing conventional epidemiological methods. Among these techniques, restriction fragment length polymorphism (RFLP) has been considered the standard method for genotyping of MTC. The aim of this work was to isolate M. tuberculosis from rodents in cattle farms contaminated with MTC located in the city of Booin-Zahra, Iran. A total of 100 samples were collected from the rodents in the contaminated farms and analyzed for the presence of Mycobacterium by growing the samples on Lowenstein-Jensen medium. All isolates were further identified by RFLP and DNA hybridization studies. As much as five samples showed the presence of Mycobacterium and these were subjected to PCR-16SrRNA, PCR-IS6110, and RD Typing (RD1, RD4, RD9, and RD12) methods. Further differentiation was performed with PvuII digestion (RFLP) and DNA hybridization using the polymorphic guanine/cytosine-rich repetitive sequences (PGRS) probe. The PGRS probe results classified two of the isolates as belonging to one cluster, whereas the remaining isolates were classified as belonging to different clusters. An analysis of the obtained genetic pattern and a comparison of these patterns with the genetic pattern of other infected farms allowed

  16. Comparison between length and velocity gauges in quantum simulations of high-order harmonic generation

    DEFF Research Database (Denmark)

    Han, Yong-Chang; Madsen, Lars Bojer

    2010-01-01

    , and acceleration forms, and two gauges, the length and velocity gauges. The relationships among the harmonic phases obtained from the Fourier transform of the three forms are discussed in detail. Although quantum mechanics is gauge invariant and the length and velocity gauges should give identical results, the two...... gauges present different computation efficiencies, which reflects the different behavior in terms of characteristics of the physical couplings acting in the two gauges. In order to obtain convergence, more angular momentum states are required in the length gauge, while more grid points are required...

  17. Detection of Coxiella burnetii in ticks by PCR and by PCR - Restriction Fragment Length Polymorphism (RFLP)

    International Nuclear Information System (INIS)

    2010-01-01

    Coxiella burnetii, as an obligata intracellular bacterium, is the etiologic agent of Q-fever. It is widely distributed in nature and is responsible for infection in various animals (cattle, sheep, goat) and humans. C. burnetii has been isolated from milk, ticks and human patients with acute and chronic Q fever. Ticks are the principal vectors and reservoirs of C. burnetii. Since over 40 species of ticks have been found to be infected with C. burnetii, ticks can serve as indicators of infection in nature. In this study, total of 2472 ticks (1446 female, 1021 male and 5 nymphs) were collected from 38 provinces of Turkey. The ticks were gathered into groups of 1 to 7 ticks as to the provinces, species and gender for DNA extraction. Following DNA extraction, the groups were examined for the presence of C. burtii by using the CB1and CB2. The ticks collected from the province of Denizli (56 in total) were gathered into 13 groups according to the species and gender. From these groups, 6 were positive for C. burnetii. The ticks collected from Ankara province, total of 160 ticks, were grouped into 53 as to their species and gender, only one group was found to be positive for C. burnetii. The specificities of PCR products were evaluated by restriction analysis. The positive PCR products were digested with the enzyme Taq1 and for bands in order of 118, 57, 43 and 39 bp's were appeared such as seen in the positive control DNA (C. burnetii Nine Mile RSA493)

  18. Autoscreening of restriction endonucleases for PCR-restriction fragment length polymorphism identification of fungal species, with Pleurotus spp. as an example.

    Science.gov (United States)

    Yang, Zhi-Hui; Huang, Ji-Xiang; Yao, Yi-Jian

    2007-12-01

    A molecular method based on PCR-restriction fragment length polymorphism (RFLP) analysis of internal transcribed spacer (ITS) ribosomal DNA sequences was designed to rapidly identify fungal species, with members of the genus Pleurotus as an example. Based on the results of phylogenetic analysis of ITS sequences from Pleurotus, a PCR-RFLP endonuclease autoscreening (PRE Auto) program was developed to screen restriction endonucleases for discriminating multiple sequences from different species. The PRE Auto program analyzes the endonuclease recognition sites and calculates the sizes of the fragments in the sequences that are imported into the program in groups according to species recognition. Every restriction endonuclease is scored through the calculation of the average coefficient for the sequence groups and the average coefficient for the sequences within a group, and then virtual electrophoresis maps for the selected restriction enzymes, based on the results of the scoring system, are displayed for the rapid determination of the candidate endonucleases. A total of 85 haplotypes representing 151 ITS sequences were used for the analysis, and 2,992 restriction endonucleases were screened to find the candidates for the identification of species. This method was verified by an experiment with 28 samples representing 12 species of Pleurotus. The results of the digestion by the restriction enzymes showed the same patterns of DNA fragments anticipated by the PRE Auto program, apart from those for four misidentified samples. ITS sequences from 14 samples (of which nine sequences were obtained in this study), including four originally misidentified samples, confirmed the species identities revealed by the PCR-RFLP analysis. The method developed here can be used for the identification of species of other living microorganisms.

  19. Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism (T-RFLP) analysis

    Science.gov (United States)

    Grant T. Kirker; M. Lynn Prewitt; Walter J. Diehl; Susan V. Diehl

    2012-01-01

    The effects of wood preservatives on the bacterial community in southern yellow pine were assessed by the molecular method ‘terminal restriction fragment length polymorphism’ (T-RFLP). Stakes, treated with 0.25 % and 0.37 % ammoniacal copper quat (ACQ-C), 0.1 % and 0.25 % chlorothalonil (CTN), 0.1 % and 0.25 % CTN with 2 % butylated hydroxytoluene (BHT), and 2 % BHT...

  20. Species determination within Staphylococcus genus by extended PCR-restriction fragment length polymorphism of saoC gene.

    Science.gov (United States)

    Bukowski, Michal; Polakowska, Klaudia; Ilczyszyn, Weronika M; Sitarska, Agnieszka; Nytko, Kinga; Kosecka, Maja; Miedzobrodzki, Jacek; Dubin, Adam; Wladyka, Benedykt

    2015-01-01

    Genetic methods based on PCR-restriction fragment length polymorphism (RFLP) are widely used for microbial species determination. In this study, we present the application of saoC gene as an effective tool for species determination and within-species diversity analysis for Staphylococcus genus. The unique sequence diversity of saoC allows us to apply four restriction enzymes to obtain RFLP patterns, which appear highly distinctive even among closely related species as well as atypical isolates of environmental origin. Such patterns were successfully obtained for 26 species belonging to Staphylococcus genus. What is more, tracing polymorphisms detected by different restriction enzymes allowed for basic phylogeny analysis for Staphylococcus aureus, which is potentially applicable for other staphylococcal species. © FEMS 2014. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  1. Using Terminal Restriction Fragment Length Polymorphism (T-RFLP) Analysis to Assess Microbial Community Structure in Compost Systems

    Science.gov (United States)

    Tiquia, Sonia M.

    Terminal restriction fragment length polymorphism (T-RFLP) analysis of PCR-amplified genes is a widely used fingerprinting technique in composting systems. This analysis is based on the restriction endonuclease digestion of fluorescently end-labeled PCR products. The digested product is mixed with a DNA size standard, itself labeled with a distinct fluorescent dye, and the fragments are then separated by capillary or gel electrophoresis using an automated sequencer. Upon analysis, only the terminal end-labeled restriction fragments are detected. An electropherogram is produced, which shows a profile of compost microbial community as a series of peaks of varying height. This technique has also been effectively used in the exploration of complex microbial environments and in the study of bacterial, archaeal, and eukaryal populations in natural habitats.

  2. Restriction fragment length polymorphism (RFLP) of two HLA-B-associated transcripts (BATs) genes in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1990-01-01

    The restriction fragment length polymorphism (RFLP) of the two human HLA-B-associated transcripts (BATs) genes, BAT1 and BAT2, was investigated using 5 different restriction enzymes and two human BAT1 and BAT2 cDNA probes. Two of the enzymes, NcoI and RsaI, revealed polymorphic patterns which were...... investigated in healthy Danes. The cDNA/restriction enzyme combination BAT1/NcoI identifies polymorphic bands at 12 kb, 8 kb, 2.5 kb, and 1.1 kb, while the BAT2/RsaI combination identifies polymorphic bands at 3.3 kb, 2.7 kb, 2.3 kb, and 0.9 kb. The frequencies of these markers were determined in 90 unrelated...

  3. Identification of Panulirus homarus puerulus larvae by restriction fragment length polymorphism of mitochondrial cytochrome oxidase I gene.

    Science.gov (United States)

    Dharani, G; Maitrayee, G A; Karthikayalu, S; Kumar, T S; Anbarasu, M; Vijayakumaran, M

    2009-02-01

    Molecular identification of puerulus larvae of Panulirus homarus of the genus Panulirus from Indian coast was studied by employing Polymerase Chain Reaction, Restriction Fragment Length Polymorphism (PCR-RFLP) analysis of the mitochondrial DNA (mtDNA) Cytochrome Oxidase Gene (COI) by agarose gel electrophoresis and Denaturing Gradient Gel Electrophoresis (DGGE). The size of amplified fragment of COI gene was estimated to be approximately 1300 base pairs (bp). Single fragment amplification was recorded during different stages of the life cycle. The RFLP digestion was carried out using five different restriction enzymes (BsplI, HhaI, RsaI, TaqI and AluI). The RFLP profile of the different endonucleases, varied between 1-5 restriction types. RFLP analysis using endonuclease TaqI enabled identification of P. homarus during different stages of its life history.

  4. Use of primer selection and restriction enzymes to assess bacterial community diversity in an agricultural soil used for potato production via terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Fortuna, Ann-Marie; Marsh, Terence L; Honeycutt, C Wayne; Halteman, William A

    2011-08-01

    Terminal restriction fragment length polymorphism (T-RFLP) can be used to assess how land use management changes the dominant members of bacterial communities. We compared T-RFLP profiles obtained via amplification with forward primers (27, 63F) each coupled with the fluorescently labeled reverse primer (1392R) and multiple restriction enzymes to determine the best combination for interrogating soil bacterial populations in an agricultural soil used for potato production. Both primer pairs provide nearly universal recognition of a 1,400-bp sequence of the bacterial domain in the V(1)-V(3) region of the 16S ribosomal RNA (rRNA) gene relative to known sequences. Labeling the reverse primer allowed for direct comparison of each forward primer and the terminal restriction fragments' relative migration units obtained with each primer pair and restriction enzyme. Redundancy analysis (RDA) and nested multivariate analysis of variance (MANOVA) were used to assess the effects of primer pair and choice of restriction enzyme on the measured relative migration units. Our research indicates that the 63F-1392R amplimer pair provides a more complete description with respect to the bacterial communities present in this potato (Solanum tuberosum L.)-barley (Hordeum vulgare L.) rotation over seeded to crimson clover (Trifolium praense L.). Domain-specific 16S rRNA gene primers are rigorously tested to determine their ability to amplify across a target region of the gene. Yet, variability within or between T-RFLP profiles can result from factors independent of the primer pair. Therefore, researchers should use RDA and MANOVA analyses to evaluate the effects that additional laboratory and environmental variables have on bacterial diversity.

  5. 15 CFR 744.15 - Restrictions on exports and reexports involving persons named in General Orders.

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Restrictions on exports and reexports involving persons named in General Orders. 744.15 Section 744.15 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) BUREAU OF INDUSTRY AND SECURITY, DEPARTMENT OF COMMERCE...

  6. Restriction fragment length polymorphism in calpain (CAPN2 gene in crossbred cattle

    Directory of Open Access Journals (Sweden)

    Maria Aparecida Cassiano Lara

    2012-12-01

    Full Text Available With advances in molecular genetics have been possible to predict the genetic value of the animal, in particular its potential to transmit desired characters to their offspring, including characters difficult to evaluate or with low heritability, as is the case of the meat tenderization. It is known that Bos taurus indicus features differences in meat tenderization, being assigned this variability to their lowest proteolysis post-mortem, as result of high activity of calpastatin. This inhibitor decreases the activity of calpain, which are the enzymes responsible for the degradation of muscle fibers during the maturation of the meat. Moreover, there were previously observed differences in the frequencies of allele A of calpain among European breeds (Hereford, Aberdeen Angus and Holstein and Bos taurus indicus (Gir, Guzerá and Nelore. This variability has been related to tenderness of meat, as cattle with Bos taurus taurus origin have more tender meat than Bos taurus indicus, showing small values of shear force. One explanation is that the Capn2A product could confer greater proteolytic activity than the encoded by the allele Capn2B. If allele A is associated with tender meat, it will be possible the early identification of the animals that have the potential to produce meat with qualities that attend the needs of the consumer market, in order to add economic value to the final product of the animal production chain. For this reason, biochemical and genetic studies related to calpain and calpastatin systems have been considered promising for the clarification of the physiological changes that occur in muscle structure during the period post-mortem, whose results have contributed to the improvement of meat quality. The objectives of this study were to investigate the RFLP in calpain (Capn2 gene and its relation with meat tenderization in 252 crossbred (Bos taurus taurus x Bos taurus indicus. The analyses were carried through by PCR-RFLP technique

  7. Phylogenetic analysis of Gossypium L. using restriction fragment length polymorphism of repeated sequences.

    Science.gov (United States)

    Zhang, Meiping; Rong, Ying; Lee, Mi-Kyung; Zhang, Yang; Stelly, David M; Zhang, Hong-Bin

    2015-10-01

    Cotton is the world's leading textile fiber crop and is also grown as a bioenergy and food crop. Knowledge of the phylogeny of closely related species and the genome origin and evolution of polyploid species is significant for advanced genomics research and breeding. We have reconstructed the phylogeny of the cotton genus, Gossypium L., and deciphered the genome origin and evolution of its five polyploid species by restriction fragment analysis of repeated sequences. Nuclear DNA of 84 accessions representing 35 species and all eight genomes of the genus were analyzed. The phylogenetic tree of the genus was reconstructed using the parsimony method on 1033 polymorphic repeated sequence restriction fragments. The genome origin of its polyploids was determined by calculating the diploid-polyploid restriction fragment correspondence (RFC). The tree is consistent with the morphological classification, genome designation and geographic distribution of the species at subgenus, section and subsection levels. Gossypium lobatum (D7) was unambiguously shown to have the highest RFC with the D-subgenomes of all five polyploids of the genus, while the common ancestor of Gossypium herbaceum (A1) and Gossypium arboreum (A2) likely contributed to the A-subgenomes of the polyploids. These results provide a comprehensive phylogenetic tree of the cotton genus and new insights into the genome origin and evolution of its polyploid species. The results also further demonstrate a simple, rapid and inexpensive method suitable for phylogenetic analysis of closely related species, especially congeneric species, and the inference of genome origin of polyploids that constitute over 70 % of flowering plants.

  8. Restriction fragment length polymorphisms of mitochondrial DNA among five freshwater fish species of the genus Astyanax (Pisces, Characidae

    Directory of Open Access Journals (Sweden)

    Cinthia Bachir Moysés

    2002-01-01

    Full Text Available Restriction fragment length polymorphism (RFLP analysis of mitochondrial DNA (mtDNA was employed to characterize species and populations of Astyanax, a Neotropical freshwater fish genus. Samples of five species, A. altiparanae, A. fasciatus, A. lacustris, A. scabripinnis paranae and A. schubarti, from the Upper Paraná and São Francisco river basins were analyzed. Two out of the ten restriction enzymes employed generated species-specific mtDNA patterns for each of the five species. MtDNA exhibited considerable polymorphism within and among populations. All populations sampled showed relatively high values of haplotype diversity. Geographically localized haplotypes were detected for A. altiparanae and A. fasciatus from the Upper Paraná and São Francisco basins. The relationships between populations are discussed.

  9. A new assay based on terminal restriction fragment length polymorphism of homocitrate synthase gene fragments for Candida species identification.

    Science.gov (United States)

    Szemiako, Kasjan; Śledzińska, Anna; Krawczyk, Beata

    2017-08-01

    Candida sp. have been responsible for an increasing number of infections, especially in patients with immunodeficiency. Species-specific differentiation of Candida sp. is difficult in routine diagnosis. This identification can have a highly significant association in therapy and prophylaxis. This work has shown a new application of the terminal restriction fragment length polymorphism (t-RFLP) method in the molecular identification of six species of Candida, which are the most common causes of fungal infections. Specific for fungi homocitrate synthase gene was chosen as a molecular target for amplification. The use of three restriction enzymes, DraI, RsaI, and BglII, for amplicon digestion can generate species-specific fluorescence labeled DNA fragment profiles, which can be used to determine the diagnostic algorithm. The designed method can be a cost-efficient high-throughput molecular technique for the identification of six clinically important Candida species.

  10. Comparative Study of IS6110 Restriction Fragment Length Polymorphism and Variable-Number Tandem-Repeat Typing of Mycobacterium tuberculosis Isolates in the Netherlands, Based on a 5-Year Nationwide Survey

    NARCIS (Netherlands)

    Beer, J.L. de; Ingen, J. van; Vries, G. de; Erkens, C.; Sebek, M.; Mulder, A.; Sloot, R.; Brandt, A.M. van den; Enaimi, M.; Kremer, K.; Supply, P.; Soolingen, D. van

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

  11. Comparative study of IS6110 restriction fragment length polymorphism and variable-number tandem-repeat typing of Mycobacterium tuberculosis isolates in the Netherlands, based on a 5-year nationwide survey

    NARCIS (Netherlands)

    de Beer, Jessica L.; van Ingen, Jakko; de Vries, Gerard; Erkens, Connie; Sebek, Maruschka; Mulder, Arnout; Sloot, Rosa; van den Brandt, Anne-Marie; Enaimi, Mimount; Kremer, Kristin; Supply, Philip; van Soolingen, Dick

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a

  12. PCR-restriction fragment length polymorphism analysis of indigenous nitrogen-fixing micro organisms lineages

    International Nuclear Information System (INIS)

    Liew Woan Ying Pauline; Jong Bor Chyan; Khairuddin Abdul Rahim

    2006-01-01

    The use of PCR-RFLP analysis as a useful microbial identification tool has been evaluated for years. This approach was verified effective worldwide, where differential DNA bands and sequence markers distinctive to specific microbes or microbial groups have been identified. In our study, PCR-RFLP technique has been adopted in the identification of our indigenous N 2 -fixing isolates obtained from several local environments. RFLP was carried out with suitable restriction enzymes and the patterns were documented. Representatives of the different patterns were selected and analysed with the 16S ribosomal DNA sequencing method. The results demonstrated correlation between the differential RFLP patterns and the 16S rDNA identities. (Author)

  13. Pst I restriction fragment length polymorphism of the human placental alkaline phosphatase gene in normal placentae and tumors

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Kam, W.; Sussman, H.H.

    1987-01-01

    The structure of the human placental alkaline phosphatase gene from normal term placentae was studied by restriction enzyme digestion and Southern blot analysis using a cDNA probe to the gene for the placental enzyme. The DNA digests fall into three distinct patterns based on the presence and intensity of an extra 1.1-kilobase Pst I Band. The extra 1.1-kilobase band is present in 9 of 27 placenta samples, and in 1 of these samples the extra band is present at double intensity. No polymorphism was revealed by digestion with restriction enzymes EcoRI, Sma I, BamHI, or Sac I. The extra Pst I-digestion site may lie in a noncoding region of the gene because no correlation was observed between the restriction fragment length polymorphism and the common placental alkaline phosphatase alleles identified by starch gel electrophoresis. In addition, because placental alkaline phosphatase is frequently re-expressed in neoplasms, the authors examined tissue from ovarian, testicular, and endometrial tumors and from BeWo choriocarcinoma cells in culture. The Pst I-DNA digestion patterns from these cells and tissues were identical to those seen in the normal ovary and term placentae. The consistent reproducible digestion patterns seen in DNA from normal and tumor tissue indicate that a major gene rearrangement is not the basis for the ectopic expression of placental alkaline phosphatase in neoplasia

  14. Restriction fragment length polymorphism (RFLP) analysis of PCR products amplified from 18S ribosomal RNA gene of Trypanosoma congolense

    International Nuclear Information System (INIS)

    Osanyo, A.; Majiwa, P.W.

    2006-01-01

    Oligonucleotide primers were designed from the conserved nucleotide sequences of 18S ribosomal RNA (18S rRNA) gene of protozoans: Trypanosoma brucei, Leishmania donovani, Triponema aequale and Lagenidium gigantum. The primers were used in polymerace chain reaction (PCR) to generate PCR products of approximately 1 Kb using genomic DNA from T. brucei and the four genotypic groups of T. congolense as template. The five PCR products so produced were digested with several restriction enzymes and hybridized to a DNA probe made from T. brucei PCR product of the same 18S rRNA gene region. Most restriction enzyme digests revealed polymorphism with respect to the location of their recognition sites on the five PCR products. The restriction fragment length polymorphism (RFLP) pattern observed indicate that the 18S rRNA gene sequences of trypanosomes: T. brucei and the four genotypes of T.congolence group are heterogeneous. The results further demonstrate that the region that was amplified can be used in specific identification of trypanosomes species and subspecies.(author)

  15. Characterization of European Yersinia enterocolitica 1A strains using restriction fragment length polymorphism and multilocus sequence analysis.

    Science.gov (United States)

    Murros, A; Säde, E; Johansson, P; Korkeala, H; Fredriksson-Ahomaa, M; Björkroth, J

    2016-10-01

    Yersinia enterocolitica is currently divided into two subspecies: subsp. enterocolitica including highly pathogenic strains of biotype 1B and subsp. palearctica including nonpathogenic strains of biotype 1A and moderately pathogenic strains of biotypes 2-5. In this work, we characterized 162 Y. enterocolitica strains of biotype 1A and 50 strains of biotypes 2-4 isolated from human, animal and food samples by restriction fragment length polymorphism using the HindIII restriction enzyme. Phylogenetic relatedness of 20 representative Y. enterocolitica strains including 15 biotype 1A strains was further studied by the multilocus sequence analysis of four housekeeping genes (glnA, gyrB, recA and HSP60). In all the analyses, biotype 1A strains formed a separate genomic group, which differed from Y. enterocolitica subsp. enterocolitica and from the strains of biotypes 2-4 of Y. enterocolitica subsp. palearctica. Based on these results, biotype 1A strains considered nonpathogenic should not be included in subspecies palearctica containing pathogenic strains of biotypes 2-5. Yersinia enterocolitica strains are currently divided into six biotypes and two subspecies. Strains of biotype 1A, which are phenotypically and genotypically very heterogeneous, are classified as subspecies palearctica. In this study, European Y. enterocolitica 1A strains isolated from both human and nonhuman sources were characterized using restriction fragment length polymorphism and multilocus sequence analysis. The European biotype 1A strains formed a separate group, which differed from strains belonging to subspecies enterocolitica and palearctica. This may indicate that the current division between the two subspecies is not sufficient considering the strain diversity within Y. enterocolitica. © 2016 The Society for Applied Microbiology.

  16. Terminal restriction fragment length polymorphism analysis of ribosomal RNA genes to assess changes in fungal community structure in soils.

    Science.gov (United States)

    Edel-Hermann, Véronique; Dreumont, Christiane; Pérez-Piqueres, Ana; Steinberg, Christian

    2004-03-01

    Monitoring the structure and dynamics of fungal communities in soils under agricultural and environmental disturbances is currently a challenge. In this study, a terminal restriction fragment length polymorphism (T-RFLP) fingerprinting method was developed for the rapid comparison of fungal community structures. The terminal restriction fragment polymorphism of different regions of the small-subunit (SSU) ribosomal RNA (rRNA) gene was simulated by sequence comparison using 10 restriction enzymes, and analyzed among three different soils using fungal-specific primers. Polymerase chain reaction amplification of the 3' end of the SSU rRNA gene with the primer nu-SSU-0817-5' and with the fluorescently labelled primer nu-SSU-1536-3', and digestion of the amplicons with AluI and MboI were found to be optimal and were used in a standardized T-RFLP procedure. Both the number and the intensity of terminal restriction fragments detected by capillary gel electrophoresis were integrated in correspondence analyses. Three soils with contrasting physicochemical properties were differentiated according to the structure of their fungal communities. Assessment of the impact on the fungal community structure of the amendment of two soils with compost or manure confirmed the reproducibility and the sensitivity of the method. Shifts in the community structure were detected between non-amended and amended soil samples. In both soils, the shift differed with the organic amendment applied. In addition, the fungal community structures of the two soils were affected in a different way by the same organic amendment. The fingerprinting method provides a rapid tool to investigate the effect of various perturbations on the fungal communities in soils.

  17. Topologically Ordered Feature Extraction Based on Sparse Group Restricted Boltzmann Machines

    Directory of Open Access Journals (Sweden)

    Zhong Chen

    2015-01-01

    Full Text Available How to extract topologically ordered features efficiently from high-dimensional data is an important problem of unsupervised feature learning domains for deep learning. To address this problem, we propose a new type of regularization for Restricted Boltzmann Machines (RBMs. Adding two extra terms in the log-likelihood function to penalize the group weights and topologically ordered factors, this type of regularization extracts topologically ordered features based on sparse group Restricted Boltzmann Machines (SGRBMs. Therefore, it encourages an RBM to learn a much smoother probability distribution because its formulations turn out to be a combination of the group weight-decay and topologically ordered factor regularizations. We apply this proposed regularization scheme to image datasets of natural images and Flying Apsara images in the Dunhuang Grotto Murals at four different historical periods. The experimental results demonstrate that the combination of these two extra terms in the log-likelihood function helps to extract more discriminative features with much sparser and more aggregative hidden activation probabilities.

  18. NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1989-01-01

    The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5...

  19. NcoI restriction fragment length polymorphism (RFLP) of the tumour necrosis factor (TNF alpha) region in primary biliary cirrhosis and in healthy Danes

    DEFF Research Database (Denmark)

    Fugger, L; Morling, N; Ryder, L P

    1989-01-01

    The restriction fragment length polymorphism of the human tumour necrosis factor (TNF alpha) region was investigated by means of 20 different restriction enzymes and a human TNF alpha cDNA probe. Only one of the enzymes, NcoI, revealed a polymorphic pattern consisting of fragments of 10.5 and 5.5...

  20. THE HUMAN FUMARYLACETOACETATE GENE : CHARACTERIZATION OF RESTRICTION-FRAGMENT-LENGTH-POLYMORPHISMS AND IDENTIFICATION OF HAPLOTYPES IN TYROSINEMIA TYPE-1 AND PSEUDODEFICIENCY

    NARCIS (Netherlands)

    ROOTWELT, H; KVITTINGEN, EA; HOIE, K; AGSTERIBBE, E; HARTOG, M; BERGER, R

    Deficiency of human fumarylacetoacetase (FAH) activity results in hereditary tyrosinemia type I. Using the restriction enzymes BglII, KpnI and StuI and a 1.3-kb cDNA probe for the FAH gene, we have found 6 restriction fragment length polymorphisms (RFLPs). These RFLPs were utilised in 3 tyrosinemia

  1. Differentiation of mixed lactic acid bacteria communities in beverage fermentations using targeted terminal restriction fragment length polymorphism.

    Science.gov (United States)

    Bokulich, Nicholas A; Mills, David A

    2012-08-01

    Lactic acid bacteria (LAB) are an important group of bacteria in beer and wine fermentations both as beneficial organisms and as spoilage agents. However, sensitive, rapid, culture-independent methods for identification and community analyses of LAB in mixed-culture fermentations are limited. We developed a terminal restriction fragment length polymorphism (TRFLP)-based assay for the detection and identification of lactic acid bacteria and Bacilli during wine, beer, and food fermentations. This technique can sensitively discriminate most species of Lactobacillales, and most genera of Bacillales, in mixed culture, as indicated by both bioinformatic predictions and empirical observations. This method was tested on a range of beer and wine fermentations containing mixed LAB communities, demonstrating the efficacy of this technique for discriminating LAB in mixed culture. Copyright © 2012 Elsevier Ltd. All rights reserved.

  2. [Health of adolescents restricted under court order: self-esteem, perceived parental support, projects].

    Science.gov (United States)

    Laure, P; Meyer, C

    2014-10-01

    To describe certain aspects of the physical and mental health of adolescents with restricted or deprived liberty as ordered by the court within the Youth Judicial Protection Service (YJP), and their ability to project themselves into the future. Survey by on-line self-administered questionnaires. Among the adolescents, 373 were randomly selected with restricted or deprived liberty, in the Lorraine region (eastern France). The data were managed and analyzed using the Modalisa(®) 7.0 (Kynos, Paris, France) survey processing software. Depending on the type of variable, comparisons were made using the chi-square test or analysis of variance. The significance threshold used was Pself-esteem score was 32.4±6.4, roughly the same as their peers in the general population (girls, 28.2; boys, 33.2; Pfacts had never been explored among adolescents with restricted or deprived liberty. This study shows results that do not match the usual representation of these adolescents by healthcare or education professionals. The quality of the work during the educational support given by the YJP Service could help explain these results. These findings need to be explored further by additional studies, which could also aim to measure the impact on physical and mental health of the educational support given by Youth Judicial Protection Service. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  3. Prevalence of Trichomonas spp. in domestic pigeons in Shandong Province, China, and genotyping by restriction fragment length polymorphism.

    Science.gov (United States)

    Jiang, Xiyue; Sun, Jingjing; Wang, Fangkun; Li, Hongmei; Zhao, Xiaomin

    2016-05-01

    Oropharyngeal swabs (n = 609) were collected randomly from 80,000 domestic pigeons (Columba livia domestica) on five pigeon farms and at one pigeon slaughterhouse in Shandong Province, China, from September 2012 to July 2013. Trichomonas spp. were detected in 206/609 (33.8%) samples. The prevalence was 14.9-31.1%, depending on different levels of sanitation and management, and was 4.8% in nestling pigeons, 13.6% in breeding pigeons and 35.2% in adolescent pigeons. Trichomonas gallinae genotypes A and B, and Trichomonas tenax-like isolates were identified by PCR-restriction fragment length polymorphism (RFLP) analysis and sequencing of the 5.8S rDNA-internal transcribed spacer (ITS) regions. RFLP analysis with the restriction enzyme BsiEI generated different RFLP band patterns between T. gallinae and T.tenax-like isolates. When BsiEI RFLP analysis was combined with HaeIII RFLP analysis, all infection types of T. gallinae and T.tenax-like isolates could be identified. Copyright © 2016 Elsevier Ltd. All rights reserved.

  4. Rapid differentiation of closely related isolates of two plant viruses by polymerase chain reaction and restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Barbara, D J; Morton, A; Spence, N J; Miller, A

    1995-09-01

    Immunocapture reverse transcriptase-polymerase chain reaction (RT-PCR) followed by restriction fragment length polymorphism (RFLP) analysis of the product has been shown to be an effective procedure for discriminating serologically indistinguishable isolates of two plant viruses, raspberry bushy dwarf (RBDV) and zucchini yellow mosaic (ZYMV). For both viruses, only limited sequence information was available at the time of primer design, but most of the isolates which were tested could be amplified (the one exception being a serologically quite distinct isolate of ZYMV). Restriction endonucleases revealing diagnostic RFLPs were readily identified. Each of two isolates of ZYMV could be detected in the presence of the other and the relative proportions approximately quantified by visual estimation of the relative intensity of the appropriate bands. A range of isolates of different RBDV pathotypes were compared; isolates were grouped in ways that accorded with their known history. Computer analysis of the published sequence from which the primers had been derived showed the sequenced isolate to be identical with an isolate imported from the USSR. The PCR/RFLP procedure is rapid (it can be completed in less than 2 days), effective and will probably be generally applicable to distinguishing closely related virus isolates, even where little sequence information is available.

  5. Genetic analysis of autoimmune gld mice. I. Identification of a restriction fragment length polymorphism closely linked to the gld mutation within a conserved linkage group

    Science.gov (United States)

    1988-01-01

    A linkage map of distal mouse chromosome 1 was generated using restriction fragment length polymorphism (RFLP) analysis of DNA prepared from 95 [C3H-gld/gld X Mus spretus)F1 X C3H-gld/gld] backcross mice. The gene order was: (centromere) C4bp, Ren-1,2, Ly-5, [At-3/gld], Apoa-2/Ly-17, Spna-1 (telomere). All mice expressing the phenotype of gld homozygotes were homozygous for the At-3 RFLP characteristic of C3H mice and none of the mice heterozygous for At-3 RFLPs had characteristics of gld homozygotes, demonstrating close linkage between these genes. The identification of an RFLP closely linked to the gld gene provides a starting point for the identification of a genetic defect that results in abnormal T cells and autoimmune disease. PMID:2894402

  6. Terminal Restriction Fragment Length Polymorphism for the Identification of Spirorchiid Ova in Tissues from the Green Sea Turtle, Chelonia mydas.

    Directory of Open Access Journals (Sweden)

    Phoebe A Chapman

    Full Text Available Blood flukes are among the most common disease causing pathogens infecting vertebrates, including humans and some of the world's most globally endangered fauna. Spirorchiid blood flukes are parasites of marine turtles, and are associated with pathology, strandings and mortalities worldwide. Their ova embolize in tissues and incite significant inflammatory responses, however attempts to draw correlations between species and lesions are frustrated by difficulties in identifying ova beyond the genus level. In this study, a newly developed terminal restriction fragment length polymorphism (T-RFLP method was validated as a tool for differentiating between mixed spirorchiid ova in turtle tissue. Initially, a multiplex PCR was used to differentiate between the five genera of spirorchiid flukes. Following this, PCR was performed using genus/genera-specific fluorescently tagged primer pairs and PCR products digested analysis using restriction endonucleases. Using capillary electrophoresis, this T-RFLP method could differentiate between twelve species and genotypes of spirorchiid flukes in turtles. It was applied to 151 tissue samples and successfully identified the spirorchiid species present. It was found to be more sensitive than visual diagnosis, detecting infections in 28 of 32 tissues that were negative on histology. Spirorchiids were present in 96.7% of tissues tested, with Neospirorchis genotype 2 being the most prevalent, present in 93% of samples. Mixed infections were common, being present in 60.7% of samples tested. The method described here is, to our knowledge, the first use of the T-RFLP technique on host tissues or in an animal ecology context, and describes a significant advancement in the clinical capacity to diagnose a common cause of illness in our environment. It is proven as a sensitive, specific and cost-efficient means of identifying spirorchiid flukes and ova in turtles, with the potential to contribute valuable information to

  7. Detection of disease-specific restriction fragment length polymorphisms in pemphigus vulgaris linked to the DQwl and DQw3 alleles of the HLA-D region

    International Nuclear Information System (INIS)

    Szafer, F.; Brautbar, C.; Tzfoni, E.

    1987-01-01

    Pemphigus vulgaris in Israeli Ashkenazi and non-Ashkenazi Jews and in Austrian non-Jewish patients is strongly associated with the DR4 and DRw6 alleles of the HLA-D region class II genes. Restriction fragment length polymorphism analysis was undertaken with DQβ, DQα, and DRβ cDNA probes. Hybridization with the DQβ probe identifies Pvu II, BamHI, and EcoRV fragments that absolutely discriminate pemphigus vulgaris patients from healthy DR-, DQ-, and ethnic-matched controls. In contrast the DQα and DRβ probes failed to identify disease-specific restriction fragment length polymorphism fragments. These studies indicate that DQw1 and DQw3 polymorphisms carried by pemphigus vulgaris patients may be directly involved in predisposition to the disease or may be tightly linked to the susceptibility gene itself. To our knowledge, this is the first example of an HLA restriction fragment length polymorphism that is highly associated with susceptibility to autoimmune disease

  8. IS1245 restriction fragment length polymorphism typing of Mycobacterium avium from patients admitted to a reference hospital in Campinas, Brazil

    Directory of Open Access Journals (Sweden)

    A.C. Panunto

    2003-10-01

    Full Text Available Mycobacterium avium is an important pathogen among immunodeficient patients, especially patients with AIDS. The natural history of this disease is unclear. Several environmental sources have been implicated as the origin of this infection. Polyclonal infection with this species is observed, challenging the understanding of its pathogenesis and treatment. In the present study 45 M. avium strains were recovered from 39 patients admitted to a reference hospital between 1996 and 1998. Species identification was performed using a species-specific nucleic acid hybridization test (AccuProbe® from Gen-Probe®. Strains were genotyped using IS1245 restriction fragment length polymorphism typing. Blood was the main source of the organism. In one patient with disseminated disease, M. avium could be recovered more than once from potentially sterile sites. Strains isolated from this patient had different genotypes, indicating that the infection was polyclonal. Four patient clones were characterized in this population, the largest clone being detected in eight patients. This finding points to a common-source transmission of the organism.

  9. Application of a new PCR primer for terminal restriction fragment length polymorphism analysis of the bacterial communities in plant roots.

    Science.gov (United States)

    Sakai, Masao; Matsuka, Akira; Komura, Taichi; Kanazawa, Shinjiro

    2004-10-01

    Contamination with plastid small subunit (SSU) rDNA is a major drawback when analyzing the bacterial communities of plant roots using culture-independent methods. In this study, a polymerase chain reaction (PCR) primer, 783r, was designed and tested to specifically amplify the SSU rDNA of various bacterial species without amplifying the SSU rDNA of plant plastids. To confirm how useful the community analysis of rhizobacteria is using 783r, the terminal restriction fragment length polymorphism (T-RFLP) method was performed with wheat (Triticum aestivum) and spinach (Spinacea oleracea) root samples. Using the standard T-RFLP method, a large T-RF peak of plant plastid SSU rDNA interfered with the bacterial community analysis. In contrast, the T-RFLP method using the 783r primer was able to detect the bacterial DNA while directly eliminating the influence of the plant-derived DNA extracted from the plant roots. Primer 783r might, therefore, be a useful PCR primer for the culture-independent analysis of bacterial communities in plant roots using SSU rDNA.

  10. Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism.

    Science.gov (United States)

    Bounamous, Azzedine; Lehrter, Véronique; Hadj-Henni, Leila; Delecolle, Jean-Claude; Depaquit, Jérôme

    2014-07-01

    A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b), t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA) on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

  11. Restriction fragment length polymorphism mapping of quantitative trait loci for malaria parasite susceptibility in the mosquito Aedes aegypti

    Energy Technology Data Exchange (ETDEWEB)

    Severson, D.W.; Thathy, V.; Mori, A. [Univ. of Wisconsin, Madison, WI (United States)] [and others

    1995-04-01

    Susceptibility of the mosquito Aedes aegypti to the malarial parasite Plasmodium gallinaceum was investigated as a quantitative trait using restriction fragment length polymorphisms (RFLP). Two F{sub 2} populations of mosquitoes were independently prepared from pairwise matings between a highly susceptible and a refractory strain of A. aegypti. RFLP were tested for association with oocyst development on the mosquito midgut. Two putative quantitative trait loci (QTL) were identified that significantly affect susceptibility. One QTL, pgs [2,LF98], is located on chromosome 2 and accounted for 65 and 49% of the observed phenotypic variance in the two populations, respectively. A second QTL, pgs[3,MalI], is located on chromosome 3 and accounted for 14 and 10% of the observed phenotypic variance in the two populations, respectively. Both QTL exhibit a partial dominance effect on susceptibility, wherein the dominance effect is derived from the refractory parent. No indication of epistasis between these QTL was detected. Evidence suggests that either a tightly linked cluster of independent genes or a single locus affecting susceptibility to various mosquito-borne parasites and pathogens has evolved near the LF98 locus; in addition to P. gallinaceum susceptibility, this general genome region has previously been implicated in susceptibility to the filaria nematode Brugia malayi and the yellow fever virus. 35 refs., 2 figs., 3 tabs.

  12. Limits of a rapid identification of common Mediterranean sandflies using polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Azzedine Bounamous

    2014-07-01

    Full Text Available A total of 131 phlebotomine Algerian sandflies have been processed in the present study. They belong to the species Phlebotomus bergeroti, Phlebotomus alexandri, Phlebotomus sergenti, Phlebotomus chabaudi, Phlebotomus riouxi, Phlebotomus perniciosus, Phlebotomus longicuspis, Phlebotomus perfiliewi, Phlebotomus ariasi, Phlebotomus chadlii, Sergentomyia fallax, Sergentomyia minuta, Sergentomyia antennata, Sergentomyia schwetzi, Sergentomyia clydei, Sergentomyia christophersi and Grassomyia dreyfussi. They have been characterised by sequencing of a part of the cytochrome b (cyt b, t RNA serine and NADH1 on the one hand and of the cytochrome C oxidase I of the mitochondrial DNA (mtDNA on the other hand. Our study highlights two sympatric populations within P. sergenti in the area of its type-locality and new haplotypes of P. perniciosus and P. longicuspis without recording the specimens called lcx previously found in North Africa. We tried to use a polymerase chain reaction-restriction fragment length polymorphism method based on a combined double digestion of each marker. These method is not interesting to identify sandflies all over the Mediterranean Basin.

  13. Transmission of tuberculosis in Havana, Cuba: a molecular epidemiological study by IS6110 restriction fragment length polymorphism typing

    Directory of Open Access Journals (Sweden)

    Diaz R

    2001-01-01

    Full Text Available The combination of molecular and conventional epidemiological methods has improved the knowledge about the transmission of tuberculosis in urban populations. To examine transmission of tuberculosis in Havana, Cuba, with DNA fingerprinting, we studied 51 out of 92 Mycobacterium tuberculosis strains isolated from tuberculosis patients who resided in Havana and whose infection was culture-confirmed in the period from September 1997 to March 1998. Isolates from 28 patients (55% had unique IS6110 restriction fragment length polymorphism (RFLP patterns, while isolates from 23 others (45% had identical patterns and belonged to 7 clusters. Three clusters consisting of six, five and two cases were each related to small outbreaks that occurred in a closed setting. Three other clustered cases were linked to a large outbreak that occurred in another institution. Younger patients were more correlated to clustering than older ones. The finding that 45% of the isolates had clustered RFLP patterns suggests that recent transmission is a key factor in the tuberculosis cases in Havana. The IS6110 RFLP typing made it possible to define the occurrence of outbreaks in two closed institutions.

  14. Genetic Diversity among Rhizobium leguminosarum bv. Trifolii Strains Revealed by Allozyme and Restriction Fragment Length Polymorphism Analyses

    Science.gov (United States)

    Demezas, David H.; Reardon, Terry B.; Watson, John M.; Gibson, Alan H.

    1991-01-01

    Allozyme electrophoresis and restriction fragment length polymorphism (RFLP) analyses were used to examine the genetic diversity of a collection of 18 Rhizobium leguminosarum bv. trifolii, 1 R. leguminosarum bv. viciae, and 2 R. meliloti strains. Allozyme analysis at 28 loci revealed 16 electrophoretic types. The mean genetic distance between electrophoretic types of R. leguminosarum and R. meliloti was 0.83. Within R. leguminosarum, the single strain of bv. viciae differed at an average of 0.65 from strains of bv. trifolii, while electrophoretic types of bv. trifolii differed at a range of 0.23 to 0.62. Analysis of RFLPs around two chromosomal DNA probes also delineated 16 unique RFLP patterns and yielded genetic diversity similar to that revealed by the allozyme data. Analysis of RFLPs around three Sym (symbiotic) plasmid-derived probes demonstrated that the Sym plasmids reflect genetic divergence similar to that of their bacterial hosts. The large genetic distances between many strains precluded reliable estimates of their genetic relationships. PMID:16348600

  15. Restriction fragment length polymorphism of the HLA-DP subregion and correlations to HLA-DP phenotypes

    International Nuclear Information System (INIS)

    Hyldig-Nielsen, J.J.; Morling, N.; Oedum, N.; Ryder, L.P.; Platz, P.; Jakobsen, B.; Svejgaard, A.

    1987-01-01

    The restriction fragment length polymorphism (RFLP) of the class II HLA-DP subregion of the major histocompatibility complex (MHC) of humans has been unraveled by Southern blotting using DP/sub α/ and DP/sub β/ probes in a study of 46 unrelated individuals with known HLA-DP types. Contrary to earlier preliminary findings with a limited number of enzymes, the RFLP appears to be quite extensive both with the DP/sub β/ (14 different DNA markers defined by individual fragments or clusters thereof) and the DP/sub α/ (8 markers) probes, especially when enzyme recognizing only four base pairs were used. A few markers were absolutely or strongly associated with individual DP antigens, whereas most were associated with two or more DP antigens as defined by primed lymphocyte typing. Thus, Southern blotting seems feasible for typing for most DP determinants by specific fragments or subtraction between the various more broadly reactive DNA markers, and the RFLP provides further information on the DP subregion in addition to that provided by primed lymphocyte typing. In two recombinant families, the DP/sub β/ and DP/sub α/ DNA markers segregated with DP antigens, whereas the DR/sub β/, DQ/sub β/, DQ/sub α/, and DX/sub α/ markers followed the DR and DQ antigens

  16. Identification of Echinococcus granulosus strains using polymerase chain reaction-restriction fragment length polymorphism amongst livestock in Moroto district, Uganda.

    Science.gov (United States)

    Chamai, Martin; Omadang, Leonard; Erume, Joseph; Ocaido, Michael; Oba, Peter; Othieno, Emmanuel; Bonaventure, Straton; Kitibwa, Annah

    2016-07-29

    A descriptive study was conducted to identify the different strains of Echinococcus granulosus occurring in livestock in Moroto district, Uganda. Echinococcus cysts from 104 domestic animals, including cattle, sheep, goats and camels, were taken and examined by microscopy, polymerase chain reaction with restriction fragment length polymorphism and Sanger DNA sequencing. Echinococcus granulosus genotypes or strains were identified through use of Bioinformatics tools: BioEdit, BLAST and MEGA6. The major finding of this study was the existence of a limited number of E. granulosus genotypes from cattle, goats, sheep and camels. The most predominant genotype was G1 (96.05%), corresponding to the common sheep strain. To a limited extent (3.95%), the study revealed the existence of Echinococcus canadensis G6/7 in three (n = 3) of the E. granulosus-positive samples. No other strains of E. granulosus were identified. It was concluded that the common sheep strain of Echinococcus sensu stricto and G6/7 of E. canadensis were responsible for echinococcal disease in Moroto district, Uganda.

  17. Characterization of Bois noir isolates by restriction fragment length polymorphism of a Stolbur-specific putative membrane protein gene.

    Science.gov (United States)

    Pacifico, D; Alma, A; Bagnoli, B; Foissac, X; Pasquini, G; Tessitori, M; Marzachì, C

    2009-06-01

    Bois noir phytoplasma (BNp), widespread in wine-producing areas of Europe and endemic in France and Italy, is classified in the 16SrXII-A subgroup, whose members are referred to as Stolbur phytoplasmas. The 16S rDNA gene of Stolbur phytoplasma shows low variability, and few non-ribosomal genes are available as markers to assess variation among isolates. We used the Stolbur-specific stol-1H10 gene, encoding a putative membrane-exposed protein, to investigate genetic diversity of French and Italian BNp isolates from plants and insects. Amplification of stol-1H10 from infected grapevines, weeds, and Hyalesthes obsoletus produced fragments of three sizes, and restriction fragment length polymorphism analysis divided these amplicons further into 12 profiles (V1 to V12). French BNp isolates were more variable than Italian ones, and different profiles were present in infected grapevines from France and Italy. Isolate V3, most abundant among Italian affected grapes but present among French ones, was found in one Urtica dioica sample and in all H. obsoletus collected on this species. Four Italian-specific profiles were represented among infected Convolvulus arvensis, the most frequent of which (V12) was also detected in H. obsoletus collected on this species. Most of the variability in the stol-1H10 sequence was associated with type II on the tuf gene.

  18. Computerised Provider Order Entry Adoption Rates Favourably Impact Length of Stay

    Directory of Open Access Journals (Sweden)

    Richard Schreiber

    2016-04-01

    Full Text Available Background Research regarding return on investment for electronic health records (EHRs is sparse. Objective To extend previously established research and examine rigorously whether increasing the adoption of computer-based provider/prescriber order entry (CPOE leads to a decrease in length of stay (LOS, and to demonstrate that the two are inversely and bidirectionally proportional even while other efforts to decrease LOS are in place. Method The study assessed CPOE, LOS and case mix index (CMI data in a community hospital in the United States, using a mature and nearly fully deployed vendor product EHR. CPOE rates and LOS over 7 years were determined on a per-patient, per-visit and per-discipline basis and compared with concomitant CMI data. Results An inverse relationship of CPOE to LOS was correlated for 13 disciplines out of 19, and organisation wide for all disciplines combined during the first 5 years of study. During the subsequent 2 years, both CPOE and LOS plateaued, except in eight disciplines where CPOE rates at first declined and LOS concurrently rose slightly, and then returned to the baseline plateau levels. CMI increased during the entire period of evaluation. An inflection point at approximately 60% CPOE adoption predicted the greatest improvement in lowering of LOS. Conclusions Rising and falling rates of CPOE correlated with reductions and rises in LOS, respectively. CPOE appeared statistically to be an independent factor in affecting LOS, over and above other efforts to shorten LOS, thus contributing to lower costs and improved efficiency outcomes as measured by LOS, even as CMI rises.

  19. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP for rapid diagnosis of neonatal sepsis

    Directory of Open Access Journals (Sweden)

    Anusha Rohit

    2016-01-01

    Full Text Available Background & objectives: The difficulties in diagnosis of neonatal sepsis are due to varied clinical presentation, low sensitivity of blood culture which is considered the gold standard and empirical antibiotic usage affecting the outcome of results. Though polymerase chain reaction (PCR based detection of bacterial 16S rRNA gene has been reported earlier, this does not provide identification of the causative agent. In this study, we used restriction fragment length polymorphism (RFLP of amplified 16S rRNA gene to identify the organisms involved in neonatal sepsis and compared the findings with blood culture. Methods: Blood samples from 97 neonates were evaluated for diagnosis of neonatal sepsis using BacT/Alert (automated blood culture and PCR-RFLP. Results: Bacterial DNA was detected by 16S rRNA gene PCR in 55 cases, while BacT/Alert culture was positive in 34 cases. Staphylococcus aureus was the most common organism detected with both methods. Klebsiella spp. was isolated from four samples by culture but was detected by PCR-RFLP in five cases while Acinetobacter spp. was isolated from one case but detected in eight cases by PCR-RFLP. The sensitivity of PCR was found to be 82.3 per cent with a negative predictive value of 85.7 per cent. Eighty of the 97 neonates had prior exposure to antibiotics. Interpretation & conclusions:The results of our study demonstrate that PCR-RFLP having a rapid turnaround time may be useful for the early diagnosis of culture negative neonatal sepsis.

  20. Rumen bacterial community evaluated by 454 pyrosequencing and terminal restriction fragment length polymorphism analyses in dairy sheep fed marine algae.

