Accuracy of qPCR for quantifying Leishmania kDNA in different skin layers of patients with American tegumentary leishmaniasis.

Science.gov (United States)

Sevilha-Santos, L; Dos Santos Júnior, A C M; Medeiros-Silva, V; Bergmann, J O; da Silva, E F; Segato, L F; Arabi, A Y M; de Paula, N A; Sampaio, R N R; Lima, B D; Gomes, C M

2018-05-03

Superficial swab sampling of American tegumentary leishmaniasis (ATL) lesions shows higher amounts of Leishmania than those from biopsy. Subcutaneous involvement is also important in ATL, but parasite quantification according to lesion depth has not been evaluated. We aim to present the best depth at which sampling should be performed for molecular exams of ATL. Patients with a clinical presentation compatible with ATL were allocated to ATL and control groups. Qualitative and quantitative qPCR assays were performed using SYBR Green and primers amplifying the kDNA minicircle of Leishmania spp. in different skin layers, including the epidermis, the superior dermis, the inferior dermis, and the hypodermis. Fifty-nine patients were included in this study, including 40 who had been diagnosed with ATL and 19 controls. The number of parasites was greater in samples of the epidermis and superior dermis (159.1 × 10 6 , range 4.0-781.7, and 75.4 × 10 6 , range 8.0-244.5, mean Leishmania parasite equivalents per μg of tissue DNA, respectively) than those in samples of the inferior dermis and hypodermis (54.6, range 8.0-256.6, and 16.8 × 10 6 , range 8.0-24.1, mean Leishmania parasite equivalents per μg of tissue DNA, respectively). The best diagnostic accuracy was achieved in the superior dermis (77.9%) and was significantly greater than that in the hypodermis (63.3%; p 0.039). We conclude that superficial sampling can retrieve a greater quantity of parasites. Future studies of the role of transepidermal elimination as a mechanism of host defence in ATL must be performed as there is a considerable quantity of Leishmania kDNA in the epidermis. Copyright © 2018 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

Evaluation of PCR procedures for detecting and quantifying Leishmania donovani DNA in large numbers of dried human blood samples from a visceral leishmaniasis focus in Northern Ethiopia.

Science.gov (United States)

Abbasi, Ibrahim; Aramin, Samar; Hailu, Asrat; Shiferaw, Welelta; Kassahun, Aysheshm; Belay, Shewaye; Jaffe, Charles; Warburg, Alon

2013-03-27

Visceral Leishmaniasis (VL) is a disseminated protozoan infection caused by Leishmania donovani parasites which affects almost half a million persons annually. Most of these are from the Indian sub-continent, East Africa and Brazil. Our study was designed to elucidate the role of symptomatic and asymptomatic Leishmania donovani infected persons in the epidemiology of VL in Northern Ethiopia. The efficacy of quantitative real-time kinetoplast DNA/PCR (qRT-kDNA PCR) for detecting Leishmania donovani in dried-blood samples was assessed in volunteers living in an endemic focus. Of 4,757 samples, 680 (14.3%) were found positive for Leishmania k-DNA but most of those (69%) had less than 10 parasites/ml of blood. Samples were re-tested using identical protocols and only 59.3% of the samples with 10 parasite/ml or less were qRT-kDNA PCR positive the second time. Furthermore, 10.8% of the PCR negative samples were positive in the second test. Most samples with higher parasitemias remained positive upon re-examination (55/59 =93%). We also compared three different methods for DNA preparation. Phenol-chloroform was more efficient than sodium hydroxide or potassium acetate. DNA sequencing of ITS1 PCR products showed that 20/22 samples were Leishmania donovani while two had ITS1 sequences homologous to Leishmania major. Although qRT-kDNA PCR is a highly sensitive test, the dependability of low positives remains questionable. It is crucial to correlate between PCR parasitemia and infectivity to sand flies. While optimal sensitivity is achieved by targeting k-DNA, it is important to validate the causative species of VL by DNA sequencing.

First Evidence of a Hybrid of Leishmania (Viannia) braziliensis/L. (V.) peruviana DNA Detected from the Phlebotomine Sand Fly Lutzomyia tejadai in Peru

Science.gov (United States)

Hashiguchi, Yoshihisa

2016-01-01

The natural infection of sand flies by Leishmania was examined in the Department of Huanuco of Peru, where cutaneous leishmaniasis caused by a hybrid of Leishmania (Viannia) braziliensis/L. (V.) peruviana is endemic. A total of 2,997 female sand flies were captured by CDC light traps and Shannon traps, of which 2,931 and 66 flies were identified as Lutzomyia tejadai and Lu fischeri, respectively. Using crude DNA extracted from individual sand flies as a template, Leishmania DNA was detected from one Lu. tejadai. The parasite species was identified as a hybrid of L. (V.) braziliensis/L. (V.) peruviana on the basis of cytochrome b and mannose phosphate isomerase gene analyses. The result suggested that Lu. tejadai is responsible for the transmission of the hybrid Leishmania circulating in this area. PMID:26735142

Natural infection of bats with Leishmania in Ethiopia.

Science.gov (United States)

Kassahun, Aysheshm; Sadlova, Jovana; Benda, Petr; Kostalova, Tatiana; Warburg, Alon; Hailu, Asrat; Baneth, Gad; Volf, Petr; Votypka, Jan

2015-10-01

The leishmaniases, a group of diseases with a worldwide-distribution, are caused by different species of Leishmania parasites. Both cutaneous and visceral leishmaniasis remain important public health problems in Ethiopia. Epidemiological cycles of these protozoans involve various sand fly (Diptera: Psychodidae) vectors and mammalian hosts, including humans. In recent years, Leishmania infections in bats have been reported in the New World countries endemic to leishmaniasis. The aim of this study was to survey natural Leishmania infection in bats collected from various regions of Ethiopia. Total DNA was isolated from spleens of 163 bats belonging to 23 species and 18 genera. Leishmania infection was detected by real-time (RT) PCR targeting a kinetoplast (k) DNA and internal transcribed spacer one (ITS1) gene of the parasite. Detection was confirmed by sequencing of the PCR products. Leishmania kDNA was detected in eight (4.9%) bats; four of them had been captured in the Aba-Roba and Awash-Methara regions that are endemic for leishmaniasis, while the other four specimens originated from non-endemic localities of Metu, Bedele and Masha. Leishmania isolates from two bats were confirmed by ITS1 PCR to be Leishmania tropica and Leishmania major, isolated from two individual bats, Cardioderma cor and Nycteris hispida, respectively. These results represent the first confirmed observation of natural infection of bats with the Old World Leishmania. Hence, bats should be considered putative hosts of Leishmania spp. affecting humans with a significant role in the transmission. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

First evidence of Leishmania infection in European brown hare (Lepus europaeus) in Greece: GIS analysis and phylogenetic position within the Leishmania spp.

Science.gov (United States)

Tsokana, C N; Sokos, C; Giannakopoulos, A; Mamuris, Z; Birtsas, P; Papaspyropoulos, K; Valiakos, G; Spyrou, V; Lefkaditis, M; Chatzopoulos, D C; Kantere, M; Manolakou, K; Touloudi, A; Burriel, A Rodi; Ferroglio, E; Hadjichristodoulou, C; Billinis, C

2016-01-01

Although the existence of a sylvatic transmission cycle of Leishmania spp., independent from the domestic cycle, has been proposed, data are scarce on Leishmania infection in wild mammals in Greece. In this study, we aimed to investigate the presence of Leishmania infection in the European brown hare in Greece, to infer the phylogenetic position of the Leishmania parasites detected in hares in Greece, and to identify any possible correlation between Leishmania infection in hares with environmental parameters, using the geographical information system (GIS). Spleen samples from 166 hares were tested by internal transcribed spacer-1 (ITS-1)-nested PCR for the detection of Leishmania DNA. Phylogenetic analysis was performed on Leishmania sequences from hares in Greece in conjunction with Leishmania sequences from dogs in Greece and 46 Leishmania sequences retrieved from GenBank. The Leishmania DNA prevalence in hares was found to be 23.49 % (95 % confidence interval (CI) 17.27-30.69). The phylogenetic analysis confirmed that the Leishmania sequences from hares in Greece belong in the Leishmania donovani complex. The widespread Leishmania infection in hares should be taken into consideration because under specific circumstances, this species can act as a reservoir host. This study suggests that the role of wild animals, including hares, in the epidemiology of Leishmania spp. in Greece deserves further elucidation.

Canine leishmaniosis caused by Leishmania major and Leishmania tropica: comparative findings and serology.

Science.gov (United States)

Baneth, Gad; Yasur-Landau, Daniel; Gilad, Matan; Nachum-Biala, Yaarit

2017-03-13

Infection and clinical disease associated with Leishmania major and Leishmania tropica, two common agents of human cutaneous leishmaniosis, have rarely been reported in dogs. This study describes dogs infected with these Leishmania spp. prevalent in the Middle East and North Africa, and compares the serological response of dogs infected with Leishmania infantum, L. major or L. tropica to whole promastigote antigen enzyme-linked immunosorbent assay (ELISA) of each species and to rK39 dipstick. Leishmania major infection in a 5-month-old male dog was associated with alopecic and ulcerative periocular and limb skin lesions which responded to allopurinol treatment. Infection was detected by skin and blood polymerase chain reaction (PCR) and confirmed by DNA sequencing but the dog was seronegative. Leishmania tropica infection was detected in a 3-month-old female dog co-infected with Babesia vogeli and Anaplasma platys and with no skin lesions. PCR and DNA sequencing of the blood and parasite culture were positive for L. tropica. Sera from 11 dogs infected with L. infantum, L. major or L. tropica were reactive with all three Leishmania spp. antigens except for sera from a dog with L. major infection. No significant differences were found between reactivity of dog sera to the antigen of the infecting species, or to the other Leishmania spp. antigens. Sera from dogs infected with L. infantum and L. tropica were positive with the rK39 antigen kit, while dogs with L. major infection were seronegative. Skin lesions in L. major infected dogs from this study and previous reports (n = 2) were ulcerative and located on the muzzle, feet and foot pads and not associated with generalized lymphadenomegaly and splenomegaly. In previous L. tropica infections, skin lesions were proliferative mucocutaneous in young dogs (n = 2), or associated with widespread dermatitis, lymphadenomegaly and splenomegaly in older dogs with similarity to L. infantum infection (n = 2). This

Description of Leishmania (Leishmania forattinii sp. n., a new parasite infecting opossums and rodents in Brazil

Directory of Open Access Journals (Sweden)

Elizaide L. A. Yoshida

1993-09-01

Full Text Available A new parasite species of Leishmania is described, L. (Leishmania forattinii sp. n., which was isolated from a pooled triturate of liver and spleen of a opossum (Didelphis marsupialis aurita and from skin samples from a rodent (Proechmys iheringi denigratus, captured in primary forest on the Atlantic Cost of Brazil. Our results on the basis of biological and molecular criteria indicate that this taxonomically distinct parasite ias a new species of the L. mexicana complex, but closely related to L. (L. aristidesi Laison & shaw, 1979, as revelated by phenetic and phylogenetic numerical analyses of the enzyme data. L. forattinii was clearly distinguishable from other Leishmania species of the genus usisng enzyme electrophoresis, monoclonal antibodies, molecular karyotypes, analysis of restriction enzyme digestion patterns of kinetoplast DNA (kDNA, as well as the use of kDNA hybridization procedures.

Expression of Recombinant Human Coagulation Factor VII by the Lizard Leishmania Expression System

Directory of Open Access Journals (Sweden)

Sina Mirzaahmadi

2011-01-01

Full Text Available The variety of recombinant protein expression systems have been developed as a resource of FVII gene expression. In the current study, the authors used a novel protein expression system based on the Iranian Lizard Leishmania, a trypanosomatid protozoan as a host for expression of FVII. Plasmid containing cDNA encoding full-length human FVII was introduced into Lizard Leishmania and positive transfectants were analyzed by SDS-PAGE and Western blot analysis. Furthermore, biological activity of purified protein was detected by PT assay. The recombinant strain harboring a construct was analyzed for expression of FVII at the mRNA and protein level. Purified rFVII was obtained and in order to confirm the purified compound was in fact rFVII. Western blot analysis was carried out. Clotting time in PT assay was reduced about 30 seconds with the purified rFVII. In Conclusion, this study has demonstrated, for the first time, that Leishmania cells can be used as an expression system for producing recombinant FVII.

A comparison of molecular markers to detect Lutzomyia longipalpis naturally infected with Leishmania (Leishmania infantum

Directory of Open Access Journals (Sweden)

Kárita Cláudia Freitas-Lidani

2014-07-01

Full Text Available The aim of the present study was to detect natural infection by Leishmania (Leishmania infantum in Lutzomyia longipalpis captured in Barcarena, state of Pará, Brazil, through the use of three primer sets. With this approach, it is unnecessary to previously dissect the sandfly specimens. DNA of 280 Lu. longipalpis female specimens were extracted from the whole insects. PCR primers for kinetoplast minicircle DNA (kDNA, the mini-exon gene and the small subunit ribosomal RNA (SSU-rRNA gene of Leishmania were used, generating fragments of 400 bp, 780 bp and 603 bp, respectively. Infection by the parasite was found with the kDNA primer in 8.6% of the cases, with the mini-exon gene primer in 7.1% of the cases and with the SSU-rRNA gene primer in 5.3% of the cases. These data show the importance of polymerase chain reaction as a tool for investigating the molecular epidemiology of visceral leishmaniasis by estimating the risk of disease transmission in endemic areas, with the kDNA primer representing the most reliable marker for the parasite.

DNA-encoded chemical libraries - achievements and remaining challenges.

Science.gov (United States)

Favalli, Nicholas; Bassi, Gabriele; Scheuermann, Jörg; Neri, Dario

2018-04-23

DNA-encoded chemical libraries (DECLs) are collections of compounds, individually coupled to DNA tags serving as amplifiable identification barcodes. Since individual compounds can be identified by the associated DNA tag, they can be stored as a mixture, allowing the synthesis and screening of combinatorial libraries of unprecedented size, facilitated by the implementation of split-and-pool synthetic procedures or other experimental methodologies. In this review, we briefly present relevant concepts and technologies, which are required for the implementation and interpretation of screening procedures with DNA-encoded chemical libraries. Moreover, we illustrate some success stories, detailing how novel ligands were discovered from encoded libraries. Finally, we critically review what can realistically be achieved with the technology at the present time, highlighting challenges and opportunities for the future. © 2018 Federation of European Biochemical Societies.

TLR1/2 activation during heterologous prime-boost vaccination (DNA-MVA enhances CD8+ T Cell responses providing protection against Leishmania (Viannia.

Directory of Open Access Journals (Sweden)

Asha Jayakumar

2011-06-01

Full Text Available Leishmania (Viannia parasites present particular challenges, as human and murine immune responses to infection are distinct from other Leishmania species, indicating a unique interaction with the host. Further, vaccination studies utilizing small animal models indicate that modalities and antigens that prevent infection by other Leishmania species are generally not protective.Using a newly developed mouse model of chronic L. (Viannia panamensis infection and the heterologous DNA prime - modified vaccinia virus Ankara (MVA boost vaccination modality, we examined whether the conserved vaccine candidate antigen tryparedoxin peroxidase (TRYP could provide protection against infection/disease.Heterologous prime - boost (DNA/MVA vaccination utilizing TRYP antigen can provide protection against disease caused by L. (V. panamensis. However, protection is dependent on modulating the innate immune response using the TLR1/2 agonist Pam3CSK4 during DNA priming. Prime-boost vaccination using DNA alone fails to protect. Prior to infection protectively vaccinated mice exhibit augmented CD4 and CD8 IFNγ and memory responses as well as decreased IL-10 and IL-13 responses. IL-13 and IL-10 have been shown to be independently critical for disease in this model. CD8 T cells have an essential role in mediating host defense, as CD8 depletion reversed protection in the vaccinated mice; vaccinated mice depleted of CD4 T cells remained protected. Hence, vaccine-induced protection is dependent upon TLR1/2 activation instructing the generation of antigen specific CD8 cells and restricting IL-13 and IL-10 responses.Given the general effectiveness of prime-boost vaccination, the recalcitrance of Leishmania (Viannia to vaccine approaches effective against other species of Leishmania is again evident. However, prime-boost vaccination modality can with modulation induce protective responses, indicating that the delivery system is critical. Moreover, these results suggest that

DNA sequencing confirms the involvement of Leishmania (L. amazonensis in american tegumentary leishmaniasis in the state of São Paulo, Brazil

Directory of Open Access Journals (Sweden)

Angela Rapela Medeiros

2008-01-01

Full Text Available INTRODUCTION: American tegumentary leishmaniasis (ATL represents one of the most important public health issues in the world. An increased number of autochthonous cases of ATL in the Northeastern region of São Paulo State has been documented in the last few years, leading to a desire to determine the Leishmania species implicated. METHODS: PCR followed by DNA sequencing was carried out to identify a 120bp fragment from the universal kDNA minicircle of the genus Leishmania in 61 skin or mucosal biopsies from patients with ATL. RESULTS: DNA sequencing permitted the identification of a particular 15bp fragment (5' …GTC TTT GGG GCA AGT... 3' in all samples. Analysis by the neighbor-joining method showed the occurrence of two distinct groups related to the genus Viannia (V and Leishmania (L, each with two subgroups. Autochthonous cases with identity to a special Leishmania sequence not referenced in Genbank predominated in subgroup V.1, suggesting the possible existence of a subtype or mutation of Leishmania Viannia in this region. In the subgroup L.2, which showed identity with a known sequence of L. (L. amazonensis, there was a balanced distribution of autochthonous and non-autochthonous cases, including the mucosal and mucocutaneus forms in four patients. The last observation may direct us to new concepts, since the mucosal compromising has commonly been attributed to L. (V. braziliensis, even though L. (L. amazonensis is more frequent in the Amazonian region. CONCLUSIONS: These results confirm the pattern of distribution and possible mutations of these species, as well as the change in the clinical form presentation of ATL in the São Paulo State.

Storing data encoded DNA in living organisms

Science.gov (United States)

Wong,; Pak C. , Wong; Kwong K. , Foote; Harlan, P [Richland, WA

2006-06-06

Current technologies allow the generation of artificial DNA molecules and/or the ability to alter the DNA sequences of existing DNA molecules. With a careful coding scheme and arrangement, it is possible to encode important information as an artificial DNA strand and store it in a living host safely and permanently. This inventive technology can be used to identify origins and protect R&D investments. It can also be used in environmental research to track generations of organisms and observe the ecological impact of pollutants. Today, there are microorganisms that can survive under extreme conditions. As well, it is advantageous to consider multicellular organisms as hosts for stored information. These living organisms can provide as memory housing and protection for stored data or information. The present invention provides well for data storage in a living organism wherein at least one DNA sequence is encoded to represent data and incorporated into a living organism.

DNA-Encoded Dynamic Combinatorial Chemical Libraries.

Science.gov (United States)

Reddavide, Francesco V; Lin, Weilin; Lehnert, Sarah; Zhang, Yixin

2015-06-26

Dynamic combinatorial chemistry (DCC) explores the thermodynamic equilibrium of reversible reactions. Its application in the discovery of protein binders is largely limited by difficulties in the analysis of complex reaction mixtures. DNA-encoded chemical library (DECL) technology allows the selection of binders from a mixture of up to billions of different compounds; however, experimental results often show low a signal-to-noise ratio and poor correlation between enrichment factor and binding affinity. Herein we describe the design and application of DNA-encoded dynamic combinatorial chemical libraries (EDCCLs). Our experiments have shown that the EDCCL approach can be used not only to convert monovalent binders into high-affinity bivalent binders, but also to cause remarkably enhanced enrichment of potent bivalent binders by driving their in situ synthesis. We also demonstrate the application of EDCCLs in DNA-templated chemical reactions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Detection of Leishmania infantum DNA in hamsters infested with ticks collected from naturally infected dogs

Directory of Open Access Journals (Sweden)

Valter dos Anjos Almeida

2016-12-01

Full Text Available ABSTRACT. Almeida V. dos A., da Hora T.N., Leça Júnior N.F., Carvalho F.S., da Silva A.L., Wenceslau A.A., Albuquerque G.R. & Silva F.L. Detection of Leishmania infantum DNA in hamsters infested with ticks collected from naturally infected dogs. [Detecção do DNA de Leishmania infantum em hamsters infestados com carrapatos coletados de cães naturalmente infectados.] Revista Brasileira de Medicina Veterinária, 38(4:329-333, 2016. Departamento de Ciências Agrárias e Ambientais, Universidade Estadual de Santa Cruz, Campus Soane Nazaré de Andrade, Hospital Veterinário, Km 16, Rodovia Jorge Amado, Ilhéus, BA 45662-900, Brasil. E-mail: fabiana.lessa@gmail.com The aim of this study was to investigate the role of Rhipicephalus sanguineus, the brown dog tick, in the transmission of Leishmania infantum. To accomplish this, we used 24 adult golden hamsters of both genders, and divided them into two groups: a control group (n = 4 and an experimental group (n = 20. The animals from the experimental group were infested with ticks obtained from dogs naturally infected with L. infantum. Hamsters of the control group were not infested and were maintained at the same conditions, as the infested animals. After three months of observation, animals were euthanized and they were posted to obtain samples of their blood, spleen, liver, lymph nodes, and skin. These samples were then processed by histopathology, immunohistochemistry, and polymerase chain reaction (PCR. Fourteen hamsters (70% of the experimental group tested PCR-positive for L. infantum DNA in samples of buffy coat. The results of this study indicated that R. sanguineus ticks can transmit some forms or parts of L. infantum to parasitized hamsters.

Toward a Better Compression for DNA Sequences Using Huffman Encoding.

Science.gov (United States)

Al-Okaily, Anas; Almarri, Badar; Al Yami, Sultan; Huang, Chun-Hsi

2017-04-01

Due to the significant amount of DNA data that are being generated by next-generation sequencing machines for genomes of lengths ranging from megabases to gigabases, there is an increasing need to compress such data to a less space and a faster transmission. Different implementations of Huffman encoding incorporating the characteristics of DNA sequences prove to better compress DNA data. These implementations center on the concepts of selecting frequent repeats so as to force a skewed Huffman tree, as well as the construction of multiple Huffman trees when encoding. The implementations demonstrate improvements on the compression ratios for five genomes with lengths ranging from 5 to 50 Mbp, compared with the standard Huffman tree algorithm. The research hence suggests an improvement on all such DNA sequence compression algorithms that use the conventional Huffman encoding. The research suggests an improvement on all DNA sequence compression algorithms that use the conventional Huffman encoding. Accompanying software is publicly available (AL-Okaily, 2016 ).

Prevalence and risk factors associated with Leishmania infection in Trang Province, southern Thailand.

Science.gov (United States)

Manomat, Jipada; Leelayoova, Saovanee; Bualert, Lertwut; Tan-Ariya, Peerapan; Siripattanapipong, Suradej; Mungthin, Mathirut; Naaglor, Tawee; Piyaraj, Phunlerd

2017-11-01

Autochthonous cutaneous and visceral leishmaniasis (VL) caused by Leishmania martiniquensis and Leishmania siamensis have been considered emerging infectious diseases in Thailand. The disease burden is significantly underestimated, especially the prevalence of Leishmania infection among HIV-positive patients. A cross-sectional study was conducted to determine the prevalence and risk factors associated with Leishmania infection among patients with HIV/AIDS living in Trang province, southern Thailand, between 2015 and 2016. Antibodies against Leishmania infection were assayed using the direct agglutination test (DAT). DNA of Leishmania was detected by ITS1-PCR using the buffy coat. Species of Leishmania were also identified. Of 724 participants, the prevalence of Leishmania infection was 25.1% (182/724) using either DAT or PCR assays. Seroprevalence of Leishmania infection was 18.5% (134/724), while Leishmania DNA detected by the PCR method was 8.4% (61/724). Of these, 24.9% (180/724) were asymptomatic, whereas 0.3% (2/724) were symptomatic VL and VL/CL (cutaneous leishmaniasis). At least five species were identified: L. siamensis, L. martiniquensis, L. donovani complex, L. lainsoni, and L. major. Multivariate analysis showed that CD4+ levels Leishmania infection. Those who were PCR positive for Leishmania DNA were significantly associated with a detectable viral load, whereas non-injection drug use (NIDU) and CD4+ levels Leishmania seropositivity. A magnitude of the prevalence of underreporting Leishmania infection among Thai patients with HIV was revealed in this study. Effective public health policy to prevent and control disease transmission is urgently needed.

2D Barcode for DNA Encoding

OpenAIRE

Elena Purcaru; Cristian Toma

2011-01-01

The paper presents a solution for endcoding/decoding DNA information in 2D barcodes. First part focuses on the existing techniques and symbologies in 2D barcodes field. The 2D barcode PDF417 is presented as starting point. The adaptations and optimizations on PDF417 and on DataMatrix lead to the solution - DNA2DBC - DeoxyriboNucleic Acid Two Dimensional Barcode. The second part shows the DNA2DBC encoding/decoding process step by step. In conclusions are enumerated the most important features ...

Chemical Space of DNA-Encoded Libraries.

Science.gov (United States)

Franzini, Raphael M; Randolph, Cassie

2016-07-28

In recent years, DNA-encoded chemical libraries (DECLs) have attracted considerable attention as a potential discovery tool in drug development. Screening encoded libraries may offer advantages over conventional hit discovery approaches and has the potential to complement such methods in pharmaceutical research. As a result of the increased application of encoded libraries in drug discovery, a growing number of hit compounds are emerging in scientific literature. In this review we evaluate reported encoded library-derived structures and identify general trends of these compounds in relation to library design parameters. We in particular emphasize the combinatorial nature of these libraries. Generally, the reported molecules demonstrate the ability of this technology to afford hits suitable for further lead development, and on the basis of them, we derive guidelines for DECL design.

Molecular Identification of Leishmania spp. in Sand Flies (Diptera: Psychodidae, Phlebotominae) From Ecuador

Science.gov (United States)

Cevallos, Varsovia; Morales, Diego; Baldeón, Manuel E; Cárdenas, Paúl; Rojas-Silva, Patricio; Ponce, Patricio

2017-01-01

Abstract The detection and identification of natural infections in sand flies by Leishmania protozoan species in endemic areas is a key factor in assessing the risk of leishmaniasis and in designing prevention and control measures for this infectious disease. In this study, we analyzed the Leishmania DNA using nuclear ribosomal internal transcript spacer (ITS) sequences. Parasite DNA was extracted from naturally infected, blood-fed sand flies collected in nine localities considered leishmaniasis-endemic foci in Ecuador. The species of parasites identified in sand flies were Leishmania major-like, Leishmania naiffi, Leishmania mexicana, Leishmania lainsoni, and “Leishmania sp. siamensis”. Sand fly specimens of Brumptomyia leopoldoi, Mycropigomyia cayennensis, Nyssomyia yuilli yuilli, Nyssomyia trapidoi, Pressatia triacantha, Pressatia dysponeta, Psychodopygus carrerai carrerai, Psychodopygus panamensis, and Trichophoromyia ubiquitalis were found positive for Leishmania parasite. These findings contribute to a better understanding of the epidemiology and transmission dynamics of the disease in high-risk areas of Ecuador. PMID:28981860

Molecular Identification of Leishmania spp. in Sand Flies (Diptera: Psychodidae, Phlebotominae) From Ecuador.

Science.gov (United States)

Quiroga, Cristina; Cevallos, Varsovia; Morales, Diego; Baldeón, Manuel E; Cárdenas, Paúl; Rojas-Silva, Patricio; Ponce, Patricio

2017-11-07

The detection and identification of natural infections in sand flies by Leishmania protozoan species in endemic areas is a key factor in assessing the risk of leishmaniasis and in designing prevention and control measures for this infectious disease. In this study, we analyzed the Leishmania DNA using nuclear ribosomal internal transcript spacer (ITS) sequences. Parasite DNA was extracted from naturally infected, blood-fed sand flies collected in nine localities considered leishmaniasis-endemic foci in Ecuador.The species of parasites identified in sand flies were Leishmania major-like, Leishmania naiffi, Leishmania mexicana, Leishmania lainsoni, and "Leishmania sp. siamensis". Sand fly specimens of Brumptomyia leopoldoi, Mycropigomyia cayennensis, Nyssomyia yuilli yuilli, Nyssomyia trapidoi, Pressatia triacantha, Pressatia dysponeta, Psychodopygus carrerai carrerai, Psychodopygus panamensis, and Trichophoromyia ubiquitalis were found positive for Leishmania parasite. These findings contribute to a better understanding of the epidemiology and transmission dynamics of the disease in high-risk areas of Ecuador. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.

First occurrence of an autochthonous canine case of Leishmania (Leishmania infantum chagasi in the municipality of Campinas, State of São Paulo, Brazil

Directory of Open Access Journals (Sweden)

Elisa San Martin Mouriz Savani

2011-08-01

Full Text Available An autochthonous case of visceral leishmaniasis is reported in a dog (Canis familiaris as an apparently natural infection in a non-endemic area. DNA obtained from spleen and liver samples produced the expected fragment in a Leishmania-specific rDNA-based nested-PCR assay. The PCR product, a 490 bp fragment, was sequenced and the nucleotide sequence was identical to that of Leishmania (Leishmania infantum chagasi. These results are surprising since no autochthonous human or canine cases of visceral leishmaniasis have ever been reported in this municipality. This case suggests that natural transmission of this disease is occurring in this area.

Cell migration induced by Leishmania (Leishmania) amazonensis, Leishmania (Leishmania) major and Leishmania (Viannia) braziliensis into the peritoneal cavity of BALB/c mice

OpenAIRE

DT Wakimoto; KV Gaspareto; TGV Silveira; MVC Lonardoni; SMA Aristides

2010-01-01

In American cutaneous leishmaniasis, the initial infection phase is characterized by recruitment of neutrophils and monocytes. The migration of these cells in response to the presence of Leishmania in the peritoneum of affected animals remains unclear. The objective of this study was to investigate cell migration to the peritoneum of BALB/c mice after infection with Leishmania (Leishmania) amazonensis, Leishmania (Viannia) braziliensis and Leishmania (Leishmania) major. Initially, Leishmania ...

The Leishmania HSP20 Is Antigenic during Natural Infections, but, as DNA Vaccine, It does not Protect BALB/c Mice against Experimental L. amazonensis Infection

Directory of Open Access Journals (Sweden)

Ana M. Montalvo-Álvarez

2008-01-01

Full Text Available Protozoa of the genus Leishmania are causative agents of leishmaniasis, an important health problem in both human and veterinary medicine. Here, we describe a new heat shock protein (HSP in Leishmania, belonging to the small HSP (sHSP family in kinetoplastids. The protein is highly conserved in different Leishmania species, showing instead significant divergence with sHSP's from other organisms. The humoral response elicited against this protein during Leishmania infection has been investigated in natural infected humans and dogs, and in experimentally infected hamsters. Leishmania HSP20 is a prominent antigen for canine hosts; on the contrary, the protein seems to be a poor antigen for human immune system. Time-course analysis of appearance of anti-HSP20 antibodies in golden hamsters indicated that these antibodies are produced at late stages of the infection, when clinical symptoms of disease are patent. Finally, the protective efficacy of HSP20 was assessed in mice using a DNA vaccine approach prior to challenge with Leishmania amazonensis.

Transcriptionally Driven DNA Replication Program of the Human Parasite Leishmania major.

Science.gov (United States)

Lombraña, Rodrigo; Álvarez, Alba; Fernández-Justel, José Miguel; Almeida, Ricardo; Poza-Carrión, César; Gomes, Fábia; Calzada, Arturo; Requena, José María; Gómez, María

2016-08-09

Faithful inheritance of eukaryotic genomes requires the orchestrated activation of multiple DNA replication origins (ORIs). Although origin firing is mechanistically conserved, how origins are specified and selected for activation varies across different model systems. Here, we provide a complete analysis of the nucleosomal landscape and replication program of the human parasite Leishmania major, building on a better evolutionary understanding of replication organization in Eukarya. We found that active transcription is a driving force for the nucleosomal organization of the L. major genome and that both the spatial and the temporal program of DNA replication can be explained as associated to RNA polymerase kinetics. This simple scenario likely provides flexibility and robustness to deal with the environmental changes that impose alterations in the genetic programs during parasitic life cycle stages. Our findings also suggest that coupling replication initiation to transcription elongation could be an ancient solution used by eukaryotic cells for origin maintenance. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

Transcriptionally Driven DNA Replication Program of the Human Parasite Leishmania major

Directory of Open Access Journals (Sweden)

Rodrigo Lombraña

2016-08-01

Full Text Available Faithful inheritance of eukaryotic genomes requires the orchestrated activation of multiple DNA replication origins (ORIs. Although origin firing is mechanistically conserved, how origins are specified and selected for activation varies across different model systems. Here, we provide a complete analysis of the nucleosomal landscape and replication program of the human parasite Leishmania major, building on a better evolutionary understanding of replication organization in Eukarya. We found that active transcription is a driving force for the nucleosomal organization of the L. major genome and that both the spatial and the temporal program of DNA replication can be explained as associated to RNA polymerase kinetics. This simple scenario likely provides flexibility and robustness to deal with the environmental changes that impose alterations in the genetic programs during parasitic life cycle stages. Our findings also suggest that coupling replication initiation to transcription elongation could be an ancient solution used by eukaryotic cells for origin maintenance.

Development and Synthesis of DNA-Encoded Benzimidazole Library.

Science.gov (United States)

Ding, Yun; Chai, Jing; Centrella, Paolo A; Gondo, Chenaimwoyo; DeLorey, Jennifer L; Clark, Matthew A

2018-04-25

Encoded library technology (ELT) is an effective approach to the discovery of novel small-molecule ligands for biological targets. A key factor for the success of the technology is the chemical diversity of the libraries. Here we report the development of DNA-conjugated benzimidazoles. Using 4-fluoro-3-nitrobenzoic acid as a key synthon, we synthesized a 320 million-member DNA-encoded benzimidazole library using Fmoc-protected amino acids, amines and aldehydes as diversity elements. Affinity selection of the library led to the discovery of a novel, potent and specific antagonist of the NK3 receptor.

Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

International Nuclear Information System (INIS)

Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

1989-01-01

Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

Molecular characterization of a Leishmania donovani cDNA clone with similarity to human 20S proteasome a-type subunit

DEFF Research Database (Denmark)

Christensen, C B; Jørgensen, L; Jensen, A T

2000-01-01

Using plasma from patients infected or previously infected with Leishmania donovanii, we isolated a L. donovanii cDNA clone with similarity to the proteasome a-type subunit from humans and other eukaryotes. The cDNA clone, designated LePa, was DNA sequenced and Northern blot analysis of L....... donovanii poly(A(+))mRNA indicated the isolation of a full length cDNA clone with a transcript size of 1.9 kb. The expressed recombinant LePa fusion protein induced proliferation of peripheral blood mononuclear cells in one out of seven patients who had suffered from visceral leishmaniasis. Plasma from 16...

From genomes to vaccines: Leishmania as a model.

Science.gov (United States)

Almeida, Renata; Norrish, Alan; Levick, Mark; Vetrie, David; Freeman, Tom; Vilo, Jaak; Ivens, Alasdair; Lange, Uta; Stober, Carmel; McCann, Sharon; Blackwell, Jenefer M

2002-01-01

The 35 Mb genome of Leishmania should be sequenced by late 2002. It contains approximately 8500 genes that will probably translate into more than 10 000 proteins. In the laboratory we have been piloting strategies to try to harness the power of the genome-proteome for rapid screening of new vaccine candidate. To this end, microarray analysis of 1094 unique genes identified using an EST analysis of 2091 cDNA clones from spliced leader libraries prepared from different developmental stages of Leishmania has been employed. The plan was to identify amastigote-expressed genes that could be used in high-throughput DNA-vaccine screens to identify potential new vaccine candidates. Despite the lack of transcriptional regulation that polycistronic transcription in Leishmania dictates, the data provide evidence for a high level of post-transcriptional regulation of RNA abundance during the developmental cycle of promastigotes in culture and in lesion-derived amastigotes of Leishmania major. This has provided 147 candidates from the 1094 unique genes that are specifically upregulated in amastigotes and are being used in vaccine studies. Using DNA vaccination, it was demonstrated that pooling strategies can work to identify protective vaccines, but it was found that some potentially protective antigens are masked by other disease-exacerbatory antigens in the pool. A total of 100 new vaccine candidates are currently being tested separately and in pools to extend this analysis, and to facilitate retrospective bioinformatic analysis to develop predictive algorithms for sequences that constitute potentially protective antigens. We are also working with other members of the Leishmania Genome Network to determine whether RNA expression determined by microarray analyses parallels expression at the protein level. We believe we are making good progress in developing strategies that will allow rapid translation of the sequence of Leishmania into potential interventions for disease

Identification of a mammalian nuclear factor and human cDNA-encoded proteins that recognize DNA containing apurinic sites

International Nuclear Information System (INIS)

Lenz, J.; Okenquist, S.A.; LoSardo, J.E.; Hamilton, K.K.; Doetsch, P.W.

1990-01-01

Damage to DNA can have lethal or mutagenic consequences for cells unless it is detected and repaired by cellular proteins. Repair depends on the ability of cellular factors to distinguish the damaged sites. Electrophoretic binding assays were used to identify a factor from the nuclei of mammalian cells that bound to DNA containing apurinic sites. A binding assay based on the use of β-galactosidase fusion proteins was subsequently used to isolate recombinant clones of human cDNAs that encoded apurinic DNA-binding proteins. Two distinct human cDNAs were identified that encoded proteins that bound apurinic DNA preferentially over undamaged, methylated, or UV-irradiated DNA. These approaches may offer a general method for the detection of proteins that recognize various types of DNA damage and for the cloning of genes encoding such proteins

Implementation of digital image encryption algorithm using logistic function and DNA encoding

Science.gov (United States)

Suryadi, MT; Satria, Yudi; Fauzi, Muhammad

2018-03-01

Cryptography is a method to secure information that might be in form of digital image. Based on past research, in order to increase security level of chaos based encryption algorithm and DNA based encryption algorithm, encryption algorithm using logistic function and DNA encoding was proposed. Digital image encryption algorithm using logistic function and DNA encoding use DNA encoding to scramble the pixel values into DNA base and scramble it in DNA addition, DNA complement, and XOR operation. The logistic function in this algorithm used as random number generator needed in DNA complement and XOR operation. The result of the test show that the PSNR values of cipher images are 7.98-7.99 bits, the entropy values are close to 8, the histogram of cipher images are uniformly distributed and the correlation coefficient of cipher images are near 0. Thus, the cipher image can be decrypted perfectly and the encryption algorithm has good resistance to entropy attack and statistical attack.

Molecular screening of Leishmania spp. infection and bloodmeals in sandflies from a leishmaniasis focus in southwestern Turkey.

Science.gov (United States)

Karaku Ş, M; Pekağ Irba Ş, M; Demir, S; Eren, H; Töz, S; Özbel, Y

2017-06-01

Leishmaniasis is an arthropod-borne disease that affects approximately 2 million people worldwide annually. The aims of this study were to detect the presence of Leishmania (Kinetoplastida: Trypanosomatidae) DNA and the feeding preferences of probable vector species in an endemic focus of Leishmania infantum in Turkey. Entomological sampling was performed in August and October 2015 in Aydın province, where cases of human and canine leishmaniasis have been reported previously. A total of 1059 sandfly specimens comprising nine species belonging to two genera, Phlebotomus and Sergentomyia (both: Diptera: Psychodidae), and five subgenera of the Phlebotomus genus (Phlebotomus, Paraphlebotomus, Larroussius, Adlerius and Transphlebotomus) were collected in five villages. Among all Phlebotomus specimens, Phlebotomus neglectus (39%) was noted as the most abundant species, followed by Phlebotomus tobbi (18%). Leishmania DNA was detected in pools from P. neglectus, P. tobbi and Sergentomyia dentata by kDNA polymerase chain reaction (PCR). Leishmania DNA from Phlebotomus specimens was identified as L. infantum, but Leishmania DNA from Sergentomyia spp. could not be identified to species level by ITS-1 real-time PCR. The detection of Leishmania DNA in wild-caught P. neglectus and the high percentage (24.2%) of human DNA in engorged specimens suggests that P. neglectus is probably an important vector species for L. infantum in Aydın province. © 2016 The Royal Entomological Society.

Molecular identification of Leishmania species in Taybad district, Iran

Directory of Open Access Journals (Sweden)

Salehi Ghodratollah

2014-09-01

Full Text Available Objective: To identify Leishmania species in patients with cutaneous leishmaniasis in the city of Taybad in Razavi Khorasan Province from April 2012 to March 2013. Methods: Among 52 persons who referred to Health Center of Taybad with suspected skin lesions, stained slide smears of 35 patients showed positive result for Leishmania. Also polymerase chain reaction assay performed using specific kDNA primers. Data of patients were analyzed with SPSS. Results: Of 35 positive smears for Leishmania, 21 (60% belonged to males and 14 (40% belonged to females. Polymerase chain reaction bands were observed in all 35 samples of which 31 (88.6% samples showed Leishmania tropica and 4 (11.4% showed Leishmania major. The highest infected age group was 11-20 years old. Conclusions: Both anthroponotic cutaneous leishmaniasis and zoonotic cutaneous leishmaniasis are present in Taybad. Leishmania tropica is the dominant causative species for anthroponotic cutaneous leishmaniasis. Further study is recommended to discover probable reservoir and vector for Leishmania major in Taybad.

Molecular detection of Leishmania infection due to Leishmania major and Leishmania turanica in the vectors and reservoir host in Iran.

Science.gov (United States)

Rassi, Yavar; Oshaghi, Mohammad Ali; Azani, Sadegh Mohammadi; Abaie, Mohammad Reza; Rafizadeh, Sina; Mohebai, Mehdi; Mohtarami, Fatemeh; Zeinali, Mohammad kazem

2011-02-01

An epidemiological study was carried out on the vectors and reservoirs of cutaneous leishmaniasis in rural areas of Damghan district, Semnan province, central Iran, during 2008-2009. Totally, 6110 sand flies were collected using sticky papers and were subjected to molecular methods for detection of Leishmania parasite. Phlebotomus papatasi Scopoli was the common species in outdoor and indoor resting places. Polymerase chain reaction technique showed that 24 out of 218 P. papatasi (11%) and 4 out of 62 Phlebotomus caucasicus Marzinovskyi (6.5%) were positive for parasites Leishmania major Yakimoff and Schokhor. Twenty-one rodent reservoir hosts captured using Sherman traps were identified as Rhombomys opimus Lichtenstein (95%) and Meriones libycus Lichtenstein (5%). Microscopic investigation on blood smear of the animals for amastigote parasites revealed 8 (40%) rodents infected with R. opimus. L. major infection in these animals was then confirmed by polymerase chain reaction against internal transcribed spacer ribosomal DNA (rDNA) loci of the parasite followed by restriction fragment length polymorphism. Further, sequence analysis of 297 bp of ITS1-rDNA loci revealed the presence of L. major and Leishmania turanica in P. papatasi, and L. major in R. opimus. This is the first molecular report of L. major infection in both vectors (P. papatasi and P. caucasicus) and reservoir host (R. opimus) in this region. The results indicated that P. papatas was the primary vector of the disease and circulating the parasite between human and reservoirs, and P. caucasicus could be considered as a secondary vector. Further, our study showed that R. opimus is the most important host reservoir for maintenance of the parasite source in the area.

A Novel Image Encryption Algorithm Based on DNA Encoding and Spatiotemporal Chaos

Directory of Open Access Journals (Sweden)

Chunyan Song

2015-10-01

Full Text Available DNA computing based image encryption is a new, promising field. In this paper, we propose a novel image encryption scheme based on DNA encoding and spatiotemporal chaos. In particular, after the plain image is primarily diffused with the bitwise Exclusive-OR operation, the DNA mapping rule is introduced to encode the diffused image. In order to enhance the encryption, the spatiotemporal chaotic system is used to confuse the rows and columns of the DNA encoded image. The experiments demonstrate that the proposed encryption algorithm is of high key sensitivity and large key space, and it can resist brute-force attack, entropy attack, differential attack, chosen-plaintext attack, known-plaintext attack and statistical attack.

Amplified DNAs in laboratory stocks of Leishmania tarentolae: extrachromosomal circles structurally and functionally similar to the inverted-H-region amplification of methotrexate-resistant Leishmania major

International Nuclear Information System (INIS)

Petrillo-Peixoto, M.L.; Beverley, S.M.

1988-01-01

We describe the structure of amplified DNA that was discovered in two laboratory stocks of the protozoan parasite Leishmania tarentolae. Restriction mapping and molecular cloning revealed that a region of 42 kilobases was amplified 8- to 30-fold in these lines. Southern blot analyses of digested DNAs or chromosomes separated by pulsed-field electrophoresis showed that the amplified DNA corresponded to the H region, a locus defined originally by its amplification in methotrexate-resistant Leishmania major. Similarities between the amplified DNA of the two species included (i) extensive cross-hybridization; (ii) approximate conservation of sequence order; (iii) extrachromosomal localization; (iv) an overall inverted, head-to-head configuration as a circular 140-kilobase tetrameric molecule; (v) two regions of DNA sequence rearrangement, each of which was closely associated with the two centers of the inverted repeats; (vi) association with methotrexate resistance; and (vii) phenotypically conservative amplification, in which the wild-type chromosomal arrangement was retained without apparent modification. Our data showed that amplified DNA mediating drug resistance arose in unselected L. tarentolae, although the pressures leading to apparently spontaneous amplification and maintenance of the H region are not known. The simple structure and limited extent of DNA amplified in these and other Leishmania lines suggests that the study of gene amplification in Leishmania spp. offers an attractive model system for the study of amplification in cultured mammalian cells and tumors. We also introduced a method for measuring the size of large circular DNAs, using gamma-irradiation to introduce limited double-strand breaks followed by sizing of the linear DNAs by pulsed-field electrophoresis

Association between Leishmania infantum DNA in the hair of dogs and their infectiousness to Lutzomyia longipalpis.

Science.gov (United States)

de Sousa Gonçalves, Rafaela; Franke, Carlos R; Magalhães-Junior, Jairo T; Souza, Bárbara M P S; Solcà, Manuela S; Larangeira, Daniela F; Barrouin-Melo, Stella Maria

2016-12-15

Diagnosis of infection with Leishmania infantum by DNA detection in the hair has been recently demonstrated in dogs and wild animals. Our objective was to investigate if polymerase chain reaction (PCR) in hair might be used to identify infectious dogs. Thus, we assessed the infectiousness to Lutzomyia longipalpis by xenodiagnosis in comparison with the detection of L. infantum DNA by PCR in the hair, and with serology for anti-Leishmania IgG by ELISA in 15 positive dogs for L. infantum infection. Eight healthy dogs were included as negative controls. Among the 15 infected dogs, 13 were found positive in the ELISA (87%), 12 were PCR positive in the hair (80%), and 10 were positive in xenodiagnosis (67%). Positivity in the hair was associated with positivity in spleen (p=0.0003), seropositivity for antibodies (p=0.0006) and parasite transmission to L. longipalpis (p=0.0028). Considering the benefits to animal welfare and feasibility of hair sampling method, studies in larger and more diverse populations of naturally infected dogs from endemic areas should be conducted to evaluate the sensitivity, specificity, and predictive values of PCR using hair as a possible biomarker of infectiousness in dogs. Copyright © 2016 Elsevier B.V. All rights reserved.

Ecological aspects and molecular detection of Leishmania DNA Ross (Kinetoplastida: Trypanosomatidae) in phlebotomine sandflies (Diptera: Psychodidae) in terra firme and várzea environments in the Middle Solimões Region, Amazonas State, Brazil.

Science.gov (United States)

Pereira Júnior, Antonio Marques; Teles, Carolina Bioni Garcia; de Azevedo dos Santos, Ana Paula; de Souza Rodrigues, Moreno; Marialva, Eric Fabrício; Pessoa, Felipe Arley Costa; Medeiros, Jansen Fernandes

2015-03-25

Phlebotomine sand flies (Diptera: Psychodidae) are insects of medical importance due to the role that some species play in the transmission of leishmaniasis. This work aimed to study some ecological aspects among sand flies fauna inhabiting two different environments: the várzea (lowland Amazonian forest) and terra firme (upland Amazonian forest), both located in Tefé Municipality, Amazonas State, Braziland to detect Leishmania infection in those phlebotomine populations. Sand flies were collected using HP light traps. Collection took place over the course of six months: January, February, April, August, September, and October of 2013. To detect natural infection by Leishmania, DNA samples were extracted from female sand flies and submitted to Polymerase Chain Reaction (PCR) targeting the kDNA gene; Leishmania species were identified by PCR-RFLP targeting the hsp70 gene and genetic sequencing. In all, 5,716 individuals were collected, and 46 species were identified. Trichophoromyia ubiquitalis (3,330 - 58.26%) and Nyssomyia antunesi (661 - 11.26%) were the most abundant species. Species richness was greater in terra firme environments (42 species) than in the várzea environments (22 species), and forests ecotopes (43 species) were richer than peridomiciles (28 species). DNA of Leishmania was found in Th. ubiquitalis and Psychodopygus davisi, both of which inhabit the terra firme environment and sequencing analysis confirmed the presence of Leishmania (Viannia) lainsoni DNA in Th. ubiquitalis in Tefé Municipality. The high abundance of Th. ubiquitalis and Ps. davisi and detection of DNA of Leishmania sp. may indicate that both species could be putative vectors for American Cutaneous Leishmaniasis (ACL) in the terra firme environment of Tefé. The sand fly fauna found in várzea is rich and diverse, exhibiting several species, nevertheless the seasonal hydric stress during part of the year that could influence the local diversity, if compared with other studies

Experimental treatment with sodium stibogluconate of hamsters infected with Leishmania (Leishmania) chagasi and Leishmania (Leishmania) amazonensis Tratamento experimental com stibogluconato de sódio em hamsters infectados com Leishmania (Leishmania) chagasi e Leishmania (Leishmania) amazonensis

OpenAIRE

Elizabeth M. de Figueiredo; Jaime Costa e Silva; Reginaldo P. Brazil

1999-01-01

The present paper reports the experimental treatment of hamsters infected with Leishmania chagasi and Leishmania amazonensis with sodium stibogluconate (20mg/kg/day x 20 days). Only with L. chagasi did the treatment result in the complete elimination of parasites from the spleen. However, no parasitological cure was achieved in hamsters infected with L. amazonensis.O presente trabalho é um relato do tratamento experimental de hamsters infectado com Leishmania chagasi e Leishmania amazonensis ...

Molecular cloning of growth hormone encoding cDNA of Indian

Indian Academy of Sciences (India)

A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

Molecular detection of Leishmania infantum and Leishmania tropica in rodent species from endemic cutaneous leishmaniasis areas in Morocco.

Science.gov (United States)

Echchakery, Mohamed; Chicharro, Carmen; Boussaa, Samia; Nieto, Javier; Carrillo, Eugenia; Sheila, Ortega; Moreno, Javier; Boumezzough, Ali

2017-10-02

Leishmaniasis remains a major public health problem in African nations, including Morocco, where little is known about the vertebrate reservoirs involved in the causal parasites' transmission cycles. The present study investigates the role of rodent species as potential reservoirs of Leishmania spp. in central Morocco, where both L. tropica and L. infantum have been reported. Rodents were caught from 22 sites in central Morocco, by using Sherman metal traps, and identified morphologically. For each specimen, genomic DNA was extracted from different tissues using the Speed Tools DNA extraction Kit. Then, samples were PCR-analyzed, targeting the SSU rRNA gene to detect Leishmania spp. DNA, followed by amplification of the internal transcribed spacer 1 (ITS1) and its sequencing to identify the species. A total of 197 rodents belonging to ten species were captured and identified: Rattus rattus (40.61%), Mus musculus (25.38%), Apodemus sylvaticus (8.63%), Mus spretus (7.11%), Meriones shawi (5.58%), Rattus norvegicus (4.57%), Meriones libycus (3.05%), Mastomys erythroleucus (2.03%), Gerbillus campestris (2.03%) and Lemniscomys barbarus (1.01%). Molecular analysis revealed the presence of Leishmania species in 18 specimens: six R. rattus (out of 80 captured; 7.5%), 11 M. musculus (out of 50 captured; 22%), and one R. norvegicus (out of 9 captured; 11.11%). To the best of our knowledge, L. infantum and L. tropica were identified in rodent species for the first time in Morocco. These findings suggest that rodent species may be involved in L. infantum and L. tropica transmission cycles in this country but that further studies are needed to confirm their role as reservoirs of Leishmania species in Morocco.

Novel features of a PIWI-like protein homolog in the parasitic protozoan Leishmania.

Directory of Open Access Journals (Sweden)

Prasad K Padmanabhan

Full Text Available In contrast to nearly all eukaryotes, the Old World Leishmania species L. infantum and L. major lack the bona fide RNAi machinery genes. Interestingly, both Leishmania genomes code for an atypical Argonaute-like protein that possesses a PIWI domain but lacks the PAZ domain found in Argonautes from RNAi proficient organisms. Using sub-cellular fractionation and confocal fluorescence microscopy, we show that unlike other eukaryotes, the PIWI-like protein is mainly localized in the single mitochondrion in Leishmania. To predict PIWI function, we generated a knockout mutant for the PIWI gene in both L. infantum (Lin and L. major species by double-targeted gene replacement. Depletion of PIWI has no effect on the viability of insect promastigote forms but leads to an important growth defect of the mammalian amastigote lifestage in vitro and significantly delays disease pathology in mice, consistent with a higher expression of the PIWI transcript in amastigotes. Moreover, amastigotes lacking PIWI display a higher sensitivity to apoptosis inducing agents than wild type parasites, suggesting that PIWI may be a sensor for apoptotic stimuli. Furthermore, a whole-genome DNA microarray analysis revealed that loss of LinPIWI in Leishmania amastigotes affects mostly the expression of specific subsets of developmentally regulated genes. Several transcripts encoding surface and membrane-bound proteins were found downregulated in the LinPIWI((-/- mutant whereas all histone transcripts were upregulated in the null mutant, supporting the possibility that PIWI plays a direct or indirect role in the stability of these transcripts. Although our data suggest that PIWI is not involved in the biogenesis or the stability of small noncoding RNAs, additional studies are required to gain further insights into the role of this protein on RNA regulation and amastigote development in Leishmania.

Phylogenetic position of Leishmania isolates from Khyber Pakhtunkhwa province of Pakistan.

Science.gov (United States)

Khan, Nazma Habib; Messenger, Louisa A; Wahid, Sobia; Sutherland, Colin J

2016-08-01

Several species of the genus Leishmania are causative agents of cutaneous leishmaniasis in Pakistan. This study aimed to determine phylogenetic placement of Leishmania species causing cutaneous leishmaniasis in Khyber Pakhtunkhwa province, Pakistan (34 Leishmania tropica, 3 Leishmania infantum), in-relation to species from other geographical areas using gene sequences encoding cytochrome b (cytb) and internal transcribed spacer 2 (its2). Based on cytochrome b sequence analysis, L. tropica strains from Pakistan and other geographical regions were differentiated into two genotype groups, A and B. Within the province, five distinct L. tropica genotypes were recognized; two in group A, three in group B. Two L. infantum isolates from the province were closely associated with both Afro-Eurasian and American species of the Leishmania donovani complex, including Leishmania chagasi, L. infantum and L. donovani from Sudan and Ethiopia; while a third L. infantum isolate could not be differentiated from visceralizing Kenyan and Indian L. donovani. We observed apposite phylogenetic placement of CL-causing L. tropica and L. infantum from Khyber Pakhtunkhwa. Affinities ascribed to Leishmania spp. From the region are valuable in tracing potential importation of leishmaniasis. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

Science.gov (United States)

Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

2018-06-27

DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

The midgut transcriptome of Lutzomyia longipalpis: comparative analysis of cDNA libraries from sugar-fed, blood-fed, post-digested and Leishmania infantum chagasi-infected sand flies

Directory of Open Access Journals (Sweden)

Elnaiem Dia-Eldin

2008-01-01

Full Text Available Abstract Background In the life cycle of Leishmania within the alimentary canal of sand flies the parasites have to survive the hostile environment of blood meal digestion, escape the blood bolus and attach to the midgut epithelium before differentiating into the infective metacyclic stages. The molecular interactions between the Leishmania parasites and the gut of the sand fly are poorly understood. In the present work we sequenced five cDNA libraries constructed from midgut tissue from the sand fly Lutzomyia longipalpis and analyzed the transcripts present following sugar feeding, blood feeding and after the blood meal has been processed and excreted, both in the presence and absence of Leishmania infantum chagasi. Results Comparative analysis of the transcripts from sugar-fed and blood-fed cDNA libraries resulted in the identification of transcripts differentially expressed during blood feeding. This included upregulated transcripts such as four distinct microvillar-like proteins (LuloMVP1, 2, 4 and 5, two peritrophin like proteins, a trypsin like protein (Lltryp1, two chymotrypsin like proteins (LuloChym1A and 2 and an unknown protein. Downregulated transcripts by blood feeding were a microvillar-like protein (LuloMVP3, a trypsin like protein (Lltryp2 and an astacin-like metalloprotease (LuloAstacin. Furthermore, a comparative analysis between blood-fed and Leishmania infected midgut cDNA libraries resulted in the identification of the transcripts that were differentially expressed due to the presence of Leishmania in the gut of the sand fly. This included down regulated transcripts such as four microvillar-like proteins (LuloMVP1,2, 4 and 5, a Chymotrypsin (LuloChym1A and a carboxypeptidase (LuloCpepA1, among others. Upregulated midgut transcripts in the presence of Leishmania were a peritrophin like protein (LuloPer1, a trypsin-like protein (Lltryp2 and an unknown protein. Conclusion This transcriptome analysis represents the largest set

Understanding serine proteases implications on Leishmania spp lifecycle.

Science.gov (United States)

Alves, Carlos Roberto; Souza, Raquel Santos de; Charret, Karen Dos Santos; Côrtes, Luzia Monteiro de Castro; Sá-Silva, Matheus Pereira de; Barral-Veloso, Laura; Oliveira, Luiz Filipe Gonçalves; da Silva, Franklin Souza

2018-01-01

Serine proteases have significant functions over a broad range of relevant biological processes to the Leishmania spp lifecycle. Data gathered here present an update on the Leishmania spp serine proteases and the status of these enzymes as part of the parasite degradome. The serine protease genes (n = 26 to 28) in Leishmania spp, which encode proteins with a wide range of molecular masses (35 kDa-115 kDa), are described along with their degrees of chromosomal and allelic synteny. Amid 17 putative Leishmania spp serine proteases, only ∼18% were experimentally demonstrated, as: signal peptidases that remove the signal peptide from secretory pre-proteins, maturases of other proteins and with metacaspase-like activity. These enzymes include those of clans SB, SC and SF. Classical inhibitors of serine proteases are used as tools for the characterization and investigation of Leishmania spp. Endogenous serine protease inhibitors, which are ecotin-like, can act modulating host actions. However, crude or synthetic based-natural serine protease inhibitors, such as potato tuber extract, Stichodactyla helianthus protease inhibitor I, fukugetin and epoxy-α-lapachone act on parasitic serine proteases and are promising leishmanicidal agents. The functional interrelationship between serine proteases and other Leishmania spp proteins demonstrate essential functions of these enzymes in parasite physiology and therefore their value as targets for leishmaniasis treatment. Copyright © 2017 Elsevier Inc. All rights reserved.

Diversity patterns, Leishmania DNA detection, and bloodmeal identification of Phlebotominae sand flies in villages in northern Colombia.

Science.gov (United States)

González, Camila; León, Cielo; Paz, Andrea; López, Marla; Molina, Gisell; Toro, Diana; Ortiz, Mario; Cordovez, Juan Manuel; Atencia, María Claudia; Aguilera, Germán; Tovar, Catalina

2018-01-01

Leishmaniases are neglected tropical diseases exhibiting complex transmission cycles due to the number of parasite species circulating, sand fly species acting as vectors and infected mammals, including humans, which are defined in the New World as accidental hosts. However, current transmission scenarios are changing, and the disease is no longer exclusively related to forested areas but urban transmission foci occur, involving some species of domestic animals as suspected reservoirs. The aim of this study was to determine the transmission cycles in urban environments by evaluating sand fly diversity, detection of Leishmania DNA, and bloodmeal sources through intra and peridomestic collections. The study was carried out in Colombia, in 13 municipalities of Cordoba department, implementing a methodology that could be further used for the evaluation of vector-borne diseases in villages or towns. Our sampling design included 24 houses randomly selected in each of 15 villages distributed in 13 municipalities, which were sampled in two seasons in 2015 and 2016. Sand flies were collected using CDC light traps placed in intra and peridomestic habitats. In addition to the morphological identification, molecular identification through DNA barcodes was also performed. A total of 19,743 sand flies were collected and 13,848 of them (10,268 females and 3,580 males) were used in molecular procedures. Circulation of two known parasite species-Leishmania infantum and Leishmania panamensis was confirmed. Blood source analyses showed that sand flies fed on humans, particularly in the case of the known L. infantum vector, P. evansi; further analyses are advised to evaluate the reservoirs involved in parasite transmission. Our sampling design allowed us to evaluate potential transmission cycles on a department scale, by defining suspected vector species, parasite species present in different municipalities and feeding habits.

Genome-wide mapping reveals single-origin chromosome replication in Leishmania, a eukaryotic microbe.

Science.gov (United States)

Marques, Catarina A; Dickens, Nicholas J; Paape, Daniel; Campbell, Samantha J; McCulloch, Richard

2015-10-19

DNA replication initiates on defined genome sites, termed origins. Origin usage appears to follow common rules in the eukaryotic organisms examined to date: all chromosomes are replicated from multiple origins, which display variations in firing efficiency and are selected from a larger pool of potential origins. To ask if these features of DNA replication are true of all eukaryotes, we describe genome-wide origin mapping in the parasite Leishmania. Origin mapping in Leishmania suggests a striking divergence in origin usage relative to characterized eukaryotes, since each chromosome appears to be replicated from a single origin. By comparing two species of Leishmania, we find evidence that such origin singularity is maintained in the face of chromosome fusion or fission events during evolution. Mapping Leishmania origins suggests that all origins fire with equal efficiency, and that the genomic sites occupied by origins differ from related non-origins sites. Finally, we provide evidence that origin location in Leishmania displays striking conservation with Trypanosoma brucei, despite the latter parasite replicating its chromosomes from multiple, variable strength origins. The demonstration of chromosome replication for a single origin in Leishmania, a microbial eukaryote, has implications for the evolution of origin multiplicity and associated controls, and may explain the pervasive aneuploidy that characterizes Leishmania chromosome architecture.

Calcein+/PI- as an early apoptotic feature in Leishmania.

Directory of Open Access Journals (Sweden)

Louise Basmaciyan

Full Text Available Although leishmaniases are responsible for high morbidity and mortality all over the world, no really satisfying treatment exists. Furthermore, the corresponding parasite Leishmania undergoes a very characteristic form of programmed cell death. Indeed, different stimuli can induce morphological and biochemical apoptotic-like features. However, the key proteins involved in mammal apoptosis, such as caspases and death receptors, are not encoded in the genome of this parasite. Currently, little is known about Leishmania apoptosis, notably owing to the lack of specific tools for programmed cell death analysis in these parasites. Furthermore, there is a need for a better understanding of Leishmania programmed cell death in order (i to better understand the role of apoptosis in unicellular organisms, (ii to better understand apoptosis in general through the study of an ancestral eukaryote, and (iii to identify new therapeutic targets against leishmaniases. To advance understanding of apoptosis in Leishmania, in this study we developed a new tool based on the quantification of calcein and propidium iodide by flow cytometry. This double labeling can be employed to distinguish early apoptosis, late apoptosis and necrosis in Leishmania live cells with a very simple and rapid assay. This paper should, therefore, be of interest for people working on Leishmania and related parasites.

Calcein+/PI- as an early apoptotic feature in Leishmania.

Science.gov (United States)

Basmaciyan, Louise; Azas, Nadine; Casanova, Magali

2017-01-01

Although leishmaniases are responsible for high morbidity and mortality all over the world, no really satisfying treatment exists. Furthermore, the corresponding parasite Leishmania undergoes a very characteristic form of programmed cell death. Indeed, different stimuli can induce morphological and biochemical apoptotic-like features. However, the key proteins involved in mammal apoptosis, such as caspases and death receptors, are not encoded in the genome of this parasite. Currently, little is known about Leishmania apoptosis, notably owing to the lack of specific tools for programmed cell death analysis in these parasites. Furthermore, there is a need for a better understanding of Leishmania programmed cell death in order (i) to better understand the role of apoptosis in unicellular organisms, (ii) to better understand apoptosis in general through the study of an ancestral eukaryote, and (iii) to identify new therapeutic targets against leishmaniases. To advance understanding of apoptosis in Leishmania, in this study we developed a new tool based on the quantification of calcein and propidium iodide by flow cytometry. This double labeling can be employed to distinguish early apoptosis, late apoptosis and necrosis in Leishmania live cells with a very simple and rapid assay. This paper should, therefore, be of interest for people working on Leishmania and related parasites.

Nuclear DNA polymerase beta from Leishmania infantum. Cloning, molecular analysis and developmental regulation

Science.gov (United States)

Taladriz, Soraya; Hanke, Tobias; Ramiro, María J.; García-Díaz, Miguel; Lacoba, Mario García de; Blanco, Luis; Larraga, Vicente

2001-01-01

We have identified a novel polymerase beta (Pol β)-like enzyme from Leishmania infantum, a parasite protozoon causing disease in humans. This protein, named Li Pol β, shows a nuclear localization that contrasts with the mitochondrial localization of Pol β from Crithidia fasciculata, a closely related parasite, the only polymerase β described so far in Trypanosomatidae. Li Pol β, that belongs to the DNA polymerase X family, displays an evolutionarily conserved Pol β-type DNA polymerase core, in which most of the key residues involved in DNA binding, nucleotide binding, dRPase and polymerization catalysis are conserved. In agreement with this, Li Pol β, overproduced in Escherichia coli, displayed intrinsic DNA polymerase activity. Cell synchronization experiments showed a correlation between both Li Pol β mRNA and protein levels along the parasite cell cycle. Analysis of these parameters at the different growth phases of the parasite, from the proliferative (non-infective) logarithmic phase to the non-dividing (highly infectious) stationary phase, showed high levels of Li Pol β at the infective phase of the parasite. The data suggest a role of Li Pol β in base excision repair in L.infantum, a parasite usually affected by oxygen stress environments into the macrophage host cells. PMID:11557814

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

Science.gov (United States)

Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

2014-04-15

DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

Assessment of PCR in the detection of Leishmania spp in experimentally infected individual phlebotomine sandflies (Diptera: Psychodidae: Phlebotominae

Directory of Open Access Journals (Sweden)

MICHALSKY Érika M.

2002-01-01

Full Text Available DNA amplification by the polymerase chain reaction (PCR was applied in the investigation of the presence of Leishmania (Kinetoplastida: Trypanosomatidae parasites in single phlebotomine sandflies. Three phlebotomine/parasite pairs were used: Lutzomyia longipalpis/Leishmania chagasi, Lutzomyia migonei/Leishmania amazonensis and Lutzomyia migonei/Leishmania braziliensis, all of them incriminated in the transmission of visceral or cutaneous leishmaniasis. DNA extraction was performed with whole insects, with no need of previous digestive tract dissection or pooling specimens. The presence of either mouse blood in the digestive tract of the sandflies or the digestive tract itself did not interfere in the PCR. Infection by as few as 10 Leishmania sp. per individual were sufficient for DNA amplification with genus-specific primers. Using primers for L. braziliensis and L. mexicana complexes, respectively, it was possible to discriminate between L. braziliensis and L. amazonensis in experimentally infected vectors (L. migonei.

