WorldWideScience

Sample records for leishmania dna encoding

  1. DNA vaccination with a plasmid encoding LACK-TSA fusion against Leishmania major infection in BALB/c mice.

    Science.gov (United States)

    Maspi, N; Ghaffarifar, F; Sharifi, Z; Dalimi, A; Khademi, S Z

    2017-12-01

    Vaccination would be the most important strategy for the prevention and elimination of leishmaniasis. The aim of the present study was to compare the immune responses induced following DNA vaccination with LACK (Leishmania analogue of the receptor kinase C), TSA (Thiol-specific-antioxidant) genes alone or LACK-TSA fusion against cutaneous leishmaniasis (CL). Cellular and humoral immune responses were evaluated before and after challenge with Leishmania major (L. major). In addition, the mean lesion size was also measured from 3th week post-infection. All immunized mice showed a partial immunity characterized by higher interferon (IFN)-γ and Immunoglobulin G (IgG2a) levels compared to control groups (pTSA fusion. Mean lesion sizes reduced significantly in all immunized mice compared with control groups at 7th week post-infection (pTSA and TSA groups than LACK group after challenge (pTSA antigens against CL. Furthermore, this study demonstrated that a bivalent vaccine can induce stronger immune responses and protection against infectious challenge with L. major.

  2. Generation of species-specific DNA probes for Leishmania aethiopica

    NARCIS (Netherlands)

    Laskay, T.; Kiessling, R.; Rinke deWit, T. F.; Wirth, D. F.

    1991-01-01

    We report here the cloning of kinetoplast DNA (kDNA) sequences from Leishmania aethiopica in order to develop a specific and sensitive method for the identification of the parasite. Analysis of the cloned kDNA sequences showed different taxonomic specificities demonstrating sequence diversity within

  3. Enhancement of immune response induced by DNA vaccine cocktail expressing complete LACK and TSA genes against Leishmania major.

    Science.gov (United States)

    Ghaffarifar, Fatemeh; Jorjani, Ogholniaz; Sharifi, Zohreh; Dalimi, Abdolhossein; Hassan, Zuhair M; Tabatabaie, Fatemeh; Khoshzaban, Fariba; Hezarjaribi, Hajar Ziaei

    2013-04-01

    Leishmaniasis is an important disease in humans. Leishmania homologue of receptor for Activated C Kinase (LACK) and thiol specific antioxidant (TSA) as immuno-dominant antigens of Leishmania major are considered the most promising molecules for a DNA vaccine. We constructed a DNA cocktail, containing plasmids encoding LACK and TSA genes of Leishmania major and evaluated the immune response and survival rate in BALB/c mice. IgG and Interferon gamma values were noticeably increased in the immunized group with DNA cocktail vaccine, which were significantly higher than those in the single-gene vaccinated and control groups (p 0.05). The immunized mice with the cocktail DNA vaccine presented a considerable reduction in diameter of lesion compared to other groups and a significant difference was observed (p < 0.05) in this regard. The survival time of the immunized mice with the cocktail DNA vaccine was significantly higher than that in the other groups (p < 0.05) after their being challenged with Leishmania major. The findings of this study indicated that the cocktail DNA vaccine increased the cellular response and survival rate and induced protection against infection with Leishmania in the mice. © 2012 The Authors © 2012 APMIS.

  4. Detection and characterization of Leishmania (Leishmania and Leishmania (Viannia by SYBR green-based real-time PCR and high resolution melt analysis targeting kinetoplast minicircle DNA.

    Directory of Open Access Journals (Sweden)

    Marcello Ceccarelli

    Full Text Available Leishmaniasis is a neglected disease with a broad clinical spectrum which includes asymptomatic infection. A thorough diagnosis, able to distinguish and quantify Leishmania parasites in a clinical sample, constitutes a key step in choosing an appropriate therapy, making an accurate prognosis and performing epidemiological studies. Several molecular techniques have been shown to be effective in the diagnosis of leishmaniasis. In particular, a number of PCR methods have been developed on various target DNA sequences including kinetoplast minicircle constant regions. The first aim of this study was to develop a SYBR green-based qPCR assay for Leishmania (Leishmania infantum detection and quantification, using kinetoplast minicircle constant region as target. To this end, two assays were compared: the first used previously published primer pairs (qPCR1, whereas the second used a nested primer pairs generating a shorter PCR product (qPCR2. The second aim of this study was to evaluate the possibility to discriminate among subgenera Leishmania (Leishmania and Leishmania (Viannia using the qPCR2 assay followed by melting or High Resolution Melt (HRM analysis. Both assays used in this study showed good sensitivity and specificity, and a good correlation with standard IFAT methods in 62 canine clinical samples. However, the qPCR2 assay allowed to discriminate between Leishmania (Leishmania and Leishmania (Viannia subgenera through melting or HRM analysis. In addition to developing assays, we investigated the number and genetic variability of kinetoplast minicircles in the Leishmania (L. infantum WHO international reference strain (MHOM/TN/80/IPT1, highlighting the presence of minicircle subclasses and sequence heterogeneity. Specifically, the kinetoplast minicircle number per cell was estimated to be 26,566±1,192, while the subclass of minicircles amplifiable by qPCR2 was estimated to be 1,263±115. This heterogeneity, also observed in canine clinical

  5. The use of kDNA minicircle subclass relative abundance to differentiate between Leishmania (L.) infantum and Leishmania (L.) amazonensis.

    Science.gov (United States)

    Ceccarelli, Marcello; Galluzzi, Luca; Diotallevi, Aurora; Andreoni, Francesca; Fowler, Hailie; Petersen, Christine; Vitale, Fabrizio; Magnani, Mauro

    2017-05-16

    Leishmaniasis is a neglected disease caused by many Leishmania species, belonging to subgenera Leishmania (Leishmania) and Leishmania (Viannia). Several qPCR-based molecular diagnostic approaches have been reported for detection and quantification of Leishmania species. Many of these approaches use the kinetoplast DNA (kDNA) minicircles as the target sequence. These assays had potential cross-species amplification, due to sequence similarity between Leishmania species. Previous works demonstrated discrimination between L. (Leishmania) and L. (Viannia) by SYBR green-based qPCR assays designed on kDNA, followed by melting or high-resolution melt (HRM) analysis. Importantly, these approaches cannot fully distinguish L. (L.) infantum from L. (L.) amazonensis, which can coexist in the same geographical area. DNA from 18 strains/isolates of L. (L.) infantum, L. (L.) amazonensis, L. (V.) braziliensis, L. (V.) panamensis, L. (V.) guyanensis, and 62 clinical samples from L. (L.) infantum-infected dogs were amplified by a previously developed qPCR (qPCR-ML) and subjected to HRM analysis; selected PCR products were sequenced using an ABI PRISM 310 Genetic Analyzer. Based on the obtained sequences, a new SYBR-green qPCR assay (qPCR-ama) intended to amplify a minicircle subclass more abundant in L. (L.) amazonensis was designed. The qPCR-ML followed by HRM analysis did not allow discrimination between L. (L.) amazonensis and L. (L.) infantum in 53.4% of cases. Hence, the novel SYBR green-based qPCR (qPCR-ama) has been tested. This assay achieved a detection limit of 0.1 pg of parasite DNA in samples spiked with host DNA and did not show cross amplification with Trypanosoma cruzi or host DNA. Although the qPCR-ama also amplified L. (L.) infantum strains, the C q values were dramatically increased compared to qPCR-ML. Therefore, the combined analysis of C q values from qPCR-ML and qPCR-ama allowed to distinguish L. (L.) infantum and L. (L.) amazonensis in 100% of tested samples

  6. Storing data encoded DNA in living organisms

    Science.gov (United States)

    Wong,; Pak C. , Wong; Kwong K. , Foote; Harlan, P [Richland, WA

    2006-06-06

    Current technologies allow the generation of artificial DNA molecules and/or the ability to alter the DNA sequences of existing DNA molecules. With a careful coding scheme and arrangement, it is possible to encode important information as an artificial DNA strand and store it in a living host safely and permanently. This inventive technology can be used to identify origins and protect R&D investments. It can also be used in environmental research to track generations of organisms and observe the ecological impact of pollutants. Today, there are microorganisms that can survive under extreme conditions. As well, it is advantageous to consider multicellular organisms as hosts for stored information. These living organisms can provide as memory housing and protection for stored data or information. The present invention provides well for data storage in a living organism wherein at least one DNA sequence is encoded to represent data and incorporated into a living organism.

  7. Leishmania diagnostic and identification py using 32P labelled DNA probes

    International Nuclear Information System (INIS)

    Andrade, Antero Silva Ribeiro de; Melo, Maria Norma de

    1999-10-01

    P 32 labelled DNA probes are valious instruments for the parasitic diseases by using hybridization reaction. In this paper we describe the methodology and present the foundations for the radioactive probes production, based on the kinetoplast DNA (kDNA), for the Leishmania diagnostic an identification. We also describe the kDNA purification protocol from Leishmania reference cepa, the process of P 32 labelling of the kDNA by using the nick translation method, gathering, sample preparation and treatment, the optimum conditions for the hybridization reaction and the procedures for the autoradiography

  8. First molecular detection of Leishmania tarentolae-like DNA in Sergentomyia minuta in Spain.

    Science.gov (United States)

    Bravo-Barriga, Daniel; Parreira, Ricardo; Maia, Carla; Blanco-Ciudad, Juan; Afonso, Maria Odete; Frontera, Eva; Campino, Lenea; Pérez-Martín, Juan Enrique; Serrano Aguilera, Francisco Javier; Reina, David

    2016-03-01

    Phlebotomine sand flies (Diptera, Psychodidae) are vectors of multiple Leishmania species, among which Leishmania infantum stands out as a being frequently pathogenic to humans and dogs in Mediterranean countries. In this study, Sergentomyia minuta sand flies were collected using CDC miniature light traps in different 431 biotopes from Southwest Spain. A total of 114 females were tested for the presence of Leishmania DNA by targeting ITS-1 and cyt-B sequences by PCR. Leishmania DNA was detected in one S. minuta. Characterization of the obtained DNA sequences by phylogenetic analyses revealed close relatedness with Leishmania tarentolae Wenyon, 1921 as well as with both human and canine pathogenic strains of Asian origin (China), previously described as Leishmania sp. To our knowledge, this is the first report of phlebotomine sand flies naturally infected with L. tarentolae-like in Spain. The possible infection of sand flies with novel Leishmania species should be taken into consideration in epidemiological studies of vector species in areas where leishmaniosis is endemic.

  9. 2D Barcode for DNA Encoding

    OpenAIRE

    Elena Purcaru; Cristian Toma

    2011-01-01

    The paper presents a solution for endcoding/decoding DNA information in 2D barcodes. First part focuses on the existing techniques and symbologies in 2D barcodes field. The 2D barcode PDF417 is presented as starting point. The adaptations and optimizations on PDF417 and on DataMatrix lead to the solution - DNA2DBC - DeoxyriboNucleic Acid Two Dimensional Barcode. The second part shows the DNA2DBC encoding/decoding process step by step. In conclusions are enumerated the most important features ...

  10. Chemical Space of DNA-Encoded Libraries.

    Science.gov (United States)

    Franzini, Raphael M; Randolph, Cassie

    2016-07-28

    In recent years, DNA-encoded chemical libraries (DECLs) have attracted considerable attention as a potential discovery tool in drug development. Screening encoded libraries may offer advantages over conventional hit discovery approaches and has the potential to complement such methods in pharmaceutical research. As a result of the increased application of encoded libraries in drug discovery, a growing number of hit compounds are emerging in scientific literature. In this review we evaluate reported encoded library-derived structures and identify general trends of these compounds in relation to library design parameters. We in particular emphasize the combinatorial nature of these libraries. Generally, the reported molecules demonstrate the ability of this technology to afford hits suitable for further lead development, and on the basis of them, we derive guidelines for DECL design.

  11. DNA-Encoded Dynamic Combinatorial Chemical Libraries.

    Science.gov (United States)

    Reddavide, Francesco V; Lin, Weilin; Lehnert, Sarah; Zhang, Yixin

    2015-06-26

    Dynamic combinatorial chemistry (DCC) explores the thermodynamic equilibrium of reversible reactions. Its application in the discovery of protein binders is largely limited by difficulties in the analysis of complex reaction mixtures. DNA-encoded chemical library (DECL) technology allows the selection of binders from a mixture of up to billions of different compounds; however, experimental results often show low a signal-to-noise ratio and poor correlation between enrichment factor and binding affinity. Herein we describe the design and application of DNA-encoded dynamic combinatorial chemical libraries (EDCCLs). Our experiments have shown that the EDCCL approach can be used not only to convert monovalent binders into high-affinity bivalent binders, but also to cause remarkably enhanced enrichment of potent bivalent binders by driving their in situ synthesis. We also demonstrate the application of EDCCLs in DNA-templated chemical reactions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  12. Characterization of monomeric DNA-binding protein Histone H1 in Leishmania braziliensis.

    Science.gov (United States)

    Carmelo, Emma; González, Gloria; Cruz, Teresa; Osuna, Antonio; Hernández, Mariano; Valladares, Basilio

    2011-08-01

    Histone H1 in Leishmania presents relevant differences compared to higher eukaryote counterparts, such as the lack of a DNA-binding central globular domain. Despite that, it is apparently fully functional since its differential expression levels have been related to changes in chromatin condensation and infectivity, among other features. The localization and the aggregation state of L. braziliensis H1 has been determined by immunolocalization, mass spectrometry, cross-linking and electrophoretic mobility shift assays. Analysis of H1 sequences from the Leishmania Genome Database revealed that our protein is included in a very divergent group of histones H1 that is present only in L. braziliensis. An antibody raised against recombinant L. braziliensis H1 recognized specifically that protein by immunoblot in L. braziliensis extracts, but not in other Leishmania species, a consequence of the sequence divergences observed among Leishmania species. Mass spectrometry analysis and in vitro DNA-binding experiments have also proven that L. braziliensis H1 is monomeric in solution, but oligomerizes upon binding to DNA. Finally, despite the lack of a globular domain, L. braziliensis H1 is able to form complexes with DNA in vitro, with higher affinity for supercoiled compared to linear DNA.

  13. Leishmania replication protein A-1 binds in vivo single-stranded telomeric DNA

    International Nuclear Information System (INIS)

    Neto, J.L. Siqueira; Lira, C.B.B.; Giardini, M.A.; Khater, L.; Perez, A.M.; Peroni, L.A.; Reis, J.R.R. dos; Freitas-Junior, L.H.; Ramos, C.H.I.; Cano, M.I.N.

    2007-01-01

    Replication protein A (RPA) is a highly conserved heterotrimeric single-stranded DNA-binding protein involved in different events of DNA metabolism. In yeast, subunits 1 (RPA-1) and 2 (RPA-2) work also as telomerase recruiters and, in humans, the complex unfolds G-quartet structures formed by the 3' G-rich telomeric strand. In most eukaryotes, RPA-1 and RPA-2 bind DNA using multiple OB fold domains. In trypanosomatids, including Leishmania, RPA-1 has a canonical OB fold and a truncated RFA-1 structural domain. In Leishmania amazonensis, RPA-1 alone can form a complex in vitro with the telomeric G-rich strand. In this work, we show that LaRPA-1 is a nuclear protein that associates in vivo with Leishmania telomeres. We mapped the boundaries of the OB fold DNA-binding domain using deletion mutants. Since Leishmania and other trypanosomatids lack homologues of known telomere end binding proteins, our results raise questions about the function of RPA-1 in parasite telomeres

  14. Optimization of loop-mediated isothermal amplification (LAMP) assays for the detection of Leishmania DNA in human blood samples.

    Science.gov (United States)

    Abbasi, Ibrahim; Kirstein, Oscar D; Hailu, Asrat; Warburg, Alon

    2016-10-01

    Visceral leishmaniasis (VL), one of the most important neglected tropical diseases, is caused by Leishmania donovani eukaryotic protozoan parasite of the genus Leishmania, the disease is prevalent mainly in the Indian sub-continent, East Africa and Brazil. VL can be diagnosed by PCR amplifying ITS1 and/or kDNA genes. The current study involved the optimization of Loop-mediated isothermal amplification (LAMP) for the detection of Leishmania DNA in human blood or tissue samples. Three LAMP systems were developed; in two of those the primers were designed based on shared regions of the ITS1 gene among different Leishmania species, while the primers for the third LAMP system were derived from a newly identified repeated region in the Leishmania genome. The LAMP tests were shown to be sufficiently sensitive to detect 0.1pg of DNA from most Leishmania species. The green nucleic acid stain SYTO16, was used here for the first time to allow real-time monitoring of LAMP amplification. The advantage of real time-LAMP using SYTO 16 over end-point LAMP product detection is discussed. The efficacy of the real time-LAMP tests for detecting Leishmania DNA in dried blood samples from volunteers living in endemic areas, was compared with that of qRT-kDNA PCR. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  15. Leishmania mexicana Gp63 cDNA Using Gene Gun Induced Higher Immunity to L. mexicana Infection Compared to Soluble Leishmania Antigen in BALB/C

    Science.gov (United States)

    Rezvan, H; Rees, R; Ali, SA

    2011-01-01

    Background Leishmaniasis is a worldwide disease prevalent in tropical and sub tropical countries. Many attempts have been made and different strategies have been approached to develop a potent vaccine against Leishmania. DNA immunisation is a method, which is shown to be effective in Leishmania vaccination. Leishmania Soluble Antigen (SLA) has also recently been used Leishmania vaccination. Methods The immunity generated by SLA and L. mexicana gp63 cDNA was compared in groups of 6 mice, which were statistically analysed by student t- test with the P-value of 0.05. SLA was administered by two different methods; intramuscular injection and injection of dendritic cells (DCs) loaded with SLA. L. mexicana gp63 cDNA was administered by the gene gun. Results Immunisation of BALB/c mice with L. mexicana gp63 resulted in high levels of Th1-type immune response and cytotoxic T lymphocytes (CTL) activity, which were accompanied with protection induced by the immunisation against L. mexicana infection. In contrast, administration of SLA, produced a mixed Th1/Th2-type immune responses as well as a high level of CTL activity but did not protect mice from the infection. Conclusion The results indicate higher protection by DNA immunisation using L. mexicana gp63 cDNA compared to SLA, which is accompanied by a high level of Th1 immune response. However, the CTL activity does not necessarily correlate with the protection induced by the vaccine. Also, gene gun immunisation is a potential approach in Leishmania vaccination. These findings would be helpful in opening new windows in Leishmania vaccine research. PMID:22347315

  16. Cloning of Salmonella typhimurium DNA encoding mutagenic DNA repair

    International Nuclear Information System (INIS)

    Thomas, S.M.; Sedgwick, S.G.

    1989-01-01

    Mutagenic DNA repair in Escherichia coli is encoded by the umuDC operon. Salmonella typhimurium DNA which has homology with E. coli umuC and is able to complement E. coli umuC122::Tn5 and umuC36 mutations has been cloned. Complementation of umuD44 mutants and hybridization with E. coli umuD also occurred, but these activities were much weaker than with umuC. Restriction enzyme mapping indicated that the composition of the cloned fragment is different from the E. coli umuDC operon. Therefore, a umu-like function of S. typhimurium has been found; the phenotype of this function is weaker than that of its E. coli counterpart, which is consistent with the weak mutagenic response of S. typhimurium to UV compared with the response in E. coli

  17. Toward a Better Compression for DNA Sequences Using Huffman Encoding.

    Science.gov (United States)

    Al-Okaily, Anas; Almarri, Badar; Al Yami, Sultan; Huang, Chun-Hsi

    2017-04-01

    Due to the significant amount of DNA data that are being generated by next-generation sequencing machines for genomes of lengths ranging from megabases to gigabases, there is an increasing need to compress such data to a less space and a faster transmission. Different implementations of Huffman encoding incorporating the characteristics of DNA sequences prove to better compress DNA data. These implementations center on the concepts of selecting frequent repeats so as to force a skewed Huffman tree, as well as the construction of multiple Huffman trees when encoding. The implementations demonstrate improvements on the compression ratios for five genomes with lengths ranging from 5 to 50 Mbp, compared with the standard Huffman tree algorithm. The research hence suggests an improvement on all such DNA sequence compression algorithms that use the conventional Huffman encoding. The research suggests an improvement on all DNA sequence compression algorithms that use the conventional Huffman encoding. Accompanying software is publicly available (AL-Okaily, 2016 ).

  18. Immunotherapy against visceral leishmaniasis with the nucleoside hydrolase-DNA vaccine of Leishmania donovani.

    Science.gov (United States)

    Gamboa-León, R; Paraguai de Souza, E; Borja-Cabrera, G P; Santos, F N; Myashiro, L M; Pinheiro, R O; Dumonteil, E; Palatnik-de-Sousa, C B

    2006-05-29

    The nucleoside hydrolase (NH36) of Leishmania (L.) donovani is a vital enzyme which releases purines or pyrimidines of foreign DNA to be used in the synthesis of parasite DNA. As a bivalent DNA vaccine, the VR1012-NH36 was immunoprotective against visceral and cutaneous murine leishmaniasis. In this work we tested the immunotherapy against Leishmania (L.) chagasi infection, using two doses of 100 or 20 microg VR1012-NH36 vaccine (i.m. route), and, as a possible immunomodulator, aqueous garlic extract (8 mg/kg/day by the i.p. route), which was effective in immunotherapy of cutaneous murine leishmaniasis. Liver parasitic load was significantly reduced following treatment with 100 microg (91%) and 20 microg (77%) of the DNA vaccine, and by 20 microg DNA vaccine and garlic extract (76%) (p=0.023). Survival was 33% for saline controls, 100% for the 100 microg vaccine, and 83 and 67% for the 20 microg vaccine with and without garlic extract addition, respectively. Garlic treatment alone did not reduce parasite load (p>0.05), but increased survival (100%). The NH36-DNA vaccine was highly effective as a new tool for the therapy and control of visceral leishmaniasis, while the mild protective effect of garlic might be related to an unspecific enhancement of IFN-gamma secretion.

  19. Cloning, sequencing and expression of cDNA encoding growth ...

    Indian Academy of Sciences (India)

    Unknown

    of medicine, animal husbandry, fish farming and animal ..... northern pike (Esox lucius) growth hormone; Mol. Mar. Biol. ... prolactin 1-luciferase fusion gene in African catfish and ... 1988 Cloning and sequencing of cDNA that encodes goat.

  20. Description of a novel eukaryotic deoxyuridine 5'-triphosphate nucleotidohydrolase in Leishmania major

    DEFF Research Database (Denmark)

    Camacho, A; Arrebola, R; Pena Diaz, Javier

    1997-01-01

    A Leishmania major full-length cDNA encoding a functional dUTP nucleotidohydrolase (dUTPase; EC 3.6.1.23) was isolated from a cDNA expression library by genetic complementation of dUTPase deficiency in Escherichia coli. The cDNA contained an open reading frame that encoded a protein of 269 amino...

  1. SYBR green-based detection of Leishmania infantum DNA using peripheral blood samples.

    Science.gov (United States)

    Ghasemian, Mehrdad; Gharavi, Mohammad Javad; Akhlaghi, Lame; Mohebali, Mehdi; Meamar, Ahmad Reza; Aryan, Ehsan; Oormazdi, Hormozd; Ghayour, Zahra

    2016-03-01

    Parasitological methods for the diagnosis of visceral leishmaniasis (VL) require invasive sampling procedures. The aim of this study was to detect Leishmania infantum (L. infantum) DNA by real time-PCR method in peripheral blood of symptomatic VL patient and compared its performance with nested PCR, an established molecular method with very high diagnostic indices. 47 parasitologically confirmed VL patients diagnosed by direct agglutination test (DAT > 3200), bone marrow aspiration and presented characteristic clinical features (fever, hepatosplenomegaly, and anemia) and 40 controls (non-endemic healthy control-30, Malaria-2, Toxoplasma gondii-2, Mycobacterium tuberculosis-2, HBV-1, HCV-1, HSV-1 and CMV-1) were enrolled in this study. SYBR-green based real time-PCR and nested PCR was performed to amplify the Kinetoplast DNA minicircle gene using the DNA extracted from Buffy coat. From among 47 patients, 45 (95.7 %) were positive by both nested-PCR and real time-PCR. These results indicate that real time-PCR was not only as sensitive as a nested-PCR assay for detection of Leishmania kDNA in clinical sample, but also more rapid. The advantage of real time-PCR based methods over nested-PCR is simple to perform, more faster in which nested-PCR requires post-PCR processing and reducing contamination risk.

  2. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Namhai Chua; Kush, A.

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids.

  3. Detection of Leishmania infantum DNA in hamsters infested with ticks collected from naturally infected dogs

    Directory of Open Access Journals (Sweden)

    Valter dos Anjos Almeida

    2016-12-01

    Full Text Available ABSTRACT. Almeida V. dos A., da Hora T.N., Leça Júnior N.F., Carvalho F.S., da Silva A.L., Wenceslau A.A., Albuquerque G.R. & Silva F.L. Detection of Leishmania infantum DNA in hamsters infested with ticks collected from naturally infected dogs. [Detecção do DNA de Leishmania infantum em hamsters infestados com carrapatos coletados de cães naturalmente infectados.] Revista Brasileira de Medicina Veterinária, 38(4:329-333, 2016. Departamento de Ciências Agrárias e Ambientais, Universidade Estadual de Santa Cruz, Campus Soane Nazaré de Andrade, Hospital Veterinário, Km 16, Rodovia Jorge Amado, Ilhéus, BA 45662-900, Brasil. E-mail: fabiana.lessa@gmail.com The aim of this study was to investigate the role of Rhipicephalus sanguineus, the brown dog tick, in the transmission of Leishmania infantum. To accomplish this, we used 24 adult golden hamsters of both genders, and divided them into two groups: a control group (n = 4 and an experimental group (n = 20. The animals from the experimental group were infested with ticks obtained from dogs naturally infected with L. infantum. Hamsters of the control group were not infested and were maintained at the same conditions, as the infested animals. After three months of observation, animals were euthanized and they were posted to obtain samples of their blood, spleen, liver, lymph nodes, and skin. These samples were then processed by histopathology, immunohistochemistry, and polymerase chain reaction (PCR. Fourteen hamsters (70% of the experimental group tested PCR-positive for L. infantum DNA in samples of buffy coat. The results of this study indicated that R. sanguineus ticks can transmit some forms or parts of L. infantum to parasitized hamsters.

  4. DNA-encoded chemical libraries - achievements and remaining challenges.

    Science.gov (United States)

    Favalli, Nicholas; Bassi, Gabriele; Scheuermann, Jörg; Neri, Dario

    2018-04-23

    DNA-encoded chemical libraries (DECLs) are collections of compounds, individually coupled to DNA tags serving as amplifiable identification barcodes. Since individual compounds can be identified by the associated DNA tag, they can be stored as a mixture, allowing the synthesis and screening of combinatorial libraries of unprecedented size, facilitated by the implementation of split-and-pool synthetic procedures or other experimental methodologies. In this review, we briefly present relevant concepts and technologies, which are required for the implementation and interpretation of screening procedures with DNA-encoded chemical libraries. Moreover, we illustrate some success stories, detailing how novel ligands were discovered from encoded libraries. Finally, we critically review what can realistically be achieved with the technology at the present time, highlighting challenges and opportunities for the future. © 2018 Federation of European Biochemical Societies.

  5. Leishmania amazonensis DNA in wild females of Lutzomyia cruzi (Diptera: Psychodidae) in the state of Mato Grosso do Sul, Brazil.

    Science.gov (United States)

    Oliveira, Everton Falcão de; Casaril, Aline Etelvina; Mateus, Nathália Lopes Fontoura; Murat, Paula Guerra; Fernandes, Wagner Souza; Oshiro, Elisa Teruya; Oliveira, Alessandra Gutierrez de; Galati, Eunice Aparecida Bianchi

    2015-12-01

    Studies on natural infection by Leishmania spp of sandflies collected in endemic and nonendemic areas can provide important information on the distribution and intensity of the transmission of these parasites. This study sought to investigate the natural infection by Leishmaniain wild female sandflies. The specimens were caught in the city of Corumbá, state of Mato Grosso do Sul (Brazil) between October 2012-March 2014, and dissected to investigate flagellates and/or submitted to molecular analysis to detect Leishmania DNA. A total of 1,164 females (77.56% of which were Lutzomyia cruzi) representing 11 species were investigated using molecular analysis; 126 specimens of Lu. cruziwere dissected and also submitted to molecular analysis. The infection rate based on the presence of Leishmania DNA considering all the sandfly species analysed was 0.69%; only Leishmania (Leishmania) amazonensis was identified in Lu. cruzi by the molecular analysis. The dissections were negative for flagellates. This is the first record of the presence of L. (L.) amazonensis DNA in Lu. cruzi, and the first record of this parasite in this area. These findings point to the need for further investigation into the possible role of this sandfly as vector of this parasite.

  6. Association between Leishmania infantum DNA in the hair of dogs and their infectiousness to Lutzomyia longipalpis.

    Science.gov (United States)

    de Sousa Gonçalves, Rafaela; Franke, Carlos R; Magalhães-Junior, Jairo T; Souza, Bárbara M P S; Solcà, Manuela S; Larangeira, Daniela F; Barrouin-Melo, Stella Maria

    2016-12-15

    Diagnosis of infection with Leishmania infantum by DNA detection in the hair has been recently demonstrated in dogs and wild animals. Our objective was to investigate if polymerase chain reaction (PCR) in hair might be used to identify infectious dogs. Thus, we assessed the infectiousness to Lutzomyia longipalpis by xenodiagnosis in comparison with the detection of L. infantum DNA by PCR in the hair, and with serology for anti-Leishmania IgG by ELISA in 15 positive dogs for L. infantum infection. Eight healthy dogs were included as negative controls. Among the 15 infected dogs, 13 were found positive in the ELISA (87%), 12 were PCR positive in the hair (80%), and 10 were positive in xenodiagnosis (67%). Positivity in the hair was associated with positivity in spleen (p=0.0003), seropositivity for antibodies (p=0.0006) and parasite transmission to L. longipalpis (p=0.0028). Considering the benefits to animal welfare and feasibility of hair sampling method, studies in larger and more diverse populations of naturally infected dogs from endemic areas should be conducted to evaluate the sensitivity, specificity, and predictive values of PCR using hair as a possible biomarker of infectiousness in dogs. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. Development and Synthesis of DNA-Encoded Benzimidazole Library.

    Science.gov (United States)

    Ding, Yun; Chai, Jing; Centrella, Paolo A; Gondo, Chenaimwoyo; DeLorey, Jennifer L; Clark, Matthew A

    2018-04-25

    Encoded library technology (ELT) is an effective approach to the discovery of novel small-molecule ligands for biological targets. A key factor for the success of the technology is the chemical diversity of the libraries. Here we report the development of DNA-conjugated benzimidazoles. Using 4-fluoro-3-nitrobenzoic acid as a key synthon, we synthesized a 320 million-member DNA-encoded benzimidazole library using Fmoc-protected amino acids, amines and aldehydes as diversity elements. Affinity selection of the library led to the discovery of a novel, potent and specific antagonist of the NK3 receptor.

  8. Transcriptionally Driven DNA Replication Program of the Human Parasite Leishmania major

    Directory of Open Access Journals (Sweden)

    Rodrigo Lombraña

    2016-08-01

    Full Text Available Faithful inheritance of eukaryotic genomes requires the orchestrated activation of multiple DNA replication origins (ORIs. Although origin firing is mechanistically conserved, how origins are specified and selected for activation varies across different model systems. Here, we provide a complete analysis of the nucleosomal landscape and replication program of the human parasite Leishmania major, building on a better evolutionary understanding of replication organization in Eukarya. We found that active transcription is a driving force for the nucleosomal organization of the L. major genome and that both the spatial and the temporal program of DNA replication can be explained as associated to RNA polymerase kinetics. This simple scenario likely provides flexibility and robustness to deal with the environmental changes that impose alterations in the genetic programs during parasitic life cycle stages. Our findings also suggest that coupling replication initiation to transcription elongation could be an ancient solution used by eukaryotic cells for origin maintenance.

  9. Molecular Detection of Leishmania DNA in Wild-Caught Phlebotomine Sand Flies (Diptera: Psychodidae) From a Cave in the State of Minas Gerais, Brazil.

    Science.gov (United States)

    Carvalho, G M L; Brazil, R P; Rêgo, F D; Ramos, M C N F; Zenóbio, A P L A; Andrade Filho, J D

    2017-01-01

    Leishmania spp. are distributed throughout the world, and different species are associated with varying degrees of disease severity. In Brazil, Leishmania transmission involves several species of phlebotomine sand flies that are closely associated with different parasites and reservoirs, and thereby giving rise to different transmission cycles. Infection occurs during the bloodmeals of sand flies obtained from a variety of wild and domestic animals, and sometimes from humans. The present study focused on detection of Leishmania DNA in phlebotomine sand flies from a cave in the state of Minas Gerais. Detection of Leishmania in female sand flies was performed with ITS1 PCR-RFLP (internal transcribed spacer 1) using HaeIII enzyme and genetic sequencing for SSUrRNA target. The survey of Leishmania DNA was carried out on 232 pools and the parasite DNA was detected in four: one pool of Lutzomyia cavernicola (Costa Lima, 1932), infected with Le. infantum (ITS1 PCR-RFLP), two pools of Evandromyia sallesi (Galvão & Coutinho, 1939), both infected with Leishmania braziliensis complex (SSUrRNA genetic sequencing analysis), and one pool of Sciopemyia sordellii (Shannon & Del Ponte, 1927), infected with subgenus Leishmania (SSUrRNA genetic sequencing analysis). The present study identified the species for Leishmania DNA detected in four pools of sand flies, all of which were captured inside the cave. These results represent the first molecular detection of Lu cavernicola with Le infantum DNA, Sc sordellii with subgenus Leishmania DNA, and Ev sallesi with Leishmania braziliensis complex DNA. The infection rate in females captured for this study was 0.17%. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  10. PCR associated with hybridization with DNA radioactive probes for diagnosis of asymptomatic infection caused by Leishmania Chagasi

    International Nuclear Information System (INIS)

    Andrade, Antero Silva Ribeiro de; Moreno, Elizabeth Castro; Gomes, Rosangela Fatima; Melo, Maria Norma de; Carneiro, Mariangela; Fernandes, Octavio

    2002-01-01

    Detection systems for diagnosis of leishmaniasis based on PCR are very promising due to their sensitivity and specificity. Secondary detection by specific radioactive DNA probes, able to type the PCR amplified products, increase the specificity and raise about tem-fold the sensitivity of the assay. The aim of this work was evaluate PCR and hybridization as a tool to identify Leishmania (Leishmania) chagasi (the specie that cause the visceral leishmaniasis in Brazil) infection in asymptomatic persons living in a endemic area. Material and Methods: A group of 226 asymptomatic individuals, living in General Carneiro (MG), was selected. Blood samples were harvested and the DNA extracted from the mononucleate cells. PCR was performed using primers addressed to the kinetoplast DNA minicircles. This protocol gives a positive reaction for all Leishmania species. The amplified products were further hybridized with cloned L.chagasi minicircles labeled with 32 P. Results: were identified 111 samples PCR positive, 2 of them hybridization negative and 133 samples hybridization positive, 24 of them PCR negative. The occurrence of samples with hybridization positive and PCR negative was expected since hybridization, with DNA probes labeled with 32 P, increase the sensitivity of the assay. The samples that presented positive PCR and negative hybridization were probably due the presence of other Leishmania species, likely L. (V.) braziliensis (that produce tegumentary leishmaniasis in the region), since L. (L.) chagasi cloned minicircles were used as hybridization probe. We conclude that this procedure is a valuable tool to access subclinical L. (L.) chagasi infections in epidemiological studies. (author)

  11. Structural insights into leishmanolysins encoded on chromosome 10 of Leishmania (Viannia braziliensis

    Directory of Open Access Journals (Sweden)

    Amanda Sutter

    Full Text Available BACKGROUND Leishmanolysins have been described as important parasite virulence factors because of their roles in the infection of promastigotes and resistance to host’s defenses. Leishmania (Viannia braziliensis contains several leishmanolysin genes in its genome, especially in chromosome 10. However, the functional impact of such diversity is not understood, but may be attributed partially to the lack of structural data for proteins from this parasite. OBJECTIVES This works aims to compare leishmanolysin sequences from L. (V. braziliensis and to understand how the diversity impacts in their structural and dynamic features. METHODS Leishmanolysin sequences were retrieved from GeneDB. Subsequently, 3D models were built using comparative modeling methods and their dynamical behavior was studied using molecular dynamic simulations. FINDINGS We identified three subgroups of leishmanolysins according to sequence variations. These differences directly affect the electrostatic properties of leishmanolysins and the geometry of their active sites. We identified two levels of structural heterogeneity that might be related to the ability of promastigotes to interact with a broad range of substrates. MAIN CONCLUSION Altogether, the structural plasticity of leishmanolysins may constitute an important evolutionary adaptation rarely explored when considering the virulence of L. (V. braziliensis parasites.

  12. Nuclear DNA polymerase beta from Leishmania infantum. Cloning, molecular analysis and developmental regulation

    Science.gov (United States)

    Taladriz, Soraya; Hanke, Tobias; Ramiro, María J.; García-Díaz, Miguel; Lacoba, Mario García de; Blanco, Luis; Larraga, Vicente

    2001-01-01

    We have identified a novel polymerase beta (Pol β)-like enzyme from Leishmania infantum, a parasite protozoon causing disease in humans. This protein, named Li Pol β, shows a nuclear localization that contrasts with the mitochondrial localization of Pol β from Crithidia fasciculata, a closely related parasite, the only polymerase β described so far in Trypanosomatidae. Li Pol β, that belongs to the DNA polymerase X family, displays an evolutionarily conserved Pol β-type DNA polymerase core, in which most of the key residues involved in DNA binding, nucleotide binding, dRPase and polymerization catalysis are conserved. In agreement with this, Li Pol β, overproduced in Escherichia coli, displayed intrinsic DNA polymerase activity. Cell synchronization experiments showed a correlation between both Li Pol β mRNA and protein levels along the parasite cell cycle. Analysis of these parameters at the different growth phases of the parasite, from the proliferative (non-infective) logarithmic phase to the non-dividing (highly infectious) stationary phase, showed high levels of Li Pol β at the infective phase of the parasite. The data suggest a role of Li Pol β in base excision repair in L.infantum, a parasite usually affected by oxygen stress environments into the macrophage host cells. PMID:11557814

  13. Detecção de DNA de Leishmania braziliensis em pacientes de leishmaniose tegumentar americana Detección de DNA de Leishmania braziliensis en pacientes de leishmaniose tegumentaria americana Detection of Leishmania braziliensis DNA in American tegumentary leishmaniasis patients

    Directory of Open Access Journals (Sweden)

    Leila Martins

    2010-06-01

    Full Text Available Foi realizado diagnóstico para leishmaniose tegumentar americana a partir de sangue de pacientes residentes em dois municípios endêmicos do estado de Pernambuco. O DNA de 119 amostras de sangue foi extraído e submetido a reação em cadeia da polimerase. Utilizaram-se primers do minicírculo do DNA do cinetoplasto (kDNA de Leishmania braziliensis, circulante em Pernambuco, cuja seqüência-alvo gera um fragmento de 750 pares de bases. No total 58 (48,7% indivíduos apresentaram amplificação positiva e 61 (51,3% negativa. Das amostras positivas para a PCR, 37 (≅ 64% pertenciam a indivíduos tratados e sem lesão. Conclui-se que a técnica de PCR é eficaz para identificar o DNA de leishmânia em material de biópsias e em sangue venoso.Fue realizado diagnóstico para leishmaniosis tegumentaria americana a partir de sangre de pacientes residentes en dos municipios endémicos del estado de Pernambuco (Noreste de Brasil. El DNA de 119 muestras de sangre fue extraído y sometido a la reacción en cadena de la polimerasa. Se utilizaron primers del minicírculo del DNA del cinetoplasto (kDNA de Leishmania braziliensis, circulante en Pernambuco, cuya secuencia blanco genera un fragmento de 750 pares de bases. En total 58 (48,7% individuos presentaron amplificación positiva y 61 (51,3% negativa. De las muestras positivas para la PCR, 37 (≅64% pertenecían a individuos tratados y sin lesión. Se concluyó que la técnica de la PCR es eficaz para identificar el DNA de Leishmania en material de biopsias y en sangre venosa.Diagnostic tests for American tegumentary leishmaniasis were performed on blood samples of patients living in two endemic municipalities in the state of Pernambuco, Northeastern Brazil. DNA was extracted from 119 samples and used as template for polymerase chain reaction (PCR analysis. The tests used primers specific for the kinetoplast mini-circle DNA (kDNA of Leishmania braziliensis, a species circulating in Pernambuco, which

  14. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1993-02-16

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a pu GOVERNMENT RIGHTS This application was funded under Department of Energy Contract DE-AC02-76ER01338. The U.S. Government has certain rights under this application and any patent issuing thereon.

  15. A Novel Audio Cryptosystem Using Chaotic Maps and DNA Encoding

    Directory of Open Access Journals (Sweden)

    S. J. Sheela

    2017-01-01

    Full Text Available Chaotic maps have good potential in security applications due to their inherent characteristics relevant to cryptography. This paper introduces a new audio cryptosystem based on chaotic maps, hybrid chaotic shift transform (HCST, and deoxyribonucleic acid (DNA encoding rules. The scheme uses chaotic maps such as two-dimensional modified Henon map (2D-MHM and standard map. The 2D-MHM which has sophisticated chaotic behavior for an extensive range of control parameters is used to perform HCST. DNA encoding technology is used as an auxiliary tool which enhances the security of the cryptosystem. The performance of the algorithm is evaluated for various speech signals using different encryption/decryption quality metrics. The simulation and comparison results show that the algorithm can achieve good encryption results and is able to resist several cryptographic attacks. The various types of analysis revealed that the algorithm is suitable for narrow band radio communication and real-time speech encryption applications.

  16. PCR associated with hybridization with DNA radioactive probes for diagnosis of asymptomatic infection caused by Leishmania Chagasi; PCR associado a hibridizacao com sondas radioativas de DNA para a identificacao de infeccao subclinica causada por Leishmania Chagasi

    Energy Technology Data Exchange (ETDEWEB)

    Andrade, Antero Silva Ribeiro de [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN), Belo Horizonte, MG (Brazil); Moreno, Elizabeth Castro [Fundacao Nacional de Saude, Belo Horizonte, MG (Brazil). Coordenacao Regional de Minas Gerais; Gomes, Rosangela Fatima; Melo, Maria Norma de; Carneiro, Mariangela [Minas Gerais Univ., Belo Horizonte, MG (Brazil). Dept. de Parasitologia; Fernandes, Octavio [Fundacao Inst. Oswaldo Cruz (FIOCRUZ), Rio de Janeiro, RJ (Brazil). Dept. de Medicina Tropical

    2002-07-01

    Detection systems for diagnosis of leishmaniasis based on PCR are very promising due to their sensitivity and specificity. Secondary detection by specific radioactive DNA probes, able to type the PCR amplified products, increase the specificity and raise about tem-fold the sensitivity of the assay. The aim of this work was evaluate PCR and hybridization as a tool to identify Leishmania (Leishmania) chagasi (the specie that cause the visceral leishmaniasis in Brazil) infection in asymptomatic persons living in a endemic area. Material and Methods: A group of 226 asymptomatic individuals, living in General Carneiro (MG), was selected. Blood samples were harvested and the DNA extracted from the mononucleate cells. PCR was performed using primers addressed to the kinetoplast DNA minicircles. This protocol gives a positive reaction for all Leishmania species. The amplified products were further hybridized with cloned L.chagasi minicircles labeled with {sup 32} P. Results: were identified 111 samples PCR positive, 2 of them hybridization negative and 133 samples hybridization positive, 24 of them PCR negative. The occurrence of samples with hybridization positive and PCR negative was expected since hybridization, with DNA probes labeled with {sup 32} P, increase the sensitivity of the assay. The samples that presented positive PCR and negative hybridization were probably due the presence of other Leishmania species, likely L. (V.) braziliensis (that produce tegumentary leishmaniasis in the region), since L. (L.) chagasi cloned minicircles were used as hybridization probe. We conclude that this procedure is a valuable tool to access subclinical L. (L.) chagasi infections in epidemiological studies. (author)

  17. Quantification of Leishmania infantum DNA in the bone marrow, lymph node and spleen of dogs.

    Science.gov (United States)

    Ramos, Rafael Antonio Nascimento; Ramos, Carlos Alberto do Nascimento; Santos, Edna Michelly de Sá; de Araújo, Flábio Ribeiro; de Carvalho, Gílcia Aparecida; Faustino, Maria Aparecida da Gloria; Alves, Leucio Câmara

    2013-01-01

    The aim of the present study was to quantify the parasite load of Leishmania infantum in dogs using real-time PCR (qPCR). Bone marrow, lymph node and spleen samples were taken from 24 dogs serologically positive for L. infantum that had been put down by the official epidemiological surveillance service. According to the clinical signs the dogs were classified as asymptomatic or symptomatic. After DNA extraction, the samples were subjected to qPCR to detect and quantify L. infantum DNA. Out of the 24 dogs, 12.5% (3/24) were classified as asymptomatic and 87.5% (21/24) as symptomatic. Real-time PCR detected L. infantum DNA in all the animals, in at least one biological sample. In particular, 100% of bone marrow and lymph node scored positive, whereas in spleen, the presence of DNA was detected in 95.9% (23/24). In addition, out of 24 animals, 15 were microscopically positive to amastigote forms of L. infantum in bone marrow. No statistical significant difference was found in the overall mean quantity of DNA among the different biological samples (P = 0.518). Considering each organ separately, there was 100% positivity in bone marrow and lymph nodes, while among the spleen samples, 95.9% (23/24) were positive. Regarding the different clinical groups, the overall mean parasite load varied significantly (P = 0.022). According to the results obtained, it was not possible determine which biological sample was most suitable tissue for the diagnosis, based only on the parasite load. Therefore, other characteristics such as convenience and easily of obtaining samples should be taken into consideration.

  18. Whatman Paper (FTA Cards for Storing and Transferring Leishmania DNA for PCR Examination

    Directory of Open Access Journals (Sweden)

    A Amin-Mohammadi

    2009-12-01

    Full Text Available "nBackground: Diagnosis of cutaneous leishmaniasis (CL is often made based on clinical manifesta­tion. Correct diagnosis and identification of the parasite are crucial for choosing the effective treat­ment and for epidemiological studies. On the other hand, determination of Leishmania species is nec­essary for designing appropriate control programs. Diagnosis by PCR is becoming a 'gold standard'. For PCR preparation, storage and shipments of specimens are necessary. In this study, Whatman filter paper (FTA Card was used to store and transfer samples for Leishmania identification using PCR. "nMethods: Among the patients who had CL lesion and referred to Parasitology Laboratory of Emam Reza Hospital, Mashhad, Iran, 44 consented cases with positive results in their direct smear were se­lected. An informed consent form and a questionnaire were completed and three different types of samples (direct smear, NNN culture, and spot on FTA card were collected. DNA extraction and PCR were carried out on three different samples from each patient. "nResults: PCR results using Whatman paper samples revealed a significant difference (P<0.0001 compared to the culture method but no significant difference was seen between PCR results using samples stored on Whatman paper and direct smears. "nConclusion: The use of FTA cards is simple, rapid, and cost-effective, and can be readily employed for large-scale population screening, especially for regions where the specimens are to be transported from distant places to the laboratory.

  19. Expression analysis of a ''Cucurbita'' cDNA encoding endonuclease

    International Nuclear Information System (INIS)

    Szopa, J.

    1995-01-01

    The nuclear matrices of plant cell nuclei display intrinsic nuclease activity which consists in nicking supercoiled DNA. A cDNA encoding a 32 kDa endonuclease has been cloned and sequenced. The nucleotide and deduced amino-acid sequences show high homology to known 14-3-3-protein sequences from other sources. The amino-acid sequence shows agreement with consensus sequences for potential phosphorylation by protein kinase A and C and for calcium, lipid and membrane-binding sites. The nucleotide-binding site is also present within the conserved part of the sequence. By Northern blot analysis, the differential expression of the corresponding mRNA was detected; it was the strongest in sink tissues. The endonuclease activity found on DNA-polyacrylamide gel electrophoresis coincided with mRNA content and was the highest in tuber. (author). 22 refs, 6 figs

  20. Transcriptionally Driven DNA Replication Program of the Human Parasite Leishmania major.

    Science.gov (United States)

    Lombraña, Rodrigo; Álvarez, Alba; Fernández-Justel, José Miguel; Almeida, Ricardo; Poza-Carrión, César; Gomes, Fábia; Calzada, Arturo; Requena, José María; Gómez, María

    2016-08-09

    Faithful inheritance of eukaryotic genomes requires the orchestrated activation of multiple DNA replication origins (ORIs). Although origin firing is mechanistically conserved, how origins are specified and selected for activation varies across different model systems. Here, we provide a complete analysis of the nucleosomal landscape and replication program of the human parasite Leishmania major, building on a better evolutionary understanding of replication organization in Eukarya. We found that active transcription is a driving force for the nucleosomal organization of the L. major genome and that both the spatial and the temporal program of DNA replication can be explained as associated to RNA polymerase kinetics. This simple scenario likely provides flexibility and robustness to deal with the environmental changes that impose alterations in the genetic programs during parasitic life cycle stages. Our findings also suggest that coupling replication initiation to transcription elongation could be an ancient solution used by eukaryotic cells for origin maintenance. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  1. Quantification of Leishmania infantum DNA in females, eggs and larvae of Rhipicephalus sanguineus

    Directory of Open Access Journals (Sweden)

    Otranto Domenico

    2011-04-01

    Full Text Available Background Leishmania infantum is a widespread parasite that affects dogs and humans worldwide. It is transmitted primarily by phlebotomine sand flies, but recently there has been much discussion on the role of the brown dog tick, Rhipicephalus sanguineus, as a potential vector for this protozoan. Recent laboratory and field investigations have contributed to this hypothesis, but a proof of the vector capacity of R. sanguineus has yet to be provided. Following a recent study suggesting that L. infantum passes transovarially from the female tick to her progeny the current study provides new evidence of the transovarial transmission of L. infantum in R. sanguineus. Methods Engorged females of R. sanguineus were collected from the environment in a dog shelter of southern Italy, where canine leishmaniosis is endemic. In the laboratory, 97 females that successfully laid eggs, their eggs and the originated larvae were subjected to DNA extraction and then tested by a TaqMan-based real time PCR targeting a fragment of the kinetoplast DNA (kDNA of L. infantum. Results and conclusions L. infantum kDNA was detected in engorged females, their eggs and originating larvae, with a parasite load ranging from 1.8 × 10-4 to 10.0 × 100. Certainly, the current study provides further evidence on the passage of L. infantum from R. sanguineus females to their offspring. The observation of promastigote forms in larvae is necessary to definitively confirm this hypothesis, which would raise interesting questions about the possible role of ticks in the maintenance of L. infantum infection among dogs in certain areas.

  2. The DNA-encoded nucleosome organization of a eukaryotic genome.

    Science.gov (United States)

    Kaplan, Noam; Moore, Irene K; Fondufe-Mittendorf, Yvonne; Gossett, Andrea J; Tillo, Desiree; Field, Yair; LeProust, Emily M; Hughes, Timothy R; Lieb, Jason D; Widom, Jonathan; Segal, Eran

    2009-03-19

    Nucleosome organization is critical for gene regulation. In living cells this organization is determined by multiple factors, including the action of chromatin remodellers, competition with site-specific DNA-binding proteins, and the DNA sequence preferences of the nucleosomes themselves. However, it has been difficult to estimate the relative importance of each of these mechanisms in vivo, because in vivo nucleosome maps reflect the combined action of all influencing factors. Here we determine the importance of nucleosome DNA sequence preferences experimentally by measuring the genome-wide occupancy of nucleosomes assembled on purified yeast genomic DNA. The resulting map, in which nucleosome occupancy is governed only by the intrinsic sequence preferences of nucleosomes, is similar to in vivo nucleosome maps generated in three different growth conditions. In vitro, nucleosome depletion is evident at many transcription factor binding sites and around gene start and end sites, indicating that nucleosome depletion at these sites in vivo is partly encoded in the genome. We confirm these results with a micrococcal nuclease-independent experiment that measures the relative affinity of nucleosomes for approximately 40,000 double-stranded 150-base-pair oligonucleotides. Using our in vitro data, we devise a computational model of nucleosome sequence preferences that is significantly correlated with in vivo nucleosome occupancy in Caenorhabditis elegans. Our results indicate that the intrinsic DNA sequence preferences of nucleosomes have a central role in determining the organization of nucleosomes in vivo.

  3. First Evidence of a Hybrid of Leishmania (Viannia) braziliensis/L. (V.) peruviana DNA Detected from the Phlebotomine Sand Fly Lutzomyia tejadai in Peru

    Science.gov (United States)

    Hashiguchi, Yoshihisa

    2016-01-01

    The natural infection of sand flies by Leishmania was examined in the Department of Huanuco of Peru, where cutaneous leishmaniasis caused by a hybrid of Leishmania (Viannia) braziliensis/L. (V.) peruviana is endemic. A total of 2,997 female sand flies were captured by CDC light traps and Shannon traps, of which 2,931 and 66 flies were identified as Lutzomyia tejadai and Lu fischeri, respectively. Using crude DNA extracted from individual sand flies as a template, Leishmania DNA was detected from one Lu. tejadai. The parasite species was identified as a hybrid of L. (V.) braziliensis/L. (V.) peruviana on the basis of cytochrome b and mannose phosphate isomerase gene analyses. The result suggested that Lu. tejadai is responsible for the transmission of the hybrid Leishmania circulating in this area. PMID:26735142

  4. Nuclear DNA replication and repair in parasites of the genus Leishmania: Exploiting differences to develop innovative therapeutic approaches.

    Science.gov (United States)

    Uzcanga, Graciela; Lara, Eliana; Gutiérrez, Fernanda; Beaty, Doyle; Beske, Timo; Teran, Rommy; Navarro, Juan-Carlos; Pasero, Philippe; Benítez, Washington; Poveda, Ana

    2017-03-01

    Leishmaniasis is a common tropical disease that affects mainly poor people in underdeveloped and developing countries. This largely neglected infection is caused by Leishmania spp, a parasite from the Trypanosomatidae family. This parasitic disease has different clinical manifestations, ranging from localized cutaneous to more harmful visceral forms. The main limitations of the current treatments are their high cost, toxicity, lack of specificity, and long duration. Efforts to improve treatments are necessary to deal with this infectious disease. Many approved drugs to combat diseases as diverse as cancer, bacterial, or viral infections take advantage of specific features of the causing agent or of the disease. Recent evidence indicates that the specific characteristics of the Trypanosomatidae replication and repair machineries could be used as possible targets for the development of new treatments. Here, we review in detail the molecular mechanisms of DNA replication and repair regulation in trypanosomatids of the genus Leishmania and the drugs that could be useful against this disease.

  5. Evaluation of PCR procedures for detecting and quantifying Leishmania donovani DNA in large numbers of dried human blood samples from a visceral leishmaniasis focus in Northern Ethiopia.

    Science.gov (United States)

    Abbasi, Ibrahim; Aramin, Samar; Hailu, Asrat; Shiferaw, Welelta; Kassahun, Aysheshm; Belay, Shewaye; Jaffe, Charles; Warburg, Alon

    2013-03-27

    Visceral Leishmaniasis (VL) is a disseminated protozoan infection caused by Leishmania donovani parasites which affects almost half a million persons annually. Most of these are from the Indian sub-continent, East Africa and Brazil. Our study was designed to elucidate the role of symptomatic and asymptomatic Leishmania donovani infected persons in the epidemiology of VL in Northern Ethiopia. The efficacy of quantitative real-time kinetoplast DNA/PCR (qRT-kDNA PCR) for detecting Leishmania donovani in dried-blood samples was assessed in volunteers living in an endemic focus. Of 4,757 samples, 680 (14.3%) were found positive for Leishmania k-DNA but most of those (69%) had less than 10 parasites/ml of blood. Samples were re-tested using identical protocols and only 59.3% of the samples with 10 parasite/ml or less were qRT-kDNA PCR positive the second time. Furthermore, 10.8% of the PCR negative samples were positive in the second test. Most samples with higher parasitemias remained positive upon re-examination (55/59 =93%). We also compared three different methods for DNA preparation. Phenol-chloroform was more efficient than sodium hydroxide or potassium acetate. DNA sequencing of ITS1 PCR products showed that 20/22 samples were Leishmania donovani while two had ITS1 sequences homologous to Leishmania major. Although qRT-kDNA PCR is a highly sensitive test, the dependability of low positives remains questionable. It is crucial to correlate between PCR parasitemia and infectivity to sand flies. While optimal sensitivity is achieved by targeting k-DNA, it is important to validate the causative species of VL by DNA sequencing.

  6. Characterization and immunological identification of cDNA clones encoding two human DNA topoisomerase II isozymes

    International Nuclear Information System (INIS)

    Chung, T.D.Y.; Drake, F.H.; Tan, K.B.; Per, S.R.; Crooke, S.T.; Mirabelli, C.K.

    1989-01-01

    Several DNA topoisomerase II partial cDNA clones obtained from a human Raji-HN2 cDNA library were sequenced and two classes of nucleotide sequences were found. One member of the first class, SP1, was identical to an internal fragment of human HeLa cell Topo II cDNA described earlier. A member of the second class, SP11, shared extensive nucleotide (75%) and predicted peptide (92%) sequence similarities with the first two-thirds of HeLa Topo II. Each class of cDNAs hybridized to unique, nonoverlapping restriction enzyme fragments of genomic DNA from several human cell lines. Synthetic 24-mer oligonucleotide probes specific for each cDNA class hybridized to 6.5-kilobase mRNAs; furthermore, hybridization of probe specific for one class was not blocked by probe specific for the other. Antibodies raised against a synthetic SP1-encoded dodecapeptide specifically recognized the 170-kDa form of Topo II, while antibodies raised against the corresponding SP11-encoded dodecapeptide, or a second unique SP11-encoded tridecapeptide, selectively recognized the 180-kDa form of Topo II. These data provide genetic and immunochemical evidence for two Topo II isozymes

  7. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  8. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  9. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  10. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  11. The Leishmania HSP20 Is Antigenic during Natural Infections, but, as DNA Vaccine, It does not Protect BALB/c Mice against Experimental L. amazonensis Infection

    Directory of Open Access Journals (Sweden)

    Ana M. Montalvo-Álvarez

    2008-01-01

    Full Text Available Protozoa of the genus Leishmania are causative agents of leishmaniasis, an important health problem in both human and veterinary medicine. Here, we describe a new heat shock protein (HSP in Leishmania, belonging to the small HSP (sHSP family in kinetoplastids. The protein is highly conserved in different Leishmania species, showing instead significant divergence with sHSP's from other organisms. The humoral response elicited against this protein during Leishmania infection has been investigated in natural infected humans and dogs, and in experimentally infected hamsters. Leishmania HSP20 is a prominent antigen for canine hosts; on the contrary, the protein seems to be a poor antigen for human immune system. Time-course analysis of appearance of anti-HSP20 antibodies in golden hamsters indicated that these antibodies are produced at late stages of the infection, when clinical symptoms of disease are patent. Finally, the protective efficacy of HSP20 was assessed in mice using a DNA vaccine approach prior to challenge with Leishmania amazonensis.

  12. Diversity patterns, Leishmania DNA detection, and bloodmeal identification of Phlebotominae sand flies in villages in northern Colombia.

    Science.gov (United States)

    González, Camila; León, Cielo; Paz, Andrea; López, Marla; Molina, Gisell; Toro, Diana; Ortiz, Mario; Cordovez, Juan Manuel; Atencia, María Claudia; Aguilera, Germán; Tovar, Catalina

    2018-01-01

    Leishmaniases are neglected tropical diseases exhibiting complex transmission cycles due to the number of parasite species circulating, sand fly species acting as vectors and infected mammals, including humans, which are defined in the New World as accidental hosts. However, current transmission scenarios are changing, and the disease is no longer exclusively related to forested areas but urban transmission foci occur, involving some species of domestic animals as suspected reservoirs. The aim of this study was to determine the transmission cycles in urban environments by evaluating sand fly diversity, detection of Leishmania DNA, and bloodmeal sources through intra and peridomestic collections. The study was carried out in Colombia, in 13 municipalities of Cordoba department, implementing a methodology that could be further used for the evaluation of vector-borne diseases in villages or towns. Our sampling design included 24 houses randomly selected in each of 15 villages distributed in 13 municipalities, which were sampled in two seasons in 2015 and 2016. Sand flies were collected using CDC light traps placed in intra and peridomestic habitats. In addition to the morphological identification, molecular identification through DNA barcodes was also performed. A total of 19,743 sand flies were collected and 13,848 of them (10,268 females and 3,580 males) were used in molecular procedures. Circulation of two known parasite species-Leishmania infantum and Leishmania panamensis was confirmed. Blood source analyses showed that sand flies fed on humans, particularly in the case of the known L. infantum vector, P. evansi; further analyses are advised to evaluate the reservoirs involved in parasite transmission. Our sampling design allowed us to evaluate potential transmission cycles on a department scale, by defining suspected vector species, parasite species present in different municipalities and feeding habits.

  13. Implementation of digital image encryption algorithm using logistic function and DNA encoding

    Science.gov (United States)

    Suryadi, MT; Satria, Yudi; Fauzi, Muhammad

    2018-03-01

    Cryptography is a method to secure information that might be in form of digital image. Based on past research, in order to increase security level of chaos based encryption algorithm and DNA based encryption algorithm, encryption algorithm using logistic function and DNA encoding was proposed. Digital image encryption algorithm using logistic function and DNA encoding use DNA encoding to scramble the pixel values into DNA base and scramble it in DNA addition, DNA complement, and XOR operation. The logistic function in this algorithm used as random number generator needed in DNA complement and XOR operation. The result of the test show that the PSNR values of cipher images are 7.98-7.99 bits, the entropy values are close to 8, the histogram of cipher images are uniformly distributed and the correlation coefficient of cipher images are near 0. Thus, the cipher image can be decrypted perfectly and the encryption algorithm has good resistance to entropy attack and statistical attack.

  14. Seasonality of sand flies (Diptera: Psychodidae) and Leishmania DNA detection in vector species in an area with endemic visceral leishmaniasis.

    Science.gov (United States)

    Saraiva, Lara; Leite, Camila Gonçalves; Lima, Ana Cristina Vianna Mariano da Rocha; Carvalho, Luiz Otávio Alves de; Pereira, Agnes Antônia Sampaio; Rugani, Jerônimo Marteleto Nunes; Rego, Felipe Dutra; Gontijo, Célia Maria Ferreira; Andrade, José Dilermando

    2017-04-01

    Leishmaniases are a serious health problem in southeast Brazil, including the city of Belo Horizonte (BH), Minas Gerais state (MG), where there are high rates of incidence and mortality due to visceral leishmaniases. BH is divided into nine sanitary districts (SD) of which one, the Venda Nova SD, was selected for this study because it has high rates of positivity for canine leishmaniasis and high incidence of human leishmaniasis. This study aimed to survey the sand fly fauna in Venda Nova SD from August 2011 to July 2013 and perform a descriptive analysis of the vector population. The sampling was carried out using automatic HP light traps at all covered areas of the Venda Nova SD, in a total of eighteen light traps. Sampled specimens were identified following Galati (2003), and females were submitted to molecular techniques for the detection and identification of Leishmania DNA. A simple environmental description was done for it area and Kernel estimation was used to infer vector density for each study site. A total of 2,427 sand fly specimens belonging to eight species and five genera were collected of which 95.3% were Lutzomyia longipalpis. The seasonal variation curve was delineated by this species. Lu. longipalpis was the most abundant at all collection points and in all months of the study, and exhibited a natural infection rate of 1.01% for Leishmania infantum and 1.77% for Leishmania braziliensis. The results show the presence and adaptation of Lu. longipalpis to the anthropic environment of BH and reinforces its role as the main vector of L. infantum in the region.

  15. Seasonality of sand flies (Diptera: Psychodidae) and Leishmania DNA detection in vector species in an area with endemic visceral leishmaniasis

    Science.gov (United States)

    Saraiva, Lara; Leite, Camila Gonçalves; Lima, Ana Cristina Vianna Mariano da Rocha; de Carvalho, Luiz Otávio Alves; Pereira, Agnes Antônia Sampaio; Rugani, Jerônimo Marteleto Nunes; Rego, Felipe Dutra; Gontijo, Célia Maria Ferreira; Andrade, José Dilermando

    2017-01-01

    BACKGROUND Leishmaniases are a serious health problem in southeast Brazil, including the city of Belo Horizonte (BH), Minas Gerais state (MG), where there are high rates of incidence and mortality due to visceral leishmaniases. BH is divided into nine sanitary districts (SD) of which one, the Venda Nova SD, was selected for this study because it has high rates of positivity for canine leishmaniasis and high incidence of human leishmaniasis. OBJECTIVES This study aimed to survey the sand fly fauna in Venda Nova SD from August 2011 to July 2013 and perform a descriptive analysis of the vector population. METHODS The sampling was carried out using automatic HP light traps at all covered areas of the Venda Nova SD, in a total of eighteen light traps. Sampled specimens were identified following Galati (2003), and females were submitted to molecular techniques for the detection and identification of Leishmania DNA. A simple environmental description was done for it area and Kernel estimation was used to infer vector density for each study site. FINDINGS A total of 2,427 sand fly specimens belonging to eight species and five genera were collected of which 95.3% were Lutzomyia longipalpis. The seasonal variation curve was delineated by this species. Lu. longipalpis was the most abundant at all collection points and in all months of the study, and exhibited a natural infection rate of 1.01% for Leishmania infantum and 1.77% for Leishmania braziliensis. MAIN CONCLUSIONS The results show the presence and adaptation of Lu. longipalpis to the anthropic environment of BH and reinforces its role as the main vector of L. infantum in the region. PMID:28327794

  16. Cloning of a Recombinant Plasmid Encoding Thiol-Specific Antioxidant Antigen (TSA) Gene of Leishmania majorand Expression in the Chinese Hamster Ovary Cell Line.

    Science.gov (United States)

    Fatemeh, Ghaffarifar; Fatemeh, Tabatabaie; Zohreh, Sharifi; Abdolhosein, Dalimiasl; Mohammad Zahir, Hassan; Mehdi, Mahdavi

    2012-01-01

    TSA (thiol-specific antioxidant antigen) is the immune-dominant antigen of Leishmania major and is considered to be the most promising candidate molecule for a recombinant or DNA vaccine against leishmaniasis. The aim of the present work was to express a plasmid containing the TSA gene in eukaryotic cells. Genomic DNA was extracted, and the TSA gene was amplified by polymerase chain reaction (PCR). The PCR product was cloned into the pTZ57R/T vector, followed by subcloning into the eukaryotic expression vector pcDNA3 (EcoRI and HindIII sites). The recombinant plasmid was characterised by restriction digest and PCR. Eukaryotic Chinese hamster ovary cells were transfected with the plasmid containing the TSA gene. Expression of the L. major TSA gene was confirmed by sodium dodecyl sulphate-polyacrylamide gel electrophoresis and Western blotting. The plasmid containing the TSA gene was successfully expressed, as demonstrated by a band of 22.1 kDa on Western blots. The plasmid containing the TSA gene can be expressed in a eukaryotic cell line. Thus, the recombinant plasmid may potentially be used as a DNA vaccine in animal models.

  17. Identification of a mammalian nuclear factor and human cDNA-encoded proteins that recognize DNA containing apurinic sites

    International Nuclear Information System (INIS)

    Lenz, J.; Okenquist, S.A.; LoSardo, J.E.; Hamilton, K.K.; Doetsch, P.W.