    Science.gov (United States)

    Castro-Carrera, T; Toral, P G; Frutos, P; McEwan, N R; Hervás, G; Abecia, L; Pinloche, E; Girdwood, S E; Belenguer, A

    2014-03-01

    Developing novel strategies to increase the content of bioactive unsaturated fatty acids (FA) in ruminant-derived products requires a deeper understanding of rumen biohydrogenation and bacteria involved in this process. Although high-throughput pyrosequencing may allow for a great coverage of bacterial diversity, it has hardly been used to investigate the microbiology of ruminal FA metabolism. In this experiment, 454 pyrosequencing and a molecular fingerprinting technique (terminal restriction fragment length polymorphism; T-RFLP) were used concurrently to assess the effect of diet supplementation with marine algae (MA) on the rumen bacterial community of dairy sheep. Eleven lactating ewes were divided in 2 lots and offered a total mixed ration based on alfalfa hay and concentrate (40:60), supplemented with 0 (control) or 8 (MA) g of MA/kg of dry matter. After 54 d on treatments, animals were slaughtered and samples of rumen content and fluid were collected separately for microbial analysis. Pyrosequencing yielded a greater coverage of bacterial diversity than T-RFLP and allowed the identification of low abundant populations. Conversely, both molecular approaches pointed to similar conclusions and showed that relevant changes due to MA addition were observed within the major ruminal phyla, namely Bacteroidetes, Firmicutes, and Proteobacteria. Decreases in the abundance of unclassified Bacteroidales, Porphyromonadaceae, and Ruminococcaceae and increases in as-yet uncultured species of the family Succinivibrionaceae, might be related to a potential role of these groups in different pathways of rumen FA metabolism. Diet supplementation with MA, however, had no effect on the relative abundance of Butyrivibrio and Pseudobutyrivibrio genera. In addition, results from both 454 pyrosequencing and T-RFLP indicate that the effect of MA was rather consistent in rumen content or fluid samples, despite inherent differences between these fractions in their bacterial composition

  1. Genetic divergence between Mexican Opuntia accessions inferred by polymerase chain reaction-restriction fragment length polymorphism analysis.

    Science.gov (United States)

    Samah, S; Valadez-Moctezuma, E; Peláez-Luna, K S; Morales-Manzano, S; Meza-Carrera, P; Cid-Contreras, R C

    2016-06-03

    Molecular methods are powerful tools in characterizing and determining relationships between plants. The aim of this study was to study genetic divergence between 103 accessions of Mexican Opuntia. To accomplish this, polymerase chain reaction (PCR)-restriction fragment length polymorphism analysis of three chloroplast intergenic spacers (atpB-rbcL, trnL-trnF, and psbA-trnH), one chloroplast gene (ycf1), two nuclear genes (ppc and PhyC), and one mitochondrial gene (cox3) was conducted. The amplified products from all the samples had very similar molecular sizes, and there were only very small differences between the undigested PCR amplicons for all regions, with the exception of ppc. We obtained 5850 bp from the seven regions, and 136 fragments were detected with eight enzymes, 37 of which (27.2%) were polymorphic. We found that 40% of the fragments from the chloroplast regions were polymorphic, 9.8% of the bands detected in the nuclear genes were polymorphic, and 20% of the bands in the mitochondrial locus were polymorphic. trnL-trnF and psbA-trnH were the most variable regions. The Nei and Li/Dice distance was very short, and ranged from 0 to 0.12; indeed, 77 of the 103 genotypes had the same genetic profile. All the xoconostle accessions (acidic fruits) were grouped together without being separated from three genotypes of prickly pear (sweet fruits). We assume that the genetic divergence between prickly pears and xoconostles is very low, and question the number of Opuntia species currently considered in Mexico.

  2. Single Cystosorus Isolate Production and Restriction Fragment Length Polymorphism Characterization of the Obligate Biotroph Spongospora subterranea f. sp. subterranea.

    Science.gov (United States)

    Qu, Xinshun; Christ, Barbara J

    2006-10-01

    ABSTRACT Spongospora subterranea f. sp. subterranea causes powdery scab in potatoes and is distributed worldwide. Genetic studies of this pathogen have been hampered due, in part, to its obligate parasitism and the lack of molecular markers for this pathogen. In this investigation, a single cystosorus inoculation technique was developed to produce large amounts of S. subterranea f. sp. subterranea plasmodia or zoosporangia in eastern black nightshade (Solanum ptycanthum) roots from which DNA was extracted. Cryopreservation of zoosporangia was used for long-term storage of the isolates. S. subterranea f. sp. subterranea-specific restriction fragment length polymorphism (RFLP) markers were developed from randomly amplified polymorphic DNA (RAPD) fragments. Cystosori of S. subterranea f. sp. subterranea were used for RAPD assays and putative pathogen-specific RAPD fragments were cloned and sequenced. The fragments were screened for specificity by Southern hybridization and subsequent DNA sequence BLAST search. Four polymorphic S. subterranea f. sp. subterranea-specific probes containing repetitive elements, and one containing single copy DNA were identified. These RFLP probes were then used to analyze 24 single cystosorus isolates derived from eight geographic locations in the United States and Canada. Genetic variation was recorded among, but not within, geographic locations. Cluster analysis separated the isolates into two major groups: group I included isolates originating from western North America, with the exception of those from Colorado, and group II included isolates originating from eastern North America and from Colorado. The techniques developed in this study, i.e., production of single cystosorus isolates of S. subterranea f. sp. subterranea and development of RFLP markers for this pathogen, provide methods to further study the genetic structure of S. subterranea f. sp. subterranea.

  3. M protein typing of Thai group A streptococcal isolates by PCR-Restriction fragment length polymorphism analysis

    Directory of Open Access Journals (Sweden)

    Good Michael F

    2005-10-01

    Full Text Available Abstract Background Group A streptococcal (GAS infections can lead to the development of severe post-infectious sequelae, such as rheumatic fever (RF and rheumatic heart disease (RHD. RF and RHD are a major health concern in developing countries, and in indigenous populations of developed nations. The majority of GAS isolates are M protein-nontypeable (MNT by standard serotyping. However, GAS typing is a necessary tool in the epidemiologically analysis of GAS and provides useful information for vaccine development. Although DNA sequencing is the most conclusive method for M protein typing, this is not a feasible approach especially in developing countries. To overcome this problem, we have developed a polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP-based assay for molecular typing the M protein gene (emm of GAS. Results Using one pair of primers, 13 known GAS M types showed one to four bands of PCR products and after digestion with Alu I, they gave different RFLP patterns. Of 106 GAS isolates examined from the normal Thai population and from patients with GAS-associated complications including RHD, 95 isolates gave RFLP patterns that corresponded to the 13 known M types. Only 11 isolates gave RFLP patterns that differed from the 13 known M types. These were then analyzed by DNA sequencing and six additional M types were identified. In addition, we found that M93 GAS was the most common M type in the population studied, and is consistent with a previous study of Thai GAS isolates. Conclusion PCR-RFLP analysis has the potential for the rapid screening of different GAS M types and is therefore considerably advantageous as an alternative M typing approach in developing countries in which GAS is endemic.

  4. 75 FR 27362 - Notice of Temporary Order Restricting Dogs From Public Lands in the Kasha-Katuwe Tent Rocks...

    Science.gov (United States)

    2010-05-14

    ... Temporary Order Restricting Dogs From Public Lands in the Kasha-Katuwe Tent Rocks National Monument in... dogs from public lands within the 5,610- acre Kasha-Katuwe Tent Rocks National Monument. This order... persons with dogs is prohibited on public land in New Mexico Prime Meridian, T. 16 N., R. 5 E., and T. 17...

  5. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing

    NARCIS (Netherlands)

    Huyen, Mai N. T.; Kremer, Kristin; Lan, Nguyen T. N.; Buu, Tran N.; Cobelens, Frank G. J.; Tiemersma, Edine W.; de Haas, Petra; van Soolingen, Dick

    2013-01-01

    In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard in typing of

  6. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing.

    NARCIS (Netherlands)

    Huyen, M.N.; Kremer, K.; Lan, N.T.; Buu, T.N.; Cobelens, F.G.; Tiemersma, E.W.; Haas, P. de; Soolingen, D. van

    2013-01-01

    BACKGROUND: In comparison to restriction fragment length polymorphism (RFLP) typing, variable number of tandem repeat (VNTR) typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard

  7. Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis

    DEFF Research Database (Denmark)

    Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.

    2000-01-01

    A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism a...

  8. Characterisation of Toxoplasma gondii isolates using polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) of the non-coding Toxoplasma gondii (TGR)-gene sequences

    DEFF Research Database (Denmark)

    Høgdall, Estrid; Vuust, Jens; Lind, Peter

    2000-01-01

    of using TGR gene variants as markers to distinguish among T. gondii isolates from different animals and different geographical sources. Based on the band patterns obtained by restriction fragment length polymorphism (RFLP) analysis of the polymerase chain reaction (PCR) amplified TGR sequences, the T...

  9. Close correlation between restriction fragment length polymorphism of the L-MYC gene and metastasis of human lung cancer to the lymph nodes and other organs

    International Nuclear Information System (INIS)

    Kawashima, Kazuko; Shikama, Hiroshi; Imoto, Kazuhiko; Izawa, Mitsuo; Nishimura, Susumu; Naruke, Tsuguo; Okabayashi, Kenzo

    1988-01-01

    Restriction length fragment polymorphism of the L-MYC gene was examined in DNAs from lung cancer tissues and normal tissues of 51 Japanese patients with lung cancer. In individual patients, no difference was seen between the restriction length fragments of the two alleles of L-MYC [6-kilobase (kb)] and 10-kb fragments in EcoRI digests in lung cancer tissues and normal tissues. But a striking correlation was found between the restriction length fragment polymorphism pattern of L-MYC and the extent of metastasis, particularly to the lymph nodes at the time of surgery: Patients with only the L band (10 kb) had few lymph node metastatic lesions, whereas patients with either the S band (6 kb) or the S and L bands almost always had lymph node metastatic lesion. A similar correlation was found between the presence of the S band and metastases to other organs. This correlation was particularly marked in cases of adenocarcinoma. These results indicate a clear genetic influence on metastases and a consequent poor prognosis for certain patients of lung cancer; L-MYC restriction length fragment polymorphism is thus shown to be a useful marker for predicting the metastatic potential of human lung cancer

  10. On the power to detect differences between male and female mutation rates for Duchenne muscular dystrophy, using classical segregation analysis and restriction fragment length polymorphisms

    NARCIS (Netherlands)

    Karel, E.R.; te Meerman, G J; Ten Kate, L P

    The power to detect departures from the theoretical proportion of new mutants in X-linked lethal disorders has been analyzed for several types of segregation analysis, including methods based on completely linked restriction fragment length polymorphisms. It is shown that all methods require large

  11. Estimation of Length and Order of Polynomial-based Filter Implemented in the Form of Farrow Structure

    Directory of Open Access Journals (Sweden)

    S. Vukotic

    2016-08-01

    Full Text Available Digital polynomial-based interpolation filters implemented using the Farrow structure are used in Digital Signal Processing (DSP to calculate the signal between its discrete samples. The two basic design parameters for these filters are number of polynomial-segments defining the finite length of impulse response, and order of polynomials in each polynomial segment. The complexity of the implementation structure and the frequency domain performance depend on these two parameters. This contribution presents estimation formulae for length and polynomial order of polynomial-based filters for various types of requirements including attenuation in stopband, width of transitions band, deviation in passband, weighting in passband/stopband.

  12. Cross-platform comparison of microarray data using order restricted inference

    Science.gov (United States)

    Klinglmueller, Florian; Tuechler, Thomas; Posch, Martin

    2013-01-01

    Motivation Titration experiments measuring the gene expression from two different tissues, along with total RNA mixtures of the pure samples, are frequently used for quality evaluation of microarray technologies. Such a design implies that the true mRNA expression of each gene, is either constant or follows a monotonic trend between the mixtures, applying itself to the use of order restricted inference procedures. Exploiting only the postulated monotonicity of titration designs, we propose three statistical analysis methods for the validation of high-throughput genetic data and corresponding preprocessing techniques. Results Our methods allow for inference of accuracy, repeatability and cross-platform agreement, with minimal required assumptions regarding the underlying data generating process. Therefore, they are readily applicable to all sorts of genetic high-throughput data independent of the degree of preprocessing. An application to the EMERALD dataset was used to demonstrate how our methods provide a rich spectrum of easily interpretable quality metrics and allow the comparison of different microarray technologies and normalization methods. The results are on par with previous work, but provide additional new insights that cast doubt on the utility of popular preprocessing techniques, specifically concerning the EMERALD projects dataset. Availability All datasets are available on EBI’s ArrayExpress web site (http://www.ebi.ac.uk/microarray-as/ae/) under accession numbers E-TABM-536, E-TABM-554 and E-TABM-555. Source code implemented in C and R is available at: http://statistics.msi.meduniwien.ac.at/float/cross_platform/. Methods for testing and variance decomposition have been made available in the R-package orQA, which can be downloaded and installed from CRAN http://cran.r-project.org. PMID:21317143

  13. Cross-platform comparison of microarray data using order restricted inference.

    Science.gov (United States)

    Klinglmueller, Florian; Tuechler, Thomas; Posch, Martin

    2011-04-01

    Titration experiments measuring the gene expression from two different tissues, along with total RNA mixtures of the pure samples, are frequently used for quality evaluation of microarray technologies. Such a design implies that the true mRNA expression of each gene, is either constant or follows a monotonic trend between the mixtures, applying itself to the use of order restricted inference procedures. Exploiting only the postulated monotonicity of titration designs, we propose three statistical analysis methods for the validation of high-throughput genetic data and corresponding preprocessing techniques. Our methods allow for inference of accuracy, repeatability and cross-platform agreement, with minimal required assumptions regarding the underlying data generating process. Therefore, they are readily applicable to all sorts of genetic high-throughput data independent of the degree of preprocessing. An application to the EMERALD dataset was used to demonstrate how our methods provide a rich spectrum of easily interpretable quality metrics and allow the comparison of different microarray technologies and normalization methods. The results are on par with previous work, but provide additional new insights that cast doubt on the utility of popular preprocessing techniques, specifically concerning the EMERALD projects dataset. All datasets are available on EBI's ArrayExpress web site http://www.ebi.ac.uk/microarray-as/ae/) under accession numbers E-TABM-536, E-TABM-554 and E-TABM-555. Source code implemented in C and R is available at: http://statistics.msi.meduniwien.ac.at/float/cross_platform/. Methods for testing and variance decomposition have been made available in the R-package orQA, which can be downloaded and installed from CRAN http://cran.r-project.org.

  14. Zone Restrictions Orders in Canadian Courts and the Reproduction of Socio-Economic Inequality

    Directory of Open Access Journals (Sweden)

    Marie-Eve Sylvestre

    2015-03-01

    Full Text Available While State and local governments have long turned to legal norms, such as vagrancy ordinances and anti-panhandling by-laws, and relied on displacement strategies ranging from orders to disperse and forced removals to control disorderly behavior in public spaces, the ways in which courts and legal actors working within the criminal justice system contribute to the monitoring of public spaces have almost completely gone unnoticed. This paper focuses on one court-imposed spatial tactic, namely zone restriction or "no go" orders. We suggest that despite the fact that these court orders rely on preventative discourses and pursue rehabilitative objectives, they may ultimately have punitive effects on the public poor and political demonstrators and contribute to creating and reproducing socio-economic inequality by creating obstacles for their reintegration, encouraging recidivism, putting the safety of individuals at risk and by neutralizing those who challenge the social and political order in various ways. Ultimately, these orders raise some concerns with respect to the rule of law since they are rarely challenged and generally appear to be shielded from review. Mientras que estados y gobiernos locales han vuelto a normas legales como la ley de vagos y maleantes, y basan sus estrategias en el desplazamiento, mediante órdenes de dispersión y traslados forzosos para controlar el comportamiento desordenado en los espacios públicos, ha pasado prácticamente desapercibida la forma en la que tribunales y agentes jurídicos trabajan dentro del sistema de justicia penal para contribuir a la vigilancia de los espacios públicos. Este artículo se centra en una táctica espacial impuesta por un tribunal, concretamente la restricción de zona o pedidos "intangibles". Se sugiere que, a pesar de que estas órdenes judiciales se basan en discursos preventivos y persiguen objetivos de rehabilitación, en última instancia pueden tener efectos punitivos sobre

  15. First Things First: Similar List Length and Output Order Effects for Verbal and Nonverbal Stimuli

    Science.gov (United States)

    Cortis, Cathleen; Dent, Kevin; Kennett, Steffan; Ward, Geoff

    2015-01-01

    When participants are presented with a short list of unrelated words and they are instructed that they may recall in any order, they nevertheless show a very strong tendency to recall in forward serial order. Thus, if asked to recall "in any orde"r: "hat, mouse, tea, stairs," participants often respond "hat, mouse, tea,…

  16. Proximal Region of the Gene Encoding Cytadherence-Related Protein Permits Molecular Typing of Mycoplasma genitalium Clinical Strains by PCR-Restriction Fragment Length Polymorphism

    Science.gov (United States)

    Musatovova, Oxana; Herrera, Caleb; Baseman, Joel B.

    2006-01-01

    Restriction fragment length polymorphism (RFLP) analysis of the PCR-amplified proximal region of the gene encoding cytadherence accessory protein P110 (MG192) revealed DNA sequence divergences among 54 Mycoplasma genitalium clinical strains isolated from the genitourinary tracts of women attending a sexually transmitted disease-related health clinic, plus one from the respiratory tract and one from synovial fluid. Seven of 56 (12.5%) strains exhibited RFLPs following digestion of the proximal region with restriction endonuclease MboI or RsaI, or both. No sequence variability was detected in the distal portion of the gene. PMID:16455921

  17. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene.

    Science.gov (United States)

    Soares, Vítor Yamashiro Rocha; Silva, Jailthon Carlos da; Silva, Kleverton Ribeiro da; Pires e Cruz, Maria do Socorro; Santos, Marcos Pérsio Dantas; Ribolla, Paulo Eduardo Martins; Alonso, Diego Peres; Coelho, Luiz Felipe Leomil; Costa, Dorcas Lamounier; Costa, Carlos Henrique Nery

    2014-06-01

    An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis of the mitochondrial cytochrome B (cytb) gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp) was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1), Bos taurus (1) and Equus caballus (2). Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.

  18. Identification of blood meal sources of Lutzomyia longipalpis using polymerase chain reaction-restriction fragment length polymorphism analysis of the cytochrome B gene

    Directory of Open Access Journals (Sweden)

    Vítor Yamashiro Rocha Soares

    2014-06-01

    Full Text Available An analysis of the dietary content of haematophagous insects can provide important information about the transmission networks of certain zoonoses. The present study evaluated the potential of polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP analysis of the mitochondrial cytochrome B (cytb gene to differentiate between vertebrate species that were identified as possible sources of sandfly meals. The complete cytb gene sequences of 11 vertebrate species available in the National Center for Biotechnology Information database were digested with Aci I, Alu I, Hae III and Rsa I restriction enzymes in silico using Restriction Mapper software. The cytb gene fragment (358 bp was amplified from tissue samples of vertebrate species and the dietary contents of sandflies and digested with restriction enzymes. Vertebrate species presented a restriction fragment profile that differed from that of other species, with the exception of Canis familiaris and Cerdocyon thous. The 358 bp fragment was identified in 76 sandflies. Of these, 10 were evaluated using the restriction enzymes and the food sources were predicted for four: Homo sapiens (1, Bos taurus (1 and Equus caballus (2. Thus, the PCR-RFLP technique could be a potential method for identifying the food sources of arthropods. However, some points must be clarified regarding the applicability of the method, such as the extent of DNA degradation through intestinal digestion, the potential for multiple sources of blood meals and the need for greater knowledge regarding intraspecific variations in mtDNA.

  19. A Semester-Long Project for Teaching Basic Techniques in Molecular Biology Such as Restriction Fragment Length Polymorphism Analysis to Undergraduate and Graduate Students

    OpenAIRE

    DiBartolomeis, Susan M.

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length ...

  20. Community analysis of preservative-treated southern pine (Pinus spp.) using terminal restriction fragment length polymorphism (T-RFLP) analysis. Part 1: Fungal field study

    Science.gov (United States)

    Grant T. Kirker; M. Lynn Prewitt; Tor P. Schultz; Susan V. Dieh

    2012-01-01

    The effects of chlorothalonil (CTN), butylated hydroxytoluene (BHT), and ammoniacal copper quat (ACQ-C) on the fungal community on southern yellow pine (SYP) were assessed using terminal restriction fragment length polymorphism (T-RFLP) analysis over 15 months. Field stakes, treated with 0.25 and 0.37 % ACQ-C, 0.1 and 0.25 % CTN, 2 % BHT alone, 0.1 and 0.25 % CTN...

  1. Performance of PCR-restriction fragment length polymorphism analysis of the Helicobacter pylori ureB gene in differentiating gene variants

    DEFF Research Database (Denmark)

    Colding, H; Hartzen, S H; Mohammadi, M

    2003-01-01

    Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...... unrelated clinical H. pylori isolates with PCR-RFLP typing of the ureB gene (933 bp), combining the results obtained with restriction enzymes HaeIII and Sau3A, and a mixture of the enzymes. We therefore find that PCR-RFLP typing of the ureB gene of H. pylori with restriction enzymes HaeIII and Sau3A...

  2. Performance of PCR-restriction fragment length polymorphism analysis of the Helicobacter pylori ureB gene in differentiating gene variants

    DEFF Research Database (Denmark)

    Colding, H; Hartzen, S H; Mohammadi, M

    2003-01-01

    unrelated clinical H. pylori isolates with PCR-RFLP typing of the ureB gene (933 bp), combining the results obtained with restriction enzymes HaeIII and Sau3A, and a mixture of the enzymes. We therefore find that PCR-RFLP typing of the ureB gene of H. pylori with restriction enzymes HaeIII and Sau3A......Recently, PCR-restriction fragment length polymorphism (PCR-RFLP) of the urease genes of Helicobacter pylori was evaluated in a meta-analysis; acceptable discriminatory indices of the ureAB and C genes were found. In the present investigation, we found a discriminatory index of 0.95 for 191...

  3. Detection of disease-specific restriction fragment length polymorphisms in pemphigus vulgaris linked to the DQwl and DQw3 alleles of the HLA-D region

    Energy Technology Data Exchange (ETDEWEB)

    Szafer, F.; Brautbar, C.; Tzfoni, E.; Frankel, G.; Sherman, L.; Cohen, I.; Hacham-Zadeh, S.; Aberer, W.; Tappeiner, G.; Holubar, K.; Steinman, L.

    1987-09-01

    Pemphigus vulgaris in Israeli Ashkenazi and non-Ashkenazi Jews and in Austrian non-Jewish patients is strongly associated with the DR4 and DRw6 alleles of the HLA-D region class II genes. Restriction fragment length polymorphism analysis was undertaken with DQ..beta.., DQ..cap alpha.., and DR..beta.. cDNA probes. Hybridization with the DQ..beta.. probe identifies Pvu II, BamHI, and EcoRV fragments that absolutely discriminate pemphigus vulgaris patients from healthy DR-, DQ-, and ethnic-matched controls. In contrast the DQ..cap alpha.. and DR..beta.. probes failed to identify disease-specific restriction fragment length polymorphism fragments. These studies indicate that DQw1 and DQw3 polymorphisms carried by pemphigus vulgaris patients may be directly involved in predisposition to the disease or may be tightly linked to the susceptibility gene itself. To our knowledge, this is the first example of an HLA restriction fragment length polymorphism that is highly associated with susceptibility to autoimmune disease.

  4. Detection and characterization of a dehalogenating microorganism by terminal restriction fragment length polymorphism fingerprinting of 16S rRNA in a sulfidogenic, 2-bromophenol-utilizing enrichment.

    Science.gov (United States)

    Fennell, Donna E; Rhee, Sung-Keun; Ahn, Young-Beom; Häggblom, Max M; Kerkhof, Lee J

    2004-02-01

    Terminal restriction fragment length polymorphism analysis of reverse-transcribed 16S rRNA during periods of community flux was used as a tool to delineate the roles of the members of a 2-bromophenol-degrading, sulfate-reducing consortium. Starved, washed cultures were amended with 2-bromophenol plus sulfate, 2-bromophenol plus hydrogen, phenol plus sulfate, or phenol with no electron acceptor and were monitored for substrate use. In the presence of sulfate, 2-bromophenol and phenol were completely degraded. In the absence of sulfate, 2-bromophenol was dehalogenated and phenol accumulated. Direct terminal restriction fragment length polymorphism fingerprinting of the 16S rRNA in the various subcultures indicated that phylotype 2BP-48 (a Desulfovibrio-like sequence) was responsible for the dehalogenation of 2-bromophenol. A stable coculture was established which contained predominantly 2BP-48 and a second Desulfovibrio-like bacterium (designated BP212 based on terminal restriction fragment length polymorphism fingerprinting) that was capable of dehalogenating 2-bromophenol to phenol. Strain 2BP-48 in the coculture could couple reductive dehalogenation to growth with 2-bromophenol, 2,6-dibromophenol, or 2-iodophenol and lactate or formate as the electron donor. In addition to halophenols, strain 2BP-48 appears to use sulfate, sulfite, and thiosulfate as electron acceptors and is capable of simultaneous sulfidogenesis and reductive dehalogenation in the presence of sulfate.

  5. Identification of Candida species by PCR and restriction fragment length polymorphism analysis of intergenic spacer regions of ribosomal DNA.

    OpenAIRE

    Williams, D W; Wilson, M J; Lewis, M A; Potts, A J

    1995-01-01

    The PCR was used to amplify a targeted region of the ribosomal DNA from 84 Candida isolates. Unique product sizes were obtained for Candida guilliermondii, Candida (Torulopsis) glabrata, and Candida pseudotropicalis. Isolates of Candida albicans, Candida tropicalis, Candida stellatoidea, Candida parapsilosis, and Candida krusei could be identified following restriction digestion of the PCR products.

  6. Quantile selection procedure and assoiated distribution of ratios of order statistics from a restricted family of probability distributions

    International Nuclear Information System (INIS)

    Gupta, S.S.; Panchapakesan, S.

    1975-01-01

    A quantile selection procedure in reliability problems pertaining to a restricted family of probability distributions is discussed. This family is assumed to be star-ordered with respect to the standard normal distribution folded at the origin. Motivation for this formulation of the problem is described. Both exact and asymptotic results dealing with the distribution of the maximum of ratios of order statistics from such a family are obtained and tables of the appropriate constants, percentiles of this statistic, are given in order to facilitate the use of the selection procedure

  7. Soil pretreatment and fast cell lysis for direct polymerase chain reaction from forest soils for terminal restriction fragment length polymorphism analysis of fungal communities

    Directory of Open Access Journals (Sweden)

    Fei Cheng

    Full Text Available Abstract Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high purity DNA from soil microbiota, five prewashing agents were compared in terms of their efficiency and effectiveness in removing soil contaminants. Residual contaminants were precipitated by adding 0.6 mL of 0.5 M CaCl2. Four cell lysis methods were applied to test their compatibility with the pretreatment (prewashing + Ca2+ flocculation and to ultimately identify the optimal cell lysis method for analyzing fungal communities in forest soils. The results showed that pretreatment with TNP + Triton X-100 + skim milk (100 mM Tris, 100 mM Na4P2O7, 1% polyvinylpyrrolidone, 100 mM NaCl, 0.05% Triton X-100, 4% skim milk, pH 10.0 removed most soil humic contaminants. When the pretreatment was combined with Ca2+ flocculation, the purity of all soil DNA samples was further improved. DNA samples obtained by the fast glass bead-beating method (MethodFGB had the highest purity. The resulting DNA was successfully used, without further purification steps, as a template for polymerase chain reaction targeting fungal internal transcribed spacer regions. The results obtained by terminal restriction fragment length polymorphism analysis indicated that the MethodFGB revealed greater fungal diversity and more distinctive community structure compared with the other methods tested. Our study provides a protocol for fungal cell lysis in soil, which is fast, convenient, and effective for analyzing fungal communities in forest soils.

  8. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    of different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included...... for virulence gene allele characterization. The 96 L. monocytogenes strains were divided into two major clusters by AFLP fingerprinting at a similarity level of 82% in concordance with the results of PFGE, RAPD, and ribotyping. One main cluster consisted of all of the 24 L. monocytogenes hly allele 1 strains...

  9. Identification of medically important Candida species by polymerase chain reaction-restriction fragment length polymorphism analysis of the rDNA ITS1 and ITS2 regions

    Directory of Open Access Journals (Sweden)

    Suphi Bayraktar

    2017-01-01

    Full Text Available Aim: We aimed to identify the distribution of species in candidal strains isolated from clinical samples and restriction fragment length polymorphism (RFLP method based on Msp I and Bln I restrictive enzyme cuts of polymerase chain reaction (PCR products after the amplification of ITS1 and ITS2 regions of rDNA genotypically. Materials and Methods: One hundred and fifty candidal strains isolated from various clinical samples were studies/ included. Phenotypic species assessment was performed using automated VITEK-2 system and kit used with the biochemical tests. Common genomic region amplification peculiar to candidal strains was carried out using ITS1 and ITS2 primer pairs. After the amplification, PCR products were cut with Msp I and Bln I restriction enzymes for species identification. Results: The majority of Candida isolates were isolated from urine (78.6% while other isolates were composed of strains isolated from swab, wound, blood and other samples by 11.3%, 3.3%, 2% and 4.7%, respectively. The result of RFLP analysis carried out with Msp I and Bln I restriction enzymes showed that candidal strains were Candida albicans by 45.3%, Candida glabrata by 19.3%, Candida tropicalis by 14.6%, Candida parapsilosis by 5.3%, Candida krusei by 5.3%, Candida lusitaniae by 0.6% and other candidal strains by 9.3%. Conclusion: When the ability to identify Candida to species level of phenotypic and PCR-RFLP methods was assessed, a great difference was found between these two methods. It may be argued that Msp I and Bln I restriction enzyme fragments can be used in the identification of medically important Candida species. Further studies are needed to develop this kind of restriction profile to be used in the identification of candidal strains.

  10. High-resolution genotyping of Listeria monocytogenes by fluorescent amplified fragment length polymorphism analysis compared to pulsed-field gel electrophoresis, random amplified polymorphic DNA analysis, ribotyping, and PCR-restriction fragment length polymorphism analysis

    DEFF Research Database (Denmark)

    Vogel, Birte Fonnesbech; Fussing, V.; Ojeniyi, B.

    2004-01-01

    The purpose of this study was to evaluate fluorescent amplified fragment length polymorphism (AFLP) analysis for the inter- and intraspecies differentiation of a collection of 96 strains of Listeria monocytogenes and 10 non- L. monocytogenes strains representing six other Listeria species...... of different origin. The AFLP technique was compared with three other molecular typing methods - ribotyping, random amplified polymorphic DNA analysis (RAPD), and pulsed-field gel electrophoresis (PFGE) - in terms of discriminatory ability. PCR-restriction fragment length polymorphism was included....... Isolates with identical DNA profiles were distributed across the spectrum of origin. It was not possible to associate certain types with specific food sectors or clinical cases, which is indicative of the spread of L. monocytogenes clones across species. Overall, AFLP fingerprinting was suitable...

  11. Phase diagram of the restricted primitive model: charge-ordering instability

    Directory of Open Access Journals (Sweden)

    O.V.Patsahan

    2004-01-01

    Full Text Available We study the phase behaviour of the restricted primitive model (RPM using a microscopic approach based on the method of collective variables with a reference system. Starting from the Hamiltonian of the RPM we derive the functional of the grand partition function given in terms of the two collective variables: the collective variables ρk and ck describing fluctuations of the total number density and charge density, respectively. Within the framework of the Gaussian approximation we found the boundary of stability with respect to fluctuations of the charge density. It is shown that due to the approximated character of the theory the boundary of stability is very sensitive to the particular choice of the long-range part of potential inside the hard core. This point is discussed in more detail.

  12. Development of a polymerase chain reaction/restriction fragment length polymorphism method for Saccharomyces cerevisiae and Saccharomyces bayanus identification in enology.

    Science.gov (United States)

    Masneuf, I; Aigle, M; Dubourdieu, D

    1996-05-01

    Several yeast strains of the species Saccharomyces cerevisiae, S. bayanus and S. paradoxus, first identified by hybridization experiments and measurements of DNA/DNA homology, were characterized using polymerase chain reaction/restriction fragment length polymorphism (PCR/RFLP) analysis of the MET2 gene. There was no exception to the agreement between this method and classical genetic analyses for any of the strains examined, so PCR/RFLP of the MET2 gene is a reliable and fast technique for delimiting S. cerevisiae and S. bayanus. Enological strains classified as S. bayanus, S. chevalieri, and S. capensis gave S. cerevisiae restriction patterns, whereas most S. uvarum strains belong to S. bayanus. Enologists should no longer use the name of S. bayanus for S. cerevisiae Gal strains, and should consider S. bayanus as a distinct species.

  13. Genetic Typing of Bovine Viral Diarrhoea Virus (BVDV by Restriction Fragment Length Polymorphism (RFLP and Identification of a New Subtype in Poland

    Directory of Open Access Journals (Sweden)

    Kuta Aleksandra

    2015-04-01

    Full Text Available Restriction fragment length polymorphism (RFLP analysis was developed for genetic typing of Polish strains of bovine viral diarrhoea virus (BVDV. The method was applied using 60 BVDV isolates, which included BVDV genotype 1, subtypes a, b, d, e, f, and g, and genotype 2a. RT-PCR products of the 5’untranslated region (5’UTR were digested using three enzymes. Restriction patterns classified the strains into seven groups, each with a specific and different pattern from other subtypes. These findings were confirmed by nucleotide sequencing and phylogenetic analysis. The results suggest that RFLP analysis is a simple, reliable, and fast genotyping method for BVDV strains in comparison with sequencing. This method can distinguish six subtypes of BVDV-1 including a new subtype 1e, identified exclusively by this method, and it allows differentiation of BVDV-1 from BVDV-2 genotype.

  14. Isolation and characterization of DNA probes from a flow-sorted human chromosome 8 library that detect restriction fragment length polymorphism (RFLP).

    Science.gov (United States)

    Wood, S; Starr, T V; Shukin, R J

    1986-01-01

    We have used a recombinant DNA library constructed from flow-sorted human chromosome 8 as a source of single-copy human probes. These probes have been screened for restriction fragment length polymorphism (RFLP) by hybridization to Southern transfers of genomic DNA from five unrelated individuals. We have detected six RFLPs distributed among four probes after screening 741 base pairs for restriction site variation. These RFLPs all behave as codominant Mendelian alleles. Two of the probes detect rare variants, while the other two detect RFLPs with PIC values of .36 and .16. Informative probes will be useful for the construction of a linkage map for chromosome 8 and for the localization of mutant alleles to this chromosome. Images Fig. 1 PMID:2879441

  15. Identification of planorbids from Venezuela by polymerase chain reaction amplification and restriction fragment length polymorphism of internal transcriber spacer of the RNA ribosomal gene

    Directory of Open Access Journals (Sweden)

    Caldeira Roberta L

    2000-01-01

    Full Text Available Snails of the genus Biomphalaria from Venezuela were subjected to morphological assessment as well as polymerase chain reaction and restriction fragment length polymorphism (PCR-RFLP analysis. Morphological identification was carried out by comparison of characters of the shell and the male and female reproductive apparatus. The PCR-RFLP involved amplification of the internal spacer region ITS1 and ITS2 of the RNA ribosomal gene and subsequent digestion of this fragment by the restriction enzymes DdeI, MnlI, HaeIII and MspI. The planorbids were compared with snails of the same species and others reported from Venezuela and present in Brazil, Cuba and Mexico. All the enzymes showed a specific profile for each species, that of DdeI being the clearest. The snails were identified as B. glabrata, B. prona and B. kuhniana.

  16. Analysis of ORF 1 in European porcine reproductive and respiratory syndrome virus by long RT-PCR and restriction fragment length polymorphism (RFLP) analysis

    DEFF Research Database (Denmark)

    Nielsen, H. S.; Storgaard, Torben; Oleksiewicz, M.B.

    2000-01-01

    A rapid method was developed for partial characterization of the replicase-encoding open reading frame 1 (ORF 1) of porcine reproductive and respiratory syndrome virus (PRRSV). It comprised long RT-PCR amplification of 11.1 kb (94%) of ORF 1, followed by restriction fragment length polymorphism...... analysis. The method was used to compare ORF 1 sequences of two divergent European-type PRRSV strains. Our results indicated that the structural and replicase parts of these two strains had evolved at overall similar rates....

  17. Off-diagonal long-range order, restricted gauge transformations, and Aharonov-Bohm effect in conductors

    International Nuclear Information System (INIS)

    Peshkin, M.

    1996-01-01

    The electrons in a conductor surrounding an external magnetic field are acted on by a vector potential that cannot be removed by a gauge transformation. Nevertheless, a macroscopic normal conductor can experience no Aharonov-Bohm (AB) effect. That is proved by assuming only that a normal conductor lacks off-diagonal long-range order (ODLRO), which means that the electrons lack long-range phase coherence. Then by restricting the Hilbert space to density matrices which lack ODLRO, one can introduce a restricted gauge transformation that removes the interaction of the conductor with the vector potential. Consequently, the AB effect on a beam particle is not shielded by the conductor. copyright 1996 The American Physical Society

  18. Serial position, output order, and list length effects for words presented on smartphones over very long intervals.

    Science.gov (United States)

    Cortis Mack, Cathleen; Cinel, Caterina; Davies, Nigel; Harding, Michael; Ward, Geoff

    2017-12-01

    Three experiments examined whether or not benchmark findings observed in the immediate retrieval from episodic memory are similarly observed over much greater time-scales. Participants were presented with experimentally-controlled lists of words at the very slow rate of one word every hour using an iPhone recall application, RECAPP, which was also used to recall the words in either any order (free recall: Experiments 1 to 3) or the same order as presented (serial recall: Experiment 3). We found strong temporal contiguity effects, weak serial position effects with very limited recency, and clear list length effects in free recall; clear primacy effects and classic error gradients in serial recall; and recency effects in a final two-alternative forced choice recognition task (Experiments 2 and 3). Our findings extend the timescales over which temporal contiguity effects have been observed, but failed to find consistent evidence for strong long-term recency effects with experimenter-controlled stimuli.

  19. Use of PCR-restriction fragment length polymorphism analysis for identification of yeast species isolated from bovine intramammary infection.

    Science.gov (United States)

    Fadda, M E; Pisano, M B; Scaccabarozzi, L; Mossa, V; Deplano, M; Moroni, P; Liciardi, M; Cosentino, S

    2013-01-01

    This study reports a rapid PCR-based technique using a one-enzyme RFLP for discrimination of yeasts isolated from bovine clinical and subclinical mastitis milk samples. We analyzed a total of 1,486 milk samples collected over 1 yr in south Sardinia and northern Italy, and 142 yeast strains were preliminarily grouped based on their cultural morphology and physiological characteristics. Assimilation tests were conducted using the identification kit API ID 32C and APILAB Plus software (bioMérieux, Marcy l'Etoile, France). For PCR-RFLP analysis, the 18S-ITS1-5.8S ribosomal(r)DNA region was amplified and then digested with HaeIII, and dendrogram analysis of RFLP fragments was carried out. Furthermore, within each of the groups identified by the API or PCR-RFLP methods, the identification of isolates was confirmed by sequencing of the D1/D2 region using an ABI Prism 310 automatic sequencer (Applied Biosystems, Foster City, CA). The combined phenotypic and molecular approach enabled the identification of 17 yeast species belonging to the genera Candida (47.9%), Cryptococcus (21.1%), Trichosporon (19.7%), Geotrichum (7.1%), and Rhodotorula (4.2%). All Candida species were correctly identified by the API test and their identification confirmed by sequencing. All strains identified with the API system as Geotrichum candidum, Cryptococcus uniguttulatus, and Rhodotorula glutinis also produced characteristic restriction patterns and were confirmed as Galactomyces geotrichum (a teleomorph of G. candidum), Filobasidium uniguttulatum (teleomorph of Crypt. uniguttulatus), and R. glutinis, respectively, by D1/D2 rDNA sequencing. With regard to the genus Trichosporon, preliminary identification by API was problematic, whereas the RFLP technique used in this study gave characteristic restriction profiles for each species. Moreover, sequencing of the D1/D2 region allowed not only successful identification of Trichosporon gracile where API could not, but also correct identification of

  20. Molecular identification of similar species of the genus Biomphalaria (Mollusca: Planorbidae determined by a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Roberta Lima Caldeira

    1998-01-01

    Full Text Available The freshwater snails Biomphalaria straminea, B. intermedia, B. kuhniana and B. peregrina, are morphologically similar; based on this similarity the first three species were therefore grouped in the complex B. straminea. The morphological identification of these species is based on characters such as vaginal wrinkling, relation between prepuce: penial sheath:deferens vas and number of muscle layers in the penis wall. In this study the polymerase chain reaction restriction fragment length polymorphism technique was used for molecular identification of these molluscs. This technique is based on the amplification of the internal transcribed spacer regions ITS1 e ITS2 of the ribosomal RNA gene and subsequent digestion of these fragments by restriction enzymes. Six enzymes were tested: Dde I, Mnl I, Hae III, Rsa I, Hpa II e Alu I. The restriction patterns obtained with DdeI presented the best profile for separation of the four species of Biomphalaria. The profiles obtained with all the enzymes were used to estimate the genetic distances among the species through analysis of common banding patterns.

  1. Simultaneous and rapid differential diagnosis of Mycoplasma genitalium and Ureaplasma urealyticum based on a polymerase chain reaction-restriction fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    R Mirnejad

    2011-01-01

    Full Text Available Objectives: The aim of this investigation was to simultaneously detect and differentiate Mycoplasma genitalium and Ureaplasma urealyticum in female patients suffering from genital complications by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP. Materials and Methods : Genital swabs were taken from 210 patients. They were transported to the laboratory in phosphate-buffered saline. For PCR, samples were analysed with genus-specific MyUu-R and MyUu-F primers. This primer set, which was originally designed in our laboratory, amplified a 465 bp fragment (M. genitalium and a 559 bp fragment (U. urealyticum. Samples containing a band of the expected sizes for the Mycoplasma strains were subjected to digestion with a restriction endonuclease enzyme of TaqI and Cac8I. Results: Of the 210 samples, a total of 100 (47.6% samples were found to be positive for Mycoplasmas (seven M. genitalium isolates, 3.3%; and 89 U. urealyticum isolates, 42.4%, and coinfections with both species were detected in four samples (1.9%. The PCR-RFLP results showed that M. genitalium and U. urealyticum are different by enzyme patterns. Conclusion: PCR-RFLP offers a rapid and easily applicable protocol to simultaneous detection and differentiation of M. genitalium and U. urealyticum from clinical samples when specific primers and restriction enzymes are used.

  2. Towards the molecular characterisation of parasitic nematode assemblages: an evaluation of terminal-restriction fragment length polymorphism (T-RFLP) analysis.

    Science.gov (United States)

    Lott, M J; Hose, G C; Power, M L

    2014-09-01

    Identifying factors which regulate temporal and regional structuring within parasite assemblages requires the development of non-invasive techniques which facilitate both the rapid discrimination of individual parasites and the capacity to monitor entire parasite communities across time and space. To this end, we have developed and evaluated a rapid fluorescence-based method, terminal restriction fragment length polymorphism (T-RFLP) analysis, for the characterisation of parasitic nematode assemblages in macropodid marsupials. The accuracy with which T-RFLP was capable of distinguishing between the constituent taxa of a parasite community was assessed by comparing sequence data from two loci (the ITS+ region of nuclear ribosomal DNA and the mitochondrial CO1) across ∼20 species of nematodes (suborder Strongylida). Our results demonstrate that with fluorescent labelling of the forward and reverse terminal restriction fragments (T-RFs) of the ITS+ region, the restriction enzyme Hinf1 was capable of generating species specific T-RFLP profiles. A notable exception was within the genus Cloacina, in which closely related species often shared identical T-RFs. This may be a consequence of the group's comparatively recent evolutionary radiation. While the CO1 displayed higher sequence diversity than the ITS+, the subsequent T-RFLP profiles were taxonomically inconsistent and could not be used to further differentiate species within Cloacina. Additionally, several of the ITS+ derived T-RFLP profiles exhibited unexpected secondary peaks, possibly as a consequence of the restriction enzymes inability to cleave partially single stranded amplicons. These data suggest that the question of T-RFLPs utility in monitoring parasite communities cannot be addressed without considering the ecology and unique evolutionary history of the constituent taxa. Copyright © 2014 Elsevier Inc. All rights reserved.

  3. Analysis of mitochondrial DNA for authentication of meats from chamois (Rupicapra rupicapra), pyrenean ibex (Capra pyrenaica), and mouflon (Ovis ammon) by polymerase chain reaction-restriction fragment length polymorphism.

    Science.gov (United States)

    Fajardo, Violeta; González, Isabel; López-Calleja, Inés; Martin, Irene; Rojas, Maria; Pavón, Miguel Angel; Hernández, Pablo E; García, Teresa; Martín, Rosario

    2007-01-01

    The prevention of fraudulent labeling of game meat constitutes an important part of food regulatory control and quality assurance systems. A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis based on mitochondrial deoxyribonucleic acid (DNA) was developed for authentication of meats from chamois (Rupicapra rupicapra), pyrenean ibex (Capra pyrenaica), and mouflon (Ovis ammon). Amplification and restriction site analysis of a DNA fragment about 720 base pairs (bp) from the mitochondrial 12S rRNA gene of all analyzed species permitted the selection of Msel and Apol endonucleases for meat speciation. The 12S rRNA restriction profiles obtained allowed the unequivocal identification of chamois, pyrenean ibex, and mouflon/sheep and their differentiation from meats of domestic species such as cattle, goat, and swine. The highly variable mitochondrial D-loop gene was also targeted to attempt discrimination between mouflon and sheep meats. A D-loop region (700-1000 bp) was amplified and sequenced in all game and domestic species analyzed, and a primer set was designed for the selective amplification of a 370 bp DNA fragment from mouflon and sheep. PCR-RFLP analysis with the selected Maell enzyme generated a single electrophoretic profile characteristic for sheep, whereas 3 different fragment patterns were obtained for mouflon meats. Consequently, the PCR-RFLP technique developed can be routinely applied in inspection programs in order to verify the correct labeling of game species.

  4. Gun Violence Restraining Orders: Alternative or Adjunct to Mental Health-Based Restrictions on Firearms?

    Science.gov (United States)

    Frattaroli, Shannon; McGinty, Emma E; Barnhorst, Amy; Greenberg, Sheldon

    2015-06-01

    The gun violence restraining order (GVRO) is a new tool for preventing gun violence. Unlike traditional approaches to prohibiting gun purchase and possession, which rely on a high threshold (adjudication by criminal justice or mental health systems) before intervening, the GVRO allows family members and intimate partners who observe a relative's dangerous behavior and believe it may be a precursor to violence to request a GVRO through the civil justice system. Once issued by the court, a GVRO authorizes law enforcement to remove any guns in the respondent's possession and prohibits the respondent from purchasing new guns. In September 2014, California's governor signed AB1014 into law, making California the first U.S. state to enact a GVRO law. This article describes the GVRO and the rationale behind the concept, considers case examples to assess the potential impact of the GVRO as a strategy for preventing gun violence, and reviews the content of the California law. Copyright © 2015 John Wiley & Sons, Ltd.

  5. The legitimacy of area-based restrictions to maintain public order: giving content to the proportionality principle from a European legal perspective

    OpenAIRE

    Todts, Liesbeth

    2017-01-01

    Abstract: This contribution aims to provide a first exploratory analysis of the criteria that must be taken into account by national authorities when considering the proportionality of public order measures restricting the individual's fundamental right to freedom of movement, such as area-based restrictions. The content of the proportionality principle as regards area-based restrictions is not always clear, in particular at European human rights level, while it is an important condition that...

  6. Use of mgc2-polymerase chain reaction-restriction fragment length polymorphism for rapid differentiation between field isolates and vaccine strains of Mycoplasma gallisepticum in Israel.

    Science.gov (United States)

    Lysnyansky, Inna; Garcia, Maricarmen; Levisohn, Sharon

    2005-06-01

    Increasing use of Mycoplasma gallisepticum (MG) live vaccines has led to a need for a rapid test for differentiation of MG field strains from the live vaccine strains ts-11 and 6/85. We examined the differentiating potential of diagnostic polymerase chain reaction (PCR) primers targeted to the gene mgc2, encoding a cytadherence-related surface protein uniquely present in MG. The mgc2-PCR diagnostic primers are specific for MG in tests of all avian mycoplasmas or bacteria present in the chicken trachea and are sensitive enough to readily detect MG in tracheal swabs from field outbreaks. Differentiation of vaccine strain ts-11 was based on identification of restriction enzyme sites in the 300-base-pair (bp) mgc2-PCR amplicon present in ts-11 and missing in MG isolates from field outbreaks in Israel. Restriction sites for the enzymes HaeII and SfaN1 were identified in the amplified region in strain ts-11 and were not found in 28 field isolates of MG, comprising a representative cross section of all the MG isolates from the period 1997-2003. In practice, differential diagnosis of MG is achieved within 1 day of submission of tracheal swab samples by mgc2-PCR amplification and restriction of the amplicon with HaeII, giving a 270-bp fragment for ts-11 or no restriction for other MG strains tested. Application of the mgc2-PCR-restriction fragment length polymorphism (mgc2-PCR-RFLP) assay enabled differential diagnosis of both components of a mixture of ts-11 and non-ts-11 DNA, detecting the field strain in the presence of a large excess of ts-11. The test was successfully applied in vivo for monitoring vaccinates in a ts-11 vaccine trial. In principle, the test may also be used to identify the 6/85 vaccine strain, which yields a 237-bp product, readily differentiated from the approximately 300-bp PCR product of all other strains tested. Further testing of field isolates will be necessary to determine the applicability of this test in the United States and other countries.

  7. Use of PCR-RFLP (Polymerase Chain Reaction - Restricted Fragment Length Polymorphism in the gene of the enzyme Stearoyl-CoA-Desaturase in Bubalus bubalis

    Directory of Open Access Journals (Sweden)

    H. Tonhati

    2010-02-01

    Full Text Available The milk is an important food because it contents Conjugated Linoleic Acids (CLA. These fatty acids are synthesized in mammary gland under action of the enzyme Stearoyl CoA-Desaturase (SCD and have showed some positive effects in human disease prevention and treatments. A variation of CLA in milk fat exists and can be partially explained by the different levels of expression of SCD. The aim was to study part of the encoding regions of SCD´s gene using PCR-RFLP (Polymerase Chain Reaction-Restriction Fragment Length Polymorphism. Genomic DNA was extracted from lactating Murrah females. After this, PCR reactions were made by using primers Z43D1 that encloses exon I, II and intron I. The fragments amplified are composed by 938 pb. Then, RFLP techniques were applied in the fragments using the restriction enzymes Pst I and Sma I. The enzyme Pst I has generated fragments of 788pb and 150bp and the Sma I has generated fragments of 693pb and 245pb. All the animals showed the same migration standard for both enzymes, characterizing a genetic monomorphism for this region of SCD gene. The analysis determined that there aren’t genetic differences between these animals in the studied regions by using Pst I and Sma I enzymes.

  8. A semester-long project for teaching basic techniques in molecular biology such as restriction fragment length polymorphism analysis to undergraduate and graduate students.

    Science.gov (United States)

    DiBartolomeis, Susan M

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky(73). Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers.