Horse cDNA clones encoding two MHC class I genes

Energy Technology Data Exchange (ETDEWEB)

Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Cloning of Salmonella typhimurium DNA encoding mutagenic DNA repair

International Nuclear Information System (INIS)

Thomas, S.M.; Sedgwick, S.G.

1989-01-01

Mutagenic DNA repair in Escherichia coli is encoded by the umuDC operon. Salmonella typhimurium DNA which has homology with E. coli umuC and is able to complement E. coli umuC122::Tn5 and umuC36 mutations has been cloned. Complementation of umuD44 mutants and hybridization with E. coli umuD also occurred, but these activities were much weaker than with umuC. Restriction enzyme mapping indicated that the composition of the cloned fragment is different from the E. coli umuDC operon. Therefore, a umu-like function of S. typhimurium has been found; the phenotype of this function is weaker than that of its E. coli counterpart, which is consistent with the weak mutagenic response of S. typhimurium to UV compared with the response in E. coli

The activity of azithromycin against Leishmania (Viannia) braziliensis and Leishmania (Leishmania) amazonensis in the golden hamster model

OpenAIRE

Sinagra,Ángel; Luna,Concepción; Abraham,David; Iannella,Maria del Carmen; Riarte,Adelina; Krolewiecki,Alejandro J.

2007-01-01

New therapeutic alternatives against leishmaniasis remain a priority. The activity of azithromycin against Leishmania (Leishmania) major has been previously demonstrated. Different responses among species of Leishmania make species-specific drug screening necessary. The activity of azithromycin against Leishmania (Viannia) braziliensis and Leishmania (Leishmania) amazonensis was evaluated in golden hamsters infected through footpad injections of metacyclic promastigotes, and compared with unt...

Rattus norvegicus (Rodentia: Muridae Infected by Leishmania (Leishmania infantum (syn. Le. chagasi in Brazil

Directory of Open Access Journals (Sweden)

Fabiana de Oliveira Lara-Silva

2014-01-01

Full Text Available In the present study we surveyed the fauna of phlebotomine sand flies and small mammals in peridomestic areas from a Brazilian municipality where the American cutaneous leishmaniasis (ACL is endemic. A total of 608 female phlebotomine sand flies were captured during nine months in 2009 and 2010. Seven different species were represented with 60% of them being Lutzomyia intermedia and Lu. whitmani, both incriminated vectors of ACL. Lu. longipalpis, a proven vector of visceral leishmaniasis (VL was also captured at high proportion (12.8%. Genomic DNA analysis of 136 species-specific pools of female sand flies followed by molecular genotyping showed the presence of Leishmania infantum DNA in two pools of Lu. longipalpis. The same Leishmania species was found in one blood sample from Rattus norvegicus among 119 blood and tissue samples analysed. This is the first report of Le. infantum in R. norvegicus in the Americas and suggests a possible role for this rodent species in the zoonotic cycle of VL. Our study coincided with the reemergence of VL in Governador Valadares.

Detection of Leishmania donovani and L. tropica in ethiopian wild rodents

Czech Academy of Sciences Publication Activity Database

Kassahun, A.; Sádlová, J.; Dvořák, V.; Košťálová, T.; Rohoušová, I.; Frynta, D.; Aghová, Tatiana; Yasur-Landau, D.; Lemma, W.; Hailu, A.; Baneth, G.; Warburg, A.; Volf, P.; Votýpka, J.

2015-01-01

Roč. 145, May 2015 (2015), s. 39-44 ISSN 0001-706X R&D Projects: GA ČR GAP506/10/0983 EU Projects: European Commission(XE) 261504 - EDENEXT Institutional support: RVO:68081766 Keywords : Leishmania donovani * Leishmania tropica * Phlebotomine sand fly * Rodents * kDNA * ITS1 Subject RIV: EG - Zoology Impact factor: 2.380, year: 2015

Leishmania infections: Molecular targets and diagnosis.

Science.gov (United States)

Akhoundi, Mohammad; Downing, Tim; Votýpka, Jan; Kuhls, Katrin; Lukeš, Julius; Cannet, Arnaud; Ravel, Christophe; Marty, Pierre; Delaunay, Pascal; Kasbari, Mohamed; Granouillac, Bruno; Gradoni, Luigi; Sereno, Denis

2017-10-01

Progress in the diagnosis of leishmaniases depends on the development of effective methods and the discovery of suitable biomarkers. We propose firstly an update classification of Leishmania species and their synonymies. We demonstrate a global map highlighting the geography of known endemic Leishmania species pathogenic to humans. We summarize a complete list of techniques currently in use and discuss their advantages and limitations. The available data highlights the benefits of molecular markers in terms of their sensitivity and specificity to quantify variation from the subgeneric level to species complexes, (sub) species within complexes, and individual populations and infection foci. Each DNA-based detection method is supplied with a comprehensive description of markers and primers and proposal for a classification based on the role of each target and primer in the detection, identification and quantification of leishmaniasis infection. We outline a genome-wide map of genes informative for diagnosis that have been used for Leishmania genotyping. Furthermore, we propose a classification method based on the suitability of well-studied molecular markers for typing the 21 known Leishmania species pathogenic to humans. This can be applied to newly discovered species and to hybrid strains originating from inter-species crosses. Developing more effective and sensitive diagnostic methods and biomarkers is vital for enhancing Leishmania infection control programs. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

A atividade da azitromicina contra a Leishmania (Viannia) braziliensis e a Leishmania (Leishmania) amazonensis no modelo golden hamster

OpenAIRE

Sinagra, Ángel; Luna, Concepción; Abraham, David; Iannella, Maria del Carmen; Riarte, Adelina; Krolewiecki, Alejandro J.

2007-01-01

New therapeutic alternatives against leishmaniasis remain a priority. The activity of azithromycin against Leishmania (Leishmania) major has been previously demonstrated. Different responses among species of Leishmania make species-specific drug screening necessary. The activity of azithromycin against Leishmania (Viannia) braziliensis and Leishmania (Leishmania) amazonensis was evaluated in golden hamsters infected through footpad injections of metacyclic promastigotes, and compared with unt...

Cloning, sequencing and expression of cDNA encoding growth ...

Indian Academy of Sciences (India)

Unknown

of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

The prevalence of canine Leishmania infantum infection in western China detected by PCR and serological tests

Directory of Open Access Journals (Sweden)

Chen Hai-Tang

2011-05-01

Full Text Available Abstract Background Canine leishmaniasis (CanL is endemic in western China, resulting in important public health problem. It is essential to evaluate the prevalence of canine Leishmania infantum infection for designing control policy. In the present study we report for the first time prevalence of Leishmania infection in dogs living in Jiuzhaigou County (Sichuan Provence, China, which is not only an important endemic area of CanL but also a tourism scenic spot, detected by PCR, ELISA and dipstick test. The results could provide key information for designing control programs against canine and human leishmaniasis. In addition, the complete sequence of the Leishmania isolate from Sichuan Province has not been reported to date and we present the sequences of 116 base-pair (bp fragment of the conserved region in the minicircle kinetoplast DNA (kDNA and the results of phylogenetic analyses based on the sequence of the amplified fragment. Results The proportion of dogs infected with Leishmania in Jiuzhaigou County was 36.79%, 9.43%, and 51.88% detected by ELISA, dipstick test, and PCR, respectively. The ELISA and PCR tests were more sensitive than dipstick test. The PCR method is the most sensitive way to detect dogs infected with Leishmania parasites. The total positive rate for infected dogs in the area was 59.43% by the three methods. The PCR products of 116-bp fragment amplified from the kDNA conserved region of dog blood samples and laboratory maintained L. infantum were DNA sequenced and the variation of the sequences was observed. The phylogenetic tree based on the sequences of 116-bp fragment reveals that L. infantum is more genetically related to visceralizing species L. donovani than to the Leishmania species associated with cutaneous disease. Conclusions More than half of dogs living in the endemic Jiuzhaigou County were infected by L. infantum. Control measures, such as treatment or eradication of infected dogs, or prohibition of

Nuclear DNA replication and repair in parasites of the genus Leishmania: Exploiting differences to develop innovative therapeutic approaches.

Science.gov (United States)

Uzcanga, Graciela; Lara, Eliana; Gutiérrez, Fernanda; Beaty, Doyle; Beske, Timo; Teran, Rommy; Navarro, Juan-Carlos; Pasero, Philippe; Benítez, Washington; Poveda, Ana

2017-03-01

Leishmaniasis is a common tropical disease that affects mainly poor people in underdeveloped and developing countries. This largely neglected infection is caused by Leishmania spp, a parasite from the Trypanosomatidae family. This parasitic disease has different clinical manifestations, ranging from localized cutaneous to more harmful visceral forms. The main limitations of the current treatments are their high cost, toxicity, lack of specificity, and long duration. Efforts to improve treatments are necessary to deal with this infectious disease. Many approved drugs to combat diseases as diverse as cancer, bacterial, or viral infections take advantage of specific features of the causing agent or of the disease. Recent evidence indicates that the specific characteristics of the Trypanosomatidae replication and repair machineries could be used as possible targets for the development of new treatments. Here, we review in detail the molecular mechanisms of DNA replication and repair regulation in trypanosomatids of the genus Leishmania and the drugs that could be useful against this disease.

Detection of Leishmania spp. in Bats from an Area of Brazil Endemic for Visceral Leishmaniasis.

Science.gov (United States)

de Rezende, M B; Herrera, H M; Carvalho, C M E; Carvalho Anjos, E A; Ramos, C A N; de Araújo, F R; Torres, J M; de Oliveira, C E

2017-12-01

The multihost parasites Leishmania spp. infect a broad range of wild mammalian species including bats. Several species of bats have adapted to a variety of food resources and shelters in urban areas. This study aimed to detect Leishmania spp. DNA in bats present in forest fragments located in metropolitan areas endemic for leishmaniasis in Campo Grande, Mato Grosso do Sul (MS), Brazil. Blood samples were obtained from 80 individuals, including eight species of Phyllostomidae and one species of Vespertilionidae. Thirty of the 80 bats were positive for Leishmania spp. using conventional PCR, all belonging to the family Phyllostomidae. Eighteen samples tested by real-time PCR (qPCR) using specific primers for the kDNA of Leishmania infantum were positive. To the best of our knowledge, this is the first report detecting Leishmania spp. in Platyrrhinus incarum in addition to being the first reported detection of L. infantum in the bat species Phyllostomus discolor, Platyrrhinus lineatus, Artibeus planirostris and Artibeus lituratus. Our results show that bats can host Leishmania spp. in areas endemic for leishmaniasis, which must be taken into account in disease control operations by public health authorities. © 2017 Blackwell Verlag GmbH.

Detection, molecular typing and phylogenetic analysis of Leishmania isolated from cases of leishmaniasis among Syrian refugees in Lebanon

Directory of Open Access Journals (Sweden)

Tamara Salloum

2016-06-01

Two molecular typing methods of 39 FFPE Leishmania isolates were used: the ITS1-PCR RFLP and the nested ITS1-5.8S rDNA gene amplification followed by sequencing and phylogenetic analysis. The efficiency of these two techniques in Leishmania identification was compared and the phylogenetic relationships among these isolates were illustrated based on the neighbor-joining (NJ method. The results were statistically correlated with the parasitic index (PI. The DNA storage in formalin-fixed paraffin embedded (FFPE tissues was assessed as well. The parasites identified were all L. tropica as determined by both techniques. ITS1-5.8S rDNA gene based typing proved to be more sensitive in the detection of parasites (positive in 69.2% of the isolates as opposed to the ITS1-PCR RFLP method that was successful in identifying L. tropica in only 43.6% of the isolates. Sequencing and phylogenetic analysis revealed high levels of heterogeneity. A statistically significant correlation was observed between PI and the results of the nested ITS1-5.8S rDNA gene PCR. Genotyping at the species level is essential for monitoring the relative frequency of CL in the Mediterranean area that is correlated to three different Leishmania species (Leishmania infantum, Leishmania major and L. tropica, each characterized by distinct epidemiological features. The obtained results highlight the need to find a universally accepted diagnostic tool for Leishmania typing.

Whatman Paper (FTA Cards for Storing and Transferring Leishmania DNA for PCR Examination

Directory of Open Access Journals (Sweden)

A Amin-Mohammadi

2009-12-01

Full Text Available "nBackground: Diagnosis of cutaneous leishmaniasis (CL is often made based on clinical manifesta­tion. Correct diagnosis and identification of the parasite are crucial for choosing the effective treat­ment and for epidemiological studies. On the other hand, determination of Leishmania species is nec­essary for designing appropriate control programs. Diagnosis by PCR is becoming a 'gold standard'. For PCR preparation, storage and shipments of specimens are necessary. In this study, Whatman filter paper (FTA Card was used to store and transfer samples for Leishmania identification using PCR. "nMethods: Among the patients who had CL lesion and referred to Parasitology Laboratory of Emam Reza Hospital, Mashhad, Iran, 44 consented cases with positive results in their direct smear were se­lected. An informed consent form and a questionnaire were completed and three different types of samples (direct smear, NNN culture, and spot on FTA card were collected. DNA extraction and PCR were carried out on three different samples from each patient. "nResults: PCR results using Whatman paper samples revealed a significant difference (P<0.0001 compared to the culture method but no significant difference was seen between PCR results using samples stored on Whatman paper and direct smears. "nConclusion: The use of FTA cards is simple, rapid, and cost-effective, and can be readily employed for large-scale population screening, especially for regions where the specimens are to be transported from distant places to the laboratory.

Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

DEFF Research Database (Denmark)

Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

2016-01-01

A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

Assessment of nuclear and mitochondrial genes in precise identification and analysis of genetic polymorphisms for the evaluation of Leishmania parasites.

Science.gov (United States)

Fotouhi-Ardakani, Reza; Dabiri, Shahriar; Ajdari, Soheila; Alimohammadian, Mohammad Hossein; AlaeeNovin, Elnaz; Taleshi, Neda; Parvizi, Parviz

2016-12-01

The polymorphism and genetic diversity of Leishmania genus has status under discussion depending on many items such as nuclear and/or mitochondrial genes, molecular tools, Leishmania species, geographical origin, condition of micro-environment of Leishmania parasites and isolation of Leishmania from clinical samples, reservoir host and vectors. The genetic variation of Leishmania species (L. major, L. tropica, L. tarentolae, L. mexicana, L. infantum) were analyzed and compared using mitochondrial (COII and Cyt b) and nuclear (nagt, ITS-rDNA and HSP70) genes. The role of each enzymatic (COII, Cyt b and nagt) or housekeeping (ITS-rDNA, HSP70) gene was employed for accurate identification of Leishmania parasites. After DNA extractions and amplifying of native, natural and reference strains of Leishmania parasites, polymerase chain reaction (PCR) products were sequenced and evaluation of genetic proximity and phylogenetic analysis were performed using MEGA6 and DnaSP5 software. Among the 72 sequences of the five genes, the number of polymorphic sites was significantly lower as compared to the monomorphic sites. Of the 72 sequences, 54 new haplotypes (five genes) of Leishmania species were submitted in GenBank (Access number: KU680818 - KU680871). Four genes had a remarkable number of informative sites (P=0.00), except HSP70 maybe because of its microsatellite regions. The non-synonymous (dN) variants of nagt gene were more than that of other expression genes (47.4%). The synonymous (dS)/dN ratio in three expression genes showed a significant variation between five Leishmania species (P=0.001). The highest and lowest levels of haplotype diversity were observed in L. tropica (81.35%) and L. major (28.38%) populations, respectively. Tajima's D index analyses showed that Cyt b gene in L. tropica species was significantly negative (Tajima's D=-2.2, PLeishmania parasites. Copyright © 2016 Elsevier B.V. All rights reserved.

Isolation and characterisation of the cDNA encoding a glycosylated accessory protein of pea chloroplast DNA polymerase.

OpenAIRE

Gaikwad, A; Tewari, K K; Kumar, D; Chen, W; Mukherjee, S K

1999-01-01

The cDNA encoding p43, a DNA binding protein from pea chloroplasts (ct) that binds to cognate DNA polymerase and stimulates the polymerase activity, has been cloned and characterised. The characteristic sequence motifs of hydroxyproline-rich glyco-proteins (HRGP) are present in the cDNA corres-ponding to the N-terminal domain of the mature p43. The protein was found to be highly O-arabinosylated. Chemically deglycosylated p43 (i.e. p29) retains its binding to both DNA and pea ct-DNA polymeras...

Lundep, a sand fly salivary endonuclease increases Leishmania parasite survival in neutrophils and inhibits XIIa contact activation in human plasma.

Directory of Open Access Journals (Sweden)

Andrezza C Chagas

2014-02-01

Full Text Available Neutrophils are the host's first line of defense against infections, and their extracellular traps (NET were recently shown to kill Leishmania parasites. Here we report a NET-destroying molecule (Lundep from the salivary glands of Lutzomyia longipalpis. Previous analysis of the sialotranscriptome of Lu. longipalpis showed the potential presence of an endonuclease. Indeed, not only was the cloned cDNA (Lundep shown to encode a highly active ss- and dsDNAse, but also the same activity was demonstrated to be secreted by salivary glands of female Lu. longipalpis. Lundep hydrolyzes both ss- and dsDNA with little sequence specificity with a calculated DNase activity of 300000 Kunitz units per mg of protein. Disruption of PMA (phorbol 12 myristate 13 acetate- or parasite-induced NETs by treatment with recombinant Lundep or salivary gland homogenates increases parasite survival in neutrophils. Furthermore, co-injection of recombinant Lundep with metacyclic promastigotes significantly exacerbates Leishmania infection in mice when compared with PBS alone or inactive (mutagenized Lundep. We hypothesize that Lundep helps the parasite to establish an infection by allowing it to escape from the leishmanicidal activity of NETs early after inoculation. Lundep may also assist blood meal intake by lowering the local viscosity caused by the release of host DNA and as an anticoagulant by inhibiting the intrinsic pathway of coagulation.

Survey of Wild and Domestic Mammals for Infection with Leishmania infantum following an Outbreak of Desert Zoonotic Visceral Leishmaniasis in Jiashi, People's Republic of China.

Directory of Open Access Journals (Sweden)

Chun-Hua Gao

Full Text Available In 2008 and 2009, an outbreak of desert-subtype zoonotic visceral leishmaniasis occurred in Jiashi county, Xinjiang, China. So far, no animal reservoir has been identified for this type of visceral leishmaniasis. Therefore, we surveyed the most common mammals (wild and domestic for Leishmania infections during the outbreak in 2008 and 2009 in order to identify the source of the visceral leishmaniasis in this region. Spleen, liver, bone marrow and blood samples collected from 86 wood mice (Apodemus sylvaticus, 61midday jirds (Meriones meridianus and 27 Yarkand hares (Lepus yarkandensis were tested for the presence of Leishmania by microscopy, culture and PCR. All of the animals were found to be negative for Leishmania infections; On the other hand, Leishmania DNA was detected in blood samples collected from livestock reared in the outbreak area: 30.36% (17/56 of sheep, 21.57% (11/51 of goats, 17.78% (8/45 of cattle, and 21.62 (8/37 of donkeys were positive for Leishmania DNA by PCR. The amplified kDNA sequences from the livestock samples matched Leishmania DNA sequences isolated from patients with visceral leishmaniasis in the study area. We suggest that these domestic mammals are a possible reservoir host for Leishmania infantum in the outbreak area.

Quantification of Leishmania infantum DNA in females, eggs and larvae of Rhipicephalus sanguineus

Directory of Open Access Journals (Sweden)

Otranto Domenico

2011-04-01

Full Text Available Background Leishmania infantum is a widespread parasite that affects dogs and humans worldwide. It is transmitted primarily by phlebotomine sand flies, but recently there has been much discussion on the role of the brown dog tick, Rhipicephalus sanguineus, as a potential vector for this protozoan. Recent laboratory and field investigations have contributed to this hypothesis, but a proof of the vector capacity of R. sanguineus has yet to be provided. Following a recent study suggesting that L. infantum passes transovarially from the female tick to her progeny the current study provides new evidence of the transovarial transmission of L. infantum in R. sanguineus. Methods Engorged females of R. sanguineus were collected from the environment in a dog shelter of southern Italy, where canine leishmaniosis is endemic. In the laboratory, 97 females that successfully laid eggs, their eggs and the originated larvae were subjected to DNA extraction and then tested by a TaqMan-based real time PCR targeting a fragment of the kinetoplast DNA (kDNA of L. infantum. Results and conclusions L. infantum kDNA was detected in engorged females, their eggs and originating larvae, with a parasite load ranging from 1.8 × 10-4 to 10.0 × 100. Certainly, the current study provides further evidence on the passage of L. infantum from R. sanguineus females to their offspring. The observation of promastigote forms in larvae is necessary to definitively confirm this hypothesis, which would raise interesting questions about the possible role of ticks in the maintenance of L. infantum infection among dogs in certain areas.

Molecular characterization of leishmania infection from naturally infected sand flies caught in a focus of cutaneous leishmaniasis (eastern iran.

Directory of Open Access Journals (Sweden)

Mohammad Akhoundi

2013-12-01

Full Text Available Cutaneous leishmaniasis due to Leishmania major is a serious and increasing problem affecting many rural areas of 17 out of 31 provinces in Iran. Little is known about sand fly fauna and leishmaniases in Eastern Iran and no study has been carried out in Sarbisheh County. The aim of this study was to determine sand flies composition and probable Leishmania infection to find the probable vectors of leishmaniasis in Sarbisheh district.Sand flies were caught using both sticky papers and CDC light traps in August 2010. They were identified morphologically and analyzed for Leishmania infection by amplification of ITS-rDNA.Totally, 842 specimens were caught and 8 species recorded. They belonged to the genera Phlebotomus and Sergentomyia: P. (Phlebotomus papatasi, P. (Paraphlebotomus sergenti, P. (Pa. caucasicus, P. (Pa. mongolensis, P. (Pa. jacusieli, S. (Sergentomyia dentata, S. (Se. sintoni and S. (Sintonius clydei. All collected females were processed for Leishmania DNA detection by PCR amplifying of Internal Transcribed Spacer1 (partial sequence, 5.8S (complete sequence and ITS2 (partial sequence fragments. Thirteen females were positive for Leishmania DNA. The sequencing of the 430 bp amplicons indicated that 9 P. papatasi and 3 females belonging to the Caucasicus group carried L. major DNA whereas one P. sergenti carried L. tropica DNA.Phlebotomus papatasi and P. sergenti are, like in several places, the probable vectors of cutaneous leishmaniases in this emerging or unknown focus of cutaneous leishmaniases.

Recombinant DNA specifying the human amyloid. beta. precursor protein (ABPP) encodes a 95-kDa polypeptide

Energy Technology Data Exchange (ETDEWEB)

Mita, S; Sadlock, J; Herbert, J; Schon, E A

1988-10-11

Although the ABPP gene give rise to multiple mRNAs, the primary translation product of this gene is unknown. The longest published cDNA sequences predict a 770-aa polypeptide of 87 kDa. However, in immunoblots, ABPP migrated as a single species of >92 kDa in rat brain, and in human, as a species of 95-100 kDa in non-membrane bound form, as multiple species of 110-135 kDa in membrane-associated form and as a 130-kDa species in fibroblasts. The sizes of these larger species relative to the MW of ABPP predicted from the cDNA sequences have been attributed to postranslational modification. However, the authors have isolated a cDNA (lambdaHAP2) from a human fetal muscle lambdagt11 cDNA library encoding an 843-aa polypeptide with a deduced MW of 94,642. This cDNA contains both exons encoding an 843-aa polypeptide with a deduced MW of 94.642. This cDNA contains both exons encoding the protease inhibitor domains. Primer extension analysis indicates that the 5' terminus of this cDNA is 14 nt from a transcriptional start site. This cDNA, encoding the longest ABPP described to date, may explain some of the observations on the sizes of tissue-derived ABPP.

Enhanced immunogenicity of DNA fusion vaccine encoding secreted hepatitis B surface antigen and chemokine RANTES

International Nuclear Information System (INIS)

Kim, Seung Jo; Suh, Dongchul; Park, Sang Eun; Park, Jeong-Sook; Byun, Hyang-Min; Lee, Chan; Lee, Sun Young; Kim, Inho; Oh, Yu-Kyoung

2003-01-01

To increase the potency of DNA vaccines, we constructed genetic fusion vaccines encoding antigen, secretion signal, and/or chemokine RANTES. The DNA vaccines encoding secreted hepatitis B surface antigen (HBsAg) were constructed by inserting HBsAg gene into an expression vector with an endoplasmic reticulum (ER)-targeting secretory signal sequence. The plasmid encoding secretory HBsAg (pER/HBs) was fused to cDNA of RANTES, generating pER/HBs/R. For comparison, HBsAg genes were cloned into pVAX1 vector with no signal sequence (pHBs), and further linked to the N-terminus of RANTES (pHBs/R). Immunofluorescence study showed the cytoplasmic localization of HBsAg protein expressed from pHBs and pHBs/R, but not from pER/HBs and pER/HBs/R at 48 h after transfection. In mice, RANTES-fused DNA vaccines more effectively elicited the levels of HBsAg-specific IgG antibodies than pHBs. All the DNA vaccines induced higher levels of IgG 2a rather than IgG 1 antibodies. Of RANTES-fused vaccines, pER/HBs/R encoding the secreted fusion protein revealed much higher humoral and CD8 + T cell-stimulating responses compared to pHBs/R. These results suggest that the immunogenicity of DNA vaccines could be enhanced by genetic fusion to a secretory signal peptide sequence and RANTES

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

1993-02-16

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

Evaluation of four molecular methods to detect Leishmania infection in dogs.

Science.gov (United States)

Albuquerque, Andreia; Campino, Lenea; Cardoso, Luís; Cortes, Sofia

2017-03-13

Canine leishmaniasis, a zoonotic disease caused by Leishmania infantum vectored by phlebotomine sand flies, is considered a relevant veterinary and public health problem in various countries, namely in the Mediterranean basin and Brazil, where dogs are considered the main reservoir hosts. Not only diseased dogs but also those subclinically infected play a relevant role in the transmission of L. infantum to vectors; therefore, early diagnosis is essential, under both a clinical and an epidemiological perspective. Molecular tools can be a more accurate and sensitive approach for diagnosis, with a wide range of protocols currently in use. The aim of the present report was to compare four PCR based protocols for the diagnosis of canine Leishmania infection in a cohort of dogs from the Douro region, Portugal. A total of 229 bone marrow samples were collected from dogs living in the Douro region, an endemic region for leishmaniasis. Four PCR protocols were evaluated for Leishmania DNA detection in canine samples, three single (ITS1-PCR, MC-PCR and Uni21/Lmj4-PCR) and one nested (nested SSU rRNA-PCR). Two of the protocols were based on nuclear targets and the other two on kinetoplastid targets. The higher overall percentage of infected dogs was detected with the nested SSU rRNA-PCR (37.6%), which also was able to detect Leishmania DNA in a higher number of samples from apparently healthy dogs (25.3%). The ITS1-PCR presented the lowest level of Leishmania detection. Nested SSU rRNA-PCR is an appropriate method to detect Leishmania infection in dogs. Accurate and early diagnosis in clinically suspect as well as apparently healthy dogs is essential, in order to treat and protect animals and public health and contribute to the control and awareness of the disease.

Human mixed infections of Leishmania spp. and Leishmania-Trypanosoma cruzi in a sub Andean Bolivian area: identification by polymerase chain reaction/hybridization and isoenzyme

Directory of Open Access Journals (Sweden)

B Bastrenta

2003-03-01

Full Text Available Parasites belonging to Leishmania braziliensis, Leishmania donovani, Leishmania mexicana complexes and Trypanosoma cruzi (clones 20 and 39 were searched in blood, lesions and strains collected from 28 patients with active cutaneous leishmaniasis and one patient with visceral leishmaniasis. PCR-hybridization with specific probes of Leishmania complexes (L. braziliensis, L. donovani and L. mexicana and T. cruzi clones was applied to the different DNA samples. Over 29 patients, 8 (27.6% presented a mixed infection Leishmania complex species, 17 (58.6% a mixed infection Leishmania-T. cruzi, and 4 (13.8% a multi Leishmania-T. cruzi infection. Several patients were infected by the two Bolivian major clones 20 and 39 of T. cruzi (44.8%. The L. braziliensis complex was more frequently detected in lesions than in blood and a reverse result was observed for L. mexicana complex. The polymerase chain reaction-hybridization design offers new arguments supporting the idea of an underestimated rate of visceral leishmanisis in Bolivia. Parasites were isolated by culture from the blood of two patients and lesions of 10 patients. The UPGMA (unweighted pair-group method with arithmetic averages dendrogram computed from Jaccard's distances obtained from 11 isoenzyme loci data confirmed the presence of the three Leishmania complexes and undoubtedly identified human infections by L. (V. braziliensis, L. (L. chagasi and L. (L. mexicana species. Additional evidence of parasite mixtures was visualized through mixed isoenzyme profiles, L. (V. braziliensis-L. (L. mexicana and Leishmania spp.-T. cruzi.The epidemiological profile in the studied area appeared more complex than currently known. This is the first report of parasitological evidence of Bolivian patients with trypanosomatidae multi infections and consequences on the diseases' control and patient treatments are discussed.

Detection of Leishmania amazonensis and Leishmania braziliensis in Culicoides (Diptera, Ceratopogonidae) in an endemic area of cutaneous leishmaniasis in the Brazilian Amazonia.

Science.gov (United States)

Rebêlo, José Manuel Macário; Rodrigues, Bruno Leite; Bandeira, Maria da Conceição Abreu; Moraes, Jorge Luiz Pinto; Fonteles, Raquel Silva; Pereira, Silma Regina Ferreira

2016-12-01

Biting midges in the genus Culicoides act as vectors of arboviruses throughout the world and as vectors of filariasis in Latin America, the Caribbean, and parts of Africa. Although Culicoides spp. are currently not considered to be vectors of Leishmania protozoa, the high abundance of biting midges in areas with active cutaneous leishmaniasis transmission points to the possibility of Culicoides infection by these pathogens. We used PCR to test captured Culicoides species for natural infection with Leishmania spp. We tested 450 Culicoides females, divided into 30 pools of 15 individuals each, as follows: nine pools of C. foxi (135 specimens), seven pools of C. filariferus (105), seven pools of C. insignis (105), five pools of C. ignacioi (75), and two pools of C. flavivenula (30). PCR confirmed the presence of Leishmania braziliensis DNA in C. ignacioi (0.14%), C. insignis (0.14%), and C. foxi (0.11); and Le. amazonensis DNA in C. filariferus (0.14%) and C. flavivenula (0.50%). We conclude that these Culicoides species can be naturally infected, but vector competence and transmission capability must be confirmed in future studies. Our results warrant further investigation into the role of these biting midge species in the leishmaniasis epidemiological cycle. © 2016 The Society for Vector Ecology.

Polymerase chain reaction-based method for the identification of Leishmania (Viannia) braziliensis and Leishmania (Viannia) guyanensis in mucosal tissues conserved in paraffin.

Science.gov (United States)

Prestes, Suzane Ribeiro; Guerra, Jorge Augusto de Oliveira; Romero, Gustavo Adolfo Sierra; Magalhaes, Laylah Kelre Costa; Santana, Rosa Amelia Gonçalves; Maciel, Marcel Gonçalves; Custódio, Ana; Barbosa, Maria das Graças Vale; Silveira, Henrique

2015-01-01

In the Americas, mucosal leishmaniasis is primarily associated with infection by Leishmania (Viannia) braziliensis. However, Leishmania (Viannia) guyanensis is another important cause of this disease in the Brazilian Amazon. In this study, we aimed at detecting Leishmaniadeoxyribonucleic acid (DNA) within paraffin-embedded fragments of mucosal tissues, and characterizing the infecting parasite species. We evaluated samples collected from 114 patients treated at a reference center in the Brazilian Amazon by polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analyses. Direct examination of biopsy imprints detected parasites in 10 of the 114 samples, while evaluation of hematoxylin and eosin-stained slides detected amastigotes in an additional 17 samples. Meanwhile, 31/114 samples (27.2%) were positive for Leishmania spp. kinetoplast deoxyribonucleic acid (kDNA) by PCR analysis. Of these, 17 (54.8%) yielded amplification of the mini-exon PCR target, thereby allowing for PCR-RFLP-based identification. Six of the samples were identified as L. (V.) braziliensis, while the remaining 11 were identified as L. (V.) guyanensis. The results of this study demonstrate the feasibility of applying molecular techniques for the diagnosis of human parasites within paraffin-embedded tissues. Moreover, our findings confirm that L. (V.) guyanensisis a relevant causative agent of mucosal leishmaniasis in the Brazilian Amazon.

Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

International Nuclear Information System (INIS)

Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

1988-01-01

Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

Can equids be a reservoir of Leishmania braziliensis in endemic areas?

Directory of Open Access Journals (Sweden)

Jessé Henrique Truppel

Full Text Available In this study, we detected Leishmania (Viannia braziliensis infection in equids living in endemic regions of cutaneous leishmaniasis. To determine the role of these animals in the Leishmania cycle, we used two approaches: serological and molecular methods. Antibodies to the parasite were assayed using the Enzyme Linked Immunosorbent Assay (ELISA. Blood samples were collected and tested by polymerase chain reaction (PCR, and the positive products were sequenced. The results showed that 11.0% (25/227 of the equids were seropositive for Leishmania sp, and 16.3% (37/227 were PCR positive. Antibodies were detected in 20 horses, 3 donkeys, and 2 mules, and the parasite DNA was detected in 30 horses, 5 donkeys, and 2 mules. Sequencing the amplified DNA revealed 100% similarity with sequences for Viannia complex, corroborating the results of PCR for L. braziliensis. Our results show that equids are infected with L. braziliensis, which could be food sources for phlebotomines in the peridomiciliary environment and consequently play a role in the cutaneous leishmaniasis cycle.

Analysis of the Antigenic and Prophylactic Properties of the Leishmania Translation Initiation Factors eIF2 and eIF2B in Natural and Experimental Leishmaniasis

Directory of Open Access Journals (Sweden)

Esther Garde

2018-04-01

Full Text Available Different members of intracellular protein families are recognized by the immune system of the vertebrate host infected by parasites of the genus Leishmania. Here, we have analyzed the antigenic and immunogenic properties of the Leishmania eIF2 and eIF2B translation initiation factors. An in silico search in Leishmania infantum sequence databases allowed the identification of the genes encoding the α, β, and γ subunits and the α, β, and δ subunits of the putative Leishmania orthologs of the eukaryotic initiation factors F2 (LieIF2 or F2B (LieIF2B, respectively. The antigenicity of these factors was analyzed by ELISA using recombinant versions of the different subunits. Antibodies against the different LieIF2 and LieIF2B subunits were found in the sera from human and canine visceral leishmaniasis patients, and also in the sera from hamsters experimentally infected with L. infantum. In L. infantum (BALB/c and Leishmania major (BALB/c or C57BL/6 challenged mice, a moderate humoral response against these protein factors was detected. Remarkably, these proteins elicited an IL-10 production by splenocytes derived from infected mice independently of the Leishmania species employed for experimental challenge. When DNA vaccines based on the expression of the LieIF2 or LieIF2B subunit encoding genes were administered in mice, an antigen-specific secretion of IFN-γ and IL-10 cytokines was observed. Furthermore, a partial protection against murine CL development due to L. major infection was generated in the vaccinated mice. Also, in this work we show that the LieIF2α subunit and the LieIF2Bβ and δ subunits have the capacity to stimulate IL-10 secretion by spleen cells from naïve mice. B-lymphocytes were identified as the major producers of this anti-inflammatory cytokine. Taking into account the data found in this study, it may be hypothesized that these proteins act as virulence factors implicated in the induction of humoral responses as well

Analysis of the Antigenic and Prophylactic Properties of the Leishmania Translation Initiation Factors eIF2 and eIF2B in Natural and Experimental Leishmaniasis.

Science.gov (United States)

Garde, Esther; Ramírez, Laura; Corvo, Laura; Solana, José C; Martín, M Elena; González, Víctor M; Gómez-Nieto, Carlos; Barral, Aldina; Barral-Netto, Manoel; Requena, José M; Iborra, Salvador; Soto, Manuel

2018-01-01

Different members of intracellular protein families are recognized by the immune system of the vertebrate host infected by parasites of the genus Leishmania . Here, we have analyzed the antigenic and immunogenic properties of the Leishmania eIF2 and eIF2B translation initiation factors. An in silico search in Leishmania infantum sequence databases allowed the identification of the genes encoding the α, β, and γ subunits and the α, β, and δ subunits of the putative Leishmania orthologs of the eukaryotic initiation factors F2 (LieIF2) or F2B (LieIF2B), respectively. The antigenicity of these factors was analyzed by ELISA using recombinant versions of the different subunits. Antibodies against the different LieIF2 and LieIF2B subunits were found in the sera from human and canine visceral leishmaniasis patients, and also in the sera from hamsters experimentally infected with L. infantum . In L. infantum (BALB/c) and Leishmania major (BALB/c or C57BL/6) challenged mice, a moderate humoral response against these protein factors was detected. Remarkably, these proteins elicited an IL-10 production by splenocytes derived from infected mice independently of the Leishmania species employed for experimental challenge. When DNA vaccines based on the expression of the LieIF2 or LieIF2B subunit encoding genes were administered in mice, an antigen-specific secretion of IFN-γ and IL-10 cytokines was observed. Furthermore, a partial protection against murine CL development due to L. major infection was generated in the vaccinated mice. Also, in this work we show that the LieIF2α subunit and the LieIF2Bβ and δ subunits have the capacity to stimulate IL-10 secretion by spleen cells from naïve mice. B-lymphocytes were identified as the major producers of this anti-inflammatory cytokine. Taking into account the data found in this study, it may be hypothesized that these proteins act as virulence factors implicated in the induction of humoral responses as well as in the

Potential role for dog fleas in the cycle of Leishmania spp.

Science.gov (United States)

Ferreira, Marilia Gabriele Prado Albuquerque; Fattori, Karina Reinaldo; Souza, Fausto; Lima, Valéria Marçal Felix

2009-10-28

Several species of Leishmania spp. cause diseases in humans that range from self-healing cutaneous lesions to fatal visceral leishmaniosis. It has been observed that besides being transmitted by sand flies, Leishmania spp. may also be transmitted by arthropods such as ticks and fleas. To investigate the possible role of dog fleas in the transmission of Leishmania spp., Ctenocefalides felis were removed from 22 dogs which were positive according to ELISA and rK-39 tests. A C. felis sample from each of the 22 dogs was used to infect a hamster. The 22 hamsters were euthanized 4 months after infection with the fleas and the blood was subjected to ELISA to detect antibody anti-Leishmania spp., and the spleen samples were submitted to PCR for detection of Leishmania spp. DNA. PCR and ELISA were both positive in 18.1% (4/22), with PCR alone being positive in 45% (10/22) and ELISA alone in only 9% (2/22). These results suggest the participation of dog fleas in the Leishmania spp. cycle. Confirmation that C. felis indeed transmit leishmaniosis to dogs requires new strategies against leishmaniosis to be enforced by public health authorities and which focus on better ways to keep dogs free of fleas.

Natural canine infection by Leishmania infantum and Leishmania amazonensis and their implications for disease control

Directory of Open Access Journals (Sweden)

Letícia da Cruz Sanches

Full Text Available Abstract Leishmaniasis is a major public health problem worldwide. Because Leishmania can adapt to new hosts or vectors, knowledge concerning the current etiological agent in dogs is important in endemic areas. This study aimed to identify the Leishmania species detected in 103 samples of peripheral blood from dogs that were naturally infected with these protozoa. The diagnosis of leishmaniasis was determined through parasitological examination, the indirect enzyme-linked immunosorbent assay (ELISA and the polymerase chain reaction (PCR. The Leishmania species were identified by means of PCR-restriction fragment length polymorphism (PCR-RFLP. The samples were subjected to PCR using oligonucleotide primers that amplify the intergenic region ITS1 of the rRNA gene in order to identify the species. The amplified DNA was digested using the restriction enzyme HaeIII. A restriction profile identical to L. amazonensis was shown in 77/103 samples and the profile was similar to L. infantum in 17/103. However, a mixed profile was shown in 9/103 samples, which impeded species identification. In conclusion, the infection in these dogs was predominantly due to L. amazonensis, thus indicating that diagnosing of cases of canine leishmaniasis needs to be reexamined, since the causative agent identified is not restricted to L. infantum.

Comparison of LAMP and PCR for molecular mass screening of sand flies for Leishmania martiniquensis infection.

Science.gov (United States)

Tiwananthagorn, Saruda; Kato, Hirotomo; Yeewa, Ranchana; Muengpan, Amontip; Polseela, Raxsina; Leelayoova, Saovanee

2017-02-01

Leishmaniasis caused by Leishmania martiniquensis infection has been reported in human and domestic animals of Martinique Island, Germany, Switzerland, USA, Myanmar and Thailand. The peculiar clinical features of disseminated cutaneous and visceral forms co-existence render the urgent need of specific diagnostic tool to identify the natural sand fly vectors for effective prevention and control strategies. Loop-mediated isothermal amplification (LAMP) of 18S rRNA gene as well as polymerase chain reaction (PCR) of minicircle kinetoplast DNA gene (PCR-mkDNA) have never been applied to detect L. martiniquensis and L. siamensis in sand fly vectors. The present study was aimed to validate malachite green-LAMP (MG-LAMP) and PCR-mkDNA techniques to detect L. martiniquensis in sand fly vectors, compared with the conventional PCR of internal transcribed spacer 1 (PCR-ITS1). We compared the validity of LAMP of 18S rRNA gene and PCR-mkDNA, to PCR-ITS1 in simulation model of L. martiniquensis infection in Sergentomyia gemmea sand flies. Attributable to the sensitivity and specificity, PCR-mkDNA was consecutively applied to detect L. martiniquensis in 380 female sand fly individuals captured in the newly identified affected region of Lamphun Province, Thailand. Results showed that PCR-mkDNA could detect at least one promastigote per sand fly, which was 10-time superior to LAMP and PCR-ITS1. In addition, PCR-mkDNA was more specific, able to differentiate L. martiniquensis from other viscerotropic Leishmania species, such as L. siamensis, L. (L.) donovani, and L. (L.) infantum. Consecutively, mass screening of L. martiniquensis in 380 female sand fly individuals by PCR-mkDNA was implemented in a new affected area of Thailand where a patient with leishmaniasis/HIV co-infection resides; however Leishmania DNA was undetected. In conclusion, PCR-mkDNA is a promising tool for molecular mass screening of L. martiniquensis infection in outbreak areas where several species of Leishmania

Comparison of LAMP and PCR for molecular mass screening of sand flies for Leishmania martiniquensis infection

Science.gov (United States)

Tiwananthagorn, Saruda; Kato, Hirotomo; Yeewa, Ranchana; Muengpan, Amontip; Polseela, Raxsina; Leelayoova, Saovanee

2017-01-01

BACKGROUND Leishmaniasis caused by Leishmania martiniquensis infection has been reported in human and domestic animals of Martinique Island, Germany, Switzerland, USA, Myanmar and Thailand. The peculiar clinical features of disseminated cutaneous and visceral forms co-existence render the urgent need of specific diagnostic tool to identify the natural sand fly vectors for effective prevention and control strategies. Loop-mediated isothermal amplification (LAMP) of 18S rRNA gene as well as polymerase chain reaction (PCR) of minicircle kinetoplast DNA gene (PCR-mkDNA) have never been applied to detect L. martiniquensis and L. siamensis in sand fly vectors. OBJECTIVE The present study was aimed to validate malachite green-LAMP (MG-LAMP) and PCR-mkDNA techniques to detect L. martiniquensis in sand fly vectors, compared with the conventional PCR of internal transcribed spacer 1 (PCR-ITS1). METHODS We compared the validity of LAMP of 18S rRNA gene and PCR-mkDNA, to PCR-ITS1 in simulation model of L. martiniquensis infection in Sergentomyia gemmea sand flies. Attributable to the sensitivity and specificity, PCR-mkDNA was consecutively applied to detect L. martiniquensis in 380 female sand fly individuals captured in the newly identified affected region of Lamphun Province, Thailand. FINDINGS AND MAIN CONCLUSIONS Results showed that PCR-mkDNA could detect at least one promastigote per sand fly, which was 10-time superior to LAMP and PCR-ITS1. In addition, PCR-mkDNA was more specific, able to differentiate L. martiniquensis from other viscerotropic Leishmania species, such as L. siamensis, L. (L.) donovani, and L. (L.) infantum. Consecutively, mass screening of L. martiniquensis in 380 female sand fly individuals by PCR-mkDNA was implemented in a new affected area of Thailand where a patient with leishmaniasis/HIV co-infection resides; however Leishmania DNA was undetected. In conclusion, PCR-mkDNA is a promising tool for molecular mass screening of L. martiniquensis

Molecular detection of Leishmania spp. in road-killed wild mammals in the Central Western area of the State of São Paulo, Brazil.

Science.gov (United States)

Richini-Pereira, Virginia Bodelão; Marson, Pamela Merlo; Hayasaka, Enio Yoshinori; Victoria, Cassiano; da Silva, Rodrigo Costa; Langoni, Hélio

2014-01-01

Road-killed wild animals have been classified as sentinels for detecting such zoonotic pathogens as Leishmania spp., offering new opportunities for epidemiological studies of this infection. This study aimed to evaluate the presence of Leishmania spp. and Leishmania chagasi DNA by PCR in tissue samples (lung, liver, spleen, kidney, heart, mesenteric lymph node and adrenal gland) from 70 road-killed wild animals. DNA was detected in tissues of one Cavia aperea (Brazilian guinea pig), five Cerdocyon thous (crab-eating fox), one Dasypus septemcinctus (seven-banded armadillo), two Didelphis albiventris (white-eared opossum), one Hydrochoerus hydrochoeris (capybara), two Myrmecophaga tridactyla (giant anteater), one Procyon cancrivorus (crab-eating raccoon), two Sphiggurus spinosus (porcupine) and one Tamandua tetradactyla (lesser anteater) from different locations in the Central Western part of São Paulo state. The Leishmania chagasi DNA were confirmed in mesenteric lymph node of one Cerdocyon thous. Results indicated common infection in wild animals. The approach employed herein proved useful for detecting the environmental occurrence of Leishmania spp. and L. chagasi, as well as determining natural wild reservoirs and contributing to understand the host-parasite interaction.

Leishmania (Viannia) braziliensis infection in wild small mammals in ecotourism area of Brazil.

Science.gov (United States)

Tonelli, Gabriel Barbosa; Tanure, Aline; Rego, Felipe Dutra; Carvalho, Gustavo Mayr de Lima; Stumpp, Rodolfo; Ássimos, Gabriela Ribeiro; Campos, Aldenise Martins; Lima, Ana Cristina Viana Mariano da Rocha; Gontijo, Célia Maria Ferreira; Paz, Gustavo Fontes; Andrade Filho, José Dilermando

2017-01-01

Leishmaniases are parasitic diseases transmitted to mammalian hosts by sand fly vectors (Diptera: Psychodidae). Despite the increasing occurrence of visceral and cutaneous leishmaniasis cases in urban centers, their transmission still occur primarily in wild environments and may be associated with professional activities and recreation, such as ecotourism. The Reserva Particular do Patrimônio Natural Santuário do Caraça (RPPNSC) is one of the largest ecotourism attractions in the State of Minas Gerais, Brazil, and comprises an area of environmental preservation with 11,233 hectares presenting a transitional vegetation between Cerrado and Atlantic Forest. The present study describes the abundance of small mammals in RPPNSC, the isolation and identification of Leishmania in five wild animals. Small mammals were bimonthly trapped along 6 trails within the RPPNSC with 10 Tomahawk traps each. Two trails were located in peridomiciliary areas near tourist lodging facilities, and four trails were located at sites visited by tourists in forest areas. The most prevalent species were Akodon cursor, Cerradomys subflavus and Oligoryzomys nigripes. Six isolates of Leishmania were obtained from these animals and identified as Leishmania braziliensis through HSP70-PCR RFLP method. Leishmania spp. DNA was detected by kDNA-PCR method and isolated by biphasic culture. Studies point to some of the captured species as potential wild reservoirs of Leishmania, suggesting they may be involved in the transmission cycle in these wild environments.

A Novel Audio Cryptosystem Using Chaotic Maps and DNA Encoding

Directory of Open Access Journals (Sweden)

S. J. Sheela

2017-01-01

Full Text Available Chaotic maps have good potential in security applications due to their inherent characteristics relevant to cryptography. This paper introduces a new audio cryptosystem based on chaotic maps, hybrid chaotic shift transform (HCST, and deoxyribonucleic acid (DNA encoding rules. The scheme uses chaotic maps such as two-dimensional modified Henon map (2D-MHM and standard map. The 2D-MHM which has sophisticated chaotic behavior for an extensive range of control parameters is used to perform HCST. DNA encoding technology is used as an auxiliary tool which enhances the security of the cryptosystem. The performance of the algorithm is evaluated for various speech signals using different encryption/decryption quality metrics. The simulation and comparison results show that the algorithm can achieve good encryption results and is able to resist several cryptographic attacks. The various types of analysis revealed that the algorithm is suitable for narrow band radio communication and real-time speech encryption applications.

Multi-Probe Based Artificial DNA Encoding and Matching Classifier for Hyperspectral Remote Sensing Imagery

Directory of Open Access Journals (Sweden)

Ke Wu

2016-08-01

Full Text Available In recent years, a novel matching classification strategy inspired by the artificial deoxyribonucleic acid (DNA technology has been proposed for hyperspectral remote sensing imagery. Such a method can describe brightness and shape information of a spectrum by encoding the spectral curve into a DNA strand, providing a more comprehensive way for spectral similarity comparison. However, it suffers from two problems: data volume is amplified when all of the bands participate in the encoding procedure and full-band comparison degrades the importance of bands carrying key information. In this paper, a new multi-probe based artificial DNA encoding and matching (MADEM method is proposed. In this method, spectral signatures are first transformed into DNA code words with a spectral feature encoding operation. After that, multiple probes for interesting classes are extracted to represent the specific fragments of DNA strands. During the course of spectral matching, the different probes are compared to obtain the similarity of different types of land covers. By computing the absolute vector distance (AVD between different probes of an unclassified spectrum and the typical DNA code words from the database, the class property of each pixel is set as the minimum distance class. The main benefit of this strategy is that the risk of redundant bands can be deeply reduced and critical spectral discrepancies can be enlarged. Two hyperspectral image datasets were tested. Comparing with the other classification methods, the overall accuracy can be improved from 1.22% to 10.09% and 1.19% to 15.87%, respectively. Furthermore, the kappa coefficient can be improved from 2.05% to 15.29% and 1.35% to 19.59%, respectively. This demonstrated that the proposed algorithm outperformed other traditional classification methods.

Mapping of a Leishmania major gene/locus that confers pentamidine resistance by deletion and insertion of transposable element

Directory of Open Access Journals (Sweden)

Coelho Adriano C.

2004-01-01

Full Text Available Pentamidine (PEN is an alternative compound to treat antimony-resistant leishmaniasis patients, which cellular target remains unclear. One approach to the identification of prospective targets is to identify genes able to mediate PEN resistance following overexpression. Starting from a genomic library of transfected parasites bearing a multicopy episomal cosmid vector containing wild-type Leishmania major DNA, we isolated one locus capable to render PEN resistance to wild type cells after DNA transfection. In order to map this Leishmania locus, cosmid insert was deleted by two successive sets of partial digestion with restriction enzymes, followed by transfection into wild type cells, overexpression, induction and functional tests in the presence of PEN. To determine the Leishmania gene related to PEN resistance, nucleotide sequencing experiments were done through insertion of the transposon Mariner element of Drosophila melanogaster (mosK into the deleted insert to work as primer island. Using general molecular techniques, we described here this method that permits a quickly identification of a functional gene facilitating nucleotide sequence experiments from large DNA fragments. Followed experiments revealed the presence of a P-Glycoprotein gene in this locus which role in Leishmania metabolism has now been analyzed.

Increased transmission potential of Leishmania major/Leishmania infantum hybrids

OpenAIRE

Volf, Petr; Benkova, Ivana; Myskova, Jitka; Sadlova, Jovana; Campino, Lenea; Ravel, Christophe

2007-01-01

Development of Leishmania infantum/Leishmania major hybrids was studied in two sand fly species. In Phlebotomus papatasi, which supported development of L. major but not L. infantum, the hybrids produced heavy late-stage infections with high numbers of metacyclic promastigotes. In the permissive vector Lutzomyia longipalpis, all Leishmania strains included in this study developed well. Hybrids were found to express L. major lipophosphoglycan, apparently enabling them to survive in P. papatasi...

Point mutations in a nucleoside transporter gene from Leishmania donovani confer drug resistance and alter substrate selectivity

OpenAIRE

Vasudevan, Gayatri; Ullman, Buddy; Landfear, Scott M.

2001-01-01

Leishmania parasites lack a purine biosynthetic pathway and depend on surface nucleoside and nucleobase transporters to provide them with host purines. Leishmania donovani possess two closely related genes that encode high affinity adenosine-pyrimidine nucleoside transporters LdNT1.1 and LdNT1.2 and that transport the toxic adenosine analog tubercidin in addition to the natural substrates. In this study, we have characterized a drug-resistant clonal mutant of L. do...

Novel selective inhibitor of Leishmania (Leishmania) amazonensis arginase.

Science.gov (United States)

da Silva, Edson R; Boechat, Nubia; Pinheiro, Luiz C S; Bastos, Monica M; Costa, Carolina C P; Bartholomeu, Juliana C; da Costa, Talita H

2015-11-01

Arginase is a glycosomal enzyme in Leishmania that is involved in polyamine and trypanothione biosynthesis. The central role of arginase in Leishmania (Leishmania) amazonensis was demonstrated by the generation of two mutants: one with an arginase lacking the glycosomal addressing signal and one in which the arginase-coding gene was knocked out. Both of these mutants exhibited decreased infectivity. Thus, arginase seems to be a potential drug target for Leishmania treatment. In an attempt to search for arginase inhibitors, 29 derivatives of the [1,2,4]triazolo[1,5-a]pyrimidine system were tested against Leishmania (Leishmania) amazonensis arginase in vitro. The [1,2,4]triazolo[1,5-a]pyrimidine scaffold containing R1  = CF3 exhibited greater activity against the arginase rather than when the substituent R1  = CH3 in the 2-position. The novel compound 2-(5-methyl-2-(trifluoromethyl)-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)hydrazinecarbothioamide (30) was the most potent, inhibiting arginase by a non-competitive mechanism, with the Ki and IC50 values for arginase inhibition estimated to be 17 ± 1 μm and 16.5 ± 0.5 μm, respectively. These results can guide the development of new drugs against leishmaniasis based on [1,2,4]triazolo[1,5-a]pyrimidine derivatives targeting the arginase enzyme. © 2015 John Wiley & Sons A/S.

Cloning of a Recombinant Plasmid Encoding Thiol-Specific Antioxidant Antigen (TSA) Gene of Leishmania majorand Expression in the Chinese Hamster Ovary Cell Line.

Science.gov (United States)

Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi

2012-01-01

TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.

Progress towards a Leishmania vaccine.

Science.gov (United States)

Tabbara, Khaled S

2006-07-01

Leishmaniasis is a vector-born protozoan disease. Approximately 12 million individuals are affected worldwide with an estimated annual incidence of 1.5-2 million. Two clinical manifestations are recognized, cutaneous, and visceral, both of which are common in the Middle East. In both forms, infection is chronic, with potential deformities, persistence following cure, and lifelong risk of reactivation. Attempts to develop an effective human Leishmania vaccine have not yet succeeded. Leishmanization, a crude form of live vaccination historically originated in this part of the world. Experimental vaccination has been extensively studied in model animals in the past 2 decades. In this review, major human killed vaccine trials are surveyed, and modern trends in Leishmania vaccine development, including subunit vaccines, naked DNA vaccines, and transmission blocking vaccines are explored. Recent findings of a link between persistence of live parasites, and maintenance of long-term immunity suggest live vaccination with attenuated strains, as a future vaccination strategy.

Molecular cloning and expression of cDNA encoding a lumenal calcium binding glycoprotein from sarcoplasmic reticulum

International Nuclear Information System (INIS)

Leberer, E.; Charuk, J.H.M.; MacLennan, D.H.; Green, N.M.

1989-01-01

Antibody screening was used to isolate a cDNA encoding the 160-kDa glycoprotein of rabbit skeletal muscle sarcoplasmic reticulum. The cDNA is identical to that encoding the 53-kDa glycoprotein except that it contains an in-frame insertion of 1,308 nucleotides near its 5' end, apparently resulting from alternative splicing. The protein encoded by the cDNA would contain a 19-residue NH 2 -terminal signal sequence and a 453-residue COOH-terminal sequence identical to the 53-kDa glycoprotein. It would also contain a 436-amino acid insert between these sequences. This insert would be highly acidic, suggesting that it might bind Ca 2+ . The purified 160-kDa glycoprotein and the glycoprotein expressed in COS-1 cells transfected with cDNA encoding the 160-kDa glycoprotein were shown to bind 45 C 2+ in a gel overlay assay. The protein was shown to be located in the lumen of the sarcoplasmic reticulum and to be associated through Ca 2+ with the membrane. The authors propose that this lumenal Ca 2+ binding glycoprotein of the sarcoplasmic reticulum be designated sarcalumenin

High Resolution Melting Analysis Targeting hsp70 as a Fast and Efficient Method for the Discrimination of Leishmania Species.

Directory of Open Access Journals (Sweden)

Ricardo Andrade Zampieri

2016-02-01

Full Text Available Protozoan parasites of the genus Leishmania cause a large spectrum of clinical manifestations known as Leishmaniases. These diseases are increasingly important public health problems in many countries both within and outside endemic regions. Thus, an accurate differential diagnosis is extremely relevant for understanding epidemiological profiles and for the administration of the best therapeutic protocol.Exploring the High Resolution Melting (HRM dissociation profiles of two amplicons using real time polymerase chain reaction (real-time PCR targeting heat-shock protein 70 coding gene (hsp70 revealed differences that allowed the discrimination of genomic DNA samples of eight Leishmania species found in the Americas, including Leishmania (Leishmania infantum chagasi, L. (L. amazonensis, L. (L. mexicana, L. (Viannia lainsoni, L. (V. braziliensis, L. (V. guyanensis, L. (V. naiffi and L. (V. shawi, and three species found in Eurasia and Africa, including L. (L. tropica, L. (L. donovani and L. (L. major. In addition, we tested DNA samples obtained from standard promastigote culture, naturally infected phlebotomines, experimentally infected mice and clinical human samples to validate the proposed protocol.HRM analysis of hsp70 amplicons is a fast and robust strategy that allowed for the detection and discrimination of all Leishmania species responsible for the Leishmaniases in Brazil and Eurasia/Africa with high sensitivity and accuracy. This method could detect less than one parasite per reaction, even in the presence of host DNA.

High Resolution Melting Analysis Targeting hsp70 as a Fast and Efficient Method for the Discrimination of Leishmania Species.

Science.gov (United States)

Zampieri, Ricardo Andrade; Laranjeira-Silva, Maria Fernanda; Muxel, Sandra Marcia; Stocco de Lima, Ana Carolina; Shaw, Jeffrey Jon; Floeter-Winter, Lucile Maria

2016-02-01

Protozoan parasites of the genus Leishmania cause a large spectrum of clinical manifestations known as Leishmaniases. These diseases are increasingly important public health problems in many countries both within and outside endemic regions. Thus, an accurate differential diagnosis is extremely relevant for understanding epidemiological profiles and for the administration of the best therapeutic protocol. Exploring the High Resolution Melting (HRM) dissociation profiles of two amplicons using real time polymerase chain reaction (real-time PCR) targeting heat-shock protein 70 coding gene (hsp70) revealed differences that allowed the discrimination of genomic DNA samples of eight Leishmania species found in the Americas, including Leishmania (Leishmania) infantum chagasi, L. (L.) amazonensis, L. (L.) mexicana, L. (Viannia) lainsoni, L. (V.) braziliensis, L. (V.) guyanensis, L. (V.) naiffi and L. (V.) shawi, and three species found in Eurasia and Africa, including L. (L.) tropica, L. (L.) donovani and L. (L.) major. In addition, we tested DNA samples obtained from standard promastigote culture, naturally infected phlebotomines, experimentally infected mice and clinical human samples to validate the proposed protocol. HRM analysis of hsp70 amplicons is a fast and robust strategy that allowed for the detection and discrimination of all Leishmania species responsible for the Leishmaniases in Brazil and Eurasia/Africa with high sensitivity and accuracy. This method could detect less than one parasite per reaction, even in the presence of host DNA.

Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease

International Nuclear Information System (INIS)

Szopa, J.

1995-01-01

The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs

Prevalence and Distribution of Leishmania RNA Virus 1 in Leishmania Parasites from French Guiana.

Science.gov (United States)

Ginouvès, Marine; Simon, Stéphane; Bourreau, Eliane; Lacoste, Vincent; Ronet, Catherine; Couppié, Pierre; Nacher, Mathieu; Demar, Magalie; Prévot, Ghislaine

2016-01-01

In South America, the presence of the Leishmania RNA virus type 1 (LRV1) was described in Leishmania guyanensis and Leishmania braziliensis strains. The aim of this study was to determine the prevalence distribution of LRV1 in Leishmania isolates in French Guiana given that, in this French overseas department, most Leishmania infections are due to these parasite species. The presence of the virus was observed in 74% of Leishmania spp. isolates, with a highest presence in the internal areas of the country. © The American Society of Tropical Medicine and Hygiene.

Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

Directory of Open Access Journals (Sweden)

Zuiter Afnan

2012-08-01

Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

Quantification of Leishmania infantum DNA in the bone marrow, lymph node and spleen of dogs.

Science.gov (United States)

Ramos, Rafael Antonio Nascimento; Ramos, Carlos Alberto do Nascimento; Santos, Edna Michelly de Sá; de Araújo, Flábio Ribeiro; de Carvalho, Gílcia Aparecida; Faustino, Maria Aparecida da Gloria; Alves, Leucio Câmara

2013-01-01

The aim of the present study was to quantify the parasite load of Leishmania infantum in dogs using real-time PCR (qPCR). Bone marrow, lymph node and spleen samples were taken from 24 dogs serologically positive for L. infantum that had been put down by the official epidemiological surveillance service. According to the clinical signs the dogs were classified as asymptomatic or symptomatic. After DNA extraction, the samples were subjected to qPCR to detect and quantify L. infantum DNA. Out of the 24 dogs, 12.5% (3/24) were classified as asymptomatic and 87.5% (21/24) as symptomatic. Real-time PCR detected L. infantum DNA in all the animals, in at least one biological sample. In particular, 100% of bone marrow and lymph node scored positive, whereas in spleen, the presence of DNA was detected in 95.9% (23/24). In addition, out of 24 animals, 15 were microscopically positive to amastigote forms of L. infantum in bone marrow. No statistical significant difference was found in the overall mean quantity of DNA among the different biological samples (P = 0.518). Considering each organ separately, there was 100% positivity in bone marrow and lymph nodes, while among the spleen samples, 95.9% (23/24) were positive. Regarding the different clinical groups, the overall mean parasite load varied significantly (P = 0.022). According to the results obtained, it was not possible determine which biological sample was most suitable tissue for the diagnosis, based only on the parasite load. Therefore, other characteristics such as convenience and easily of obtaining samples should be taken into consideration.

Identification of Leishmania tropica from micro-foci of cutaneous leishmaniasis in the Kenyan Rift Valley.

Science.gov (United States)

Odiwuor, Samwel; Muia, Alfred; Magiri, Charles; Maes, Ilse; Kirigi, George; Dujardin, Jean-Claude; Wasunna, Monique; Mbuchi, Margaret; Auwera, Gert Van der

2012-07-01

We performed diagnosis and species identification of parasites in lesion samples from suspected cutaneous leishmaniasis patients in four villages, three of which are in a known Leishmania tropica endemic region in Kenya. Samples were analyzed both by microscopy and PCR for Leishmania, and typed by an assay using four ribosomal DNA-based species-identification PCRs. The lesions were demonstrated to be caused by L. tropica, which confirms the re-emergence of cutaneous leishmaniasis from this species after a period of reduced incidence in the endemic zone. Our report highlights the importance of an intervention and sustained Leishmania control program.

Disseminated Leishmaniasis Caused by Leishmania Tropica in a Puppy from Karaj, Central Iran

Directory of Open Access Journals (Sweden)

M Mohebali

2011-06-01

Full Text Available A 5-month old puppy with muco-cutaneous lesions in the chin, around lips and eyes was exam­ined physically and microscopically for leishmaniasis. Muco-cutaneous lesions containing a large num­ber of amastigotes of Leishmania spp. were observed. Amastigotes were also detected in liver and spleen of the puppy. The animal was positive with Dipstick rK39 kit and high level of anti-Leishmania antibodies was detected by direct agglutination test (DAT. DNA, Using PCR-RFLP technique extracted from cultured Leishmania promastigotes and L. tropica was identified. This is the first report of concurrent mucosal and visceral involvement of L. tropica in a puppy from Iran.

Parasitological Confirmation and Analysis of Leishmania Diversity in Asymptomatic and Subclinical Infection following Resolution of Cutaneous Leishmaniasis.

Directory of Open Access Journals (Sweden)

Mariana Rosales-Chilama

2015-12-01

Full Text Available The contribution of individuals with subclinical infection to the transmission and endemicity of cutaneous leishmaniasis (CL is unknown. Immunological evidence of exposure to Leishmania in residents of endemic areas has been the basis for defining the human population with asymptomatic infection. However, parasitological confirmation of subclinical infection is lacking.We investigated the presence and viability of Leishmania in blood and non-invasive mucosal tissue samples from individuals with immunological evidence of subclinical infection in endemic areas for CL caused by Leishmania (Viannia in Colombia. Detection of Leishmania kDNA was conducted by PCR-Southern Blot, and parasite viability was confirmed by amplification of parasite 7SLRNA gene transcripts. A molecular tool for genetic diversity analysis of parasite populations causing persistent subclinical infection based on PCR amplification and sequence analysis of an 82bp region between kDNA conserved blocks 1 and 2 was developed.Persistent Leishmania infection was demonstrated in 40% (46 of 114 of leishmanin skin test (LST positive individuals without active disease; parasite viability was established in 59% of these (27 of 46; 24% of total. Parasite burden quantified from circulating blood monocytes, nasal, conjunctival or tonsil mucosal swab samples was comparable, and ranged between 0.2 to 22 parasites per reaction. kDNA sequences were obtained from samples from 2 individuals with asymptomatic infection and from 26 with history of CL, allowing genetic distance analysis that revealed diversity among sequences and clustering within the L. (Viannia subgenus.Our results provide parasitological confirmation of persistent infection among residents of endemic areas of L. (Viannia transmission who have experienced asymptomatic infection or recovered from CL, revealing a reservoir of infection that potentially contributes to the endemicity and transmission of disease. kDNA genotyping

Parasitological Confirmation and Analysis of Leishmania Diversity in Asymptomatic and Subclinical Infection following Resolution of Cutaneous Leishmaniasis.