    1990-01-01

    Damage to DNA can have lethal or mutagenic consequences for cells unless it is detected and repaired by cellular proteins. Repair depends on the ability of cellular factors to distinguish the damaged sites. Electrophoretic binding assays were used to identify a factor from the nuclei of mammalian cells that bound to DNA containing apurinic sites. A binding assay based on the use of β-galactosidase fusion proteins was subsequently used to isolate recombinant clones of human cDNAs that encoded apurinic DNA-binding proteins. Two distinct human cDNAs were identified that encoded proteins that bound apurinic DNA preferentially over undamaged, methylated, or UV-irradiated DNA. These approaches may offer a general method for the detection of proteins that recognize various types of DNA damage and for the cloning of genes encoding such proteins

  18. Whatman Paper (FTA Cards) for Storing and Transferring Leishmania DNA for PCR Examination

    OpenAIRE

    A Amin-Mohammadi; E Eskandari; AA Akhavan; M Ganjbakhsh; Z Hosseininejad; M Afzalaghaei; F Berenji; M Mohajery; A Khamesipour; A Fata

    2009-01-01

    "nBackground: Diagnosis of cutaneous leishmaniasis (CL) is often made based on clinical manifesta­tion. Correct diagnosis and identification of the parasite are crucial for choosing the effective treat­ment and for epidemiological studies. On the other hand, determination of Leishmania species is nec­essary for designing appropriate control programs. Diagnosis by PCR is becoming a 'gold standard'. For PCR preparation, storage and shipments of specimens are necessary. In this study, ...

  19. Molecular cloning of growth hormone encoding cDNA of Indian

    Indian Academy of Sciences (India)

    A modified rapid amplification of cDNA ends (RACE) strategy has been developed for cloning highly conserved cDNA sequences. Using this modified method, the growth hormone (GH) encoding cDNA sequences of Labeo rohita, Cirrhina mrigala and Catla catla have been cloned, characterized and overexpressed in ...

  20. Accuracy of qPCR for quantifying Leishmania kDNA in different skin layers of patients with American tegumentary leishmaniasis.

    Science.gov (United States)

    Sevilha-Santos, L; Dos Santos Júnior, A C M; Medeiros-Silva, V; Bergmann, J O; da Silva, E F; Segato, L F; Arabi, A Y M; de Paula, N A; Sampaio, R N R; Lima, B D; Gomes, C M

    2018-05-03

    Superficial swab sampling of American tegumentary leishmaniasis (ATL) lesions shows higher amounts of Leishmania than those from biopsy. Subcutaneous involvement is also important in ATL, but parasite quantification according to lesion depth has not been evaluated. We aim to present the best depth at which sampling should be performed for molecular exams of ATL. Patients with a clinical presentation compatible with ATL were allocated to ATL and control groups. Qualitative and quantitative qPCR assays were performed using SYBR Green and primers amplifying the kDNA minicircle of Leishmania spp. in different skin layers, including the epidermis, the superior dermis, the inferior dermis, and the hypodermis. Fifty-nine patients were included in this study, including 40 who had been diagnosed with ATL and 19 controls. The number of parasites was greater in samples of the epidermis and superior dermis (159.1 × 10 6 , range 4.0-781.7, and 75.4 × 10 6 , range 8.0-244.5, mean Leishmania parasite equivalents per μg of tissue DNA, respectively) than those in samples of the inferior dermis and hypodermis (54.6, range 8.0-256.6, and 16.8 × 10 6 , range 8.0-24.1, mean Leishmania parasite equivalents per μg of tissue DNA, respectively). The best diagnostic accuracy was achieved in the superior dermis (77.9%) and was significantly greater than that in the hypodermis (63.3%; p 0.039). We conclude that superficial sampling can retrieve a greater quantity of parasites. Future studies of the role of transepidermal elimination as a mechanism of host defence in ATL must be performed as there is a considerable quantity of Leishmania kDNA in the epidermis. Copyright © 2018 European Society of Clinical Microbiology and Infectious Diseases. Published by Elsevier Ltd. All rights reserved.

  1. Molecular characterization of a Leishmania donovani cDNA clone with similarity to human 20S proteasome a-type subunit

    DEFF Research Database (Denmark)

    Christensen, C B; Jørgensen, L; Jensen, A T

    2000-01-01

    Using plasma from patients infected or previously infected with Leishmania donovanii, we isolated a L. donovanii cDNA clone with similarity to the proteasome a-type subunit from humans and other eukaryotes. The cDNA clone, designated LePa, was DNA sequenced and Northern blot analysis of L....... donovanii poly(A(+))mRNA indicated the isolation of a full length cDNA clone with a transcript size of 1.9 kb. The expressed recombinant LePa fusion protein induced proliferation of peripheral blood mononuclear cells in one out of seven patients who had suffered from visceral leishmaniasis. Plasma from 16...

  2. Isolation and characterisation of the cDNA encoding a glycosylated accessory protein of pea chloroplast DNA polymerase.

    OpenAIRE

    Gaikwad, A; Tewari, K K; Kumar, D; Chen, W; Mukherjee, S K

    1999-01-01

    The cDNA encoding p43, a DNA binding protein from pea chloroplasts (ct) that binds to cognate DNA polymerase and stimulates the polymerase activity, has been cloned and characterised. The characteristic sequence motifs of hydroxyproline-rich glyco-proteins (HRGP) are present in the cDNA corres-ponding to the N-terminal domain of the mature p43. The protein was found to be highly O-arabinosylated. Chemically deglycosylated p43 (i.e. p29) retains its binding to both DNA and pea ct-DNA polymeras...

  3. DNA sequencing confirms the involvement of Leishmania (L. amazonensis in american tegumentary leishmaniasis in the state of São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Angela Rapela Medeiros

    2008-01-01

    Full Text Available INTRODUCTION: American tegumentary leishmaniasis (ATL represents one of the most important public health issues in the world. An increased number of autochthonous cases of ATL in the Northeastern region of São Paulo State has been documented in the last few years, leading to a desire to determine the Leishmania species implicated. METHODS: PCR followed by DNA sequencing was carried out to identify a 120bp fragment from the universal kDNA minicircle of the genus Leishmania in 61 skin or mucosal biopsies from patients with ATL. RESULTS: DNA sequencing permitted the identification of a particular 15bp fragment (5' …GTC TTT GGG GCA AGT... 3' in all samples. Analysis by the neighbor-joining method showed the occurrence of two distinct groups related to the genus Viannia (V and Leishmania (L, each with two subgroups. Autochthonous cases with identity to a special Leishmania sequence not referenced in Genbank predominated in subgroup V.1, suggesting the possible existence of a subtype or mutation of Leishmania Viannia in this region. In the subgroup L.2, which showed identity with a known sequence of L. (L. amazonensis, there was a balanced distribution of autochthonous and non-autochthonous cases, including the mucosal and mucocutaneus forms in four patients. The last observation may direct us to new concepts, since the mucosal compromising has commonly been attributed to L. (V. braziliensis, even though L. (L. amazonensis is more frequent in the Amazonian region. CONCLUSIONS: These results confirm the pattern of distribution and possible mutations of these species, as well as the change in the clinical form presentation of ATL in the São Paulo State.

  4. Detection of DNA from Leishmania (Viannia: accuracy of polymerase chain reaction for the diagnosis of cutaneous leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Herintha Coeto Neitzke-Abreu

    Full Text Available Cutaneous leishmaniasis (CL can occur in skin and mucosa, causing disfiguring lesions. The laboratory diagnosis of CL involves immunological methods and optical detection of the parasite, al of which have limitations. There is a need for more effective diagnostic methods for CL which wil allow treatment to be initiated more promptly in order to help prevent the development of severe forms of mucosal disease, and to estimate the prognosis of the infection. The polymerase chain reaction (PCR has been widely used to diagnose CL, because of its higher sensitivity. This study estimated the accuracy and compared PCRs of samples from lesion scarification (PCR-L and blood sample-enriched leukocytes (PCR-B with three conventional diagnostic techniques: parasite direct search (DS, Montenegro skin test (MST, and indirect immunofluorescence reaction (IIF. The study included 276 patients under suspicion of CL. We conducted a cross-sectional study, in which patients were selected by convenience sampling. We used MP3H/MP1L primers to generate a Leishmania (Viannia (minicircle kDNA fragment of 70-bp. Of 106 patients with CL, 83.87%, 51.67%, 64.52%, 85.71%, or 96.10% tested positive by PCR-L, PCR-B, DS, IIF, or MST, respectively. Five patients tested positive only by PCR-L, and two other patients only by PCR-B. PCR-L is indicated for use in patients with chronic lesions or Leishmania reinfection, which may progress to mucosal lesion. PCR-B is indicated for use in patients with negative results in conventional tests or for patients with no apparent lesion. PCR is not only useful in diagnosing CL but also helps to identify the infecting species.

  5. TLR1/2 activation during heterologous prime-boost vaccination (DNA-MVA enhances CD8+ T Cell responses providing protection against Leishmania (Viannia.

    Directory of Open Access Journals (Sweden)

    Asha Jayakumar

    2011-06-01

    Full Text Available Leishmania (Viannia parasites present particular challenges, as human and murine immune responses to infection are distinct from other Leishmania species, indicating a unique interaction with the host. Further, vaccination studies utilizing small animal models indicate that modalities and antigens that prevent infection by other Leishmania species are generally not protective.Using a newly developed mouse model of chronic L. (Viannia panamensis infection and the heterologous DNA prime - modified vaccinia virus Ankara (MVA boost vaccination modality, we examined whether the conserved vaccine candidate antigen tryparedoxin peroxidase (TRYP could provide protection against infection/disease.Heterologous prime - boost (DNA/MVA vaccination utilizing TRYP antigen can provide protection against disease caused by L. (V. panamensis. However, protection is dependent on modulating the innate immune response using the TLR1/2 agonist Pam3CSK4 during DNA priming. Prime-boost vaccination using DNA alone fails to protect. Prior to infection protectively vaccinated mice exhibit augmented CD4 and CD8 IFNγ and memory responses as well as decreased IL-10 and IL-13 responses. IL-13 and IL-10 have been shown to be independently critical for disease in this model. CD8 T cells have an essential role in mediating host defense, as CD8 depletion reversed protection in the vaccinated mice; vaccinated mice depleted of CD4 T cells remained protected. Hence, vaccine-induced protection is dependent upon TLR1/2 activation instructing the generation of antigen specific CD8 cells and restricting IL-13 and IL-10 responses.Given the general effectiveness of prime-boost vaccination, the recalcitrance of Leishmania (Viannia to vaccine approaches effective against other species of Leishmania is again evident. However, prime-boost vaccination modality can with modulation induce protective responses, indicating that the delivery system is critical. Moreover, these results suggest that

  6. Designing universal primers for the isolation of DNA sequences encoding Proanthocyanidins biosynthetic enzymes in Crataegus aronia

    Directory of Open Access Journals (Sweden)

    Zuiter Afnan

    2012-08-01

    Full Text Available Abstract Background Hawthorn is the common name of all plant species in the genus Crataegus, which belongs to the Rosaceae family. Crataegus are considered useful medicinal plants because of their high content of proanthocyanidins (PAs and other related compounds. To improve PAs production in Crataegus tissues, the sequences of genes encoding PAs biosynthetic enzymes are required. Findings Different bioinformatics tools, including BLAST, multiple sequence alignment and alignment PCR analysis were used to design primers suitable for the amplification of DNA fragments from 10 candidate genes encoding enzymes involved in PAs biosynthesis in C. aronia. DNA sequencing results proved the utility of the designed primers. The primers were used successfully to amplify DNA fragments of different PAs biosynthesis genes in different Rosaceae plants. Conclusion To the best of our knowledge, this is the first use of the alignment PCR approach to isolate DNA sequences encoding PAs biosynthetic enzymes in Rosaceae plants.

  7. A Novel Image Encryption Algorithm Based on DNA Encoding and Spatiotemporal Chaos

    Directory of Open Access Journals (Sweden)

    Chunyan Song

    2015-10-01

    Full Text Available DNA computing based image encryption is a new, promising field. In this paper, we propose a novel image encryption scheme based on DNA encoding and spatiotemporal chaos. In particular, after the plain image is primarily diffused with the bitwise Exclusive-OR operation, the DNA mapping rule is introduced to encode the diffused image. In order to enhance the encryption, the spatiotemporal chaotic system is used to confuse the rows and columns of the DNA encoded image. The experiments demonstrate that the proposed encryption algorithm is of high key sensitivity and large key space, and it can resist brute-force attack, entropy attack, differential attack, chosen-plaintext attack, known-plaintext attack and statistical attack.

  8. Submicrometre geometrically encoded fluorescent barcodes self-assembled from DNA

    Science.gov (United States)

    Lin, Chenxiang; Jungmann, Ralf; Leifer, Andrew M.; Li, Chao; Levner, Daniel; Church, George M.; Shih, William M.; Yin, Peng

    2012-10-01

    The identification and differentiation of a large number of distinct molecular species with high temporal and spatial resolution is a major challenge in biomedical science. Fluorescence microscopy is a powerful tool, but its multiplexing ability is limited by the number of spectrally distinguishable fluorophores. Here, we used (deoxy)ribonucleic acid (DNA)-origami technology to construct submicrometre nanorods that act as fluorescent barcodes. We demonstrate that spatial control over the positioning of fluorophores on the surface of a stiff DNA nanorod can produce 216 distinct barcodes that can be decoded unambiguously using epifluorescence or total internal reflection fluorescence microscopy. Barcodes with higher spatial information density were demonstrated via the construction of super-resolution barcodes with features spaced by ˜40 nm. One species of the barcodes was used to tag yeast surface receptors, which suggests their potential applications as in situ imaging probes for diverse biomolecular and cellular entities in their native environments.

  9. DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

    Science.gov (United States)

    Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

    2018-06-27

    DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

  10. Enhanced immunogenicity of DNA fusion vaccine encoding secreted hepatitis B surface antigen and chemokine RANTES

    International Nuclear Information System (INIS)

    Kim, Seung Jo; Suh, Dongchul; Park, Sang Eun; Park, Jeong-Sook; Byun, Hyang-Min; Lee, Chan; Lee, Sun Young; Kim, Inho; Oh, Yu-Kyoung

    2003-01-01

    To increase the potency of DNA vaccines, we constructed genetic fusion vaccines encoding antigen, secretion signal, and/or chemokine RANTES. The DNA vaccines encoding secreted hepatitis B surface antigen (HBsAg) were constructed by inserting HBsAg gene into an expression vector with an endoplasmic reticulum (ER)-targeting secretory signal sequence. The plasmid encoding secretory HBsAg (pER/HBs) was fused to cDNA of RANTES, generating pER/HBs/R. For comparison, HBsAg genes were cloned into pVAX1 vector with no signal sequence (pHBs), and further linked to the N-terminus of RANTES (pHBs/R). Immunofluorescence study showed the cytoplasmic localization of HBsAg protein expressed from pHBs and pHBs/R, but not from pER/HBs and pER/HBs/R at 48 h after transfection. In mice, RANTES-fused DNA vaccines more effectively elicited the levels of HBsAg-specific IgG antibodies than pHBs. All the DNA vaccines induced higher levels of IgG 2a rather than IgG 1 antibodies. Of RANTES-fused vaccines, pER/HBs/R encoding the secreted fusion protein revealed much higher humoral and CD8 + T cell-stimulating responses compared to pHBs/R. These results suggest that the immunogenicity of DNA vaccines could be enhanced by genetic fusion to a secretory signal peptide sequence and RANTES

  11. DNA Encoding Training Using 3D Gesture Interaction.

    Science.gov (United States)

    Nicola, Stelian; Handrea, Flavia-Laura; Crişan-Vida, Mihaela; Stoicu-Tivadar, Lăcrămioara

    2017-01-01

    The work described in this paper summarizes the development process and presents the results of a human genetics training application, studying the 20 amino acids formed by the combination of the 3 nucleotides of DNA targeting mainly medical and bioinformatics students. Currently, the domain applications using recognized human gestures of the Leap Motion sensor are used in molecules controlling and learning from Mendeleev table or in visualizing the animated reactions of specific molecules with water. The novelty in the current application consists in using the Leap Motion sensor creating new gestures for the application control and creating a tag based algorithm corresponding to each amino acid, depending on the position in the 3D virtual space of the 4 nucleotides of DNA and their type. The team proposes a 3D application based on Unity editor and on Leap Motion sensor where the user has the liberty of forming different combinations of the 20 amino acids. The results confirm that this new type of study of medicine/biochemistry using the Leap Motion sensor for handling amino acids is suitable for students. The application is original and interactive and the users can create their own amino acid structures in a 3D-like environment which they could not do otherwise using traditional pen-and-paper.

  12. Biomolecule-to-fluorescent-color encoder: modulation of fluorescence emission via DNA structural changes

    Science.gov (United States)

    Nishimura, Takahiro; Ogura, Yusuke; Yamada, Kenji; Ohno, Yuko; Tanida, Jun

    2014-01-01

    A biomolecule-to-fluorescent-color (B/F) encoder for optical readout of biomolecular information is proposed. In the B/F encoder, a set of fluorescence wavelengths and their intensity levels are used for coding of a biomolecular signal. A hybridization chain reaction of hairpin DNAs labeled with fluorescent reporters was performed to generate the fluorescence color codes. The fluorescence is modulated via fluorescence resonance energy transfer, which is controlled by DNA structural changes. The results demonstrate that fluorescent color codes can be configured based on two wavelengths and five intensities using the B/F encoder, and the assigned codes can be retrieved via fluorescence measurements. PMID:25071950

  13. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  14. Immunogenicity of DNA vaccines encoding simian immunodeficiency virus antigen targeted to dendritic cells in rhesus macaques.

    Directory of Open Access Journals (Sweden)

    Matthias Tenbusch

    Full Text Available BACKGROUND: Targeting antigens encoded by DNA vaccines to dendritic cells (DCs in the presence of adjuvants enhances their immunogenicity and efficacy in mice. METHODOLOGY/PRINCIPAL FINDINGS: To explore the immunogenicity of this approach in non-human primates, we generated a single chain antibody to the antigen uptake receptor DEC-205 expressed on rhesus macaque DCs. DNA vaccines encoding this single chain antibody fused to the SIV capsid protein were delivered to six monkeys each by either intramuscular electroporation or conventional intramuscular injection co-injected or not with poly ICLC, a stabilized poly I: C analogue, as adjuvant. Antibodies to capsid were induced by the DC-targeting and non-targeting control DNA delivered by electroporation while conventional DNA immunization at a 10-fold higher dose of DNA failed to induce detectable humoral immune responses. Substantial cellular immune responses were also observed after DNA electroporation of both DNAs, but stronger responses were induced by the non-targeting vaccine. Conventional immunization with the DC-targeting DNA at a 10-fold higher dose did not give rise to substantial cellular immune responses, neither when co-injected with poly ICLC. CONCLUSIONS/SIGNIFICANCE: The study confirms the potent immunogenicity of DNA vaccines delivered by electroporation. Targeting the DNA via a single chain antibody to DEC-205 expressed by DCs, however, does not improve the immunogenicity of the antigens in non-human primates.

  15. Isolation and characterization of two cDNA clones encoding for glutamate dehydrogenase in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Ficarelli, A; Tassi, F; Restivo, F M

    1999-03-01

    We have isolated two full length cDNA clones encoding Nicotiana plumbaginifolia NADH-glutamate dehydrogenase. Both clones share amino acid boxes of homology corresponding to conserved GDH catalytic domains and putative mitochondrial targeting sequence. One clone shows a putative EF-hand loop. The level of the two transcripts is affected differently by carbon source.

  16. Phlebotomine sandfly (Diptera: Psychodidae) diversity and their Leishmania DNA in a hot spot of American Cutaneous Leishmaniasis human cases along the Brazilian border with Peru and Bolivia.

    Science.gov (United States)

    Teles, Carolina Bioni Garcia; Santos, Ana Paula de Azevedo Dos; Freitas, Rui Alves; Oliveira, Arley Faria José de; Ogawa, Guilherme Maerschner; Rodrigues, Moreno Souza; Pessoa, Felipe Arley Costa; Medeiros, Jansen Fernandes; Camargo, Luís Marcelo Aranha

    2016-06-10

    In this study, we identified the phlebotomine sandfly vectors involved in the transmission of American Cutaneous Leishmaniasis (ACL) in Assis Brasil, Acre, Brazil, which is located on the Brazil-Peru-Bolivia frontier. The genotyping of Leishmania in phlebotomines was performed using polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism. A total of 6,850 sandflies comprising 67 species were captured by using CDC light traps in rural areas of the municipality. Three sandfly species were found in the state of Acre for the first time: Lutzomyia georgii, Lu. complexa and Lu. evangelistai. The predominant species was Lu. auraensis/Lu. ruifreitasi and Lu. davisi (total 59.27%). 32 of 368 pools were positive for the presence of Leishmania DNA (16 pools corresponding to Lu. davisi, and 16 corresponding to Lu. auraensis/Lu. ruifreitasi), with a minimal infection prevalence of 1.85% in Lu. davisi and 2.05% in Lu. auraensis/Lu. ruifreitasi. The Leishmania species found showed maximum identity with L. (Viannia) guyanensis and L. (V.) braziliensis in both phlebotomine species. Based on these results and similar scenarios previously described along the Brazil/Peru/Bolivia tri-border, the studied area must take into consideration the possibility of Lu. davisi and Lu. auraensis/Lu. ruifreitasi as probable vectors of ACL in this municipality.

  17. Phlebotomine sandfly (Diptera: Psychodidae) diversity and their Leishmania DNA in a hot spot of American Cutaneous Leishmaniasis human cases along the Brazilian border with Peru and Bolivia

    Science.gov (United States)

    Teles, Carolina Bioni Garcia; dos Santos, Ana Paula de Azevedo; Freitas, Rui Alves; de Oliveira, Arley Faria José; Ogawa, Guilherme Maerschner; Rodrigues, Moreno Souza; Pessoa, Felipe Arley Costa; Medeiros, Jansen Fernandes; Camargo, Luís Marcelo Aranha

    2016-01-01

    In this study, we identified the phlebotomine sandfly vectors involved in the transmission of American Cutaneous Leishmaniasis (ACL) in Assis Brasil, Acre, Brazil, which is located on the Brazil-Peru-Bolivia frontier. The genotyping of Leishmania in phlebotomines was performed using polymerase chain reaction (PCR) and PCR-restriction fragment length polymorphism. A total of 6,850 sandflies comprising 67 species were captured by using CDC light traps in rural areas of the municipality. Three sandfly species were found in the state of Acre for the first time: Lutzomyia georgii, Lu. complexa and Lu. evangelistai. The predominant species was Lu. auraensis/Lu. ruifreitasi and Lu. davisi (total 59.27%). 32 of 368 pools were positive for the presence of Leishmania DNA (16 pools corresponding to Lu. davisi, and 16 corresponding to Lu. auraensis/Lu. ruifreitasi), with a minimal infection prevalence of 1.85% in Lu. davisi and 2.05% in Lu. auraensis/Lu. ruifreitasi. The Leishmania species found showed maximum identity with L. (Viannia) guyanensis and L. (V.) braziliensis in both phlebotomine species. Based on these results and similar scenarios previously described along the Brazil/Peru/Bolivia tri-border, the studied area must take into consideration the possibility of Lu. davisi and Lu. auraensis/Lu. ruifreitasi as probable vectors of ACL in this municipality. PMID:27304023

  18. Palladium polypyridyl complexes: synthesis, characterization, DNA interaction and biological activity on Leishmania (L.) mexicana

    Energy Technology Data Exchange (ETDEWEB)

    Navarro, Maribel [Instituto Venezolano de Investigaciones Cientificas, Caracas (Venezuela). Centro de Quimica; Betancourt, Adelmo [Universidad de Carabobo, Valencia (Venezuela). Facultad Experimental de Ciencia y Tecnologia. Dept. de Quimica; Hernandez, Clara [Universidad de Carabobo Sede Aragua, Maracay (Venezuela). Facultad de Ciencias de la Salud. Dept. de Ciencias Basicas; Marchan, Edgar [Universidad de Oriente, Cumana (Venezuela). Inst. de Investigaciones en Biomedicina y Ciencias Aplicadas. Nucleo de Sucre

    2008-07-01

    This paper describes the search for new potential chemotherapeutic agents based on transition metal complexes with planar ligands. In this study, palladium polypyridyl complexes were synthesized and characterized by elemental analysis, NMR, UV-VIS and IR spectroscopies. The interaction of the complexes with DNA was also investigated by spectroscopic methods. All metal-to-ligand charge transfer (MLCT) bands of the palladium polypyridyl complexes exhibited hypochromism and red shift in the presence of DNA. The binding constant and viscosity data suggested that the complexes [PdCl{sub 2}(phen)] and [PdCl{sub 2}(phendiamine)] interact with DNA by electrostatic forces. Additionally, these complexes induced an important leishmanistatic effect on L. (L.) mexicana promastigotes at the final concentration of 10 {mu}mol L{sup -1} in 48 h. (author)

  19. Palladium polypyridyl complexes: synthesis, characterization, DNA interaction and biological activity on Leishmania (L.) mexicana

    International Nuclear Information System (INIS)

    Navarro, Maribel; Betancourt, Adelmo; Hernandez, Clara; Marchan, Edgar

    2008-01-01

    This paper describes the search for new potential chemotherapeutic agents based on transition metal complexes with planar ligands. In this study, palladium polypyridyl complexes were synthesized and characterized by elemental analysis, NMR, UV-VIS and IR spectroscopies. The interaction of the complexes with DNA was also investigated by spectroscopic methods. All metal-to-ligand charge transfer (MLCT) bands of the palladium polypyridyl complexes exhibited hypochromism and red shift in the presence of DNA. The binding constant and viscosity data suggested that the complexes [PdCl 2 (phen)] and [PdCl 2 (phendiamine)] interact with DNA by electrostatic forces. Additionally, these complexes induced an important leishmanistatic effect on L. (L.) mexicana promastigotes at the final concentration of 10 μmol L -1 in 48 h. (author)

  20. High density of Leishmania major and rarity of other mammals' Leishmania in zoonotic cutaneous leishmaniasis foci, Iran.

    Science.gov (United States)

    Bordbar, Ali; Parvizi, Parviz

    2014-03-01

    Only Leishmania major is well known as a causative agent of zoonotic cutaneous leishmaniasis (ZCL) in Iran. Our objective was to find Leishmania parasites circulating in reservoir hosts, sand flies and human simultaneously. Sand flies, rodents and prepared smears of humans were sampled. DNA of Leishmania parasites was extracted, and two fragments of ITS-rDNA gene amplified by PCR. RFLP and sequencing were employed to identify Leishmania parasites. Leishmania major and L. turanica were identified unequivocally by targeting and sequencing ITS-rDNA from humans, rodents and sand flies. The new Leishmania species close to gerbilli (GenBank Accession Nos. EF413076; EF413087) was discovered only in sand flies. Based on parasite detection of ITS-rDNA in main and potential reservoir hosts and vectors and humans, we conclude that at least two Leishmania species are common in the Turkmen Sahra ZCL focus. Phylogenetic analysis proved that the new Leishmania is closely related to Leishmania mammal parasites (Leishmania major, Leishmania turanica, Leishmania gerbilli). Its role as a principal agent of ZCL is unknown because it was found only in sand flies. Our findings shed new light on the transmission cycles of several Leishmania parasites in sand flies, reservoir hosts and humans. © 2014 John Wiley & Sons Ltd.

  1. Encoded novel forms of HSP70 or a cytolytic protein increase DNA vaccine potency.

    Science.gov (United States)

    Garrod, Tamsin; Grubor-Bauk, Branka; Yu, Stanley; Gargett, Tessa; Gowans, Eric J

    2014-01-01

    In humans, DNA vaccines have failed to demonstrate the equivalent levels of immunogenicity that were shown in smaller animals. Previous studies have encoded adjuvants, predominantly cytokines, within these vaccines in an attempt to increase antigen-specific immune responses. However, these strategies have lacked breadth of innate immune activation and have led to disappointing results in clinical trials. Damage associated molecular patterns (DAMPs) have been identified as pattern recognition receptor (PRR) agonists. DAMPs can bind to a wide range of PRRs on dendritic cells (DCs) and thus our studies have aimed to utilize this characteristic to act as an adjuvant in a DNA vaccine approach. Specifically, HSP70 has been identified as a DAMP, but has been limited by its lack of accessibility to PRRs in and on DCs. Here, we discuss the promising results achieved with the inclusion of membrane-bound or secreted HSP70 into a DNA vaccine encoding HIV gag as the model immunogen.

  2. Investigation of Double-Band Electrophoretic Pattern of ITS-rDNA Region in Iranian Isolates of Leishmania Tropica

    Directory of Open Access Journals (Sweden)

    MA Ghatee

    2013-06-01

    Full Text Available Background: Leishmania tropica is a genetically divergent species. Amplification of entire internal tran­scribed spacer (ITS region of L. tropica isolates obtained from Bam district, one of the well known focus of anthroponotic cutaneous leishmaniasis ACL( in Iran, revealed a double-band pat­tern in agarose gel electrophoresis. This study explains how this pattern occurs.Methods: Twenty seven L. tropica smear preparations were collected from Bam district, south east Iran, and eight L. major and one L. infantum smear preparations were gathered from Shiraz, south west Iran. Furthermore one L. major and one L. infantum cultured standard strains were tested using entire ITS-PCR to survey their electrophoretic pattern. The ITS sequences of L. tropica, L. major, and L. infantum already deposited in GenBank were analyzed. Analysis of GenBank sequences of L. tropica revealed two groups of sequences based on length size, one group having a 100 bp gap. Therefore, a new re­verse primer namely LITS-MG was designed to exclude this gap in PCR products.Results: Whole ITS fragment amplification resulted in a double-band pattern in all L. tropica cases, while a sharp single band was observed for L. infantum and L. major isolates. This result was correspond­ing to the result obtained from in silico analysis of GenBank sequences. Use of LITS-MG primer was expectedly resulted in a single band including ITS1, 5.8s and partial ITS2 product for L. tropica which is appropriate for following molecular studies such as sequencing or restriction analysis.Conclusion: Sequences analysis of GenBank L. tropica sequences and following practical laboratory tests revealed at least two alleles in L. tropica which were confirmed in Bam isolates. This especial double-band pattern is because of a 100 bp fragment difference within ITS-rDNA alleles

  3. Multi-Probe Based Artificial DNA Encoding and Matching Classifier for Hyperspectral Remote Sensing Imagery

    Directory of Open Access Journals (Sweden)

    Ke Wu

    2016-08-01

    Full Text Available In recent years, a novel matching classification strategy inspired by the artificial deoxyribonucleic acid (DNA technology has been proposed for hyperspectral remote sensing imagery. Such a method can describe brightness and shape information of a spectrum by encoding the spectral curve into a DNA strand, providing a more comprehensive way for spectral similarity comparison. However, it suffers from two problems: data volume is amplified when all of the bands participate in the encoding procedure and full-band comparison degrades the importance of bands carrying key information. In this paper, a new multi-probe based artificial DNA encoding and matching (MADEM method is proposed. In this method, spectral signatures are first transformed into DNA code words with a spectral feature encoding operation. After that, multiple probes for interesting classes are extracted to represent the specific fragments of DNA strands. During the course of spectral matching, the different probes are compared to obtain the similarity of different types of land covers. By computing the absolute vector distance (AVD between different probes of an unclassified spectrum and the typical DNA code words from the database, the class property of each pixel is set as the minimum distance class. The main benefit of this strategy is that the risk of redundant bands can be deeply reduced and critical spectral discrepancies can be enlarged. Two hyperspectral image datasets were tested. Comparing with the other classification methods, the overall accuracy can be improved from 1.22% to 10.09% and 1.19% to 15.87%, respectively. Furthermore, the kappa coefficient can be improved from 2.05% to 15.29% and 1.35% to 19.59%, respectively. This demonstrated that the proposed algorithm outperformed other traditional classification methods.

  4. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  5. Novel p38α MAP kinase inhibitors identified from yoctoReactor DNA-encoded small molecule library

    DEFF Research Database (Denmark)

    Petersen, L. K.; Blakskjær, P.; Chaikuad, A.

    2016-01-01

    A highly specific and potent (7 nM cellular IC50) inhibitor of p38α kinase was identified directly from a 12.6 million membered DNA-encoded small molecule library. This was achieved using the high fidelity yoctoReactor technology (yR) for preparing the DNA-encoded library, and a homogeneous...... interactions. Moreover, the crystal structure showed, that although buried in the p38α active site, the original DNA attachment point of the compound was accessible through a channel created by the distorted P-loop conformation. This study demonstrates the usability of DNA-encoded library technologies...

  6. Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

    International Nuclear Information System (INIS)

    Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

    1987-01-01

    The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

  7. A ready-to-use duplex qPCR to detect Leishmania infantum DNA in naturally infected dogs.

    Science.gov (United States)

    Rampazzo, Rita de Cássia Pontello; Solcà, Manuela da Silva; Santos, Liliane Celestino Sales; Pereira, Lais de Novaes; Guedes, José Carlos Oliveira; Veras, Patrícia Sampaio Tavares; Fraga, Deborah Bittencourt Mothé; Krieger, Marco Aurélio; Costa, Alexandre Dias Tavares

    2017-11-15

    Canine visceral leishmaniasis (CVL) is a systemic disease caused by Leishmania infantum. A precise CVL diagnosis would allow for a faster and more specific treatment. Quantitative PCR (qPCR) is a sensitive and specific technique that can diagnose CVL and also monitor parasite load in the animal during the course of the infection or treatment. The aim of this study was to develop a ready-to-use (gelified and freezer-free) duplex qPCR for the identification of infected animals. We combined a new qPCR protocol that detects the canine 18S rRNA gene with an existing protocol for L. infantum kDNA detection, creating a duplex qPCR. This duplex method was then developed into a ready-to-use format. The performance of the duplex and singleplex reactions were compared in the traditional format (liquid and freezer-stored). Furthermore, the duplex qPCR performance was compared between the ready-to-use and traditional formats. The singleplex and new duplex qPCR exhibited the same detection limit in the traditional format (0.1 parasites/reaction). The ready-to-use format showed a detection limit of 1 parasite/reaction without affecting the reaction efficiency. The performance of the new qPCR protocol in the two formats was assessed using canine tissue samples from 82 dogs in an endemic CVL area that were previously characterized by standard serological and parasitological protocols. Splenic aspirates provided a higher rate of positivity (92.9%) followed by skin (50%) and blood (35.7%). The reported detection limits were observed for all tissues studied. Our results show that the amplification of L. infantum kDNA and canine DNA in a single tube, using either the traditional or ready-to-use format, exhibited the same diagnostic performance as amplification of the parasite kDNA alone. The detection of the host gene strengthens the qPCR results by confirming the presence and quality of DNA in the samples and the absence of polymerase inhibitors. The ready-to-use duplex qPCR format

  8. DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

    Science.gov (United States)

    Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

    2014-04-15

    DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

  9. Discovery of Potent and Selective Inhibitors for ADAMTS-4 through DNA-Encoded Library Technology (ELT).

    Science.gov (United States)

    Ding, Yun; O'Keefe, Heather; DeLorey, Jennifer L; Israel, David I; Messer, Jeffrey A; Chiu, Cynthia H; Skinner, Steven R; Matico, Rosalie E; Murray-Thompson, Monique F; Li, Fan; Clark, Matthew A; Cuozzo, John W; Arico-Muendel, Christopher; Morgan, Barry A

    2015-08-13

    The aggrecan degrading metalloprotease ADAMTS-4 has been identified as a novel therapeutic target for osteoarthritis. Here, we use DNA-encoded Library Technology (ELT) to identify novel ADAMTS-4 inhibitors from a DNA-encoded triazine library by affinity selection. Structure-activity relationship studies based on the selection information led to the identification of potent and highly selective inhibitors. For example, 4-(((4-(6,7-dimethoxy-3,4-dihydroisoquinolin-2(1H)-yl)-6-(((4-methylpiperazin-1-yl)methyl)amino)-1,3,5-triazin-2-yl)amino)methyl)-N-ethyl-N-(m-tolyl)benzamide has IC50 of 10 nM against ADAMTS-4, with >1000-fold selectivity over ADAMT-5, MMP-13, TACE, and ADAMTS-13. These inhibitors have no obvious zinc ligand functionality.

  10. Frequency and persistency of DNA vaccine encoding GP25 by oral on common carp

    Directory of Open Access Journals (Sweden)

    Sri Nuryati

    2015-05-01

    Full Text Available ABSTRACT Koi herpesvirus (KHV is a major viral pathogen that infects common carp and koi. KHV disease outbreak is happened in almost all centre of common carp culture in Indonesia and caused mass mortality. Deoxyribonucleic acid (DNA vaccination method is one of ways to cope with KHV infection. Vaccines were commonly given by injection. The aim of this research was to get frequency and persistency of DNA vaccine encoding GP25 given by oral delivery method in common carp. This research would like to determine dose, frequency of vaccination, persistency of DNA vaccine and culture medium for the bacterial host. DNA vaccine persistency test was done by using polymerase chain reaction (PCR method with the specific primer for GP25 gene. The results showed that level of DNA vaccine that could be detected in feed was 7.56 ng (equal to 1.598×1010 copies. Efficient culture medium for Escherichia coli DH5α carrying DNA vaccine was LB triptone. Feeding fish with diet supplemented with 1 mL E. coli DH5α containing DNA vaccine for each fish and two times a week allowed persistence of DNA vaccine in kindney and spleen. Keywords: common carp, KHV, DNA vaccine, GP25, persistance  ABSTRAK Koi herpesvirus (KHV adalah virus patogen utama yang menginfeksi ikan mas dan ikan koi. Wabah penyakit KHV terjadi di hampir semua sentra budidaya ikan mas di Indonesia dan menyebabkan kematian massal ikan. Metode vaksinasi DNA merupakan salah satu cara yang dapat dilakukan untuk menanggulangi serangan KHV. Pemberian vaksin umumnya dilakukan dengan cara injeksi. Tujuan penelitian ini adalah untuk menguji frekuensi dan persistensi vaksin DNA GP25 antivirus KHV yang diberikan melalui oral pada ikan mas. Pada penelitian ini dilakukan uji dosis, frekuensi pemberian vaksin, persistensi vaksin DNA, dan media kultur bakteri inang. Persistensi vaksin DNA dianalisis menggunakan metode PCR dengan primer spesifik gen GP25. Hasil penelitian menunjukkan bahwa dosis vaksin DNA yang

  11. Sequence of a cDNA encoding turtle high mobility group 1 protein.

    Science.gov (United States)

    Zheng, Jifang; Hu, Bi; Wu, Duansheng

    2005-07-01

    In order to understand sequence information about turtle HMG1 gene, a cDNA encoding HMG1 protein of the Chinese soft-shell turtle (Pelodiscus sinensis) was amplified by RT-PCR from kidney total RNA, and was cloned, sequenced and analyzed. The results revealed that the open reading frame (ORF) of turtle HMG1 cDNA is 606 bp long. The ORF codifies 202 amino acid residues, from which two DNA-binding domains and one polyacidic region are derived. The DNA-binding domains share higher amino acid identity with homologues sequences of chicken (96.5%) and mammalian (74%) than homologues sequence of rainbow trout (67%). The polyacidic region shows 84.6% amino acid homology with the equivalent region of chicken HMG1 cDNA. Turtle HMG1 protein contains 3 Cys residues located at completely conserved positions. Conservation in sequence and structure suggests that the functions of turtle HMG1 cDNA may be highly conserved during evolution. To our knowledge, this is the first report of HMG1 cDNA sequence in any reptilian.

  12. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  13. Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

    Science.gov (United States)

    Bell, Nicholas A. W.; Keyser, Ulrich F.

    2016-07-01

    The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

  14. Agrobacterium T-DNA-encoded protein Atu6002 interferes with the host auxin response

    Science.gov (United States)

    Lacroix, Benoît; Gizatullina, Diana I.; Babst, Benjamin A.; Gifford, Andrew N.; Citovsky, Vitaly

    2013-01-01

    Summary Several genes in the Agrobacterium tumefaciens transferred (T) DNA encode proteins that are involved in developmental alterations leading to the formation of tumors in infected plants. We investigated the role of the protein encoded by the Atu6002 gene, the function of which is completely unknown. The Atu6002 expression occurs in Agrobacterium-induced tumors, and is also activated upon activation of plant cell division by growth hormones. Within the expressing plant cells, the Atu6002 protein is targeted to the plasma membrane. Interestingly, constitutive ectopic expression of Atu6002 in transgenic tobacco plants lead to a severe developmental phenotype characterized by stunted growth, shorter internodes, lanceolate leaves, increased branching, and modified flower morphology. These Atu6002-expressing plants also displayed impaired response to auxin. However, auxin cellular uptake and polar transport were not significantly inhibited in these plants, suggesting that Atu6002 interferes with auxin perception or signaling pathways. PMID:24128370

  15. The midgut transcriptome of Lutzomyia longipalpis: comparative analysis of cDNA libraries from sugar-fed, blood-fed, post-digested and Leishmania infantum chagasi-infected sand flies

    Directory of Open Access Journals (Sweden)

    Elnaiem Dia-Eldin

    2008-01-01

    Full Text Available Abstract Background In the life cycle of Leishmania within the alimentary canal of sand flies the parasites have to survive the hostile environment of blood meal digestion, escape the blood bolus and attach to the midgut epithelium before differentiating into the infective metacyclic stages. The molecular interactions between the Leishmania parasites and the gut of the sand fly are poorly understood. In the present work we sequenced five cDNA libraries constructed from midgut tissue from the sand fly Lutzomyia longipalpis and analyzed the transcripts present following sugar feeding, blood feeding and after the blood meal has been processed and excreted, both in the presence and absence of Leishmania infantum chagasi. Results Comparative analysis of the transcripts from sugar-fed and blood-fed cDNA libraries resulted in the identification of transcripts differentially expressed during blood feeding. This included upregulated transcripts such as four distinct microvillar-like proteins (LuloMVP1, 2, 4 and 5, two peritrophin like proteins, a trypsin like protein (Lltryp1, two chymotrypsin like proteins (LuloChym1A and 2 and an unknown protein. Downregulated transcripts by blood feeding were a microvillar-like protein (LuloMVP3, a trypsin like protein (Lltryp2 and an astacin-like metalloprotease (LuloAstacin. Furthermore, a comparative analysis between blood-fed and Leishmania infected midgut cDNA libraries resulted in the identification of the transcripts that were differentially expressed due to the presence of Leishmania in the gut of the sand fly. This included down regulated transcripts such as four microvillar-like proteins (LuloMVP1,2, 4 and 5, a Chymotrypsin (LuloChym1A and a carboxypeptidase (LuloCpepA1, among others. Upregulated midgut transcripts in the presence of Leishmania were a peritrophin like protein (LuloPer1, a trypsin-like protein (Lltryp2 and an unknown protein. Conclusion This transcriptome analysis represents the largest set

  16. Achievements, Challenges, and Opportunities in DNA-Encoded Library Research: An Academic Point of View.

    Science.gov (United States)

    Yuen, Lik Hang; Franzini, Raphael M

    2017-05-04

    DNA-encoded chemical libraries (DECLs) are pools of DNA-tagged small molecules that enable facile screening and identification of bio-macromolecule binders. The successful development of DECLs has led to their increasingly important role in drug development, and screening hits have entered clinical trials. In this review, we summarize the development and currently active research areas of DECLs with a focus on contributions from groups at academic institutes. We further look at opportunities and future directions of DECL research in medicinal chemistry and chemical biology based on the symbiotic relationship between academia and industry. Challenges associated with the application of DECLs in academic drug discovery are further discussed. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Analytical Performance of Four Polymerase Chain Reaction (PCR and Real Time PCR (qPCR Assays for the Detection of Six Leishmania Species DNA in Colombia

    Directory of Open Access Journals (Sweden)

    Cielo M. León

    2017-10-01

    Full Text Available Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR, limit of detection (LoD and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia. Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America.

  18. Analytical Performance of Four Polymerase Chain Reaction (PCR) and Real Time PCR (qPCR) Assays for the Detection of Six Leishmania Species DNA in Colombia

    Science.gov (United States)

    León, Cielo M.; Muñoz, Marina; Hernández, Carolina; Ayala, Martha S.; Flórez, Carolina; Teherán, Aníbal; Cubides, Juan R.; Ramírez, Juan D.

    2017-01-01

    Leishmaniasis comprises a spectrum of parasitic diseases caused by protozoans of the genus Leishmania. Molecular tools have been widely employed for the detection of Leishmania due to its high sensitivity and specificity. However, the analytical performance of molecular platforms as PCR and real time PCR (qPCR) including a wide variety of molecular markers has never been evaluated. Herein, the aim was to evaluate the analytical performance of 4 PCR-based assays (designed on four different targets) and applied on conventional and real-time PCR platforms. We evaluated the analytical performance of conventional PCR and real time PCR, determining exclusivity and inclusivity, Anticipated Reportable Range (ARR), limit of detection (LoD) and accuracy using primers directed to kDNA, HSP70, 18S and ITS-1 targets. We observed that the kDNA was the most sensitive but does not meet the criterion of exclusivity. The HSP70 presented a higher LoD in conventional PCR and qPCR in comparison with the other markers (1 × 101 and 1 × 10-1 equivalent parasites/mL respectively) and had a higher coefficient of variation in qPCR. No statistically significant differences were found between the days of the test with the four molecular markers. The present study revealed that the 18S marker presented the best performance in terms of analytical sensitivity and specificity for the qPCR in the species tested (species circulating in Colombia). Therefore, we recommend to explore the analytical and diagnostic performance in future studies using a broader number of species across America. PMID:29046670

  19. Recombinant DNA specifying the human amyloid. beta. precursor protein (ABPP) encodes a 95-kDa polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Mita, S; Sadlock, J; Herbert, J; Schon, E A

    1988-10-11

    Although the ABPP gene give rise to multiple mRNAs, the primary translation product of this gene is unknown. The longest published cDNA sequences predict a 770-aa polypeptide of 87 kDa. However, in immunoblots, ABPP migrated as a single species of >92 kDa in rat brain, and in human, as a species of 95-100 kDa in non-membrane bound form, as multiple species of 110-135 kDa in membrane-associated form and as a 130-kDa species in fibroblasts. The sizes of these larger species relative to the MW of ABPP predicted from the cDNA sequences have been attributed to postranslational modification. However, the authors have isolated a cDNA (lambdaHAP2) from a human fetal muscle lambdagt11 cDNA library encoding an 843-aa polypeptide with a deduced MW of 94,642. This cDNA contains both exons encoding an 843-aa polypeptide with a deduced MW of 94.642. This cDNA contains both exons encoding the protease inhibitor domains. Primer extension analysis indicates that the 5' terminus of this cDNA is 14 nt from a transcriptional start site. This cDNA, encoding the longest ABPP described to date, may explain some of the observations on the sizes of tissue-derived ABPP.

  20. A putative peroxidase cDNA from turnip and analysis of the encoded protein sequence.

    Science.gov (United States)

    Romero-Gómez, S; Duarte-Vázquez, M A; García-Almendárez, B E; Mayorga-Martínez, L; Cervantes-Avilés, O; Regalado, C

    2008-12-01

    A putative peroxidase cDNA was isolated from turnip roots (Brassica napus L. var. purple top white globe) by reverse transcriptase-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA ends (RACE). Total RNA extracted from mature turnip roots was used as a template for RT-PCR, using a degenerated primer designed to amplify the highly conserved distal motif of plant peroxidases. The resulting partial sequence was used to design the rest of the specific primers for 5' and 3' RACE. Two cDNA fragments were purified, sequenced, and aligned with the partial sequence from RT-PCR, and a complete overlapping sequence was obtained and labeled as BbPA (Genbank Accession No. AY423440, named as podC). The full length cDNA is 1167bp long and contains a 1077bp open reading frame (ORF) encoding a 358 deduced amino acid peroxidase polypeptide. The putative peroxidase (BnPA) showed a calculated Mr of 34kDa, and isoelectric point (pI) of 4.5, with no significant identity with other reported turnip peroxidases. Sequence alignment showed that only three peroxidases have a significant identity with BnPA namely AtP29a (84%), and AtPA2 (81%) from Arabidopsis thaliana, and HRPA2 (82%) from horseradish (Armoracia rusticana). Work is in progress to clone this gene into an adequate host to study the specific role and possible biotechnological applications of this alternative peroxidase source.

  1. Efficacy of DNA vaccine encoding koi herpesvirus glycoprotein GP-25in common carp juvenile by immersion

    Directory of Open Access Journals (Sweden)

    Soko Nuswantoro

    2013-11-01

    Full Text Available Koi herpesvirus (KHV is a herpesvirus that particularly infects and causes mass mortality to koi and common carp. Therefore, the protection of common carp from KHV infection is urgently needed. In this study, we developed an application of DNA vaccine encoding KHV glycoprotein-25 by immersion method to increase survival of common carp against KHV infection. A total of 400 common carp juveniles at 30-day-old were immersed in 1-L water containing 1.3×108CFU/mL of the killed Escherichia coli cells carrying DNA vaccine. Three frequencies and three duration of fish immersion were tested, namely: 1×30 minutes, 1×60 minutes, 1× 90 minutes, 2×90 minutes and 3×90 minutes by interval of 24 hours. Reversetranscription polymerase chain reaction analysis showed that DNA vaccine was successfully expressed in the vaccinated fish. Fish at twenty eight days post vaccination were challenged by injecting 10-4 mL of KHV per fish. The result showed that vaccination by 1×30 minutes immersion allowed 61% of fish survived, and this was significantly higher (p<0.05 compared to control (without vaccination, but it was similar among vaccination treatments (p>0.05. The relative percent survival of vaccinated fish were also similar among treatments (p>0.05. DNA vaccination has increased fish survival about two fold higher compared to unvaccinated fish control (26.67%. Thus, DNA vaccination was effectively delivered by immersion for 1×30 minutes, and this technique can be useful to level up the resistance of common carp juveniles against KHV infection. Keywords: DNA vaccine, KHV, glycoprotein, immersion, common carp

  2. Serine Protease Variants Encoded by Echis ocellatus Venom Gland cDNA: Cloning and Sequencing Analysis

    Directory of Open Access Journals (Sweden)

    S. S. Hasson

    2010-01-01

    Full Text Available Envenoming by Echis saw-scaled viper is the leading cause of death and morbidity in Africa due to snake bite. Despite its medical importance, there have been few investigations into the toxin composition of the venom of this viper. Here, we report the cloning of cDNA sequences encoding four groups or isoforms of the haemostasis-disruptive Serine protease proteins (SPs from the venom glands of Echis ocellatus. All these SP sequences encoded the cysteine residues scaffold that form the 6-disulphide bonds responsible for the characteristic tertiary structure of venom serine proteases. All the Echis ocellatus EoSP groups showed varying degrees of sequence similarity to published viper venom SPs. However, these groups also showed marked intercluster sequence conservation across them which were significantly different from that of previously published viper SPs. Because viper venom SPs exhibit a high degree of sequence similarity and yet exert profoundly different effects on the mammalian haemostatic system, no attempt was made to assign functionality to the new Echis ocellatus EoSPs on the basis of sequence alone. The extraordinary level of interspecific and intergeneric sequence conservation exhibited by the Echis ocellatus EoSPs and analogous serine proteases from other viper species leads us to speculate that antibodies to representative molecules should neutralise (that we will exploit, by epidermal DNA immunization the biological function of this important group of venom toxins in vipers that are distributed throughout Africa, the Middle East, and the Indian subcontinent.

  3. Ecological aspects and molecular detection of Leishmania DNA Ross (Kinetoplastida: Trypanosomatidae) in phlebotomine sandflies (Diptera: Psychodidae) in terra firme and várzea environments in the Middle Solimões Region, Amazonas State, Brazil.

    Science.gov (United States)

    Pereira Júnior, Antonio Marques; Teles, Carolina Bioni Garcia; de Azevedo dos Santos, Ana Paula; de Souza Rodrigues, Moreno; Marialva, Eric Fabrício; Pessoa, Felipe Arley Costa; Medeiros, Jansen Fernandes

    2015-03-25

    Phlebotomine sand flies (Diptera: Psychodidae) are insects of medical importance due to the role that some species play in the transmission of leishmaniasis. This work aimed to study some ecological aspects among sand flies fauna inhabiting two different environments: the várzea (lowland Amazonian forest) and terra firme (upland Amazonian forest), both located in Tefé Municipality, Amazonas State, Braziland to detect Leishmania infection in those phlebotomine populations. Sand flies were collected using HP light traps. Collection took place over the course of six months: January, February, April, August, September, and October of 2013. To detect natural infection by Leishmania, DNA samples were extracted from female sand flies and submitted to Polymerase Chain Reaction (PCR) targeting the kDNA gene; Leishmania species were identified by PCR-RFLP targeting the hsp70 gene and genetic sequencing. In all, 5,716 individuals were collected, and 46 species were identified. Trichophoromyia ubiquitalis (3,330 - 58.26%) and Nyssomyia antunesi (661 - 11.26%) were the most abundant species. Species richness was greater in terra firme environments (42 species) than in the várzea environments (22 species), and forests ecotopes (43 species) were richer than peridomiciles (28 species). DNA of Leishmania was found in Th. ubiquitalis and Psychodopygus davisi, both of which inhabit the terra firme environment and sequencing analysis confirmed the presence of Leishmania (Viannia) lainsoni DNA in Th. ubiquitalis in Tefé Municipality. The high abundance of Th. ubiquitalis and Ps. davisi and detection of DNA of Leishmania sp. may indicate that both species could be putative vectors for American Cutaneous Leishmaniasis (ACL) in the terra firme environment of Tefé. The sand fly fauna found in várzea is rich and diverse, exhibiting several species, nevertheless the seasonal hydric stress during part of the year that could influence the local diversity, if compared with other studies

  4. Genes that encodes NAGT, MIF1 and MIF2 are not virulence factors for kala-azar caused by Leishmania infantum

    Directory of Open Access Journals (Sweden)

    Bruno Guedes Alcoforado Aguiar

    2014-10-01

    Full Text Available Introduction Kala-azar is a disease resulting from infection by Leishmania donovani and Leishmania infantum. Most patients with the disease exhibit prolonged fever, wasting, anemia and hepatosplenomegaly without complications. However, some patients develop severe disease with hemorrhagic manifestations, bacterial infections, jaundice, and edema dyspnea, among other symptoms, followed by death. Among the parasite molecules that might influence the disease severity are the macrophage migration inhibitory factor-like proteins (MIF1 and MIF2 and N-acetylglucosamine-1-phosphotransferase (NAGT, which act in the first step of protein N-glycosylation. This study aimed to determine whether MIF1, MIF2 and NAGT are virulence factors for severe kala-azar. Methods To determine the parasite genotype in kala-azar patients from Northeastern Brazil, we sequenced the NAGT genes of L. infantum from 68 patients as well as the MIF1 and MIF2 genes from 76 different subjects with diverse clinical manifestations. After polymerase chain reaction (PCR, the fragments were sequenced, followed by polymorphism identification. Results The nucleotide sequencing of the 144 amplicons revealed the absence of genetic variability of the NAGT, MIF1 and MIF2 genes between the isolates. The conservation of these genes suggests that the clinical variability of kala-azar does not depend upon these genes. Additionally, this conservation suggests that these genes may be critical for parasite survival. Conclusions NAGT, MIF1 and MIF2 do not alter the severity of kala-azar. NAGT, MIF1 and MIF2 are highly conserved among different isolates of identical species and exhibit potential for use in phylogenetic inferences or molecular diagnosis.

  5. Cloning and expression of a cDNA encoding human sterol carrier protein 2

    International Nuclear Information System (INIS)

    Yamamoto, Ritsu; Kallen, C.B.; Babalola, G.O.; Rennert, H.; Strauss, J.F. III; Billheimer, J.T.

    1991-01-01

    The authors report the cloning and expression of a cDNA encoding human sterol carrier protein 2 (SCP 2 ). The 1.3-kilobase (kb) cDNA contains an open reading frame which encompasses a 143-amino acid sequence which is 89% identical to the rat SCP 2 amino acid sequence. The deduced amino acid sequence of the polypeptide reveals a 20-residue amino-terminal leader sequence in front of the mature polypeptide, which contains a carboxyl-terminal tripeptide (Ala-Lys-Leu) related to the peroxisome targeting sequence. The expressed cDNA in COS-7 cells yields a 15.3-kDa polypeptide and increased amounts of a 13.2-kDa polypeptide, both reacting with a specific rabbit antiserum to rat liver SCP 2 . The cDNA insert hybridizes with 3.2- and 1.8-kb mRNA species in human liver poly(A) + RNA. In human fibroblasts and placenta the 1.8-kb mRNA was most abundant. Southern blot analysis suggests either that there are multiple copies of the SCP 2 gene in the human genome or that the SCP 2 gene is very large. Coexpression of the SCP 2 cDNA with expression vectors for cholesterol side-chain cleavage enzyme and adrenodoxin resulted in a 2.5-fold enhancement of progestin synthesis over that obtained with expression of the steroidogenic enzyme system alone. These findings are concordant with the notion that SCP 2 plays a role in regulating steroidogenesis, among other possible functions

  6. Arabidopsis thaliana GYRB3 does not encode a DNA gyrase subunit.

    Directory of Open Access Journals (Sweden)

    Katherine M Evans-Roberts

    2010-03-01

    Full Text Available DNA topoisomerases are enzymes that control the topology of DNA in all cells. DNA gyrase is unique among the topoisomerases in that it is the only enzyme that can actively supercoil DNA using the free energy of ATP hydrolysis. Until recently gyrase was thought to be unique to bacteria, but has now been discovered in plants. The genome of the model plant, Arabidopsis thaliana, is predicted to encode four gyrase subunits: AtGyrA, AtGyrB1, AtGyrB2 and AtGyrB3.We found, contrary to previous data, that AtGyrB3 is not essential to the survival of A. thaliana. Bioinformatic analysis suggests AtGyrB3 is considerably shorter than other gyrase B subunits, lacking part of the ATPase domain and other key motifs found in all type II topoisomerases; but it does contain a putative DNA-binding domain. Partially purified AtGyrB3 cannot bind E. coli GyrA or support supercoiling. AtGyrB3 cannot complement an E. coli gyrB temperature-sensitive strain, whereas AtGyrB2 can. Yeast two-hybrid analysis suggests that AtGyrB3 cannot bind to AtGyrA or form a dimer.These data strongly suggest that AtGyrB3 is not a gyrase subunit but has another unknown function. One possibility is that it is a nuclear protein with a role in meiosis in pollen.

  7. First evidence of Leishmania infection in European brown hare (Lepus europaeus) in Greece: GIS analysis and phylogenetic position within the Leishmania spp.

    Science.gov (United States)

    Tsokana, C N; Sokos, C; Giannakopoulos, A; Mamuris, Z; Birtsas, P; Papaspyropoulos, K; Valiakos, G; Spyrou, V; Lefkaditis, M; Chatzopoulos, D C; Kantere, M; Manolakou, K; Touloudi, A; Burriel, A Rodi; Ferroglio, E; Hadjichristodoulou, C; Billinis, C

    2016-01-01

    Although the existence of a sylvatic transmission cycle of Leishmania spp., independent from the domestic cycle, has been proposed, data are scarce on Leishmania infection in wild mammals in Greece. In this study, we aimed to investigate the presence of Leishmania infection in the European brown hare in Greece, to infer the phylogenetic position of the Leishmania parasites detected in hares in Greece, and to identify any possible correlation between Leishmania infection in hares with environmental parameters, using the geographical information system (GIS). Spleen samples from 166 hares were tested by internal transcribed spacer-1 (ITS-1)-nested PCR for the detection of Leishmania DNA. Phylogenetic analysis was performed on Leishmania sequences from hares in Greece in conjunction with Leishmania sequences from dogs in Greece and 46 Leishmania sequences retrieved from GenBank. The Leishmania DNA prevalence in hares was found to be 23.49 % (95 % confidence interval (CI) 17.27-30.69). The phylogenetic analysis confirmed that the Leishmania sequences from hares in Greece belong in the Leishmania donovani complex. The widespread Leishmania infection in hares should be taken into consideration because under specific circumstances, this species can act as a reservoir host. This study suggests that the role of wild animals, including hares, in the epidemiology of Leishmania spp. in Greece deserves further elucidation.

  8. Canine Skin and Conjunctival Swab Samples for the Detection and Quantification of Leishmania infantum DNA in an Endemic Urban Area in Brazil

    Science.gov (United States)

    de Almeida Ferreira, Sidney; Leite, Rodrigo Souza; Ituassu, Leonardo Trindade; Almeida, Gregório Guilherme; Souza, Daniel Menezes; Fujiwara, Ricardo Toshio; de Andrade, Antero Silva Ribeiro; Melo, Maria Norma

    2012-01-01

    Background We evaluated kDNA PCR/hybridization and quantitative real-time PCR (qPCR) targeting the gene of DNA polymerase of Leishmania infantum for CVL diagnosis and assessment of parasite load in clinical samples obtained invasively and non-invasively. Methodology/Principal Findings Eighty naturally infected dogs from an endemic urban area in Brazil were used. Animals were divided into two groups based on the presence or absence of CVL clinical sings. Skin biopsies, bone marrow, blood and conjunctival swabs samples were collected and submitted to L. infantum DNA detection. In addition, anti-Leishmania antibody titers were measured by Immunofluorescence antibody test. The symptomatic dogs had increased titers compared to asymptomatic dogs (P = 0.025). The frequencies of positive results obtained by kDNA PCR/hybridization for asymptomatic and symptomatic dogs, respectively, were as follows: right conjunctiva, 77.5% and 95.0%; left conjunctiva, 75.0% and 87.5%; skin, 45.0% and 75.0%; bone marrow, 50.0% and 77.5%; and blood, 27.5% and 22.5%. In both groups, the parasite load in the skin samples was the highest (P<0.0001). The parasite loads in the conjunctival swab and bone marrow samples were statistically equivalent within each group. The parasite burden in conjunctival swabs was higher in the dogs with clinical signs than in asymptomatic dogs (P = 0.028). This same relationship was also observed in the bone marrow samples (P = 0.002). No differences in amastigotes load in the skin were detected between the groups. Conclusions The conjunctival swab is a suitable clinical sample for qualitative molecular diagnosis of CVL. The highest parasite burdens were detected in skin regardless of the presence of VL-associated clinical signs. The qPCR results emphasized the role of dogs, particularly asymptomatic dogs, as reservoirs for CVL because of the high cutaneous parasite loads. These results may help to explain the maintenance of high transmission rates and

  9. cDNA encoding a polypeptide including a hev ein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  10. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  11. Characterization of cDNA encoding human placental anticoagulant protein (PP4): Homology with the lipocortin family

    International Nuclear Information System (INIS)

    Grundmann, U.; Abel, K.J.; Bohn, H.; Loebermann, H.; Lottspeich, F.; Kuepper, H.

    1988-01-01

    A cDNA library prepared from human placenta was screened for sequences encoding the placental protein 4 (PP4). PP4 is an anticoagulant protein that acts as an indirect inhibitor of the thromboplastin-specific complex, which is involved in the blood coagulation cascade. Partial amino acid sequence information from PP4-derived cyanogen bromide fragments was used to design three oligonucleotide probes for screening the library. From 10 6 independent recombinants, 18 clones were identified that hybridized to all three probes. These 18 recombinants contained cDNA inserts encoding a protein of 320 amino acid residues. In addition to the PP4 cDNA the authors identified 9 other recombinants encoding a protein with considerable similarity (74%) to PP4, which was termed PP4-X. PP4 and PP4-X belong to the lipocortin family, as judged by their homology to lipocortin I and calpactin I

  12. Isolation and sequence of complementary DNA encoding human extracellular superoxide dismutase

    International Nuclear Information System (INIS)

    Hjalmarsson, K.; Marklund, S.L.; Engstroem, A.; Edlund, T.

    1987-01-01

    A complementary DNA (cDNA) clone from a human placenta cDNA library encoding extracellular superoxide dismutase has been isolated and the nucleotide sequence determined. The cDNA has a very high G + C content. EC-SOD is synthesized with a putative 18-amino acid signal peptide, preceding the 222 amino acids in the mature enzyme, indicating that the enzyme is a secretory protein. The first 95 amino acids of the mature enzyme show no sequence homology with other sequenced proteins and there is one possible N-glycosylation site (Asn-89). The amino acid sequence from residues 96-193 shows strong homology (∼ 50%) with the final two-thirds of the sequences of all know eukaryotic CuZn SODs, whereas the homology with the P. leiognathi CuZn SOD is clearly lower. The ligands to Cu and Zn, the cysteines forming the intrasubunit disulfide bridge in the CuZn SODs, and the arginine found in all CuZn SODs in the entrance to the active site can all be identified in EC-SOD. A comparison with bovine CuZn SOD, the three-dimensional structure of which is known, reveals that the homologies occur in the active site and the divergencies are in the part constituting the subunit contact area in CuZn SOD. Amino acid sequence 194-222 in the carboxyl-terminal end of EC-SOD is strongly hydrophilic and contains nine amino acids with a positive charge. This sequence probably confers the affinity of EC-SOD for heparin and heparan sulfate. An analysis of the amino acid sequence homologies with CuZn SODs from various species indicates that the EC-SODs may have evolved form the CuZn SODs before the evolution of fungi and plants

  13. Prioritizing multiple therapeutic targets in parallel using automated DNA-encoded library screening

    Science.gov (United States)

    Machutta, Carl A.; Kollmann, Christopher S.; Lind, Kenneth E.; Bai, Xiaopeng; Chan, Pan F.; Huang, Jianzhong; Ballell, Lluis; Belyanskaya, Svetlana; Besra, Gurdyal S.; Barros-Aguirre, David; Bates, Robert H.; Centrella, Paolo A.; Chang, Sandy S.; Chai, Jing; Choudhry, Anthony E.; Coffin, Aaron; Davie, Christopher P.; Deng, Hongfeng; Deng, Jianghe; Ding, Yun; Dodson, Jason W.; Fosbenner, David T.; Gao, Enoch N.; Graham, Taylor L.; Graybill, Todd L.; Ingraham, Karen; Johnson, Walter P.; King, Bryan W.; Kwiatkowski, Christopher R.; Lelièvre, Joël; Li, Yue; Liu, Xiaorong; Lu, Quinn; Lehr, Ruth; Mendoza-Losana, Alfonso; Martin, John; McCloskey, Lynn; McCormick, Patti; O'Keefe, Heather P.; O'Keeffe, Thomas; Pao, Christina; Phelps, Christopher B.; Qi, Hongwei; Rafferty, Keith; Scavello, Genaro S.; Steiginga, Matt S.; Sundersingh, Flora S.; Sweitzer, Sharon M.; Szewczuk, Lawrence M.; Taylor, Amy; Toh, May Fern; Wang, Juan; Wang, Minghui; Wilkins, Devan J.; Xia, Bing; Yao, Gang; Zhang, Jean; Zhou, Jingye; Donahue, Christine P.; Messer, Jeffrey A.; Holmes, David; Arico-Muendel, Christopher C.; Pope, Andrew J.; Gross, Jeffrey W.; Evindar, Ghotas

    2017-07-01

    The identification and prioritization of chemically tractable therapeutic targets is a significant challenge in the discovery of new medicines. We have developed a novel method that rapidly screens multiple proteins in parallel using DNA-encoded library technology (ELT). Initial efforts were focused on the efficient discovery of antibacterial leads against 119 targets from Acinetobacter baumannii and Staphylococcus aureus. The success of this effort led to the hypothesis that the relative number of ELT binders alone could be used to assess the ligandability of large sets of proteins. This concept was further explored by screening 42 targets from Mycobacterium tuberculosis. Active chemical series for six targets from our initial effort as well as three chemotypes for DHFR from M. tuberculosis are reported. The findings demonstrate that parallel ELT selections can be used to assess ligandability and highlight opportunities for successful lead and tool discovery.