  9. [Establishing a new genotyping method of hepatitis B virus by polymerase chain reaction- restriction fragment length polymorphism (PCR-RFLP) to analysis on S region and its application].

    Science.gov (United States)

    Peng, Liang; Ding, Jing-Juan; Zhang, Li-Sha

    2004-08-01

    To establish a new polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method of genotyping HBV using Mbo I, BsTN I, BsmA I, Hpa II and investigate the relationship between genotype and clinical spectrum of hepatitis B. 124 full-genomic HBV sequences and 13 S-genomic sequences were analyzed, genotype specific regions were identified by the restriction enzymes Mbo I, BsTN I, BsmA I, Hpa II. And 176 samples from different kinds of hepatitis B were genotyped by this method. Five samples had been randomly selected and directly sequenced their S gene, to assess the accuracy. In 176 serum samples of patients with hepatitis B from Guizhou area, genotype B and C were found in 56.8% and 43.2% respectively. The proportions of genotype B and C in ASC were 40.0% and 15.7% (chi-square = 12.16, P < 0.005); and they were 31.6% and 14.0% in CHB (chi-square = 7.88, P < 0.005). Genotyping HBV, based on S gene RFLP seems to be highly sensitive, differential and accurate and could be used in large-scale surveys. HBV genotype B and C are existed in Guizhou area.

  10. Molecular identification of Candida species isolated from cases of neonatal candidemia using polymerase chain reaction-restriction fragment length polymorphism in a tertiary care hospital

    Directory of Open Access Journals (Sweden)

    Akeela Fatima

    2017-01-01

    Full Text Available Context: Candida spp. is an emerging cause of bloodstream infections worldwide. Delay in speciation of Candida isolates by conventional methods and resistance to antifungal drugs in various Candida species are responsible for the increase in morbidity and mortality due to candidemia. Hence, the rapid identification of Candida isolates is very important for the proper management of patients with candidemia. Aims: The aim was to re-evaluate the identification of various Candida spp. by polymerase chain reaction (PCR-restriction fragment length polymorphism (RFLP and to evaluate the accuracy, speed, and cost of phenotypic methodology versus PCR-RFLP. Settings and Design: Hospital-based cross-sectional study. Materials and Methods: Ninety consecutive clinical isolates of seven Candida species, isolated from blood of neonates and identified by routine phenotypic methods, were re-evaluated using universal primers internal transcribed spacer 1 (ITS1 and ITS4 for PCR amplification and Msp I restriction enzyme for RFLP. Statistical Analysis Used: Kappa test for agreement. Results: The results of PCR-RFLP were 100% in agreement with those obtained using conventional phenotypic methods. Identification could be achieved within 3 work days by both the methods. Our routine methods proved to be cost effective than PCR-RFLP. Conclusions: We can continue with our routine phenotypic methods and PCR-RFLP can be used for periodic quality control or when conventional methods fail to identify a species.

  11. Genetic Characterization of Campylobacter Jejuni and C. coli Isolated From Broilers Using flaA PCR-Restriction Fragment Length Polymorphism Method in Shiraz, Southern Iran.

    Science.gov (United States)

    Khoshbakht, Rahem; Tabatabaei, Mohammad; Hosseinzadeh, Saeid; Shirzad Aski, Hesamaddin; Seifi, Saeed

    2015-05-01

    Thermophilic campylobacters, particularly Campylobacter jejuni and C. coli are the main agents of human campylobacteriosis. Campylobacter contaminated chicken products is the most important source of foodborne gastroenteritis. Evaluation of genetic diversity among Campylobacter population is critical for understanding the epidemiology of this bacterium and developing effective control strategies against Campylobacter infections and other related disorders. The aim of this study was to investigate the polymorphism of thermophilic Campylobacter isolated from broiler fecal samples in Shiraz, southern Iran. Ninety Campylobacter isolates were recovered from broiler feces using enrichment process followed by cultivation method. The isolates were species typing on the basis of polymerase chain reaction (PCR) detection of 16SrRNA and multiplex PCR for determining two thermophilic species. To evaluate strain diversity of thermophilic Campylobacter isolates, flaA PCR-Restriction Fragment Length Polymorphism (RFLP) was performed using DdeI restriction enzyme. All 90 Campylobacter isolates confirmed by m-PCR were successfully typed using flaA-PCR-RFLP. Eleven different types were defined according to flaA-typing method and the RFLP patterns were located at three separate clusters in RFLP image analysis dendrogram. Campylobacter jejuni isolates significantly showed more variety than C. coli isolates. A relatively low genetic diversity existed among C. jejuni and C. coli isolated from broilers in Shiraz, southern Iran. In our knowledge, this was the first report of genetic diversity among broiler originated human pathogen thermophilic campylobacters in Shiraz, southern Iran.

  12. Genotyping of infectious bursal disease virus strains by restriction fragment length polymorphism analysis of the VP1, VP2, and VP3 genes.

    Science.gov (United States)

    Gomes, A D; Abreu, J T; Redondo, R A F; Martins, N R S; Resende, J S; Resende, M

    2005-12-01

    SUMMARY. This study aimed to genotype infectious bursal disease virus (IBDV) isolates from the Minas Gerais state poultry industry. RNA was extracted from bursae obtained from field cases without passage or commercial vaccines. Genetic subtyping of IBDV isolates and vaccine strains was carried out by the reverse transcriptase-polymerase chain reaction (RT-PCR) and restriction fragment length polymorphism (RFLP) analysis. A 588-bp fragment in the VP1 gene, an 847-bp fragment in the VP2 gene, and a 320-bp fragment in the VP3 gene were amplified by PCR and digested with restriction enzymes PstI and ScaI (VP1); BamHI, BstEII, and PstI (VP2); and NcoI, ScaI, and XbaI (VP3). Our work shows that complementing the clinical history of the outbreaks with RT-PCR followed by RFLP analysis using PstI for VP1, BamHI for VP2, and XbaI for VP3 allowed an accurate classification of a causative agent as a very virulent IBDV.

  13. A Semester-Long Project for Teaching Basic Techniques in Molecular Biology Such as Restriction Fragment Length Polymorphism Analysis to Undergraduate and Graduate Students

    Science.gov (United States)

    DiBartolomeis, Susan M.

    2011-01-01

    Several reports on science education suggest that students at all levels learn better if they are immersed in a project that is long term, yielding results that require analysis and interpretation. I describe a 12-wk laboratory project suitable for upper-level undergraduates and first-year graduate students, in which the students molecularly locate and map a gene from Drosophila melanogaster called dusky and one of dusky's mutant alleles. The mapping strategy uses restriction fragment length polymorphism analysis; hence, students perform most of the basic techniques of molecular biology (DNA isolation, restriction enzyme digestion and mapping, plasmid vector subcloning, agarose and polyacrylamide gel electrophoresis, DNA labeling, and Southern hybridization) toward the single goal of characterizing dusky and the mutant allele dusky73. Students work as individuals, pairs, or in groups of up to four students. Some exercises require multitasking and collaboration between groups. Finally, results from everyone in the class are required for the final analysis. Results of pre- and postquizzes and surveys indicate that student knowledge of appropriate topics and skills increased significantly, students felt more confident in the laboratory, and students found the laboratory project interesting and challenging. Former students report that the lab was useful in their careers. PMID:21364104

  14. Biological markers of asexuality: Handedness, birth order, and finger length ratios in self-identified asexual men and women.

    Science.gov (United States)

    Yule, Morag A; Brotto, Lori A; Gorzalka, Boris B

    2014-02-01

    Human asexuality is defined as a lack of sexual attraction to anyone or anything and it has been suggested that it may be best conceptualized as a sexual orientation. Non-right-handedness, fraternal birth order, and finger length ratio (2D:4D) are early neurodevelopmental markers associated with sexual orientation. We conducted an Internet study investigating the relationship between self-identification as asexual, handedness, number of older siblings, and self-measured finger-lengths in comparison to individuals of other sexual orientation groups. A total of 325 asexuals (60 men and 265 women; M age, 24.8 years), 690 heterosexuals (190 men and 500 women; M age, 23.5 years), and 268 non-heterosexuals (homosexual and bisexual; 64 men and 204 women; M age, 29.0 years) completed online questionnaires. Asexual men and women were 2.4 and 2.5 times, respectively, more likely to be non-right-handed than their heterosexual counterparts and there were significant differences between sexual orientation groups in number of older brothers and older sisters, and this depended on handedness. Asexual and non-heterosexual men were more likely to be later-born than heterosexual men, and asexual women were more likely to be earlier-born than non-heterosexual women. We found no significant differences between sexual orientation groups on measurements of 2D:4D ratio. This is one of the first studies to test and provide preliminary empirical support for an underlying neurodevelopmental basis to account for the lack of sexual attraction characteristic of asexuality.

  15. Optimal Decision-Making in Fuzzy Economic Order Quantity (EOQ Model under Restricted Space: A Non-Linear Programming Approach

    Directory of Open Access Journals (Sweden)

    M. Pattnaik

    2013-08-01

    Full Text Available In this paper the concept of fuzzy Non-Linear Programming Technique is applied to solve an economic order quantity (EOQ model under restricted space. Since various types of uncertainties and imprecision are inherent in real inventory problems they are classically modeled using the approaches from the probability theory. However, there are uncertainties that cannot be appropriately treated by usual probabilistic models. The questions how to define inventory optimization tasks in such environment how to interpret optimal solutions arise. This paper allows the modification of the Single item EOQ model in presence of fuzzy decision making process where demand is related to the unit price and the setup cost varies with the quantity produced/Purchased. This paper considers the modification of objective function and storage area in the presence of imprecisely estimated parameters. The model is developed for the problem by employing different modeling approaches over an infinite planning horizon. It incorporates all concepts of a fuzzy arithmetic approach, the quantity ordered and the demand per unit compares both fuzzy non linear and other models. Investigation of the properties of an optimal solution allows developing an algorithm whose validity is illustrated through an example problem and ugh MATLAB (R2009a version software, the two and three dimensional diagrams are represented to the application. Sensitivity analysis of the optimal solution is also studied with respect to changes in different parameter values and to draw managerial insights of the decision problem.

  16. Molecular typing of Iranian mycobacteria isolates by polymerase chain reaction-restriction fragment length polymorphism analysis of 360-bp rpoB gene.

    Science.gov (United States)

    Hadifar, Shima; Moghim, Sharareh; Fazeli, Hossein; GhasemianSafaei, Hajieh; Havaei, Seyed Asghar; Farid, Fariba; Esfahani, Bahram Nasr

    2015-01-01

    Diagnosis and typing of Mycobacterium genus provides basic tools for investigating the epidemiology and pathogenesis of this group of bacteria. Polymerase chain reaction (PCR)-restriction fragment length polymorphism analysis (PRA) is an accurate method providing diagnosis and typing of species of mycobacteria. The present study is conducted by the purpose of determining restriction fragment profiles of common types of mycobacteria by PRA method of rpoB gene in this geographical region. Totally 60 clinical and environmental isolates from February to October, 2013 were collected and subcultured and identified by phenotypic methods. A 360 bp fragment of the rpoB gene amplified by PCR and products were digested by MspI and HaeIII enzymes. In the present study, of all mycobacteria isolates identified by PRA method, 13 isolates (21.66%) were Mycobacterium tuberculosis, 34 isolates (56.66%) were rapidly growing Nontuberculosis Mycobacteria (NTM) that including 26 clinical isolates (43.33%) and 8 environmental isolates (13.33%), 11 isolates (18.33%) were clinical slowly growing NTM. among the clinical NTM isolates, Mycobacterium fortuitum Type I with the frequency of 57.77% was the most prevalent type isolates. Furthermore, an unrecorded of the PRA pattern of Mycobacterium conceptionense (HeaIII: 120/90/80, MspI: 120/105/80) was found. This study demonstrated that the PRA method was high discriminatory power for identification and typing of mycobacteria species and was able to identify 96.6% of all isolates. Based on the result of this study, rpoB gene could be a potentially useful tool for identification and investigation of molecular epidemiology of mycobacterial species.

  17. Mapping of the human APOB gene to chromosome 2p and demonstration of a two-allele restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Huang, L.; Miller, D.A.; Bruns, G.A.P.; Breslow, J.L.

    1986-01-01

    ApoB is a large glycoprotein with an apparent molecular mass of 550 kDa on NaDodSO 4 /PAGE. Recently, apoB cDNA clones have been isolated from an expression library made with mRNA from a human hepatoma cell line. These clones, which were all 1.5-1.6 kilobases (kb) long and corresponded to the 3' end of apoB mRNA, were used to demonstrate that hepatic apoB mRNA is ≅ 22 kb long. In the current report, a probe derived from one of these cDNA clones, pB8, was used for in situ hybridization experiments to map the human gene for apoB, APOB, to the distal half of the short arm of chromosome 2. This probe was also used to analyze somatic cell hybrids and, in agreement with the in situ hybridization studies, concordancy was demonstrated with chromosome 2. In addition, two hybrids with chromosome 2 translocations that contain only the short arm reacted with the pB8 probe. A third hybrid with a complex rearrangement of chromosome 2, which deleted an interstitial region and the tip of the short arm of chromosome 2, did not react. These data indicate that APOB maps to either 2p21-p23 or 2p24-pter. In further studies, DNA from normal individuals, digested with the restriction endonuclease EcoRI and subjected to Southern blot analysis with the pB8 probe, revealed a two-allele restriction fragment length polymorphism (RFLP). The mapping studies provide the means for understanding the relationship of the APOB locus to others in the human genome, whereas the demonstration of an APOB RFLP increases their ability to assess the role of this locus in determining plasma lipoprotein levels

  18. Comparative analysis of human cytomegalovirus a-sequence in multiple clinical isolates by using polymerase chain reaction and restriction fragment length polymorphism assays.

    Science.gov (United States)

    Zaia, J A; Gallez-Hawkins, G; Churchill, M A; Morton-Blackshere, A; Pande, H; Adler, S P; Schmidt, G M; Forman, S J

    1990-01-01

    The human cytomegalovirus (HCMV) a-sequence (a-seq) is located in the joining region between the long (L) and short (S) unique sequences of the virus (L-S junction), and this hypervariable junction has been used to differentiate HCMV strains. The purpose of this study was to investigate whether there are differences among strains of human cytomegalovirus which could be characterized by polymerase chain reaction (PCR) amplification of the a-seq of HCMV DNA and to compare a PCR method of strain differentiation with conventional restriction fragment length polymorphism (RFLP) methodology by using HCMV junction probes. Laboratory strains of HCMV and viral isolates from individuals with HCMV infection were characterized by using both RFLPs and PCR. The PCR assay amplified regions in the major immediate-early gene (IE-1), the 64/65-kDa matrix phosphoprotein (pp65), and the a-seq of the L-S junction region. HCMV laboratory strains Towne, AD169, and Davis were distinguishable, in terms of size of the amplified product, when analyzed by PCR with primers specific for the a-seq but were indistinguishable by using PCR targeted to IE-1 and pp65 sequences. When this technique was applied to a characterization of isolates from individuals with HCMV infection, selected isolates could be readily distinguished. In addition, when the a-seq PCR product was analyzed with restriction enzyme digestion for the presence of specific sequences, these DNA differences were confirmed. PCR analysis across the variable a-seq of HCMV demonstrated differences among strains which were confirmed by RFLP in 38 of 40 isolates analyzed. The most informative restriction enzyme sites in the a-seq for distinguishing HCMV isolates were those of MnlI and BssHII. This indicates that the a-seq of HCMV is heterogeneous among wild strains, and PCR of the a-seq of HCMV is a practical way to characterize differences in strains of HCMV. Images PMID:1980680

  19. Genetic Diversity of African and Worldwide Strains of Ralstonia solanacearum as Determined by PCR-Restriction Fragment Length Polymorphism Analysis of the hrp Gene Region

    Science.gov (United States)

    Poussier, Stephane; Vandewalle, Peggy; Luisetti, Jacques

    1999-01-01

    The genetic diversity among a worldwide collection of 120 strains of Ralstonia solanacearum was assessed by restriction fragment length polymorphism (RFLP) analysis of amplified fragments from the hrp gene region. Five amplified fragments appeared to be specific to R. solanacearum. Fifteen different profiles were identified among the 120 bacterial strains, and a hierarchical cluster analysis distributed them into eight clusters. Each cluster included strains belonging to a single biovar, except for strains of biovars 3 and 4, which could not be separated. However, the biovar 1 strains showed rather extensive diversity since they were distributed into five clusters whereas the biovar 2 and the biovar 3 and 4 strains were gathered into one and two clusters, respectively. PCR-RFLP analysis of the hrp gene region confirmed the results of previous studies which split the species into an “Americanum” division including biovar 1 and 2 strains and an “Asiaticum” division including biovar 3 and 4 strains. However, the present study showed that most of the biovar 1 strains, originating from African countries (Reunion Island, Madagascar, Zimbabwe, and Angola) and being included in a separate cluster, belong to the “Asiaticum” rather than to the “Americanum” division. These African strains could thus have evolved separately from other biovar 1 strains originating from the Americas. PMID:10224018

  20. Analysis of the bacterial diversity existing on animal hide and wool: development of a preliminary PCR-restriction fragment length polymorphism fingerprint database for identifying isolates.

    Science.gov (United States)

    Chen, Yu; Gao, Hongwei; Zhang, Yanming; Deng, Mingjun; Wu, Zhenxing; Zhu, Laihua; Duan, Qing; Xu, Biao; Liang, Chengzhu; Yue, Zhiqin; Xiao, Xizhi

    2012-01-01

    Twenty-one bacterial strains were isolated from imported cattle hide and rabbit wool using two types of media, nutrient broth, and nutrient broth with serum. The bacteria identified were Brevibacillus laterosporus, Leclercia adecarboxylata, Peptococcus niger, Bacillus circulans, Raoultella ornithinolytica, Bacillus subtilis, Bacillus cereus, Bacillus thermobacillus, Bacillus choshinensis, Bacillus sphaericus, Acinetobacter haemolyticus, Sphingomonas paucimobilis, Bacillus thuringiensis, Staphylococcus intermedius, Mycobacteria, Moraxella, Klebsiella pneumoniae, Ralstonia pickettii, Staphylococcus chromogenes, Comamonas testosteroni, and Cupriavidus pauculus. The 16s rDNA gene of each bacterium was amplified using the universal primers 27f and 1492r. The amplicons were digested with AvaI, BamHI, BgII, DraI, EcoRI, EcoRV, HindIII, HinfI, HpaI, PstI, SmaI, TaqII, XbaI, XmaI, AluI, XhoI, and PvuI individually. A specific fingerprint from the PCR-restriction fragment length polymorphism method based on 16s rDNA was obtained for each bacterium. The results showed that the method developed was useful not only for bacterial identification but also for the etiological investigation of pathogens in imported animal hair and wool.

  1. Clustering of Beijing genotype Mycobacterium tuberculosis isolates from the Mekong delta in Vietnam on the basis of variable number of tandem repeat versus restriction fragment length polymorphism typing

    Directory of Open Access Journals (Sweden)

    Huyen Mai NT

    2013-02-01

    Full Text Available Abstract Background In comparison to restriction fragment length polymorphism (RFLP typing, variable number of tandem repeat (VNTR typing is easier to perform, faster and yields results in a simple, numerical format. Therefore, this technique has gained recognition as the new international gold standard in typing of Mycobacterium tuberculosis. However, some reports indicated that VNTR typing may be less suitable for Beijing genotype isolates. We therefore compared the performance of internationally standardized RFLP and 24 loci VNTR typing to discriminate among 100 Beijing genotype isolates from the Southern Vietnam. Methods Hundred Beijing genotype strains defined by spoligotyping were randomly selected and typed by RFLP and VNTR typing. The discriminatory power of VNTR and RFLP typing was compared using the Bionumerics software. Results Among 95 Beijing strains available for analysis, 14 clusters were identified comprising 34 strains and 61 unique profiles in 24 loci VNTR typing ((Hunter Gaston Discrimination Index (HGDI = 0.994. 13 clusters containing 31 strains and 64 unique patterns in RFLP typing (HGDI = 0.994 were found. Nine RFLP clusters were subdivided by VNTR typing and 12 VNTR clusters were split by RFLP. Five isolates (5% revealing double alleles or no signal in two or more loci in VNTR typing could not be analyzed. Conclusions Overall, 24 loci VNTR typing and RFLP typing had similar high-level of discrimination among 95 Beijing strains from Southern Vietnam. However, loci VNTR 154, VNTR 2461 and VNTR 3171 had hardly added any value to the level of discrimination.

  2. Application of restriction fragment length polymorphism analysis to simple and rapid genotyping of bovine viral diarrhea virus strains isolated in Japan.

    Science.gov (United States)

    Seki, Yoshihisa; Seimiya, Yukio M; Motokawa, Masato; Yaegashi, Gakuji; Nagai, Makoto; Hayashi, Michiko

    2008-04-01

    The E2 regions of 177 bovine viral diarrhea virus (BVDV) strains isolated in Japan between 1957 and 2006 were analyzed for genotyping. The strains were classified into 8 genotypes (1a, 1b, 1c, 1d, 1e, 1f, So and 2a) based on the phylogenetic analysis. The restriction fragment length polymorphism (RFLP) analysis of the RT-PCR products using 6 selected enzymes (Apo I, Mly I, BstAP I, Pvu II, Ear I, EcoR V) disclosed the cutting patterns classified into 11 groups (I-XI), each of that consisted of strains belonging to a single genotype. Namely, groups-I and -II were composed by genotype-1a strains, groups-III and -IV by 1b strains, and groups-V and -VI by 1c strains. Other groups-VII, -VIII, -IX, -X and -XI comprised genotypes-1d, -1e, -1f, -So and -2a strains, respectively. The results suggest that the RFLP analysis can simply and rapidly differentiate the 8 genotypes of BVDV strains.

  3. The prevalence of cryptosporidiosis in Turkish children, and geno typing of isolates by nested polymerase chain reaction-restriction fragment length polymorphism

    International Nuclear Information System (INIS)

    Tamer, Gulden S.; Turk, M.; Dagci, H.; Pektas, B.; Guruz, Adnan Y.; Uner, A.; Guy, E.C.

    2007-01-01

    Objective was to verify the incidence of cryptosporidiosis among Turkish elementary school students. The study was conducted in the Dept. of Parasitology, Faculty of Medicine, Ege University, Turkey during a 3-month period in 2006. We assessed the fecal samples of 707 children using modified acid-fast and phenol-auramine staining followed by modified Ritchie concentration method. All cryptosporidium species isolates were analysed by nested polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) to differentiate genotypes of the isolates. After the coprological examination, 4 samples were found to be positive for cryptosporidium species oocysts. In the present study, all 4 oocysts were of zoonotic origin and belonged to cryptoporodium parvum genotype 2 indicating that in Turkey the potential sources of human cryptosporidiosis is from animals. The application of genotyping to clinical isolates of cryptosporidium has significantly increased our knowledge and understanding of the distribution and epidemiology of this parasite. The PCR and RFLP techniques represent a more rapid and simple method of genotyping to support epidemiological and clinical investigations than conventional analytical DNA techniques. (author)

  4. Pst I restriction fragment length polymorphism of human placental alkaline phosphatase gene: Mendelian in segregation and localization of mutation site in the gene

    International Nuclear Information System (INIS)

    Tsavaler, L.; Penhallow, R.C.; Sussman, H.H.

    1988-01-01

    The pattern of inheritance of a Pst I restriction fragment length polymorphism (RFLP) of the human placental alkaline phosphatase gene was studied in nine nuclear families by Southern blot hybridization analysis of genomic DNA. The dimorphic RFLP is defined by the presence of allelic fragments 1.0 kilobase and 0.8 kilobase long. The results of this study show that the two alleles of the Pst I RFLP of the placental alkaline phosphatase gene segregate as codominant traits according to Mendelian expectations. For a polymorphism to be useful as a genetic marker the probability that an offspring is informative (PIC) must be at least 0.15. The allelic frequency of the 1.0-kilobase allele is 0.21, which correlates to a probability that an offspring is informative of 0.275 and is indicative of a useful polymorphism. By using probes derived from different regions of the placental alkaline phosphatase cDNA, the mutated Pst I site causing the RFLP was located in the penultimate intron 2497 base pairs downstream from the transcriptional initiation site

  5. Novel polymerase chain reaction-restriction fragment length polymorphism assay to determine internal transcribed spacer-2 group in the Chagas disease vector, Triatoma dimidiata (Latreille, 1811

    Directory of Open Access Journals (Sweden)

    Bethany Richards

    2013-06-01

    Full Text Available Triatoma dimidiata is the most important Chagas disease insect vector in Central America as this species is primarily responsible for Trypanosoma cruzi transmission to humans, the protozoan parasite that causes Chagas disease. T. dimidiata sensu lato is a genetically diverse assemblage of taxa and effective vector control requires a clear understanding of the geographic distribution and epidemiological importance of its taxa. The nuclear ribosomal internal transcribed spacer 2 (ITS-2 is frequently used to infer the systematics of triatomines. However, oftentimes amplification and sequencing of ITS-2 fails, likely due to both the large polymerase chain reaction (PCR product and polymerase slippage near the 5' end. To overcome these challenges we have designed new primers that amplify only the 3'-most 200 base pairs of ITS-2. This region distinguishes the ITS-2 group for 100% of known T. dimidiata haplotypes. Furthermore, we have developed a PCR-restriction fragment length polymorphism (RFLP approach to determine the ITS-2 group, greatly reducing, but not eliminating, the number of amplified products that need to be sequenced. Although there are limitations with this new PCR-RFLP approach, its use will help with understanding the geographic distribution of T. dimidiata taxa and can facilitate other studies characterising the taxa, e.g. their ecology, evolution and epidemiological importance, thus improving vector control.

  6. SMART amplification combined with cDNA size fractionation in order to obtain large full-length clones

    Directory of Open Access Journals (Sweden)

    Poustka Annemarie

    2004-06-01

    Full Text Available Abstract Background cDNA libraries are widely used to identify genes and splice variants, and as a physical resource for full-length clones. Conventionally-generated cDNA libraries contain a high percentage of 5'-truncated clones. Current library construction methods that enrich for full-length mRNA are laborious, and involve several enzymatic steps performed on mRNA, which renders them sensitive to RNA degradation. The SMART technique for full-length enrichment is robust but results in limited cDNA insert size of the library. Results We describe a method to construct SMART full-length enriched cDNA libraries with large insert sizes. Sub-libraries were generated from size-fractionated cDNA with an average insert size of up to seven kb. The percentage of full-length clones was calculated for different size ranges from BLAST results of over 12,000 5'ESTs. Conclusions The presented technique is suitable to generate full-length enriched cDNA libraries with large average insert sizes in a straightforward and robust way. The representation of full-coding clones is high also for large cDNAs (70%, 4–10 kb, when high-quality starting mRNA is used.

  7. 15 CFR 744.13 - Restrictions on exports and reexports to persons designated pursuant to Executive Order 12947...

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Restrictions on exports and reexports....13 Section 744.13 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade... POLICY: END-USER AND END-USE BASED § 744.13 Restrictions on exports and reexports to persons designated...

  8. Molecular identification of Mycobacterium tuberculosis complex by region of differentiation-typing and polymerase chain reaction-restriction fragment length polymorphism method.

    Science.gov (United States)

    Mirzaki, Seydeh Zeinab; Mosavari, Nader; Nazari, Razieh; Akbarian, Morteza

    2016-12-01

    Tuberculosis (TB) is one of the most common zoonotic infectious diseases in the world. Identification of Mycobacterium isolates is essential for proper treatment of TB. The aim of this study was to identify Mycobacterium isolates collected from TB patients in Alborz Province, Iran, by region of differentiation (RD)-typing. Fifty samples from tuberculosis patients were cultured in pyruvate and glycerinated Lowenstein-Jensen medium. DNA was extracted from the isolates by the van Solingen method and subjected to polymerase chain reaction (PCR)-16SrRNA, PCR-IS6110, and RD-typing with primers RD1, RD4, RD9, and RD12, respectively. Out of 50 isolates, only one isolate appeared negative in IS6110-PCR and was considered nontuberculosis complex. The remaining isolates gave PCR products of approximately 543bp, 245bp, 146bp, 172bp, 235bp, and 369bp with 16s-rRNA, IS6110-PCR, RD-1, RD-4, RD-9, and RD-12 PCR, respectively. PCR-restriction fragment length polymorphism of oxyR pseudogene confirmed the results. All isolates except one from Alborz Province appeared positive for Mycobacterium tuberculosis. Based on the obtained results, all isolates except one were identified as M. tuberculosis. The only negative isolate appeared 93% and 97% similar to Nocardia or Mycobacterium sp. (Mycobacterium neoaurum), respectively, based on sequencing and alignment of 16s-rRNA and hsp65. Accurate identification of Mycobacterium isolates is of utmost importance for proper and immediate treatment of TB patients. In this study, RD-typing appeared to be a suitable method for correct identification of M. tuberculosis isolates. Copyright © 2016.

  9. Detection and Resolution of Cryptosporidium Species and Species Mixtures by Genus-Specific Nested PCR-Restriction Fragment Length Polymorphism Analysis, Direct Sequencing, and Cloning ▿

    Science.gov (United States)

    Ruecker, Norma J.; Hoffman, Rebecca M.; Chalmers, Rachel M.; Neumann, Norman F.

    2011-01-01

    Molecular methods incorporating nested PCR-restriction fragment length polymorphism (RFLP) analysis of the 18S rRNA gene of Cryptosporidium species were validated to assess performance based on limit of detection (LoD) and for detecting and resolving mixtures of species and genotypes within a single sample. The 95% LoD was determined for seven species (Cryptosporidium hominis, C. parvum, C. felis, C. meleagridis, C. ubiquitum, C. muris, and C. andersoni) and ranged from 7 to 11 plasmid template copies with overlapping 95% confidence limits. The LoD values for genomic DNA from oocysts on microscope slides were 7 and 10 template copies for C. andersoni and C. parvum, respectively. The repetitive nested PCR-RFLP slide protocol had an LoD of 4 oocysts per slide. When templates of two species were mixed in equal ratios in the nested PCR-RFLP reaction mixture, there was no amplification bias toward one species over another. At high ratios of template mixtures (>1:10), there was a reduction or loss of detection of the less abundant species by RFLP analysis, most likely due to heteroduplex formation in the later cycles of the PCR. Replicate nested PCR was successful at resolving many mixtures of Cryptosporidium at template concentrations near or below the LoD. The cloning of nested PCR products resulted in 17% of the cloned sequences being recombinants of the two original templates. Limiting-dilution nested PCR followed by the sequencing of PCR products resulted in no sequence anomalies, suggesting that this method is an effective and accurate way to study the species diversity of Cryptosporidium, particularly for environmental water samples, in which mixtures of parasites are common. PMID:21498746

  10. Differentiation of canine distemper virus isolates in fur animals from various vaccine strains by reverse transcription-polymerase chain reaction-restriction fragment length polymorphism according to phylogenetic relations in china

    Directory of Open Access Journals (Sweden)

    Zhao Jianjun

    2011-02-01

    Full Text Available Abstract In order to effectively identify the vaccine and field strains of Canine distemper virus (CDV, a new differential diagnostic test has been developed based on reverse transcription-polymerase chain reaction (RT-PCR and restriction fragment length polymorphism (RFLP. We selected an 829 bp fragment of the nucleoprotein (N gene of CDV. By RFLP analysis using BamHI, field isolates were distinguishable from the vaccine strains. Two fragments were obtained from the vaccine strains by RT-PCR-RFLP analysis while three were observed in the field strains. An 829 nucleotide region of the CDV N gene was analyzed in 19 CDV field strains isolated from minks, raccoon dogs and foxes in China between 2005 and 2007. The results suggest this method is precise, accurate and efficient. It was also determined that three different genotypes exist in CDV field strains in fur animal herds of the north of China, most of which belong to Asian type. Mutated field strains, JSY06-R1, JSY06-R2 and JDH07-F1 also exist in Northern China, but are most closely related to the standard virulent strain A75/17, designated in Arctic and America-2 genetype in the present study, respectively.

  11. 15 CFR 744.8 - Restrictions on exports and reexports to persons designated pursuant to Executive Order 13382...

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Restrictions on exports and reexports... Destruction Proliferators and Their Supporters. 744.8 Section 744.8 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) BUREAU OF INDUSTRY AND SECURITY, DEPARTMENT OF COMMERCE...

  12. 15 CFR 744.12 - Restrictions on exports and reexports to persons designated in or pursuant to Executive Order...

    Science.gov (United States)

    2010-01-01

    ... 15 Commerce and Foreign Trade 2 2010-01-01 2010-01-01 false Restrictions on exports and reexports...) (SDGT). 744.12 Section 744.12 Commerce and Foreign Trade Regulations Relating to Commerce and Foreign Trade (Continued) BUREAU OF INDUSTRY AND SECURITY, DEPARTMENT OF COMMERCE EXPORT ADMINISTRATION...

  13. Some applications of the most general form of the higher-order GUP with minimal length uncertainty and maximal momentum

    Science.gov (United States)

    Shababi, Homa; Chung, Won Sang

    2018-04-01

    In this paper, using the new type of D-dimensional nonperturbative Generalized Uncertainty Principle (GUP) which has predicted both a minimal length uncertainty and a maximal observable momentum,1 first, we obtain the maximally localized states and express their connections to [P. Pedram, Phys. Lett. B 714, 317 (2012)]. Then, in the context of our proposed GUP and using the generalized Schrödinger equation, we solve some important problems including particle in a box and one-dimensional hydrogen atom. Next, implying modified Bohr-Sommerfeld quantization, we obtain energy spectra of quantum harmonic oscillator and quantum bouncer. Finally, as an example, we investigate some statistical properties of a free particle, including partition function and internal energy, in the presence of the mentioned GUP.

  14. Properties of hypothesis testing techniques and (Bayesian) model selection for exploration-based and theory-based (order-restricted) hypotheses.

    Science.gov (United States)

    Kuiper, Rebecca M; Nederhoff, Tim; Klugkist, Irene

    2015-05-01

    In this paper, the performance of six types of techniques for comparisons of means is examined. These six emerge from the distinction between the method employed (hypothesis testing, model selection using information criteria, or Bayesian model selection) and the set of hypotheses that is investigated (a classical, exploration-based set of hypotheses containing equality constraints on the means, or a theory-based limited set of hypotheses with equality and/or order restrictions). A simulation study is conducted to examine the performance of these techniques. We demonstrate that, if one has specific, a priori specified hypotheses, confirmation (i.e., investigating theory-based hypotheses) has advantages over exploration (i.e., examining all possible equality-constrained hypotheses). Furthermore, examining reasonable order-restricted hypotheses has more power to detect the true effect/non-null hypothesis than evaluating only equality restrictions. Additionally, when investigating more than one theory-based hypothesis, model selection is preferred over hypothesis testing. Because of the first two results, we further examine the techniques that are able to evaluate order restrictions in a confirmatory fashion by examining their performance when the homogeneity of variance assumption is violated. Results show that the techniques are robust to heterogeneity when the sample sizes are equal. When the sample sizes are unequal, the performance is affected by heterogeneity. The size and direction of the deviations from the baseline, where there is no heterogeneity, depend on the effect size (of the means) and on the trend in the group variances with respect to the ordering of the group sizes. Importantly, the deviations are less pronounced when the group variances and sizes exhibit the same trend (e.g., are both increasing with group number). © 2014 The British Psychological Society.

  15. New poly(dimethylsiloxane)/poly(perfluorooctylethyl acrylate) block copolymers: structure and order across multiple length scales in thin films

    KAUST Repository

    Martinelli, Elisa

    2011-01-01

    Three sets of a new class of low surface tension block copolymers were synthesized consisting of a poly(dimethylsiloxane) (PDMS) block and a poly(perfluorooctylethyl acrylate) (AF8) block. The polymers were prepared using a bromo-terminated PDMS macroinitiator, to which was attached an AF8 block grown using atom transfer radical polymerization (ATRP) in such a designed way that the molecular weight and composition of the two polymer blocks were regularly varied. The interplay of both the phase separated microstructure and the mesomorphic character of the fluorinated domains with their effect on surface structure was evaluated using a suite of analytical tools. Surfaces of spin-coated and thermally annealed films were assessed using a combination of X-ray photoelectron spectroscopy (XPS) and near-edge X-ray absorption fine structure (NEXAFS) studies. Both atomic force microscopy (AFM) measurements and grazing incidence small angle X-ray scattering (GISAXS) studies were carried out to evaluate the microstructure of the thin films. Even in block copolymers in which the PDMS block was the majority component, a significant presence of the lower surface energy AF8 block was detected at the film surface. Moreover, the perfluorooctyl helices of the AF8 repeat units were highly oriented at the surface in an ordered, tilted smectic structure, which was compared with those of the bulk powder samples using wide-angle X-ray powder diffraction (WAXD) studies. © 2011 The Royal Society of Chemistry.

  16. Comparative Study of IS6110 Restriction Fragment Length Polymorphism and Variable-Number Tandem-Repeat Typing of Mycobacterium tuberculosis Isolates in the Netherlands, Based on a 5-Year Nationwide Survey

    Science.gov (United States)

    de Beer, Jessica L.; van Ingen, Jakko; de Vries, Gerard; Erkens, Connie; Sebek, Maruschka; Mulder, Arnout; Sloot, Rosa; van den Brandt, Anne-Marie; Enaimi, Mimount; Kremer, Kristin; Supply, Philip

    2013-01-01

    In order to switch from IS6110 and polymorphic GC-rich repetitive sequence (PGRS) restriction fragment length polymorphism (RFLP) to 24-locus variable-number tandem-repeat (VNTR) typing of Mycobacterium tuberculosis complex isolates in the national tuberculosis control program in The Netherlands, a detailed evaluation on discriminatory power and agreement with findings in a cluster investigation was performed on 3,975 tuberculosis cases during the period of 2004 to 2008. The level of discrimination of the two typing methods did not differ substantially: RFLP typing yielded 2,733 distinct patterns compared to 2,607 in VNTR typing. The global concordance, defined as isolates labeled unique or identically distributed in clusters by both methods, amounted to 78.5% (n = 3,123). Of the remaining 855 cases, 12% (n = 479) of the cases were clustered only by VNTR, 7.7% (n = 305) only by RFLP typing, and 1.8% (n = 71) revealed different cluster compositions in the two approaches. A cluster investigation was performed for 87% (n = 1,462) of the cases clustered by RFLP. For the 740 cases with confirmed or presumed epidemiological links, 92% were concordant with VNTR typing. In contrast, only 64% of the 722 cases without an epidemiological link but clustered by RFLP typing were also clustered by VNTR typing. We conclude that VNTR typing has a discriminatory power equal to IS6110 RFLP typing but is in better agreement with findings in a cluster investigation performed on an RFLP-clustering-based cluster investigation. Both aspects make VNTR typing a suitable method for tuberculosis surveillance systems. PMID:23363841

  17. Development and utility of cleaved amplified polymorphic sequences (CAPS) and restriction fragment length polymorphisms (RFLPs) linked to the Fom-2 fusarium wilt resistance gene in melon (Cucumis melo L.).

    Science.gov (United States)

    Zheng, X Y; Wolff, D W; Baudracco-Arnas, S; Pitrat, M

    1999-08-01

    Fusarium wilt, caused by Fusarium oxysporum Schlecht f. sp. melonis Snyder & Hans, is a worldwide soil-borne disease of melon (Cucumis melo L.). Resistance to races 0 and 1 of Fusarium wilt is conditioned by the dominant gene Fom-2. To facilitate marker-assisted backcrossing with selection for Fusarium wilt resistance, we developed cleaved amplified polymorphic sequences (CAPS) and restriction fragment length polymorphisms (RFLP) markers by converting RAPD markers E07 (a 1.25-kb band) and G17 (a 1.05-kb band), respectively. The RAPD-PCR polymorphic fragments from the susceptible line 'Vedrantais' were cloned and sequenced in order to construct primers that would amplify only the target fragment. The derived primers, E07SCAR-1/E07SCAR-2 from E07 and G17SCAR-1/G17SCAR-2 from G17, yielded a single 1.25-kb fragment (designated SCE07) and a 1.05-kb fragment (designated SCG17) (the same as RAPD markers E07 and G17), respectively, from both resistant and susceptible melon lines, thus demonstrating locus-specific associated primers. Potential CAPS markers were first revealed by comparing sequence data between fragments amplified from resistant (PI 161375) and susceptible ('Vedrantais') lines and were then confirmed by electrophoresis of restriction endonuclease digestion products. Twelve restriction endonucleases were evaluated for their potential use as CAPS markers within the SCE07 fragment. Three (BclI, MspI, and BssSI) yielded ideal CAPS markers and were subsequently subjected to extensive testing using an additional 88 diverse melon cultigens, 93 and 119 F(2) individuals from crosses of 'Vedrantais' x PI 161375 and 'Ananas Yokneam'×MR-1 respectively, and 17 families from a backcross BC(1)S(1) population derived from the breeding line 'MD8654' as a resistance source. BclI- and MspI-CAPS are susceptible-linked markers, whereas the BssSI-CAPS is a resistant-linked marker. The CAPS markers that resulted from double digestion by BclI and BssSI are co-dominant. Results

  18. Factors affecting the duration of nestling period and fledging order in Tengmalm's owl (Aegolius funereus: effect of wing length and hatching sequence.

    Directory of Open Access Journals (Sweden)

    Marek Kouba

    Full Text Available In altricial birds, the nestling period is an important part of the breeding phase because the juveniles may spend quite a long time in the nest, with associated high energy costs for the parents. The length of the nestling period can be variable and its duration may be influenced by both biotic and abiotic factors; however, studies of this have mostly been undertaken on passerine birds. We studied individual duration of nestling period of 98 Tengmalm's owl chicks (Aegolius funereus at 27 nests during five breeding seasons using a camera and chip system and radio-telemetry. We found the nestlings stayed in the nest box for 27 - 38 days from hatching (mean ± SD, 32.4 ± 2.2 days. The individual duration of nestling period was negatively related to wing length, but no formally significant effect was found for body weight, sex, prey availability and/or weather conditions. The fledging sequence of individual nestlings was primarily related to hatching order; no relationship with wing length and/or other factors was found in this case. We suggest the length of wing is the most important measure of body condition and individual quality in Tengmalm's owl young determining the duration of the nestling period. Other differences from passerines (e.g., the lack of effect of weather or prey availability on nestling period are considered likely to be due to different life-history traits, in particular different food habits and nesting sites and greater risk of nest predation among passerines.

  19. Differentiation of Candida glabrata, C. nivariensis and C. bracarensis based on fragment length polymorphism of ITS1 and ITS2 and restriction fragment length polymorphism of ITS and D1/D2 regions in rDNA

    DEFF Research Database (Denmark)

    Mirhendi, H; Bruun, B; Schønheyder, H C

    2011-01-01

    Different molecular methods for the discrimination of Candida glabrata, C. bracarensis and C. nivariensis were evaluated and the prevalence of these species among Danish blood isolates investigated. Control strains were used to determine fragment length polymorphism in the ITS1, ITS2, ITS1-5.8S...... enzymes were suitable for RFLP differentiation of the species. Enzymatic digestion of the D1/D2 domain with TatI produced unique band sizes for each of the three species. PCR-RFLP and PNA-FISH were in agreement for all of the isolates tested. None of the 133 Danish blood isolates were C. nivariensis or C....... bracarensis. Fragment size polymorphism of ITS1 and RFLP of the D1/D2 domain or the ITS region are useful methods for the differentiation of the species within the C. glabrata group. C. bracarensis and C. nivariensis are rare among Danish C. glabrata blood isolates....

  20. Distinguishing the Effects of Bond-Length Alternation versus Bond-Order Alternation on the Nonlinear Optical Properties of π-Conjugated Chromophores

    KAUST Repository

    Gieseking, Rebecca L.

    2015-06-18

    Understanding the relationships between the molecular nonlinear optical (NLO) properties and the bond-length alternation (BLA) or π-bond-order alternation (BOA) along the molecular backbone of linear π-conjugated systems has proven widely useful in the development of NLO organic chromophores and materials. Here, we examine model polymethines to elucidate the reliability of these relationships. While BLA is solely a measure of molecular geometric structure, BOA includes information pertaining to the electronic structure. As a result, BLA is found to be a good predictor of NLO properties only when optimized geometries are considered, whereas BOA is more broadly applicable. Proper understanding of the distinction between BLA and BOA is critical when designing computational studies of NLO properties, especially for molecules in complex environments or in nonequilibrium geometries. © 2015 American Chemical Society.

  1. Soil pretreatment and fast cell lysis for direct polymerase chain reaction from forest soils for terminal restriction fragment length polymorphism analysis of fungal communities

    Science.gov (United States)

    Fei Cheng; Lin Hou; Keith Woeste; Zhengchun Shang; Xiaobang Peng; Peng Zhao; Shuoxin Zhang

    2016-01-01

    Humic substances in soil DNA samples can influence the assessment of microbial diversity and community composition. Using multiple steps during or after cell lysis adds expenses, is time-consuming, and causes DNA loss. A pretreatment of soil samples and a single step DNA extraction may improve experimental results. In order to optimize a protocol for obtaining high...

  2. [Contribution of Leishmania identification using polymerase chain reaction--restriction fragment length polymerase for epidemiological studies of cutaneous leishmaniasis in Tunisia].

    Science.gov (United States)

    Bousslimi, N; Ben Abda, I; Ben Mously, R; Siala, E; Harrat, Z; Zallagua, N; Bouratbine, A; Aoun, K

    2014-02-01

    Three forms of cutaneous leishmaniasis (CL) are endemic in Tunisia. The identification of the causative species is useful to complete epidemiological data and to manage the cases. The aim of this study is to assess PCR-RFLP technique in the identification of Leishmania species responsible of CL in Tunisia and to compare the results of this technique to those of isoenzyme analysis. Sixty-one CL lesions were sampled. Dermal samples were tested by culture on NNN medium and analyzed by PCR-RFLP assay targeting the ITS1 region of ribosomal DNA. Species identification was performed by both iso-enzymatic typing for positive cultures and analysis of restriction profiles after enzymatic digestion by HaeIII of the obtained amplicons. Thirty-eight (62%) samples were positive by culture. The iso-enzymatic typing of 32 isolates identified 3 L. infantum, 23 L. major MON-25 and 6 L. tropica MON-8. Sixty samples were positive by PCR. The PCR-RFLP digestion profiles of the 56 PCR products identified 12 L. infantum, 38 L. major and 6 L. tropica. The results of both techniques were concordant in the 32 strains identified by both techniques. Species identification correlated with the geographical distribution of CL forms endemic in Tunisia. Results of PCR-RFLP revealed highly concordant with those of isoenzyme electrophoresis. Thanks to its simplicity, rapidity and ability to be performed directly on biological samples, this technique appears as an interesting alternative for the identification of Leishmania strains responsible of CL in Tunisia. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  3. Genetic evidence for the existence of cryptic species in the Anopheles albitarsis complex in Brazil: allozymes and mitochondrial DNA restriction fragment length polymorphisms.

    Science.gov (United States)

    Narang, S K; Klein, T A; Perera, O P; Lima, J B; Tang, A T

    1993-02-01

    Allozyme and mitochondrial DNA (mtDNA) restriction studies were undertaken to determine the extent of genetic divergence among field populations of Anopheles albitarsis in Brazil. Two sympatric species, An. deaneorum and An. marajoara, were identified in collections from Costa Marques (CM), Rondonia. Genetic evidence includes (1) the presence of two types of individuals, each with diagnostic allelic clusters (for Had-1, Pgi-1, Pep-1, Mpi-1, and Idh-1), (2) a deficiency of heterozygotes, and (3) characteristic mtDNA haplotypes. In addition, two allopatric cryptic species of An. marajoara were identified, one from Iguape (An. marajoara form IG), Sao Paulo state, and the other from the Island of Marajo (An. marajoara form MA). Though form IG and form-MA resemble form CM in wing spot morphology, they differ from it in diagnostic allozymes and mtDNA haplotypes. An. marajoara form CM had a higher variability (mean heterozygosity, H = 0.22, and percentage of polymorphic loci, P = 66.7) than did form IG and form MA (H = 0.08 in both, and P = 25.0 and 33.3, respectively). Form MA and form IG are genetically more similar to each other than both are to form CM. Based on wing morphology, estimates of F statistics, and genetic similarities, we propose that An. albitarsis in Brazil is a species complex. It comprises at least two morphologically distinguishable species: (1) An. deaneorum (currently one taxon) and (2) the An. marajoara species complex, which further consists of at least three cryptic forms, marajoara form MA, marajoara form IG, and marajoara form CM.

  4. Fundamental length

    International Nuclear Information System (INIS)

    Pradhan, T.

    1975-01-01

    The concept of fundamental length was first put forward by Heisenberg from purely dimensional reasons. From a study of the observed masses of the elementary particles known at that time, it is sumrised that this length should be of the order of magnitude 1 approximately 10 -13 cm. It was Heisenberg's belief that introduction of such a fundamental length would eliminate the divergence difficulties from relativistic quantum field theory by cutting off the high energy regions of the 'proper fields'. Since the divergence difficulties arise primarily due to infinite number of degrees of freedom, one simple remedy would be the introduction of a principle that limits these degrees of freedom by removing the effectiveness of the waves with a frequency exceeding a certain limit without destroying the relativistic invariance of the theory. The principle can be stated as follows: It is in principle impossible to invent an experiment of any kind that will permit a distintion between the positions of two particles at rest, the distance between which is below a certain limit. A more elegant way of introducing fundamental length into quantum theory is through commutation relations between two position operators. In quantum field theory such as quantum electrodynamics, it can be introduced through the commutation relation between two interpolating photon fields (vector potentials). (K.B.)

  5. 'Length'at Length

    Indian Academy of Sciences (India)

    Admin

    He was interested to know how `large' is the set of numbers x for which the series is convergent. Here large refers to its length. But his set is not in the class ♢. Here is another problem discussed by Borel. Consider .... have an infinite collection of pairs of new shoes and want to choose one shoe from each pair. We have an ...