Science.gov (United States)

Rosales-Chilama, Mariana; Gongora, Rafael E; Valderrama, Liliana; Jojoa, Jimena; Alexander, Neal; Rubiano, Luisa C; Cossio, Alexandra; Adams, Emily R; Saravia, Nancy G; Gomez, María Adelaida

2015-12-01

The contribution of individuals with subclinical infection to the transmission and endemicity of cutaneous leishmaniasis (CL) is unknown. Immunological evidence of exposure to Leishmania in residents of endemic areas has been the basis for defining the human population with asymptomatic infection. However, parasitological confirmation of subclinical infection is lacking. We investigated the presence and viability of Leishmania in blood and non-invasive mucosal tissue samples from individuals with immunological evidence of subclinical infection in endemic areas for CL caused by Leishmania (Viannia) in Colombia. Detection of Leishmania kDNA was conducted by PCR-Southern Blot, and parasite viability was confirmed by amplification of parasite 7SLRNA gene transcripts. A molecular tool for genetic diversity analysis of parasite populations causing persistent subclinical infection based on PCR amplification and sequence analysis of an 82bp region between kDNA conserved blocks 1 and 2 was developed. Persistent Leishmania infection was demonstrated in 40% (46 of 114) of leishmanin skin test (LST) positive individuals without active disease; parasite viability was established in 59% of these (27 of 46; 24% of total). Parasite burden quantified from circulating blood monocytes, nasal, conjunctival or tonsil mucosal swab samples was comparable, and ranged between 0.2 to 22 parasites per reaction. kDNA sequences were obtained from samples from 2 individuals with asymptomatic infection and from 26 with history of CL, allowing genetic distance analysis that revealed diversity among sequences and clustering within the L. (Viannia) subgenus. Our results provide parasitological confirmation of persistent infection among residents of endemic areas of L. (Viannia) transmission who have experienced asymptomatic infection or recovered from CL, revealing a reservoir of infection that potentially contributes to the endemicity and transmission of disease. kDNA genotyping establishes proof

Canine cutaneous leishmaniasis caused by neotropical Leishmania infantum despite of systemic disease: A case report.

Science.gov (United States)

Cavalcanti, Amanda; Lobo, Rogério; Cupolillo, Elisa; Bustamante, Fábio; Porrozzi, Renato

2012-12-01

Visceral leishmaniasis is an anthropozoonosis caused by a protozoan Leishmania infantum (syn. Leishmania chagasi). Here, we report a typical case of canine cutaneous leishmaniasis due to L. infantum infection without any other systemic symptom in one dog in the city of Rio de Janeiro, Brazil. A mongrel female dog was admitted in a veterinary clinic with reports of chronic wounds in the body. Physical examination revealed erosive lesions in the limbs, nasal ulcers, presence of ectoparasites and seborrheic dermatitis. Blood samples and fragments of healthy and injured skin were collected. The complete hemogram revealed aregenerative normocytic normochromic anemia and erythrocyte rouleaux, and biochemical analysis revealed normal renal and hepatic functions. Cytology of the muzzle and skin lesions suggested pyogranulomatous inflammatory process. The histopathology of a skin fragment was performed and revealed suspicion of protozoa accompanied by necrotizing dermatitis. The diagnosis of leishmaniasis was accomplished by positive serology, isolation of Leishmania from the skin lesion, and also by molecular test (PCR targeting the conserved region of Leishmania kDNA). Culture was positive for damaged skin samples. PCR targeting a fragment of Leishmania hsp70 gene was performed employing DNA extracted from damaged skin. RFLP of the amplified hsp70 fragment identified the parasite as L. infantum, instead of Leishmania braziliensis, the main agent of cutaneous leishmaniasis in Rio de Janeiro. Characterization of isolated promastigotes by five different enzymatic systems confirmed the species identification of the etiological agent. Serology was positive by ELISA and rapid test. This case warns to the suspicion of viscerotropic Leishmania in cases of chronic skin lesions and brings the discussion of the mechanisms involved in the parasite tissue tropism. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

Distinct Macrophage Fates after in vitro Infection with Different Species of Leishmania: Induction of Apoptosis by Leishmania (Leishmania) amazonensis, but Not by Leishmania (Viannia) guyanensis.

Science.gov (United States)

DaMata, Jarina Pena; Mendes, Bárbara Pinheiro; Maciel-Lima, Kátia; Menezes, Cristiane Alves Silva; Dutra, Walderez Ornelas; Sousa, Lirlândia Pires; Horta, Maria Fátima

2015-01-01

Leishmania is an intracellular parasite in vertebrate hosts, including man. During infection, amastigotes replicate inside macrophages and are transmitted to healthy cells, leading to amplification of the infection. Although transfer of amastigotes from infected to healthy cells is a crucial step that may shape the outcome of the infection, it is not fully understood. Here we compare L. amazonensis and L. guyanensis infection in C57BL/6 and BALB/c mice and investigate the fate of macrophages when infected with these species of Leishmania in vitro. As previously shown, infection of mice results in distinct outcomes: L. amazonensis causes a chronic infection in both strains of mice (although milder in C57BL/6), whereas L. guyanensis does not cause them disease. In vitro, infection is persistent in L. amazonensis-infected macrophages whereas L. guyanensis growth is controlled by host cells from both strains of mice. We demonstrate that, in vitro, L. amazonensis induces apoptosis of both C57BL/6 and BALB/c macrophages, characterized by PS exposure, DNA cleavage into nucleosomal size fragments, and consequent hypodiploidy. None of these signs were seen in macrophages infected with L. guyanensis, which seem to die through necrosis, as indicated by increased PI-, but not Annexin V-, positive cells. L. amazonensis-induced macrophage apoptosis was associated to activation of caspases-3, -8 and -9 in both strains of mice. Considering these two species of Leishmania and strains of mice, macrophage apoptosis, induced at the initial moments of infection, correlates with chronic infection, regardless of its severity. We present evidence suggestive that macrophages phagocytize L. amazonensis-infected cells, which has not been verified so far. The ingestion of apoptotic infected macrophages by healthy macrophages could be a way of amastigote spreading, leading to the establishment of infection.

Distinct Macrophage Fates after in vitro Infection with Different Species of Leishmania: Induction of Apoptosis by Leishmania (Leishmania amazonensis, but Not by Leishmania (Viannia guyanensis.

Directory of Open Access Journals (Sweden)

Jarina Pena DaMata

Full Text Available Leishmania is an intracellular parasite in vertebrate hosts, including man. During infection, amastigotes replicate inside macrophages and are transmitted to healthy cells, leading to amplification of the infection. Although transfer of amastigotes from infected to healthy cells is a crucial step that may shape the outcome of the infection, it is not fully understood. Here we compare L. amazonensis and L. guyanensis infection in C57BL/6 and BALB/c mice and investigate the fate of macrophages when infected with these species of Leishmania in vitro. As previously shown, infection of mice results in distinct outcomes: L. amazonensis causes a chronic infection in both strains of mice (although milder in C57BL/6, whereas L. guyanensis does not cause them disease. In vitro, infection is persistent in L. amazonensis-infected macrophages whereas L. guyanensis growth is controlled by host cells from both strains of mice. We demonstrate that, in vitro, L. amazonensis induces apoptosis of both C57BL/6 and BALB/c macrophages, characterized by PS exposure, DNA cleavage into nucleosomal size fragments, and consequent hypodiploidy. None of these signs were seen in macrophages infected with L. guyanensis, which seem to die through necrosis, as indicated by increased PI-, but not Annexin V-, positive cells. L. amazonensis-induced macrophage apoptosis was associated to activation of caspases-3, -8 and -9 in both strains of mice. Considering these two species of Leishmania and strains of mice, macrophage apoptosis, induced at the initial moments of infection, correlates with chronic infection, regardless of its severity. We present evidence suggestive that macrophages phagocytize L. amazonensis-infected cells, which has not been verified so far. The ingestion of apoptotic infected macrophages by healthy macrophages could be a way of amastigote spreading, leading to the establishment of infection.

Sequence of a cloned cDNA encoding human ribosomal protein S11

Energy Technology Data Exchange (ETDEWEB)

Lott, J B; Mackie, G A

1988-02-11

The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

Cloning and Expression of TRYP6 Gene from Leishmania major (MRHO/IR/75/ER

Directory of Open Access Journals (Sweden)

G Eslami

2008-06-01

Full Text Available Background: Leishmania, needs to detoxify the macrophage derived potent peroxides (H2O2. Tryparedoxin path­way contains tryparedoxin peroxidase (TSA or TRYP. The aim of the study was to detect the full-length gene se­quence and its encoded protein of the LmTRYP6 gene (EU251502, and comparison the gene sequence with LmTRYP6 (LmjF15.1140, another previously reported member of this gene family.Methods: L.major (MRHO/IR/75/ER promastigotes were cultured, DNA and RNA were extracted and the inter­ested gene was amplified using PCR and RT-PCR methods.  PCR/ RT-PCR fragments were purified and cloned first in pTZ57R/T and then in pET15b expression vector. The expressed protein was verified using western blot method. Char­acterization of the expressed protein was performed bioinformatically.Results: Molecular evaluation revealed that the cloned LmTRYP6 gene (EU251502 encoded a predicted 184 amino acid long protein with a theoretical isoelectric point of 6.1101. Alignment showed a number of changes in amino acid composition including the replacement of highly conserved Trp177 by Cys in LmTRYP6 (ABX26130.Conclusion: So far no study has been done on this group, i.e.  TRYP6 gene, from tryparedoxin peroxidase family. The low homology with LmTRYP6 (LmjF15.1140 and vast array of differences observed in the gene under study (LmTRYP6; EU251502 could open new windows in the field of anti-Leishmania combat. Based on its important role in the viability and successful establishment of the parasite in the host organism it looks to be very good candi­date for vaccine development and any other sort of novel drug development.

Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

International Nuclear Information System (INIS)

Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

1987-01-01

The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

Detection and molecular identification of leishmania RNA virus (LRV) in Iranian Leishmania species.

Science.gov (United States)

Hajjaran, Homa; Mahdi, Maryam; Mohebali, Mehdi; Samimi-Rad, Katayoun; Ataei-Pirkooh, Angila; Kazemi-Rad, Elham; Naddaf, Saied Reza; Raoofian, Reza

2016-12-01

Leishmania RNA virus (LRV) was first detected in members of the subgenus Leishmania (Viannia), and later, the virulence and metastasis of the New World species were attributed to this virus. The data on the presence of LRV in Old World species are confined to Leishmania major and a few Leishmania aethiopica isolates. The aim of this study was to survey the presence of LRV in various Iranian Leishmania species originating from patients and animal reservoir hosts. Genomic nucleic acids were extracted from 50 cultured isolates belonging to the species Leishmania major, Leishmania tropica, and Leishmania infantum. A partial sequence of the viral RNA-dependent RNA polymerase (RdRp) gene was amplified, sequenced and compared with appropriate sequences from the GenBank database. We detected the virus in two parasite specimens: an isolate of L. infantum derived from a visceral leishmaniasis (VL) patient who was unresponsive to meglumine antimoniate treatment, and an L. major isolate originating from a great gerbil, Rhombomys opimus. The Iranian LRV sequences showed the highest similarities to an Old World L. major LRV2 and were genetically distant from LRV1 isolates detected in New World Leishmania parasites. We could not attribute treatment failure in VL patient to the presence of LRV due to the limited number of specimens analyzed. Further studies with inclusion of more clinical samples are required to elucidate the potential role of LRVs in pathogenesis or treatment failure of Old World leishmaniasis.

Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

Science.gov (United States)

Dunham, S P; Onions, D E

2001-06-21

A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

Serological and molecular survey of Leishmania parasites in apparently healthy dogs in the West Bank, Palestine

Directory of Open Access Journals (Sweden)

Hamarsheh Omar

2012-08-01

Full Text Available Abstract Background Canine visceral leishmaniasis (CVL is caused by Leishmania infantum in all Mediterranean countries. The Leishmania parasite is transmitted by the bite of a corresponding sand fly vector and primarily maintained in nature by wild and domestic reservoirs, including dogs, foxes and jackals. Infected dogs are the primary reservoir host in endemic regions and are the most significant risk disposing humans to infection. The present study aimed at assessing the prevalence of infection with Leishmania and identification of Leishmania infantum in domestic dogs in the West Bank, Palestine. Methods The infection rate among domestic dogs collected from seven districts in the Palestinian West Bank was investigated by examination of parasites in culture from the buffy coat using serological and molecular methods; based on ELISA, internal transcribed spacer 1 (ITS1 and cysteine protease (CPB PCR. Results Out of 215 dogs examined for Leishmania, 36 (16.7% were positive in at least one method. Twenty three animals (11.5% were positive for Leishmania DNA, whereas, ELISA and culture revealed 16 (7.5%, and 4 (1.5% respectively. CPB-PCR on one of three culture-positive isolates revealed Leishmania infantum as the causative agent for Leishmania infection in dogs. Conclusions Our study showed that canine leishmania infection is prevalent with varying degrees in all the seven studied districts in Palestine despite the absence of human VL cases in 4 of these districts. The causative agent was confirmed to be Leishmania infantum.

Characterization of cDNA encoding human placental anticoagulant protein (PP4): Homology with the lipocortin family

International Nuclear Information System (INIS)

Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.

1988-01-01

A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I

Evaluation of HIV-Leishmania co-infection in patients from the northwestern Paraná State, Brazil = Avaliação da co-infecção HIV-Leishmania em pacientes da região noroeste do Estado do Paraná, Brasil

Directory of Open Access Journals (Sweden)

Élide Aparecida Oliveira

2011-01-01

Full Text Available Leishmaniasis occurs throughout the world and is one of the opportunistic infections that attack HIV-infected individuals. Few data are available on American cutaneous leishmaniasis (ACL in HIV-infected patients. Current research investigates the occurrence ofHIV-Leishmania co-infection in HIV-infected individuals in an endemic region in Southern of Brazil. A non-randomized transversal investigation, molecular and serum epidemiologic type, on the occurrence of ACL in 169 HIV-infected patients was undertaken. The patients were followed up at the Integrated Nucleus of Health of the city Maringá, Southern of Brazil. Results showed that 13 (7.7% of the HIV-infected patients also presented Leishmania (Viannia DNA, detectable in blood by PCR. Serology, direct research, culture and PCR in skin material produced negative results. PCR positiveness for Leishmania was not associated with CD4 T lymphocytes count, opportunistic disease, treatment, use of proteases inhibitors, tattooing/piercing or use of injectable drugs, residential environment or previous ACL history. Results show that HIVinfected patients who live in endemic areas may reveal Leishmania DNA in the blood without any ACL symptoms. Above findings may be attributed to anti-retrovirus medicine that controls viral replication and maintains the functionality of the immune system and to a possible anti- Leishmania activity of these drugs.As leishmanioses ocorrem em todo o mundo e são infecções oportunistas que afetam indivíduos portadores do vírus HIV. Este estudo investigou a ocorrência da co-infecção HIV-Leishmania em portadores do HIV numa região endêmica para LTA do Sul do Brasil. Foi realizado estudo transversal, não randomizado, utilizando metodologia molecular e sorológica, sobre a ocorrência de LTA em 169 portadores do HIV. Foram estudados pacientes atendidos no Núcleo Integrado de Saúde de Maringá, Paraná, Sul do Brasil. Observou-se que 13 (7,7% dos pacientes infectados

Enhancement of the priming efficacy of DNA vaccines encoding dendritic cell-targeted antigens by synergistic toll-like receptor ligands

Directory of Open Access Journals (Sweden)

Kornbluth Richard S

2009-08-01

Full Text Available Abstract Background Targeting of protein antigens to dendritic cells (DC via the DEC205 receptor enhances presentation of antigen-derived peptides on MHC-I and MHC-II molecules and, in the presence of costimulatory signals, antigen-specific immune responses. The immunogenicity and efficacy of DNA vaccination can also be enhanced by fusing the encoded antigen to single chain antibodies directed against DEC205. To further improve this strategy, we evaluated different toll-like receptor ligands (TLR and CD40 ligands (CD40L as adjuvants for DNA vaccines encoding a DEC205-single-chain antibody fused to the ovalbumin model antigen or HIV-1 Gag and assessed the priming efficacy of DNA in a DNA prime adenoviral vector boost immunization regimen. Results Mice were primed with the adjuvanted DEC-205 targeted DNA vaccines and boosted with adenoviral vectors encoding the same antigens. CD8+ T cell responses were determined after the adenoviral booster immunization, to determine how well the different DNA immunization regimens prime for the adenoviral boost. In the absence of adjuvants, targeting of DNA-encoded ovalbumin to DCs suppressed CD8+ T-cell responses after the adenoviral booster immunization. CD8+ T-cell responses to the DEC205 targeted DNA vaccines increased only slightly by adding either the TLR-9 ligand CpG, the TLR-3 ligand Poly I:C, or CD40 ligand expression plasmids. However, the combination of both TLR-ligands led to a strong enhancement of CD8+ T-cell responses compared to a non-targeted DNA vaccine. This finding was confirmed using HIV Gag as antigen. Conclusion Although DNA prime adenoviral vector boost immunizations belong to the strongest inducers of cytotoxic T cell responses in different animal models and humans, the CD8+ T cell responses can be further improved by targeting the DNA encoded antigen to DEC205 in the presence of synergistic TLR ligands CpG and Poly I:C.

Molecular and serological detection of Leishmania spp. in captive wild animals from Ilha Solteira, SP, Brazil Detecção sorológica e molecular de Leishmania spp. em animais selvagens do zoológico de Ilha Solteira, SP, Brasil

Directory of Open Access Journals (Sweden)

Márcia Mariza Gomes Jusi

2011-09-01

Full Text Available Leishmaniasis is a zoonotic disease that affects 12 million people worldwide. Several mammalian species can serve as a reservoir for this disease. Dogs are the main reservoir for visceral leishmaniasis in urban areas, which has become a serious public health concern in Brazil. The aim of this study was to evaluate the presence of Leishmania spp. in captive wild animals from Ilha Solteira, São Paulo, Brazil. Blood and various tissues samples were collected from animals of five different species: Speothos venaticus, Chrysocyon brachyurus, Cerdocyon thous, Pseudalopex vetulus, and Procyon cancrivorus. Antibodies against Leishmania spp. were detected in three wild canids by indirect fluorescent antibody test (IFAT and enzyme-linked immunosorbent assay (ELISA. PCR analyses of blood and bone marrow from all animals were negative, but Leishmania DNA was found in the tissues and skin of seropositive animals. Positive PCR samples were also positive for Leishmania donovani complex. Analysis of sequenced PCR products showed similarities with different regions of Leishmania (Leishmania infantum and Leishmania (Leishmania chagasi kinetoplastids. Measures to control visceral leishmaniasis in wild animals kept in Brazilian zoos should be established, as no disease control programs are currently available.Leishmaniose é uma doença zoonótica que afeta cerca de 12 milhões de pessoas no mundo todo. Várias espécies mamíferas podem servir de reservatório para a doença. Os cães são considerados os principais reservatórios para a leishmaniose visceral em áreas urbanas, o que tem se tornado um sério problema de saúde pública no Brasil. O objetivo deste trabalho foi avaliar a presença de Leishmania spp. em animais selvagens mantidos no zoológico de Ilha Solteira, São Paulo, Brasil. Foram coletados amostras de sangue e tecidos de cinco espécies diferentes: Speothos venaticus, Chrysocyon brachyurus, Cerdocyon thous, Pseudalopex vetulus, e Procyon

Seasonality of sand flies (Diptera: Psychodidae) and Leishmania DNA detection in vector species in an area with endemic visceral leishmaniasis.

Science.gov (United States)

Saraiva, Lara; Leite, Camila Gonçalves; Lima, Ana Cristina Vianna Mariano da Rocha; Carvalho, Luiz Otávio Alves de; Pereira, Agnes Antônia Sampaio; Rugani, Jerônimo Marteleto Nunes; Rego, Felipe Dutra; Gontijo, Célia Maria Ferreira; Andrade, José Dilermando

2017-04-01

Leishmaniases are a serious health problem in southeast Brazil, including the city of Belo Horizonte (BH), Minas Gerais state (MG), where there are high rates of incidence and mortality due to visceral leishmaniases. BH is divided into nine sanitary districts (SD) of which one, the Venda Nova SD, was selected for this study because it has high rates of positivity for canine leishmaniasis and high incidence of human leishmaniasis. This study aimed to survey the sand fly fauna in Venda Nova SD from August 2011 to July 2013 and perform a descriptive analysis of the vector population. The sampling was carried out using automatic HP light traps at all covered areas of the Venda Nova SD, in a total of eighteen light traps. Sampled specimens were identified following Galati (2003), and females were submitted to molecular techniques for the detection and identification of Leishmania DNA. A simple environmental description was done for it area and Kernel estimation was used to infer vector density for each study site. A total of 2,427 sand fly specimens belonging to eight species and five genera were collected of which 95.3% were Lutzomyia longipalpis. The seasonal variation curve was delineated by this species. Lu. longipalpis was the most abundant at all collection points and in all months of the study, and exhibited a natural infection rate of 1.01% for Leishmania infantum and 1.77% for Leishmania braziliensis. The results show the presence and adaptation of Lu. longipalpis to the anthropic environment of BH and reinforces its role as the main vector of L. infantum in the region.

Seasonality of sand flies (Diptera: Psychodidae) and Leishmania DNA detection in vector species in an area with endemic visceral leishmaniasis

Science.gov (United States)

Saraiva, Lara; Leite, Camila Gonçalves; Lima, Ana Cristina Vianna Mariano da Rocha; de Carvalho, Luiz Otávio Alves; Pereira, Agnes Antônia Sampaio; Rugani, Jerônimo Marteleto Nunes; Rego, Felipe Dutra; Gontijo, Célia Maria Ferreira; Andrade, José Dilermando

2017-01-01

BACKGROUND Leishmaniases are a serious health problem in southeast Brazil, including the city of Belo Horizonte (BH), Minas Gerais state (MG), where there are high rates of incidence and mortality due to visceral leishmaniases. BH is divided into nine sanitary districts (SD) of which one, the Venda Nova SD, was selected for this study because it has high rates of positivity for canine leishmaniasis and high incidence of human leishmaniasis. OBJECTIVES This study aimed to survey the sand fly fauna in Venda Nova SD from August 2011 to July 2013 and perform a descriptive analysis of the vector population. METHODS The sampling was carried out using automatic HP light traps at all covered areas of the Venda Nova SD, in a total of eighteen light traps. Sampled specimens were identified following Galati (2003), and females were submitted to molecular techniques for the detection and identification of Leishmania DNA. A simple environmental description was done for it area and Kernel estimation was used to infer vector density for each study site. FINDINGS A total of 2,427 sand fly specimens belonging to eight species and five genera were collected of which 95.3% were Lutzomyia longipalpis. The seasonal variation curve was delineated by this species. Lu. longipalpis was the most abundant at all collection points and in all months of the study, and exhibited a natural infection rate of 1.01% for Leishmania infantum and 1.77% for Leishmania braziliensis. MAIN CONCLUSIONS The results show the presence and adaptation of Lu. longipalpis to the anthropic environment of BH and reinforces its role as the main vector of L. infantum in the region. PMID:28327794

Lab-on-a-chip platform for high throughput drug discovery with DNA-encoded chemical libraries

Science.gov (United States)

Grünzner, S.; Reddavide, F. V.; Steinfelder, C.; Cui, M.; Busek, M.; Klotzbach, U.; Zhang, Y.; Sonntag, F.

2017-02-01

The fast development of DNA-encoded chemical libraries (DECL) in the past 10 years has received great attention from pharmaceutical industries. It applies the selection approach for small molecular drug discovery. Because of the limited choices of DNA-compatible chemical reactions, most DNA-encoded chemical libraries have a narrow structural diversity and low synthetic yield. There is also a poor correlation between the ranking of compounds resulted from analyzing the sequencing data and the affinity measured through biochemical assays. By combining DECL with dynamical chemical library, the resulting DNA-encoded dynamic library (EDCCL) explores the thermodynamic equilibrium of reversible reactions as well as the advantages of DNA encoded compounds for manipulation/detection, thus leads to enhanced signal-to-noise ratio of the selection process and higher library quality. However, the library dynamics are caused by the weak interactions between the DNA strands, which also result in relatively low affinity of the bidentate interaction, as compared to a stable DNA duplex. To take advantage of both stably assembled dual-pharmacophore libraries and EDCCLs, we extended the concept of EDCCLs to heat-induced EDCCLs (hi-EDCCLs), in which the heat-induced recombination process of stable DNA duplexes and affinity capture are carried out separately. To replace the extremely laborious and repetitive manual process, a fully automated device will facilitate the use of DECL in drug discovery. Herein we describe a novel lab-on-a-chip platform for high throughput drug discovery with hi-EDCCL. A microfluidic system with integrated actuation was designed which is able to provide a continuous sample circulation by reducing the volume to a minimum. It consists of a cooled and a heated chamber for constant circulation. The system is capable to generate stable temperatures above 75 °C in the heated chamber to melt the double strands of the DNA and less than 15 °C in the cooled chamber

Leishmania (V.) braziliensis infecting bats from Pantanal wetland, Brazil: First records for Platyrrhinus lineatus and Artibeus planirostris.

Science.gov (United States)

de Castro Ferreira, Eduardo; Pereira, Agnes Antônio Sampaio; Silveira, Maurício; Margonari, Carina; Marcon, Glaucia Elisete Barbosa; de Oliveira França, Adriana; Castro, Ludiele Souza; Bordignon, Marcelo Oscar; Fischer, Erich; Tomas, Walfrido Moraes; Dorval, Maria Elizabeth Cavalheiros; Gontijo, Célia Maria Ferreira

2017-08-01

In the New World genus Leishmania parasites are etiological agents of neglected zoonoses known as leishmaniasis. Its epidemiology is very complex due to the participation of several species of sand fly vectors and mammalian hosts, and man is an accidental host. Control is very difficult because of the different epidemiological patterns of transmission observed. Studies about Leishmania spp. infection in bats are so scarce, which represents a large gap in knowledge about the role of these animals in the transmission cycle of these pathogens, especially when considering that Chiroptera is one of the most abundant and diverse orders among mammals. Leishmaniasis in Mato Grosso do Sul, Brazil are remarkably frequent, probably due to the abundance of its regional mastofauna. The recent record of L. braziliensis in bats from this state indicates the need to clarify the role of these mammals in the transmission cycle. In this study we evaluated the presence of Leishmania parasites in the skin of different species of bats, using PCR directed to Leishmania spp. kDNA for screening followed by PCR/RFLP analysis of the hsp70 gene for the identification of parasite species. Leishmania species identification was confirmed by PCR directed to the G6PD gene of L. braziliensis, followed by sequencing of the PCR product. Samples from 47 bats were processed, of which in three specimens (6.38%) was detected the presence of Leishmania sp. kDNA. PCR/RFLP and sequencing identified the species involved in the infection as L. braziliensis in all of them. This is the first report of Leishmania braziliensis in bats from Pantanal ecosystem and the first record of this species in Platyrrhinus lineatus and Artibeus planirostris, bats with a wide distribution in South America. These results reinforce the need to deepen the knowledge about the possibility of bats act as reservoirs of Leishmania spp. especially considering their ability of dispersion and occupation of anthropic environments

Biomolecule-to-fluorescent-color encoder: modulation of fluorescence emission via DNA structural changes

Science.gov (United States)

Nishimura, Takahiro; Ogura, Yusuke; Yamada, Kenji; Ohno, Yuko; Tanida, Jun

2014-01-01

A biomolecule-to-fluorescent-color (B/F) encoder for optical readout of biomolecular information is proposed. In the B/F encoder, a set of fluorescence wavelengths and their intensity levels are used for coding of a biomolecular signal. A hybridization chain reaction of hairpin DNAs labeled with fluorescent reporters was performed to generate the fluorescence color codes. The fluorescence is modulated via fluorescence resonance energy transfer, which is controlled by DNA structural changes. The results demonstrate that fluorescent color codes can be configured based on two wavelengths and five intensities using the B/F encoder, and the assigned codes can be retrieved via fluorescence measurements. PMID:25071950

Canine Skin and Conjunctival Swab Samples for the Detection and Quantification of Leishmania infantum DNA in an Endemic Urban Area in Brazil

Science.gov (United States)

de Almeida Ferreira, Sidney; Leite, Rodrigo Souza; Ituassu, Leonardo Trindade; Almeida, Gregório Guilherme; Souza, Daniel Menezes; Fujiwara, Ricardo Toshio; de Andrade, Antero Silva Ribeiro; Melo, Maria Norma

2012-01-01

Background We evaluated kDNA PCR/hybridization and quantitative real-time PCR (qPCR) targeting the gene of DNA polymerase of Leishmania infantum for CVL diagnosis and assessment of parasite load in clinical samples obtained invasively and non-invasively. Methodology/Principal Findings Eighty naturally infected dogs from an endemic urban area in Brazil were used. Animals were divided into two groups based on the presence or absence of CVL clinical sings. Skin biopsies, bone marrow, blood and conjunctival swabs samples were collected and submitted to L. infantum DNA detection. In addition, anti-Leishmania antibody titers were measured by Immunofluorescence antibody test. The symptomatic dogs had increased titers compared to asymptomatic dogs (P = 0.025). The frequencies of positive results obtained by kDNA PCR/hybridization for asymptomatic and symptomatic dogs, respectively, were as follows: right conjunctiva, 77.5% and 95.0%; left conjunctiva, 75.0% and 87.5%; skin, 45.0% and 75.0%; bone marrow, 50.0% and 77.5%; and blood, 27.5% and 22.5%. In both groups, the parasite load in the skin samples was the highest (P<0.0001). The parasite loads in the conjunctival swab and bone marrow samples were statistically equivalent within each group. The parasite burden in conjunctival swabs was higher in the dogs with clinical signs than in asymptomatic dogs (P = 0.028). This same relationship was also observed in the bone marrow samples (P = 0.002). No differences in amastigotes load in the skin were detected between the groups. Conclusions The conjunctival swab is a suitable clinical sample for qualitative molecular diagnosis of CVL. The highest parasite burdens were detected in skin regardless of the presence of VL-associated clinical signs. The qPCR results emphasized the role of dogs, particularly asymptomatic dogs, as reservoirs for CVL because of the high cutaneous parasite loads. These results may help to explain the maintenance of high transmission rates and

Effects of nitro-heterocyclic derivatives against Leishmania (Leishmania) infantum promastigotes and intracellular amastigotes.

Science.gov (United States)

Petri e Silva, Simone Carolina Soares; Palace-Berl, Fanny; Tavares, Leoberto Costa; Soares, Sandra Regina Castro; Lindoso, José Angelo Lauletta

2016-04-01

Leishmaniasis is an overlooked tropical disease affecting approximately 1 million people in several countries. Clinical manifestation depends on the interaction between Leishmania and the host's immune response. Currently available treatment options for leishmaniasis are limited and induce severe side effects. In this research, we tested nitro-heterocyclic compounds (BSF series) as a new alternative against Leishmania. Its activity was measured in Leishmania (Leishmania) infantum promastigotes and intracellular amastigotes using MTT colorimetric assay. Additionally, we assessed the phosphatidylserine exposure by promastigotes, measured by flow cytometry, as well as nitric oxide production, measured by Griess' method. The nitro-heterocyclic compounds (BSF series) showed activity against L. (L.) infantum promastigotes, inducting the phosphatidylserine exposition by promastigotes, decreasing intracellular amastigotes and increasing oxide nitric production. The selectivity index was more prominent to Leishmania than to macrophages. Compared to amphotericin b, our compounds presented higher IC50, however the selectivity index was more specific to parasite than to amphotericin b. In conclusion, these nitro-heterocyclic compounds showed to be promising as an anti-Leishmania drug, in in vitro studies. Copyright © 2016 Elsevier Inc. All rights reserved.

Leishmania (L. mexicana infected bats in Mexico: novel potential reservoirs.

Directory of Open Access Journals (Sweden)

Miriam Berzunza-Cruz

2015-01-01

Full Text Available Leishmania (Leishmania mexicana causes cutaneous leishmaniasis, an endemic zoonosis affecting a growing number of patients in the southeastern states of Mexico. Some foci are found in shade-grown cocoa and coffee plantations, or near perennial forests that provide rich breeding grounds for the sand fly vectors, but also harbor a variety of bat species that live off the abundant fruits provided by these shade-giving trees. The close proximity between sand flies and bats makes their interaction feasible, yet bats infected with Leishmania (L. mexicana have not been reported. Here we analyzed 420 bats from six states of Mexico that had reported patients with leishmaniasis. Tissues of bats, including skin, heart, liver and/or spleen were screened by PCR for Leishmania (L. mexicana DNA. We found that 41 bats (9.77%, belonging to 13 species, showed positive PCR results in various tissues. The infected tissues showed no evidence of macroscopic lesions. Of the infected bats, 12 species were frugivorous, insectivorous or nectarivorous, and only one species was sanguivorous (Desmodus rotundus, and most of them belonged to the family Phyllostomidae. The eco-region where most of the infected bats were caught is the Gulf Coastal Plain of Chiapas and Tabasco. Through experimental infections of two Tadarida brasiliensis bats in captivity, we show that this species can harbor viable, infective Leishmania (L. mexicana parasites that are capable of infecting BALB/c mice. We conclude that various species of bats belonging to the family Phyllostomidae are possible reservoir hosts for Leishmania (L. mexicana, if it can be shown that such bats are infective for the sand fly vector. Further studies are needed to determine how these bats become infected, how long the parasite remains viable inside these potential hosts and whether they are infective to sand flies to fully evaluate their impact on disease epidemiology.

Leishmania (L.) mexicana Infected Bats in Mexico: Novel Potential Reservoirs

Science.gov (United States)

Berzunza-Cruz, Miriam; Rodríguez-Moreno, Ángel; Gutiérrez-Granados, Gabriel; González-Salazar, Constantino; Stephens, Christopher R.; Hidalgo-Mihart, Mircea; Marina, Carlos F.; Rebollar-Téllez, Eduardo A.; Bailón-Martínez, Dulce; Balcells, Cristina Domingo; Ibarra-Cerdeña, Carlos N.; Sánchez-Cordero, Víctor; Becker, Ingeborg

2015-01-01

Leishmania (Leishmania) mexicana causes cutaneous leishmaniasis, an endemic zoonosis affecting a growing number of patients in the southeastern states of Mexico. Some foci are found in shade-grown cocoa and coffee plantations, or near perennial forests that provide rich breeding grounds for the sand fly vectors, but also harbor a variety of bat species that live off the abundant fruits provided by these shade-giving trees. The close proximity between sand flies and bats makes their interaction feasible, yet bats infected with Leishmania (L.) mexicana have not been reported. Here we analyzed 420 bats from six states of Mexico that had reported patients with leishmaniasis. Tissues of bats, including skin, heart, liver and/or spleen were screened by PCR for Leishmania (L.) mexicana DNA. We found that 41 bats (9.77%), belonging to 13 species, showed positive PCR results in various tissues. The infected tissues showed no evidence of macroscopic lesions. Of the infected bats, 12 species were frugivorous, insectivorous or nectarivorous, and only one species was sanguivorous (Desmodus rotundus), and most of them belonged to the family Phyllostomidae. The eco-region where most of the infected bats were caught is the Gulf Coastal Plain of Chiapas and Tabasco. Through experimental infections of two Tadarida brasiliensis bats in captivity, we show that this species can harbor viable, infective Leishmania (L.) mexicana parasites that are capable of infecting BALB/c mice. We conclude that various species of bats belonging to the family Phyllostomidae are possible reservoir hosts for Leishmania (L.) mexicana, if it can be shown that such bats are infective for the sand fly vector. Further studies are needed to determine how these bats become infected, how long the parasite remains viable inside these potential hosts and whether they are infective to sand flies to fully evaluate their impact on disease epidemiology. PMID:25629729

Encoded novel forms of HSP70 or a cytolytic protein increase DNA vaccine potency.

Science.gov (United States)

Garrod, Tamsin; Grubor-Bauk, Branka; Yu, Stanley; Gargett, Tessa; Gowans, Eric J

2014-01-01

In humans, DNA vaccines have failed to demonstrate the equivalent levels of immunogenicity that were shown in smaller animals. Previous studies have encoded adjuvants, predominantly cytokines, within these vaccines in an attempt to increase antigen-specific immune responses. However, these strategies have lacked breadth of innate immune activation and have led to disappointing results in clinical trials. Damage associated molecular patterns (DAMPs) have been identified as pattern recognition receptor (PRR) agonists. DAMPs can bind to a wide range of PRRs on dendritic cells (DCs) and thus our studies have aimed to utilize this characteristic to act as an adjuvant in a DNA vaccine approach. Specifically, HSP70 has been identified as a DAMP, but has been limited by its lack of accessibility to PRRs in and on DCs. Here, we discuss the promising results achieved with the inclusion of membrane-bound or secreted HSP70 into a DNA vaccine encoding HIV gag as the model immunogen.

Serological and molecular survey of Leishmania infection in dogs from Luanda, Angola.

Science.gov (United States)

Vilhena, Hugo; Granada, Sara; Oliveira, Ana Cristina; Schallig, Henk D F H; Nachum-Biala, Yaarit; Cardoso, Luís; Baneth, Gad

2014-03-24

Canine leishmaniosis (CanL) due to Leishmania infantum is a global zoonosis endemic in more than 70 countries in Europe, North Africa, Asia and America; however, data on this infection is scarce from southern Africa. The aim of this study was to survey dogs in Luanda, Angola, for Leishmania infection. One hundred-and-three dogs presented to a veterinary medical centre in Luanda were serologically and molecularly assessed for Leishmania with the direct agglutination test (DAT) and polymerase chain reaction (PCR). Two dogs were seropositive, with DAT titres of 800 and ≥6400; the latter was also found to be PCR-positive and confirmed to be infected with L. infantum by DNA sequence analysis. No other dog was found to be PCR-positive. The first dog had been imported from Portugal, but the latter had never left Angola (neither had its parents), strongly suggesting an autochthonous infection. Although other cases of CanL have previously been described in the country, this is the first reported study of canine Leishmania infection at the population level, as well as the first report on the molecular characterization of L. infantum in dogs from Angola.

Sequence of a cDNA encoding turtle high mobility group 1 protein.

Science.gov (United States)

Zheng, Jifang; Hu, Bi; Wu, Duansheng

2005-07-01

In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

Leishmania infantum EndoG is an endo/exo-nuclease essential for parasite survival.

Directory of Open Access Journals (Sweden)

Eva Rico

Full Text Available EndoG, a member of the DNA/RNA non-specific ββα-metal family of nucleases, has been demonstrated to be present in many organisms, including Trypanosomatids. This nuclease participates in the apoptotic program in these parasites by migrating from the mitochondrion to the nucleus, where it takes part in the degradation of genomic DNA that characterizes this process. We now demonstrate that Leishmania infantum EndoG (LiEndoG is an endo-exonuclease that has a preferential 5' exonuclease activity on linear DNA. Regardless of its role during apoptotic cell death, this enzyme seems to be necessary during normal development of the parasites as indicated by the reduced growth rates observed in LiEndoG hemi-knockouts and their poor infectivity in differentiated THP-1 cells. The pro-life role of this protein is also corroborated by the higher survival rates of parasites that over-express this protein after treatment with the LiEndoG inhibitor Lei49. Taken together, our results demonstrate that this enzyme plays essential roles in both survival and death of Leishmania parasites.

Changes to cholesterol trafficking in macrophages by Leishmania parasites infection.

Science.gov (United States)

Semini, Geo; Paape, Daniel; Paterou, Athina; Schroeder, Juliane; Barrios-Llerena, Martin; Aebischer, Toni

2017-08-01

Leishmania spp. are protozoan parasites that are transmitted by sandfly vectors during blood sucking to vertebrate hosts and cause a spectrum of diseases called leishmaniases. It has been demonstrated that host cholesterol plays an important role during Leishmania infection. Nevertheless, little is known about the intracellular distribution of this lipid early after internalization of the parasite. Here, pulse-chase experiments with radiolabeled cholesteryl esterified to fatty acids bound to low-density lipoproteins indicated that retention of this source of cholesterol is increased in parasite-containing subcellular fractions, while uptake is unaffected. This is correlated with a reduction or absence of detectable NPC1 (Niemann-Pick disease, type C1), a protein responsible for cholesterol efflux from endocytic compartments, in the Leishmania mexicana habitat and infected cells. Filipin staining revealed a halo around parasites within parasitophorous vacuoles (PV) likely representing free cholesterol accumulation. Labeling of host cell membranous cholesterol by fluorescent cholesterol species before infection revealed that this pool is also trafficked to the PV but becomes incorporated into the parasites' membranes and seems not to contribute to the halo detected by filipin. This cholesterol sequestration happened early after infection and was functionally significant as it correlated with the upregulation of mRNA-encoding proteins required for cholesterol biosynthesis. Thus, sequestration of cholesterol by Leishmania amastigotes early after infection provides a basis to understand perturbation of cholesterol-dependent processes in macrophages that were shown previously by others to be necessary for their proper function in innate and adaptive immune responses. © 2017 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Comparison of Leishmania typing results obtained from 16 European clinical laboratories in 2014.

Science.gov (United States)

Van der Auwera, Gert; Bart, Aldert; Chicharro, Carmen; Cortes, Sofia; Davidsson, Leigh; Di Muccio, Trentina; Dujardin, Jean-Claude; Felger, Ingrid; Paglia, Maria Grazia; Grimm, Felix; Harms, Gundel; Jaffe, Charles L; Manser, Monika; Ravel, Christophe; Robert-Gangneux, Florence; Roelfsema, Jeroen; Töz, Seray; Verweij, Jaco J; Chiodini, Peter L

2016-12-08

Leishmaniasis is endemic in southern Europe, and in other European countries cases are diagnosed in travellers who have visited affected areas both within the continent and beyond. Prompt and accurate diagnosis poses a challenge in clinical practice in Europe. Different methods exist for identification of the infecting Leishmania species. Sixteen clinical laboratories in 10 European countries, plus Israel and Turkey, conducted a study to assess their genotyping performance. DNA from 21 promastigote cultures of 13 species was analysed blindly by the routinely used typing method. Five different molecular targets were used, which were analysed with PCR-based methods. Different levels of identification were achieved, and either the Leishmania subgenus, species complex, or actual species were reported. The overall error rate of strains placed in the wrong complex or species was 8.5%. Various reasons for incorrect typing were identified. The study shows there is considerable room for improvement and standardisation of Leishmania typing. The use of well validated standard operating procedures is recommended, covering testing, interpretation, and reporting guidelines. Application of the internal transcribed spacer 1 of the rDNA array should be restricted to Old World samples, while the heat-shock protein 70 gene and the mini-exon can be applied globally. This article is copyright of The Authors, 2016.

Immunogenicity and efficacy of a bivalent DNA vaccine containing LeIF and TSA genes against murine cutaneous leishmaniasis.

Science.gov (United States)

Maspi, Nahid; Ghaffarifar, Fatemeh; Sharifi, Zohreh; Dalimi, Abdolhossein; Dayer, Mohammad Saaid

2017-03-01

There is no effective vaccine for the prevention and elimination of leishmaniasis. For this reason, we assessed the protective effects of DNA vaccines containing LeIF, TSA genes alone, or LeIF-TSA fusion against cutaneous leishmaniasis pEGFP-N1 plasmid (empty vector) and phosphate buffer saline (PBS) were used as control groups. Therefore, cellular and humoral immune responses were evaluated before and after the challenge with Leishmania major. Lesion diameter was also measured 3-12 weeks after challenge. All immunized mice with plasmid DNA encoding Leishmania antigens induced the partial immunity characterized by increased IFN-γ and IgG2a levels compared with control groups (p TSA, and LeIF-TSA, respectively, than in PBS group at 12th week post infection. IFN/IL-4 and IgG2a/IgG1 ratios indicated that group receiving LeIF-TSA fusion had the highest IFN-γ and IgG2a levels. In this study, DNA immunization promoted Th1 immune response characterized by higher IFN-γ and IgG2a levels and also reduction in lesion size. These results showed that a bivalent vaccine containing two distinct antigens may induce more potent immune responses against leishmaniasis. © 2017 APMIS. Published by John Wiley & Sons Ltd.

The DNA-encoded nucleosome organization of a eukaryotic genome.

Science.gov (United States)

Kaplan, Noam; Moore, Irene K; Fondufe-Mittendorf, Yvonne; Gossett, Andrea J; Tillo, Desiree; Field, Yair; LeProust, Emily M; Hughes, Timothy R; Lieb, Jason D; Widom, Jonathan; Segal, Eran

2009-03-19

Nucleosome organization is critical for gene regulation. In living cells this organization is determined by multiple factors, including the action of chromatin remodellers, competition with site-specific DNA-binding proteins, and the DNA sequence preferences of the nucleosomes themselves. However, it has been difficult to estimate the relative importance of each of these mechanisms in vivo, because in vivo nucleosome maps reflect the combined action of all influencing factors. Here we determine the importance of nucleosome DNA sequence preferences experimentally by measuring the genome-wide occupancy of nucleosomes assembled on purified yeast genomic DNA. The resulting map, in which nucleosome occupancy is governed only by the intrinsic sequence preferences of nucleosomes, is similar to in vivo nucleosome maps generated in three different growth conditions. In vitro, nucleosome depletion is evident at many transcription factor binding sites and around gene start and end sites, indicating that nucleosome depletion at these sites in vivo is partly encoded in the genome. We confirm these results with a micrococcal nuclease-independent experiment that measures the relative affinity of nucleosomes for approximately 40,000 double-stranded 150-base-pair oligonucleotides. Using our in vitro data, we devise a computational model of nucleosome sequence preferences that is significantly correlated with in vivo nucleosome occupancy in Caenorhabditis elegans. Our results indicate that the intrinsic DNA sequence preferences of nucleosomes have a central role in determining the organization of nucleosomes in vivo.

Natural infection of phlebotomines (Diptera: Psychodidae) by Leishmania (Leishmania) amazonensis in an area of ecotourism in Central-Western Brazil.

Science.gov (United States)

Brilhante, Andreia Fernandes; Nunes, Vânia Lúcia Brandão; Kohatsu, Kleber Augusto; Galati, Eunice Aparecida Bianchi; Rocca, Maria Elizabeth Ghizzi; Ishikawa, Edna Aoba Yassui

2015-01-01

Bonito municipality, known as an area of ecoturism, in Mato Grosso do Sul state, Brazil, is also a focus of visceral and cutaneous leishmaniases, with cases registered in both human and canine populations. This study sought to investigate natural infection by flagellate forms of Leishmania in phlebotomines of the urban area of Bonito. Sand flies were collected fortnightly from October 2005 to July 2006 with modified automatic light traps installed in peridomiciles and animal shelters in the center and on the outskirts of the city. The females were dissected and their guts observed under an optical microscope. A total of 1977 specimens were captured, Lutzomyia longipalpis (88.4 %) and Bichromomyia flaviscutelata (3.0 %) being the most frequent species. Bi. flaviscutellata was found infected by flagellates that were identified as Leishmania (Leishmania) amazonensis by indirect immunofluorescence reaction, employing monoclonal antibodies and the biotin-avidin system. This is the first report of natural infection by L. amazonensis in Bi. flaviscutellata in a Brazilian urban area. As Bi. flaviscutellata is only slightly attracted by humans, the transmission of L. amazonensis in the study area may have a zoonotic character; however, the sympatric occurrence of this parasite and Lu. longipalpis should be taken into consideration by the local health authorities since this sand fly has already been found with L. amazonensis DNA in a focus of canine visceral leishmaniasis in Bonito municipality.

Leishmania OligoC-TesT as a simple, rapid, and standardized tool for molecular diagnosis of cutaneous leishmaniasis in Peru.

Science.gov (United States)

Espinosa, Diego; Boggild, Andrea K; Deborggraeve, Stijn; Laurent, Thierry; Valencia, Cristian; Pacheco, Rosa; Miranda-Verástegui, César; Llanos-Cuentas, Alejandro; Leclipteux, Thierry; Dujardin, Jean-Claude; Büscher, Philippe; Arévalo, Jorge

2009-08-01

Molecular methods such as PCR have become attractive tools for diagnosis of cutaneous leishmaniasis (CL), both for their high sensitivity and for their specificity. However, their practical use in routine diagnosis is limited due to the infrastructural requirements and the lack of any standardization. Recently, a simplified and standardized PCR format for molecular detection of Leishmania was developed. The Leishmania OligoC-TesT is based on simple and rapid detection using a dipstick with PCR-amplified Leishmania DNA. In this study, we estimated the diagnostic accuracy of the Leishmania OligoC-TesT for 61 specimens from 44 CL-suspected patients presenting at the leishmaniasis clinic of the Instituto de Medicina Tropical Alexander von Humboldt, Peru. On the basis of parasitological detection and the leishmanin skin test (LST), patients were classified as (i) confirmed CL cases, (ii) LST-positive cases, and (iii) LST-negative cases. The sensitivities of the Leishmania OligoC-TesT was 74% (95% confidence interval (CI), 60.5% to 84.1%) for lesion aspirates and 92% (95% CI, 81.2% to 96.9%) for scrapings. A significantly higher sensitivity was observed with a conventional PCR targeting the kinetoplast DNA on the aspirates (94%) (P = 0.001), while there was no significant difference in sensitivity for the lesion scrapings (88%) (P = 0.317). In addition, the Leishmania OligoC-TesT was evaluated for 13 CL-suspected patients in two different peripheral health centers in the central jungle of Peru. Our findings clearly indicate the high accuracy of the Leishmania OligoC-TesT for lesion scrapings for simple and rapid molecular diagnosis of CL in Peru.

Leishmania OligoC-TesT as a Simple, Rapid, and Standardized Tool for Molecular Diagnosis of Cutaneous Leishmaniasis in Peru▿

Science.gov (United States)

Espinosa, Diego; Boggild, Andrea K.; Deborggraeve, Stijn; Laurent, Thierry; Valencia, Cristian; Pacheco, Rosa; Miranda-Verástegui, César; Llanos-Cuentas, Alejandro; Leclipteux, Thierry; Dujardin, Jean-Claude; Büscher, Philippe; Arévalo, Jorge

2009-01-01

Molecular methods such as PCR have become attractive tools for diagnosis of cutaneous leishmaniasis (CL), both for their high sensitivity and for their specificity. However, their practical use in routine diagnosis is limited due to the infrastructural requirements and the lack of any standardization. Recently, a simplified and standardized PCR format for molecular detection of Leishmania was developed. The Leishmania OligoC-TesT is based on simple and rapid detection using a dipstick with PCR-amplified Leishmania DNA. In this study, we estimated the diagnostic accuracy of the Leishmania OligoC-TesT for 61 specimens from 44 CL-suspected patients presenting at the leishmaniasis clinic of the Instituto de Medicina Tropical Alexander von Humboldt, Peru. On the basis of parasitological detection and the leishmanin skin test (LST), patients were classified as (i) confirmed CL cases, (ii) LST-positive cases, and (iii) LST-negative cases. The sensitivities of the Leishmania OligoC-TesT was 74% (95% confidence interval (CI), 60.5% to 84.1%) for lesion aspirates and 92% (95% CI, 81.2% to 96.9%) for scrapings. A significantly higher sensitivity was observed with a conventional PCR targeting the kinetoplast DNA on the aspirates (94%) (P = 0.001), while there was no significant difference in sensitivity for the lesion scrapings (88%) (P = 0.317). In addition, the Leishmania OligoC-TesT was evaluated for 13 CL-suspected patients in two different peripheral health centers in the central jungle of Peru. Our findings clearly indicate the high accuracy of the Leishmania OligoC-TesT for lesion scrapings for simple and rapid molecular diagnosis of CL in Peru. PMID:19553579

Leishmania infantum nicotinamidase is required for late-stage development in its natural sand fly vector, Phlebotomus perniciosus.

Science.gov (United States)

Gazanion, Elodie; Seblova, Veronika; Votypka, Jan; Vergnes, Baptiste; Garcia, Déborah; Volf, Petr; Sereno, Denis

2012-04-01

Leishmania infantum nicotinamidase, encoded by the Lipnc1 gene, converts nicotinamide into nicotinicacid to ensure Nicotinamide–Adenine–Dinucleotide (NAD+) biosynthesis. We were curious to explore the role of this enzyme during L. infantum development in its natural sand fly vector, Phlebotomus perniciosus (Diptera, Phlebotominae), using null mutants with a deleted Lipnc1 gene. The null mutants developed as well as the wild type L. infantum at the early time points post their ingestion within the bloodmeal. In contrast, once the blood meal digestion was completed, the null mutants were unable to develop further and establish late-stage infections. Data highlight the importance of the nicotinamide degradation pathway for Leishmania development in sand flies. They indicate that the endogenous nicotinamidase is essential for Leishmania development in the sand fly after the blood meal has been digested and the remnants defecated.

Cross-species genetic exchange between visceral and cutaneous strains of Leishmania in the sand fly vector.

Science.gov (United States)

Romano, Audrey; Inbar, Ehud; Debrabant, Alain; Charmoy, Melanie; Lawyer, Phillip; Ribeiro-Gomes, Flavia; Barhoumi, Mourad; Grigg, Michael; Shaik, Jahangheer; Dobson, Deborah; Beverley, Stephen M; Sacks, David L

2014-11-25

Genetic exchange between Leishmania major strains during their development in the sand fly vector has been experimentally shown. To investigate the possibility of genetic exchange between different Leishmania species, a cutaneous strain of L. major and a visceral strain of Leishmania infantum, each bearing a different drug-resistant marker, were used to coinfect Lutzomyia longipalpis sand flies. Eleven double-drug-resistant progeny clones, each the product of an independent mating event, were generated and submitted to genotype and phenotype analyses. The analysis of multiple allelic markers across the genome suggested that each progeny clone inherited at least one full set of chromosomes from each parent, with loss of heterozygosity at some loci, and uniparental retention of maxicircle kinetoplast DNA. Hybrids with DNA contents of approximately 2n, 3n, and 4n were observed. In vivo studies revealed clear differences in the ability of the hybrids to produce pathology in the skin or to disseminate to and grow in the viscera, suggesting polymorphisms and differential inheritance of the gene(s) controlling these traits. The studies, to our knowledge, represent the first experimental confirmation of cross-species mating in Leishmania, opening the way toward genetic linkage analysis of important traits and providing strong evidence that genetic exchange is responsible for the generation of the mixed-species genotypes observed in natural populations.

Immunogenicity of DNA vaccines encoding simian immunodeficiency virus antigen targeted to dendritic cells in rhesus macaques.

Directory of Open Access Journals (Sweden)

Matthias Tenbusch

Full Text Available BACKGROUND: Targeting antigens encoded by DNA vaccines to dendritic cells (DCs in the presence of adjuvants enhances their immunogenicity and efficacy in mice. METHODOLOGY/PRINCIPAL FINDINGS: To explore the immunogenicity of this approach in non-human primates, we generated a single chain antibody to the antigen uptake receptor DEC-205 expressed on rhesus macaque DCs. DNA vaccines encoding this single chain antibody fused to the SIV capsid protein were delivered to six monkeys each by either intramuscular electroporation or conventional intramuscular injection co-injected or not with poly ICLC, a stabilized poly I: C analogue, as adjuvant. Antibodies to capsid were induced by the DC-targeting and non-targeting control DNA delivered by electroporation while conventional DNA immunization at a 10-fold higher dose of DNA failed to induce detectable humoral immune responses. Substantial cellular immune responses were also observed after DNA electroporation of both DNAs, but stronger responses were induced by the non-targeting vaccine. Conventional immunization with the DC-targeting DNA at a 10-fold higher dose did not give rise to substantial cellular immune responses, neither when co-injected with poly ICLC. CONCLUSIONS/SIGNIFICANCE: The study confirms the potent immunogenicity of DNA vaccines delivered by electroporation. Targeting the DNA via a single chain antibody to DEC-205 expressed by DCs, however, does not improve the immunogenicity of the antigens in non-human primates.

Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

Science.gov (United States)

Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

2016-02-17

Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Qualitative and quantitative polymerase chain reaction (PCR) for detection of Leishmania in spleen samples from naturally infected dogs.

Science.gov (United States)

Solcà, Manuela da Silva; Guedes, Carlos Eduardo Sampaio; Nascimento, Eliane Gomes; Oliveira, Geraldo Gileno de Sá; dos Santos, Washington Luis Conrado; Fraga, Deborah Bittencourt Mothé; Veras, Patrícia Sampaio Tavares

2012-03-23

Because infected dogs are widely considered to be the main domestic reservoir for Leishmania infantum (syn Leishmania chagasi) parasites in Brazil, the diagnosis of canine visceral leishmaniasis (CVL) must be made both accurately and promptly. The present study attempted to standardize a conventional polymerase chain reaction (cPCR) protocol for the detection of L. infantum DNA in canine spleen samples. Quantitative PCR (qPCR) technique was used to confirm the presence of Leishmania DNA in the canine spleen fragments. A comparison was made between the efficacies of these molecular diagnostic techniques and conventional parasitological and serological methods. cPCR protocols for spleen samples were standardized using primers that amplify a 145 bp fragment, located at the parasite kinetoplast minicircle. The genus specificity of the cPCR protocol was assessed by its inability to amplify the DNA of other common canine pathogens, such as Ehrlichia canis, Babesia canis, Toxoplasma gondii and Trypanosoma cruzi. cPCR protocol sensitivity was tested by assessing the reaction detection limit, determined to be 10 fg of L. infantum reference strain DNA, which corresponds to a range of 0.03-0.1 parasites per fragment. Standardized cPCR protocol was used to detect the presence of Leishmania in 45 dog spleen samples. Our results showed that 40% of the spleen fragment cultures were positive for Leishmania parasites, 58% of the dog serum samples tested positive using ELISA, and parasite DNA was detected in 44% using qPCR, while 47% of the spleen samples using cPCR. Diagnostic methods performance was assessed and revealed a better degree of ascertainment for cPCR when compared to other diagnostic methods. The sensitivity of ELISA was 83.3%, qPCR was 83.3%, and cPCR was 88.9%; PPV for ELISA was 57.7%, qPCR was 75% and cPCR was 76.2%; the Kappa coefficients were found to be 0.40 (fair) for ELISA, 0.64 (substantial) for qPCR and 0.68 (substantial) for cPCR. In both oligosymptomatic

Phlebotomine sandfly (Diptera: Psychodidae) diversity and their Leishmania DNA in a hot spot of American Cutaneous Leishmaniasis human cases along the Brazilian border with Peru and Bolivia.

Science.gov (United States)

Teles, Carolina Bioni Garcia; Santos, Ana Paula de Azevedo Dos; Freitas, Rui Alves; Oliveira, Arley Faria José de; Ogawa, Guilherme Maerschner; Rodrigues, Moreno Souza; Pessoa, Felipe Arley Costa; Medeiros, Jansen Fernandes; Camargo, Luís Marcelo Aranha

2016-06-10

In this study, we identified the phlebotomine sandfly vectors involved in the transmission of American Cutaneous Leishmaniasis (ACL) in Assis Brasil, Acre, Brazil, which is located on the Brazil-Peru-Bolivia frontier. The genotyping of Leishmania in phlebotomines was performed using polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism. A total of 6,850 sandflies comprising 67 species were captured by using CDC light traps in rural areas of the municipality. Three sandfly species were found in the state of Acre for the first time: Lutzomyia georgii, Lu. complexa and Lu. evangelistai. The predominant species was Lu. auraensis/Lu. ruifreitasi and Lu. davisi (total 59.27%). 32 of 368 pools were positive for the presence of Leishmania DNA (16 pools corresponding to Lu. davisi, and 16 corresponding to Lu. auraensis/Lu. ruifreitasi), with a minimal infection prevalence of 1.85% in Lu. davisi and 2.05% in Lu. auraensis/Lu. ruifreitasi. The Leishmania species found showed maximum identity with L. (Viannia) guyanensis and L. (V.) braziliensis in both phlebotomine species. Based on these results and similar scenarios previously described along the Brazil/Peru/Bolivia tri-border, the studied area must take into consideration the possibility of Lu. davisi and Lu. auraensis/Lu. ruifreitasi as probable vectors of ACL in this municipality.

Phlebotomine sandfly (Diptera: Psychodidae) diversity and their Leishmania DNA in a hot spot of American Cutaneous Leishmaniasis human cases along the Brazilian border with Peru and Bolivia

Science.gov (United States)

Teles, Carolina Bioni Garcia; dos Santos, Ana Paula de Azevedo; Freitas, Rui Alves; de Oliveira, Arley Faria José; Ogawa, Guilherme Maerschner; Rodrigues, Moreno Souza; Pessoa, Felipe Arley Costa; Medeiros, Jansen Fernandes; Camargo, Luís Marcelo Aranha

2016-01-01

In this study, we identified the phlebotomine sandfly vectors involved in the transmission of American Cutaneous Leishmaniasis (ACL) in Assis Brasil, Acre, Brazil, which is located on the Brazil-Peru-Bolivia frontier. The genotyping of Leishmania in phlebotomines was performed using polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism. A total of 6,850 sandflies comprising 67 species were captured by using CDC light traps in rural areas of the municipality. Three sandfly species were found in the state of Acre for the first time: Lutzomyia georgii, Lu. complexa and Lu. evangelistai. The predominant species was Lu. auraensis/Lu. ruifreitasi and Lu. davisi (total 59.27%). 32 of 368 pools were positive for the presence of Leishmania DNA (16 pools corresponding to Lu. davisi, and 16 corresponding to Lu. auraensis/Lu. ruifreitasi), with a minimal infection prevalence of 1.85% in Lu. davisi and 2.05% in Lu. auraensis/Lu. ruifreitasi. The Leishmania species found showed maximum identity with L. (Viannia) guyanensis and L. (V.) braziliensis in both phlebotomine species. Based on these results and similar scenarios previously described along the Brazil/Peru/Bolivia tri-border, the studied area must take into consideration the possibility of Lu. davisi and Lu. auraensis/Lu. ruifreitasi as probable vectors of ACL in this municipality. PMID:27304023

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

1999-05-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

cDNA encoding a polypeptide including a hevein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

1995-03-21

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

RNase-L regulates the stability of mitochondrial DNA-encoded mRNAs in mouse embryo fibroblasts

International Nuclear Information System (INIS)

Chandrasekaran, Krish; Mehrabian, Zara; Li Xiaoling; Hassel, Bret

2004-01-01

Accelerated decrease in the levels of mitochondrial DNA-encoded mRNA (mt-mRNA) occurs in neuronal cells exposed either to the excitatory amino acid, glutamate or to the sodium ionophore, monensin, suggesting a role of mitochondrial RNase(s) on the stability of mt-mRNAs. Here we report that in mouse embryo fibroblasts that are devoid of the interferon-regulated RNase, RNase-L, the monensin-induced decrease in the half-life of mt-mRNA was reduced. In monensin (250 nM)-treated RNase-L +/+ cells the average half-life of mt-mRNA, determined after termination of transcription with actinomycin D, was found to be 3 h, whereas in monensin-treated RNase-L -/- cells the half-life of mt-mRNA was >6 h. In contrast, the stability of nuclear DNA-encoded β-actin mRNA was unaffected. Induction of RNase-L expression in mouse 3T3 fibroblasts further decreased the monensin-induced reduction in mt-mRNA half-life to 1.5 h. The results indicate that the RNase-L-dependent decrease in mtDNA-encoded mRNA transcript levels occurs through a decrease in the half-life of mt-mRNA, and that RNase-L may play a role in the stability of mt-mRNA

Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

Science.gov (United States)

Bell, Nicholas A. W.; Keyser, Ulrich F.

2016-07-01

The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

Inhibition of growth of Leishmania mexicana mexicana by Leishmania mexicana amazonensis during "in vitro" co-cultivation Inibição do crescimento de Leishmania mexicana mexicana por Leishmania mexicana amazonensis durante o co-cultivo "in vitro"

Directory of Open Access Journals (Sweden)

Raquel S. Pacheco

1987-12-01

Full Text Available Inhibition of one Leishmania subspecies by exometabolites of another subspecies, a phenomenon not previously reported, is suggested by our recent observations in cell cloning experiments with Leishmania mexicana mexicana and Leishmania mexicana amazonensis. Clones were identified using the technique of schizodeme analysis. The phenomenon observed is clearly relevant to studies of parasite isolation, leishmanial metabolism, cross-immunity and chemotherapy.Inhibição do crescimento de um subespécie de Leishmania por exometabólitos de outra subespécie, um fenômeno ainda não notificado, é sugerido em nossas recentes observações em experimentos de clonagem celular com Leishmania mexicana mexicana e Leishmania mexicana amazonensis. Os clones foram identificados usando a técnica de análise de esquizodemas. O fenômeno observado é claramente relevante em estudos de isolamento parasitário, metabolismo, imunidade cruzada e quimioterapia.

Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase

Science.gov (United States)

Roldán-Arjona, Teresa; Wei, Ying-Fei; Carter, Kenneth C.; Klungland, Arne; Anselmino, Catherine; Wang, Rui-Ping; Augustus, Meena; Lindahl, Tomas

1997-01-01

The major mutagenic base lesion in DNA caused by exposure to reactive oxygen species is 8-hydroxyguanine (8-oxo-7,8-dihydroguanine). In bacteria and Saccharomyces cerevisiae, this damaged base is excised by a DNA glycosylase with an associated lyase activity for chain cleavage. We have cloned, sequenced, and expressed a human cDNA with partial sequence homology to the relevant yeast gene. The encoded 47-kDa human enzyme releases free 8-hydroxyguanine from oxidized DNA and introduces a chain break in a double-stranded oligonucleotide specifically at an 8-hydroxyguanine residue base paired with cytosine. Expression of the human protein in a DNA repair-deficient E. coli mutM mutY strain partly suppresses its spontaneous mutator phenotype. The gene encoding the human enzyme maps to chromosome 3p25. These results show that human cells have an enzyme that can initiate base excision repair at mutagenic DNA lesions caused by active oxygen. PMID:9223306

Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth

International Nuclear Information System (INIS)

Chan, Waiyee; Liu, Qingrong; Borjigin, J.; Busch, H.; Rennert, O.M.; Tease, L.A.; Chan, Puikwong

1989-01-01

A cDNA encoding human nucleophosmin (protein B23) was obtained by screening a human placental cDNA library in δgtll first with monoclonal antibody to rat nucleophosmin and then with confirmed partial cDNA of human nucleophosmin as probes. The cDNA had 1,311 bp with a coding sequence encoding a protein of 294 amino acids. The identity of the cDNA was confirmed by the presence of encoded amino acid sequences identical with those determined by sequencing pure rat nucleophosmin (a total of 138 amino acids). The most striking feature of the sequence is an acidic cluster located in the middle of the molecule. The cluster consists of 26 Asp/Glu and 1 Phe and Ala. Comparison of human nucleophosmin and Xenopus nucleolar protein NO38 shows 64.3% sequence identity. The N-terminal 130 amino acids of human nucleophosmin also bear 50% identity with that of Xenopus nucleoplasmin. Northern blot analysis of rat liver total RNA with a partial nucleophosmin cDNA as probe demonstrated a homogeneous mRNA band of about 1.6 kb. Similar observations were made in hypertrophic rat liver and Novikoff hepatoma. When the protein levels were compared with Western blot immunoassays, Navikoff hepatoma showed 20 times more nucleophosmin, while only about 5 times more nucleophosmin was observed in hypertrophic rat liver than in unstimulated normal liver

Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

International Nuclear Information System (INIS)

Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

1988-01-01

Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

Isolation and characterization of human cDNA clones encoding the α and the α' subunits of casein kinase II

International Nuclear Information System (INIS)

Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.