  14. A combined approach of hollow microneedles and nanocarriers for skin immunization with plasmid DNA encoding ovalbumin

    Directory of Open Access Journals (Sweden)

    Pamornpathomkul B

    2017-01-01

    Full Text Available Boonnada Pamornpathomkul,1 Adisak Wongkajornsilp,2 Wanida Laiwattanapaisal,3 Theerasak Rojanarata,1 Praneet Opanasopit,1 Tanasait Ngawhirunpat1 1Department of Pharmaceutical Technology, Faculty of Pharmacy, Pharmaceutical Development of Green Innovations Group, Silpakorn University, Nakhon Pathom, 2Department of Pharmacology, Faculty of Medicine Siriraj Hospital, Mahidol University, Bangkok, 3Department of Clinical Chemistry, Faculty of Allied Health Sciences, Chulalongkorn University, Bangkok, Thailand Abstract: The aim of this study was to investigate the use of different types of microneedles (MNs and nanocarriers for in vitro skin permeation and in vivo immunization of plasmid DNA encoding ovalbumin (pOVA. In vitro skin permeation studies indicated that hollow MNs had a superior enhancing effect on skin permeation compared with solid MN patches, electroporation (EP patches, the combination of MN and EP patches, and untreated skin. Upon using hollow MNs combined with nanocarriers for pOVA delivery, the skin permeation was higher than for the delivery of naked pOVA, as evidenced by the increased amount of pOVA in Franz diffusion cells and immunoglobulin G (IgG antibody responses. When the hollow MNs were used for the delivery of nanocarrier:pOVA complexes into the skin of mice, they induced a stronger IgG immune response than conventional subcutaneous (SC injections. In addition, immunization of mice with the hollow MNs did not induce signs of skin infection or pinpoint bleeding. Accordingly, the hollow MNs combined with a nanocarrier delivery system is a promising approach for delivering pOVA complexes to the skin for promoting successful immunization. Keywords: hollow microneedle, solid microneedle, electroporation, plasmid DNA encoding ovalbumin, skin immunization, nanocarrier

  15. Isolation, nucleotide sequence and expression of a cDNA encoding feline granulocyte colony-stimulating factor.

    Science.gov (United States)

    Dunham, S P; Onions, D E

    2001-06-21

    A cDNA encoding feline granulocyte colony stimulating factor (fG-CSF) was cloned from alveolar macrophages using the reverse transcriptase-polymerase chain reaction. The cDNA is 949 bp in length and encodes a predicted mature protein of 174 amino acids. Recombinant fG-CSF was expressed as a glutathione S-transferase fusion and purified by affinity chromatography. Biological activity of the recombinant protein was demonstrated using the murine myeloblastic cell line GNFS-60, which showed an ED50 for fG-CSF of approximately 2 ng/ml. Copyright 2001 Academic Press.

  16. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Science.gov (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  17. Isolation and characterization of human cDNA clones encoding the α and the α' subunits of casein kinase II

    International Nuclear Information System (INIS)

    Lozeman, F.J.; Litchfield, D.W.; Piening, C.; Takio, Koji; Walsh, K.A.; Krebs, E.G.

    1990-01-01

    Casein kinase II is a widely distributed protein serine/threonine kinase. The holoenzyme appears to be a tetramer, containing two α or α' subunits (or one of each) and two β subunits. Complementary DNA clones encoding the subunits of casein kinase II were isolated from a human T-cell λgt 10 library using cDNA clones isolated from Drosophila melanogasten. One of the human cDNA clones (hT4.1) was 2.2 kb long, including a coding region of 1176 bp preceded by 156 bp (5' untranslated region) and followed by 871 bp (3' untranslated region). The hT4.1 close was nearly identical in size and sequence with a cDNA clone from HepG2 human hepatoma cultured cells. Another of the human T-cell cDNA clones (hT9.1) was 1.8 kb long, containing a coding region of 1053 bp preceded by 171 by (5' untranslated region) and followed by 550 bp (3' untranslated region). Amino acid sequences deduced from these two cDNA clones were about 85% identical. Most of the difference between the two encoded polypeptides was in the carboxy-terminal region, but heterogeneity was distributed throughout the molecules. Partial amino acid sequence was determined in a mixture of α and α' subunits from bovine lung casein kinase II. The bovine sequences aligned with the 2 human cDNA-encoded polypeptides with only 2 discrepancies out of 535 amino acid positions. This confirmed that the two human T-cell cDNA clones encoded the α and α' subunits of casein kinase II. These studies show that there are two distinct catalytic subunits for casein II (α and α') and that the sequence of these subunits is largely conserved between the bovine and the human

  18. The ada operon of Mycobacterium tuberculosis encodes two DNA methyltransferases for inducible repair of DNA alkylation damage.

    Science.gov (United States)

    Yang, Mingyi; Aamodt, Randi M; Dalhus, Bjørn; Balasingham, Seetha; Helle, Ina; Andersen, Pernille; Tønjum, Tone; Alseth, Ingrun; Rognes, Torbjørn; Bjørås, Magnar

    2011-06-10

    The ada operon of Mycobacterium tuberculosis, which encodes a composite protein of AdaA and AlkA and a separate AdaB/Ogt protein, was characterized. M. tuberculosis treated with N-methyl-N'-nitro-N-nitrosoguanidine induced transcription of the adaA-alkA and adaB genes, suggesting that M. tuberculosis mount an inducible response to methylating agents. Survival assays of the methyltransferase defective Escherichia coli mutant KT233 (ada ogt), showed that expression of the adaB gene rescued the alkylation sensitivity. Further, adaB but not adaA-alkA complemented the hypermutator phenotype of KT233. Purified AdaA-AlkA and AdaB possessed methyltransferase activity. These data suggested that AdaB counteract the cytotoxic and mutagenic effect of O(6)-methylguanine, while AdaA-AlkA most likely transfers methyl groups from innocuous methylphosphotriesters. AdaA-AlkA did not possess alkylbase DNA glycosylase activity nor rescue the alkylation sensitivity of the E. coli mutant BK2118 (tag alkA). We propose that AdaA-AlkA is a positive regulator of the adaptive response in M. tuberculosis. It thus appears that the ada operon of M. tuberculosis suppresses the mutagenic effect of alkylation but not the cytotoxic effect of lesions such as 3-methylpurines. Collectively, these data indicate that M. tuberculosis hypermutator strains with defective adaptive response genes might sustain robustness to cytotoxic alkylation DNA damage and confer a selective advantage contributing to host adaptation. Copyright © 2011 Elsevier B.V. All rights reserved.

  19. Characterization of the cDNA encoding human nucleophosmin and studies of its role in normal and abnormal growth

    International Nuclear Information System (INIS)

    Chan, Waiyee; Liu, Qingrong; Borjigin, J.; Busch, H.; Rennert, O.M.; Tease, L.A.; Chan, Puikwong

    1989-01-01

    A cDNA encoding human nucleophosmin (protein B23) was obtained by screening a human placental cDNA library in δgtll first with monoclonal antibody to rat nucleophosmin and then with confirmed partial cDNA of human nucleophosmin as probes. The cDNA had 1,311 bp with a coding sequence encoding a protein of 294 amino acids. The identity of the cDNA was confirmed by the presence of encoded amino acid sequences identical with those determined by sequencing pure rat nucleophosmin (a total of 138 amino acids). The most striking feature of the sequence is an acidic cluster located in the middle of the molecule. The cluster consists of 26 Asp/Glu and 1 Phe and Ala. Comparison of human nucleophosmin and Xenopus nucleolar protein NO38 shows 64.3% sequence identity. The N-terminal 130 amino acids of human nucleophosmin also bear 50% identity with that of Xenopus nucleoplasmin. Northern blot analysis of rat liver total RNA with a partial nucleophosmin cDNA as probe demonstrated a homogeneous mRNA band of about 1.6 kb. Similar observations were made in hypertrophic rat liver and Novikoff hepatoma. When the protein levels were compared with Western blot immunoassays, Navikoff hepatoma showed 20 times more nucleophosmin, while only about 5 times more nucleophosmin was observed in hypertrophic rat liver than in unstimulated normal liver

  20. Cloning of a cDNA encoding a novel human nuclear phosphoprotein belonging to the WD-40 family

    DEFF Research Database (Denmark)

    Honoré, B; Leffers, H; Madsen, Peder

    1994-01-01

    We have cloned and expressed in vaccinia virus a cDNA encoding an ubiquitous 501-amino-acid (aa) phosphoprotein that corresponds to protein IEF SSP 9502 (79,400 Da, pI 4.5) in the master 2-D-gel keratinocyte protein database [Celis et al., Electrophoresis 14 (1993) 1091-1198]. The deduced aa...

  1. A cDNA encoding a pRB-binding protein with properties of the transcription factor E2F

    DEFF Research Database (Denmark)

    Helin, K; Lees, J A; Vidal, M

    1992-01-01

    The retinoblastoma protein (pRB) plays an important role in the control of cell proliferation, apparently by binding to and regulating cellular transcription factors such as E2F. Here we describe the characterization of a cDNA clone that encodes a protein with properties of E2F. This clone, RBP3...

  2. Molecular cloning and expression of cDNA encoding a lumenal calcium binding glycoprotein from sarcoplasmic reticulum

    International Nuclear Information System (INIS)

    Leberer, E.; Charuk, J.H.M.; MacLennan, D.H.; Green, N.M.

    1989-01-01

    Antibody screening was used to isolate a cDNA encoding the 160-kDa glycoprotein of rabbit skeletal muscle sarcoplasmic reticulum. The cDNA is identical to that encoding the 53-kDa glycoprotein except that it contains an in-frame insertion of 1,308 nucleotides near its 5' end, apparently resulting from alternative splicing. The protein encoded by the cDNA would contain a 19-residue NH 2 -terminal signal sequence and a 453-residue COOH-terminal sequence identical to the 53-kDa glycoprotein. It would also contain a 436-amino acid insert between these sequences. This insert would be highly acidic, suggesting that it might bind Ca 2+ . The purified 160-kDa glycoprotein and the glycoprotein expressed in COS-1 cells transfected with cDNA encoding the 160-kDa glycoprotein were shown to bind 45 C 2+ in a gel overlay assay. The protein was shown to be located in the lumen of the sarcoplasmic reticulum and to be associated through Ca 2+ with the membrane. The authors propose that this lumenal Ca 2+ binding glycoprotein of the sarcoplasmic reticulum be designated sarcalumenin

  3. Molecular Identification of Leishmania spp. in Sand Flies (Diptera: Psychodidae, Phlebotominae) From Ecuador

    Science.gov (United States)

    Cevallos, Varsovia; Morales, Diego; Baldeón, Manuel E; Cárdenas, Paúl; Rojas-Silva, Patricio; Ponce, Patricio

    2017-01-01

    Abstract The detection and identification of natural infections in sand flies by Leishmania protozoan species in endemic areas is a key factor in assessing the risk of leishmaniasis and in designing prevention and control measures for this infectious disease. In this study, we analyzed the Leishmania DNA using nuclear ribosomal internal transcript spacer (ITS) sequences. Parasite DNA was extracted from naturally infected, blood-fed sand flies collected in nine localities considered leishmaniasis-endemic foci in Ecuador. The species of parasites identified in sand flies were Leishmania major-like, Leishmania naiffi, Leishmania mexicana, Leishmania lainsoni, and “Leishmania sp. siamensis”. Sand fly specimens of Brumptomyia leopoldoi, Mycropigomyia cayennensis, Nyssomyia yuilli yuilli, Nyssomyia trapidoi, Pressatia triacantha, Pressatia dysponeta, Psychodopygus carrerai carrerai, Psychodopygus panamensis, and Trichophoromyia ubiquitalis were found positive for Leishmania parasite. These findings contribute to a better understanding of the epidemiology and transmission dynamics of the disease in high-risk areas of Ecuador. PMID:28981860

  4. Molecular cloning and functional expression of a human cDNA encoding the antimutator enzyme 8-hydroxyguanine-DNA glycosylase

    Science.gov (United States)

    Roldán-Arjona, Teresa; Wei, Ying-Fei; Carter, Kenneth C.; Klungland, Arne; Anselmino, Catherine; Wang, Rui-Ping; Augustus, Meena; Lindahl, Tomas

    1997-01-01

    The major mutagenic base lesion in DNA caused by exposure to reactive oxygen species is 8-hydroxyguanine (8-oxo-7,8-dihydroguanine). In bacteria and Saccharomyces cerevisiae, this damaged base is excised by a DNA glycosylase with an associated lyase activity for chain cleavage. We have cloned, sequenced, and expressed a human cDNA with partial sequence homology to the relevant yeast gene. The encoded 47-kDa human enzyme releases free 8-hydroxyguanine from oxidized DNA and introduces a chain break in a double-stranded oligonucleotide specifically at an 8-hydroxyguanine residue base paired with cytosine. Expression of the human protein in a DNA repair-deficient E. coli mutM mutY strain partly suppresses its spontaneous mutator phenotype. The gene encoding the human enzyme maps to chromosome 3p25. These results show that human cells have an enzyme that can initiate base excision repair at mutagenic DNA lesions caused by active oxygen. PMID:9223306

  5. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  6. The Mycobacterium tuberculosis Rv2540c DNA sequence encodes a bifunctional chorismate synthase

    Directory of Open Access Journals (Sweden)

    Santos Diógenes S

    2008-04-01

    Full Text Available Abstract Background The emergence of multi- and extensively-drug resistant Mycobacterium tuberculosis strains has created an urgent need for new agents to treat tuberculosis (TB. The enzymes of shikimate pathway are attractive targets to the development of antitubercular agents because it is essential for M. tuberculosis and is absent from humans. Chorismate synthase (CS is the seventh enzyme of this route and catalyzes the NADH- and FMN-dependent synthesis of chorismate, a precursor of aromatic amino acids, naphthoquinones, menaquinones, and mycobactins. Although the M. tuberculosis Rv2540c (aroF sequence has been annotated to encode a chorismate synthase, there has been no report on its correct assignment and functional characterization of its protein product. Results In the present work, we describe DNA amplification of aroF-encoded CS from M. tuberculosis (MtCS, molecular cloning, protein expression, and purification to homogeneity. N-terminal amino acid sequencing, mass spectrometry and gel filtration chromatography were employed to determine identity, subunit molecular weight and oligomeric state in solution of homogeneous recombinant MtCS. The bifunctionality of MtCS was determined by measurements of both chorismate synthase and NADH:FMN oxidoreductase activities. The flavin reductase activity was characterized, showing the existence of a complex between FMNox and MtCS. FMNox and NADH equilibrium binding was measured. Primary deuterium, solvent and multiple kinetic isotope effects are described and suggest distinct steps for hydride and proton transfers, with the former being more rate-limiting. Conclusion This is the first report showing that a bacterial CS is bifunctional. Primary deuterium kinetic isotope effects show that C4-proS hydrogen is being transferred during the reduction of FMNox by NADH and that hydride transfer contributes significantly to the rate-limiting step of FMN reduction reaction. Solvent kinetic isotope effects and

  7. Lab-on-a-chip platform for high throughput drug discovery with DNA-encoded chemical libraries

    Science.gov (United States)

    Grünzner, S.; Reddavide, F. V.; Steinfelder, C.; Cui, M.; Busek, M.; Klotzbach, U.; Zhang, Y.; Sonntag, F.

    2017-02-01

    The fast development of DNA-encoded chemical libraries (DECL) in the past 10 years has received great attention from pharmaceutical industries. It applies the selection approach for small molecular drug discovery. Because of the limited choices of DNA-compatible chemical reactions, most DNA-encoded chemical libraries have a narrow structural diversity and low synthetic yield. There is also a poor correlation between the ranking of compounds resulted from analyzing the sequencing data and the affinity measured through biochemical assays. By combining DECL with dynamical chemical library, the resulting DNA-encoded dynamic library (EDCCL) explores the thermodynamic equilibrium of reversible reactions as well as the advantages of DNA encoded compounds for manipulation/detection, thus leads to enhanced signal-to-noise ratio of the selection process and higher library quality. However, the library dynamics are caused by the weak interactions between the DNA strands, which also result in relatively low affinity of the bidentate interaction, as compared to a stable DNA duplex. To take advantage of both stably assembled dual-pharmacophore libraries and EDCCLs, we extended the concept of EDCCLs to heat-induced EDCCLs (hi-EDCCLs), in which the heat-induced recombination process of stable DNA duplexes and affinity capture are carried out separately. To replace the extremely laborious and repetitive manual process, a fully automated device will facilitate the use of DECL in drug discovery. Herein we describe a novel lab-on-a-chip platform for high throughput drug discovery with hi-EDCCL. A microfluidic system with integrated actuation was designed which is able to provide a continuous sample circulation by reducing the volume to a minimum. It consists of a cooled and a heated chamber for constant circulation. The system is capable to generate stable temperatures above 75 °C in the heated chamber to melt the double strands of the DNA and less than 15 °C in the cooled chamber

  8. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  9. Identification of a cryptic prokaryotic promoter within the cDNA encoding the 5' end of dengue virus RNA genome.

    Directory of Open Access Journals (Sweden)

    Dongsheng Li

    Full Text Available Infectious cDNA clones of RNA viruses are important research tools, but flavivirus cDNA clones have proven difficult to assemble and propagate in bacteria. This has been attributed to genetic instability and/or host cell toxicity, however the mechanism leading to these difficulties has not been fully elucidated. Here we identify and characterize an efficient cryptic bacterial promoter in the cDNA encoding the dengue virus (DENV 5' UTR. Following cryptic transcription in E. coli, protein expression initiated at a conserved in-frame AUG that is downstream from the authentic DENV initiation codon, yielding a DENV polyprotein fragment that was truncated at the N-terminus. A more complete understanding of constitutive viral protein expression in E. coli might help explain the cloning and propagation difficulties generally observed with flavivirus cDNA.

  10. Mucosal delivery of a transmission-blocking DNA vaccine encoding Giardia lamblia CWP2 by Salmonella typhimurium bactofection vehicle.

    Science.gov (United States)

    Abdul-Wahid, Aws; Faubert, Gaétan

    2007-12-05

    In this study, we investigated the use of Salmonella typhimurium (STM1 strain) as a bactofection vehicle to deliver a transmission-blocking DNA vaccine (TBDV) plasmid to the intestinal immune system. The gene encoding the full length cyst wall protein-2 (CWP2) from Giardia lamblia was subcloned into the pCDNA3 mammalian expression vector and stably introduced into S. typhimurium STM1. Eight-week-old female BALB/c mice were orally immunized every 2 weeks, for a total of three immunizations. Vaccinated and control mice were sacrificed 1 week following the last injection. Administration of the DNA vaccine led to the production of CWP2-specific cellular immune responses characterized by a mixed Th1/Th2 response. Using ELISA, antigen-specific IgA and IgG antibodies were detected in intestinal secretions. Moreover, analysis of sera demonstrated that the DNA immunization also stimulated the production of CWP2-specific IgG antibodies that were mainly of the IgG2a isotype. Finally, challenge infection with live Giardia muris cysts revealed that mice receiving the CWP2-encoding DNA vaccine were able to reduce cyst shedding by approximately 60% compared to control mice. These results demonstrate, for the first time, the development of parasite transmission-blocking immunity at the intestinal level following the administration of a mucosal DNA vaccine delivered by S. typhimurium STM1.

  11. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  12. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  13. RNase-L regulates the stability of mitochondrial DNA-encoded mRNAs in mouse embryo fibroblasts

    International Nuclear Information System (INIS)

    Chandrasekaran, Krish; Mehrabian, Zara; Li Xiaoling; Hassel, Bret

    2004-01-01

    Accelerated decrease in the levels of mitochondrial DNA-encoded mRNA (mt-mRNA) occurs in neuronal cells exposed either to the excitatory amino acid, glutamate or to the sodium ionophore, monensin, suggesting a role of mitochondrial RNase(s) on the stability of mt-mRNAs. Here we report that in mouse embryo fibroblasts that are devoid of the interferon-regulated RNase, RNase-L, the monensin-induced decrease in the half-life of mt-mRNA was reduced. In monensin (250 nM)-treated RNase-L +/+ cells the average half-life of mt-mRNA, determined after termination of transcription with actinomycin D, was found to be 3 h, whereas in monensin-treated RNase-L -/- cells the half-life of mt-mRNA was >6 h. In contrast, the stability of nuclear DNA-encoded β-actin mRNA was unaffected. Induction of RNase-L expression in mouse 3T3 fibroblasts further decreased the monensin-induced reduction in mt-mRNA half-life to 1.5 h. The results indicate that the RNase-L-dependent decrease in mtDNA-encoded mRNA transcript levels occurs through a decrease in the half-life of mt-mRNA, and that RNase-L may play a role in the stability of mt-mRNA

  14. Novel features of a PIWI-like protein homolog in the parasitic protozoan Leishmania.

    Directory of Open Access Journals (Sweden)

    Prasad K Padmanabhan

    Full Text Available In contrast to nearly all eukaryotes, the Old World Leishmania species L. infantum and L. major lack the bona fide RNAi machinery genes. Interestingly, both Leishmania genomes code for an atypical Argonaute-like protein that possesses a PIWI domain but lacks the PAZ domain found in Argonautes from RNAi proficient organisms. Using sub-cellular fractionation and confocal fluorescence microscopy, we show that unlike other eukaryotes, the PIWI-like protein is mainly localized in the single mitochondrion in Leishmania. To predict PIWI function, we generated a knockout mutant for the PIWI gene in both L. infantum (Lin and L. major species by double-targeted gene replacement. Depletion of PIWI has no effect on the viability of insect promastigote forms but leads to an important growth defect of the mammalian amastigote lifestage in vitro and significantly delays disease pathology in mice, consistent with a higher expression of the PIWI transcript in amastigotes. Moreover, amastigotes lacking PIWI display a higher sensitivity to apoptosis inducing agents than wild type parasites, suggesting that PIWI may be a sensor for apoptotic stimuli. Furthermore, a whole-genome DNA microarray analysis revealed that loss of LinPIWI in Leishmania amastigotes affects mostly the expression of specific subsets of developmentally regulated genes. Several transcripts encoding surface and membrane-bound proteins were found downregulated in the LinPIWI((-/- mutant whereas all histone transcripts were upregulated in the null mutant, supporting the possibility that PIWI plays a direct or indirect role in the stability of these transcripts. Although our data suggest that PIWI is not involved in the biogenesis or the stability of small noncoding RNAs, additional studies are required to gain further insights into the role of this protein on RNA regulation and amastigote development in Leishmania.

  15. Progress towards a Leishmania vaccine.

    Science.gov (United States)

    Tabbara, Khaled S

    2006-07-01

    Leishmaniasis is a vector-born protozoan disease. Approximately 12 million individuals are affected worldwide with an estimated annual incidence of 1.5-2 million. Two clinical manifestations are recognized, cutaneous, and visceral, both of which are common in the Middle East. In both forms, infection is chronic, with potential deformities, persistence following cure, and lifelong risk of reactivation. Attempts to develop an effective human Leishmania vaccine have not yet succeeded. Leishmanization, a crude form of live vaccination historically originated in this part of the world. Experimental vaccination has been extensively studied in model animals in the past 2 decades. In this review, major human killed vaccine trials are surveyed, and modern trends in Leishmania vaccine development, including subunit vaccines, naked DNA vaccines, and transmission blocking vaccines are explored. Recent findings of a link between persistence of live parasites, and maintenance of long-term immunity suggest live vaccination with attenuated strains, as a future vaccination strategy.

  16. rad-Dependent response of the chk1-encoded protein kinase at the DNA damage checkpoint

    NARCIS (Netherlands)

    Walworth, N.C.; Bernards, R.A.

    1996-01-01

    Exposure of eukaryotic cells to agents that generate DNA damage results in transient arrest of progression through the cell cycle. In fission yeast, the DNA damage checkpoint associated with cell cycle arrest before mitosis requires the protein kinase p56chk1. DNA damage induced by ultraviolet

  17. Cell migration induced by Leishmania (Leishmania) amazonensis, Leishmania (Leishmania) major and Leishmania (Viannia) braziliensis into the peritoneal cavity of BALB/c mice

    OpenAIRE

    DT Wakimoto; KV Gaspareto; TGV Silveira; MVC Lonardoni; SMA Aristides

    2010-01-01

    In American cutaneous leishmaniasis, the initial infection phase is characterized by recruitment of neutrophils and monocytes. The migration of these cells in response to the presence of Leishmania in the peritoneum of affected animals remains unclear. The objective of this study was to investigate cell migration to the peritoneum of BALB/c mice after infection with Leishmania (Leishmania) amazonensis, Leishmania (Viannia) braziliensis and Leishmania (Leishmania) major. Initially, Leishmania ...

  18. Autonomous assembly of synthetic oligonucleotides built from an expanded DNA alphabet. Total synthesis of a gene encoding kanamycin resistance

    Directory of Open Access Journals (Sweden)

    Kristen K. Merritt

    2014-10-01

    Full Text Available Background: Many synthetic biologists seek to increase the degree of autonomy in the assembly of long DNA (L-DNA constructs from short synthetic DNA fragments, which are today quite inexpensive because of automated solid-phase synthesis. However, the low information density of DNA built from just four nucleotide “letters”, the presence of strong (G:C and weak (A:T nucleobase pairs, the non-canonical folded structures that compete with Watson–Crick pairing, and other features intrinsic to natural DNA, generally prevent the autonomous assembly of short single-stranded oligonucleotides greater than a dozen or so.Results: We describe a new strategy to autonomously assemble L-DNA constructs from fragments of synthetic single-stranded DNA. This strategy uses an artificially expanded genetic information system (AEGIS that adds nucleotides to the four (G, A, C, and T found in standard DNA by shuffling hydrogen-bonding units on the nucleobases, all while retaining the overall Watson–Crick base-pairing geometry. The added information density allows larger numbers of synthetic fragments to self-assemble without off-target hybridization, hairpin formation, and non-canonical folding interactions. The AEGIS pairs are then converted into standard pairs to produce a fully natural L-DNA product. Here, we report the autonomous assembly of a gene encoding kanamycin resistance using this strategy. Synthetic fragments were built from a six-letter alphabet having two AEGIS components, 5-methyl-2’-deoxyisocytidine and 2’-deoxyisoguanosine (respectively S and B, at their overlapping ends. Gaps in the overlapped assembly were then filled in using DNA polymerases, and the nicks were sealed by ligase. The S:B pairs in the ligated construct were then converted to T:A pairs during PCR amplification. When cloned into a plasmid, the product was shown to make Escherichia coli resistant to kanamycin. A parallel study that attempted to assemble similarly sized genes

  19. Safety and immunogenicity of a novel therapeutic DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Juan, Long; Xiao, Zhao; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    Current clinically available treatments for rheumatoid arthritis (RA) fail to cure the disease or unsatisfactorily halt disease progression. To overcome these limitations, the development of therapeutic DNA vaccines and boosters may offer new promising strategies. Because type II collagen (CII) as a critical autoantigen in RA and native chicken type II collagen (nCCII) has been used to effectively treat RA, we previously developed a novel therapeutic DNA vaccine encoding CCII (pcDNA-CCOL2A1) with efficacy comparable to that of the current "gold standard", methotrexate(MTX). Here, we systemically evaluated the safety and immunogenicity of the pcDNA-CCOL2A1 vaccine in normal Wistar rats. Group 1 received only a single intramuscular injection into the hind leg with pcDNA-CCOL2A1 at the maximum dosage of 3 mg/kg on day 0; Group 2 was injected with normal saline (NS) as a negative control. All rats were monitored daily for any systemic adverse events, reactions at the injection site, and changes in body weights. Plasma and tissues from all experimental rats were collected on day 14 for routine examinations of hematology and biochemistry parameters, anti-CII IgG antibody reactivity, and histopathology. Our results indicated clearly that at the maximum dosage of 3 mg/kg, the pcDNA-CCOL2A1 vaccine was safe and well-tolerated. No abnormal clinical signs or deaths occurred in the pcDNA-CCOL2A1 group compared with the NS group. Furthermore, no major alterations were observed in hematology, biochemistry, and histopathology, even at the maximum dose. In particularly, no anti-CII IgG antibodies were detected in vaccinated normal rats at 14 d after vaccination; this was relevant because we previously demonstrated that the pcDNA-CCOL2A1 vaccine, when administered at the therapeutic dosage of 300 μg/kg alone, did not induce anti-CII IgG antibody production and significantly reduced levels of anti-CII IgG antibodies in the plasma of rats with established collagen-induced arthritis

  20. Bacteriophage T5 encodes a homolog of the eukaryotic transcription coactivator PC4 implicated in recombination-dependent DNA replication.

    Science.gov (United States)

    Steigemann, Birthe; Schulz, Annina; Werten, Sebastiaan

    2013-11-15

    The RNA polymerase II cofactor PC4 globally regulates transcription of protein-encoding genes through interactions with unwinding DNA, the basal transcription machinery and transcription activators. Here, we report the surprising identification of PC4 homologs in all sequenced representatives of the T5 family of bacteriophages, as well as in an archaeon and seven phyla of eubacteria. We have solved the crystal structure of the full-length T5 protein at 1.9Å, revealing a striking resemblance to the characteristic single-stranded DNA (ssDNA)-binding core domain of PC4. Intriguing novel structural features include a potential regulatory region at the N-terminus and a C-terminal extension of the homodimerisation interface. The genome organisation of T5-related bacteriophages points at involvement of the PC4 homolog in recombination-dependent DNA replication, strongly suggesting that the protein corresponds to the hitherto elusive replicative ssDNA-binding protein of the T5 family. Our findings imply that PC4-like factors intervene in multiple unwinding-related processes by acting as versatile modifiers of nucleic acid conformation and raise the possibility that the eukaryotic transcription coactivator derives from ancestral DNA replication, recombination and repair factors. © 2013.

  1. Natural infection of bats with Leishmania in Ethiopia.

    Science.gov (United States)

    Kassahun, Aysheshm; Sadlova, Jovana; Benda, Petr; Kostalova, Tatiana; Warburg, Alon; Hailu, Asrat; Baneth, Gad; Volf, Petr; Votypka, Jan

    2015-10-01

    The leishmaniases, a group of diseases with a worldwide-distribution, are caused by different species of Leishmania parasites. Both cutaneous and visceral leishmaniasis remain important public health problems in Ethiopia. Epidemiological cycles of these protozoans involve various sand fly (Diptera: Psychodidae) vectors and mammalian hosts, including humans. In recent years, Leishmania infections in bats have been reported in the New World countries endemic to leishmaniasis. The aim of this study was to survey natural Leishmania infection in bats collected from various regions of Ethiopia. Total DNA was isolated from spleens of 163 bats belonging to 23 species and 18 genera. Leishmania infection was detected by real-time (RT) PCR targeting a kinetoplast (k) DNA and internal transcribed spacer one (ITS1) gene of the parasite. Detection was confirmed by sequencing of the PCR products. Leishmania kDNA was detected in eight (4.9%) bats; four of them had been captured in the Aba-Roba and Awash-Methara regions that are endemic for leishmaniasis, while the other four specimens originated from non-endemic localities of Metu, Bedele and Masha. Leishmania isolates from two bats were confirmed by ITS1 PCR to be Leishmania tropica and Leishmania major, isolated from two individual bats, Cardioderma cor and Nycteris hispida, respectively. These results represent the first confirmed observation of natural infection of bats with the Old World Leishmania. Hence, bats should be considered putative hosts of Leishmania spp. affecting humans with a significant role in the transmission. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  2. Description of Leishmania (Leishmania forattinii sp. n., a new parasite infecting opossums and rodents in Brazil

    Directory of Open Access Journals (Sweden)

    Elizaide L. A. Yoshida

    1993-09-01

    Full Text Available A new parasite species of Leishmania is described, L. (Leishmania forattinii sp. n., which was isolated from a pooled triturate of liver and spleen of a opossum (Didelphis marsupialis aurita and from skin samples from a rodent (Proechmys iheringi denigratus, captured in primary forest on the Atlantic Cost of Brazil. Our results on the basis of biological and molecular criteria indicate that this taxonomically distinct parasite ias a new species of the L. mexicana complex, but closely related to L. (L. aristidesi Laison & shaw, 1979, as revelated by phenetic and phylogenetic numerical analyses of the enzyme data. L. forattinii was clearly distinguishable from other Leishmania species of the genus usisng enzyme electrophoresis, monoclonal antibodies, molecular karyotypes, analysis of restriction enzyme digestion patterns of kinetoplast DNA (kDNA, as well as the use of kDNA hybridization procedures.

  3. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  4. Prevalence and risk factors associated with Leishmania infection in Trang Province, southern Thailand.

    Science.gov (United States)

    Manomat, Jipada; Leelayoova, Saovanee; Bualert, Lertwut; Tan-Ariya, Peerapan; Siripattanapipong, Suradej; Mungthin, Mathirut; Naaglor, Tawee; Piyaraj, Phunlerd

    2017-11-01

    Autochthonous cutaneous and visceral leishmaniasis (VL) caused by Leishmania martiniquensis and Leishmania siamensis have been considered emerging infectious diseases in Thailand. The disease burden is significantly underestimated, especially the prevalence of Leishmania infection among HIV-positive patients. A cross-sectional study was conducted to determine the prevalence and risk factors associated with Leishmania infection among patients with HIV/AIDS living in Trang province, southern Thailand, between 2015 and 2016. Antibodies against Leishmania infection were assayed using the direct agglutination test (DAT). DNA of Leishmania was detected by ITS1-PCR using the buffy coat. Species of Leishmania were also identified. Of 724 participants, the prevalence of Leishmania infection was 25.1% (182/724) using either DAT or PCR assays. Seroprevalence of Leishmania infection was 18.5% (134/724), while Leishmania DNA detected by the PCR method was 8.4% (61/724). Of these, 24.9% (180/724) were asymptomatic, whereas 0.3% (2/724) were symptomatic VL and VL/CL (cutaneous leishmaniasis). At least five species were identified: L. siamensis, L. martiniquensis, L. donovani complex, L. lainsoni, and L. major. Multivariate analysis showed that CD4+ levels Leishmania infection. Those who were PCR positive for Leishmania DNA were significantly associated with a detectable viral load, whereas non-injection drug use (NIDU) and CD4+ levels Leishmania seropositivity. A magnitude of the prevalence of underreporting Leishmania infection among Thai patients with HIV was revealed in this study. Effective public health policy to prevent and control disease transmission is urgently needed.

  5. Yeast DNA-repair gene RAD14 encodes a zinc metalloprotein with affinity for ultraviolet-damaged DNA

    International Nuclear Information System (INIS)

    Guzder, S.N.; Sung, P.; Prakash, S.; Prakash, L.

    1993-01-01

    Xeroderma pigmentosum (XP) patients suffer from a high incidence of skin cancers due to a defect in excision repair of UV light-damaged DNA. Of the seven XP complementation groups, A--G, group A represents a severe and frequent form of the disease. The Saccharomyces cerevisiae RAD14 gene is a homolog of the XP-A correcting (XPAC) gene. Like XP-A cells, rad14-null mutants are defective in the incision step of excision repair of UV-damaged DNA. The authors have purified RAD14 protein to homogeneity from extract of a yeast strain genetically tailored to overexpress RAD14. As determined by atomic emission spectroscopy, RAD14 contains one zinc atom. They also show in vitro that RAD14 binds zinc but does not bind other divalent metal ions. In DNA mobility-shift assays, RAD14 binds specifically to UV-damaged DNA. Removal of cyclobutane pyrimidine dimers from damaged DNA by enzymatic photoreactivation has no effect on binding, strongly suggesting that RAD14 recognizes pyrimidine(6-4)pyrimidone photoproduct sites. These findings indicate that RAD14 functions in damage recognition during excision repair. 37 refs., 4 figs

  6. Nucleotide sequence of a human cDNA encoding a ras-related protein (rap1B)

    Energy Technology Data Exchange (ETDEWEB)

    Pizon, V; Lerosey, I; Chardin, P; Tavitian, A [INSERM, Paris (France)

    1988-08-11

    The authors have previously characterized two human ras-related genes rap1 and rap2. Using the rap1 clone as probe they isolated and sequenced a new rap cDNA encoding the 184aa rap1B protein. The rap1B protein is 95% identical to rap1 and shares several properties with the ras protein suggesting that it could bind GTP/GDP and have a membrane location. As for rap1, the structural characteristics of rap1B suggest that the rap and ras proteins might interact on the same effector.

  7. Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp.) Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B.

    Science.gov (United States)

    Chénard, Caroline; Wirth, Jennifer F; Suttle, Curtis A

    2016-06-14

    Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages. Filamentous cyanobacteria belonging to the genus Nostoc are widespread and ecologically important in freshwater, yet little is known about the genomic content of their viruses. Here we report the first genomic analysis of cyanophages infecting

  8. Identification of the polypeptides encoded in the unassigned reading frames 2, 4, 4L, and 5 of human mitochondrial DNA

    International Nuclear Information System (INIS)

    Mariottini, P.; Chomyn, A.; Riley, M.; Cottrell, B.; Doolittle, R.F.; Attardi, G.

    1986-01-01

    In previous work, antibodies prepared against chemically synthesized peptides predicted from the DNA sequence were used to identify the polypeptides encoded in three of the eight unassigned reading frames (URFs) of human mitochondrial DNA (mtDNA). In the present study, this approach has been extended to other human mtDNA URFs. In particular, antibodies directed against the NH 2 -terminal octapeptide of the putative URF2 product specifically precipitated component 11 of the HeLa cell mitochondrial translation products, the reaction being inhibited by the specific peptide. Similarly, antibodies directed against the COOH-terminal nonapeptide of the putative URF4 product reacted specifically with components 4 and 5, and antibodies against a COOH-terminal heptapeptide of the presumptive URF4L product reacted specifically with component 26. Antibodies against the NH 2 -terminal heptapeptide of the putative product of URF5 reacted with component 1, but only to a marginal extent; however, the results of a trypsin fingerprinting analysis of component 1 point strongly to this component as being the authentic product of URF5. The polypeptide assignments to the mtDNA URFs analyzed here are supported by the relative electrophoretic mobilities of proteins 11, 4-5, 26, and 1, which are those expected for the molecular weights predicted from the DNA sequence for the products of URF2, URF4, URF4L, and URF5, respectively. With the present assignment, seven of the eight human mtDNA URFs have been shown to be expressed in HeLa cells

  9. Expression of Recombinant Human Coagulation Factor VII by the Lizard Leishmania Expression System

    Directory of Open Access Journals (Sweden)

    Sina Mirzaahmadi

    2011-01-01

    Full Text Available The variety of recombinant protein expression systems have been developed as a resource of FVII gene expression. In the current study, the authors used a novel protein expression system based on the Iranian Lizard Leishmania, a trypanosomatid protozoan as a host for expression of FVII. Plasmid containing cDNA encoding full-length human FVII was introduced into Lizard Leishmania and positive transfectants were analyzed by SDS-PAGE and Western blot analysis. Furthermore, biological activity of purified protein was detected by PT assay. The recombinant strain harboring a construct was analyzed for expression of FVII at the mRNA and protein level. Purified rFVII was obtained and in order to confirm the purified compound was in fact rFVII. Western blot analysis was carried out. Clotting time in PT assay was reduced about 30 seconds with the purified rFVII. In Conclusion, this study has demonstrated, for the first time, that Leishmania cells can be used as an expression system for producing recombinant FVII.

  10. Immunization with plasmid DNA encoding the hemagglutinin and the nucleoprotein confers robust protection against a lethal canine distemper virus challenge.

    Science.gov (United States)

    Dahl, Lotte; Jensen, Trine Hammer; Gottschalck, Elisabeth; Karlskov-Mortensen, Peter; Jensen, Tove Dannemann; Nielsen, Line; Andersen, Mads Klindt; Buckland, Robin; Wild, T Fabian; Blixenkrone-Møller, Merete

    2004-09-09

    We have investigated the protective effect of immunization of a highly susceptible natural host of canine distemper virus (CDV) with DNA plasmids encoding the viral nucleoprotein (N) and hemagglutinin (H). The combined intradermal and intramuscular routes of immunization elicited high virus-neutralizing serum antibody titres in mink (Mustela vison). To mimic natural exposure, we also conducted challenge infection by horizontal transmission from infected contact animals. Other groups received a lethal challenge infection by administration to the mucosae of the respiratory tract and into the muscle. One of the mink vaccinated with N plasmid alone developed severe disease after challenge. In contrast, vaccination with the H plasmid together with the N plasmid conferred solid protection against disease and we were unable to detect CDV infection in PBMCs or in different tissues after challenge. Our findings show that DNA immunization by the combined intradermal and intramuscular routes can confer solid protective immunity against naturally transmitted morbillivirus infection and disease.

  11. Light-dependent, plastome-wide association of the plastid-encoded RNA polymerase with chloroplast DNA.

    Science.gov (United States)

    Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian

    2013-12-01

    Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  12. An Oral DNA Vaccine Encoding Endoglin Eradicates Breast Tumors by Blocking Their Blood Supply

    National Research Council Canada - National Science Library

    Reisfeld, Ralph A

    2007-01-01

    In an effort to meet the urgent need for the development of novel and effective treatments for metastatic breast cancer, we developed and evaluated a novel, oral DNA vaccine targeting endoglin (CD105...

  13. The protein encoded by the proto-oncogene DEK changes the topology of chromatin and reduces the efficiency of DNA replication in a chromatin-specific manner

    DEFF Research Database (Denmark)

    Alexiadis, V; Waldmann, T; Andersen, Jens S.

    2000-01-01

    The structure of chromatin regulates the genetic activity of the underlying DNA sequence. We report here that the protein encoded by the proto-oncogene DEK, which is involved in acute myelogenous leukemia, induces alterations of the superhelical density of DNA in chromatin. The change in topology...

  14. Leishmania infections: Molecular targets and diagnosis.

    Science.gov (United States)

    Akhoundi, Mohammad; Downing, Tim; Votýpka, Jan; Kuhls, Katrin; Lukeš, Julius; Cannet, Arnaud; Ravel, Christophe; Marty, Pierre; Delaunay, Pascal; Kasbari, Mohamed; Granouillac, Bruno; Gradoni, Luigi; Sereno, Denis

    2017-10-01

    Progress in the diagnosis of leishmaniases depends on the development of effective methods and the discovery of suitable biomarkers. We propose firstly an update classification of Leishmania species and their synonymies. We demonstrate a global map highlighting the geography of known endemic Leishmania species pathogenic to humans. We summarize a complete list of techniques currently in use and discuss their advantages and limitations. The available data highlights the benefits of molecular markers in terms of their sensitivity and specificity to quantify variation from the subgeneric level to species complexes, (sub) species within complexes, and individual populations and infection foci. Each DNA-based detection method is supplied with a comprehensive description of markers and primers and proposal for a classification based on the role of each target and primer in the detection, identification and quantification of leishmaniasis infection. We outline a genome-wide map of genes informative for diagnosis that have been used for Leishmania genotyping. Furthermore, we propose a classification method based on the suitability of well-studied molecular markers for typing the 21 known Leishmania species pathogenic to humans. This can be applied to newly discovered species and to hybrid strains originating from inter-species crosses. Developing more effective and sensitive diagnostic methods and biomarkers is vital for enhancing Leishmania infection control programs. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. Construction of adiponectin-encoding plasmid DNA and gene therapy of non-obese type 2 diabetes mellitus.

    Science.gov (United States)

    Nan, Mei Hua; Park, Jeong-Sook; Myung, Chang-Seon

    2010-01-01

    Adiponectin (ADN), an insulin-sensitizing adipokine, stimulates glucose uptake, inhibits gluconeogenesis, and plays an important role in improving insulin sensitivity. Since blood levels of ADN are low in type 2 diabetes mellitus (DM), this study was designed to investigate the therapeutic effectiveness of increasing the ADN level through injection of plasmid DNA encoding ADN in type 2 DM. A non-obese type 2 DM mouse model was established via combined administration of streptozotocin with nicotinamide and exhibited significantly higher plasma glucose concentration and insulin resistance compared with normal controls according to oral glucose tolerance and insulin challenge tests. Plasmid DNA encoding mouse ADN from differentiated NIH3T3 adipocytes was constructed in pVAX1 (pVAX/ADN). Transfection of pVAX/ADN into various cell lines including HeLa, HT22, HEK293, HepG2, and SK-Hep1 cells, increased ADN mRNA expression levels in a dose-dependent manner. The administration of pVAX/ADN into non-obese type 2 DM mice via tail vein significantly increased the blood level of ADN and decreased the plasma glucose concentration. Moreover, the parameters related to insulin resistance (HOMA-IR) and insulin sensitivity (QUICKI) were significantly improved. These results suggest that ADN gene therapy could be a clinically effective tool for the treatment of type 2 DM.

  16. Strategies to enhance immunogenicity of cDNA vaccine encoded antigens by modulation of antigen processing

    NARCIS (Netherlands)

    Platteel, Anouk C M; Marit de Groot, A; Andersen, Peter; Ovaa, Huib; Kloetzel, Peter M; Mishto, Michele; Sijts, Alice J A M

    2016-01-01

    Most vaccines are based on protective humoral responses while for intracellular pathogens CD8(+) T cells are regularly needed to provide protection. However, poor processing efficiency of antigens is often a limiting factor in CD8(+) T cell priming, hampering vaccine efficacy. The multistage cDNA

  17. A atividade da azitromicina contra a Leishmania (Viannia) braziliensis e a Leishmania (Leishmania) amazonensis no modelo golden hamster

    OpenAIRE

    Sinagra, Ángel; Luna, Concepción; Abraham, David; Iannella, Maria del Carmen; Riarte, Adelina; Krolewiecki, Alejandro J.

    2007-01-01

    New therapeutic alternatives against leishmaniasis remain a priority. The activity of azithromycin against Leishmania (Leishmania) major has been previously demonstrated. Different responses among species of Leishmania make species-specific drug screening necessary. The activity of azithromycin against Leishmania (Viannia) braziliensis and Leishmania (Leishmania) amazonensis was evaluated in golden hamsters infected through footpad injections of metacyclic promastigotes, and compared with unt...

  18. The activity of azithromycin against Leishmania (Viannia) braziliensis and Leishmania (Leishmania) amazonensis in the golden hamster model

    OpenAIRE

    Sinagra,Ángel; Luna,Concepción; Abraham,David; Iannella,Maria del Carmen; Riarte,Adelina; Krolewiecki,Alejandro J.

    2007-01-01

    New therapeutic alternatives against leishmaniasis remain a priority. The activity of azithromycin against Leishmania (Leishmania) major has been previously demonstrated. Different responses among species of Leishmania make species-specific drug screening necessary. The activity of azithromycin against Leishmania (Viannia) braziliensis and Leishmania (Leishmania) amazonensis was evaluated in golden hamsters infected through footpad injections of metacyclic promastigotes, and compared with unt...

  19. Diverse replication-associated protein encoding circular DNA viruses in guano samples of Central-Eastern European bats.

    Science.gov (United States)

    Kemenesi, Gábor; Kurucz, Kornélia; Zana, Brigitta; Földes, Fanni; Urbán, Péter; Vlaschenko, Anton; Kravchenko, Kseniia; Budinski, Ivana; Szodoray-Parádi, Farkas; Bücs, Szilárd; Jére, Csaba; Csősz, István; Szodoray-Parádi, Abigél; Estók, Péter; Görföl, Tamás; Boldogh, Sándor; Jakab, Ferenc

    2018-03-01

    Circular replication-associated protein encoding single-stranded DNA (CRESS DNA) viruses are increasingly recognized worldwide in a variety of samples. Representative members include well-described veterinary pathogens with worldwide distribution, such as porcine circoviruses or beak and feather disease virus. In addition, numerous novel viruses belonging to the family Circoviridae with unverified pathogenic roles have been discovered in different human samples. Viruses of the family Genomoviridae have also been described as being highly abundant in different faecal and environmental samples, with case reports showing them to be suspected pathogens in human infections. In order to investigate the genetic diversity of these viruses in European bat populations, we tested guano samples from Georgia, Hungary, Romania, Serbia and Ukraine. This resulted in the detection of six novel members of the family Circoviridae and two novel members of the family Genomoviridae. Interestingly, a gemini-like virus, namely niminivirus, which was originally found in raw sewage samples in Nigeria, was also detected in our samples. We analyzed the nucleotide composition of members of the family Circoviridae to determine the possible host origins of these viruses. This study provides the first dataset on CRESS DNA viruses of European bats, and members of several novel viral species were discovered.

  20. Quantitative PCR is a Valuable Tool to Monitor the Performance of DNA-Encoded Chemical Library Selections.

    Science.gov (United States)

    Li, Yizhou; Zimmermann, Gunther; Scheuermann, Jörg; Neri, Dario

    2017-05-04

    Phage-display libraries and DNA-encoded chemical libraries (DECLs) represent useful tools for the isolation of specific binding molecules from large combinatorial sets of compounds. With both methods, specific binders are recovered at the end of affinity capture procedures by using target proteins of interest immobilized on a solid support. However, although the efficiency of phage-display selections is routinely quantified by counting the phage titer before and after the affinity capture step, no similar quantification procedures have been reported for the characterization of DECL selections. In this article, we describe the potential and limitations of quantitative PCR (qPCR) methods for the evaluation of selection efficiency by using a combinatorial chemical library with more than 35 million compounds. In the experimental conditions chosen for the selections, a quantification of DNA input/recovery over five orders of magnitude could be performed, revealing a successful enrichment of abundant binders, which could be confirmed by DNA sequencing. qPCR provided rapid information about the performance of selections, thus facilitating the optimization of experimental conditions. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. Viruses Infecting a Freshwater Filamentous Cyanobacterium (Nostoc sp. Encode a Functional CRISPR Array and a Proteobacterial DNA Polymerase B

    Directory of Open Access Journals (Sweden)

    Caroline Chénard

    2016-06-01

    Full Text Available Here we present the first genomic characterization of viruses infecting Nostoc, a genus of ecologically important cyanobacteria that are widespread in freshwater. Cyanophages A-1 and N-1 were isolated in the 1970s and infect Nostoc sp. strain PCC 7210 but remained genomically uncharacterized. Their 68,304- and 64,960-bp genomes are strikingly different from those of other sequenced cyanophages. Many putative genes that code for proteins with known functions are similar to those found in filamentous cyanobacteria, showing a long evolutionary history in their host. Cyanophage N-1 encodes a CRISPR array that is transcribed during infection and is similar to the DR5 family of CRISPRs commonly found in cyanobacteria. The presence of a host-related CRISPR array in a cyanophage suggests that the phage can transfer the CRISPR among related cyanobacteria and thereby provide resistance to infection with competing phages. Both viruses also encode a distinct DNA polymerase B that is closely related to those found in plasmids of Cyanothece sp. strain PCC 7424, Nostoc sp. strain PCC 7120, and Anabaena variabilis ATCC 29413. These polymerases form a distinct evolutionary group that is more closely related to DNA polymerases of proteobacteria than to those of other viruses. This suggests that the polymerase was acquired from a proteobacterium by an ancestral virus and transferred to the cyanobacterial plasmid. Many other open reading frames are similar to a prophage-like element in the genome of Nostoc sp. strain PCC 7524. The Nostoc cyanophages reveal a history of gene transfers between filamentous cyanobacteria and their viruses that have helped to forge the evolutionary trajectory of this previously unrecognized group of phages.

  2. Molecular cloning and sequence of cDNA encoding the plasma membrane proton pump (H+-ATPase) of Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Harper, J.F.; Surowy, T.K.; Sussman, M.R.

    1989-01-01

    In plants, the transport of solutes across the plasma membrane is driven by a proton pump (H + -ATPase) that produces an electric potential and pH gradient. The authors isolated and sequenced a full-length cDNA clone that encodes this enzyme in Arabidopsis thaliana. The protein predicted from its nucleotide sequence encodes 959 amino acids and has a molecular mass of 104,207 Da. The plant protein shows structural features common to a family of cation-translocating ATPases found in the plasma membrane of prokaryotic and eukaryotic cells, with the greatest overall identity in amino acid sequence (36%) to the H + -ATPase observed in the plasma membrane of fungi. The structure predicted from a hydropathy plant contains at least eight transmembrane segments, with most of the protein (73%) extending into the cytoplasm and only 5% of the residues exposed on the external surface. Unique features of the plant enzyme include diverged sequences at the amino and carboxyl termini as well as greater hydrophilic character in three extracellular loops

  3. Molecular identification of Leishmania species in Taybad district, Iran

    Directory of Open Access Journals (Sweden)

    Salehi Ghodratollah

    2014-09-01

    Full Text Available Objective: To identify Leishmania species in patients with cutaneous leishmaniasis in the city of Taybad in Razavi Khorasan Province from April 2012 to March 2013. Methods: Among 52 persons who referred to Health Center of Taybad with suspected skin lesions, stained slide smears of 35 patients showed positive result for Leishmania. Also polymerase chain reaction assay performed using specific kDNA primers. Data of patients were analyzed with SPSS. Results: Of 35 positive smears for Leishmania, 21 (60% belonged to males and 14 (40% belonged to females. Polymerase chain reaction bands were observed in all 35 samples of which 31 (88.6% samples showed Leishmania tropica and 4 (11.4% showed Leishmania major. The highest infected age group was 11-20 years old. Conclusions: Both anthroponotic cutaneous leishmaniasis and zoonotic cutaneous leishmaniasis are present in Taybad. Leishmania tropica is the dominant causative species for anthroponotic cutaneous leishmaniasis. Further study is recommended to discover probable reservoir and vector for Leishmania major in Taybad.

  4. A plastome mutation affects processing of both chloroplast and nuclear DNA-encoded plastid proteins.

    Science.gov (United States)

    Johnson, E M; Schnabelrauch, L S; Sears, B B

    1991-01-01

    Immunoblotting of a chloroplast mutant (pm7) of Oenothera showed that three proteins, cytochrome f and the 23 kDa and 16 kDa subunits of the oxygen-evolving subcomplex of photosystem II, were larger than the corresponding mature proteins of the wild type and, thus, appear to be improperly processed in pm7. The mutant is also chlorotic and has little or no internal membrane development in the plastids. The improperly processed proteins, and other proteins that are completely missing, represent products of both the plastid and nuclear genomes. To test for linkage of these defects, a green revertant of pm7 was isolated from cultures in which the mutant plastids were maintained in a nuclear background homozygous for the plastome mutator (pm) gene. In this revertant, all proteins analyzed co-reverted to the wild-type condition, indicating that a single mutation in a plastome gene is responsible for the complex phenotype of pm7. These results suggest that the defect in pm7 lies in a gene that affects a processing protease encoded in the chloroplast genome.

  5. Structure-based domain assignment in Leishmania infantum EndoG: characterization of a pH-dependent regulatory switch and a C-terminal extension that largely dictates DNA substrate preferences.

    Science.gov (United States)

    Oliva, Cristina; Sánchez-Murcia, Pedro A; Rico, Eva; Bravo, Ana; Menéndez, Margarita; Gago, Federico; Jiménez-Ruiz, Antonio

    2017-09-06

    Mitochondrial endonuclease G from Leishmania infantum (LiEndoG) participates in the degradation of double-stranded DNA (dsDNA) during parasite cell death and is catalytically inactive at a pH of 8.0 or above. The presence, in the primary sequence, of an acidic amino acid-rich insertion exclusive to trypanosomatids and its spatial position in a homology-built model of LiEndoG led us to postulate that this peptide stretch might act as a pH sensor for self-inhibition. We found that a LiEndoG variant lacking residues 145-180 is indeed far more active than its wild-type counterpart at pH values >7.0. In addition, we discovered that (i) LiEndoG exists as a homodimer, (ii) replacement of Ser211 in the active-site SRGH motif with the canonical aspartate from the DRGH motif of other nucleases leads to a catalytically deficient enzyme, (iii) the activity of the S211D variant can be restored upon the concomitant replacement of Ala247 with Arg and (iv) a C-terminal extension is responsible for the observed preferential cleavage of single-stranded DNA (ssDNA) and ssDNA-dsDNA junctions. Taken together, our results support the view that LiEndoG is a multidomain molecular machine whose nuclease activity can be subtly modulated or even abrogated through architectural changes brought about by environmental conditions and interaction with other binding partners. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Experimental treatment with sodium stibogluconate of hamsters infected with Leishmania (Leishmania) chagasi and Leishmania (Leishmania) amazonensis Tratamento experimental com stibogluconato de sódio em hamsters infectados com Leishmania (Leishmania) chagasi e Leishmania (Leishmania) amazonensis

    OpenAIRE

    Elizabeth M. de Figueiredo; Jaime Costa e Silva; Reginaldo P. Brazil

    1999-01-01

    The present paper reports the experimental treatment of hamsters infected with Leishmania chagasi and Leishmania amazonensis with sodium stibogluconate (20mg/kg/day x 20 days). Only with L. chagasi did the treatment result in the complete elimination of parasites from the spleen. However, no parasitological cure was achieved in hamsters infected with L. amazonensis.O presente trabalho é um relato do tratamento experimental de hamsters infectado com Leishmania chagasi e Leishmania amazonensis ...

  7. Immunogenicity and protective efficacy of Semliki forest virus replicon-based DNA vaccines encoding goatpox virus structural proteins

    International Nuclear Information System (INIS)

    Zheng Min; Jin Ningyi; Liu Qi; Huo Xiaowei; Li Yang; Hu Bo; Ma Haili; Zhu Zhanbo; Cong Yanzhao; Li Xiao; Jin Minglan; Zhu Guangze

    2009-01-01

    Goatpox, caused by goatpox virus (GTPV), is an acute feverish and contagious disease in goats often associated with high morbidity and high mortality. To resolve potential safety risks and vaccination side effects of existing live attenuated goatpox vaccine (AV41), two Semliki forest virus (SFV) replicon-based bicistronic expression DNA vaccines (pCSm-AAL and pCSm-BAA) which encode GTPV structural proteins corresponding to the Vaccinia virus proteins A27, L1, A33, and B5, respectively, were constructed. Then, theirs ability to induce humoral and cellular response in mice and goats, and protect goats against virulent virus challenge were evaluated. The results showed that, vaccination with pCSm-AAL and pCSm-BAA in combination could elicit strong humoral and cellular responses in mice and goats, provide partial protection against viral challenge in goats, and reduce disease symptoms. Additionally, priming vaccination with the above-mentioned DNA vaccines could significantly reduce the goats' side reactions from boosting vaccinations with current live vaccine (AV41), which include skin lesions at the inoculation site and fevers. Data obtained in this study could not only facilitate improvement of the current goatpox vaccination strategy, but also provide valuable guidance to suitable candidates for evaluation and development of orthopoxvirus vaccines.

  8. Canine leishmaniosis caused by Leishmania major and Leishmania tropica: comparative findings and serology.

    Science.gov (United States)

    Baneth, Gad; Yasur-Landau, Daniel; Gilad, Matan; Nachum-Biala, Yaarit

    2017-03-13

    Infection and clinical disease associated with Leishmania major and Leishmania tropica, two common agents of human cutaneous leishmaniosis, have rarely been reported in dogs. This study describes dogs infected with these Leishmania spp. prevalent in the Middle East and North Africa, and compares the serological response of dogs infected with Leishmania infantum, L. major or L. tropica to whole promastigote antigen enzyme-linked immunosorbent assay (ELISA) of each species and to rK39 dipstick. Leishmania major infection in a 5-month-old male dog was associated with alopecic and ulcerative periocular and limb skin lesions which responded to allopurinol treatment. Infection was detected by skin and blood polymerase chain reaction (PCR) and confirmed by DNA sequencing but the dog was seronegative. Leishmania tropica infection was detected in a 3-month-old female dog co-infected with Babesia vogeli and Anaplasma platys and with no skin lesions. PCR and DNA sequencing of the blood and parasite culture were positive for L. tropica. Sera from 11 dogs infected with L. infantum, L. major or L. tropica were reactive with all three Leishmania spp. antigens except for sera from a dog with L. major infection. No significant differences were found between reactivity of dog sera to the antigen of the infecting species, or to the other Leishmania spp. antigens. Sera from dogs infected with L. infantum and L. tropica were positive with the rK39 antigen kit, while dogs with L. major infection were seronegative. Skin lesions in L. major infected dogs from this study and previous reports (n = 2) were ulcerative and located on the muzzle, feet and foot pads and not associated with generalized lymphadenomegaly and splenomegaly. In previous L. tropica infections, skin lesions were proliferative mucocutaneous in young dogs (n = 2), or associated with widespread dermatitis, lymphadenomegaly and splenomegaly in older dogs with similarity to L. infantum infection (n = 2). This

  9. Isolation and structure of a cDNA encoding the B1 (CD20) cell-surface antigen of human B lymphocytes

    International Nuclear Information System (INIS)

    Tender, T.F.; Streuli, M.; Schlossman, S.F.; Saito, H.

    1988-01-01

    The B1 (CD20) molecule is a M/sub r/ 33,000 phosphoprotein on the surface of human B lymphocytes that may serve a central role in the homoral immune response by regulating B-cell proliferation and differentiation. In this report, a cDNA clone that encodes the B1 molecule was isolated and the amino acid sequence of B1 was determined. B-cell-specific cDNA clones were selected from a human tonsillar cDNA library by differential hybridization with labeled cDNA derived from either size-fractionated B-cell mRNA or size-fractionated T-cell mRNA. Of the 261 cDNA clones isolated, 3 cross-hybridizing cDNA clones were chosen as potential candidates for encoding B1 based on their selective hybridization to RNA from B1-positive cell lines. The longest clone, pB1-21, contained a 2.8-kilobase insert with an 891-base-pair open reading frame that encodes a protein of 33 kDa. mRNA synthesized from the pB1-21 cDNA clone in vitro was translated into a protein of the same apparent molecular weight as B1. Limited proteinase digestion of the pB1-21 translation product and B1 generated peptides of the same sizes, indicating that the pB1-21 cDNA encodes the B1 molecule. Gel blot analysis indicated that pB1-21 hybridized with two mRNA species of 2.8 and 3.4 kilobases only in B1-positive cell lines. The amino acid sequence deduced from the pB1-21 nucleotide sequence apparently lacks a signal sequence and contains three extensive hydrophobic regions. The deduced B1 amino acid sequence shows no significant homology with other known patients

  10. Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

    Science.gov (United States)

    Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

    2014-08-20

    DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

  11. Serological and molecular survey of Leishmania parasites in apparently healthy dogs in the West Bank, Palestine

    Directory of Open Access Journals (Sweden)

    Hamarsheh Omar

    2012-08-01

    Full Text Available Abstract Background Canine visceral leishmaniasis (CVL is caused by Leishmania infantum in all Mediterranean countries. The Leishmania parasite is transmitted by the bite of a corresponding sand fly vector and primarily maintained in nature by wild and domestic reservoirs, including dogs, foxes and jackals. Infected dogs are the primary reservoir host in endemic regions and are the most significant risk disposing humans to infection. The present study aimed at assessing the prevalence of infection with Leishmania and identification of Leishmania infantum in domestic dogs in the West Bank, Palestine. Methods The infection rate among domestic dogs collected from seven districts in the Palestinian West Bank was investigated by examination of parasites in culture from the buffy coat using serological and molecular methods; based on ELISA, internal transcribed spacer 1 (ITS1 and cysteine protease (CPB PCR. Results Out of 215 dogs examined for Leishmania, 36 (16.7% were positive in at least one method. Twenty three animals (11.5% were positive for Leishmania DNA, whereas, ELISA and culture revealed 16 (7.5%, and 4 (1.5% respectively. CPB-PCR on one of three culture-positive isolates revealed Leishmania infantum as the causative agent for Leishmania infection in dogs. Conclusions Our study showed that canine leishmania infection is prevalent with varying degrees in all the seven studied districts in Palestine despite the absence of human VL cases in 4 of these districts. The causative agent was confirmed to be Leishmania infantum.

  12. Isolation and sequence analysis of a cDNA clone encoding the fifth complement component

    DEFF Research Database (Denmark)

    Lundwall, Åke B; Wetsel, Rick A; Kristensen, Torsten

    1985-01-01

    DNA clone of 1.85 kilobase pairs was isolated. Hybridization of the mixed-sequence probe to the complementary strand of the plasmid insert and sequence analysis by the dideoxy method predicted the expected protein sequence of C5a (positions 1-12), amino-terminal to the anticipated priming site. The sequence......, subcloned into M13 mp8, and sequenced at random by the dideoxy technique, thereby generating a contiguous sequence of 1703 base pairs. This clone contained coding sequence for the C-terminal 262 amino acid residues of the beta-chain, the entire C5a fragment, and the N-terminal 98 residues of the alpha......'-chain. The 3' end of the clone had a polyadenylated tail preceded by a polyadenylation recognition site, a 3'-untranslated region, and base pairs homologous to the human Alu concensus sequence. Comparison of the derived partial human C5 protein sequence with that previously determined for murine C3 and human...

  13. Enhancement of the priming efficacy of DNA vaccines encoding dendritic cell-targeted antigens by synergistic toll-like receptor ligands

    Directory of Open Access Journals (Sweden)

    Kornbluth Richard S

    2009-08-01

    Full Text Available Abstract Background Targeting of protein antigens to dendritic cells (DC via the DEC205 receptor enhances presentation of antigen-derived peptides on MHC-I and MHC-II molecules and, in the presence of costimulatory signals, antigen-specific immune responses. The immunogenicity and efficacy of DNA vaccination can also be enhanced by fusing the encoded antigen to single chain antibodies directed against DEC205. To further improve this strategy, we evaluated different toll-like receptor ligands (TLR and CD40 ligands (CD40L as adjuvants for DNA vaccines encoding a DEC205-single-chain antibody fused to the ovalbumin model antigen or HIV-1 Gag and assessed the priming efficacy of DNA in a DNA prime adenoviral vector boost immunization regimen. Results Mice were primed with the adjuvanted DEC-205 targeted DNA vaccines and boosted with adenoviral vectors encoding the same antigens. CD8+ T cell responses were determined after the adenoviral booster immunization, to determine how well the different DNA immunization regimens prime for the adenoviral boost. In the absence of adjuvants, targeting of DNA-encoded ovalbumin to DCs suppressed CD8+ T-cell responses after the adenoviral booster immunization. CD8+ T-cell responses to the DEC205 targeted DNA vaccines increased only slightly by adding either the TLR-9 ligand CpG, the TLR-3 ligand Poly I:C, or CD40 ligand expression plasmids. However, the combination of both TLR-ligands led to a strong enhancement of CD8+ T-cell responses compared to a non-targeted DNA vaccine. This finding was confirmed using HIV Gag as antigen. Conclusion Although DNA prime adenoviral vector boost immunizations belong to the strongest inducers of cytotoxic T cell responses in different animal models and humans, the CD8+ T cell responses can be further improved by targeting the DNA encoded antigen to DEC205 in the presence of synergistic TLR ligands CpG and Poly I:C.

  14. Understanding serine proteases implications on Leishmania spp lifecycle.

    Science.gov (United States)

    Alves, Carlos Roberto; Souza, Raquel Santos de; Charret, Karen Dos Santos; Côrtes, Luzia Monteiro de Castro; Sá-Silva, Matheus Pereira de; Barral-Veloso, Laura; Oliveira, Luiz Filipe Gonçalves; da Silva, Franklin Souza

    2018-01-01

    Serine proteases have significant functions over a broad range of relevant biological processes to the Leishmania spp lifecycle. Data gathered here present an update on the Leishmania spp serine proteases and the status of these enzymes as part of the parasite degradome. The serine protease genes (n = 26 to 28) in Leishmania spp, which encode proteins with a wide range of molecular masses (35 kDa-115 kDa), are described along with their degrees of chromosomal and allelic synteny. Amid 17 putative Leishmania spp serine proteases, only ∼18% were experimentally demonstrated, as: signal peptidases that remove the signal peptide from secretory pre-proteins, maturases of other proteins and with metacaspase-like activity. These enzymes include those of clans SB, SC and SF. Classical inhibitors of serine proteases are used as tools for the characterization and investigation of Leishmania spp. Endogenous serine protease inhibitors, which are ecotin-like, can act modulating host actions. However, crude or synthetic based-natural serine protease inhibitors, such as potato tuber extract, Stichodactyla helianthus protease inhibitor I, fukugetin and epoxy-α-lapachone act on parasitic serine proteases and are promising leishmanicidal agents. The functional interrelationship between serine proteases and other Leishmania spp proteins demonstrate essential functions of these enzymes in parasite physiology and therefore their value as targets for leishmaniasis treatment. Copyright © 2017 Elsevier Inc. All rights reserved.

  15. Calcein+/PI- as an early apoptotic feature in Leishmania.

    Science.gov (United States)

    Basmaciyan, Louise; Azas, Nadine; Casanova, Magali

    2017-01-01

    Although leishmaniases are responsible for high morbidity and mortality all over the world, no really satisfying treatment exists. Furthermore, the corresponding parasite Leishmania undergoes a very characteristic form of programmed cell death. Indeed, different stimuli can induce morphological and biochemical apoptotic-like features. However, the key proteins involved in mammal apoptosis, such as caspases and death receptors, are not encoded in the genome of this parasite. Currently, little is known about Leishmania apoptosis, notably owing to the lack of specific tools for programmed cell death analysis in these parasites. Furthermore, there is a need for a better understanding of Leishmania programmed cell death in order (i) to better understand the role of apoptosis in unicellular organisms, (ii) to better understand apoptosis in general through the study of an ancestral eukaryote, and (iii) to identify new therapeutic targets against leishmaniases. To advance understanding of apoptosis in Leishmania, in this study we developed a new tool based on the quantification of calcein and propidium iodide by flow cytometry. This double labeling can be employed to distinguish early apoptosis, late apoptosis and necrosis in Leishmania live cells with a very simple and rapid assay. This paper should, therefore, be of interest for people working on Leishmania and related parasites.