  6. Evaluation of the use of amplified 16S rRNA gene-restriction fragment length polymorphism analysis to detect enterobacter cloacae and bacillus licheniformis for microbial enhanced oil recovery field pilot

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)

    1999-09-01

    Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)

  7. CTCF binding at the H19 imprinting control region mediates maternally inherited higher-order chromatin conformation to restrict enhancer access to Igf2

    Science.gov (United States)

    Kurukuti, Sreenivasulu; Tiwari, Vijay Kumar; Tavoosidana, Gholamreza; Pugacheva, Elena; Murrell, Adele; Zhao, Zhihu; Lobanenkov, Victor; Reik, Wolf; Ohlsson, Rolf

    2006-01-01

    It is thought that the H19 imprinting control region (ICR) directs the silencing of the maternally inherited Igf2 allele through a CTCF-dependent chromatin insulator. The ICR has been shown to interact physically with a silencer region in Igf2, differentially methylated region (DMR)1, but the role of CTCF in this chromatin loop and whether it restricts the physical access of distal enhancers to Igf2 is not known. We performed systematic chromosome conformation capture analyses in the Igf2/H19 region over >160 kb, identifying sequences that interact physically with the distal enhancers and the ICR. We found that, on the paternal chromosome, enhancers interact with the Igf2 promoters but that, on the maternal allele, this is prevented by CTCF binding within the H19 ICR. CTCF binding in the maternal ICR regulates its interaction with matrix attachment region (MAR)3 and DMR1 at Igf2, thus forming a tight loop around the maternal Igf2 locus, which may contribute to its silencing. Mutation of CTCF binding sites in the H19 ICR leads to loss of CTCF binding and de novo methylation of a CTCF target site within Igf2 DMR1, showing that CTCF can coordinate regional epigenetic marks. This systematic chromosome conformation capture analysis of an imprinting cluster reveals that CTCF has a critical role in the epigenetic regulation of higher-order chromatin structure and gene silencing over considerable distances in the genome. PMID:16815976

  8. Discrimination of press fit candidate microorganism (Enterobacter cloacae, Bacillus licheniformis) by restriction fragment length polymorphic analysis of the 16SrRNA gene; 16S rRNA idenshi no sengen danpen kchotakei kaiseki niyoru atsunyukoho biseibutsu (Enterobacter cloacae, Bacillus licheni-formis) no shikibetsu

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya; Yonebayashi, Eiji; Enomoto, Heiji

    1999-09-01

    In MeOH viewed as one of the improvement method for recovery of the petroleum with hope, the development of discrimination technique of press fit candidate microorganism and oil reservoir resident microorganism which exists in the test object oil reservoir was tried in order to monitor the survival situation of the microorganism which inserted in the oil reservoir under pressure. 16S rRNA amplified by the PCR using the universal primer The microorganism that it cut off the gene at restriction enzyme HhaI,MspI, AluI and inhabits oil reservoir water and oil reservoir rock in the object oil reservoir by ( necessarily TaqI ) and restriction fragment length polymorphic analysis was classified. As the result, the effectiveness of the this PCR-RFLP method was indicated the microorganism which showed RFLP pattern which is identical with the press fit candidate microorganism in the oil reservoir resident microorganism for the discrimination of the press fit candidate microorganism without existing. And, it was indicated that the this PCR-RFLP method was effective for the investigation of oil reservoir resident microbial community which can positively utilize source of nutrition inserted to oil reservoir with the press fit candidate microorganism under pressure, and it was possible to grasp oil reservoir resident microorganism to be especially considered in MEOR. (translated by NEDO)

  9. Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes

    Science.gov (United States)

    Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.

    2001-01-01

    Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restriction fragment length polymorphism (T-RFLP) analysis. The suitablility of T-RFLP analysis for investigating communities of nirS-containing denitrifiers was established by the correspondence of dominant terminal restriction fragments (T-RFs) of nirS to computer-simulated T-RFs of nirS clones. These clones belonged to clusters II, III, and IV from the same cores and were analyzed in a previous study (G. Braker, J. Zhou, L. Wu, A. H. Devol, and J. M. Tiedje, Appl. Environ. Microbiol. 66:2096–2104, 2000). T-RFLP analysis of nirS and bacterial rDNA revealed a high level of functional and phylogenetic diversity, whereas the level of diversity of Archaea was lower. A comparison of T-RFLPs based on the presence or absence of T-RFs and correspondence analysis based on the frequencies and heights of T-RFs allowed us to group sediment samples according to the sampling location and thus clearly distinguish Puget Sound and the Washington margin populations. However, changes in community structure within sediment core sections during the transition from aerobic to anaerobic conditions were minor. Thus, within the top layers of marine sediments, redox gradients seem to result from the differential metabolic activities of populations of similar communities, probably through mixing by marine invertebrates rather than from the development of distinct communities. PMID:11282647

  10. Characterization of Erwinia amylovora strains from different host plants using repetitive-sequences PCR analysis, and restriction fragment length polymorphism and short-sequence DNA repeats of plasmid pEA29.

    Science.gov (United States)

    Barionovi, D; Giorgi, S; Stoeger, A R; Ruppitsch, W; Scortichini, M

    2006-05-01

    The three main aims of the study were the assessment of the genetic relationship between a deviating Erwinia amylovora strain isolated from Amelanchier sp. (Maloideae) grown in Canada and other strains from Maloideae and Rosoideae, the investigation of the variability of the PstI fragment of the pEA29 plasmid using restriction fragment length polymorphism (RFLP) analysis and the determination of the number of short-sequence DNA repeats (SSR) by DNA sequence analysis in representative strains. Ninety-three strains obtained from 12 plant genera and different geographical locations were examined by repetitive-sequences PCR using Enterobacterial Repetitive Intergenic Consensus, BOX and Repetitive Extragenic Palindromic primer sets. Upon the unweighted pair group method with arithmetic mean analysis, a deviating strain from Amelanchier sp. was analysed using amplified ribosomal DNA restriction analysis (ARDRA) analysis and the sequencing of the 16S rDNA gene. This strain showed 99% similarity to other E. amylovora strains in the 16S gene and the same banding pattern with ARDRA. The RFLP analysis of pEA29 plasmid using MspI and Sau3A restriction enzymes showed a higher variability than that previously observed and no clear-cut grouping of the strains was possible. The number of SSR units reiterated two to 12 times. The strains obtained from pear orchards showing for the first time symptoms of fire blight had a low number of SSR units. The strains from Maloideae exhibit a wider genetic variability than previously thought. The RFLP analysis of a fragment of the pEA29 plasmid would not seem a reliable method for typing E. amylovora strains. A low number of SSR units was observed with first epidemics of fire blight. The current detection techniques are mainly based on the genetic similarities observed within the strains from the cultivated tree-fruit crops. For a more reliable detection of the fire blight pathogen also in wild and ornamentals Rosaceous plants the genetic

  11. Use of PCR-restriction fragment length polymorphism analysis to identify the main new world Leishmania species and analyze their taxonomic properties and polymorphism by application of the assay to clinical samples.

    Science.gov (United States)

    Rotureau, Brice; Ravel, Christophe; Couppié, Pierre; Pratlong, Francine; Nacher, Mathieu; Dedet, Jean-Pierre; Carme, Bernard

    2006-02-01

    At least 13 characterized Leishmania species are known to infect humans in South America. Five of these parasites are transmitted in the sylvatic ecotopes of the whole French Guianan territory and responsible for cutaneous leishmaniasis. For the diagnosis of cutaneous leishmaniasis, restriction fragment length polymorphism (RFLP) analyses have shown promising results. Thus, the end of the small subunit and internal transcribed spacer 1 of the rRNA genes were sequenced and targeted by PCR-RFLP analysis in the 10 main New World (NW) Leishmania species from the two subgenera. Then, the procedure was tested on 40 samples from patients with cutaneous leishmaniasis, and its results were compared with those of conventional methods. (i) The results of this simple genus-specific method were in agreement with those of previous isoenzyme analyses. (ii) This method distinguished the most medically relevant Leishmania species with only one enzyme (RsaI). (iii) This method could be performed directly on human biopsy specimens (sensitivity of 85.7%). Performing NW Leishmania species typing rapidly and easily in the field constitutes a very valuable improvement for detection of Leishmania spp. Revealing great diversity with several enzymes, this method could also be useful for taxonomic, ecological, and epidemiological studies in space and time.

  12. Physical localization of NORs and ITS length variants in old ...

    Indian Academy of Sciences (India)

    No variation at the number of Ag-NORs per metaphase was found among the 51 durum wheat cultivars, but the PCR-RFLP technique carried out with the restriction enzyme HpaII, allowed the detection of ITS length variants among them. The molecular data was used in order to establish the genetic relationships among ...

  13. Effects of magnetic order on the superconducting length scales and critical fields in single crystal ErNi2B2C

    DEFF Research Database (Denmark)

    Gammel, P.L.; Barber, B.P.; Ramirez, A.P.

    1999-01-01

    The flux line form factor in small angle neutron scattering and transport data determines the superconducting length scares and critical fields in single crystal ErNi2B2C. For H parallel to c, the coherence length xi increases and the penetration depth lambda decreases when crossing T-N = 6.0 K......, the Neel transition. The critical fields show corresponding anomalies near T-N. For H perpendicular to c, the fourfold modulation of the upper critical field H-c2 is strongly temperature dependent, changing sign near T-N, and can be modeled using the anisotropy of the sublattice magnetization....

  14. Characterization of gut microbiota profiles in coronary artery disease patients using data mining analysis of terminal restriction fragment length polymorphism: gut microbiota could be a diagnostic marker of coronary artery disease.

    Science.gov (United States)

    Emoto, Takuo; Yamashita, Tomoya; Kobayashi, Toshio; Sasaki, Naoto; Hirota, Yushi; Hayashi, Tomohiro; So, Anna; Kasahara, Kazuyuki; Yodoi, Keiko; Matsumoto, Takuya; Mizoguchi, Taiji; Ogawa, Wataru; Hirata, Ken-Ichi

    2017-01-01

    The association between atherosclerosis and gut microbiota has been attracting increased attention. We previously demonstrated a possible link between gut microbiota and coronary artery disease. Our aim of this study was to clarify the gut microbiota profiles in coronary artery disease patients using data mining analysis of terminal restriction fragment length polymorphism (T-RFLP). This study included 39 coronary artery disease (CAD) patients and 30 age- and sex- matched no-CAD controls (Ctrls) with coronary risk factors. Bacterial DNA was extracted from their fecal samples and analyzed by T-RFLP and data mining analysis using the classification and regression algorithm. Five additional CAD patients were newly recruited to confirm the reliability of this analysis. Data mining analysis could divide the composition of gut microbiota into 2 characteristic nodes. The CAD group was classified into 4 CAD pattern nodes (35/39 = 90 %), while the Ctrl group was classified into 3 Ctrl pattern nodes (28/30 = 93 %). Five additional CAD samples were applied to the same dividing model, which could validate the accuracy to predict the risk of CAD by data mining analysis. We could demonstrate that operational taxonomic unit 853 (OTU853), OTU657, and OTU990 were determined important both by the data mining method and by the usual statistical comparison. We classified the gut microbiota profiles in coronary artery disease patients using data mining analysis of T-RFLP data and demonstrated the possibility that gut microbiota is a diagnostic marker of suffering from CAD.

  15. Evaluation of the Epidemiological Relevance of Variable-Number Tandem-Repeat Genotyping of Mycobacterium bovis and Comparison of the Method with IS6110 Restriction Fragment Length Polymorphism Analysis and Spoligotyping†

    Science.gov (United States)

    Allix, Caroline; Walravens, Karl; Saegerman, Claude; Godfroid, Jacques; Supply, Philip; Fauville-Dufaux, Maryse

    2006-01-01

    Sources of Mycobacterium bovis contamination remain unclear for many cases of animal and human disease. A major limitation is the lack of sufficiently informative or epidemiologically well evaluated molecular methods for typing. Here, we report an evaluation of a high-throughput method based on 29 mycobacterial interspersed repetitive unit-variable-number tandem-repeat (MIRU-VNTR) loci to genotype 127 M. bovis isolates from cattle from 77 different Belgian farms, representative of a nationwide collection obtained from 1995 to 2003. MIRU-VNTR stability was demonstrated by analyzing a series of 74 isolates in total, obtained from different animals from a single farm or from different farms with an identified epidemiological link. The genotyping results and the genotypic diversity (h) were compared with those obtained by IS6110 restriction fragment length polymorphism (RFLP) analysis and spoligotyping. Among 68 isolates with no known epidemiological link, MIRU-VNTR typing discriminated better than either RFLP analysis or spoligotyping, with isolates taken individually (32 versus 16 and 17 genotypes; h = 0.91 versus 0.73 and 0.85, respectively) or in combination (32 versus 28 genotypes; h = 0.91 versus 0.92). Maximal resolution was already achieved with a subset of 9 loci. The observed congruence of the genetic relationships based on IS6110 RFLP analysis, spoligotyping, and MIRU-VNTR markers is consistent with a clonal population structure of M. bovis. These results support MIRU-VNTR typing as a convenient and discriminatory technique for analysis of the population structure of M. bovis in much greater detail and for addressing some still unresolved issues in the epidemiology of the pathogen. PMID:16757584

  16. A Study on Campylobacter jejuni and Campylobacter coli through Commercial Broiler Production Chains in Thailand: Antimicrobial Resistance, the Characterization of DNA Gyrase Subunit A Mutation, and Genetic Diversity by Flagellin A Gene Restriction Fragment Length Polymorphism.

    Science.gov (United States)

    Thomrongsuwannakij, Thotsapol; Blackall, Patrick J; Chansiripornchai, Niwat

    2017-06-01

    chain reaction-restriction fragment length polymorphism of the flagellin A gene (flaA-RFLP) to determine their genetic relationships. Ten distinct clusters were recognized by flaA-RFLP typing. The results showed that horizontal transmission was the major route of Campylobacter transmission in this study. In conclusion, the emergence of MDR and high resistance rates to several antimicrobials are major concerns identified in this study. The prudent use of these agents and active surveillance of resistance at the farm level are essential steps to reduce the public health risks identified in this work.

  17. Fundamental length and relativistic length

    International Nuclear Information System (INIS)

    Strel'tsov, V.N.

    1988-01-01

    It si noted that the introduction of fundamental length contradicts the conventional representations concerning the contraction of the longitudinal size of fast-moving objects. The use of the concept of relativistic length and the following ''elongation formula'' permits one to solve this problem

  18. Flame Length

    Data.gov (United States)

    Earth Data Analysis Center, University of New Mexico — Flame length was modeled using FlamMap, an interagency fire behavior mapping and analysis program that computes potential fire behavior characteristics. The tool...

  19. [The EU law on genetically modified organisms: the European Commission changes the strategy in order to allow, restrict, or prohibit its culture].

    Science.gov (United States)

    González Vaqué, Luis

    2010-01-01

    On July 13 2010, the European Commission adopted a series of measures which outline a new approach on Genetically Modified Organisms (GMOs) cultivation in the Member States. This proposal, which still retains the basis of the existing science-based GMO authorisation system, will be implemented through: a Communication from the Commission, explaining the new approach on the freedom for Member States to decide on the cultivation of genetically modified crops; the "Proposal for a Regulation of the European Parliament and of the Council amending Directive 2001/18/EC as regards the possibility for the Member States to restrict or prohibit the cultivation of GMOs in their territory"; and a new "European Commission Recommendation (2010/C 200/01) of 13 July 2010 on guidelines for the development of national co-existence measures to avoid the unintended presence of GMOs in conventional and organic crops".

  20. Could test length or order affect scores on letter number sequencing of the WAIS-III and WMS-III? Ruling out effects of fatigue.

    Science.gov (United States)

    Tulsky, D S; Zhu, J

    2000-11-01

    The Letter Number Sequencing subtest of the WAIS-III and WMS-III was administered at the end of the standardization edition of the WMS-III. It was not administered as part of the WAIS-III standardization battery. Nevertheless, the subtest was included in the published version of the WAIS-III. This study examines differences between examinees administered the Letter Number Sequencing subtest at three different times during a psychological battery: (1) as part of the published battery, (2) as part of the WMS-III when the WMS-III was administered as the first test in a sequence, and (3) as part of the WMS-III standardization when the WAIS-III was administered immediately preceding the WMS-III. The participants were 372 examinees ( n = 124 in each condition) who were matched on key demographic variables. A repeated measures MANOVA yielded no difference in subtest scores when administered in any of these conditions. The results show no evidence of fatigue or ordering effects on the Letter Number Sequencing subtest.

  1. Quantitative analysis of Terminal Restriction Fragment Length Polymorphism (T-RFLP microbial community profiles: peak height data showed to be more reproducible than peak area Análise quantitativa de perfis de T-RFLP de comunidades microbianas: dados de altura de picos mostraram-se mais reprodutíveis do que os de área

    Directory of Open Access Journals (Sweden)

    Roberto A. Caffaro-Filho

    2007-12-01

    Full Text Available Terminal Restriction Fragment Length Polymorphism (T-RFLP is a culture-independent fingerprinting method for microbial community analysis. Profiles generated by an automated electrophoresis system can be analysed quantitatively using either peak height or peak area data. Statistical testing demontrated that peak height data showed to be more reproducible than peak area data.Terminal Restriction Fragment Length Polymorphism (T-RFLP é um método molecular, independente de cultivo, para análise de comunidades microbianas. Perfis gerados por um sistema automatizado de eletroforese podem ser analisados quantitativamente usando dados de altura ou área dos picos. Os dados de altura mostraram-se mais reprodutíveis do que os de área.

  2. Significant reduction in red blood cell transfusions in a general hospital after successful implementation of a restrictive transfusion policy supported by prospective computerized order auditing.

    Science.gov (United States)

    Yerrabothala, Swaroopa; Desrosiers, Kevin P; Szczepiorkowski, Zbigniew M; Dunbar, Nancy M

    2014-10-01

    Our hospital transfusion policy was recently revised to recommend single-unit red blood cell transfusion (RBC TXN) for nonbleeding inpatients when the hemoglobin (Hb) level is not more than 7 g/dL. Our computerized provider order entry system was reconfigured to provide real-time decision support using prospective computerized order auditing based on the most recent Hb level and to remove the single-click ordering option for 2-unit RBC TXNs to enhance compliance. This study was undertaken to assess the impact of these changes on hospital transfusion practice. This study analyzed the total number of transfusion events, proportion of single and 2-unit transfusions and the Hb transfusion trigger in the preimplementation period (October 2011-March 2012) compared to the postimplementation period (October 2012-March 2013). In the postimplementation period the total number of RBC units transfused/1000 patient-days decreased from 60.8 to 44.2 (p auditing has resulted in significantly decreased RBC utilization at our institution. © 2014 AABB.

  3. Restrictive Cardiomyopathy

    Science.gov (United States)

    ... can be mistaken for a condition called constrictive pericarditis. This condition causes the sac-like membrane around ... inflamed and thickened. Surgery can usually correct constrictive pericarditis. On the other hand, restrictive cardiomyopathy cannot be ...

  4. Arthrobacter luteus restriction endonuclease cleavage map of X174 RF DNA

    NARCIS (Netherlands)

    Vereijken, J.M.; Mansfeld, A.D.M. van; Baas, P.D.; Jansz, H.S.

    1975-01-01

    Cleavage of X174 RF DNA with the restriction endonuclease from Arthrobacter luteus (Alu I) produces 23 fragments of approximately 24–1100 base pairs in length. The order of most of these fragments has been established by digestion of Haemophilus influenzae Rd (Hind II) and Haemophilus aegyptius (Hae

  5. A new and improved method based on polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) for the determination of A1298C mutation in the methylenetetrahydrofolate reductase (MTHFR) gene.

    Science.gov (United States)

    Machnik, Grzegorz; Zapala, Malgorzata; Pelc, Ewa; Gasecka-Czapla, Monika; Kaczmarczyk, Grzegorz; Okopien, Boguslaw

    2013-01-01

    Intracellular folate homeostasis and metabolism is regulated by numerous genes. Among them, 5,10-methylenetetrahydrofolate reductase (MTHFR) is of special interest because of its involvement in regulation of the homocysteine level in the body as a result of folate metabolism. Moreover, some studies demonstrated that the homocysteine plasma level in individuals may be influenced by polymorphisms present in the MTHFR gene. Two common, clinically relevant mutations have been described: MTHFR C677T and MTHFR A1298C. Although several laboratory techniques allow genotyping of both polymorphisms, PCR-RFLP analysis is simple to perform, relatively cheap, and thus one of the most utilized. In the case of A1298C, the PCR-RFLP technique that utilizes MboII endonuclease class II requires an acrylamide gel electrophoresis, since agarose gel electrophoresis is unable to resolve short deoxyribonucleic acid (DNA) fragments after restriction digestion. Agarose gel electrophoresis is commonly preferred over that of acrylamide. To resolve this inconvenience, a novel PCR-RFLP, AjuI-based method to genotype A1298C alleles has been developed that can be performed on standard agarose gel.

  6. Enterocytozoon bieneusi Identification Using Real-Time Polymerase Chain Reaction and Restriction Fragment Length Polymorphism in HIV-Infected Humans from Kinshasa Province of the Democratic Republic of Congo

    Directory of Open Access Journals (Sweden)

    Roger Wumba

    2012-01-01

    in 242 HIV-infected patients. Typing was based on DNA polymorphism of the ribosomal DNA ITS region of E. bieneusi. PCRRFLP generated with two restriction enzymes (Nla III and Fnu 4HI in PCR-amplified ITS products for classifying strains into different lineages. The diagnosis performance of the indirect immune-fluorescence-monoclonal antibody (IFI-AcM was defined in comparison with real-time PCR as the gold standard. Results. Out of 242 HIV-infected patients, using the real-time PCR, the prevalence of E. bieneusi was 7.9% (n=19 among the 19 E. bieneusi, one was coinfected with E. intestinalis. In 19 E. bieneusi persons using PCR-RFLP method, 5 type I strains of E. bieneusi (26.3% and 5 type IV strains of E. bieneusi (26.3% were identified. The sensitivity of IFI-AcM was poor as estimated 42.1%. Conclusion. Despite different PCR methods, there is possible association between HIVinfection, geographic location (France, Cameroun, Democratic Republic of Congo, and the concurrence of type I and type IV strains.

  7. Genetic polymorphism of toll-like receptors 4 gene by polymerase chain reaction-restriction fragment length polymorphisms, polymerase chain reaction-single-strand conformational polymorphism to correlate with mastitic cows

    Directory of Open Access Journals (Sweden)

    Pooja H. Gupta

    2015-05-01

    Full Text Available Aim: An attempt has been made to study the toll-like receptors 4 (TLR4 gene polymorphism from cattle DNA to correlate with mastitis cows. Materials and Methods: In present investigation, two fragments of TLR4 gene named T4CRBR1 and T4CRBR2 of a 316 bp and 382 bp were amplified by polymerase chain reaction (PCR, respectively from Kankrej (22 and Triple cross (24 cattle. The genetic polymorphisms in the two populations were detected by a single-strand conformational polymorphism in the first locus and by digesting the fragments with restriction endonuclease Alu I in the second one. Results: Results showed that both alleles (A and B of two loci were found in all the two populations and the value of polymorphism information content indicated that these were highly polymorphic. Statistical results of χ2 test indicated that two polymorphism sites in the two populations fit with Hardy–Weinberg equilibrium (p˂0.05. Meanwhile, the effect of polymorphism of TLR4 gene on the somatic cell score (SCS indicated the cattle with allele a in T4CRBR1 showed lower SCS than that of allele B (p<0.05. Thus, the allele A might play an important role in mastitis resistance in cows. Conclusion: The relationship between the bovine mastitis trait and the polymorphism of TLR4 gene indicated that the bovine TLR4 gene may play an important role in mastitis resistance.

  8. Enterocytozoon bieneusi Identification Using Real-Time Polymerase Chain Reaction and Restriction Fragment Length Polymorphism in HIV-Infected Humans from Kinshasa Province of the Democratic Republic of Congo

    Science.gov (United States)

    Wumba, Roger; Jean, Menotti; Benjamin, Longo-Mbenza; Madone, Mandina; Fabien, Kintoki; Josué, Zanga; Jean, Sala; Eric, Kendjo; AC, Guillo-Olczyk; Marc, Thellier

    2012-01-01

    Objective. To determine the prevalence and the genotypes of Enterocytozoon bieneusi in stool specimens from HIV patients. Methods. This cross-sectional study was carried out in Kinshasa hospitals between 2009 and 2012. Detection of microsporidia including E. bieneusi and E. intestinalis was performed in 242 HIV-infected patients. Typing was based on DNA polymorphism of the ribosomal DNA ITS region of E. bieneusi. PCRRFLP generated with two restriction enzymes (Nla III and Fnu 4HI) in PCR-amplified ITS products for classifying strains into different lineages. The diagnosis performance of the indirect immune-fluorescence-monoclonal antibody (IFI-AcM) was defined in comparison with real-time PCR as the gold standard. Results. Out of 242 HIV-infected patients, using the real-time PCR, the prevalence of E. bieneusi was 7.9% (n = 19) among the 19 E. bieneusi, one was coinfected with E. intestinalis. In 19 E. bieneusi persons using PCR-RFLP method, 5 type I strains of E. bieneusi (26.3%) and 5 type IV strains of E. bieneusi (26.3%) were identified. The sensitivity of IFI-AcM was poor as estimated 42.1%. Conclusion. Despite different PCR methods, there is possible association between HIVinfection, geographic location (France, Cameroun, Democratic Republic of Congo), and the concurrence of type I and type IV strains. PMID:22811884

  9. Restricted Mobilities

    DEFF Research Database (Denmark)

    Nielsen, Mette; Lassen, Claus

    2012-01-01

    communities and shopping centres through mobility lenses. The article shows how different mobility systems enable and restrict the public access to private-public spaces, and it points out that proprietary communities create an unequal potential for human movement and access in the city. The main argument......Privatisation of public spaces in the contemporary city has increased during the last decades but only few studies have approached this field from a mobility perspective. Therefore the article seeks to rectify this by exploring two Australian examples of private spaces in the city; gated...... and stratification mechanisms. In conclusion the article therefore suggests that future urban research and planning also needs a mobile understanding of spaces in the cities and how different mobility systems play an important role to sustain the exclusiveness that often characterises the private/public spaces...

  10. Comparison of the gut microbiota composition between obese and non-obese individuals in a Japanese population, as analyzed by terminal restriction fragment length polymorphism and next-generation sequencing.

    Science.gov (United States)

    Kasai, Chika; Sugimoto, Kazushi; Moritani, Isao; Tanaka, Junichiro; Oya, Yumi; Inoue, Hidekazu; Tameda, Masahiko; Shiraki, Katsuya; Ito, Masaaki; Takei, Yoshiyuki; Takase, Kojiro

    2015-08-11

    Obesity has become one of the most serious social problems in developed countries, including Japan. The relationship between the gut microbiota and obesity has recently attracted the attention of many researchers. Although the gut microbiota was long thought to contribute to obesity, the exact association remains largely unknown. We examined the human gut microbiota composition in a Japanese population in order to determine its relationship to obesity. Stool samples from 23 non-obese subjects (body mass index [BMI] gut microbiota compositions and that certain bacterial species were significantly associated with each group (obese: Blautia hydrogenotorophica, Coprococcus catus, Eubacterium ventriosum, Ruminococcus bromii, Ruminococcus obeum; non-obese: Bacteroides faecichinchillae, Bacteroides thetaiotaomicron, Blautia wexlerae, Clostridium bolteae, Flavonifractor plautii). Gut microbial properties differ between obese and non-obese subjects in Japan, suggesting that gut microbiota composition is related to obesity.

  11. Characterization of a three bacteria mixed culture in a chemostat: evaluation and application of a quantitative terminal-restriction fragment length polymorphism (T-RFLP) analysis for absolute and species specific cell enumeration.

    Science.gov (United States)

    Schmidt, Julia K; König, Brigitte; Reichl, Udo

    2007-03-01

    Growth dynamics of Pseudomonas aeruginosa, Burkholderia cepacia, and Staphylococcus aureus in a batch and chemostat, were investigated as a laboratory model system for persistent infections in cystic fibrosis. Most species-specific enumeration methods for mixed cultures are laborious or only qualitative, and therefore impede generation of quantitative data required for validation of mathematical models. Here, a quantitative T-RFLP method was evaluated and applied for specific and absolute cell number enumerations. The method was tested to be unbiased by quantitative sample composition and allowed reproducible enumerations of mixed cultures. For assay validation, samples of defined concentration containing one, two or three species were quantified. Logarithmically transformed absolute cell numbers of single-species dilutions were linear within a lower working range of 10(4)-10(6) cfu/mL (species-dependent) and an upper working range of 10(10) cfu/mL. Quantifications of single species (10(6)-10(10) cfu/mL) spiked with one or two other species agreed well with single species controls. Differences between slopes of first order linear regression of spiked and pure dilution series were insignificant. Coefficient of variation of defined mixed replicates was maximum 4.39%, of a three-species chemostat it was maximum 1.76%. T-RFLP monitoring of pure cultures in parallel shake flasks and of a three-species mixed chemostat gave very consistent results. Coexistence of at least two species after a time period equivalent to more than 33 volume exchanges was found. This result was not predicted from pure cultures clearly indicating the need for quantitative mixed culture experiments to better understand microbial growth dynamics and for mathematical model validation.

  12. 44 CFR 402.2 - Restricted commodities.

    Science.gov (United States)

    2010-10-01

    ... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Restricted commodities. 402.2... SHIPMENTS ON AMERICAN FLAG SHIPS AND AIRCRAFT (T-1, INT. 1) § 402.2 Restricted commodities. The restrictions of Transportation Order T-1 apply to the transportation or discharge of (a) commodities on the...

  13. HLA DQJ3 restriction fragment length polymorphism and ...

    African Journals Online (AJOL)

    1991-03-16

    Mar 16, 1991 ... We should like to thank Dr Fritz Bach, University of Minnesota, for generously providing the DQf3 probe; Dr R. Martell for his advice and constructive criticism; Chris Martin and Derek Taljaard for technical assistance and Veronique Bruneau for typing the manuscript. This work was supported by grants from ...

  14. The relation between the PST1 restriction fragment length ...

    African Journals Online (AJOL)

    Triton X-100 lysis method.17 DNA (1 - 3 ~g) was amplified by. PCR using 1 unit of Taq1 polymerase in 50 ~l of reaction mixture containing polymerase buffer and 1 pmol of oligonucleotides. The primers used were: 5' GAGCGCTCTCGAGGAGTACAC 3' [bp 2238 - 2258] and. 5' GACTGGCTTCCACTGCTGTGC 3' [bp 2956 ...

  15. HLA DQβ restriction fragment length polymorphism and rheumatQid ...

    African Journals Online (AJOL)

    Two variants of the HLA-DR4-linked DQw3 allele, namely OQw7 and DQw8, were analysed in patients of mixed ancestry (Cape Coloureds) with rheumatoid arthritis and in healthy individuals from the same population group using a DQ-β specific cDNA probe. The DQw7 allele, identified by 3,4 kb Hind III or 3,7 kb and 6,9 ...

  16. Diversity of the marine picocyanobacteria Prochlorococcus and Synechococcus assessed by terminal restriction fragment length polymorphisms of 16S-23S rRNA internal transcribed spacer sequences Diversidad de las picocianobacterias marinas Prochlorococcus y Synechococcus por medio de polimorfismos de longitud de fragmentos de restricción terminal en secuencias del espaciador transcrito interno del ARNr 16S - 23S

    Directory of Open Access Journals (Sweden)

    PARIS LAVIN

    2008-12-01

    Full Text Available In order to assess the appropriateness of the use of internal transcribed spacer (ITS sequences for the study of population genetics of marine cyanobacteria, we amplified and cloned the 16S rRNA gene plus the 16S-23S ITS regions of six strains of Prochlorococcus and Synechococcus. We analyzed them by denaturing gradient gel electrophoresis (DGGE and terminal restriction fragment length polymorphisms (T-RFLP. When using the standard application of these techniques, we obtained more than one band or terminal restriction fragment (T-RF per strain or cloned sequence. Reports in literature have suggested that these anomalies can result from the formation of secondary structures. Secondary structures of the ITS sequences of Prochlorococcus and Synechococcus strains were computationally modelled at the different temperatures that were used during the polymerase chain reaction (PCR. Modelling results predicted the existence of hairpin loops that would still be present at the extensión temperature; it is likely that these loops produced incomplete and single stranded PCR products. We modified the standard T-RFLP procedure by adding the labelled ITS primer in the last two cycles of the PCR reaction; this resulted, in most cases, in only one T-RF per ribotype. Application of this technique to a natural picoplankton community in marine waters off northern Chile, showed that it was possible to identify the presence, and determine the relative abundance, of several phylogenetic lineages within the genera Prochlorococcus and Synechococcus inhabiting the euphotic zone. Phylogenetic analysis of ITS sequences obtained by cloning and sequencing DNA from the same sample confirmed the presence of the different genotypes. With the proposed modification, T-RFLP profiles should therefore be suitable for studying the diversity of natural populations of cyanobacteria, and should become an important tool to study the factors influencing the genetic structure and

  17. Full HPV typing by a single restriction enzyme.

    Science.gov (United States)

    Santiago, Enrique; Camacho, Lucía; Junquera, Maria Luisa; Vázquez, Fernando

    2006-09-01

    Restriction fragment length polymorphism (RFLP) methods for genotyping genital human papillomavirus (HPV) are considered labor consuming and constrained by the reduced set of restriction enzymes capable of detecting specific mutations. However, we think that these methods have not taken full advantage of the high diversity of the known restriction enzymes. We have set out to find the best restriction enzyme for HPV typing. An extensive search for enzymes was carried out by combining statistical methods and database information. The search maximized the discrimination between high- and low-risk types by examining the sequence of the L1 gene flanked by primers MY09/11. Different electrophoretic resolutions and two variations of the RFLP method were considered. HpyCH4V is the best enzyme for discriminating between risk types. Moreover, HpyCH4V generates different patterns for virtually all the HPV types. The typical pattern consists of two or three fragments, which facilitates typing in mixed infections. The typing of a set of clinical samples confirmed the expectations. This result illustrates the possibilities of statistical methods to exploit the high diversity of restriction enzymes in order to classify samples in a pre-established hierarchy of types for which DNA sequences are known.

  18. Curves of restricted type in euclidean spaces

    Directory of Open Access Journals (Sweden)

    Bengü Kılıç Bayram

    2014-01-01

    Full Text Available Submanifolds of restricted type were introduced in [7]. In the present study we consider restricted type of curves in Em. We give some special examples. We also show that spherical curve in S2(r C E3 is of restricted type if and only if either ƒ(s is constant or a linear function of s of the form ƒ(s = ±s + b and every closed W - curve of rank k and of length 2(r in E2k is of restricted type.

  19. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  20. Preferential role restrictions

    CSIR Research Space (South Africa)

    Britz, K

    2013-07-01

    Full Text Available We extend the Description Logic ALC with preferential role restrictions as class constructs, and argue that preferential universal restriction represents a defeasible version of standard universal restriction. The resulting DL is more expressive...

  1. Overview of bunch length measurements

    International Nuclear Information System (INIS)

    Lumpkin, A. H.

    1999-01-01

    An overview of particle and photon beam bunch length measurements is presented in the context of free-electron laser (FEL) challenges. Particle-beam peak current is a critical factor in obtaining adequate FEL gain for both oscillators and self-amplified spontaneous emission (SASE) devices. Since measurement of charge is a standard measurement, the bunch length becomes the key issue for ultrashort bunches. Both time-domain and frequency-domain techniques are presented in the context of using electromagnetic radiation over eight orders of magnitude in wavelength. In addition, the measurement of microbunching in a micropulse is addressed

  2. Determining if DNA Stained with a Cyanine Dye Can Be Digested with Restriction Enzymes.

    Science.gov (United States)

    Maschmann, April; Masters, Cody; Davison, Melissa; Lallman, Joshua; Thompson, Drew; Kounovsky-Shafer, Kristy L

    2018-02-02

    Visualization of DNA for fluorescence microscopy utilizes a variety of dyes such as cyanine dyes. These dyes are utilized due to their high affinity and sensitivity for DNA. In order to determine if the DNA molecules are full length after the completion of the experiment, a method is required to determine if the stained molecules are full length by digesting DNA with restriction enzymes. However, stained DNA may inhibit the enzymes, so a method is needed to determine what enzymes one could use for fluorochrome stained DNA. In this method, DNA is stained with a cyanine dye overnight to allow the dye and DNA to equilibrate. Next, stained DNA is digested with a restriction enzyme, loaded into a gel and electrophoresed. The experimental DNA digest bands are compared to an in silico digest to determine the restriction enzyme activity. If there is the same number of bands as expected, then the reaction is complete. More bands than expected indicate partial digestion and less bands indicate incomplete digestion. The advantage of this method is its simplicity and it uses equipment that a scientist would need for a restriction enzyme assay and gel electrophoresis. A limitation of this method is that the enzymes available to most scientists are commercially available enzymes; however, any restriction enzymes could be used.

  3. 7 CFR 982.50 - Restricted obligation.

    Science.gov (United States)

    2010-01-01

    ... WASHINGTON Order Regulating Handling Control of Distribution § 982.50 Restricted obligation. (a) No handler... procedures as are necessary to facilitate the administration of this option among handlers. (d) Whenever the...

  4. Telomere length analysis.

    Science.gov (United States)

    Canela, Andrés; Klatt, Peter; Blasco, María A

    2007-01-01

    Most somatic cells of long-lived species undergo telomere shortening throughout life. Critically short telomeres trigger loss of cell viability in tissues, which has been related to alteration of tissue function and loss of regenerative capabilities in aging and aging-related diseases. Hence, telomere length is an important biomarker for aging and can be used in the prognosis of aging diseases. These facts highlight the importance of developing methods for telomere length determination that can be employed to evaluate telomere length during the human aging process. Telomere length quantification methods have improved greatly in accuracy and sensitivity since the development of the conventional telomeric Southern blot. Here, we describe the different methodologies recently developed for telomere length quantification, as well as their potential applications for human aging studies.

  5. DETECÇÃO DO COMPLEXO Mycobacterium tuberculosis NO LEITE PELA REAÇÃO EM CADEIA DA POLIMERASE SEGUIDA DE ANÁLISE DE RESTRIÇÃO DO FRAGMENTO AMPLIFICADO (PRA DETECTION OF Mycobacterium tuberculosis COMPLEX BY PCR-RESTRICTION FRAGMENT LENGTH POLYMORFISM ANALYSIS OF THE HSP65 GENE

    Directory of Open Access Journals (Sweden)

    Joab Trajano Silva

    2008-12-01

    , up to species level, is time consuming and difficult. In this work, the objective was to standardize a polymerase chain reaction followed by an enzyme restriction analysis in order to identify the M. tuberculosis complex in milk, without a microbiological isolation step. Reference strains and raw milk seeded with M. Bovis, were used as the starting material.  A 441pb fragment of the hsp65 gene was amplified and digested by two restriction enzymes BstEII and HaeIII. The obtained profile was used to identify the M. tuberculosis complex in milk. The minimum limit of detection of M. bovis in milk was 10CFU/mL. PRA methodology proved to be a specific and sensible method. It can be used to assist the microbiological and biochemical methods commonly used to identifying the bacilli in clinical samples, as milk 

    Key word: Detection limit (PRA, Mycobacterium tuberculosis complex, milk Mycobacterium bovis, Restriction Enzyme Analysis (PCR,

  6. An Investigation of the Influence of Chain Length on the Interfacial Ordering of L-Lysine and L-Proline and Their Homopeptides at Hydrophobic and Hydrophilic Interfaces Studied by Sum Frequency Generation and Quartz Crystal Microbalance

    Energy Technology Data Exchange (ETDEWEB)

    York, R.L.; Holinga, G.J.; Somorjai, G.A.

    2009-02-23

    Sum frequency generation vibrational spectroscopy (SFG) and quartz crystal microbalance with dissipation monitoring (QCM-D) are employed to study the interfacial structure and adsorbed amount of the amino acids l-lysine and l-proline and their corresponding homopeptides, poly-l-lysine and poly-l-proline, at two liquid-solid interfaces. SFG and QCM-D experiments of these molecules are carried out at the interface between phosphate buffered saline at pH 7.4 (PBS) and the hydrophobic deuterated polystyrene (d{sub 8}-PS) surface as well as the interface between PBS and hydrophilic fused silica (SiO{sub 2}). The SFG spectra of the amino acids studied here are qualitatively similar to their corresponding homopeptides; however, the SFG signal from amino acids at the solid/PBS interface is smaller in magnitude relative to their more massive homopeptides at the concentrations studied here. Substantial differences are observed in SFG spectra for each species between the hydrophobic d{sub 8}-PS and the hydrophilic SiO{sub 2} liquid-solid interfaces, suggesting surface-dependent interfacial ordering of the biomolecules. Over the range of concentrations used in this study, QCM-D measurements also indicate that on both surfaces poly-l-lysine adsorbs to a greater extent than its constituent amino acid l-lysine. The opposite trend is demonstrated by poly-l-proline which sticks to both surfaces less extensively than its corresponding amino acid, l-proline. Lastly, we find that the adsorption of the molecules studied here can have a strong influence on interfacial water structure as detected in the SFG spectra.

  7. Fractional baud-length coding

    Directory of Open Access Journals (Sweden)

    J. Vierinen

    2011-06-01

    Full Text Available We present a novel approach for modulating radar transmissions in order to improve target range and Doppler estimation accuracy. This is achieved by using non-uniform baud lengths. With this method it is possible to increase sub-baud range-resolution of phase coded radar measurements while maintaining a narrow transmission bandwidth. We first derive target backscatter amplitude estimation error covariance matrix for arbitrary targets when estimating backscatter in amplitude domain. We define target optimality and discuss different search strategies that can be used to find well performing transmission envelopes. We give several simulated examples of the method showing that fractional baud-length coding results in smaller estimation errors than conventional uniform baud length transmission codes when estimating the target backscatter amplitude at sub-baud range resolution. We also demonstrate the method in practice by analyzing the range resolved power of a low-altitude meteor trail echo that was measured using a fractional baud-length experiment with the EISCAT UHF system.

  8. Telomere length and depression

    DEFF Research Database (Denmark)

    Wium-Andersen, Marie Kim; Ørsted, David Dynnes; Rode, Line

    2017-01-01

    BACKGROUND: Depression has been cross-sectionally associated with short telomeres as a measure of biological age. However, the direction and nature of the association is currently unclear. AIMS: We examined whether short telomere length is associated with depression cross-sectionally as well...... as prospectively and genetically. METHOD: Telomere length and three polymorphisms, TERT, TERC and OBFC1, were measured in 67 306 individuals aged 20-100 years from the Danish general population and associated with register-based attendance at hospital for depression and purchase of antidepressant medication....... RESULTS: Attendance at hospital for depression was associated with short telomere length cross-sectionally, but not prospectively. Further, purchase of antidepressant medication was not associated with short telomere length cross-sectionally or prospectively. Mean follow-up was 7.6 years (range 0...

  9. Myofilament length dependent activation

    Energy Technology Data Exchange (ETDEWEB)

    de Tombe, Pieter P.; Mateja, Ryan D.; Tachampa, Kittipong; Mou, Younss Ait; Farman, Gerrie P.; Irving, Thomas C. (IIT); (Loyola)

    2010-05-25

    The Frank-Starling law of the heart describes the interrelationship between end-diastolic volume and cardiac ejection volume, a regulatory system that operates on a beat-to-beat basis. The main cellular mechanism that underlies this phenomenon is an increase in the responsiveness of cardiac myofilaments to activating Ca{sup 2+} ions at a longer sarcomere length, commonly referred to as myofilament length-dependent activation. This review focuses on what molecular mechanisms may underlie myofilament length dependency. Specifically, the roles of inter-filament spacing, thick and thin filament based regulation, as well as sarcomeric regulatory proteins are discussed. Although the 'Frank-Starling law of the heart' constitutes a fundamental cardiac property that has been appreciated for well over a century, it is still not known in muscle how the contractile apparatus transduces the information concerning sarcomere length to modulate ventricular pressure development.

  10. Upper Extremity Length Equalization

    OpenAIRE

    DeCoster, Thomas A.; Ritterbusch, John; Crawford, Mark

    1992-01-01

    Significant upper extremity length inequality is uncommon but can cause major functional problems. The ability to position and use the hand may be impaired by shortness of any of the long bones of the upper extremity. In many respects upper and lower extremity length problems are similar. They most commonly occur after injury to a growing bone and the treatment modalities utilized in the lower extremity may be applied to the upper extremity. These treatment options include epiphysiodesis, sho...

  11. Restrictions and Proportionality

    DEFF Research Database (Denmark)

    Werlauff, Erik

    2009-01-01

    The article discusses three central aspects of the freedoms under European Community law, namely 1) the prohibition against restrictions as an important extension of the prohibition against discrimination, 2) a prohibition against exit restrictions which is just as important as the prohibition...... against host country restrictions, but which is often not recognised to the same extent by national law, and 3) the importance of also identifying and recognising an exit restriction, so that it is possible to achieve the required test of appropriateness and proportionality in relation to the rule...

  12. Interplay between multiple length and time scales in complex ...

    Indian Academy of Sciences (India)

    Administrator

    micelles and enzymes, can span several orders of magnitude in length and time scales. The length and time scales of ... length and time scales is required in order to understand and predict structure and dynamics in such com- plex systems. This review .... The late 1980s saw the birth of femtochemistry with Ahmed Zewail ...

  13. Length of a Hanging Cable

    Directory of Open Access Journals (Sweden)

    Eric Costello

    2011-01-01

    Full Text Available The shape of a cable hanging under its own weight and uniform horizontal tension between two power poles is a catenary. The catenary is a curve which has an equation defined by a hyperbolic cosine function and a scaling factor. The scaling factor for power cables hanging under their own weight is equal to the horizontal tension on the cable divided by the weight of the cable. Both of these values are unknown for this problem. Newton's method was used to approximate the scaling factor and the arc length function to determine the length of the cable. A script was written using the Python programming language in order to quickly perform several iterations of Newton's method to get a good approximation for the scaling factor.

  14. Restricting wolves risks escape

    Science.gov (United States)

    Mech, L. David; Ballard, Warren; Bangs, Ed; Ream, Bob

    2010-01-01

    Implementing the proposal set forth by Licht and colleagues (BioScience 60: 147–153) requires restricting wolves to tiny "islands," areas that are magnitudes smaller than the ranges of most wolf populations. Wolves naturally have large ranges; restricting their spatial needs increases the risk of wolves escaping, exacerbating public relations and political and legal problems.

  15. Relativistic Length Agony Continued

    Science.gov (United States)

    Redzic, D. V.

    2014-06-01

    We made an attempt to remedy recent confusing treatments of some basic relativistic concepts and results. Following the argument presented in an earlier paper (Redzic 2008b), we discussed the misconceptions that are recurrent points in the literature devoted to teaching relativity such as: there is no change in the object in Special Relativity, illusory character of relativistic length contraction, stresses and strains induced by Lorentz contraction, and related issues. We gave several examples of the traps of everyday language that lurk in Special Relativity. To remove a possible conceptual and terminological muddle, we made a distinction between the relativistic length reduction and relativistic FitzGerald-Lorentz contraction, corresponding to a passive and an active aspect of length contraction, respectively; we pointed out that both aspects have fundamental dynamical contents. As an illustration of our considerations, we discussed briefly the Dewan-Beran-Bell spaceship paradox and the 'pole in a barn' paradox.

  16. Telomere Length and Mortality

    DEFF Research Database (Denmark)

    Kimura, Masayuki; Hjelmborg, Jacob V B; Gardner, Jeffrey P

    2008-01-01

    Leukocyte telomere length, representing the mean length of all telomeres in leukocytes, is ostensibly a bioindicator of human aging. The authors hypothesized that shorter telomeres might forecast imminent mortality in elderly people better than leukocyte telomere length. They performed mortality...... telomeres predicted the death of the first co-twin better than the mTRFL did (mTRFL: 0.56, 95% confidence interval (CI): 0.49, 0.63; mTRFL(50): 0.59, 95% CI: 0.52, 0.66; mTRFL(25): 0.59, 95% CI: 0.52, 0.66; MTRFL: 0.60, 95% CI: 0.53, 0.67). The telomere-mortality association was stronger in years 3-4 than...

  17. Full Length Research Article

    African Journals Online (AJOL)

    Administrator

    Out of the 320 male sheep examined, 87(27.2%) were infected, while 9(19.1%) of the 47 females examined were infected (Table 2). Infection varied from one abattoir to another. Age related distribution of P. cervi is shown in Table 3. Out of 356 adult sheep (>2yrs) examined, 35. Full Length Research Article. 12 ...

  18. Screening length in dusty plasma crystals

    International Nuclear Information System (INIS)

    Nikolaev, V S; Timofeev, A V

    2016-01-01

    Particles interaction and value of the screening length in dusty plasma systems are of great interest in dusty plasma area. Three inter-particle potentials (Debye potential, Gurevich potential and interaction potential in the weakly collisional regime) are used to solve equilibrium equations for two dusty particles suspended in a parabolic trap. The inter-particle distance dependence on screening length, trap parameter and particle charge is obtained. The functional form of inter-particle distance dependence on ion temperature is investigated and compared with experimental data at 200-300 K in order to test used potentials applicability to dusty plasma systems at room temperatures. The preference is given to the Yukawa-type potential including effective values of particle charge and screening length. The estimated effective value of the screening length is 5-15 times larger than the Debye length. (paper)

  19. Betaine improved restriction digestion.

    Science.gov (United States)

    Sugimoto, Keiki; Makihara, Tohru; Saito, Aya; Ohishi, Nobuya; Nagase, Takahide; Takai, Daiya

    2005-12-02

    Here we report that supplementation of a common compound betaine (1-carboxy-N,N,N-trimethylmethanaminium inner salt) enhances restriction digestion of DNA molecules being resistant to digestion despite the existence of recognition sites. A previous study reported total isostabilization of DNA was achieved in the presence of 5.2M of betaine, however, we have observed the enhancement of restriction kinetics at 0.3M of betaine, therefore, it likely provided some catalytic proficiency to restriction enzymes rather than the induction of DNA conformational changes. Betaine also enhances catalytic efficiency of PCR, and our result of restriction digestion, taken together, suggests potential application of betaine in other enzymatic reactions in an aqueous solution.

  20. The SME gauge sector with minimum length

    Energy Technology Data Exchange (ETDEWEB)

    Belich, H.; Louzada, H.L.C. [Universidade Federal do Espirito Santo, Departamento de Fisica e Quimica, Vitoria, ES (Brazil)

    2017-12-15

    We study the gauge sector of the Standard Model Extension (SME) with the Lorentz covariant deformed Heisenberg algebra associated to the minimum length. In order to find and estimate corrections, we clarify whether the violation of Lorentz symmetry and the existence of a minimum length are independent phenomena or are, in some way, related. With this goal, we analyze the dispersion relations of this theory. (orig.)

  1. Gap length distributions by PEPR

    International Nuclear Information System (INIS)

    Warszawer, T.N.

    1980-01-01

    Conditions guaranteeing exponential gap length distributions are formulated and discussed. Exponential gap length distributions of bubble chamber tracks first obtained on a CRT device are presented. Distributions of resulting average gap lengths and their velocity dependence are discussed. (orig.)

  2. Energy restriction and potential energy restriction mimetics.

    Science.gov (United States)

    Nikolai, Sibylle; Pallauf, Kathrin; Huebbe, Patricia; Rimbach, Gerald

    2015-12-01

    Energy restriction (ER; also known as caloric restriction) is the only nutritional intervention that has repeatedly been shown to increase lifespan in model organisms and may delay ageing in humans. In the present review we discuss current scientific literature on ER and its molecular, metabolic and hormonal effects. Moreover, criteria for the classification of substances that might induce positive ER-like changes without having to reduce energy intake are summarised. Additionally, the putative ER mimetics (ERM) 2-deoxy-d-glucose, metformin, rapamycin, resveratrol, spermidine and lipoic acid and their suggested molecular targets are discussed. While there are reports on these ERM candidates that describe lifespan extension in model organisms, data on longevity-inducing effects in higher organisms such as mice remain controversial or are missing. Furthermore, some of these candidates produce detrimental side effects such as immunosuppression or lactic acidosis, or have not been tested for safety in long-term studies. Up to now, there are no known ERM that could be recommended without limitations for use in humans.