1990-01-01

Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human

Leishmania major methionine sulfoxide reductase A is required for resistance to oxidative stress and efficient replication in macrophages.

Directory of Open Access Journals (Sweden)

Fiona M Sansom

Full Text Available Leishmania are protozoan parasites that proliferate within the phagolysome of mammalian macrophages. While a number of anti-oxidant systems in these parasites have been shown to protect against endogenous as well as host-generated reactive oxygen species, the potential role of enzymes involved in the repair of oxidatively damaged proteins remains uncharacterized. The Leishmania spp genomes encode a single putative methionine sulfoxide reductase (MsrA that could have a role in reducing oxidized free and proteinogenic methionine residues. A GFP-fusion of L. major MsrA was shown to have a cytoplasmic localization by immunofluorescence microscopy and subcellular fractionation. An L. major msrA null mutant, generated by targeted replacement of both chromosomal allelles, was viable in rich medium but was unable to reduce exogenous methionine sulfoxide when cultivated in the presence of this amino acid, indicating that msrA encodes a functional MsrA. The ΔmsrA mutant exhibited increased sensitivity to H(2O(2 compared to wild type parasites and was unable to proliferate normally in macrophages. Wild type sensitivity to H(2O(2 and infectivity in macrophages was restored by complementation of the mutant with a plasmid encoding MsrA. Unexpectedly, the ΔmsrA mutant was able to induce normal lesions in susceptible BALB/c indicating that this protein is not essential for pathogenesis in vivo. Our results suggest that Leishmania MsrA contributes to the anti-oxidative defences of these parasites, but that complementary oxidative defence mechansims are up-regulated in lesion amastigotes.

Leishmania (Leishmania infantum chagasi em canídeos silvestres mantidos em cativeiro, no Estado de Mato Grosso Leishmania (Leishmania infantum chagasi in wild canids kept in captivity in the State of Mato Grosso

Directory of Open Access Journals (Sweden)

Nely Pinheiro Souza

2010-06-01

Full Text Available INTRODUÇÃO: Leishmaniose visceral é uma zoonose que acomete diversos mamíferos tendo os canídeos domésticos como principais reservatórios em ambiente urbano. A presente nota descreve a infecção de canídeos silvestres por Leishmania (Leishmania infantum chagasi mantidos em cativeiro no Estado de Mato Grosso, Brasil. MÉTODOS: De seis raposas (Cerdocyon thous e um cachorro vinagre (Spheotos venaticus, foram coletadas amostras de pele, medula óssea e linfonodo para detecção e caracterização de Leishmania sp pela técnica de PCR-RFLP. RESULTADOS: Todos as animais pesquisados apresentaram-se positivos para Leishmania (L. infantum chagasi. CONCLUSÕES: Destaca-se a importância de monitoramento adequado dos mesmos, além do maior controle desta enfermidade já que estes animais estão em ambientes de recreação pública.INTRODUCTION: Visceral leishmaniasis is a zoonosis that affects many mammals, and domestic canids are the main reservoirs in urban environments. This note describes infection by Leishmania (Leishmania infantum chagasi among wild canids kept in captivity in the State of Mato Grosso, Brazil. METHODS: Skin, bone marrow and lymph node samples were collected from six crab-eating foxes (Cerdocyon thous and one bush dog (Spheotos venaticus, in order to detect and characterize Leishmania using the PCR-RFLP technique. RESULTS: All the animals studied were positive for Leishmania (L. infantum chagasi. CONCLUSIONS: This study highlights the importance of adequate monitoring of these animals, as well as greater control of this disease, given that these animals are in a public recreation environment.

Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

Directory of Open Access Journals (Sweden)

Utut Widyastuti Suharsono

2008-11-01

Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

Science.gov (United States)

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

Discovery of Potent and Selective Inhibitors for ADAMTS-4 through DNA-Encoded Library Technology (ELT).

Science.gov (United States)

Ding, Yun; O'Keefe, Heather; DeLorey, Jennifer L; Israel, David I; Messer, Jeffrey A; Chiu, Cynthia H; Skinner, Steven R; Matico, Rosalie E; Murray-Thompson, Monique F; Li, Fan; Clark, Matthew A; Cuozzo, John W; Arico-Muendel, Christopher; Morgan, Barry A

2015-08-13

The aggrecan degrading metalloprotease ADAMTS-4 has been identified as a novel therapeutic target for osteoarthritis. Here, we use DNA-encoded Library Technology (ELT) to identify novel ADAMTS-4 inhibitors from a DNA-encoded triazine library by affinity selection. Structure-activity relationship studies based on the selection information led to the identification of potent and highly selective inhibitors. For example, 4-(((4-(6,7-dimethoxy-3,4-dihydroisoquinolin-2(1H)-yl)-6-(((4-methylpiperazin-1-yl)methyl)amino)-1,3,5-triazin-2-yl)amino)methyl)-N-ethyl-N-(m-tolyl)benzamide has IC50 of 10 nM against ADAMTS-4, with >1000-fold selectivity over ADAMT-5, MMP-13, TACE, and ADAMTS-13. These inhibitors have no obvious zinc ligand functionality.

Leishmania major infection in a dog with cutaneous manifestations.

Science.gov (United States)

Baneth, Gad; Nachum-Biala, Yaarit; Shabat Simon, Maytal; Brenner, Ori; Gaier, Sarit; Rojas, Alicia; Yasur-Landau, Daniel

2016-05-10

Leishmania major is a main cause of cutaneous leishmaniasis in humans in an area that stretches from India through Central Asia, the Middle East, to North and West Africa. In Israel, it is a common infection of humans with rodents as the reservoir hosts and Phlebotomus papatasi as its sand fly vector. A 6 months old spayed female mixed breed dog was referred to the Hebrew University Veterinary Teaching Hospital with a large ulcerative dermal lesion on the muzzle, and lesions in the foot pads and left hind leg. Histopathology of a skin biopsy found chronic lymphohistiocytic dermatitis with the presence of Leishmania spp. amastigotes in the muzzle. Physical examination indicated that the dog was overall in a good clinical condition and the main findings were the skin lesions and enlarged prescapular lymph nodes. Complete blood count and serum biochemistry profile were within reference ranges. Serology by ELISA was positive for Leishmania spp. and PCR of the prescapular lymph node was positive by an ITS1 region PCR-high resolution melt analysis. However, the melt curve and subsequent DNA sequencing indicated that infection was caused by L. major and not L. infantum, which is the main causative agent of canine leishmaniosis in the Mediterranean region. DNA was extracted from the paraffin embedded muzzle biopsy and PCR with sequencing also indicated L. major. The dog's young age and the absence of hyperglobulinemia and anemia were not typical of L. infantum infection. The dog was treated with allopurinol and the skin lesions improved and later disappeared when the dog was re-evaluated. This is the first molecularly-confirmed case of L. major infection in a dog. Two previous reports of L. major in dogs originated from Saudi-Arabia and Egypt in 1985 and 1987 were confirmed by enzymatic biochemical techniques. Serology for L. infantum was positive probably due to the well documented serological cross-reactivity between Leishmania spp. Although dogs and wild carnivores are

Detection of DNA from Leishmania (Viannia: accuracy of polymerase chain reaction for the diagnosis of cutaneous leishmaniasis.

Directory of Open Access Journals (Sweden)

Herintha Coeto Neitzke-Abreu

Full Text Available Cutaneous leishmaniasis (CL can occur in skin and mucosa, causing disfiguring lesions. The laboratory diagnosis of CL involves immunological methods and optical detection of the parasite, al of which have limitations. There is a need for more effective diagnostic methods for CL which wil allow treatment to be initiated more promptly in order to help prevent the development of severe forms of mucosal disease, and to estimate the prognosis of the infection. The polymerase chain reaction (PCR has been widely used to diagnose CL, because of its higher sensitivity. This study estimated the accuracy and compared PCRs of samples from lesion scarification (PCR-L and blood sample-enriched leukocytes (PCR-B with three conventional diagnostic techniques: parasite direct search (DS, Montenegro skin test (MST, and indirect immunofluorescence reaction (IIF. The study included 276 patients under suspicion of CL. We conducted a cross-sectional study, in which patients were selected by convenience sampling. We used MP3H/MP1L primers to generate a Leishmania (Viannia (minicircle kDNA fragment of 70-bp. Of 106 patients with CL, 83.87%, 51.67%, 64.52%, 85.71%, or 96.10% tested positive by PCR-L, PCR-B, DS, IIF, or MST, respectively. Five patients tested positive only by PCR-L, and two other patients only by PCR-B. PCR-L is indicated for use in patients with chronic lesions or Leishmania reinfection, which may progress to mucosal lesion. PCR-B is indicated for use in patients with negative results in conventional tests or for patients with no apparent lesion. PCR is not only useful in diagnosing CL but also helps to identify the infecting species.

Could Phlebotomus mascittii play a role as a natural vector for Leishmania infantum? New data.

Science.gov (United States)

Obwaller, Adelheid G; Karakus, Mehmet; Poeppl, Wolfgang; Töz, Seray; Özbel, Yusuf; Aspöck, Horst; Walochnik, Julia

2016-08-19

The occurrence of phlebotomine sand flies in Central Europe was questioned until they were recorded for the first time in Germany in 1999, and ten years later also in Austria. The aim of this study was to investigate sand flies collected in Austria for their carrier status of Leishmania spp. From 2012 to 2013 field studies were conducted in eastern Austria. Altogether, 22 individuals of sand flies were found, all morphologically identified as Phlebotomus (Transphlebotomus) mascittii Grassi, 1908. Twelve non-engorged female specimens with no visible remnants of a blood meal in their bodies were individually investigated for Leishmania spp. by ITS-1 real-time PCR. One out of these was positive for Leishmania, identified as Leishmania infantum by DNA sequencing. This finding suggests that L. infantum is not excreted by P. mascittii and possibly can establish an infection within P. mascittii. Interestingly, an asymptomatic dog living on the farm where this sand fly had been caught was also Leishmania-positive. This study provides new data on the suspected vector capacity of P. mascittii, being the northernmost sand fly species in Europe and in most central European regions the only sand fly species found. Proven vector capacity of P. mascittii for Leishmania spp. would be of significant medico-veterinary importance, not only with respect to expanding sand fly populations in Central Europe related to global warming, but also in the light of globalization and increasing movements of humans.

Molecular Identification of Leishmania spp. in Sand Flies (Diptera: Psychodidae: Phlebotominae) in the Lençóis Maranhenses National Park, Brazil.

Science.gov (United States)

Pereira-Filho, Adalberto Alves; Fonteles, Raquel Silva; Bandeira, Maria da Conceição Abreu; Moraes, Jorge Luiz Pinto; Rebêlo, José Manuel Macário; Melo, Maria Norma

2018-02-20

Sand flies are very common in the region of Lençóis Maranhenses National Park, an important tourist attraction in Brazil. However, the role of some species and their relative importance locally in Leishmania Ross 1903 transmission is unclear. The objective of this study was to identify Leishmania infection in phlebotomine sand flies collected around the Lençóis Maranhenses National Park, an important conservation area and popular international/national tourist destination with a high incidence of leishmaniasis. Sand flies were collected in peridomiciliary areas on the tourist route from September 2012 to August 2013. The captured females were subjected to molecular analyses for the detection of Leishmania DNA. Sand flies were infected with four Leishmania species: Leishmania (Viannia) braziliensis (Vianna, 1911) was found in Lutzomyia whitmani (Antunes and Coutinho, 1939) (2.1%) and Lutzomyia longipalpis (Lutz and Neiva, 1912) (1.7%); Leishmania (Leishmania) infantum (Nicole, 1908) infected Lutzomyia wellcomei (Fraiha, Shaw, and Lainson, 1971) (20%), Lutzomyia sordellii (Shannon and Del Ponte, 1927) (4.3%), Lu. longipalpis (3.7%), and Lu. whitmani (0.8%); Leishmania (Leishmania) amazonensis (Lainson & Shaw, 1972) was found in Lu. whitmani (0.58%), while Leishmania (Viannia) lainsoni infected Lutzomyia evandroi (Costa Lima and Antunes, 1936) (3.4%), Lu. longipalpis (1.06%), and Lu. whitmani (0.29%). The occurrence of these parasites requires control measures to reduce the incidence of cutaneous leishmaniasis and to contain a possible epidemic of visceral leishmaniasis, the most severe form of the disease.

Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

International Nuclear Information System (INIS)

Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.

1988-01-01

The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

Direct detection of Leishmania from clinical samples.

Science.gov (United States)

Waitumbi, John N; Bast, Joshua; Nyakoe, Nancy; Magiri, Charles; Quintana, Miguel; Takhampunya, Ratree; Schuster, Anthony L; Van de Wyngaerde, Marshall T; McAvin, James C; Coleman, Russell E

2017-01-01

The ability to rapidly and accurately diagnose leishmaniasis is a military priority. Testing was conducted to evaluate diagnostic sensitivity and specificity of field-expedient Leishmania genus and visceral Leishmania specific dual-fluorogenic, hydrolysis probe (TaqMan), polymerase chain reaction assays previously established for use in vector surveillance. Blood samples of patients with confirmed visceral leishmaniasis and controls without the disease from Baringo District, Kenya, were tested. Leishmania genus assay sensitivity was 100% (14/14) and specificity was 84% (16/19). Visceral Leishmania assay sensitivity was 93% (13/14) and specificity 80% (4/5). Cutaneous leishmaniasis (CL) skin scrapes of patients from Honduras were also evaluated. Leishmania genus assay sensitivity was 100% (10/10). Visceral Leishmania assay specificity was 100% (10/10) from cutaneous leishmaniasis samples; no fluorescence above background was reported. These results show promise in a rapid, sensitive, and specific method for Leishmania direct detection from clinical samples.

A calmodulin-like protein (LCALA) is a new Leishmania amazonensis candidate for telomere end-binding protein.

Science.gov (United States)

Morea, Edna G O; Viviescas, Maria Alejandra; Fernandes, Carlos A H; Matioli, Fabio F; Lira, Cristina B B; Fernandez, Maribel F; Moraes, Barbara S; da Silva, Marcelo S; Storti, Camila B; Fontes, Marcos R M; Cano, Maria Isabel N

2017-11-01

Leishmania spp. telomeres are composed of 5'-TTAGGG-3' repeats associated with proteins. We have previously identified LaRbp38 and LaRPA-1 as proteins that bind the G-rich telomeric strand. At that time, we had also partially characterized a protein: DNA complex, named LaGT1, but we could not identify its protein component. Using protein-DNA interaction and competition assays, we confirmed that LaGT1 is highly specific to the G-rich telomeric single-stranded DNA. Three protein bands, with LaGT1 activity, were isolated from affinity-purified protein extracts in-gel digested, and sequenced de novo using mass spectrometry analysis. In silico analysis of the digested peptide identified them as a putative calmodulin with sequences identical to the T. cruzi calmodulin. In the Leishmania genome, the calmodulin ortholog is present in three identical copies. We cloned and sequenced one of the gene copies, named it LCalA, and obtained the recombinant protein. Multiple sequence alignment and molecular modeling showed that LCalA shares homology to most eukaryotes calmodulin. In addition, we demonstrated that LCalA is nuclear, partially co-localizes with telomeres and binds in vivo the G-rich telomeric strand. Recombinant LCalA can bind specifically and with relative affinity to the G-rich telomeric single-strand and to a 3'G-overhang, and DNA binding is calcium dependent. We have described a novel candidate component of Leishmania telomeres, LCalA, a nuclear calmodulin that binds the G-rich telomeric strand with high specificity and relative affinity, in a calcium-dependent manner. LCalA is the first reported calmodulin that binds in vivo telomeric DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

First molecular detection of Leishmania major within naturally infected Phlebotomus salehi from a zoonotic cutaneous leishmaniasis focus in southern Iran.

Science.gov (United States)

Azizi, K; Fakoorziba, M R; Jalali, M; Moemenbellah-Fard, M D

2012-03-01

Human cutaneous leishmaniasis (CL) is a major notifiable public health problem in many parts of Iran. It is often caused by the zooflagellate parasite Leishmania major which is mainly transmitted by the bites of female phlebotomine sandflies belonging to the genus Phlebotomus (Diptera: Psychodidae). The annual incidence of CL in Fars province, southern Iran, was about 108-144 in 2007. The leishmanial infections of wild sandflies that may act as vectors were thus investigated at an endemic focus in this province. In all 330 female Phlebotomus sandflies were screened for the detection of Leishmania-specific kinetoplast DNA (kDNA) by polymerase chain reaction (PCR) methods. A two stage nested PCR protocol was used to establish the identity of Leishmania major species in naturally infected sandflies. The L. major kDNA was detected in 18 (5.5%) individual sandflies which belonged to four different Phlebotomus species (Phlebotomus papatasi, Phlebotomus salehi, Phlebotomus sergenti and P. major group). For the first time, one naturally infected P. salehi specimen contained the kDNA of the protozoan parasite, L. major, with a main band of 560 base pairs identified using the nested PCR method. It seems most likely therefore that P. salehi is potentially a rare sylvatic vector of L. major parasites in parts of this province. This is the first combined morphological and molecular studies of P. salehi in Iran.

First evidence of autochthonous cases of Leishmania (Leishmania) infantum in horse (Equus caballus) in the Americas and mixed infection of Leishmania infantum and Leishmania (Viannia) braziliensis.

Science.gov (United States)

Soares, Isabel R; Silva, Soraia O; Moreira, Filipe Moraghi; Prado, Luan Gavião; Fantini, Priscila; Maranhão, Renata de Pino Albuquerque; da Silva Filho, José Monteiro; Melo, Maria Norma; Palhares, Maristela S

2013-11-08

This study reports the first evidence of infection by Leishmania infantum in Equus caballus in Americas and the first mixed infection of L. infantum/Leishmania braziliensis on this mammalian species in the world. The diagnoses was based on presence of parasites in lesions and bone marrow aspirates, their identification by using specific primers for L. infantum and L. braziliensis complexes and also serological methods IFAT and ELISA. The analysis of the PCR products suggested mixed infection in three animals. Further studies involving equine leishmaniasis are carrying out in order to clarify the dynamic of Leishmania sp. in this mammalian specie and their role in the transmission of those parasites in urban endemic area of Belo Horizonte, Minas Gerais State, Brazil. Copyright © 2013 Elsevier B.V. All rights reserved.

Functional and genetic evidence that nucleoside transport is highly conserved in Leishmania species: Implications for pyrimidine-based chemotherapy

Directory of Open Access Journals (Sweden)

Khalid J.H. Alzahrani

2017-08-01

Full Text Available Leishmania pyrimidine salvage is replete with opportunities for therapeutic intervention with enzyme inhibitors or antimetabolites. Their uptake into cells depends upon specific transporters; therefore it is essential to establish whether various Leishmania species possess similar pyrimidine transporters capable of drug uptake. Here, we report a comprehensive characterization of pyrimidine transport in L. major and L. mexicana. In both species, two transporters for uridine/adenosine were detected, one of which also transported uracil and the antimetabolites 5-fluoruracil (5-FU and 5F,2′deoxyuridine (5F,2′dUrd, and was designated uridine-uracil transporter 1 (UUT1; the other transporter mediated uptake of adenosine, uridine, 5F,2′dUrd and thymidine and was designated Nucleoside Transporter 1 (NT1. To verify the reported L. donovani model of two NT1-like genes encoding uridine/adenosine transporters, and an NT2 gene encoding an inosine transporter, we cloned the corresponding L. major and L. mexicana genes, expressing each in T. brucei. Consistent with the L. donovani reports, the NT1-like genes of either species mediated the adenosine-sensitive uptake of [3H]-uridine but not of [3H]-inosine. Conversely, the NT2-like genes mediated uptake of [3H]-inosine but not [3H]-uridine. Among pyrimidine antimetabolites tested, 5-FU and 5F,2′dUrd were the most effective antileishmanials; resistance to both analogs was induced in L. major and L. mexicana. In each case it was found that the resistant cells had lost the transport capacity for the inducing drug. Metabolomics analysis found that the mechanism of action of 5-FU and 5F-2′dUrd was similar in both Leishmania species, with major changes in deoxynucleotide metabolism. We conclude that the pyrimidine salvage system is highly conserved in Leishmania species - essential information for the development of pyrimidine-based chemotherapy. Keywords: Leishmania, Pyrimidine metabolism, Uracil

Lutzomyia longipalpis saliva or salivary protein LJM19 protects against Leishmania braziliensis and the saliva of its vector, Lutzomyia intermedia.

Directory of Open Access Journals (Sweden)

Natalia M Tavares

Full Text Available BACKGROUND: Leishmania transmission occurs in the presence of insect saliva. Immunity to Phlebotomus papatasi or Lutzomyia longipalpis saliva or salivary components confers protection against an infection by Leishmania in the presence of the homologous saliva. However, immunization with Lutzomyia intermedia saliva did not protect mice against Leishmania braziliensis plus Lu. intermedia saliva. In the present study, we have studied whether the immunization with Lu. longipalpis saliva or a DNA plasmid coding for LJM19 salivary protein would be protective against L. braziliensis infection in the presence of Lu. intermedia saliva, the natural vector for L. braziliensis. METHODOLOGY/PRINCIPAL FINDINGS: Immunization with Lu. longipalpis saliva or with LJM19 DNA plasmid induced a Delayed-Type Hypersensitivity (DTH response against Lu. longipalpis as well as against a Lu. intermedia saliva challenge. Immunized and unimmunized control hamsters were then intradermally infected in the ears with L. braziliensis in the presence of Lu. longipalpis or Lu. intermedia saliva. Animals immunized with Lu. longipalpis saliva exhibited smaller lesion sizes as well as reduced disease burdens both at lesion site and in the draining lymph nodes. These alterations were associated with a significant decrease in the expression levels of IL-10 and TGF-β. Animals immunized with LJM19 DNA plasmid presented similar findings in protection and immune response and additionally increased IFN-γ expression. CONCLUSIONS/SIGNIFICANCE: Immunization with Lu. longipalpis saliva or with a DNA plasmid coding LJM19 salivary protein induced protection in hamsters challenged with L. braziliensis plus Lu. intermedia saliva. These findings point out an important role of immune response against saliva components, suggesting the possibility to develop a vaccine using a single component of Lu. longipalpis saliva to generate protection against different species of Leishmania, even those

Lutzomyia sand fly diversity and rates of infection by Wolbachia and an exotic Leishmania species on Barro Colorado Island, Panama.

Directory of Open Access Journals (Sweden)

Jorge Azpurua

2010-03-01

Full Text Available Sand flies (Diptera, Psychodidae, Phlebotominae in the genus Lutzomyia are the predominant vectors of the protozoan disease leishmaniasis in the New World. Within the watershed of the Panama Canal, the cutaneous form of leishmaniasis is a continuous health threat for residents, tourists and members of an international research community. Here we report the results of screening a tropical forest assemblage of sand fly species for infection by both Leishmania and a microbe that can potentially serve in vector population control, the cytoplasmically transmitted rickettsia, Wolbachia pipientis. Knowing accurately which Lutzomyia species are present, what their evolutionary relationships are, and how they are infected by strains of both Leishmania and Wolbachia is of critical value for building strategies to mitigate the impact of this disease in humans.We collected, sorted and then used DNA sequences to determine the diversity and probable phylogenetic relationships of the Phlebotominae occurring in the understory of Barro Colorado Island in the Republic of Panama. Sequence from CO1, the DNA barcoding gene, supported 18 morphology-based species determinations while revealing the presence of two possible "cryptic" species, one (Lu. sp. nr vespertilionis within the Vespertilionis group, the other (Lu. gomezi within the Lutzomyia-cruciata series. Using ITS-1 and "minicircle" primers we detected Leishmania DNA in 43.3% of Lu. trapidoi, 26.3% of Lu. gomezi individuals and in 0% of the other 18 sand fly species. Identical ITS-1 sequence was obtained from the Leishmania infecting Lu. trapidoi and Lu. gomezi, sequence which was 93% similar to Leishmania (viannia naiffi in GenBank, a species previously unknown in Panama, but recognized as a type of cutaneous leishmaniasis vectored broadly across northern and central South America. Distinct strains of the intracellular bacterium Wolbachia were detected in three of 20 sand fly species, including Lu. trapidoi

cDNA encoding a polypeptide including a hev ein sequence

Energy Technology Data Exchange (ETDEWEB)

Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

2000-07-04

A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

Geographic Distribution of Leishmania Species in Ecuador Based on the Cytochrome B Gene Sequence Analysis.

Science.gov (United States)

Kato, Hirotomo; Gomez, Eduardo A; Martini-Robles, Luiggi; Muzzio, Jenny; Velez, Lenin; Calvopiña, Manuel; Romero-Alvarez, Daniel; Mimori, Tatsuyuki; Uezato, Hiroshi; Hashiguchi, Yoshihisa

2016-07-01

A countrywide epidemiological study was performed to elucidate the current geographic distribution of causative species of cutaneous leishmaniasis (CL) in Ecuador by using FTA card-spotted samples and smear slides as DNA sources. Putative Leishmania in 165 samples collected from patients with CL in 16 provinces of Ecuador were examined at the species level based on the cytochrome b gene sequence analysis. Of these, 125 samples were successfully identified as Leishmania (Viannia) guyanensis, L. (V.) braziliensis, L. (V.) naiffi, L. (V.) lainsoni, and L. (Leishmania) mexicana. Two dominant species, L. (V.) guyanensis and L. (V.) braziliensis, were widely distributed in Pacific coast subtropical and Amazonian tropical areas, respectively. Recently reported L. (V.) naiffi and L. (V.) lainsoni were identified in Amazonian areas, and L. (L.) mexicana was identified in an Andean highland area. Importantly, the present study demonstrated that cases of L. (V.) braziliensis infection are increasing in Pacific coast areas.

Identification and biochemical characterization of Leishmania strains isolated in Peru, Mexico, and Spain.

Science.gov (United States)

Rodríguez-González, Isabel; Marín, Clotilde; Vargas, Franklin; Córdova, Ofelia; Barrera, Mario; Gutiérrez-Sánchez, Ramón; Alunda, Jose María; Sánchez-Moreno, Manuel

2006-01-01

Eight Leishmania promastigotes were isolated from different geographical areas: three (LP1, LP2, and LP3) from the provincial department La Libertad and the fourth (LP4) from the department of Cajamarca (northern Peru); another three (LM1, LM2, and LM3) in the province of Campeche (Mexico); and the last (LS1) from a clinical case of a dog in Madrid (Spain). The isolates were characterized by carbohydrate cell-surface residues using agglutinations with four purified lectins, by isoenzyme analysis using different isoenzymes, by analysis of kinetoplast DNA (kDNA) restriction fragment length polymorphism using four different restriction endonucleases and by the final metabolite patterns after in vitro culture. These isolates were compared with four reference strains and typified as: Leishmania (Leishmania) donovani, two strains of L. (L.) infantum, and one species of L. (Viania) peruviana. According to our results and the statistical study, the Peruvian isolates represent three different strains: one would be L. (V.) peruviana, another the strain isolated in Cajamarca (LP4) and the third would include the three strains from the department of La Libertad (LP1, LP2, and LP3), these latter three isolates being phylogenetically closer to the reference strain L. (L.) donovani. Meanwhile, the three isolates from Mexico form a group with close phylogenetic relationships to each other. The isolate from Spain belongs to the species L. (L.) infantum. Thus, a close correlation was drawn between the identity of each strain and its geographical origin.

Phlebotomine Sand Fly Fauna and Leishmania Infection in the Vicinity of the Serra do Cipó National Park, a Natural Brazilian Heritage Site

Science.gov (United States)

Lana, Rosana Silva; Michalsky, Érika Monteiro; Fortes-Dias, Consuelo Latorre; França-Silva, João Carlos; Lara-Silva, Fabiana de Oliveira; Lima, Ana Cristina Vianna Mariano da Rocha; Moreira de Avelar, Daniel; Martins, Juliana Cristina Dias; Dias, Edelberto Santos

2015-01-01

In the New World, the leishmaniases are primarily transmitted to humans through the bites of Leishmania-infected Lutzomyia (Diptera: Psychodidae) phlebotomine sand flies. Any or both of two basic clinical forms of these diseases are endemic to several cities in Brazil—the American cutaneous leishmaniasis (ACL) and the American visceral leishmaniasis (AVL). The present study was conducted in the urban area of a small-sized Brazilian municipality (Jaboticatubas), in which three cases of AVL and nine of ACL have been reported in the last five years. Jaboticatubas is an important tourism hub, as it includes a major part of the Serra do Cipó National Park. Currently, no local data is available on the entomological fauna or circulating Leishmania. During the one-year period of this study, we captured 3,104 phlebotomine sand flies belonging to sixteen Lutzomyia species. In addition to identifying incriminated or suspected vectors of ACL with DNA of the etiological agent of AVL and vice versa, we also detected Leishmania DNA in unexpected Lutzomyia species. The expressive presence of vectors and natural Leishmania infection indicates favorable conditions for the spreading of leishmaniases in the vicinity of the Serra do Cipó National Park. PMID:25793193

Gluconeogenesis in Leishmania mexicana

Science.gov (United States)

Rodriguez-Contreras, Dayana; Hamilton, Nicklas

2014-01-01

Gluconeogenesis is an active pathway in Leishmania amastigotes and is essential for their survival within the mammalian cells. However, our knowledge about this pathway in trypanosomatids is very limited. We investigated the role of glycerol kinase (GK), phosphoenolpyruvate carboxykinase (PEPCK), and pyruvate phosphate dikinase (PPDK) in gluconeogenesis by generating the respective Leishmania mexicana Δgk, Δpepck, and Δppdk null mutants. Our results demonstrated that indeed GK, PEPCK, and PPDK are key players in the gluconeogenesis pathway in Leishmania, although stage-specific differences in their contribution to this pathway were found. GK participates in the entry of glycerol in promastigotes and amastigotes; PEPCK participates in the entry of aspartate in promastigotes, and PPDK is involved in the entry of alanine in amastigotes. Furthermore, the majority of alanine enters into the pathway via decarboxylation of pyruvate in promastigotes, whereas pathway redundancy is suggested for the entry of aspartate in amastigotes. Interestingly, we also found that l-lactate, an abundant glucogenic precursor in mammals, was used by Leishmania amastigotes to synthesize mannogen, entering the pathway through PPDK. On the basis of these new results, we propose a revision in the current model of gluconeogenesis in Leishmania, emphasizing the differences between amastigotes and promastigotes. This work underlines the importance of studying the trypanosomatid intracellular life cycle stages to gain a better understanding of the pathologies caused in humans. PMID:25288791

A unique, highly conserved secretory invertase is differentially expressed by promastigote developmental forms of all species of the human pathogen, Leishmania

Science.gov (United States)

Lyda, Todd A.; Joshi, Manju B.; Andersen, John F.; Kelada, Andrew Y.; Owings, Joshua P.; Bates, Paul A.; Dwyer, Dennis M.

2015-01-01

Leishmania are protozoan pathogens of humans that exist as extracellular promastigotes in the gut of their sand fly vectors and as obligate intracellular amastigotes within phagolysosomes of infected macrophages. Between infectious blood meal feeds, sand flies take plant juice meals that contain sucrose and store these sugars in their crop. Such sugars are regurgitated into the sand fly anterior midgut where they impact the developing promastigote parasite population. In this report we showed that promastigotes of all Leishmania species secreted an invertase/sucrase enzyme during their growth in vitro. In contrast, neither L. donovani nor L. mexicana amastigotes possessed any detectable invertase activity. Importantly, no released/secreted invertase activity was detected in culture supernatants from either Trypanosoma brucei or Trypanosoma cruzi. Using HPLC, the L. donovani secretory invertase was isolated and subjected to amino acid sequencing. Subsequently, we used a molecular approach to identify the LdINV and LmexINV genes encoding the ~72 kDa invertases produced by these organisms. Interestingly, we identified high fidelity LdINV-like homologs in the genomes of all Leishmania sp. but none were present in either T. brucei or T. cruzi. Northern blot and RT-PCR analyses showed that these genes were developmentally/differentially expressed in promastigotes but not amastigotes of these parasites. Homologous transfection studies demonstrated that these genes in fact encoded the functional secretory invertases produced by these parasites. Cumulatively, our results suggest that these secretory enzymes play critical roles in the survival/growth/development and transmission of all Leishmania parasites within their sand fly vector hosts. PMID:25763714

The Gut Microbiome of the Vector Lutzomyia longipalpis Is Essential for Survival of Leishmania infantum.

Science.gov (United States)

Kelly, Patrick H; Bahr, Sarah M; Serafim, Tiago D; Ajami, Nadim J; Petrosino, Joseph F; Meneses, Claudio; Kirby, John R; Valenzuela, Jesus G; Kamhawi, Shaden; Wilson, Mary E

2017-01-17

The vector-borne disease leishmaniasis, caused by Leishmania species protozoa, is transmitted to humans by phlebotomine sand flies. Development of Leishmania to infective metacyclic promastigotes in the insect gut, a process termed metacyclogenesis, is an essential prerequisite for transmission. Based on the hypothesis that vector gut microbiota influence the development of virulent parasites, we sequenced midgut microbiomes in the sand fly Lutzomyia longipalpis with or without Leishmania infantum infection. Sucrose-fed sand flies contained a highly diverse, stable midgut microbiome. Blood feeding caused a decrease in microbial richness that eventually recovered. However, bacterial richness progressively decreased in L. infantum-infected sand flies. Acetobacteraceae spp. became dominant and numbers of Pseudomonadaceae spp. diminished coordinately as the parasite underwent metacyclogenesis and parasite numbers increased. Importantly, antibiotic-mediated perturbation of the midgut microbiome rendered sand flies unable to support parasite growth and metacyclogenesis. Together, these data suggest that the sand fly midgut microbiome is a critical factor for Leishmania growth and differentiation to its infective state prior to disease transmission. Leishmania infantum, a parasitic protozoan causing fatal visceral leishmaniasis, is transmitted to humans through the bite of the sand fly Lutzomyia longipalpis Development of the parasite to its virulent metacyclic state occurs in the sand fly gut. In this study, the microbiota within the Lu. longipalpis midgut was delineated by 16S ribosomal DNA (rDNA) sequencing, revealing a highly diverse community composition that lost diversity as parasites developed to their metacyclic state and increased in abundance in infected flies. Perturbing sand fly gut microbiota with an antibiotic cocktail, which alone had no effect on either the parasite or the fly, arrested both the development of virulent parasites and parasite expansion

Development of a rapid loop-mediated isothermal amplification assay for diagnosis and assessment of cure of Leishmania infection.

Science.gov (United States)

Verma, Sandeep; Singh, Ruchi; Sharma, Vanila; Bumb, Ram Avtar; Negi, Narendra Singh; Ramesh, V; Salotra, Poonam

2017-03-23

Leishmaniasis is a spectrum of diseases with great relevance to public health. Conventional diagnostic methods are time consuming, needing trained personnel. A robust, rapid and cost effective diagnostic test is warranted for on-time diagnosis and field application. We have developed a loop mediated isothermal amplification (LAMP) assay with primers (n = 6) based on Leishmania donovani kDNA for detection of Leishmania infection, using a closed tube to prevent cross-contamination. The assay was used to detect Leishmania infection in biological samples obtained from patients of visceral leishmaniasis (VL), post kala-azar dermal leishmaniasis (PKDL) and cutaneous leishmaniasis (CL). The assay was positive for L. donovani, L. tropica and L. major parasites, with the highest sensitivity towards L. donovani (1 fg DNA). The high sensitivity of the assay for detection of L. donovani was reflected in its ability to detect parasite DNA within 30 min of amplification time with a threshold detection limit of ≥25 copies per reaction. The assay detected parasite in 64 of 66 VL blood samples (sensitivity, 96.9%; 95% CI: 89.6-99.2%), 15 of 15 VL bone marrow aspirate samples (sensitivity, 100%; 95% CI:79.6-100%), 65 of 67 PKDL tissue biopsy samples (sensitivity, 97%; 95% CI:89.7-99.2%). The assay was evaluated in a few cases of CL wherein it was found positive in 8 of 10 tissue biopsies (sensitivity, 80%; 95% CI: 49-94.3%). The assay was negative in all control blood (n = 76) and tissue biopsy (n = 24) samples (specificity, 100%; 95% CI: 96.3-100%). Further, the assay was evaluated for its utility in assessment of cure in treated VL and PKDL patients. The assay detected parasite DNA in 2 of 20VL blood samples and 2 of 21 PKDL tissue samples. Out of 4 cases that were positive for parasite DNA at post treatment stage, 2 patients (1VL and 1 PKDL) returned with relapse. The study demonstrated a Leishmania genus specific closed tube LAMP assay for reliable and rapid

The use of radionuclide DNA probe technology for epidemiological studies of tegumentary leishmaniasis in Mato Grosso state

Directory of Open Access Journals (Sweden)

Antero Silva Ribeiro de Andrade

2005-10-01

Full Text Available DNA hybridisation, using probes labelled with 32P, was used to type Leishmania samples isolated from patients living in endemic areas of Mato Grosso State (Brazil, and clinically diagnosed as having tegumentary leishmaniasis. kDNA cloned mini-circle probes specific for the Leishmania mexicana and Leishmania braziliensis complexes were used. The results showed that L. braziliensis is the predominant group infecting human patients in the state. Sixty-eight samples were typed, 64 samples (94.1% belonging to the L. braziliensis complex and only four (5.9% belonging to the L. mexicana complex. Accurate identification of the Leishmania permits better orientation of the medical follow-up, since clinical manifestations may vary depending on the complex to which the parasite belongs. The epidemiological information furnished by the identification of the Leishmania in given endemic area is also essential for the design of appropriate control measuresHibridização, utilizando sondas de DNA marcadas com 32P, foi utilizada para a tipagem de amostras de Leishmania isoladas de pacientes do estado do Mato Grosso (Brasil, diagnosticados clinicamente como portadores de leishmaniose tegumentar. Sondas de minicírculos clonados de kDNA, específicas para os complexos Leishmania mexicana e Leishmania braziliensis, foram utilizadas. Os resultados demonstraram que o complexo L. brasiliensis é o grupo predominante infectando pacientes humanos no estado do Mato Grosso. Foram tipadas 68 amostras: 64 (94,1% foram identificadas como pertencentes ao complexo L. brasiliensis e somente 4 (5,9% como pertencentes ao complexo L. mexicana. A tipagem de Leishmania é importante para um melhor acompanhamento médico, uma vez que as manifestações clínicas podem variar em função do complexo ao qual o parasita pertence. A informação fornecida pela identificação também é essencial para a definição das medidas de controle mais adequadas e compreensão da epidemiologia da

Analytical Performance of Four Polymerase Chain Reaction (PCR and Real Time PCR (qPCR Assays for the Detection of Six Leishmania Species DNA in Colombia

Directory of Open Access Journals (Sweden)

Cielo M. León

2017-10-01

Full Text Available Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR, limit of detection (LoD and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia. Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America.

Analytical Performance of Four Polymerase Chain Reaction (PCR) and Real Time PCR (qPCR) Assays for the Detection of Six Leishmania Species DNA in Colombia

Science.gov (United States)

León, Cielo M.; Muñoz, Marina; Hernández, Carolina; Ayala, Martha S.; Flórez, Carolina; Teherán, Aníbal; Cubides, Juan R.; Ramírez, Juan D.

2017-01-01

Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR) including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets) and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR), limit of detection (LoD) and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively) and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia). Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America. PMID:29046670

Molecular detection and identification of Leishmania spp. in naturally infected Phlebotomus tobbi and Sergentomyia dentata in a focus of human and canine leishmaniasis in western Turkey.

Science.gov (United States)

Özbel, Yusuf; Karakuş, Mehmet; Arserim, Suha K; Kalkan, Şaban Orçun; Töz, Seray

2016-03-01

Human visceral leishmaniasis (VL) is reported from 38 provinces of Turkey and dogs are accepted as main reservoir hosts. Kuşadası town, belonging to Aydın province and located in western part of Turkey, is endemic for human and canine visceral leishmaniasis caused by Leishmania infantum MON1 and MON98. In this study, phlebotomine survey was conducted to determine the vector sand fly species and to identify sand fly blood meal sources. In August and September 2012, 1027 sand fly specimens were caught using CDC light traps. Eight Phlebotomus and two Sergentomyia species with the dominancy of Phlebotomus tobbi (61.34%) were detected. A total of 622 female sand flies (571 Phlebotomus; 51 Sergentomyia) were checked for Leishmania infection by direct dissection of the midgut. The half of the midgut content was inoculated into NNN culture for isolation of the parasite. Leishmania species-specific ITS1 real time PCR, conventional PCR assays of ITS1 and hsp70 genes and subsequent sequencing were performed from extracted DNAs. A region of cytochrome b (cyt-b) gene of vertebrates based PCR was used to determine the source of blood meal of sand flies. In microscopical examinations, two female specimens (0.32%) were found naturally infected with high number and different stages of promastigotes. No growth was observed in NNN culture but Leishmania DNA was obtained from both specimens. First positive specimen was identified as P. tobbi and L. infantum DNA was detected. Second specimen was Sergentomyia dentata, but Leishmania DNA could not be identified on species level. A total of 16 blood-fed female P. tobbi specimens were used for blood meal analysis and eight, three and one specimens were positive for human, dog and mouse, respectively. This is the first detection of Leishmania promastigotes using microscopical examination in P. tobbi and S. dentata in human and canine visceral leishmaniasis endemic area in western part of Turkey. Our results indicate that, (i) P. tobbi is

CRISPR-Cas9-Mediated Genome Editing in Leishmania donovani.

Science.gov (United States)

Zhang, Wen-Wei; Matlashewski, Greg

2015-07-21

The prokaryotic CRISPR (clustered regularly interspaced short palindromic repeat)-Cas9, an RNA-guided endonuclease, has been shown to mediate efficient genome editing in a wide variety of organisms. In the present study, the CRISPR-Cas9 system has been adapted to Leishmania donovani, a protozoan parasite that causes fatal human visceral leishmaniasis. We introduced the Cas9 nuclease into L. donovani and generated guide RNA (gRNA) expression vectors by using the L. donovani rRNA promoter and the hepatitis delta virus (HDV) ribozyme. It is demonstrated within that L. donovani mainly used homology-directed repair (HDR) and microhomology-mediated end joining (MMEJ) to repair the Cas9 nuclease-created double-strand DNA break (DSB). The nonhomologous end-joining (NHEJ) pathway appears to be absent in L. donovani. With this CRISPR-Cas9 system, it was possible to generate knockouts without selection by insertion of an oligonucleotide donor with stop codons and 25-nucleotide homology arms into the Cas9 cleavage site. Likewise, we disrupted and precisely tagged endogenous genes by inserting a bleomycin drug selection marker and GFP gene into the Cas9 cleavage site. With the use of Hammerhead and HDV ribozymes, a double-gRNA expression vector that further improved gene-targeting efficiency was developed, and it was used to make precise deletion of the 3-kb miltefosine transporter gene (LdMT). In addition, this study identified a novel single point mutation caused by CRISPR-Cas9 in LdMT (M381T) that led to miltefosine resistance, a concern for the only available oral antileishmanial drug. Together, these results demonstrate that the CRISPR-Cas9 system represents an effective genome engineering tool for L. donovani. Leishmania donovani is the causative agent of fatal visceral leishmaniasis. To understand Leishmania infection and pathogenesis and identify new drug targets for control of leishmaniasis, more-efficient ways to manipulate this parasite genome are required. In this

Identification of Leishmania spp. promastigotes in the intestines, ovaries, and salivary glands of Rhipicephalus sanguineus actively infesting dogs.

Science.gov (United States)

Viol, Milena Araúz; Guerrero, Felix D; de Oliveira, Bruno César Miranda; de Aquino, Monally Conceição Costa; Loiola, Saulo Hudson; de Melo, Guilherme Dias; de Souza Gomes, Aparecida Helena; Kanamura, Cristina Takami; Garcia, Marcos Valério; Andreotti, Renato; de Lima, Valéria Marçal Félix; Bresciani, Katia Denise Saraiva

2016-09-01

Sand flies are recognized as the major vector of canine visceral leishmaniasis. However, in some areas of Brazil where sand flies do not occur, this disease is found in humans and dogs. There has been speculation that ticks might play a role in transmission of canine visceral leishmaniasis and the DNA of Leishmania spp. has been reported in whole ticks. We investigated the presence of Leishmania spp. promastigotes in the intestines, ovaries, and salivary glands of Rhipicephalus sanguineus ticks collected from tick-infested dogs in two cities of Brazil. We used 66 dogs that tested positive and 33 that tested negative for Leishmania spp. according to direct cytological examination assays. Ten ticks were collected from each dog and dissected to collect the intestines, ovaries, and salivary glands for immunohistochemistry (IHC) and diagnostic real-time polymerase chain reaction (RT-PCR). IHC results showed Leishmania spp. in 98, 14, and 8 % of the intestines, ovaries, and salivary glands, respectively. Real-time PCR showed that 89, 41, and 33 % of the tick intestine, ovary, and salivary glands, respectively, were positive for Leishmania spp. The verification of promastigotes of Leishmania spp. by two independent techniques in ticks collected from these urban region dogs showed that there is need for clarification of the role of ticks in the transmission of canine visceral leishmaniasis in Brazil.

Nitric oxide production by Peromyscus yucatanicus (Rodentia infected with Leishmania (Leishmania mexicana

Directory of Open Access Journals (Sweden)

Elsy Nalleli Loría-Cervera

2013-04-01

Full Text Available Peromyscus yucatanicus (Rodentia: Cricetidae is a primary reservoir of Leishmania (Leishmania mexicana (Kinetoplastida: Trypanosomatidae. Nitric oxide (NO generally plays a crucial role in the containment and elimination of Leishmania. The aim of this study was to determine the amount of NO produced by P. yucatanicus infected with L. (L. mexicana. Subclinical and clinical infections were established in P. yucatanicus through inoculation with 1 x 10 2 and 2.5 x 10 6 promastigotes, respectively. Peritoneal macrophages were cultured alone or co-cultured with lymphocytes with or without soluble Leishmania antigen. The level of NO production was determined using the Griess reaction. The amount of NO produced was significantly higher (p ≤ 0.0001 in co-cultured macrophages and lymphocytes than in macrophages cultured alone. No differences in NO production were found between P. yucatanicus with subclinical L. (L. mexicana infections and animals with clinical infections. These results support the hypothesis that the immunological mechanisms of NO production in P. yucatanicus are similar to those described in mouse models of leishmaniasis and, despite NO production, P. yucatanicus is unable to clear the parasite infection.

Demonstration of genetic exchange during cyclical development of Leishmania in the sand fly vector.

Science.gov (United States)

Akopyants, Natalia S; Kimblin, Nicola; Secundino, Nagila; Patrick, Rachel; Peters, Nathan; Lawyer, Phillip; Dobson, Deborah E; Beverley, Stephen M; Sacks, David L

2009-04-10

Genetic exchange has not been shown to be a mechanism underlying the extensive diversity of Leishmania parasites. We report here evidence that the invertebrate stages of Leishmania are capable of having a sexual cycle consistent with a meiotic process like that described for African trypanosomes. Hybrid progeny were generated that bore full genomic complements from both parents, but kinetoplast DNA maxicircles from one parent. Mating occurred only in the sand fly vector, and hybrids were transmitted to the mammalian host by sand fly bite. Genetic exchange likely contributes to phenotypic diversity in natural populations, and analysis of hybrid progeny will be useful for positional cloning of the genes controlling traits such as virulence, tissue tropism, and drug resistance.

Genetic Manipulation of Leishmania donovani to Explore the Involvement of Argininosuccinate Synthase in Oxidative Stress Management

Science.gov (United States)

Sardar, Abul Hasan; Jardim, Armando; Ghosh, Ayan Kumar; Mandal, Abhishek; Das, Sushmita; Saini, Savita; Abhishek, Kumar; Singh, Ruby; Verma, Sudha; Kumar, Ajay; Das, Pradeep

2016-01-01

Reactive oxygen and nitrogen species (ROS and RNS) produced by the phagocytic cells are the most common arsenals used to kill the intracellular pathogens. However, Leishmania, an intracellular pathogen, has evolved mechanisms to survive by counterbalancing the toxic oxygen metabolites produced during infection. Polyamines, the major contributor in this anti-oxidant machinery, are largely dependent on the availability of L-arginine in the intracellular milieu. Argininosuccinate synthase (ASS) plays an important role as the rate-limiting step required for converting L-citrulline to argininosuccinate to provide arginine for an assortment of metabolic processes. Leishmania produce an active ASS enzyme, yet it has an incomplete urea cycle as it lacks an argininosuccinate lyase (ASL). There is no evidence for endogenous synthesis of L-arginine in Leishmania, which suggests that these parasites salvage L-arginine from extracellular milieu and makes the biological function of ASS and the production of argininosuccinate in Leishmania unclear. Our previous quantitative proteomic analysis of Leishmania promastigotes treated with sub-lethal doses of ROS, RNS, or a combination of both, led to the identification of several differentially expressed proteins which included ASS. To assess the involvement of ASS in stress management, a mutant cell line with greatly reduced ASS activity was created by a double-targeted gene replacement strategy in L. donovani promastigote. Interestingly, LdASS is encoded by three copies of allele, but Western blot analysis showed the third allele did not appear to express ASS. The free thiol levels in the mutant LdASS-/-/+ cell line were decreased. Furthermore, the cell viability in L-arginine depleted medium was greatly attenuated on exposure to different stress environments and was adversely impacted in its ability to infect mice. These findings suggest that ASS is important for Leishmania donovani to counterbalance the stressed environments

Detection of Leishmania RNA virus in Leishmania parasites.

Directory of Open Access Journals (Sweden)

Haroun Zangger

Full Text Available Patients suffering from cutaneous leishmaniasis (CL caused by New World Leishmania (Viannia species are at high risk of developing mucosal (ML or disseminated cutaneous leishmaniasis (DCL. After the formation of a primary skin lesion at the site of the bite by a Leishmania-infected sand fly, the infection can disseminate to form secondary lesions. This metastatic phenotype causes significant morbidity and is often associated with a hyper-inflammatory immune response leading to the destruction of nasopharyngeal tissues in ML, and appearance of nodules or numerous ulcerated skin lesions in DCL. Recently, we connected this aggressive phenotype to the presence of Leishmania RNA virus (LRV in strains of L. guyanensis, showing that LRV is responsible for elevated parasitaemia, destructive hyper-inflammation and an overall exacerbation of the disease. Further studies of this relationship and the distribution of LRVs in other Leishmania strains and species would benefit from improved methods of viral detection and quantitation, especially ones not dependent on prior knowledge of the viral sequence as LRVs show significant evolutionary divergence.This study reports various techniques, among which, the use of an anti-dsRNA monoclonal antibody (J2 stands out for its specific and quantitative recognition of dsRNA in a sequence-independent fashion. Applications of J2 include immunofluorescence, ELISA and dot blot: techniques complementing an arsenal of other detection tools, such as nucleic acid purification and quantitative real-time-PCR. We evaluate each method as well as demonstrate a successful LRV detection by the J2 antibody in several parasite strains, a freshly isolated patient sample and lesion biopsies of infected mice.We propose that refinements of these methods could be transferred to the field for use as a diagnostic tool in detecting the presence of LRV, and potentially assessing the LRV-related risk of complications in cutaneous leishmaniasis.

Characterization of a midgut mucin-like glycoconjugate of Lutzomyia longipalpis with a potential role in Leishmania attachment.

Science.gov (United States)

Myšková, Jitka; Dostálová, Anna; Pěničková, Lucie; Halada, Petr; Bates, Paul A; Volf, Petr

2016-07-25

Leishmania parasites are transmitted by phlebotomine sand flies and a crucial step in their life-cycle is the binding to the sand fly midgut. Laboratory studies on sand fly competence to Leishmania parasites suggest that the sand flies fall into two groups: several species are termed "specific/restricted" vectors that support the development of one Leishmania species only, while the others belong to so-called "permissive" vectors susceptible to a wide range of Leishmania species. In a previous study we revealed a correlation between specificity vs permissivity of the vector and glycosylation of its midgut proteins. Lutzomyia longipalpis and other four permissive species tested possessed O-linked glycoproteins whereas none were detected in three specific vectors examined. We used a combination of biochemical, molecular and parasitological approaches to characterize biochemical and biological properties of O-linked glycoprotein of Lu. longipalpis. Lectin blotting and mass spectrometry revealed that this molecule with an apparent molecular weight about 45-50 kDa corresponds to a putative 19 kDa protein with unknown function detected in a midgut cDNA library of Lu. longipalpis. We produced a recombinant glycoprotein rLuloG with molecular weight around 45 kDa. Anti-rLuloG antibodies localize the native glycoprotein on epithelial midgut surface of Lu. longipalpis. Although we could not prove involvement of LuloG in Leishmania attachment by blocking the native protein with anti-rLuloG during sand fly infections, we demonstrated strong binding of rLuloG to whole surface of Leishmania promastigotes. We characterized a novel O-glycoprotein from sand fly Lutzomyia longipalpis. It has mucin-like properties and is localized on the luminal side of the midgut epithelium. Recombinant form of the protein binds to Leishmania parasites in vitro. We propose a role of this molecule in Leishmania attachment to sand fly midgut.

Geographic Distribution of Leishmania Species in Ecuador Based on the Cytochrome B Gene Sequence Analysis

Science.gov (United States)

Kato, Hirotomo; Gomez, Eduardo A.; Martini-Robles, Luiggi; Muzzio, Jenny; Velez, Lenin; Calvopiña, Manuel; Romero-Alvarez, Daniel; Mimori, Tatsuyuki; Uezato, Hiroshi; Hashiguchi, Yoshihisa

2016-01-01

A countrywide epidemiological study was performed to elucidate the current geographic distribution of causative species of cutaneous leishmaniasis (CL) in Ecuador by using FTA card-spotted samples and smear slides as DNA sources. Putative Leishmania in 165 samples collected from patients with CL in 16 provinces of Ecuador were examined at the species level based on the cytochrome b gene sequence analysis. Of these, 125 samples were successfully identified as Leishmania (Viannia) guyanensis, L. (V.) braziliensis, L. (V.) naiffi, L. (V.) lainsoni, and L. (Leishmania) mexicana. Two dominant species, L. (V.) guyanensis and L. (V.) braziliensis, were widely distributed in Pacific coast subtropical and Amazonian tropical areas, respectively. Recently reported L. (V.) naiffi and L. (V.) lainsoni were identified in Amazonian areas, and L. (L.) mexicana was identified in an Andean highland area. Importantly, the present study demonstrated that cases of L. (V.) braziliensis infection are increasing in Pacific coast areas. PMID:27410039

Geographic Distribution of Leishmania Species in Ecuador Based on the Cytochrome B Gene Sequence Analysis.

Directory of Open Access Journals (Sweden)

Hirotomo Kato

2016-07-01

Full Text Available A countrywide epidemiological study was performed to elucidate the current geographic distribution of causative species of cutaneous leishmaniasis (CL in Ecuador by using FTA card-spotted samples and smear slides as DNA sources. Putative Leishmania in 165 samples collected from patients with CL in 16 provinces of Ecuador were examined at the species level based on the cytochrome b gene sequence analysis. Of these, 125 samples were successfully identified as Leishmania (Viannia guyanensis, L. (V. braziliensis, L. (V. naiffi, L. (V. lainsoni, and L. (Leishmania mexicana. Two dominant species, L. (V. guyanensis and L. (V. braziliensis, were widely distributed in Pacific coast subtropical and Amazonian tropical areas, respectively. Recently reported L. (V. naiffi and L. (V. lainsoni were identified in Amazonian areas, and L. (L. mexicana was identified in an Andean highland area. Importantly, the present study demonstrated that cases of L. (V. braziliensis infection are increasing in Pacific coast areas.

Phylogenetic analysis of HSP70 and cyt b gene sequences for Chinese Leishmania isolates and ultrastructural characteristics of Chinese Leishmania sp.

Science.gov (United States)

Yuan, Dongmei; Qin, Hanxiao; Zhang, Jianguo; Liao, Lin; Chen, Qiwei; Chen, Dali; Chen, Jianping

2017-02-01

Leishmaniasis is a worldwide epidemic disease caused by the genus Leishmania, which is still endemic in the west and northwest areas of China. Some viewpoints of the traditional taxonomy of Chinese Leishmania have been challenged by recent phylogenetic researches based on different molecular markers. However, the taxonomic positions and phylogenetic relationships of Chinese Leishmania isolates remain controversial, which need for more data and further analysis. In this study, the heat shock protein 70 (HSP70) gene and cytochrome b (cyt b) gene were used for phylogenetic analysis of Chinese Leishmania isolates from patients, dogs, gerbils, and sand flies in different geographic origins. Besides, for the interesting Leishmania sp. in China, the ultrastructure of three Chinese Leishmania sp. strains (MHOM/CN/90/SC10H2, SD, GL) were observed by transmission electron microscopy. Bayesian trees from HSP70 and cyt b congruently indicated that the 14 Chinese Leishmania isolates belong to three Leishmania species including L. donovani complex, L. gerbilli, and L. (Sauroleishmania) sp. Their identity further confirmed that the undescribed Leishmania species causing visceral Leishmaniasis (VL) in China is closely related to L. tarentolae. The phylogenetic results from HSP70 also suggested the classification of subspecies within L. donovani complex: KXG-918, KXG-927, KXG-Liu, KXG-Xu, 9044, SC6, and KXG-65 belong to L. donovani; Cy, WenChuan, and 801 were proposed to be L. infantum. Through transmission electron microscopy, unexpectedly, the Golgi apparatus were not observed in SC10H2, SD, and GL, which was similar to previous reports of reptilian Leishmania. The statistical analysis of microtubule counts separated SC10H2, SD, and GL as one group from any other reference strain (L. donovani MHOM/IN/80/DD8; L. tropica MHOM/SU/74/K27; L. gerbilli MRHO/CN/60/GERBILLI). The ultrastructural characteristics of Leishmania sp. partly lend support to the phylogenetic inference that

In vitro anti-leishmania evaluation of nickel complexes with a triazolopyrimidine derivative against Leishmania infantum and Leishmania braziliensis.

Science.gov (United States)

Ramírez-Macías, Inmaculada; Maldonado, Carmen R; Marín, Clotilde; Olmo, Francisco; Gutiérrez-Sánchez, Ramón; Rosales, María J; Quirós, Miguel; Salas, Juan M; Sánchez-Moreno, Manuel

2012-07-01

Studies on the anti-proliferative activity in vitro of seven ternary nickel (II) complexes with a triazolopyrimidine derivative and different aliphatic or aromatic amines as auxiliary ligands against promastigote and amastigote forms of Leishmania infantum and Leishmania braziliensis have been carried out. These compounds are not toxic for the host cells and two of them are effective at lower concentrations than the reference drug used in the present study (Glucantime). In general, the in vitro growth rate of Leishmania spp. was reduced, its capacity to infect cells was negatively affected and the multiplication of the amastigotes decreased. Ultrastructural analysis and metabolism excretion studies were executed in order to propose a possible mechanism for the action of the assayed compounds. Our results show that the potential mechanism is at the level of organelles membranes, either by direct action on the microtubules or by their disorganization, leading to vacuolization, degradation and ultimately cell death. Copyright © 2012 Elsevier Inc. All rights reserved.

Arabidopsis thaliana GYRB3 does not encode a DNA gyrase subunit.

Directory of Open Access Journals (Sweden)

Katherine M Evans-Roberts

2010-03-01

Full Text Available DNA topoisomerases are enzymes that control the topology of DNA in all cells. DNA gyrase is unique among the topoisomerases in that it is the only enzyme that can actively supercoil DNA using the free energy of ATP hydrolysis. Until recently gyrase was thought to be unique to bacteria, but has now been discovered in plants. The genome of the model plant, Arabidopsis thaliana, is predicted to encode four gyrase subunits: AtGyrA, AtGyrB1, AtGyrB2 and AtGyrB3.We found, contrary to previous data, that AtGyrB3 is not essential to the survival of A. thaliana. Bioinformatic analysis suggests AtGyrB3 is considerably shorter than other gyrase B subunits, lacking part of the ATPase domain and other key motifs found in all type II topoisomerases; but it does contain a putative DNA-binding domain. Partially purified AtGyrB3 cannot bind E. coli GyrA or support supercoiling. AtGyrB3 cannot complement an E. coli gyrB temperature-sensitive strain, whereas AtGyrB2 can. Yeast two-hybrid analysis suggests that AtGyrB3 cannot bind to AtGyrA or form a dimer.These data strongly suggest that AtGyrB3 is not a gyrase subunit but has another unknown function. One possibility is that it is a nuclear protein with a role in meiosis in pollen.

Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

Science.gov (United States)

Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

2014-08-20

DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

An Innovative Field-Applicable Molecular Test to Diagnose Cutaneous Leishmania Viannia spp. Infections.

Directory of Open Access Journals (Sweden)

Omar A Saldarriaga

2016-04-01

Full Text Available Cutaneous and mucosal leishmaniasis is widely distributed in Central and South America. Leishmania of the Viannia subgenus are the most frequent species infecting humans. L. (V. braziliensis, L. (V. panamensis are also responsible for metastatic mucosal leishmaniasis. Conventional or real time PCR is a more sensitive diagnostic test than microscopy, but the cost and requirement for infrastructure and trained personnel makes it impractical in most endemic regions. Primary health systems need a sensitive and specific point of care (POC diagnostic tool. We developed a novel POC molecular diagnostic test for cutaneous leishmaniasis caused by Leishmania (Viannia spp. Parasite DNA was amplified using isothermal Recombinase Polymerase Amplification (RPA with primers and probes that targeted the kinetoplast DNA. The amplification product was detected by naked eye with a lateral flow (LF immunochromatographic strip. The RPA-LF had an analytical sensitivity equivalent to 0.1 parasites per reaction. The test amplified the principal L. Viannia species from multiple countries: L. (V. braziliensis (n = 33, L. (V. guyanensis (n = 17, L. (V. panamensis (n = 9. The less common L. (V. lainsoni, L. (V. shawi, and L. (V. naiffi were also amplified. No amplification was observed in parasites of the L. (Leishmania subgenus. In a small number of clinical samples (n = 13 we found 100% agreement between PCR and RPA-LF. The high analytical sensitivity and clinical validation indicate the test could improve the efficiency of diagnosis, especially in chronic lesions with submicroscopic parasite burdens. Field implementation of the RPA-LF test could contribute to management and control of cutaneous and mucosal leishmaniasis.

Leishmania hijacking of the macrophage intracellular compartments.

Science.gov (United States)

Liévin-Le Moal, Vanessa; Loiseau, Philippe M

2016-02-01

Leishmania spp., transmitted to humans by the bite of the sandfly vector, are responsible for the three major forms of leishmaniasis, cutaneous, diffuse mucocutaneous and visceral. Leishmania spp. interact with membrane receptors of neutrophils and macrophages. In macrophages, the parasite is internalized within a parasitophorous vacuole and engages in a particular intracellular lifestyle in which the flagellated, motile Leishmania promastigote metacyclic form differentiates into non-motile, metacyclic amastigote form. This phenomenon is induced by Leishmania-triggered events leading to the fusion of the parasitophorous vacuole with vesicular members of the host cell endocytic pathway including recycling endosomes, late endosomes and the endoplasmic reticulum. Maturation of the parasitophorous vacuole leads to the intracellular proliferation of the Leishmania amastigote forms by acquisition of host cell nutrients while escaping host defense responses. © 2015 FEBS.

Passive transfer of leishmania lipopolysaccharide confers parasite survival in macrophages

International Nuclear Information System (INIS)

Handman, E.; Schnur, L.F.; Spithill, T.W.; Mitchell, G.F.

1986-01-01

Infection of macrophages by the intracellular protozoan parasite Leishmania involves specific attachment to the host membrane, followed by phagocytosis and intracellular survival and growth. Two parasite molecules have been implicated in the attachment event: Leishmania lipopolysaccharide (L-LPS) and a glycoprotein (gp63). This study was designed to clarify the role of L-LPS in infection and the stage in the process of infection at which it operates. The authors have recently identified a Leishmania major strain (LRC-L119) which lacks the L-LPS molecule and is not infective for hamsters or mice. This parasite was isolated from a gerbil in Kenya and was identified phenotypically as L. major by isoenzyme and fatty acid analysis. In this study they have confirmed at the genotype level that LRC-L119 is L. major by analyzing and comparing the organization of cloned DNA sequences in the genome of different strains of L. major. Here they show that LRC-L119 promastigotes are phagocytosed rapidly by macrophages in vitro, but in contrast to virulent strains of L. major, they are then killed over a period of 18 hr. In addition, they show that transfer of purified L-LPS from a virulent clone of L. major (V121) into LRC-L119 promastigotes confers on them the ability to survive in macrophages in vitro

Phlebotomine Sand Fly Fauna and Leishmania Infection in the Vicinity of the Serra do Cipó National Park, a Natural Brazilian Heritage Site

Directory of Open Access Journals (Sweden)

Rosana Silva Lana

2015-01-01

Full Text Available In the New World, the leishmaniases are primarily transmitted to humans through the bites of Leishmania-infected Lutzomyia (Diptera: Psychodidae phlebotomine sand flies. Any or both of two basic clinical forms of these diseases are endemic to several cities in Brazil—the American cutaneous leishmaniasis (ACL and the American visceral leishmaniasis (AVL. The present study was conducted in the urban area of a small-sized Brazilian municipality (Jaboticatubas, in which three cases of AVL and nine of ACL have been reported in the last five years. Jaboticatubas is an important tourism hub, as it includes a major part of the Serra do Cipó National Park. Currently, no local data is available on the entomological fauna or circulating Leishmania. During the one-year period of this study, we captured 3,104 phlebotomine sand flies belonging to sixteen Lutzomyia species. In addition to identifying incriminated or suspected vectors of ACL with DNA of the etiological agent of AVL and vice versa, we also detected Leishmania DNA in unexpected Lutzomyia species. The expressive presence of vectors and natural Leishmania infection indicates favorable conditions for the spreading of leishmaniases in the vicinity of the Serra do Cipó National Park.

Experimental mixed infection of Leishmania (Leishmania) amazonensis and Leishmania (L.) infantum in hamsters (Mesocricetus auratus).