  16. Calcein+/PI- as an early apoptotic feature in Leishmania.

    Directory of Open Access Journals (Sweden)

    Louise Basmaciyan

    Full Text Available Although leishmaniases are responsible for high morbidity and mortality all over the world, no really satisfying treatment exists. Furthermore, the corresponding parasite Leishmania undergoes a very characteristic form of programmed cell death. Indeed, different stimuli can induce morphological and biochemical apoptotic-like features. However, the key proteins involved in mammal apoptosis, such as caspases and death receptors, are not encoded in the genome of this parasite. Currently, little is known about Leishmania apoptosis, notably owing to the lack of specific tools for programmed cell death analysis in these parasites. Furthermore, there is a need for a better understanding of Leishmania programmed cell death in order (i to better understand the role of apoptosis in unicellular organisms, (ii to better understand apoptosis in general through the study of an ancestral eukaryote, and (iii to identify new therapeutic targets against leishmaniases. To advance understanding of apoptosis in Leishmania, in this study we developed a new tool based on the quantification of calcein and propidium iodide by flow cytometry. This double labeling can be employed to distinguish early apoptosis, late apoptosis and necrosis in Leishmania live cells with a very simple and rapid assay. This paper should, therefore, be of interest for people working on Leishmania and related parasites.

  17. MicroRNA expression in rainbow trout (Oncorhynchus mykiss) vaccinated with a DNA vaccine encoding the glycoprotein gene of Viral hemorrhagic septicemia virus

    DEFF Research Database (Denmark)

    Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels

    particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...

  18. Cloning, characterization and heterologous expression of epoxide hydrolase-encoding cDNA sequences from yeasts belonging to the genera Rhodotorula and Rhodosporidium

    NARCIS (Netherlands)

    Visser, H.; Weijers, C.A.G.M.; Ooyen, van A.J.J.; Verdoes, J.C.

    2002-01-01

    Epoxide hydrolase-encoding cDNA sequences were isolated from the basidiomycetous yeast species Rhodosporidium toruloides CBS 349, Rhodosporidium toruloides CBS 14 and Rhodotorula araucariae CBS 6031 in order to evaluate the molecular data and potential application of this type of enzymes. The

  19. scsB, a cDNA encoding the hydrogenosomal beta subunit of succinyl-CoA synthetase from the anaerobic fungus Neocallimastix frontalis

    NARCIS (Netherlands)

    Brondijk, THC; Durand, R; vanderGiezen, M; Gottschal, JC; Prins, RA; Fevre, M

    1996-01-01

    A clone containing a Neocallimastix frontalis cDNA assumed to encode the beta subunit of succinyl-CoA synthetase (SCSB) was identified by sequence homology with prokaryotic and eukaryotic counterparts. An open reading frame of 1311 bp was found. The deduced 437 amino acid sequence showed a high

  20. Induction of cytotoxic T-cell responses by gene gun DNA vaccination with minigenes encoding influenza A virus HA and NP CTL-epitopes

    DEFF Research Database (Denmark)

    Fomsgaard, A; Nielsen, H V; Kirkby, N

    1999-01-01

    degree of controllability. We have examined the induction of murine CTL's by this approach using DNA plasmid minigene vaccines encoding known mouse K(k) minimal CTL epitopes (8 amino acids) from the influenza A virus hemagglutinin and nucleoprotein. We here report that such an approach is feasible...

  1. First occurrence of an autochthonous canine case of Leishmania (Leishmania infantum chagasi in the municipality of Campinas, State of São Paulo, Brazil

    Directory of Open Access Journals (Sweden)

    Elisa San Martin Mouriz Savani

    2011-08-01

    Full Text Available An autochthonous case of visceral leishmaniasis is reported in a dog (Canis familiaris as an apparently natural infection in a non-endemic area. DNA obtained from spleen and liver samples produced the expected fragment in a Leishmania-specific rDNA-based nested-PCR assay. The PCR product, a 490 bp fragment, was sequenced and the nucleotide sequence was identical to that of Leishmania (Leishmania infantum chagasi. These results are surprising since no autochthonous human or canine cases of visceral leishmaniasis have ever been reported in this municipality. This case suggests that natural transmission of this disease is occurring in this area.

  2. A comparison of molecular markers to detect Lutzomyia longipalpis naturally infected with Leishmania (Leishmania infantum

    Directory of Open Access Journals (Sweden)

    Kárita Cláudia Freitas-Lidani

    2014-07-01

    Full Text Available The aim of the present study was to detect natural infection by Leishmania (Leishmania infantum in Lutzomyia longipalpis captured in Barcarena, state of Pará, Brazil, through the use of three primer sets. With this approach, it is unnecessary to previously dissect the sandfly specimens. DNA of 280 Lu. longipalpis female specimens were extracted from the whole insects. PCR primers for kinetoplast minicircle DNA (kDNA, the mini-exon gene and the small subunit ribosomal RNA (SSU-rRNA gene of Leishmania were used, generating fragments of 400 bp, 780 bp and 603 bp, respectively. Infection by the parasite was found with the kDNA primer in 8.6% of the cases, with the mini-exon gene primer in 7.1% of the cases and with the SSU-rRNA gene primer in 5.3% of the cases. These data show the importance of polymerase chain reaction as a tool for investigating the molecular epidemiology of visceral leishmaniasis by estimating the risk of disease transmission in endemic areas, with the kDNA primer representing the most reliable marker for the parasite.

  3. Gluconeogenesis in Leishmania mexicana

    Science.gov (United States)

    Rodriguez-Contreras, Dayana; Hamilton, Nicklas

    2014-01-01

    Gluconeogenesis is an active pathway in Leishmania amastigotes and is essential for their survival within the mammalian cells. However, our knowledge about this pathway in trypanosomatids is very limited. We investigated the role of glycerol kinase (GK), phosphoenolpyruvate carboxykinase (PEPCK), and pyruvate phosphate dikinase (PPDK) in gluconeogenesis by generating the respective Leishmania mexicana Δgk, Δpepck, and Δppdk null mutants. Our results demonstrated that indeed GK, PEPCK, and PPDK are key players in the gluconeogenesis pathway in Leishmania, although stage-specific differences in their contribution to this pathway were found. GK participates in the entry of glycerol in promastigotes and amastigotes; PEPCK participates in the entry of aspartate in promastigotes, and PPDK is involved in the entry of alanine in amastigotes. Furthermore, the majority of alanine enters into the pathway via decarboxylation of pyruvate in promastigotes, whereas pathway redundancy is suggested for the entry of aspartate in amastigotes. Interestingly, we also found that l-lactate, an abundant glucogenic precursor in mammals, was used by Leishmania amastigotes to synthesize mannogen, entering the pathway through PPDK. On the basis of these new results, we propose a revision in the current model of gluconeogenesis in Leishmania, emphasizing the differences between amastigotes and promastigotes. This work underlines the importance of studying the trypanosomatid intracellular life cycle stages to gain a better understanding of the pathologies caused in humans. PMID:25288791

  4. Heterologous expression of a Rauvolfia cDNA encoding strictosidine glucosidase, a biosynthetic key to over 2000 monoterpenoid indole alkaloids.

    Science.gov (United States)

    Gerasimenko, Irina; Sheludko, Yuri; Ma, Xueyan; Stöckigt, Joachim

    2002-04-01

    Strictosidine glucosidase (SG) is an enzyme that catalyses the second step in the biosynthesis of various classes of monoterpenoid indole alkaloids. Based on the comparison of cDNA sequences of SG from Catharanthus roseus and raucaffricine glucosidase (RG) from Rauvolfia serpentina, primers for RT-PCR were designed and the cDNA encoding SG was cloned from R. serpentina cell suspension cultures. The active enzyme was expressed in Escherichia coli and purified to homogeneity. Analysis of its deduced amino-acid sequence assigned the SG from R. serpentina to family 1 of glycosyl hydrolases. In contrast to the SG from C. roseus, the enzyme from R. serpentina is predicted to lack an uncleavable N-terminal signal sequence, which is believed to direct proteins to the endoplasmic reticulum. The temperature and pH optimum, enzyme kinetic parameters and substrate specificity of the heterologously expressed SG were studied and compared to those of the C. roseus enzyme, revealing some differences between the two glucosidases. In vitro deglucosylation of strictosidine by R. serpentina SG proceeds by the same mechanism as has been shown for the C. roseus enzyme preparation. The reaction gives rise to the end product cathenamine and involves 4,21-dehydrocorynantheine aldehyde as an intermediate. The enzymatic hydrolysis of dolichantoside (Nbeta-methylstrictosidine) leads to several products. One of them was identified as a new compound, 3-isocorreantine A. From the data it can be concluded that the divergence of the biosynthetic pathways leading to different classes of indole alkaloids formed in R. serpentina and C. roseus cell suspension cultures occurs at a later stage than strictosidine deglucosylation.

  5. Discovery of cofactor-specific, bactericidal Mycobacterium tuberculosis InhA inhibitors using DNA-encoded library technology.

    Science.gov (United States)

    Soutter, Holly H; Centrella, Paolo; Clark, Matthew A; Cuozzo, John W; Dumelin, Christoph E; Guie, Marie-Aude; Habeshian, Sevan; Keefe, Anthony D; Kennedy, Kaitlyn M; Sigel, Eric A; Troast, Dawn M; Zhang, Ying; Ferguson, Andrew D; Davies, Gareth; Stead, Eleanor R; Breed, Jason; Madhavapeddi, Prashanti; Read, Jon A

    2016-12-06

    Millions of individuals are infected with and die from tuberculosis (TB) each year, and multidrug-resistant (MDR) strains of TB are increasingly prevalent. As such, there is an urgent need to identify novel drugs to treat TB infections. Current frontline therapies include the drug isoniazid, which inhibits the essential NADH-dependent enoyl-acyl-carrier protein (ACP) reductase, InhA. To inhibit InhA, isoniazid must be activated by the catalase-peroxidase KatG. Isoniazid resistance is linked primarily to mutations in the katG gene. Discovery of InhA inhibitors that do not require KatG activation is crucial to combat MDR TB. Multiple discovery efforts have been made against InhA in recent years. Until recently, despite achieving high potency against the enzyme, these efforts have been thwarted by lack of cellular activity. We describe here the use of DNA-encoded X-Chem (DEX) screening, combined with selection of appropriate physical properties, to identify multiple classes of InhA inhibitors with cell-based activity. The utilization of DEX screening allowed the interrogation of very large compound libraries (10 11 unique small molecules) against multiple forms of the InhA enzyme in a multiplexed format. Comparison of the enriched library members across various screening conditions allowed the identification of cofactor-specific inhibitors of InhA that do not require activation by KatG, many of which had bactericidal activity in cell-based assays.

  6. Identification and characterization of a novel Cut family cDNA that encodes human copper transporter protein CutC

    International Nuclear Information System (INIS)

    Li Jixi; Ji Chaoneng; Chen Jinzhong; Yang Zhenxing; Wang Yijing; Fei, Xiangwei; Zheng Mei; Gu Xing; Wen Ge; Xie Yi; Mao Yumin

    2005-01-01

    Copper is an essential heavy metal trace element that plays important roles in cell physiology. The Cut family was associated with the copper homeostasis and involved in several important metabolisms, such as uptake, storage, delivery, and efflux of copper. In this study, a novel Cut family cDNA was isolated from the human fetal brain library, which encodes a 273 amino acid protein with a molecular mass of about 29.3 kDa and a calculated pI of 8.17. It was named hCutC (human copper transporter protein CutC). The ORF of hCutC gene was cloned into pQE30 vector and expressed in Escherichia coli M15. The secreted hCutC protein was purified to a homogenicity of 95% by using the Ni-NTA affinity chromatography. RT-PCR analysis showed that the hCutC gene expressed extensively in human tissues. Subcellular location analysis of hCutC-EGFP fusion protein revealed that hCutC was distributed to cytoplasm of COS-7 cells, and both cytoplasm and nucleus of AD293 cells. The results suggest that hCutC may be one shuttle protein and play important roles in intracellular copper trafficking

  7. Loss of long term protection with the inclusion of HIV pol to a DNA vaccine encoding gag.

    Science.gov (United States)

    Garrod, Tamsin J; Gargett, Tessa; Yu, Wenbo; Major, Lee; Burrell, Christopher J; Wesselingh, Steven; Suhrbier, Andreas; Grubor-Bauk, Branka; Gowans, Eric J

    2014-11-04

    Traditional vaccine strategies that induce antibody responses have failed to protect against HIV infection in clinical trials, and thus cell-mediated immunity is now an additional criterion. Recent clinical trials that aimed to induce strong T cell responses failed to do so. Therefore, to enhance induction of protective T cell responses, it is crucial that the optimum antigen combination is chosen. Limited research has been performed into the number of antigens selected for an HIV vaccine. This study aimed to compare DNA vaccines encoding either a single HIV antigen or a combination of two antigens, using intradermal vaccination of C57BL/6 mice. Immune assays were performed on splenocytes, and in vivo protection was examined by challenge with a chimeric virus, EcoHIV, able to infect mouse but not human leukocytes, at 10 days (short term) and 60 days (long term) post final vaccination. At 60 days there was significantly lower frequency of induced antigen-specific CD8(+) T cells in the spleens of pCMVgag-pol-vaccinated mice compared with mice which received pCMVgag only. Most importantly, short term viral control of EcoHIV was similar for pCMVgag and pCMVgag-pol-vaccinated mice at day 10, but only the pCMVgag-vaccinated significantly controlled EcoHIV at day 60 compared with pCMV-vaccinated mice, showing that control was reduced with the inclusion of the HIV pol gene. Copyright © 2014 Elsevier B.V. All rights reserved.

  8. Lundep, a sand fly salivary endonuclease increases Leishmania parasite survival in neutrophils and inhibits XIIa contact activation in human plasma.

    Directory of Open Access Journals (Sweden)

    Andrezza C Chagas

    2014-02-01

    Full Text Available Neutrophils are the host's first line of defense against infections, and their extracellular traps (NET were recently shown to kill Leishmania parasites. Here we report a NET-destroying molecule (Lundep from the salivary glands of Lutzomyia longipalpis. Previous analysis of the sialotranscriptome of Lu. longipalpis showed the potential presence of an endonuclease. Indeed, not only was the cloned cDNA (Lundep shown to encode a highly active ss- and dsDNAse, but also the same activity was demonstrated to be secreted by salivary glands of female Lu. longipalpis. Lundep hydrolyzes both ss- and dsDNA with little sequence specificity with a calculated DNase activity of 300000 Kunitz units per mg of protein. Disruption of PMA (phorbol 12 myristate 13 acetate- or parasite-induced NETs by treatment with recombinant Lundep or salivary gland homogenates increases parasite survival in neutrophils. Furthermore, co-injection of recombinant Lundep with metacyclic promastigotes significantly exacerbates Leishmania infection in mice when compared with PBS alone or inactive (mutagenized Lundep. We hypothesize that Lundep helps the parasite to establish an infection by allowing it to escape from the leishmanicidal activity of NETs early after inoculation. Lundep may also assist blood meal intake by lowering the local viscosity caused by the release of host DNA and as an anticoagulant by inhibiting the intrinsic pathway of coagulation.

  9. Protective effect of the DNA vaccine encoding the major house dust mite allergens on allergic inflammation in the murine model of house dust mite allergy

    Directory of Open Access Journals (Sweden)

    Lee Jaechun

    2006-02-01

    Full Text Available Abstract Background Vaccination with naked DNA encoding antigen induces cellular and humoral immunity characterized by the activation of specific Th1 cells. Objective To evaluate the effects of vaccination with mixed naked DNA plasmids encoding Der p 1, Der p 2, Der p 3, Der f 1, Der f 2, and Der f 3, the major house dust mite allergens on the allergic inflammation to the whole house dust mites (HDM crude extract. Methods Three hundred micrograms of these gene mixtures were injected into muscle of BALB/c mice. Control mice were injected with the pcDNA 3.1 blank vector. After 3 weeks, the mice were actively sensitized and inhaled with the whole house dust mite extract intranasally. Results The vaccinated mice showed a significantly decreased synthesis of total and HDM-specific IgE compared with controls. Analysis of the cytokine profile of lymphocytes after challenge with HDM crude extract revealed that mRNA expression of interferon-γ was higher in the vaccinated mice than in the controls. Reduced infiltration of inflammatory cells and the prominent infiltration of CD8+ T cells were observed in histology of lung tissue from the vaccinated mice. Conclusion Vaccination with DNA encoding the major house dust mite allergens provides a promising approach for treating allergic responses to whole house dust mite allergens.

  10. Molecular Identification of Leishmania spp. in Sand Flies (Diptera: Psychodidae, Phlebotominae) From Ecuador.

    Science.gov (United States)

    Quiroga, Cristina; Cevallos, Varsovia; Morales, Diego; Baldeón, Manuel E; Cárdenas, Paúl; Rojas-Silva, Patricio; Ponce, Patricio

    2017-11-07

    The detection and identification of natural infections in sand flies by Leishmania protozoan species in endemic areas is a key factor in assessing the risk of leishmaniasis and in designing prevention and control measures for this infectious disease. In this study, we analyzed the Leishmania DNA using nuclear ribosomal internal transcript spacer (ITS) sequences. Parasite DNA was extracted from naturally infected, blood-fed sand flies collected in nine localities considered leishmaniasis-endemic foci in Ecuador.The species of parasites identified in sand flies were Leishmania major-like, Leishmania naiffi, Leishmania mexicana, Leishmania lainsoni, and "Leishmania sp. siamensis". Sand fly specimens of Brumptomyia leopoldoi, Mycropigomyia cayennensis, Nyssomyia yuilli yuilli, Nyssomyia trapidoi, Pressatia triacantha, Pressatia dysponeta, Psychodopygus carrerai carrerai, Psychodopygus panamensis, and Trichophoromyia ubiquitalis were found positive for Leishmania parasite. These findings contribute to a better understanding of the epidemiology and transmission dynamics of the disease in high-risk areas of Ecuador. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America.

  11. Increased transmission potential of Leishmania major/Leishmania infantum hybrids

    OpenAIRE

    Volf, Petr; Benkova, Ivana; Myskova, Jitka; Sadlova, Jovana; Campino, Lenea; Ravel, Christophe

    2007-01-01

    Development of Leishmania infantum/Leishmania major hybrids was studied in two sand fly species. In Phlebotomus papatasi, which supported development of L. major but not L. infantum, the hybrids produced heavy late-stage infections with high numbers of metacyclic promastigotes. In the permissive vector Lutzomyia longipalpis, all Leishmania strains included in this study developed well. Hybrids were found to express L. major lipophosphoglycan, apparently enabling them to survive in P. papatasi...

  12. Assessment of a DNA vaccine encoding an anchored-glycosylphosphatidylinositol tegumental antigen complexed to protamine sulphate on immunoprotection against murine schistosomiasis

    Directory of Open Access Journals (Sweden)

    Eduardo JM Nascimento

    2007-02-01

    Full Text Available Protamine sulphate/DNA complexes have been shown to protect DNA from DNase digestion in a lipid system for gene transfer. A DNA-based vaccine complexed to protamine sulphate was used to induce an immune response against Schistosoma mansoni anchored-glycosylphosphatidylinositol tegumental antigen in BALB/c mice. The protection elicited ranged from 33 to 44%. The spectrum of the elicited immune response induced by the vaccine formulation without protamine was characterized by a high level of IgG (IgG1> IgG2a. Protamine sulphate added to the DNA vaccine formulation retained the green fluorescent protein encoding-plasmid longer in muscle and spleen. The experiments in vivo showed that under protamine sulphate effect, the scope of protection remained unchanged, but a modulation in antibody production (IgG1= IgG2a was observed.

  13. Isolation and sequence of cDNA encoding a cytochrome P-450 from an insecticide-resistant strain of the house fly, Musca domestica.

    OpenAIRE

    Feyereisen, R; Koener, J F; Farnsworth, D E; Nebert, D W

    1989-01-01

    A cDNA expression library from phenobarbital-treated house fly (Musca domestica) was screened with rabbit antisera directed against partially purified house fly cytochrome P-450. Two overlapping clones with insert lengths of 1.3 and 1.5 kilobases were isolated. The sequence of a 1629-base-pair (bp) cDNA was obtained, with an open reading frame (nucleotides 81-1610) encoding a P-450 protein of 509 residues (Mr = 58,738). The insect P-450 protein contains a hydrophobic NH2 terminus and a 22-res...

  14. Analysis of the Antigenic and Prophylactic Properties of the Leishmania Translation Initiation Factors eIF2 and eIF2B in Natural and Experimental Leishmaniasis

    Directory of Open Access Journals (Sweden)

    Esther Garde

    2018-04-01

    Full Text Available Different members of intracellular protein families are recognized by the immune system of the vertebrate host infected by parasites of the genus Leishmania. Here, we have analyzed the antigenic and immunogenic properties of the Leishmania eIF2 and eIF2B translation initiation factors. An in silico search in Leishmania infantum sequence databases allowed the identification of the genes encoding the α, β, and γ subunits and the α, β, and δ subunits of the putative Leishmania orthologs of the eukaryotic initiation factors F2 (LieIF2 or F2B (LieIF2B, respectively. The antigenicity of these factors was analyzed by ELISA using recombinant versions of the different subunits. Antibodies against the different LieIF2 and LieIF2B subunits were found in the sera from human and canine visceral leishmaniasis patients, and also in the sera from hamsters experimentally infected with L. infantum. In L. infantum (BALB/c and Leishmania major (BALB/c or C57BL/6 challenged mice, a moderate humoral response against these protein factors was detected. Remarkably, these proteins elicited an IL-10 production by splenocytes derived from infected mice independently of the Leishmania species employed for experimental challenge. When DNA vaccines based on the expression of the LieIF2 or LieIF2B subunit encoding genes were administered in mice, an antigen-specific secretion of IFN-γ and IL-10 cytokines was observed. Furthermore, a partial protection against murine CL development due to L. major infection was generated in the vaccinated mice. Also, in this work we show that the LieIF2α subunit and the LieIF2Bβ and δ subunits have the capacity to stimulate IL-10 secretion by spleen cells from naïve mice. B-lymphocytes were identified as the major producers of this anti-inflammatory cytokine. Taking into account the data found in this study, it may be hypothesized that these proteins act as virulence factors implicated in the induction of humoral responses as well

  15. Analysis of the Antigenic and Prophylactic Properties of the Leishmania Translation Initiation Factors eIF2 and eIF2B in Natural and Experimental Leishmaniasis.

    Science.gov (United States)

    Garde, Esther; Ramírez, Laura; Corvo, Laura; Solana, José C; Martín, M Elena; González, Víctor M; Gómez-Nieto, Carlos; Barral, Aldina; Barral-Netto, Manoel; Requena, José M; Iborra, Salvador; Soto, Manuel

    2018-01-01

    Different members of intracellular protein families are recognized by the immune system of the vertebrate host infected by parasites of the genus Leishmania . Here, we have analyzed the antigenic and immunogenic properties of the Leishmania eIF2 and eIF2B translation initiation factors. An in silico search in Leishmania infantum sequence databases allowed the identification of the genes encoding the α, β, and γ subunits and the α, β, and δ subunits of the putative Leishmania orthologs of the eukaryotic initiation factors F2 (LieIF2) or F2B (LieIF2B), respectively. The antigenicity of these factors was analyzed by ELISA using recombinant versions of the different subunits. Antibodies against the different LieIF2 and LieIF2B subunits were found in the sera from human and canine visceral leishmaniasis patients, and also in the sera from hamsters experimentally infected with L. infantum . In L. infantum (BALB/c) and Leishmania major (BALB/c or C57BL/6) challenged mice, a moderate humoral response against these protein factors was detected. Remarkably, these proteins elicited an IL-10 production by splenocytes derived from infected mice independently of the Leishmania species employed for experimental challenge. When DNA vaccines based on the expression of the LieIF2 or LieIF2B subunit encoding genes were administered in mice, an antigen-specific secretion of IFN-γ and IL-10 cytokines was observed. Furthermore, a partial protection against murine CL development due to L. major infection was generated in the vaccinated mice. Also, in this work we show that the LieIF2α subunit and the LieIF2Bβ and δ subunits have the capacity to stimulate IL-10 secretion by spleen cells from naïve mice. B-lymphocytes were identified as the major producers of this anti-inflammatory cytokine. Taking into account the data found in this study, it may be hypothesized that these proteins act as virulence factors implicated in the induction of humoral responses as well as in the

  16. From genomes to vaccines: Leishmania as a model.

    Science.gov (United States)

    Almeida, Renata; Norrish, Alan; Levick, Mark; Vetrie, David; Freeman, Tom; Vilo, Jaak; Ivens, Alasdair; Lange, Uta; Stober, Carmel; McCann, Sharon; Blackwell, Jenefer M

    2002-01-01

    The 35 Mb genome of Leishmania should be sequenced by late 2002. It contains approximately 8500 genes that will probably translate into more than 10 000 proteins. In the laboratory we have been piloting strategies to try to harness the power of the genome-proteome for rapid screening of new vaccine candidate. To this end, microarray analysis of 1094 unique genes identified using an EST analysis of 2091 cDNA clones from spliced leader libraries prepared from different developmental stages of Leishmania has been employed. The plan was to identify amastigote-expressed genes that could be used in high-throughput DNA-vaccine screens to identify potential new vaccine candidates. Despite the lack of transcriptional regulation that polycistronic transcription in Leishmania dictates, the data provide evidence for a high level of post-transcriptional regulation of RNA abundance during the developmental cycle of promastigotes in culture and in lesion-derived amastigotes of Leishmania major. This has provided 147 candidates from the 1094 unique genes that are specifically upregulated in amastigotes and are being used in vaccine studies. Using DNA vaccination, it was demonstrated that pooling strategies can work to identify protective vaccines, but it was found that some potentially protective antigens are masked by other disease-exacerbatory antigens in the pool. A total of 100 new vaccine candidates are currently being tested separately and in pools to extend this analysis, and to facilitate retrospective bioinformatic analysis to develop predictive algorithms for sequences that constitute potentially protective antigens. We are also working with other members of the Leishmania Genome Network to determine whether RNA expression determined by microarray analyses parallels expression at the protein level. We believe we are making good progress in developing strategies that will allow rapid translation of the sequence of Leishmania into potential interventions for disease

  17. Assessment of PCR in the detection of Leishmania spp in experimentally infected individual phlebotomine sandflies (Diptera: Psychodidae: Phlebotominae

    Directory of Open Access Journals (Sweden)

    MICHALSKY Érika M.

    2002-01-01

    Full Text Available DNA amplification by the polymerase chain reaction (PCR was applied in the investigation of the presence of Leishmania (Kinetoplastida: Trypanosomatidae parasites in single phlebotomine sandflies. Three phlebotomine/parasite pairs were used: Lutzomyia longipalpis/Leishmania chagasi, Lutzomyia migonei/Leishmania amazonensis and Lutzomyia migonei/Leishmania braziliensis, all of them incriminated in the transmission of visceral or cutaneous leishmaniasis. DNA extraction was performed with whole insects, with no need of previous digestive tract dissection or pooling specimens. The presence of either mouse blood in the digestive tract of the sandflies or the digestive tract itself did not interfere in the PCR. Infection by as few as 10 Leishmania sp. per individual were sufficient for DNA amplification with genus-specific primers. Using primers for L. braziliensis and L. mexicana complexes, respectively, it was possible to discriminate between L. braziliensis and L. amazonensis in experimentally infected vectors (L. migonei.

  18. Cloning and chromosomal assignment of a human cDNA encoding a T cell- and natural killer cell-specific trypsin-like serine protease

    International Nuclear Information System (INIS)

    Gershenfeld, H.K.; Hershberger, R.J.; Shows, T.B.; Weissman, I.L.

    1988-01-01

    A cDNA clone encoding a human T cell- and natural killer cell-specific serine protease was obtained by screening a phage λgt10 cDNA library from phytohemagglutinin-stimulated human peripheral blood lymphocytes with the mouse Hanukah factor cDNA clone. In an RNA blot-hybridization analysis, this human Hanukah factor cDNA hybridized with a 1.3-kilobase band in allogeneic-stimulated cytotoxic T cells and the Jurkat cell line, but this transcript was not detectable in normal muscle, liver, tonsil, or thymus. By dot-blot hybridization, this cDNA hybridized with RNA from three cytolytic T-cell clones and three noncytolytic T-cell clones grown in vitro as well as with purified CD16 + natural killer cells and CD3 + , CD16 - T-cell large granular lymphocytes from peripheral blood lymphocytes (CD = cluster designation). The nucleotide sequence of this cDNA clone encodes a predicted serine protease of 262 amino acids. The active enzyme is 71% and 77% similar to the mouse sequence at the amino acid and DNA level, respectively. The human and mouse sequences conserve the active site residues of serine proteases--the trypsin-specific Asp-189 and all 10 cysteine residues. The gene for the human Hanukah factor serine protease is located on human chromosome 5. The authors propose that this trypsin-like serine protease may function as a common component necessary for lysis of target cells by cytotoxic T lymphocytes and natural killer cells

  19. Molecular detection of Leishmania infection due to Leishmania major and Leishmania turanica in the vectors and reservoir host in Iran.

    Science.gov (United States)

    Rassi, Yavar; Oshaghi, Mohammad Ali; Azani, Sadegh Mohammadi; Abaie, Mohammad Reza; Rafizadeh, Sina; Mohebai, Mehdi; Mohtarami, Fatemeh; Zeinali, Mohammad kazem

    2011-02-01

    An epidemiological study was carried out on the vectors and reservoirs of cutaneous leishmaniasis in rural areas of Damghan district, Semnan province, central Iran, during 2008-2009. Totally, 6110 sand flies were collected using sticky papers and were subjected to molecular methods for detection of Leishmania parasite. Phlebotomus papatasi Scopoli was the common species in outdoor and indoor resting places. Polymerase chain reaction technique showed that 24 out of 218 P. papatasi (11%) and 4 out of 62 Phlebotomus caucasicus Marzinovskyi (6.5%) were positive for parasites Leishmania major Yakimoff and Schokhor. Twenty-one rodent reservoir hosts captured using Sherman traps were identified as Rhombomys opimus Lichtenstein (95%) and Meriones libycus Lichtenstein (5%). Microscopic investigation on blood smear of the animals for amastigote parasites revealed 8 (40%) rodents infected with R. opimus. L. major infection in these animals was then confirmed by polymerase chain reaction against internal transcribed spacer ribosomal DNA (rDNA) loci of the parasite followed by restriction fragment length polymorphism. Further, sequence analysis of 297 bp of ITS1-rDNA loci revealed the presence of L. major and Leishmania turanica in P. papatasi, and L. major in R. opimus. This is the first molecular report of L. major infection in both vectors (P. papatasi and P. caucasicus) and reservoir host (R. opimus) in this region. The results indicated that P. papatas was the primary vector of the disease and circulating the parasite between human and reservoirs, and P. caucasicus could be considered as a secondary vector. Further, our study showed that R. opimus is the most important host reservoir for maintenance of the parasite source in the area.

  20. Molecular cloning and characterization of the full-length cDNA encoding the tree shrew (tupaia belangeri) CD28

    Science.gov (United States)

    Huang, Xiaoyan; Yan, Yan; Wang, Sha; Wang, Qinying; Shi, Jian; Shao, Zhanshe; Dai, Jiejie

    2017-11-01

    CD28 is one of the most important co-stimulatory molecules expressed by naive and primed T cells. The tree shrews (Tupaia belangeri), as an ideal animal model for analyzing mechanism of human diseases receiving extensive attentions, demands essential research tools, in particular in the study of cellular markers and monoclonal antibodies for immunological studies. However, little is known about tree shrew CD28 (tsCD28) until now. In this study, a 663 bp of the full-length CD28 cDNA, encoding a polypeptide of 220 amino acids was cloned from tree shrew spleen lymphocytes. The nucleotide sequence of the tsCD28 showed 85%, 76%, and 75% similarities with human, rat, and mouse, respectively, which showed the affinity relationship between tree shrew and human is much closer than between human and rodents. The open reading frame (ORF) sequence of tsCD28 gene was predicted to be in correspondence with the signal sequence, immunoglobulin variable-like (IgV) domain, transmembrane domain and cytoplasmic tail, respectively.We also analyzed its molecular characteristics with other mammals by using biology software such as Clustal W 2.0 and so forth. Our results showed that tsCD28 contained many features conserved in CD28 genes from other mammals, including conserved signal peptide and glycosylation sites, and several residues responsible for binding to the CD28R, and the tsCD28 amino acid sequence were found a close genetic relationship with human and monkey. The crystal structure and surface charge revealed most regions of tree shrew CD28 molecule surface charges are similar as human. However, compared with human CD28 (hCD28) regions, in some areas, the surface positive charge of tsCD28 was less than hCD28, which may affect antibody binding. The present study is the first report of cloning and characterization of CD28 in tree shrew. This study provides a theoretical basis for the further study the structure and function of tree shrew CD28 and utilize tree shrew as an effective

  1. Attenuated Salmonella enterica serovar Typhi and Shigella flexneri 2a strains mucosally deliver DNA vaccines encoding measles virus hemagglutinin, inducing specific immune responses and protection in cotton rats.

    Science.gov (United States)

    Pasetti, Marcela F; Barry, Eileen M; Losonsky, Genevieve; Singh, Mahender; Medina-Moreno, Sandra M; Polo, John M; Ulmer, Jeffrey; Robinson, Harriet; Sztein, Marcelo B; Levine, Myron M

    2003-05-01

    Measles remains a leading cause of child mortality in developing countries. Residual maternal measles antibodies and immunologic immaturity dampen immunogenicity of the current vaccine in young infants. Because cotton rat respiratory tract is susceptible to measles virus (MV) replication after intranasal (i.n.) challenge, this model can be used to assess the efficacy of MV vaccines. Pursuing a new measles vaccine strategy that might be effective in young infants, we used attenuated Salmonella enterica serovar Typhi CVD 908-htrA and Shigella flexneri 2a CVD 1208 vaccines to deliver mucosally to cotton rats eukaryotic expression plasmid pGA3-mH and Sindbis virus-based DNA replicon pMSIN-H encoding MV hemagglutinin (H). The initial i.n. dose-response with bacterial vectors alone identified a well-tolerated dosage (1 x 10(9) to 7 x 10(9) CFU) and a volume (20 micro l) that elicited strong antivector immune responses. Animals immunized i.n. on days 0, 28, and 76 with bacterial vectors carrying DNA plasmids encoding MV H or immunized parenterally with these naked DNA vaccine plasmids developed MV plaque reduction neutralizing antibodies and proliferative responses against MV antigens. In a subsequent experiment of identical design, cotton rats were challenged with wild-type MV 1 month after the third dose of vaccine or placebo. MV titers were significantly reduced in lung tissue of animals immunized with MV DNA vaccines delivered either via bacterial live vectors or parenterally. Since attenuated serovar Typhi and S. flexneri can deliver measles DNA vaccines mucosally in cotton rats, inducing measles immune responses (including neutralizing antibodies) and protection, boosting strategies can now be evaluated in animals primed with MV DNA vaccines.

  2. Genome-wide mapping reveals single-origin chromosome replication in Leishmania, a eukaryotic microbe.

    Science.gov (United States)

    Marques, Catarina A; Dickens, Nicholas J; Paape, Daniel; Campbell, Samantha J; McCulloch, Richard

    2015-10-19

    DNA replication initiates on defined genome sites, termed origins. Origin usage appears to follow common rules in the eukaryotic organisms examined to date: all chromosomes are replicated from multiple origins, which display variations in firing efficiency and are selected from a larger pool of potential origins. To ask if these features of DNA replication are true of all eukaryotes, we describe genome-wide origin mapping in the parasite Leishmania. Origin mapping in Leishmania suggests a striking divergence in origin usage relative to characterized eukaryotes, since each chromosome appears to be replicated from a single origin. By comparing two species of Leishmania, we find evidence that such origin singularity is maintained in the face of chromosome fusion or fission events during evolution. Mapping Leishmania origins suggests that all origins fire with equal efficiency, and that the genomic sites occupied by origins differ from related non-origins sites. Finally, we provide evidence that origin location in Leishmania displays striking conservation with Trypanosoma brucei, despite the latter parasite replicating its chromosomes from multiple, variable strength origins. The demonstration of chromosome replication for a single origin in Leishmania, a microbial eukaryote, has implications for the evolution of origin multiplicity and associated controls, and may explain the pervasive aneuploidy that characterizes Leishmania chromosome architecture.

  3. Cloning and Expression of TRYP6 Gene from Leishmania major (MRHO/IR/75/ER

    Directory of Open Access Journals (Sweden)

    G Eslami

    2008-06-01

    Full Text Available Background: Leishmania, needs to detoxify the macrophage derived potent peroxides (H2O2. Tryparedoxin path­way contains tryparedoxin peroxidase (TSA or TRYP. The aim of the study was to detect the full-length gene se­quence and its encoded protein of the LmTRYP6 gene (EU251502, and comparison the gene sequence with LmTRYP6 (LmjF15.1140, another previously reported member of this gene family.Methods: L.major (MRHO/IR/75/ER promastigotes were cultured, DNA and RNA were extracted and the inter­ested gene was amplified using PCR and RT-PCR methods.  PCR/ RT-PCR fragments were purified and cloned first in pTZ57R/T and then in pET15b expression vector. The expressed protein was verified using western blot method. Char­acterization of the expressed protein was performed bioinformatically.Results: Molecular evaluation revealed that the cloned LmTRYP6 gene (EU251502 encoded a predicted 184 amino acid long protein with a theoretical isoelectric point of 6.1101. Alignment showed a number of changes in amino acid composition including the replacement of highly conserved Trp177 by Cys in LmTRYP6 (ABX26130.Conclusion: So far no study has been done on this group, i.e.  TRYP6 gene, from tryparedoxin peroxidase family. The low homology with LmTRYP6 (LmjF15.1140 and vast array of differences observed in the gene under study (LmTRYP6; EU251502 could open new windows in the field of anti-Leishmania combat. Based on its important role in the viability and successful establishment of the parasite in the host organism it looks to be very good candi­date for vaccine development and any other sort of novel drug development.

  4. Characterization of cDNA encoding molt-inhibiting hormone of the crab, Cancer pagurus; expression of MIH in non-X-organ tissues.

    Science.gov (United States)

    Lu, W; Wainwright, G; Olohan, L A; Webster, S G; Rees, H H; Turner, P C

    2001-10-31

    Synthesis of ecdysteroids (molting hormones) by crustacean Y-organs is regulated by a neuropeptide, molt-inhibiting hormone (MIH), produced in eyestalk neural ganglia. We report here the molecular cloning of a cDNA encoding MIH of the edible crab, Cancer pagurus. Full-length MIH cDNA was obtained by using reverse transcription-polymerase chain reaction (RT-PCR) with degenerate oligonucleotides based upon the amino acid sequence of MIH, in conjunction with 5'- and 3'-RACE. Full-length clones of MIH cDNA were obtained that encoded a 35 amino acid putative signal peptide and the mature 78 amino acid peptide. Of various tissues examined by Northern blot analysis, the X-organ was the sole major site of expression of the MIH gene. However, a nested-PCR approach using non-degenerate MIH-specific primers indicated the presence of MIH transcripts in other tissues. Southern blot analysis indicated a simple gene arrangement with at least two copies of the MIH gene in the genome of C. pagurus. Additional Southern blotting experiments detected MIH-hybridizing bands in another Cancer species, Cancer antennarius and another crab species, Carcinus maenas.

  5. Identification of Leishmania tropica from micro-foci of cutaneous leishmaniasis in the Kenyan Rift Valley.

    Science.gov (United States)

    Odiwuor, Samwel; Muia, Alfred; Magiri, Charles; Maes, Ilse; Kirigi, George; Dujardin, Jean-Claude; Wasunna, Monique; Mbuchi, Margaret; Auwera, Gert Van der

    2012-07-01

    We performed diagnosis and species identification of parasites in lesion samples from suspected cutaneous leishmaniasis patients in four villages, three of which are in a known Leishmania tropica endemic region in Kenya. Samples were analyzed both by microscopy and PCR for Leishmania, and typed by an assay using four ribosomal DNA-based species-identification PCRs. The lesions were demonstrated to be caused by L. tropica, which confirms the re-emergence of cutaneous leishmaniasis from this species after a period of reduced incidence in the endemic zone. Our report highlights the importance of an intervention and sustained Leishmania control program.

  6. Nucleotide sequence of Phaseolus vulgaris L. alcohol dehydrogenase encoding cDNA and three-dimensional structure prediction of the deduced protein.

    Science.gov (United States)

    Amelia, Kassim; Khor, Chin Yin; Shah, Farida Habib; Bhore, Subhash J

    2015-01-01

    Common beans (Phaseolus vulgaris L.) are widely consumed as a source of proteins and natural products. However, its yield needs to be increased. In line with the agenda of Phaseomics (an international consortium), work of expressed sequence tags (ESTs) generation from bean pods was initiated. Altogether, 5972 ESTs have been isolated. Alcohol dehydrogenase (AD) encoding gene cDNA was a noticeable transcript among the generated ESTs. This AD is an important enzyme; therefore, to understand more about it this study was undertaken. The objective of this study was to elucidate P. vulgaris L. AD (PvAD) gene cDNA sequence and to predict the three-dimensional (3D) structure of deduced protein. positive and negative strands of the PvAD cDNA clone were sequenced using M13 forward and M13 reverse primers to elucidate the nucleotide sequence. Deduced PvAD cDNA and protein sequence was analyzed for their basic features using online bioinformatics tools. Sequence comparison was carried out using bl2seq program, and tree-view program was used to construct a phylogenetic tree. The secondary structures and 3D structure of PvAD protein were predicted by using the PHYRE automatic fold recognition server. The sequencing results analysis showed that PvAD cDNA is 1294 bp in length. It's open reading frame encodes for a protein that contains 371 amino acids. Deduced protein sequence analysis showed the presence of putative substrate binding, catalytic Zn binding, and NAD binding sites. Results indicate that the predicted 3D structure of PvAD protein is analogous to the experimentally determined crystal structure of s-nitrosoglutathione reductase from an Arabidopsis species. The 1294 bp long PvAD cDNA encodes for 371 amino acid long protein that contains conserved domains required for biological functions of AD. The predicted deduced PvAD protein's 3D structure reflects the analogy with the crystal structure of Arabidopsis thaliana s-nitrosoglutathione reductase. Further study is required

  7. Phylogenetic position of Leishmania isolates from Khyber Pakhtunkhwa province of Pakistan.

    Science.gov (United States)

    Khan, Nazma Habib; Messenger, Louisa A; Wahid, Sobia; Sutherland, Colin J

    2016-08-01

    Several species of the genus Leishmania are causative agents of cutaneous leishmaniasis in Pakistan. This study aimed to determine phylogenetic placement of Leishmania species causing cutaneous leishmaniasis in Khyber Pakhtunkhwa province, Pakistan (34 Leishmania tropica, 3 Leishmania infantum), in-relation to species from other geographical areas using gene sequences encoding cytochrome b (cytb) and internal transcribed spacer 2 (its2). Based on cytochrome b sequence analysis, L. tropica strains from Pakistan and other geographical regions were differentiated into two genotype groups, A and B. Within the province, five distinct L. tropica genotypes were recognized; two in group A, three in group B. Two L. infantum isolates from the province were closely associated with both Afro-Eurasian and American species of the Leishmania donovani complex, including Leishmania chagasi, L. infantum and L. donovani from Sudan and Ethiopia; while a third L. infantum isolate could not be differentiated from visceralizing Kenyan and Indian L. donovani. We observed apposite phylogenetic placement of CL-causing L. tropica and L. infantum from Khyber Pakhtunkhwa. Affinities ascribed to Leishmania spp. From the region are valuable in tracing potential importation of leishmaniasis. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  8. A Sequence-Specific Interaction between the Saccharomyces cerevisiae rRNA Gene Repeats and a Locus Encoding an RNA Polymerase I Subunit Affects Ribosomal DNA Stability

    Science.gov (United States)

    Cahyani, Inswasti; Cridge, Andrew G.; Engelke, David R.; Ganley, Austen R. D.

    2014-01-01

    The spatial organization of eukaryotic genomes is linked to their functions. However, how individual features of the global spatial structure contribute to nuclear function remains largely unknown. We previously identified a high-frequency interchromosomal interaction within the Saccharomyces cerevisiae genome that occurs between the intergenic spacer of the ribosomal DNA (rDNA) repeats and the intergenic sequence between the locus encoding the second largest RNA polymerase I subunit and a lysine tRNA gene [i.e., RPA135-tK(CUU)P]. Here, we used quantitative chromosome conformation capture in combination with replacement mapping to identify a 75-bp sequence within the RPA135-tK(CUU)P intergenic region that is involved in the interaction. We demonstrate that the RPA135-IGS1 interaction is dependent on the rDNA copy number and the Msn2 protein. Surprisingly, we found that the interaction does not govern RPA135 transcription. Instead, replacement of a 605-bp region within the RPA135-tK(CUU)P intergenic region results in a reduction in the RPA135-IGS1 interaction level and fluctuations in rDNA copy number. We conclude that the chromosomal interaction that occurs between the RPA135-tK(CUU)P and rDNA IGS1 loci stabilizes rDNA repeat number and contributes to the maintenance of nucleolar stability. Our results provide evidence that the DNA loci involved in chromosomal interactions are composite elements, sections of which function in stabilizing the interaction or mediating a functional outcome. PMID:25421713

  9. Detection of Leishmania donovani and L. tropica in ethiopian wild rodents

    Czech Academy of Sciences Publication Activity Database

    Kassahun, A.; Sádlová, J.; Dvořák, V.; Košťálová, T.; Rohoušová, I.; Frynta, D.; Aghová, Tatiana; Yasur-Landau, D.; Lemma, W.; Hailu, A.; Baneth, G.; Warburg, A.; Volf, P.; Votýpka, J.

    2015-01-01

    Roč. 145, May 2015 (2015), s. 39-44 ISSN 0001-706X R&D Projects: GA ČR GAP506/10/0983 EU Projects: European Commission(XE) 261504 - EDENEXT Institutional support: RVO:68081766 Keywords : Leishmania donovani * Leishmania tropica * Phlebotomine sand fly * Rodents * kDNA * ITS1 Subject RIV: EG - Zoology Impact factor: 2.380, year: 2015

  10. Human mixed infections of Leishmania spp. and Leishmania-Trypanosoma cruzi in a sub Andean Bolivian area: identification by polymerase chain reaction/hybridization and isoenzyme

    Directory of Open Access Journals (Sweden)

    B Bastrenta

    2003-03-01

    Full Text Available Parasites belonging to Leishmania braziliensis, Leishmania donovani, Leishmania mexicana complexes and Trypanosoma cruzi (clones 20 and 39 were searched in blood, lesions and strains collected from 28 patients with active cutaneous leishmaniasis and one patient with visceral leishmaniasis. PCR-hybridization with specific probes of Leishmania complexes (L. braziliensis, L. donovani and L. mexicana and T. cruzi clones was applied to the different DNA samples. Over 29 patients, 8 (27.6% presented a mixed infection Leishmania complex species, 17 (58.6% a mixed infection Leishmania-T. cruzi, and 4 (13.8% a multi Leishmania-T. cruzi infection. Several patients were infected by the two Bolivian major clones 20 and 39 of T. cruzi (44.8%. The L. braziliensis complex was more frequently detected in lesions than in blood and a reverse result was observed for L. mexicana complex. The polymerase chain reaction-hybridization design offers new arguments supporting the idea of an underestimated rate of visceral leishmanisis in Bolivia. Parasites were isolated by culture from the blood of two patients and lesions of 10 patients. The UPGMA (unweighted pair-group method with arithmetic averages dendrogram computed from Jaccard's distances obtained from 11 isoenzyme loci data confirmed the presence of the three Leishmania complexes and undoubtedly identified human infections by L. (V. braziliensis, L. (L. chagasi and L. (L. mexicana species. Additional evidence of parasite mixtures was visualized through mixed isoenzyme profiles, L. (V. braziliensis-L. (L. mexicana and Leishmania spp.-T. cruzi.The epidemiological profile in the studied area appeared more complex than currently known. This is the first report of parasitological evidence of Bolivian patients with trypanosomatidae multi infections and consequences on the diseases' control and patient treatments are discussed.

  11. Cloning and expression of DNA encoding a ripening form of a polypeptide having rhamno-galacturonase activity.

    NARCIS (Netherlands)

    Musters, W.; Stam, H.; Suykerbuyk, M.E.; Visser, J.; Verbakel, J.M.

    1993-01-01

    The invention relates to isolation of an Aspergillus gene encoding rhamnogalacturonase (RG-ase) and the construction of recombinant Aspergillus strains with overexpression of RG-ase. These strains can be used for the commercial production of RG-ase. RG-ase is an important enzyme in processes

  12. Cloning and molecular characterization of the salt-regulated jojoba ScRab cDNA encoding a small GTP-binding protein.

    Science.gov (United States)

    Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

    2002-10-01

    Salt stress results in a massive change in gene expression. An 837 bp cDNA designated ScRab was cloned from shoot cultures of the salt tolerant jojoba (Simmondsia chinesis). The cloned cDNA encodes a full length 200 amino acid long polypeptide that bears high homology to the Rab subfamily of small GTP binding proteins, particularly, the Rab5 subfamily. ScRab expression is reduced in shoots grown in the presence of salt compared to shoots from non-stressed cultures. His6-tagged ScRAB protein was expressed in E. coli, and purified to homogeneity. The purified protein bound radiolabelled GTP. The unlabelled guanine nucleotides GTP, GTP gamma S and GDP but not ATP, CTP or UTP competed with GTP binding.

  13. Molecular screening of Leishmania spp. infection and bloodmeals in sandflies from a leishmaniasis focus in southwestern Turkey.

    Science.gov (United States)

    Karaku Ş, M; Pekağ Irba Ş, M; Demir, S; Eren, H; Töz, S; Özbel, Y

    2017-06-01

    Leishmaniasis is an arthropod-borne disease that affects approximately 2 million people worldwide annually. The aims of this study were to detect the presence of Leishmania (Kinetoplastida: Trypanosomatidae) DNA and the feeding preferences of probable vector species in an endemic focus of Leishmania infantum in Turkey. Entomological sampling was performed in August and October 2015 in Aydın province, where cases of human and canine leishmaniasis have been reported previously. A total of 1059 sandfly specimens comprising nine species belonging to two genera, Phlebotomus and Sergentomyia (both: Diptera: Psychodidae), and five subgenera of the Phlebotomus genus (Phlebotomus, Paraphlebotomus, Larroussius, Adlerius and Transphlebotomus) were collected in five villages. Among all Phlebotomus specimens, Phlebotomus neglectus (39%) was noted as the most abundant species, followed by Phlebotomus tobbi (18%). Leishmania DNA was detected in pools from P. neglectus, P. tobbi and Sergentomyia dentata by kDNA polymerase chain reaction (PCR). Leishmania DNA from Phlebotomus specimens was identified as L. infantum, but Leishmania DNA from Sergentomyia spp. could not be identified to species level by ITS-1 real-time PCR. The detection of Leishmania DNA in wild-caught P. neglectus and the high percentage (24.2%) of human DNA in engorged specimens suggests that P. neglectus is probably an important vector species for L. infantum in Aydın province. © 2016 The Royal Entomological Society.

  14. Innate Immunity against Leishmania Infections

    Science.gov (United States)

    Gurung, Prajwal; Kanneganti, Thirumala-Devi

    2015-01-01

    Leishmaniasis is a major health problem that affects more than 300 million people throughout the world. The morbidity associated with the disease causes serious economic burden in Leishmania endemic regions. Despite the morbidity and economic burden associated with Leishmaniasis, this disease rarely gets noticed and is still categorized under neglected tropical diseases. The lack of research combined with the ability of Leishmania to evade immune recognition has rendered our efforts to design therapeutic treatments or vaccines challenging. Herein, we review the literature on Leishmania from innate immune perspective and discuss potential problems as well as solutions and future directions that could aid in identifying novel therapeutic targets to eliminate this parasite. PMID:26249747

  15. Molecular cloning of the cDNA encoding follicle-stimulating hormone beta subunit of the Chinese soft-shell turtle Pelodiscus sinensis, and its gene expression.

    Science.gov (United States)

    Chien, Jung-Tsun; Shen, San-Tai; Lin, Yao-Sung; Yu, John Yuh-Lin

    2005-04-01

    Follicle-stimulating hormone (FSH) is a member of the pituitary glycoprotein hormone family. These hormones are composed of two dissimilar subunits, alpha and beta. Very little information is available regarding the nucleotide and amino acid sequence of FSHbeta in reptilian species. For better understanding of the phylogenetic diversity and evolution of FSH molecule, we have isolated and sequenced the complementary DNA (cDNA) encoding the Chinese soft-shell turtle (Pelodiscus sinensis, Family of Trionychidae) FSHbeta precursor molecule by reverse transcription-polymerase chain reaction (RT-PCR) and rapid amplification of cDNA end (RACE) methods. The cloned Chinese soft-shell turtle FSHbeta cDNA consists of 602-bp nucleotides, including 34-bp nucleotides of the 5'-untranslated region (UTR), 396-bp of the open reading frame, and 3'-UTR of 206-bp nucleotides. It encodes a 131-amino acid precursor molecule of FSHbeta subunit with a signal peptide of 20 amino acids followed by a mature protein of 111 amino acids. Twelve cysteine residues, forming six disulfide bonds within beta-subunit and two putative asparagine-linked glycosylation sites, are also conserved in the Chinese soft-shell turtle FSHbeta subunit. The deduced amino acid sequence of the Chinese soft-shell turtle FSHbeta shares identities of 97% with Reeves's turtle (Family of Bataguridae), 83-89% with birds, 61-70% with mammals, 63-66% with amphibians and 40-58% with fish. By contrast, when comparing the FSHbeta with the beta-subunits of the Chinese soft-shell turtle luteinizing hormone and thyroid stimulating hormone, the homologies are as low as 38 and 39%, respectively. A phylogenetic tree including reptilian species of FSHbeta subunits, is presented for the first time. Out of various tissues examined, FSHbeta mRNA was only expressed in the pituitary gland and can be up-regulated by gonadotropin-releasing hormone in pituitary tissue culture as estimated by fluorescence real-time PCR analysis.

  16. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    International Nuclear Information System (INIS)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-01-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, 32 P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV

  17. Cloning and characterization of DNA complementary to the canine distemper virus mRNA encoding matrix, phosphoprotein, and nucleocapsid protein

    Energy Technology Data Exchange (ETDEWEB)

    Rozenblatt, S.; Eizenberg, O.; Englund, G.; Bellini, W.J.

    1985-02-01

    Double-stranded cDNA synthesized from total polyadenylate-containing mRNA, extracted from monkey kidney cells infected with canine distemper virus (CDV), has been cloned into the PstI site of Escherichia coli plasmid pBR322. Clones containing canine distemper virus DNA were identified by hybridization to a canine distemper virus-specific, /sup 32/P-labeled cDNA. Four specific clones containing different classes of sequences have been identified. The cloned plasmids contain inserts of 800 (clone 44-80), 960 (clone 74-16), 1700 (clone 364), and 950 (clone 40-9) base pairs. The sizes of the mRNA species complementary to these inserts are 1500, 1850, 1850 and 2500 nucleotides, respectively, as determined by the Northern technique. Three of the cloned DNA fragments were further identified as the reverse transcripts of the mRNA coding for the matrix, phosphoprotein, and nucleocapsid protein of CDV.

  18. Natural canine infection by Leishmania infantum and Leishmania amazonensis and their implications for disease control

    Directory of Open Access Journals (Sweden)

    Letícia da Cruz Sanches

    Full Text Available Abstract Leishmaniasis is a major public health problem worldwide. Because Leishmania can adapt to new hosts or vectors, knowledge concerning the current etiological agent in dogs is important in endemic areas. This study aimed to identify the Leishmania species detected in 103 samples of peripheral blood from dogs that were naturally infected with these protozoa. The diagnosis of leishmaniasis was determined through parasitological examination, the indirect enzyme-linked immunosorbent assay (ELISA and the polymerase chain reaction (PCR. The Leishmania species were identified by means of PCR-restriction fragment length polymorphism (PCR-RFLP. The samples were subjected to PCR using oligonucleotide primers that amplify the intergenic region ITS1 of the rRNA gene in order to identify the species. The amplified DNA was digested using the restriction enzyme HaeIII. A restriction profile identical to L. amazonensis was shown in 77/103 samples and the profile was similar to L. infantum in 17/103. However, a mixed profile was shown in 9/103 samples, which impeded species identification. In conclusion, the infection in these dogs was predominantly due to L. amazonensis, thus indicating that diagnosing of cases of canine leishmaniasis needs to be reexamined, since the causative agent identified is not restricted to L. infantum.

  19. Increased mRNA expression of a laminin-binding protein in human colon carcinoma: Complete sequence of a full-length cDNA encoding the protein

    International Nuclear Information System (INIS)

    Yow, Hsiukang; Wong, Jau Min; Chen, Hai Shiene; Lee, C.; Steele, G.D. Jr.; Chen, Lanbo

    1988-01-01

    Reliable markers to distinguish human colon carcinoma from normal colonic epithelium are needed particularly for poorly differentiated tumors where no useful marker is currently available. To search for markers the authors constructed cDNA libraries from human colon carcinoma cell lines and screened for clones that hybridize to a greater degree with mRNAs of colon carcinomas than with their normal counterparts. Here they report one such cDNA clone that hybridizes with a 1.2-kilobase (kb) mRNA, the level of which is ∼9-fold greater in colon carcinoma than in adjacent normal colonic epithelium. Blot hybridization of total RNA from a variety of human colon carcinoma cell lines shows that the level of this 1.2-kb mRNA in poorly differentiated colon carcinomas is as high as or higher than that in well-differentiated carcinomas. Molecular cloning and complete sequencing of cDNA corresponding to the full-length open reading frame of this 1.2-kb mRNA unexpectedly show it to contain all the partial cDNA sequence encoding 135 amino acid residues previously reported for a human laminin receptor. The deduced amino acid sequence suggests that this putative laminin-binding protein from human colon carcinomas consists of 295 amino acid residues with interesting features. There is an unusual C-terminal 70-amino acid segment, which is trypsin-resistant and highly negatively charged

  20. Safety and efficacy of a xenogeneic DNA vaccine encoding for human tyrosinase as adjunctive treatment for oral malignant melanoma in dogs following surgical excision of the primary tumor.

    Science.gov (United States)

    Grosenbaugh, Deborah A; Leard, A Timothy; Bergman, Philip J; Klein, Mary K; Meleo, Karri; Susaneck, Steven; Hess, Paul R; Jankowski, Monika K; Jones, Pamela D; Leibman, Nicole F; Johnson, Maribeth H; Kurzman, Ilene D; Wolchok, Jedd D

    2011-12-01

    To evaluate the safety and efficacy of a vaccine containing plasmid DNA with an insert encoding human tyrosinase (ie, huTyr vaccine) as adjunctive treatment for oral malignant melanoma (MM) in dogs. 111 dogs (58 prospectively enrolled in a multicenter clinical trial and 53 historical controls) with stage II or III oral MM (modified World Health Organization staging scale, I to IV) in which locoregional disease control was achieved. 58 dogs received an initial series of 4 injections of huTyr vaccine (102 μg of DNA/injection) administered transdermally by use of a needle-free IM vaccination device. Dogs were monitored for adverse reactions. Surviving dogs received booster injections at 6-month intervals thereafter. Survival time for vaccinates was compared with that of historical control dogs via Kaplan-Meier survival analysis for the outcome of death. Kaplan-Meier analysis of survival time until death attributable to MM was determined to be significantly improved for dogs that received the huTyr vaccine, compared with that of historical controls. However, median survival time could not be determined for vaccinates because dogs as adjunctive treatment for oral MM. Response to DNA vaccination in dogs with oral MM may be useful in development of plasmid DNA vaccination protocols for human patients with similar disease.

  1. Identification of a cDNA encoding a parathyroid hormone-like peptide from a human tumor associated with humoral hypercalcemia of malignancy

    International Nuclear Information System (INIS)

    Mangin, M.; Webb, A.C.; Dreyer, B.E.

    1988-01-01

    Humoral hypercalcemia of malignancy is a common paraneoplastic syndrome that appears to be mediated in many instances by a parathyroid hormone-like peptide. Poly(A) + RNA from a human renal carcinoma associated with this syndrome was enriched by preparative electrophoresis and used to construct an enriched cDNA library in phage λgt10. The library was screened with a codon-preference oligonucleotide synthesized on the basis of a partial N-terminal amino acid sequence from a human tumor-derived peptide, and a 2.0 kilo-base cDNA was identified. The cDNA encodes a 177 amino acid protein consisting of a 36 amino acid leader sequence and a 141 amino acid mature peptide. The first 13 amino acids of the deduced sequence of the mature peptide display strong homology to human PTH, with complete divergence thereafter. RNA blot-hybridization analysis revealed multiple transcripts in mRNA from tumors associated with the humor syndrome and also in mRNA from normal human keratinocytes. Southern blot analysis of genomic DNA from humans and rodents revealed a simple pattern compatible with a single-copy gene. The gene has been mapped to chromosome 12

  2. Leishmania (L.) mexicana Infected Bats in Mexico: Novel Potential Reservoirs

    Science.gov (United States)

    Berzunza-Cruz, Miriam; Rodríguez-Moreno, Ángel; Gutiérrez-Granados, Gabriel; González-Salazar, Constantino; Stephens, Christopher R.; Hidalgo-Mihart, Mircea; Marina, Carlos F.; Rebollar-Téllez, Eduardo A.; Bailón-Martínez, Dulce; Balcells, Cristina Domingo; Ibarra-Cerdeña, Carlos N.; Sánchez-Cordero, Víctor; Becker, Ingeborg

    2015-01-01

    Leishmania (Leishmania) mexicana causes cutaneous leishmaniasis, an endemic zoonosis affecting a growing number of patients in the southeastern states of Mexico. Some foci are found in shade-grown cocoa and coffee plantations, or near perennial forests that provide rich breeding grounds for the sand fly vectors, but also harbor a variety of bat species that live off the abundant fruits provided by these shade-giving trees. The close proximity between sand flies and bats makes their interaction feasible, yet bats infected with Leishmania (L.) mexicana have not been reported. Here we analyzed 420 bats from six states of Mexico that had reported patients with leishmaniasis. Tissues of bats, including skin, heart, liver and/or spleen were screened by PCR for Leishmania (L.) mexicana DNA. We found that 41 bats (9.77%), belonging to 13 species, showed positive PCR results in various tissues. The infected tissues showed no evidence of macroscopic lesions. Of the infected bats, 12 species were frugivorous, insectivorous or nectarivorous, and only one species was sanguivorous (Desmodus rotundus), and most of them belonged to the family Phyllostomidae. The eco-region where most of the infected bats were caught is the Gulf Coastal Plain of Chiapas and Tabasco. Through experimental infections of two Tadarida brasiliensis bats in captivity, we show that this species can harbor viable, infective Leishmania (L.) mexicana parasites that are capable of infecting BALB/c mice. We conclude that various species of bats belonging to the family Phyllostomidae are possible reservoir hosts for Leishmania (L.) mexicana, if it can be shown that such bats are infective for the sand fly vector. Further studies are needed to determine how these bats become infected, how long the parasite remains viable inside these potential hosts and whether they are infective to sand flies to fully evaluate their impact on disease epidemiology. PMID:25629729

  3. Leishmania (L. mexicana infected bats in Mexico: novel potential reservoirs.

    Directory of Open Access Journals (Sweden)

    Miriam Berzunza-Cruz

    2015-01-01

    Full Text Available Leishmania (Leishmania mexicana causes cutaneous leishmaniasis, an endemic zoonosis affecting a growing number of patients in the southeastern states of Mexico. Some foci are found in shade-grown cocoa and coffee plantations, or near perennial forests that provide rich breeding grounds for the sand fly vectors, but also harbor a variety of bat species that live off the abundant fruits provided by these shade-giving trees. The close proximity between sand flies and bats makes their interaction feasible, yet bats infected with Leishmania (L. mexicana have not been reported. Here we analyzed 420 bats from six states of Mexico that had reported patients with leishmaniasis. Tissues of bats, including skin, heart, liver and/or spleen were screened by PCR for Leishmania (L. mexicana DNA. We found that 41 bats (9.77%, belonging to 13 species, showed positive PCR results in various tissues. The infected tissues showed no evidence of macroscopic lesions. Of the infected bats, 12 species were frugivorous, insectivorous or nectarivorous, and only one species was sanguivorous (Desmodus rotundus, and most of them belonged to the family Phyllostomidae. The eco-region where most of the infected bats were caught is the Gulf Coastal Plain of Chiapas and Tabasco. Through experimental infections of two Tadarida brasiliensis bats in captivity, we show that this species can harbor viable, infective Leishmania (L. mexicana parasites that are capable of infecting BALB/c mice. We conclude that various species of bats belonging to the family Phyllostomidae are possible reservoir hosts for Leishmania (L. mexicana, if it can be shown that such bats are infective for the sand fly vector. Further studies are needed to determine how these bats become infected, how long the parasite remains viable inside these potential hosts and whether they are infective to sand flies to fully evaluate their impact on disease epidemiology.

  4. Isolation and characterisation of cDNA clones representing the genes encoding the major tuber storage protein (dioscorin) of yam (Dioscorea cayenensis Lam.).

    Science.gov (United States)

    Conlan, R S; Griffiths, L A; Napier, J A; Shewry, P R; Mantell, S; Ainsworth, C

    1995-06-01

    cDNA clones encoding dioscorins, the major tuber storage proteins (M(r) 32,000) of yam (Dioscorea cayenesis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1% similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of M(r) 30,015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6% similar with respect to each other, but show no sequence identity with other plant proteins or with the major tuber storage proteins of potato (patatin) or sweet potato (sporamin). Storage protein gene expression was restricted to developing tubers and was not induced by growth conditions known to induce expression of tuber storage protein genes in other plant species. The codon usage of the dioscorin genes suggests that the Dioscoreaceae are more closely related to dicotyledonous than to monocotyledonous plants.

  5. Characterization of the cDNA encoding a BPI/LBP homologue in venom gland of the hundred-pace snake Deinagkistrodon acutus

    Directory of Open Access Journals (Sweden)

    Jianrao HU, Mingfu CAO, Jiong Chen

    2009-10-01

    Full Text Available Bactericidal/permeability-increasing protein (BPI and LPS-binding protein (LBP play an important role in host defence. Current evidence shows that BPI/LBP may be widely existed in different cells and tissue types of animals. A full-length cDNA clone encoding a BPI/LBP homologue (dBPI, 1757bp in size, was characterized in venom gland of the hundred-pace snake Deinagkistrodon acutus. Its deduced amino acid sequence of 417 residues had 13.8%–21.5% identity to BPI like 1(BPIL1 and BPI like 3(BPIL3 of other animals. Conserved cysteine residues which are involved in disulfide bond formation between the final strand of the N-terminal beta sheet and the long alpha helix of BPI are identified as Cys146-Cys183 of dBPI. Phylogenetic tree analysis showed that the BPI/LBP homologues formed five large clusters and dBPI was in a large cluster including BPIL1 and BPIL3. dBPI mRNA shows a tissue specific expression in venom gland. This is the first study to identify the cDNA encoding BPI/LBP homologues from reptiles [Current Zoology 55 (5: –2009].

  6. α/sub i/-3 cDNA encodes the α subunit of G/sub k/, the stimulatory G protein of receptor-regulated K+ channels

    International Nuclear Information System (INIS)

    Codina, J.; Olate, J.; Abramowitz, J.; Mattera, R.; Cook, R.G.; Birnbaumer, L.