  3. Length of excitable knots

    Science.gov (United States)

    Maucher, Fabian; Sutcliffe, Paul

    2017-07-01

    In this paper, we present extensive numerical simulations of an excitable medium to study the long-term dynamics of knotted vortex strings for all torus knots up to crossing number 11. We demonstrate that FitzHugh-Nagumo evolution preserves the knot topology for all the examples presented, thereby providing a field theory approach to the study of knots. Furthermore, the evolution yields a well-defined minimal length for each knot that is comparable to the ropelength of ideal knots. We highlight the role of the medium boundary in stabilizing the length of the knot and discuss the implications beyond torus knots. We also show that there is not a unique attractor within a given knot topology.

  4. Pion nucleus scattering lengths

    International Nuclear Information System (INIS)

    Huang, W.T.; Levinson, C.A.; Banerjee, M.K.

    1971-09-01

    Soft pion theory and the Fubini-Furlan mass dispersion relations have been used to analyze the pion nucleon scattering lengths and obtain a value for the sigma commutator term. With this value and using the same principles, scattering lengths have been predicted for nuclei with mass number ranging from 6 to 23. Agreement with experiment is very good. For those who believe in the Gell-Mann-Levy sigma model, the evaluation of the commutator yields the value 0.26(m/sub σ//m/sub π/) 2 for the sigma nucleon coupling constant. The large dispersive corrections for the isosymmetric case implies that the basic idea behind many of the soft pion calculations, namely, slow variation of matrix elements from the soft pion limit to the physical pion mass, is not correct. 11 refs., 1 fig., 3 tabs

  5. [Effects of fertilization on fine root diameter, root length and specific root length in Larix kaempferi plantation].

    Science.gov (United States)

    Yu, Li-zhong; Ding, Guo-quan; Shi, Jian-wei; Yu, Shui-qiang; Zhu, Jiao-jun; Zhao, Lian-fu

    2007-05-01

    With 16 years old Larix kaempfersoil plantation in the mountainous area of eastern Liaoning Province as test object, this paper studied the effects of fertilization on the fine root diameter, root length, and specific root length (SRL) of the first to fifth order roots. The results showed that with ascending root orders, the mean fine root diameter and root length increased, while the SRL decreased significantly. Among the five order roots, the first order roots were the thinnest in diameter, the shortest in length, and the highest in SRL, but the fifth order roots were in reverse. The variance coefficients for the fine root diameter, root length, and SRL increased from the first to the fifth order roots. Except for the first order roots, soil depth had no significant influence on the fine root diameter, root length and SRL. Fertilization affected the fine root diameter, root length, and SRL of the first and the second order roots significantly, hut had little effects on other order roots. N fertilization decreased the mean diameter of the first and the second order roots significantly, and N or N + P fertilization decreased the mean length of the first order roots in surface soil (0-10 cm) significantly. The SRL of the first order roots in surface soil increased significantly under N fertilization.

  6. Comparison of restrictive and liberal transfusion strategy on postoperative delirium in aged patients following total hip replacement: a preliminary study.

    Science.gov (United States)

    Fan, Yun-Xia; Liu, Fang-Fang; Jia, Min; Yang, Jiao-Jiao; Shen, Jin-Chun; Zhu, Guang-Ming; Zhu, Si-Hai; Li, Wei-Yan; Yang, Jian-Jun; Ji, Mu-Huo

    2014-01-01

    Few studies have examined the association between perioperative blood transfusion and postoperative delirium (POD) in aged patients undergoing total hip replacement surgery. In this prospective study, 186 patients older than 65 years undergoing elective unilateral total hip replacement surgery were enrolled. Of those, 94 patients were randomly assigned to the restrictive strategy transfusion strategy group, in which red blood cells were transfused in order to maintain 10.0 g/dL>hemoglobin≧8.0 g/dL. Ninety-two patients were randomly assigned to the liberal transfusion strategy group, in which red blood cells were transfused in order to maintain hemoglobin≧10.0 g/dL. POD was diagnosed by confusion assessment method. The baseline characteristics of patients, the length of hospital stay, the incidence of POD, myocardial infarction, stroke, wound infection, pulmonary embolism, and the transfusion volume were recorded. No difference was observed in the baseline characteristics, the length of hospital stay, and the incidence of POD, myocardial infarction, stroke, wound infection, and pulmonary embolism between the two groups (P>0.05). The proportion of patients transfused with red blood cell and frozen plasma was decreased in the restrictive transfusion group compared with the liberal transfusion group (P<0.05). In conclusion, restrictive transfusion does not influence the incidence of POD but reduces blood transfusion. Thus, restrictive transfusion may serve as an effective and safe strategy for aged patients following total hip replacement. Copyright © 2014. Published by Elsevier Ireland Ltd.

  7. Length-weight and length-length relationships of freshwater wild ...

    African Journals Online (AJOL)

    Length-weight and length-length relationships of freshwater wild catfish Mystus bleekeri from Nala Daik, Sialkot, Pakistan. ... Linear regression analysis was used, first to compute the degree of relationship between length and weight and then among total (TL), standard (SL) and fork lengths (FL). LWR exhibited a highly ...

  8. Relativistic length agony continued

    Directory of Open Access Journals (Sweden)

    Redžić D.V.

    2014-01-01

    Full Text Available We made an attempt to remedy recent confusing treatments of some basic relativistic concepts and results. Following the argument presented in an earlier paper (Redžić 2008b, we discussed the misconceptions that are recurrent points in the literature devoted to teaching relativity such as: there is no change in the object in Special Relativity, illusory character of relativistic length contraction, stresses and strains induced by Lorentz contraction, and related issues. We gave several examples of the traps of everyday language that lurk in Special Relativity. To remove a possible conceptual and terminological muddle, we made a distinction between the relativistic length reduction and relativistic FitzGerald-Lorentz contraction, corresponding to a passive and an active aspect of length contraction, respectively; we pointed out that both aspects have fundamental dynamical contents. As an illustration of our considerations, we discussed briefly the Dewan-Beran-Bell spaceship paradox and the ‘pole in a barn’ paradox. [Projekat Ministarstva nauke Republike Srbije, br. 171028

  9. Molecular markers. Amplified fragment length polymorphism

    Directory of Open Access Journals (Sweden)

    Pržulj Novo

    2005-01-01

    Full Text Available Amplified Fragment Length Polymorphism molecular markers (AFLPs has been developed combining procedures of RFLPs and RAPDs molekular markers, i.e. the first step is restriction digestion of the genomic DNA that is followed by selective amplification of the restricted fragments. The advantage of the AFLP technique is that it allows rapid generation of a large number of reproducible markers. The reproducibility of AFLPs markers is assured by the use of restriction site-specific adapters and adapter-specific primers for PCR reaction. Only fragments containing the restriction site sequence plus the additional nucleotides will be amplified and the more selected nucleotides added on the primer sequence the fewer the number of fragments amplified by PCR. The amplified products are normally separated on a sequencing gel and visualized after exposure to X-ray film or by using fluorescent labeled primers. AFLP shave proven to be extremely proficient in revealing diversity at below the species level. A disadvantage of AFLP technique is that AFLPs are essentially a dominant marker system and not able to identify heterozygotes.

  10. Short cervical length dilemma.

    Science.gov (United States)

    Suhag, Anju; Berghella, Vincenzo

    2015-06-01

    Preterm birth (PTB) is a leading cause of neonatal morbidity and mortality. With research efforts, the rate of PTB decreased to 11.4% in 2013. Transvaginal ultrasound (TVU) cervical length (CL) screening predicts PTB. In asymptomatic singletons without prior spontaneous PTB (sPTB), TVU CL screening should be done. If the cervix is 20 mm or less, vaginal progesterone is indicated. In asymptomatic singletons with prior sPTB, serial CL screening is indicated. In multiple gestations, routine cervical screening is not indicated. In symptomatic women with preterm labor, TVU CL screening and fetal fibronectin testing is recommended. Copyright © 2015 Elsevier Inc. All rights reserved.

  11. discouraged by queue length

    Directory of Open Access Journals (Sweden)

    P. R. Parthasarathy

    2001-01-01

    Full Text Available The transient solution is obtained analytically using continued fractions for a state-dependent birth-death queue in which potential customers are discouraged by the queue length. This queueing system is then compared with the well-known infinite server queueing system which has the same steady state solution as the model under consideration, whereas their transient solutions are different. A natural measure of speed of convergence of the mean number in the system to its stationarity is also computed.

  12. Primary length standard adjustment

    Science.gov (United States)

    Ševčík, Robert; Guttenová, Jana

    2007-04-01

    This paper deals with problems and techniques connected with primary length standard adjusting, which includes disassembling of the device and by use of the secondary laser with collimated beam and diffraction laws successively reassembling of the laser. In the reassembling process the device was enhanced with substituting the thermal grease cooling of cold finger by copper socket cooler. This improved external cooling system enables more effective cooling of molecular iodine in the cell, which allows better pressure stability of iodine vapor and easier readjustment of the system.

  13. Late gestational nutrient restriction

    DEFF Research Database (Denmark)

    Tygesen, Malin Plumhoff; Nielsen, Mette Olaf; Nørgaard, Peder

    2008-01-01

    We investigated the effect of 50% nutrient restriction during the last 6 weeks of gestation on twin-pregnant ewes' plasma glucose, non-esterified fatty acid, ß-hydroxybutyrate, insulin, IGF-1 and leptin concentrations and the effects on lamb birth weight and ewes' lactation performance. Plasma...... metabolite and hormone concentrations in restricted ewes suggest that maternal tissues were being mobilised. Despite the ewes' adaptations their lambs weighed significantly less at birth. Furthermore, colostrum and milk yields were markedly reduced up until the latest measurement at 3 weeks post partum...... despite adlibitum access to feed. Reduced milk yields coincided with reduced plasma IGF-1 concentration pre partum in nutrient restricted ewes indicating, that mammary gland development may have been compromised. The present data suggest that leptin is not involved in the regulation of early lactation...

  14. Protein restriction and cancer.

    Science.gov (United States)

    Yin, Jie; Ren, Wenkai; Huang, Xingguo; Li, Tiejun; Yin, Yulong

    2018-03-26

    Protein restriction without malnutrition is currently an effective nutritional intervention known to prevent diseases and promote health span from yeast to human. Recently, low protein diets are reported to be associated with lowered cancer incidence and mortality risk of cancers in human. In murine models, protein restriction inhibits tumor growth via mTOR signaling pathway. IGF-1, amino acid metabolic programing, FGF21, and autophagy may also serve as potential mechanisms of protein restriction mediated cancer prevention. Together, dietary intervention aimed at reducing protein intake can be beneficial and has the potential to be widely adopted and effective in preventing and treating cancers. Copyright © 2018 Elsevier B.V. All rights reserved.

  15. 76 FR 18245 - West Tavaputs Plateau Road Restriction Order, Utah

    Science.gov (United States)

    2011-04-01

    ... Road Salt Lake Meridian, Utah T. 11 S., R. 18 E., sec. 27, SE\\1/4\\SE\\1/4\\; sec. 33, S\\1/2\\SE\\1/4\\; sec... Road Salt Lake Meridian, Utah T. 13 S., R. 17 E., sec. 8, S\\1/2\\SW\\1/4\\; sec. 17, NW\\1/4\\NW\\1/4\\; sec...\\. Jack Ridge Road Salt Lake Meridian, Utah T. 13 S., R. 16 E., sec. 8, NE\\1/4\\; sec. 9, SE\\1/4\\NE\\1/4...

  16. Relation between Tolman length and isothermal compressibility for simple liquids

    International Nuclear Information System (INIS)

    Wang Xiao-Song; Zhu Ru-Zeng

    2013-01-01

    The Tolman length δ 0 of a liquid with a plane surface has attracted increasing theoretical attention in recent years, but the expression of Tolman length in terms of observable quantities is still not very clear. In 2001, Bartell gave a simple expression of Tolman length δ 0 in terms of isothermal compressibility. However, this expression predicts that Tolman length is always negative, which is contrary to the results of molecular dynamics simulations (MDS) for simple liquids. In this paper, this contradiction is analyzed and the reason for the discrepancy in the sign is found. In addition, we introduce a new expression of Tolman length in terms of isothermal compressibility for simple fluids not near the critical points under some weak restrictions. The Tolman length of simple liquids calculated by using this formula is consistent with that obtained using MDS regarding the sign

  17. Training Restricted Boltzmann Machines

    DEFF Research Database (Denmark)

    Fischer, Asja

    Restricted Boltzmann machines (RBMs) are probabilistic graphical models that can also be interpreted as stochastic neural networks. Training RBMs is known to be challenging. Computing the likelihood of the model parameters or its gradient is in general computationally intensive. Thus, training...

  18. Scattering lengths of calcium and barium isotopes

    NARCIS (Netherlands)

    Dammalapati, U.; Willmann, L.; Knoop, S.

    2011-01-01

    We have calculated the s-wave scattering length of all the even isotopes of calcium (Ca) and barium (Ba) in order to investigate the prospect of Bose-Einstein condensation (BEC). For Ca we have used an accurate molecular potential based on detailed spectroscopic data. Our calculations show that Ca

  19. Word Order

    DEFF Research Database (Denmark)

    Rijkhoff, Jan

    2015-01-01

    The way constituents are ordered in a linguistic expression is determined by general principles and language specific rules. This article is mostly concerned with general ordering principles and the three main linguistic categories that are relevant for constituent order research: formal, functio...

  20. Sleep restriction progress to cardiac autonomic imbalance ...

    African Journals Online (AJOL)

    Since it's more difficult to maintain adequate sleep duration among night watchmen during their working schedule, hence the purpose of our present study was to investigate whether mental stress or fatigue over restricted sleep period in night shift, affects HRV, in order to elucidate on cardiac autonomic modulation among ...

  1. Restricted and quasi-toral restricted Lie-Rinehart algebras

    Directory of Open Access Journals (Sweden)

    Sun Bing

    2015-09-01

    Full Text Available In this paper, we introduce the definition of restrictable Lie-Rinehart algebras, the concept of restrictability is by far more tractable than that of a restricted Lie-Rinehart algebra. Moreover, we obtain some properties of p-mappings and restrictable Lie-Rinehart algebras. Finally, we give some sufficient conditions for the commutativity of quasi-toral restricted Lie-Rinehart algebras and study how a quasi-toral restricted Lie-Rinehart algebra with zero center and of minimal dimension should be.

  2. Correlation lengths of electrostatic turbulence

    International Nuclear Information System (INIS)

    Guiziou, L.; Garbet, X.

    1995-01-01

    This document deals with correlation length of electrostatic turbulence. First, the model of drift waves turbulence is presented. Then, the radial correlation length is determined analytically with toroidal coupling and non linear coupling. (TEC). 5 refs

  3. Correlation lengths of electrostatic turbulence

    International Nuclear Information System (INIS)

    Guiziou, L.; Garbet, X.

    1995-01-01

    In this paper, the radial correlation length of an electrostatic drift wave turbulence is analytically determined in various regimes. The analysis relies on the calculation of a range of mode non linear interaction, which is an instantaneous correlation length. The link with the usual correlation length has not been investigated yet. (TEC). 5 refs

  4. Random Number Conversion and LOCC Conversion via Restricted Storage

    OpenAIRE

    Kumagai, Wataru; Hayashi, Masahito

    2014-01-01

    We consider random number conversion (RNC) through random number storage with restricted size. We clarify the relation between the performance of RNC and the size of storage in the framework of first- and second- order asymptotics, and derive their rate regions. Then, we show that the results for RNC with restricted storage recover those for conventional RNC without storage in the limit of storage size. To treat RNC via restricted storage, we introduce a new kind of probability distributions ...

  5. Programmable DNA-Guided Artificial Restriction Enzymes.

    Science.gov (United States)

    Enghiad, Behnam; Zhao, Huimin

    2017-05-19

    Restriction enzymes are essential tools for recombinant DNA technology that have revolutionized modern biological research. However, they have limited sequence specificity and availability. Here we report a Pyrococcus furiosus Argonaute (PfAgo) based platform for generating artificial restriction enzymes (AREs) capable of recognizing and cleaving DNA sequences at virtually any arbitrary site and generating defined sticky ends of varying length. Short DNA guides are used to direct PfAgo to target sites for cleavage at high temperatures (>87 °C) followed by reannealing of the cleaved single stranded DNAs. We used this platform to generate over 18 AREs for DNA fingerprinting and molecular cloning of PCR-amplified or genomic DNAs. These AREs work as efficiently as their naturally occurring counterparts, and some of them even do not have any naturally occurring counterparts, demonstrating easy programmability, generality, versatility, and high efficiency for this new technology.

  6. Restrictions of anthelmintic usage

    DEFF Research Database (Denmark)

    Nielsen, Martin Krarup

    2009-01-01

    in 1966. The province of Quebec in Canada, and an increasing number of European countries, have implemented prescription-only restrictions on anthelmintic drugs. Denmark introduced this legislation ten years ago, and some evidence has been generated describing potential consequences. It is without dispute...... that Danish veterinarians are now deeply involved with parasite management in equine establishments. However, little is known about the impact on levels of anthelmintic resistance and the risk of parasitic disease under these circumstances. In addition, the legislation makes huge demands on diagnosis...

  7. A novel DNA restriction technology based on laser pulse energy conversion on sequence-specific bound metal nanoparticles

    Science.gov (United States)

    Csaki, Andrea; Maubach, Gunter; Garwe, Frank; Steinbrueck, Andrea; Koenig, Karsten; Fritzsche, Wolfgang

    2005-03-01

    DNA restriction is a basic method in today"s molecular biology. Besides application for DNA manipulation, this method is used in DNA analytics for 'restriction analysis'. Thereby DNA is digested by sequence specific restriction enzymes, and the length distribution of the resulting fragments is detected by gel electrophoresis. Differences in the sequence lead to different restriction patterns. A disadvantage of this standard method is the limitation to a small set of fixed sequences, so that the assay can not be adapted to any sequence of interest (e.g. SNP). We designed a scheme for DNA restriction in order to provide access to any desired sequence, based on laser light conversion on sequence-specific positioned metal nanoparticles. Especially gold nanoparticles are known for their interesting optical properties caused by plasmon resonance. The resulting absorption can be used to convert laser light pulses into heat, resulting in nanoparticle destruction. We work on the combination of this principle with DNA-modification of nanoparticles and the sequence-specific binding (hybridization) of these DNA-nanoparticle complexes along DNA molecules. Different mechanisms of light-conversion were studied, and the destructive effect of laser light on the nanoparticles and DNA is demonstrated.

  8. 7 CFR 982.41 - Free and restricted percentages.

    Science.gov (United States)

    2010-01-01

    ... Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... WASHINGTON Order Regulating Handling Marketing Policy § 982.41 Free and restricted percentages. The free and restricted percentages computed by the Board or established by the Secretary pursuant to § 982.40 shall apply...

  9. Length expectation values in quantum Regge calculus

    International Nuclear Information System (INIS)

    Khatsymovsky, V.M.

    2004-01-01

    Regge calculus configuration superspace can be embedded into a more general superspace where the length of any edge is defined ambiguously depending on the 4-tetrahedron containing the edge. Moreover, the latter superspace can be extended further so that even edge lengths in each the 4-tetrahedron are not defined, only area tensors of the 2-faces in it are. We make use of our previous result concerning quantization of the area tensor Regge calculus which gives finite expectation values for areas. Also our result is used showing that quantum measure in the Regge calculus can be uniquely fixed once we know quantum measure on (the space of the functionals on) the superspace of the theory with ambiguously defined edge lengths. We find that in this framework quantization of the usual Regge calculus is defined up to a parameter. The theory may possess nonzero (of the order of Planck scale) or zero length expectation values depending on whether this parameter is larger or smaller than a certain value. Vanishing length expectation values means that the theory is becoming continuous, here dynamically in the originally discrete framework

  10. The growth performance of growing pigs during feed restriction and ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-01-19

    Jan 19, 2009 ... Data on the body length (BL) and height at shoulders (HS) followed the same trend as observed for ADG. Feed intakes of pigs were significantly affected during the restriction and ... programmes. This result in considerable loses in the field .... 12.08 MJME/kg diet made up of 20% cassava chips, 5.5% maize,.

  11. Bunch length and the 102/90 degrees optics

    CERN Document Server

    Lamont, M

    1998-01-01

    The bunch length in LEP has become a cause for concern, particularly in the ramp to high energies. Short bunch lengths excite higher order modes which can cause heating of the inter-cavity bellows a nd may be picked up by antennae cables causing burning. The bunch length is also important from a cryogenics viewpoint; HOM losses go up with shorter bunches and more cryogenics power is required. Measurements made during 1997 show that it is strongly advisable to maintain bunch lengths above 9 mm particularly with high bunch currents. The use of a low emittance lattice such as 102/90 degr ees exacerbates the problem; because of the decreased momentum compaction the bunch lengths are naturally shorter. This paper quantifies the bunch lengths to be expected at various stages of ope ration in 1998 and presents recommendations for the avoidance of bunch lengths shorter than 9 mm.

  12. Amplified-fragment length polymorphism fingerprinting of Mycoplasma species

    DEFF Research Database (Denmark)

    Kokotovic, Branko; Friis, N.F.; Jensen, J.S.

    1999-01-01

    Amplified-fragment length polymorphism (AFLP) is a whole-genome fingerprinting method based on selective amplification of restriction fragments. The potential of the method for the characterization of mycoplasmas was investigated in a total of 50 strains of human and animal origin, including......I restriction endonucleases and subsequent ligation of corresponding site-specific adapters. The amplification of AFLP templates with a single set of nonselective primers resulted in reproducible fingerprints of approximately 60 to 80 fragments in the size range of 50 to 500 bp, The method was able...

  13. Endangered Species: Pesticide Restrictions

    Science.gov (United States)

    Our goal is to protect threatened and endangered species and their habitats, without placing unnecessary burden on agriculture and pesticide users. Pesticide limitations are developed to ensure safe use of pesticides in order to meet this goal.

  14. The Effective Coherence Length in Anisotropic Superconductors

    International Nuclear Information System (INIS)

    Polturak, E.; Koren, G.; Nesher, O

    1999-01-01

    If electrons are transmitted from a normal conductor(N) into a superconductor(S), common wisdom has it that the electrons are converted into Cooper pairs within a coherence length from the interface. This is true in conventional superconductors with an isotropic order parameter. We have established experimentally that the situation is rather different in high Tc superconductors having an anisotropic order parameter. We used epitaxial thin film S/N bilayers having different interface orientations in order to inject carriers from S into N along different directions. The distance to which these carriers penetrate were determined through their effect on the Tc of the bilayers. We found that the effective coherence length is 20A only along the a or b directions, while in other directions we find a length of 250dr20A out of plane, and an even larger value for in-plane, off high symmetry directions. These observations can be explained using the Blonder-Tinkham-Klapwijk model adapted to anisotropic superconductivity. Several implications of our results on outstanding problems with high Tc junctions will be discussed

  15. 7 Length-weight relationship

    African Journals Online (AJOL)

    Administrator

    Length-weight measurements were taken from well-preserved fish specimens from which stomachs were extracted for the analysis of the food contents, using frequency of occurrence, numerical and gravimetric methods, as well as index of relative importance. The length-frequency analysis showed a size distribution with a ...

  16. Comparison of fiber length analyzers

    Science.gov (United States)

    Don Guay; Nancy Ross Sutherland; Walter Rantanen; Nicole Malandri; Aimee Stephens; Kathleen Mattingly; Matt Schneider

    2005-01-01

    In recent years, several fiber new fiber length analyzers have been developed and brought to market. The new instruments provide faster measurements and the capability of both laboratory and on-line analysis. Do the various fiber analyzers provide the same length, coarseness, width, and fines measurements for a given fiber sample? This paper provides a comparison of...

  17. Sizing of high-pressure restriction orifices

    International Nuclear Information System (INIS)

    Casado Flores, E.

    1995-01-01

    Constant up-grading of power plants sometimes requires the modification of components which form part of suppliers' packages. In order to protect technology they have developed, however, the suppliers do not supply their calculation criteria. In order to reduce the costs of such improvements, and so as to be able to undertake the modification without having to rely on the original supplier, this paper describes the basic criteria applicable to the study of high-pressure restriction orifices, which can be considered to be representative of the components in question. The restriction orifices discussed are: - Insert - Multiplates in series with one perforation in each plate - Multiplates in series with several perforations in each plate For each type, an explanation of their sizing is given, together with the equations relating the corresponding flow and pressure drop. (Author)

  18. 5 CFR 838.242 - Computing lengths of service.

    Science.gov (United States)

    2010-01-01

    ... 5 Administrative Personnel 2 2010-01-01 2010-01-01 false Computing lengths of service. 838.242... Affecting Employee Annuities Procedures for Computing the Amount Payable § 838.242 Computing lengths of service. (a)(1) The smallest unit of time that OPM will calculate in computing a formula in a court order...

  19. Sleep restriction progress to cardiac autonomic imbalance

    Directory of Open Access Journals (Sweden)

    Arbind Kumar Choudhary

    2018-06-01

    Full Text Available Previous studies have shown that night shift work is thought to be a risk factor for cardiovascular disease and inadequate sleep is a common feature of night shift work. Since it’s more difficult to maintain adequate sleep duration among night watchmen during their working schedule, hence the purpose of our present study was to investigate whether mental stress or fatigue over restricted sleep period in night shift, affects HRV, in order to elucidate on cardiac autonomic modulation among nigh watchmen. With the purpose of this, autonomic activity determined from the levels of the heart rate variability (HRV, and also measured, body mass index (BMI, body fat percentage from skin fold thickness (biceps, triceps, and sub-scapular, supra-iliac among normal sleep watchmen (n = 28 and restricted sleep watchmen (n = 28 at first (1st day, fourth (4th day and seventh (7th day of restricted sleep period. We observed that among restricted sleep individuals, sleepiness was significant increase at 4th day and 7th day when compare to normal sleep individuals, and, there was significant increase in, mean NN, VLF, LF, LF(nu, LF/HF AND significant decrease in SDNN, RMSSD, TSP, HF, and HF(nu at 4th and 7th day of restricted sleep period. In addition to, this variable was more significant increase on 7th day, when compare with 4th day. As well as there was significant negative correlation between LF(nu and HF(nu at subsequent 4th day [r (48 = −0.84; P = 0.01] and 7th day[r (48 = −0.95; P = 0.01] of restricted sleep period. However we didn’t observe any significant variation in BMI, and body fat percentage among restricted sleep individuals when compare to normal sleep individuals with in this restricted sleep periods. Hence we concluded that partial sleep loss may cause autonomic imbalance represented by increased sympathetic and decreased parasympathetic activity; as revealed by altered HRV indices observed in this study. Keywords: Sleep

  20. Genetic relationships of Corynebacterium diphtheriae strains isolated from a diphtheria case and carriers by restriction fragment length polymorphism of rRNA genes Relação genética de cepas de Corynebacterium diphtheriae isoladas de caso e seus contatos por RLFP de rRNA gene

    Directory of Open Access Journals (Sweden)

    Claudio Tavares Sacchi

    1995-08-01

    Full Text Available In the present study we report the results of an analysis, based on ribotyping of Corynebacterium diphtheriae intermedius strains isolated from a 9 years old child with clinical diphtheria and his 5 contacts. Quantitative analysis of RFLPs of rRNA was used to determine relatedness of these 7 C.diphtheriae strains providing support data in the diphtheria epidemiology. We have also tested those strains for toxigenicity in vitro by using the Elek's gel diffusion method and in vivo by using cell culture method on cultured monkey kidney cell (VERO cells. The hybridization results revealed that the 5 C.diphtheriae strains isolated from contacts and one isolated from the clinical case (nose case strain had identical RFLP patterns with all 4 restriction endonucleases used, ribotype B. The genetic distance from this ribotype and ribotype A (throat case strain, that we initially assumed to be responsible for the illness of the patient, was of 0.450 showing poor genetic correlation among these two ribotypes. We found no significant differences concerned to the toxin production by using the cell culture method. In conclusion, the use of RFLPs of rRNA gene was successful in detecting minor differences in closely related toxigenic C.diphtheriae intermedius strains and providing information about genetic relationships among them.No presente estudo, nós reportamos os resultados de uma análise, baseada na ribotipagem de cepas de C. diphtheriae intermedius isoladas de uma criança de 9 anos com difteria e seus 5 contatos. Análise quantitativa por RFLP de rRNA foi usada para determinar a relação destas 7 cepas de C. diphtheriae fornecendo dados de interesse epidemiológico. Nós também testamos estas cepas para toxicidade in vitro usando método de difusão de Elek e in vivo usando método de cultura celular com células VERO. Os resultados de hibridização revelaram que as 5 cepas de C. diphtheriae isoladas dos contatos e uma isolada do caso (cepa isolada

  1. Aperiodic order

    CERN Document Server

    Grimm, Uwe

    2017-01-01

    Quasicrystals are non-periodic solids that were discovered in 1982 by Dan Shechtman, Nobel Prize Laureate in Chemistry 2011. The mathematics that underlies this discovery or that proceeded from it, known as the theory of Aperiodic Order, is the subject of this comprehensive multi-volume series. This second volume begins to develop the theory in more depth. A collection of leading experts, among them Robert V. Moody, cover various aspects of crystallography, generalising appropriately from the classical case to the setting of aperiodically ordered structures. A strong focus is placed upon almost periodicity, a central concept of crystallography that captures the coherent repetition of local motifs or patterns, and its close links to Fourier analysis. The book opens with a foreword by Jeffrey C. Lagarias on the wider mathematical perspective and closes with an epilogue on the emergence of quasicrystals, written by Peter Kramer, one of the founders of the field.

  2. Restriction enzyme-mediated DNA family shuffling.

    Science.gov (United States)

    Behrendorff, James B Y H; Johnston, Wayne A; Gillam, Elizabeth M J

    2014-01-01

    DNA shuffling is an established recombinatorial method that was originally developed to increase the speed of directed evolution experiments beyond what could be accomplished using error-prone PCR alone. To achieve this, mutated copies of a protein-coding sequence are fragmented with DNase I and the fragments are then reassembled in a PCR without primers. The fragments anneal where there is sufficient sequence identity, resulting in full-length variants of the original gene that have inherited mutations from multiple templates. Subsequent studies demonstrated that directed evolution could be further accelerated by shuffling similar native protein-coding sequences from the same gene family, rather than mutated variants of a single gene. Generally at least 65-75 % global identity between parental sequences is required in DNA family shuffling, with recombination mostly occurring at sites with at least five consecutive nucleotides of local identity. Since DNA shuffling was originally developed, many variations on the method have been published. In particular, the use of restriction enzymes in the fragmentation step allows for greater customization of fragment lengths than DNase I digestion and avoids the risk that parental sequences may be over-digested into unusable very small fragments. Restriction enzyme-mediated fragmentation also reduces the occurrence of undigested parental sequences that would otherwise reduce the number of unique variants in the resulting library. In the current chapter, we provide a brief overview of the alternative methods currently available for DNA shuffling as well as a protocol presented here that improves on several previous implementations of restriction enzyme-mediated DNA family shuffling, in particular with regard to purification of DNA fragments for reassembly.

  3. Maximum length scale in density based topology optimization

    DEFF Research Database (Denmark)

    Lazarov, Boyan Stefanov; Wang, Fengwen

    2017-01-01

    The focus of this work is on two new techniques for imposing maximum length scale in topology optimization. Restrictions on the maximum length scale provide designers with full control over the optimized structure and open possibilities to tailor the optimized design for broader range...... of manufacturing processes by fulfilling the associated technological constraints. One of the proposed methods is based on combination of several filters and builds on top of the classical density filtering which can be viewed as a low pass filter applied to the design parametrization. The main idea...

  4. Validity of plant fiber length measurement : a review of fiber length measurement based on kenaf as a model

    Science.gov (United States)

    James S. Han; Theodore. Mianowski; Yi-yu. Lin

    1999-01-01

    The efficacy of fiber length measurement techniques such as digitizing, the Kajaani procedure, and NIH Image are compared in order to determine the optimal tool. Kenaf bast fibers, aspen, and red pine fibers were collected from different anatomical parts, and the fiber lengths were compared using various analytical tools. A statistical analysis on the validity of the...

  5. Property Rights, Restrictions and Responsibilities

    DEFF Research Database (Denmark)

    Enemark, Stig

    more to a social, ethical commitment or attitude to environmental sustainability and good husbandry. This paper provides an overall understanding of the concept of land administration systems for dealing with rights, restrictions and responsibilities in future spatially enabled government. Finally......Land Administration Systems are the basis for conceptualizing rights, restrictions and responsibilities related to people, policies and places. Property rights are normally concerned with ownership and tenure whereas restrictions usually control use and activities on land. Responsibilities relate...

  6. Internal restriction sites: quality assurance aids in genotyping.

    Science.gov (United States)

    O'Rourke, Brendon A; Dennis, Julie A; Healy, Peter J

    2006-03-01

    Improvements to restriction fragment length polymorphism (RFLP)-based genotyping assays currently used for detection of mutations responsible for bovine ferrochelatase and myophosphorylase deficiencies, and equine hyperkalemic periodic paralysis (HYPP) are described. Reports of sporadic inhibition of restriction enzyme activity suggest a critical factor in RFLP-based genotyping assays should be assurance that restriction enzymes perform to specification with every sample. The RFLP genotyping assays that use either a mismatched recognition sequence in one or both of the oligonucleotides, or incorporate a second native site within the PCR amplicon, provide the mechanism by which efficiency of restriction enzymes can be assessed with every sample. The outcome is confirmation of the activity of the discriminating enzyme regardless of genotype.

  7. Restricted three-body problem in effective-field-theory models of gravity

    Science.gov (United States)

    Battista, Emmanuele; Esposito, Giampiero

    2014-04-01

    One of the outstanding problems of classical celestial mechanics was the restricted three-body problem, in which a planetoid of small mass is subject to the Newtonian attraction of two celestial bodies of large mass, as it occurs, for example, in the Sun-Earth-Moon system. On the other hand, over the last decades, a systematic investigation of quantum corrections to the Newtonian potential has been carried out in the literature on quantum gravity. The present paper studies the effect of these tiny quantum corrections on the evaluation of equilibrium points. It is shown that, despite the extreme smallness of the corrections, there exists no choice of sign of these corrections for which all qualitative features of the restricted three-body problem in Newtonian theory remain unaffected. Moreover, first-order stability of equilibrium points is characterized by solving a pair of algebraic equations of fifth degree, where some coefficients depend on the Planck length. The coordinates of stable equilibrium points are slightly changed with respect to Newtonian theory, because the planetoid is no longer at equal distance from the two bodies of large mass. The effect is conceptually interesting but too small to be observed, at least for the restricted three-body problems available in the solar system.

  8. Hydrodynamic slip length as a surface property

    Science.gov (United States)

    Ramos-Alvarado, Bladimir; Kumar, Satish; Peterson, G. P.

    2016-02-01

    Equilibrium and nonequilibrium molecular dynamics simulations were conducted in order to evaluate the hypothesis that the hydrodynamic slip length is a surface property. The system under investigation was water confined between two graphite layers to form nanochannels of different sizes (3-8 nm). The water-carbon interaction potential was calibrated by matching wettability experiments of graphitic-carbon surfaces free of airborne hydrocarbon contamination. Three equilibrium theories were used to calculate the hydrodynamic slip length. It was found that one of the recently reported equilibrium theories for the calculation of the slip length featured confinement effects, while the others resulted in calculations significantly hindered by the large margin of error observed between independent simulations. The hydrodynamic slip length was found to be channel-size independent using equilibrium calculations, i.e., suggesting a consistency with the definition of a surface property, for 5-nm channels and larger. The analysis of the individual trajectories of liquid particles revealed that the reason for observing confinement effects in 3-nm nanochannels is the high mobility of the bulk particles. Nonequilibrium calculations were not consistently affected by size but by noisiness in the smallest systems.

  9. The relationship between telomere length and beekeeping among Malaysians.

    Science.gov (United States)

    Nasir, Nurul Fatihah Mohamad; Kannan, Thirumulu Ponnuraj; Sulaiman, Siti Amrah; Shamsuddin, Shaharum; Azlina, Ahmad; Stangaciu, Stefan

    2015-06-01

    The belief that beekeepers live longer than anyone else is present since ages. However, no research has been done to explore the longevity of life in beekeepers. Here, we investigated the telomere length in 30 male beekeepers and 30 male non-beekeepers and associated them with the longevity of life using Southern analysis of terminal restriction fragments (TRFs) generated by Hinf I/Rsa I digestion of human genomic DNA using TeloTAGGG Telomere Length Assay. Interestingly, we found that the telomere length of male beekeepers was significantly longer than those of male non-beekeepers with a p value of less than 0.05, suggesting that beekeepers may have longer life compared to non-beekeepers. We further found that the consumption of bee products for a long period and frequent consumption of bee products per day are associated with telomere length. An increase of year in consuming bee products is associated with a mean increase in telomere length of 0.258 kbp. In addition, an increase in frequency of eating bee products per day was also associated with a mean increase of 2.66 kbp in telomere length. These results suggested that bee products might play some roles in telomere length maintenance.

  10. Restriction site polymorphisms in the pig beta-globin gene cluster.

    Science.gov (United States)

    Rando, A; Masina, P

    1985-01-01

    A restriction fragment length polymorphism was detected in pig DNA digested with Hind III restriction endonuclease and probed with rabbit beta 1-globin gene. Eight different phenotypes were observed and for six of them family data demonstrated that they are determined by three alleles. As this polymorphism is not found with four other restriction endonucleases (Bam HI, Eco RI, Kpn I, and Pst I), single point mutations are proposed to explain the observed differences.

  11. Molecular motion in restricted geometries

    Indian Academy of Sciences (India)

    Molecular dynamics in restricted geometries is known to exhibit anomalous behaviour. Diffusion, translational or rotational, of molecules is altered significantly on confinement in restricted geometries. Quasielastic neutron scattering (QENS) offers a unique possibility of studying molecular motion in such systems. Both time ...

  12. Restriction glycosylases: involvement of endonuclease activities in the restriction process.

    Science.gov (United States)

    Zhang, Yingbiao; Matsuzaka, Tomoyuki; Yano, Hirokazu; Furuta, Yoshikazu; Nakano, Toshiaki; Ishikawa, Ken; Fukuyo, Masaki; Takahashi, Noriko; Suzuki, Yutaka; Sugano, Sumio; Ide, Hiroshi; Kobayashi, Ichizo

    2017-02-17

    All restriction enzymes examined are phosphodiesterases generating 3΄-OH and 5΄-P ends, but one restriction enzyme (restriction glycosylase) excises unmethylated bases from its recognition sequence. Whether its restriction activity involves endonucleolytic cleavage remains unclear. One report on this enzyme, R.PabI from a hyperthermophile, ascribed the breakage to high temperature while another showed its weak AP lyase activity generates atypical ends. Here, we addressed this issue in mesophiles. We purified R.PabI homologs from Campylobacter coli (R.CcoLI) and Helicobacter pylori (R.HpyAXII) and demonstrated their DNA cleavage, DNA glycosylase and AP lyase activities in vitro at 37°C. The AP lyase activity is more coupled with glycosylase activity in R.CcoLI than in R.PabI. R.CcoLI/R.PabI expression caused restriction of incoming bacteriophage/plasmid DNA and endogenous chromosomal DNA within Escherichia coli at 37°C. The R.PabI-mediated restriction was promoted by AP endonuclease action in vivo or in vitro. These results reveal the role of endonucleolytic DNA cleavage in restriction and yet point to diversity among the endonucleases. The cleaved ends are difficult to repair in vivo, which may indicate their biological significance. These results support generalization of the concept of restriction–modification system to the concept of self-recognizing epigenetic system, which combines any epigenetic labeling and any DNA damaging.

  13. Improving computer security for authentication of users: influence of proactive password restrictions.

    Science.gov (United States)

    Proctor, Robert W; Lien, Mei-Ching; Vu, Kim-Phuong L; Schultz, E Eugene; Salvendy, Gavriel

    2002-05-01

    Entering a username-password combination is a widely used procedure for identification and authentication in computer systems. However, it is a notoriously weak method, in that the passwords adopted by many users are easy to crack. In an attempt to improve security, proactive password checking may be used, in which passwords must meet several criteria to be more resistant to cracking. In two experiments, we examined the influence of proactive password restrictions on the time that it took to generate an acceptable password and to use it subsequently to long in. The required length was a minimum of five characters in Experiment 1 and eight characters in Experiment 2. In both experiments, one condition had only the length restriction, and the other had additional restrictions. The additional restrictions greatly increased the time it took to generate the password but had only a small effect on the time it took to use it subsequently to long in. For the five-character passwords, 75% were cracked when no other restrictions were imposed, and this was reduced to 33% with the additional restrictions. For the eight-character passwords, 17% were cracked with no other restrictions, and 12.5% with restrictions. The results indicate that increasing the minimum character length reduces crackability and increases security, regardless of whether additional restrictions are imposed.

  14. Aging, adiposity, and calorie restriction.

    Science.gov (United States)

    Fontana, Luigi; Klein, Samuel

    2007-03-07

    Excessive calorie intake and subsequent obesity increases the risk of developing chronic disease and decreases life expectancy. In rodent models, calorie restriction with adequate nutrient intake decreases the risk of developing chronic disease and extends maximum life span. To evaluate the physiological and clinical implications of calorie restriction with adequate nutrient intake. Search of PubMed (1966-December 2006) using terms encompassing various aspects of calorie restriction, dietary restriction, aging, longevity, life span, adiposity, and obesity; hand search of journals that focus on obesity, geriatrics, or aging; and search of reference lists of pertinent research and review articles and books. Reviewed reports (both basic science and clinical) included epidemiologic studies, case-control studies, and randomized controlled trials, with quality of data assessed by taking into account publication in a peer-reviewed journal, number of animals or individuals studied, objectivity of measurements, and techniques used to minimize bias. It is not known whether calorie restriction extends maximum life span or life expectancy in lean humans. However, calorie restriction in adult men and women causes many of the same metabolic adaptations that occur in calorie-restricted rodents and monkeys, including decreased metabolic, hormonal, and inflammatory risk factors for diabetes, cardiovascular disease, and possibly cancer. Excessive calorie restriction causes malnutrition and has adverse clinical effects. Calorie restriction in adult men and women causes beneficial metabolic, hormonal, and functional changes, but the precise amount of calorie intake or body fat mass associated with optimal health and maximum longevity in humans is not known. In addition, it is possible that even moderate calorie restriction may be harmful in specific patient populations, such as lean persons who have minimal amounts of body fat.

  15. SNP-RFLPing: restriction enzyme mining for SNPs in genomes

    OpenAIRE

    Chang, Hsueh-Wei; Yang, Cheng-Hong; Chang, Phei-Lang; Cheng, Yu-Huei; Chuang, Li-Yeh

    2006-01-01

    Abstract Background The restriction fragment length polymorphism (RFLP) is a common laboratory method for the genotyping of single nucleotide polymorphisms (SNPs). Here, we describe a web-based software, named SNP-RFLPing, which provides the restriction enzyme for RFLP assays on a batch of SNPs and genes from the human, rat, and mouse genomes. Results Three user-friendly inputs are included: 1) NCBI dbSNP "rs" or "ss" IDs; 2) NCBI Entrez gene ID and HUGO gene name; 3) any formats of SNP-in-se...

  16. CEBAF Upgrade Bunch Length Measurements

    Energy Technology Data Exchange (ETDEWEB)

    Ahmad, Mahmoud [Old Dominion Univ., Norfolk, VA (United States)

    2016-05-01

    Many accelerators use short electron bunches and measuring the bunch length is important for efficient operations. CEBAF needs a suitable bunch length because bunches that are too long will result in beam interruption to the halls due to excessive energy spread and beam loss. In this work, bunch length is measured by invasive and non-invasive techniques at different beam energies. Two new measurement techniques have been commissioned; a harmonic cavity showed good results compared to expectations from simulation, and a real time interferometer is commissioned and first checkouts were performed. Three other techniques were used for measurements and comparison purposes without modifying the old procedures. Two of them can be used when the beam is not compressed longitudinally while the other one, the synchrotron light monitor, can be used with compressed or uncompressed beam.

  17. Continuously variable focal length lens

    Science.gov (United States)

    Adams, Bernhard W; Chollet, Matthieu C

    2013-12-17

    A material preferably in crystal form having a low atomic number such as beryllium (Z=4) provides for the focusing of x-rays in a continuously variable manner. The material is provided with plural spaced curvilinear, optically matched slots and/or recesses through which an x-ray beam is directed. The focal length of the material may be decreased or increased by increasing or decreasing, respectively, the number of slots (or recesses) through which the x-ray beam is directed, while fine tuning of the focal length is accomplished by rotation of the material so as to change the path length of the x-ray beam through the aligned cylindrical slows. X-ray analysis of a fixed point in a solid material may be performed by scanning the energy of the x-ray beam while rotating the material to maintain the beam's focal point at a fixed point in the specimen undergoing analysis.

  18. Kondo length in bosonic lattices

    Science.gov (United States)

    Giuliano, Domenico; Sodano, Pasquale; Trombettoni, Andrea

    2017-09-01

    Motivated by the fact that the low-energy properties of the Kondo model can be effectively simulated in spin chains, we study the realization of the effect with bond impurities in ultracold bosonic lattices at half filling. After presenting a discussion of the effective theory and of the mapping of the bosonic chain onto a lattice spin Hamiltonian, we provide estimates for the Kondo length as a function of the parameters of the bosonic model. We point out that the Kondo length can be extracted from the integrated real-space correlation functions, which are experimentally accessible quantities in experiments with cold atoms.

  19. Restrictive techniques: gastric banding

    Directory of Open Access Journals (Sweden)

    Katia Cristina da Cunha

    2006-03-01

    Full Text Available Surgery for the treatment of severe obesity has a definite role onthe therapeutic armamentarium all over the world. Initiated 40years ago, bariatric surgery has already a long way thanks tohundred of surgeons, who had constantly searched for the besttechnique for the adequate control of severe obesity. Among theimportant breakthroughs in obesity surgery there is theadjustable gastric band. It is a sylastic band, inflatable andadjustable, which is placed on the top of the stomach in order tocreate a 15-20 cc pouch, with an outlet of 1.3cm. The adjustablegastric band has also a subcutaneous reservoir through whichadjustments can be made, according to the patient evolution.The main feature of the adjustable gastric band is the fact thatis minimal invasive, reversible, adjustable and placedlaparoscopically. Then greatly diminishing the surgical traumato the severe obese patient. Belachew and Favretti’s techniqueof laparoscopic application of the adjustable gastric band isdescribed and the evolution of the technique during this years,as we has been practiced since 1998. The perioperative care ofthe patient is also described, as well as the follow-up and shortand long term controls.

  20. Genomic Fingerprinting of the Vaccine Strain of Clostridium Tetani by Restriction Fragment Length Polymorphism Technique

    Directory of Open Access Journals (Sweden)

    Naser Harzandi

    2013-05-01

    Full Text Available Background: Clostridium tetani or Nicolaier’s bacillus is an obligatory anaerobic, Gram-positive, movable with terminal or sub terminal spore. The chromosome of C. tetani contains 2,799,250 bp with a G+C content of 28.6%. The aim of this study was identification and genomic fingerprinting of the vaccine strain of C. tetani.Materials and Methods: The vaccine strain of C. tetani was provided by Razi Vaccine and Serum Research Institute. The seeds were inoculated into Columbia blood agar and grown for 72 h and transferred to the thioglycolate broth medium for further 36 h culturing. The cultures were incubated at 35ºC in anaerobic conditions. DNA extraction with phenol/ chloroform method was performed. After extraction, the consistency of DNA was assayed. Next, the vaccine strain was digested using pvuII enzyme and incubated at 37ºC for overnight. The digested DNA was gel-electrophoresed by 1% agarose for a short time. Then, the gel was studied with Gel Doc system and transferred to Hybond N+membrane using standard DNA blotting techniques.Results: The vaccine strain of C. tetani genome was fingerprinted by RFLP technique. Our preliminary results showed no divergence exists in the vaccine strain used for the production tetanus toxoid during the periods of 1990-2011.Conclusion: Observation suggests that there is lack of significant changes in RFLP genomic fingerprinting profile of the vaccine strain. Therefore, this strain did not lose its efficiency in tetanus vaccine production. RFLP analysis is worthwhile in investigating the nature of the vaccine strain C. tetani.

  1. Culture, Polymerase Chain Reaction and Restriction Fragment Length Polymorphism Studies in Bartonella bacilliformis

    Science.gov (United States)

    1998-09-22

    bartonellosis were conclusively linked in 1885. Bartonellosis earned the name Carrion’s disease from a Peruvian medical student, Daniel Alcides Carrion . In 1885...the life of Daniel Alcides Carri6n. A. J. C. P. 1991. 95(4): s58-s66. 4. Gray GC, Johnson AA., Thornton SA., et al. An epidemic of Oroya Fever in the... Carrion linked the two phases of the disease through self-experimentation. Carrion inoculated himself with blood taken from the eruption of a patient

  2. Restriction fragment length polymorphism within the class I gene loci of the equine major histocompatibility complex

    International Nuclear Information System (INIS)

    Alexander, A.J.; Bailey, E.; Woodward, J.G.

    1986-01-01

    Fourteen standard bred horses were serotyped as homozygous for 1 of 6 Equine Leukocyte Antigen (ELA) specificities. DNA was purified from peripheral leukocytes and digested with Hind III or Pvu II. Southern blot hybridization analysis was carried out using a 32 P-labeled mouse cDNA probe (PH2IIa) specific for class I MHC genes. Both enzymes generated blots that contained a large number of bands (23 to 30) per horse. Significant polymorphism existed among most fragment sizes, while a dozen highly conserved band sizes suggested the presence of Qa/tla - like genes. Only 2 animals (both W6's) showed identical band patterns. Polymorphism was greatest between horses of different serotypes and was significantly decreased within serotypes. Unique bands were present on both blots for both W1's and W6's and may account for the serologic specificity seen in ELA W1 and W6 horses. This study is consistent with the findings in other higher vertebrates and implies that the MHC of the horse includes a highly polymorphic class I multigene family

  3. Evaluating the Relationship between FRET Changes and Distance Changes Using DNA Length and Restriction Enzyme Specificity

    Science.gov (United States)

    Pazhani, Yogitha; Horn, Abigail E.; Grado, Lizbeth; Kugel, Jennifer F.

    2016-01-01

    FRET (Fo¨rster resonance energy transfer) involves the transfer of energy from an excited donor fluorophore to an acceptor molecule in a manner that is dependent on the distance between the two. A biochemistry laboratory experiment is described that teaches students how to use FRET to evaluate distance changes in biological molecules. Students…

  4. Cyclic codes of length 2

    Indian Academy of Sciences (India)

    Springer Verlag Heidelberg #4 2048 1996 Dec 15 10:16:45

    [X]/〈X2m. − 1〉 are given. Cyclic codes of length 2m over the finite field Fq, of odd characteristic, are defined in terms of their generator polynomials. The exact minimum distance and the dimension of the codes are obtained. Keywords.