Science.gov (United States)

DE Lima Celeste, Jordanna Luíza; Venuto Moura, Ana Paula; França-Silva, João Carlos; Matos DE Sousa, Gabriela; Oliveira Silva, Soraia; Norma Melo, Maria; Luiz Tafuri, Wagner; Carvalho Souza, Carolina; Monteiro DE Andrade, Hélida

2017-08-01

In South America, visceral leishmaniasis is frequently caused by Leishmania infantum and, at an unknown frequency, by Leishmania amazonensis. Therefore, mixed infections with these organisms are possible. Mixed infections might affect the clinical course, immune response, diagnosis, treatment and epidemiology of the disease. Here we describe the clinical course of mixed infections with L. amazonensis and L. infantum in a hamster model. We show that mixed infections are associated with more severe clinical disease than infection with L. amazonensis or L. infantum alone. In spleens with mixed infections, L. infantum outcompeted L. amazonensis in the tissue, but not in culture from tissue. We found increased levels of IgG in animals infected with L. infantum. Although more than 30 bands were revealed in a Western blot, the highest immunogenicity was observed with proteins having molecular masses of 95 and 90 kDa, whereas proteins with molecular masses of lower than 50 kDa were reactive frequently with serum from hamsters infected with L. amazonensis, and proteins with molecular masses of 80 and 70 kDa were reactive only with serum from hamsters infected with L. infantum. This finding has important implications regarding the biology of Leishmania and humoral immune responses to infections with these organisms.

In vitro activity of the beta-carboline alkaloids harmane, harmine, and harmaline toward parasites of the species Leishmania infantum.

Science.gov (United States)

Di Giorgio, C; Delmas, F; Ollivier, E; Elias, R; Balansard, G; Timon-David, P

2004-01-01

Harmane, harmine, and harmaline were investigated for their in vitro antileishmanial activity toward parasites of the species Leishmania infantum. Harmane and Harmine displayed a moderate antiproliferative activity toward human monocytes and exerted a weak antileishmanial activity toward both the promastigote and the amastigote forms of the parasite. Their mechanism of action on the promastigote form of the parasite involved interactions with DNA metabolism leading to an accumulation of parasites in the S-G(2)M phases of the cell-cycle. Harmaline, at the contrary, was deprived from toxicity toward human cells and Leishmania promastigotes, however it exerted a strong antileishmanial activity toward the intracellular amastigote form of the parasite. This property was shown to partly result from the capacity of the molecule to prevent parasite internalization within macrophages by inhibiting Leishmania PKC activity.

The use of radionuclide DNA probe technology for epidemiological studies of tegumentary leishmaniasis in Mato Grosso state, Brazil

Energy Technology Data Exchange (ETDEWEB)

Andrade, Antero Silva Ribeiro de [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN), Belo Horizonte, MG (Brazil); Fernandes, Octavio [Fundacao Oswaldo Cruz (FIOCRUZ), Rio de Janeiro, RJ (Brazil). Dept. de Medicina Tropical; Heub, Marcia; Fontes, Cor Jesus [Universidade Federal do Mato Grosso, Cuiaba, MT (Brazil). Hospital Universitario Julio Muller; Carvalho, Maria de Lourdes Ribeiro; Melo, Maria Norma de [Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil). Dept. de Parasitologia

2005-10-15

DNA hybridisation, using probes labelled with 32 P, was used to type Leishmania samples isolated from patients living in endemic areas of Mato Grosso State (Brazil), and clinically diagnosed as having tegumentary leishmaniasis. k DNA cloned mini-circle probes specific for the Leishmania mexicana and Leishmania braziliensis complexes were used. The results showed that L. braziliensis is the predominant group infecting human patients in the state. Sixty-eight samples were typed, 64 samples (94.1%) belonging to the L. braziliensis complex and only four (5.9%) belonging to the L. mexicana complex. Accurate identification of the Leishmania permits better orientation of the medical follow-up, since clinical manifestations may vary depending on the complex to which the parasite belongs. The epidemiological information furnished by the identification of the Leishmania in given endemic area is also essential for the design of appropriate control measures. (author)

The use of radionuclide DNA probe technology for epidemiological studies of tegumentary leishmaniasis in Mato Grosso state, Brazil

International Nuclear Information System (INIS)

Andrade, Antero Silva Ribeiro de; Fernandes, Octavio; Heub, Marcia; Fontes, Cor Jesus; Carvalho, Maria de Lourdes Ribeiro; Melo, Maria Norma de

2005-01-01

DNA hybridisation, using probes labelled with 32 P, was used to type Leishmania samples isolated from patients living in endemic areas of Mato Grosso State (Brazil), and clinically diagnosed as having tegumentary leishmaniasis. k DNA cloned mini-circle probes specific for the Leishmania mexicana and Leishmania braziliensis complexes were used. The results showed that L. braziliensis is the predominant group infecting human patients in the state. Sixty-eight samples were typed, 64 samples (94.1%) belonging to the L. braziliensis complex and only four (5.9%) belonging to the L. mexicana complex. Accurate identification of the Leishmania permits better orientation of the medical follow-up, since clinical manifestations may vary depending on the complex to which the parasite belongs. The epidemiological information furnished by the identification of the Leishmania in given endemic area is also essential for the design of appropriate control measures. (author)

Leishmania infantum and Leishmania braziliensis: differences and similarities to evade the innate immune system

Directory of Open Access Journals (Sweden)

Sarah Athayde Couto Falcão

2016-08-01

Full Text Available Visceral Leishmaniasis is a severe form of the disease, caused by Leishmania infantum in the New World. Patients present an anergic immune response that favors parasite establishment and spreading through tissues like bone marrow and liver. On the other hand, Leishmania braziliensis causes localized cutaneous lesions, which can be self healing in some individuals. Interactions between host and parasite are essential to understand disease pathogenesis and progression. In this context, dendritic cells (DCs act as essential bridges that connect innate and adaptive immune responses. In this way, the aim of this study was to compare the effects of these two Leishmania species, in some aspects of human dendritic cells biology to better understanding of the evasion mechanisms of Leishmania from host innate immune response. To do so, DCs were obtained from monocytes from whole peripheral blood’s healthy volunteers donors and infected with L. infantum or L. braziliensis for 24 hours. We observed similar rates of infection (around 40% as well as parasite burden for both Leishmania species. Concerning surface molecules, we observed that both parasites induced CD86 expression when DCs were infected for 24h. On the other hand, we detected a lower surface expression of CD209 in the presence of both L. braziliensis and L. infantum, but only the last one promoted the survival of dendritic cells after 24 hours. Therefore, DCs infected by both Leishmania species showed a higher expression of CD86 and a decrease of CD209 expression, suggesting that both enter DCs through CD209 molecule. However, only L. infantum had the ability to inhibit DC apoptotic death, as an evasion mechanism that enables its spreading to organs like bone marrow and liver. Lastly, L. braziliensis was more silent parasite, once it did not inhibit DC apoptosis in our in vitro model.

Identification of a RAC/AKT-like gene in Leishmania parasites as a putative therapeutic target in leishmaniasis.

Science.gov (United States)

Varela-M, Rubén E; Ochoa, Rodrigo; Muskus, Carlos E; Muro, Antonio; Mollinedo, Faustino

2017-10-10

Leishmaniasis is one of the world's most neglected diseases caused by at least 20 different species of the protozoan parasite Leishmania. Although new drugs have become recently available, current therapy for leishmaniasis is still unsatisfactory. A subgroup of serine/threonine protein kinases named as related to A and C protein kinases (RAC), or protein kinase B (PKB)/AKT, has been identified in several organisms including Trypanosoma cruzi parasites. PKB/AKT plays a critical role in mammalian cell signaling promoting cell survival and is a major drug target in cancer therapy. However, the role of protozoan parasitic PKB/AKT remains to be elucidated. We have found that anti-human AKT antibodies recognized a protein of about 57 kDa in Leishmania spp. parasites. Anti-human phospho-AKT(Thr308) antibodies identified a protein in extracts from Leishmania spp. that was upregulated following parasite exposure to stressful conditions, such as nutrient deprivation or heat shock. Incubation of AKT inhibitor X with Leishmania spp. promastigotes under stressful conditions or with Leishmania-infected macrophages led to parasite cell death. We have identified and cloned a novel gene from Leishmania donovani named Ld-RAC/AKT-like gene, encoding a 510-amino acid protein of approximately 57.6 kDa that shows a 26.5% identity with mammalian AKT1. Ld-RAC/AKT-like protein contains major mammalian PKB/AKT hallmarks, including the typical pleckstrin, protein kinase and AGC kinase domains. Unlike mammalian AKT that contains key phosphorylation sites at Thr308 and Ser473 in the activation loop and hydrophobic motif, respectively, Ld-RAC/AKT-like protein has a Thr residue in both motifs. By domain sequence comparison, we classified AKT proteins from different origins in four major subcategories that included different parasites. Our data suggest that Ld-RAC/AKT-like protein represents a Leishmania orthologue of mammalian AKT involved in parasite stress response and survival, and

Distribution and identification of sand flies naturally infected with Leishmania from the Southeastern Peruvian Amazon.

Directory of Open Access Journals (Sweden)

Victor Zorrilla

2017-11-01

Full Text Available Cutaneous leishmaniasis (CL is an important health problem in the New World affecting civilian and military populations that are frequently exposed in endemic settings. The Peruvian region of Madre de Dios located near the border with Brazil is one of the most endemic CL regions in South America with more than 4,451 reported cases between 2010 and 2015 according to the Peruvian epidemiology directorate. However, little is known regarding the diversity and distribution of sand fly vectors in this region. In this study, we aimed to characterize the sand fly fauna in this endemic setting and identify sand fly species naturally infected with Leishmania possibly involved in pathogen transmission.Sand fly collections were carried out during 2014 and 2015 in the communities of Flor de Acre, Villa Primavera, Mavila and Arca Pacahuara using CDC light traps and Shannon traps. Collected specimens were identified and non-blood-fed females were selected for Leishmania infection screening using kinetoplastid DNA-PCR (kDNA-PCR and nested Real time PCR for species identification.A total of 10,897 phlebotomines belonging to the genus Lutzomyia (58 species and Brumptomyia (2 species were collected. Our study confirmed the widespread distribution and abundance of Lutzomyia (Trichophoromyia spp. (24%, Lu. whitmani (19.4% and Lu. yucumensis (15.8% in the region. Analysis of Shannon diversity index indicates variability in sand fly composition across sites with Villa Primavera presenting the highest sand fly diversity and abundance. Leishmania screening by kDNA-PCR resulted in 45 positive pools collected from Flor de Acre (34 pools, Mavila (10 pools and Arca Pacahuara (1 pool and included 14 species: Lu. yucumensis, Lu. aragoi, Lu. sallesi, Lu. sherlocki, Lu. shawi, Lu. walkeri, Lu nevesi, Lu. migonei, Lu. davisi, Lu. carrerai, Lu. hirsuta, Lu. (Trichophoromyia spp., Lu. llanosmartinsi and Lu. whitmani. Lutzomyia sherlocki, Lu. walkeri and Lu. llanosmartinsi had the

Distribution and identification of sand flies naturally infected with Leishmania from the Southeastern Peruvian Amazon.

Science.gov (United States)

Zorrilla, Victor; De Los Santos, Maxy B; Espada, Liz; Santos, Rocío Del Pilar; Fernandez, Roberto; Urquia, Albino; Stoops, Craig A; Ballard, Sarah-Blythe; Lescano, Andres G; Vásquez, Gissella M; Valdivia, Hugo O

2017-11-01

Cutaneous leishmaniasis (CL) is an important health problem in the New World affecting civilian and military populations that are frequently exposed in endemic settings. The Peruvian region of Madre de Dios located near the border with Brazil is one of the most endemic CL regions in South America with more than 4,451 reported cases between 2010 and 2015 according to the Peruvian epidemiology directorate. However, little is known regarding the diversity and distribution of sand fly vectors in this region. In this study, we aimed to characterize the sand fly fauna in this endemic setting and identify sand fly species naturally infected with Leishmania possibly involved in pathogen transmission. Sand fly collections were carried out during 2014 and 2015 in the communities of Flor de Acre, Villa Primavera, Mavila and Arca Pacahuara using CDC light traps and Shannon traps. Collected specimens were identified and non-blood-fed females were selected for Leishmania infection screening using kinetoplastid DNA-PCR (kDNA-PCR) and nested Real time PCR for species identification. A total of 10,897 phlebotomines belonging to the genus Lutzomyia (58 species) and Brumptomyia (2 species) were collected. Our study confirmed the widespread distribution and abundance of Lutzomyia (Trichophoromyia) spp. (24%), Lu. whitmani (19.4%) and Lu. yucumensis (15.8%) in the region. Analysis of Shannon diversity index indicates variability in sand fly composition across sites with Villa Primavera presenting the highest sand fly diversity and abundance. Leishmania screening by kDNA-PCR resulted in 45 positive pools collected from Flor de Acre (34 pools), Mavila (10 pools) and Arca Pacahuara (1 pool) and included 14 species: Lu. yucumensis, Lu. aragoi, Lu. sallesi, Lu. sherlocki, Lu. shawi, Lu. walkeri, Lu nevesi, Lu. migonei, Lu. davisi, Lu. carrerai, Lu. hirsuta, Lu. (Trichophoromyia) spp., Lu. llanosmartinsi and Lu. whitmani. Lutzomyia sherlocki, Lu. walkeri and Lu. llanosmartinsi had the

Distribution and identification of sand flies naturally infected with Leishmania from the Southeastern Peruvian Amazon

Science.gov (United States)

Zorrilla, Victor; De Los Santos, Maxy B.; Espada, Liz; Santos, Rocío del Pilar; Fernandez, Roberto; Urquia, Albino; Stoops, Craig A.; Ballard, Sarah-Blythe; Lescano, Andres G.; Vásquez, Gissella M.; Valdivia, Hugo O.

2017-01-01

Background Cutaneous leishmaniasis (CL) is an important health problem in the New World affecting civilian and military populations that are frequently exposed in endemic settings. The Peruvian region of Madre de Dios located near the border with Brazil is one of the most endemic CL regions in South America with more than 4,451 reported cases between 2010 and 2015 according to the Peruvian epidemiology directorate. However, little is known regarding the diversity and distribution of sand fly vectors in this region. In this study, we aimed to characterize the sand fly fauna in this endemic setting and identify sand fly species naturally infected with Leishmania possibly involved in pathogen transmission. Methods Sand fly collections were carried out during 2014 and 2015 in the communities of Flor de Acre, Villa Primavera, Mavila and Arca Pacahuara using CDC light traps and Shannon traps. Collected specimens were identified and non-blood-fed females were selected for Leishmania infection screening using kinetoplastid DNA-PCR (kDNA-PCR) and nested Real time PCR for species identification. Results A total of 10,897 phlebotomines belonging to the genus Lutzomyia (58 species) and Brumptomyia (2 species) were collected. Our study confirmed the widespread distribution and abundance of Lutzomyia (Trichophoromyia) spp. (24%), Lu. whitmani (19.4%) and Lu. yucumensis (15.8%) in the region. Analysis of Shannon diversity index indicates variability in sand fly composition across sites with Villa Primavera presenting the highest sand fly diversity and abundance. Leishmania screening by kDNA-PCR resulted in 45 positive pools collected from Flor de Acre (34 pools), Mavila (10 pools) and Arca Pacahuara (1 pool) and included 14 species: Lu. yucumensis, Lu. aragoi, Lu. sallesi, Lu. sherlocki, Lu. shawi, Lu. walkeri, Lu nevesi, Lu. migonei, Lu. davisi, Lu. carrerai, Lu. hirsuta, Lu. (Trichophoromyia) spp., Lu. llanosmartinsi and Lu. whitmani. Lutzomyia sherlocki, Lu. walkeri and Lu

Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA.

Science.gov (United States)

Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian

2013-12-01

Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

Intracellular zinc flux causes reactive oxygen species mediated mitochondrial dysfunction leading to cell death in Leishmania donovani.

Directory of Open Access Journals (Sweden)

Anjali Kumari

Full Text Available Leishmaniasis caused by Leishmania parasite is a global threat to public health and one of the most neglected tropical diseases. Therefore, the discovery of novel drug targets and effective drug is a major challenge and an important goal. Leishmania is an obligate intracellular parasite that alternates between sand fly and human host. To survive and establish infections, Leishmania parasites scavenge and internalize nutrients from the host. Nevertheless, host cells presents mechanism like nutrient restriction to inhibit microbial growth and control infection. Zinc is crucial for cellular growth and disruption in its homeostasis hinders growth and survival in many cells. However, little is known about the role of zinc in Leishmania growth and survival. In this study, the effect of zinc on the growth and survival of L.donovani was analyzed by both Zinc-depletion and Zinc-supplementation using Zinc-specific chelator N, N, N', N'-tetrakis (2-pyridylmethyl ethylenediamine (TPEN and Zinc Sulfate (ZnSO4. Treatment of parasites with TPEN rather than ZnSO4 had significantly affected the growth in a dose- and time-dependent manner. The pre-treatment of promastigotes with TPEN resulted into reduced host-parasite interaction as indicated by decreased association index. Zn depletion resulted into flux in intracellular labile Zn pool and increased in ROS generation correlated with decreased intracellular total thiol and retention of plasma membrane integrity without phosphatidylserine exposure in TPEN treated promastigotes. We also observed that TPEN-induced Zn depletion resulted into collapse of mitochondrial membrane potential which is associated with increase in cytosolic calcium and cytochrome-c. DNA fragmentation analysis showed increased DNA fragments in Zn-depleted cells. In summary, intracellular Zn depletion in the L. donovani promastigotes led to ROS-mediated caspase-independent mitochondrial dysfunction resulting into apoptosis-like cell death

Identification of species of leishmania isolated from patients with cutaneous leishmaniasis in Kermanshah; using RAPD-PCR technique

Directory of Open Access Journals (Sweden)

Yazdan Hamzavi

2010-09-01

Full Text Available Annually many numbers of pationts with Cutaneous Leishmaniasis (CL have been reported in Kermanshah province- IRAN. The study aimed to identify species of Leishmania isolated from patients with CT in Kermanshah. Seven isolates of Leishmania obtained from patients with CL, without any travelling to other provinces, were cultured in NNN medium. After mass production of leptomonads in RPMI 1640 medium DNA was purified and the species were diagnosed using RAPD-PCR technique. The study of electrophoretic fingerprints of the product of RAPD-PCR in seven isolates showed that Leshmania major was the causative agent of CL patients in Kermanshah province. More studies in this field recommended.

Innate Immunity against Leishmania Infections

Science.gov (United States)

Gurung, Prajwal; Kanneganti, Thirumala-Devi

2015-01-01

Leishmaniasis is a major health problem that affects more than 300 million people throughout the world. The morbidity associated with the disease causes serious economic burden in Leishmania endemic regions. Despite the morbidity and economic burden associated with Leishmaniasis, this disease rarely gets noticed and is still categorized under neglected tropical diseases. The lack of research combined with the ability of Leishmania to evade immune recognition has rendered our efforts to design therapeutic treatments or vaccines challenging. Herein, we review the literature on Leishmania from innate immune perspective and discuss potential problems as well as solutions and future directions that could aid in identifying novel therapeutic targets to eliminate this parasite. PMID:26249747

Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

Science.gov (United States)

Ficarelli, A; Tassi, F; Restivo, F M

1999-03-01

We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

Molecular diagnosis of canine visceral leishmaniasis: a comparative study of three methods using skin and spleen from dogs with natural Leishmania infantum infection.

Science.gov (United States)

Reis, Levi Eduardo Soares; Coura-Vital, Wendel; Roatt, Bruno Mendes; Bouillet, Leoneide Érica Maduro; Ker, Henrique Gama; Fortes de Brito, Rory Cristiane; Resende, Daniela de Melo; Carneiro, Mariângela; Giunchetti, Rodolfo Cordeiro; Marques, Marcos José; Carneiro, Cláudia Martins; Reis, Alexandre Barbosa

2013-11-08

Polymerase chain reaction (PCR) and its variations represent highly sensitive and specific methods for Leishmania DNA detection and subsequent canine visceral leishmaniasis (CVL) diagnosis. The aim of this work was to compare three different molecular diagnosis techniques (conventional PCR [cPCR], seminested PCR [snPCR], and quantitative PCR [qPCR]) in samples of skin and spleen from 60 seropositive dogs by immunofluorescence antibody test and enzyme-linked immunosorbent assay. Parasitological analysis was conducted by culture of bone marrow aspirate and optical microscopic assessment of ear skin and spleen samples stained with Giemsa, the standard tests for CVL diagnosis. The primers L150/L152 and LINR4/LIN17/LIN19 were used to amplify the conserved region of the Leishmania kDNA minicircle in the cPCR, and snPCR and qPCR were performed using the DNA polymerase gene (DNA pol α) primers from Leishmania infantum. The parasitological analysis revealed parasites in 61.7% of the samples. Sensitivities were 89.2%, 86.5%, and 97.3% in the skin and 81.1%, 94.6%, and 100.0% in spleen samples used for cPCR, snPCR, and qPCR, respectively. We demonstrated that the qPCR method was the best technique to detect L. infantum in both skin and spleen samples. However, we recommend the use of skin due to the high sensitivity and sampling being less invasive. Copyright © 2013 Elsevier B.V. All rights reserved.

Detection and Differentiation of Leishmania spp. in Clinical Specimens by Use of a SYBR Green-Based Real-Time PCR Assay.

Science.gov (United States)

de Almeida, Marcos E; Koru, Ozgur; Steurer, Francis; Herwaldt, Barbara L; da Silva, Alexandre J

2017-01-01

Leishmaniasis in humans is caused by Leishmania spp. in the subgenera Leishmania and Viannia Species identification often has clinical relevance. Until recently, our laboratory relied on conventional PCR amplification of the internal transcribed spacer 2 (ITS2) region (ITS2-PCR) followed by sequencing analysis of the PCR product to differentiate Leishmania spp. Here we describe a novel real-time quantitative PCR (qPCR) approach based on the SYBR green technology (LSG-qPCR), which uses genus-specific primers that target the ITS1 region and amplify DNA from at least 10 Leishmania spp., followed by analysis of the melting temperature (T m ) of the amplicons on qPCR platforms (the Mx3000P qPCR system [Stratagene-Agilent] and the 7500 real-time PCR system [ABI Life Technologies]). We initially evaluated the assay by testing reference Leishmania isolates and comparing the results with those from the conventional ITS2-PCR approach. Then we compared the results from the real-time and conventional molecular approaches for clinical specimens from 1,051 patients submitted to the reference laboratory of the Centers for Disease Control and Prevention for Leishmania diagnostic testing. Specimens from 477 patients tested positive for Leishmania spp. with the LSG-qPCR assay, specimens from 465 of these 477 patients also tested positive with the conventional ITS2-PCR approach, and specimens from 10 of these 465 patients had positive results because of retesting prompted by LSG-qPCR positivity. On the basis of the T m values of the LSG-qPCR amplicons from reference and clinical specimens, we were able to differentiate four groups of Leishmania parasites: the Viannia subgenus in aggregate; the Leishmania (Leishmania) donovani complex in aggregate; the species L (L) tropica; and the species L (L) mexicana, L (L) amazonensis, L (L) major, and L (L) aethiopica in aggregate. Copyright © 2016 American Society for Microbiology.

Genetic Manipulation of Leishmania donovani to Explore the Involvement of Argininosuccinate Synthase in Oxidative Stress Management.

Directory of Open Access Journals (Sweden)

Abul Hasan Sardar

2016-03-01

Full Text Available Reactive oxygen and nitrogen species (ROS and RNS produced by the phagocytic cells are the most common arsenals used to kill the intracellular pathogens. However, Leishmania, an intracellular pathogen, has evolved mechanisms to survive by counterbalancing the toxic oxygen metabolites produced during infection. Polyamines, the major contributor in this anti-oxidant machinery, are largely dependent on the availability of L-arginine in the intracellular milieu. Argininosuccinate synthase (ASS plays an important role as the rate-limiting step required for converting L-citrulline to argininosuccinate to provide arginine for an assortment of metabolic processes. Leishmania produce an active ASS enzyme, yet it has an incomplete urea cycle as it lacks an argininosuccinate lyase (ASL. There is no evidence for endogenous synthesis of L-arginine in Leishmania, which suggests that these parasites salvage L-arginine from extracellular milieu and makes the biological function of ASS and the production of argininosuccinate in Leishmania unclear. Our previous quantitative proteomic analysis of Leishmania promastigotes treated with sub-lethal doses of ROS, RNS, or a combination of both, led to the identification of several differentially expressed proteins which included ASS. To assess the involvement of ASS in stress management, a mutant cell line with greatly reduced ASS activity was created by a double-targeted gene replacement strategy in L. donovani promastigote. Interestingly, LdASS is encoded by three copies of allele, but Western blot analysis showed the third allele did not appear to express ASS. The free thiol levels in the mutant LdASS-/-/+ cell line were decreased. Furthermore, the cell viability in L-arginine depleted medium was greatly attenuated on exposure to different stress environments and was adversely impacted in its ability to infect mice. These findings suggest that ASS is important for Leishmania donovani to counterbalance the stressed

The Seminested PCR Based Detection of Leishmania infantum Infection in Asymptomatic Dogs in a New Endemic Focus of Visceral Leishmaniasis in Iran

Directory of Open Access Journals (Sweden)

Y Rassi

2007-06-01

Full Text Available Visceral Leishmaniasis (Kala-azar is a serious health problem in some northern and south western parts of Iran. The incidence of kala-azar caused by Leishmania infantum has recently increased in Nourabad-Mamassani district of Fars Province, in the south of the country. This study was designed to determine the role of asymptomatic dogs as host reservoir of L. infantum in this new formed focus and detection of prevalence of infection near them. A total of 20 as¬ymptomatic stray and sheep dogs were randomly sampled. The Buffy coat layer of their peripheral blood was used for DNA extraction and PCR. A species specific seminested PCR was used for DNA amplification using LINR4, LIN17 and LIN19 primers. These primers amplified variable area of the minicircle kDNA of Leishmania parasites. Of the 20 sampled dogs checked for leishmanial kDNA, six (30% were found naturally infected. It is concluded that, dogs (Canis familiaris even if asympto¬matic, is considered as the domestic host reservoir of kala-azar in this endemic focus.

Functional and genetic evidence that nucleoside transport is highly conserved in Leishmania species: Implications for pyrimidine-based chemotherapy.

Science.gov (United States)

Alzahrani, Khalid J H; Ali, Juma A M; Eze, Anthonius A; Looi, Wan Limm; Tagoe, Daniel N A; Creek, Darren J; Barrett, Michael P; de Koning, Harry P

2017-08-01

Leishmania pyrimidine salvage is replete with opportunities for therapeutic intervention with enzyme inhibitors or antimetabolites. Their uptake into cells depends upon specific transporters; therefore it is essential to establish whether various Leishmania species possess similar pyrimidine transporters capable of drug uptake. Here, we report a comprehensive characterization of pyrimidine transport in L. major and L. mexicana. In both species, two transporters for uridine/adenosine were detected, one of which also transported uracil and the antimetabolites 5-fluoruracil (5-FU) and 5F,2'deoxyuridine (5F,2'dUrd), and was designated uridine-uracil transporter 1 (UUT1); the other transporter mediated uptake of adenosine, uridine, 5F,2'dUrd and thymidine and was designated Nucleoside Transporter 1 (NT1). To verify the reported L. donovani model of two NT1-like genes encoding uridine/adenosine transporters, and an NT2 gene encoding an inosine transporter, we cloned the corresponding L. major and L. mexicana genes, expressing each in T. brucei. Consistent with the L. donovani reports, the NT1-like genes of either species mediated the adenosine-sensitive uptake of [ 3 H]-uridine but not of [ 3 H]-inosine. Conversely, the NT2-like genes mediated uptake of [ 3 H]-inosine but not [ 3 H]-uridine. Among pyrimidine antimetabolites tested, 5-FU and 5F,2'dUrd were the most effective antileishmanials; resistance to both analogs was induced in L. major and L. mexicana. In each case it was found that the resistant cells had lost the transport capacity for the inducing drug. Metabolomics analysis found that the mechanism of action of 5-FU and 5F-2'dUrd was similar in both Leishmania species, with major changes in deoxynucleotide metabolism. We conclude that the pyrimidine salvage system is highly conserved in Leishmania species - essential information for the development of pyrimidine-based chemotherapy. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights

Molecular Diversity between Salivary Proteins from New World and Old World Sand Flies with Emphasis on Bichromomyia olmeca, the Sand Fly Vector of Leishmania mexicana in Mesoamerica.

Science.gov (United States)

Abdeladhim, Maha; V Coutinho-Abreu, Iliano; Townsend, Shannon; Pasos-Pinto, Silvia; Sanchez, Laura; Rasouli, Manoochehr; B Guimaraes-Costa, Anderson; Aslan, Hamide; Francischetti, Ivo M B; Oliveira, Fabiano; Becker, Ingeborg; Kamhawi, Shaden; Ribeiro, Jose M C; Jochim, Ryan C; Valenzuela, Jesus G

2016-07-01

Sand fly saliva has been shown to have proteins with potent biological activities, salivary proteins that can be used as biomarkers of vector exposure, and salivary proteins that are candidate vaccines against different forms of leishmaniasis. Sand fly salivary gland transcriptomic approach has contributed significantly to the identification and characterization of many of these salivary proteins from important Leishmania vectors; however, sand fly vectors in some regions of the world are still neglected, as Bichromomyia olmeca (formerly known as Lutzomyia olmeca olmeca), a proven vector of Leishmania mexicana in Mexico and Central America. Despite the importance of this vector in transmitting Leishmania parasite in Mesoamerica there is no information on the repertoire of B. olmeca salivary proteins and their relationship to salivary proteins from other sand fly species. A cDNA library of the salivary glands of wild-caught B. olmeca was constructed, sequenced, and analyzed. We identified transcripts encoding for novel salivary proteins from this sand fly species and performed a comparative analysis between B. olmeca salivary proteins and those from other sand fly species. With this new information we present an updated catalog of the salivary proteins specific to New World sand flies and salivary proteins common to all sand fly species. We also report in this work the anti-Factor Xa activity of Lofaxin, a salivary anticoagulant protein present in this sand fly species. This study provides information on the first transcriptome of a sand fly from Mesoamerica and adds information to the limited repertoire of salivary transcriptomes from the Americas. This comparative analysis also shows a fast degree of evolution in salivary proteins from New World sand flies as compared with Old World sand flies.

Arginase expression modulates nitric oxide production in Leishmania (Leishmania) amazonensis.

Science.gov (United States)

Acuña, Stephanie Maia; Aoki, Juliana Ide; Laranjeira-Silva, Maria Fernanda; Zampieri, Ricardo Andrade; Fernandes, Juliane Cristina Ribeiro; Muxel, Sandra Marcia; Floeter-Winter, Lucile Maria

2017-01-01

Arginase is an enzyme that converts L-arginine to urea and L-ornithine, an essential substrate for the polyamine pathway supporting Leishmania (Leishmania) amazonensis replication and its survival in the mammalian host. L-arginine is also the substrate of macrophage nitric oxide synthase 2 (NOS2) to produce nitric oxide (NO) that kills the parasite. This competition can define the fate of Leishmania infection. The transcriptomic profiling identified a family of oxidoreductases in L. (L.) amazonensis wild-type (La-WT) and L. (L.) amazonensis arginase knockout (La-arg-) promastigotes and axenic amastigotes. We highlighted the identification of an oxidoreductase that could act as nitric oxide synthase-like (NOS-like), due to the following evidences: conserved domain composition, the participation of NO production during the time course of promastigotes growth and during the axenic amastigotes differentiation, regulation dependence on arginase activity, as well as reduction of NO amount through the NOS activity inhibition. NO quantification was measured by DAF-FM labeling analysis in a flow cytometry. We described an arginase-dependent NOS-like activity in L. (L.) amazonensis and its role in the parasite growth. The increased detection of NO production in the mid-stationary and late-stationary growth phases of La-WT promastigotes could suggest that this production is an important factor to metacyclogenesis triggering. On the other hand, La-arg- showed an earlier increase in NO production compared to La-WT, suggesting that NO production can be arginase-dependent. Interestingly, La-WT and La-arg- axenic amastigotes produced higher levels of NO than those observed in promastigotes. As a conclusion, our work suggested that NOS-like is expressed in Leishmania in the stationary growth phase promastigotes and amastigotes, and could be correlated to metacyclogenesis and amastigotes growth in a dependent way to the internal pool of L-arginine and arginase activity.

Mucosal delivery of a transmission-blocking DNA vaccine encoding Giardia lamblia CWP2 by Salmonella typhimurium bactofection vehicle.

Science.gov (United States)

Abdul-Wahid, Aws; Faubert, Gaétan

2007-12-05

In this study, we investigated the use of Salmonella typhimurium (STM1 strain) as a bactofection vehicle to deliver a transmission-blocking DNA vaccine (TBDV) plasmid to the intestinal immune system. The gene encoding the full length cyst wall protein-2 (CWP2) from Giardia lamblia was subcloned into the pCDNA3 mammalian expression vector and stably introduced into S. typhimurium STM1. Eight-week-old female BALB/c mice were orally immunized every 2 weeks, for a total of three immunizations. Vaccinated and control mice were sacrificed 1 week following the last injection. Administration of the DNA vaccine led to the production of CWP2-specific cellular immune responses characterized by a mixed Th1/Th2 response. Using ELISA, antigen-specific IgA and IgG antibodies were detected in intestinal secretions. Moreover, analysis of sera demonstrated that the DNA immunization also stimulated the production of CWP2-specific IgG antibodies that were mainly of the IgG2a isotype. Finally, challenge infection with live Giardia muris cysts revealed that mice receiving the CWP2-encoding DNA vaccine were able to reduce cyst shedding by approximately 60% compared to control mice. These results demonstrate, for the first time, the development of parasite transmission-blocking immunity at the intestinal level following the administration of a mucosal DNA vaccine delivered by S. typhimurium STM1.

Achievements, Challenges, and Opportunities in DNA-Encoded Library Research: An Academic Point of View.

Science.gov (United States)

Yuen, Lik Hang; Franzini, Raphael M

2017-05-04

DNA-encoded chemical libraries (DECLs) are pools of DNA-tagged small molecules that enable facile screening and identification of bio-macromolecule binders. The successful development of DECLs has led to their increasingly important role in drug development, and screening hits have entered clinical trials. In this review, we summarize the development and currently active research areas of DECLs with a focus on contributions from groups at academic institutes. We further look at opportunities and future directions of DECL research in medicinal chemistry and chemical biology based on the symbiotic relationship between academia and industry. Challenges associated with the application of DECLs in academic drug discovery are further discussed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

A putative ATP/GTP binding protein affects Leishmania mexicana growth in insect vectors and vertebrate hosts

Science.gov (United States)

Hlaváčová, Jana; Zimmer, Sara L.; Butenko, Anzhelika; Podešvová, Lucie; Leštinová, Tereza; Lukeš, Julius; Kostygov, Alexei; Votýpka, Jan; Volf, Petr

2017-01-01

Background Leishmania virulence factors responsible for the complicated epidemiology of the various leishmaniases remain mainly unidentified. This study is a characterization of a gene previously identified as upregulated in two of three overlapping datasets containing putative factors important for Leishmania’s ability to establish mammalian intracellular infection and to colonize the gut of an insect vector. Methodology/Principal findings The investigated gene encodes ATP/GTP binding motif-containing protein related to Leishmania development 1 (ALD1), a cytosolic protein that contains a cryptic ATP/GTP binding P-loop. We compared differentiation, growth rates, and infective abilities of wild-type and ALD1 null mutant cell lines of L. mexicana. Loss of ALD1 results in retarded growth kinetics but not defects in differentiation in axenic culture. Similarly, when mice and the sand fly vector were infected with the ALD1 null mutant, the primary difference in infection and colonization phenotype relative to wild type was an inability to achieve maximal host pathogenicity. While ability of the ALD1 null mutant cells to infect macrophages in vitro was not affected, replication within macrophages was clearly curtailed. Conclusions/Significance L. mexicana ALD1, encoding a protein with no assigned functional domains or motifs, was identified utilizing multiple comparative analyses with the related and often experimentally overlooked monoxenous flagellates. We found that it plays a role in Leishmania infection and colonization in vitro and in vivo. Results suggest that ALD1 functions in L. mexicana’s general metabolic network, rather than function in specific aspect of virulence as anticipated from the compared datasets. This result validates our comparative genomics approach for finding relevant factors, yet highlights the importance of quality laboratory-based analysis of genes tagged by these methods. PMID:28742133

Persistence of Leishmania antigen in C57Bl/6j inbred mice infected with Leishmania (Leishmania amazonensis Persistência do antígeno da Leishmania no camundongo isogênico C57Bl/6j infectado com a Leishmania (Leishmania amazonensis

Directory of Open Access Journals (Sweden)

C. Vasconcellos

1999-07-01

Full Text Available PURPOSE. To develop an animal model for studying mucocutaneous leishmaniasis. METHODS. The hind footpad of C57Bl/6j inbred mice was experimentally infected with 10(7 Leishmania (Leishmania amazonensis promastigote and the skin was studied through light and electron transmission microscopy and immunohistochemistry (PAP techniques. RESULTS. There were morphological evidences of cellular immune mechanisms and hypersensitivity reaction after eight weeks of infection and metastasis and well shaped parasites at ultrastructural level by fifty-one weeks post infection. Relapse of infection with mucosa lesions occurred around the 50th week after inoculation. CONCLUSION. The use of this animal model in long term follow up could be an useful experimental model for human mucocutaneous leishmaniasis.OBJETIVO. Desenvolver um modelo experimental para o estudo da leishmaniose cutâneo-mucosa. MÉTODOS. O coxim plantar traseiro de camundongos isogênicos C57Bl/6j foi inoculado com 10(7 formas promastigotas da Leishmania (Leishmania amazonensis e a pele foi estudada através da microscopia óptica e eletrônica e de técnica imunohistoquímica (PAP. RESULTADOS. Ocorreram evidências morfológicas de mecanismos imunes mediados por células, concomitantemente ao de reação de hipersensibilidade, após a oitava semana de infecção e a presença de parasitas com ultraestrutura preservada na quinquagésima primeira semana após a infecção. Houve recidiva da infecção com surgimento de lesões mucosas por volta da 50a semana pós inoculação. CONCLUSÃO. Este modelo animal, com um período de tempo de seguimento prolongado, poderia ser empregado como modelo para o estudo experimental da leishmaniose cutâneo-mucosa.

Asymptomatic Leishmania Infected Children: A Seroprevalence and Molecular Survey in a Rural Area of Fars Province, Southern Iran

Directory of Open Access Journals (Sweden)

Akram Layegh Gigloo

2018-01-01

Full Text Available The current study aimed to evaluate the seroprevalence of visceral leishmaniasis in asymptomatic healthy children in a rural area of Fars province, Southern Iran. Blood samples were taken from 617 asymptomatic healthy children and serum samples along with buffy coat were separated from the blood. The serum samples were assessed for antibodies against Leishmania infantum by an indirect ELISA and the buffy coats were tested for the presence of L. infantum DNA by molecular method. Of the 617 recruited children, 297 (48.1% were female and 317 (51.4% were male. Anti-Leishmania antibodies were detected in 17 (2.8% of the children. From those 17 seropositive cases, 5 (29.4% were male and 12 (70.6% cases were female. Children aged 5–8 years had the highest seroprevalence rate; however, no associations were found between seropositivity to Leishmania and gender or age of the children. Moreover, L. infantum DNA was detected in buffy coat of 8 (1.3% of 617 children. Three of the PCR-positive cases were seropositive whereas 14 of seropositive subjects (82.3% were PCR-negative. Findings of the current study revealed a considerable subclinical leishmanial infection in children in the studied rural area in the south of Iran. Results of the current study could be used for surveillance, prevention, and control of VL in the area.

Whatman Paper (FTA Cards) for Storing and Transferring Leishmania DNA for PCR Examination

OpenAIRE

A Amin-Mohammadi; E Eskandari; AA Akhavan; M Ganjbakhsh; Z Hosseininejad; M Afzalaghaei; F Berenji; M Mohajery; A Khamesipour; A Fata

2009-01-01

"nBackground: Diagnosis of cutaneous leishmaniasis (CL) is often made based on clinical manifesta­tion. Correct diagnosis and identification of the parasite are crucial for choosing the effective treat­ment and for epidemiological studies. On the other hand, determination of Leishmania species is nec­essary for designing appropriate control programs. Diagnosis by PCR is becoming a 'gold standard'. For PCR preparation, storage and shipments of specimens are necessary. In this study, ...

Phylogenomic reconstruction supports supercontinent origins for Leishmania.

Science.gov (United States)

Harkins, Kelly M; Schwartz, Rachel S; Cartwright, Reed A; Stone, Anne C

2016-03-01

Leishmania, a genus of parasites transmitted to human hosts and mammalian/reptilian reservoirs by an insect vector, is the causative agent of the human disease complex leishmaniasis. The evolutionary relationships within the genus Leishmania and its origins are the source of ongoing debate, reflected in conflicting phylogenetic and biogeographic reconstructions. This study employs a recently described bioinformatics method, SISRS, to identify over 200,000 informative sites across the genome from newly sequenced and publicly available Leishmania data. This dataset is used to reconstruct the evolutionary relationships of this genus. Additionally, we constructed a large multi-gene dataset, using it to reconstruct the phylogeny and estimate divergence dates for species. We conclude that the genus Leishmania evolved at least 90-100 million years ago, supporting a modified version of the Multiple Origins hypothesis that we call the Supercontinent hypothesis. According to this scenario, separate Leishmania clades emerged prior to, and during, the breakup of Gondwana. Additionally, we confirm that reptile-infecting Leishmania are derived from mammalian forms and that the species that infect porcupines and sloths form a clade long separated from other species. Finally, we firmly place the guinea-pig infecting species, Leishmaniaenriettii, the globally dispersed Leishmaniasiamensis, and the newly identified Australian species from a kangaroo, as sibling species whose distribution arises from the ancient connection between Australia, Antarctica, and South America. Copyright © 2015 Elsevier B.V. All rights reserved.

Screening for Inhibitors of Essential Leishmania Glucose Transporters

Science.gov (United States)

2013-07-01

Leishmania Glucose Transporters PRINCIPAL INVESTIGATOR: Scott M. Landfear, Ph.D. CONTRACTING ORGANIZATION: Oregon Health & Science...COVERED 1 July 2009- 30 June 2013 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Screening for Inhibitors of Essential Leishmania Glucose Transporters 5b...The objective of this project was to identify compounds that selectively inhibit the essential Leishmania glucose transporters and could hence serve

Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

Directory of Open Access Journals (Sweden)

Mayara C. Lombardi

2014-12-01

Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

Genome sequencing of the lizard parasite Leishmania tarentolae reveals loss of genes associated to the intracellular stage of human pathogenic species

Science.gov (United States)

Raymond, Frédéric; Boisvert, Sébastien; Roy, Gaétan; Ritt, Jean-François; Légaré, Danielle; Isnard, Amandine; Stanke, Mario; Olivier, Martin; Tremblay, Michel J.; Papadopoulou, Barbara; Ouellette, Marc; Corbeil, Jacques

2012-01-01

The Leishmania tarentolae Parrot-TarII strain genome sequence was resolved to an average 16-fold mean coverage by next-generation DNA sequencing technologies. This is the first non-pathogenic to humans kinetoplastid protozoan genome to be described thus providing an opportunity for comparison with the completed genomes of pathogenic Leishmania species. A high synteny was observed between all sequenced Leishmania species. A limited number of chromosomal regions diverged between L. tarentolae and L. infantum, while remaining syntenic to L. major. Globally, >90% of the L. tarentolae gene content was shared with the other Leishmania species. We identified 95 predicted coding sequences unique to L. tarentolae and 250 genes that were absent from L. tarentolae. Interestingly, many of the latter genes were expressed in the intracellular amastigote stage of pathogenic species. In addition, genes coding for products involved in antioxidant defence or participating in vesicular-mediated protein transport were underrepresented in L. tarentolae. In contrast to other Leishmania genomes, two gene families were expanded in L. tarentolae, namely the zinc metallo-peptidase surface glycoprotein GP63 and the promastigote surface antigen PSA31C. Overall, L. tarentolae's gene content appears better adapted to the promastigote insect stage rather than the amastigote mammalian stage. PMID:21998295

[Molecular typing of Leishmania (Leishmania) amazonensis and species of the subgenus Viannia associated with cutaneous and mucosal leishmaniasis in Colombia: A concordance study].

Science.gov (United States)

Ovalle-Bracho, Clemencia; Camargo, Carolina; Díaz-Toro, Yira; Parra-Muñoz, Marcela

2018-03-15

Multilocus enzyme electrophoresis (MLEE) is the reference standard for the characterization of Leishmania species. The test is restricted to specialized laboratories due to its technical complexity, cost, and time required to obtain results. Polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) is used to identify Leishmania species. To establish the concordance between the two tests as identifying methods for circulating species in Colombia. A total of 96 isolates from patients with cutaneous or mucosal leishmaniasis were selected and identified by MLEE and PCR-RFLP with miniexon and hsp70 as the molecular targets, which were used sequentially. Restriction enzymes HaeIII and BccI were similarly applied. Cohen's kappa coefficient and the 95% confidence interval (CI) were calculated. The kappa coefficient and the 95% CI between MLEE and PCR-RFLP displayed "very good" concordance with a coefficient of 0.98 (CI95%: 0.98 to 1.00). The identified species were Leishmania Viannia braziliensis, Leishmania Viannia panamensis, Leishmania Viannia guyanensis and Leishmania Leishmania amazonensis. A total of 80 of the 96 isolates were sequenced and the results obtained by PCR-RFLP were confirmed. Due to the concordance obtained between tests results with the amplification of the genes miniexon and hsp70, PCR-RFLP is proposed as an alternative for identifying circulating Leishmania species in Colombia.

Leishmania infantum nicotinamidase is required for late-stage development in its natural sand fly vector, Phlebotomus perniciosus

OpenAIRE

Gazanion, Elodie; Seblova, V.; Votypka, J.; Vergnes, Baptiste; Garcia, Deborah; Volf, P.; Sereno, Denis

2012-01-01

Leishmania infantum nicotinamidase, encoded by the Lipnc1 gene, converts nicotinamide into nicotinic acid to ensure Nicotinamide-Adenine-Dinucleotide (NAD(+)) biosynthesis. We were curious to explore the role of this enzyme during L infantum development in its natural sand fly vector, Phlebotomus perniciosus (Diptera, Phlebotominae), using null mutants with a deleted Lipnc1 gene. The null mutants developed as well as the wild type L infantum at the early time points post their ingestion withi...

A ready-to-use duplex qPCR to detect Leishmania infantum DNA in naturally infected dogs.

Science.gov (United States)

Rampazzo, Rita de Cássia Pontello; Solcà, Manuela da Silva; Santos, Liliane Celestino Sales; Pereira, Lais de Novaes; Guedes, José Carlos Oliveira; Veras, Patrícia Sampaio Tavares; Fraga, Deborah Bittencourt Mothé; Krieger, Marco Aurélio; Costa, Alexandre Dias Tavares

2017-11-15

Canine visceral leishmaniasis (CVL) is a systemic disease caused by Leishmania infantum. A precise CVL diagnosis would allow for a faster and more specific treatment. Quantitative PCR (qPCR) is a sensitive and specific technique that can diagnose CVL and also monitor parasite load in the animal during the course of the infection or treatment. The aim of this study was to develop a ready-to-use (gelified and freezer-free) duplex qPCR for the identification of infected animals. We combined a new qPCR protocol that detects the canine 18S rRNA gene with an existing protocol for L. infantum kDNA detection, creating a duplex qPCR. This duplex method was then developed into a ready-to-use format. The performance of the duplex and singleplex reactions were compared in the traditional format (liquid and freezer-stored). Furthermore, the duplex qPCR performance was compared between the ready-to-use and traditional formats. The singleplex and new duplex qPCR exhibited the same detection limit in the traditional format (0.1 parasites/reaction). The ready-to-use format showed a detection limit of 1 parasite/reaction without affecting the reaction efficiency. The performance of the new qPCR protocol in the two formats was assessed using canine tissue samples from 82 dogs in an endemic CVL area that were previously characterized by standard serological and parasitological protocols. Splenic aspirates provided a higher rate of positivity (92.9%) followed by skin (50%) and blood (35.7%). The reported detection limits were observed for all tissues studied. Our results show that the amplification of L. infantum kDNA and canine DNA in a single tube, using either the traditional or ready-to-use format, exhibited the same diagnostic performance as amplification of the parasite kDNA alone. The detection of the host gene strengthens the qPCR results by confirming the presence and quality of DNA in the samples and the absence of polymerase inhibitors. The ready-to-use duplex qPCR format

Recent Advances in Vaccines Against Leishmania Based on Patent Applications.

Science.gov (United States)

Thomaz-Soccol, Vanete; Ferreira da Costa, Eduardo Scopel; Karp, Susan Grace; Junior Letti, Luiz Alberto; Soccol, Flavia Thomaz; Soccol, Carlos Ricardo

2018-01-01

Leishmaniasis is caused by parasites of the genus Leishmania, and represents a group of chronic diseases with an epidemiological and clinical diversity. The disease is endemic in tropical regions, being found in 98 countries, affecting around 12 million people, with an estimated increase of 1.5 million per year. The present review aims to analyze recent and most important patents regarding development of vaccines to improve immunization against leishmaniasis. For this purpose, the Web of Science - Derwent Innovations Index was consulted. There is also a short description of the licensed vaccines already on the market for commercialization, and a critical opinion on future developments. The data herein presented comprises national and international filings, thus considering the patent's country of origin, and can be used an indicator of a country's technological development regarding a specific field. Several types of vaccines against Leishmania were studied. The main classes comprise: vaccines using live cells (virulent or attenuated); dead cells; containing recombinant protein; using DNA of the parasite. United States (74 patents) leads the ranking of patent applications for vaccines against Leishmania, followed by Brazil (36 patents), which is an endemic region of leishmaniasis with 20,000 human cases of cutaneous leishmaniasis and over 3,000 cases of visceral form. This review showed that there is still a lot of space for development regarding the creation of a feasible, effective vaccine against leishmaniasis. The scientific community appears to be taking steps in the right direction, though. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Identification of Leishmania donovani Topoisomerase 1 inhibitors via intuitive scaffold hopping and bioisosteric modification of known Top 1 inhibitors

Science.gov (United States)

Mamidala, Rajinikanth; Majumdar, Papiya; Jha, Kunal Kumar; Bathula, Chandramohan; Agarwal, Rahul; Chary, M. Thirumala; Mazumdar, H. K.; Munshi, Parthapratim; Sen, Subhabrata

2016-05-01

A library of arylidenefuropyridinediones was discovered as potent inhibitors of Leishmania donovani Topoisomerase 1 (LdTop1) where the active molecules displayed considerable inhibition with single digit micromolar EC50 values. This molecular library was designed via intuitive scaffold hopping and bioisosteric modification of known topoisomerase 1 inhibitors such as camptothecin, edotecarin and etc. The design was rationalized by molecular docking analysis of the compound prototype with human topoisomerase 1 (HTop1) and Leishmania donovani topoisomerase 1(LdTop1). The most active compound 4 displayed no cytotoxicity against normal mammalian COS7 cell line (~100 fold less inhibition at the EC50). Similar to camptothecin, 4 interacted with free LdTop1 as observed in the preincubation DNA relaxation inhibition experiment. It also displayed anti-protozoal activity against Leishmania donovani promastigote. Crystal structure investigation of 4 and its molecular modelling with LdTop1 revealed putative binding sites in the enzyme that could be harnessed to generate molecules with better potency.

[Eco-epidemiological aspects, natural detection and molecular identification of Leishmania spp. in Lutzomyia reburra, Lutzomyia barrettoi majuscula and Lutzomyia trapidoi].

Science.gov (United States)

Arrivillaga-Henríquez, Jazzmín; Enríquez, Sandra; Romero, Vanessa; Echeverría, Gustavo; Pérez-Barrera, Jorge; Poveda, Ana; Navarro, Juan-Carlos; Warburg, Alon; Benítez, Washington

2017-03-29

The province of Pichincha in Ecuador is an endemic area of cutaneous leishmaniasis, where anthropophilic sand flies with natural infection by Leishmania, have been reported as vectors. However, the role in transmission of zoophilic species has not been evaluated. To evaluate natural infection by Leishmania in two zoophilic phlebotomine sand fly species, Lutzomyia reburra and Lu. barrettoi majuscula, and one anthropophilic species, Lu. trapidoi, as well as the endophagy and synanthropism of these species in the northwest of Pichincha. Phlebotomines were collected using CDC light traps in different habitats and altitudes with presence of cutaneous leishmaniasis. Leishmania infection was detected using genomic DNA from females of the collected sand flies. We amplified the internal transcribed spacer gene of ribosomal RNA I (ITS1), the mitochondrial topoisomerase II gene (mtTOPOII), and the nuclear topoisomerase II gene (TopoII). Percentages of positivity for Leishmania, at spatio-temporal scale, proportion of endophagy and synanthropism index were calculated. Natural infection was determined for Le. amazonensis in Lu. reburra (9.5%) and Lu. b. majuscula (23.8%), while in Lu. trapidoi we detected Le. amazonensis, Le. brazilienis and Le. naiffi-lainsoni. Phlebotomines were asynanthropic and with low endophagy. Natural infection with Le. amazonensis was recorded for the first time in Lu. reburra and Lu. b. majuscula, demonstrating the importance of zoophilic phlebotomines in the maintenance of the Leishmania transmission cycle in endemic foci.

Physalis angulata induces death of promastigotes and amastigotes of Leishmania (Leishmania) amazonensis via the generation of reactive oxygen species.

Science.gov (United States)

Da Silva, B J M; Da Silva, R R P; Rodrigues, A P D; Farias, L H S; Do Nascimento, J L M; Silva, E O

2016-03-01

Leishmaniasis are a neglected group of emerging diseases that have been found in 98 countries and are caused by protozoa of the genus Leishmania. The therapy for leishmaniasis causes several side effects and leads to drug-resistant strains. Natural products from plants have exhibited activities against Leishmania in various experimental models. Physalis angulata is a widely used plant in popular medicine, and in the literature it has well-documented leishmanicidal activity. However, its mechanism of action is still unknown. Thus, this study aims to evaluate the mechanism driving the leishmanicidal activity of an aqueous extract of P. angulata root (AEPa). AEPa was effective against both promastigotes and intracellular amastigote forms of Leishmania amazonensis. This effect was mediated by an increase of reactive oxygen species (ROS), but not of nitric oxide (NO). The increased production of ROS induces cell death by phenotypes seems by apoptosis cell death in Leishmania, but not autophagy or necrosis. In addition, morphological analysis of macrophages showed that AEPa induced a high number of cytoplasmic projections, increased the volume of cytoplasm and number of vacuoles, caused cytoskeleton alterations and resulted in high spreading ability. AEPa also promoted superoxide anion (O2(-)) production in both uninfected macrophages and those infected with Leishmania. Therefore, these results revealed that AEPa causes cell death by phenotypes seems by apoptosis cell death in L. amazonensis and modulates macrophage activation through morphofunctional alterations and O2(-) generation to induce Leishmania death. Copyright © 2015 Elsevier Ltd. All rights reserved.

Structural insights into leishmanolysins encoded on chromosome 10 of Leishmania (Viannia braziliensis

Directory of Open Access Journals (Sweden)

Amanda Sutter

Full Text Available BACKGROUND Leishmanolysins have been described as important parasite virulence factors because of their roles in the infection of promastigotes and resistance to host’s defenses. Leishmania (Viannia braziliensis contains several leishmanolysin genes in its genome, especially in chromosome 10. However, the functional impact of such diversity is not understood, but may be attributed partially to the lack of structural data for proteins from this parasite. OBJECTIVES This works aims to compare leishmanolysin sequences from L. (V. braziliensis and to understand how the diversity impacts in their structural and dynamic features. METHODS Leishmanolysin sequences were retrieved from GeneDB. Subsequently, 3D models were built using comparative modeling methods and their dynamical behavior was studied using molecular dynamic simulations. FINDINGS We identified three subgroups of leishmanolysins according to sequence variations. These differences directly affect the electrostatic properties of leishmanolysins and the geometry of their active sites. We identified two levels of structural heterogeneity that might be related to the ability of promastigotes to interact with a broad range of substrates. MAIN CONCLUSION Altogether, the structural plasticity of leishmanolysins may constitute an important evolutionary adaptation rarely explored when considering the virulence of L. (V. braziliensis parasites.

Quantification of anti-Leishmania antibodies in saliva of dogs.

Science.gov (United States)

Cantos-Barreda, Ana; Escribano, Damián; Bernal, Luis J; Cerón, José J; Martínez-Subiela, Silvia

2017-08-15

Detection of serum anti-Leishmania antibodies by quantitative or qualitative techniques has been the most used method to diagnose Canine Leishmaniosis (CanL). Nevertheless, saliva may represent an alternative to blood because it is easy to collect, painless and non-invasive in comparison with serum. In this study, two time-resolved immunofluorometric assays (TR-IFMAs) for quantification of anti-Leishmania IgG2 and IgA antibodies in saliva were developed and validated and their ability to distinguish Leishmania-seronegative from seropositive dogs was evaluated. The analytical study was performed by evaluation of assay precision, sensitivity and accuracy. In addition, serum from 48 dogs (21 Leishmania-seropositive and 27 Leishmania-seronegative) were analyzed by TR-IFMAs. The assays were precise, with an intra- and inter-assay coefficients of variation lower than 11%, and showed high level of accuracy, as determined by linearity under dilution (R 2 =0.99) and recovery tests (>88.60%). Anti-Leishmania IgG2 antibodies in saliva were significantly higher in the seropositive group compared with the seronegative (pLeishmania IgA antibodies between both groups were observed. Furthermore, TR-IFMA for quantification of anti-Leishmania IgG2 antibodies in saliva showed higher differences between seropositive and seronegative dogs than the commercial assay used in serum. In conclusion, TR-IFMAs developed may be used to quantify anti-Leishmania IgG2 and IgA antibodies in canine saliva with an adequate precision, analytical sensitivity and accuracy. Quantification of anti-Leishmania IgG2 antibodies in saliva could be potentially used to evaluate the humoral response in CanL. However, IgA in saliva seemed not to have diagnostic value for this disease. For future studies, it would be desirable to evaluate the ability of the IgG2 assay to detect dogs with subclinical disease or with low antibody titers in serum and also to study the antibodies behaviour in saliva during the

The Genome Sequence of Leishmania (Leishmania) amazonensis: Functional Annotation and Extended Analysis of Gene Models

Science.gov (United States)

Real, Fernando; Vidal, Ramon Oliveira; Carazzolle, Marcelo Falsarella; Mondego, Jorge Maurício Costa; Costa, Gustavo Gilson Lacerda; Herai, Roberto Hirochi; Würtele, Martin; de Carvalho, Lucas Miguel; e Ferreira, Renata Carmona; Mortara, Renato Arruda; Barbiéri, Clara Lucia; Mieczkowski, Piotr; da Silveira, José Franco; Briones, Marcelo Ribeiro da Silva; Pereira, Gonçalo Amarante Guimarães; Bahia, Diana

2013-01-01

We present the sequencing and annotation of the Leishmania (Leishmania) amazonensis genome, an etiological agent of human cutaneous leishmaniasis in the Amazon region of Brazil. L. (L.) amazonensis shares features with Leishmania (L.) mexicana but also exhibits unique characteristics regarding geographical distribution and clinical manifestations of cutaneous lesions (e.g. borderline disseminated cutaneous leishmaniasis). Predicted genes were scored for orthologous gene families and conserved domains in comparison with other human pathogenic Leishmania spp. Carboxypeptidase, aminotransferase, and 3′-nucleotidase genes and ATPase, thioredoxin, and chaperone-related domains were represented more abundantly in L. (L.) amazonensis and L. (L.) mexicana species. Phylogenetic analysis revealed that these two species share groups of amastin surface proteins unique to the genus that could be related to specific features of disease outcomes and host cell interactions. Additionally, we describe a hypothetical hybrid interactome of potentially secreted L. (L.) amazonensis proteins and host proteins under the assumption that parasite factors mimic their mammalian counterparts. The model predicts an interaction between an L. (L.) amazonensis heat-shock protein and mammalian Toll-like receptor 9, which is implicated in important immune responses such as cytokine and nitric oxide production. The analysis presented here represents valuable information for future studies of leishmaniasis pathogenicity and treatment. PMID:23857904

Comparison between quantitative nucleic acid sequence-based amplification, real-time reverse transcriptase PCR, and real-time PCR for quantification of Leishmania parasites

NARCIS (Netherlands)

van der Meide, Wendy; Guerra, Jorge; Schoone, Gerard; Farenhorst, Marit; Coelho, Leila; Faber, William; Peekel, Inge; Schallig, Henk

2008-01-01

DNA or RNA amplification methods for detection of Leishmania parasites have advantages regarding sensitivity and potential quantitative characteristics in comparison with conventional diagnostic methods but are often still not routinely applied. However, the use and application of molecular assays

Agrobacterium T-DNA-encoded protein Atu6002 interferes with the host auxin response

Science.gov (United States)

Lacroix, Benoît; Gizatullina, Diana I.; Babst, Benjamin A.; Gifford, Andrew N.; Citovsky, Vitaly

2013-01-01

Summary Several genes in the Agrobacterium tumefaciens transferred (T) DNA encode proteins that are involved in developmental alterations leading to the formation of tumors in infected plants. We investigated the role of the protein encoded by the Atu6002 gene, the function of which is completely unknown. The Atu6002 expression occurs in Agrobacterium-induced tumors, and is also activated upon activation of plant cell division by growth hormones. Within the expressing plant cells, the Atu6002 protein is targeted to the plasma membrane. Interestingly, constitutive ectopic expression of Atu6002 in transgenic tobacco plants lead to a severe developmental phenotype characterized by stunted growth, shorter internodes, lanceolate leaves, increased branching, and modified flower morphology. These Atu6002-expressing plants also displayed impaired response to auxin. However, auxin cellular uptake and polar transport were not significantly inhibited in these plants, suggesting that Atu6002 interferes with auxin perception or signaling pathways. PMID:24128370

Antileishmanial activity and tubulin polymerization inhibition of podophyllotoxin derivatives on Leishmania infantum

Directory of Open Access Journals (Sweden)

José Miguel Escudero-Martínez

2017-12-01

Full Text Available Leishmania microtubules play an important role not only in cell division, but also in keeping the shape of the parasite and motility of its free-living stages. Microtubules result from the self-assembly of alpha and beta tubulins, two phylogenetically conserved and very abundant eukaryotic proteins in kinetoplastids. The colchicine binding domain has inspired the discovery and development of several drugs currently in clinical use against parasites. However, this domain is less conserved in kinetoplastids and may be selectively targeted by new compounds. This report shows the antileishmanial effect of several series of compounds (53, derived from podophyllotoxin (a natural cyclolignan isolated from rhizomes of Podophyllum spp. and podophyllic aldehyde, on a transgenic, fluorescence-emitting strain of Leishmania infantum. These compounds were tested on both promastigotes and amastigote-infected mouse splenocytes, and in mammalian – mouse non-infected splenocytes and liver HepG2 cells – in order to determine selective indexes of the drugs. Results obtained with podophyllotoxin derivatives showed that the hydroxyl group at position C-7α was a structural requisite to kill the parasites. On regards podophyllic aldehyde, derivatives with C9-aldehyde group integrated into a bicyclic heterostructure displayed more potent antileishmanial effects and were relatively safe for host cells. Docking studies of podophyllotoxin and podophyllic aldehyde derivatives showed that these compounds share a similar pattern of interaction at the colchicine site of Leishmania tubulin, thus pointing to a common mechanism of action. However, the results obtained suggested that despite tubulin is a remarkable target against leishmaniasis, there is a poor correlation between inhibition of tubulin polymerization and antileishmanial effect of many of the compounds tested, fact that points to alternative pathways to kill the parasites. Keywords: Leishmania, Tubulin, DNA

Cloning and expression of a cDNA encoding human sterol carrier protein 2

International Nuclear Information System (INIS)

Yamamoto, Ritsu; Kallen, C.B.; Babalola, G.O.; Rennert, H.; Strauss, J.F. III; Billheimer, J.T.

1991-01-01

The authors report the cloning and expression of a cDNA encoding human sterol carrier protein 2 (SCP 2 ). The 1.3-kilobase (kb) cDNA contains an open reading frame which encompasses a 143-amino acid sequence which is 89% identical to the rat SCP 2 amino acid sequence. The deduced amino acid sequence of the polypeptide reveals a 20-residue amino-terminal leader sequence in front of the mature polypeptide, which contains a carboxyl-terminal tripeptide (Ala-Lys-Leu) related to the peroxisome targeting sequence. The expressed cDNA in COS-7 cells yields a 15.3-kDa polypeptide and increased amounts of a 13.2-kDa polypeptide, both reacting with a specific rabbit antiserum to rat liver SCP 2 . The cDNA insert hybridizes with 3.2- and 1.8-kb mRNA species in human liver poly(A) + RNA. In human fibroblasts and placenta the 1.8-kb mRNA was most abundant. Southern blot analysis suggests either that there are multiple copies of the SCP 2 gene in the human genome or that the SCP 2 gene is very large. Coexpression of the SCP 2 cDNA with expression vectors for cholesterol side-chain cleavage enzyme and adrenodoxin resulted in a 2.5-fold enhancement of progestin synthesis over that obtained with expression of the steroidogenic enzyme system alone. These findings are concordant with the notion that SCP 2 plays a role in regulating steroidogenesis, among other possible functions

Molecular Characterization of Leishmania Parasites in Giemsa-Stained Slides from Cases of Human Cutaneous and Visceral Leishmaniasis, Eastern Algeria.

Science.gov (United States)

Beldi, Nadia; Mansouri, Roukaya; Bettaieb, Jihene; Yaacoub, Alia; Souguir Omrani, Hejer; Saadi Ben Aoun, Yusr; Saadni, Farida; Guizani, Ikram; Guerbouj, Souheila

2017-06-01

In Algeria, visceral leishmaniasis (VL) is due to Leishmania (L.) infantum, while three cutaneous forms (CL) are caused by Leishmania major, Leishmania tropica and Leishmania infantum. In this study, the use of Giemsa-stained slides was evaluated with two PCR techniques, in Eastern Algeria. A total of 136 samples corresponding to 100 CL smears (skin scrapings) and 36 VL slides (bone marrow aspirates) collected from 2008 to 2014 were tested. Upon DNA extraction, two PCRs were used to amplify the ribosomal Internal Transcribed Spacer 1 (ITS1) and mini-exon genes. Amplified products were digested (PCR-RFLP) and profiles analyzed for Leishmania species identification. A statistical analysis was also performed. ITS1-PCR was found significantly more sensitive than mini-exon-PCR (77.95% positives vs. 67.65%; p = 0.001). Comparison of PCR positivity showed statistically significant differences between old and recently prepared slides suggesting a better use of recent slides in PCR analyses. For species identification, PCR-restriction fragment length polymorphism (RFLP) results of ITS1 and mini-exon were concordant. L. infantum was identified from VL cases and L. infantum, L. major, and L. tropica from CL ones. According to geographical origin, L. infantum was found in North-Eastern provinces, while L. major was distributed from the North to the Center-East of Algeria. Interestingly, two L. tropica samples were identified in Annaba, located far North-East Algeria. Distribution of leishmaniasis in Eastern parts of Algeria, besides finding of L. tropica in the far North, is in this study described for the first time using molecular tools, thus confirming the usefulness of slides for PCR identification of Leishmania parasites in retrospective epidemiological investigations.

LaRbp38: A Leishmania amazonensis protein that binds nuclear and kinetoplast DNAs

International Nuclear Information System (INIS)

Lira, C.B.B.; Siqueira Neto, J.L.; Giardini, M.A.; Winck, F.V.; Ramos, C.H.I.; Cano, M.I.N.