    1988-01-01

    cDNA cloning has identified the presence in the human genome of three genes encoding α subunits of pertussis toxin substrates, generically called G/sub i/. They are named α/sub i/-1, α/sub i/-2 and α/sub i/-3. However, none of these genes has been functionally identified with any of the α subunits of several possible G proteins, including pertussis toxin-sensitive G/sub p/'s, stimulatory to phospholipase C or A 2 , G/sub i/, inhibitory to adenylyl cyclase, or G/sub k/, stimulatory to a type of K + channels. The authors now report the nucleotide sequence and the complete predicted amino acid sequence of human liver α/sub i/-3 and the partial amino acid sequence of proteolytic fragments of the α subunit of human erythrocyte G/sub k/. The amino acid sequence of the proteolytic fragment is uniquely encoded by the cDNA of α/sub i/-3, thus identifying it as α/sub k/. The probable identity of α/sub i/-1 with α/sub p/ and possible roles for α/sub i/-2, as well as additional roles for α/sub i/-1 and α/sub i/-3 (α/sub k/) are discussed

  7. Effect of cytokine-encoding plasmid delivery on immune response to Japanese encephalitis virus DNA vaccine in mice.

    Science.gov (United States)

    Bharati, Kaushik; Appaiahgari, Mohan Babu; Vrati, Sudhanshu

    2005-01-01

    We have previously shown that immunization of mice with plasmid pMEa synthesizing Japanese encephalitis virus (JEV) envelope protein induced anti-JEV humoral and cellular immune responses. We now show that intra-muscular co-administration of mice with pMEa and pGM-CSF, encoding murine granulocyte-macrophage colony-stimulating factor or pIL-2, encoding murine interleukin-2 given 4 days after pMEa, augmented anti-JEV antibody titers. This did not enhance the level of protection in immunized mice against JEV. However, intra-dermal co-administration of pMEa and pGM-CSF in mice using the gene gun, enhanced anti-JEV antibody titers resulting in an increased level of protection in mice against lethal JEV challenge.

  8. Mucosal application of gp140 encoding DNA polyplexes to different tissues results in altered immunological outcomes in mice.

    Directory of Open Access Journals (Sweden)

    Jamie F S Mann

    Full Text Available Increasing evidence suggests that mucosally targeted vaccines will enhance local humoral and cellular responses whilst still eliciting systemic immunity. We therefore investigated the capacity of nasal, sublingual or vaginal delivery of DNA-PEI polyplexes to prime immune responses prior to mucosal protein boost vaccination. Using a plasmid expressing the model antigen HIV CN54gp140 we show that each of these mucosal surfaces were permissive for DNA priming and production of antigen-specific antibody responses. The elicitation of systemic immune responses using nasally delivered polyplexed DNA followed by recombinant protein boost vaccination was equivalent to a systemic prime-boost regimen, but the mucosally applied modality had the advantage in that significant levels of antigen-specific IgA were detected in vaginal mucosal secretions. Moreover, mucosal vaccination elicited both local and systemic antigen-specific IgG(+ and IgA(+ antibody secreting cells. Finally, using an Influenza challenge model we found that a nasal or sublingual, but not vaginal, DNA prime/protein boost regimen protected against infectious challenge. These data demonstrate that mucosally applied plasmid DNA complexed to PEI followed by a mucosal protein boost generates sufficient antigen-specific humoral antibody production to protect from mucosal viral challenge.

  9. Distinct Macrophage Fates after in vitro Infection with Different Species of Leishmania: Induction of Apoptosis by Leishmania (Leishmania) amazonensis, but Not by Leishmania (Viannia) guyanensis.

    Science.gov (United States)

    DaMata, Jarina Pena; Mendes, Bárbara Pinheiro; Maciel-Lima, Kátia; Menezes, Cristiane Alves Silva; Dutra, Walderez Ornelas; Sousa, Lirlândia Pires; Horta, Maria Fátima

    2015-01-01

    Leishmania is an intracellular parasite in vertebrate hosts, including man. During infection, amastigotes replicate inside macrophages and are transmitted to healthy cells, leading to amplification of the infection. Although transfer of amastigotes from infected to healthy cells is a crucial step that may shape the outcome of the infection, it is not fully understood. Here we compare L. amazonensis and L. guyanensis infection in C57BL/6 and BALB/c mice and investigate the fate of macrophages when infected with these species of Leishmania in vitro. As previously shown, infection of mice results in distinct outcomes: L. amazonensis causes a chronic infection in both strains of mice (although milder in C57BL/6), whereas L. guyanensis does not cause them disease. In vitro, infection is persistent in L. amazonensis-infected macrophages whereas L. guyanensis growth is controlled by host cells from both strains of mice. We demonstrate that, in vitro, L. amazonensis induces apoptosis of both C57BL/6 and BALB/c macrophages, characterized by PS exposure, DNA cleavage into nucleosomal size fragments, and consequent hypodiploidy. None of these signs were seen in macrophages infected with L. guyanensis, which seem to die through necrosis, as indicated by increased PI-, but not Annexin V-, positive cells. L. amazonensis-induced macrophage apoptosis was associated to activation of caspases-3, -8 and -9 in both strains of mice. Considering these two species of Leishmania and strains of mice, macrophage apoptosis, induced at the initial moments of infection, correlates with chronic infection, regardless of its severity. We present evidence suggestive that macrophages phagocytize L. amazonensis-infected cells, which has not been verified so far. The ingestion of apoptotic infected macrophages by healthy macrophages could be a way of amastigote spreading, leading to the establishment of infection.

  10. Distinct Macrophage Fates after in vitro Infection with Different Species of Leishmania: Induction of Apoptosis by Leishmania (Leishmania amazonensis, but Not by Leishmania (Viannia guyanensis.

    Directory of Open Access Journals (Sweden)

    Jarina Pena DaMata

    Full Text Available Leishmania is an intracellular parasite in vertebrate hosts, including man. During infection, amastigotes replicate inside macrophages and are transmitted to healthy cells, leading to amplification of the infection. Although transfer of amastigotes from infected to healthy cells is a crucial step that may shape the outcome of the infection, it is not fully understood. Here we compare L. amazonensis and L. guyanensis infection in C57BL/6 and BALB/c mice and investigate the fate of macrophages when infected with these species of Leishmania in vitro. As previously shown, infection of mice results in distinct outcomes: L. amazonensis causes a chronic infection in both strains of mice (although milder in C57BL/6, whereas L. guyanensis does not cause them disease. In vitro, infection is persistent in L. amazonensis-infected macrophages whereas L. guyanensis growth is controlled by host cells from both strains of mice. We demonstrate that, in vitro, L. amazonensis induces apoptosis of both C57BL/6 and BALB/c macrophages, characterized by PS exposure, DNA cleavage into nucleosomal size fragments, and consequent hypodiploidy. None of these signs were seen in macrophages infected with L. guyanensis, which seem to die through necrosis, as indicated by increased PI-, but not Annexin V-, positive cells. L. amazonensis-induced macrophage apoptosis was associated to activation of caspases-3, -8 and -9 in both strains of mice. Considering these two species of Leishmania and strains of mice, macrophage apoptosis, induced at the initial moments of infection, correlates with chronic infection, regardless of its severity. We present evidence suggestive that macrophages phagocytize L. amazonensis-infected cells, which has not been verified so far. The ingestion of apoptotic infected macrophages by healthy macrophages could be a way of amastigote spreading, leading to the establishment of infection.

  11. Determination of cDNA encoding BCR/ABL fusion gene in patients with chronic myelogenous leukemia using a novel FRET-based quantum dots-DNA nanosensor.

    Science.gov (United States)

    Shamsipur, Mojtaba; Nasirian, Vahid; Barati, Ali; Mansouri, Kamran; Vaisi-Raygani, Asad; Kashanian, Soheila

    2017-05-08

    In the present study, we developed a sensitive method based on fluorescence resonance energy transfer (FRET) for the determination of the BCR/ABL fusion gene, which is used as a biomarker to confirm the clinical diagnosis of both chronic myelogenous leukemia (CML) and acute lymphocytic leukemia (ALL). For this purpose, CdTe quantum dots (QDs) were conjugated to amino-modified 18-mer oligonucleotide ((N)DNA) to form the QDs-(N)DNA nanosensor. In the presence of methylene blue (MB) as an intercalator, the hybridization of QDs-(N)DNA with the target BCR/ABL fusion gene (complementary DNA), brings the MB (acceptor) at close proximity of the QDs (donor), leading to FRET upon photoexcitation of the QDs. The enhancement in the emission intensity of MB was used to follow up the hybridization, which was linearly proportional to concentration of the target complementary DNA in a range from 1.0 × 10 -9 to 1.25 × 10 -7  M. The detection limit of the proposed method was obtained to be 1.5 × 10 -10  M. Finally, the feasibility and selectivity of the proposed nanosensor was evaluated by the analysis of derived nucleotides from both mismatched sequences and clinical samples of patients with leukemia as real samples. Copyright © 2017 Elsevier B.V. All rights reserved.

  12. Point mutations in a nucleoside transporter gene from Leishmania donovani confer drug resistance and alter substrate selectivity

    OpenAIRE

    Vasudevan, Gayatri; Ullman, Buddy; Landfear, Scott M.

    2001-01-01

    Leishmania parasites lack a purine biosynthetic pathway and depend on surface nucleoside and nucleobase transporters to provide them with host purines. Leishmania donovani possess two closely related genes that encode high affinity adenosine-pyrimidine nucleoside transporters LdNT1.1 and LdNT1.2 and that transport the toxic adenosine analog tubercidin in addition to the natural substrates. In this study, we have characterized a drug-resistant clonal mutant of L. do...

  13. Dendritic cell mediated delivery of plasmid DNA encoding LAMP/HIV-1 Gag fusion immunogen enhances T cell epitope responses in HLA DR4 transgenic mice.

    Directory of Open Access Journals (Sweden)

    Gregory G Simon

    2010-01-01

    Full Text Available This report describes the identification and bioinformatics analysis of HLA-DR4-restricted HIV-1 Gag epitope peptides, and the application of dendritic cell mediated immunization of DNA plasmid constructs. BALB/c (H-2d and HLA-DR4 (DRA1*0101, DRB1*0401 transgenic mice were immunized with immature dendritic cells transfected by a recombinant DNA plasmid encoding the lysosome-associated membrane protein-1/HIV-1 Gag (pLAMP/gag chimera antigen. Three immunization protocols were compared: 1 primary subcutaneous immunization with 1x10(5 immature dendritic cells transfected by electroporation with the pLAMP/gag DNA plasmid, and a second subcutaneous immunization with the naked pLAMP/gag DNA plasmid; 2 primary immunization as above, and a second subcutaneous immunization with a pool of overlapping peptides spanning the HIV-1 Gag sequence; and 3 immunization twice by subcutaneous injection of the pLAMP/gag DNA plasmid. Primary immunization with pLAMP/gag-transfected dendritic cells elicited the greatest number of peptide specific T-cell responses, as measured by ex vivo IFN-gamma ELISpot assay, both in BALB/c and HLA-DR4 transgenic mice. The pLAMP/gag-transfected dendritic cells prime and naked DNA boost immunization protocol also resulted in an increased apparent avidity of peptide in the ELISpot assay. Strikingly, 20 of 25 peptide-specific T-cell responses in the HLA-DR4 transgenic mice contained sequences that corresponded, entirely or partially to 18 of the 19 human HLA-DR4 epitopes listed in the HIV molecular immunology database. Selection of the most conserved epitope peptides as vaccine targets was facilitated by analysis of their representation and variability in all reported sequences. These data provide a model system that demonstrates a the superiority of immunization with dendritic cells transfected with LAMP/gag plasmid DNA, as compared to naked DNA, b the value of HLA transgenic mice as a model system for the identification and evaluation

  14. Cloning, molecular characterization and expression of a cDNA encoding a functional NADH-cytochrome b5 reductase from Mucor racemosus PTCC 5305 in E. coli

    Directory of Open Access Journals (Sweden)

    NED A SETAYESH

    2009-01-01

    Full Text Available The present work aims to study a new NADH-cytochrome b5 reductase (cb5r from Mucor racemosus PTCC 5305. A cDNA coding for cb s r was isolated from a Mucor racemosus PTCC 5305 cDNA library. The nucleotide sequence of the cDNA including coding and sequences flanking regions was determined. The open reading frame starting from ATG and ending with TAG stop codon encoded 228 amino acids and displayed the closest similarity (73% with Mortierella alpina cb s r. Lack of hydrophobic residues in the N-terminal sequence was apparent, suggesting that the enzyme is a soluble isoform. The coding sequence was then cloned in the pET16b transcription vector carrying an N-terminal-linked His-Tag® sequence and expressed in Escherichia coli BL21 (DE3. The enzyme was then homogeneously purified by a metal affinity column. The recombinant Mucor enzyme was shown to have its optimal activity at pH and temperature of about 7.5 and 40 °C, respectively. The apparent Km value was calculated to be 13 μM for ferricyanide. To our knowledge, this is the first report on cloning and expression of a native fungal soluble isoform of NADH-cytochrome b5 reductase in E. coli.

  15. Cloning and sequencing of the cDNA encoding a core protein of the paired helical filament of Alzheimer's disease: Identification as the microtubule-associated protein tau

    International Nuclear Information System (INIS)

    Goedert, M.; Wischik, C.M.; Crowther, R.A.; Walker, J.E.; Klug, A.

    1988-01-01

    Screening of cDNA libraries prepared from the frontal cortex of an Alzheimer's disease patient and from fetal human brain has led to isolation of the cDNA for a core protein of the paired helical filament of Alzheimer's disease. The partial amino acid sequence of this core protein was used to design synthetic oligonucleotide probes. The cDNA encodes a protein of 352 amino acids that contains a characteristic amino acid repeat in its carboxyl-terminal half. This protein is highly homologous to the sequence of the mouse microtubule-associated protein tau and thus constitutes the human equivalent of mouse tau. RNA blot analysis indicates the presence of two major transcripts, 6 and 2 kilobases long, with a wide distribution in normal human brain. Tau protein mRNAs were found in normal amounts in the frontal cortex from patients with Alzheimer's disease. The proof that at least part of tau protein forms a component of the paired helical filament core opens the way to understanding the mode of formation of paired helical filaments and thus, ultimately, the pathogenesis of Alzheimer's disease

  16. Novel Point Mutations and A8027G Polymorphism in Mitochondrial-DNA-Encoded Cytochrome c Oxidase II Gene in Mexican Patients with Probable Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Verónica Loera-Castañeda

    2014-01-01

    Full Text Available Mitochondrial dysfunction has been thought to contribute to Alzheimer disease (AD pathogenesis through the accumulation of mitochondrial DNA mutations and net production of reactive oxygen species (ROS. Mitochondrial cytochrome c-oxidase plays a key role in the regulation of aerobic production of energy and is composed of 13 subunits. The 3 largest subunits (I, II, and III forming the catalytic core are encoded by mitochondrial DNA. The aim of this work was to look for mutations in mitochondrial cytochrome c-oxidase gene II (MTCO II in blood samples from probable AD Mexican patients. MTCO II gene was sequenced in 33 patients with diagnosis of probable AD. Four patients (12% harbored the A8027G polymorphism and three of them were early onset (EO AD cases with familial history of the disease. In addition, other four patients with EOAD had only one of the following point mutations: A8003C, T8082C, C8201T, or G7603A. Neither of the point mutations found in this work has been described previously for AD patients, and the A8027G polymorphism has been described previously; however, it hasn’t been related to AD. We will need further investigation to demonstrate the role of the point mutations of mitochondrial DNA in the pathogenesis of AD.

  17. Identification and Molecular Characterization of the cDNA Encoding Cucumis melo Allergen, Cuc m 3, a Plant Pathogenesis-Related Protein

    Directory of Open Access Journals (Sweden)

    Mojtaba Sankian

    2014-05-01

    Full Text Available Background: Melon (Cucumis melo allergy is one of the most common food allergies, characterized by oral allergy syndrome. To date, two allergen molecules, Cuc m 1 and Cuc m 2, have been fully characterized in melon pulp, but there are few reports about the molecular characteristics of Cuc m 3. Methods:The Cuc m 3 cDNA has been characterized by rapid amplification of cDNA ends (RACE, which revealed a 456 base-pair (bp fragment encoding a 151-amino acid polypeptide with a predicted molecular mass of 16.97 kDa, and identified 79 and 178 bp untranslated sequences at the 5′ and 3´ ends, respectively. Results: In silico analysis showed strong similarities between Cuc m 3 and other plant pathogen-related protein 1s from cucumber, grape, bell pepper, and tomato. Conclusion: Here we report the identification and characterization of the Cuc m 3 cDNA, which will be utilized for further analyses of structural and allergenic features of this allergen

  18. Detection of Leishmania spp. in Bats from an Area of Brazil Endemic for Visceral Leishmaniasis.

    Science.gov (United States)

    de Rezende, M B; Herrera, H M; Carvalho, C M E; Carvalho Anjos, E A; Ramos, C A N; de Araújo, F R; Torres, J M; de Oliveira, C E

    2017-12-01

    The multihost parasites Leishmania spp. infect a broad range of wild mammalian species including bats. Several species of bats have adapted to a variety of food resources and shelters in urban areas. This study aimed to detect Leishmania spp. DNA in bats present in forest fragments located in metropolitan areas endemic for leishmaniasis in Campo Grande, Mato Grosso do Sul (MS), Brazil. Blood samples were obtained from 80 individuals, including eight species of Phyllostomidae and one species of Vespertilionidae. Thirty of the 80 bats were positive for Leishmania spp. using conventional PCR, all belonging to the family Phyllostomidae. Eighteen samples tested by real-time PCR (qPCR) using specific primers for the kDNA of Leishmania infantum were positive. To the best of our knowledge, this is the first report detecting Leishmania spp. in Platyrrhinus incarum in addition to being the first reported detection of L. infantum in the bat species Phyllostomus discolor, Platyrrhinus lineatus, Artibeus planirostris and Artibeus lituratus. Our results show that bats can host Leishmania spp. in areas endemic for leishmaniasis, which must be taken into account in disease control operations by public health authorities. © 2017 Blackwell Verlag GmbH.

  19. Assessment of nuclear and mitochondrial genes in precise identification and analysis of genetic polymorphisms for the evaluation of Leishmania parasites.

    Science.gov (United States)

    Fotouhi-Ardakani, Reza; Dabiri, Shahriar; Ajdari, Soheila; Alimohammadian, Mohammad Hossein; AlaeeNovin, Elnaz; Taleshi, Neda; Parvizi, Parviz

    2016-12-01

    The polymorphism and genetic diversity of Leishmania genus has status under discussion depending on many items such as nuclear and/or mitochondrial genes, molecular tools, Leishmania species, geographical origin, condition of micro-environment of Leishmania parasites and isolation of Leishmania from clinical samples, reservoir host and vectors. The genetic variation of Leishmania species (L. major, L. tropica, L. tarentolae, L. mexicana, L. infantum) were analyzed and compared using mitochondrial (COII and Cyt b) and nuclear (nagt, ITS-rDNA and HSP70) genes. The role of each enzymatic (COII, Cyt b and nagt) or housekeeping (ITS-rDNA, HSP70) gene was employed for accurate identification of Leishmania parasites. After DNA extractions and amplifying of native, natural and reference strains of Leishmania parasites, polymerase chain reaction (PCR) products were sequenced and evaluation of genetic proximity and phylogenetic analysis were performed using MEGA6 and DnaSP5 software. Among the 72 sequences of the five genes, the number of polymorphic sites was significantly lower as compared to the monomorphic sites. Of the 72 sequences, 54 new haplotypes (five genes) of Leishmania species were submitted in GenBank (Access number: KU680818 - KU680871). Four genes had a remarkable number of informative sites (P=0.00), except HSP70 maybe because of its microsatellite regions. The non-synonymous (dN) variants of nagt gene were more than that of other expression genes (47.4%). The synonymous (dS)/dN ratio in three expression genes showed a significant variation between five Leishmania species (P=0.001). The highest and lowest levels of haplotype diversity were observed in L. tropica (81.35%) and L. major (28.38%) populations, respectively. Tajima's D index analyses showed that Cyt b gene in L. tropica species was significantly negative (Tajima's D=-2.2, PLeishmania parasites. Copyright © 2016 Elsevier B.V. All rights reserved.

  20. Molecular Identification of Leishmania spp. in Sand Flies (Diptera: Psychodidae: Phlebotominae) in the Lençóis Maranhenses National Park, Brazil.

    Science.gov (United States)

    Pereira-Filho, Adalberto Alves; Fonteles, Raquel Silva; Bandeira, Maria da Conceição Abreu; Moraes, Jorge Luiz Pinto; Rebêlo, José Manuel Macário; Melo, Maria Norma

    2018-02-20

    Sand flies are very common in the region of Lençóis Maranhenses National Park, an important tourist attraction in Brazil. However, the role of some species and their relative importance locally in Leishmania Ross 1903 transmission is unclear. The objective of this study was to identify Leishmania infection in phlebotomine sand flies collected around the Lençóis Maranhenses National Park, an important conservation area and popular international/national tourist destination with a high incidence of leishmaniasis. Sand flies were collected in peridomiciliary areas on the tourist route from September 2012 to August 2013. The captured females were subjected to molecular analyses for the detection of Leishmania DNA. Sand flies were infected with four Leishmania species: Leishmania (Viannia) braziliensis (Vianna, 1911) was found in Lutzomyia whitmani (Antunes and Coutinho, 1939) (2.1%) and Lutzomyia longipalpis (Lutz and Neiva, 1912) (1.7%); Leishmania (Leishmania) infantum (Nicole, 1908) infected Lutzomyia wellcomei (Fraiha, Shaw, and Lainson, 1971) (20%), Lutzomyia sordellii (Shannon and Del Ponte, 1927) (4.3%), Lu. longipalpis (3.7%), and Lu. whitmani (0.8%); Leishmania (Leishmania) amazonensis (Lainson & Shaw, 1972) was found in Lu. whitmani (0.58%), while Leishmania (Viannia) lainsoni infected Lutzomyia evandroi (Costa Lima and Antunes, 1936) (3.4%), Lu. longipalpis (1.06%), and Lu. whitmani (0.29%). The occurrence of these parasites requires control measures to reduce the incidence of cutaneous leishmaniasis and to contain a possible epidemic of visceral leishmaniasis, the most severe form of the disease.

  1. EG-07CELL CYCLE SIGNATURE AND TUMOR PHYLOGENY ARE ENCODED IN THE EVOLUTIONARY DYNAMICS OF DNA METHYLATION IN GLIOMA

    Science.gov (United States)

    Mazor, Tali; Pankov, Aleksandr; Johnson, Brett E.; Hong, Chibo; Bell, Robert J.A.; Smirnov, Ivan V.; Reis, Gerald F.; Phillips, Joanna J.; Barnes, Michael; Bollen, Andrew W.; Taylor, Barry S.; Molinaro, Annette M.; Olshen, Adam B.; Song, Jun S.; Berger, Mitchel S.; Chang, Susan M.; Costello, Joseph F.

    2014-01-01

    The clonal evolution of tumor cell populations can be reconstructed from patterns of genetic alterations. In contrast, tumor epigenetic states, including DNA methylation, are reversible and sensitive to the tumor microenvironment, presumably precluding the use of epigenetics to discover tumor phylogeny. Here we examined the spatial and temporal dynamics of DNA methylation in a clinically and genetically characterized cohort of IDH1-mutant low-grade gliomas and their patient-matched recurrences. WHO grade II gliomas are diffuse, infiltrative tumors that frequently recur and may undergo malignant progression to a higher grade with a worse prognosis. The extent to which epigenetic alterations contribute to the evolution of low-grade gliomas, including malignant progression, is unknown. While all gliomas in the cohort exhibited the hypermethylation signature associated with IDH1 mutation, low-grade gliomas that underwent malignant progression to high-grade glioblastoma (GBM) had a unique signature of DNA hypomethylation enriched for active enhancers, as well as sites of age-related hypermethylation in the brain. Genes with promoter hypomethylation and concordant transcriptional upregulation during evolution to GBM were enriched in cell cycle function, evolving in concert with genetic alterations that deregulate the G1/S cell cycle checkpoint. Despite the plasticity of tumor epigenetic states, phyloepigenetic trees robustly recapitulated phylogenetic trees derived from somatic mutations in the same patients. These findings highlight widespread co-dependency of genetic and epigenetic events throughout the clonal evolution of initial and recurrent glioma.

  2. Evaluation of humoral and cellular immune responses to a DNA vaccine encoding chicken type II collagen for rheumatoid arthritis in normal rats.

    Science.gov (United States)

    Xiao, Zhao; Juan, Long; Song, Yun; Zhijian, Zhang; Jing, Jin; Kun, Yu; Yuna, Hao; Dongfa, Dai; Lili, Ding; Liuxin, Tan; Fei, Liang; Nan, Liu; Fang, Yuan; Yuying, Sun; Yongzhi, Xi

    2015-01-01

    A major challenge in the development of effective therapies for rheumatoid arthritis (RA) is finding a method for the specific inhibition of the inflammatory disease processes without the induction of generalized immunosuppression. Of note, the development of therapeutic DNA vaccines and boosters that may restore immunological tolerance remains a high priority. pcDNA-CCOL2A1 is a therapeutic DNA vaccine encoding chicken type II collagen(CCII). This vaccine was developed by our laboratory and has been shown to exhibit efficacy comparable to that of the current "gold standard" treatment, methotrexate (MTX). Here, we used enzyme-linked immunosorbent assays with anti-CII IgG antibodies, quantified the expression levels of Th1, Th2, and Th3 cytokines, and performed flow cytometric analyses of different T-cell subsets, including Th1, Th2, Th17, Tc, Ts, Treg, and CD4(+)CD29(+)T cells to systemically evaluate humoral and cellular immune responses to pcDNA-CCOL2A1 vaccine in normal rats. Similar to our observations at maximum dosage of 3 mg/kg, vaccination of normal rats with 300 μg/kg pcDNA-CCOL2A1 vaccine did not induce the production of anti-CII IgG. Furthermore, no significant changes were observed in the expression levels of pro-inflammatory cytokines interleukin (IL)-1α, IL-5, IL-6, IL-12(IL-23p40), monocyte chemotactic protein (MCP)-1, macrophage inflammatory protein (MIP)-1α, regulated on activation in normal T-cell expressed and secreted (RANTES), receptor activator for nuclear factor-κB ligand (RANKL), and granulocyte colony-stimulating factor (G-CSF) or anti-inflammatory cytokines IL-4 and IL-10 in vaccinated normal rats relative to that in controls(P > 0.05). However, transforming growth factor (TGF)-β levels were significantly increased on days 10 and 14, while interferon (IFN)-γ and tumor necrosis factor (TNF)-α levels were significantly decreased on days 28 and 35 after vaccination(P 0.05), with the exception of Treg cells, which were significantly

  3. Molecular cloning and sequence analysis of complementary DNA encoding rat mammary gland medium-chain S-acyl fatty acid synthetase thio ester hydrolase

    International Nuclear Information System (INIS)

    Safford, R.; de Silva, J.; Lucas, C.

    1987-01-01

    Poly(A) + RNA from pregnant rat mammary glands was size-fractionated by sucrose gradient centrifugation, and fractions enriched in medium-chain S-acyl fatty acid synthetase thio ester hydrolase (MCH) were identified by in vitro translation and immunoprecipitation. A cDNA library was constructed, in pBR322, from enriched poly(A) + RNA and screened with two oligonucleotide probes deduced from rat MCH amino acid sequence data. Cross-hybridizing clones were isolated and found to contain cDNA inserts ranging from ∼ 1100 to 1550 base pairs (bp). A 1550-bp cDNA insert, from clone 43H09, was confirmed to encode MCH by hybrid-select translation/immunoprecipitation studies and by comparison of the amino acid sequence deduced from the DNA sequence of the clone to the amino acid sequence of the MCH peptides. Northern blot analysis revealed the size of the MCH mRNA to be 1500 nucleotides, and it is therefore concluded that the 1550-bp insert (including G x C tails) of clone 43H09 represents a full- or near-full-length copy of the MCH gene. The rat MCH sequence is the first reported sequence of a thioesterase from a mammalian source, but comparison of the deduced amino acid sequences of MCH and the recently published mallard duck medium-chain S-acyl fatty acid synthetase thioesterase reveals significant homology. In particular, a seven amino acid sequence containing the proposed active serine of the duck thioesterase is found to be perfectly conserved in rat MCH

  4. [Molecular cloning and characterization of cDNA of the rpc10+ gene encoding the smallest subunit of nuclear RNA polymerases of Schizosaccharomyces pombe].

    Science.gov (United States)

    Shpakovskiĭ, G V; Lebedenko, E N

    1997-05-01

    The full-length cDNA of the rpc10+ gene encoding mini-subunit Rpc10, which is common for all three nuclear RNA polymerases of the fission yeast Schizosaccharomyces pombe, was cloned and sequenced. The Rpc10 subunit of Sz. pombe and its homologs from S. cerevisiae and H. sapiens are positively charged proteins with a highly conserved C-terminal region and an invariant zinc-binding domain (Zn-finger) of a typical amino acid composition: YxCx2Cx12RCx2CGxR. Functional tests of heterospecific complementation, using tetrad analysis or plasmid shuffling, showed that the Rpc10 subunit of Sz. pombe can successfully replace the homologous ABC10 alpha subunit in nuclear RNA polymerases I-III of S. cerevisiae.

  5. Isolation of cDNA encoding a newly identified major allergenic protein of rye-grass pollen: intracellular targeting to the amyloplast.

    Science.gov (United States)

    Singh, M B; Hough, T; Theerakulpisut, P; Avjioglu, A; Davies, S; Smith, P M; Taylor, P; Simpson, R J; Ward, L D; McCluskey, J

    1991-01-01

    We have identified a major allergenic protein from rye-grass pollen, tentatively designated Lol pIb of 31kDa and with pI 9.0. A cDNA clone encoding Lol pIb has been isolated, sequenced, and characterized. Lol pIb is located mainly in the starch granules. This is a distinct allergen from Lol pI, which is located in the cytosol. Lol pIb is synthesized in pollen as a pre-allergen with a transit peptide targeting the allergen to amyloplasts. Epitope mapping of the fusion protein localized the IgE binding determinant in the C-terminal domain. Images PMID:1671715

  6. The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

    Science.gov (United States)

    Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

    2017-03-01

    The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  7. DNA vaccine encoding myristoylated membrane protein (MMP) of rock bream iridovirus (RBIV) induces protective immunity in rock bream (Oplegnathus fasciatus).

    Science.gov (United States)

    Jung, Myung-Hwa; Nikapitiya, Chamilani; Jung, Sung-Ju

    2018-02-01

    Rock bream iridovirus (RBIV) causes severe mass mortalities in rock bream (Oplegnathus fasciatus) in Korea. In this study, we investigated the potential of viral membrane protein to induce antiviral status protecting rock bream against RBIV infection. We found that fish administered with ORF008L (myristoylated membrane protein, MMP) vaccine exhibited significantly higher levels of survival compared to ORF007L (major capsid protein, MCP). Moreover, ORF008L-based DNA vaccinated fish showed significant protection at 4 and 8 weeks post vaccination (wpv) than non-vaccinated fish after infected with RBIV (6.7 × 10 5 ) at 23 °C, with relative percent survival (RPS) of 73.36% and 46.72%, respectively. All of the survivors from the first RBIV infection were strongly protected (100% RPS) from re-infected with RBIV (1.1 × 10 7 ) at 100 dpi. In addition, the MMP (ORF008L)-based DNA vaccine significantly induced the gene expression of TLR3 (14.2-fold), MyD88 (11.6-fold), Mx (84.7-fold), ISG15 (8.7-fold), PKR (25.6-fold), MHC class I (13.3-fold), Fas (6.7-fold), Fas ligand (6.7-fold), caspase9 (17.0-fold) and caspase3 (15.3-fold) at 7 days post vaccination in the muscle (vaccine injection site). Our results showed the induction of immune responses and suggest the possibility of developing preventive measures against RBIV using myristoylated membrane protein-based DNA vaccine. Copyright © 2018 Elsevier Ltd. All rights reserved.

  8. The predominant WT1 isoform (+KTS) encodes a DNA-binding protein targeting the planar cell polarity gene Scribble in renal podocytes.

    Science.gov (United States)

    Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A

    2010-07-01

    WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.

  9. The predominant WT1 isoform (+KTS) encodes a DNA binding protein targeting the planar cell polarity gene Scribble in renal podocytes

    Science.gov (United States)

    Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.

    2010-01-01

    WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064

  10. A DNA-Encoded Library of Chemical Compounds Based on Common Scaffolding Structures Reveals the Impact of Ligand Geometry on Protein Recognition.

    Science.gov (United States)

    Favalli, Nicholas; Biendl, Stefan; Hartmann, Marco; Piazzi, Jacopo; Sladojevich, Filippo; Gräslund, Susanne; Brown, Peter J; Näreoja, Katja; Schüler, Herwig; Scheuermann, Jörg; Franzini, Raphael; Neri, Dario

    2018-06-01

    A DNA-encoded chemical library (DECL) with 1.2 million compounds was synthesized by combinatorial reaction of seven central scaffolds with two sets of 343×492 building blocks. Library screening by affinity capture revealed that for some target proteins, the chemical nature of building blocks dominated the selection results, whereas for other proteins, the central scaffold also crucially contributed to ligand affinity. Molecules based on a 3,5-bis(aminomethyl)benzoic acid core structure were found to bind human serum albumin with a K d value of 6 nm, while compounds with the same substituents on an equidistant but flexible l-lysine scaffold showed 140-fold lower affinity. A 18 nm tankyrase-1 binder featured l-lysine as linking moiety, while molecules based on d-Lysine or (2S,4S)-amino-l-proline showed no detectable binding to the target. This work suggests that central scaffolds which predispose the orientation of chemical building blocks toward the protein target may enhance the screening productivity of encoded libraries. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  11. Novel selective inhibitor of Leishmania (Leishmania) amazonensis arginase.

    Science.gov (United States)

    da Silva, Edson R; Boechat, Nubia; Pinheiro, Luiz C S; Bastos, Monica M; Costa, Carolina C P; Bartholomeu, Juliana C; da Costa, Talita H

    2015-11-01

    Arginase is a glycosomal enzyme in Leishmania that is involved in polyamine and trypanothione biosynthesis. The central role of arginase in Leishmania (Leishmania) amazonensis was demonstrated by the generation of two mutants: one with an arginase lacking the glycosomal addressing signal and one in which the arginase-coding gene was knocked out. Both of these mutants exhibited decreased infectivity. Thus, arginase seems to be a potential drug target for Leishmania treatment. In an attempt to search for arginase inhibitors, 29 derivatives of the [1,2,4]triazolo[1,5-a]pyrimidine system were tested against Leishmania (Leishmania) amazonensis arginase in vitro. The [1,2,4]triazolo[1,5-a]pyrimidine scaffold containing R1  = CF3 exhibited greater activity against the arginase rather than when the substituent R1  = CH3 in the 2-position. The novel compound 2-(5-methyl-2-(trifluoromethyl)-[1,2,4]triazolo[1,5-a]pyrimidin-7-yl)hydrazinecarbothioamide (30) was the most potent, inhibiting arginase by a non-competitive mechanism, with the Ki and IC50 values for arginase inhibition estimated to be 17 ± 1 μm and 16.5 ± 0.5 μm, respectively. These results can guide the development of new drugs against leishmaniasis based on [1,2,4]triazolo[1,5-a]pyrimidine derivatives targeting the arginase enzyme. © 2015 John Wiley & Sons A/S.

  12. Rattus norvegicus (Rodentia: Muridae Infected by Leishmania (Leishmania infantum (syn. Le. chagasi in Brazil

    Directory of Open Access Journals (Sweden)

    Fabiana de Oliveira Lara-Silva

    2014-01-01

    Full Text Available In the present study we surveyed the fauna of phlebotomine sand flies and small mammals in peridomestic areas from a Brazilian municipality where the American cutaneous leishmaniasis (ACL is endemic. A total of 608 female phlebotomine sand flies were captured during nine months in 2009 and 2010. Seven different species were represented with 60% of them being Lutzomyia intermedia and Lu. whitmani, both incriminated vectors of ACL. Lu. longipalpis, a proven vector of visceral leishmaniasis (VL was also captured at high proportion (12.8%. Genomic DNA analysis of 136 species-specific pools of female sand flies followed by molecular genotyping showed the presence of Leishmania infantum DNA in two pools of Lu. longipalpis. The same Leishmania species was found in one blood sample from Rattus norvegicus among 119 blood and tissue samples analysed. This is the first report of Le. infantum in R. norvegicus in the Americas and suggests a possible role for this rodent species in the zoonotic cycle of VL. Our study coincided with the reemergence of VL in Governador Valadares.

  13. Cloning of a cDNA encoding the human cation-dependent mannose 6-phosphate-specific receptor

    International Nuclear Information System (INIS)

    Pohlmann, R.; Nagel, G.; Schmidt, B.

    1987-01-01

    Complementary DNA clones for the human cation-dependent mannose 6-phosphate-specific receptor have been isolated from a human placenta library in λgt11. The nucleotide sequence of the 2463-base-pair cDNA insert includes a 145-base-pair 5' untranslated region, an open reading frame of 831 base pairs corresponding to 277 amino acids, and a 1487-base-pair 3' untranslated region. The deduced amino acid sequence is colinear with that determined by amino acid sequencing of the N-terminus peptide (41 residues) and nine tryptic peptides (93 additional residues). The receptor is synthesized as a precursor with a signal peptide of 20 amino acids. The hydrophobicity profile of the receptor indicates a single membrane-spanning domain, which separates an N-terminal region containing five potential N-glycosylation sites from a C-terminal region lacking N-glycosylation sites. Thus the N-terminal (M/sub r/ = 18,299) and C-terminal (M/sub r/ ≤ 7648) segments of the mature receptor are assumed to be exposed to the extracytosolic and cytosolic sides of the membrane, respectively. Analysis of a panel of somatic cell (mouse-human) hybrids shows that the gene for the receptor is located on human chromosome 12

  14. Protective efficacy of cationic-PLGA microspheres loaded with DNA vaccine encoding the sip gene of Streptococcus agalactiae in tilapia.

    Science.gov (United States)

    Ma, Yan-Ping; Ke, Hao; Liang, Zhi-Ling; Ma, Jiang-Yao; Hao, Le; Liu, Zhen-Xing

    2017-07-01

    Streptococcus agalactiae (S. agalactiae) is an important fish pathogen, which has received more attention in the past decade due to the increasing economic losses in the tilapia industry worldwide. As existing effective vaccines of S. agalactiae in fish have obvious disadvantage, to select immunoprotective antigens and package materials would undoubtedly contribute to the development of novel oral vaccines. In the present study, surface immunogenic protein (sip) was selected from the S. agalactiae serovar I a genomes as immunogenic protein in DNA vaccine form with cationic chitosan and biodegradable and biocompatible PLGA. The pcSip plasmid in cationic-PLGA was successfully expressed in tissues of immunized tilapia and the immunogenicity was assessed in tilapia challenge model. A significant increase was observed in the cytokine levels of IL-1β, TNF-α, CC1, CC2 in spleen and kidney tissues. Furthermore, immunized tilapia conferred different levels of protection against challenge with a lethal dose of highly virulent serovar I a S. agalactiae. Our results indicated that the pcSip plasmid in cationic-PLGA induced high level of antibodies and protection against S. agalactiae infection, could be effective oral DNA vaccine candidates. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. Cloning and sequence of cDNA encoding 1-aminocyclo- propane-1-carboxylate oxidase in Vanda flowers

    Directory of Open Access Journals (Sweden)

    Pattana Srifah Huehne

    2013-08-01

    Full Text Available The 1-aminocyclopropane-1-carboxylate oxidase (ACO gene in the final step of ethylene biosynthesis was isolated from ethylene-sensitive Vanda Miss Joaquim flowers. This consists of 1,242 base pairs (bp encoding for 326 amino acid residues. To investigate the specific divergence in orchid ACO sequences, the deduced Vanda ACO was aligned with five other orchid ACOs. The results reveal that the ACO sequences within Doritaenopsis, Phalaenopsis and Vanda show highly conserved and almost 95% identical homology, while the ACOs isolated from Cymbidium, Dendrobium and Cattleya are 8788% identical to Vanda ACO. In addition, the 2-oxoglutarate- Fe(II_oxygenase (Oxy domain of orchid ACOs consists of a higher degree of amino acid conservation than that of the non-haem dioxygenase (DIOX_N domain. The overall homology regions of Vanda ACO are commonly folded into 12 α-helices and 12 β-sheets similar to the three dimensional template-structure of Petunia ACO. This Vanda ACO cloned gene is highly expressed in flower tissue compared with root and leaf tissues. In particular, there is an abundance of ACO transcript accumulation in the column followed by the lip and the perianth of Vanda Miss Joaquim flowers at the fully-open stage.

  16. Detection, molecular typing and phylogenetic analysis of Leishmania isolated from cases of leishmaniasis among Syrian refugees in Lebanon

    Directory of Open Access Journals (Sweden)

    Tamara Salloum

    2016-06-01

    Two molecular typing methods of 39 FFPE Leishmania isolates were used: the ITS1-PCR RFLP and the nested ITS1-5.8S rDNA gene amplification followed by sequencing and phylogenetic analysis. The efficiency of these two techniques in Leishmania identification was compared and the phylogenetic relationships among these isolates were illustrated based on the neighbor-joining (NJ method. The results were statistically correlated with the parasitic index (PI. The DNA storage in formalin-fixed paraffin embedded (FFPE tissues was assessed as well. The parasites identified were all L. tropica as determined by both techniques. ITS1-5.8S rDNA gene based typing proved to be more sensitive in the detection of parasites (positive in 69.2% of the isolates as opposed to the ITS1-PCR RFLP method that was successful in identifying L. tropica in only 43.6% of the isolates. Sequencing and phylogenetic analysis revealed high levels of heterogeneity. A statistically significant correlation was observed between PI and the results of the nested ITS1-5.8S rDNA gene PCR. Genotyping at the species level is essential for monitoring the relative frequency of CL in the Mediterranean area that is correlated to three different Leishmania species (Leishmania infantum, Leishmania major and L. tropica, each characterized by distinct epidemiological features. The obtained results highlight the need to find a universally accepted diagnostic tool for Leishmania typing.

  17. DNA vaccine encoding nucleocapsid and surface proteins of wild type canine distemper virus protects its natural host against distemper.

    Science.gov (United States)

    Cherpillod, P; Tipold, A; Griot-Wenk, M; Cardozo, C; Schmid, I; Fatzer, R; Schobesberger, M; Zurbriggen, R; Bruckner, L; Roch, F; Vandevelde, M; Wittek, R; Zurbriggen, A

    2000-07-01

    Canine distemper virus (CDV), a member of the genus Morbillivirus induces a highly infectious, frequently lethal disease in dogs and other carnivores. Current vaccines against canine distemper consisting of attenuated viruses have been in use for many years and have greatly reduced the incidence of distemper in the dog population. However, certain strains may not guarantee adequate protection and others can induce post vaccinal encephalitis. We tested a DNA vaccine for its ability to protect dogs, the natural host of CDV, against distemper. We constructed plasmids containing the nucleocapsid, the fusion, and the attachment protein genes of a virulent canine distemper virus strain. Mice inoculated with these plasmids developed humoral and cellular immune responses against CDV antigens. Dogs immunized with the expression plasmids developed virus-neutralizing antibodies. Significantly, vaccinated dogs were protected against challenge with virulent CDV, whereas unvaccinated animals succumbed to distemper.

  18. Cloning and molecular characterization of the glyceraldehyde-3-phosphate dehydrogenase-encoding gene and cDNA from the plant pathogenic fungus Glomerella cingulata.

    Science.gov (United States)

    Templeton, M D; Rikkerink, E H; Solon, S L; Crowhurst, R N

    1992-12-01

    The glyceraldehyde-3-phosphate dehydrogenase gene (gpdA) has been identified from a genomic DNA library prepared from the plant pathogenic fungus Glomerella cingulata. Nucleotide sequence data revealed that this gene codes for a putative 338-amino-acid protein encoded by two exons of 129 and 885 bp, separated by an intron 216 bp long. The 5' leader sequence is also spliced by an intron of 156 bp. A cDNA clone was prepared using the polymerase chain reaction, the sequence of which was used to confirm the presence of the intron in the coding sequence and the splicing of the 5' leader sequence. The transcriptional start point (tsp) was mapped at -253 nt from the site of the initiation of translation by primer extension and is adjacent to a 42-bp pyrimidine-rich region. The general structure of the 5' flanking region shows similarities to gpdA from Aspergillus nidulans. The putative protein product is 71-86% identical at the aa level to GPDs from Aspergillus nidulans, Cryphonectria parasitica, Curvularia lunata, Podospora anserina and Ustilago maydis.

  19. Molecular cloning of a cDNA encoding the precursor of adenoregulin from frog skin. Relationships with the vertebrate defensive peptides, dermaseptins.

    Science.gov (United States)

    Amiche, M; Ducancel, F; Lajeunesse, E; Boulain, J C; Ménez, A; Nicolas, P

    1993-03-31

    Adenoregulin has recently been isolated from Phyllomedusa skin as a 33 amino acid residues peptide which enhanced binding of agonists to the A1 adenosine receptor. In order to study the structure of the precursor of adenoregulin we constructed a cDNA library from mRNAs extracted from the skin of Phyllomedusa bicolor. We detected the complete nucleotide sequence of a cDNA encoding the adenoregulin biosynthetic precursor. The deduced sequence of the precursor is 81 amino acids long, exhibits a putative signal sequence at the NH2 terminus and contains a single copy of the biologically active peptide at the COOH terminus. Structural and conformational homologies that are observed between adenoregulin and the dermaseptins, antimicrobial peptides exhibiting strong membranolytic activities against various pathogenic agents, suggest that adenoregulin is an additional member of the growing family of cytotropic antimicrobial peptides that allow vertebrate animals to defend themselves against microorganisms. As such, the adenosine receptor regulating activity of adenoregulin could be due to its ability to interact with and disrupt membranes lipid bilayers.

  20. Direct detection of Leishmania from clinical samples.

    Science.gov (United States)

    Waitumbi, John N; Bast, Joshua; Nyakoe, Nancy; Magiri, Charles; Quintana, Miguel; Takhampunya, Ratree; Schuster, Anthony L; Van de Wyngaerde, Marshall T; McAvin, James C; Coleman, Russell E

    2017-01-01

    The ability to rapidly and accurately diagnose leishmaniasis is a military priority. Testing was conducted to evaluate diagnostic sensitivity and specificity of field-expedient Leishmania genus and visceral Leishmania specific dual-fluorogenic, hydrolysis probe (TaqMan), polymerase chain reaction assays previously established for use in vector surveillance. Blood samples of patients with confirmed visceral leishmaniasis and controls without the disease from Baringo District, Kenya, were tested. Leishmania genus assay sensitivity was 100% (14/14) and specificity was 84% (16/19). Visceral Leishmania assay sensitivity was 93% (13/14) and specificity 80% (4/5). Cutaneous leishmaniasis (CL) skin scrapes of patients from Honduras were also evaluated. Leishmania genus assay sensitivity was 100% (10/10). Visceral Leishmania assay specificity was 100% (10/10) from cutaneous leishmaniasis samples; no fluorescence above background was reported. These results show promise in a rapid, sensitive, and specific method for Leishmania direct detection from clinical samples.

  1. Molecular detection of Leishmania infantum and Leishmania tropica in rodent species from endemic cutaneous leishmaniasis areas in Morocco.

    Science.gov (United States)

    Echchakery, Mohamed; Chicharro, Carmen; Boussaa, Samia; Nieto, Javier; Carrillo, Eugenia; Sheila, Ortega; Moreno, Javier; Boumezzough, Ali

    2017-10-02

    Leishmaniasis remains a major public health problem in African nations, including Morocco, where little is known about the vertebrate reservoirs involved in the causal parasites' transmission cycles. The present study investigates the role of rodent species as potential reservoirs of Leishmania spp. in central Morocco, where both L. tropica and L. infantum have been reported. Rodents were caught from 22 sites in central Morocco, by using Sherman metal traps, and identified morphologically. For each specimen, genomic DNA was extracted from different tissues using the Speed Tools DNA extraction Kit. Then, samples were PCR-analyzed, targeting the SSU rRNA gene to detect Leishmania spp. DNA, followed by amplification of the internal transcribed spacer 1 (ITS1) and its sequencing to identify the species. A total of 197 rodents belonging to ten species were captured and identified: Rattus rattus (40.61%), Mus musculus (25.38%), Apodemus sylvaticus (8.63%), Mus spretus (7.11%), Meriones shawi (5.58%), Rattus norvegicus (4.57%), Meriones libycus (3.05%), Mastomys erythroleucus (2.03%), Gerbillus campestris (2.03%) and Lemniscomys barbarus (1.01%). Molecular analysis revealed the presence of Leishmania species in 18 specimens: six R. rattus (out of 80 captured; 7.5%), 11 M. musculus (out of 50 captured; 22%), and one R. norvegicus (out of 9 captured; 11.11%). To the best of our knowledge, L. infantum and L. tropica were identified in rodent species for the first time in Morocco. These findings suggest that rodent species may be involved in L. infantum and L. tropica transmission cycles in this country but that further studies are needed to confirm their role as reservoirs of Leishmania species in Morocco.

  2. Isolation and characterization of cDNA encoding the 80-kDa subunit protein of the human autoantigen Ku (p70/p80) recognized by autoantibodies from patients with scleroderma-polymyositis overlap syndrome

    International Nuclear Information System (INIS)

    Mimori, Tsuneyo; Ohosone, Yasuo; Hama, Nobuaki; Suwa, Akira; Akizuki, Masashi; Homma, Mitsuo; Griffith, A.J.; Hardin, J.A.

    1990-01-01

    Anti-Ku (p70/p80) autoantibodies in patients with scleroderma-polymyositis overlap syndrome recognize a 70-kDa/80-kDa protein heterodimer which binds to terminal regions of double-stranded DNA. In the present study, the authors isolated full-length cDNAs that encode the 80-kDa Ku subunit. Initial screening of a human spleen cDNA library with anti-Ku antibodies yielded a cDNA of 1.0 kilobase (kb) (termed K71) encoding a portion of the 80-kDa Ku polypeptide (identification based on immunological criteria). In RNA blots, this cDNA hybridized with two mRNAs of 3.4 and 2.6 kb. In vitro transcription and translation experiments produced an immunoprecipitable polypeptide which comigrated with the 80-kDa Ku subunit. The Ku80-6 cDNA proved to be 3304 nucleotides in length, with an additional poly(A) tail, closely approximating the size of the larger mRNA. It contains a single long open reading frame encoding 732 amino acids. The putative polypeptide has a high content of acidic amino acids and a region with periodic repeat of leucine in every seventh position which may form the leucine zipper structure. In genomic DNA blots, probes derived from the opposite ends of cDNA Ku80-6 hybridized with several nonoverlapping restriction fragments from human leukocyte DNA, indicating that the gene encoding the 80-kDa Ku polypeptide is divided into several exons by intervening sequences

  3. Comparative analysis and molecular characterization of a gene BANF1 encoded a DNA-binding protein during mitosis from the Giant Panda and Black Bear.

    Science.gov (United States)

    Zeng, Yichun; Hou, Yi-Ling; Ding, Xiang; Hou, Wan-Ru; Li, Jian

    2014-01-01

    Barrier to autointegration factor 1 (BANF1) is a DNA-binding protein found in the nucleus and cytoplasm of eukaryotic cells that functions to establish nuclear architecture during mitosis. The cDNA and the genomic sequence of BANF1 were cloned from the Giant Panda (Ailuropoda melanoleuca) and Black Bear (Ursus thibetanus mupinensis) using RT-PCR technology and Touchdown-PCR, respectively. The cDNA of the BANF1 cloned from Giant Panda and Black Bear is 297 bp in size, containing an open reading frame of 270 bp encoding 89 amino acids. The length of the genomic sequence from Giant Panda is 521 bp, from Black Bear is 536 bp, which were found both to possess 2 exons. Alignment analysis indicated that the nucleotide sequence and the deduced amino acid sequence are highly conserved to some mammalian species studied. Topology prediction showed there is one Protein kinase C phosphorylation site, one Casein kinase II phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Giant Panda, and there is one Protein kinase C phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Black Bear. The BANF1 gene can be readily expressed in E. coli. Results showed that the protein BANF1 fusion with the N-terminally His-tagged form gave rise to the accumulation of an expected 14 kD polypeptide that formed inclusion bodies. The expression products obtained could be used to purify the proteins and study their function further.

  4. Safety and immunogenicity of an oral DNA vaccine encoding Sip of Streptococcus agalactiae from Nile tilapia Oreochromis niloticus delivered by live attenuated Salmonella typhimurium.

    Science.gov (United States)

    Huang, L Y; Wang, K Y; Xiao, D; Chen, D F; Geng, Y; Wang, J; He, Y; Wang, E L; Huang, J L; Xiao, G Y

    2014-05-01

    Attenuated Salmonella typhimurium SL7207 was used as a carrier for a reconstructed DNA vaccine against Streptococcus agalactiae. A 1.02 kb DNA fragment, encoding for a portion of the surface immunogenic protein (Sip) of S. agalactiae was inserted into pVAX1. The recombinant plasmid pVAX1-sip was transfected in EPC cells to detect the transient expression by an indirect immunofluorescence assay, together with Western blot analysis. The pVAX1-sip was transformed by electroporation into SL7207. The stability of pVAX1-sip into Salmonella was over 90% after 50 generations with antibiotic selection in vitro while remained stable over 80% during 35 generations under antibiotic-free conditions. The LD50 of SL/pVAX1-sip was 1.7 × 10(11) CFU/fish by intragastric administration which indicated a quite low virulence. Tilapias were inoculated orally at 10(8) CFU/fish, the recombinant bacteria were found present in intestinal tract, spleens and livers and eventually eliminated from the tissues 4 weeks after immunization. Fish immunized at 10(7), 10(8) and 10(9) CFU/fish with different immunization times caused various levels of serum antibody and an effective protection against lethal challenge with the wild-type strain S. agalactiae. Integration studies showed that the pVAX1-sip did not integrate with tilapia chromosomes. The DNA vaccine SL/pVAX1-sip was proved to be safe and effective in protecting tilapias against S. agalactiae infection. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. Cloning and functional expression of a cDNA encoding stearoyl-ACP Δ9-desaturase from the endosperm of coconut (Cocos nucifera L.).

    Science.gov (United States)

    Gao, Lingchao; Sun, Ruhao; Liang, Yuanxue; Zhang, Mengdan; Zheng, Yusheng; Li, Dongdong

    2014-10-01

    Coconut (Cocos nucifera L.) is an economically tropical fruit tree with special fatty acid compositions. The stearoyl-acyl carrier protein (ACP) desaturase (SAD) plays a key role in the properties of the majority of cellular glycerolipids. In this paper, a full-length cDNA of a stearoyl-acyl carrier protein desaturase, designated CocoFAD, was isolated from cDNA library prepared from the endosperm of coconut (C. nucifera L.). An 1176 bp cDNA from overlapped PCR products containing ORF encoding a 391-amino acid (aa) protein was obtained. The coded protein was virtually identical and shared the homology to other Δ9-desaturase plant sequences (greater than 80% as similarity to that of Elaeis guineensis Jacq). The real-time fluorescent quantitative PCR result indicated that the yield of CocoFAD was the highest in the endosperm of 8-month-old coconut and leaf, and the yield was reduced to 50% of the highest level in the endosperm of 15-month-old coconut. The coding region showed heterologous expression in strain INVSc1 of yeast (Saccharomyces cerevisiae). GC-MS analysis showed that the levels of palmitoleic acid (16:1) and oleic acid (18:1) were improved significantly; meanwhile stearic acid (18:0) was reduced. These results indicated that the plastidial Δ9 desaturase from the endosperm of coconut was involved in the biosynthesis of hexadecenoic acid and octadecenoic acid, which was similar with other plants. These results may be valuable for understanding the mechanism of fatty acid metabolism and the genetic improvement of CocoFAD gene in palm plants in the future. Copyright © 2014 Elsevier B.V. All rights reserved.

  6. DNA Vaccine Encoding the Chimeric Form of Schistosoma mansoni Sm-TSP2 and Sm29 Confers Partial Protection against Challenge Infection

    Science.gov (United States)

    Gonçalves de Assis, Natan Raimundo; Batistoni de Morais, Suellen; Figueiredo, Bárbara Castro Pimentel; Ricci, Natasha Delaqua; de Almeida, Leonardo Augusto; da Silva Pinheiro, Carina; Martins, Vicente de Paulo; Oliveira, Sergio Costa

    2015-01-01

    Schistosomiasis is an important parasitic disease worldwide that affects more than 207 million people in 76 countries and causes approximately 250,000 deaths per year. The best long-term strategy to control schistosomiasis is through immunization combined with drug treatment. Due to the ability of DNA vaccines to generate humoral and cellular immune responses, such vaccines are considered a promising approach against schistosomiasis. Sm29 and tetraspanin-2 (Sm-TSP2) are two proteins that are located in the S. mansoni tegument of adult worms and schistosomula and induce high levels of protection through recombinant protein immunization. In this study, we transfected BHK-21 cells with plasmids encoding Sm29, Sm-TSP2 or a chimera containing both genes. Using RT-PCR analysis and western blot, we confirmed that the DNA vaccine constructs were transcribed and translated, respectively, in BHK-21 cells. After immunization of mice, we evaluated the reduction in worm burden. We observed worm burden reductions of 17-22%, 22%, 31-32% and 24-32% in animals immunized with the pUMVC3/Sm29, pUMVC3/SmTSP-2, pUMVC3/Chimera and pUMVC3/Sm29 + pUMVC3/SmTSP-2 plasmids, respectively. We evaluated the humoral response elicited by DNA vaccines, and animals immunized with pUMVC3/Sm29 and pUMVC3/Sm29 + pUMVC3/SmTSP-2 showed higher titers of anti-Sm29 antibodies. The cytokine profile produced by the spleen cells of immunized mice was then evaluated. We observed higher production of Th1 cytokines, such as TNF-α and IFN-γ, in vaccinated mice and no significant production of IL-4 and IL-5. The DNA vaccines tested in this study showed the ability to generate a protective immune response against schistosomiasis, probably through the production of Th1 cytokines. However, future strategies aiming to optimize the protective response induced by a chimeric DNA construct need to be developed. PMID:25942636

  7. DNA Vaccine Encoding the Chimeric Form of Schistosoma mansoni Sm-TSP2 and Sm29 Confers Partial Protection against Challenge Infection.

    Directory of Open Access Journals (Sweden)

    Natan Raimundo Gonçalves de Assis

    Full Text Available Schistosomiasis is an important parasitic disease worldwide that affects more than 207 million people in 76 countries and causes approximately 250,000 deaths per year. The best long-term strategy to control schistosomiasis is through immunization combined with drug treatment. Due to the ability of DNA vaccines to generate humoral and cellular immune responses, such vaccines are considered a promising approach against schistosomiasis. Sm29 and tetraspanin-2 (Sm-TSP2 are two proteins that are located in the S. mansoni tegument of adult worms and schistosomula and induce high levels of protection through recombinant protein immunization. In this study, we transfected BHK-21 cells with plasmids encoding Sm29, Sm-TSP2 or a chimera containing both genes. Using RT-PCR analysis and western blot, we confirmed that the DNA vaccine constructs were transcribed and translated, respectively, in BHK-21 cells. After immunization of mice, we evaluated the reduction in worm burden. We observed worm burden reductions of 17-22%, 22%, 31-32% and 24-32% in animals immunized with the pUMVC3/Sm29, pUMVC3/SmTSP-2, pUMVC3/Chimera and pUMVC3/Sm29 + pUMVC3/SmTSP-2 plasmids, respectively. We evaluated the humoral response elicited by DNA vaccines, and animals immunized with pUMVC3/Sm29 and pUMVC3/Sm29 + pUMVC3/SmTSP-2 showed higher titers of anti-Sm29 antibodies. The cytokine profile produced by the spleen cells of immunized mice was then evaluated. We observed higher production of Th1 cytokines, such as TNF-α and IFN-γ, in vaccinated mice and no significant production of IL-4 and IL-5. The DNA vaccines tested in this study showed the ability to generate a protective immune response against schistosomiasis, probably through the production of Th1 cytokines. However, future strategies aiming to optimize the protective response induced by a chimeric DNA construct need to be developed.

  8. Prevalence and Distribution of Leishmania RNA Virus 1 in Leishmania Parasites from French Guiana.

    Science.gov (United States)

    Ginouvès, Marine; Simon, Stéphane; Bourreau, Eliane; Lacoste, Vincent; Ronet, Catherine; Couppié, Pierre; Nacher, Mathieu; Demar, Magalie; Prévot, Ghislaine

    2016-01-01

    In South America, the presence of the Leishmania RNA virus type 1 (LRV1) was described in Leishmania guyanensis and Leishmania braziliensis strains. The aim of this study was to determine the prevalence distribution of LRV1 in Leishmania isolates in French Guiana given that, in this French overseas department, most Leishmania infections are due to these parasite species. The presence of the virus was observed in 74% of Leishmania spp. isolates, with a highest presence in the internal areas of the country. © The American Society of Tropical Medicine and Hygiene.

  9. Potential role for dog fleas in the cycle of Leishmania spp.

    Science.gov (United States)

    Ferreira, Marilia Gabriele Prado Albuquerque; Fattori, Karina Reinaldo; Souza, Fausto; Lima, Valéria Marçal Felix

    2009-10-28

    Several species of Leishmania spp. cause diseases in humans that range from self-healing cutaneous lesions to fatal visceral leishmaniosis. It has been observed that besides being transmitted by sand flies, Leishmania spp. may also be transmitted by arthropods such as ticks and fleas. To investigate the possible role of dog fleas in the transmission of Leishmania spp., Ctenocefalides felis were removed from 22 dogs which were positive according to ELISA and rK-39 tests. A C. felis sample from each of the 22 dogs was used to infect a hamster. The 22 hamsters were euthanized 4 months after infection with the fleas and the blood was subjected to ELISA to detect antibody anti-Leishmania spp., and the spleen samples were submitted to PCR for detection of Leishmania spp. DNA. PCR and ELISA were both positive in 18.1% (4/22), with PCR alone being positive in 45% (10/22) and ELISA alone in only 9% (2/22). These results suggest the participation of dog fleas in the Leishmania spp. cycle. Confirmation that C. felis indeed transmit leishmaniosis to dogs requires new strategies against leishmaniosis to be enforced by public health authorities and which focus on better ways to keep dogs free of fleas.

  10. Could Phlebotomus mascittii play a role as a natural vector for Leishmania infantum? New data.

    Science.gov (United States)

    Obwaller, Adelheid G; Karakus, Mehmet; Poeppl, Wolfgang; Töz, Seray; Özbel, Yusuf; Aspöck, Horst; Walochnik, Julia

    2016-08-19

    The occurrence of phlebotomine sand flies in Central Europe was questioned until they were recorded for the first time in Germany in 1999, and ten years later also in Austria. The aim of this study was to investigate sand flies collected in Austria for their carrier status of Leishmania spp. From 2012 to 2013 field studies were conducted in eastern Austria. Altogether, 22 individuals of sand flies were found, all morphologically identified as Phlebotomus (Transphlebotomus) mascittii Grassi, 1908. Twelve non-engorged female specimens with no visible remnants of a blood meal in their bodies were individually investigated for Leishmania spp. by ITS-1 real-time PCR. One out of these was positive for Leishmania, identified as Leishmania infantum by DNA sequencing. This finding suggests that L. infantum is not excreted by P. mascittii and possibly can establish an infection within P. mascittii. Interestingly, an asymptomatic dog living on the farm where this sand fly had been caught was also Leishmania-positive. This study provides new data on the suspected vector capacity of P. mascittii, being the northernmost sand fly species in Europe and in most central European regions the only sand fly species found. Proven vector capacity of P. mascittii for Leishmania spp. would be of significant medico-veterinary importance, not only with respect to expanding sand fly populations in Central Europe related to global warming, but also in the light of globalization and increasing movements of humans.

  11. Immuno-efficacy of DNA vaccines encoding PLP1 and ROP18 against experimental Toxoplasma gondii infection in mice.

    Science.gov (United States)

    Chen, Yajun; Yu, Miao; Hemandez, J A; Li, Jiexi; Yuan, Zi-Guo; Yan, Haikuo

    2018-05-01

    We constructed a new plasmid pIRESneo/ROP18/PLP1 that was injected intramuscularly into Kunming mice to evaluate its immune efficacy. The immunized mice exhibited significantly increased serum IgG2a levels, lymphocyte counts and Th1-type cytokine (IL-2, IL-12 and IFN-γ) levels. Moreover, the immunized mice exhibited longer survival times (44.7 ± 2.1 days for ROP18/PLP1 and 47.2 ± 2.9 days for ROP18/PLP1 + IL-18) and lower brain cyst burden (68.9% for ROP18/PLP1 and 72.4% for ROP18/PLP1 + IL-18) than control mice after T. gondii challenge. Our results demonstrate that the multiple-gene DNA vaccine including both ROP18 and PLP1 elicits greater protection against T. gondii challenge and stronger immunogenicity than single-gene vaccines. Copyright © 2018 Elsevier Inc. All rights reserved.

  12. ARG1 (altered response to gravity) encodes a DnaJ-like protein that potentially interacts with the cytoskeleton

    Science.gov (United States)

    Sedbrook, J. C.; Chen, R.; Masson, P. H.

    1999-01-01

    Gravitropism allows plant organs to direct their growth at a specific angle from the gravity vector, promoting upward growth for shoots and downward growth for roots. Little is known about the mechanisms underlying gravitropic signal transduction. We found that mutations in the ARG1 locus of Arabidopsis thaliana alter root and hypocotyl gravitropism without affecting phototropism, root growth responses to phytohormones or inhibitors of auxin transport, or starch accumulation. The positional cloning of ARG1 revealed a DnaJ-like protein containing a coiled-coil region homologous to coiled coils found in cytoskeleton-interacting proteins. These data suggest that ARG1 participates in a gravity-signaling process involving the cytoskeleton. A combination of Northern blot studies and analysis of ARG1-GUS fusion-reporter expression in transgenic plants demonstrated that ARG1 is expressed in all organs. Ubiquitous ARG1 expression in Arabidopsis and the identification of an ortholog in Caenorhabditis elegans suggest that ARG1 is involved in other essential processes.

  13. Cloning of a cDNA encoding a surface antigen of Schistosoma mansoni schistosomula recognized by sera of vassinated mice

    International Nuclear Information System (INIS)

    Dalton, J.P.; Tom, T.D.; Strand, M.

    1987-01-01

    Spleen cells of mice vaccinated with radiation-attenuated Schistosoma mansoni cercariae were used to produce monoclonal antibodies directed against newly transformed schistosomular surface antigens. One of these monoclonal antibodies recognized a polypeptide of 18 kDa. Binding was measured by radioimmunoassay. This glycoprotein was purified by monoclonal antibody immunoaffinity chromatography and a polyclonal antiserum was prepared against it. Immunofluorescence assays showed that the polyclonal antiserum bound to the surface of newly transformed schistosomula and lung-stage organisms but not to the surface of liver-stage and adult worms. Using this polyclonal antiserum we isolated recombinant clones from an adult worm cDNA expression library constructed in λgt11. Clone 654.2 contained an insert of 0.52 kilobase and hybridized to a 1.2-kilobase mRNA species from adult worms. Most importantly, clone 654.2 produced a fusion protein of 125 kDa that was reactive with sera of vaccinated mice that are capable of transferring resistance. This result encourages future vaccination trials with the fusion protein

  14. Comparison between quantitative nucleic acid sequence-based amplification, real-time reverse transcriptase PCR, and real-time PCR for quantification of Leishmania parasites

    NARCIS (Netherlands)

    van der Meide, Wendy; Guerra, Jorge; Schoone, Gerard; Farenhorst, Marit; Coelho, Leila; Faber, William; Peekel, Inge; Schallig, Henk

    2008-01-01

    DNA or RNA amplification methods for detection of Leishmania parasites have advantages regarding sensitivity and potential quantitative characteristics in comparison with conventional diagnostic methods but are often still not routinely applied. However, the use and application of molecular assays

  15. A DNA vaccine encoding multiple HIV CD4 epitopes elicits vigorous polyfunctional, long-lived CD4+ and CD8+ T cell responses.