  5. Diet, nutrition and telomere length.

    Science.gov (United States)

    Paul, Ligi

    2011-10-01

    The ends of human chromosomes are protected by DNA-protein complexes termed telomeres, which prevent the chromosomes from fusing with each other and from being recognized as a double-strand break by DNA repair proteins. Due to the incomplete replication of linear chromosomes by DNA polymerase, telomeric DNA shortens with repeated cell divisions until the telomeres reach a critical length, at which point the cells enter senescence. Telomere length is an indicator of biological aging, and dysfunction of telomeres is linked to age-related pathologies like cardiovascular disease, Parkinson disease, Alzheimer disease and cancer. Telomere length has been shown to be positively associated with nutritional status in human and animal studies. Various nutrients influence telomere length potentially through mechanisms that reflect their role in cellular functions including inflammation, oxidative stress, DNA integrity, DNA methylation and activity of telomerase, the enzyme that adds the telomeric repeats to the ends of the newly synthesized DNA. Copyright © 2011 Elsevier Inc. All rights reserved.

  6. Femur length and biparietal diameter

    African Journals Online (AJOL)

    2014-12-02

    Dec 2, 2014 ... Shipp TD, Bromley B, Mascola M, Benacerraf B. Variation in fetal femur length with respect to maternal race. J Ultrasound Med 2001;20:141‑4. 25. Deter RL, Harrist RB, Birnholz JC, Hadlock FP. Quantitative Obstetrical. Ultrasonography. New York: Wiley; 1986. 26. Yeh MN, Bracero L, Reilly KB, Murtha L, ...

  7. Non-integrability of restricted double pendula

    Energy Technology Data Exchange (ETDEWEB)

    Stachowiak, Tomasz, E-mail: stachowiak@cft.edu.pl [Center for Theoretical Physics PAS, Al. Lotnikow 32/46, 02-668 Warsaw (Poland); Szumiński, Wojciech, E-mail: uz88szuminski@gmail.com [Institute of Physics, University of Zielona Góra, Licealna 9, PL-65-407 Zielona Góra (Poland)

    2015-12-18

    We consider two special types of double pendula, with the motion of masses restricted to various surfaces. In order to get quick insight into the dynamics of the considered systems the Poincaré cross sections as well as bifurcation diagrams have been used. The numerical computations show that both models are chaotic which suggests that they are not integrable. We give an analytic proof of this fact checking the properties of the differential Galois group of the system's variational equations along a particular non-equilibrium solution.

  8. Keeping disease at arm's length

    DEFF Research Database (Denmark)

    Lassen, Aske Juul

    2015-01-01

    and physical activities at the activity centre. In this way, keeping disease at arm’s length is analysed as an ambiguous health strategy. The article shows the importance of looking into how active ageing is practised, as active ageing seems to work well in the everyday life of the older people by not giving......Many older people live with a range of chronic diseases. However, these diseases do not necessarily impede an active lifestyle. In this article the author analyses the relation between the active ageing discourse and the way older people at two Danish activity centres handle disease. How does...... active ageing change everyday life with chronic disease, and how do older people combine an active life with a range of chronic diseases? The participants in the study use activities to keep their diseases at arm’s length, and this distancing of disease at the same time enables them to engage in social...

  9. Fractional order junctions

    Science.gov (United States)

    Machado, J. Tenreiro

    2015-01-01

    Gottfried Leibniz generalized the derivation and integration, extending the operators from integer up to real, or even complex, orders. It is presently recognized that the resulting models capture long term memory effects difficult to describe by classical tools. Leon Chua generalized the set of lumped electrical elements that provide the building blocks in mathematical models. His proposal of the memristor and of higher order elements broadened the scope of variables and relationships embedded in the development of models. This paper follows the two directions and proposes a new logical step, by generalizing the concept of junction. Classical junctions interconnect system elements using simple algebraic restrictions. Nevertheless, this simplistic approach may be misleading in the presence of unexpected dynamical phenomena and requires including additional "parasitic" elements. The novel γ -junction includes, as special cases, the standard series and parallel connections and allows a new degree of freedom when building models. The proposal motivates the search for experimental and real world manifestations of the abstract conjectures.

  10. Order Aggressiveness and Order Book Dynamics

    OpenAIRE

    Anthony D. Hall; Nikolaus Hautsch

    2004-01-01

    In this paper, we study the determinants of order aggressiveness and traders' order submission strategy in an open limit order book market. Using order book data from the Australian Stock Exchange, we model traders' aggressiveness in market trading, limit order trading as well as in order cancellations on both sides of the market using a six-dimensional autoregressive intensity model. The information revealed by the open order book plays an important role in explaining the degree of order agg...

  11. Analysis of telomere length in Dolly, a sheep derived by nuclear transfer.

    Science.gov (United States)

    Shiels, P G; Kind, A J; Campbell, K H; Wilmut, I; Waddington, D; Colman, A; Schnieke, A E

    1999-01-01

    We have used a (TTAGGG) oligonucleotide probe to demonstrate that ovine telomeres are composed of (TTAGGG) repeat arrays and to compare the terminal restriction fragment lengths of sheep derived by natural mating and nuclear transfer. Here we show that ovine somatic telomeres decrease in length with age, and that Dolly, derived by the transfer of 6-year-old adult somatic nucleus, exhibits diminished terminal restriction fragment lengths. The decrease is consistent with the age of the donor tissue and telomere erosion during in vitro culture. Nuclear transfer does not restore telomere lengths. Dolly otherwise appears physiologically and phenotypically normal for her breed and age. We further report on apparent telomere lengthening in sheep, occurring during the first year in naturally derived lambs.

  12. SNP-RFLPing: restriction enzyme mining for SNPs in genomes

    Directory of Open Access Journals (Sweden)

    Cheng Yu-Huei

    2006-02-01

    Full Text Available Abstract Background The restriction fragment length polymorphism (RFLP is a common laboratory method for the genotyping of single nucleotide polymorphisms (SNPs. Here, we describe a web-based software, named SNP-RFLPing, which provides the restriction enzyme for RFLP assays on a batch of SNPs and genes from the human, rat, and mouse genomes. Results Three user-friendly inputs are included: 1 NCBI dbSNP "rs" or "ss" IDs; 2 NCBI Entrez gene ID and HUGO gene name; 3 any formats of SNP-in-sequence, are allowed to perform the SNP-RFLPing assay. These inputs are auto-programmed to SNP-containing sequences and their complementary sequences for the selection of restriction enzymes. All SNPs with available RFLP restriction enzymes of each input genes are provided even if many SNPs exist. The SNP-RFLPing analysis provides the SNP contig position, heterozygosity, function, protein residue, and amino acid position for cSNPs, as well as commercial and non-commercial restriction enzymes. Conclusion This web-based software solves the input format problems in similar softwares and greatly simplifies the procedure for providing the RFLP enzyme. Mixed free forms of input data are friendly to users who perform the SNP-RFLPing assay. SNP-RFLPing offers a time-saving application for association studies in personalized medicine and is freely available at http://bio.kuas.edu.tw/snp-rflp/.

  13. SNP-RFLPing: restriction enzyme mining for SNPs in genomes.

    Science.gov (United States)

    Chang, Hsueh-Wei; Yang, Cheng-Hong; Chang, Phei-Lang; Cheng, Yu-Huei; Chuang, Li-Yeh

    2006-02-17

    The restriction fragment length polymorphism (RFLP) is a common laboratory method for the genotyping of single nucleotide polymorphisms (SNPs). Here, we describe a web-based software, named SNP-RFLPing, which provides the restriction enzyme for RFLP assays on a batch of SNPs and genes from the human, rat, and mouse genomes. Three user-friendly inputs are included: 1) NCBI dbSNP "rs" or "ss" IDs; 2) NCBI Entrez gene ID and HUGO gene name; 3) any formats of SNP-in-sequence, are allowed to perform the SNP-RFLPing assay. These inputs are auto-programmed to SNP-containing sequences and their complementary sequences for the selection of restriction enzymes. All SNPs with available RFLP restriction enzymes of each input genes are provided even if many SNPs exist. The SNP-RFLPing analysis provides the SNP contig position, heterozygosity, function, protein residue, and amino acid position for cSNPs, as well as commercial and non-commercial restriction enzymes. This web-based software solves the input format problems in similar softwares and greatly simplifies the procedure for providing the RFLP enzyme. Mixed free forms of input data are friendly to users who perform the SNP-RFLPing assay. SNP-RFLPing offers a time-saving application for association studies in personalized medicine and is freely available at http://bio.kuas.edu.tw/snp-rflp/.

  14. Normal telomere lengths in naive and memory CD4+ T cells in HIV type 1 infection: a mathematical interpretation

    NARCIS (Netherlands)

    Wolthers, K. C.; Noest, A. J.; Otto, S. A.; Miedema, F.; de Boer, R. J.

    1999-01-01

    To study CD4+ T cell productivity during HIV-1 infection, CD4+ T cell telomere lengths were measured. Cross-sectional and longitudinal analysis of HIV-1-infected individuals with CD4+ T cells counts >300 cells/mm3 showed normal average telomeric restriction fragment (TRF) length and normal

  15. Normal telomere lengths in naive and memory CD4 T cells in HIV type 1 infection : a mathematical interpretation

    NARCIS (Netherlands)

    Wolthers, K.C.; Noest, A.J.; Otto, S.A.; Miedema, F.; Boer, R.J. de

    1999-01-01

    To study CD4+ T cell productivity during HIV-1 infection, CD4+ T cell telomere lengths were measured. Cross-sectional and longitudinal analysis of HIV-1-infected individuals with CD4+ T cells counts >300 cells/mm3 showed normal average telomeric restriction fragment (TRF) length and normal

  16. Gentile statistics and restricted partitions

    Indian Academy of Sciences (India)

    In a recent paper (Tran et al, Ann. Phys. 311, 204 (2004)), some asymptotic number theoretical results on the partitioning of an integer were derived exploiting its connection to the quantum density of states of a many-particle system. We generalise these results to obtain an asymptotic formula for the restricted or coloured ...

  17. Gentile statistics and restricted partitions

    Indian Academy of Sciences (India)

    We generalise these results to obtain an asymptotic formula for the restricted or coloured partitions p k s ( n ) , which is the number of partitions of an integer into the summand of th powers of integers such that each power of a given integer may occur utmost times. While the method is not rigorous, it reproduces the ...

  18. Restrictive dermopathy and fetal behaviour

    NARCIS (Netherlands)

    Mulder, EJH; Beemer, FA; Stoutenbeek, P

    We report three siblings from consecutive pregnancies affected with restrictive dermopathy (RD). During the second pregnancy, fetal behavioural development and growth were studied extensively using ultrasound at 1-4 week intervals. Dramatic and sudden changes occurred in fetal body movements and

  19. Pacifier restriction and exclusive breastfeeding.

    Science.gov (United States)

    Kair, Laura R; Kenron, Daniel; Etheredge, Konnette; Jaffe, Arthur C; Phillipi, Carrie A

    2013-04-01

    We tested the hypothesis that removing pacifiers from routine distribution in our mother-baby unit (MBU) would be associated with greater breastfeeding initiation or exclusivity during the birth hospitalization. We retrospectively compared exclusive breastfeeding, breastfeeding plus supplemental formula feeding, and exclusive formula feeding rates for 2249 infants admitted to the MBU at our university teaching hospital during the 5 months before and 8 months after restriction of routine pacifier distribution. Formula supplementation, if not medically indicated, was discouraged per standard practice, but access to formula was not restricted. Of the 2249 infants, 79% were exclusively breastfed from July through November 2010, when pacifiers were routinely distributed. During the 8-month period after pacifier restriction, this proportion decreased significantly to 68% (P pacifier distribution during the newborn hospitalization without also restricting access to formula was associated with decreased exclusive breastfeeding, increased supplemental formula feeding, and increased exclusive formula feeding. Because high-quality, prospective medical literature addressing pacifier use and breastfeeding does not conclusively show an adverse relationship in women who are motivated to breastfeed, more studies are needed to help determine what effect, if any, pacifiers have on breastfeeding initiation and exclusivity in the immediate newborn period.

  20. Cellular Mechanisms of Ciliary Length Control

    Directory of Open Access Journals (Sweden)

    Jacob Keeling

    2016-01-01

    Full Text Available Cilia and flagella are evolutionarily conserved, membrane-bound, microtubule-based organelles on the surface of most eukaryotic cells. They play important roles in coordinating a variety of signaling pathways during growth, development, cell mobility, and tissue homeostasis. Defects in ciliary structure or function are associated with multiple human disorders called ciliopathies. These diseases affect diverse tissues, including, but not limited to the eyes, kidneys, brain, and lungs. Many processes must be coordinated simultaneously in order to initiate ciliogenesis. These include cell cycle, vesicular trafficking, and axonemal extension. Centrioles play a central role in both cell cycle progression and ciliogenesis, making the transition between basal bodies and mitotic spindle organizers integral to both processes. The maturation of centrioles involves a functional shift from cell division toward cilium nucleation which takes place concurrently with its migration and fusion to the plasma membrane. Several proteinaceous structures of the distal appendages in mother centrioles are required for this docking process. Ciliary assembly and maintenance requires a precise balance between two indispensable processes; so called assembly and disassembly. The interplay between them determines the length of the resulting cilia. These processes require a highly conserved transport system to provide the necessary substances at the tips of the cilia and to recycle ciliary turnover products to the base using a based microtubule intraflagellar transport (IFT system. In this review; we discuss the stages of ciliogenesis as well as mechanisms controlling the lengths of assembled cilia.

  1. Controlling pandemic flu: the value of international air travel restrictions.

    Directory of Open Access Journals (Sweden)

    Joshua M Epstein

    2007-05-01

    Full Text Available Planning for a possible influenza pandemic is an extremely high priority, as social and economic effects of an unmitigated pandemic would be devastating. Mathematical models can be used to explore different scenarios and provide insight into potential costs, benefits, and effectiveness of prevention and control strategies under consideration.A stochastic, equation-based epidemic model is used to study global transmission of pandemic flu, including the effects of travel restrictions and vaccination. Economic costs of intervention are also considered. The distribution of First Passage Times (FPT to the United States and the numbers of infected persons in metropolitan areas worldwide are studied assuming various times and locations of the initial outbreak. International air travel restrictions alone provide a small delay in FPT to the U.S. When other containment measures are applied at the source in conjunction with travel restrictions, delays could be much longer. If in addition, control measures are instituted worldwide, there is a significant reduction in cases worldwide and specifically in the U.S. However, if travel restrictions are not combined with other measures, local epidemic severity may increase, because restriction-induced delays can push local outbreaks into high epidemic season. The per annum cost to the U.S. economy of international and major domestic air passenger travel restrictions is minimal: on the order of 0.8% of Gross National Product.International air travel restrictions may provide a small but important delay in the spread of a pandemic, especially if other disease control measures are implemented during the afforded time. However, if other measures are not instituted, delays may worsen regional epidemics by pushing the outbreak into high epidemic season. This important interaction between policy and seasonality is only evident with a global-scale model. Since the benefit of travel restrictions can be substantial while

  2. 49 CFR 215.203 - Restricted cars.

    Science.gov (United States)

    2010-10-01

    ... 49 Transportation 4 2010-10-01 2010-10-01 false Restricted cars. 215.203 Section 215.203..., DEPARTMENT OF TRANSPORTATION RAILROAD FREIGHT CAR SAFETY STANDARDS Restricted Equipment § 215.203 Restricted cars. (a) This section restricts the operation of any railroad freight car that is— (1) More than 50...

  3. Determination of funnel length from cross section versus LET measurements

    International Nuclear Information System (INIS)

    Golke, K.W.

    1993-01-01

    This paper proposes an empirical model and method for determining the funnel length from heavy ion upset cross section as a function LET data. It is valid for bulk technologies having a lightly doped epi region over a heavily doped substrate region. Definition of the funnel length is necessary in order to define the heavy ion track length along which charge is collected. Knowing the track length and the threshold LET for upset, the critical charge can be calculated. Critical charge as well as sensitive volume dimensions for upset are required input parameters for upset calculation codes such as CREME. The more accurate the critical charge calculation, the more accurate the calculated upset rate

  4. Higher-Order Program Generation

    DEFF Research Database (Denmark)

    Rhiger, Morten

    for OCaml, a dialect of ML, that provides run-time code generation for OCaml programs. We apply these byte-code combinators in semantics-directed compilation for an imperative language and in run-time specialization using type-directed partial evaluation. Finally, we present an approach to compiling goal......This dissertation addresses the challenges of embedding programming languages, specializing generic programs to specific parameters, and generating specialized instances of programs directly as executable code. Our main tools are higher-order programming techniques and automatic program generation...... infrastructure of higher-order functions, types, and modules. Furthermore, it has been observed that embedded programs can be restricted to those having simple types using a technique called ``phantom types''. We prove, using an idealized higher-order language, that such an embedding is sound (i.e., when all...

  5. Restrictive partially blind signature for resource-constrained information systems

    NARCIS (Netherlands)

    Qiu, Weidong; Gong, Zheng; Liu, Bozhong; Long, Yu; Chen, Kefei

    2010-01-01

    Restrictive partially blind signature, which is designed for privacy oriented information systems, allows a user to obtain a blind signature from a signer whilst the blind message must obey some certain rules. In order to reduce storage and communication costs, several public-key cryptosystems are

  6. Caloric restriction and its mimetics

    Directory of Open Access Journals (Sweden)

    Shin-Hae Lee

    2013-04-01

    Full Text Available Caloric restriction is the most reliable intervention to preventage-related disorders and extend lifespan. The reduction ofcalories by 10-30% compared to an ad libitum diet is known toextend the longevity of various species from yeast to rodents.The underlying mechanisms by which the benefits of caloricrestriction occur have not yet been clearly defined. However,many studies are being conducted in an attempt to elucidatethese mechanisms, and there are indications that the benefits ofcaloric restriction are related to alteration of the metabolic rateand the accumulation of reactive oxygen species. Duringmolecular signaling, insulin/insulin-like growth factor signaling,target of rapamycin pathway, adenosine monophosphateactivated protein kinase signaling, and Sirtuin are focused asunderlying pathways that mediate the benefits of caloricrestriction. Here, we will review the current status of caloricrestriction. [BMB Reports 2013; 46(4: 181-187

  7. On transition in plasma turbulence with multiple scale lengths

    Energy Technology Data Exchange (ETDEWEB)

    Itoh, K.; Spineanu, F.; Vlad, M.O. [National Inst. for Fusion Science, Toki, Gifu (Japan); Itoh, S.-I.; Kawasaki, M. [Kyushu Univ., Research Institute for Applied Mechanics, Kasuga, Fukuoka (Japan)

    2003-05-01

    A statistical theory of plasma turbulence which is composed of multiple-scale fluctuations is examined. Influences of statistical noise and variance of rapidly-changing variable in an adiabatic approximation are investigated. It is confirmed that the contributions of noise and variance remain higher order corrections. Transition rate of the turbulence with multiple scale lengths is obtained under the refined adiabatic approximation. (author)

  8. Mapping genes within a YAC by computer-assisted interpretation of partial restriction digestions.

    OpenAIRE

    Shields, D C; Butler, A; Mosurski, K R; Walsh, M T; Whitehead, A S

    1996-01-01

    Partial restriction digestion is used to map restriction sites and the location of genes within yeast artificial chromosomes (YACs). Locus-specific probes are hybridised to the partially digested YAC DNA and the fragments to which they hybridise are compared with the pattern of partial digestion products that include each map region. A least squares criterion is presented which allows for error in fragment length determination. This rapidly defines the most likely location of a marker within ...

  9. Focal Length Affects Depicted Shape and Perception of Facial Images.

    Directory of Open Access Journals (Sweden)

    Vít Třebický

    Full Text Available Static photographs are currently the most often employed stimuli in research on social perception. The method of photograph acquisition might affect the depicted subject's facial appearance and thus also the impression of such stimuli. An important factor influencing the resulting photograph is focal length, as different focal lengths produce various levels of image distortion. Here we tested whether different focal lengths (50, 85, 105 mm affect depicted shape and perception of female and male faces. We collected three portrait photographs of 45 (22 females, 23 males participants under standardized conditions and camera setting varying only in the focal length. Subsequently, the three photographs from each individual were shown on screen in a randomized order using a 3-alternative forced-choice paradigm. The images were judged for attractiveness, dominance, and femininity/masculinity by 369 raters (193 females, 176 males. Facial width-to-height ratio (fWHR was measured from each photograph and overall facial shape was analysed employing geometric morphometric methods (GMM. Our results showed that photographs taken with 50 mm focal length were rated as significantly less feminine/masculine, attractive, and dominant compared to the images taken with longer focal lengths. Further, shorter focal lengths produced faces with smaller fWHR. Subsequent GMM revealed focal length significantly affected overall facial shape of the photographed subjects. Thus methodology of photograph acquisition, focal length in this case, can significantly affect results of studies using photographic stimuli perhaps due to different levels of perspective distortion that influence shapes and proportions of morphological traits.

  10. Does neighborhood size really cause the word length effect?

    Science.gov (United States)

    Guitard, Dominic; Saint-Aubin, Jean; Tehan, Gerald; Tolan, Anne

    2018-02-01

    In short-term serial recall, it is well-known that short words are remembered better than long words. This word length effect has been the cornerstone of the working memory model and a benchmark effect that all models of immediate memory should account for. Currently, there is no consensus as to what determines the word length effect. Jalbert and colleagues (Jalbert, Neath, Bireta, & Surprenant, 2011a; Jalbert, Neath, & Surprenant, 2011b) suggested that neighborhood size is one causal factor. In six experiments we systematically examined their suggestion. In Experiment 1, with an immediate serial recall task, multiple word lengths, and a large pool of words controlled for neighborhood size, the typical word length effect was present. In Experiments 2 and 3, with an order reconstruction task and words with either many or few neighbors, we observed the typical word length effect. In Experiment 4 we tested the hypothesis that the previous abolition of the word length effect when neighborhood size was controlled was due to a confounded factor: frequency of orthographic structure. As predicted, we reversed the word length effect when using short words with less frequent orthographic structures than the long words, as was done in both of Jalbert et al.'s studies. In Experiments 5 and 6, we again observed the typical word length effect, even if we controlled for neighborhood size and frequency of orthographic structure. Overall, the results were not consistent with the predictions of Jalbert et al. and clearly showed a large and reliable word length effect after controlling for neighborhood size.

  11. Physiogenomic analysis of weight loss induced by dietary carbohydrate restriction

    Directory of Open Access Journals (Sweden)

    Wood Richard J

    2006-05-01

    Full Text Available Abstract Background Diets that restrict carbohydrate (CHO have proven to be a successful dietary treatment of obesity for many people, but the degree of weight loss varies across individuals. The extent to which genetic factors associate with the magnitude of weight loss induced by CHO restriction is unknown. We examined associations among polymorphisms in candidate genes and weight loss in order to understand the physiological factors influencing body weight responses to CHO restriction. Methods We screened for genetic associations with weight loss in 86 healthy adults who were instructed to restrict CHO to a level that induced a small level of ketosis (CHO ~10% of total energy. A total of 27 single nucleotide polymorphisms (SNPs were selected from 15 candidate genes involved in fat digestion/metabolism, intracellular glucose metabolism, lipoprotein remodeling, and appetite regulation. Multiple linear regression was used to rank the SNPs according to probability of association, and the most significant associations were analyzed in greater detail. Results Mean weight loss was 6.4 kg. SNPs in the gastric lipase (LIPF, hepatic glycogen synthase (GYS2, cholesteryl ester transfer protein (CETP and galanin (GAL genes were significantly associated with weight loss. Conclusion A strong association between weight loss induced by dietary CHO restriction and variability in genes regulating fat digestion, hepatic glucose metabolism, intravascular lipoprotein remodeling, and appetite were detected. These discoveries could provide clues to important physiologic adaptations underlying the body mass response to CHO restriction.

  12. Item and order memory for novel visual patterns assessed by two-choice recognition.

    Science.gov (United States)

    Avons, S E; Ward, Geoff; Melling, Lindsay

    2004-07-01

    Five experiments examined item and order memory for short lists of novel visual patterns. Memory was tested either by an item recognition test, choosing between a target and a similar foil (Experiments 1, 3a, and 4), or by a relative recency decision between two patterns that occupied adjacent list positions (Experiments 2, 3b, and 5). For both item recognition and relative recency tasks, accuracy was in most cases constant across serial positions, except for a recency advantage that was usually restricted to the most recent item or recency decision. Only a small and marginally significant effect of list length was observed for item recognition. Relative recency was more sensitive to list length and fell to near-chance levels with lists of eight items. We conclude that for these materials, prerecency item recognition depends on stable, context-free descriptions of items. Relative recency judgements are sensitive to list properties, but fail to show evidence of primacy or extended recency that are observed when other techniques are used to study serial order memory. We discuss the results in relation to four current models of serial order memory that embody different assumptions in the way that serial order is represented. Copyright 2004 The Experimental Psychology Society

  13. An Adequate First Order Logic of Intervals

    DEFF Research Database (Denmark)

    Chaochen, Zhou; Hansen, Michael Reichhardt

    1998-01-01

    This paper introduces left and right neighbourhoods as primitive interval modalities to define other unary and binary modalities of intervals in a first order logic with interval length. A complete first order logic for the neighbourhood modalities is presented. It is demonstrated how the logic can...... support formal specification and verification of liveness and fairness, and also of various notions of real analysis....

  14. Prenatal undernutrition and leukocyte telomere length in late adulthood: the Dutch famine birth cohort study

    NARCIS (Netherlands)

    de Rooij, Susanne R.; van Pelt, Ans M. M.; Ozanne, Susan E.; Korver, Cindy M.; van Daalen, Saskia K. M.; Painter, Rebecca C.; Schwab, Matthias; Viegas, Marcelo H.; Roseboom, Tessa J.

    2015-01-01

    Energy restriction in prenatal life has detrimental effects on later life health and longevity. Studies in rats have shown that the shortening of telomeres in key tissues plays an important role in this association. The aim of the current study was to investigate leukocyte telomere length in

  15. The effect of regular strength training on telomere length in human skeletal muscle

    DEFF Research Database (Denmark)

    Kadi, F.; Ponsot, Elodie; Piehl-Aulin, Karin

    2008-01-01

    taken from the vastus lateralis, and the mean and minimum telomeric restriction fragments (TRF) (telomere length) were determined, using the Southern blot protocol previously used for the analysis of skeletal muscle. RESULTS: There was no abnormal shortening of telomeres in PL. On the contrary, the mean...

  16. Evidence of a normal mean telomere fragment length in patients with Ullrich-Turner syndrome

    DEFF Research Database (Denmark)

    Kveiborg, Marie; Gravholt, Claus Højbjerg; Kassem, M

    2001-01-01

    Clinical and epidemiological studies suggest that premature ageing and increased morbidity and mortality is present in Ullrich-Turner syndrome. We studied telomere restriction fragment length (TRFL) in 30 women with Ullrich-Turner syndrome and 30 age-matched control women. All Turner women had th...

  17. Role of Surgeon in Length of Stay in ICU after Cardiac Bypass Surgery

    Directory of Open Access Journals (Sweden)

    Mahdi Najafi

    2010-03-01

    Conclusion: Surgeon category may independently predict a prolonged length of stay in the ICU. We suggest that a unique discharge protocol for post-CABG patients be considered to restrict the role of surgeon in the ICU stay of these patients.

  18. Effects of subcutaneous IL-2 therapy on telomere lengths in PBMC in HIV-infected patients

    DEFF Research Database (Denmark)

    Aladdin, H; Larsen, C S; Schjerling, P

    2001-01-01

    In this study we investigated the effect of interleukin-2 (IL-2) on mean terminal restriction fragment (TRF) lengths in peripheral blood mononuclear cells (PBMC). Ten human immunodeficiency virus (HIV)-infected individuals were included and IL-2 was administered subcutaneously with 3 x 106 IU thr...

  19. IS-linked movement of a restriction-modification system.

    Directory of Open Access Journals (Sweden)

    Noriko Takahashi

    Full Text Available Potential mobility of restriction-modification systems has been suggested by evolutionary/bioinformatic analysis of prokaryotic genomes. Here we demonstrate in vivo movement of a restriction-modification system within a genome under a laboratory condition. After blocking replication of a temperature-sensitive plasmid carrying a PaeR7I restriction-modification system in Escherichia coli cells, the plasmid was found integrated into the chromosome of the surviving cells. Sequence analysis revealed that, in the majority of products, the restriction-modification system was linked to chromosomal insertion sequences (ISs. Three types of products were: (I apparent co-integration of the plasmid and the chromosome at a chromosomal IS1 or IS5 copy (24/28 analyzed; (II de novo insertion of IS1 with the entire plasmid except for a 1-3 bp terminal deletion (2/28; and (III reciprocal crossing-over between the plasmid and the chromosome involving 1-3 bp of sequence identity (2/28. An R-negative mutation apparently decreased the efficiency of successful integration by two orders of magnitude. Reconstruction experiments demonstrated that the restriction-dependence was mainly due to selection against cells without proper integration: their growth was inhibited by the restriction enzyme action. These results demonstrate collaboration of a mobile element and a restriction-modification system for successful joint migration. This collaboration may have promoted the spread and, therefore, the long-term persistence of these complexes and restriction-modification systems in a wide range of prokaryotes.

  20. [Application of double created restriction site PCR-RFLP to identify MGMT gene polymorphisms].

    Science.gov (United States)

    Wang, Wei; Miao, Wenbin; Qiu, Yulan; Xia, Zhaolin

    2008-01-01

    To develop a proper assay for identifying single nucleotide polymorphisms( SNPs) of the MGMT gene. PCR primers were designed by create restriction site (CRS) method, then polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) was adopted to identify four SNPs in MGMT gene. By PCR, one primer pair yielded target products containing MGMT84 SNP site, and the other primer pair yielded target products containing MGMT143, 160, 178 SNP sites. Four restriction enzymes were adopted to identify the four SNPs, respectively. The effects of PCR and RFLP were good. The methods for four SNPs of MGMT determinated by CRS-PCR-RFLP theory could be facility, economy, and rapidness.

  1. Restriction Map Variation at the Adh Locus of Drosophila Melanogaster in Inverted and Noninverted Chromosomes

    OpenAIRE

    Aguade, M.

    1988-01-01

    Restriction map variation among 39 Standard and 40 In(2L)t chromosomes extracted from a Spanish natural population of Drosophila melanogaster was investigated for a 2.7-kb region encompassing the Adh locus with ten four-cutter restriction enzymes. A total of 20 polymorphisms were detected, representing 15 restriction site polymorphisms, 4 length polymorphisms and the allozyme polymorphism. Variation at the DNA level was compared among St-Adh(F), St-Adh(S) and t-Adh(S) chromosomes. t-Adh(S) ch...

  2. Detection of possible restriction sites for type II restriction enzymes in DNA sequences.

    Science.gov (United States)

    Gagniuc, P; Cimponeriu, D; Ionescu-Tîrgovişte, C; Mihai, Andrada; Stavarachi, Monica; Mihai, T; Gavrilă, L

    2011-01-01

    In order to make a step forward in the knowledge of the mechanism operating in complex polygenic disorders such as diabetes and obesity, this paper proposes a new algorithm (PRSD -possible restriction site detection) and its implementation in Applied Genetics software. This software can be used for in silico detection of potential (hidden) recognition sites for endonucleases and for nucleotide repeats identification. The recognition sites for endonucleases may result from hidden sequences through deletion or insertion of a specific number of nucleotides. Tests were conducted on DNA sequences downloaded from NCBI servers using specific recognition sites for common type II restriction enzymes introduced in the software database (n = 126). Each possible recognition site indicated by the PRSD algorithm implemented in Applied Genetics was checked and confirmed by NEBcutter V2.0 and Webcutter 2.0 software. In the sequence NG_008724.1 (which includes 63632 nucleotides) we found a high number of potential restriction sites for ECO R1 that may be produced by deletion (n = 43 sites) or insertion (n = 591 sites) of one nucleotide. The second module of Applied Genetics has been designed to find simple repeats sizes with a real future in understanding the role of SNPs (Single Nucleotide Polymorphisms) in the pathogenesis of the complex metabolic disorders. We have tested the presence of simple repetitive sequences in five DNA sequence. The software indicated exact position of each repeats detected in the tested sequences. Future development of Applied Genetics can provide an alternative for powerful tools used to search for restriction sites or repetitive sequences or to improve genotyping methods.

  3. String matching with variable length gaps

    DEFF Research Database (Denmark)

    Bille, Philip; Gørtz, Inge Li; Vildhøj, Hjalte Wedel

    2012-01-01

    We consider string matching with variable length gaps. Given a string T and a pattern P consisting of strings separated by variable length gaps (arbitrary strings of length in a specified range), the problem is to find all ending positions of substrings in T that match P. This problem is a basic...

  4. Identification of Egyptian Fasciola species by PCR and restriction endonucleases digestion of the nuclear small subunit ribosomal RNA gene.

    Science.gov (United States)

    El-Gozamy, Bothina R; Shoukry, Nahla M

    2009-08-01

    Fascioliasis is one of the familiar zoonotic health problems of worldwide distribution including Egypt. In this study, a simple and rapid polymerase chain reaction/restriction fragment length polymorphisms (PCR/RFLPs) assay, using the common restriction endonucleases Aval, EcoRI, Eael, Sac11 and Avail was applied to differentiate between both Fasciola gigantica and F. hepatica. The five restriction endonucleases were used to differentiate between the two species of Fasciola based on -1950 bp long sequence of the 18S nuclear small subunit ribosomal RNA gene. Aval and EcoRI restriction endonucleases failed to differentiate between the two Fasciola species when each restriction enzyme gave the same restriction patterns in both of them. However, F. gigantica and F. hepatica were well-differentiated when their small subunit ribosomal DNA were digested with Eael and Sac 11 restriction endonucleases.

  5. Rurality study of restricted areas

    Directory of Open Access Journals (Sweden)

    Sergio Rivaroli

    2011-02-01

    Full Text Available Two main perspectives of investigation emerge from the study of a territory’s rurality: a geographical approach and a sociological approach. The research examines the sub-regional study case of ‘Nuovo circondario imolese’. The analysis shows that the combination of traditional institutional criteria with detailed informations about the territory, generates more accurate results which determine a better comprehension of the characteristics of restricted areas’ rurality. Over the period 1991-2001, the study highlights an increase in rural areas. This result could be interpreted as an effect of urban sprawl’s intensification, that increases the competition between non-farm residences and agricultural activities.

  6. A phenomenological π-p scattering length from pionic hydrogen

    International Nuclear Information System (INIS)

    Ericson, T.E.O.; Loiseau, B.; Wycech, S.

    2004-01-01

    We derive a closed, model independent, expression for the electromagnetic correction factor to a phenomenological hadronic scattering length a h extracted from a hydrogenic atom. It is obtained in a non-relativistic approach and in the limit of a short ranged hadronic interaction to terms of order α 2 logα using an extended charge distribution. A hadronic πN scattering length a h π - p =0.0870(5)m π -1 is deduced leading to a πNN coupling constant from the GMO relation g c 2 /(4π)=14.04(17)

  7. A phenomenological $\\pi^{-}p$ scattering length from pionic hydrogen

    CERN Document Server

    Ericson, Torleif Eric Oskar; Wycech, S

    2004-01-01

    We derive a closed, model independent, expression for the electromagnetic correction factor to a phenomenological hadronic scattering length a/sup h/ extracted from a hydrogenic atom. It is obtained in a non-relativistic approach and in the limit of a short ranged hadronic interaction to terms of order alpha /sup 2/ log alpha using an extended charge distribution. A hadronic pi N scattering length a/sub pi -p//sup h/ = 0.0870(5)m/sub pi //sup -1/ is deduced leading to a pi NN coupling constant from the GMO relation g/sub c //sup 2//(4 pi ) = 14.04(17). (28 refs).

  8. Parenting and restrictions in childhood epilepsy

    NARCIS (Netherlands)

    Rodenburg, R.; Meijer, A.M.; Scherphof, C.; Carpay, J.A.; Augustijn, P.; Aldenkamp, A.P.; Deković, M.

    2013-01-01

    Purpose: From the overprotection literature, the predictive and interactional (moderation) effects of controlling and indulgent parenting on restrictions in children with epilepsy were examined. Methods: Parents of 73 children with epilepsy completed questionnaires on parenting, restrictions, and

  9. 9 CFR 78.5 - General restrictions.

    Science.gov (United States)

    2010-01-01

    ... INTERSTATE TRANSPORTATION OF ANIMALS (INCLUDING POULTRY) AND ANIMAL PRODUCTS BRUCELLOSIS Restrictions on Interstate Movement of Cattle Because of Brucellosis § 78.5 General restrictions. Cattle may not be moved...

  10. Calculation of the Crack Length for a Pipe Specimen using the Modified Load Ratio Method

    Energy Technology Data Exchange (ETDEWEB)

    Choi, Jung Hun; Koo, Jae Mean; Seok, Chang Sung [Sungkyunkwan University, Suwon (Korea, Republic of); Huh, Yong; Park, Jae Sil [Samsung Electronics Co., Suwon (Korea, Republic of)

    2009-12-15

    The objective of this paper is to apply the load ratio method to the measurement of the crack length of the real scale pipe specimen. The load ratio method was modified and finite element analyses were performed to derive the relationship between the normalized compliance and the normalized crack length for the pipe specimen. In order to measure the crack length, the direct current potential drop method and the modified load ratio method were applied to the pipe test. The applicability of the modified load ratio method was confirmed by comparing the calculated crack length with the measured crack length from the pipe experiment.

  11. Calculation of the Crack Length for a Pipe Specimen using the Modified Load Ratio Method

    International Nuclear Information System (INIS)

    Choi, Jung Hun; Koo, Jae Mean; Seok, Chang Sung; Huh, Yong; Park, Jae Sil

    2009-01-01

    The objective of this paper is to apply the load ratio method to the measurement of the crack length of the real scale pipe specimen. The load ratio method was modified and finite element analyses were performed to derive the relationship between the normalized compliance and the normalized crack length for the pipe specimen. In order to measure the crack length, the direct current potential drop method and the modified load ratio method were applied to the pipe test. The applicability of the modified load ratio method was confirmed by comparing the calculated crack length with the measured crack length from the pipe experiment

  12. 21 CFR 203.20 - Sales restrictions.

    Science.gov (United States)

    2010-04-01

    ... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Sales restrictions. 203.20 Section 203.20 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS: GENERAL PRESCRIPTION DRUG MARKETING Sales Restrictions § 203.20 Sales restrictions. Except as provided in § 203.22 or...

  13. Problem-Solving Test: Restriction Endonuclease Mapping

    Science.gov (United States)

    Szeberenyi, Jozsef

    2011-01-01

    The term "restriction endonuclease mapping" covers a number of related techniques used to identify specific restriction enzyme recognition sites on small DNA molecules. A method for restriction endonuclease mapping of a 1,000-basepair (bp)-long DNA molecule is described in the fictitious experiment of this test. The most important fact needed to…

  14. Restrictive Imputation of Incomplete Survey Data

    NARCIS (Netherlands)

    Vink, G.

    2015-01-01

    This dissertation focuses on finding plausible imputations when there is some restriction posed on the imputation model. In these restrictive situations, current imputation methodology does not lead to satisfactory imputations. The restrictions, and the resulting missing data problems are real-life

  15. Restricted Schur polynomials and finite N counting

    International Nuclear Information System (INIS)

    Collins, Storm

    2009-01-01

    Restricted Schur polynomials have been posited as orthonormal operators for the change of basis from N=4 SYM to type IIB string theory. In this paper we briefly expound the relationship between the restricted Schur polynomials and the operators forwarded by Brown, Heslop, and Ramgoolam. We then briefly examine the finite N counting of the restricted Schur polynomials.

  16. Restriction Enzyme Mapping: A Simple Student Practical.

    Science.gov (United States)

    Higgins, Stephen J.; And Others

    1990-01-01

    An experiment that uses the recombinant plasmid pX1108 to illustrate restriction mapping is described. The experiment involves three restriction enzymes and employs single and double restriction enzyme digestions. A list of needed materials, procedures, safety precautions, results, and discussion are included. (KR)

  17. Do cell phones affect establishing electronic working length?

    Science.gov (United States)

    Hurstel, Justine; Guivarc'h, Maud; Pommel, Ludovic; Camps, Jean; Tassery, Hervé; Cohen, Stephen; Bukiet, Frédéric

    2015-06-01

    Patients often keep their cell phones on and nearby during root canal therapy. Cell phones release electromagnetic interference, which might disturb electronic working length measurements. The purpose of this ex vivo study was to determine the effect of a cell phone (Apple iPhone 5 [Apple, Cupertino, CA] or KP100 [LG, Seoul, Korea]) placed into direct contact with an electronic apex locator (EAL) (Dentaport Root ZX module [J Morita Corp, Tokyo, Japan] or Propex II [Dentsply Maillefer, Ballaigues, Switzerland]) on working length determination. Twenty-six human premolars without fractures or carious lesions were used; previously cleaned; and observed under magnification (×15) in order to check for the presence of only 1 apical foramen, the absence of apical resorption, an "open" apex, and accessory canals. The working length measurement was performed with a #15 K-file in the presence of 2.6% sodium hypochlorite under 4 conditions: (1) visually, under the microscope until the file tip reached the canal terminus; (2) electronically, without the cell phone in proximity; (3) electronically, with the cell phone in standby mode placed in physical contact with the EAL; and (4) electronically, with the cell phone activated by a call in the same position. The experimental model for electronic working length determination was a screw top plastic container filled with a saline solution. The measurements were repeated 3 times per canal under each condition. Scores of 1 to 3 categorized the stability of the readings as follows: (1) good stability; (2) unstable reading with minor difficulties determining the working length; and (3) major difficulties or impossible to determine the working length. A 2-way repeated measures analysis of variance (way 1: cell phone type and way 2: EAL model) was performed, and a second repeated measures analysis of variance was performed to seek a difference among the 4 working length determination conditions. Neither the cell phone type nor the EAL

  18. Peyronie's Reconstruction for Maximum Length and Girth Gain: Geometrical Principles

    Directory of Open Access Journals (Sweden)

    Paulo H. Egydio

    2008-01-01

    Full Text Available Peyronie's disease has been associated with penile shortening and some degree of erectile dysfunction. Surgical reconstruction should be based on giving a functional penis, that is, rectifying the penis with rigidity enough to make the sexual intercourse. The procedure should be discussed preoperatively in terms of length and girth reconstruction in order to improve patient satisfaction. The tunical reconstruction for maximum penile length and girth restoration should be based on the maximum length of the dissected neurovascular bundle possible and the application of geometrical principles to define the precise site and size of tunical incision and grafting procedure. As penile rectification and rigidity are required to achieve complete functional restoration of the penis and 20 to 54% of patients experience associated erectile dysfunction, penile straightening alone may not be enough to provide complete functional restoration. Therefore, phosphodiesterase inhibitors, self-injection, or penile prosthesis may need to be added in some cases.

  19. Automated body hair counting and length measurement.

    Science.gov (United States)

    Vallotton, P; Thomas, N

    2008-11-01

    Hair loss or hair excess is a common condition. There is a growing need to quantitatively assess the success of interventions aimed at replenishing areas that lack hair or at removing hair from areas such as the back, the legs, or the arms. Non-invasive methods that do not require staining are highly desirable because the staining process itself may affect the efficacy of the treatment. We introduce a system based on a flatbed scanner and on novel and sensitive image analysis algorithms to count the number of hairs and their individual length. Additionally, a measure of hair visibility is introduced, which allows assessing objectively the severity of the condition. Our system is able to detect even hairs that are difficult to see to a human observer. It is robust to skin impurities or variations in the skin texture and colour. Scanner imaging ensures a sharp image over the whole field. The system analyses on the order of two images per minute, making it suitable for large clinical studies. Counts delivered by a human counter vs. the software were within 10% of each other (N=12). Based on our results, we expect that the software will be useful to a number of researchers investigating medical and cosmetic issues involving objective assessment of pilosity. The algorithm itself may be of use for other applications.

  20. Full length prototype SSC dipole test results

    International Nuclear Information System (INIS)

    Strait, J.; Brown, B.C.; Carson, J.

    1987-01-01

    Results are presented from tests of the first full length prototype SSC dipole magnet. The cryogenic behavior of the magnet during a slow cooldown to 4.5K and a slow warmup to room temperature has been measured. Magnetic field quality was measured at currents up to 2000 A. Averaged over the body field all harmonics with the exception of b 2 and b 8 are at or within the tolerances specified by the SSC Central Design Group. (The values of b 2 and b 8 result from known design and construction defects which will be be corrected in later magnets.) Using an NMR probe the average body field strength is measured to be 10.283 G/A with point to point variations on the order of one part in 1000. Data are presented on quench behavior of the magnet up to 3500 A (approximately 55% of full field) including longitudinal and transverse velocities for the first 250 msec of the quench

  1. A Traffic Restriction Scheme for Enhancing Carpooling

    Directory of Open Access Journals (Sweden)

    Dong Ding

    2017-01-01

    Full Text Available For the purpose of alleviating traffic congestion, this paper proposes a scheme to encourage travelers to carpool by traffic restriction. By a variational inequity we describe travelers’ mode (solo driving and carpooling and route choice under user equilibrium principle in the context of fixed demand and detect the performance of a simple network with various restriction links, restriction proportions, and carpooling costs. Then the optimal traffic restriction scheme aiming at minimal total travel cost is designed through a bilevel program and applied to a Sioux Fall network example with genetic algorithm. According to various requirements, optimal restriction regions and proportions for restricted automobiles are captured. From the results it is found that traffic restriction scheme is possible to enhance carpooling and alleviate congestion. However, higher carpooling demand is not always helpful to the whole network. The topology of network, OD demand, and carpooling cost are included in the factors influencing the performance of the traffic system.

  2. 33 CFR 83.35 - Sound signals in restricted visibility (Rule 35).

    Science.gov (United States)

    2010-07-01

    ... engaged in fishing; vessels engaged in towing or pushing. A vessel not under command; a vessel restricted... fishing, whether underway or at anchor; and a vessel engaged in towing or pushing another vessel shall... length; and (2) A barge, canal boat, scow, or other nondescript craft. ...

  3. The X chromosome shows less genetic variation at restriction sites than the autosomes

    NARCIS (Netherlands)

    Hofker, M. H.; Skraastad, M. I.; Bergen, A. A.; Wapenaar, M. C.; Bakker, E.; Millington-Ward, A.; van Ommen, G. J.; Pearson, P. L.

    1986-01-01

    Using a standard technique, 122 single-copy probes were screened for their ability to detect restriction fragment length polymorphisms (RFLPs) in the human genome. The use of a standardized RFLP screening enables the introduction of statistical methods in the analysis of differences in RFLP content

  4. Short Rayleigh Length Free Electron Lasers

    CERN Document Server

    Crooker, P P; Armstead, R L; Blau, J

    2004-01-01

    Conventional free electron laser (FEL) oscillators minimize the optical mode volume around the electron beam in the undulator by making the resonator Rayleigh length about one third of the undulator length. This maximizes gain and beam-mode coupling. In compact configurations of high-power infrared FELs or moderate power UV FELs, the resulting optical intensity can damage the resonator mirrors. To increase the spot size and thereby reduce the optical intensity at the mirrors below the damage threshold, a shorter Rayleigh length can be used, but the FEL interaction is significantly altered. A new FEL interaction is described and analyzed with a Rayleigh length that is only one tenth the undulator length, or less. The effect of mirror vibration and positioning are more critical in the short Rayleigh length design, but we find that they are still within normal design tolerances.

  5. Measurement of endodontic file lengths: calibrated versus uncalibrated digital images.

    Science.gov (United States)

    Loushine, R J; Weller, R N; Kimbrough, W F; Potter, B J

    2001-12-01

    This in vitro study compared the accuracy of file length measurements made on calibrated and uncalibrated direct digital images. Endodontic files of known lengths and ISO sizes were used in 10 single-rooted, relatively straight teeth within cadaver specimens. The crowns of the teeth were ground flat and an orthodontic wire of known length was secured to the coronal surface. This wire was placed mesiodistally and perpendicular to the root and served as the reference point for the file measurement and as a calibration reference length. A #20 file was hand-measured to a length that reached the apical third of each tooth. It was inserted and a radiographic image was secured. The instrument was remeasured three additional times at different lengths on the same tooth and reinserted before each image acquisition. Thus 40 digital images were acquired using a GE X-ray unit and a Schick Computed Dental Radiography (CDR) #2 sensor. These images were placed in random order, and an independent, blinded investigator determined the file lengths using on-screen calibrated and uncalibrated measurement of the CDR image with a straight-line and multiple-line measuring technique. The experimental measurements were compared with each other and with the known clinical measurements. A two-way analysis of variance indicated that there was a statistically significant difference showing that the calibrated measurements were more accurate than the uncalibrated measurements (p = 0.0001), and there was no significant difference between the straight-line and multiple-line measuring techniques (p = 0.14).

  6. Radiographic assessment of endodontic working length

    OpenAIRE

    Osama S Alothmani; Lara T Friedlander; Nicholas P Chandler

    2013-01-01

    The use of radiographs for working length determination is usual practice in endodontics. Exposing radiographs following the principles of the paralleling technique allows more accurate length determination compared to the bisecting-angle method. However, it has been reported that up to 28.5% of cases can have the file tip extending beyond the confines of the root canals despite an acceptable radiographic appearance. The accuracy of radiographic working length determination could be affected ...

  7. Information, polarization and term length in democracy

    DEFF Research Database (Denmark)

    Schultz, Christian

    2008-01-01

    accountable, but the re-election incentive leads to policy-distortion as the government seeks to manipulate swing voters' beliefs to make its ideology more popular. This creates a trade-off: A short term length improves accountability but gives distortions. A short term length is best for swing voters when......This paper considers term lengths in a representative democracy where the political issue divides the population on the left-right scale. Parties are ideologically different and better informed about the consequences of policies than voters are. A short term length makes the government more...

  8. The Benefits of Calorie Restriction and Calorie Restriction Mimetics as Related to the Eye

    OpenAIRE

    Anekonda, T.S.

    2009-01-01

    The effects of calorie restriction without malnutrition seem to possess many beneficial effects in numerous disease states. Recently, studies related to calorie restriction mimetics that biochemically mimic the effects of calorie restriction are also becoming increasingly popular. Both calorie restriction and calorie restriction mimetics trigger an adaptive response reminiscent of mild-stress or low-dose toxic response, which is frequently referred to as hormesis in the toxicology literature....

  9. Restrictive vs liberal transfusion for upper gastrointestinal bleeding: a meta-analysis of randomized controlled trials.