2007-01-01

Leishmania amazonensis causes a wide spectrum of leishmaniasis. There are no vaccines or adequate treatment for leishmaniasis, therefore there is considerable interest in the identification of new targets for anti-leishmania drugs. The central role of telomere-binding proteins in cell maintenance makes these proteins potential targets for new drugs. In this work, we used a combination of purification chromatographies to screen L. amazonensis proteins for molecules capable of binding double-stranded telomeric DNA. This approach resulted in the purification of a 38 kDa polypeptide that was identified by mass spectrometry as Rbp38, a trypanosomatid protein previously shown to stabilize mitochondrial RNA and to associate with nuclear and kinetoplast DNAs. Western blotting and supershift assays confirmed the identity of the protein as LaRbp38. Competition and chromatin immunoprecipitation assays confirmed that LaRbp38 interacted with kinetoplast and nuclear DNAs in vivo and suggested that LaRbp38 may have dual cellular localization and more than one function

A Cutaneous Ulcer Resulting from Mycobacterium ulcerans—Leishmania braziliensis Coinfection in South America

Science.gov (United States)

Mougin, Benjamin; Avenel-Audran, Martine; Hasseine, Lilia; Martin, Ludovic; Cottin, Jane; Pomares, Christelle; Delaunay, Pascal; Marty, Pierre; Ravel, Christophe; Chabasse, Dominique; Abgueguen, Pierre

2011-01-01

Buruli ulcer is a tropical skin disease caused by Mycobacterium ulcerans. Its mode of transmission is not yet clearly understood. We report here a cutaneous ulcer in a European traveler in South America resulting from a coinfection detected specifically for Mycobacterium ulcerans and Leishmania braziliensis DNA with real-time polymerase chain reaction. This observation of a unique cutaneous ulcer raises the issue about possible modes of transmission of those two pathogens by the same vector. PMID:22049045

Cryopreservation of Leishmania Species in Manisa Province.

Science.gov (United States)

Çavuş, İbrahim; Ocak, Fulya; Kaya, Tuğba; Özbilgin, Ahmet

2017-09-01

It was aimed to assess the success of the cryopreservation process which is carried out in order to preserve the genetic material and the virulence of the Leishmania species that are an important health problem in our region. Leishmania tropica, L. infantum, L. major, and L. donovani strains in Novy-MacNeal-Nicolle (NNN) medium in MCBU were used. Promastigotes cultured in the NNN medium were transferred to RPMI 1640 medium; promastigotes in the logarithmic phase were washed three times with PBS, and 15% dimethylsulfoxide (DMSO) was added. Leishmania species were transferred to 12 separate tubes. The tubes were stored at -86°C for one night by placing them in Coolcell boxes. The tubes were transferred into a liquid nitrogen tank. One cryotube per Leishmania strain is thawed monthly and cultured in NNN medium. For the duration of study it was observed that each Leishmania isolate preserved 60-65% of their viability and entered the logarithmic phase on the 7th day following the inoculation in the NNN medium. Abnormalities in the structures and movements of the promastigotes were not observed in microscopic examinations. The following conclusions were made: cryopreservation is important for studies planned related to leishmaniasis and cryopreservation with DMSO is successful.

Gene Cloning of Iranian Leishmania major Mannose-1-Phosphate Guanyltransferase

Directory of Open Access Journals (Sweden)

R Salehi

2009-07-01

Full Text Available "nBackground: Leishmania is an obligatory intracellular protozoan parasite, which infects human be­ings when infected sand fly vector takes a blood meal.  Most efforts are towards designing an effective vaccine to prevent leishmaniasis. In this way, development of candidate antigen for vaccine has spe­cial im­portant. In this study, we cloned mannose-1-phosphate guanyltransferase gene of Iranian L .major in pET32a expression vector. "nMethods: Primers based on L. major mannose-1-phosphate guanyltransferase sequence gene was de­signed and synthesized. DNA of Leishmania promastigotes was extracted and PCR reaction was done. PCR product was cloned into pTZ57R and sub cloned into pET32a expression vector. "nResults: Recombinant plasmid containing 1140 bp as L. major mannose-1-phosphate guanyltrans­ferase gene was extracted and confirmed by restriction analysis. PCR product was sequenced and de­posited to GenBank. There were some differences in amino acid sequences between Iranian L. major mannose-1-phosphate guanyltransferase and others previously accepted in GenBank "nConclusion: We amplified and cloned Iranian L. major mannose-1-phosphate guanyltransferase successfully.

Transcriptome profiling identifies genes/pathways associated with experimental resistance to paromomycin in Leishmania donovani

Directory of Open Access Journals (Sweden)

Aditya Verma

2017-12-01

Full Text Available Widespread resistance towards antimony and reports of relapses following miltefosine treatment has severely affected the management of visceral leishmaniasis (VL in the Indian subcontinent. Paromomycin (PMM, an aminoglycoside antibiotic, has been licensed for VL treatment in India in 2007. Although its use is still restricted in the field, unraveling the molecular mechanism of resistance towards PMM is the key to preserve the drug. In this study, PMM resistant lines were selected up to 100 μM of PMM in three distinct field isolates of Leishmania donovani at promastigote stage. The resistance induced at promastigote level was also evident in amastigotes which showed 6 fold decreases in PMM susceptibility. Comparative transcriptome profiling of PMM resistant (PMM-R and the corresponding PMM sensitive (PMM-S parasites revealed modulated expression of 500 genes (1.5 fold cut off in PMM-R parasites. Selected genes were validated for their modulated expression by quantitative real-time PCR. Functional classification and pathway analysis of modulated genes indicated probable adaptations in drug resistant lines which included a reduced oxidative phosphorylation; b increased glycosomal succinate fermentation and substrate level phosphorylation; c dependency on lipids and amino acids for energy generation; d reduced DNA synthesis and increased DNA damage repair and e decreased protein synthesis and degradation. Interestingly, PMM-R parasites showed a marked increase in PMM susceptibility in presence of verapamil and amlodipine, antagonists of Ca2+ channel that are also modulators of ABC transporters. Moreover, infection of macrophages by PMM-R parasites led to modulated nitric oxide (NO levels while reactive oxygen species (ROS level remained unaltered. The present study highlights the putative mechanisms of PMM resistance in Leishmania. Keywords: Leishmania donovani, Drug resistance, Paromomycin, Transcriptome, ABC transporters, Nitric oxide, Visceral

Cloning of a cDNA encoding a novel human nuclear phosphoprotein belonging to the WD-40 family

DEFF Research Database (Denmark)

Honoré, B; Leffers, H; Madsen, Peder

1994-01-01

We have cloned and expressed in vaccinia virus a cDNA encoding an ubiquitous 501-amino-acid (aa) phosphoprotein that corresponds to protein IEF SSP 9502 (79,400 Da, pI 4.5) in the master 2-D-gel keratinocyte protein database [Celis et al., Electrophoresis 14 (1993) 1091-1198]. The deduced aa...

Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

Science.gov (United States)

Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

2015-01-01

Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

Phlebotomus sergenti in a Cutaneous Leishmaniasis Focus in Azilal Province (High Atlas, Morocco): Molecular Detection and Genotyping of Leishmania tropica, and Feeding Behavior

Science.gov (United States)

Ajaoud, Malika; Es-Sette, Nargys; Charrel, Rémi N; Laamrani-Idrissi, Abderahmane; Nhammi, Haddou; Riyad, Myriam; Lemrani, Meryem

2015-01-01

Background Phlebotomus (Paraphlebotomus) sergenti is at least one of the confirmed vectors for the transmission of cutaneous leishmaniasis caused by Leishmania tropica and distributed widely in Morocco. This form of leishmaniasis is considered largely as anthroponotic, although dogs were found infected with Leishmania tropica, suggestive of zoonosis in some rural areas. Methodology and Findings This survey aimed at (i) studying the presence of Leishmania in field caught Phlebotomus sergenti, (ii) investigating genetic diversity within Leishmania tropica and (iii) identifying the host-blood feeding preferences of Phlebotomus sergenti. A total of 4,407 sand flies were collected in three rural areas of Azilal province, using CDC miniature light traps. Samples collected were found to consist of 13 species: Phlebotomus spp. and 3 Sergentomyia spp. The most abundant species was Phlebotomus sergenti, accounting for 45.75 % of the total. 965 female Phlebotomus sergenti were screened for the presence of Leishmania by ITS1-PCR-RFLP, giving a positive rate of 5.7% (55/965), all being identified as Leishmania tropica. Nucleotide heterogeneity of PCR-amplified ITS1-5.8S rRNA gene-ITS2 was noted. Analyses of 31 sequences obtained segregated them into 16 haplotypes, of which 7 contain superimposed peaks at certain nucleotide positions, suggestive of heterozygosity. Phlebotomus sergenti collected were found to feed on a large variety of vertebrate hosts, as determined by Cytochrome b sequencing of the DNA from the blood meals of 64 engorged females. Conclusion Our findings supported the notion that Phlebotomus sergenti is the primary vector of Leishmania tropica in this focus, and that the latter is genetically very heterogeneous. Furthermore, our results might be suggestive of a certain level of heterozygosity in Leishmania tropica population. This finding, as well as the feeding of the vectors on different animals are of interest for further investigation. PMID:25826399

Phlebotomus sergenti in a cutaneous leishmaniasis focus in Azilal province (High Atlas, Morocco: molecular detection and genotyping of Leishmania tropica, and feeding behavior.

Directory of Open Access Journals (Sweden)

Malika Ajaoud

2015-03-01

Full Text Available Phlebotomus (Paraphlebotomus sergenti is at least one of the confirmed vectors for the transmission of cutaneous leishmaniasis caused by Leishmania tropica and distributed widely in Morocco. This form of leishmaniasis is considered largely as anthroponotic, although dogs were found infected with Leishmania tropica, suggestive of zoonosis in some rural areas.This survey aimed at (i studying the presence of Leishmania in field caught Phlebotomus sergenti, (ii investigating genetic diversity within Leishmania tropica and (iii identifying the host-blood feeding preferences of Phlebotomus sergenti. A total of 4,407 sand flies were collected in three rural areas of Azilal province, using CDC miniature light traps. Samples collected were found to consist of 13 species: Phlebotomus spp. and 3 Sergentomyia spp. The most abundant species was Phlebotomus sergenti, accounting for 45.75 % of the total. 965 female Phlebotomus sergenti were screened for the presence of Leishmania by ITS1-PCR-RFLP, giving a positive rate of 5.7% (55/965, all being identified as Leishmania tropica. Nucleotide heterogeneity of PCR-amplified ITS1-5.8S rRNA gene-ITS2 was noted. Analyses of 31 sequences obtained segregated them into 16 haplotypes, of which 7 contain superimposed peaks at certain nucleotide positions, suggestive of heterozygosity. Phlebotomus sergenti collected were found to feed on a large variety of vertebrate hosts, as determined by Cytochrome b sequencing of the DNA from the blood meals of 64 engorged females.Our findings supported the notion that Phlebotomus sergenti is the primary vector of Leishmania tropica in this focus, and that the latter is genetically very heterogeneous. Furthermore, our results might be suggestive of a certain level of heterozygosity in Leishmania tropica population. This finding, as well as the feeding of the vectors on different animals are of interest for further investigation.

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

The current status of phlebotomine sand flies in Albania and incrimination of Phlebotomus neglectus (Diptera, Psychodidae) as the main vector of Leishmania infantum.

Science.gov (United States)

Velo, Enkelejda; Bongiorno, Gioia; Kadriaj, Perparim; Myrseli, Teita; Crilly, James; Lika, Aldin; Mersini, Kujtim; Di Muccio, Trentina; Bino, Silvia; Gramiccia, Marina; Gradoni, Luigi; Maroli, Michele

2017-01-01

The incidence of visceral leishmaniasis (VL) in Albania is higher than in other countries of southern Europe, however the role of local sand fly species in the transmission of Leishmania infantum was not addressed conclusively. In 2006, a country-wide collection of sand flies performed in 14 sites selected based on recent occurrence of VL cases showed that Phlebotomus neglectus was by far the most prevalent species (95.6%). Furthermore, 15% of pools made from 422 P. neglectus females tested positive for Leishmania sp. genomic DNA. In the same year, Culicoides trapping was performed for bluetongue disease surveillance in 91 sites of southern Albania, targeting livestock farms regardless recent occurrence of VL in the surveyed areas. In 35 sites where sand flies were collected along with midges, Phlebotomus perfiliewi was the most prevalent among the Phlebotomus species identified, however search for leishmanial DNA in females of this species was unsuccessful. In 2011, sand flies were trapped in 4 sites of north Albania characterized by high VL incidence, and females were dissected to search for Leishmania infections. Both P. neglectus and P. tobbi were collected at high densities. Two positive specimens were detected from a sample of 64 P. neglectus trapped in one site (3.1%). Parasites were successfully cultured from one specimen and characterized as belonging to Leishmania infantum zymodeme MON-1, the only zymodeme so far identified as the agent of human and canine leishmaniasis in the country. Altogether our studies indicate that P. neglectus is the main leishmaniasis vector in Albania.

Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

International Nuclear Information System (INIS)

Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.

1987-01-01

A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

Role of pro-inflammatory cytokine IL-17 in Leishmania pathogenesis and in protective immunity by Leishmania vaccines.

Science.gov (United States)

Banerjee, Antara; Bhattacharya, Parna; Joshi, Amritanshu B; Ismail, Nevien; Dey, Ranadhir; Nakhasi, Hira L

2016-11-01

The clinical outcome of Leishmania pathogenesis ranges from active skin lesions to fatal visceral dissemination and severely impaired T cell immunity. It is well established that a strong Th1 immune response is protective against cutaneous forms of the disease, however a mixed Th1/Th2 response is most commonly observed against visceral infections as evident from previous studies. Aside from Th1/Th2 cytokines, the pro-inflammatory IL-17 cytokine family plays an important role in the clearance of intracellular pathogens. In Leishmania induced skin lesions, IL-17 produced by Th17 cells is shown to exacerbate the disease, suggesting a role in pathogenesis. However, a protective role for IL-17 is indicated by the expansion of IL-17 producing cells in vaccine-induced immunity. In human visceral leishmaniasis (VL) it has been demonstrated that IL-17 and IL-22 are associated with protection against re-exposure to Leishmania, which further suggests the involvement of IL-17 in vaccine induced protective immunity. Although there is no vaccine against any form of leishmaniasis, the development of genetically modified live attenuated parasites as vaccine candidates prove to be promising, as they successfully induce a robust protective immune response in various animal models. However, the role of IL-17 producing cells and Th17 cells in response to these vaccine candidates remains unexplored. In this article, we review the role of IL-17 in Leishmania pathogenesis and the potential impact on vaccine induced immunity, with a special focus on live attenuated Leishmania parasites. Published by Elsevier Inc.

Hepatozoon canis and Leishmania spp. coinfection in dogs diagnosed with visceral leishmaniasis.

Science.gov (United States)

Morgado, Fernanda Nazaré; Cavalcanti, Amanda Dos Santos; Miranda, Luisa Helena de; O'Dwyer, Lúcia Helena; Silva, Maria Regina Lucas da; Menezes, Rodrigo Caldas; Andrade da Silva, Aurea Virgínia; Boité, Mariana Côrtes; Cupolillo, Elisa; Porrozzi, Renato

2016-01-01

This study describes the occurrence of dogs naturally co-infected with Hepatozoon canis and two Leishmania species: L. infantum or L. braziliensis. Four dogs serologically diagnosed with Visceral Leishmaniasis were euthanized. Liver and spleen samples were collected for histopathological analysis and DNA isolation. H. canis meronts were observed in tissues from all four dogs. H. canis infection was confirmed by PCR followed by sequencing of a fragment of 18S rRNA gene. Leishmania detection and typing was confirmed by ITS1' PCR-RFLP and parasite burden was calculated using ssrRNA quantitative qPCR. A DPP - Dual Path platform test was performed. One out (Dog #2) of four animals was asymptomatic. Dogs #1 and #4 were infected by L. infantum and were DPP test positive. Dogs #2 and #3 were infected by L. braziliensis and were DPP test negative. Furthermore, visceral dissemination was observed in Dogs #2 and #3, since L. braziliensis was detected in liver and spleen samples. The visceral dissemination of L. braziliensis associated with systemic signs suggested that this co-infection could influence the parasite burden and disease progression.

Seasonal variation in the prevalence of sand flies infected with Leishmania donovani.

Science.gov (United States)

Tiwary, Puja; Kumar, Dinesh; Mishra, Mukesh; Singh, Rudra Pratap; Rai, Madhukar; Sundar, Shyam

2013-01-01

Visceral Leishmaniasis (VL) is a life threatening neglected infectious disease in the Indian subcontinent, transmitted by the bite of female sand flies. Estimation of the infectivity in the vector population, collected in different seasons, may be useful to better understanding the transmission dynamics of VL as well as to plan vector control measures. We collected sand flies from highly endemic regions of Bihar state, India for one year over three seasons. The species of the sand flies were confirmed by species-specific PCR-RFLP. Leishmania donovani infection was investigated in 1397 female Phlebotomus argentipes using PCR, targeting the Leishmania specific minicircle of the kDNA region. Further, the parasitic load in the infected sand flies was measured using quantitative PCR. Though sand flies were most abundant in the rainy season, the highest rate of infection was detected in the winter season with 2.84% sand flies infected followed by the summer and rainy seasons respectively. This study can help in vector elimination programmes and to reduce disease transmission.

Deprivation of L-Arginine Induces Oxidative Stress Mediated Apoptosis in Leishmania donovani Promastigotes: Contribution of the Polyamine Pathway

Science.gov (United States)

Mandal, Abhishek; Das, Sushmita; Roy, Saptarshi; Ghosh, Ayan Kumar; Sardar, Abul Hasan; Verma, Sudha; Saini, Savita; Singh, Ruby; Abhishek, Kumar; Kumar, Ajay; Mandal, Chitra; Das, Pradeep

2016-01-01

The growth and survival of intracellular parasites depends on the availability of extracellular nutrients. Deprivation of nutrients viz glucose or amino acid alters redox balance in mammalian cells as well as some lower organisms. To further understand the relationship, the mechanistic role of L-arginine in regulation of redox mediated survival of Leishmania donovani promastigotes was investigated. L-arginine deprivation from the culture medium was found to inhibit cell growth, reduce proliferation and increase L-arginine uptake. Relative expression of enzymes, involved in L-arginine metabolism, which leads to polyamine and trypanothione biosynthesis, were downregulated causing decreased production of polyamines in L-arginine deprived parasites and cell death. The resultant increase in reactive oxygen species (ROS), due to L-arginine deprivation, correlated with increased NADP+/NADPH ratio, decreased superoxide dismutase (SOD) level, increased lipid peroxidation and reduced thiol content. A deficiency of L-arginine triggered phosphatidyl serine externalization, a change in mitochondrial membrane potential, release of intracellular calcium and cytochrome-c. This finally led to DNA damage in Leishmania promastigotes. In summary, the growth and survival of Leishmania depends on the availability of extracellular L-arginine. In its absence the parasite undergoes ROS mediated, caspase-independent apoptosis-like cell death. Therefore, L-arginine metabolism pathway could be a probable target for controlling the growth of Leishmania parasites and disease pathogenesis. PMID:26808657

Leishmania Hijacks Myeloid Cells for Immune Escape

Directory of Open Access Journals (Sweden)

María Martínez-López

2018-05-01

Full Text Available Protozoan parasites of the Leishmania genus are the causative agents of leishmaniasis, a group of neglected tropical diseases whose clinical manifestations vary depending on the infectious Leishmania species but also on host factors. Recognition of the parasite by host myeloid immune cells is a key to trigger an effective Leishmania-specific immunity. However, the parasite is able to persist in host myeloid cells by evading, delaying and manipulating host immunity in order to escape host resistance and ensure its transmission. Neutrophils are first in infiltrating infection sites and could act either favoring or protecting against infection, depending on factors such as the genetic background of the host or the parasite species. Macrophages are the main host cells where the parasites grow and divide. However, macrophages are also the main effector population involved in parasite clearance. Parasite elimination by macrophages requires the priming and development of an effector Th1 adaptive immunity driven by specific subtypes of dendritic cells. Herein, we will provide a comprehensive outline of how myeloid cells regulate innate and adaptive immunity against Leishmania, and the mechanisms used by the parasites to promote their evasion and sabotage. Understanding the interactions between Leishmania and the host myeloid cells may lead to the development of new therapeutic approaches and improved vaccination to leishmaniases, an important worldwide health problem in which current therapeutic or preventive approaches are limited.

A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

Science.gov (United States)

Wang, W.; Takezawa, D.; Poovaiah, B. W.

1996-01-01

A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

Arginase activity of Leishmania isolated from patients with cutaneous leishmaniasis.

Science.gov (United States)

Badirzadeh, A; Taheri, T; Abedi-Astaneh, F; Taslimi, Y; Abdossamadi, Z; Montakhab-Yeganeh, H; Aghashahi, M; Niyyati, M; Rafati, S

2017-09-01

Cutaneous leishmaniasis (CL) is one of the most important vector-borne parasitic diseases, highly endemic in Iran, and its prevalence is increasing all over the country. Arginase (ARG) activity in isolated Leishmania parasites from CL patients is yet to be explored. This study aimed to compare the ARG activity of isolated Leishmania promastigotes from CL patients with a standard strain of Leishmania major and its influences on the disease pathogenesis. We recruited 16 confirmed CL patients from Qom Province, in central Iran; after detection of Leishmania species using PCR-RFLP, we assessed the levels of ARG in the isolated promastigotes and determined the parasites' growth rate. Only L. major was identified from CL patients. The level of ARG activity in the isolated Leishmania promastigotes from CL patients was significantly higher than that obtained from the standard strain of L. major. No significant correlations between ARG activity and lesion size, number or duration were observed; in contrast, a significant negative correlation was seen between ARG level and Leishmania' growth rate. The obtained results suggest that increased ARG expression and activity in the isolated Leishmania promastigotes might contribute to the higher parasite infectivity and play a major role in the pathogenicity of the CL. © 2017 John Wiley & Sons Ltd.

Leishmania Surveillance and Diagnostic Capability in Support of the Joint Biological Agent Identification and Diagnostic System (JBAIDS) and Leishmania Vector Surveillance

Science.gov (United States)

2013-02-07

01-10-09 to 07-02-13 ’+. I II L~ J.\\NU :::OU~ Ill L~ :la. l-UI’I I 11J.\\l- I NUIVI~~I1 LEISHMANIA SURVEILLANCE AND DIAGNOSTIC CAPABILITY IN None...SUPPORT OF THE JOINT BIOLOGICAL AGENT IDENTIFICATION AND :lD. l:JI1J.\\NI NUIVI~~I1 DIAGNOSTIC SYSTEM (JBAIDS) None . ./ LEISHMANIA VECTOR...Field Station at Kisumu completed project activities through a resource sharing arrangement with the 59th MDW. Testing of the Leishmania epidemiology

Leishmania infection and blood food sources of phlebotomines in an area of Brazil endemic for visceral and tegumentary leishmaniasis

Science.gov (United States)

Guimarães-e-Silva, Antônia Suely; Silva, Soraia de Oliveira; Ribeiro da Silva, Rosa Cristina; Pinheiro, Valéria Cristina Soares; Rebêlo, José Manuel Macário; Melo, Maria Norma

2017-01-01

The aims of the study were to determine the blood feeding preferences of sandflies and to identify species of Leishmania that infected phlebotomines in Caxias, Maranhão, Brazil, an area that is highly endemic for leishmaniasis. Sandflies were captured in light traps located in the peridomiciliary environments of randomly selected houses in urban and rural settings between 1800 and 0600 hours on new moon days between March 2013 and February 2015. DNA extracts from 982 engorged female sandflies were submitted to fragment length polymorphism analysis to identify infecting species of Leishmania, and blood sources were identified for 778 of these specimens. Infection by Leishmania infantum was detected in Lutzomyia longipalpis, Lu. whitmani and Lu. termitophila; L. infantum/L. braziliensis in Lu. longipalpis, Lu. whitmani and Lu. trinidadensis; L. shawi in Lu. longipalpis; L. mexicana in Lu. longipalpis; L. braziliensis in Lu. longipalpis and Lu. whitmani; L. guyanensis in Lu. longipalpis and Lu. termitophila; L. amazonensis in Lu. longipalpis and L. lainsoni or L. naiffi in Lu. longipalpis, while Lu. longipalpis and Lu. trinidadensis were infected with unidentified Leishmania sp. Blood sources were identified in 573 individual phlebotomines and the preferred hosts were, in decreasing order, chicken, dog, rodent and human with lower preferences for pig, horse, opossum and cattle. Lu. longipalpis and Lu. whitmani performed mixed feeding on man, dog and rodent, while Lu. longipalpis was the most opportunistic species, feeding on the blood of all hosts surveyed, but preferably on dog/chicken, dog/rodent and rodent/chicken. Our findings reveal the concomitant circulation of Leishmania species that cause visceral leishmaniasis and tegumentary leishmaniasis in the study area, and explain the occurrence of autochthonous human cases of both clinical forms of leishmaniasis in Caxias, Maranhão. The results support our hypothesis that, in the municipality of Caxias, transmission

Molecular mechanisms of drug resistance in natural Leishmania populations vary with genetic background.

Directory of Open Access Journals (Sweden)

Saskia Decuypere

Full Text Available The evolution of drug-resistance in pathogens is a major global health threat. Elucidating the molecular basis of pathogen drug-resistance has been the focus of many studies but rarely is it known whether a drug-resistance mechanism identified is universal for the studied pathogen; it has seldom been clarified whether drug-resistance mechanisms vary with the pathogen's genotype. Nevertheless this is of critical importance in gaining an understanding of the complexity of this global threat and in underpinning epidemiological surveillance of pathogen drug resistance in the field. This study aimed to assess the molecular and phenotypic heterogeneity that emerges in natural parasite populations under drug treatment pressure. We studied lines of the protozoan parasite Leishmania (L. donovani with differential susceptibility to antimonial drugs; the lines being derived from clinical isolates belonging to two distinct genetic populations that circulate in the leishmaniasis endemic region of Nepal. Parasite pathways known to be affected by antimonial drugs were characterised on five experimental levels in the lines of the two populations. Characterisation of DNA sequence, gene expression, protein expression and thiol levels revealed a number of molecular features that mark antimonial-resistant parasites in only one of the two populations studied. A final series of in vitro stress phenotyping experiments confirmed this heterogeneity amongst drug-resistant parasites from the two populations. These data provide evidence that the molecular changes associated with antimonial-resistance in natural Leishmania populations depend on the genetic background of the Leishmania population, which has resulted in a divergent set of resistance markers in the Leishmania populations. This heterogeneity of parasite adaptations provides severe challenges for the control of drug resistance in the field and the design of molecular surveillance tools for widespread

Functional transcriptomics of wild-caught Lutzomyia intermedia salivary glands: identification of a protective salivary protein against Leishmania braziliensis infection.

Science.gov (United States)

de Moura, Tatiana R; Oliveira, Fabiano; Carneiro, Marcia W; Miranda, José Carlos; Clarêncio, Jorge; Barral-Netto, Manoel; Brodskyn, Cláudia; Barral, Aldina; Ribeiro, José M C; Valenzuela, Jesus G; de Oliveira, Camila I

2013-01-01

Leishmania parasites are transmitted in the presence of sand fly saliva. Together with the parasite, the sand fly injects salivary components that change the environment at the feeding site. Mice immunized with Phlebotomus papatasi salivary gland (SG) homogenate are protected against Leishmania major infection, while immunity to Lutzomyia intermedia SG homogenate exacerbated experimental Leishmania braziliensis infection. In humans, antibodies to Lu. intermedia saliva are associated with risk of acquiring L. braziliensis infection. Despite these important findings, there is no information regarding the repertoire of Lu. intermedia salivary proteins. A cDNA library from the Salivary Glands (SGs) of wild-caught Lu. intermedia was constructed, sequenced, and complemented by a proteomic approach based on 1D SDS PAGE and mass/mass spectrometry to validate the transcripts present in this cDNA library. We identified the most abundant transcripts and proteins reported in other sand fly species as well as novel proteins such as neurotoxin-like proteins, peptides with ML domain, and three small peptides found so far only in this sand fly species. DNA plasmids coding for ten selected transcripts were constructed and used to immunize BALB/c mice to study their immunogenicity. Plasmid Linb-11--coding for a 4.5-kDa protein--induced a cellular immune response and conferred protection against L. braziliensis infection. This protection correlated with a decreased parasite load and an increased frequency of IFN-γ-producing cells. We identified the most abundant and novel proteins present in the SGs of Lu. intermedia, a vector of cutaneous leishmaniasis in the Americas. We also show for the first time that immunity to a single salivary protein from Lu. intermedia can protect against cutaneous leishmaniasis caused by L. braziliensis.

FIRST REPORT OF CUTANEOUS LEISHMANIASIS CAUSED BY Leishmania (Leishmania infantum chagasi IN AN URBAN AREA OF RIO DE JANEIRO, BRAZIL

Directory of Open Access Journals (Sweden)

Marcelo Rosandiski LYRA

2015-10-01

Full Text Available SUMMARY American tegumentary leishmaniasis (ATL is an infectious disease caused by protozoa of the genus Leishmania, and transmitted by sandflies. In the state of Rio de Janeiro, almost all of the cases of American tegumentary leishmaniasis (ATL are caused by Leishmania (Viannia braziliensis, while cases of visceral leishmaniasis (VL are caused by Leishmania (Leishmania infantum chagasi. The resurgence of autochthonous VL cases in Rio de Janeiro is related to the geographic expansion of the vector Lutzomyia longipalpis and its ability to adapt to urban areas. We report the first case of leishmaniasis with exclusively cutaneous manifestations caused by L. (L. infantum chagasi in an urban area of Rio de Janeiro. An eighty-one-year-old woman presented three pleomorphic skin lesions that were not associated with systemic symptoms or visceromegalies. Multilocus enzyme electrophoresis identified L. (L. infantum chagasi, but direct smear and PCR of bone narrow were negative for Leishmania sp. (suggesting exclusively cutaneous involvement. We discuss the different dermatological presentations of viscerotropic leishmaniasis of the New and Old World, and the clinical and epidemiological importance of the case. Etiologic diagnosis of ATL based upon exclusive clinical criteria may lead to incorrect conclusions. We should be aware of the constant changes in epidemiological patterns related to leishmaniases.

Leishmaniasis cutánea zosteriforme causada por Leishmania (Viannia panamensis y Leishmania (Viannia braziliensis: reporte de tres casos

Directory of Open Access Journals (Sweden)

Camilo Andrés Morales

2014-09-01

Se presentan tres casos de leishmaniasis cutánea zosteriforme en los que se identificaron Leishmania panamensis y Leishmania braziliensis como especies infectantes. La sospecha epidemiológica derivada de la procedencia de los pacientes, así como la sospecha clínica a partir del reconocimiento de una presentación infrecuente de la enfermedad, permitieron hacer el diagnóstico.

TRANSCRIPTIONAL INHIBITION OF INTERLEUKIN-12 PROMOTER ACTIVITY IN LEISHMANIA SPP.-INFECTED MACROPHAGES

Science.gov (United States)

Jayakumar, Asha; Widenmaier, Robyn; Ma, Xiaojing; McDowell, Mary Ann

2009-01-01

To establish and persist within a host, Leishmania spp. parasites delay the onset of cell-mediated immunity by suppressing interleukin-12 (IL-12) production from host macrophages. Although it is established that Leishmania spp.-infected macrophages have impaired IL-12 production, the mechanisms that account for this suppression remain to be completely elucidated. Using a luciferase reporter assay assessing IL-12 transcription, we report here that Leishmania major, Leishmania donovani, and Leishmania chagasi inhibit IL-12 transcription in response to interferon-gamma, lipopolysaccharide, and CD40 ligand and that Leishmania spp. lipophosphoglycan, phosphoglycans, and major surface protein are not necessary for inhibition. In addition, all the Leishmania spp. strains and life-cycle stages tested inhibited IL-12 promoter activity. Our data further reveal that autocrine-acting host factors play no role in the inhibitory response and that phagocytosis signaling is necessary for inhibition of IL-12. PMID:18372625

Sand fly captures with Disney traps in area of occurrence of Leishmania (Leishmania) amazonensis in the state of Mato Grosso do Sul, mid-western Brazil.

Science.gov (United States)

Dorval, Maria Elizabeth Cavalheiros; Alves, Tulia Peixoto; Cristaldo, Geucira; Rocha, Hilda Carlos da; Alves, Murilo Andrade; Oshiro, Elisa Teruya; Oliveira, Alessandra Gutierrez de; Brazil, Reginaldo Peçanha; Galati, Eunice Aparecida Bianchi; Cunha, Rivaldo Venancio da

2010-01-01

The work was conducted to study phlebotomine fauna (Diptera: Psychodidae) and aspects of American cutaneous leishmaniasis transmission in a forested area where Leishmania (Leishmania) amazonensis occurs, situated in the municipality of Bela Vista, State of Mato Grosso do Sul, Brazil. The captures were conducted with modified Disney traps, using hamster (Mesocricetus auratus) as bait, from May 2004 to January 2006. Ten species of phlebotomine sandflies were captured: Brumptomyia avellari, Brumptomyia brumpti, Bichromomyia flaviscutellata, Evandromyia bourrouli, Evandromyia lenti, Lutzomyia longipalpis, Psathyromyia campograndensis, Psathyromyia punctigeniculata, Psathyromyia shannoni and Sciopemyia sordellii. The two predominant species were Ev bourrouli (57.3%) and Bi flaviscutellata (41.4%), present at all sampling sites. Two of the 36 hamsters used as bait presented natural infection with Leishmania. The parasite was identified as Leishmania (Leishmania) amazonensis. Analysis of the results revealed the efficiency of Disney traps for capturing Bichromomyia flaviscutellata and the simultaneous presence of both vector and the Leishmania species transmitted by the same can be considered a predictive factor of the occurrence of leishmaniasis outbreaks for the human population that occupies the location.

Frequency and persistency of DNA vaccine encoding GP25 by oral on common carp

Directory of Open Access Journals (Sweden)

Sri Nuryati

2015-05-01

Full Text Available ABSTRACT Koi herpesvirus (KHV is a major viral pathogen that infects common carp and koi. KHV disease outbreak is happened in almost all centre of common carp culture in Indonesia and caused mass mortality. Deoxyribonucleic acid (DNA vaccination method is one of ways to cope with KHV infection. Vaccines were commonly given by injection. The aim of this research was to get frequency and persistency of DNA vaccine encoding GP25 given by oral delivery method in common carp. This research would like to determine dose, frequency of vaccination, persistency of DNA vaccine and culture medium for the bacterial host. DNA vaccine persistency test was done by using polymerase chain reaction (PCR method with the specific primer for GP25 gene. The results showed that level of DNA vaccine that could be detected in feed was 7.56 ng (equal to 1.598×1010 copies. Efficient culture medium for Escherichia coli DH5α carrying DNA vaccine was LB triptone. Feeding fish with diet supplemented with 1 mL E. coli DH5α containing DNA vaccine for each fish and two times a week allowed persistence of DNA vaccine in kindney and spleen. Keywords: common carp, KHV, DNA vaccine, GP25, persistance  ABSTRAK Koi herpesvirus (KHV adalah virus patogen utama yang menginfeksi ikan mas dan ikan koi. Wabah penyakit KHV terjadi di hampir semua sentra budidaya ikan mas di Indonesia dan menyebabkan kematian massal ikan. Metode vaksinasi DNA merupakan salah satu cara yang dapat dilakukan untuk menanggulangi serangan KHV. Pemberian vaksin umumnya dilakukan dengan cara injeksi. Tujuan penelitian ini adalah untuk menguji frekuensi dan persistensi vaksin DNA GP25 antivirus KHV yang diberikan melalui oral pada ikan mas. Pada penelitian ini dilakukan uji dosis, frekuensi pemberian vaksin, persistensi vaksin DNA, dan media kultur bakteri inang. Persistensi vaksin DNA dianalisis menggunakan metode PCR dengan primer spesifik gen GP25. Hasil penelitian menunjukkan bahwa dosis vaksin DNA yang

Histopatologia da forma localizada de leishmaniose cutânea por Leishmania (Leishmania amazonensis Histopathology of the localized form of cutaneous leishmaniasis due to Leishmania (Leishmania amazonensis

Directory of Open Access Journals (Sweden)

Mário A. P. Moraes

1994-10-01

Full Text Available São descritas as alterações microscópicas presentes na forma localizada (ulcerada da Leishmaniose cutânea produzida por Leishmania (Leishmania amazonensis. Nesse tipo de manifestação, menos conhecido do que a forma anérgica ou difusa devida ao mesmo agente, as lesões são clinicamente idênticas às de leishmaniose cutânea causada por espécies outras de Leishmania, pertencentes ao subgênero Viannia. Na infecção localizada por L. (L. amazonensis, entretanto, há um aspecto peculiar, só recentemente conhecido, ou seja, cerca de 50% dos indivíduos atingidos não reagem ao teste de Montenegro. A principal característica histológica observada foi a acumulação na derme, quase sempre focal, de numerosos macrófagos contendo no citoplasma um grande vacúolo cheio de amastigotas. O quadro é semelhante ao da forma difusa, porém sem o aspecto histiocitomatóide, próprio da última. Afora esses grupos de macrófagos, vêem-se também, na forma localizada, muitas células mononucleares da inflamação, principalmente plasmócitos e macrófagos não parasitados. Os acúmulos de macrófagos com amastigotas, quando volumosos, podem sofrer necrose na parte central; os parasitos, contidos nas células, são destruídos com elas ou liberados, e sua eliminação através da úlcera deve contribuir para a cura do processo. Esse tipo de necrose nunca foi descrito em casos da forma difusa. Não houve grande diferença, no quadro histológico, entre pacientes Montenegro-negativos e positivos. Apenas em alguns casos, do grupo Montenegro-positivo, havia granulomas formados por histiócitos epitelióides sem parasitos. Quanto à persistência das células com parasitos nas lesões, observou-se que aos seis meses ou mais de evolução, em ambos os grupos, ainda estavam elas presentes. Tal achado não é comum na leishmaniose tegumentar por L. (V. braziliensis.The microscopic changes found in the localized form of the human cutaneous leishmaniasis due

Antigenicity of Leishmania-Activated C-Kinase Antigen (LACK in Human Peripheral Blood Mononuclear Cells, and Protective Effect of Prime-Boost Vaccination With pCI-neo-LACK Plus Attenuated LACK-Expressing Vaccinia Viruses in Hamsters

Directory of Open Access Journals (Sweden)

Laura Fernández

2018-04-01

Full Text Available Leishmania-activated C-kinase antigen (LACK is a highly conserved protein among Leishmania species and is considered a viable vaccine candidate for human leishmaniasis. In animal models, prime-boost vaccination with LACK-expressing plasmids plus attenuated vaccinia viruses (modified vaccinia Ankara [MVA] and mutant M65 expressing LACK, has been shown to protect against cutaneous leishmaniasis (CL. Further, LACK demonstrated to induce the production of protective cytokines in patients with active CL or cured visceral leishmaniasis, as well as in asymptomatic individuals from endemic areas. However, whether LACK is capable to trigger cytokine release by peripheral blood mononuclear cells from patients cured of CL due to Leishmania infantum (L. infantum or induce protection in L. infantum-infected hamsters [visceral leishmaniasis (VL model], has not yet been analyzed. The present work examines the ex vivo immunogenicity of LACK in cured VL and CL patients, and asymptomatic subjects from an L. infantum area. It also evaluates the vaccine potential of LACK against L. infantum infection in hamsters, in a protocol of priming with plasmid pCI-neo-LACK (DNA-LACK followed by a booster with the poxvirus vectors MVA-LACK or M65-LACK. LACK-stimulated PBMC from both asymptomatic and cured subjects responded by producing IFN-γ, TNF-α, and granzyme B (Th1-type response. Further, 78% of PBMC samples that responded to soluble Leishmania antigen showed IFN-γ secretion following stimulation with LACK. In hamsters, the protocol of DNA-LACK prime/MVA-LACK or M65-LACK virus boost vaccination significantly reduced the amount of Leishmania DNA in the liver and bone marrow, with no differences recorded between the use of MVA or M65 virus vector options. In summary, the Th1-type and cytotoxic responses elicited by LACK in PBMC from human subjects infected with L. infantum, and the parasite protective effect of prime/boost vaccination in hamsters with DNA

A cDNA encoding a pRB-binding protein with properties of the transcription factor E2F

DEFF Research Database (Denmark)

Helin, K; Lees, J A; Vidal, M

1992-01-01

The retinoblastoma protein (pRB) plays an important role in the control of cell proliferation, apparently by binding to and regulating cellular transcription factors such as E2F. Here we describe the characterization of a cDNA clone that encodes a protein with properties of E2F. This clone, RBP3...

SnoVault and encodeD: A novel object-based storage system and applications to ENCODE metadata.

Directory of Open Access Journals (Sweden)

Benjamin C Hitz

Full Text Available The Encyclopedia of DNA elements (ENCODE project is an ongoing collaborative effort to create a comprehensive catalog of functional elements initiated shortly after the completion of the Human Genome Project. The current database exceeds 6500 experiments across more than 450 cell lines and tissues using a wide array of experimental techniques to study the chromatin structure, regulatory and transcriptional landscape of the H. sapiens and M. musculus genomes. All ENCODE experimental data, metadata, and associated computational analyses are submitted to the ENCODE Data Coordination Center (DCC for validation, tracking, storage, unified processing, and distribution to community resources and the scientific community. As the volume of data increases, the identification and organization of experimental details becomes increasingly intricate and demands careful curation. The ENCODE DCC has created a general purpose software system, known as SnoVault, that supports metadata and file submission, a database used for metadata storage, web pages for displaying the metadata and a robust API for querying the metadata. The software is fully open-source, code and installation instructions can be found at: http://github.com/ENCODE-DCC/snovault/ (for the generic database and http://github.com/ENCODE-DCC/encoded/ to store genomic data in the manner of ENCODE. The core database engine, SnoVault (which is completely independent of ENCODE, genomic data, or bioinformatic data has been released as a separate Python package.

Erythema exsudativum multiforme after a Leishmania skin test

NARCIS (Netherlands)

Wind, Bas S.; Guimarães, Luiz H.; Machado, Paulo R. L.

2014-01-01

A 45-year-old otherwise healthy male from an endemic region for Leishmania braziliensis infection in Bahia, Brazil, presented with three erosive hemorrhagic infiltrated plaques on the left shin accompanied with lymphadenopathy in the groin since one month. A Leishmania skin test performed on the

Leishmania naiffi and Leishmania guyanensis reference genomes highlight genome structure and gene evolution in the Viannia subgenus.

Science.gov (United States)

Coughlan, Simone; Taylor, Ali Shirley; Feane, Eoghan; Sanders, Mandy; Schonian, Gabriele; Cotton, James A; Downing, Tim

2018-04-01

The unicellular protozoan parasite Leishmania causes the neglected tropical disease leishmaniasis, affecting 12 million people in 98 countries. In South America, where the Viannia subgenus predominates, so far only L. ( Viannia ) braziliensis and L. ( V. ) panamensis have been sequenced, assembled and annotated as reference genomes. Addressing this deficit in molecular information can inform species typing, epidemiological monitoring and clinical treatment. Here, L. ( V. ) naiffi and L. ( V. ) guyanensis genomic DNA was sequenced to assemble these two genomes as draft references from short sequence reads. The methods used were tested using short sequence reads for L. braziliensis M2904 against its published reference as a comparison. This assembly and annotation pipeline identified 70 additional genes not annotated on the original M2904 reference. Phylogenetic and evolutionary comparisons of L. guyanensis and L. naiffi with 10 other Viannia genomes revealed four traits common to all Viannia : aneuploidy, 22 orthologous groups of genes absent in other Leishmania subgenera, elevated TATE transposon copies and a high NADH-dependent fumarate reductase gene copy number. Within the Viannia , there were limited structural changes in genome architecture specific to individual species: a 45 Kb amplification on chromosome 34 was present in all bar L. lainsoni , L. naiffi had a higher copy number of the virulence factor leishmanolysin, and laboratory isolate L. shawi M8408 had a possible minichromosome derived from the 3' end of chromosome 34 . This combination of genome assembly, phylogenetics and comparative analysis across an extended panel of diverse Viannia has uncovered new insights into the origin and evolution of this subgenus and can help improve diagnostics for leishmaniasis surveillance.

2-Alkynoic fatty acids inhibit topoisomerase IB from Leishmania donovani.

Science.gov (United States)

Carballeira, Néstor M; Cartagena, Michelle; Sanabria, David; Tasdemir, Deniz; Prada, Christopher F; Reguera, Rosa M; Balaña-Fouce, Rafael

2012-10-01

2-Alkynoic fatty acids display antimycobacterial, antifungal, and pesticidal activities but their antiprotozoal activity has received little attention. In this work we synthesized the 2-octadecynoic acid (2-ODA), 2-hexadecynoic acid (2-HDA), and 2-tetradecynoic acid (2-TDA) and show that 2-ODA is the best inhibitor of the Leishmania donovani DNA topoisomerase IB enzyme (LdTopIB) with an EC(50)=5.3±0.7μM. The potency of LdTopIB inhibition follows the trend 2-ODA>2-HDA>2-TDA, indicating that the effectiveness of inhibition depends on the fatty acid carbon chain length. All of the studied 2-alkynoic fatty acids were less potent inhibitors of the human topoisomerase IB enzyme (hTopIB) as compared to LdTopIB. 2-ODA also displayed in vitro activity against Leishmania donovani (IC(50)=11.0μM), but it was less effective against other protozoa, Trypanosoma cruzi (IC(50)=48.1μM) and Trypanosoma brucei rhodesiense (IC(50)=64.5μM). The antiprotozoal activity of the 2-alkynoic fatty acids, in general, followed the trend 2-ODA>2-HDA>2-TDA. The experimental information gathered so far indicates that 2-ODA is a promising antileishmanial compound. Copyright © 2012 Elsevier Ltd. All rights reserved.

Monocyte-Derived Signals Activate Human Natural Killer Cells in Response to Leishmania Parasites

Science.gov (United States)

Messlinger, Helena; Sebald, Heidi; Heger, Lukas; Dudziak, Diana; Bogdan, Christian; Schleicher, Ulrike

2018-01-01

Activated natural killer (NK) cells release interferon (IFN)-γ, which is crucial for the control of intracellular pathogens such as Leishmania. In contrast to experimental murine leishmaniasis, the human NK cell response to Leishmania is still poorly characterized. Here, we investigated the interaction of human blood NK cells with promastigotes of different Leishmania species (Leishmania major, Leishmania mexicana, Leishmania infantum, and Leishmania donovani). When peripheral blood mononuclear cells or purified NK cells and monocytes (all derived from healthy blood donors from Germany without a history of leishmaniasis) were exposed to promastigotes, NK cells showed increased surface expression of the activation marker CD69. The extent of this effect varied depending on the Leishmania species; differences between dermotropic and viscerotropic L. infantum strains were not observed. Upregulation of CD69 required direct contact between monocytes and Leishmania and was partly inhibitable by anti-interleukin (IL)-18. Unexpectedly, IL-18 was undetectable in most of the supernatants (SNs) of monocyte/parasite cocultures. Confocal fluorescence microscopy of non-permeabilized cells revealed that Leishmania-infected monocytes trans-presented IL-18 to NK cells. Native, but not heat-treated SNs of monocyte/Leishmania cocultures also induced CD69 on NK cells, indicating the involvement of a soluble heat-labile factor other than IL-18. A role for the NK cell-activating cytokines IL-1β, IL-2, IL-12, IL-15, IL-21, and IFN-α/β was excluded. The increase of CD69 was not paralleled by NK cell IFN-γ production or enhanced cytotoxicity. However, prior exposure of NK cells to Leishmania parasites synergistically increased their IFN-γ release in response to IL-12, which was dependent on endogenous IL-18. CD1c+ dendritic cells were identified as possible source of Leishmania-induced IL-12. Finally, we observed that direct contact between Leishmania and NK cells reduced the

Monocyte-Derived Signals Activate Human Natural Killer Cells in Response to Leishmania Parasites

Directory of Open Access Journals (Sweden)

Helena Messlinger

2018-01-01

Full Text Available Activated natural killer (NK cells release interferon (IFN-γ, which is crucial for the control of intracellular pathogens such as Leishmania. In contrast to experimental murine leishmaniasis, the human NK cell response to Leishmania is still poorly characterized. Here, we investigated the interaction of human blood NK cells with promastigotes of different Leishmania species (Leishmania major, Leishmania mexicana, Leishmania infantum, and Leishmania donovani. When peripheral blood mononuclear cells or purified NK cells and monocytes (all derived from healthy blood donors from Germany without a history of leishmaniasis were exposed to promastigotes, NK cells showed increased surface expression of the activation marker CD69. The extent of this effect varied depending on the Leishmania species; differences between dermotropic and viscerotropic L. infantum strains were not observed. Upregulation of CD69 required direct contact between monocytes and Leishmania and was partly inhibitable by anti-interleukin (IL-18. Unexpectedly, IL-18 was undetectable in most of the supernatants (SNs of monocyte/parasite cocultures. Confocal fluorescence microscopy of non-permeabilized cells revealed that Leishmania-infected monocytes trans-presented IL-18 to NK cells. Native, but not heat-treated SNs of monocyte/Leishmania cocultures also induced CD69 on NK cells, indicating the involvement of a soluble heat-labile factor other than IL-18. A role for the NK cell-activating cytokines IL-1β, IL-2, IL-12, IL-15, IL-21, and IFN-α/β was excluded. The increase of CD69 was not paralleled by NK cell IFN-γ production or enhanced cytotoxicity. However, prior exposure of NK cells to Leishmania parasites synergistically increased their IFN-γ release in response to IL-12, which was dependent on endogenous IL-18. CD1c+ dendritic cells were identified as possible source of Leishmania-induced IL-12. Finally, we observed that direct contact between Leishmania and NK cells

Cloning and chromosomal assignment of a human cDNA encoding a T cell- and natural killer cell-specific trypsin-like serine protease

International Nuclear Information System (INIS)

Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.

1988-01-01

A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage λgt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16 + natural killer cells and CD3 + , CD16 - T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells

Analysis of kinetoplast cytochrome b gene of 16 Leishmania isolates from different foci of China: different species of Leishmania in China and their phylogenetic inference

Science.gov (United States)

2013-01-01

Background Leishmania species belong to the family Trypanosomatidae and cause leishmaniasis, a geographically widespread disease that infects humans and other vertebrates. This disease remains endemic in China. Due to the large geographic area and complex ecological environment, the taxonomic position and phylogenetic relationship of Chinese Leishmania isolates remain uncertain. A recent internal transcribed spacer 1 and cytochrome oxidase II phylogeny of Chinese Leishmania isolates has challenged some aspects of their traditional taxonomy as well as cladistics hypotheses of their phylogeny. The current study was designed to provide further disease background and sequence analysis. Methods We systematically analyzed 50 cytochrome b (cyt b) gene sequences of 19 isolates (16 from China, 3 from other countries) sequenced after polymerase chain reaction (PCR) using a special primer for cyt b as well as 31 sequences downloaded from GenBank. After alignment, the data were analyzed using the maximum parsimony, Bayesian and netwok methods. Results Sequences of six haplotypes representing 10 Chinese isolates formed a monophyletic group and clustered with Leishmania tarentolae. The isolates GS1, GS7, XJ771 of this study from China clustered with other isolates of Leishmania donovani complex. The isolate JS1 was a sister to Leishmania tropica, which represented an L. tropica complex instead of clustering with L. donovani complex or with the other 10 Chinese isolates. The isolates KXG-2 and GS-GER20 formed a monophyletic group with Leishmania turanica from central Asia. In the different phylogenetic trees, all of the Chinese isolates occurred in at least four groups regardless of geographic distribution. Conclusions The undescribed Leishmania species of China, which are clearly causative agents of canine leishmaniasis and human visceral leishmaniasis and are related to Sauroleishmania, may have evolved from a common ancestral parasite that came from the Americas and may have

Persistence of phlebotomine Leishmania vectors in urban sites of Catania (Sicily, Italy).

Science.gov (United States)

Lisi, Oscar; D'Urso, Vera; Vaccalluzzo, Valerio; Bongiorno, Gioia; Khoury, Cristina; Severini, Francesco; Di Muccio, Trentina; Gramiccia, Marina; Gradoni, Luigi; Maroli, Michele

2014-12-09

Pioneering research on "Mediterranean Kala-Azar" carried out by Adler and Theodor early in the past century (~1930s) had identified Catania city (Sicily) as a major focus of the disease nowadays known as zoonotic visceral leishmaniasis (VL). Despite the fact that disease in both humans and dogs has continued to be highly prevalent in the Catania province up to the present times, research on Leishmania vectors in this urban focus dates back to that distant period. This study aimed to evaluate the persistence and current composition of the sand fly fauna in urban environments of Catania in recent years, 2006 and 2013. In 2006 fifty-one suitable collecting sites were identified within 44 sub-units of a grid drawn to include the urban Catania area. In 2013 the survey was restricted to four of the most productive and representative sites resulting from the 2006 survey. In both periods 3 collections per month were performed using standard sticky traps set for 3 days in wall holes/cavities along public roads, from the end of April through December. 43/51 sites (84.3%) were found positive for sand flies. The 2006 collections accounted for a total of 4341 specimens including six species. Among competent Leishmania vector species, P. perniciosus was the most prevalent (36.5%) being identified in all sand fly-positive sites, with significant abundance in those of the old city centre. Other species of interest were P. sergenti (2.5%) and P. neglectus (1.5%). The 2013 survey produced 1130 sand flies, of which 39.5% were P. perniciosus, 1.6% P. sergenti and 0.7% P. neglectus. A search for Leishmania DNA in a small sample of 72 P. perniciosus females revealed 11% infection prevalence. Our findings from an old urban focus of leishmaniasis demonstrate that phlebotomine sand flies have adapted fairly well to the drastic environmental changes that have occurred in cities of the Western world in the past century and still represent a potential risk for Leishmania transmission.

Occurrence of Leishmania (Leishmania chagasi in a domestic cat (Felis catus in Andradina, São Paulo, Brazil: case report Ocorrência de Leishmania (Leishmania chagasi em gato doméstico (Felis catus em Andradina, São Paulo, Brasil: relato de caso

Directory of Open Access Journals (Sweden)

Willian Marinho Dourado Coelho

2010-12-01

Full Text Available This work describes natural infection by Leishmania in a domestic cat where amastigote forms of the parasite were observed in the popliteal lymph node imprint. Positive and negative serological reactions were observed by enzyme-linked immunosorbent assay (ELISA and indirect immunofluorescence assay (IFA, respectively. Polymerase chain reaction (PCR revealed that the nucleotide sequence of the sample was identical to Leishmania (L. chagasi. This is the first report of the disease in felines of the city of Andradina, SP, an area considered endemic for canine and human visceral leishmaniasis.Neste trabalho, é relatada a infecção natural por Leishmania em um gato doméstico no qual, formas amastigotas do parasito foram observadas em imprint de linfonodo poplíteo. Reações sorológicas positivas e negativas foram observadas pelo teste de imunoadsorção enzimática (ELISA e reação de imunofluorescência indireta (RIFI, respectivamente. A reação em cadeia da polimerase (PCR revelou que a sequência de nucleotídeos foi idêntica à Leishmania (L. chagasi. Este é o primeiro relato da doença em felino da cidade de Andradina, Estado de São Paulo, Brasil, área considerada endêmica para leishmaniose visceral canina e humana.

Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.

Directory of Open Access Journals (Sweden)

Dongsheng Li

Full Text Available Infectious cDNA clones of RNA viruses are important research tools, but flavivirus cDNA clones have proven difficult to assemble and propagate in bacteria. This has been attributed to genetic instability and/or host cell toxicity, however the mechanism leading to these difficulties has not been fully elucidated. Here we identify and characterize an efficient cryptic bacterial promoter in the cDNA encoding the dengue virus (DENV 5' UTR. Following cryptic transcription in E. coli, protein expression initiated at a conserved in-frame AUG that is downstream from the authentic DENV initiation codon, yielding a DENV polyprotein fragment that was truncated at the N-terminus. A more complete understanding of constitutive viral protein expression in E. coli might help explain the cloning and propagation difficulties generally observed with flavivirus cDNA.

Structure-based domain assignment in Leishmania infantum EndoG: characterization of a pH-dependent regulatory switch and a C-terminal extension that largely dictates DNA substrate preferences.

Science.gov (United States)

Oliva, Cristina; Sánchez-Murcia, Pedro A; Rico, Eva; Bravo, Ana; Menéndez, Margarita; Gago, Federico; Jiménez-Ruiz, Antonio

2017-09-06

Mitochondrial endonuclease G from Leishmania infantum (LiEndoG) participates in the degradation of double-stranded DNA (dsDNA) during parasite cell death and is catalytically inactive at a pH of 8.0 or above. The presence, in the primary sequence, of an acidic amino acid-rich insertion exclusive to trypanosomatids and its spatial position in a homology-built model of LiEndoG led us to postulate that this peptide stretch might act as a pH sensor for self-inhibition. We found that a LiEndoG variant lacking residues 145-180 is indeed far more active than its wild-type counterpart at pH values >7.0. In addition, we discovered that (i) LiEndoG exists as a homodimer, (ii) replacement of Ser211 in the active-site SRGH motif with the canonical aspartate from the DRGH motif of other nucleases leads to a catalytically deficient enzyme, (iii) the activity of the S211D variant can be restored upon the concomitant replacement of Ala247 with Arg and (iv) a C-terminal extension is responsible for the observed preferential cleavage of single-stranded DNA (ssDNA) and ssDNA-dsDNA junctions. Taken together, our results support the view that LiEndoG is a multidomain molecular machine whose nuclease activity can be subtly modulated or even abrogated through architectural changes brought about by environmental conditions and interaction with other binding partners. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Suppression of LPS-induced inflammatory responses in macrophages infected with Leishmania

Directory of Open Access Journals (Sweden)

Kelly Ben L

2010-02-01

Full Text Available Abstract Background Chronic inflammation activated by macrophage innate pathogen recognition receptors such as TLR4 can lead to a range of inflammatory diseases, including atherosclerosis, Crohn's disease, arthritis and cancer. Unlike many microbes, the kinetoplastid protozoan pathogen Leishmania has been shown to avoid and even actively suppress host inflammatory cytokine responses, such as LPS-induced IL-12 production. The nature and scope of Leishmania-mediated inflammatory cytokine suppression, however, is not well characterized. Advancing our knowledge of such microbe-mediated cytokine suppression may provide new avenues for therapeutic intervention in inflammatory disease. Methods We explored the kinetics of a range of cytokine and chemokine responses in primary murine macrophages stimulated with LPS in the presence versus absence of two clinically distinct species of Leishmania using sensitive multiplex cytokine analyses. To confirm that these effects were parasite-specific, we compared the effects of Leishmania uptake on LPS-induced cytokine expression with uptake of inert latex beads. Results Whilst Leishmania uptake alone did not induce significant levels of any cytokine analysed in this study, Leishmania uptake in the presence of LPS caused parasite-specific suppression of certain LPS-induced pro-inflammatory cytokines, including IL-12, IL-17 and IL-6. Interestingly, L. amazonensis was generally more suppressive than L. major. We also found that other LPS-induced proinflammatory cytokines, such as IL-1α, TNF-α and the chemokines MIP-1α and MCP-1 and also the anti-inflammatory cytokine IL-10, were augmented during Leishmania uptake, in a parasite-specific manner. Conclusions During uptake by macrophages, Leishmania evades the activation of a broad range of cytokines and chemokines. Further, in the presence of a strong inflammatory stimulus, Leishmania suppresses certain proinflammatory cytokine responses in a parasite

46-kDa protein located in the flagellar pocket of Leishmania ...

Indian Academy of Sciences (India)

NII

Cloning and expression of endocytic Rab GTPases from Leishmania. Fractionation of early compartment from. Leishmania containing endocytic probes. Rab7:WT. Rab5: WT. Localization of Rab5 and Rab7 in Leishmania. Phase. LTR. Merge. Rab7-GFP. Rab5-GFP. LTR. Phase. Merge. Rab5-GFP. Rab7-GFP. Lysosomes.

Differentiation of Leishmania (Viannia) panamensis and Leishmania (V.) guyanensis using BccI for hsp70 PCR-RFLP.

Science.gov (United States)

Montalvo Alvarez, Ana Margarita; Nodarse, Jorge Fraga; Goodridge, Ivón Montano; Fidalgo, Lianet Monzote; Marin, Marcel; Van Der Auwera, Gert; Dujardin, Jean-Claude; Bernal, Iván Darío Velez; Muskus, Carlos

2010-05-01

Leishmania panamensis and Leishmania guyanensis are two species of the subgenus Viannia that are genetically very similar. Both parasites are usually associated with cutaneous leishmaniasis, but also have the potential to cause the mucocutaneous form of the disease. In addition, the study of foci and consequently the identification of vectors and probable reservoirs involved in transmission require a correct differentiation between both species, which is important at epidemiological level. We explored the possibility of identifying these species by using restriction fragment length polymorphisms (RFLP) in the gene coding for heat-shock protein 70 (hsp70). Previously, an hsp70 PCR-RFLP assay proved to be very effective in differentiating other Leishmania species when HaeIII is used as restriction enzyme. Based on hsp70 sequences analysis, BccI was found to generate species-specific fragments that can easily be recognized by agarose gel electrophoresis. Using the analysis of biopsies, scrapings, and parasite isolates previously grouped in a cluster comprising both L. panamensis and L. guyanensis, we showed that our approach allowed differentiation of both entities. This offers the possibility not only for identification of parasites in biological samples, but also to apply molecular epidemiology in certain countries of the New World, where several Leishmania species could coexist. Copyright 2009 Royal Society of Tropical Medicine and Hygiene. Published by Elsevier Ltd. All rights reserved.

Natural Leishmania sp. reservoirs and phlebotomine sandfly food source identification in Ibitipoca State Park, Minas Gerais, Brazil

Directory of Open Access Journals (Sweden)

Patrícia Flávia Quaresma

2012-06-01

Full Text Available Leishmania spp are distributed throughout the world and different species are associated with varying degrees of disease severity. However, leishmaniasis is thought to be confined to areas of the world where its insect vectors, sandflies, are present. Phlebotomine sandflies obtain blood meals from a variety of wild and domestic animals and sometimes from humans. These vectors transmit Leishmania spp, the aetiological agent of leishmaniasis. Identification of sandfly blood meals has generally been performed using serological methods, although a few studies have used molecular procedures in artificially fed insects. In this study, cytochrome b gene (cytB polymerase chain reaction (PCR was performed in DNA samples isolated from 38 engorged Psychodopygus lloydi and the expected 359 bp fragment was identified from all of the samples. The amplified product was digested using restriction enzymes and analysed for restriction fragment length polymorphisms (RFLPs. We identified food sources for 23 females; 34.8% yielded a primate-specific banding profile and 26.1% and 39.1% showed banding patterns specific to birds or mixed restriction profiles (rodent/marsupial, human/bird, rodent/marsupial/human, respectively. The food sources of 15 flies could not be identified. Two female P. lloydi were determined to be infected by Leishmania using internal transcribed spacer 1 and heat shock protein 70 kDa PCR-RFLP. The two female sandflies, both of which fed on rodents/marsupials, were further characterised as infected with Leishmania (Viannia braziliensis. These results constitute an important step towards applying methodologies based on cytB amplification as a tool for identifying the food sources of female sandflies.

Isolation and characterization of cDNA encoding the 80-kDa subunit protein of the human autoantigen Ku (p70/p80) recognized by autoantibodies from patients with scleroderma-polymyositis overlap syndrome

International Nuclear Information System (INIS)

Mimori, Tsuneyo; Ohosone, Yasuo; Hama, Nobuaki; Suwa, Akira; Akizuki, Masashi; Homma, Mitsuo; Griffith, A.J.; Hardin, J.A.

1990-01-01

Anti-Ku (p70/p80) autoantibodies in patients with scleroderma-polymyositis overlap syndrome recognize a 70-kDa/80-kDa protein heterodimer which binds to terminal regions of double-stranded DNA. In the present study, the authors isolated full-length cDNAs that encode the 80-kDa Ku subunit. Initial screening of a human spleen cDNA library with anti-Ku antibodies yielded a cDNA of 1.0 kilobase (kb) (termed K71) encoding a portion of the 80-kDa Ku polypeptide (identification based on immunological criteria). In RNA blots, this cDNA hybridized with two mRNAs of 3.4 and 2.6 kb. In vitro transcription and translation experiments produced an immunoprecipitable polypeptide which comigrated with the 80-kDa Ku subunit. The Ku80-6 cDNA proved to be 3304 nucleotides in length, with an additional poly(A) tail, closely approximating the size of the larger mRNA. It contains a single long open reading frame encoding 732 amino acids. The putative polypeptide has a high content of acidic amino acids and a region with periodic repeat of leucine in every seventh position which may form the leucine zipper structure. In genomic DNA blots, probes derived from the opposite ends of cDNA Ku80-6 hybridized with several nonoverlapping restriction fragments from human leukocyte DNA, indicating that the gene encoding the 80-kDa Ku polypeptide is divided into several exons by intervening sequences

Hepatozoon canis and Leishmania spp. coinfection in dogs diagnosed with visceral leishmaniasis

Directory of Open Access Journals (Sweden)

Fernanda Nazaré Morgado

Full Text Available Abstract This study describes the occurrence of dogs naturally co-infected with Hepatozoon canis and two Leishmania species: L. infantum or L. braziliensis. Four dogs serologically diagnosed with Visceral Leishmaniasis were euthanized. Liver and spleen samples were collected for histopathological analysis and DNA isolation. H. canis meronts were observed in tissues from all four dogs. H. canis infection was confirmed by PCR followed by sequencing of a fragment of 18S rRNA gene. Leishmania detection and typing was confirmed by ITS1' PCR-RFLP and parasite burden was calculated using ssrRNA quantitative qPCR. A DPP - Dual Path platform test was performed. One out (Dog #2 of four animals was asymptomatic. Dogs #1 and #4 were infected by L. infantum and were DPP test positive. Dogs #2 and #3 were infected by L. braziliensis and were DPP test negative. Furthermore, visceral dissemination was observed in Dogs #2 and #3, since L. braziliensis was detected in liver and spleen samples. The visceral dissemination of L. braziliensis associated with systemic signs suggested that this co-infection could influence the parasite burden and disease progression.

Clinical and parasitological protection in a Leishmania infantum-macaque model vaccinated with adenovirus and the recombinant A2 antigen.