    Directory of Open Access Journals (Sweden)

    Daniela Santoro Rosa

    Full Text Available T-cell based vaccines against HIV have the goal of limiting both transmission and disease progression by inducing broad and functionally relevant T cell responses. Moreover, polyfunctional and long-lived specific memory T cells have been associated to vaccine-induced protection. CD4(+ T cells are important for the generation and maintenance of functional CD8(+ cytotoxic T cells. We have recently developed a DNA vaccine encoding 18 conserved multiple HLA-DR-binding HIV-1 CD4 epitopes (HIVBr18, capable of eliciting broad CD4(+ T cell responses in multiple HLA class II transgenic mice. Here, we evaluated the breadth and functional profile of HIVBr18-induced immune responses in BALB/c mice. Immunized mice displayed high-magnitude, broad CD4(+/CD8(+ T cell responses, and 8/18 vaccine-encoded peptides were recognized. In addition, HIVBr18 immunization was able to induce polyfunctional CD4(+ and CD8(+ T cells that proliferate and produce any two cytokines (IFNγ/TNFα, IFNγ/IL-2 or TNFα/IL-2 simultaneously in response to HIV-1 peptides. For CD4(+ T cells exclusively, we also detected cells that proliferate and produce all three tested cytokines simultaneously (IFNγ/TNFα/IL-2. The vaccine also generated long-lived central and effector memory CD4(+ T cells, a desirable feature for T-cell based vaccines. By virtue of inducing broad, polyfunctional and long-lived T cell responses against conserved CD4(+ T cell epitopes, combined administration of this vaccine concept may provide sustained help for CD8(+ T cells and antibody responses- elicited by other HIV immunogens.

  16. DNA prime/Adenovirus boost malaria vaccine encoding P. falciparum CSP and AMA1 induces sterile protection associated with cell-mediated immunity.

    Directory of Open Access Journals (Sweden)

    Ilin Chuang

    Full Text Available BACKGROUND: Gene-based vaccination using prime/boost regimens protects animals and humans against malaria, inducing cell-mediated responses that in animal models target liver stage malaria parasites. We tested a DNA prime/adenovirus boost malaria vaccine in a Phase 1 clinical trial with controlled human malaria infection. METHODOLOGY/PRINCIPAL FINDINGS: The vaccine regimen was three monthly doses of two DNA plasmids (DNA followed four months later by a single boost with two non-replicating human serotype 5 adenovirus vectors (Ad. The constructs encoded genes expressing P. falciparum circumsporozoite protein (CSP and apical membrane antigen-1 (AMA1. The regimen was safe and well-tolerated, with mostly mild adverse events that occurred at the site of injection. Only one AE (diarrhea, possibly related to immunization, was severe (Grade 3, preventing daily activities. Four weeks after the Ad boost, 15 study subjects were challenged with P. falciparum sporozoites by mosquito bite, and four (27% were sterilely protected. Antibody responses by ELISA rose after Ad boost but were low (CSP geometric mean titer 210, range 44-817; AMA1 geometric mean micrograms/milliliter 11.9, range 1.5-102 and were not associated with protection. Ex vivo IFN-γ ELISpot responses after Ad boost were modest (CSP geometric mean spot forming cells/million peripheral blood mononuclear cells 86, range 13-408; AMA1 348, range 88-1270 and were highest in three protected subjects. ELISpot responses to AMA1 were significantly associated with protection (p = 0.019. Flow cytometry identified predominant IFN-γ mono-secreting CD8+ T cell responses in three protected subjects. No subjects with high pre-existing anti-Ad5 neutralizing antibodies were protected but the association was not statistically significant. SIGNIFICANCE: The DNA/Ad regimen provided the highest sterile immunity achieved against malaria following immunization with a gene-based subunit vaccine (27%. Protection

  17. Efficacy of chimeric DNA vaccines encoding Eimeria tenella 5401 and chicken IFN-γ or IL-2 against coccidiosis in chickens.

    Science.gov (United States)

    Song, Xiaokai; Huang, Xinmei; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui

    2015-09-01

    Chimeric DNA vaccines encoding Eimeria tenella (E. tenella) surface antigen 5401 were constructed and their efficacies against E. tenella challenge were studied. The open reading frame (ORF) of 5401 was cloned into the prokaryotic expression vector pGEX-4T2 to express the recombinant protein and the expressed recombinant protein was identified by Western blot. The ORF of 5401 and chicken cytokine gene IFN-γ or IL-2 were cloned into the eukaryotic expression vector pVAX1 consecutively to construct DNA vaccines pVAX-5401-IFN-γ, pVAX-5401-IL-2 and pVAX-5401. The expression of aim genes in vivo was detected by reverse transcription-polymerase chain reaction and Western blot. Fourteen-day-old chickens were inoculated twice at an interval of 7 days with 100 µg of plasmids pVAX-5401, pVAX-5401-IFN-γ and pVAX-5401-IL-2 or 200 µg of recombinant 5401 protein by leg intramuscular injection, respectively. Seven days after the second inoculation, all chickens except the unchallenged control group were challenged orally with 5 × 10(4) sporulated oocysts of E. tenella. Seven days after challenge, all chickens were weighted and slaughtered to determine the effects of immunization. The results showed the recombinant protein was about 90 kDa and reacted with antiserum against soluble sporozoites. The animal experiment showed that all the DNA vaccines pVAX-5401, pVAX-5401-IFN-γ or pVAX-5401-IL-2 and the recombinant 5401 protein could obviously alleviate body weight loss and cecal lesions as compared with non-vaccinated challenged control and empty vector pVAX1control. Furthermore, pVAX-5401-IFN-γ or pVAX-5401-IL-2 induced anti-coccidial index (ACI) of 180.01 or 177.24 which were significantly higher than that of pVAX-5401. The results suggested that 5401 was an effective candidate antigen for vaccine. This finding also suggested that chicken IFN-γ or IL-2 could effectively improve the efficacies of DNA vaccines against avian coccidiosis. Copyright © 2015 Elsevier

  18. Survey of Wild and Domestic Mammals for Infection with Leishmania infantum following an Outbreak of Desert Zoonotic Visceral Leishmaniasis in Jiashi, People's Republic of China.

    Directory of Open Access Journals (Sweden)

    Chun-Hua Gao

    Full Text Available In 2008 and 2009, an outbreak of desert-subtype zoonotic visceral leishmaniasis occurred in Jiashi county, Xinjiang, China. So far, no animal reservoir has been identified for this type of visceral leishmaniasis. Therefore, we surveyed the most common mammals (wild and domestic for Leishmania infections during the outbreak in 2008 and 2009 in order to identify the source of the visceral leishmaniasis in this region. Spleen, liver, bone marrow and blood samples collected from 86 wood mice (Apodemus sylvaticus, 61midday jirds (Meriones meridianus and 27 Yarkand hares (Lepus yarkandensis were tested for the presence of Leishmania by microscopy, culture and PCR. All of the animals were found to be negative for Leishmania infections; On the other hand, Leishmania DNA was detected in blood samples collected from livestock reared in the outbreak area: 30.36% (17/56 of sheep, 21.57% (11/51 of goats, 17.78% (8/45 of cattle, and 21.62 (8/37 of donkeys were positive for Leishmania DNA by PCR. The amplified kDNA sequences from the livestock samples matched Leishmania DNA sequences isolated from patients with visceral leishmaniasis in the study area. We suggest that these domestic mammals are a possible reservoir host for Leishmania infantum in the outbreak area.

  19. Canine cutaneous leishmaniasis caused by neotropical Leishmania infantum despite of systemic disease: A case report.

    Science.gov (United States)

    Cavalcanti, Amanda; Lobo, Rogério; Cupolillo, Elisa; Bustamante, Fábio; Porrozzi, Renato

    2012-12-01

    Visceral leishmaniasis is an anthropozoonosis caused by a protozoan Leishmania infantum (syn. Leishmania chagasi). Here, we report a typical case of canine cutaneous leishmaniasis due to L. infantum infection without any other systemic symptom in one dog in the city of Rio de Janeiro, Brazil. A mongrel female dog was admitted in a veterinary clinic with reports of chronic wounds in the body. Physical examination revealed erosive lesions in the limbs, nasal ulcers, presence of ectoparasites and seborrheic dermatitis. Blood samples and fragments of healthy and injured skin were collected. The complete hemogram revealed aregenerative normocytic normochromic anemia and erythrocyte rouleaux, and biochemical analysis revealed normal renal and hepatic functions. Cytology of the muzzle and skin lesions suggested pyogranulomatous inflammatory process. The histopathology of a skin fragment was performed and revealed suspicion of protozoa accompanied by necrotizing dermatitis. The diagnosis of leishmaniasis was accomplished by positive serology, isolation of Leishmania from the skin lesion, and also by molecular test (PCR targeting the conserved region of Leishmania kDNA). Culture was positive for damaged skin samples. PCR targeting a fragment of Leishmania hsp70 gene was performed employing DNA extracted from damaged skin. RFLP of the amplified hsp70 fragment identified the parasite as L. infantum, instead of Leishmania braziliensis, the main agent of cutaneous leishmaniasis in Rio de Janeiro. Characterization of isolated promastigotes by five different enzymatic systems confirmed the species identification of the etiological agent. Serology was positive by ELISA and rapid test. This case warns to the suspicion of viscerotropic Leishmania in cases of chronic skin lesions and brings the discussion of the mechanisms involved in the parasite tissue tropism. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  20. Changes to cholesterol trafficking in macrophages by Leishmania parasites infection.

    Science.gov (United States)

    Semini, Geo; Paape, Daniel; Paterou, Athina; Schroeder, Juliane; Barrios-Llerena, Martin; Aebischer, Toni

    2017-08-01

    Leishmania spp. are protozoan parasites that are transmitted by sandfly vectors during blood sucking to vertebrate hosts and cause a spectrum of diseases called leishmaniases. It has been demonstrated that host cholesterol plays an important role during Leishmania infection. Nevertheless, little is known about the intracellular distribution of this lipid early after internalization of the parasite. Here, pulse-chase experiments with radiolabeled cholesteryl esterified to fatty acids bound to low-density lipoproteins indicated that retention of this source of cholesterol is increased in parasite-containing subcellular fractions, while uptake is unaffected. This is correlated with a reduction or absence of detectable NPC1 (Niemann-Pick disease, type C1), a protein responsible for cholesterol efflux from endocytic compartments, in the Leishmania mexicana habitat and infected cells. Filipin staining revealed a halo around parasites within parasitophorous vacuoles (PV) likely representing free cholesterol accumulation. Labeling of host cell membranous cholesterol by fluorescent cholesterol species before infection revealed that this pool is also trafficked to the PV but becomes incorporated into the parasites' membranes and seems not to contribute to the halo detected by filipin. This cholesterol sequestration happened early after infection and was functionally significant as it correlated with the upregulation of mRNA-encoding proteins required for cholesterol biosynthesis. Thus, sequestration of cholesterol by Leishmania amastigotes early after infection provides a basis to understand perturbation of cholesterol-dependent processes in macrophages that were shown previously by others to be necessary for their proper function in innate and adaptive immune responses. © 2017 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

  1. Leishmania (Viannia) braziliensis infection in wild small mammals in ecotourism area of Brazil.

    Science.gov (United States)

    Tonelli, Gabriel Barbosa; Tanure, Aline; Rego, Felipe Dutra; Carvalho, Gustavo Mayr de Lima; Stumpp, Rodolfo; Ássimos, Gabriela Ribeiro; Campos, Aldenise Martins; Lima, Ana Cristina Viana Mariano da Rocha; Gontijo, Célia Maria Ferreira; Paz, Gustavo Fontes; Andrade Filho, José Dilermando

    2017-01-01

    Leishmaniases are parasitic diseases transmitted to mammalian hosts by sand fly vectors (Diptera: Psychodidae). Despite the increasing occurrence of visceral and cutaneous leishmaniasis cases in urban centers, their transmission still occur primarily in wild environments and may be associated with professional activities and recreation, such as ecotourism. The Reserva Particular do Patrimônio Natural Santuário do Caraça (RPPNSC) is one of the largest ecotourism attractions in the State of Minas Gerais, Brazil, and comprises an area of environmental preservation with 11,233 hectares presenting a transitional vegetation between Cerrado and Atlantic Forest. The present study describes the abundance of small mammals in RPPNSC, the isolation and identification of Leishmania in five wild animals. Small mammals were bimonthly trapped along 6 trails within the RPPNSC with 10 Tomahawk traps each. Two trails were located in peridomiciliary areas near tourist lodging facilities, and four trails were located at sites visited by tourists in forest areas. The most prevalent species were Akodon cursor, Cerradomys subflavus and Oligoryzomys nigripes. Six isolates of Leishmania were obtained from these animals and identified as Leishmania braziliensis through HSP70-PCR RFLP method. Leishmania spp. DNA was detected by kDNA-PCR method and isolated by biphasic culture. Studies point to some of the captured species as potential wild reservoirs of Leishmania, suggesting they may be involved in the transmission cycle in these wild environments.

  2. Molecular Diversity between Salivary Proteins from New World and Old World Sand Flies with Emphasis on Bichromomyia olmeca, the Sand Fly Vector of Leishmania mexicana in Mesoamerica.

    Science.gov (United States)

    Abdeladhim, Maha; V Coutinho-Abreu, Iliano; Townsend, Shannon; Pasos-Pinto, Silvia; Sanchez, Laura; Rasouli, Manoochehr; B Guimaraes-Costa, Anderson; Aslan, Hamide; Francischetti, Ivo M B; Oliveira, Fabiano; Becker, Ingeborg; Kamhawi, Shaden; Ribeiro, Jose M C; Jochim, Ryan C; Valenzuela, Jesus G

    2016-07-01

    Sand fly saliva has been shown to have proteins with potent biological activities, salivary proteins that can be used as biomarkers of vector exposure, and salivary proteins that are candidate vaccines against different forms of leishmaniasis. Sand fly salivary gland transcriptomic approach has contributed significantly to the identification and characterization of many of these salivary proteins from important Leishmania vectors; however, sand fly vectors in some regions of the world are still neglected, as Bichromomyia olmeca (formerly known as Lutzomyia olmeca olmeca), a proven vector of Leishmania mexicana in Mexico and Central America. Despite the importance of this vector in transmitting Leishmania parasite in Mesoamerica there is no information on the repertoire of B. olmeca salivary proteins and their relationship to salivary proteins from other sand fly species. A cDNA library of the salivary glands of wild-caught B. olmeca was constructed, sequenced, and analyzed. We identified transcripts encoding for novel salivary proteins from this sand fly species and performed a comparative analysis between B. olmeca salivary proteins and those from other sand fly species. With this new information we present an updated catalog of the salivary proteins specific to New World sand flies and salivary proteins common to all sand fly species. We also report in this work the anti-Factor Xa activity of Lofaxin, a salivary anticoagulant protein present in this sand fly species. This study provides information on the first transcriptome of a sand fly from Mesoamerica and adds information to the limited repertoire of salivary transcriptomes from the Americas. This comparative analysis also shows a fast degree of evolution in salivary proteins from New World sand flies as compared with Old World sand flies.

  3. Molecular characterization of leishmania infection from naturally infected sand flies caught in a focus of cutaneous leishmaniasis (eastern iran.

    Directory of Open Access Journals (Sweden)

    Mohammad Akhoundi

    2013-12-01

    Full Text Available Cutaneous leishmaniasis due to Leishmania major is a serious and increasing problem affecting many rural areas of 17 out of 31 provinces in Iran. Little is known about sand fly fauna and leishmaniases in Eastern Iran and no study has been carried out in Sarbisheh County. The aim of this study was to determine sand flies composition and probable Leishmania infection to find the probable vectors of leishmaniasis in Sarbisheh district.Sand flies were caught using both sticky papers and CDC light traps in August 2010. They were identified morphologically and analyzed for Leishmania infection by amplification of ITS-rDNA.Totally, 842 specimens were caught and 8 species recorded. They belonged to the genera Phlebotomus and Sergentomyia: P. (Phlebotomus papatasi, P. (Paraphlebotomus sergenti, P. (Pa. caucasicus, P. (Pa. mongolensis, P. (Pa. jacusieli, S. (Sergentomyia dentata, S. (Se. sintoni and S. (Sintonius clydei. All collected females were processed for Leishmania DNA detection by PCR amplifying of Internal Transcribed Spacer1 (partial sequence, 5.8S (complete sequence and ITS2 (partial sequence fragments. Thirteen females were positive for Leishmania DNA. The sequencing of the 430 bp amplicons indicated that 9 P. papatasi and 3 females belonging to the Caucasicus group carried L. major DNA whereas one P. sergenti carried L. tropica DNA.Phlebotomus papatasi and P. sergenti are, like in several places, the probable vectors of cutaneous leishmaniases in this emerging or unknown focus of cutaneous leishmaniases.

  4. The prevalence of canine Leishmania infantum infection in western China detected by PCR and serological tests

    Directory of Open Access Journals (Sweden)

    Chen Hai-Tang

    2011-05-01

    Full Text Available Abstract Background Canine leishmaniasis (CanL is endemic in western China, resulting in important public health problem. It is essential to evaluate the prevalence of canine Leishmania infantum infection for designing control policy. In the present study we report for the first time prevalence of Leishmania infection in dogs living in Jiuzhaigou County (Sichuan Provence, China, which is not only an important endemic area of CanL but also a tourism scenic spot, detected by PCR, ELISA and dipstick test. The results could provide key information for designing control programs against canine and human leishmaniasis. In addition, the complete sequence of the Leishmania isolate from Sichuan Province has not been reported to date and we present the sequences of 116 base-pair (bp fragment of the conserved region in the minicircle kinetoplast DNA (kDNA and the results of phylogenetic analyses based on the sequence of the amplified fragment. Results The proportion of dogs infected with Leishmania in Jiuzhaigou County was 36.79%, 9.43%, and 51.88% detected by ELISA, dipstick test, and PCR, respectively. The ELISA and PCR tests were more sensitive than dipstick test. The PCR method is the most sensitive way to detect dogs infected with Leishmania parasites. The total positive rate for infected dogs in the area was 59.43% by the three methods. The PCR products of 116-bp fragment amplified from the kDNA conserved region of dog blood samples and laboratory maintained L. infantum were DNA sequenced and the variation of the sequences was observed. The phylogenetic tree based on the sequences of 116-bp fragment reveals that L. infantum is more genetically related to visceralizing species L. donovani than to the Leishmania species associated with cutaneous disease. Conclusions More than half of dogs living in the endemic Jiuzhaigou County were infected by L. infantum. Control measures, such as treatment or eradication of infected dogs, or prohibition of

  5. Combined virus-like particle and fusion protein-encoding DNA vaccination of cotton rats induces protection against respiratory syncytial virus without causing vaccine-enhanced disease

    Energy Technology Data Exchange (ETDEWEB)

    Hwang, Hye Suk; Lee, Young-Tae; Kim, Ki-Hye; Park, Soojin; Kwon, Young-Man; Lee, Youri; Ko, Eun-Ju; Jung, Yu-Jin [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Lee, Jong Seok [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); National Institute of Biological Resources, Incheon (Korea, Republic of); Kim, Yu-Jin [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Lee, Yu-Na; Kim, Min-Chul [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Animal and Plant Quarantine Agency, Gyeonggi-do, Gimcheon, Gyeongsangbukdo (Korea, Republic of); Cho, Minkyoung [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States); Kang, Sang-Moo, E-mail: skang24@gsu.edu [Center for Inflammation, Immunity & Infection, Institute for Biomedical Sciences and Department of Biology, Georgia State University, Atlanta, GA (United States)

    2016-07-15

    A safe and effective vaccine against respiratory syncytial virus (RSV) should confer protection without causing vaccine-enhanced disease. Here, using a cotton rat model, we investigated the protective efficacy and safety of an RSV combination vaccine composed of F-encoding plasmid DNA and virus-like particles containing RSV fusion (F) and attachment (G) glycoproteins (FFG-VLP). Cotton rats with FFG-VLP vaccination controlled lung viral replication below the detection limit, and effectively induced neutralizing activity and antibody-secreting cell responses. In comparison with formalin inactivated RSV (FI-RSV) causing severe RSV disease after challenge, FFG-VLP vaccination did not cause weight loss, airway hyper-responsiveness, IL-4 cytokines, histopathology, and infiltrates of proinflammatory cells such as eosinophils. FFG-VLP was even more effective in preventing RSV-induced pulmonary inflammation than live RSV infections. This study provides evidence that FFG-VLP can be developed into a safe and effective RSV vaccine candidate. - Highlights: • Combined RSV FFG VLP vaccine is effective in inducing F specific responses. • FFG VLP vaccine confers RSV neutralizing activity and viral control in cotton rats. • Cotton rats with RSV FFG VLP vaccination do not show vaccine-enhanced disease. • Cotton rats with FFG VLP vaccine induce F specific antibody secreting cell responses. • Cotton rats with FFG VLP do not induce lung cellular infiltrates and Th2 cytokine.

  6. Cloning of cDNA sequences encoding cowpea (Vigna unguiculata) vicilins: Computational simulations suggest a binding mode of cowpea vicilins to chitin oligomers.

    Science.gov (United States)

    Rocha, Antônio J; Sousa, Bruno L; Girão, Matheus S; Barroso-Neto, Ito L; Monteiro-Júnior, José E; Oliveira, José T A; Nagano, Celso S; Carneiro, Rômulo F; Monteiro-Moreira, Ana C O; Rocha, Bruno A M; Freire, Valder N; Grangeiro, Thalles B

    2018-05-27

    Vicilins are 7S globulins which constitute the major seed storage proteins in leguminous species. Variant vicilins showing differential binding affinities for chitin have been implicated in the resistance and susceptibility of cowpea to the bruchid Callosobruchus maculatus. These proteins are members of the cupin superfamily, which includes a wide variety of enzymes and non-catalytic seed storage proteins. The cupin fold does not share similarity with any known chitin-biding domain. Therefore, it is poorly understood how these storage proteins bind to chitin. In this work, partial cDNA sequences encoding β-vignin, the major component of cowpea vicilins, were obtained from developing seeds. Three-dimensional molecular models of β-vignin showed the characteristic cupin fold and computational simulations revealed that each vicilin trimer contained 3 chitin-binding sites. Interaction models showed that chito-oligosaccharides bound to β-vignin were stabilized mainly by hydrogen bonds, a common structural feature of typical carbohydrate-binding proteins. Furthermore, many of the residues involved in the chitin-binding sites of β-vignin are conserved in other 7S globulins. These results support previous experimental evidences on the ability of vicilin-like proteins from cowpea and other leguminous species to bind in vitro to chitin as well as in vivo to chitinous structures of larval C. maculatus midgut. Copyright © 2018. Published by Elsevier B.V.

  7. Isolation and characterization of a cDNA encoding phytochrome A in the non-photosynthetic parasitic plant, Orobanche minor Sm.

    Science.gov (United States)

    Trakulnaleamsai, Chitra; Okazawa, Atsushi; An, Chung-Il; Kajiyama, Shin'ichiro; Fukusaki, Ei'ichiro; Yoneyama, Koichi; Takeuchi, Yasutomo; Kobayashi, Akio

    2005-01-01

    In this study, the isolation and characterization of a phytochrome A (PHYA) homologous cDNA (OmPHYA) in the non-photosynthetic holoparasitic plant Orobanche minor are described. The present findings provide the first report of the presence of a PHYA homolog in the holoparasite. This study found that OmPHYA is of similar size to the other PHYAs of green plants and shows 72, 77, and 77% amino acid sequence identity with PHYA in Arabidopsis, potato, and tobacco respectively. The OmPHYA contains a conserved chromophore attachment cysteine at position 323. Although OmPHYA shows high sequence identity with other PHYAs in green plants, 13 amino acid substitutions located in both the N and C-terminal domains are observed (a total of 26 amino acids). OmPHYA is encoded by a single gene within the O. minor genome. The abundance of the OmPHYA transcript as well as nuclear translocation of OmphyA occurs in a light-dependent manner.

  8. Combined virus-like particle and fusion protein-encoding DNA vaccination of cotton rats induces protection against respiratory syncytial virus without causing vaccine-enhanced disease

    International Nuclear Information System (INIS)

    Hwang, Hye Suk; Lee, Young-Tae; Kim, Ki-Hye; Park, Soojin; Kwon, Young-Man; Lee, Youri; Ko, Eun-Ju; Jung, Yu-Jin; Lee, Jong Seok; Kim, Yu-Jin; Lee, Yu-Na; Kim, Min-Chul; Cho, Minkyoung; Kang, Sang-Moo

    2016-01-01

    A safe and effective vaccine against respiratory syncytial virus (RSV) should confer protection without causing vaccine-enhanced disease. Here, using a cotton rat model, we investigated the protective efficacy and safety of an RSV combination vaccine composed of F-encoding plasmid DNA and virus-like particles containing RSV fusion (F) and attachment (G) glycoproteins (FFG-VLP). Cotton rats with FFG-VLP vaccination controlled lung viral replication below the detection limit, and effectively induced neutralizing activity and antibody-secreting cell responses. In comparison with formalin inactivated RSV (FI-RSV) causing severe RSV disease after challenge, FFG-VLP vaccination did not cause weight loss, airway hyper-responsiveness, IL-4 cytokines, histopathology, and infiltrates of proinflammatory cells such as eosinophils. FFG-VLP was even more effective in preventing RSV-induced pulmonary inflammation than live RSV infections. This study provides evidence that FFG-VLP can be developed into a safe and effective RSV vaccine candidate. - Highlights: • Combined RSV FFG VLP vaccine is effective in inducing F specific responses. • FFG VLP vaccine confers RSV neutralizing activity and viral control in cotton rats. • Cotton rats with RSV FFG VLP vaccination do not show vaccine-enhanced disease. • Cotton rats with FFG VLP vaccine induce F specific antibody secreting cell responses. • Cotton rats with FFG VLP do not induce lung cellular infiltrates and Th2 cytokine.

  9. Characterization of Leishmania Soluble Exo-Antigen

    National Research Council Canada - National Science Library

    Cui, Liwang

    2003-01-01

    .... Vaccine development is the ultimate solution for this problem. Our previous research indicates that Leishmania parasites secrete, excrete, or shed antigens into the medium during in vitro culture...

  10. Intranasal delivery of cationic PLGA nano/microparticles-loaded FMDV DNA vaccine encoding IL-6 elicited protective immunity against FMDV challenge.

    Directory of Open Access Journals (Sweden)

    Gang Wang

    Full Text Available Mucosal vaccination has been demonstrated to be an effective means of eliciting protective immunity against aerosol infections of foot and mouth disease virus (FMDV and various approaches have been used to improve mucosal response to this pathogen. In this study, cationic PLGA (poly(lactide-co-glycolide nano/microparticles were used as an intranasal delivery vehicle as a means administering FMDV DNA vaccine encoding the FMDV capsid protein and the bovine IL-6 gene as a means of enhancing mucosal and systemic immune responses in animals. Three eukaryotic expression plasmids with or without bovine IL-6 gene (pc-P12A3C, pc-IL2AP12A3C and pc-P12AIL3C were generated. The two latter plasmids were designed with the IL-6 gene located either before or between the P12A and 3C genes, respectively, as a means of determining if the location of the IL-6 gene affected capsid assembly and the subsequent immune response. Guinea pigs and rats were intranasally vaccinated with the respective chitosan-coated PLGA nano/microparticles-loaded FMDV DNA vaccine formulations. Animals immunized with pc-P12AIL3C (followed by animals vaccinated with pc-P12A3C and pc-IL2AP12A3C developed the highest levels of antigen-specific serum IgG and IgA antibody responses and the highest levels of sIgA (secretory IgA present in mucosal tissues. However, the highest levels of neutralizing antibodies were generated in pc-IL2AP12A3C-immunized animals (followed by pc-P12AIL3C- and then in pc-P12A3C-immunized animals. pc-IL2AP12A3C-immunized animals also developed stronger cell mediated immune responses (followed by pc-P12AIL3C- and pc-P12A3C-immunized animals as evidenced by antigen-specific T-cell proliferation and expression levels of IFN-γ by both CD4+ and CD8+ splenic T cells. The percentage of animals protected against FMDV challenge following immunizations with pc-IL2AP12A3C, pc-P12AIL3C or pc-P12A3C were 3/5, 1/5 and 0/5, respectively. These data suggested that intranasal delivery

  11. Arginase expression modulates nitric oxide production in Leishmania (Leishmania) amazonensis.

    Science.gov (United States)

    Acuña, Stephanie Maia; Aoki, Juliana Ide; Laranjeira-Silva, Maria Fernanda; Zampieri, Ricardo Andrade; Fernandes, Juliane Cristina Ribeiro; Muxel, Sandra Marcia; Floeter-Winter, Lucile Maria

    2017-01-01

    Arginase is an enzyme that converts L-arginine to urea and L-ornithine, an essential substrate for the polyamine pathway supporting Leishmania (Leishmania) amazonensis replication and its survival in the mammalian host. L-arginine is also the substrate of macrophage nitric oxide synthase 2 (NOS2) to produce nitric oxide (NO) that kills the parasite. This competition can define the fate of Leishmania infection. The transcriptomic profiling identified a family of oxidoreductases in L. (L.) amazonensis wild-type (La-WT) and L. (L.) amazonensis arginase knockout (La-arg-) promastigotes and axenic amastigotes. We highlighted the identification of an oxidoreductase that could act as nitric oxide synthase-like (NOS-like), due to the following evidences: conserved domain composition, the participation of NO production during the time course of promastigotes growth and during the axenic amastigotes differentiation, regulation dependence on arginase activity, as well as reduction of NO amount through the NOS activity inhibition. NO quantification was measured by DAF-FM labeling analysis in a flow cytometry. We described an arginase-dependent NOS-like activity in L. (L.) amazonensis and its role in the parasite growth. The increased detection of NO production in the mid-stationary and late-stationary growth phases of La-WT promastigotes could suggest that this production is an important factor to metacyclogenesis triggering. On the other hand, La-arg- showed an earlier increase in NO production compared to La-WT, suggesting that NO production can be arginase-dependent. Interestingly, La-WT and La-arg- axenic amastigotes produced higher levels of NO than those observed in promastigotes. As a conclusion, our work suggested that NOS-like is expressed in Leishmania in the stationary growth phase promastigotes and amastigotes, and could be correlated to metacyclogenesis and amastigotes growth in a dependent way to the internal pool of L-arginine and arginase activity.

  12. Detection of Leishmania RNA virus in Leishmania parasites.

    Directory of Open Access Journals (Sweden)

    Haroun Zangger

    Full Text Available Patients suffering from cutaneous leishmaniasis (CL caused by New World Leishmania (Viannia species are at high risk of developing mucosal (ML or disseminated cutaneous leishmaniasis (DCL. After the formation of a primary skin lesion at the site of the bite by a Leishmania-infected sand fly, the infection can disseminate to form secondary lesions. This metastatic phenotype causes significant morbidity and is often associated with a hyper-inflammatory immune response leading to the destruction of nasopharyngeal tissues in ML, and appearance of nodules or numerous ulcerated skin lesions in DCL. Recently, we connected this aggressive phenotype to the presence of Leishmania RNA virus (LRV in strains of L. guyanensis, showing that LRV is responsible for elevated parasitaemia, destructive hyper-inflammation and an overall exacerbation of the disease. Further studies of this relationship and the distribution of LRVs in other Leishmania strains and species would benefit from improved methods of viral detection and quantitation, especially ones not dependent on prior knowledge of the viral sequence as LRVs show significant evolutionary divergence.This study reports various techniques, among which, the use of an anti-dsRNA monoclonal antibody (J2 stands out for its specific and quantitative recognition of dsRNA in a sequence-independent fashion. Applications of J2 include immunofluorescence, ELISA and dot blot: techniques complementing an arsenal of other detection tools, such as nucleic acid purification and quantitative real-time-PCR. We evaluate each method as well as demonstrate a successful LRV detection by the J2 antibody in several parasite strains, a freshly isolated patient sample and lesion biopsies of infected mice.We propose that refinements of these methods could be transferred to the field for use as a diagnostic tool in detecting the presence of LRV, and potentially assessing the LRV-related risk of complications in cutaneous leishmaniasis.

  13. Passive transfer of leishmania lipopolysaccharide confers parasite survival in macrophages

    International Nuclear Information System (INIS)

    Handman, E.; Schnur, L.F.; Spithill, T.W.; Mitchell, G.F.

    1986-01-01

    Infection of macrophages by the intracellular protozoan parasite Leishmania involves specific attachment to the host membrane, followed by phagocytosis and intracellular survival and growth. Two parasite molecules have been implicated in the attachment event: Leishmania lipopolysaccharide (L-LPS) and a glycoprotein (gp63). This study was designed to clarify the role of L-LPS in infection and the stage in the process of infection at which it operates. The authors have recently identified a Leishmania major strain (LRC-L119) which lacks the L-LPS molecule and is not infective for hamsters or mice. This parasite was isolated from a gerbil in Kenya and was identified phenotypically as L. major by isoenzyme and fatty acid analysis. In this study they have confirmed at the genotype level that LRC-L119 is L. major by analyzing and comparing the organization of cloned DNA sequences in the genome of different strains of L. major. Here they show that LRC-L119 promastigotes are phagocytosed rapidly by macrophages in vitro, but in contrast to virulent strains of L. major, they are then killed over a period of 18 hr. In addition, they show that transfer of purified L-LPS from a virulent clone of L. major (V121) into LRC-L119 promastigotes confers on them the ability to survive in macrophages in vitro

  14. Natural infection of phlebotomines (Diptera: Psychodidae) by Leishmania (Leishmania) amazonensis in an area of ecotourism in Central-Western Brazil.

    Science.gov (United States)

    Brilhante, Andreia Fernandes; Nunes, Vânia Lúcia Brandão; Kohatsu, Kleber Augusto; Galati, Eunice Aparecida Bianchi; Rocca, Maria Elizabeth Ghizzi; Ishikawa, Edna Aoba Yassui

    2015-01-01

    Bonito municipality, known as an area of ecoturism, in Mato Grosso do Sul state, Brazil, is also a focus of visceral and cutaneous leishmaniases, with cases registered in both human and canine populations. This study sought to investigate natural infection by flagellate forms of Leishmania in phlebotomines of the urban area of Bonito. Sand flies were collected fortnightly from October 2005 to July 2006 with modified automatic light traps installed in peridomiciles and animal shelters in the center and on the outskirts of the city. The females were dissected and their guts observed under an optical microscope. A total of 1977 specimens were captured, Lutzomyia longipalpis (88.4 %) and Bichromomyia flaviscutelata (3.0 %) being the most frequent species. Bi. flaviscutellata was found infected by flagellates that were identified as Leishmania (Leishmania) amazonensis by indirect immunofluorescence reaction, employing monoclonal antibodies and the biotin-avidin system. This is the first report of natural infection by L. amazonensis in Bi. flaviscutellata in a Brazilian urban area. As Bi. flaviscutellata is only slightly attracted by humans, the transmission of L. amazonensis in the study area may have a zoonotic character; however, the sympatric occurrence of this parasite and Lu. longipalpis should be taken into consideration by the local health authorities since this sand fly has already been found with L. amazonensis DNA in a focus of canine visceral leishmaniasis in Bonito municipality.

  15. Amplified DNAs in laboratory stocks of Leishmania tarentolae: extrachromosomal circles structurally and functionally similar to the inverted-H-region amplification of methotrexate-resistant Leishmania major

    International Nuclear Information System (INIS)

    Petrillo-Peixoto, M.L.; Beverley, S.M.

    1988-01-01

    We describe the structure of amplified DNA that was discovered in two laboratory stocks of the protozoan parasite Leishmania tarentolae. Restriction mapping and molecular cloning revealed that a region of 42 kilobases was amplified 8- to 30-fold in these lines. Southern blot analyses of digested DNAs or chromosomes separated by pulsed-field electrophoresis showed that the amplified DNA corresponded to the H region, a locus defined originally by its amplification in methotrexate-resistant Leishmania major. Similarities between the amplified DNA of the two species included (i) extensive cross-hybridization; (ii) approximate conservation of sequence order; (iii) extrachromosomal localization; (iv) an overall inverted, head-to-head configuration as a circular 140-kilobase tetrameric molecule; (v) two regions of DNA sequence rearrangement, each of which was closely associated with the two centers of the inverted repeats; (vi) association with methotrexate resistance; and (vii) phenotypically conservative amplification, in which the wild-type chromosomal arrangement was retained without apparent modification. Our data showed that amplified DNA mediating drug resistance arose in unselected L. tarentolae, although the pressures leading to apparently spontaneous amplification and maintenance of the H region are not known. The simple structure and limited extent of DNA amplified in these and other Leishmania lines suggests that the study of gene amplification in Leishmania spp. offers an attractive model system for the study of amplification in cultured mammalian cells and tumors. We also introduced a method for measuring the size of large circular DNAs, using gamma-irradiation to introduce limited double-strand breaks followed by sizing of the linear DNAs by pulsed-field electrophoresis

  16. Leishmania (V.) braziliensis infecting bats from Pantanal wetland, Brazil: First records for Platyrrhinus lineatus and Artibeus planirostris.

    Science.gov (United States)

    de Castro Ferreira, Eduardo; Pereira, Agnes Antônio Sampaio; Silveira, Maurício; Margonari, Carina; Marcon, Glaucia Elisete Barbosa; de Oliveira França, Adriana; Castro, Ludiele Souza; Bordignon, Marcelo Oscar; Fischer, Erich; Tomas, Walfrido Moraes; Dorval, Maria Elizabeth Cavalheiros; Gontijo, Célia Maria Ferreira

    2017-08-01

    In the New World genus Leishmania parasites are etiological agents of neglected zoonoses known as leishmaniasis. Its epidemiology is very complex due to the participation of several species of sand fly vectors and mammalian hosts, and man is an accidental host. Control is very difficult because of the different epidemiological patterns of transmission observed. Studies about Leishmania spp. infection in bats are so scarce, which represents a large gap in knowledge about the role of these animals in the transmission cycle of these pathogens, especially when considering that Chiroptera is one of the most abundant and diverse orders among mammals. Leishmaniasis in Mato Grosso do Sul, Brazil are remarkably frequent, probably due to the abundance of its regional mastofauna. The recent record of L. braziliensis in bats from this state indicates the need to clarify the role of these mammals in the transmission cycle. In this study we evaluated the presence of Leishmania parasites in the skin of different species of bats, using PCR directed to Leishmania spp. kDNA for screening followed by PCR/RFLP analysis of the hsp70 gene for the identification of parasite species. Leishmania species identification was confirmed by PCR directed to the G6PD gene of L. braziliensis, followed by sequencing of the PCR product. Samples from 47 bats were processed, of which in three specimens (6.38%) was detected the presence of Leishmania sp. kDNA. PCR/RFLP and sequencing identified the species involved in the infection as L. braziliensis in all of them. This is the first report of Leishmania braziliensis in bats from Pantanal ecosystem and the first record of this species in Platyrrhinus lineatus and Artibeus planirostris, bats with a wide distribution in South America. These results reinforce the need to deepen the knowledge about the possibility of bats act as reservoirs of Leishmania spp. especially considering their ability of dispersion and occupation of anthropic environments

  17. Disseminated Leishmaniasis Caused by Leishmania Tropica in a Puppy from Karaj, Central Iran

    Directory of Open Access Journals (Sweden)

    M Mohebali

    2011-06-01

    Full Text Available A 5-month old puppy with muco-cutaneous lesions in the chin, around lips and eyes was exam­ined physically and microscopically for leishmaniasis. Muco-cutaneous lesions containing a large num­ber of amastigotes of Leishmania spp. were observed. Amastigotes were also detected in liver and spleen of the puppy. The animal was positive with Dipstick rK39 kit and high level of anti-Leishmania antibodies was detected by direct agglutination test (DAT. DNA, Using PCR-RFLP technique extracted from cultured Leishmania promastigotes and L. tropica was identified. This is the first report of concurrent mucosal and visceral involvement of L. tropica in a puppy from Iran.

  18. Geographic Distribution of Leishmania Species in Ecuador Based on the Cytochrome B Gene Sequence Analysis

    Science.gov (United States)

    Kato, Hirotomo; Gomez, Eduardo A.; Martini-Robles, Luiggi; Muzzio, Jenny; Velez, Lenin; Calvopiña, Manuel; Romero-Alvarez, Daniel; Mimori, Tatsuyuki; Uezato, Hiroshi; Hashiguchi, Yoshihisa

    2016-01-01

    A countrywide epidemiological study was performed to elucidate the current geographic distribution of causative species of cutaneous leishmaniasis (CL) in Ecuador by using FTA card-spotted samples and smear slides as DNA sources. Putative Leishmania in 165 samples collected from patients with CL in 16 provinces of Ecuador were examined at the species level based on the cytochrome b gene sequence analysis. Of these, 125 samples were successfully identified as Leishmania (Viannia) guyanensis, L. (V.) braziliensis, L. (V.) naiffi, L. (V.) lainsoni, and L. (Leishmania) mexicana. Two dominant species, L. (V.) guyanensis and L. (V.) braziliensis, were widely distributed in Pacific coast subtropical and Amazonian tropical areas, respectively. Recently reported L. (V.) naiffi and L. (V.) lainsoni were identified in Amazonian areas, and L. (L.) mexicana was identified in an Andean highland area. Importantly, the present study demonstrated that cases of L. (V.) braziliensis infection are increasing in Pacific coast areas. PMID:27410039

  19. Geographic Distribution of Leishmania Species in Ecuador Based on the Cytochrome B Gene Sequence Analysis.

    Science.gov (United States)

    Kato, Hirotomo; Gomez, Eduardo A; Martini-Robles, Luiggi; Muzzio, Jenny; Velez, Lenin; Calvopiña, Manuel; Romero-Alvarez, Daniel; Mimori, Tatsuyuki; Uezato, Hiroshi; Hashiguchi, Yoshihisa

    2016-07-01

    A countrywide epidemiological study was performed to elucidate the current geographic distribution of causative species of cutaneous leishmaniasis (CL) in Ecuador by using FTA card-spotted samples and smear slides as DNA sources. Putative Leishmania in 165 samples collected from patients with CL in 16 provinces of Ecuador were examined at the species level based on the cytochrome b gene sequence analysis. Of these, 125 samples were successfully identified as Leishmania (Viannia) guyanensis, L. (V.) braziliensis, L. (V.) naiffi, L. (V.) lainsoni, and L. (Leishmania) mexicana. Two dominant species, L. (V.) guyanensis and L. (V.) braziliensis, were widely distributed in Pacific coast subtropical and Amazonian tropical areas, respectively. Recently reported L. (V.) naiffi and L. (V.) lainsoni were identified in Amazonian areas, and L. (L.) mexicana was identified in an Andean highland area. Importantly, the present study demonstrated that cases of L. (V.) braziliensis infection are increasing in Pacific coast areas.

  20. Geographic Distribution of Leishmania Species in Ecuador Based on the Cytochrome B Gene Sequence Analysis.

    Directory of Open Access Journals (Sweden)

    Hirotomo Kato

    2016-07-01

    Full Text Available A countrywide epidemiological study was performed to elucidate the current geographic distribution of causative species of cutaneous leishmaniasis (CL in Ecuador by using FTA card-spotted samples and smear slides as DNA sources. Putative Leishmania in 165 samples collected from patients with CL in 16 provinces of Ecuador were examined at the species level based on the cytochrome b gene sequence analysis. Of these, 125 samples were successfully identified as Leishmania (Viannia guyanensis, L. (V. braziliensis, L. (V. naiffi, L. (V. lainsoni, and L. (Leishmania mexicana. Two dominant species, L. (V. guyanensis and L. (V. braziliensis, were widely distributed in Pacific coast subtropical and Amazonian tropical areas, respectively. Recently reported L. (V. naiffi and L. (V. lainsoni were identified in Amazonian areas, and L. (L. mexicana was identified in an Andean highland area. Importantly, the present study demonstrated that cases of L. (V. braziliensis infection are increasing in Pacific coast areas.

  1. Displacement encoder

    International Nuclear Information System (INIS)

    Hesketh, T.G.

    1983-01-01

    In an optical encoder, light from an optical fibre input A is encoded by means of the encoding disc and is subsequently collected for transmission via optical fibre B. At some point in the optical path between the fibres A and B, the light is separated into component form by means of a filtering or dispersive system and each colour component is associated with a respective one of the coding channels of the disc. In this way, the significance of each bit of the coded information is represented by a respective colour thereby enabling the components to be re-combined for transmission by the fibre B without loss of information. (author)

  2. Experimental mixed infection of Leishmania (Leishmania) amazonensis and Leishmania (L.) infantum in hamsters (Mesocricetus auratus).

    Science.gov (United States)

    DE Lima Celeste, Jordanna Luíza; Venuto Moura, Ana Paula; França-Silva, João Carlos; Matos DE Sousa, Gabriela; Oliveira Silva, Soraia; Norma Melo, Maria; Luiz Tafuri, Wagner; Carvalho Souza, Carolina; Monteiro DE Andrade, Hélida

    2017-08-01

    In South America, visceral leishmaniasis is frequently caused by Leishmania infantum and, at an unknown frequency, by Leishmania amazonensis. Therefore, mixed infections with these organisms are possible. Mixed infections might affect the clinical course, immune response, diagnosis, treatment and epidemiology of the disease. Here we describe the clinical course of mixed infections with L. amazonensis and L. infantum in a hamster model. We show that mixed infections are associated with more severe clinical disease than infection with L. amazonensis or L. infantum alone. In spleens with mixed infections, L. infantum outcompeted L. amazonensis in the tissue, but not in culture from tissue. We found increased levels of IgG in animals infected with L. infantum. Although more than 30 bands were revealed in a Western blot, the highest immunogenicity was observed with proteins having molecular masses of 95 and 90 kDa, whereas proteins with molecular masses of lower than 50 kDa were reactive frequently with serum from hamsters infected with L. amazonensis, and proteins with molecular masses of 80 and 70 kDa were reactive only with serum from hamsters infected with L. infantum. This finding has important implications regarding the biology of Leishmania and humoral immune responses to infections with these organisms.

  3. Leishmania hijacking of the macrophage intracellular compartments.

    Science.gov (United States)

    Liévin-Le Moal, Vanessa; Loiseau, Philippe M

    2016-02-01

    Leishmania spp., transmitted to humans by the bite of the sandfly vector, are responsible for the three major forms of leishmaniasis, cutaneous, diffuse mucocutaneous and visceral. Leishmania spp. interact with membrane receptors of neutrophils and macrophages. In macrophages, the parasite is internalized within a parasitophorous vacuole and engages in a particular intracellular lifestyle in which the flagellated, motile Leishmania promastigote metacyclic form differentiates into non-motile, metacyclic amastigote form. This phenomenon is induced by Leishmania-triggered events leading to the fusion of the parasitophorous vacuole with vesicular members of the host cell endocytic pathway including recycling endosomes, late endosomes and the endoplasmic reticulum. Maturation of the parasitophorous vacuole leads to the intracellular proliferation of the Leishmania amastigote forms by acquisition of host cell nutrients while escaping host defense responses. © 2015 FEBS.

  4. Evaluation of four molecular methods to detect Leishmania infection in dogs.

    Science.gov (United States)

    Albuquerque, Andreia; Campino, Lenea; Cardoso, Luís; Cortes, Sofia

    2017-03-13

    Canine leishmaniasis, a zoonotic disease caused by Leishmania infantum vectored by phlebotomine sand flies, is considered a relevant veterinary and public health problem in various countries, namely in the Mediterranean basin and Brazil, where dogs are considered the main reservoir hosts. Not only diseased dogs but also those subclinically infected play a relevant role in the transmission of L. infantum to vectors; therefore, early diagnosis is essential, under both a clinical and an epidemiological perspective. Molecular tools can be a more accurate and sensitive approach for diagnosis, with a wide range of protocols currently in use. The aim of the present report was to compare four PCR based protocols for the diagnosis of canine Leishmania infection in a cohort of dogs from the Douro region, Portugal. A total of 229 bone marrow samples were collected from dogs living in the Douro region, an endemic region for leishmaniasis. Four PCR protocols were evaluated for Leishmania DNA detection in canine samples, three single (ITS1-PCR, MC-PCR and Uni21/Lmj4-PCR) and one nested (nested SSU rRNA-PCR). Two of the protocols were based on nuclear targets and the other two on kinetoplastid targets. The higher overall percentage of infected dogs was detected with the nested SSU rRNA-PCR (37.6%), which also was able to detect Leishmania DNA in a higher number of samples from apparently healthy dogs (25.3%). The ITS1-PCR presented the lowest level of Leishmania detection. Nested SSU rRNA-PCR is an appropriate method to detect Leishmania infection in dogs. Accurate and early diagnosis in clinically suspect as well as apparently healthy dogs is essential, in order to treat and protect animals and public health and contribute to the control and awareness of the disease.

  5. Cationic lipid-formulated DNA vaccine against hepatitis B virus: immunogenicity of MIDGE-Th1 vectors encoding small and large surface antigen in comparison to a licensed protein vaccine.

    Directory of Open Access Journals (Sweden)

    Anne Endmann

    Full Text Available Currently marketed vaccines against hepatitis B virus (HBV based on the small (S hepatitis B surface antigen (HBsAg fail to induce a protective immune response in about 10% of vaccinees. DNA vaccination and the inclusion of PreS1 and PreS2 domains of HBsAg have been reported to represent feasible strategies to improve the efficacy of HBV vaccines. Here, we evaluated the immunogenicity of SAINT-18-formulated MIDGE-Th1 vectors encoding the S or the large (L protein of HBsAg in mice and pigs. In both animal models, vectors encoding the secretion-competent S protein induced stronger humoral responses than vectors encoding the L protein, which was shown to be retained mainly intracellularly despite the presence of a heterologous secretion signal. In pigs, SAINT-18-formulated MIDGE-Th1 vectors encoding the S protein elicited an immune response of the same magnitude as the licensed protein vaccine Engerix-B, with S protein-specific antibody levels significantly higher than those considered protective in humans, and lasting for at least six months after the third immunization. Thus, our results provide not only the proof of concept for the SAINT-18-formulated MIDGE-Th1 vector approach but also confirm that with a cationic-lipid formulation, a DNA vaccine at a relatively low dose can elicit an immune response similar to a human dose of an aluminum hydroxide-adjuvanted protein vaccine in large animals.

  6. Genetic Manipulation of Leishmania donovani to Explore the Involvement of Argininosuccinate Synthase in Oxidative Stress Management

    Science.gov (United States)

    Sardar, Abul Hasan; Jardim, Armando; Ghosh, Ayan Kumar; Mandal, Abhishek; Das, Sushmita; Saini, Savita; Abhishek, Kumar; Singh, Ruby; Verma, Sudha; Kumar, Ajay; Das, Pradeep

    2016-01-01

    Reactive oxygen and nitrogen species (ROS and RNS) produced by the phagocytic cells are the most common arsenals used to kill the intracellular pathogens. However, Leishmania, an intracellular pathogen, has evolved mechanisms to survive by counterbalancing the toxic oxygen metabolites produced during infection. Polyamines, the major contributor in this anti-oxidant machinery, are largely dependent on the availability of L-arginine in the intracellular milieu. Argininosuccinate synthase (ASS) plays an important role as the rate-limiting step required for converting L-citrulline to argininosuccinate to provide arginine for an assortment of metabolic processes. Leishmania produce an active ASS enzyme, yet it has an incomplete urea cycle as it lacks an argininosuccinate lyase (ASL). There is no evidence for endogenous synthesis of L-arginine in Leishmania, which suggests that these parasites salvage L-arginine from extracellular milieu and makes the biological function of ASS and the production of argininosuccinate in Leishmania unclear. Our previous quantitative proteomic analysis of Leishmania promastigotes treated with sub-lethal doses of ROS, RNS, or a combination of both, led to the identification of several differentially expressed proteins which included ASS. To assess the involvement of ASS in stress management, a mutant cell line with greatly reduced ASS activity was created by a double-targeted gene replacement strategy in L. donovani promastigote. Interestingly, LdASS is encoded by three copies of allele, but Western blot analysis showed the third allele did not appear to express ASS. The free thiol levels in the mutant LdASS-/-/+ cell line were decreased. Furthermore, the cell viability in L-arginine depleted medium was greatly attenuated on exposure to different stress environments and was adversely impacted in its ability to infect mice. These findings suggest that ASS is important for Leishmania donovani to counterbalance the stressed environments

  7. Genetic Manipulation of Leishmania donovani to Explore the Involvement of Argininosuccinate Synthase in Oxidative Stress Management.

    Directory of Open Access Journals (Sweden)

    Abul Hasan Sardar

    2016-03-01

    Full Text Available Reactive oxygen and nitrogen species (ROS and RNS produced by the phagocytic cells are the most common arsenals used to kill the intracellular pathogens. However, Leishmania, an intracellular pathogen, has evolved mechanisms to survive by counterbalancing the toxic oxygen metabolites produced during infection. Polyamines, the major contributor in this anti-oxidant machinery, are largely dependent on the availability of L-arginine in the intracellular milieu. Argininosuccinate synthase (ASS plays an important role as the rate-limiting step required for converting L-citrulline to argininosuccinate to provide arginine for an assortment of metabolic processes. Leishmania produce an active ASS enzyme, yet it has an incomplete urea cycle as it lacks an argininosuccinate lyase (ASL. There is no evidence for endogenous synthesis of L-arginine in Leishmania, which suggests that these parasites salvage L-arginine from extracellular milieu and makes the biological function of ASS and the production of argininosuccinate in Leishmania unclear. Our previous quantitative proteomic analysis of Leishmania promastigotes treated with sub-lethal doses of ROS, RNS, or a combination of both, led to the identification of several differentially expressed proteins which included ASS. To assess the involvement of ASS in stress management, a mutant cell line with greatly reduced ASS activity was created by a double-targeted gene replacement strategy in L. donovani promastigote. Interestingly, LdASS is encoded by three copies of allele, but Western blot analysis showed the third allele did not appear to express ASS. The free thiol levels in the mutant LdASS-/-/+ cell line were decreased. Furthermore, the cell viability in L-arginine depleted medium was greatly attenuated on exposure to different stress environments and was adversely impacted in its ability to infect mice. These findings suggest that ASS is important for Leishmania donovani to counterbalance the stressed

  8. High Resolution Melting Analysis Targeting hsp70 as a Fast and Efficient Method for the Discrimination of Leishmania Species.

    Science.gov (United States)

    Zampieri, Ricardo Andrade; Laranjeira-Silva, Maria Fernanda; Muxel, Sandra Marcia; Stocco de Lima, Ana Carolina; Shaw, Jeffrey Jon; Floeter-Winter, Lucile Maria

    2016-02-01

    Protozoan parasites of the genus Leishmania cause a large spectrum of clinical manifestations known as Leishmaniases. These diseases are increasingly important public health problems in many countries both within and outside endemic regions. Thus, an accurate differential diagnosis is extremely relevant for understanding epidemiological profiles and for the administration of the best therapeutic protocol. Exploring the High Resolution Melting (HRM) dissociation profiles of two amplicons using real time polymerase chain reaction (real-time PCR) targeting heat-shock protein 70 coding gene (hsp70) revealed differences that allowed the discrimination of genomic DNA samples of eight Leishmania species found in the Americas, including Leishmania (Leishmania) infantum chagasi, L. (L.) amazonensis, L. (L.) mexicana, L. (Viannia) lainsoni, L. (V.) braziliensis, L. (V.) guyanensis, L. (V.) naiffi and L. (V.) shawi, and three species found in Eurasia and Africa, including L. (L.) tropica, L. (L.) donovani and L. (L.) major. In addition, we tested DNA samples obtained from standard promastigote culture, naturally infected phlebotomines, experimentally infected mice and clinical human samples to validate the proposed protocol. HRM analysis of hsp70 amplicons is a fast and robust strategy that allowed for the detection and discrimination of all Leishmania species responsible for the Leishmaniases in Brazil and Eurasia/Africa with high sensitivity and accuracy. This method could detect less than one parasite per reaction, even in the presence of host DNA.

  9. High Resolution Melting Analysis Targeting hsp70 as a Fast and Efficient Method for the Discrimination of Leishmania Species.

    Directory of Open Access Journals (Sweden)

    Ricardo Andrade Zampieri

    2016-02-01

    Full Text Available Protozoan parasites of the genus Leishmania cause a large spectrum of clinical manifestations known as Leishmaniases. These diseases are increasingly important public health problems in many countries both within and outside endemic regions. Thus, an accurate differential diagnosis is extremely relevant for understanding epidemiological profiles and for the administration of the best therapeutic protocol.Exploring the High Resolution Melting (HRM dissociation profiles of two amplicons using real time polymerase chain reaction (real-time PCR targeting heat-shock protein 70 coding gene (hsp70 revealed differences that allowed the discrimination of genomic DNA samples of eight Leishmania species found in the Americas, including Leishmania (Leishmania infantum chagasi, L. (L. amazonensis, L. (L. mexicana, L. (Viannia lainsoni, L. (V. braziliensis, L. (V. guyanensis, L. (V. naiffi and L. (V. shawi, and three species found in Eurasia and Africa, including L. (L. tropica, L. (L. donovani and L. (L. major. In addition, we tested DNA samples obtained from standard promastigote culture, naturally infected phlebotomines, experimentally infected mice and clinical human samples to validate the proposed protocol.HRM analysis of hsp70 amplicons is a fast and robust strategy that allowed for the detection and discrimination of all Leishmania species responsible for the Leishmaniases in Brazil and Eurasia/Africa with high sensitivity and accuracy. This method could detect less than one parasite per reaction, even in the presence of host DNA.

  10. Identification of Leishmania spp. promastigotes in the intestines, ovaries, and salivary glands of Rhipicephalus sanguineus actively infesting dogs.

    Science.gov (United States)

    Viol, Milena Araúz; Guerrero, Felix D; de Oliveira, Bruno César Miranda; de Aquino, Monally Conceição Costa; Loiola, Saulo Hudson; de Melo, Guilherme Dias; de Souza Gomes, Aparecida Helena; Kanamura, Cristina Takami; Garcia, Marcos Valério; Andreotti, Renato; de Lima, Valéria Marçal Félix; Bresciani, Katia Denise Saraiva

    2016-09-01

    Sand flies are recognized as the major vector of canine visceral leishmaniasis. However, in some areas of Brazil where sand flies do not occur, this disease is found in humans and dogs. There has been speculation that ticks might play a role in transmission of canine visceral leishmaniasis and the DNA of Leishmania spp. has been reported in whole ticks. We investigated the presence of Leishmania spp. promastigotes in the intestines, ovaries, and salivary glands of Rhipicephalus sanguineus ticks collected from tick-infested dogs in two cities of Brazil. We used 66 dogs that tested positive and 33 that tested negative for Leishmania spp. according to direct cytological examination assays. Ten ticks were collected from each dog and dissected to collect the intestines, ovaries, and salivary glands for immunohistochemistry (IHC) and diagnostic real-time polymerase chain reaction (RT-PCR). IHC results showed Leishmania spp. in 98, 14, and 8 % of the intestines, ovaries, and salivary glands, respectively. Real-time PCR showed that 89, 41, and 33 % of the tick intestine, ovary, and salivary glands, respectively, were positive for Leishmania spp. The verification of promastigotes of Leishmania spp. by two independent techniques in ticks collected from these urban region dogs showed that there is need for clarification of the role of ticks in the transmission of canine visceral leishmaniasis in Brazil.

  11. An HIV-1 encoded peptide mimics the DNA binding loop of NF-κB and binds thioredoxin with high affinity

    International Nuclear Information System (INIS)

    Su Guoping; Wang Min; Taylor, Ethan Will

    2005-01-01

    Pro-fs is a human immunodeficiency virus type 1 (HIV-l)-encoded putative selenoprotein, predicted by a theoretical analysis of the viral genome; it is potentially expressed by a -1 frameshift from the protease coding region. Pro-fs has significant sequence similarity to the DNA binding loop of nuclear factor kappa B (NF-κB), which is known to bind thioredoxin (Trx). We hypothesize that the putative HIV-1 pro-fs gene product functions by mimicry of NF-κB via binding to Trx. The hypothesis was tested in vitro by co-immunoprecipitation and GST-pull down assays, using a purified mutant pro-fs protein, in which the two potential selenocysteine residues were mutated to cysteines, in order to permit expression in bacteria. Both experiments showed that pro-fs binds to human wild type Trx (Trx-wt) with high affinity. Mutation of the two conserved cysteine residues in the Trx active site redox center to serine (Ser) (Trx-CS) weakened but failed to abolish the interaction. In pro-fs-transfected 293T cells, using confocal microscopy and fluorescence resonance energy transfer (FRET), we have observed that pro-fs localizes in cell nuclei and forms oligomers. Upon stimulation by phorbol 12-myristate 13-acetate (PMA), Trx translocates into cell nuclei. Significant FRET efficiency was detected in the nuclei of PMA-stimulated 293T cells co-expressing fluorescence-tagged pro-fs and Trx-wt or Trx-CS. These results indicate that in living cells the double cysteine mutant of pro-fs binds to both Trx and Trx-CS with high affinity, suggesting that Trx-pro-fs binding is a structurally-specific interaction, involving more of the Trx molecule than just its active site cysteine residues. These results establish the capacity for functional mimicry of the Trx binding ability of the NF-κB/Rel family of transcription factors by the putative HIV-1 pro-fs protein

  12. Detection and Differentiation of Leishmania spp. in Clinical Specimens by Use of a SYBR Green-Based Real-Time PCR Assay.

    Science.gov (United States)

    de Almeida, Marcos E; Koru, Ozgur; Steurer, Francis; Herwaldt, Barbara L; da Silva, Alexandre J

    2017-01-01

    Leishmaniasis in humans is caused by Leishmania spp. in the subgenera Leishmania and Viannia Species identification often has clinical relevance. Until recently, our laboratory relied on conventional PCR amplification of the internal transcribed spacer 2 (ITS2) region (ITS2-PCR) followed by sequencing analysis of the PCR product to differentiate Leishmania spp. Here we describe a novel real-time quantitative PCR (qPCR) approach based on the SYBR green technology (LSG-qPCR), which uses genus-specific primers that target the ITS1 region and amplify DNA from at least 10 Leishmania spp., followed by analysis of the melting temperature (T m ) of the amplicons on qPCR platforms (the Mx3000P qPCR system [Stratagene-Agilent] and the 7500 real-time PCR system [ABI Life Technologies]). We initially evaluated the assay by testing reference Leishmania isolates and comparing the results with those from the conventional ITS2-PCR approach. Then we compared the results from the real-time and conventional molecular approaches for clinical specimens from 1,051 patients submitted to the reference laboratory of the Centers for Disease Control and Prevention for Leishmania diagnostic testing. Specimens from 477 patients tested positive for Leishmania spp. with the LSG-qPCR assay, specimens from 465 of these 477 patients also tested positive with the conventional ITS2-PCR approach, and specimens from 10 of these 465 patients had positive results because of retesting prompted by LSG-qPCR positivity. On the basis of the T m values of the LSG-qPCR amplicons from reference and clinical specimens, we were able to differentiate four groups of Leishmania parasites: the Viannia subgenus in aggregate; the Leishmania (Leishmania) donovani complex in aggregate; the species L (L) tropica; and the species L (L) mexicana, L (L) amazonensis, L (L) major, and L (L) aethiopica in aggregate. Copyright © 2016 American Society for Microbiology.

  13. Characterization of a midgut mucin-like glycoconjugate of Lutzomyia longipalpis with a potential role in Leishmania attachment.

    Science.gov (United States)

    Myšková, Jitka; Dostálová, Anna; Pěničková, Lucie; Halada, Petr; Bates, Paul A; Volf, Petr

    2016-07-25

    Leishmania parasites are transmitted by phlebotomine sand flies and a crucial step in their life-cycle is the binding to the sand fly midgut. Laboratory studies on sand fly competence to Leishmania parasites suggest that the sand flies fall into two groups: several species are termed "specific/restricted" vectors that support the development of one Leishmania species only, while the others belong to so-called "permissive" vectors susceptible to a wide range of Leishmania species. In a previous study we revealed a correlation between specificity vs permissivity of the vector and glycosylation of its midgut proteins. Lutzomyia longipalpis and other four permissive species tested possessed O-linked glycoproteins whereas none were detected in three specific vectors examined. We used a combination of biochemical, molecular and parasitological approaches to characterize biochemical and biological properties of O-linked glycoprotein of Lu. longipalpis. Lectin blotting and mass spectrometry revealed that this molecule with an apparent molecular weight about 45-50 kDa corresponds to a putative 19 kDa protein with unknown function detected in a midgut cDNA library of Lu. longipalpis. We produced a recombinant glycoprotein rLuloG with molecular weight around 45 kDa. Anti-rLuloG antibodies localize the native glycoprotein on epithelial midgut surface of Lu. longipalpis. Although we could not prove involvement of LuloG in Leishmania attachment by blocking the native protein with anti-rLuloG during sand fly infections, we demonstrated strong binding of rLuloG to whole surface of Leishmania promastigotes. We characterized a novel O-glycoprotein from sand fly Lutzomyia longipalpis. It has mucin-like properties and is localized on the luminal side of the midgut epithelium. Recombinant form of the protein binds to Leishmania parasites in vitro. We propose a role of this molecule in Leishmania attachment to sand fly midgut.

  14. Virus neutralizing antibody response in mice and dogs with a bicistronic DNA vaccine encoding rabies virus glycoprotein and canine parvovirus VP2.

    Science.gov (United States)

    Patial, Sonika; Chaturvedi, V K; Rai, A; Saini, M; Chandra, Rajesh; Saini, Y; Gupta, Praveen K

    2007-05-16

    A bicistronic DNA vaccine against rabies and parvovirus infection of dogs was developed by subcloning rabies glycoprotein and canine parvovirus (CPV) VP2 genes into a bicistronic vector. After characterizing the expression of both the proteins in vitro, the bicistronic DNA vaccine was injected in mice and induced immune response was compared with monocistronic DNA vaccines. There was no significant difference in ELISA and virus neutralizing (VN) antibody responses against rabies and CPV in mice immunized with either bicistronic or monocistronic DNA vaccine. Further, there was significantly similar protection in mice immunized with either bicistronic or monocistronic rabies DNA vaccine on rabies virus challenge. Similarly, dogs immunized with monocistronic and bicistronic DNA vaccines developed comparable VN antibodies against rabies and CPV. This study indicated that bicistronic DNA vaccine can be used in dogs to induce virus neutralizing immune responses against both rabies and CPV.

  15. Detection and molecular identification of leishmania RNA virus (LRV) in Iranian Leishmania species.

    Science.gov (United States)

    Hajjaran, Homa; Mahdi, Maryam; Mohebali, Mehdi; Samimi-Rad, Katayoun; Ataei-Pirkooh, Angila; Kazemi-Rad, Elham; Naddaf, Saied Reza; Raoofian, Reza

    2016-12-01

    Leishmania RNA virus (LRV) was first detected in members of the subgenus Leishmania (Viannia), and later, the virulence and metastasis of the New World species were attributed to this virus. The data on the presence of LRV in Old World species are confined to Leishmania major and a few Leishmania aethiopica isolates. The aim of this study was to survey the presence of LRV in various Iranian Leishmania species originating from patients and animal reservoir hosts. Genomic nucleic acids were extracted from 50 cultured isolates belonging to the species Leishmania major, Leishmania tropica, and Leishmania infantum. A partial sequence of the viral RNA-dependent RNA polymerase (RdRp) gene was amplified, sequenced and compared with appropriate sequences from the GenBank database. We detected the virus in two parasite specimens: an isolate of L. infantum derived from a visceral leishmaniasis (VL) patient who was unresponsive to meglumine antimoniate treatment, and an L. major isolate originating from a great gerbil, Rhombomys opimus. The Iranian LRV sequences showed the highest similarities to an Old World L. major LRV2 and were genetically distant from LRV1 isolates detected in New World Leishmania parasites. We could not attribute treatment failure in VL patient to the presence of LRV due to the limited number of specimens analyzed. Further studies with inclusion of more clinical samples are required to elucidate the potential role of LRVs in pathogenesis or treatment failure of Old World leishmaniasis.