    Science.gov (United States)

    Wang, Juan; Bao, Yong-Xin; Bai, Ming; Zhang, Yong-Guo; Xu, Wen-Da; Qi, Xing-Shun

    2013-10-28

    To compare the outcome of upper gastrointestinal bleeding (UGIB) between patients receiving restrictive and liberal transfusion. PubMed, EMBASE, and Cochrane Library databases were employed to identify all relevant randomized controlled trials regarding the outcome of UGIB after restrictive or liberal transfusion. Primary outcomes were death and rebleeding. Secondary outcomes were length of hospitalization, amount of blood transfused, and hematocrit and hemoglobin at discharge or after expansion. Overall, 4 papers were included in this meta-analysis. The incidence of death was significantly lower in patients receiving restrictive transfusion than those receiving liberal transfusion (OR: 0.52, 95%CI: 0.31-0.87, P = 0.01). The incidence of rebleeding was lower in patients receiving restrictive transfusion than those receiving liberal transfusion, but this difference did not reach any statistical significance (OR: 0.26, 95%CI: 0.03-2.10, P = 0.21). Compared with those receiving liberal transfusion, patients receiving restrictive transfusion had a significantly shorter length of hospitalization (standard mean difference: -0.17, 95%CI: -0.30--0.04, P = 0.009) and a significantly smaller amount of blood transfused (standard mean difference: -0.74, 95%CI: -1.15--0.32, P = 0.0005) with a lower hematocrit and hemoglobin level at discharge or after expansion. Restrictive transfusion should be employed in patients with UGIB.

  10. Microtubules restrict plastid sedimentation in protonemata of the moss Ceratodon

    Science.gov (United States)

    Schwuchow, J.; Sack, F. D.

    1994-01-01

    Apical cells of protonemata of the moss Ceratodon purpureus are unusual among plant cells with sedimentation in that only some amyloplasts sediment and these do not fall completely to the bottom of vertical cells. To determine whether the cytoskeleton restricts plastid sedimentation, the effects of amiprophos-methyl (APM) and cytochalasin D (CD) on plastid position were quantified. APM treatments of 30-60 min increased the plastid sedimentation that is normally seen along the length of untreated or control cells. Longer APM treatments often resulted in more dramatic plastid sedimentation, and in some cases almost all plastids sedimented to the lowermost point in the cell. In contrast, the microfilament inhibitor CD did not affect longitudinal plastid sedimentation compared to untreated cells, although it did disturb or eliminate plastid zonation in the tip. These data suggest that microtubules restrict the sedimentation of plastids along the length of the cell and that microtubules are load-bearing for all the plastids in the apical cell. This demonstrates the importance of the cytoskeleton in maintaining organelle position and cell organization against the force of gravity.

  11. Bond lengths in organic and metal-organic compounds revisited: X-H bond lengths from neutron diffraction data.

    Science.gov (United States)

    Allen, Frank H; Bruno, Ian J

    2010-06-01

    The number of structures in the Cambridge Structural Database (CSD) has increased by an order of magnitude since the preparation of two major compilations of standard bond lengths in mid-1985. It is now of interest to examine whether this huge increase in data availability has implications for the mean bond-length values published in the late 1980s. Those compilations reported mean X-H bond lengths derived from rather sparse information and for rather few chemical environments. During the intervening years, the number of neutron studies has also increased, although only by a factor of around 2.25, permitting a new analysis of X-H bond-length distributions for (a) organic X = C, N, O, B, and (b) a variety of terminal and homometallic bridging transition metal hydrides. New mean values are reported here and are compared with earlier results. These new overall means are also complemented by an analysis of X-H distances at lower temperatures (T chemical environments for which statistically acceptable mean X-H bond lengths can be obtained, although values from individual structures are also collated to further extend the chemical range of this compilation. Updated default 'neutron-normalization' distances for use in hydrogen-bond and deformation-density studies are also proposed for C-H, N-H and O-H, and the low-temperature analysis provides specific values for certain chemical environments and hybridization states of X.

  12. Normal standards for kidney length as measured with US in premature infants

    International Nuclear Information System (INIS)

    Schlesinger, A.E.; Hedlund, G.L.; Pierson, W.P.; Null, D.M.

    1986-01-01

    In order to develop normal standards for kidney length in premature infants, the authors measured kidney length by US imaging in 39 (to date) premature infants less than 72 hours old and without known renal disease. Kidney length was compared with four different parameters of body size, including gestational age, birth weight, birth length, and body surface area. Similar standards have been generated previously for normal renal length as measured by US imaging in full-term infants and older children. These standards have proven utility in cases of congenital and acquired disorders that abnormally increase or decrease renal size. Scatter plots of kidney length versus body weight and kidney length versus body surface area conformed well to a logarithmic distribution, with a high correlation coefficient and close-fitting 95% confidence limits (SEE = 2.05)

  13. Genetic association of telomere length with hepatocellular carcinoma risk: A Mendelian randomization analysis.

    Science.gov (United States)

    Cheng, Yue; Yu, Chengxiao; Huang, Mingtao; Du, Fangzhi; Song, Ci; Ma, Zijian; Zhai, Xiangjun; Yang, Yuan; Liu, Jibin; Bei, Jin-Xin; Jia, Weihua; Jin, Guangfu; Li, Shengping; Zhou, Weiping; Liu, Jianjun; Dai, Juncheng; Hu, Zhibin

    2017-10-01

    Observational studies show an association between telomere length and Hepatocellular carcinoma (HCC) risk, but the relationship is controversial. Particularly, it remains unclear whether the association is due to confounding or biases inherent in conventional epidemiological studies. Here, we applied Mendelian randomization approach to evaluate whether telomere length is causally associated with HCC risk. Individual-level data were from HBV-related HCC Genome-wide association studies (1,538 HBV positive HCC patients and 1,465 HBV positive controls). Genetic risk score, as proxy for actual measured telomere length, derived from nine telomere length-associated genetic variants was used to evaluate the effect of telomere length on HCC risk. We observed a significant risk signal between genetically increased telomere length and HBV-related HCC risk (OR=2.09, 95% CI 1.32-3.31, P=0.002). Furthermore, a U-shaped curve was fitted by the restricted cubic spline curve, which indicated that either short or long telomere length would increase HCC risk (P=0.0022 for non-linearity test). Subgroup analysis did not reveal significant heterogeneity between different age, gender, smoking status and drinking status groups. Our results indicated that a genetic background that favors longer or shorter telomere length may increase HBV-related HCC risk-a U-shaped association. Copyright © 2017 Elsevier Ltd. All rights reserved.

  14. Analysis of the age of Panax ginseng based on telomere length and telomerase activity.

    Science.gov (United States)

    Liang, Jiabei; Jiang, Chao; Peng, Huasheng; Shi, Qinghua; Guo, Xiang; Yuan, Yuan; Huang, Luqi

    2015-01-23

    Ginseng, which is the root of Panax ginseng (Araliaceae), has been used in Oriental medicine as a stimulant and dietary supplement for more than 7,000 years. Older ginseng plants are substantially more medically potent, but ginseng age can be simulated using unscrupulous cultivation practices. Telomeres progressively shorten with each cell division until they reach a critical length, at which point cells enter replicative senescence. However, in some cells, telomerase maintains telomere length. In this study, to determine whether telomere length reflects ginseng age and which tissue is best for such an analysis, we examined telomerase activity in the main roots, leaves, stems, secondary roots and seeds of ginseng plants of known age. Telomere length in the main root (approximately 1 cm below the rhizome) was found to be the best indicator of age. Telomeric terminal restriction fragment (TRF) lengths, which are indicators of telomere length, were determined for the main roots of plants of different ages through Southern hybridization analysis. Telomere length was shown to be positively correlated with plant age, and a simple mathematical model was formulated to describe the relationship between telomere length and age for P. ginseng.

  15. Order aggressiveness and order book dynamics

    DEFF Research Database (Denmark)

    Hall, Anthony D.; Hautsch, Nikolaus

    2006-01-01

    employing a six-dimensional autoregressive conditional intensity model. Using order book data from the Australian Stock Exchange, we find that market depth, the queued volume, the bid-ask spread, recent volatility, as well as recent changes in both the order flow and the price play an important role...

  16. THE ENIGMATIC ORDER

    African Journals Online (AJOL)

    tion of this order democracy made its entry into the world of chivalry ... monly referred to as 'people's de- mocracies') are solely military ... Order of the Gar- ter, the Order of the Thistle and the Or- der of the Bath as orders of merit point to the process whereby the ancient temporal orders of chivalry have be- come democratized.

  17. A partial digest approach to restriction site mapping.

    Science.gov (United States)

    Skiena, S S; Sundaram, G

    1994-03-01

    We present a new, practical algorithm to resolve the experimental data in restriction site analysis, which is a common technique for mapping DNA. Specifically, we assert that multiple digestions with a single restriction enzyme can provide sufficient information to identify the positions of the restriction sites with high probability. The motivation for the new approach comes from combinatorial results on the number of mutually homeometric sets in one dimension, where two sets of n points are homeometric if the multiset of n(n-1)/2 distances they determine are the same. Since experimental data contain errors, we propose algorithms for reconstructing sets from noisy interpoint distances, including the possibility of missing fragments. We analyse the performance of these algorithms under a reasonable probability distribution, establishing a relative error limit of r = theta(1/n2) beyond which our technique becomes infeasible. Through simulations, we establish that our technique is robust enough to reconstruct data with relative errors of up to 7.0% in the measured fragment lengths for typical problems, which appears sufficient for certain biological applications.

  18. An efficient method for generation and subcloning of tandemly repeated DNA sequences with defined length, orientation and spacing.

    Science.gov (United States)

    Jiang, S W; Trujillo, M A; Eberhardt, N L

    1996-08-15

    Tandemly repeated DNA sequences generated from single synthetic oligonucleotide monomers are useful for many purposes. With conventional ligation procedures low yields and random orientation of oligomers makes cloning of defined repeated sequences difficult. We solved these problems using 2 bp overhangs to direct orientation and random incorporation of linkers containing restriction sites during ligation. Ligation products are amplified by PCR using the linker oligonucleotides as primers. Restriction digestion of the PCR products generate multimer distributions whose length is controlled by the monomer/linker ratio. The concatenated DNA fragments of defined length, orientation and spacing can be directly used for subcloning or other applications without further treatment.

  19. On Sequence Lengths of Some Special External Exclusive OR Type LFSR Structures – Study and Analysis

    Directory of Open Access Journals (Sweden)

    A Ahmad

    2014-12-01

    Full Text Available The study of the length of pseudo-random binary sequences generated by Linear- Feedback Shift Registers (LFSRs plays an important role in the design approaches of built-in selftest, cryptosystems, and other applications. However, certain LFSR structures might not be appropriate in some situations. Given that determining the length of generated pseudo-random binary sequence is a complex task, therefore, before using an LFSR structure, it is essential to investigate the length and the properties of the sequence. This paper investigates some conditions and LFSR’s structures, which restrict the pseudo-random binary sequences’ generation to a certain fixed length. The outcomes of this paper are presented in the form of theorems, simulations, and analyses. We believe that these outcomes are of great importance to the designers of built-in self-test equipment, cryptosystems, and other applications such as radar, CDMA, error correction, and Monte Carlo simulation.

  20. Hierarchy length in orphaned colonies of the ant Temnothorax nylanderi

    Science.gov (United States)

    Heinze, J.

    2008-08-01

    Workers of the ant Temnothorax nylanderi form dominance orders in orphaned colonies in which only one or a few top-ranking workers begin to produce males from unfertilized eggs. Between one and 11 individuals initiated 80% of all aggression in 14 queenless colonies. As predicted from inclusive fitness models (Molet M, van Baalen M, Monnin T, Insectes Soc 52:247 256, 2005), hierarchy length was found to first increase with colony size and then to level off at larger worker numbers. The frequency and skew of aggression decreased with increasing size, indicating that rank orders are less pronounced in larger colonies.

  1. 7 CFR 29.3037 - Length.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Length. 29.3037 Section 29.3037 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing.... Length, as an element of quality, does not apply to tobacco in strip form. (See Elements of quality.) [24...

  2. 7 CFR 29.6024 - Length.

    Science.gov (United States)

    2010-01-01

    ... 7 Agriculture 2 2010-01-01 2010-01-01 false Length. 29.6024 Section 29.6024 Agriculture Regulations of the Department of Agriculture AGRICULTURAL MARKETING SERVICE (Standards, Inspections, Marketing... INSPECTION Standards Definitions § 29.6024 Length. The linear measurement of cured tobacco leaves from the...

  3. Local gauge invariant QED with fundamental length

    International Nuclear Information System (INIS)

    Kadyshevsky, V.G.; Mateev, M.D.

    1981-01-01

    A local gauge theory of electromagnetic interactions with the fundamental length l as a new universal scale is worked out. The Lagrangian contains new extra terms in which the coupling constant is proportional to the fundamental length. The theory has an elegant geometrical basis: in momentum representation one faces de Sitter momentum space with curvature radius 1/l [ru

  4. Analysis of ureteral length in adult cadavers

    Directory of Open Access Journals (Sweden)

    Hugo F. F. Novaes

    2013-04-01

    Full Text Available Introduction In some occasions, correlations between human structures can help planning surgical intra-abdominal interventions. The previous determination of ureteral length helps pre-operatory planning of surgeries, reduces costs of auxiliary exams, the correct choice of double-J catheter with low morbidity and fewer symptoms, and an adequate adhesion to treatment. Objective To evaluate ureteral length in adult cadavers and to analyze its correlation with anthropometric measures. Materials and Methods: From April 2009 to January 2012 we determined ureteral length of adult cadavers submitted to necropsy and obtained the following measures: height, distance from shoulder to wrist, elbow-wrist, xiphoid appendix-umbilicus, umbilicus-pubis, xiphoid appendix-pubis and between iliac spines. We analyzed the correlations between ureteral length and those anthropometric measures. Results We dissected 115 ureters from 115 adult corpses from April 2009 to January 2012. Median ureteral length didn't vary between sexes or according to height. It was observed no correlation among ureteral length and all considered anthropometric measures in all analyzed subgroups and in general population. There were no significant differences between right and left ureteral measures. Conclusions There is no difference of ureteral length in relation to height or gender (male or female. There is no significant correlation among ureteral length and the considered anthropometric measures.

  5. The length of the male urethra

    Directory of Open Access Journals (Sweden)

    Tobias. S. Kohler

    2008-08-01

    Full Text Available PURPOSE: Catheter-based medical devices are an important component of the urologic armamentarium. To our knowledge, there is no population-based data regarding normal male urethral length. We evaluated the length of the urethra in men with normal genitourinary anatomy undergoing either Foley catheter removal or standard cystoscopy. MATERIALS AND METHODS: Male urethral length was obtained in 109 men. After study permission was obtained, the subject's penis was placed on a gentle stretch and the catheter was marked at the tip of the penis. The catheter was then removed and the distance from the mark to the beginning of the re-inflated balloon was measured. Alternatively, urethral length was measured at the time of cystoscopy, on removal of the cystoscope. Data on age, weight, and height was obtained in patients when possible. RESULTS: The mean urethral length was 22.3 cm with a standard deviation of 2.4 cm. Urethral length varied between 15 cm and 29 cm. No statistically significant correlation was found between urethral length and height, weight, body mass index (BMI, or age. CONCLUSIONS: Literature documenting the length of the normal male adult urethra is scarce. Our data adds to basic anatomic information of the male urethra and may be used to optimize genitourinary device design.

  6. On the homology length spectrum of surfaces

    OpenAIRE

    Massart, Daniel; Parlier, Hugo

    2014-01-01

    On a surface with a Finsler metric, we investigate the asymptotic growth of the number of closed geodesics of length less than L which minimize length among all geodesic multicurves in the same homology class. An important class of surfaces which are of interest to us are hyperbolic surfaces.

  7. Paternal age and telomere length in twins

    DEFF Research Database (Denmark)

    Hjelmborg, Jacob B; Dalgård, Christine; Mangino, Massimo

    2015-01-01

    Telomere length, a highly heritable trait, is longer in offspring of older fathers. This perplexing feature has been attributed to the longer telomeres in sperm of older men and it might be an 'epigenetic' mechanism through which paternal age plays a role in telomere length regulation in humans...

  8. Influence of mandibular length on mouth opening

    NARCIS (Netherlands)

    Dijkstra, PU; Hof, AL; Stegenga, B; De Bont, LGM

    Theoretically, mouth opening not only reflects the mobility of the temporomandibular joints (TMJs) but also the mandibular length. Clinically, the exact relationship between mouth opening, mandibular length, and mobility of TMJs is unclear. To study this relationship 91 healthy subjects, 59 women

  9. Assessing restrictiveness of national alcohol marketing policies.

    Science.gov (United States)

    Esser, Marissa B; Jernigan, David H

    2014-01-01

    To develop an approach for monitoring national alcohol marketing policies globally, an area of the World Health Organization's (WHO) Global Alcohol Strategy. Data on restrictiveness of alcohol marketing policies came from the 2002 and 2008 WHO Global Surveys on Alcohol and Health. We included four scales in a sensitivity analysis to determine optimal weights to score countries on their marketing policies and applied the selected scale to assess national marketing policy restrictiveness. Nearly, 36% of countries had no marketing restrictions. The overall restrictiveness levels were not significantly different between 2002 and 2008. The number of countries with strict marketing regulations did not differ across years. This method of monitoring alcohol marketing restrictiveness helps track progress towards implementing WHO'S Global Alcohol Strategy. Findings indicate a consistent lack of restrictive policies over time, making this a priority area for national and global action. © The Author 2014. Medical Council on Alcohol and Oxford University Press. All rights reserved.

  10. Placental Adaptations in Growth Restriction

    Directory of Open Access Journals (Sweden)

    Song Zhang

    2015-01-01

    Full Text Available The placenta is the primary interface between the fetus and mother and plays an important role in maintaining fetal development and growth by facilitating the transfer of substrates and participating in modulating the maternal immune response to prevent immunological rejection of the conceptus. The major substrates required for fetal growth include oxygen, glucose, amino acids and fatty acids, and their transport processes depend on morphological characteristics of the placenta, such as placental size, morphology, blood flow and vascularity. Other factors including insulin-like growth factors, apoptosis, autophagy and glucocorticoid exposure also affect placental growth and substrate transport capacity. Intrauterine growth restriction (IUGR is often a consequence of insufficiency, and is associated with a high incidence of perinatal morbidity and mortality, as well as increased risk of cardiovascular and metabolic diseases in later life. Several different experimental methods have been used to induce placental insufficiency and IUGR in animal models and a range of factors that regulate placental growth and substrate transport capacity have been demonstrated. While no model system completely recapitulates human IUGR, these animal models allow us to carefully dissect cellular and molecular mechanisms to improve our understanding and facilitate development of therapeutic interventions.

  11. Cardiac MRI in restrictive cardiomyopathy

    Energy Technology Data Exchange (ETDEWEB)

    Gupta, A. [Department of Cardiovascular Radiology, All India Institute of Medical Sciences, Ansari Nagar, Delhi (India); Singh Gulati, G., E-mail: gulatigurpreet@rediffmail.com [Department of Cardiovascular Radiology, All India Institute of Medical Sciences, Ansari Nagar, Delhi (India); Seth, S. [Department of Cardiology, All India Institute of Medical Sciences, Ansari Nagar, Delhi (India); Sharma, S. [Department of Cardiovascular Radiology, All India Institute of Medical Sciences, Ansari Nagar, Delhi (India)

    2012-02-15

    Restrictive cardiomyopathy (RCM) is a specific group of heart muscle disorders characterized by inadequate ventricular relaxation during diastole. This leads to diastolic dysfunction with relative preservation of systolic function. Although short axis systolic function is usually preserved in RCM, the long axis systolic function may be severely impaired. Confirmation of diagnosis and information regarding aetiology, extent of myocardial damage, and response to treatment requires imaging. Importantly, differentiation from constrictive pericarditis (CCP) is needed, as only the latter is managed surgically. Echocardiography is the initial cardiac imaging technique but cannot reliably suggest a tissue diagnosis; although recent advances, especially tissue Doppler imaging and spectral tracking, have improved its ability to differentiate RCM from CCP. Cardiac catheterization is the reference standard, but is invasive, two-dimensional, and does not aid myocardial characterization. Cardiac magnetic resonance (CMR) is a versatile technique providing anatomical, morphological and functional information. In recent years, it has been shown to provide important information regarding disease mechanisms, and also been found useful to guide treatment, assess its outcome and predict patient prognosis. This review describes the CMR features of RCM, appearances in various diseases, its overall role in patient management, and how it compares with other imaging techniques.

  12. Radiographic assessment of endodontic working length

    Directory of Open Access Journals (Sweden)

    Osama S Alothmani

    2013-01-01

    Full Text Available The use of radiographs for working length determination is usual practice in endodontics. Exposing radiographs following the principles of the paralleling technique allows more accurate length determination compared to the bisecting-angle method. However, it has been reported that up to 28.5% of cases can have the file tip extending beyond the confines of the root canals despite an acceptable radiographic appearance. The accuracy of radiographic working length determination could be affected by the location of the apical foramen, tooth type, canal curvature and superimposition of surrounding structures. Variations among observers by virtue of training and experience may also influence the accuracy of the procedure. The interpretation of radiographs could be affected by film speed and viewing conditions, with the superiority of digital imaging over conventional radiography for working length determination remaining debatable. The combination of several methods is recommended for acquiring the most accurate working length.

  13. Economic issues of broiler production length

    Directory of Open Access Journals (Sweden)

    Szőllősi László

    2014-01-01

    Full Text Available The length of broiler production cycle is also an important factor when profitability is measured. This paper is to determine the effects of different market ages and down-time period, overall broiler production cycle length on performance and economic parameters based on Hungarian production and financial circumstances. A deterministic model was constructed to manage the function-like correlations of age-related daily weight gain, daily feed intake and daily mortality data. The results show that broiler production cycle length has a significant effect on production and economic performance. Cycle length is determined by the length of down-time and grow-out periods. If down-time period is reduced by one day, an average net income of EUR 0.55 per m2 is realizable. However, the production period is not directly proportional either with emerging costs or obtainable revenues. Profit maximization is attainable if the production period is 41-42 days.

  14. 75 FR 47777 - Certain Cut-to-Length Carbon-Quality Steel Plate Products From Italy: Final Results of...

    Science.gov (United States)

    2010-08-09

    ...-Quality Steel Plate Products From Italy: Final Results of Antidumping Duty Administrative Review AGENCY... administrative review of the antidumping duty order on certain cut-to-length carbon-quality steel plate products...-length carbon-quality steel plate products (CTL plate) from Italy. See Certain Cut-to-Length Carbon...

  15. Terminal restriction fragment length measurement errors are affected mainly by fragment length, G+C nucleotide content and secondary structure melting point

    Czech Academy of Sciences Publication Activity Database

    Bukovská, Petra; Jelínková, Markéta; Hršelová, Hana; Sýkorová, Zuzana; Gryndler, Milan

    2010-01-01

    Roč. 82, č. 3 (2010), s. 223-228 ISSN 0167-7012 R&D Projects: GA MŠk 1M0571 Institutional research plan: CEZ:AV0Z60050516; CEZ:AV0Z50200510 Keywords : T-RFLP * drift * DNA fragment Subject RIV: EF - Botanics Impact factor: 2.018, year: 2010

  16. Measuring Regulatory Restrictions in Logistics Services

    OpenAIRE

    Claire HOLLWEG; Marn-Heong WONG

    2009-01-01

    This study measures the extent of restrictions on trade in logistics services in the ASEAN+6 economies by constructing a logistics regulatory restrictiveness index for each economy that quantifies the extent of government regulations faced by logistics service providers. This is the first study of its kind to construct a regulatory index of the entire logistics sector, which includes the main modes of international transport and customs restrictions. The indices show that large differences ex...

  17. Dependency Ordering of Atomic Observables

    Science.gov (United States)

    Cīrulis, Jānis

    2015-12-01

    The notion of atomic observable was introduced by S.Gudder for effect test spaces in 1997. In this paper an observable is a σ-homomorphism from the Borel algebra on a line to some logic. Roughly, an observable on a logic is atomic, if it is completely determined by its restriction to one-element subsets of its point spectrum. In particular, every discrete observable is atomic. We study some elementary properties of such observables, and discuss a possible notion of functional dependency between them. Algebraically, a dependency is a certain preorder relation on the set of all atomic observables, which induces an order relation on the set of all maximal orthogonal subsets of the logic. Several properties, as well as characteristics in terms of the underlying logic, of these relations are stated.

  18. [Preoperative restricted versus liberal fluid administration on perioperative safety for pancreatic surgery: a Meta-analysis].

    Science.gov (United States)

    Wang, G S; Dong, M; Sheng, W W; Zhou, J P

    2017-08-01

    Objective: To assess the perioperative safety of preoperative restricted fluid administration and liberal fluid administration for pancreatic surgery. Methods: The randomized controlled trials comparing restricted and liberal in pancreatic surgery were collected by searching the databases of PubMed, Embase and the Cochrane Library.Two reviewers independently selected studies according to the inclusion and exclusion criteria, then extracted the data and assessed the quality of included studies.Meta-analysis was performed by RevMan 5.3 software. Results: A total of 4 studies involving 785 patients were finally included, with 396 cases in restricted group and 389 cases in liberal group.Results of Meta-analysis showed that there was no statistically significant difference between the two groups in terms of intraoperative blood loss, postoperative complications, mortality, reoperation in-hospital and length of stay(all P >0.05). Conclusion: With regard to pancreatic surgery, restricted fluid administration do not have outstanding advantages.

  19. Identification of high school students' ability level of constructing free body diagrams to solve restricted and structured response items in force matter

    Science.gov (United States)

    Rahmaniar, Andinisa; Rusnayati, Heni; Sutiadi, Asep

    2017-05-01

    While solving physics problem particularly in force matter, it is needed to have the ability of constructing free body diagrams which can help students to analyse every force which acts on an object, the length of its vector and the naming of its force. Mix method was used to explain the result without any special treatment to participants. The participants were high school students in first grade totals 35 students. The purpose of this study is to identify students' ability level of constructing free body diagrams in solving restricted and structured response items. Considering of two types of test, every student would be classified into four levels ability of constructing free body diagrams which is every level has different characteristic and some students were interviewed while solving test in order to know how students solve the problem. The result showed students' ability of constructing free body diagrams on restricted response items about 34.86% included in no evidence of level, 24.11% inadequate level, 29.14% needs improvement level and 4.0% adequate level. On structured response items is about 16.59% included no evidence of level, 23.99% inadequate level, 36% needs improvement level, and 13.71% adequate level. Researcher found that students who constructed free body diagrams first and constructed free body diagrams correctly were more successful in solving restricted and structured response items.

  20. Antenatal risk factor for intrauterine growth restriction

    Directory of Open Access Journals (Sweden)

    N. D. Guliyev

    2015-01-01

    Full Text Available Objective: to study pregnancy and delivery characteristics in mothers who have given birth to infants with intrauterine growth restriction. Pregnancy and delivery outcomes were studied in 315 mothers who had given birth to infants with intrauterine growth restriction (a study group. The studies have shown that toxemia, anemia, and preeclampsia prevent physiological pregnancy that concurrent with placental insufficiency leads to serious metabolic disturbances in the mother-placenta-fetus system and eventually lead to intrauterine growth restriction. A set of pathological factors of pregnancy required surgical delivery in mothers with fetal growth restriction.

  1. Breaking RAD: an evaluation of the utility of restriction site-associated DNA sequencing for genome scans of adaptation.

    Science.gov (United States)

    Lowry, David B; Hoban, Sean; Kelley, Joanna L; Lotterhos, Katie E; Reed, Laura K; Antolin, Michael F; Storfer, Andrew

    2017-03-01

    Understanding how and why populations evolve is of fundamental importance to molecular ecology. Restriction site-associated DNA sequencing (RADseq), a popular reduced representation method, has ushered in a new era of genome-scale research for assessing population structure, hybridization, demographic history, phylogeography and migration. RADseq has also been widely used to conduct genome scans to detect loci involved in adaptive divergence among natural populations. Here, we examine the capacity of those RADseq-based genome scan studies to detect loci involved in local adaptation. To understand what proportion of the genome is missed by RADseq studies, we developed a simple model using different numbers of RAD-tags, genome sizes and extents of linkage disequilibrium (length of haplotype blocks). Under the best-case modelling scenario, we found that RADseq using six- or eight-base pair cutting restriction enzymes would fail to sample many regions of the genome, especially for species with short linkage disequilibrium. We then surveyed recent studies that have used RADseq for genome scans and found that the median density of markers across these studies was 4.08 RAD-tag markers per megabase (one marker per 245 kb). The length of linkage disequilibrium for many species is one to three orders of magnitude less than density of the typical recent RADseq study. Thus, we conclude that genome scans based on RADseq data alone, while useful for studies of neutral genetic variation and genetic population structure, will likely miss many loci under selection in studies of local adaptation. © 2016 John Wiley & Sons Ltd.

  2. Tapasin facilitation of natural HLA-A and -B allomorphs is strongly influenced by peptide length, depends on stability, and separates closely related allomorphs

    DEFF Research Database (Denmark)

    Geironson, Linda; Thuring, Camilla; Harndahl, Mikkel

    2013-01-01

    Despite an abundance of peptides inside a cell, only a small fraction is ultimately presented by HLA-I on the cell surface. The presented peptides have HLA-I allomorph-specific motifs and are restricted in length. So far, detailed length studies have been limited to few allomorphs. Peptide-HLA-I ...

  3. Kidney Length in Normal Korean Children

    International Nuclear Information System (INIS)

    Kim, In One; Cheon, Jung Eun; Lee, Young Seok; Lee, Sun Wha; Kim, Ok Hwa; Kim, Ji Hye; Kim, Hong Dae; Sim, Jung Suk

    2010-01-01

    Renal length offers important information to detect or follow-up various renal diseases. The purpose of this study was to determine the kidney length of normal Korean children in relation to age, height, weight, body surface area (BSA), and body mass index (BMI). Children between 1 month and 15 years of age without urological abnormality were recruited. Children below 3rd percentile and over 97th percentile for height or weight were excluded. Both renal lengths were measured in the prone position three times and then averaged by experienced radiologists. The mean length and standard deviation for each age group was obtained, and regression equation was calculated between renal length and age, weight, height, BSA, and BMI, respectively. Renal length was measured in 550 children. Renal length grows rapidly until 24 month, while the growth rate is reduced thereafter. The regression equation for age is: renal length (mm) = 45.953 + 1.064 x age (month, ≤ 24 months) (R2 = 0.720) or 62.173 + 0.203 x age (months, > 24 months) (R2 = 0.711). The regression equation for height is: renal length (mm) = 24.494 + 0.457 x height (cm) (R2 = 0.894). The regression equation for weight is: renal length (mm) = 38.342 + 2.117 x weight (kg, ≤18 kg) (R2 = 0.852) or 64.498 + 0.646 x weight (kg, > 18 kg) (R2 = 0.651). The regression equation for BSA is: renal length (mm) = 31.622 + 61.363 x BSA (m2, ≤ 0.7) (R2 = 0.857) or 52.717 + 29.959 x BSA (m2, > 0.7) (R2 = 0.715). The regression equation for BMI is: renal length (mm) = 44.474 + 1.163 x BMI (R2 = 0.079). This study provides data on the normal renal length and its association with age, weight, height, BSA and BMI. The results of this study will guide the detection and follow-up of renal diseases in Korean children

  4. The genus Mustelus (Family Triakidae, Order Carcharhiniformes ...

    African Journals Online (AJOL)

    spamer

    The genus Mustelus (Family Triakidae, Order. Carcharhiniformes), commonly called .... suitable for sharks with a well-defined length-at-birth. (L0). This eliminates the .... Table I: Parameter estimates using Fabens' method and standard errors (SE) and 95% confidence intervals (CI) for the Von. Bertalanffy growth model fitted ...

  5. Geometric aspects of ordering phenomena

    Science.gov (United States)

    Cugliandolo, Leticia F.

    2017-01-01

    A macroscopic system prepared in a disordered phase and quenched across a second-order phase transition into an ordered phase undergoes a coarsening process whereby it orders locally in one of the equilibrium states. The study of the evolution of the morphology of the ordered structures in two dimensions has recently unveiled two interesting and generic features. On the one hand, the dynamics first approach a critical percolating state via the growth of a new lengthscale and satisfying scaling properties with respect to it. The time needed to reach the critical percolating state diverges with the system size, though more weakly than the equilibration time. On the other hand, once the critical percolating structures established, the geometrical and statistical properties at larger scales than the one established by the usual dynamic growing length remain the ones of critical percolation. These observations are common to different microscopic dynamics (single spin flip, local and non-local spin exchange, voter) in pure or weakly disordered systems. We discuss these results and we refer to the relevant publications for details. xml:lang="fr"

  6. Zero-point length from string fluctuations

    International Nuclear Information System (INIS)

    Fontanini, Michele; Spallucci, Euro; Padmanabhan, T.

    2006-01-01

    One of the leading candidates for quantum gravity, viz. string theory, has the following features incorporated in it. (i) The full spacetime is higher-dimensional, with (possibly) compact extra-dimensions; (ii) there is a natural minimal length below which the concept of continuum spacetime needs to be modified by some deeper concept. On the other hand, the existence of a minimal length (zero-point length) in four-dimensional spacetime, with obvious implications as UV regulator, has been often conjectured as a natural aftermath of any correct quantum theory of gravity. We show that one can incorporate the apparently unrelated pieces of information-zero-point length, extra-dimensions, string T-duality-in a consistent framework. This is done in terms of a modified Kaluza-Klein theory that interpolates between (high-energy) string theory and (low-energy) quantum field theory. In this model, the zero-point length in four dimensions is a 'virtual memory' of the length scale of compact extra-dimensions. Such a scale turns out to be determined by T-duality inherited from the underlying fundamental string theory. From a low energy perspective short distance infinities are cutoff by a minimal length which is proportional to the square root of the string slope, i.e., α ' . Thus, we bridge the gap between the string theory domain and the low energy arena of point-particle quantum field theory

  7. Classifying images using restricted Boltzmann machines and convolutional neural networks

    Science.gov (United States)

    Zhao, Zhijun; Xu, Tongde; Dai, Chenyu

    2017-07-01

    To improve the feature recognition ability of deep model transfer learning, we propose a hybrid deep transfer learning method for image classification based on restricted Boltzmann machines (RBM) and convolutional neural networks (CNNs). It integrates learning abilities of two models, which conducts subject classification by exacting structural higher-order statistics features of images. While the method transfers the trained convolutional neural networks to the target datasets, fully-connected layers can be replaced by restricted Boltzmann machine layers; then the restricted Boltzmann machine layers and Softmax classifier are retrained, and BP neural network can be used to fine-tuned the hybrid model. The restricted Boltzmann machine layers has not only fully integrated the whole feature maps, but also learns the statistical features of target datasets in the view of the biggest logarithmic likelihood, thus removing the effects caused by the content differences between datasets. The experimental results show that the proposed method has improved the accuracy of image classification, outperforming other methods on Pascal VOC2007 and Caltech101 datasets.

  8. Bunch Length Measurements in SPEAR3

    Energy Technology Data Exchange (ETDEWEB)

    Corbett, W.J.; Fisher, A.; Huang, X.; Safranek, J.; Sebek, J.; /SLAC; Lumpkin, A.; /Argonne; Sannibale, F.; /LBL, Berkeley; Mok, W.; /Unlisted

    2007-11-28

    A series of bunch length measurements were made in SPEAR3 for two different machine optics. In the achromatic optics the bunch length increases from the low-current value of 16.6ps rms to about 30ps at 25ma/bunch yielding an inductive impedance of -0.17{Omega}. Reducing the momentum compaction factor by a factor of {approx}60 [1] yields a low-current bunch length of {approx}4ps rms. In this paper we review the experimental setup and results.

  9. Electron bunch length measurement at the Vanderbilt FEL

    Energy Technology Data Exchange (ETDEWEB)

    Amirmadhi, F.; Brau, C.A.; Mendenhall, M. [Vanderbilt Free-Electron-Laser Center, Nashville, TN (United States)] [and others

    1995-12-31

    During the past few years, a number of experiments have been performed to demonstrate the possibility to extract the longitudinal charge distribution from spectroscopic measurements of the coherent far-infrared radiation emitted as transition radiation or synchrotron radiation. Coherent emission occurs in a spectral region where the wavelength is comparable to or longer than the bunch length, leading to an enhancement of the radiation intensity that is on the order of the number of particles per bunch, as compared to incoherent radiation. This technique is particularly useful in the region of mm and sub-mm bunch lengths, a range where streak-cameras cannot be used for beam diagnostics due to their limited time resolution. Here we report on experiments that go beyond the proof of principle of this technique by applying it to the study and optimization of FEL performance. We investigated the longitudinal bunch length of the Vanderbilt FEL by analyzing the spectrum of coherent transition radiation emitted by the electron bunches. By monitoring the bunch length while applying a bunch-compression technique, the amount of the compression could be easily observed. This enabled us to perform a systematic study of the FEL performance, especially gain and optical pulse width, as a function of the longitudinal electron distribution in the bunch. The results of this study will be presented and discussed.

  10. Effect of Amphiphilic Alkyl Chain Length Upon Purified LATEX Stability

    International Nuclear Information System (INIS)

    Amira Amir Hassan; Amir Hashim Mohd Yatim

    2015-01-01

    Rubber particles in purified latex (PL) are stabilized by a film of protein and fatty acid soap (surfactant). Saturated straight-chain fatty acid soaps can assist an enhancement of latex stability. However, whether the alkyl chain length plays an important role in increasing the stability is still an issue. The aim of this study is to investigate the effect of alkyl chain length of anionic surfactant on the stability of purified latex. The fatty acid soap of decanoate (9), laurate (11), sodium dodecyl sulphate (SDS) (12) and palmitate (15) were used. The numbers in parentheses indicating the number of carbon present in alkyl chain of the soap. The results showed that the impact of alkyl chain length on the stability of latex is in the order of laurate > decanoate > SDS > palmitate > purified latex accordingly. The alkyl chain length does giving a significant effect on latex stability after longer stirring time. The particle size of latex with the presence of surfactant is greater compare to a single particle itself due to extension of particles diameter. Thus suitable interaction of the nonpolar tail of surfactant with the hydrophobic regions of latex surface played a major role in maintaining a stable latex system. (author)

  11. On the orders of finite semisimple groups

    Indian Academy of Sciences (India)

    Since the Galois group, Gal(Fq/Fq), is procyclic and A is a finite Galois-module, its Her- brand quotient is 1, i.e., |H0(Fq, A)|=|H1(Fq, A)|. ..... These pairs are quite special, in the sense that they admit a geometric reasoning for the coincidence of orders. We describe it in the last section. If we do not restrict ourselves to the ...

  12. 18 CFR 35.39 - Affiliate restrictions.

    Science.gov (United States)

    2010-04-01

    ... 18 Conservation of Power and Water Resources 1 2010-04-01 2010-04-01 false Affiliate restrictions... Sales of Electric Energy, Capacity and Ancillary Services at Market-Based Rates § 35.39 Affiliate restrictions. (a) General affiliate provisions. As a condition of obtaining and retaining market-based rate...

  13. 46 CFR 184.202 - Restrictions.

    Science.gov (United States)

    2010-10-01

    ... 46 Shipping 7 2010-10-01 2010-10-01 false Restrictions. 184.202 Section 184.202 Shipping COAST... CONTROL AND MISCELLANEOUS SYSTEMS AND EQUIPMENT Cooking and Heating § 184.202 Restrictions. (a) The use of... in § 184.240 of this part. The use of these fuels for cooking, heating, and lighting on ferry vessels...

  14. 50 CFR 24.11 - General restrictions.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 6 2010-10-01 2010-10-01 false General restrictions. 24.11 Section 24.11 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE INTERIOR (CONTINUED... § 24.11 General restrictions. No person shall import, export, or reexport plants at any place other...

  15. 50 CFR 14.11 - General restrictions.

    Science.gov (United States)

    2010-10-01

    ... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false General restrictions. 14.11 Section 14.11 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE INTERIOR TAKING....11 General restrictions. Except as otherwise provided in this part, no person may import or export...

  16. Relationship Between Calorie Restriction, Lipid Peroxidation ...

    African Journals Online (AJOL)

    In the brain of the caloric restricted rats, there was little or no change in the tGSH and GSH, although the GSSG and GSSG/GSH% ratio were increased significantly. These results suggest that aging of rats had been decelerated by caloric restriction due to the decrease in the peroxidative damage in the lungs and brain.

  17. 50 CFR 648.104 - Gear restrictions.

    Science.gov (United States)

    2010-10-01

    ..., lines, or chafing gear, on the top of the regulated portion of a trawl net; except that, one splitting... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Gear restrictions. 648.104 Section 648.104... Flounder Fisheries § 648.104 Gear restrictions. (a) General. (1) Otter trawlers whose owners are issued a...

  18. 50 CFR 648.123 - Gear restrictions.

    Science.gov (United States)

    2010-10-01

    ... limited to, nets, net strengtheners, ropes, lines, or chafing gear, on the top of the regulated portion of... 50 Wildlife and Fisheries 8 2010-10-01 2010-10-01 false Gear restrictions. 648.123 Section 648.123... § 648.123 Gear restrictions. (a) Trawl vessel gear restrictions—(1) Minimum mesh size. No owner or...

  19. Isothermal detection of RNA with restriction endonucleases.

    Science.gov (United States)

    Yan, Lei; Nakayama, Shizuka; Yitbarek, Saron; Greenfield, Isabel; Sintim, Herman O

    2011-01-07

    Herein, we demonstrate how to detect nucleic acids that do not contain restriction endonuclease recognition sites with restriction endonucleases. We show that the topology of DNA probes used in this detection strategy remarkably affects the efficiency of RNA/DNA detection.

  20. Massively parallel characterization of restriction endonucleases.

    Science.gov (United States)

    Kamps-Hughes, Nick; Quimby, Aine; Zhu, Zhenyu; Johnson, Eric A

    2013-06-01

    Restriction endonucleases are highly specific in recognizing the particular DNA sequence they act on. However, their activity is affected by sequence context, enzyme concentration and buffer composition. Changes in these factors may lead to either ineffective cleavage at the cognate restriction site or relaxed specificity allowing cleavage of degenerate 'star' sites. Additionally, uncharacterized restriction endonucleases and engineered variants present novel activities. Traditionally, restriction endonuclease activity is assayed on simple substrates such as plasmids and synthesized oligonucleotides. We present and use high-throughput Illumina sequencing-based strategies to assay the sequence specificity and flanking sequence preference of restriction endonucleases. The techniques use fragmented DNA from sequenced genomes to quantify restriction endonuclease cleavage on a complex genomic DNA substrate in a single reaction. By mapping millions of restriction site-flanking reads back to the Escherichia coli and Drosophila melanogaster genomes we were able to quantitatively characterize the cognate and star site activity of EcoRI and MfeI and demonstrate genome-wide decreases in star activity with engineered high-fidelity variants EcoRI-HF and MfeI-HF, as well as quantify the influence on MfeI cleavage conferred by flanking nucleotides. The methods presented are readily applicable to all type II restriction endonucleases that cleave both strands of double-stranded DNA.

  1. Natural spline interpolation and exponential parameterization for length estimation of curves

    Science.gov (United States)

    Kozera, R.; Wilkołazka, M.

    2017-07-01

    This paper tackles the problem of estimating a length of a regular parameterized curve γ from an ordered sample of interpolation points in arbitrary Euclidean space by a natural spline. The corresponding tabular parameters are not given and are approximated by the so-called exponential parameterization (depending on λ ∈ [0, 1]). The respective convergence orders α(λ) for estimating length of γ are established for curves sampled more-or-less uniformly. The numerical experiments confirm a slow convergence orders α(λ) = 2 for all λ ∈ [0, 1) and a cubic order α(1) = 3 once natural spline is used.

  2. Impedance of finite length resistive cylinder

    Directory of Open Access Journals (Sweden)

    S. Krinsky

    2004-11-01

    Full Text Available We determine the impedance of a cylindrical metal tube (resistor of radius a, length g, and conductivity σ attached at each end to perfect conductors of semi-infinite length. Our main interest is in the asymptotic behavior of the impedance at high frequency (k≫1/a. In the equilibrium regime, ka^{2}≪g, the impedance per unit length is accurately described by the well-known result for an infinite length tube with conductivity σ. In the transient regime, ka^{2}≫g, where the contribution of transition radiation arising from the discontinuity in conductivity is important, we derive an analytic expression for the impedance and compute the short-range wakefield. The analytic results are shown to agree with numerical evaluation of the impedance.

  3. FULL LENGTH RESEARCH ARTICLE Adamu & Babatunde (2008 ...

    African Journals Online (AJOL)

    Dr. Ahmed

    FULL LENGTH RESEARCH ARTICLE. Adamu & Babatunde (2008) SWJ:21-25. Comparative Studies On the Dying rate Migration. COMPARATIVE STUDIES ON DYEING RATE MIGRATION AND WASH FASTNESS PROPERTIES OF AZO DYES. DERIVED FROM 2-AMINOTHIAZOLE DERIVATIVES ON ACETATE FABRICS.

  4. Identification of amplified fragment length polymorphism (AFLP ...

    African Journals Online (AJOL)

    Identification of amplified fragment length polymorphism (AFLP) fragments linked to soybean mosaic virus resistance gene in Glycine soja and conversion to a sequence characterized amplified regions (SCAR) marker for rapid selection.

  5. Martian Length of Day Measurements from Rovers

    Science.gov (United States)

    Eubanks, T. M.; Bills, B.

    2012-06-01

    Changes in the Martian Length of Day (LOD) can be determined at a scientifically use level by a combination of regular (but not necessarily frequent) range and Doppler measurements from Earth and dead reckoning in a Kalman filter.

  6. Complementary DNA-amplified fragment length polymorphism ...

    African Journals Online (AJOL)

    Complementary DNA-amplified fragment length polymorphism (AFLP-cDNA) analysis of differential gene expression from the xerophyte Ammopiptanthus mongolicus in response to cold, drought and cold together with drought.

  7. Relationship between morphological and amplified fragment length ...

    African Journals Online (AJOL)

    Relationship between morphological and amplified fragment length polymorphism (AFLP) marker based genetic distance with heterosis in hot pepper (Capsicum annuum L.) SL Krishnamurthy, A Mohan Rao, K Madhavi Reddy, S Ramesh, Shailaja Hittalmani, Rao M. Gopinath ...

  8. Chord length distribution for a compound capsule

    International Nuclear Information System (INIS)

    Pitřík, Pavel

    2017-01-01

    Chord length distribution is a factor important in the calculation of ionisation chamber responses. This article describes Monte Carlo calculations of the chord length distribution for a non-convex compound capsule. A Monte Carlo code was set up for generation of random chords and calculation of their lengths based on the input number of generations and cavity dimensions. The code was written in JavaScript and can be executed in the majority of HTML viewers. The plot of occurrence of cords of different lengths has 3 peaks. It was found that the compound capsule cavity cannot be simply replaced with a spherical cavity of a triangular design. Furthermore, the compound capsule cavity is directionally dependent, which must be taken into account in calculations involving non-isotropic fields of primary particles in the beam, unless equilibrium of the secondary charged particles is attained. (orig.)

  9. Mixing lengths scaling in a gravity flow

    Energy Technology Data Exchange (ETDEWEB)

    Ecke, Robert E [Los Alamos National Laboratory; Rivera, Micheal [Los Alamos National Laboratory; Chen, Jun [Los Alamos National Laboratory; Ecke, Robert E [Los Alamos National Laboratory

    2009-01-01

    We present an experimental study of the mixing processes in a gravity current. The turbulent transport of momentum and buoyancy can be described in a very direct and compact form by a Prandtl mixing length model [1]: the turbulent vertical fluxes of momentum and buoyancy are found to scale quadraticatly with the vertical mean gradients of velocity and density. The scaling coefficient is the square of the mixing length, approximately constant over the mixing zone of the stratified shear layer. We show in this paper how, in different flow configurations, this length can be related to the shear length of the flow {radical}({var_epsilon}/{partial_derivative}{sub z}u{sup 3}).

  10. CPS Trawl Life History Length Frequency Data

    Data.gov (United States)

    National Oceanic and Atmospheric Administration, Department of Commerce — Length distribution of a subset of individuals from a species (mainly non-target) caught during SWFSC-FRD fishery independent trawl surveys of coastal pelagic...

  11. Restricted gravity: Abelian projection of Einstein's theory

    International Nuclear Information System (INIS)

    Cho, Y.M.

    2013-01-01

    Treating Einstein's theory as a gauge theory of Lorentz group, we decompose the gravitational connection Γμ into the restricted connection made of the potential of the maximal Abelian subgroup H of Lorentz group G and the valence connection made of G/H part of the potential which transforms covariantly under Lorentz gauge transformation. With this we show that Einstein's theory can be decomposed into the restricted gravity made of the restricted connection which has the full Lorentz gauge invariance which has the valence connection as gravitational source. The decomposition shows the existence of a restricted theory of gravitation which has the full general invariance but is much simpler than Einstein's theory. Moreover, it tells that the restricted gravity can be written as an Abelian gauge theory,

  12. Dynamics of telomere length in different age groups in a Latvian population.

    Science.gov (United States)

    Zole, Egija; Pliss, Liana; Ranka, Renate; Krumina, Astrida; Baumanis, Viesturs

    2013-12-01

    The shortening of telomeres with ageing is a well-documented observation; however, the reported number of nucleotides in telomeres varies between different laboratories and studies. Such variability is likely caused by ethnic differences between the populations studied. Until now, there were no studies that investigated the variability of telomere length in a senescent Latvian population of the most common mitochondrial haplogroups, defined as H (45%), U (25%), Y chromosomal N1c (40%) and R1a1 (40%). Telomere length was determined in 121 individuals in different age groups, including a control group containing individuals of 20-40 years old and groups of individuals between 60-70 years old, 71-80 years old, 81-90 years old, and above 90 years old. Telomere length was determined using the Southern blot telomeric restriction fragment assay (TRF). Decreased telomere length with ageing was confirmed, but a comparison of centenarians and individuals between 60-90 years of age did not demonstrate a significant difference in telomere length. However, significant variability in telomere length was observed in the control group, indicating probable rapid telomere shortening in some individuals that could lead up to development of health status decline appearing with ageing. Telomere length measured in mononuclear blood cells (MNC) was compared with the telomere length measured in whole peripheral white blood cells (WBC) using TRF. Telomere length in MNC was longer than in WBC for the control group with individuals 20 to 40 years old; in contrast, for the group of individuals aged 65 to 85 years old, measured telomere length was shorter in MNC when compared to WBC.

  13. Process for fabricating continuous lengths of superconductor

    Science.gov (United States)

    Kroeger, Donald M.; List, III, Frederick A.

    1998-01-01

    A process for manufacturing a superconductor. The process is accomplished by depositing a superconductor precursor powder on a continuous length of a first substrate ribbon, overlaying a continuous length of a second substrate ribbon on said first substrate ribbon, and applying sufficient pressure to form a bound layered superconductor precursor between said first substrate ribbon and said second substrates ribbon. The layered superconductor precursor is then heat treated to form a super conductor layer.