Science.gov (United States)

Grimaldi, Gabriel; Teva, Antonio; Porrozzi, Renato; Pinto, Marcelo A; Marchevsky, Renato S; Rocha, Maria Gabrielle L; Dutra, Miriam S; Bruña-Romero, Oscar; Fernandes, Ana-Paula; Gazzinelli, Ricardo T

2014-06-01

Visceral leishmaniasis (VL) is a severe vector-born disease of humans and dogs caused by Leishmania donovani complex parasites. Approximately 0.2 to 0.4 million new human VL cases occur annually worldwide. In the new world, these alarming numbers are primarily due to the impracticality of current control methods based on vector reduction and dog euthanasia. Thus, a prophylactic vaccine appears to be essential for VL control. The current efforts to develop an efficacious vaccine include the use of animal models that are as close to human VL. We have previously reported a L. infantum-macaque infection model that is reliable to determine which vaccine candidates are most worthy for further development. Among the few amastigote antigens tested so far, one of specific interest is the recombinant A2 (rA2) protein that protects against experimental L. infantum infections in mice and dogs. Primates were vaccinated using three rA2-based prime-boost immunization regimes: three doses of rA2 plus recombinant human interleukin-12 (rhIL-12) adsorbed in alum (rA2/rhIL-12/alum); two doses of non-replicative adenovirus recombinant vector encoding A2 (Ad5-A2) followed by two boosts with rA2/rhIL-12/alum (Ad5-A2+rA2/rhIL12/alum); and plasmid DNA encoding A2 gene (DNA-A2) boosted with two doses of Ad5-A2 (DNA-A2+Ad5-A2). Primates received a subsequent infectious challenge with L. infantum. Vaccines, apart from being safe, were immunogenic as animals responded with increased pre-challenge production of anti-A2-specific IgG antibodies, though with some variability in the response, depending on the vaccine formulation/protocol. The relative parasite load in the liver was significantly lower in immunized macaques as compared to controls. Protection correlated with hepatic granuloma resolution, and reduction of clinical symptoms, particularly when primates were vaccinated with the Ad5-A2+rA2/rhIL12/alum protocol. The remarkable clinical protection induced by A2 in an animal model that is

The protein encoded by the proto-oncogene DEK changes the topology of chromatin and reduces the efficiency of DNA replication in a chromatin-specific manner

DEFF Research Database (Denmark)

Alexiadis, V; Waldmann, T; Andersen, Jens S.

2000-01-01

The structure of chromatin regulates the genetic activity of the underlying DNA sequence. We report here that the protein encoded by the proto-oncogene DEK, which is involved in acute myelogenous leukemia, induces alterations of the superhelical density of DNA in chromatin. The change in topology...

Asymptomatic dogs are highly competent to transmit Leishmania (Leishmania) infantum chagasi to the natural vector.

Science.gov (United States)

Laurenti, Márcia Dalastra; Rossi, Claudio Nazaretian; da Matta, Vânia Lúcia Ribeiro; Tomokane, Thaise Yumie; Corbett, Carlos Eduardo Pereira; Secundino, Nágila Francinete Costa; Pimenta, Paulo Filemon Paulocci; Marcondes, Mary

2013-09-23

We evaluated the ability of dogs naturally infected with Leishmania (Leishmania) infantum chagasi to transfer the parasite to the vector and the factors associated with transmission. Thirty-eight infected dogs were confirmed to be infected by direct observation of Leishmania in lymph node smears. Dogs were grouped according to external clinical signs and laboratory data into symptomatic (n=24) and asymptomatic (n=14) animals. All dogs were sedated and submitted to xenodiagnosis with F1-laboratory-reared Lutzomyia longipalpis. After blood digestion, sand flies were dissected and examined for the presence of promastigotes. Following canine euthanasia, fragments of skin, lymph nodes, and spleen were collected and processed using immunohistochemistry to evaluate tissue parasitism. Specific antibodies were detected using an enzyme-linked immunosorbent assay. Antibody levels were found to be higher in symptomatic dogs compared to asymptomatic dogs (p=0.0396). Both groups presented amastigotes in lymph nodes, while skin parasitism was observed in only 58.3% of symptomatic and in 35.7% of asymptomatic dogs. Parasites were visualized in the spleens of 66.7% and 71.4% of symptomatic and asymptomatic dogs, respectively. Parasite load varied from mild to intense, and was not significantly different between groups. All asymptomatic dogs except for one (93%) were competent to transmit Leishmania to the vector, including eight (61.5%) without skin parasitism. Sixteen symptomatic animals (67%) infected sand flies; six (37.5%) showed no amastigotes in the skin. Skin parasitism was not crucial for the ability to infect Lutzomyia longipalpis but the presence of Leishmania in lymph nodes was significantly related to a positive xenodiagnosis. Additionally, a higher proportion of infected vectors that fed on asymptomatic dogs was observed (p=0.0494). Clinical severity was inversely correlated with the infection rate of sand flies (p=0.027) and was directly correlated with antibody

Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

Directory of Open Access Journals (Sweden)

S. S. Hasson

2010-01-01

Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

Efficacy of Recombinant Canine Distemper Virus Expressing Leishmania Antigen against Leishmania Challenge in Dogs.

Science.gov (United States)

Miura, Ryuichi; Kooriyama, Takanori; Yoneda, Misako; Takenaka, Akiko; Doki, Miho; Goto, Yasuyuki; Sanjoba, Chizu; Endo, Yasuyuki; Fujiyuki, Tomoko; Sugai, Akihiro; Tsukiyama-Kohara, Kyoko; Matsumoto, Yoshitsugu; Sato, Hiroki; Kai, Chieko

2015-01-01

Canine distemper virus (CDV) vaccination confers long-term protection against CDV reinfection. To investigate the utility of CDV as a polyvalent vaccine vector for Leishmania, we generated recombinant CDVs, based on an avirulent Yanaka strain, that expressed Leishmania antigens: LACK, TSA, or LmSTI1 (rCDV-LACK, rCDV-TSA, and rCDV-LmSTI1, respectively). Dogs immunized with rCDV-LACK were protected against challenge with lethal doses of virulent CDV, in the same way as the parental Yanaka strain. To evaluate the protective effects of the recombinant CDVs against cutaneous leishmaniasis in dogs, dogs were immunized with one recombinant CDV or a cocktail of three recombinant CDVs, before intradermal challenge (in the ears) with infective-stage promastigotes of Leishmania major. Unvaccinated dogs showed increased nodules with ulcer formation after 3 weeks, whereas dogs immunized with rCDV-LACK showed markedly smaller nodules without ulceration. Although the rCDV-TSA- and rCDV-LmSTI1-immunized dogs showed little protection against L. major, the cocktail of three recombinant CDVs more effectively suppressed the progression of nodule formation than immunization with rCDV-LACK alone. These results indicate that recombinant CDV is suitable for use as a polyvalent live attenuated vaccine for protection against both CDV and L. major infections in dogs.

Experimental Acquisition, Development, and Transmission of Leishmania tropica by Phlebotomus duboscqi

Science.gov (United States)

2013-01-01

ac ta t ropica Experimental acquisition, development, and transmission of Leishmania tropica by Phlebotomus duboscqi Hanafi A. Hanafi, El...August 2012 Accepted 2 September 2012 Available online 10 September 2012 Keywords: Phlebotomus duboscqi Leishmania tropica Transmission Vector...competency a b s t r a c t We report experimental infection and transmission of Leishmania tropica (Wright), by the blood-feeding sand

Molecular cloning and functional analysis of the gene encoding ...

African Journals Online (AJOL)

Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

Real-time PCR for Leishmania species identification: Evaluation and comparison with classical techniques.

Science.gov (United States)

de Morais, Rayana Carla Silva; da Costa Oliveira, Cintia Nascimento; de Albuquerque, Suênia da Cunha Gonçalves; Mendonça Trajano Silva, Lays Adrianne; Pessoa-E-Silva, Rômulo; Alves da Cruz, Heidi Lacerda; de Brito, Maria Edileuza Felinto; de Paiva Cavalcanti, Milena

2016-06-01

Cutaneous leishmaniasis (CL) is a parasitic disease caused by various Leishmania species. Several studies have shown that real time quantitative PCR (qPCR) can be used for Leishmania spp. identification by analyzing the melting temperature (Tm). Thus, the aim of this study was to evaluate the viability of qPCR for differentiating eight closely related Leishmania species that cause the same clinical form of the disease and to compare the results with classical techniques. qPCR assays for standardizing the Tm using reference strains were performed. After the CL diagnosis on blood samples of domestic animals, positive samples were analyzed by their Tm and qPCR products were purified and sequenced. Ten human samples previously characterized by Multilocus Enzyme Electrophoresis (MLEE) were also analyzed by Tm. A Restriction Fragment Length Polymorphism (RFLP) assay, a reference test, was also standardized, by using the reference strains. Through standardization of Tm for Leishmania spp., two Tm ranges were created for analysis: 1 (Tm = 78-79.99 °C) included Leishmania (V.) braziliensis, Leishmania (V.) panamensis, Leishmania (V.) lainsoni, Leishmania (V.) guyanensis and Leishmania (V.) shawi; and 2 (Tm = 80-82.2 °C) included Leishmania (V.) naiffi, Leishmania (L.) amazonensis and Leishmania (L.) mexicana. A total of 223 positive blood samples were analyzed, with 58 included in range 1 and 165 in range 2. L. (V.) braziliensis, L. (V.) panamensis and L. (V.) guyanensis were identified by sequencing, while L. (V.) braziliensis, L. (L.) mexicana and L. (V.) panamensis were identified by RFLP analysis. Ten human samples previously characterized by Multilocus Enzyme Electrophoresis (MLEE) were also analyzed by qPCR Tm analysis; five were classified in range 1 and five in range 2. A concordance of 80% was calculated between qPCR and the gold-standard (MLEE) with no significant difference between the methods (p = 0.6499); a similar result was observed for sequencing

Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

Energy Technology Data Exchange (ETDEWEB)

Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

1988-08-11

The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

Science.gov (United States)

Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

2008-12-01

A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

Science.gov (United States)

Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon

2010-01-01

Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

Diagnosis of canine visceral leishmaniasis with radiolabelled probes: comparison of the kDNA PCR-hybridization with three molecular methods in different clinical samples

Energy Technology Data Exchange (ETDEWEB)

Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R., E-mail: antero@cdtn.br [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN-MG), Belo Horizonte, MG (Brazil). Lab. de Radiobiologia; Melo, Maria N., E-mail: melo@icb.ufmg.br [Departamento de Parasitologia. Instituto de Ciencias Biologicas. Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil)

2011-07-01

Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with {sup 32}P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)

Diagnosis of canine visceral leishmaniasis with radiolabelled probes: comparison of the kDNA PCR-hybridization with three molecular methods in different clinical samples

International Nuclear Information System (INIS)

Ferreira, Aline Leandra C.; Ferreira, Sidney A.; Carregal, Virginia M.; Andrade, Antero Silva R.

2011-01-01

Leishmania (Leishmania) chagasi is responsible for visceral leishmaniasis (VL) in Brazil and the dog is the main domestic reservoir. Disease control is based on the elimination of infected animals and the use of a sensitive and specific diagnostic test is necessary. The Brazilian VL control program emphasizes serologic surveys, mainly using the enzyme-linked immunosorbent assay (ELISA) and the immunofluorescence antibody test (IFAT), followed by the elimination of the seropositive dogs. However, these techniques present limitations in terms of sensitivity and specificity. The Polymerase Chain Reaction (PCR) associated to hybridization with DNA probes labeled with 32 P has been recognized as a valuable tool for Leishmania identification. In this study, the sensitivity of kDNA PCR hybridization method was compared with three other molecular methods: Internal Transcribed Spacer 1 Nested PCR (ITS-1nPCR), Leishmania nested PCR (LnPCR) and Seminested kDNA PCR (kDNA snPCR). The comparison was performed in different clinical specimens: conjunctival swab, skin, blood and bone marrow. A group of thirty symptomatic dogs, positive in the parasitological and serological tests, was used. When. The techniques targeting kDNA mini-circles (kDNA snPCR and KDNA PCR-hybridization) showed the worst result for blood samples. The KDNA-PCR hybridization showed the best sensitivity for conjunctival swab. By comparing the samples on the basis of positivity obtained by the sum of all methods, the blood showed the worst outcome (71/120).The bone marrow showed the highest positivity (106/120), followed by conjunctival swab (100/120) and skin (89/120). Since the bone marrow samples are unsuitable for routine epidemiological surveys, the conjunctival swab was recommended because it allows high sensitivity, especially when associated with kDNA PCR hybridization method, and is a noninvasive sampling method. (author)

Genetic metabolic complementation establishes a requirement for GDP-fucose in Leishmania.

Science.gov (United States)

Guo, Hongjie; Novozhilova, Natalia M; Bandini, Giulia; Turco, Salvatore J; Ferguson, Michael A J; Beverley, Stephen M

2017-06-23

To survive in its sand fly vector, the trypanosomatid protozoan parasite Leishmania first attaches to the midgut to avoid excretion, but eventually it must detach for transmission by the next bite. In Leishmania major strain Friedlin, this is controlled by modifications of the stage-specific adhesin lipophosphoglycan (LPG). During differentiation to infective metacyclics, d-arabinopyranose (d-Ara p ) caps the LPG side-chain galactose residues, blocking interaction with the midgut lectin PpGalec, thereby leading to parasite detachment and transmission. Previously, we characterized two closely related L. major genes ( FKP40 and AFKP80 ) encoding bifunctional proteins with kinase/pyrophosphorylase activities required for salvage and conversion of l-fucose and/or d-Ara p into the nucleotide-sugar substrates required by glycosyltransferases. Whereas only AFKP80 yielded GDP-d-Ara p from exogenous d-Ara p , both proteins were able to salvage l-fucose to GDP-fucose. We now show that Δ afkp80 - null mutants ablated d-Ara p modifications of LPG as predicted, whereas Δ fkp40 - null mutants resembled wild type (WT). Fucoconjugates had not been reported previously in L. major , but unexpectedly, we were unable to generate fkp40 - / afkp80 - double mutants, unless one of the A/FKPs was expressed ectopically. To test whether GDP-fucose itself was essential for Leishmania viability, we employed "genetic metabolite complementation." First, the trypanosome de novo pathway enzymes GDP-mannose dehydratase (GMD) and GDP-fucose synthetase (GMER) were expressed ectopically; from these cells, the Δ fkp40 - /Δ afkp80 - double mutant was now readily obtained. As expected, the Δ fkp40 - /Δ afkp80 - /+ TbGMD-GMER line lacked the capacity to generate GDP-Ara p , while synthesizing abundant GDP-fucose. These results establish a requirement for GDP-fucose for L. major viability and predict the existence of an essential fucoconjugate(s). © 2017 by The American Society for Biochemistry and

Protective effect of the DNA vaccine encoding the major house dust mite allergens on allergic inflammation in the murine model of house dust mite allergy

Directory of Open Access Journals (Sweden)

Lee Jaechun

2006-02-01

Full Text Available Abstract Background Vaccination with naked DNA encoding antigen induces cellular and humoral immunity characterized by the activation of specific Th1 cells. Objective To evaluate the effects of vaccination with mixed naked DNA plasmids encoding Der p 1, Der p 2, Der p 3, Der f 1, Der f 2, and Der f 3, the major house dust mite allergens on the allergic inflammation to the whole house dust mites (HDM crude extract. Methods Three hundred micrograms of these gene mixtures were injected into muscle of BALB/c mice. Control mice were injected with the pcDNA 3.1 blank vector. After 3 weeks, the mice were actively sensitized and inhaled with the whole house dust mite extract intranasally. Results The vaccinated mice showed a significantly decreased synthesis of total and HDM-specific IgE compared with controls. Analysis of the cytokine profile of lymphocytes after challenge with HDM crude extract revealed that mRNA expression of interferon-γ was higher in the vaccinated mice than in the controls. Reduced infiltration of inflammatory cells and the prominent infiltration of CD8+ T cells were observed in histology of lung tissue from the vaccinated mice. Conclusion Vaccination with DNA encoding the major house dust mite allergens provides a promising approach for treating allergic responses to whole house dust mite allergens.

Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

NARCIS (Netherlands)

Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

2002-01-01

Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

First Cases of Cutaneous Leishmaniasis Caused by Leishmania (Viannia) naiffi Infection in Surinam

NARCIS (Netherlands)

van Thiel, Pieter-Paul A. M.; van Gool, Tom; Kager, Piet A.; Bart, Aldert

2010-01-01

Cutaneous leishmaniasis in Surinam is generally caused by infection by Leishmania guyanensis. We report three cases of infection with Leishmania (Viannia) naiffi, a Leishmania species not described from Surinam before. Treatment with pentamidine proved to be effective

Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

Science.gov (United States)

Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

2001-10-31

Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

Genetic Diversity in Natural Populations of New World Leishmania

Directory of Open Access Journals (Sweden)

Cupolillo Elisa

1998-01-01

Full Text Available Our results have shown the wide diversity of parasites within New World Leishmania. Biochemical and molecular characterization of species within the genus has revealed that much of the population heterogeneity has a genetic basis. The source of genetic diversity among Leishmania appears to arise from predominantly asexual, clonal reproduction, although occasional bouts of sexual reproduction can not be ruled out. Genetic variation is extensive with some clones widely distributed and others seemingly unique and localized to a particular endemic focus. Epidemiological studies of leishmaniasis has been directed to the ecology and dynamics of transmission of Leishmania species/variants, particularly in localized areas. Future research using molecular techniques should aim to identify and follow Leishmania types in nature and correlate genetic typing with important clinical characteristics such as virulence, pathogenicity, drug resistance and antigenic variation. The epidemiological significance of such variation not only has important implications for the control of the leishmaniases, but would also help to elucidate the evolutionary biology of the causative agents.

Screening For Inhibitors Of Essential Leishmania Glucose Transporters

Science.gov (United States)

2011-07-01

parasite life cycle and, unlike he amastigote form that lives inside mammalian macrophages, s viable provided that an alternative energy source such as pro...glucose transporters havebeenvalidated asnewdrug targets for proto- zoan parasites including Plasmodium falciparum, Leishmania mexicana and Trypanosoma...such as Leishmania species, Trypanosoma rucei, and Plasmodium falciparum, the causative agents of leish- aniasis, African sleeping sickness, and malaria

Leishmania (Leishmania mexicana en el corregimiento de San Matías, municipio de Gómez Plata, Antioquia, Colombia

Directory of Open Access Journals (Sweden)

Diana Sierra

2006-10-01

Full Text Available Introducción. La leishmaniaisis es una enfermedad encontrada en focos naturales de infección donde están presentes insectos vectores y mamíferos reservorios deLeishmania. Objetivo. Registrar por primera vez la presencia de Leishmania (Leishmania mexicana Biagi, 1953, en el corregimiento de San Matías, municipio de Gómez Plata, departamento de Antioquia. Materiales y métodos. La especie fue aislada de un paciente con leishmaniasis cutánea localizada e identificada por la técnica de Inmunofluorescencia utilizando anticuerpos monoclonales específicos de especie y electroforesis de enzimas . Resultados y conclusión. Su perfil isoenzimático similar al de las cepas de referencia L. (L. mexicana (MNCY/BZ/62/M379 y L. (L. mexicana (MHOM/BE/82/BEL21, permitió concluír que la especie aislada del paciente es L. (L. mexicana.

Metacyclic promastigotes of Leishmania amazonensis selection using gamma irradiation

Energy Technology Data Exchange (ETDEWEB)

Bonetti, Franco C.; Nascimento, Nanci do [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil). Centro de Biologia Molecular]. E-mail: fbonetti@usp.br; Andrade Junior, Heitor Franco de [Instituto de Medicina Tropical de Sao Paulo, SP (Brazil). Lab. de Protozoologia

2005-07-01

Leishmania spp. causes a spectrum of human diseases, ranging from self-healing skin lesions to severe and lethal visceral disease. In previous work we demonstrated that the protein and nucleic acid metabolism and oxidative respiration were severely affected by irradiation, in a dose response way, but a small but representative fractions are relatively radio resistant, surviving after 800 Gy of {sup 60}Co irradiation. The best explanation could be a selection of metacyclic promastigotes. In these forms, the G0 state allows the adequate correction of DNA repair after the irradiation insult. In this work, we are looking for the ideal radiation dose to select the higher proportion of metacyclic forms of L.. (L.) amazonensis in culture. Parasites were grown in RPMI 1640 medium, plus 20% fetal calf serum, than they were irradiated with different doses ranging between 25 and 400 Gy. Parasites irradiated at 400 Gy infected, proportionally, more cells than parasites irradiated at other doses. To confirm this metacyclogenesis, a complement lysis assay was performed with 5, 10 and 20% of male guinea pig blood serum at 20 deg C for 3 hours, and parasites counted. Guinea pig serum a 10% promotes more lysis, with 200 Gy irradiated parasites being less affected, probably due to metacyclic selection. These preliminary results suggests that the ionizing radiation, specially between 200 and 400 Gy, could be a alternative tool for the selection of metacyclic forms of Leishmania amazonensis in culture. (a0011uth.

Metacyclic promastigotes of Leishmania amazonensis selection using gamma irradiation

International Nuclear Information System (INIS)

Bonetti, Franco C.; Nascimento, Nanci do; Andrade Junior, Heitor Franco de

2005-01-01

Leishmania spp. causes a spectrum of human diseases, ranging from self-healing skin lesions to severe and lethal visceral disease. In previous work we demonstrated that the protein and nucleic acid metabolism and oxidative respiration were severely affected by irradiation, in a dose response way, but a small but representative fractions are relatively radio resistant, surviving after 800 Gy of 60 Co irradiation. The best explanation could be a selection of metacyclic promastigotes. In these forms, the G0 state allows the adequate correction of DNA repair after the irradiation insult. In this work, we are looking for the ideal radiation dose to select the higher proportion of metacyclic forms of L.. (L.) amazonensis in culture. Parasites were grown in RPMI 1640 medium, plus 20% fetal calf serum, than they were irradiated with different doses ranging between 25 and 400 Gy. Parasites irradiated at 400 Gy infected, proportionally, more cells than parasites irradiated at other doses. To confirm this metacyclogenesis, a complement lysis assay was performed with 5, 10 and 20% of male guinea pig blood serum at 20 deg C for 3 hours, and parasites counted. Guinea pig serum a 10% promotes more lysis, with 200 Gy irradiated parasites being less affected, probably due to metacyclic selection. These preliminary results suggests that the ionizing radiation, specially between 200 and 400 Gy, could be a alternative tool for the selection of metacyclic forms of Leishmania amazonensis in culture. (author)

Molecular crosstalks in Leishmania-sandfly-host relationships

Directory of Open Access Journals (Sweden)

Volf P.

2008-09-01

Full Text Available Sandflies (Diptera: Phlebotominae are vectors of Leishmania parasites, causative agents of important human and animal diseases with diverse manifestations. This review summarizes present knowledge about the vectorial part of Leishmania life cycle and parasite transmission to the vertebrate host. Particularly, it focuses on molecules that determine the establishment of parasite infection in sandfly midgut. It describes the concept of specific versus permissive sandfly vectors, explains the epidemiological consequences of broad susceptibility of permissive sandflies and demonstrates that genetic exchange may positively affect Leishmania fitness in the vector. Last but not least, the review describes recent knowledge about circulating antibodies produced by hosts in response to sandfly bites. Studies on specificity and kinetics of antibody response revealed that anti-saliva IgG could be used as a marker of host exposure to sandflies, i.e. as a useful tool for evaluation of vector control.

Diagnosis of Leishmania (Leishmania chagasi infection in dogs and the relationship with environmental and sanitary aspects in the municipality of Palmas, state of Tocantins, Brazil

Directory of Open Access Journals (Sweden)

Julio Gomes Bigeli

2012-02-01

Full Text Available INTRODUCTION: The aim of the present study was to identify the presence of Leishmania (Leishmania chagasi infection in dogs in the City of Palmas, Tocantins, Brazil, using the PCR technique to list the hot spots of infected dogs in the city and associate their occurrence to significant environmental changes at capture sites. METHODS: DNA was extracted from blood of dogs, and the PCR were performed with primers RV1/RV2. After screening the population studied, the regions of the city that had the highest occurrence of canine infection were detected. These sites were visited, and ecological parameters denoting anthropogenic disturbance were evaluated. RESULTS: Some important features were listed in the regions visited, such as low urbanization, lack of public collection of sewage, limited garbage collection, vacant lots with tall vegetation, decaying organic matter, and, most importantly, the occurrence of stray dogs and poultry in homes. CONCLUSIONS: The methodology for screening the population was very efficient, especially in evaluating a large number of individuals in a short time, with a high degree of automation. The results indicate an association between the observed parameters and the occurrence of infection in dogs. The model presented in the city is ideal for studies of disease progression and expansion and for the evaluation of control measures adopted for canine VL.

Quantitative PCR is a Valuable Tool to Monitor the Performance of DNA-Encoded Chemical Library Selections.

Science.gov (United States)

Li, Yizhou; Zimmermann, Gunther; Scheuermann, Jörg; Neri, Dario

2017-05-04

Phage-display libraries and DNA-encoded chemical libraries (DECLs) represent useful tools for the isolation of specific binding molecules from large combinatorial sets of compounds. With both methods, specific binders are recovered at the end of affinity capture procedures by using target proteins of interest immobilized on a solid support. However, although the efficiency of phage-display selections is routinely quantified by counting the phage titer before and after the affinity capture step, no similar quantification procedures have been reported for the characterization of DECL selections. In this article, we describe the potential and limitations of quantitative PCR (qPCR) methods for the evaluation of selection efficiency by using a combinatorial chemical library with more than 35 million compounds. In the experimental conditions chosen for the selections, a quantification of DNA input/recovery over five orders of magnitude could be performed, revealing a successful enrichment of abundant binders, which could be confirmed by DNA sequencing. qPCR provided rapid information about the performance of selections, thus facilitating the optimization of experimental conditions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular characterization of sandflies and Leishmania detection in main vector of zoonotic cutaneous leishmaniasis in Abarkouh district of Yazd province, Iran.

Science.gov (United States)

Jafari, R; Najafzadeh, N; Sedaghat, M M; Parvizi, P

2013-10-01

To assess molecular characterization, distribution, seasonal activities of sandfly species and Leishmania parasites infecting them for this zoonotic cutaneous leishmaniasis focus. The collections were carried out in 2009-2011 using CDC traps, Sticky Papers and manual aspirator in and around the villages in Abarkouh district. Individual sandflies were characterized by PCR amplification and sequencing of fragments of their mitochondrial cytochrome b gene. Leishmania parasite infections within sandflies were performed by targeting Cyt b, ITS-rDNA, k-DNA and microsatellite genes. The PCR assays detected only Leishmania major (L. major). All infections (30) were found in the abundant and widespread vector Phlebotomus papatasi (P. papatasi). Small numbers of other sandfly species were also screened for infections, but none was found. Sergentomyia sintoni and P. papatasi were the predominant members in all locations of this district and in all habitats throughout the trapping season. Only five other sandfly species were found, namely Phlebotomus ansari, Phlebotomus caucasicus, Phlebotomus sergenti, Sergentomyia dentata and Sergentomyia merviney. In the current survey, the only infections detected are of L. major in females of P. papatasi (30 out of 190). The rates of infection of P. papatasi by L. major are not significantly different in compare with other locations in Iran with no diversity of parasite strains. Zoonotic cutaneous leishmaniasis may have emerged only recently in Abarkouh district, and the reason may well be the instability of the transmission cycles there. Copyright © 2013 Hainan Medical College. Published by Elsevier B.V. All rights reserved.

Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp.) Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B.

Science.gov (United States)

Chénard, Caroline; Wirth, Jennifer F; Suttle, Curtis A

2016-06-14

Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages. Filamentous cyanobacteria belonging to the genus Nostoc are widespread and ecologically important in freshwater, yet little is known about the genomic content of their viruses. Here we report the first genomic analysis of cyanophages infecting

Anti-Leishmania activity of new ruthenium(II) complexes: Effect on parasite-host interaction.

Science.gov (United States)

Costa, Mônica S; Gonçalves, Yasmim G; Nunes, Débora C O; Napolitano, Danielle R; Maia, Pedro I S; Rodrigues, Renata S; Rodrigues, Veridiana M; Von Poelhsitz, Gustavo; Yoneyama, Kelly A G

2017-10-01

Leishmaniasis is a parasitic disease caused by protozoa of the genus Leishmania. The many complications presented by the current treatment - including high toxicity, high cost and parasite resistance - make the development of new therapeutic agents indispensable. The present study aims to evaluate the anti-Leishmania potential of new ruthenium(II) complexes, cis‑[Ru II (η 2 -O 2 CR)(dppm) 2 ]PF 6 , with dppm=bis(diphenylphosphino)methane and R=4-butylbenzoate (bbato) 1, 4-(methylthio)benzoate (mtbato) 2 and 3-hydroxy-4-methoxybenzoate (hmxbato) 3, in promastigote cytotoxicity and their effect on parasite-host interaction. The cytotoxicity of complexes was analyzed by MTT assay against Leishmania (Leishmania) amazonensis, Leishmania (Viannia) braziliensis, Leishmania (Leishmania) infantum promastigotes and the murine macrophage (RAW 264.7). The effect of complexes on parasite-host interaction was evaluated by in vitro infectivity assay performed in the presence of two different concentrations of each complex: the promastigote IC 50 value and the concentration nontoxic to 90% of RAW 264.7 macrophages. Complexes 1-3 exhibited potent cytotoxic activity against all Leishmania species assayed. The IC 50 values ranged from 7.52-12.59μM (complex 1); 0.70-3.28μM (complex 2) and 0.52-1.75μM (complex 3). All complexes significantly inhibited the infectivity index at both tested concentrations. The infectivity inhibitions ranged from 37 to 85%. Interestingly, the infectivity inhibitions due to complex action did not differ significantly at either of the tested concentrations, except for the complex 1 against Leishmania (Leishmania) infantum. The infectivity inhibitions resulted from reductions in both percentage of infected macrophages and number of parasites per macrophage. Taken together the results suggest remarkable leishmanicidal activity in vitro by these new ruthenium(II) complexes. Copyright © 2017 Elsevier Inc. All rights reserved.

Development of a loop-mediated isothermal amplification method for rapid mass-screening of sand flies for Leishmania infection.

Science.gov (United States)

Nzelu, Chukwunonso O; Gomez, Eduardo A; Cáceres, Abraham G; Sakurai, Tatsuya; Martini-Robles, Luiggi; Uezato, Hiroshi; Mimori, Tatsuyuki; Katakura, Ken; Hashiguchi, Yoshihisa; Kato, Hirotomo

2014-04-01

Entomological monitoring of Leishmania infection in leishmaniasis endemic areas offers epidemiologic advantages for predicting the risk and expansion of the disease, as well as evaluation of the effectiveness of control programs. In this study, we developed a highly sensitive loop-mediated isothermal amplification (LAMP) method for the mass screening of sand flies for Leishmania infection based on the 18S rRNA gene. The LAMP technique could detect 0.01 parasites, which was more sensitive than classical PCR. The method was robust and could amplify the target DNA within 1h from a crude sand fly template without DNA purification. Amplicon detection could be accomplished by the newly developed colorimetric malachite green (MG)--mediated naked eye visualization. Pre-addition of MG to the LAMP reaction solution did not inhibit amplification efficiency. The field applicability of the colorimetric MG-based LAMP assay was demonstrated with 397 field-caught samples from the endemic areas of Ecuador and eight positive sand flies were detected. The robustness, superior sensitivity, and ability to produce better visual discriminatory reaction products than existing LAMP fluorescence and turbidity assays indicated the field potential usefulness of this new method for surveillance and epidemiological studies of leishmaniasis in developing countries. Copyright © 2013 Elsevier B.V. All rights reserved.

Efficacy of Recombinant Canine Distemper Virus Expressing Leishmania Antigen against Leishmania Challenge in Dogs.

Directory of Open Access Journals (Sweden)

Ryuichi Miura

Full Text Available Canine distemper virus (CDV vaccination confers long-term protection against CDV reinfection. To investigate the utility of CDV as a polyvalent vaccine vector for Leishmania, we generated recombinant CDVs, based on an avirulent Yanaka strain, that expressed Leishmania antigens: LACK, TSA, or LmSTI1 (rCDV-LACK, rCDV-TSA, and rCDV-LmSTI1, respectively. Dogs immunized with rCDV-LACK were protected against challenge with lethal doses of virulent CDV, in the same way as the parental Yanaka strain. To evaluate the protective effects of the recombinant CDVs against cutaneous leishmaniasis in dogs, dogs were immunized with one recombinant CDV or a cocktail of three recombinant CDVs, before intradermal challenge (in the ears with infective-stage promastigotes of Leishmania major. Unvaccinated dogs showed increased nodules with ulcer formation after 3 weeks, whereas dogs immunized with rCDV-LACK showed markedly smaller nodules without ulceration. Although the rCDV-TSA- and rCDV-LmSTI1-immunized dogs showed little protection against L. major, the cocktail of three recombinant CDVs more effectively suppressed the progression of nodule formation than immunization with rCDV-LACK alone. These results indicate that recombinant CDV is suitable for use as a polyvalent live attenuated vaccine for protection against both CDV and L. major infections in dogs.

ENCODE: A Sourcebook of Epigenomes and Chromatin Language

Directory of Open Access Journals (Sweden)

Maryam Yavartanoo

2013-03-01

Full Text Available Until recently, since the Human Genome Project, the general view has been that the majority of the human genome is composed of junk DNA and has little or no selective advantage to the organism. Now we know that this conclusion is an oversimplification. In April 2003, the National Human Genome Research Institute (NHGRI launched an international research consortium called Encyclopedia of DNA Elements (ENCODE to uncover non-coding functional elements in the human genome. The result of this project has identified a set of new DNA regulatory elements, based on novel relationships among chromatin accessibility, histone modifications, nucleosome positioning, DNA methylation, transcription, and the occupancy of sequence-specific factors. The project gives us new insights into the organization and regulation of the human genome and epigenome. Here, we sought to summarize particular aspects of the ENCODE project and highlight the features and data that have recently been released. At the end of this review, we have summarized a case study we conducted using the ENCODE epigenome data.

Assessment of a DNA vaccine encoding an anchored-glycosylphosphatidylinositol tegumental antigen complexed to protamine sulphate on immunoprotection against murine schistosomiasis

Directory of Open Access Journals (Sweden)

Eduardo JM Nascimento

2007-02-01

Full Text Available Protamine sulphate/DNA complexes have been shown to protect DNA from DNase digestion in a lipid system for gene transfer. A DNA-based vaccine complexed to protamine sulphate was used to induce an immune response against Schistosoma mansoni anchored-glycosylphosphatidylinositol tegumental antigen in BALB/c mice. The protection elicited ranged from 33 to 44%. The spectrum of the elicited immune response induced by the vaccine formulation without protamine was characterized by a high level of IgG (IgG1> IgG2a. Protamine sulphate added to the DNA vaccine formulation retained the green fluorescent protein encoding-plasmid longer in muscle and spleen. The experiments in vivo showed that under protamine sulphate effect, the scope of protection remained unchanged, but a modulation in antibody production (IgG1= IgG2a was observed.

Sand fly captures with Disney traps in area of occurrence of Leishmania (Leishmania amazonensis in the state of Mato Grosso do Sul, mid-western Brazil Capturas de flebotomíneos com armadilhas de Disney em área de ocorrência de Leishmania (Leishmania amazonensis no estado de Mato Grosso do Sul, região Centro-Oeste do Brasil

Directory of Open Access Journals (Sweden)

Maria Elizabeth Cavalheiros Dorval

2010-10-01

Full Text Available INTRODUCTION: The work was conducted to study phlebotomine fauna (Diptera: Psychodidae and aspects of American cutaneous leishmaniasis transmission in a forested area where Leishmania (Leishmania amazonensis occurs, situated in the municipality of Bela Vista, State of Mato Grosso do Sul, Brazil. METHODS: The captures were conducted with modified Disney traps, using hamster (Mesocricetus auratus as bait, from May 2004 to January 2006. RESULTS: Ten species of phlebotomine sandflies were captured: Brumptomyia avellari, Brumptomyia brumpti, Bichromomyia flaviscutellata, Evandromyia bourrouli, Evandromyia lenti, Lutzomyia longipalpis, Psathyromyia campograndensis, Psathyromyia punctigeniculata, Psathyromyia shannoni and Sciopemyia sordellii. The two predominant species were Ev bourrouli (57.3% and Bi flaviscutellata (41.4%, present at all sampling sites. Two of the 36 hamsters used as bait presented natural infection with Leishmania. The parasite was identified as Leishmania (Leishmania amazonensis. CONCLUSIONS: Analysis of the results revealed the efficiency of Disney traps for capturing Bichromomyia flaviscutellata and the simultaneous presence of both vector and the Leishmania species transmitted by the same can be considered a predictive factor of the occurrence of leishmaniasis outbreaks for the human population that occupies the location.INTRODUÇÃO: O estudo foi realizado com o objetivo de estudar a fauna de flebotomíneos (Diptera: Psychodidae e aspectos ligados à transmissão da leishmaniose tegumentar americana em uma área florestal com ocorrência de Leishmania (Leishmania amazonensis, situada no município de Bela Vista, Estado do Mato Grosso do Sul, Brasil. MÉTODOS: As capturas de flebotomíneos foram realizadas utilizando-se armadilhas tipo Disney modificadas, com isca roedor, Mesocricetus auratus, no período de maio de 2004 a janeiro de 2006. RESULTADOS: As coletas resultaram na identificação de 10 espécies de Phlebotominae

RIPK1 and PGAM5 Control Leishmania Replication through Distinct Mechanisms.

Science.gov (United States)

Farias Luz, Nivea; Balaji, Sakthi; Okuda, Kendi; Barreto, Aline Silva; Bertin, John; Gough, Peter J; Gazzinelli, Ricardo; Almeida, Roque P; Bozza, Marcelo T; Borges, Valeria M; Chan, Francis Ka-Ming

2016-06-15

Leishmaniasis is an important parasitic disease found in the tropics and subtropics. Cutaneous and visceral leishmaniasis affect an estimated 1.5 million people worldwide. Despite its human health relevance, relatively little is known about the cell death pathways that control Leishmania replication in the host. Necroptosis is a recently identified form of cell death with potent antiviral effects. Receptor interacting protein kinase 1 (RIPK1) is a critical kinase that mediates necroptosis downstream of death receptors and TLRs. Heme, a product of hemoglobin catabolism during certain intracellular pathogen infections, is also a potent inducer of macrophage necroptosis. We found that human visceral leishmaniasis patients exhibit elevated serum levels of heme. Therefore, we examined the impact of heme and necroptosis on Leishmania replication. Indeed, heme potently inhibited Leishmania replication in bone marrow-derived macrophages. Moreover, we found that inhibition of RIPK1 kinase activity also enhanced parasite replication in the absence of heme. We further found that the mitochondrial phosphatase phosphoglycerate mutase family member 5 (PGAM5), a putative downstream effector of RIPK1, was also required for inhibition of Leishmania replication. In mouse infection, both PGAM5 and RIPK1 kinase activity are required for IL-1β expression in response to Leishmania However, PGAM5, but not RIPK1 kinase activity, was directly responsible for Leishmania-induced IL-1β secretion and NO production in bone marrow-derived macrophages. Collectively, these results revealed that RIPK1 and PGAM5 function independently to exert optimal control of Leishmania replication in the host. Copyright © 2016 by The American Association of Immunologists, Inc.

Prioritizing multiple therapeutic targets in parallel using automated DNA-encoded library screening

Science.gov (United States)

Machutta, Carl A.; Kollmann, Christopher S.; Lind, Kenneth E.; Bai, Xiaopeng; Chan, Pan F.; Huang, Jianzhong; Ballell, Lluis; Belyanskaya, Svetlana; Besra, Gurdyal S.; Barros-Aguirre, David; Bates, Robert H.; Centrella, Paolo A.; Chang, Sandy S.; Chai, Jing; Choudhry, Anthony E.; Coffin, Aaron; Davie, Christopher P.; Deng, Hongfeng; Deng, Jianghe; Ding, Yun; Dodson, Jason W.; Fosbenner, David T.; Gao, Enoch N.; Graham, Taylor L.; Graybill, Todd L.; Ingraham, Karen; Johnson, Walter P.; King, Bryan W.; Kwiatkowski, Christopher R.; Lelièvre, Joël; Li, Yue; Liu, Xiaorong; Lu, Quinn; Lehr, Ruth; Mendoza-Losana, Alfonso; Martin, John; McCloskey, Lynn; McCormick, Patti; O'Keefe, Heather P.; O'Keeffe, Thomas; Pao, Christina; Phelps, Christopher B.; Qi, Hongwei; Rafferty, Keith; Scavello, Genaro S.; Steiginga, Matt S.; Sundersingh, Flora S.; Sweitzer, Sharon M.; Szewczuk, Lawrence M.; Taylor, Amy; Toh, May Fern; Wang, Juan; Wang, Minghui; Wilkins, Devan J.; Xia, Bing; Yao, Gang; Zhang, Jean; Zhou, Jingye; Donahue, Christine P.; Messer, Jeffrey A.; Holmes, David; Arico-Muendel, Christopher C.; Pope, Andrew J.; Gross, Jeffrey W.; Evindar, Ghotas

2017-07-01

The identification and prioritization of chemically tractable therapeutic targets is a significant challenge in the discovery of new medicines. We have developed a novel method that rapidly screens multiple proteins in parallel using DNA-encoded library technology (ELT). Initial efforts were focused on the efficient discovery of antibacterial leads against 119 targets from Acinetobacter baumannii and Staphylococcus aureus. The success of this effort led to the hypothesis that the relative number of ELT binders alone could be used to assess the ligandability of large sets of proteins. This concept was further explored by screening 42 targets from Mycobacterium tuberculosis. Active chemical series for six targets from our initial effort as well as three chemotypes for DHFR from M. tuberculosis are reported. The findings demonstrate that parallel ELT selections can be used to assess ligandability and highlight opportunities for successful lead and tool discovery.

A Historical Overview of the Classification, Evolution, and Dispersion of Leishmania Parasites and Sandflies.

Directory of Open Access Journals (Sweden)

Mohammad Akhoundi

2016-03-01

Full Text Available The aim of this study is to describe the major evolutionary historical events among Leishmania, sandflies, and the associated animal reservoirs in detail, in accordance with the geographical evolution of the Earth, which has not been previously discussed on a large scale.Leishmania and sandfly classification has always been a controversial matter, and the increasing number of species currently described further complicates this issue. Despite several hypotheses on the origin, evolution, and distribution of Leishmania and sandflies in the Old and New World, no consistent agreement exists regarding dissemination of the actors that play roles in leishmaniasis. For this purpose, we present here three centuries of research on sandflies and Leishmania descriptions, as well as a complete description of Leishmania and sandfly fossils and the emergence date of each Leishmania and sandfly group during different geographical periods, from 550 million years ago until now. We discuss critically the different approaches that were used for Leishmana and sandfly classification and their synonymies, proposing an updated classification for each species of Leishmania and sandfly. We update information on the current distribution and dispersion of different species of Leishmania (53, sandflies (more than 800 at genus or subgenus level, and animal reservoirs in each of the following geographical ecozones: Palearctic, Nearctic, Neotropic, Afrotropical, Oriental, Malagasy, and Australian. We propose an updated list of the potential and proven sandfly vectors for each Leishmania species in the Old and New World. Finally, we address a classical question about digenetic Leishmania evolution: which was the first host, a vertebrate or an invertebrate?We propose an updated view of events that have played important roles in the geographical dispersion of sandflies, in relation to both the Leishmania species they transmit and the animal reservoirs of the parasites.

A Historical Overview of the Classification, Evolution, and Dispersion of Leishmania Parasites and Sandflies

Science.gov (United States)

Akhoundi, Mohammad; Kuhls, Katrin; Cannet, Arnaud; Votýpka, Jan; Marty, Pierre; Delaunay, Pascal; Sereno, Denis

2016-01-01

Background The aim of this study is to describe the major evolutionary historical events among Leishmania, sandflies, and the associated animal reservoirs in detail, in accordance with the geographical evolution of the Earth, which has not been previously discussed on a large scale. Methodology and Principal Findings Leishmania and sandfly classification has always been a controversial matter, and the increasing number of species currently described further complicates this issue. Despite several hypotheses on the origin, evolution, and distribution of Leishmania and sandflies in the Old and New World, no consistent agreement exists regarding dissemination of the actors that play roles in leishmaniasis. For this purpose, we present here three centuries of research on sandflies and Leishmania descriptions, as well as a complete description of Leishmania and sandfly fossils and the emergence date of each Leishmania and sandfly group during different geographical periods, from 550 million years ago until now. We discuss critically the different approaches that were used for Leishmana and sandfly classification and their synonymies, proposing an updated classification for each species of Leishmania and sandfly. We update information on the current distribution and dispersion of different species of Leishmania (53), sandflies (more than 800 at genus or subgenus level), and animal reservoirs in each of the following geographical ecozones: Palearctic, Nearctic, Neotropic, Afrotropical, Oriental, Malagasy, and Australian. We propose an updated list of the potential and proven sandfly vectors for each Leishmania species in the Old and New World. Finally, we address a classical question about digenetic Leishmania evolution: which was the first host, a vertebrate or an invertebrate? Conclusions and Significance We propose an updated view of events that have played important roles in the geographical dispersion of sandflies, in relation to both the Leishmania species they

A Historical Overview of the Classification, Evolution, and Dispersion of Leishmania Parasites and Sandflies.

Science.gov (United States)

Akhoundi, Mohammad; Kuhls, Katrin; Cannet, Arnaud; Votýpka, Jan; Marty, Pierre; Delaunay, Pascal; Sereno, Denis

2016-03-01

The aim of this study is to describe the major evolutionary historical events among Leishmania, sandflies, and the associated animal reservoirs in detail, in accordance with the geographical evolution of the Earth, which has not been previously discussed on a large scale. Leishmania and sandfly classification has always been a controversial matter, and the increasing number of species currently described further complicates this issue. Despite several hypotheses on the origin, evolution, and distribution of Leishmania and sandflies in the Old and New World, no consistent agreement exists regarding dissemination of the actors that play roles in leishmaniasis. For this purpose, we present here three centuries of research on sandflies and Leishmania descriptions, as well as a complete description of Leishmania and sandfly fossils and the emergence date of each Leishmania and sandfly group during different geographical periods, from 550 million years ago until now. We discuss critically the different approaches that were used for Leishmana and sandfly classification and their synonymies, proposing an updated classification for each species of Leishmania and sandfly. We update information on the current distribution and dispersion of different species of Leishmania (53), sandflies (more than 800 at genus or subgenus level), and animal reservoirs in each of the following geographical ecozones: Palearctic, Nearctic, Neotropic, Afrotropical, Oriental, Malagasy, and Australian. We propose an updated list of the potential and proven sandfly vectors for each Leishmania species in the Old and New World. Finally, we address a classical question about digenetic Leishmania evolution: which was the first host, a vertebrate or an invertebrate? We propose an updated view of events that have played important roles in the geographical dispersion of sandflies, in relation to both the Leishmania species they transmit and the animal reservoirs of the parasites.

Neutrophils reduce the parasite burden in Leishmania (Leishmania amazonensis-infected macrophages.

Directory of Open Access Journals (Sweden)

Erico Vinícius de Souza Carmo

2010-11-01

Full Text Available Studies on the role of neutrophils in Leishmania infection were mainly performed with L. (L major, whereas less information is available for L. (L amazonensis. Previous results from our laboratory showed a large infiltrate of neutrophils in the site of infection in a mouse strain resistant to L. (L. amazonensis (C3H/HePas. In contrast, the susceptible strain (BALB/c displayed a predominance of macrophages harboring a high number of amastigotes and very few neutrophils. These findings led us to investigate the interaction of inflammatory neutrophils with L. (L. amazonensis-infected macrophages in vitro.Mouse peritoneal macrophages infected with L. (L. amazonensis were co-cultured with inflammatory neutrophils, and after four days, the infection was quantified microscopically. Data are representative of three experiments with similar results. The main findings were 1 intracellular parasites were efficiently destroyed in the co-cultures; 2 the leishmanicidal effect was similar when cells were obtained from mouse strains resistant (C3H/HePas or susceptible (BALB/c to L. (L. amazonensis; 3 parasite destruction did not require contact between infected macrophages and neutrophils; 4 tumor necrosis factor alpha (TNF-α, neutrophil elastase and platelet activating factor (PAF were involved with the leishmanicidal activity, and 5 destruction of the parasites did not depend on generation of oxygen or nitrogen radicals, indicating that parasite clearance did not involve the classical pathway of macrophage activation by TNF-α, as reported for other Leishmania species.The present results provide evidence that neutrophils in concert with macrophages play a previously unrecognized leishmanicidal effect on L. (L. amazonensis. We believe these findings may help to understand the mechanisms involved in innate immunity in cutaneous infection by this Leishmania species.

The mating competence of geographically diverse Leishmania major strains in their natural and unnatural sand fly vectors.

Science.gov (United States)

Inbar, Ehud; Akopyants, Natalia S; Charmoy, Melanie; Romano, Audrey; Lawyer, Phillip; Elnaiem, Dia-Eldin A; Kauffmann, Florence; Barhoumi, Mourad; Grigg, Michael; Owens, Katherine; Fay, Michael; Dobson, Deborah E; Shaik, Jahangheer; Beverley, Stephen M; Sacks, David

2013-01-01

Invertebrate stages of Leishmania are capable of genetic exchange during their extracellular growth and development in the sand fly vector. Here we explore two variables: the ability of diverse L. major strains from across its natural range to undergo mating in pairwise tests; and the timing of the appearance of hybrids and their developmental stage associations within both natural (Phlebotomus duboscqi) and unnatural (Lutzomyia longipalpis) sand fly vectors. Following co-infection of flies with parental lines bearing independent drug markers, doubly-drug resistant hybrid progeny were selected, from which 96 clonal lines were analyzed for DNA content and genotyped for parent alleles at 4-6 unlinked nuclear loci as well as the maxicircle DNA. As seen previously, the majority of hybrids showed '2n' DNA contents, but with a significant number of '3n' and one '4n' offspring. In the natural vector, 97% of the nuclear loci showed both parental alleles; however, 3% (4/150) showed only one parental allele. In the unnatural vector, the frequency of uniparental inheritance rose to 10% (27/275). We attribute this to loss of heterozygosity after mating, most likely arising from aneuploidy which is both common and temporally variable in Leishmania. As seen previously, only uniparental inheritance of maxicircle kDNA was observed. Hybrids were recovered at similar efficiencies in all pairwise crosses tested, suggesting that L. major lacks detectable 'mating types' that limit free genetic exchange. In the natural vector, comparisons of the timing of hybrid formation with the presence of developmental stages suggest nectomonads as the most likely sexually competent stage, with hybrids emerging well before the first appearance of metacyclic promastigotes. These studies provide an important perspective on the prevalence of genetic exchange in natural populations of L. major and a guide for experimental studies to understand the biology of mating.

Impact of phlebotomine sand flies on U.S. military operations at Tallil Air Base, Iraq: 4. Detection and identification of leishmania parasites in sand flies.

Science.gov (United States)

Coleman, Russell E; Hochberg, Lisa P; Swanson, Katherine I; Lee, John S; McAvin, James C; Moulton, John K; Eddington, David O; Groebner, Jennifer L; O'Guinn, Monica L; Putnam, John L

2009-05-01

Sand flies collected between April 2003 and November 2004 at Tallil Air Base, Iraq, were evaluated for the presence of Leishmania parasites using a combination of a real-time Leishmania-generic polymerase chain reaction (PCR) assay and sequencing of a 360-bp fragment of the glucose-6-phosphate-isomerase (GPI) gene. A total of 2,505 pools containing 26,574 sand flies were tested using the real-time PCR assay. Leishmania DNA was initially detected in 536 pools; however, after extensive retesting with the real-time PCR assay, a total of 456 pools were considered positive and 80 were considered indeterminate. A total of 532 samples were evaluated for Leishmania GPI by sequencing, to include 439 PCR-positive samples, 80 PCR-indeterminate samples, and 13 PCR-negative samples. Leishmania GPI was detected in 284 samples that were sequenced, to include 281 (64%) of the PCR-positive samples and 3 (4%) of the PCR-indeterminate samples. Of the 284 sequences identified as Leishmania, 261 (91.9%) were L. tarentolae, 18 (6.3%) were L. donovani-complex parasites, 3 (1.1%) were L. tropica, and 2 were similar to both L. major and L. tropica. Minimum field infection rates were 0.09% for L. donovani-complex parasites, 0.02% for L. tropica, and 0.01% for the L. major/tropica-like parasite. Subsequent sequencing of a 600-bp region of the "Hyper" gene of 12 of the L. donovani-complex parasites showed that all 12 parasites were L. infantum. These data suggest that L. infantum was the primary leishmanial threat to U.S. military personnel deployed to Tallil Air Base. The implications of these findings are discussed.

immune response in human leishmania infections Respuesta inmune en infecciones humanas por Leishmania spp

Directory of Open Access Journals (Sweden)

Sara María Robledo Restrepo

2000-03-01

Full Text Available This review summarizes relevant information about the immune response triggered during leishmaniosis, a disease of great importance from the epidemiological point of view, since it is endemic in Colombia and other countries. We emphasize on human leishmaniosis; nevertheless, some important findings in the murine model are also mentioned. This information allows to conclude that Leishmania infection is a complex and coordinated process, which includes adhesion and entrance of the parasite into the host cells and its survival inside them. Events that mediate the infection process may influence its result in terms of elimination of the parasite or development of the disease, through induction or not of an effective specific immune response which involves host cell activation and parasite destruction. La presente revisión tiene como objetivo resumir la información más relevante acerca de la respuesta inmune que se desencadena durante la leishmaniosis, una enfermedad de gran importancia desde el punto de vista epidemiológico dado que es endémica en Colombia y otros países. Aunque la respuesta inmune en la leishmaniosis es un tema que se ha estudiado ampliamente en las infecciones por especies de Leishmania del Viejo Mundo, particularmente Leishmania major y Leishmania donovani y en el modelo murino, la presente revisión hace énfasis en la leishmaniosis humana. Algunos hallazgos importantes en el modelo murino también se mencionan. La información contenida en la revisión, en su mayoría, proviene de publicaciones derivadas de investigaciones, las cuales se seleccionaron con base en la calidad del trabajo realizado y en los aportes de sus resultados en el avance del conocimiento sobre las infecciones en humanos. La síntesis de la información seleccionada nos permite concluir que la infección por Leishmania es un proceso complejo y coordinado que incluye la adherencia y entrada del parásito a la célula hospedera y su posterior

Bacteriophage T5 encodes a homolog of the eukaryotic transcription coactivator PC4 implicated in recombination-dependent DNA replication.

Science.gov (United States)

Steigemann, Birthe; Schulz, Annina; Werten, Sebastiaan

2013-11-15

The RNA polymerase II cofactor PC4 globally regulates transcription of protein-encoding genes through interactions with unwinding DNA, the basal transcription machinery and transcription activators. Here, we report the surprising identification of PC4 homologs in all sequenced representatives of the T5 family of bacteriophages, as well as in an archaeon and seven phyla of eubacteria. We have solved the crystal structure of the full-length T5 protein at 1.9Å, revealing a striking resemblance to the characteristic single-stranded DNA (ssDNA)-binding core domain of PC4. Intriguing novel structural features include a potential regulatory region at the N-terminus and a C-terminal extension of the homodimerisation interface. The genome organisation of T5-related bacteriophages points at involvement of the PC4 homolog in recombination-dependent DNA replication, strongly suggesting that the protein corresponds to the hitherto elusive replicative ssDNA-binding protein of the T5 family. Our findings imply that PC4-like factors intervene in multiple unwinding-related processes by acting as versatile modifiers of nucleic acid conformation and raise the possibility that the eukaryotic transcription coactivator derives from ancestral DNA replication, recombination and repair factors. © 2013.

scsB, a cDNA encoding the hydrogenosomal beta subunit of succinyl-CoA synthetase from the anaerobic fungus Neocallimastix frontalis

NARCIS (Netherlands)

Brondijk, THC; Durand, R; vanderGiezen, M; Gottschal, JC; Prins, RA; Fevre, M

1996-01-01

A clone containing a Neocallimastix frontalis cDNA assumed to encode the beta subunit of succinyl-CoA synthetase (SCSB) was identified by sequence homology with prokaryotic and eukaryotic counterparts. An open reading frame of 1311 bp was found. The deduced 437 amino acid sequence showed a high

Innate Immunity to Leishmania Infection: Within Phagocytes

Directory of Open Access Journals (Sweden)

Marcela Freitas Lopes

2014-01-01

Full Text Available Infection by Leishmania takes place in the context of inflammation and tissue repair. Besides tissue resident macrophages, inflammatory macrophages and neutrophils are recruited to the infection site and serve both as host cells and as effectors against infection. Recent studies suggest additional important roles for monocytes and dendritic cells. This paper addresses recent experimental findings regarding the regulation of Leishmania major infection by these major phagocyte populations. In addition, the role of IL-4 on dendritic cells and monocytes is discussed.

Infection by Leishmania spp. in Free-Ranging Opossums (Didelphis albiventris) in an Environmentally Protected Area Inhabited by Humans in Southeastern Brazil.

Science.gov (United States)

Paiz, Laís Moraes; Donalisio, Maria Rita; Richini-Pereira, Virgínia Bodelão; Motoie, Gabriela; Castagna, Claudio Luiz; Tolezano, José Eduardo

2016-11-01

There is a growing concern about the participation of wild hosts and reservoirs in the epidemiology of leishmaniasis, particularly within the context of increasingly frequent environmental changes and the expansion of the One Health concept. This work is a molecular research of infection by Leishmania spp. among the wildlife of an environmentally protected area located in the municipality of Campinas, São Paulo, Brazil. The studied area has a history of intense environmental changes, with notifications of human cases of cutaneous leishmaniasis in the 1990s, and a focus of canine visceral leishmaniasis since 2009. Eighty-two wild mammals were sampled by monthly captures in this region over a 1-year period. Blood samples were collected from each animal and subjected to DNA extraction and PCR using primers for the region of the internal transcribed spacer-1. The results of gene sequencing for the first time revealed the infection of opossums (Didelphis albiventris) by Leishmania spp., subgenera Leishmania and Viannia, in Campinas. These findings, in addition to environmental and historical characteristics of the studied area, indicate a possible role of wildlife in the introduction and/or maintenance of natural foci of leishmaniasis transmission.

Safety and immunogenicity of a novel therapeutic DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

Science.gov (United States)

Juan, Long; Xiao, Zhao; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

2015-01-01

Current clinically available treatments for rheumatoid arthritis (RA) fail to cure the disease or unsatisfactorily halt disease progression. To overcome these limitations, the development of therapeutic DNA vaccines and boosters may offer new promising strategies. Because type II collagen (CII) as a critical autoantigen in RA and native chicken type II collagen (nCCII) has been used to effectively treat RA, we previously developed a novel therapeutic DNA vaccine encoding CCII (pcDNA-CCOL2A1) with efficacy comparable to that of the current "gold standard", methotrexate(MTX). Here, we systemically evaluated the safety and immunogenicity of the pcDNA-CCOL2A1 vaccine in normal Wistar rats. Group 1 received only a single intramuscular injection into the hind leg with pcDNA-CCOL2A1 at the maximum dosage of 3 mg/kg on day 0; Group 2 was injected with normal saline (NS) as a negative control. All rats were monitored daily for any systemic adverse events, reactions at the injection site, and changes in body weights. Plasma and tissues from all experimental rats were collected on day 14 for routine examinations of hematology and biochemistry parameters, anti-CII IgG antibody reactivity, and histopathology. Our results indicated clearly that at the maximum dosage of 3 mg/kg, the pcDNA-CCOL2A1 vaccine was safe and well-tolerated. No abnormal clinical signs or deaths occurred in the pcDNA-CCOL2A1 group compared with the NS group. Furthermore, no major alterations were observed in hematology, biochemistry, and histopathology, even at the maximum dose. In particularly, no anti-CII IgG antibodies were detected in vaccinated normal rats at 14 d after vaccination; this was relevant because we previously demonstrated that the pcDNA-CCOL2A1 vaccine, when administered at the therapeutic dosage of 300 μg/kg alone, did not induce anti-CII IgG antibody production and significantly reduced levels of anti-CII IgG antibodies in the plasma of rats with established collagen-induced arthritis

LeishCyc: a biochemical pathways database for Leishmania major

Directory of Open Access Journals (Sweden)

Doyle Maria A

2009-06-01

Full Text Available Abstract Background Leishmania spp. are sandfly transmitted protozoan parasites that cause a spectrum of diseases in more than 12 million people worldwide. Much research is now focusing on how these parasites adapt to the distinct nutrient environments they encounter in the digestive tract of the sandfly vector and the phagolysosome compartment of mammalian macrophages. While data mining and annotation of the genomes of three Leishmania species has provided an initial inventory of predicted metabolic components and associated pathways, resources for integrating this information into metabolic networks and incorporating data from transcript, protein, and metabolite profiling studies is currently lacking. The development of a reliable, expertly curated, and widely available model of Leishmania metabolic networks is required to facilitate systems analysis, as well as discovery and prioritization of new drug targets for this important human pathogen. Description The LeishCyc database was initially built from the genome sequence of Leishmania major (v5.2, based on the annotation published by the Wellcome Trust Sanger Institute. LeishCyc was manually curated to remove errors, correct automated predictions, and add information from the literature. The ongoing curation is based on public sources, literature searches, and our own experimental and bioinformatics studies. In a number of instances we have improved on the original genome annotation, and, in some ambiguous cases, collected relevant information from the literature in order to help clarify gene or protein annotation in the future. All genes in LeishCyc are linked to the corresponding entry in GeneDB (Wellcome Trust Sanger Institute. Conclusion The LeishCyc database describes Leishmania major genes, gene products, metabolites, their relationships and biochemical organization into metabolic pathways. LeishCyc provides a systematic approach to organizing the evolving information about Leishmania

Leishmania serology in the diagnosis of cutaneous leishmaniasis

International Nuclear Information System (INIS)

Mashood, A.H.; Malik, N.; Abbasi, S.

2013-01-01

Background: The gold standard to diagnose cutaneous leishmaniasis is histopathology, but there has always been a need of a rapid, reliable, cheap and convenient laboratory investigation. Serological tests fulfill the above criteria. Objective: The objective of the study was to determine the sensitivity and specificity of enzyme linked immunosorbent assay (ELISA) in detection of leishmania antibodies, in comparison with the histopathology. Place and duration of study: The study was conducted in Military Hospital Rawalpindi from 1st November 2010 to 30th June 2011. Patients and methods: The study population included the patients who were clinically diagnosed with cutaneous leishmaniasis. All of them were biopsied and serum was sent for leishmania serology. Results: A total of 47 patients were included. They were all adult males. The histopathology was positive in 31/47 patients (65.95%), while the leishmania serology was positive in 36/47 cases (76.59%). The sensitiuites was 74.19%, specificity was 18.75%, positive predictive value has 63.88%, negative predicative value was 27% and accuracy was 55%. Conclusion: In the light of sensitivity analysis, it may be concluded that leishmania serology has moderate sensitivity and low specificity; hence it is not a reliable test for cutaneous leishmaniasis. (author)

Identification of geographically distributed sub-populations of Leishmania (Leishmania major by microsatellite analysis

Directory of Open Access Journals (Sweden)

Schwenkenbecher Jan

2008-06-01

Full Text Available Abstract Background Leishmania (Leishmania major, one of the agents causing cutaneous leishmaniasis (CL in humans, is widely distributed in the Old World where different species of wild rodent and phlebotomine sand fly serve as animal reservoir hosts and vectors, respectively. Despite this, strains of L. (L. major isolated from many different sources over many years have proved to be relatively uniform. To investigate the population structure of the species highly polymorphic microsatellite markers were employed for greater discrimination among it's otherwise closely related strains, an approach applied successfully to other species of Leishmania. Results Multilocus Microsatellite Typing (MLMT based on 10 different microsatellite markers was applied to 106 strains of L. (L. major from different regions where it is endemic. On applying a Bayesian model-based approach, three main populations were identified, corresponding to three separate geographical regions: Central Asia (CA; the Middle East (ME; and Africa (AF. This was congruent with phylogenetic reconstructions based on genetic distances. Re-analysis separated each of the populations into two sub-populations. The two African sub-populations did not correlate well with strains' geographical origin. Strains falling into the sub-populations CA and ME did mostly group according to their place of isolation although some anomalies were seen, probably, owing to human migration. Conclusion The model- and distance-based analyses of the microsatellite data exposed three main populations of L. (L. major, Central Asia, the Middle East and Africa, each of which separated into two sub-populations. This probably correlates with the different species of rodent host.

Unraveling the genetic diversity and phylogeny of Leishmania RNA virus 1 strains of infected Leishmania isolates circulating in French Guiana.

Science.gov (United States)

Tirera, Sourakhata; Ginouves, Marine; Donato, Damien; Caballero, Ignacio S; Bouchier, Christiane; Lavergne, Anne; Bourreau, Eliane; Mosnier, Emilie; Vantilcke, Vincent; Couppié, Pierre; Prevot, Ghislaine; Lacoste, Vincent

2017-07-01

Leishmania RNA virus type 1 (LRV1) is an endosymbiont of some Leishmania (Vianna) species in South America. Presence of LRV1 in parasites exacerbates disease severity in animal models and humans, related to a disproportioned innate immune response, and is correlated with drug treatment failures in humans. Although the virus was identified decades ago, its genomic diversity has been overlooked until now. We subjected LRV1 strains from 19 L. (V.) guyanensis and one L. (V.) braziliensis isolates obtained from cutaneous leishmaniasis samples identified throughout French Guiana with next-generation sequencing and de novo sequence assembly. We generated and analyzed 24 unique LRV1 sequences over their full-length coding regions. Multiple alignment of these new sequences revealed variability (0.5%-23.5%) across the entire sequence except for highly conserved motifs within the 5' untranslated region. Phylogenetic analyses showed that viral genomes of L. (V.) guyanensis grouped into five distinct clusters. They further showed a species-dependent clustering between viral genomes of L. (V.) guyanensis and L. (V.) braziliensis, confirming a long-term co-evolutionary history. Noteworthy, we identified cases of multiple LRV1 infections in three of the 20 Leishmania isolates. Here, we present the first-ever estimate of LRV1 genomic diversity that exists in Leishmania (V.) guyanensis parasites. Genetic characterization and phylogenetic analyses of these viruses has shed light on their evolutionary relationships. To our knowledge, this study is also the first to report cases of multiple LRV1 infections in some parasites. Finally, this work has made it possible to develop molecular tools for adequate identification and genotyping of LRV1 strains for diagnostic purposes. Given the suspected worsening role of LRV1 infection in the pathogenesis of human leishmaniasis, these data have a major impact from a clinical viewpoint and for the management of Leishmania-infected patients.

NKT cell activation by Leishmania mexicana LPG: Description of a novel pathway.

Science.gov (United States)

Zamora-Chimal, Jaime; Fernández-Figueroa, Edith A; Ruiz-Remigio, Adriana; Wilkins-Rodríguez, Arturo A; Delgado-Domínguez, José; Salaiza-Suazo, Norma; Gutiérrez-Kobeh, Laila; Becker, Ingeborg

2017-02-01

NKT cells have been associated with protection against Leishmania donovani, yet their role in infections with Leishmania mexicana has not been addressed, nor has the activation pathway been defined after stimulation with Leishmania mexicana lipophosphoglycan (LPG). We analyzed the activation of NKT cells and their cytokine production in response to Leishmania mexicana LPG. Additionally we compared NKT-cell numbers and cytokine profile in lymph nodes of skin lesions induced by Leishmania mexicana in BALB/c and C57BL/6 mice. We show that LPG activates NKT cells primarily through the indirect pathway, initiating with TLR2 stimulation of dendritic cells (DC), thereby enhancing TLR2, MHC II, and CD86 expressions and IL-12p70 production. This leads to IFN-γ production by NKT cells. C57BL/6 mice showed enhanced DC activation, which correlated with augmented IFN-γ production by NKT cells. Additionally, infected C57BL/6 mice showed elevated percentages of NKT cells with higher IFN-γ and IL-4 production in lymph nodes. We conclude that the response of NKT cells towards Leishmania mexicana LPG initiates with the indirect activation, after binding of LPG to TLR2 in DC. This indirect activation pathway enables NKT cells to produce IFN-γ during the innate phase of Leishmania infection, the magnitude of which differs between mouse strains. Copyright © 2016 The Authors. Published by Elsevier GmbH.. All rights reserved.