  16. Lutzomyia (Pintomyia) fischeri (Diptera: Psychodidae: Phlebotominae), a probable vector of American cutaneous leishmaniasis: detection of natural infection by Leishmania (Viannia) DNA in specimens from the municipality of Porto Alegre (RS), Brazil, using multiplex PCR assay.

    Science.gov (United States)

    Pita-Pereira, Daniela de; Souza, Getúlio D; Pereira, Thaís de Araújo; Zwetsch, Adriana; Britto, Constança; Rangel, Elizabeth F

    2011-12-01

    In order to determine natural Leishmania (Viannia) infection in Lutzomyia (Pintomyia) fischeri, a multiplex PCR methodology coupled to non-isotopic hybridization was adopted for the analysis of sand fly samples collected by CDC light traps in an endemic area of American Cutaneous Leishmaniasis (ACL) in the periurban region of the municipality of Porto Alegre, Rio Grande do Sul State, Brazil. We analyzed by PCR methodology 560 specimens of Lutzomyia (Pintomyia) fischeri (520 females and 40 males). The wild sand flies were grouped into 56 pools (52 females and 4 males) of 10 each, and positive results were detected in 2 of the 52 female pools, representing a minimum infection rate of 0.38% based on the presence of at least 1 infected insect in the pool. This result associated with some local evidence such as anthopophily, spatial distribution in accordance with the transmission area and human case incidence, suggests that L. (P.)fischeri may be considered as a secondary vector of ACL in the studied locality. Copyright © 2011 Elsevier B.V. All rights reserved.

  17. Leishmania major infection in a dog with cutaneous manifestations.

    Science.gov (United States)

    Baneth, Gad; Nachum-Biala, Yaarit; Shabat Simon, Maytal; Brenner, Ori; Gaier, Sarit; Rojas, Alicia; Yasur-Landau, Daniel

    2016-05-10

    Leishmania major is a main cause of cutaneous leishmaniasis in humans in an area that stretches from India through Central Asia, the Middle East, to North and West Africa. In Israel, it is a common infection of humans with rodents as the reservoir hosts and Phlebotomus papatasi as its sand fly vector. A 6 months old spayed female mixed breed dog was referred to the Hebrew University Veterinary Teaching Hospital with a large ulcerative dermal lesion on the muzzle, and lesions in the foot pads and left hind leg. Histopathology of a skin biopsy found chronic lymphohistiocytic dermatitis with the presence of Leishmania spp. amastigotes in the muzzle. Physical examination indicated that the dog was overall in a good clinical condition and the main findings were the skin lesions and enlarged prescapular lymph nodes. Complete blood count and serum biochemistry profile were within reference ranges. Serology by ELISA was positive for Leishmania spp. and PCR of the prescapular lymph node was positive by an ITS1 region PCR-high resolution melt analysis. However, the melt curve and subsequent DNA sequencing indicated that infection was caused by L. major and not L. infantum, which is the main causative agent of canine leishmaniosis in the Mediterranean region. DNA was extracted from the paraffin embedded muzzle biopsy and PCR with sequencing also indicated L. major. The dog's young age and the absence of hyperglobulinemia and anemia were not typical of L. infantum infection. The dog was treated with allopurinol and the skin lesions improved and later disappeared when the dog was re-evaluated. This is the first molecularly-confirmed case of L. major infection in a dog. Two previous reports of L. major in dogs originated from Saudi-Arabia and Egypt in 1985 and 1987 were confirmed by enzymatic biochemical techniques. Serology for L. infantum was positive probably due to the well documented serological cross-reactivity between Leishmania spp. Although dogs and wild carnivores are

  18. Leishmania infantum nicotinamidase is required for late-stage development in its natural sand fly vector, Phlebotomus perniciosus.

    Science.gov (United States)

    Gazanion, Elodie; Seblova, Veronika; Votypka, Jan; Vergnes, Baptiste; Garcia, Déborah; Volf, Petr; Sereno, Denis

    2012-04-01

    Leishmania infantum nicotinamidase, encoded by the Lipnc1 gene, converts nicotinamide into nicotinicacid to ensure Nicotinamide–Adenine–Dinucleotide (NAD+) biosynthesis. We were curious to explore the role of this enzyme during L. infantum development in its natural sand fly vector, Phlebotomus perniciosus (Diptera, Phlebotominae), using null mutants with a deleted Lipnc1 gene. The null mutants developed as well as the wild type L. infantum at the early time points post their ingestion within the bloodmeal. In contrast, once the blood meal digestion was completed, the null mutants were unable to develop further and establish late-stage infections. Data highlight the importance of the nicotinamide degradation pathway for Leishmania development in sand flies. They indicate that the endogenous nicotinamidase is essential for Leishmania development in the sand fly after the blood meal has been digested and the remnants defecated.

  19. RPA-1 from Leishmania amazonensis (LaRPA-1) structurally differs from other eukaryote RPA-1 and interacts with telomeric DNA via its N-terminal OB-fold domain.

    Science.gov (United States)

    Pavani, R S; Fernandes, C; Perez, A M; Vasconcelos, E J R; Siqueira-Neto, J L; Fontes, M R; Cano, M I N

    2014-12-20

    Replication protein A-1 (RPA-1) is a single-stranded DNA-binding protein involved in DNA metabolism. We previously demonstrated the interaction between LaRPA-1 and telomeric DNA. Here, we expressed and purified truncated mutants of LaRPA-1 and used circular dichroism measurements and molecular dynamics simulations to demonstrate that the tertiary structure of LaRPA-1 differs from human and yeast RPA-1. LaRPA-1 interacts with telomeric ssDNA via its N-terminal OB-fold domain, whereas RPA from higher eukaryotes show different binding modes to ssDNA. Our results show that LaRPA-1 is evolutionary distinct from other RPA-1 proteins and can potentially be used for targeting trypanosomatid telomeres. Copyright © 2014 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  20. Vaccination with DNA encoding truncated enterohemorrhagic Escherichia coli (EHEC factor for adherence-1 gene (efa-1’ confers protective immunity to mice infected with E. coli O157:H7

    Directory of Open Access Journals (Sweden)

    Roberto eRiquelme-Neira

    2016-01-01

    Full Text Available Enterohemorrhagic Escherichia coli (EHEC O157:H7 is the predominant causative agent of hemorrhagic colitis in humans and is the cause of haemolytic uraemic syndrome and other illnesses. Cattle have been implicated as the main reservoir of this organism. Here, we evaluated the immunogenicity and protective efficacy of a DNA vaccine encoding conserved sequences of truncated EHEC factor for adherence-1 (efa-1’ in a mouse model. Intranasal administration of plasmid DNA carrying the efa-1’ gene (pVAXefa-1’ into C57BL/6 mice elicited both humoral and cellular immune responses. In animals immunized with pVAXefa-1`, EHEC-secreted protein-specific IgM and IgG antibodies were detected in sera at day 45. Anti-EHEC-secreted protein sIgA was also detected in nasal and bronchoalveolar lavages. In addition, antigen-specific T-cell-proliferation, IL-10 and IFN-γ were observed upon re-stimulation with either heat-killed bacteria or EHEC-secreted proteins. Vaccinated animals were also protected against challenge with E. coli O157:H7 strain EDL933. These results suggest that DNA vaccine encoding efa-1´ have therapeutic potential in interventions against EHEC infections. This approach could lead to a new strategy in the production of vaccines that prevent infections in cattle.

  1. DNA sequence polymorphisms within the bovine guanine nucleotide-binding protein Gs subunit alpha (Gsα-encoding (GNAS genomic imprinting domain are associated with performance traits

    Directory of Open Access Journals (Sweden)

    Mullen Michael P

    2011-01-01

    Full Text Available Abstract Background Genes which are epigenetically regulated via genomic imprinting can be potential targets for artificial selection during animal breeding. Indeed, imprinted loci have been shown to underlie some important quantitative traits in domestic mammals, most notably muscle mass and fat deposition. In this candidate gene study, we have identified novel associations between six validated single nucleotide polymorphisms (SNPs spanning a 97.6 kb region within the bovine guanine nucleotide-binding protein Gs subunit alpha gene (GNAS domain on bovine chromosome 13 and genetic merit for a range of performance traits in 848 progeny-tested Holstein-Friesian sires. The mammalian GNAS domain consists of a number of reciprocally-imprinted, alternatively-spliced genes which can play a major role in growth, development and disease in mice and humans. Based on the current annotation of the bovine GNAS domain, four of the SNPs analysed (rs43101491, rs43101493, rs43101485 and rs43101486 were located upstream of the GNAS gene, while one SNP (rs41694646 was located in the second intron of the GNAS gene. The final SNP (rs41694656 was located in the first exon of transcripts encoding the putative bovine neuroendocrine-specific protein NESP55, resulting in an aspartic acid-to-asparagine amino acid substitution at amino acid position 192. Results SNP genotype-phenotype association analyses indicate that the single intronic GNAS SNP (rs41694646 is associated (P ≤ 0.05 with a range of performance traits including milk yield, milk protein yield, the content of fat and protein in milk, culled cow carcass weight and progeny carcass conformation, measures of animal body size, direct calving difficulty (i.e. difficulty in calving due to the size of the calf and gestation length. Association (P ≤ 0.01 with direct calving difficulty (i.e. due to calf size and maternal calving difficulty (i.e. due to the maternal pelvic width size was also observed at the rs

  2. Recent Advances in Vaccines Against Leishmania Based on Patent Applications.

    Science.gov (United States)

    Thomaz-Soccol, Vanete; Ferreira da Costa, Eduardo Scopel; Karp, Susan Grace; Junior Letti, Luiz Alberto; Soccol, Flavia Thomaz; Soccol, Carlos Ricardo

    2018-01-01

    Leishmaniasis is caused by parasites of the genus Leishmania, and represents a group of chronic diseases with an epidemiological and clinical diversity. The disease is endemic in tropical regions, being found in 98 countries, affecting around 12 million people, with an estimated increase of 1.5 million per year. The present review aims to analyze recent and most important patents regarding development of vaccines to improve immunization against leishmaniasis. For this purpose, the Web of Science - Derwent Innovations Index was consulted. There is also a short description of the licensed vaccines already on the market for commercialization, and a critical opinion on future developments. The data herein presented comprises national and international filings, thus considering the patent's country of origin, and can be used an indicator of a country's technological development regarding a specific field. Several types of vaccines against Leishmania were studied. The main classes comprise: vaccines using live cells (virulent or attenuated); dead cells; containing recombinant protein; using DNA of the parasite. United States (74 patents) leads the ranking of patent applications for vaccines against Leishmania, followed by Brazil (36 patents), which is an endemic region of leishmaniasis with 20,000 human cases of cutaneous leishmaniasis and over 3,000 cases of visceral form. This review showed that there is still a lot of space for development regarding the creation of a feasible, effective vaccine against leishmaniasis. The scientific community appears to be taking steps in the right direction, though. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

  3. Phylogenomic reconstruction supports supercontinent origins for Leishmania.

    Science.gov (United States)

    Harkins, Kelly M; Schwartz, Rachel S; Cartwright, Reed A; Stone, Anne C

    2016-03-01

    Leishmania, a genus of parasites transmitted to human hosts and mammalian/reptilian reservoirs by an insect vector, is the causative agent of the human disease complex leishmaniasis. The evolutionary relationships within the genus Leishmania and its origins are the source of ongoing debate, reflected in conflicting phylogenetic and biogeographic reconstructions. This study employs a recently described bioinformatics method, SISRS, to identify over 200,000 informative sites across the genome from newly sequenced and publicly available Leishmania data. This dataset is used to reconstruct the evolutionary relationships of this genus. Additionally, we constructed a large multi-gene dataset, using it to reconstruct the phylogeny and estimate divergence dates for species. We conclude that the genus Leishmania evolved at least 90-100 million years ago, supporting a modified version of the Multiple Origins hypothesis that we call the Supercontinent hypothesis. According to this scenario, separate Leishmania clades emerged prior to, and during, the breakup of Gondwana. Additionally, we confirm that reptile-infecting Leishmania are derived from mammalian forms and that the species that infect porcupines and sloths form a clade long separated from other species. Finally, we firmly place the guinea-pig infecting species, Leishmaniaenriettii, the globally dispersed Leishmaniasiamensis, and the newly identified Australian species from a kangaroo, as sibling species whose distribution arises from the ancient connection between Australia, Antarctica, and South America. Copyright © 2015 Elsevier B.V. All rights reserved.

  4. The Gut Microbiome of the Vector Lutzomyia longipalpis Is Essential for Survival of Leishmania infantum.

    Science.gov (United States)

    Kelly, Patrick H; Bahr, Sarah M; Serafim, Tiago D; Ajami, Nadim J; Petrosino, Joseph F; Meneses, Claudio; Kirby, John R; Valenzuela, Jesus G; Kamhawi, Shaden; Wilson, Mary E

    2017-01-17

    The vector-borne disease leishmaniasis, caused by Leishmania species protozoa, is transmitted to humans by phlebotomine sand flies. Development of Leishmania to infective metacyclic promastigotes in the insect gut, a process termed metacyclogenesis, is an essential prerequisite for transmission. Based on the hypothesis that vector gut microbiota influence the development of virulent parasites, we sequenced midgut microbiomes in the sand fly Lutzomyia longipalpis with or without Leishmania infantum infection. Sucrose-fed sand flies contained a highly diverse, stable midgut microbiome. Blood feeding caused a decrease in microbial richness that eventually recovered. However, bacterial richness progressively decreased in L. infantum-infected sand flies. Acetobacteraceae spp. became dominant and numbers of Pseudomonadaceae spp. diminished coordinately as the parasite underwent metacyclogenesis and parasite numbers increased. Importantly, antibiotic-mediated perturbation of the midgut microbiome rendered sand flies unable to support parasite growth and metacyclogenesis. Together, these data suggest that the sand fly midgut microbiome is a critical factor for Leishmania growth and differentiation to its infective state prior to disease transmission. Leishmania infantum, a parasitic protozoan causing fatal visceral leishmaniasis, is transmitted to humans through the bite of the sand fly Lutzomyia longipalpis Development of the parasite to its virulent metacyclic state occurs in the sand fly gut. In this study, the microbiota within the Lu. longipalpis midgut was delineated by 16S ribosomal DNA (rDNA) sequencing, revealing a highly diverse community composition that lost diversity as parasites developed to their metacyclic state and increased in abundance in infected flies. Perturbing sand fly gut microbiota with an antibiotic cocktail, which alone had no effect on either the parasite or the fly, arrested both the development of virulent parasites and parasite expansion

  5. Vaccine development against Leishmania donovani

    Directory of Open Access Journals (Sweden)

    Amrita eDas

    2012-05-01

    Full Text Available Visceral leishmaniasis (VL caused by Leishmania donovani and Leishmania infantum/ chagasi represents the second most challenging infectious disease worldwide, affecting nearly 500,000 people and 60,000 deaths annually. Zoonotic VL (ZVL caused by L. infantum is re-emergent canid zoonoses which represents a complex epidemiological cycle in New world where domestic dogs serve as reservoir host responsible for potentially fatal human infection where dog culling is the only control measure for eliminating reservoir host. Lifelong immunity in human against reinfection has motivated several attempts in developing prophylactic vaccines against the disease but very few have progressed beyond experimental stage. Absence of any licensed vaccine along with high toxicity and increasing resistance to the current chemotherapeutic drugs has further complicated the situation in endemic regions of the world. Advances in vaccinology, including recombinant proteins, novel antigen-delivery systems/adjuvants, heterologous prime-boost regimens and strategies for intracellular antigen presentation, have contributed to recent advances in vaccine development against VL. Attempts to develop an effective vaccine for use in domestic dogs in areas of canine VL should be pursued for preventing human infection. Studies in animal models and human patients have revealed the pathogenic mechanisms of disease progression and features of protective immunity. This review will summarize the accumulated knowledge about pathogenesis, immune response and prerequisites for protective immunity against human VL. Authors will discuss promising vaccine targets, their developmental status and future prospects in a quest for rational vaccine development against VL. In addition, several challenges such as safety issues, a renewed and coordinated commitment to basic research, preclinical studies and trial design will be addressed to overcome the problems faced in developing effective vaccines

  6. Detection of Leishmania amazonensis and Leishmania braziliensis in Culicoides (Diptera, Ceratopogonidae) in an endemic area of cutaneous leishmaniasis in the Brazilian Amazonia.

    Science.gov (United States)

    Rebêlo, José Manuel Macário; Rodrigues, Bruno Leite; Bandeira, Maria da Conceição Abreu; Moraes, Jorge Luiz Pinto; Fonteles, Raquel Silva; Pereira, Silma Regina Ferreira

    2016-12-01

    Biting midges in the genus Culicoides act as vectors of arboviruses throughout the world and as vectors of filariasis in Latin America, the Caribbean, and parts of Africa. Although Culicoides spp. are currently not considered to be vectors of Leishmania protozoa, the high abundance of biting midges in areas with active cutaneous leishmaniasis transmission points to the possibility of Culicoides infection by these pathogens. We used PCR to test captured Culicoides species for natural infection with Leishmania spp. We tested 450 Culicoides females, divided into 30 pools of 15 individuals each, as follows: nine pools of C. foxi (135 specimens), seven pools of C. filariferus (105), seven pools of C. insignis (105), five pools of C. ignacioi (75), and two pools of C. flavivenula (30). PCR confirmed the presence of Leishmania braziliensis DNA in C. ignacioi (0.14%), C. insignis (0.14%), and C. foxi (0.11); and Le. amazonensis DNA in C. filariferus (0.14%) and C. flavivenula (0.50%). We conclude that these Culicoides species can be naturally infected, but vector competence and transmission capability must be confirmed in future studies. Our results warrant further investigation into the role of these biting midge species in the leishmaniasis epidemiological cycle. © 2016 The Society for Vector Ecology.

  7. Polymerase chain reaction-based method for the identification of Leishmania (Viannia) braziliensis and Leishmania (Viannia) guyanensis in mucosal tissues conserved in paraffin.

    Science.gov (United States)

    Prestes, Suzane Ribeiro; Guerra, Jorge Augusto de Oliveira; Romero, Gustavo Adolfo Sierra; Magalhaes, Laylah Kelre Costa; Santana, Rosa Amelia Gonçalves; Maciel, Marcel Gonçalves; Custódio, Ana; Barbosa, Maria das Graças Vale; Silveira, Henrique

    2015-01-01

    In the Americas, mucosal leishmaniasis is primarily associated with infection by Leishmania (Viannia) braziliensis. However, Leishmania (Viannia) guyanensis is another important cause of this disease in the Brazilian Amazon. In this study, we aimed at detecting Leishmaniadeoxyribonucleic acid (DNA) within paraffin-embedded fragments of mucosal tissues, and characterizing the infecting parasite species. We evaluated samples collected from 114 patients treated at a reference center in the Brazilian Amazon by polymerase chain reaction (PCR) and restriction fragment length polymorphism (RFLP) analyses. Direct examination of biopsy imprints detected parasites in 10 of the 114 samples, while evaluation of hematoxylin and eosin-stained slides detected amastigotes in an additional 17 samples. Meanwhile, 31/114 samples (27.2%) were positive for Leishmania spp. kinetoplast deoxyribonucleic acid (kDNA) by PCR analysis. Of these, 17 (54.8%) yielded amplification of the mini-exon PCR target, thereby allowing for PCR-RFLP-based identification. Six of the samples were identified as L. (V.) braziliensis, while the remaining 11 were identified as L. (V.) guyanensis. The results of this study demonstrate the feasibility of applying molecular techniques for the diagnosis of human parasites within paraffin-embedded tissues. Moreover, our findings confirm that L. (V.) guyanensisis a relevant causative agent of mucosal leishmaniasis in the Brazilian Amazon.

  8. Tlys, a newly identified Sulfolobus spindle-shaped virus 1 transcript expressed in the lysogenic state, encodes a DNA-binding protein interacting at the promoters of the early genes

    DEFF Research Database (Denmark)

    Fusco, Salvatore; She, Qunxin; Bartolucci, Simonetta

    2013-01-01

    -binding motif. DNA-binding assays demonstrated that the recombinant F55, purified from Escherichia coli, is indeed a putative transcription factor able to recognize site specifically target sequences in the promoters of the early induced T5, T6, and Tind transcripts, as well as of its own promoter. Binding...... the growth of the lysogenic host. The correponding gene f55 lies between two transcriptional units (T6 and Tind) that are upregulated upon UV irradiation. The open reading frame f55 encodes a 6.3-kDa protein which shows sequence identity with negative regulators that fold into the ribbon-helix-helix DNA....... Taking together the transcriptional analysis data and the biochemical evidences, we surmise that the protein F55 is involved in the regulation of the lysogenic state of SSV1....

  9. A Cutaneous Ulcer Resulting from Mycobacterium ulcerans—Leishmania braziliensis Coinfection in South America

    Science.gov (United States)

    Mougin, Benjamin; Avenel-Audran, Martine; Hasseine, Lilia; Martin, Ludovic; Cottin, Jane; Pomares, Christelle; Delaunay, Pascal; Marty, Pierre; Ravel, Christophe; Chabasse, Dominique; Abgueguen, Pierre

    2011-01-01

    Buruli ulcer is a tropical skin disease caused by Mycobacterium ulcerans. Its mode of transmission is not yet clearly understood. We report here a cutaneous ulcer in a European traveler in South America resulting from a coinfection detected specifically for Mycobacterium ulcerans and Leishmania braziliensis DNA with real-time polymerase chain reaction. This observation of a unique cutaneous ulcer raises the issue about possible modes of transmission of those two pathogens by the same vector. PMID:22049045

  10. Serological and molecular survey of Leishmania infection in dogs from Luanda, Angola.

    Science.gov (United States)

    Vilhena, Hugo; Granada, Sara; Oliveira, Ana Cristina; Schallig, Henk D F H; Nachum-Biala, Yaarit; Cardoso, Luís; Baneth, Gad

    2014-03-24

    Canine leishmaniosis (CanL) due to Leishmania infantum is a global zoonosis endemic in more than 70 countries in Europe, North Africa, Asia and America; however, data on this infection is scarce from southern Africa. The aim of this study was to survey dogs in Luanda, Angola, for Leishmania infection. One hundred-and-three dogs presented to a veterinary medical centre in Luanda were serologically and molecularly assessed for Leishmania with the direct agglutination test (DAT) and polymerase chain reaction (PCR). Two dogs were seropositive, with DAT titres of 800 and ≥6400; the latter was also found to be PCR-positive and confirmed to be infected with L. infantum by DNA sequence analysis. No other dog was found to be PCR-positive. The first dog had been imported from Portugal, but the latter had never left Angola (neither had its parents), strongly suggesting an autochthonous infection. Although other cases of CanL have previously been described in the country, this is the first reported study of canine Leishmania infection at the population level, as well as the first report on the molecular characterization of L. infantum in dogs from Angola.

  11. Identification of species of leishmania isolated from patients with cutaneous leishmaniasis in Kermanshah; using RAPD-PCR technique

    Directory of Open Access Journals (Sweden)

    Yazdan Hamzavi

    2010-09-01

    Full Text Available Annually many numbers of pationts with Cutaneous Leishmaniasis (CL have been reported in Kermanshah province- IRAN. The study aimed to identify species of Leishmania isolated from patients with CT in Kermanshah. Seven isolates of Leishmania obtained from patients with CL, without any travelling to other provinces, were cultured in NNN medium. After mass production of leptomonads in RPMI 1640 medium DNA was purified and the species were diagnosed using RAPD-PCR technique. The study of electrophoretic fingerprints of the product of RAPD-PCR in seven isolates showed that Leshmania major was the causative agent of CL patients in Kermanshah province. More studies in this field recommended.

  12. Metacyclic promastigotes of Leishmania amazonensis selection using gamma irradiation

    Energy Technology Data Exchange (ETDEWEB)

    Bonetti, Franco C.; Nascimento, Nanci do [Instituto de Pesquisas Energeticas e Nucleares (IPEN), Sao Paulo, SP (Brazil). Centro de Biologia Molecular]. E-mail: fbonetti@usp.br; Andrade Junior, Heitor Franco de [Instituto de Medicina Tropical de Sao Paulo, SP (Brazil). Lab. de Protozoologia

    2005-07-01

    Leishmania spp. causes a spectrum of human diseases, ranging from self-healing skin lesions to severe and lethal visceral disease. In previous work we demonstrated that the protein and nucleic acid metabolism and oxidative respiration were severely affected by irradiation, in a dose response way, but a small but representative fractions are relatively radio resistant, surviving after 800 Gy of {sup 60}Co irradiation. The best explanation could be a selection of metacyclic promastigotes. In these forms, the G0 state allows the adequate correction of DNA repair after the irradiation insult. In this work, we are looking for the ideal radiation dose to select the higher proportion of metacyclic forms of L.. (L.) amazonensis in culture. Parasites were grown in RPMI 1640 medium, plus 20% fetal calf serum, than they were irradiated with different doses ranging between 25 and 400 Gy. Parasites irradiated at 400 Gy infected, proportionally, more cells than parasites irradiated at other doses. To confirm this metacyclogenesis, a complement lysis assay was performed with 5, 10 and 20% of male guinea pig blood serum at 20 deg C for 3 hours, and parasites counted. Guinea pig serum a 10% promotes more lysis, with 200 Gy irradiated parasites being less affected, probably due to metacyclic selection. These preliminary results suggests that the ionizing radiation, specially between 200 and 400 Gy, could be a alternative tool for the selection of metacyclic forms of Leishmania amazonensis in culture. (a0011uth.

  13. Metacyclic promastigotes of Leishmania amazonensis selection using gamma irradiation

    International Nuclear Information System (INIS)

    Bonetti, Franco C.; Nascimento, Nanci do; Andrade Junior, Heitor Franco de

    2005-01-01

    Leishmania spp. causes a spectrum of human diseases, ranging from self-healing skin lesions to severe and lethal visceral disease. In previous work we demonstrated that the protein and nucleic acid metabolism and oxidative respiration were severely affected by irradiation, in a dose response way, but a small but representative fractions are relatively radio resistant, surviving after 800 Gy of 60 Co irradiation. The best explanation could be a selection of metacyclic promastigotes. In these forms, the G0 state allows the adequate correction of DNA repair after the irradiation insult. In this work, we are looking for the ideal radiation dose to select the higher proportion of metacyclic forms of L.. (L.) amazonensis in culture. Parasites were grown in RPMI 1640 medium, plus 20% fetal calf serum, than they were irradiated with different doses ranging between 25 and 400 Gy. Parasites irradiated at 400 Gy infected, proportionally, more cells than parasites irradiated at other doses. To confirm this metacyclogenesis, a complement lysis assay was performed with 5, 10 and 20% of male guinea pig blood serum at 20 deg C for 3 hours, and parasites counted. Guinea pig serum a 10% promotes more lysis, with 200 Gy irradiated parasites being less affected, probably due to metacyclic selection. These preliminary results suggests that the ionizing radiation, specially between 200 and 400 Gy, could be a alternative tool for the selection of metacyclic forms of Leishmania amazonensis in culture. (author)

  14. Gene Cloning of Iranian Leishmania major Mannose-1-Phosphate Guanyltransferase

    Directory of Open Access Journals (Sweden)

    R Salehi

    2009-07-01

    Full Text Available "nBackground: Leishmania is an obligatory intracellular protozoan parasite, which infects human be­ings when infected sand fly vector takes a blood meal.  Most efforts are towards designing an effective vaccine to prevent leishmaniasis. In this way, development of candidate antigen for vaccine has spe­cial im­portant. In this study, we cloned mannose-1-phosphate guanyltransferase gene of Iranian L .major in pET32a expression vector. "nMethods: Primers based on L. major mannose-1-phosphate guanyltransferase sequence gene was de­signed and synthesized. DNA of Leishmania promastigotes was extracted and PCR reaction was done. PCR product was cloned into pTZ57R and sub cloned into pET32a expression vector. "nResults: Recombinant plasmid containing 1140 bp as L. major mannose-1-phosphate guanyltrans­ferase gene was extracted and confirmed by restriction analysis. PCR product was sequenced and de­posited to GenBank. There were some differences in amino acid sequences between Iranian L. major mannose-1-phosphate guanyltransferase and others previously accepted in GenBank "nConclusion: We amplified and cloned Iranian L. major mannose-1-phosphate guanyltransferase successfully.

  15. 2-Alkynoic fatty acids inhibit topoisomerase IB from Leishmania donovani.

    Science.gov (United States)

    Carballeira, Néstor M; Cartagena, Michelle; Sanabria, David; Tasdemir, Deniz; Prada, Christopher F; Reguera, Rosa M; Balaña-Fouce, Rafael

    2012-10-01

    2-Alkynoic fatty acids display antimycobacterial, antifungal, and pesticidal activities but their antiprotozoal activity has received little attention. In this work we synthesized the 2-octadecynoic acid (2-ODA), 2-hexadecynoic acid (2-HDA), and 2-tetradecynoic acid (2-TDA) and show that 2-ODA is the best inhibitor of the Leishmania donovani DNA topoisomerase IB enzyme (LdTopIB) with an EC(50)=5.3±0.7μM. The potency of LdTopIB inhibition follows the trend 2-ODA>2-HDA>2-TDA, indicating that the effectiveness of inhibition depends on the fatty acid carbon chain length. All of the studied 2-alkynoic fatty acids were less potent inhibitors of the human topoisomerase IB enzyme (hTopIB) as compared to LdTopIB. 2-ODA also displayed in vitro activity against Leishmania donovani (IC(50)=11.0μM), but it was less effective against other protozoa, Trypanosoma cruzi (IC(50)=48.1μM) and Trypanosoma brucei rhodesiense (IC(50)=64.5μM). The antiprotozoal activity of the 2-alkynoic fatty acids, in general, followed the trend 2-ODA>2-HDA>2-TDA. The experimental information gathered so far indicates that 2-ODA is a promising antileishmanial compound. Copyright © 2012 Elsevier Ltd. All rights reserved.

  16. Screening for Inhibitors of Essential Leishmania Glucose Transporters

    Science.gov (United States)

    2013-07-01

    Leishmania Glucose Transporters PRINCIPAL INVESTIGATOR: Scott M. Landfear, Ph.D. CONTRACTING ORGANIZATION: Oregon Health & Science...COVERED 1 July 2009- 30 June 2013 4. TITLE AND SUBTITLE 5a. CONTRACT NUMBER Screening for Inhibitors of Essential Leishmania Glucose Transporters 5b...The objective of this project was to identify compounds that selectively inhibit the essential Leishmania glucose transporters and could hence serve

  17. Chondroitin sulfate-polyethylenimine copolymer-coated superparamagnetic iron oxide nanoparticles as an efficient magneto-gene carrier for microRNA-encoding plasmid DNA delivery

    Science.gov (United States)

    Lo, Yu-Lun; Chou, Han-Lin; Liao, Zi-Xian; Huang, Shih-Jer; Ke, Jyun-Han; Liu, Yu-Sheng; Chiu, Chien-Chih; Wang, Li-Fang

    2015-04-01

    MicroRNA-128 (miR-128) is an attractive therapeutic molecule with powerful glioblastoma regulation properties. However, miR-128 lacks biological stability and leads to poor delivery efficacy in clinical applications. In our previous study, we demonstrated two effective transgene carriers, including polyethylenimine (PEI)-decorated superparamagnetic iron oxide nanoparticles (SPIONs) as well as chemically-conjugated chondroitin sulfate-PEI copolymers (CPs). In this contribution, we report optimized conditions for coating CPs onto the surfaces of SPIONs, forming CPIOs, for magneto-gene delivery systems. The optimized weight ratio of the CPs and SPIONs is 2 : 1, which resulted in the formation of a stable particle as a good transgene carrier. The hydrodynamic diameter of the CPIOs is ~136 nm. The gel electrophoresis results demonstrate that the weight ratio of CPIO/DNA required to completely encapsulate pDNA is >=3. The in vitro tests of CPIO/DNA were done in 293 T, CRL5802, and U87-MG cells in the presence and absence of an external magnetic field. The magnetofection efficiency of CPIO/DNA was measured in the three cell lines with or without fetal bovine serum (FBS). CPIO/DNA exhibited remarkably improved gene expression in the presence of the magnetic field and 10% FBS as compared with a gold non-viral standard, PEI/DNA, and a commercial magnetofection reagent, PolyMag/DNA. In addition, CPIO/DNA showed less cytotoxicity than PEI/DNA and PolyMag/DNA against the three cell lines. The transfection efficiency of the magnetoplex improved significantly with an assisted magnetic field. In miR-128 delivery, a microRNA plate array and fluorescence in situ hybridization were used to demonstrate that CPIO/pMIRNA-128 indeed expresses more miR-128 with the assisted magnetic field than without. In a biodistribution test, CPIO/Cy5-DNA showed higher accumulation at the tumor site where an external magnet is placed nearby.MicroRNA-128 (miR-128) is an attractive therapeutic molecule

  18. cDNA for the human β2-adrenergic receptor: a protein with multiple membrane-spanning domains and encoded by a gene whose chromosomal location is shared with that of the receptor for platelet-derived growth factor

    International Nuclear Information System (INIS)

    Kobilka, B.K.; Dixon, R.A.F.; Frielle, T.

    1987-01-01

    The authors have isolated and sequenced a cDNA encoding the human β 2 -adrenergic receptor. The deduced amino acid sequence (413 residues) is that of a protein containing seven clusters of hydrophobic amino acids suggestive of membrane-spanning domains. While the protein is 87% identical overall with the previously cloned hamster β 2 -adrenergic receptor, the most highly conserved regions are the putative transmembrane helices (95% identical) and cytoplasmic loops (93% identical), suggesting that these regions of the molecule harbor important functional domains. Several of the transmembrane helices also share lesser degrees of identity with comparable regions of select members of the opsin family of visual pigments. They have localized the gene for the β 2 -adrenergic receptor to q31-q32 on chromosome 5. This is the same position recently determined for the gene encoding the receptor for platelet-derived growth factor and is adjacent to that for the FMS protooncogene, which encodes the receptor for the macrophage colony-stimulating factor

  19. Signal sequence and keyword trap in silico for selection of full-length human cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries.

    Science.gov (United States)

    Otsuki, Tetsuji; Ota, Toshio; Nishikawa, Tetsuo; Hayashi, Koji; Suzuki, Yutaka; Yamamoto, Jun-ichi; Wakamatsu, Ai; Kimura, Kouichi; Sakamoto, Katsuhiko; Hatano, Naoto; Kawai, Yuri; Ishii, Shizuko; Saito, Kaoru; Kojima, Shin-ichi; Sugiyama, Tomoyasu; Ono, Tetsuyoshi; Okano, Kazunori; Yoshikawa, Yoko; Aotsuka, Satoshi; Sasaki, Naokazu; Hattori, Atsushi; Okumura, Koji; Nagai, Keiichi; Sugano, Sumio; Isogai, Takao

    2005-01-01

    We have developed an in silico method of selection of human full-length cDNAs encoding secretion or membrane proteins from oligo-capped cDNA libraries. Fullness rates were increased to about 80% by combination of the oligo-capping method and ATGpr, software for prediction of translation start point and the coding potential. Then, using 5'-end single-pass sequences, cDNAs having the signal sequence were selected by PSORT ('signal sequence trap'). We also applied 'secretion or membrane protein-related keyword trap' based on the result of BLAST search against the SWISS-PROT database for the cDNAs which could not be selected by PSORT. Using the above procedures, 789 cDNAs were primarily selected and subjected to full-length sequencing, and 334 of these cDNAs were finally selected as novel. Most of the cDNAs (295 cDNAs: 88.3%) were predicted to encode secretion or membrane proteins. In particular, 165(80.5%) of the 205 cDNAs selected by PSORT were predicted to have signal sequences, while 70 (54.2%) of the 129 cDNAs selected by 'keyword trap' preserved the secretion or membrane protein-related keywords. Many important cDNAs were obtained, including transporters, receptors, and ligands, involved in significant cellular functions. Thus, an efficient method of selecting secretion or membrane protein-encoding cDNAs was developed by combining the above four procedures.

  20. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

    Science.gov (United States)

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-10-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  1. Comparison of LAMP and PCR for molecular mass screening of sand flies for Leishmania martiniquensis infection.

    Science.gov (United States)

    Tiwananthagorn, Saruda; Kato, Hirotomo; Yeewa, Ranchana; Muengpan, Amontip; Polseela, Raxsina; Leelayoova, Saovanee

    2017-02-01

    Leishmaniasis caused by Leishmania martiniquensis infection has been reported in human and domestic animals of Martinique Island, Germany, Switzerland, USA, Myanmar and Thailand. The peculiar clinical features of disseminated cutaneous and visceral forms co-existence render the urgent need of specific diagnostic tool to identify the natural sand fly vectors for effective prevention and control strategies. Loop-mediated isothermal amplification (LAMP) of 18S rRNA gene as well as polymerase chain reaction (PCR) of minicircle kinetoplast DNA gene (PCR-mkDNA) have never been applied to detect L. martiniquensis and L. siamensis in sand fly vectors. The present study was aimed to validate malachite green-LAMP (MG-LAMP) and PCR-mkDNA techniques to detect L. martiniquensis in sand fly vectors, compared with the conventional PCR of internal transcribed spacer 1 (PCR-ITS1). We compared the validity of LAMP of 18S rRNA gene and PCR-mkDNA, to PCR-ITS1 in simulation model of L. martiniquensis infection in Sergentomyia gemmea sand flies. Attributable to the sensitivity and specificity, PCR-mkDNA was consecutively applied to detect L. martiniquensis in 380 female sand fly individuals captured in the newly identified affected region of Lamphun Province, Thailand. Results showed that PCR-mkDNA could detect at least one promastigote per sand fly, which was 10-time superior to LAMP and PCR-ITS1. In addition, PCR-mkDNA was more specific, able to differentiate L. martiniquensis from other viscerotropic Leishmania species, such as L. siamensis, L. (L.) donovani, and L. (L.) infantum. Consecutively, mass screening of L. martiniquensis in 380 female sand fly individuals by PCR-mkDNA was implemented in a new affected area of Thailand where a patient with leishmaniasis/HIV co-infection resides; however Leishmania DNA was undetected. In conclusion, PCR-mkDNA is a promising tool for molecular mass screening of L. martiniquensis infection in outbreak areas where several species of Leishmania

  2. Comparison of LAMP and PCR for molecular mass screening of sand flies for Leishmania martiniquensis infection

    Science.gov (United States)

    Tiwananthagorn, Saruda; Kato, Hirotomo; Yeewa, Ranchana; Muengpan, Amontip; Polseela, Raxsina; Leelayoova, Saovanee

    2017-01-01

    BACKGROUND Leishmaniasis caused by Leishmania martiniquensis infection has been reported in human and domestic animals of Martinique Island, Germany, Switzerland, USA, Myanmar and Thailand. The peculiar clinical features of disseminated cutaneous and visceral forms co-existence render the urgent need of specific diagnostic tool to identify the natural sand fly vectors for effective prevention and control strategies. Loop-mediated isothermal amplification (LAMP) of 18S rRNA gene as well as polymerase chain reaction (PCR) of minicircle kinetoplast DNA gene (PCR-mkDNA) have never been applied to detect L. martiniquensis and L. siamensis in sand fly vectors. OBJECTIVE The present study was aimed to validate malachite green-LAMP (MG-LAMP) and PCR-mkDNA techniques to detect L. martiniquensis in sand fly vectors, compared with the conventional PCR of internal transcribed spacer 1 (PCR-ITS1). METHODS We compared the validity of LAMP of 18S rRNA gene and PCR-mkDNA, to PCR-ITS1 in simulation model of L. martiniquensis infection in Sergentomyia gemmea sand flies. Attributable to the sensitivity and specificity, PCR-mkDNA was consecutively applied to detect L. martiniquensis in 380 female sand fly individuals captured in the newly identified affected region of Lamphun Province, Thailand. FINDINGS AND MAIN CONCLUSIONS Results showed that PCR-mkDNA could detect at least one promastigote per sand fly, which was 10-time superior to LAMP and PCR-ITS1. In addition, PCR-mkDNA was more specific, able to differentiate L. martiniquensis from other viscerotropic Leishmania species, such as L. siamensis, L. (L.) donovani, and L. (L.) infantum. Consecutively, mass screening of L. martiniquensis in 380 female sand fly individuals by PCR-mkDNA was implemented in a new affected area of Thailand where a patient with leishmaniasis/HIV co-infection resides; however Leishmania DNA was undetected. In conclusion, PCR-mkDNA is a promising tool for molecular mass screening of L. martiniquensis

  3. In vitro activity of the beta-carboline alkaloids harmane, harmine, and harmaline toward parasites of the species Leishmania infantum.

    Science.gov (United States)

    Di Giorgio, C; Delmas, F; Ollivier, E; Elias, R; Balansard, G; Timon-David, P

    2004-01-01

    Harmane, harmine, and harmaline were investigated for their in vitro antileishmanial activity toward parasites of the species Leishmania infantum. Harmane and Harmine displayed a moderate antiproliferative activity toward human monocytes and exerted a weak antileishmanial activity toward both the promastigote and the amastigote forms of the parasite. Their mechanism of action on the promastigote form of the parasite involved interactions with DNA metabolism leading to an accumulation of parasites in the S-G(2)M phases of the cell-cycle. Harmaline, at the contrary, was deprived from toxicity toward human cells and Leishmania promastigotes, however it exerted a strong antileishmanial activity toward the intracellular amastigote form of the parasite. This property was shown to partly result from the capacity of the molecule to prevent parasite internalization within macrophages by inhibiting Leishmania PKC activity.

  4. Mapping of a Leishmania major gene/locus that confers pentamidine resistance by deletion and insertion of transposable element

    Directory of Open Access Journals (Sweden)

    Coelho Adriano C.

    2004-01-01

    Full Text Available Pentamidine (PEN is an alternative compound to treat antimony-resistant leishmaniasis patients, which cellular target remains unclear. One approach to the identification of prospective targets is to identify genes able to mediate PEN resistance following overexpression. Starting from a genomic library of transfected parasites bearing a multicopy episomal cosmid vector containing wild-type Leishmania major DNA, we isolated one locus capable to render PEN resistance to wild type cells after DNA transfection. In order to map this Leishmania locus, cosmid insert was deleted by two successive sets of partial digestion with restriction enzymes, followed by transfection into wild type cells, overexpression, induction and functional tests in the presence of PEN. To determine the Leishmania gene related to PEN resistance, nucleotide sequencing experiments were done through insertion of the transposon Mariner element of Drosophila melanogaster (mosK into the deleted insert to work as primer island. Using general molecular techniques, we described here this method that permits a quickly identification of a functional gene facilitating nucleotide sequence experiments from large DNA fragments. Followed experiments revealed the presence of a P-Glycoprotein gene in this locus which role in Leishmania metabolism has now been analyzed.

  5. Identification of cDNA encoding an additional α subunit of a human GTP-binding protein: Expression of three αi subtypes in human tissues and cell lines

    International Nuclear Information System (INIS)

    Kim, S.; Ang, S.L.; Bloch, D.B.; Bloch, K.D.; Kawahara, Y.; Tolman, C.; Lee, R.; Seidman, J.G.; Neer, E.J.

    1988-01-01

    The guanine nucleotide-binding proteins (G proteins), which mediate hormonal regulation of many membrane functions, are composed of α, β, and γ subunits. The authors have cloned and characterized cDNA from a human T-cell library encoding a form of α i that is different from the human α i subtypes previously reported. α i is the α subunit of a class of G proteins that inhibits adenylate cyclase and regulates other enzymes and ion channels. This cDNA encodes a polypeptide of 354 amino acids and is assigned to encode the α i-3 subtype of G proteins on the basis of its similarity to other α i -like cDNAs and the presence of a predicted site for ADP ribosylation by pertussis toxin. They have determined the expression of mRNA for this and two other subtypes of human α i (α i-1 and α i-2 ) in a variety of human fetal tissues and in human cell lines. All three α i subtypes were present in the tissues tested. However, analysis of individual cell types reveals specificity of α i-1 expression. mRNA for α i-1 is absent in T cells, B cells, and monocytes but is present in other cell lines. The finding of differential expression of α i-1 genes may permit characterization of distinct physiological roles for this α i subunit. mRNA for α i-2 and α i-3 was found in all the primary and transformed cell lines tested. Thus, some cells contain all three α i subtypes. This observation raises the question of how cells prevent cross talk among receptors that are coupled to effectors through such similar α proteins

  6. Cloning of a cDNA encoding the rat high molecular weight neurofilament peptide (NF-H): Developmental and tissue expression in the rat, and mapping of its human homologue to chromosomes 1 and 22

    International Nuclear Information System (INIS)

    Lieberburg, I.; Spinner, N.; Snyder, S.

    1989-01-01

    Neurofilaments (NFs) are the intermediate filaments specific to nervous tissue. Three peptides with apparent molecular masses of approximately 68 (NF-L), 145 (NF-M), and 200 (NF-H) kDa appear to be the major components of NF. The expression of these peptides is specific to nervous tissue and is developmentally regulated. Recently, complete cDNAs encoding NF-L and NF-M, and partial cDNAs encoding NF-H, have been described. To better understand the normal pathophysiology of NFs the authors chose to clone the cDNA encoding the rat NF-H peptide. Using monoclonal antibodies that recognized NF-H, they screened a rat brain λgt11 library and identified a clone that contained a 2,100-nucleotide cDNA insert representing the carboxyl-terminal portion of the NF-H protein. Levels of NF-H mRNA varied 20-fold among brain regions, with highest levels in pons/medulla, spinal cord, and cerebellum, and lowest levels in olfactory bulb and hypothalamus. Based on these results, the authors infer that half of the developmental increase and most of the interregional variation in the levels of the NF-H mRNA are mediated through message stabilization. Sequence information revealed that the carboxyl-terminal region of the NF-H peptide contained a unique serine-, proline-, alanine-, glutamic acid-, and lysine-rich repeat. Genomic blots revealed a single copy of the gene in the rat genome and two copies in the human genome. In situ hybridizations performed on human chromosomes mapped the NF-H gene to chromosomes 1 and 22

  7. Cloning and characterization of a cDNA encoding topoisomerase II in pea and analysis of its expression in relation to cell proliferation.

    Science.gov (United States)

    Reddy, M K; Nair, S; Tewari, K K; Mudgil, Y; Yadav, B S; Sopory, S K

    1999-09-01

    We have isolated and sequenced four overlapping cDNA clones to identify the full-length cDNA for topoisomerase II (PsTopII) from pea. Using degenerate primers, based on the conserved amino acid sequences of other eukaryotic type II topoisomerases, a 680 bp fragment was PCR-amplified with pea cDNA as template. This fragment was used as a probe to screen an oligo-dT-primed pea cDNA library. A partial cDNA clone was isolated that was truncated at the 3' end. RACE-PCR was employed to isolate the remaining portion of the gene. The total size of PsTopII is 4639 bp with an open reading frame of 4392 bp. The deduced amino acid sequence shows a strong homology to other eukaryotic topoisomerase II (topo II) at the N-terminus end. The topo II transcript was abundant in proliferative tissues. We also show that the level of topo II transcripts could be stimulated by exogenous application of growth factors that induced proliferation in vitro cultures. Light irradiation to etiolated tissue strongly stimulated the expression of topo II. These results suggest that topo II gene expression is up-regulated in response to light and hormones and correlates with cell proliferation. Besides, we have also isolated and analysed the 5'-flanking region of the pea TopII gene. This is first report on the isolation of a putative promoter for topoisomerase II from plants.

  8. DNA vaccines encoding proteins from wild-type and attenuated canine distemper virus protect equally well against wild-type virus challenge.

    Science.gov (United States)

    Nielsen, Line; Jensen, Trine Hammer; Kristensen, Birte; Jensen, Tove Dannemann; Karlskov-Mortensen, Peter; Lund, Morten; Aasted, Bent; Blixenkrone-Møller, Merete

    2012-10-01

    Immunity induced by DNA vaccines containing the hemagglutinin (H) and nucleoprotein (N) genes of wild-type and attenuated canine distemper virus (CDV) was investigated in mink (Mustela vison), a highly susceptible natural host of CDV. All DNA-immunized mink seroconverted, and significant levels of virus-neutralizing (VN) antibodies were present on the day of challenge with wild-type CDV. The DNA vaccines also primed the cell-mediated memory responses, as indicated by an early increase in the number of interferon-gamma (IFN-γ)-producing lymphocytes after challenge. Importantly, the wild-type and attenuated CDV DNA vaccines had a long-term protective effect against wild-type CDV challenge. The vaccine-induced immunity induced by the H and N genes from wild-type CDV and those from attenuated CDV was comparable. Because these two DNA vaccines were shown to protect equally well against wild-type virus challenge, it is suggested that the genetic/antigenic heterogeneity between vaccine strains and contemporary wild-type strains are unlikely to cause vaccine failure.

  9. Immunogenicity and efficacy of a bivalent DNA vaccine containing LeIF and TSA genes against murine cutaneous leishmaniasis.

    Science.gov (United States)

    Maspi, Nahid; Ghaffarifar, Fatemeh; Sharifi, Zohreh; Dalimi, Abdolhossein; Dayer, Mohammad Saaid

    2017-03-01

    There is no effective vaccine for the prevention and elimination of leishmaniasis. For this reason, we assessed the protective effects of DNA vaccines containing LeIF, TSA genes alone, or LeIF-TSA fusion against cutaneous leishmaniasis pEGFP-N1 plasmid (empty vector) and phosphate buffer saline (PBS) were used as control groups. Therefore, cellular and humoral immune responses were evaluated before and after the challenge with Leishmania major. Lesion diameter was also measured 3-12 weeks after challenge. All immunized mice with plasmid DNA encoding Leishmania antigens induced the partial immunity characterized by increased IFN-γ and IgG2a levels compared with control groups (p TSA, and LeIF-TSA, respectively, than in PBS group at 12th week post infection. IFN/IL-4 and IgG2a/IgG1 ratios indicated that group receiving LeIF-TSA fusion had the highest IFN-γ and IgG2a levels. In this study, DNA immunization promoted Th1 immune response characterized by higher IFN-γ and IgG2a levels and also reduction in lesion size. These results showed that a bivalent vaccine containing two distinct antigens may induce more potent immune responses against leishmaniasis. © 2017 APMIS. Published by John Wiley & Sons Ltd.

  10. In vitro anti-leishmania evaluation of nickel complexes with a triazolopyrimidine derivative against Leishmania infantum and Leishmania braziliensis.

    Science.gov (United States)

    Ramírez-Macías, Inmaculada; Maldonado, Carmen R; Marín, Clotilde; Olmo, Francisco; Gutiérrez-Sánchez, Ramón; Rosales, María J; Quirós, Miguel; Salas, Juan M; Sánchez-Moreno, Manuel

    2012-07-01

    Studies on the anti-proliferative activity in vitro of seven ternary nickel (II) complexes with a triazolopyrimidine derivative and different aliphatic or aromatic amines as auxiliary ligands against promastigote and amastigote forms of Leishmania infantum and Leishmania braziliensis have been carried out. These compounds are not toxic for the host cells and two of them are effective at lower concentrations than the reference drug used in the present study (Glucantime). In general, the in vitro growth rate of Leishmania spp. was reduced, its capacity to infect cells was negatively affected and the multiplication of the amastigotes decreased. Ultrastructural analysis and metabolism excretion studies were executed in order to propose a possible mechanism for the action of the assayed compounds. Our results show that the potential mechanism is at the level of organelles membranes, either by direct action on the microtubules or by their disorganization, leading to vacuolization, degradation and ultimately cell death. Copyright © 2012 Elsevier Inc. All rights reserved.

  11. Leishmania Hijacks Myeloid Cells for Immune Escape

    Directory of Open Access Journals (Sweden)

    María Martínez-López

    2018-05-01

    Full Text Available Protozoan parasites of the Leishmania genus are the causative agents of leishmaniasis, a group of neglected tropical diseases whose clinical manifestations vary depending on the infectious Leishmania species but also on host factors. Recognition of the parasite by host myeloid immune cells is a key to trigger an effective Leishmania-specific immunity. However, the parasite is able to persist in host myeloid cells by evading, delaying and manipulating host immunity in order to escape host resistance and ensure its transmission. Neutrophils are first in infiltrating infection sites and could act either favoring or protecting against infection, depending on factors such as the genetic background of the host or the parasite species. Macrophages are the main host cells where the parasites grow and divide. However, macrophages are also the main effector population involved in parasite clearance. Parasite elimination by macrophages requires the priming and development of an effector Th1 adaptive immunity driven by specific subtypes of dendritic cells. Herein, we will provide a comprehensive outline of how myeloid cells regulate innate and adaptive immunity against Leishmania, and the mechanisms used by the parasites to promote their evasion and sabotage. Understanding the interactions between Leishmania and the host myeloid cells may lead to the development of new therapeutic approaches and improved vaccination to leishmaniases, an important worldwide health problem in which current therapeutic or preventive approaches are limited.

  12. Cryopreservation of Leishmania Species in Manisa Province.

    Science.gov (United States)

    Çavuş, İbrahim; Ocak, Fulya; Kaya, Tuğba; Özbilgin, Ahmet

    2017-09-01

    It was aimed to assess the success of the cryopreservation process which is carried out in order to preserve the genetic material and the virulence of the Leishmania species that are an important health problem in our region. Leishmania tropica, L. infantum, L. major, and L. donovani strains in Novy-MacNeal-Nicolle (NNN) medium in MCBU were used. Promastigotes cultured in the NNN medium were transferred to RPMI 1640 medium; promastigotes in the logarithmic phase were washed three times with PBS, and 15% dimethylsulfoxide (DMSO) was added. Leishmania species were transferred to 12 separate tubes. The tubes were stored at -86°C for one night by placing them in Coolcell boxes. The tubes were transferred into a liquid nitrogen tank. One cryotube per Leishmania strain is thawed monthly and cultured in NNN medium. For the duration of study it was observed that each Leishmania isolate preserved 60-65% of their viability and entered the logarithmic phase on the 7th day following the inoculation in the NNN medium. Abnormalities in the structures and movements of the promastigotes were not observed in microscopic examinations. The following conclusions were made: cryopreservation is important for studies planned related to leishmaniasis and cryopreservation with DMSO is successful.

  13. CRISPR-Cas9-Mediated Genome Editing in Leishmania donovani.

    Science.gov (United States)

    Zhang, Wen-Wei; Matlashewski, Greg

    2015-07-21

    The prokaryotic CRISPR (clustered regularly interspaced short palindromic repeat)-Cas9, an RNA-guided endonuclease, has been shown to mediate efficient genome editing in a wide variety of organisms. In the present study, the CRISPR-Cas9 system has been adapted to Leishmania donovani, a protozoan parasite that causes fatal human visceral leishmaniasis. We introduced the Cas9 nuclease into L. donovani and generated guide RNA (gRNA) expression vectors by using the L. donovani rRNA promoter and the hepatitis delta virus (HDV) ribozyme. It is demonstrated within that L. donovani mainly used homology-directed repair (HDR) and microhomology-mediated end joining (MMEJ) to repair the Cas9 nuclease-created double-strand DNA break (DSB). The nonhomologous end-joining (NHEJ) pathway appears to be absent in L. donovani. With this CRISPR-Cas9 system, it was possible to generate knockouts without selection by insertion of an oligonucleotide donor with stop codons and 25-nucleotide homology arms into the Cas9 cleavage site. Likewise, we disrupted and precisely tagged endogenous genes by inserting a bleomycin drug selection marker and GFP gene into the Cas9 cleavage site. With the use of Hammerhead and HDV ribozymes, a double-gRNA expression vector that further improved gene-targeting efficiency was developed, and it was used to make precise deletion of the 3-kb miltefosine transporter gene (LdMT). In addition, this study identified a novel single point mutation caused by CRISPR-Cas9 in LdMT (M381T) that led to miltefosine resistance, a concern for the only available oral antileishmanial drug. Together, these results demonstrate that the CRISPR-Cas9 system represents an effective genome engineering tool for L. donovani. Leishmania donovani is the causative agent of fatal visceral leishmaniasis. To understand Leishmania infection and pathogenesis and identify new drug targets for control of leishmaniasis, more-efficient ways to manipulate this parasite genome are required. In this

  14. Parasitological Confirmation and Analysis of Leishmania Diversity in Asymptomatic and Subclinical Infection following Resolution of Cutaneous Leishmaniasis.

    Science.gov (United States)

    Rosales-Chilama, Mariana; Gongora, Rafael E; Valderrama, Liliana; Jojoa, Jimena; Alexander, Neal; Rubiano, Luisa C; Cossio, Alexandra; Adams, Emily R; Saravia, Nancy G; Gomez, María Adelaida

    2015-12-01

    The contribution of individuals with subclinical infection to the transmission and endemicity of cutaneous leishmaniasis (CL) is unknown. Immunological evidence of exposure to Leishmania in residents of endemic areas has been the basis for defining the human population with asymptomatic infection. However, parasitological confirmation of subclinical infection is lacking. We investigated the presence and viability of Leishmania in blood and non-invasive mucosal tissue samples from individuals with immunological evidence of subclinical infection in endemic areas for CL caused by Leishmania (Viannia) in Colombia. Detection of Leishmania kDNA was conducted by PCR-Southern Blot, and parasite viability was confirmed by amplification of parasite 7SLRNA gene transcripts. A molecular tool for genetic diversity analysis of parasite populations causing persistent subclinical infection based on PCR amplification and sequence analysis of an 82bp region between kDNA conserved blocks 1 and 2 was developed. Persistent Leishmania infection was demonstrated in 40% (46 of 114) of leishmanin skin test (LST) positive individuals without active disease; parasite viability was established in 59% of these (27 of 46; 24% of total). Parasite burden quantified from circulating blood monocytes, nasal, conjunctival or tonsil mucosal swab samples was comparable, and ranged between 0.2 to 22 parasites per reaction. kDNA sequences were obtained from samples from 2 individuals with asymptomatic infection and from 26 with history of CL, allowing genetic distance analysis that revealed diversity among sequences and clustering within the L. (Viannia) subgenus. Our results provide parasitological confirmation of persistent infection among residents of endemic areas of L. (Viannia) transmission who have experienced asymptomatic infection or recovered from CL, revealing a reservoir of infection that potentially contributes to the endemicity and transmission of disease. kDNA genotyping establishes proof

  15. Parasitological Confirmation and Analysis of Leishmania Diversity in Asymptomatic and Subclinical Infection following Resolution of Cutaneous Leishmaniasis.

    Directory of Open Access Journals (Sweden)

    Mariana Rosales-Chilama

    2015-12-01

    Full Text Available The contribution of individuals with subclinical infection to the transmission and endemicity of cutaneous leishmaniasis (CL is unknown. Immunological evidence of exposure to Leishmania in residents of endemic areas has been the basis for defining the human population with asymptomatic infection. However, parasitological confirmation of subclinical infection is lacking.We investigated the presence and viability of Leishmania in blood and non-invasive mucosal tissue samples from individuals with immunological evidence of subclinical infection in endemic areas for CL caused by Leishmania (Viannia in Colombia. Detection of Leishmania kDNA was conducted by PCR-Southern Blot, and parasite viability was confirmed by amplification of parasite 7SLRNA gene transcripts. A molecular tool for genetic diversity analysis of parasite populations causing persistent subclinical infection based on PCR amplification and sequence analysis of an 82bp region between kDNA conserved blocks 1 and 2 was developed.Persistent Leishmania infection was demonstrated in 40% (46 of 114 of leishmanin skin test (LST positive individuals without active disease; parasite viability was established in 59% of these (27 of 46; 24% of total. Parasite burden quantified from circulating blood monocytes, nasal, conjunctival or tonsil mucosal swab samples was comparable, and ranged between 0.2 to 22 parasites per reaction. kDNA sequences were obtained from samples from 2 individuals with asymptomatic infection and from 26 with history of CL, allowing genetic distance analysis that revealed diversity among sequences and clustering within the L. (Viannia subgenus.Our results provide parasitological confirmation of persistent infection among residents of endemic areas of L. (Viannia transmission who have experienced asymptomatic infection or recovered from CL, revealing a reservoir of infection that potentially contributes to the endemicity and transmission of disease. kDNA genotyping

  16. First evidence of autochthonous cases of Leishmania (Leishmania) infantum in horse (Equus caballus) in the Americas and mixed infection of Leishmania infantum and Leishmania (Viannia) braziliensis.

    Science.gov (United States)

    Soares, Isabel R; Silva, Soraia O; Moreira, Filipe Moraghi; Prado, Luan Gavião; Fantini, Priscila; Maranhão, Renata de Pino Albuquerque; da Silva Filho, José Monteiro; Melo, Maria Norma; Palhares, Maristela S

    2013-11-08

    This study reports the first evidence of infection by Leishmania infantum in Equus caballus in Americas and the first mixed infection of L. infantum/Leishmania braziliensis on this mammalian species in the world. The diagnoses was based on presence of parasites in lesions and bone marrow aspirates, their identification by using specific primers for L. infantum and L. braziliensis complexes and also serological methods IFAT and ELISA. The analysis of the PCR products suggested mixed infection in three animals. Further studies involving equine leishmaniasis are carrying out in order to clarify the dynamic of Leishmania sp. in this mammalian specie and their role in the transmission of those parasites in urban endemic area of Belo Horizonte, Minas Gerais State, Brazil. Copyright © 2013 Elsevier B.V. All rights reserved.

  17. Molecular cloning of a cDNA encoding human calumenin, expression in Escherichia coli and analysis of its Ca2+-binding activity

    DEFF Research Database (Denmark)

    Vorum, H; Liu, X; Madsen, Peder

    1998-01-01

    By microsequencing and cDNA cloning we have identified the transformation-sensitive protein No. IEF SSP 9302 as the human homologue of calumenin. The nucleotide sequence predicts a 315 amino acid protein with high identity to murine and rat calumenin. The deduced protein contains a 19 amino acid N...

  18. Enhanced immune response and protective effects of nano-chitosan-based DNA vaccine encoding T cell epitopes of Esat-6 and FL against Mycobacterium tuberculosis infection.

    Directory of Open Access Journals (Sweden)

    Ganzhu Feng

    Full Text Available Development of a novel and effective vaccine against Mycobacterium tuberculosis (M.tb is a challenging for preventing TB infection. In this study, a novel nanoparticle-based recombinant DNA vaccine was developed, which contains Esat-6 three T cell epitopes (Esat-6/3e and fms-like tyrosine kinase 3 ligand (FL genes (termed Esat-6/3e-FL, and was enveloped with chitosan (CS nanoparticles (nano-chitosan. The immunologic and protective efficacy of the nano-chitosan-based DNA vaccine (termed nano-Esat-6/3e-FL was assessed in C57BL/6 mice after intramuscular prime vaccination with the plasmids DNA and nasal boost with the Esat-6/3e peptides. The results showed that the immunized mice remarkably elicited enhanced T cell responses and protection against M.tb H37Rv challenge. These findings indicate that the nano-chitosan can significantly elevate the immunologic and protective effects of the DNA vaccine, and the nano-Esat-6/3e-FL is a useful vaccine for preventing M.tb infection in mice.

  19. DNA binding sites recognised in vitro by a knotted class 1 homeodomain protein encoded by the hooded gene, k, in barley (Hordeum vulgare)

    DEFF Research Database (Denmark)

    Krusell, L; Rasmussen, I; Gausing, K

    1997-01-01

    of knotted1 from maize was isolated from barley seedlings and expressed as a maltose binding protein fusion in E. coli. The purified HvH21-fusion protein selected DNA fragments with 1-3 copies of the sequence TGAC. Gel shift experiments showed that the TGAC element was required for binding and the results...

  20. Molecular detection of Leishmania spp. in road-killed wild mammals in the Central Western area of the State of São Paulo, Brazil.

    Science.gov (United States)

    Richini-Pereira, Virginia Bodelão; Marson, Pamela Merlo; Hayasaka, Enio Yoshinori; Victoria, Cassiano; da Silva, Rodrigo Costa; Langoni, Hélio

    2014-01-01

    Road-killed wild animals have been classified as sentinels for detecting such zoonotic pathogens as Leishmania spp., offering new opportunities for epidemiological studies of this infection. This study aimed to evaluate the presence of Leishmania spp. and Leishmania chagasi DNA by PCR in tissue samples (lung, liver, spleen, kidney, heart, mesenteric lymph node and adrenal gland) from 70 road-killed wild animals. DNA was detected in tissues of one Cavia aperea (Brazilian guinea pig), five Cerdocyon thous (crab-eating fox), one Dasypus septemcinctus (seven-banded armadillo), two Didelphis albiventris (white-eared opossum), one Hydrochoerus hydrochoeris (capybara), two Myrmecophaga tridactyla (giant anteater), one Procyon cancrivorus (crab-eating raccoon), two Sphiggurus spinosus (porcupine) and one Tamandua tetradactyla (lesser anteater) from different locations in the Central Western part of São Paulo state. The Leishmania chagasi DNA were confirmed in mesenteric lymph node of one Cerdocyon thous. Results indicated common infection in wild animals. The approach employed herein proved useful for detecting the environmental occurrence of Leishmania spp. and L. chagasi, as well as determining natural wild reservoirs and contributing to understand the host-parasite interaction.

  1. Leishmania infantum nicotinamidase is required for late-stage development in its natural sand fly vector, Phlebotomus perniciosus

    OpenAIRE

    Gazanion, Elodie; Seblova, V.; Votypka, J.; Vergnes, Baptiste; Garcia, Deborah; Volf, P.; Sereno, Denis

    2012-01-01

    Leishmania infantum nicotinamidase, encoded by the Lipnc1 gene, converts nicotinamide into nicotinic acid to ensure Nicotinamide-Adenine-Dinucleotide (NAD(+)) biosynthesis. We were curious to explore the role of this enzyme during L infantum development in its natural sand fly vector, Phlebotomus perniciosus (Diptera, Phlebotominae), using null mutants with a deleted Lipnc1 gene. The null mutants developed as well as the wild type L infantum at the early time points post their ingestion withi...

  2. Innate Immunity to Leishmania Infection: Within Phagocytes

    Directory of Open Access Journals (Sweden)

    Marcela Freitas Lopes

    2014-01-01

    Full Text Available Infection by Leishmania takes place in the context of inflammation and tissue repair. Besides tissue resident macrophages, inflammatory macrophages and neutrophils are recruited to the infection site and serve both as host cells and as effectors against infection. Recent studies suggest additional important roles for monocytes and dendritic cells. This paper addresses recent experimental findings regarding the regulation of Leishmania major infection by these major phagocyte populations. In addition, the role of IL-4 on dendritic cells and monocytes is discussed.

  3. Tensor GSVD of Patient- and Platform-Matched Tumor and Normal DNA Copy-Number Profiles Uncovers Chromosome Arm-Wide Patterns of Tumor-Exclusive Platform-Consistent Alterations Encoding for Cell Transformation and Predicting Ovarian Cancer Survival

    Science.gov (United States)

    Sankaranarayanan, Preethi; Schomay, Theodore E.; Aiello, Katherine A.; Alter, Orly

    2015-01-01

    The number of large-scale high-dimensional datasets recording different aspects of a single disease is growing, accompanied by a need for frameworks that can create one coherent model from multiple tensors of matched columns, e.g., patients and platforms, but independent rows, e.g., probes. We define and prove the mathematical properties of a novel tensor generalized singular value decomposition (GSVD), which can simultaneously find the similarities and dissimilarities, i.e., patterns of varying relative significance, between any two such tensors. We demonstrate the tensor GSVD in comparative modeling of patient- and platform-matched but probe-independent ovarian serous cystadenocarcinoma (OV) tumor, mostly high-grade, and normal DNA copy-number profiles, across each chromosome arm, and combination of two arms, separately. The modeling uncovers previously unrecognized patterns of tumor-exclusive platform-consistent co-occurring copy-number alterations (CNAs). We find, first, and validate that each of the patterns across only 7p and Xq, and the combination of 6p+12p, is correlated with a patient’s prognosis, is independent of the tumor’s stage, the best predictor of OV survival to date, and together with stage makes a better predictor than stage alone. Second, these patterns include most known OV-associated CNAs that map to these chromosome arms, as well as several previously unreported, yet frequent focal CNAs. Third, differential mRNA, microRNA, and protein expression consistently map to the DNA CNAs. A coherent picture emerges for each pattern, suggesting roles for the CNAs in OV pathogenesis and personalized therapy. In 6p+12p, deletion of the p21-encoding CDKN1A and p38-encoding MAPK14 and amplification of RAD51AP1 and KRAS encode for human cell transformation, and are correlated with a cell’s immortality, and a patient’s shorter survival time. In 7p, RPA3 deletion and POLD2 amplification are correlated with DNA stability, and a longer survival. In Xq

  4. Tensor GSVD of patient- and platform-matched tumor and normal DNA copy-number profiles uncovers chromosome arm-wide patterns of tumor-exclusive platform-consistent alterations encoding for cell transformation and predicting ovarian cancer survival.