  14. Length and coverage of inhibitory decision rules

    KAUST Repository

    Alsolami, Fawaz

    2012-01-01

    Authors present algorithms for optimization of inhibitory rules relative to the length and coverage. Inhibitory rules have a relation "attribute ≠ value" on the right-hand side. The considered algorithms are based on extensions of dynamic programming. Paper contains also comparison of length and coverage of inhibitory rules constructed by a greedy algorithm and by the dynamic programming algorithm. © 2012 Springer-Verlag.

  15. Derived length for arbitrary topological spaces

    Directory of Open Access Journals (Sweden)

    A. J. Jayanthan

    1992-01-01

    Full Text Available The notion of derived length is as old as that of ordinal numbers itself. It is also known as the Cantor-Bendixon length. It is defined only for dispersed (that is scattered spaces. In this paper this notion has been extended in a natural way for all topological spaces such that all its pleasing properties are retained. In this process we solve a problem posed by V. Kannan. ([1] Page 158.

  16. Tourism and fashion: factors affecting trip length

    OpenAIRE

    Calderón García, María Haydeé; G. Gallarza, Martina; Fayos Gardó, Teresa; O'Sullivan, P.

    2016-01-01

    Tourism and shopping are closely related, and the influence of fashion shopping on a tourist's decision to travel is especially significant. The concept of cognitive and hedonic involvement enables us to relate the importance given to shopping by consumers of fashion products and of tourism services. This research analyses whether tourist involvement in fashion shopping has an impact on the length of their stay in a destination. In addition, it examines whether trip length is conditioned by t...

  17. Liberal versus restrictive fluid management in abdominal surgery: a meta-analysis.

    Science.gov (United States)

    Jia, Feng-Ju; Yan, Qiao-Yuan; Sun, Qi; Tuxun, Tuerhongjiang; Liu, Hui; Shao, Li

    2017-03-01

    This study compared perioperative restrictive fluid therapy to liberal (conventional) fluid therapy in patients undergoing major abdominal surgery and investigated the rate of post-operative morbidity (complication rates), recovery (time to flatus), and the length of hospital stay. The Medline, PubMed, Cochrane, and EMBASE databases were searched until June 18, 2015. Randomized controlled trials, two-arm prospective studies, and retrospective studies were included in our analyses. A sensitivity analysis, publication bias assessment, and quality assessment were performed. The effects of the two therapies were similar in the subgroup analysis of patients who underwent hepato-gastroenterological surgery (P = 0.287). However, in a subgroup of patients who underwent vascular abdominal surgery, the restricted fluid treatment regimen was associated with a lower risk of complications in comparison with the conventional regimen (pooled OR = 0.12, 95 % CI 0.03-0.47, P = 0.002). There was no difference between the two regimens with respect to the incidence of cardiopulmonary complications (P = 0.733). However, the patients who received the restricted fluid treatment regimen had a shorter time to flatus (P = 0.031) and a shorter hospital stay (P = 0.033) than the patients who received the conventional regimen. Restrictive fluid therapy and liberal conventional therapy were associated with similar rates of overall and cardiopulmonary complications; however, restrictive fluid therapy was associated with a more rapid recovery and a shorter length of hospital stay.

  18. 78 FR 29113 - Certain Cut-to-Length Carbon-Quality Steel Plate Products From the Republic of Korea: Final...

    Science.gov (United States)

    2013-05-17

    ...-Quality Steel Plate Products From the Republic of Korea: Final Results of Antidumping Duty Administrative... administrative review of the antidumping duty order on certain cut-to-length carbon-quality steel plate products... duty order on certain cut-to-length carbon-quality steel plate products from the Republic of Korea...

  19. 77 FR 21527 - Certain Cut-to-Length Carbon-Quality Steel Plate Products From the Republic of Korea: Final...

    Science.gov (United States)

    2012-04-10

    ...-Quality Steel Plate Products From the Republic of Korea: Final Results of Antidumping Duty Administrative... administrative review of the antidumping duty order on certain cut-to-length carbon-quality steel plate products... duty order on certain cut-to-length carbon-quality steel plate products (CTL plate) from the Republic...

  20. Measuring the Restrictiveness of Living Environments for Children and Youth: Reconceptualizing Restriction

    Science.gov (United States)

    Rauktis, Mary E.; Huefner, Jonathan C.; O'Brien, Kirk; Pecora, Peter J.; Doucette, Ann; Thompson, Ronald W.

    2009-01-01

    The "Restrictiveness of Living Environment Scale" has long been the primary way to conceptualize the "restrictiveness" of a child's living situation. However, changes in systems of care and other factors have created a need to revisit how restrictiveness is conceptualized and measured. A measure was created to assess an environment's level of…

  1. Second order interference of chaotic light reflected from random medium

    OpenAIRE

    Zyuzin, A. Yu.

    2014-01-01

    We consider the reflection from a random medium of light with short coherence length. We found that the second order correlation function of light can have a peak in a direction where the reflection angle is equal to angle of incidence. This occurs when the size of the region, from which light is collected, is larger than the coherence length.

  2. DNA origami-based nanoribbons: assembly, length distribution, and twist

    International Nuclear Information System (INIS)

    Jungmann, Ralf; Scheible, Max; Kuzyk, Anton; Pardatscher, Guenther; Simmel, Friedrich C; Castro, Carlos E

    2011-01-01

    A variety of polymerization methods for the assembly of elongated nanoribbons from rectangular DNA origami structures are investigated. The most efficient method utilizes single-stranded DNA oligonucleotides to bridge an intermolecular scaffold seam between origami monomers. This approach allows the fabrication of origami ribbons with lengths of several micrometers, which can be used for long-range ordered arrangement of proteins. It is quantitatively shown that the length distribution of origami ribbons obtained with this technique follows the theoretical prediction for a simple linear polymerization reaction. The design of flat single layer origami structures with constant crossover spacing inevitably results in local underwinding of the DNA helix, which leads to a global twist of the origami structures that also translates to the nanoribbons.

  3. DNA origami-based nanoribbons: assembly, length distribution, and twist

    Energy Technology Data Exchange (ETDEWEB)

    Jungmann, Ralf; Scheible, Max; Kuzyk, Anton; Pardatscher, Guenther; Simmel, Friedrich C [Lehrstuhl fuer Bioelektronik, Physik-Department and ZNN/WSI, Technische Universitaet Muenchen, Am Coulombwall 4a, 85748 Garching (Germany); Castro, Carlos E, E-mail: simmel@ph.tum.de [Labor fuer Biomolekulare Nanotechnologie, Physik-Department and ZNN/WSI, Technische Universitaet Muenchen, Am Coulombwall 4a, 85748 Garching (Germany)

    2011-07-08

    A variety of polymerization methods for the assembly of elongated nanoribbons from rectangular DNA origami structures are investigated. The most efficient method utilizes single-stranded DNA oligonucleotides to bridge an intermolecular scaffold seam between origami monomers. This approach allows the fabrication of origami ribbons with lengths of several micrometers, which can be used for long-range ordered arrangement of proteins. It is quantitatively shown that the length distribution of origami ribbons obtained with this technique follows the theoretical prediction for a simple linear polymerization reaction. The design of flat single layer origami structures with constant crossover spacing inevitably results in local underwinding of the DNA helix, which leads to a global twist of the origami structures that also translates to the nanoribbons.

  4. Bond-length fluctuations in the copper oxide superconductors

    CERN Document Server

    Goodenough, J B

    2003-01-01

    Superconductivity in the copper oxides occurs at a crossover from localized to itinerant electronic behaviour, a transition that is first order. A spinodal phase segregation is normally accomplished by atomic diffusion; but where it occurs at too low a temperature for atomic diffusion, it may be realized by cooperative atomic displacements. Locally cooperative, fluctuating atomic displacements may stabilize a distinguishable phase lying between a localized-electron phase and a Fermi-liquid phase; this intermediate phase exhibits quantum-critical-point behaviour with strong electron-lattice interactions making charge transport vibronic. Ordering of the bond-length fluctuations at lower temperatures would normally stabilize a charge-density wave (CDW), which suppresses superconductivity. It is argued that in the copper oxide superconductors, crossover occurs at an optimal doping concentration for the formation of ordered two-electron/two-hole bosonic bags of spin S = 0 in a matrix of localized spins; the correl...

  5. Adjusted priors for Bayes factors involving reparameterized order constraints

    NARCIS (Netherlands)

    Heck, D.W.; Wagenmakers, E.-J.

    Many psychological theories that are instantiated as statistical models imply order constraints on the model parameters. To fit and test such restrictions, order constraints of the form θi≤θj can be reparameterized with auxiliary parameters η∈[0,1] to replace the original parameters by θi=η⋅θj. This

  6. 12 CFR 1777.24 - Notice of intent to issue an order.

    Science.gov (United States)

    2010-01-01

    ... level or critical capital level, and its risk-based capital level; (2) A description of the restrictions... containing the proposed order. (c) Contents of notice. A notice of intent to issue an order under this... such restrictions or prohibitions would become effective or the proposed date for the commencement and...

  7. Restriction fragment polymorphisms in the major histocompatibility complex of diabetic BB rats

    DEFF Research Database (Denmark)

    Kastern, W.; Dyrberg, T.; Scholler, J.

    1984-01-01

    DNA isolated from diabetic BB (BB/Hagedorn) rats was examined for restriction fragment length differences within the major histocompatibility complex (MHC) as compared with nondiabetic (W-subline) BB rats. Polymorphisms were detected using a mouse class I MHC gene as probe. Specifically, a 2-kb Bam......HI fragment was present in all the nondiabetic rats examined, but absent in the diabetic rats. Similar polymorphisms were observed with various other restriction enzymes, particularly XbaI, HindII, and SacI. There were no polymorphisms detected using either a human DR-alpha (class II antigen heavy chain...

  8. Carbohydrate-Restriction with High-Intensity Interval Training: An Optimal Combination for Treating Metabolic Diseases?

    Directory of Open Access Journals (Sweden)

    Monique E. Francois

    2017-10-01

    Full Text Available Lifestyle interventions incorporating both diet and exercise strategies remain cornerstone therapies for treating metabolic disease. Carbohydrate-restriction and high-intensity interval training (HIIT have independently been shown to improve cardiovascular and metabolic health. Carbohydrate-restriction reduces postprandial hyperglycemia, thereby limiting potential deleterious metabolic and cardiovascular consequences of excessive glucose excursions. Additionally, carbohydrate-restriction has been shown to improve body composition and blood lipids. The benefits of exercise for improving insulin sensitivity are well known. In this regard, HIIT has been shown to rapidly improve glucose control, endothelial function, and cardiorespiratory fitness. Here, we report the available evidence for each strategy and speculate that the combination of carbohydrate-restriction and HIIT will synergistically maximize the benefits of both approaches. We hypothesize that this lifestyle strategy represents an optimal intervention to treat metabolic disease; however, further research is warranted in order to harness the potential benefits of carbohydrate-restriction and HIIT for improving cardiometabolic health.

  9. First-order inflation

    International Nuclear Information System (INIS)

    Kolb, E.W.

    1991-01-01

    In the original proposal, inflation occurred in the process of a strongly first-order phase transition. This model was soon demonstrated to be fatally flawed. Subsequent models for inflation involved phase transitions that were second-order, or perhaps weakly first-order; some even involved no phase transition at all. Recently the possibility of inflation during a strongly first-order phase transition has been reviewed. In this talk I will discuss some models for first-order inflation, and emphasize unique signatures that result if inflation is realized in a first-order transition. Before discussing first-order inflation, I will briefly review some of the history of inflation to demonstrate how first-order inflation differs from other models. (orig.)

  10. First-order inflation

    International Nuclear Information System (INIS)

    Kolb, E.W.; Chicago Univ., IL

    1990-09-01

    In the original proposal, inflation occurred in the process of a strongly first-order phase transition. This model was soon demonstrated to be fatally flawed. Subsequent models for inflation involved phase transitions that were second-order, or perhaps weakly first-order; some even involved no phase transition at all. Recently the possibility of inflation during a strongly first-order phase transition has been revived. In this talk I will discuss some models for first-order inflation, and emphasize unique signatures that result in inflation is realized in a first-order transition. Before discussing first-order inflation, I will briefly review some of the history of inflation to demonstrate how first-order inflation differs from other models. 58 refs., 3 figs

  11. SNV's modes of ordering

    NARCIS (Netherlands)

    Hummel, John; Duim, van der Rene

    2016-01-01

    This article adopts an aidnographic approach to examine how internal organizational modes of ordering have influenced tourism development practices of SNV Netherlands Development Organisation (SNV). Our research revealed six modes of ordering: administration, project management, enterprising,

  12. First-order inflation

    Energy Technology Data Exchange (ETDEWEB)

    Kolb, E.W. (Fermi National Accelerator Lab., Batavia, IL (USA) Chicago Univ., IL (USA). Enrico Fermi Inst.)

    1990-09-01

    In the original proposal, inflation occurred in the process of a strongly first-order phase transition. This model was soon demonstrated to be fatally flawed. Subsequent models for inflation involved phase transitions that were second-order, or perhaps weakly first-order; some even involved no phase transition at all. Recently the possibility of inflation during a strongly first-order phase transition has been revived. In this talk I will discuss some models for first-order inflation, and emphasize unique signatures that result in inflation is realized in a first-order transition. Before discussing first-order inflation, I will briefly review some of the history of inflation to demonstrate how first-order inflation differs from other models. 58 refs., 3 figs.

  13. Why restrictions on the immigration of health workers are unjust.

    Science.gov (United States)

    Hidalgo, Javier

    2014-12-01

    Some bioethicists and political philosophers argue that rich states should restrict the immigration of health workers from poor countries in order to prevent harm to people in these countries. In this essay, I argue that restrictions on the immigration of health workers are unjust, even if this immigration results in bad health outcomes for people in poor countries. I contend that negative duties to refrain from interfering with the occupational liberties of health workers outweighs rich states' positive duties to prevent harm to people in sending countries. Furthermore, I defend this claim against the objection that health workers in poor countries acquire special duties to their compatriots that render them liable to coercive interference. © 2012 John Wiley & Sons Ltd.

  14. MARTINDALE'S DRUGS RESTRICTED IN SPORT POCKET COMPANION 2009

    Directory of Open Access Journals (Sweden)

    Sean C. Sweetman

    2009-06-01

    Full Text Available Over 500 drugs restricted in sport presented in alphabetical order. To inform and alert the athlete about the potential problem of drug taking for any kind of reasons on and off during training and competition.A comprehensive index of drug names, synonyms, medical usage, single and multi-ingredient preparations and trade (on occasion street names of drugs from 40 countries worldwide (Martindale data. The classification of World Anti-Doping Agency (WADA is added to the explanation of drugs limitation in sport in and out of competition. A glossary of common medical terms is also included.This pocket publication is a must-have list of restricted drugs for athletes, trainers, sports medicine professionals, in short for anyone in exercise physiology and human performance fields.

  15. Umbilical cord length in singleton gestations: a Finnish population-based retrospective register study.

    Science.gov (United States)

    Georgiadis, L; Keski-Nisula, L; Harju, M; Räisänen, S; Georgiadis, S; Hannila, M-L; Heinonen, S

    2014-04-01

    Many complications of pregnancy and delivery are associated with umbilical cord length. It is important to examine the variation in length, in order to identify normal and abnormal conditions. Moreover, the factors influencing cord growth and development are not precisely known. The main objectives were to provide updated reference charts for umbilical cord length in singleton pregnancies and to evaluate potential factors affecting cord length. Birth register data of 47,284 singleton pregnant women delivering in Kuopio University Hospital, Finland was collected prospectively. Gender-specific centile charts for cord length from 22 to 44 gestational weeks were obtained using generalized additive models for location, scale, and shape (GAMLSS). Gestational, fetal, and maternal factors were studied for their potential influence on cord length with single variable analysis and stepwise multiple linear regression analysis. Cord length increased according to gestational age, while the growth decelerated post-term. Birth weight, placental weight, pregravid maternal body mass index, parity, and maternal age correlated to cord length. Gestational diabetes and previous miscarriages were associated with longer cords, while female gender and placental abruption were associated with shorter cords. Girls had shorter cords throughout gestation although there was substantial variation in length in both genders. Cord length associated significantly with birth weight, placental weight, and gestational age. Significantly shorter cords were found in women with placental abruption. This important finding requires further investigation. Copyright © 2014 Elsevier Ltd. All rights reserved.

  16. Urban water restrictions: Attitudes and avoidance

    Science.gov (United States)

    Cooper, Bethany; Burton, Michael; Crase, Lin

    2011-12-01

    In most urban cities across Australia, water restrictions remain the dominant policy mechanism to restrict urban water consumption. The extensive adoption of water restrictions as a means to limit demand, over several years, means that Australian urban water prices have consistently not reflected the opportunity cost of water. Given the generally strong political support for water restrictions and the likelihood that they will persist for some time, there is value in understanding households' attitudes in this context. More specifically, identifying the welfare gains associated with avoiding urban water restrictions entirely would be a nontrivial contribution to our knowledge and offer insights into the benefits of alternative policy responses. This paper describes the results from a contingent valuation study that investigates consumers' willingness to pay to avoid urban water restrictions. Importantly, the research also investigates the influence of cognitive and exogenous dimensions on the utility gain associated with avoiding water restrictions. The results provide insights into the impact of the current policy mechanism on economic welfare.

  17. Exact multi-restricted Schur polynomial correlators

    International Nuclear Information System (INIS)

    Bhattacharyya, Rajsekhar; Koch, Robert de Mello; Stephanou, Michael

    2008-01-01

    We derive a product rule satisfied by restricted Schur polynomials. We focus mostly on the case that the restricted Schur polynomial is built using two matrices, although our analysis easily extends to more than two matrices. This product rule allows us to compute exact multi-point correlation functions of restricted Schur polynomials, in the free field theory limit. As an example of the use of our formulas, we compute two point functions of certain single trace operators built using two matrices and three point functions of certain restricted Schur polynomials, exactly, in the free field theory limit. Our results suggest that gravitons become strongly coupled at sufficiently high energy, while the restricted Schur polynomials for totally antisymmetric representations remain weakly interacting at these energies. This is in perfect accord with the half-BPS (single matrix) results of hep-th/0512312. Finally, by studying the interaction of two restricted Schur polynomials we suggest a physical interpretation for the labels of the restricted Schur polynomial: the composite operator χ R,(r n ,r m ) (Z,X) is constructed from the half BPS 'partons' χ r n (Z) and χ r m (X).

  18. Inventory order crossovers

    NARCIS (Netherlands)

    Riezebos, J.

    2006-01-01

    The control policies that are used in inventory management systems assume that orders arrive in the same sequence as they were ordered. Due to changes in supply chains and markets, this assumption is no longer valid. This paper aims at providing an improved understanding of the phenomenon of order

  19. Decoding restricted participation in sequential electricity markets

    Energy Technology Data Exchange (ETDEWEB)

    Knaut, Andreas; Paschmann, Martin

    2017-06-15

    Restricted participation in sequential markets may cause high price volatility and welfare losses. In this paper we therefore analyze the drivers of restricted participation in the German intraday auction which is a short-term electricity market with quarter-hourly products. Applying a fundamental electricity market model with 15-minute temporal resolution, we identify the lack of sub-hourly market coupling being the most relevant driver of restricted participation. We derive a proxy for price volatility and find that full market coupling may trigger quarter-hourly price volatility to decrease by a factor close to four.

  20. Association of Telomere Length with Breast Cancer Prognostic Factors.

    Directory of Open Access Journals (Sweden)

    Kaoutar Ennour-Idrissi

    Full Text Available Telomere length, a marker of cell aging, seems to be affected by the same factors thought to be associated with breast cancer prognosis.To examine associations of peripheral blood cell-measured telomere length with traditional and potential prognostic factors in breast cancer patients.We conducted a cross-sectional analysis of data collected before surgery from 162 breast cancer patients recruited consecutively between 01/2011 and 05/2012, at a breast cancer reference center. Data on the main lifestyle factors (smoking, alcohol consumption, physical activity were collected using standardized questionnaires. Anthropometric factors were measured. Tumor biological characteristics were extracted from pathology reports. Telomere length was measured using a highly reproducible quantitative PCR method in peripheral white blood cells. Spearman partial rank-order correlations and multivariate general linear models were used to evaluate relationships between telomere length and prognostic factors.Telomere length was positively associated with total physical activity (rs = 0.17, P = 0.033; Ptrend = 0.069, occupational physical activity (rs = 0.15, P = 0.054; Ptrend = 0.054 and transportation-related physical activity (rs = 0.19, P = 0.019; P = 0.005. Among post-menopausal women, telomere length remained positively associated with total physical activity (rs = 0.27, P = 0.016; Ptrend = 0.054 and occupational physical activity (rs = 0.26, P = 0.021; Ptrend = 0.056 and was only associated with transportation-related physical activity among pre-menopausal women (rs = 0.27, P = 0.015; P = 0.004. No association was observed between telomere length and recreational or household activities, other lifestyle factors or traditional prognostic factors.Telomeres are longer in more active breast cancer patients. Since white blood cells are involved in anticancer immune responses, these findings suggest that even regular low-intensity physical activity, such as that

  1. Ultrasound Assessment of Cervical Length in Pregnancy

    Directory of Open Access Journals (Sweden)

    An-Shine Chao

    2008-09-01

    Full Text Available Cervical length in high-risk women for preterm birth has to be identified before early second trimester. Sequential evaluations lead to high predictive significance. The mean cervical length at 24 weeks is about 35 mm when measured by transvaginal ultrasound. A short cervix is defined as a cervix that is less than 25 mm and funneling, i.e. ballooning of the membranes into a dilated internal os, but with a closed external os. Factors such as short cervical length, uterine anomaly, previous cervical surgery, multiple gestation and positive fetal fibronectin results are associated with preterm delivery. Serial transvaginal ultrasound examinations during the early second trimester would provide longitudinal changes in the cervical length. The use of 17α-hydroxyprogesterone caproate and cerclage has shown to be beneficial in preventing preterm delivery. When combined with other predictors such as occiput position, parity, maternal age and body mass index, cervical length is a useful parameter for predicting the feasibility of labor induction and successful delivery.

  2. Functional scoliosis caused by leg length discrepancy

    Science.gov (United States)

    Daniszewska, Barbara; Zolynski, Krystian

    2010-01-01

    Introduction Leg length discrepancy (LLD) causes pelvic obliquity in the frontal plane and lumbar scoliosis with convexity towards the shorter extremity. Leg length discrepancy is observed in 3-15% of the population. Unequalized lower limb length discrepancy leads to posture deformation, gait asymmetry, low back pain and discopathy. Material and methods In the years 1998-2006, 369 children, aged 5 to 17 years (209 girls, 160 boys) with LLD-related functional scoliosis were treated. An external or internal shoe lift was applied. Results Among 369 children the discrepancy of 0.5 cm was observed in 27, 1 cm in 329, 1.5 cm in 9 and 2 cm in 4 children. During the first follow-up examination, within 2 weeks, the adjustment of the spine to new static conditions was noted and correction of the curve in 316 examined children (83.7%). In 53 children (14.7%) the correction was observed later and was accompanied by slight low back pain. The time needed for real equalization of limbs was 3 to 24 months. The time needed for real equalization of the discrepancy was 11.3 months. Conclusions Leg length discrepancy equalization results in elimination of scoliosis. Leg length discrepancy < 2 cm is a static disorder; that is why measurements should be performed in a standing position using blocks of adequate thickness and the position of the posterior superior iliac spine should be estimated. PMID:22371777

  3. 77 FR 51561 - Notice of Temporary Restriction Order for Skinny Dipper Hot Springs, Boise County, ID

    Science.gov (United States)

    2012-08-24

    ... effect for two years or until rescinded or modified by the authorized officer or designated Federal... currently at high risk. Between 2004 and present there have been at least two fatalities, several assaults...), construction of unauthorized structures, and damage/removal of vegetation. The BLM will post signs at main...

  4. Estimation of average causal effect using the restricted mean residual lifetime as effect measure

    DEFF Research Database (Denmark)

    Mansourvar, Zahra; Martinussen, Torben

    2017-01-01

    Although mean residual lifetime is often of interest in biomedical studies, restricted mean residual lifetime must be considered in order to accommodate censoring. Differences in the restricted mean residual lifetime can be used as an appropriate quantity for comparing different treatment groups...... with respect to their survival times. In observational studies where the factor of interest is not randomized, covariate adjustment is needed to take into account imbalances in confounding factors. In this article, we develop an estimator for the average causal treatment difference using the restricted mean...

  5. Environmental stresses disrupt telomere length homeostasis.

    Directory of Open Access Journals (Sweden)

    Gal Hagit Romano

    Full Text Available Telomeres protect the chromosome ends from degradation and play crucial roles in cellular aging and disease. Recent studies have additionally found a correlation between psychological stress, telomere length, and health outcome in humans. However, studies have not yet explored the causal relationship between stress and telomere length, or the molecular mechanisms underlying that relationship. Using yeast as a model organism, we show that stresses may have very different outcomes: alcohol and acetic acid elongate telomeres, whereas caffeine and high temperatures shorten telomeres. Additional treatments, such as oxidative stress, show no effect. By combining genome-wide expression measurements with a systematic genetic screen, we identify the Rap1/Rif1 pathway as the central mediator of the telomeric response to environmental signals. These results demonstrate that telomere length can be manipulated, and that a carefully regulated homeostasis may become markedly deregulated in opposing directions in response to different environmental cues.

  6. Extending electronic length frequency analysis in R

    DEFF Research Database (Denmark)

    Taylor, M. H.; Mildenberger, Tobias K.

    2017-01-01

    of the asymptotic length parameter (L-infinity) are found to have significant effects on parameter estimation error. An outlook provides context as to the significance of the R-based implementation for further testing and development, as well as the general relevance of the method for data-limited stock assessment.......Electronic length frequency analysis (ELEFAN) is a system of stock assessment methods using length-frequency (LFQ) data. One step is the estimation of growth from the progression of LFQ modes through time using the von Bertalanffy growth function (VBGF). The option to fit a seasonally oscillating...... with known values, the accuracy of the soVBGF parameter estimation was evaluated. The results indicate that both optimisation approaches are capable of finding high scoring solutions, yet settings regarding the initial restructuring process for LFQ bin scoring (i.e. "moving average,") and the fixing...

  7. Resonance effects in neutron scattering lengths

    International Nuclear Information System (INIS)

    Lynn, J.E.

    1989-01-01

    The nature of neutron scattering lengths is described and the nuclear effects giving rise to their variation is discussed. Some examples of the shortcomings of the available nuclear data base, particularly for heavy nuclei, are given. Methods are presented for improving this data base, in particular for obtaining the energy variation of the complex coherent scattering length from long to sub-angstrom wave lengths from the available sources of slow neutron cross section data. Examples of this information are given for several of the rare earth nuclides. Some examples of the effect of resonances in neutron reflection and diffraction are discussed. This report documents a seminar given at Argonne National Laboratory in March 1989. 18 refs., 18 figs

  8. Minimal Length Scale Scenarios for Quantum Gravity.

    Science.gov (United States)

    Hossenfelder, Sabine

    2013-01-01

    We review the question of whether the fundamental laws of nature limit our ability to probe arbitrarily short distances. First, we examine what insights can be gained from thought experiments for probes of shortest distances, and summarize what can be learned from different approaches to a theory of quantum gravity. Then we discuss some models that have been developed to implement a minimal length scale in quantum mechanics and quantum field theory. These models have entered the literature as the generalized uncertainty principle or the modified dispersion relation, and have allowed the study of the effects of a minimal length scale in quantum mechanics, quantum electrodynamics, thermodynamics, black-hole physics and cosmology. Finally, we touch upon the question of ways to circumvent the manifestation of a minimal length scale in short-distance physics.

  9. Nuclear reactor with scrammable part length rod

    International Nuclear Information System (INIS)

    Bevilacqua, F.

    1979-01-01

    A new part length rod is provided. It may be used to control xenon induced power oscillations but to contribute to shutdown reactivity when a rapid shutdown of the reactor is required. The part length rod consists of a control rod with three regions. The lower control region is a longer weaker active portion separated from an upper stronger shorter poison section by an intermediate section which is a relative non-absorber of neutrons. The combination of the longer weaker control section with the upper high worth poison section permits the part length rod of this to be scrammed into the core when a reactor shutdown is required but also permits the control rod to be used as a tool to control power distribution in both the axial and radial directions during normal operation

  10. Minimal Length Scale Scenarios for Quantum Gravity

    Directory of Open Access Journals (Sweden)

    Sabine Hossenfelder

    2013-01-01

    Full Text Available We review the question of whether the fundamental laws of nature limit our ability to probe arbitrarily short distances. First, we examine what insights can be gained from thought experiments for probes of shortest distances, and summarize what can be learned from different approaches to a theory of quantum gravity. Then we discuss some models that have been developed to implement a minimal length scale in quantum mechanics and quantum field theory. These models have entered the literature as the generalized uncertainty principle or the modified dispersion relation, and have allowed the study of the effects of a minimal length scale in quantum mechanics, quantum electrodynamics, thermodynamics, black-hole physics and cosmology. Finally, we touch upon the question of ways to circumvent the manifestation of a minimal length scale in short-distance physics.

  11. Length quantization of DNA partially expelled from heads of a bacteriophage T3 mutant

    Energy Technology Data Exchange (ETDEWEB)

    Serwer, Philip, E-mail: serwer@uthscsa.edu [Department of Biochemistry, The University of Texas Health Science Center, 7703 Floyd Curl Drive, San Antonio, TX 78229-3900 (United States); Wright, Elena T. [Department of Biochemistry, The University of Texas Health Science Center, 7703 Floyd Curl Drive, San Antonio, TX 78229-3900 (United States); Liu, Zheng; Jiang, Wen [Markey Center for Structural Biology, Department of Biological Sciences, Purdue University, West Lafayette, IN 47907 (United States)

    2014-05-15

    DNA packaging of phages phi29, T3 and T7 sometimes produces incompletely packaged DNA with quantized lengths, based on gel electrophoretic band formation. We discover here a packaging ATPase-free, in vitro model for packaged DNA length quantization. We use directed evolution to isolate a five-site T3 point mutant that hyper-produces tail-free capsids with mature DNA (heads). Three tail gene mutations, but no head gene mutations, are present. A variable-length DNA segment leaks from some mutant heads, based on DNase I-protection assay and electron microscopy. The protected DNA segment has quantized lengths, based on restriction endonuclease analysis: six sharp bands of DNA missing 3.7–12.3% of the last end packaged. Native gel electrophoresis confirms quantized DNA expulsion and, after removal of external DNA, provides evidence that capsid radius is the quantization-ruler. Capsid-based DNA length quantization possibly evolved via selection for stalling that provides time for feedback control during DNA packaging and injection. - Graphical abstract: Highlights: • We implement directed evolution- and DNA-sequencing-based phage assembly genetics. • We purify stable, mutant phage heads with a partially leaked mature DNA molecule. • Native gels and DNase-protection show leaked DNA segments to have quantized lengths. • Native gels after DNase I-removal of leaked DNA reveal the capsids to vary in radius. • Thus, we hypothesize leaked DNA quantization via variably quantized capsid radius.

  12. Telomere length and fetal programming: A review of recent scientific advances.

    Science.gov (United States)

    Whiteman, Valerie E; Goswami, Anjali; Salihu, Hamisu M

    2017-05-01

    We sought to synthesize a comprehensive literature review comprising recent research linking fetal programming to fetal telomere length. We also explored the potential effects fetal telomere length shortening has on fetal phenotypes. Utilizing the PubMed database as our primary search engine, we retrieved and reviewed 165 articles of published research. The inclusion criteria limited the articles to those that appeared within the last ten years, were pertinent to humans, and without restriction to language of publication. Our results showed that socio-demographic factors like age, sex, genetic inheritance, and acquired disease impact telomere length. Further, we found several maternal characteristics to be associated with fetal telomere length shortening, and these include maternal chemical exposure (eg, tobacco smoke), maternal stress during pregnancy, maternal nutritional and sleeping disorders during pregnancy as well as maternal disease status. Due to paucity of data, our review could not synthesize evidence directly linking fetal phenotypes to telomere length shortening. Although the research summarized in this review shows some association between determinants of intrauterine programming and fetal telomere length, there is still significant work that needs to be done to delineate the direct relationship of telomere attrition with specific fetal phenotypes. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  13. 32 CFR 806.24 - Fee restrictions.

    Science.gov (United States)

    2010-07-01

    ... INFORMATION ACT PROGRAM § 806.24 Fee restrictions. For FOIA purposes, Air Force activities will consider the cost of collecting a fee to be $15 and will not assess requesters' fees for any amount less than $15. ...

  14. Restricted Coherent Risk Measures and Actuarial Solvency

    Directory of Open Access Journals (Sweden)

    Christos E. Kountzakis

    2012-01-01

    Full Text Available We prove a general dual representation form for restricted coherent risk measures, and we apply it to a minimization problem of the required solvency capital for an insurance company.

  15. 50 CFR 665.99 - Area restrictions.

    Science.gov (United States)

    2010-10-01

    ..., DEPARTMENT OF COMMERCE (CONTINUED) FISHERIES IN THE WESTERN PACIFIC American Samoa Fisheries § 665.99 Area restrictions. Fishing is prohibited in all no-take MPAs. The following U.S. EEZ waters around American Samoa...

  16. EGFR Activation by Spatially Restricted Ligands

    National Research Council Canada - National Science Library

    Clouse, Katherine N; Goodrich, Jennifer S

    2006-01-01

    ...) functions in the localization and translational regulation of grk mRNA. The purpose of this project is to identify factors that function with Sqd to produce spatially-restricted Egfr activation...

  17. EGFR Activation by Spatially Restricted Ligands

    National Research Council Canada - National Science Library

    Goodrich, Jennifer S

    2005-01-01

    ...) functions in the localization and translational regulation of grk mRNA. The purpose of this project is to identify factors that function with Squid to produce spatially-restricted EGFR activation...

  18. EGFR Activation by Spatially Restricted Ligands

    National Research Council Canada - National Science Library

    Clouse, Katherine N; Goodrich, Jennifer S

    2006-01-01

    ...) activity has been associated with an increased prognosis of breast cancer. During cogenesis in Drosophila melanogaster local Egfr activation by the spatially-restricted TGFalpha-like ligand Gurken (Grk...

  19. EGFR Activation by Spatially Restricted Ligands

    National Research Council Canada - National Science Library

    Goodrich, Jennifer S

    2005-01-01

    ...) activity has been associated with an increased prognosis of breast cancer. During oogenesis in Drosophila melanogaster, local EGFR activation by the spatially restricted TGF alpha-like ligand, Gurken (Grk...

  20. The welfare effects of mobility restrictions

    Czech Academy of Sciences Publication Activity Database

    Jeong, Byeongju

    2003-01-01

    Roč. 6, č. 3 (2003), s. 685-696 ISSN 1094-2025 Institutional research plan: CEZ:AV0Z7085904 Keywords : mobility restriction * partnership * search Subject RIV: AH - Economics Impact factor: 0.600, year: 2003

  1. Health Benefits of Fasting and Caloric Restriction.

    Science.gov (United States)

    Golbidi, Saeid; Daiber, Andreas; Korac, Bato; Li, Huige; Essop, M Faadiel; Laher, Ismail

    2017-10-23

    Obesity and obesity-related diseases, largely resulting from urbanization and behavioral changes, are now of global importance. Energy restriction, though, is associated with health improvements and increased longevity. We review some important mechanisms related to calorie limitation aimed at controlling of metabolic diseases, particularly diabetes. Calorie restriction triggers a complex series of intricate events, including activation of cellular stress response elements, improved autophagy, modification of apoptosis, and alteration in hormonal balance. Intermittent fasting is not only more acceptable to patients, but it also prevents some of the adverse effects of chronic calorie restriction, especially malnutrition. There are many somatic and potentially psychologic benefits of fasting or intermittent calorie restriction. However, some behavioral modifications related to abstinence of binge eating following a fasting period are crucial in maintaining the desired favorable outcomes.

  2. New plasma diagnosis by coherence length spectroscopy

    International Nuclear Information System (INIS)

    Poolyarat, N.; Kim, Y.W.

    2008-01-01

    A new methodology and instrumentation have been developed for diagnosis of dense high temperature plasmas. In a plasma medium, collision processes shorten the optical coherence length at a given emission wavelength. By measuring the coherence length, the rate of collisions a radiating particle experiences can be determined. A map of the collision rates throughout the plasma can speak volumes about the atomic and thermal state of the plasma. Both the time-integrated and time-resolved interference fringes are obtained using emissions due to the transition between 3s 2 3p 5 ( 2 P o 3/2 )4p and 3s 2 3p 5 ( 2 P o 3/2 )7d. We have observed that the coherence length indeed decreases with increasing collision rate, and in addition, as a function of time as a result of cumulative collisions. The coherence length was found to be 4200±800 nm at 50 torr where the collision frequency is 2.14x10 11 s -1 , and 2400±130 nm at 140 torr where the collision frequency is 8.13x10 11 s -1 . We have also discovered that the coherence length varies with the direction of the viewing line of sight into the discharge plasma. The anisotropy results from the non-uniform structure in the discharge current, and this is further investigated by intentionally deforming the tip of the cathode. A photographic examination of both the cathode and the anode disc confirms the non-axis-symmetric structure of the plasma, which leads to the asymmetry in the plasma, in agreement with the angular dependence of the coherence length. (author)

  3. Alterations in the antioxidant defense system in prepubertal children with a history of extrauterine growth restriction.

    Science.gov (United States)

    Ortiz-Espejo, M; Gil-Campos, M; Mesa, M D; García-Rodríguez, C E; Muñoz-Villanueva, M C; Pérez-Navero, J L

    2014-01-01

    The role of oxidative stress is well known in the pathogenesis of acquired malnutrition. Intrauterine growth restriction has been associated with an imbalance in oxidative stress/antioxidant system. Therefore, early postnatal environment and, consequently, extrauterine growth restriction might be associated with alterations in the antioxidant defense system, even in the prepubertal stage. This is a descriptive, analytical, and observational case-control study. The study included two groups; 38 Caucasian prepubertal children born prematurely and with a history of extrauterine growth restriction as the case group, and 123 gender- and age-matched controls. Plasma exogenous antioxidant (retinol, β-carotene, and α-tocopherol) concentrations were measured by HPLC; antioxidant enzyme activities of catalase, glutathione reductase, glutathione peroxidase, and superoxide dismutase were determined in lysed erythrocytes by spectrophotometric techniques. Catalase and glutathione peroxidase concentrations were significantly lower in extrauterine growth restriction children than in controls (P restriction prepubertal children as compared with controls. After correction by gestational age, birth weight, and length, statistically significant differences were also found, except for retinol. Prepubertal children with a history of extrauterine growth restriction present alterations in their antioxidant defense system. Knowing these alterations may be important in establishing pharmacological and nutritional treatments as this situation might be associated with higher metabolic disorders in adulthood.

  4. Context Tree Estimation in Variable Length Hidden Markov Models

    OpenAIRE

    Dumont, Thierry

    2011-01-01

    We address the issue of context tree estimation in variable length hidden Markov models. We propose an estimator of the context tree of the hidden Markov process which needs no prior upper bound on the depth of the context tree. We prove that the estimator is strongly consistent. This uses information-theoretic mixture inequalities in the spirit of Finesso and Lorenzo(Consistent estimation of the order for Markov and hidden Markov chains(1990)) and E.Gassiat and S.Boucheron (Optimal error exp...

  5. Sighting optics including an optical element having a first focal length and a second focal length

    Science.gov (United States)

    Crandall, David Lynn [Idaho Falls, ID

    2011-08-01

    One embodiment of sighting optics according to the teachings provided herein may include a front sight and a rear sight positioned in spaced-apart relation. The rear sight includes an optical element having a first focal length and a second focal length. The first focal length is selected so that it is about equal to a distance separating the optical element and the front sight and the second focal length is selected so that it is about equal to a target distance. The optical element thus brings into simultaneous focus, for a user, images of the front sight and the target.

  6. Cutting Whole Length or Partial Length of Internal Anal Sphincter in Managementof Fissure in Ano

    Directory of Open Access Journals (Sweden)

    Furat Shani Aoda

    2017-12-01

    Full Text Available A chronic anal fissure is a common painful perianal condition.The main operative procedure to treat this painful condition is a lateral internal sphincteretomy (LIS.The aim of study is to compare the outcome and complications of closed LIS up to the dentate line (whole length of internal sphincter or up to the fissure apex (partial length of internal sphincter in the treatment of anal fissure.It is a prospective comparativestudy including 100 patients with chronic fissure in ano. All patients assigned to undergo closed LIS. Those patients were randomly divided into two groups: 50 patients underwent LIS to the level of dentate line (whole length and other 50 patients underwent LIS to the level of fissure apex (partial length. Patients were followed up weekly in the 1st month, twice monthly in the second month then monthly   for next 2 months and finally after 1 year. There was satisfactory relief of pain in all patients in both groups & complete healing of the fissure occurred. Regarding post operative incontinence no major degree of incontinence occur in both group but minor degree of incontinence persists In 7 patients after whole length LIS after one year. In conclusion, both whole length & partial length LIS associated with improvement of pain, good chance of healing but whole length LIS associated with more chance of long term  flatus incontinence. Hence,we recommend partial length LIS as treatment forchronic anal fissure.

  7. Apparatus for fabricating continuous lengths of superconductor

    Science.gov (United States)

    Kroeger, Donald M.; List, III, Frederick A.

    2001-01-01

    A process and apparatus for manufacturing a superconductor. The process is accomplished by depositing a superconductor precursor powder on a continuous length of a first substrate ribbon, overlaying a continuous length of a second substrate ribbon on said first substrate ribbon, and applying sufficient pressure to form a bound layered superconductor comprising a layer of said superconducting precursor powder between said first substrate ribbon and said second substrates ribbon. The layered superconductor is then heat treated to establish the superconducting phase of said superconductor precursor powder.

  8. Stride length: measuring its instantaneous value

    International Nuclear Information System (INIS)

    Campiglio, G C; Mazzeo, J R

    2007-01-01

    Human gait has been studied from different viewpoints: kinematics, dynamics, sensibility and others. Many of its characteristics still remain open to research, both for normal gait and for pathological gait. Objective measures of some of its most significant spatial/temporal parameters are important in this context. Stride length, one of these parameters, is defined as the distance between two consecutive contacts of one foot with ground. On this work we present a device designed to provide automatic measures of stride length. Its features make it particularly appropriate for the evaluation of pathological gait

  9. Behavioral and Physiological Consequences of Sleep Restriction

    OpenAIRE

    Banks, Siobhan; Dinges, David F.

    2007-01-01

    Adequate sleep is essential for general healthy functioning. This paper reviews recent research on the effects of chronic sleep restriction on neurobehavioral and physiological functioning and discusses implications for health and lifestyle. Restricting sleep below an individual's optimal time in bed (TIB) can cause a range of neurobehavioral deficits, including lapses of attention, slowed working memory, reduced cognitive throughput, depressed mood, and perseveration of thought. Neurobehavio...

  10. Advanced Restricted Area Entry Control System (ARAECS)

    OpenAIRE

    Appleton, Robert; Casillas, Jose; Scales, Gregory; Green, Robert; Niehoff, Mellissa; Fitzgerald, David; Ouellette, David

    2014-01-01

    Approved for public release; distribution is unlimited The Navy requires a capability for effective and efficient entry control for restricted areas that house critical assets. This thesis describes an Advanced Restricted Area Entry Control System (ARAECS) to meet this requirement. System requirements were obtained from existing governing documentation as well as stakeholder inputs. A functional architecture was developed and then modeled using the Imagine That Inc. ExtendSim tool. Factors...

  11. Date restricted queries in web search engines

    OpenAIRE

    Lewandowski, Dirk

    2004-01-01

    Search engines usually offer a date restricted search on their advanced search pages. But determining the actual update of a web page is not without problems. We conduct a study testing date restricted queries on the search engines Google, Teoma and Yahoo!. We find that these searches fail to work properly in the examined engines. We discuss implications of this for further research and search engine development.

  12. Public Investment, Revenue Shocks, and Borrowing Restrictions

    OpenAIRE

    Büttner, Thiess; Wildasin, David E.

    2010-01-01

    This paper lays out a theory of taxation and public investment in an intertemporal setting under conditions of revenue shocks. Without borrowing restrictions, the optimal policy is characterized by smooth time paths of taxes and public investment. While the introduction of formal borrowing restrictions leads to some precautionary savings, it gives rise to fluctuations in public investment in response to adverse but also favorable revenue shocks. This theoretical result is tested empirically u...

  13. Fractional-order devices

    CERN Document Server

    Biswas, Karabi; Caponetto, Riccardo; Mendes Lopes, António; Tenreiro Machado, José António

    2017-01-01

    This book focuses on two specific areas related to fractional order systems – the realization of physical devices characterized by non-integer order impedance, usually called fractional-order elements (FOEs); and the characterization of vegetable tissues via electrical impedance spectroscopy (EIS) – and provides readers with new tools for designing new types of integrated circuits. The majority of the book addresses FOEs. The interest in these topics is related to the need to produce “analogue” electronic devices characterized by non-integer order impedance, and to the characterization of natural phenomena, which are systems with memory or aftereffects and for which the fractional-order calculus tool is the ideal choice for analysis. FOEs represent the building blocks for designing and realizing analogue integrated electronic circuits, which the authors believe hold the potential for a wealth of mass-market applications. The freedom to choose either an integer- or non-integer-order analogue integrator...

  14. The design of artificial retroviral restriction factors

    International Nuclear Information System (INIS)

    Yap, Melvyn W.; Mortuza, Gulnahar B.; Taylor, Ian A.; Stoye, Jonathan P.

    2007-01-01

    In addition to the ability to bind the retroviral capsid protein, the retroviral restriction factors Fv1, Trim5α and Trim5-CypA share the common property of containing sequences that promote self-association. Otherwise Fv1 and Trim5α appear unrelated. Mutational analyses showed that restriction was invariably lost when changes designed to disrupt the sequences responsible for multimerization were introduced. A novel restriction protein could be obtained by substituting sequences from the self-associating domain of Fv1 for the Trim5 sequences in Trim5-CypA. Similarly, a fusion protein containing cyclophilin A joined to arfaptin2, a protein known to form extended dimers, was also shown to restrict HIV-1. Hence, multimerization of a capsid-binding domain could be the common minimum design feature for capsid-dependent retroviral restriction factors. However, not all domains that promote multimerization can substitute for the N-terminal domains of Fv1 and Trim5α. Moreover, only CypA can provide a capsid-binding site with different N-terminal domains. It is suggested that the spatial relationship between the multiple target binding sites may be important for restriction

  15. HLA-DPB1 typing with polymerase chain reaction and restriction fragment length polymorphism technique in Danes

    DEFF Research Database (Denmark)

    Hviid, Thomas Vauvert F.; Madsen, Hans O; Morling, Niels

    1992-01-01

    endonucleases: RsaI, FokI, ApaI, SacI, BstUI, EcoNI, and DdeI, and the DNA fragments were separated by electrophoresis in agarose gels. Altogether, 71 individuals were investigated and 16 different HLA-DPB1 types were observed in 26 different heterozygotic combinations, as well as five possible homozygotes...

  16. 45 CFR 264.1 - What restrictions apply to the length of time Federal TANF assistance may be provided?

    Science.gov (United States)

    2010-10-01

    ... Welfare OFFICE OF FAMILY ASSISTANCE (ASSISTANCE PROGRAMS), ADMINISTRATION FOR CHILDREN AND FAMILIES, DEPARTMENT OF HEALTH AND HUMAN SERVICES OTHER ACCOUNTABILITY PROVISIONS What Specific Rules Apply for Other... individual; (ii) Sexual abuse; (iii) Sexual activity involving a dependent child; (iv) Being forced as the...

  17. Genotyping of Campylobacter jejuni strains from Danish broiler chickens by restriction fragment length polymorphism of the LPS gene cluster

    DEFF Research Database (Denmark)

    Knudsen, K.N.; Bang, Dang Duong; Nielsen, E.M.

    2005-01-01

    Aims: To apply and evaluate LG (LPS genes) genotyping, which is a genotyping method based on a cluster of genes involved in the synthesis of surface lipopolysaccharides (LPS) in Campylobacter species, for typing of Campylobacter jejuni isolates obtained from Danish broiler chickens. Furthermore...... and LG genotyping was low when applied to poultry isolates. This is in contrast to previous studies on isolates of human origin that reported a high correlation between results obtained by the two typing methods....

  18. Rapid detection of dihydropteroate polymorphism in AIDS-related Pneumocystis carinii pneumonia by restriction fragment length polymorphism

    DEFF Research Database (Denmark)

    Helweg-Larsen, J; Eugen-Olsen, Jesper; Lundgren, B

    2000-01-01

    Sulpha agents, which act by inhibiting the enzyme dihydropteroate synthase (DHPS), are used widely for the treatment and prophylaxis of Pneumocystis carinii pneumonia (PCP). Recently, we have shown that mutations in the dihydropteroate synthase (DHPS) gene of Pneumocystis carinii f.sp hominis...

  19. Restriction fragment length polymorphism of rRNA genes for molecular typing of members of the family Legionellaceae

    DEFF Research Database (Denmark)

    Bangsborg, J M; Gerner-Smidt, P; Colding, H

    1995-01-01

    Typing of Legionella pneumophila remains important in the investigation of outbreaks of Legionnaires' disease and in the control of organisms contaminating hospital water. We found that the discriminatory power of a nonradioactive ribotyping method could be improved by combining results obtained...... of the combinations of enzymes used. Some strains belonging to the same serogroup were assigned to different ribotypes, and some ribotypes contained members of different serogroups, indicating, as others have found, that serogroup and genotype are not always related. The discriminatory power of the method...

  20. Simple, specific molecular typing of dengue virus isolates using one-step RT-PCR and restriction fragment length polymorphism.

    Science.gov (United States)

    Ortiz, Alma; Capitan, Zeuz; Mendoza, Yaxelis; Cisneros, Julio; Moreno, Brechla; Zaldivar, Yamitzel; Garcia, Mariana; Smith, Rebecca E; Motta, Jorge; Pascale, Juan Miguel

    2012-10-01

    A one-step RT-PCR and one-enzyme RFLP was used to detect and distinguish among flaviviruses, including the four serotypes of dengue and the St. Louis Encephalitis, West Nile and Yellow Fever viruses in cultured virus samples or acute-phase human serum. Using a previously described RT-PCR, but novel RFLP procedure, results are obtained in 24 h with basic PCR and electrophoresis equipment. There is 95% agreement between RT-PCR/RFLP results and those achieved by indirect immunofluorescence assays, and 100% agreement between RT-PCR/RFLP results and gene sequencing. This method is more rapid than tests of cytopathic effect based on virus isolation in tissue culture, and simpler than real-time PCR. It does not require specialized equipment, radioisotopes or computer analysis and is a method that can be applied widely in the developing world. It allows for prompt determination of whether a flavivirus is the cause of illness in a febrile patient, rapid identification of dengue serotypes in circulation, and improved patient management in cases where prior dengue exposure make dengue hemorrhagic fever or dengue shock syndrome a risk. Copyright © 2012 Elsevier B.V. All rights reserved.