Dihydrotestosterone enhances growth and infectivity of Leishmania Mexicana.

Science.gov (United States)

Sánchez-García, L; Wilkins-Rodriguez, A; Salaiza-Suazo, N; Morales-Montor, J; Becker, I

2018-03-01

A strong sex-associated susceptibility towards Leishmania has been reported in males, yet little is known on the effect of hormones in Leishmania physiopathogenicity. Due to the enhanced susceptibility of males to Leishmania mexicana infections, we were interested in analysing the effect exerted by the main androgen produced in males (DHT) on L. mexicana promastigotes. Thus, the aim of this study was to assess the regulation exerted by dihydrotestosterone (DHT) on L. mexicana replication, infectivity, survival and development of tissue lesions. Experiments included growth curves of L. mexicana promastigotes incubated with different doses of DHT, their infection rate, intracellular survival and lesion development in BALB/c mice. Our data show that DHT significantly enhances parasite replication, infection rate and survival in bone marrow-derived macrophages (BMMФ). Promastigotes in the presence of DHT produced significantly larger lesions in BALB/c earlobes. These results suggest that DHT probably plays a critical role during L. mexicana infections, and the higher susceptibility of males possibly relates to benefits gained by the parasite from host-derived hormones. Our data shed new light on the physiopathology of Leishmania infections and are the first attempt to understand the direct interaction between Leishmania and androgens, particularly DHT. Understanding this trans-regulation process employed by parasites to exploit host molecules sheds new light on L. mexicana physiopathogenesis and opens a possible field for studies on drug development. © 2017 John Wiley & Sons Ltd.

The yeast Saccharomyces cerevisiae DNA polymerase IV: possible involvement in double strand break DNA repair.

OpenAIRE

Leem, S H; Ropp, P A; Sugino, A

1994-01-01

We identified and purified a new DNA polymerase (DNA polymerase IV), which is similar to mammalian DNA polymerase beta, from Saccharomyces cerevisiae and suggested that it is encoded by YCR14C (POLX) on chromosome III. Here, we provided a direct evidence that the purified DNA polymerase IV is indeed encoded by POLX. Strains harboring a pol4 deletion mutation exhibit neither mitotic growth defect nor a meiosis defect, suggesting that DNA polymerase IV participates in nonessential functions in ...

Editing and methylation at a single site by functionally interdependent activities

Czech Academy of Sciences Publication Activity Database

Rubio, M.A.T.; Gaston, K.W.; McKenney, K. M.; Fleming, I.M.C.; Paris, Zdeněk; Limbach, P.A.; Alfonzo, J. D.

2017-01-01

Roč. 542, č. 7642 (2017), s. 494-497 ISSN 0028-0836 R&D Projects: GA ČR GJ15-21450Y Institutional support: RVO:60077344 Keywords : encoded transfer-rnas * Leishmania tarentolae * Trypanosoma brucei * DNA deamination * anticodon loop * mitochondria * marsupials * discovery Subject RIV: EB - Genetics ; Molecular Biology OBOR OECD: Biochemistry and molecular biology Impact factor: 40.137, year: 2016

First description of Leishmania (Viannia) infection in Evandromyia saulensis, Pressatia sp. and Trichophoromyia auraensis (Psychodidae: Phlebotominae) in a transmission area of cutaneous leishmaniasis in Acre state, Amazon Basin, Brazil

Science.gov (United States)

de Araujo-Pereira, Thais; de Pita-Pereira, Daniela; Boité, Mariana Côrtes; Melo, Myllena; da Costa-Rego, Taiana Amancio; Fuzari, Andressa Alencastre; Brazil, Reginaldo Peçanha; Britto, Constança

2017-01-01

Studies on the sandfly fauna to evaluate natural infection indexes are still limited in the Brazilian Amazon, a region with an increasing incidence of cutaneous leishmaniasis. Here, by using a multiplex polymerase chain reaction directed to Leishmania kDNA and hybridisation, we were able to identify L. (Viannia) subgenus in 12 out of 173 sandflies captured in the municipality of Rio Branco, Acre state, revealing a positivity of 6.94%. By sequencing the Leishmania 234 bp-hsp70 amplified products from positive samples, infection by L. (V.) braziliensis was confirmed in five sandflies: one Evandromyia saulensis, three Trichophoromyia auraensis and one Pressatia sp. The finding of L. (Viannia) DNA in two Ev. saulensis corresponds to the first record of possible infection associated with this sandfly. Moreover, our study reveals for the first time in Brazil, Th. auraensis and Pressatia sp. infected by L. (Viannia) parasites. PMID:28076470

T-cell responses associated with resistance to Leishmania infection in individuals from endemic areas for Leishmania (Viannia braziliensis

Directory of Open Access Journals (Sweden)

Rita C Bittar

2007-08-01

Full Text Available Subclinical or asymptomatic infection is documented in individuals living in endemic areas for leishmaniasis suggesting that the development of an appropriate immune response can control parasite replication and maintain tissue integrity. A low morbidity indicates that intrinsic factors could favor resistance to Leishmania infection. Herein, leishmanial T-cell responses induced in subjects with low susceptibility to leishmaniasis as asymptomatic subjects were compared to those observed in cured cutaneous leishmaniasis (CCL patients, who controlled the disease after antimonial therapy. All of them have shown maintenance of specific long-term immune responses characterized by expansion of higher proportions of CD4+ as compared to CD8+ Leishmania reactive T-lymphocytes. Asymptomatic subjects had lower indexes of in vitro Leishmania induced lymphoproliferative responses and interferon-gamma (IFN-gamma production in comparison to CCL patients. On the other hand, interleukin (IL-10 production was much higher in asymptomatics than in CCL, while no differences in IL-5 levels were found. In conclusion, long lived T-cell responses achieved by asymptomatic individuals differed from those who had developed symptomatic leishmaniasis in terms of intensity of lymphocyte activation (proliferation or IFN-gamma and regulatory mechanisms (IL-10. The absence of the disease in asymptomatics could be explained by their intrinsic ability to create a balance between immunoregulatory (IL-10 and effector cytokines (IFN-gamma, leading to parasite destruction without producing skin tissue damage. The establishment of profiles of cell-mediated immune responses associated with resistance against Leishmania infection is likely to make new inroads into understanding the long-lived immune protection against the disease.

In vivo and in vitro phagocytosis of Leishmania (Leishmania) amazonensis promastigotes by B-1 cells.

Science.gov (United States)

Geraldo, M M; Costa, C R; Barbosa, F M C; Vivanco, B C; Gonzaga, W F K M; Novaes E Brito, R R; Popi, A F; Lopes, J D; Xander, P

2016-06-01

Leishmaniasis is caused by Leishmania parasites that infect several cell types. The promastigote stage of Leishmania is internalized by phagocytic cells and transformed into the obligate intracellular amastigote form. B-1 cells are a subpopulation of B cells that are able to differentiate in vitro and in vivo into mononuclear phagocyte-like cells with phagocytic properties. B-1 cells use several receptors for phagocytosis, such as the mannose receptor and third complement receptor. Leishmania binds to the same receptors on macrophages. In this study, we demonstrated that phagocytes derived from B-1 cells (B-1 CDP) were able to internalize promastigotes of L. (L.) amazonensis in vitro. The internalized promastigotes differentiated into amastigotes. Our results showed that the phagocytic index was higher in B-1 CDP compared to peritoneal macrophages and bone marrow-derived macrophages. The in vivo phagocytic ability of B-1 cells was also demonstrated. Parasites were detected inside purified B-1 cells after intraperitoneal infection with L. (L.) amazonensis promastigotes. Intraperitoneal stimulation with the parasites led to an increase in both IL-10 and TNF-α. These results highlight the importance of studying B-1 CDP cells as phagocytic cells that can participate and contribute to immunity to parasites. © 2016 John Wiley & Sons Ltd.

Functional Characterization of Monomeric GTPase Rab1 in the Secretory Pathway of Leishmania*

Science.gov (United States)

Bahl, Surbhi; Parashar, Smriti; Malhotra, Himanshu; Raje, Manoj; Mukhopadhyay, Amitabha

2015-01-01

Leishmania secretes a large number of its effectors to the extracellular milieu. However, regulation of the secretory pathway in Leishmania is not well characterized. Here, we report the cloning, expression, and characterization of the Rab1 homologue from Leishmania. We have found that LdRab1 localizes in Golgi in Leishmania. To understand the role of LdRab1 in the secretory pathway of Leishmania, we have generated transgenic parasites overexpressing GFP-LdRab1:WT, GFP-LdRab1:Q67L (a GTPase-deficient dominant positive mutant of Rab1), and GFP-LdRab1:S22N (a GDP-locked dominant negative mutant of Rab1). Surprisingly, our results have shown that overexpression of GFP-LdRab1:Q67L or GFP-LdRab1:S22N does not disrupt the trafficking and localization of hemoglobin receptor in Leishmania. To determine whether the Rab1-dependent secretory pathway is conserved in parasites, we have analyzed the role of LdRab1 in the secretion of secretory acid phosphatase and Ldgp63 in Leishmania. Our results have shown that overexpression of GFP-LdRab1:Q67L or GFP-LdRab1:S22N significantly inhibits the secretion of secretory acid phosphatase by Leishmania. We have also found that overexpression of GFP-LdRab1:Q67L or GFP-LdRab1:S22N retains RFP-Ldgp63 in Golgi and blocks the secretion of Ldgp63, whereas the trafficking of RFP-Ldgp63 in GFP-LdRab1:WT-expressing cells is unaltered in comparison with control cells. Taken together, our results have shown that the Rab1-regulated secretory pathway is well conserved, and hemoglobin receptor trafficking follows an Rab1-independent secretory pathway in Leishmania. PMID:26499792

Functional Characterization of Monomeric GTPase Rab1 in the Secretory Pathway of Leishmania.

Science.gov (United States)

Bahl, Surbhi; Parashar, Smriti; Malhotra, Himanshu; Raje, Manoj; Mukhopadhyay, Amitabha

2015-12-11

Leishmania secretes a large number of its effectors to the extracellular milieu. However, regulation of the secretory pathway in Leishmania is not well characterized. Here, we report the cloning, expression, and characterization of the Rab1 homologue from Leishmania. We have found that LdRab1 localizes in Golgi in Leishmania. To understand the role of LdRab1 in the secretory pathway of Leishmania, we have generated transgenic parasites overexpressing GFP-LdRab1:WT, GFP-LdRab1:Q67L (a GTPase-deficient dominant positive mutant of Rab1), and GFP-LdRab1:S22N (a GDP-locked dominant negative mutant of Rab1). Surprisingly, our results have shown that overexpression of GFP-LdRab1:Q67L or GFP-LdRab1:S22N does not disrupt the trafficking and localization of hemoglobin receptor in Leishmania. To determine whether the Rab1-dependent secretory pathway is conserved in parasites, we have analyzed the role of LdRab1 in the secretion of secretory acid phosphatase and Ldgp63 in Leishmania. Our results have shown that overexpression of GFP-LdRab1:Q67L or GFP-LdRab1:S22N significantly inhibits the secretion of secretory acid phosphatase by Leishmania. We have also found that overexpression of GFP-LdRab1:Q67L or GFP-LdRab1:S22N retains RFP-Ldgp63 in Golgi and blocks the secretion of Ldgp63, whereas the trafficking of RFP-Ldgp63 in GFP-LdRab1:WT-expressing cells is unaltered in comparison with control cells. Taken together, our results have shown that the Rab1-regulated secretory pathway is well conserved, and hemoglobin receptor trafficking follows an Rab1-independent secretory pathway in Leishmania. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

Identification of a secreted casein kinase 1 in Leishmania donovani: effect of protein over expression on parasite growth and virulence.

Directory of Open Access Journals (Sweden)

Mary Dan-Goor

Full Text Available Casein kinase 1 (CK1 plays an important role in eukaryotic signaling pathways, and their substrates include key regulatory proteins involved in cell differentiation, proliferation and chromosome segregation. The Leishmania genome encodes six potential CK1 isoforms, of which five have orthologs in other trypanosomatidae. Leishmania donovani CK1 isoform 4 (Ldck1.4, orthologous to LmjF27.1780 is unique to Leishmania and contains a putative secretion signal peptide. The full-length gene and three shorter constructs were cloned and expressed in E. coli as His-tag proteins. Only the full-length 62.3 kDa protein showed protein kinase activity indicating that the N-terminal and C-terminal domains are essential for protein activity. LdCK1.4-FLAG was stably over expressed in L. donovani, and shown by immunofluorescence to be localized primarily in the cytosol. Western blotting using anti-FLAG and anti-CK1.4 antibodies showed that this CK1 isoform is expressed and secreted by promastigotes. Over expression of LdCK1.4 had a significant effect on promastigote growth in culture with these parasites growing to higher cell densities than the control parasites (wild-type or Ld:luciferase, P<0.001. Analysis by flow cytometry showed a higher percentage, ∼4-5-fold, of virulent metacyclic promastigotes on day 3 among the LdCK1.4 parasites. Finally, parasites over expressing LdCK1.4 gave significantly higher infections of mouse peritoneal macrophages compared to wild-type parasites, 28.6% versus 6.3%, respectively (p = 0.0005. These results suggest that LdCK1.4 plays an important role in parasite survival and virulence. Further studies are needed to validate CK1.4 as a therapeutic target in Leishmania.

Preparation of live attenuated leishmania parasites by using laser technology

Science.gov (United States)

Hussain, Nabiha; Alkhouri, Hassan; Haddad, Shaden

2018-05-01

Leishmaniasis is a parasitic disease of humans, affecting the skin, mucosal and/or internal organs, caused by flagellate protozoa Leishmania of the Trypanosomatidae family. Leishmania would be one for which a vaccine could be developed with relative ease. Many studies mount an effective response that resolves the infection and confers solid immunity to reinfection and suggesting that infection may be a prerequisite for immunological memory. Genetically altered live attenuated parasites with controlled infectivity could achieve such immunological memory. Recent concepts include use of genetically modified live-attenuated Leishmania parasites, and proteomics approach for the search of a cross-protective leishmanial vaccine that would ideally protect against both cutaneous and visceral forms of the disease. No licensed vaccine is available till date against any form of leishmaniasis. The present study evaluated role of laser technology in development of a safe live Leishmania vaccine, a vaccine is a biological preparation that improves immunity to a particular disease, and is often made from weakened or killed forms of LPs. The parasite culture was expanded in RPMI 1640 medium with 10% fetal calf serum (FCS) and grown until stationary phase for experiments. 80 samples of leishmania promastigotes (Culture media of LPs) were exposed to Nd:YAG laser (wavelength 1064 nm, single spot or double) with different outputs powers (7w, 100 Hz, 99.03w/cm2, 0.99 J/cm2 and 8 w, 100 Hz, 113.18w/cm2 1.13J/cm2)) for suitable exposer times. The effect of semiconductor laser (wavelength 810 nm, 7w, 2000 Hz, 99.03w/cm2, 0.05 J/cm2) or (7 w, 500 Hz, 99.03 w/cm2, 0.2J/cm2) single spot or double with long exposure times. The viability of Leishmania parasites was measured using XTT method; viable parasites were decreased with long exposure times. XTT test referred both these wavelengths were effective in killing percentage of Leishmania promastigotes, the remaining were devoid flagellum that

Nerolidol, the main constituent of Piper aduncum essential oil, has anti-Leishmania braziliensis activity.

Science.gov (United States)

Ceole, Ligia Fernanda; Cardoso, Maria DAS Graças; Soares, Maurilio José

2017-08-01

Leishmania (Viannia) braziliensis is a protozoan that causes mucocutaneous leishmaniasis, which is an infectious disease that affects more than 12 million people worldwide. The available treatment is limited, has side-effects or is inefficient. In a search for alternative compounds of natural origin, we tested the microbicidal activity of Piper aduncum essential oil (PaEO) on this parasite. Our data showed that PaEO had an inhibitory effect on the growth of L. braziliensis promastigotes with an IC50/24 h=77·9 µg mL-1. The main constituent (nerolidol: 25·22%) presented a similar inhibitory effect (IC50/24 h = 74·3 µg mL-1). Ultrastructural observation of nerolidol-treated parasites by scanning and transmission electron microscopies revealed cell shrinkage and morphological alterations in the mitochondrion, nuclear chromatin and flagellar pocket. Flow cytometry analysis showed a reduction in the cell size, loss of mitochondrial membrane potential, phosphatidylserine exposure and DNA degradation, which when associated with the morphological changes indicated that nerolidol induced incidental cell death in the L. braziliensis promastigotes. The results presented here indicate that nerolidol derivatives are promising compounds for further evaluation against Leishmania parasites.

Molecular detection and identification of Leishmania infection in naturally infected sand flies in a focus of cutaneous leishmaniasis in northern Morocco.

Science.gov (United States)

Es-Sette, Nargys; Ajaoud, Malika; Laamrani-Idrissi, Abderrahman; Mellouki, Fouad; Lemrani, Meryem

2014-07-02

Cutaneous leishmaniasis is an infectious disease caused by various species of the flagellate protozoan Leishmania. During the past 20 years, cutaneous leishmaniasis has emerged as a major public health threat in Morocco. The main objective of this study was to study the occurrence of Leishmania infection in vectors and to identify sand fly blood meal sources in an endemic locality of cutaneous leishmaniasis within Sefrou province, where the vectors of leishmaniasis were still unknown. 2650 sand flies were collected using CDC miniature light traps and identified morphologically. The identified sand flies were tested for Leishmania infection by nested PCR. The source of blood meal of 10 freshly engorged females: 6 Phlebotomus longicuspis and 4 Phlebotomus sergenti, was determined using the Cyt b sequence. The collected sand flies consisted of 10 species, seven of which belonged to the genus Phlebotomus and three to the genus Sergentomyia. The most abundant species was P. longicuspis, accounting for 72% of the total sand flies collected. In females of three P. longicuspis and four P. sergenti, Leishmania infantum and Leishmania tropica DNA was detected, respectively.The source of blood meal of engorged females showed that all sand flies tested fed on humans. We report for the first time the natural infection of P. longicuspis with L. infantum in Morocco. The high frequency of this species in this region, in addition to its anthropophilic character make P. longicuspis the putative vector of L. infantum in this cutaneous leishmaniasis focus where L. tropica is confirmed as the causative agent of the disease and P. sergenti as its vector. The presence of L. infantum, and its presumed vector in this area, makes this a site of high risk of visceral leishmaniasis, mostly because of the proximity of a focus of human and canine visceral leishmaniasis.

Circulating species of Leishmania at microclimate area of Boulemane Province, Morocco: impact of environmental and human factors.

Science.gov (United States)

Hmamouch, Asmae; El Alem, Mahmoud Mohamed; Hakkour, Maryam; Amarir, Fatima; Daghbach, Hassan; Habbari, Khalid; Fellah, Hajiba; Bekhti, Khadija; Sebti, Faiza

2017-02-22

Cutaneous leishmaniasis (CL) is widely distributed in Morocco where its geographical range and incidence are related to environmental factors. This study aimed to examine the impact of several factors on the distribution of CL in Boulemane Province, which is characterized by several microclimates, and to identify the Leishmania species circulating in these areas. Ordinary least squares regression (OLSR) analysis was performed to study the impact of poverty, vulnerability, population density, urbanization and bioclimatic factors on the distribution of CL in this province. Molecular characterization of parasites was performed using a previously described PCR-RFLP method targeting the ITS1 of ribosomal DNA of Leishmania. A total of 1009 cases were declared in Boulemane Province between the years 2000 and 2015 with incidences fluctuating over the years (P = 0.007). Analyzing geographical maps of the study region identified four unique microclimate areas; sub-humid, semi-arid, arid and Saharan. The geographical distribution and molecular identification of species shows that the Saharan microclimate, characterized by the presence of Leishmania major was the most affected (47.78%) followed by semi-arid area where Leishmania tropica was identified in three districts. Among several environmental factors included in the study, poverty had the greatest influence on the spatial extension of the disease in this province. The incidence of CL in Boulemane Province varies between microclimate areas, and environmental factors partly explain this variation. However, the existence of CL in the most affected districts is mainly related to poverty, population movement and human behavior. To our knowledge, this the first study utilizing molecular techniques to confirm L. tropica and L. major as the causative agents of CL in Boulemane Province. Our findings indicate that the spatial and temporal distribution of CL in Boulemane Province is strongly related to poverty and population

Monocyte Chemotactic Protein 1 in Plasma from Soluble Leishmania Antigen-Stimulated Whole Blood as a Potential Biomarker of the Cellular Immune Response to Leishmania infantum

Directory of Open Access Journals (Sweden)

Ana V. Ibarra-Meneses

2017-09-01

Full Text Available New biomarkers are needed to identify asymptomatic Leishmania infection as well as immunity following vaccination or treatment. With the aim of finding a robust biomarker to assess an effective cellular immune response, monocyte chemotactic protein 1 (MCP-1 was examined in plasma from soluble Leishmania antigen (SLA-stimulated whole blood collected from subjects living in a Leishmania infantum-endemic area. MCP-1, expressed 110 times more strongly than IL-2, identified 87.5% of asymptomatic subjects and verified some asymptomatic subjects close to the cutoff. MCP-1 was also significantly elevated in all patients cured of visceral leishmaniasis (VL, unlike IL-2, indicating the specific memory response generated against Leishmania. These results show MCP-1 to be a robust candidate biomarker of immunity that could be used as a marker of cure and to both select and follow the population in vaccine phase I–III human clinical trials with developed rapid, easy-to-use field tools.

MicroRNA expression in rainbow trout (Oncorhynchus mykiss) vaccinated with a DNA vaccine encoding the glycoprotein gene of Viral hemorrhagic septicemia virus

DEFF Research Database (Denmark)

Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels

particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...

Induction of cytotoxic T-cell responses by gene gun DNA vaccination with minigenes encoding influenza A virus HA and NP CTL-epitopes

DEFF Research Database (Denmark)

Fomsgaard, A; Nielsen, H V; Kirkby, N

1999-01-01

degree of controllability. We have examined the induction of murine CTL's by this approach using DNA plasmid minigene vaccines encoding known mouse K(k) minimal CTL epitopes (8 amino acids) from the influenza A virus hemagglutinin and nucleoprotein. We here report that such an approach is feasible...

Efficacy of DNA vaccine encoding koi herpesvirus glycoprotein GP-25in common carp juvenile by immersion

Directory of Open Access Journals (Sweden)

Soko Nuswantoro

2013-11-01

Full Text Available Koi herpesvirus (KHV is a herpesvirus that particularly infects and causes mass mortality to koi and common carp. Therefore, the protection of common carp from KHV infection is urgently needed. In this study, we developed an application of DNA vaccine encoding KHV glycoprotein-25 by immersion method to increase survival of common carp against KHV infection. A total of 400 common carp juveniles at 30-day-old were immersed in 1-L water containing 1.3×108CFU/mL of the killed Escherichia coli cells carrying DNA vaccine. Three frequencies and three duration of fish immersion were tested, namely: 1×30 minutes, 1×60 minutes, 1× 90 minutes, 2×90 minutes and 3×90 minutes by interval of 24 hours. Reversetranscription polymerase chain reaction analysis showed that DNA vaccine was successfully expressed in the vaccinated fish. Fish at twenty eight days post vaccination were challenged by injecting 10-4 mL of KHV per fish. The result showed that vaccination by 1×30 minutes immersion allowed 61% of fish survived, and this was significantly higher (p<0.05 compared to control (without vaccination, but it was similar among vaccination treatments (p>0.05. The relative percent survival of vaccinated fish were also similar among treatments (p>0.05. DNA vaccination has increased fish survival about two fold higher compared to unvaccinated fish control (26.67%. Thus, DNA vaccination was effectively delivered by immersion for 1×30 minutes, and this technique can be useful to level up the resistance of common carp juveniles against KHV infection. Keywords: DNA vaccine, KHV, glycoprotein, immersion, common carp

Isolation and sequence of cDNA encoding a cytochrome P-450 from an insecticide-resistant strain of the house fly, Musca domestica.

OpenAIRE

Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W

1989-01-01

A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...

[Natural infection with Leishmania infantum chagasi in Lutzomyia (Lutzomyia) longipalpis (Diptera: Psychodidae) sandflies captured in the municipality of Janaúba, State of Minas Gerais, Brazil].

Science.gov (United States)

Michalsky, Erika Monteiro; Guedes, Karla de Sena; Lara e Silva, Fabiana de Oliveira; França-Silva, João Carlos; Dias, Consuelo Latorre Fortes; Barata, Ricardo Andrade; Dias, Edelberto Santos

2011-01-01

Visceral leishmaniasis has been notified in nearly all states of Brazil, and particularly in the north of Minas Gerais, where the disease is endemic. The aim of this study was to detect natural infection of Lutzomyia longipalpis and, through the PCR/RFLP technique, identify Leishmania species found in sandflies in the municipality of Janaúba. Using light traps, 1,550 females of L. longipalpis were caught and grouped into pools of 10 specimens to be subjected to DNA extraction and amplification, by means of generic PCR and cacophony. Out of the 155 pools, six were positive for Leishmania sp., and thus the infection rate in the municipality was 3.9%. Through PCR/RFLP, the digestion pattern among the positive samples was found to be similar to that of the reference strain of Leishmania chagasi (MHOM/BR/74/PP75). The detection of natural infection associated with studies on the epidemiology of visceral leishmaniasis suggests that L. longipalpis is involved in transmission of L. infantum chagasi in Janaúba, particularly in areas of intense transmission of visceral leishmaniasis.

Clinical and parasitological protection in a Leishmania infantum-macaque model vaccinated with adenovirus and the recombinant A2 antigen.

Directory of Open Access Journals (Sweden)

Gabriel Grimaldi

2014-06-01

Full Text Available BACKGROUND: Visceral leishmaniasis (VL is a severe vector-born disease of humans and dogs caused by Leishmania donovani complex parasites. Approximately 0.2 to 0.4 million new human VL cases occur annually worldwide. In the new world, these alarming numbers are primarily due to the impracticality of current control methods based on vector reduction and dog euthanasia. Thus, a prophylactic vaccine appears to be essential for VL control. The current efforts to develop an efficacious vaccine include the use of animal models that are as close to human VL. We have previously reported a L. infantum-macaque infection model that is reliable to determine which vaccine candidates are most worthy for further development. Among the few amastigote antigens tested so far, one of specific interest is the recombinant A2 (rA2 protein that protects against experimental L. infantum infections in mice and dogs. METHODOLOGY/PRINCIPAL FINDINGS: Primates were vaccinated using three rA2-based prime-boost immunization regimes: three doses of rA2 plus recombinant human interleukin-12 (rhIL-12 adsorbed in alum (rA2/rhIL-12/alum; two doses of non-replicative adenovirus recombinant vector encoding A2 (Ad5-A2 followed by two boosts with rA2/rhIL-12/alum (Ad5-A2+rA2/rhIL12/alum; and plasmid DNA encoding A2 gene (DNA-A2 boosted with two doses of Ad5-A2 (DNA-A2+Ad5-A2. Primates received a subsequent infectious challenge with L. infantum. Vaccines, apart from being safe, were immunogenic as animals responded with increased pre-challenge production of anti-A2-specific IgG antibodies, though with some variability in the response, depending on the vaccine formulation/protocol. The relative parasite load in the liver was significantly lower in immunized macaques as compared to controls. Protection correlated with hepatic granuloma resolution, and reduction of clinical symptoms, particularly when primates were vaccinated with the Ad5-A2+rA2/rhIL12/alum protocol. CONCLUSIONS

DSFL database: A hub of target proteins of Leishmania sp. to combat leishmaniasis

Directory of Open Access Journals (Sweden)

Ameer Khusro

2017-07-01

Full Text Available Leishmaniasis is a vector-borne chronic infectious tropical dermal disease caused by the protozoa parasite of the genus Leishmania that causes high mortality globally. Among three different clinical forms of leishmaniasis, visceral leishmaniasis (VL or kala-azar is a systemic public health disease with high morbidity and mortality in developing countries, caused by Leishmania donovani, Leishmania infantum or Leishmania chagasi. Unfortunately, there is no vaccine available till date for the treatment of leishmaniasis. On the other hand, the therapeutics approved to treat this fatal disease is expensive, toxic, and associated with serious side effects. Furthermore, the emergence of drug-resistant Leishmania parasites in most endemic countries due to the incessant utilization of existing drugs is a major concern at present. Drug Search for Leishmaniasis (DSFL is a unique database that involves 50 crystallized target proteins of varied Leishmania sp. in order to develop new drugs in future by interacting several antiparasitic compounds or molecules with specific protein through computational tools. The structure of target protein from different Leishmania sp. is available in this database. In this review, we spotlighted not only the current global status of leishmaniasis in brief but also detailed information about target proteins of various Leishmania sp. available in DSFL. DSFL has created a new expectation for mankind in order to combat leishmaniasis by targeting parasitic proteins and commence a new era to get rid of drug resistance parasites. The database will substantiate to be a worthwhile project for further development of new, non-toxic, and cost-effective antileishmanial drugs as targeted therapies using in vitro/in vivo assays.

Identification of Tunisian Leishmania spp. by PCR amplification of cysteine proteinase B (cpb) genes and phylogenetic analysis.

Science.gov (United States)

Chaouch, Melek; Fathallah-Mili, Akila; Driss, Mehdi; Lahmadi, Ramzi; Ayari, Chiraz; Guizani, Ikram; Ben Said, Moncef; Benabderrazak, Souha

2013-03-01

Discrimination of the Old World Leishmania parasites is important for diagnosis and epidemiological studies of leishmaniasis. We have developed PCR assays that allow the discrimination between Leishmania major, Leishmania tropica and Leishmania infantum Tunisian species. The identification was performed by a simple PCR targeting cysteine protease B (cpb) gene copies. These PCR can be a routine molecular biology tools for discrimination of Leishmania spp. from different geographical origins and different clinical forms. Our assays can be an informative source for cpb gene studying concerning drug, diagnostics and vaccine research. The PCR products of the cpb gene and the N-acetylglucosamine-1-phosphate transferase (nagt) Leishmania gene were sequenced and aligned. Phylogenetic trees of Leishmania based cpb and nagt sequences are close in topology and present the classic distribution of Leishmania in the Old World. The phylogenetic analysis has enabled the characterization and identification of different strains, using both multicopy (cpb) and single copy (nagt) genes. Indeed, the cpb phylogenetic analysis allowed us to identify the Tunisian Leishmania killicki species, and a group which gathers the least evolved isolates of the Leishmania donovani complex, that was originated from East Africa. This clustering confirms the African origin for the visceralizing species of the L. donovani complex. Copyright © 2012 Elsevier B.V. All rights reserved.

LR1: a candidate RNA virus of Leishmania.

OpenAIRE

Tarr, P I; Aline, R F; Smiley, B L; Scholler, J; Keithly, J; Stuart, K

1988-01-01

Although viruses are important biological agents and useful molecular tools, little is known about the viruses of parasites. We report here the discovery of a candidate for an RNA virus in a kinetoplastid parasite. This potential virus, which we term LR1, is present in the promastigote form of the human pathogen Leishmania braziliensis guyanensis CUMC1-1A but not in 11 other stocks of Leishmania that were examined nor in Trypanosoma brucei. The candidate viral RNA has a size of approximately ...

Characterization of Leishmania Soluble Exo-Antigen

National Research Council Canada - National Science Library

Cui, Liwang

2003-01-01

.... Vaccine development is the ultimate solution for this problem. Our previous research indicates that Leishmania parasites secrete, excrete, or shed antigens into the medium during in vitro culture...

The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

Science.gov (United States)

Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar

2011-06-10

The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

Directory of Open Access Journals (Sweden)

Jianrao HU, Mingfu CAO, Jiong Chen

2009-10-01

Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

First Report on Isolation and Characterization of Leishmania major from Meriones hurrianae (Rodentia: Gerbillidae) of A Rural Cutaneous leishmaniasis Focus in South-Eastern Iran.

Science.gov (United States)

Kassiri, Hamid; Naddaf, Saied Reza; Javadian, Ezat-Aldin; Mohebali, Mehdi

2013-09-01

Zoonotic Cutaneous Leishmaniasis (ZCL) is an endemic health problem in many rural areas of Iran, with doubled number of incidences over the last decade. Different species of rodents serve as natural reservoir host for ZCL. The disease is considered as a major health problem in rural areas of Mirjaveh, Chabahar, and Konarak Counties of Sistan va Baluchistan Province. This study describes the identity of Leishmania species, isolated from Meriones hurrianae from Chabahar County using RAPD-PCR methodology. Rodents were entrapped by live traps baited with roasted walnut, tomato, and cucumber during spring and summer. All rodents were identified based on external features including fur color, ears characteristics, tail length, hind feet, body measurements, and internal features of teeth and cranium. Giemsa-stained impressions from rodents' ears were examined for amastigotes microscopically. The samples from infected rodents were cultured in NNN+LIT medium and then the harvested parasites at the stationary phase were subjected to DNA extraction followed by amplification with RAPD-PCR. All the 28 entrapped animals were identified as M. hurrianae. Five animals showed to harbor Leishmania parasite by microscopy. Leishmania DNA isolated from five M. hurrianae produced distinctive bands of L. major with four primers. However, the products that were amplified with primers AB1-07, 327, and 329 were stable and reproducible. This is the first report on the isolation and identification of L. major from M. hurrianae from Iran. Regarding infection rate of 17.8%, M. hurrianae seems to play the major role in the maintenance and transmission of disease to humans in this area.

Estudo histológico e parasitológico do trato gastrintestinal de cães infectados com Leishmania (Leishmania) chagasi

OpenAIRE

Aldair Junio Woyames Pinto

2011-01-01

São poucas as descrições das alterações patológicas e parasitológicas relacionadas ao envolvimento do trato gastrointestinal (TGI) na leishmaniose visceral canina e, sobretudo considerando-se o TGI de forma sistemática. Assim, neste trabalho objetivou-se um estudo sistemático, clínico, anatomopatológico e parasitológico do TGI de cães naturalmente infectados com Leishmania (Leishmania) chagasi provenientes da região metropolitana de Belo Horizonte, MG. Após confirmação sorológica (RIFI e ELIS...

The Polymerase chain reaction as a tool of molecular diagnosis of Leishmania infection in the Sudan

International Nuclear Information System (INIS)

Hashim, Amna Osman Yousif

1997-06-01

Leishmaniasis, manifesting on it's different clinical forms is endemic in different regions of the Sudan. diagnosis of the disease in the Sudan is usually done using simple methods such as microscopical examination of slit smirs, Histological sections and cultures. Serological diagnosis using enzymes linked immunosorbent assay (ELISA)- and direct agglutination test (DAT) are sometimes used as more sensitive tool has thrown light on the epidemiology of the disease in the Sudan. This study was conducted on 126 subjects to identify the parasites-causing the different clinical manifestations, to determine the genetic diversity of different isolates of Lieshmania- and to detect parasites in the peripheral blood of subjects from highly endemic foci. The study population consisted of 7 with suspected VL, 12 with suspected ML, 14 with suspected PKDL, 2 with sporotrichoid CL and 89 healthy games wardens and army soldiers from highly endemic foci. Parasites were cultured in biphasic medium and subcultured in liquid medium until mass production was stabilized. Extraction of DNA was done using three methods which were phenol/ chloroform/ isoamylalcohol, K buffer and proteinase K as well as lysing of the parasite with distilled water. The KDNA was amplified using species namely AJSI and DeB8. The products were analysed on 1.5% agarose gel-and were visualized and photographed with U.V. transilluminator and camera. Characteristic bands of 700 and 800 b.p corresponding to the full length of mini circle of L.major and L.donovani respectively were obtained on amplification of KDNA from patients with VL and CL. In some cases lower bands of 400 and 500 b.p PKDL and multiple bands for sporotrichoid CL.Leishmania DNA was detected from the conjucativa of the eye of a patient with PKDL. The genetic diversity of Leishmania parasite was determined by digesting PCR products from PKDL, sporotrichoids CL and VL patients. Different patterns were produced for each digesting product. This result

The Polymerase chain reaction as a tool of molecular diagnosis of Leishmania infection in the Sudan

Energy Technology Data Exchange (ETDEWEB)

Hashim, Amna Osman Yousif [Department of Zoology, Faculty of Science, University of Khartoum, Khartoum (Sudan)

1997-06-01

Leishmaniasis, manifesting on it`s different clinical forms is endemic in different regions of the Sudan. diagnosis of the disease in the Sudan is usually done using simple methods such as microscopical examination of slit smirs, Histological sections and cultures. Serological diagnosis using enzymes linked immunosorbent assay (ELISA)- and direct agglutination test (DAT) are sometimes used as more sensitive tool has thrown light on the epidemiology of the disease in the Sudan. This study was conducted on 126 subjects to identify the parasites-causing the different clinical manifestations, to determine the genetic diversity of different isolates of Lieshmania- and to detect parasites in the peripheral blood of subjects from highly endemic foci. The study population consisted of 7 with suspected VL, 12 with suspected ML, 14 with suspected PKDL, 2 with sporotrichoid CL and 89 healthy games wardens and army soldiers from highly endemic foci. Parasites were cultured in biphasic medium and subcultured in liquid medium until mass production was stabilized. Extraction of DNA was done using three methods which were phenol/ chloroform/ isoamylalcohol, K buffer and proteinase K as well as lysing of the parasite with distilled water. The KDNA was amplified using species namely AJSI and DeB8. The products were analysed on 1.5% agarose gel-and were visualized and photographed with U.V. transilluminator and camera. Characteristic bands of 700 and 800 b.p corresponding to the full length of mini circle of L.major and L.donovani respectively were obtained on amplification of KDNA from patients with VL and CL. In some cases lower bands of 400 and 500 b.p PKDL and multiple bands for sporotrichoid CL.Leishmania DNA was detected from the conjucativa of the eye of a patient with PKDL. The genetic diversity of Leishmania parasite was determined by digesting PCR products from PKDL, sporotrichoids CL and VL patients. Different patterns were produced for each digesting product. This result

Anti-Leishmania and cytotoxic activities of perillaldehyde epoxide synthetic positional isomers.

Science.gov (United States)

Keesen, Tatjana Souza Lima; da Silva, Larisse Virgolino; da Câmara Rocha, Juliana; Andrade, Luciana Nalone; Lima, Tamires Cardoso; de Sousa, Damião Pergentino

2018-03-13

Leishmaniasis belongs to a complex of zoonotic disease caused by protozoa of the genus Leishmania and is considered a major public health problem. Several essential oil chemical components have inhibitory effect against protozoa, including Leishmania donovani. Thus, the aim of this study was to evaluate for the first time the anti-Leishmania activity of two p-menthane monoterpene isomers (EPER-1: perillaldehyde 1,2-epoxide and EPER-2: perillaldehyde 8,9-epoxide) against L. donovani promastigotes as well as evaluating cytotoxic effect on mononuclear peripheral blood cells. Results of anti-Leishmania assay revealed that EPER-2 (IC 50  = 3.8 μg.mL -1 ) was 16-fold more potent than its isomer EPER-1 (IC 50  = 64.6 μg.mL -1 ). In contrast to PBMC cells, EPER-2 was not cytotoxic (IC 50  > 400 μg.mL -1 ) when compared to positive control. These data suggest that the disposition of epoxide group into the p-menthane skeleton affects the anti-Leishmania activity, being that the presence of the exocyclic epoxide group considerably increased potency. Thus, it was possible to observe that the location of the epoxide group into the p-menthane skeleton resulted in different potencies.

Leishmania exosomes and other virulence factors: Impact on innate immune response and macrophage functions.

Science.gov (United States)

Atayde, Vanessa Diniz; Hassani, Kasra; da Silva Lira Filho, Alonso; Borges, Andrezza Raposo; Adhikari, Anupam; Martel, Caroline; Olivier, Martin

2016-11-01

Leishmania parasites are the causative agents of the leishmaniases, a collection of vector-borne diseases that range from simple cutaneous to fatal visceral forms. Employing potent immune modulation mechanisms, Leishmania is able to render the host macrophage inactive and persist inside its phagolysosome. In the last few years, the role of exosomes in Leishmania-host interactions has been increasingly investigated. For instance, it was reported that Leishmania exosome release is augmented following temperature shift, a condition mimicking parasite's entry into its mammalian host. Leishmania exosomes were found to strongly affect macrophage cell signaling and functions, similarly to whole parasites. Importantly, these vesicles were shown to be pro-inflammatory, capable to recruit neutrophils at their inoculation site exacerbating the pathology. In this review, we provide the most recent insights on the role of exosomes and other virulence factors, especially the surface protease GP63, in Leishmania-host interactions, deepening our knowledge on leishmaniasis and paving the way for the development of new therapeutics. Copyright © 2016 Elsevier Inc. All rights reserved.

The Dynamics of Lateral Gene Transfer in Genus Leishmania - A Route for Adaptation and Species Diversification

Science.gov (United States)

Vikeved, Elisabet; Backlund, Anders; Alsmark, Cecilia

2016-01-01

Background The genome of Leishmania major harbours a comparably high proportion of genes of prokaryote origin, acquired by lateral gene transfer (LGT). Some of these are present in closely related trypanosomatids, while some are detected in Leishmania only. We have evaluated the impact and destiny of LGT in genus Leishmania. Methodology/Principal Findings To study the dynamics and fate of LGTs we have performed phylogenetic, as well as nucleotide and amino acid composition analyses within orthologous groups of LGTs detected in Leishmania. A set of universal trypanosomatid LGTs was added as a reference group. Both groups of LGTs have, to some extent, ameliorated to resemble the recipient genomes. However, while virtually all of the universal trypanosomatid LGTs are distributed and conserved in the entire genus Leishmania, the LGTs uniquely present in genus Leishmania are more prone to gene loss and display faster rates of evolution. Furthermore, a PCR based approach has been employed to ascertain the presence of a set of twenty LGTs uniquely present in genus Leishmania, and three universal trypanosomatid LGTs, in ten additional strains of Leishmania. Evolutionary rates and predicted expression levels of these LGTs have also been estimated. Ten of the twenty LGTs are distributed and conserved in all species investigated, while the remainder have been subjected to modifications, or undergone pseudogenization, degradation or loss in one or more species. Conclusions/Significance LGTs unique to the genus Leishmania have been acquired after the divergence of Leishmania from the other trypanosomatids, and are evolving faster than their recipient genomes. This implies that LGT in genus Leishmania is a continuous and dynamic process contributing to species differentiation and speciation. This study also highlights the importance of carefully evaluating these dynamic genes, e.g. as LGTs have been suggested as potential drug targets. PMID:26730948

The Dynamics of Lateral Gene Transfer in Genus Leishmania - A Route for Adaptation and Species Diversification.

Science.gov (United States)

Vikeved, Elisabet; Backlund, Anders; Alsmark, Cecilia

2016-01-01

The genome of Leishmania major harbours a comparably high proportion of genes of prokaryote origin, acquired by lateral gene transfer (LGT). Some of these are present in closely related trypanosomatids, while some are detected in Leishmania only. We have evaluated the impact and destiny of LGT in genus Leishmania. To study the dynamics and fate of LGTs we have performed phylogenetic, as well as nucleotide and amino acid composition analyses within orthologous groups of LGTs detected in Leishmania. A set of universal trypanosomatid LGTs was added as a reference group. Both groups of LGTs have, to some extent, ameliorated to resemble the recipient genomes. However, while virtually all of the universal trypanosomatid LGTs are distributed and conserved in the entire genus Leishmania, the LGTs uniquely present in genus Leishmania are more prone to gene loss and display faster rates of evolution. Furthermore, a PCR based approach has been employed to ascertain the presence of a set of twenty LGTs uniquely present in genus Leishmania, and three universal trypanosomatid LGTs, in ten additional strains of Leishmania. Evolutionary rates and predicted expression levels of these LGTs have also been estimated. Ten of the twenty LGTs are distributed and conserved in all species investigated, while the remainder have been subjected to modifications, or undergone pseudogenization, degradation or loss in one or more species. LGTs unique to the genus Leishmania have been acquired after the divergence of Leishmania from the other trypanosomatids, and are evolving faster than their recipient genomes. This implies that LGT in genus Leishmania is a continuous and dynamic process contributing to species differentiation and speciation. This study also highlights the importance of carefully evaluating these dynamic genes, e.g. as LGTs have been suggested as potential drug targets.

The Dynamics of Lateral Gene Transfer in Genus Leishmania - A Route for Adaptation and Species Diversification.

Directory of Open Access Journals (Sweden)

Elisabet Vikeved

2016-01-01

Full Text Available The genome of Leishmania major harbours a comparably high proportion of genes of prokaryote origin, acquired by lateral gene transfer (LGT. Some of these are present in closely related trypanosomatids, while some are detected in Leishmania only. We have evaluated the impact and destiny of LGT in genus Leishmania.To study the dynamics and fate of LGTs we have performed phylogenetic, as well as nucleotide and amino acid composition analyses within orthologous groups of LGTs detected in Leishmania. A set of universal trypanosomatid LGTs was added as a reference group. Both groups of LGTs have, to some extent, ameliorated to resemble the recipient genomes. However, while virtually all of the universal trypanosomatid LGTs are distributed and conserved in the entire genus Leishmania, the LGTs uniquely present in genus Leishmania are more prone to gene loss and display faster rates of evolution. Furthermore, a PCR based approach has been employed to ascertain the presence of a set of twenty LGTs uniquely present in genus Leishmania, and three universal trypanosomatid LGTs, in ten additional strains of Leishmania. Evolutionary rates and predicted expression levels of these LGTs have also been estimated. Ten of the twenty LGTs are distributed and conserved in all species investigated, while the remainder have been subjected to modifications, or undergone pseudogenization, degradation or loss in one or more species.LGTs unique to the genus Leishmania have been acquired after the divergence of Leishmania from the other trypanosomatids, and are evolving faster than their recipient genomes. This implies that LGT in genus Leishmania is a continuous and dynamic process contributing to species differentiation and speciation. This study also highlights the importance of carefully evaluating these dynamic genes, e.g. as LGTs have been suggested as potential drug targets.

DNA probes

International Nuclear Information System (INIS)

Castelino, J.

1992-01-01

The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32 P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

Peptone-yeast autolysate-fetal bovine serum 10, a simple, inexpensive liquid medium for cultivation of Leishmania spp.

OpenAIRE

Palomino, J C

1982-01-01

A simple liquid medium for the cultivation of Leishmania parasites is described. Leishmania brasiliensis and Leishmania peruviana cultured in this medium reached cell densities greater than 10(7) promastigotes per ml within 7 days. This medium compares very favorably with the more complex media used to cultivate Leishmania spp. and other hemoflagellates.

Diverse replication-associated protein encoding circular DNA viruses in guano samples of Central-Eastern European bats.

Science.gov (United States)

Kemenesi, Gábor; Kurucz, Kornélia; Zana, Brigitta; Földes, Fanni; Urbán, Péter; Vlaschenko, Anton; Kravchenko, Kseniia; Budinski, Ivana; Szodoray-Parádi, Farkas; Bücs, Szilárd; Jére, Csaba; Csősz, István; Szodoray-Parádi, Abigél; Estók, Péter; Görföl, Tamás; Boldogh, Sándor; Jakab, Ferenc

2018-03-01

Circular replication-associated protein encoding single-stranded DNA (CRESS DNA) viruses are increasingly recognized worldwide in a variety of samples. Representative members include well-described veterinary pathogens with worldwide distribution, such as porcine circoviruses or beak and feather disease virus. In addition, numerous novel viruses belonging to the family Circoviridae with unverified pathogenic roles have been discovered in different human samples. Viruses of the family Genomoviridae have also been described as being highly abundant in different faecal and environmental samples, with case reports showing them to be suspected pathogens in human infections. In order to investigate the genetic diversity of these viruses in European bat populations, we tested guano samples from Georgia, Hungary, Romania, Serbia and Ukraine. This resulted in the detection of six novel members of the family Circoviridae and two novel members of the family Genomoviridae. Interestingly, a gemini-like virus, namely niminivirus, which was originally found in raw sewage samples in Nigeria, was also detected in our samples. We analyzed the nucleotide composition of members of the family Circoviridae to determine the possible host origins of these viruses. This study provides the first dataset on CRESS DNA viruses of European bats, and members of several novel viral species were discovered.

Cloning and molecular characterization of the salt-regulated jojoba ScRab cDNA encoding a small GTP-binding protein.

Science.gov (United States)

Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

2002-10-01

Salt stress results in a massive change in gene expression. An 837 bp cDNA designated ScRab was cloned from shoot cultures of the salt tolerant jojoba (Simmondsia chinesis). The cloned cDNA encodes a full length 200 amino acid long polypeptide that bears high homology to the Rab subfamily of small GTP binding proteins, particularly, the Rab5 subfamily. ScRab expression is reduced in shoots grown in the presence of salt compared to shoots from non-stressed cultures. His6-tagged ScRAB protein was expressed in E. coli, and purified to homogeneity. The purified protein bound radiolabelled GTP. The unlabelled guanine nucleotides GTP, GTP gamma S and GDP but not ATP, CTP or UTP competed with GTP binding.

Genes that encodes NAGT, MIF1 and MIF2 are not virulence factors for kala-azar caused by Leishmania infantum

Directory of Open Access Journals (Sweden)

Bruno Guedes Alcoforado Aguiar

2014-10-01

Full Text Available Introduction Kala-azar is a disease resulting from infection by Leishmania donovani and Leishmania infantum. Most patients with the disease exhibit prolonged fever, wasting, anemia and hepatosplenomegaly without complications. However, some patients develop severe disease with hemorrhagic manifestations, bacterial infections, jaundice, and edema dyspnea, among other symptoms, followed by death. Among the parasite molecules that might influence the disease severity are the macrophage migration inhibitory factor-like proteins (MIF1 and MIF2 and N-acetylglucosamine-1-phosphotransferase (NAGT, which act in the first step of protein N-glycosylation. This study aimed to determine whether MIF1, MIF2 and NAGT are virulence factors for severe kala-azar. Methods To determine the parasite genotype in kala-azar patients from Northeastern Brazil, we sequenced the NAGT genes of L. infantum from 68 patients as well as the MIF1 and MIF2 genes from 76 different subjects with diverse clinical manifestations. After polymerase chain reaction (PCR, the fragments were sequenced, followed by polymorphism identification. Results The nucleotide sequencing of the 144 amplicons revealed the absence of genetic variability of the NAGT, MIF1 and MIF2 genes between the isolates. The conservation of these genes suggests that the clinical variability of kala-azar does not depend upon these genes. Additionally, this conservation suggests that these genes may be critical for parasite survival. Conclusions NAGT, MIF1 and MIF2 do not alter the severity of kala-azar. NAGT, MIF1 and MIF2 are highly conserved among different isolates of identical species and exhibit potential for use in phylogenetic inferences or molecular diagnosis.

Characterization of a Novel Endoplasmic Reticulum Protein Involved in Tubercidin Resistance in Leishmania major.

Directory of Open Access Journals (Sweden)

Juliana Ide Aoki

2016-09-01

Full Text Available Tubercidin (TUB is a toxic adenosine analog with potential antiparasitic activity against Leishmania, with mechanism of action and resistance that are not completely understood. For understanding the mechanisms of action and identifying the potential metabolic pathways affected by this drug, we employed in this study an overexpression/selection approach using TUB for the identification of potential targets, as well as, drug resistance genes in L. major. Although, TUB is toxic to the mammalian host, these findings can provide evidences for a rational drug design based on purine pathway against leishmaniasis.After transfection of a cosmid genomic library into L. major Friedlin (LmjF parasites and application of the overexpression/selection method, we identified two cosmids (cosTUB1 and cosTU2 containing two different loci capable of conferring significant levels of TUB resistance. In the cosTUB1 contained a gene encoding NUPM1-like protein, which has been previously described as associated with TUB resistance in L. amazonensis. In the cosTUB2 we identified and characterized a gene encoding a 63 kDa protein that we denoted as tubercidin-resistance protein (TRP. Functional analysis revealed that the transfectants were less susceptible to TUB than LmjF parasites or those transfected with the control vector. In addition, the trp mRNA and protein levels in cosTUB2 transfectants were higher than LmjF. TRP immunolocalization revealed that it was co-localized to the endoplasmic reticulum (ER, a cellular compartment with many functions. In silico predictions indicated that TRP contains only a hypothetical transmembrane domain. Thus, it is likely that TRP is a lumen protein involved in multidrug efflux transport that may be involved in the purine metabolic pathway.This study demonstrated for the first time that TRP is associated with TUB resistance in Leishmania. The next challenge is to determine how TRP mediates TUB resistance and whether purine

Characterization of a Novel Endoplasmic Reticulum Protein Involved in Tubercidin Resistance in Leishmania major.

Science.gov (United States)

Aoki, Juliana Ide; Coelho, Adriano Cappellazzo; Muxel, Sandra Marcia; Zampieri, Ricardo Andrade; Sanchez, Eduardo Milton Ramos; Nerland, Audun Helge; Floeter-Winter, Lucile Maria; Cotrim, Paulo Cesar

2016-09-01

Tubercidin (TUB) is a toxic adenosine analog with potential antiparasitic activity against Leishmania, with mechanism of action and resistance that are not completely understood. For understanding the mechanisms of action and identifying the potential metabolic pathways affected by this drug, we employed in this study an overexpression/selection approach using TUB for the identification of potential targets, as well as, drug resistance genes in L. major. Although, TUB is toxic to the mammalian host, these findings can provide evidences for a rational drug design based on purine pathway against leishmaniasis. After transfection of a cosmid genomic library into L. major Friedlin (LmjF) parasites and application of the overexpression/selection method, we identified two cosmids (cosTUB1 and cosTU2) containing two different loci capable of conferring significant levels of TUB resistance. In the cosTUB1 contained a gene encoding NUPM1-like protein, which has been previously described as associated with TUB resistance in L. amazonensis. In the cosTUB2 we identified and characterized a gene encoding a 63 kDa protein that we denoted as tubercidin-resistance protein (TRP). Functional analysis revealed that the transfectants were less susceptible to TUB than LmjF parasites or those transfected with the control vector. In addition, the trp mRNA and protein levels in cosTUB2 transfectants were higher than LmjF. TRP immunolocalization revealed that it was co-localized to the endoplasmic reticulum (ER), a cellular compartment with many functions. In silico predictions indicated that TRP contains only a hypothetical transmembrane domain. Thus, it is likely that TRP is a lumen protein involved in multidrug efflux transport that may be involved in the purine metabolic pathway. This study demonstrated for the first time that TRP is associated with TUB resistance in Leishmania. The next challenge is to determine how TRP mediates TUB resistance and whether purine metabolism is affected

Identification and phylogenetic relationship of Iranian strains of various Leishmania species isolated from cutaneous and visceral cases of leishmaniasis based on N-acetylglucosamine-1-phosphate transferase gene.

Science.gov (United States)

Hajjaran, Homa; Mohebali, Mehdi; Teimouri, Aref; Oshaghi, Mohammad Ali; Mirjalali, Hamed; Kazemi-Rad, Elham; Shiee, Mohammad Reza; Naddaf, Saied Reza

2014-08-01

The identity of Iranian Leishmania species has been resolved to some extent by some genetic markers. In this study, based on N-acetylglucosamine-1-phosphate transferase (nagt) gene, we further elucidated the identity and phylogeny of the prevalent species in this country. DNAs of 121 isolates belonging to cutaneous leishmaniasis (CL) patients, canine visceral leishmaniasis (CVL) cases, and Rhombomys opimus rodents were amplified by targeting a partial sequence of nagt gene. All the amplicons were analyzed with restriction fragment length polymorphism (RFLP) using Acc1 enzyme, and 49 amplicons representing different reservoir hosts were sequenced and aligned with similar sequences from GenBank database. The RFLP analysis revealed that 41 CL patients were infected Leishmania tropica and 36 with Leishmania major. Among 10 CVL isolates, 6 were identified as Leishmania infantum and 4 as L. tropica. Amongst 34 rodents' isolates, 11 and 23 isolates exhibited patterns similar to those of L. major, and L. tropica/Leishmania turanica, respectively. The sequencing results from all CL patients, CVL cases, and 4 reservoir rodents were in agreement with RFLP analysis and showed 99-100% homologies with the registered species of L. major, L. tropica, and L. infantum from Turkey, Tunisia, Iraq and Israel. Of the 7 rodent isolates exhibiting RFLP patterns similar to L. tropica/L. turanica, 3 exhibited the highest homologies (99-100%) with L. turanica and 4 with Leishmania gerbilli. The 49 nagt DNA sequences were grouped into five clusters representing L. major, L. tropica, L. infantum, L. turanica and L. gerbilli species, encompassing 19 haplotypes. No correlation was observed between intraspecies divergence and geographic distribution of haplotypes. The L. tropica haplotypes exhibited more homologies with those of L. infantum than L. major (97.2% vs. 96.9%), a probable indication to the potential ability of L. tropica to visceralize. Characterization of Iranian Leishmania isolates

Further support for a palaearctic origin of Leishmania

Directory of Open Access Journals (Sweden)

Sara F Kerr

2000-08-01

Full Text Available The fossil record and systematics of murid rodents, reservoirs of zoonotic cutaneous leishmaniasis in the Palaearctic, Oriental, African, Nearctic and Neotropical, strongly support a Palaearctic origin of Leishmania. The fossil record and systematics of phlebotomine sand flies reinforce this idea. Interpretations of molecular data that place the origin of Leishmania in the Neotropical are inconsistent with the natural histories of reservoirs and vectors. The evolutionary pattern of New World rats (Sigmodontinae indicates that they may be the most important reservoirs of zoonotic cutaneous leishmaniasis throughout their range.

A combined approach of hollow microneedles and nanocarriers for skin immunization with plasmid DNA encoding ovalbumin

Directory of Open Access Journals (Sweden)

Pamornpathomkul B

2017-01-01

Full Text Available Boonnada Pamornpathomkul,1 Adisak Wongkajornsilp,2 Wanida Laiwattanapaisal,3 Theerasak Rojanarata,1 Praneet Opanasopit,1 Tanasait Ngawhirunpat1 1Department of Pharmaceutical Technology, Faculty of Pharmacy, Pharmaceutical Development of Green Innovations Group, Silpakorn University, Nakhon Pathom, 2Department of Pharmacology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 3Department of Clinical Chemistry, Faculty of Allied Health Sciences, Chulalongkorn University, Bangkok, Thailand Abstract: The aim of this study was to investigate the use of different types of microneedles (MNs and nanocarriers for in vitro skin permeation and in vivo immunization of plasmid DNA encoding ovalbumin (pOVA. In vitro skin permeation studies indicated that hollow MNs had a superior enhancing effect on skin permeation compared with solid MN patches, electroporation (EP patches, the combination of MN and EP patches, and untreated skin. Upon using hollow MNs combined with nanocarriers for pOVA delivery, the skin permeation was higher than for the delivery of naked pOVA, as evidenced by the increased amount of pOVA in Franz diffusion cells and immunoglobulin G (IgG antibody responses. When the hollow MNs were used for the delivery of nanocarrier:pOVA complexes into the skin of mice, they induced a stronger IgG immune response than conventional subcutaneous (SC injections. In addition, immunization of mice with the hollow MNs did not induce signs of skin infection or pinpoint bleeding. Accordingly, the hollow MNs combined with a nanocarrier delivery system is a promising approach for delivering pOVA complexes to the skin for promoting successful immunization. Keywords: hollow microneedle, solid microneedle, electroporation, plasmid DNA encoding ovalbumin, skin immunization, nanocarrier

Eugenia uniflora L. Essential Oil as a Potential Anti-Leishmania Agent: Effects on Leishmania amazonensis and Possible Mechanisms of Action

Science.gov (United States)

Amorim, Layane Valéria; de Oliveira, Jamylla Mirck Guerra; Dias, Clarice Noleto; Moraes, Denise Fernandes Coutinho; Andrade, Eloisa Helena de Aguiar; Maia, Jose Guilherme Soares; Carneiro, Sabrina Maria Portela; Carvalho, Fernando Aécio de Amorim

2013-01-01

Eugenia uniflora L. is a member of the Myrtaceae family and is commonly known as Brazilian cherry tree. In this study, we evaluated the chemical composition of Eugenia uniflora L. essential oil (EuEO) by using gas chromatography-mass spectrometry (GC-MS) and assessed its anti-Leishmania activity. We also explored the potential mechanisms of action and cytotoxicity of EuEO. Thirty-two compounds were identified, which constituted 92.65% of the total oil composition. The most abundant components were sesquiterpenes (91.92%), with curzerene (47.3%), γ-elemene (14.25%), and trans-β-elemenone (10.4%) being the major constituents. The bioactivity shown by EuEO against promastigotes (IC50, 3.04 μg·mL−1) and amastigotes (IC50, 1.92 μg·mL−1) suggested significant anti-Leishmania activity. In the cytotoxicity determination, EuEO was 20 times more toxic to amastigotes than to macrophages. Hemolytic activity was 63.22% at the highest concentration tested (400 μg·mL−1); however, there appeared to be no toxicity at 50 μg·mL−1. While the data show that EuEO activity is not mediated by nitric oxide production, they do suggest that macrophage activation may be involved in EuEO anti-Leishmania activity, as evidenced by increases in both the phagocytic capacity and the lysosomal activity. More studies are needed to determine in vivo activity as well as additional mechanisms of the anti-Leishmania activity. PMID:23533469

Eugenia uniflora L. Essential Oil as a Potential Anti-Leishmania Agent: Effects on Leishmania amazonensis and Possible Mechanisms of Action

Directory of Open Access Journals (Sweden)

Klinger Antonio da Franca Rodrigues

2013-01-01

Full Text Available Eugenia uniflora L. is a member of the Myrtaceae family and is commonly known as Brazilian cherry tree. In this study, we evaluated the chemical composition of Eugenia uniflora L. essential oil (EuEO by using gas chromatography-mass spectrometry (GC-MS and assessed its anti-Leishmania activity. We also explored the potential mechanisms of action and cytotoxicity of EuEO. Thirty-two compounds were identified, which constituted 92.65% of the total oil composition. The most abundant components were sesquiterpenes (91.92%, with curzerene (47.3%, γ-elemene (14.25%, and trans-β-elemenone (10.4% being the major constituents. The bioactivity shown by EuEO against promastigotes (IC50, 3.04 μg·mL−1 and amastigotes (IC50, 1.92 μg·mL−1 suggested significant anti-Leishmania activity. In the cytotoxicity determination, EuEO was 20 times more toxic to amastigotes than to macrophages. Hemolytic activity was 63.22% at the highest concentration tested (400 μg·mL−1; however, there appeared to be no toxicity at 50 μg·mL−1. While the data show that EuEO activity is not mediated by nitric oxide production, they do suggest that macrophage activation may be involved in EuEO anti-Leishmania activity, as evidenced by increases in both the phagocytic capacity and the lysosomal activity. More studies are needed to determine in vivo activity as well as additional mechanisms of the anti-Leishmania activity.

Eugenia uniflora L. Essential Oil as a Potential Anti-Leishmania Agent: Effects on Leishmania amazonensis and Possible Mechanisms of Action.

Science.gov (United States)

Rodrigues, Klinger Antonio da Franca; Amorim, Layane Valéria; de Oliveira, Jamylla Mirck Guerra; Dias, Clarice Noleto; Moraes, Denise Fernandes Coutinho; Andrade, Eloisa Helena de Aguiar; Maia, Jose Guilherme Soares; Carneiro, Sabrina Maria Portela; Carvalho, Fernando Aécio de Amorim

2013-01-01

Eugenia uniflora L. is a member of the Myrtaceae family and is commonly known as Brazilian cherry tree. In this study, we evaluated the chemical composition of Eugenia uniflora L. essential oil (EuEO) by using gas chromatography-mass spectrometry (GC-MS) and assessed its anti-Leishmania activity. We also explored the potential mechanisms of action and cytotoxicity of EuEO. Thirty-two compounds were identified, which constituted 92.65% of the total oil composition. The most abundant components were sesquiterpenes (91.92%), with curzerene (47.3%), γ -elemene (14.25%), and trans- β -elemenone (10.4%) being the major constituents. The bioactivity shown by EuEO against promastigotes (IC50, 3.04  μ g·mL(-1)) and amastigotes (IC50, 1.92  μ g·mL(-1)) suggested significant anti-Leishmania activity. In the cytotoxicity determination, EuEO was 20 times more toxic to amastigotes than to macrophages. Hemolytic activity was 63.22% at the highest concentration tested (400  μ g·mL(-1)); however, there appeared to be no toxicity at 50  μ g·mL(-1). While the data show that EuEO activity is not mediated by nitric oxide production, they do suggest that macrophage activation may be involved in EuEO anti-Leishmania activity, as evidenced by increases in both the phagocytic capacity and the lysosomal activity. More studies are needed to determine in vivo activity as well as additional mechanisms of the anti-Leishmania activity.

Large-Scale Investigation of Leishmania Interaction Networks with Host Extracellular Matrix by Surface Plasmon Resonance Imaging

Science.gov (United States)

Fatoux-Ardore, Marie; Peysselon, Franck; Weiss, Anthony; Bastien, Patrick; Pratlong, Francine

2014-01-01

We have set up an assay to study the interactions of live pathogens with their hosts by using protein and glycosaminoglycan arrays probed by surface plasmon resonance imaging. We have used this assay to characterize the interactions of Leishmania promastigotes with ∼70 mammalian host biomolecules (extracellular proteins, glycosaminoglycans, growth factors, cell surface receptors). We have identified, in total, 27 new partners (23 proteins, 4 glycosaminoglycans) of procyclic promastigotes of six Leishmania species and 18 partners (15 proteins, 3 glycosaminoglycans) of three species of stationary-phase promastigotes for all the strains tested. The diversity of the interaction repertoires of Leishmania parasites reflects their dynamic and complex interplay with their mammalian hosts, which depends mostly on the species and strains of Leishmania. Stationary-phase Leishmania parasites target extracellular matrix proteins and glycosaminoglycans, which are highly connected in the extracellular interaction network. Heparin and heparan sulfate bind to most Leishmania strains tested, and 6-O-sulfate groups play a crucial role in these interactions. Numerous Leishmania strains bind to tropoelastin, and some strains are even able to degrade it. Several strains interact with collagen VI, which is expressed by macrophages. Most Leishmania promastigotes interact with several regulators of angiogenesis, including antiangiogenic factors (endostatin, anastellin) and proangiogenic factors (ECM-1, VEGF, and TEM8 [also known as anthrax toxin receptor 1]), which are regulated by hypoxia. Since hypoxia modulates the infection of macrophages by the parasites, these interactions might influence the infection of host cells by Leishmania. PMID:24478075

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...