    Directory of Open Access Journals (Sweden)

    Preethi Sankaranarayanan

    Full Text Available The number of large-scale high-dimensional datasets recording different aspects of a single disease is growing, accompanied by a need for frameworks that can create one coherent model from multiple tensors of matched columns, e.g., patients and platforms, but independent rows, e.g., probes. We define and prove the mathematical properties of a novel tensor generalized singular value decomposition (GSVD, which can simultaneously find the similarities and dissimilarities, i.e., patterns of varying relative significance, between any two such tensors. We demonstrate the tensor GSVD in comparative modeling of patient- and platform-matched but probe-independent ovarian serous cystadenocarcinoma (OV tumor, mostly high-grade, and normal DNA copy-number profiles, across each chromosome arm, and combination of two arms, separately. The modeling uncovers previously unrecognized patterns of tumor-exclusive platform-consistent co-occurring copy-number alterations (CNAs. We find, first, and validate that each of the patterns across only 7p and Xq, and the combination of 6p+12p, is correlated with a patient's prognosis, is independent of the tumor's stage, the best predictor of OV survival to date, and together with stage makes a better predictor than stage alone. Second, these patterns include most known OV-associated CNAs that map to these chromosome arms, as well as several previously unreported, yet frequent focal CNAs. Third, differential mRNA, microRNA, and protein expression consistently map to the DNA CNAs. A coherent picture emerges for each pattern, suggesting roles for the CNAs in OV pathogenesis and personalized therapy. In 6p+12p, deletion of the p21-encoding CDKN1A and p38-encoding MAPK14 and amplification of RAD51AP1 and KRAS encode for human cell transformation, and are correlated with a cell's immortality, and a patient's shorter survival time. In 7p, RPA3 deletion and POLD2 amplification are correlated with DNA stability, and a longer survival

  5. Can equids be a reservoir of Leishmania braziliensis in endemic areas?

    Directory of Open Access Journals (Sweden)

    Jessé Henrique Truppel

    Full Text Available In this study, we detected Leishmania (Viannia braziliensis infection in equids living in endemic regions of cutaneous leishmaniasis. To determine the role of these animals in the Leishmania cycle, we used two approaches: serological and molecular methods. Antibodies to the parasite were assayed using the Enzyme Linked Immunosorbent Assay (ELISA. Blood samples were collected and tested by polymerase chain reaction (PCR, and the positive products were sequenced. The results showed that 11.0% (25/227 of the equids were seropositive for Leishmania sp, and 16.3% (37/227 were PCR positive. Antibodies were detected in 20 horses, 3 donkeys, and 2 mules, and the parasite DNA was detected in 30 horses, 5 donkeys, and 2 mules. Sequencing the amplified DNA revealed 100% similarity with sequences for Viannia complex, corroborating the results of PCR for L. braziliensis. Our results show that equids are infected with L. braziliensis, which could be food sources for phlebotomines in the peridomiciliary environment and consequently play a role in the cutaneous leishmaniasis cycle.

  6. Comparison of Leishmania typing results obtained from 16 European clinical laboratories in 2014.

    Science.gov (United States)

    Van der Auwera, Gert; Bart, Aldert; Chicharro, Carmen; Cortes, Sofia; Davidsson, Leigh; Di Muccio, Trentina; Dujardin, Jean-Claude; Felger, Ingrid; Paglia, Maria Grazia; Grimm, Felix; Harms, Gundel; Jaffe, Charles L; Manser, Monika; Ravel, Christophe; Robert-Gangneux, Florence; Roelfsema, Jeroen; Töz, Seray; Verweij, Jaco J; Chiodini, Peter L

    2016-12-08

    Leishmaniasis is endemic in southern Europe, and in other European countries cases are diagnosed in travellers who have visited affected areas both within the continent and beyond. Prompt and accurate diagnosis poses a challenge in clinical practice in Europe. Different methods exist for identification of the infecting Leishmania species. Sixteen clinical laboratories in 10 European countries, plus Israel and Turkey, conducted a study to assess their genotyping performance. DNA from 21 promastigote cultures of 13 species was analysed blindly by the routinely used typing method. Five different molecular targets were used, which were analysed with PCR-based methods. Different levels of identification were achieved, and either the Leishmania subgenus, species complex, or actual species were reported. The overall error rate of strains placed in the wrong complex or species was 8.5%. Various reasons for incorrect typing were identified. The study shows there is considerable room for improvement and standardisation of Leishmania typing. The use of well validated standard operating procedures is recommended, covering testing, interpretation, and reporting guidelines. Application of the internal transcribed spacer 1 of the rDNA array should be restricted to Old World samples, while the heat-shock protein 70 gene and the mini-exon can be applied globally. This article is copyright of The Authors, 2016.

  7. Identification and biochemical characterization of Leishmania strains isolated in Peru, Mexico, and Spain.

    Science.gov (United States)

    Rodríguez-González, Isabel; Marín, Clotilde; Vargas, Franklin; Córdova, Ofelia; Barrera, Mario; Gutiérrez-Sánchez, Ramón; Alunda, Jose María; Sánchez-Moreno, Manuel

    2006-01-01

    Eight Leishmania promastigotes were isolated from different geographical areas: three (LP1, LP2, and LP3) from the provincial department La Libertad and the fourth (LP4) from the department of Cajamarca (northern Peru); another three (LM1, LM2, and LM3) in the province of Campeche (Mexico); and the last (LS1) from a clinical case of a dog in Madrid (Spain). The isolates were characterized by carbohydrate cell-surface residues using agglutinations with four purified lectins, by isoenzyme analysis using different isoenzymes, by analysis of kinetoplast DNA (kDNA) restriction fragment length polymorphism using four different restriction endonucleases and by the final metabolite patterns after in vitro culture. These isolates were compared with four reference strains and typified as: Leishmania (Leishmania) donovani, two strains of L. (L.) infantum, and one species of L. (Viania) peruviana. According to our results and the statistical study, the Peruvian isolates represent three different strains: one would be L. (V.) peruviana, another the strain isolated in Cajamarca (LP4) and the third would include the three strains from the department of La Libertad (LP1, LP2, and LP3), these latter three isolates being phylogenetically closer to the reference strain L. (L.) donovani. Meanwhile, the three isolates from Mexico form a group with close phylogenetic relationships to each other. The isolate from Spain belongs to the species L. (L.) infantum. Thus, a close correlation was drawn between the identity of each strain and its geographical origin.

  8. The effects of gamma irradiation on growth and expression of genes encoding DNA repair-related proteins in Lombardy poplar (Populus nigra var. italica).

    Science.gov (United States)

    Nishiguchi, Mitsuru; Nanjo, Tokihiko; Yoshida, Kazumasa

    2012-07-01

    In this study, to elucidate the mechanisms of adaptation and tolerance to ionizing radiation in woody plants, we investigated the various biological effects of γ-rays on the Lombardy poplar (Populus nigra L. var. italica Du Roi). We detected abnormal leaf shape and color, fusion, distorted venation, shortened internode, fasciation and increased axillary shoots in γ-irradiated poplar plants. Acute γ-irradiation with a dose of 100Gy greatly reduced the height, stem diameter and biomass of poplar plantlets. After receiving doses of 200 and 300Gy, all the plantlets stopped growing, and then most of them withered after 4-10 weeks of γ-irradiation. Comet assays showed that nuclear DNA in suspension-cultured poplar cells had been damaged by γ-rays. To determine whether DNA repair-related proteins are involved in the response to γ-rays in Lombardy poplars, we cloned the PnRAD51, PnLIG4, PnKU70, PnXRCC4, PnPCNA and PnOGG1 cDNAs and investigated their mRNA expression. The PnRAD51, PnLIG4, PnKU70, PnXRCC4 and PnPCNA mRNAs were increased by γ-rays, but the PnOGG1 mRNA was decreased. Moreover, the expression of PnLIG4, PnKU70 and PnRAD51 was also up-regulated by Zeocin known as a DNA cleavage agent. These observations suggest that the morphogenesis, growth and protective gene expression in Lombardy poplars are severely affected by the DNA damage and unknown cellular events caused by γ-irradiation. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Immunization with a DNA vaccine encoding Toxoplasma gondii Superoxide dismutase (TgSOD) induces partial immune protection against acute toxoplasmosis in BALB/c mice.

    Science.gov (United States)

    Liu, Yuan; Cao, Aiping; Li, Yawen; Li, Xun; Cong, Hua; He, Shenyi; Zhou, Huaiyu

    2017-06-07

    Toxoplasma gondii (T. gondii) is an obligate intracellular protozoan parasite that infects all warm-blooded animals including humans and causes toxoplasmosis. An effective vaccine could be an ideal choice for preventing and controlling toxoplasmosis. T. gondii Superoxide dismutase (TgSOD) might participate in affecting the intracellular growth of both bradyzoite and tachyzoite forms. In the present study, the TgSOD gene was used to construct a DNA vaccine (pEGFP-SOD). TgSOD gene was amplified and inserted into eukaryotic vector pEGFP-C1 and formed the DNA vaccine pEGFP-SOD. Then the BALB/c mice were immunized intramuscularly with the DNA vaccine and those injected with pEGFP-C1, PBS or nothing were treated as controls. Four weeks after the last immunization, all mouse groups followed by challenging intraperitoneally with tachyzoites of T. gondii ME49 strain. Results showed higher levels of total IgG, IgG2α in the sera and interferon gamma (IFN-γ) in the splenocytes from pEGFP-SOD inoculated mice than those unvaccinated, or inoculated with either empty plasmid vector or PBS. The proportions of CD4 + T cells and CD8 + T cells in the spleen from pEGFP-SOD inoculated mice were significantly (p < 0.05) increased compared to control groups. In addition, the survival time of mice immunized with pEGFP-SOD was significantly prolonged as compared to the controls (p < 0.05) although all the mice died. The present study revealed that the DNA vaccine triggered strong humoral and cellular immune responses, and aroused partial protective immunity against acute T. gondii infection in BALB/c mice. The collective data suggests the SOD may be a potential vaccine candidate for further development.

  10. Susceptibility of spiny rats (Proechimys semispinosus to Leishmania (Viannia panamensis and Leishmania (Leishmania chagasi

    Directory of Open Access Journals (Sweden)

    BL Travi

    2002-09-01

    Full Text Available The role of Proechimys semispinosus as reservoir of Leishmania (Viannia panamensis on the Colombian Pacific coast was experimentally evaluated. The susceptibility to L. chagasi also was assessed to determine the utility of this rodent as a model for studying reservoir characteristics in the laboratory. Wild-caught animals were screened for natural trypanosomatid infections, and negative individuals were inoculated intradermally (ID in the snout or feet with 10(7 promastigotes of L. panamensis. L. chagasi was inoculated intracardially (10(7 promastigotes or ID in the ear (10(8 promastigotes. PCR-hybridization showed that 15% of 33 spiny rats were naturally infected with L. Viannia sp. Animals experimentally infected with L. panamensis developed non-ulcerated lesions that disappeared by the 7th week post-infection (p.i. and became more resistant upon reinfection. Infectivity to sand flies was low (1/20-1/48 infected/fed flies and transient, and both culture and PCR-hybridization showed that L. panamensis was cleared by the 13th week p.i. Animals inoculated with L. chagasi became subclinically infected and were non-infective to sand flies. Transient infectivity to vectors of spiny rats infected with L. panamensis, combined with population characteristics, e.g., abundance, exploitation of degraded habitats and high reproductive rates, could make them epidemiologically suitable reservoirs.

  11. Molecular cloning and characterization of a cDNA encoding the gibberellin biosynthetic enzyme ent-kaurene synthase B from pumpkin (Cucurbita maxima L.).

    Science.gov (United States)

    Yamaguchi, S; Saito, T; Abe, H; Yamane, H; Murofushi, N; Kamiya, Y

    1996-08-01

    The first committed step in the formation of diterpenoids leading to gibberellin (GA) biosynthesis is the conversion of geranylgeranyl diphosphate (GGDP) to ent-kaurene. ent-Kaurene synthase A (KSA) catalyzes the conversion of GGDP to copalyl diphosphate (CDP), which is subsequently converted to ent-kaurene by ent-kaurene synthase B (KSB). A full-length KSB cDNA was isolated from developing cotyledons in immature seeds of pumpkin (Cucurbita maxima L.). Degenerate oligonucleotide primers were designed from the amino acid sequences obtained from the purified protein to amplify a cDNA fragment, which was used for library screening. The isolated full-length cDNA was expressed in Escherichia coli as a fusion protein, which demonstrated the KSB activity to cyclize [3H]CDP to [3H]ent-kaurene. The KSB transcript was most abundant in growing tissues, but was detected in every organ in pumpkin seedlings. The deduced amino acid sequence shares significant homology with other terpene cyclases, including the conserved DDXXD motif, a putative divalent metal ion-diphosphate complex binding site. A putative transit peptide sequence that may target the translated product into the plastids is present in the N-terminal region.

  12. Evaluation of protective effect of multiantigenic DNA vaccine encoding MIC3 and ROP18 antigen segments of Toxoplasma gondii in mice.

    Science.gov (United States)

    Qu, Daofeng; Han, Jianzhong; Du, Aifang

    2013-07-01

    The high incidence and severe damage caused by Toxoplasma gondii infection clearly indicates the need for the development of a vaccine. In this study, we evaluated the immune responses and protection against toxoplasmosis by immunizing ICR mice with a multiantigenic DNA vaccine. To develop the multiantigenic vaccine, two T. gondii antigens, MIC3 and ROP18, selected on the basis of previous studies were chosen. ICR mice were immunized subcutaneously with PBS, empty pcDNA3.1 vector, pMIC3, pROP18, and pROP18-MIC3, respectively. The results of lymphocyte proliferation assay, cytokine, and antibody determinations showed that mice immunized with pROP18-MIC3 elicited stronger humoral and Th1-type cellular immune responses than those immunized with single-gene plasmids, empty plasmid, or phosphate-buffered saline. After a lethal challenge with the highly virulent T. gondii RH strain, a prolonged survival time in pROP18-MIC3-immunized mice was observed in comparison to control groups. Our study indicates that the introduction of multiantigenic DNA vaccine is more powerful and efficient than single-gene vaccine, and deserves further evaluation and development.

  13. Phlebotomus sergenti in a Cutaneous Leishmaniasis Focus in Azilal Province (High Atlas, Morocco): Molecular Detection and Genotyping of Leishmania tropica, and Feeding Behavior

    Science.gov (United States)

    Ajaoud, Malika; Es-Sette, Nargys; Charrel, Rémi N; Laamrani-Idrissi, Abderahmane; Nhammi, Haddou; Riyad, Myriam; Lemrani, Meryem

    2015-01-01

    Background Phlebotomus (Paraphlebotomus) sergenti is at least one of the confirmed vectors for the transmission of cutaneous leishmaniasis caused by Leishmania tropica and distributed widely in Morocco. This form of leishmaniasis is considered largely as anthroponotic, although dogs were found infected with Leishmania tropica, suggestive of zoonosis in some rural areas. Methodology and Findings This survey aimed at (i) studying the presence of Leishmania in field caught Phlebotomus sergenti, (ii) investigating genetic diversity within Leishmania tropica and (iii) identifying the host-blood feeding preferences of Phlebotomus sergenti. A total of 4,407 sand flies were collected in three rural areas of Azilal province, using CDC miniature light traps. Samples collected were found to consist of 13 species: Phlebotomus spp. and 3 Sergentomyia spp. The most abundant species was Phlebotomus sergenti, accounting for 45.75 % of the total. 965 female Phlebotomus sergenti were screened for the presence of Leishmania by ITS1-PCR-RFLP, giving a positive rate of 5.7% (55/965), all being identified as Leishmania tropica. Nucleotide heterogeneity of PCR-amplified ITS1-5.8S rRNA gene-ITS2 was noted. Analyses of 31 sequences obtained segregated them into 16 haplotypes, of which 7 contain superimposed peaks at certain nucleotide positions, suggestive of heterozygosity. Phlebotomus sergenti collected were found to feed on a large variety of vertebrate hosts, as determined by Cytochrome b sequencing of the DNA from the blood meals of 64 engorged females. Conclusion Our findings supported the notion that Phlebotomus sergenti is the primary vector of Leishmania tropica in this focus, and that the latter is genetically very heterogeneous. Furthermore, our results might be suggestive of a certain level of heterozygosity in Leishmania tropica population. This finding, as well as the feeding of the vectors on different animals are of interest for further investigation. PMID:25826399

  14. Phlebotomus sergenti in a cutaneous leishmaniasis focus in Azilal province (High Atlas, Morocco: molecular detection and genotyping of Leishmania tropica, and feeding behavior.

    Directory of Open Access Journals (Sweden)

    Malika Ajaoud

    2015-03-01

    Full Text Available Phlebotomus (Paraphlebotomus sergenti is at least one of the confirmed vectors for the transmission of cutaneous leishmaniasis caused by Leishmania tropica and distributed widely in Morocco. This form of leishmaniasis is considered largely as anthroponotic, although dogs were found infected with Leishmania tropica, suggestive of zoonosis in some rural areas.This survey aimed at (i studying the presence of Leishmania in field caught Phlebotomus sergenti, (ii investigating genetic diversity within Leishmania tropica and (iii identifying the host-blood feeding preferences of Phlebotomus sergenti. A total of 4,407 sand flies were collected in three rural areas of Azilal province, using CDC miniature light traps. Samples collected were found to consist of 13 species: Phlebotomus spp. and 3 Sergentomyia spp. The most abundant species was Phlebotomus sergenti, accounting for 45.75 % of the total. 965 female Phlebotomus sergenti were screened for the presence of Leishmania by ITS1-PCR-RFLP, giving a positive rate of 5.7% (55/965, all being identified as Leishmania tropica. Nucleotide heterogeneity of PCR-amplified ITS1-5.8S rRNA gene-ITS2 was noted. Analyses of 31 sequences obtained segregated them into 16 haplotypes, of which 7 contain superimposed peaks at certain nucleotide positions, suggestive of heterozygosity. Phlebotomus sergenti collected were found to feed on a large variety of vertebrate hosts, as determined by Cytochrome b sequencing of the DNA from the blood meals of 64 engorged females.Our findings supported the notion that Phlebotomus sergenti is the primary vector of Leishmania tropica in this focus, and that the latter is genetically very heterogeneous. Furthermore, our results might be suggestive of a certain level of heterozygosity in Leishmania tropica population. This finding, as well as the feeding of the vectors on different animals are of interest for further investigation.

  15. Clinical and parasitological protection in a Leishmania infantum-macaque model vaccinated with adenovirus and the recombinant A2 antigen.

    Science.gov (United States)

    Grimaldi, Gabriel; Teva, Antonio; Porrozzi, Renato; Pinto, Marcelo A; Marchevsky, Renato S; Rocha, Maria Gabrielle L; Dutra, Miriam S; Bruña-Romero, Oscar; Fernandes, Ana-Paula; Gazzinelli, Ricardo T

    2014-06-01

    Visceral leishmaniasis (VL) is a severe vector-born disease of humans and dogs caused by Leishmania donovani complex parasites. Approximately 0.2 to 0.4 million new human VL cases occur annually worldwide. In the new world, these alarming numbers are primarily due to the impracticality of current control methods based on vector reduction and dog euthanasia. Thus, a prophylactic vaccine appears to be essential for VL control. The current efforts to develop an efficacious vaccine include the use of animal models that are as close to human VL. We have previously reported a L. infantum-macaque infection model that is reliable to determine which vaccine candidates are most worthy for further development. Among the few amastigote antigens tested so far, one of specific interest is the recombinant A2 (rA2) protein that protects against experimental L. infantum infections in mice and dogs. Primates were vaccinated using three rA2-based prime-boost immunization regimes: three doses of rA2 plus recombinant human interleukin-12 (rhIL-12) adsorbed in alum (rA2/rhIL-12/alum); two doses of non-replicative adenovirus recombinant vector encoding A2 (Ad5-A2) followed by two boosts with rA2/rhIL-12/alum (Ad5-A2+rA2/rhIL12/alum); and plasmid DNA encoding A2 gene (DNA-A2) boosted with two doses of Ad5-A2 (DNA-A2+Ad5-A2). Primates received a subsequent infectious challenge with L. infantum. Vaccines, apart from being safe, were immunogenic as animals responded with increased pre-challenge production of anti-A2-specific IgG antibodies, though with some variability in the response, depending on the vaccine formulation/protocol. The relative parasite load in the liver was significantly lower in immunized macaques as compared to controls. Protection correlated with hepatic granuloma resolution, and reduction of clinical symptoms, particularly when primates were vaccinated with the Ad5-A2+rA2/rhIL12/alum protocol. The remarkable clinical protection induced by A2 in an animal model that is

  16. Clinical and parasitological protection in a Leishmania infantum-macaque model vaccinated with adenovirus and the recombinant A2 antigen.

    Directory of Open Access Journals (Sweden)

    Gabriel Grimaldi

    2014-06-01

    Full Text Available BACKGROUND: Visceral leishmaniasis (VL is a severe vector-born disease of humans and dogs caused by Leishmania donovani complex parasites. Approximately 0.2 to 0.4 million new human VL cases occur annually worldwide. In the new world, these alarming numbers are primarily due to the impracticality of current control methods based on vector reduction and dog euthanasia. Thus, a prophylactic vaccine appears to be essential for VL control. The current efforts to develop an efficacious vaccine include the use of animal models that are as close to human VL. We have previously reported a L. infantum-macaque infection model that is reliable to determine which vaccine candidates are most worthy for further development. Among the few amastigote antigens tested so far, one of specific interest is the recombinant A2 (rA2 protein that protects against experimental L. infantum infections in mice and dogs. METHODOLOGY/PRINCIPAL FINDINGS: Primates were vaccinated using three rA2-based prime-boost immunization regimes: three doses of rA2 plus recombinant human interleukin-12 (rhIL-12 adsorbed in alum (rA2/rhIL-12/alum; two doses of non-replicative adenovirus recombinant vector encoding A2 (Ad5-A2 followed by two boosts with rA2/rhIL-12/alum (Ad5-A2+rA2/rhIL12/alum; and plasmid DNA encoding A2 gene (DNA-A2 boosted with two doses of Ad5-A2 (DNA-A2+Ad5-A2. Primates received a subsequent infectious challenge with L. infantum. Vaccines, apart from being safe, were immunogenic as animals responded with increased pre-challenge production of anti-A2-specific IgG antibodies, though with some variability in the response, depending on the vaccine formulation/protocol. The relative parasite load in the liver was significantly lower in immunized macaques as compared to controls. Protection correlated with hepatic granuloma resolution, and reduction of clinical symptoms, particularly when primates were vaccinated with the Ad5-A2+rA2/rhIL12/alum protocol. CONCLUSIONS

  17. Diagnosis of Leishmania infantum infection by Polymerase Chain Reaction in wild mammals

    Directory of Open Access Journals (Sweden)

    Mayara C. Lombardi

    2014-12-01

    Full Text Available Visceral leishmaniasis is a chronic infectious disease caused by Leishmania infantum (synonym: Leishmania chagasi and transmitted by the sandfly Lutzomyia longipalpis in Brazil. It is an endemic zoonosis in several regions of the country, including Belo Horizonte (State of Minas Gerais. In urban areas, the domestic dog is susceptible and considered the most important animal reservoir. However, L. infantum has been previously diagnosed in other species, including captive primates and canids. This study aimed to evaluate the presence of the agent DNA in captive animals as well as some free ranging animals from the Zoo-Botanical Foundation of Belo Horizonte by Polymerase Chain Reaction. Eighty one blood samples from primates, carnivores, ruminants, edentates, marsupial, and a monogastric herbivore were analyzed. Three primates Alouatta guariba (brown howler monkey, and two canids Speothos venaticus (bush dog were positive, demonstrating the importance of leishmaniasis control in endemic areas for preservation of wildlife species in captivity.

  18. Demonstration of genetic exchange during cyclical development of Leishmania in the sand fly vector.

    Science.gov (United States)

    Akopyants, Natalia S; Kimblin, Nicola; Secundino, Nagila; Patrick, Rachel; Peters, Nathan; Lawyer, Phillip; Dobson, Deborah E; Beverley, Stephen M; Sacks, David L

    2009-04-10

    Genetic exchange has not been shown to be a mechanism underlying the extensive diversity of Leishmania parasites. We report here evidence that the invertebrate stages of Leishmania are capable of having a sexual cycle consistent with a meiotic process like that described for African trypanosomes. Hybrid progeny were generated that bore full genomic complements from both parents, but kinetoplast DNA maxicircles from one parent. Mating occurred only in the sand fly vector, and hybrids were transmitted to the mammalian host by sand fly bite. Genetic exchange likely contributes to phenotypic diversity in natural populations, and analysis of hybrid progeny will be useful for positional cloning of the genes controlling traits such as virulence, tissue tropism, and drug resistance.

  19. Effects of nitro-heterocyclic derivatives against Leishmania (Leishmania) infantum promastigotes and intracellular amastigotes.

    Science.gov (United States)

    Petri e Silva, Simone Carolina Soares; Palace-Berl, Fanny; Tavares, Leoberto Costa; Soares, Sandra Regina Castro; Lindoso, José Angelo Lauletta

    2016-04-01

    Leishmaniasis is an overlooked tropical disease affecting approximately 1 million people in several countries. Clinical manifestation depends on the interaction between Leishmania and the host's immune response. Currently available treatment options for leishmaniasis are limited and induce severe side effects. In this research, we tested nitro-heterocyclic compounds (BSF series) as a new alternative against Leishmania. Its activity was measured in Leishmania (Leishmania) infantum promastigotes and intracellular amastigotes using MTT colorimetric assay. Additionally, we assessed the phosphatidylserine exposure by promastigotes, measured by flow cytometry, as well as nitric oxide production, measured by Griess' method. The nitro-heterocyclic compounds (BSF series) showed activity against L. (L.) infantum promastigotes, inducting the phosphatidylserine exposition by promastigotes, decreasing intracellular amastigotes and increasing oxide nitric production. The selectivity index was more prominent to Leishmania than to macrophages. Compared to amphotericin b, our compounds presented higher IC50, however the selectivity index was more specific to parasite than to amphotericin b. In conclusion, these nitro-heterocyclic compounds showed to be promising as an anti-Leishmania drug, in in vitro studies. Copyright © 2016 Elsevier Inc. All rights reserved.

  20. Cross-species genetic exchange between visceral and cutaneous strains of Leishmania in the sand fly vector.

    Science.gov (United States)

    Romano, Audrey; Inbar, Ehud; Debrabant, Alain; Charmoy, Melanie; Lawyer, Phillip; Ribeiro-Gomes, Flavia; Barhoumi, Mourad; Grigg, Michael; Shaik, Jahangheer; Dobson, Deborah; Beverley, Stephen M; Sacks, David L

    2014-11-25

    Genetic exchange between Leishmania major strains during their development in the sand fly vector has been experimentally shown. To investigate the possibility of genetic exchange between different Leishmania species, a cutaneous strain of L. major and a visceral strain of Leishmania infantum, each bearing a different drug-resistant marker, were used to coinfect Lutzomyia longipalpis sand flies. Eleven double-drug-resistant progeny clones, each the product of an independent mating event, were generated and submitted to genotype and phenotype analyses. The analysis of multiple allelic markers across the genome suggested that each progeny clone inherited at least one full set of chromosomes from each parent, with loss of heterozygosity at some loci, and uniparental retention of maxicircle kinetoplast DNA. Hybrids with DNA contents of approximately 2n, 3n, and 4n were observed. In vivo studies revealed clear differences in the ability of the hybrids to produce pathology in the skin or to disseminate to and grow in the viscera, suggesting polymorphisms and differential inheritance of the gene(s) controlling these traits. The studies, to our knowledge, represent the first experimental confirmation of cross-species mating in Leishmania, opening the way toward genetic linkage analysis of important traits and providing strong evidence that genetic exchange is responsible for the generation of the mixed-species genotypes observed in natural populations.

  1. Impact of a Central Scaffold on the Binding Affinity of Fragment Pairs Isolated from DNA-Encoded Self-Assembling Chemical Libraries.

    Science.gov (United States)

    Bigatti, Martina; Dal Corso, Alberto; Vanetti, Sara; Cazzamalli, Samuele; Rieder, Ulrike; Scheuermann, Jörg; Neri, Dario; Sladojevich, Filippo

    2017-11-08

    The screening of encoded self-assembling chemical libraries allows the identification of fragment pairs that bind to adjacent pockets on target proteins of interest. For practical applications, it is necessary to link these ligand pairs into discrete organic molecules, devoid of any nucleic acid component. Here we describe the discovery of a synergistic binding pair for acid alpha-1 glycoprotein and a chemical strategy for the identification of optimal linkers, connecting the two fragments. The procedure yielded a set of small organic ligands, the best of which exhibited a dissociation constant of 9.9 nm, as measured in solution by fluorescence polarization. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  2. In vitro efficacy of a gene-activated nerve guidance conduit incorporating non-viral PEI-pDNA nanoparticles carrying genes encoding for NGF, GDNF and c-Jun.

    Science.gov (United States)

    Lackington, William A; Raftery, Rosanne M; O'Brien, Fergal J

    2018-06-07

    Despite the success of tissue engineered nerve guidance conduits (NGCs) for the treatment of small peripheral nerve injuries, autografts remain the clinical gold standard for larger injuries. The delivery of neurotrophic factors from conduits might enhance repair for more effective treatment of larger injuries but the efficacy of such systems is dependent on a safe, effective platform for controlled and localised therapeutic delivery. Gene therapy might offer an innovative approach to control the timing, release and level of neurotrophic factor production by directing cells to transiently sustain therapeutic protein production in situ. In this study, a gene-activated NGC was developed by incorporating non-viral polyethyleneimine-plasmid DNA (PEI-pDNA) nanoparticles (N/P 7 ratio, 2μg dose) with the pDNA encoding for nerve growth factor (NGF), glial derived neurotrophic factor (GDNF) or the transcription factor c-Jun. The physicochemical properties of PEI-pDNA nanoparticles, morphology, size and charge, were shown to be suitable for gene delivery and demonstrated high Schwann cell transfection efficiency (60±13%) in vitro. While all three genes showed therapeutic potential in terms of enhancing neurotrophic cytokine production while promoting neurite outgrowth, delivery of the gene encoding for c-Jun showed the greatest capacity to enhance regenerative cellular processes in vitro. Ultimately, this gene-activated NGC construct was shown to be capable of transfecting both Schwann cells (S42 cells) and neuronal cells (PC12 and dorsal root ganglia) in vitro, demonstrating potential for future therapeutic applications in vivo. The basic requirements of biomaterial-based nerve guidance conduits have now been well established and include being able to bridge a nerve injury to support macroscopic guidance between nerve stumps, while being strong enough to withstand longitudinal tension and circumferential compression, in addition to being mechanically sound to facilitate

  3. First Cases of Cutaneous Leishmaniasis Caused by Leishmania (Viannia) naiffi Infection in Surinam

    NARCIS (Netherlands)

    van Thiel, Pieter-Paul A. M.; van Gool, Tom; Kager, Piet A.; Bart, Aldert

    2010-01-01

    Cutaneous leishmaniasis in Surinam is generally caused by infection by Leishmania guyanensis. We report three cases of infection with Leishmania (Viannia) naiffi, a Leishmania species not described from Surinam before. Treatment with pentamidine proved to be effective

  4. Identification of a RAC/AKT-like gene in Leishmania parasites as a putative therapeutic target in leishmaniasis.

    Science.gov (United States)

    Varela-M, Rubén E; Ochoa, Rodrigo; Muskus, Carlos E; Muro, Antonio; Mollinedo, Faustino

    2017-10-10

    Leishmaniasis is one of the world's most neglected diseases caused by at least 20 different species of the protozoan parasite Leishmania. Although new drugs have become recently available, current therapy for leishmaniasis is still unsatisfactory. A subgroup of serine/threonine protein kinases named as related to A and C protein kinases (RAC), or protein kinase B (PKB)/AKT, has been identified in several organisms including Trypanosoma cruzi parasites. PKB/AKT plays a critical role in mammalian cell signaling promoting cell survival and is a major drug target in cancer therapy. However, the role of protozoan parasitic PKB/AKT remains to be elucidated. We have found that anti-human AKT antibodies recognized a protein of about 57 kDa in Leishmania spp. parasites. Anti-human phospho-AKT(Thr308) antibodies identified a protein in extracts from Leishmania spp. that was upregulated following parasite exposure to stressful conditions, such as nutrient deprivation or heat shock. Incubation of AKT inhibitor X with Leishmania spp. promastigotes under stressful conditions or with Leishmania-infected macrophages led to parasite cell death. We have identified and cloned a novel gene from Leishmania donovani named Ld-RAC/AKT-like gene, encoding a 510-amino acid protein of approximately 57.6 kDa that shows a 26.5% identity with mammalian AKT1. Ld-RAC/AKT-like protein contains major mammalian PKB/AKT hallmarks, including the typical pleckstrin, protein kinase and AGC kinase domains. Unlike mammalian AKT that contains key phosphorylation sites at Thr308 and Ser473 in the activation loop and hydrophobic motif, respectively, Ld-RAC/AKT-like protein has a Thr residue in both motifs. By domain sequence comparison, we classified AKT proteins from different origins in four major subcategories that included different parasites. Our data suggest that Ld-RAC/AKT-like protein represents a Leishmania orthologue of mammalian AKT involved in parasite stress response and survival, and

  5. Involvement of Leishmania donovani major surface glycoprotein ...

    Indian Academy of Sciences (India)

    The major surface glycoprotein gp63 of the kinetoplastid protozoal parasite Leishmania is implicated as a ligand mediating uptake of the parasite into, and survival within, the host macrophage. By expressing gp63 antisense RNA from an episomal vector in L. donovani promastigotes, gp63-deficient transfectants were ...

  6. Leishmania OligoC-TesT as a simple, rapid, and standardized tool for molecular diagnosis of cutaneous leishmaniasis in Peru.

    Science.gov (United States)

    Espinosa, Diego; Boggild, Andrea K; Deborggraeve, Stijn; Laurent, Thierry; Valencia, Cristian; Pacheco, Rosa; Miranda-Verástegui, César; Llanos-Cuentas, Alejandro; Leclipteux, Thierry; Dujardin, Jean-Claude; Büscher, Philippe; Arévalo, Jorge

    2009-08-01

    Molecular methods such as PCR have become attractive tools for diagnosis of cutaneous leishmaniasis (CL), both for their high sensitivity and for their specificity. However, their practical use in routine diagnosis is limited due to the infrastructural requirements and the lack of any standardization. Recently, a simplified and standardized PCR format for molecular detection of Leishmania was developed. The Leishmania OligoC-TesT is based on simple and rapid detection using a dipstick with PCR-amplified Leishmania DNA. In this study, we estimated the diagnostic accuracy of the Leishmania OligoC-TesT for 61 specimens from 44 CL-suspected patients presenting at the leishmaniasis clinic of the Instituto de Medicina Tropical Alexander von Humboldt, Peru. On the basis of parasitological detection and the leishmanin skin test (LST), patients were classified as (i) confirmed CL cases, (ii) LST-positive cases, and (iii) LST-negative cases. The sensitivities of the Leishmania OligoC-TesT was 74% (95% confidence interval (CI), 60.5% to 84.1%) for lesion aspirates and 92% (95% CI, 81.2% to 96.9%) for scrapings. A significantly higher sensitivity was observed with a conventional PCR targeting the kinetoplast DNA on the aspirates (94%) (P = 0.001), while there was no significant difference in sensitivity for the lesion scrapings (88%) (P = 0.317). In addition, the Leishmania OligoC-TesT was evaluated for 13 CL-suspected patients in two different peripheral health centers in the central jungle of Peru. Our findings clearly indicate the high accuracy of the Leishmania OligoC-TesT for lesion scrapings for simple and rapid molecular diagnosis of CL in Peru.

  7. Leishmania OligoC-TesT as a Simple, Rapid, and Standardized Tool for Molecular Diagnosis of Cutaneous Leishmaniasis in Peru▿

    Science.gov (United States)

    Espinosa, Diego; Boggild, Andrea K.; Deborggraeve, Stijn; Laurent, Thierry; Valencia, Cristian; Pacheco, Rosa; Miranda-Verástegui, César; Llanos-Cuentas, Alejandro; Leclipteux, Thierry; Dujardin, Jean-Claude; Büscher, Philippe; Arévalo, Jorge

    2009-01-01

    Molecular methods such as PCR have become attractive tools for diagnosis of cutaneous leishmaniasis (CL), both for their high sensitivity and for their specificity. However, their practical use in routine diagnosis is limited due to the infrastructural requirements and the lack of any standardization. Recently, a simplified and standardized PCR format for molecular detection of Leishmania was developed. The Leishmania OligoC-TesT is based on simple and rapid detection using a dipstick with PCR-amplified Leishmania DNA. In this study, we estimated the diagnostic accuracy of the Leishmania OligoC-TesT for 61 specimens from 44 CL-suspected patients presenting at the leishmaniasis clinic of the Instituto de Medicina Tropical Alexander von Humboldt, Peru. On the basis of parasitological detection and the leishmanin skin test (LST), patients were classified as (i) confirmed CL cases, (ii) LST-positive cases, and (iii) LST-negative cases. The sensitivities of the Leishmania OligoC-TesT was 74% (95% confidence interval (CI), 60.5% to 84.1%) for lesion aspirates and 92% (95% CI, 81.2% to 96.9%) for scrapings. A significantly higher sensitivity was observed with a conventional PCR targeting the kinetoplast DNA on the aspirates (94%) (P = 0.001), while there was no significant difference in sensitivity for the lesion scrapings (88%) (P = 0.317). In addition, the Leishmania OligoC-TesT was evaluated for 13 CL-suspected patients in two different peripheral health centers in the central jungle of Peru. Our findings clearly indicate the high accuracy of the Leishmania OligoC-TesT for lesion scrapings for simple and rapid molecular diagnosis of CL in Peru. PMID:19553579

  8. Leishmania infection and blood food sources of phlebotomines in an area of Brazil endemic for visceral and tegumentary leishmaniasis

    Science.gov (United States)

    Guimarães-e-Silva, Antônia Suely; Silva, Soraia de Oliveira; Ribeiro da Silva, Rosa Cristina; Pinheiro, Valéria Cristina Soares; Rebêlo, José Manuel Macário; Melo, Maria Norma

    2017-01-01

    The aims of the study were to determine the blood feeding preferences of sandflies and to identify species of Leishmania that infected phlebotomines in Caxias, Maranhão, Brazil, an area that is highly endemic for leishmaniasis. Sandflies were captured in light traps located in the peridomiciliary environments of randomly selected houses in urban and rural settings between 1800 and 0600 hours on new moon days between March 2013 and February 2015. DNA extracts from 982 engorged female sandflies were submitted to fragment length polymorphism analysis to identify infecting species of Leishmania, and blood sources were identified for 778 of these specimens. Infection by Leishmania infantum was detected in Lutzomyia longipalpis, Lu. whitmani and Lu. termitophila; L. infantum/L. braziliensis in Lu. longipalpis, Lu. whitmani and Lu. trinidadensis; L. shawi in Lu. longipalpis; L. mexicana in Lu. longipalpis; L. braziliensis in Lu. longipalpis and Lu. whitmani; L. guyanensis in Lu. longipalpis and Lu. termitophila; L. amazonensis in Lu. longipalpis and L. lainsoni or L. naiffi in Lu. longipalpis, while Lu. longipalpis and Lu. trinidadensis were infected with unidentified Leishmania sp. Blood sources were identified in 573 individual phlebotomines and the preferred hosts were, in decreasing order, chicken, dog, rodent and human with lower preferences for pig, horse, opossum and cattle. Lu. longipalpis and Lu. whitmani performed mixed feeding on man, dog and rodent, while Lu. longipalpis was the most opportunistic species, feeding on the blood of all hosts surveyed, but preferably on dog/chicken, dog/rodent and rodent/chicken. Our findings reveal the concomitant circulation of Leishmania species that cause visceral leishmaniasis and tegumentary leishmaniasis in the study area, and explain the occurrence of autochthonous human cases of both clinical forms of leishmaniasis in Caxias, Maranhão. The results support our hypothesis that, in the municipality of Caxias, transmission

  9. Molecular Characterization of Leishmania Parasites in Giemsa-Stained Slides from Cases of Human Cutaneous and Visceral Leishmaniasis, Eastern Algeria.

    Science.gov (United States)

    Beldi, Nadia; Mansouri, Roukaya; Bettaieb, Jihene; Yaacoub, Alia; Souguir Omrani, Hejer; Saadi Ben Aoun, Yusr; Saadni, Farida; Guizani, Ikram; Guerbouj, Souheila

    2017-06-01

    In Algeria, visceral leishmaniasis (VL) is due to Leishmania (L.) infantum, while three cutaneous forms (CL) are caused by Leishmania major, Leishmania tropica and Leishmania infantum. In this study, the use of Giemsa-stained slides was evaluated with two PCR techniques, in Eastern Algeria. A total of 136 samples corresponding to 100 CL smears (skin scrapings) and 36 VL slides (bone marrow aspirates) collected from 2008 to 2014 were tested. Upon DNA extraction, two PCRs were used to amplify the ribosomal Internal Transcribed Spacer 1 (ITS1) and mini-exon genes. Amplified products were digested (PCR-RFLP) and profiles analyzed for Leishmania species identification. A statistical analysis was also performed. ITS1-PCR was found significantly more sensitive than mini-exon-PCR (77.95% positives vs. 67.65%; p = 0.001). Comparison of PCR positivity showed statistically significant differences between old and recently prepared slides suggesting a better use of recent slides in PCR analyses. For species identification, PCR-restriction fragment length polymorphism (RFLP) results of ITS1 and mini-exon were concordant. L. infantum was identified from VL cases and L. infantum, L. major, and L. tropica from CL ones. According to geographical origin, L. infantum was found in North-Eastern provinces, while L. major was distributed from the North to the Center-East of Algeria. Interestingly, two L. tropica samples were identified in Annaba, located far North-East Algeria. Distribution of leishmaniasis in Eastern parts of Algeria, besides finding of L. tropica in the far North, is in this study described for the first time using molecular tools, thus confirming the usefulness of slides for PCR identification of Leishmania parasites in retrospective epidemiological investigations.

  10. Molecular and serological detection of Leishmania spp. in captive wild animals from Ilha Solteira, SP, Brazil Detecção sorológica e molecular de Leishmania spp. em animais selvagens do zoológico de Ilha Solteira, SP, Brasil

    Directory of Open Access Journals (Sweden)

    Márcia Mariza Gomes Jusi

    2011-09-01

    Full Text Available Leishmaniasis is a zoonotic disease that affects 12 million people worldwide. Several mammalian species can serve as a reservoir for this disease. Dogs are the main reservoir for visceral leishmaniasis in urban areas, which has become a serious public health concern in Brazil. The aim of this study was to evaluate the presence of Leishmania spp. in captive wild animals from Ilha Solteira, São Paulo, Brazil. Blood and various tissues samples were collected from animals of five different species: Speothos venaticus, Chrysocyon brachyurus, Cerdocyon thous, Pseudalopex vetulus, and Procyon cancrivorus. Antibodies against Leishmania spp. were detected in three wild canids by indirect fluorescent antibody test (IFAT and enzyme-linked immunosorbent assay (ELISA. PCR analyses of blood and bone marrow from all animals were negative, but Leishmania DNA was found in the tissues and skin of seropositive animals. Positive PCR samples were also positive for Leishmania donovani complex. Analysis of sequenced PCR products showed similarities with different regions of Leishmania (Leishmania infantum and Leishmania (Leishmania chagasi kinetoplastids. Measures to control visceral leishmaniasis in wild animals kept in Brazilian zoos should be established, as no disease control programs are currently available.Leishmaniose é uma doença zoonótica que afeta cerca de 12 milhões de pessoas no mundo todo. Várias espécies mamíferas podem servir de reservatório para a doença. Os cães são considerados os principais reservatórios para a leishmaniose visceral em áreas urbanas, o que tem se tornado um sério problema de saúde pública no Brasil. O objetivo deste trabalho foi avaliar a presença de Leishmania spp. em animais selvagens mantidos no zoológico de Ilha Solteira, São Paulo, Brasil. Foram coletados amostras de sangue e tecidos de cinco espécies diferentes: Speothos venaticus, Chrysocyon brachyurus, Cerdocyon thous, Pseudalopex vetulus, e Procyon

  11. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Science.gov (United States)

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  12. Distribution and identification of sand flies naturally infected with Leishmania from the Southeastern Peruvian Amazon.

    Science.gov (United States)

    Zorrilla, Victor; De Los Santos, Maxy B; Espada, Liz; Santos, Rocío Del Pilar; Fernandez, Roberto; Urquia, Albino; Stoops, Craig A; Ballard, Sarah-Blythe; Lescano, Andres G; Vásquez, Gissella M; Valdivia, Hugo O

    2017-11-01

    Cutaneous leishmaniasis (CL) is an important health problem in the New World affecting civilian and military populations that are frequently exposed in endemic settings. The Peruvian region of Madre de Dios located near the border with Brazil is one of the most endemic CL regions in South America with more than 4,451 reported cases between 2010 and 2015 according to the Peruvian epidemiology directorate. However, little is known regarding the diversity and distribution of sand fly vectors in this region. In this study, we aimed to characterize the sand fly fauna in this endemic setting and identify sand fly species naturally infected with Leishmania possibly involved in pathogen transmission. Sand fly collections were carried out during 2014 and 2015 in the communities of Flor de Acre, Villa Primavera, Mavila and Arca Pacahuara using CDC light traps and Shannon traps. Collected specimens were identified and non-blood-fed females were selected for Leishmania infection screening using kinetoplastid DNA-PCR (kDNA-PCR) and nested Real time PCR for species identification. A total of 10,897 phlebotomines belonging to the genus Lutzomyia (58 species) and Brumptomyia (2 species) were collected. Our study confirmed the widespread distribution and abundance of Lutzomyia (Trichophoromyia) spp. (24%), Lu. whitmani (19.4%) and Lu. yucumensis (15.8%) in the region. Analysis of Shannon diversity index indicates variability in sand fly composition across sites with Villa Primavera presenting the highest sand fly diversity and abundance. Leishmania screening by kDNA-PCR resulted in 45 positive pools collected from Flor de Acre (34 pools), Mavila (10 pools) and Arca Pacahuara (1 pool) and included 14 species: Lu. yucumensis, Lu. aragoi, Lu. sallesi, Lu. sherlocki, Lu. shawi, Lu. walkeri, Lu nevesi, Lu. migonei, Lu. davisi, Lu. carrerai, Lu. hirsuta, Lu. (Trichophoromyia) spp., Lu. llanosmartinsi and Lu. whitmani. Lutzomyia sherlocki, Lu. walkeri and Lu. llanosmartinsi had the

  13. Distribution and identification of sand flies naturally infected with Leishmania from the Southeastern Peruvian Amazon.

    Directory of Open Access Journals (Sweden)

    Victor Zorrilla

    2017-11-01

    Full Text Available Cutaneous leishmaniasis (CL is an important health problem in the New World affecting civilian and military populations that are frequently exposed in endemic settings. The Peruvian region of Madre de Dios located near the border with Brazil is one of the most endemic CL regions in South America with more than 4,451 reported cases between 2010 and 2015 according to the Peruvian epidemiology directorate. However, little is known regarding the diversity and distribution of sand fly vectors in this region. In this study, we aimed to characterize the sand fly fauna in this endemic setting and identify sand fly species naturally infected with Leishmania possibly involved in pathogen transmission.Sand fly collections were carried out during 2014 and 2015 in the communities of Flor de Acre, Villa Primavera, Mavila and Arca Pacahuara using CDC light traps and Shannon traps. Collected specimens were identified and non-blood-fed females were selected for Leishmania infection screening using kinetoplastid DNA-PCR (kDNA-PCR and nested Real time PCR for species identification.A total of 10,897 phlebotomines belonging to the genus Lutzomyia (58 species and Brumptomyia (2 species were collected. Our study confirmed the widespread distribution and abundance of Lutzomyia (Trichophoromyia spp. (24%, Lu. whitmani (19.4% and Lu. yucumensis (15.8% in the region. Analysis of Shannon diversity index indicates variability in sand fly composition across sites with Villa Primavera presenting the highest sand fly diversity and abundance. Leishmania screening by kDNA-PCR resulted in 45 positive pools collected from Flor de Acre (34 pools, Mavila (10 pools and Arca Pacahuara (1 pool and included 14 species: Lu. yucumensis, Lu. aragoi, Lu. sallesi, Lu. sherlocki, Lu. shawi, Lu. walkeri, Lu nevesi, Lu. migonei, Lu. davisi, Lu. carrerai, Lu. hirsuta, Lu. (Trichophoromyia spp., Lu. llanosmartinsi and Lu. whitmani. Lutzomyia sherlocki, Lu. walkeri and Lu. llanosmartinsi had the

  14. Distribution and identification of sand flies naturally infected with Leishmania from the Southeastern Peruvian Amazon

    Science.gov (United States)

    Zorrilla, Victor; De Los Santos, Maxy B.; Espada, Liz; Santos, Rocío del Pilar; Fernandez, Roberto; Urquia, Albino; Stoops, Craig A.; Ballard, Sarah-Blythe; Lescano, Andres G.; Vásquez, Gissella M.; Valdivia, Hugo O.

    2017-01-01

    Background Cutaneous leishmaniasis (CL) is an important health problem in the New World affecting civilian and military populations that are frequently exposed in endemic settings. The Peruvian region of Madre de Dios located near the border with Brazil is one of the most endemic CL regions in South America with more than 4,451 reported cases between 2010 and 2015 according to the Peruvian epidemiology directorate. However, little is known regarding the diversity and distribution of sand fly vectors in this region. In this study, we aimed to characterize the sand fly fauna in this endemic setting and identify sand fly species naturally infected with Leishmania possibly involved in pathogen transmission. Methods Sand fly collections were carried out during 2014 and 2015 in the communities of Flor de Acre, Villa Primavera, Mavila and Arca Pacahuara using CDC light traps and Shannon traps. Collected specimens were identified and non-blood-fed females were selected for Leishmania infection screening using kinetoplastid DNA-PCR (kDNA-PCR) and nested Real time PCR for species identification. Results A total of 10,897 phlebotomines belonging to the genus Lutzomyia (58 species) and Brumptomyia (2 species) were collected. Our study confirmed the widespread distribution and abundance of Lutzomyia (Trichophoromyia) spp. (24%), Lu. whitmani (19.4%) and Lu. yucumensis (15.8%) in the region. Analysis of Shannon diversity index indicates variability in sand fly composition across sites with Villa Primavera presenting the highest sand fly diversity and abundance. Leishmania screening by kDNA-PCR resulted in 45 positive pools collected from Flor de Acre (34 pools), Mavila (10 pools) and Arca Pacahuara (1 pool) and included 14 species: Lu. yucumensis, Lu. aragoi, Lu. sallesi, Lu. sherlocki, Lu. shawi, Lu. walkeri, Lu nevesi, Lu. migonei, Lu. davisi, Lu. carrerai, Lu. hirsuta, Lu. (Trichophoromyia) spp., Lu. llanosmartinsi and Lu. whitmani. Lutzomyia sherlocki, Lu. walkeri and Lu

  15. First molecular detection of Leishmania major within naturally infected Phlebotomus salehi from a zoonotic cutaneous leishmaniasis focus in southern Iran.

    Science.gov (United States)

    Azizi, K; Fakoorziba, M R; Jalali, M; Moemenbellah-Fard, M D

    2012-03-01

    Human cutaneous leishmaniasis (CL) is a major notifiable public health problem in many parts of Iran. It is often caused by the zooflagellate parasite Leishmania major which is mainly transmitted by the bites of female phlebotomine sandflies belonging to the genus Phlebotomus (Diptera: Psychodidae). The annual incidence of CL in Fars province, southern Iran, was about 108-144 in 2007. The leishmanial infections of wild sandflies that may act as vectors were thus investigated at an endemic focus in this province. In all 330 female Phlebotomus sandflies were screened for the detection of Leishmania-specific kinetoplast DNA (kDNA) by polymerase chain reaction (PCR) methods. A two stage nested PCR protocol was used to establish the identity of Leishmania major species in naturally infected sandflies. The L. major kDNA was detected in 18 (5.5%) individual sandflies which belonged to four different Phlebotomus species (Phlebotomus papatasi, Phlebotomus salehi, Phlebotomus sergenti and P. major group). For the first time, one naturally infected P. salehi specimen contained the kDNA of the protozoan parasite, L. major, with a main band of 560 base pairs identified using the nested PCR method. It seems most likely therefore that P. salehi is potentially a rare sylvatic vector of L. major parasites in parts of this province. This is the first combined morphological and molecular studies of P. salehi in Iran.

  16. Inhibition of growth of Leishmania mexicana mexicana by Leishmania mexicana amazonensis during "in vitro" co-cultivation Inibição do crescimento de Leishmania mexicana mexicana por Leishmania mexicana amazonensis durante o co-cultivo "in vitro"

    Directory of Open Access Journals (Sweden)

    Raquel S. Pacheco

    1987-12-01

    Full Text Available Inhibition of one Leishmania subspecies by exometabolites of another subspecies, a phenomenon not previously reported, is suggested by our recent observations in cell cloning experiments with Leishmania mexicana mexicana and Leishmania mexicana amazonensis. Clones were identified using the technique of schizodeme analysis. The phenomenon observed is clearly relevant to studies of parasite isolation, leishmanial metabolism, cross-immunity and chemotherapy.Inhibição do crescimento de um subespécie de Leishmania por exometabólitos de outra subespécie, um fenômeno ainda não notificado, é sugerido em nossas recentes observações em experimentos de clonagem celular com Leishmania mexicana mexicana e Leishmania mexicana amazonensis. Os clones foram identificados usando a técnica de análise de esquizodemas. O fenômeno observado é claramente relevante em estudos de isolamento parasitário, metabolismo, imunidade cruzada e quimioterapia.

  17. Molecular cloning and cold shock induced overexpression of the DNA encoding phor sensor domain from Mycobacterium tuberculosis as a target molecule for novel anti-tubercular drugs

    Science.gov (United States)

    Langi, Gladys Emmanuella Putri; Moeis, Maelita R.; Ihsanawati, Giri-Rachman, Ernawati Arifin

    2014-03-01

    Mycobacterium tuberculosis (Mtb), the sole cause of Tuberculosis (TB), is still a major global problem. The discovery of new anti-tubercular drugs is needed to face the increasing TB cases, especially to prevent the increase of cases with resistant Mtb. A potential novel drug target is the Mtb PhoR sensor domain protein which is the histidine kinase extracellular domain for receiving environmental signals. This protein is the initial part of the two-component system PhoR-PhoP regulating 114 genes related to the virulence of Mtb. In this study, the gene encoding PhoR sensor domain (SensPhoR) was subcloned from pGEM-T SensPhoR from the previous study (Suwanto, 2012) to pColdII. The construct pColdII SensPhoR was confirmed through restriction analysis and sequencing. Using the construct, SensPhoR was overexpressed at 15°C using Escherichia coli BL21 (DE3). Low temperature was chosen because according to the solubility prediction program of recombinant proteins from The University of Oklahama, the PhoR sensor domain has a chance of 79.8% to be expressed as insoluble proteins in Escherichia coli's (E. coli) cytoplasm. This prediction is also supported by other similar programs: PROSO and PROSO II. The SDS PAGE result indicated that the PhoR sensor domain recombinant protein was overexpressed. For future studies, this protein will be purified and used for structure analysis which can be used to find potential drugs through rational drug design.

  18. Enhanced anti-tumor effect of a gene gun-delivered DNA vaccine encoding the human papillomavirus type 16 oncoproteins genetically fused to the herpes simplex virus glycoprotein D

    Directory of Open Access Journals (Sweden)

    M.O. Diniz

    2011-05-01

    Full Text Available Anti-cancer DNA vaccines have attracted growing interest as a simple and non-invasive method for both the treatment and prevention of tumors induced by human papillomaviruses. Nonetheless, the low immunogenicity of parenterally administered vaccines, particularly regarding the activation of cytotoxic CD8+ T cell responses, suggests that further improvements in both vaccine composition and administration routes are still required. In the present study, we report the immune responses and anti-tumor effects of a DNA vaccine (pgD-E7E6E5 expressing three proteins (E7, E6, and E5 of the human papillomavirus type 16 genetically fused to the glycoprotein D of the human herpes simplex virus type 1, which was administered to mice by the intradermal (id route using a gene gun. A single id dose of pgD-E7E6E5 (2 µg/dose induced a strong activation of E7-specific interferon-γ (INF-γ-producing CD8+ T cells and full prophylactic anti-tumor effects in the vaccinated mice. Three vaccine doses inhibited tumor growth in 70% of the mice with established tumors. In addition, a single vaccine dose consisting of the co-administration of pgD-E7E6E5 and the vector encoding interleukin-12 or granulocyte-macrophage colony-stimulating factor further enhanced the therapeutic anti-tumor effects and conferred protection to 60 and 50% of the vaccinated mice, respectively. In conclusion, id administration of pgD-E7E6E5 significantly enhanced the immunogenicity and anti-tumor effects of the DNA vaccine, representing a promising administration route for future clinical trials.

  19. High frequency of the IVS2-2A>G DNA sequence variation in SLC26A5, encoding the cochlear motor protein prestin, precludes its involvement in hereditary hearing loss

    Directory of Open Access Journals (Sweden)

    Pereira Fred A

    2005-08-01

    Full Text Available Abstract Background Cochlear outer hair cells change their length in response to variations in membrane potential. This capability, called electromotility, is believed to enable the sensitivity and frequency selectivity of the mammalian cochlea. Prestin is a transmembrane protein required for electromotility. Homozygous prestin knockout mice are profoundly hearing impaired. In humans, a single nucleotide change in SLC26A5, encoding prestin, has been reported in association with hearing loss. This DNA sequence variation, IVS2-2A>G, occurs in the exon 3 splice acceptor site and is expected to abolish splicing of exon 3. Methods To further explore the relationship between hearing loss and the IVS2-2A>G transition, and assess allele frequency, genomic DNA from hearing impaired and control subjects was analyzed by DNA sequencing. SLC26A5 genomic DNA sequences from human, chimp, rat, mouse, zebrafish and fruit fly were aligned and compared for evolutionary conservation of the exon 3 splice acceptor site. Alternative splice acceptor sites within intron 2 of human SLC26A5 were sought using a splice site prediction program from the Berkeley Drosophila Genome Project. Results The IVS2-2A>G variant was found in a heterozygous state in 4 of 74 hearing impaired subjects of Hispanic, Caucasian or uncertain ethnicity and 4 of 150 Hispanic or Caucasian controls (p = 0.45. The IVS2-2A>G variant was not found in 106 subjects of Asian or African American descent. No homozygous subjects were identified (n = 330. Sequence alignment of SLC26A5 orthologs demonstrated that the A nucleotide at position IVS2-2 is invariant among several eukaryotic species. Sequence analysis also revealed five potential alternative splice acceptor sites in intron 2 of human SLC26A5. Conclusion These data suggest that the IVS2-2A>G variant may not occur more frequently in hearing impaired subjects than in controls. The identification of five potential alternative splice acceptor sites in

  20. Leishmania naiffi and Leishmania guyanensis reference genomes highlight genome structure and gene evolution in the Viannia subgenus.

    Science.gov (United States)

    Coughlan, Simone; Taylor, Ali Shirley; Feane, Eoghan; Sanders, Mandy; Schonian, Gabriele; Cotton, James A; Downing, Tim

    2018-04-01

    The unicellular protozoan parasite Leishmania causes the neglected tropical disease leishmaniasis, affecting 12 million people in 98 countries. In South America, where the Viannia subgenus predominates, so far only L. ( Viannia ) braziliensis and L. ( V. ) panamensis have been sequenced, assembled and annotated as reference genomes. Addressing this deficit in molecular information can inform species typing, epidemiological monitoring and clinical treatment. Here, L. ( V. ) naiffi and L. ( V. ) guyanensis genomic DNA was sequenced to assemble these two genomes as draft references from short sequence reads. The methods used were tested using short sequence reads for L. braziliensis M2904 against its published reference as a comparison. This assembly and annotation pipeline identified 70 additional genes not annotated on the original M2904 reference. Phylogenetic and evolutionary comparisons of L. guyanensis and L. naiffi with 10 other Viannia genomes revealed four traits common to all Viannia : aneuploidy, 22 orthologous groups of genes absent in other Leishmania subgenera, elevated TATE transposon copies and a high NADH-dependent fumarate reductase gene copy number. Within the Viannia , there were limited structural changes in genome architecture specific to individual species: a 45 Kb amplification on chromosome 34 was present in all bar L. lainsoni , L. naiffi had a higher copy number of the virulence factor leishmanolysin, and laboratory isolate L. shawi M8408 had a possible minichromosome derived from the 3' end of chromosome 34 . This combination of genome assembly, phylogenetics and comparative analysis across an extended panel of diverse Viannia has uncovered new insights into the origin and evolution of this subgenus and can help improve diagnostics for leishmaniasis surveillance.

  1. Intracellular zinc flux causes reactive oxygen species mediated mitochondrial dysfunction leading to cell death in Leishmania donovani.

    Directory of Open Access Journals (Sweden)

    Anjali Kumari

    Full Text Available Leishmaniasis caused by Leishmania parasite is a global threat to public health and one of the most neglected tropical diseases. Therefore, the discovery of novel drug targets and effective drug is a major challenge and an important goal. Leishmania is an obligate intracellular parasite that alternates between sand fly and human host. To survive and establish infections, Leishmania parasites scavenge and internalize nutrients from the host. Nevertheless, host cells presents mechanism like nutrient restriction to inhibit microbial growth and control infection. Zinc is crucial for cellular growth and disruption in its homeostasis hinders growth and survival in many cells. However, little is known about the role of zinc in Leishmania growth and survival. In this study, the effect of zinc on the growth and survival of L.donovani was analyzed by both Zinc-depletion and Zinc-supplementation using Zinc-specific chelator N, N, N', N'-tetrakis (2-pyridylmethyl ethylenediamine (TPEN and Zinc Sulfate (ZnSO4. Treatment of parasites with TPEN rather than ZnSO4 had significantly affected the growth in a dose- and time-dependent manner. The pre-treatment of promastigotes with TPEN resulted into reduced host-parasite interaction as indicated by decreased association index. Zn depletion resulted into flux in intracellular labile Zn pool and increased in ROS generation correlated with decreased intracellular total thiol and retention of plasma membrane integrity without phosphatidylserine exposure in TPEN treated promastigotes. We also observed that TPEN-induced Zn depletion resulted into collapse of mitochondrial membrane potential which is associated with increase in cytosolic calcium and cytochrome-c. DNA fragmentation analysis showed increased DNA fragments in Zn-depleted cells. In summary, intracellular Zn depletion in the L. donovani promastigotes led to ROS-mediated caspase-independent mitochondrial dysfunction resulting into apoptosis-like cell death

  2. Enhanced Efficacy of a Codon-Optimized DNA Vaccine Encoding the Glycoprotein Precursor Gene of Lassa Virus in a Guinea Pig Disease Model When Delivered by Dermal Electroporation

    Directory of Open Access Journals (Sweden)

    Niranjan Y. Sardesai

    2013-07-01

    Full Text Available Lassa virus (LASV causes a severe, often fatal, hemorrhagic fever endemic to West Africa. Presently, there are no FDA-licensed medical countermeasures for this disease. In a pilot study, we constructed a DNA vaccine (pLASV-GPC that expressed the LASV glycoprotein precursor gene (GPC. This plasmid was used to vaccinate guinea pigs (GPs using intramuscular electroporation as the delivery platform. Vaccinated GPs were protected from lethal infection (5/6 with LASV compared to the controls. However, vaccinated GPs experienced transient viremia after challenge, although lower than the mock-vaccinated controls. In a follow-on study, we developed a new device that allowed for both the vaccine and electroporation pulse to be delivered to the dermis. We also codon-optimized the GPC sequence of the vaccine to enhance expression in GPs. Together, these innovations resulted in enhanced efficacy of the vaccine. Unlike the pilot study where neutralizing titers were not detected until after virus challenge, modest neutralizing titers were detected in guinea pigs before challenge, with escalating titers detected after challenge. The vaccinated GPs were never ill and were not viremic at any timepoint. The combination of the codon-optimized vaccine and dermal electroporation delivery is a worthy candidate for further development.

  3. Efficient replication of the in vitro transcripts from cloned cDNA of tomato black ring virus satellite RNA requires the 48K satellite RNA-encoded protein.

    Science.gov (United States)

    Hemmer, O; Oncino, C; Fritsch, C

    1993-06-01

    Tomato black ring virus isolate L supports the multiplication of a large satellite RNA of 1376 nt which has no common features with the two genomic RNAs except for the terminal motif 5' VPg UUGAAAA and a 3' poly(A) tail. The TBRV sat-RNA contains an ORF for a protein of 48K which is translated both in vitro and in vivo. To determine the function of the 48K protein we have studied the effect of different mutations introduced in the ORF of the cDNA clone on the capacity of transcripts to multiply in Chenopodium quinoa plants or protoplasts when inoculated along with the genomic RNAs. Transcripts in which nucleotides have been substituted within the 5' proximal region of the ORF multiplied poorly even when the modification conserved the 48K protein sequence, suggesting that this portion of the ORF contains cis-acting RNA sequences. Transcripts with alterations in the internal region of the ORF retained their multiplication capacity provided the mutation did not destroy the ORF or modify the length of the protein expressed. The absence of multiplication in plants of transcripts unable to express the 48K protein and their inability to replicate in protoplasts suggest strongly that the sat-RNA translation product itself is implicated in the replication of sat-RNA.

  4. Isolation and characterization of a cDNA encoding (S)-cis-N-methylstylopine 14-hydroxylase from opium poppy, a key enzyme in sanguinarine biosynthesis.

    Science.gov (United States)

    Beaudoin, Guillaume A W; Facchini, Peter J

    2013-02-15

    Sanguinarine is a benzo[c]phenenthridine alkaloid with potent antimicrobial properties found commonly in plants of the Papaveraceae, including the roots of opium poppy (Papaver somniferum). Sanguinarine is formed from the central 1-benzylisoquinoline intermediate (S)-reticuline via the protoberberine alkaloid (S)-scoulerine, which undergoes five enzymatic oxidations and an N-methylation. The first four oxidations from (S)-scoulerine are catalyzed by cytochromes P450, whereas the final conversion involves a flavoprotein oxidase. All but one gene in the biosynthetic pathway from (S)-reticuline to sanguinarine has been identified. In this communication, we report the isolation and characterization of (S)-cis-N-methylstylopine 14-hydroxylase (MSH) from opium poppy based on the transcriptional induction in elicitor-treated cell suspension cultures and root-specific expression of the corresponding gene. Along with protopine 6-hydroxylase, which catalyzes the subsequent and penultimate step in sanguinarine biosynthesis, MSH is a member of the CYP82N subfamily of cytochromes P450. The full-length MSH cDNA was expressed in Saccharomyces cerevisiae and the recombinant microsomal protein was tested for enzymatic activity using 25 benzylisoquinoline alkaloids representing a wide range of structural subgroups. The only enzymatic substrates were the N-methylated protoberberine alkaloids N-methylstylopine and N-methylcanadine, which were converted to protopine and allocryptopine, respectively. Copyright © 2013. Published by Elsevier Inc.

  5. Human C6orf211 Encodes Armt1, a Protein Carboxyl Methyltransferase that Targets PCNA and Is Linked to the DNA Damage Response

    Directory of Open Access Journals (Sweden)

    J. Jefferson P. Perry

    2015-03-01

    Full Text Available Recent evidence supports the presence of an L-glutamyl methyltransferase(s in eukaryotic cells, but this enzyme class has been defined only in certain prokaryotic species. Here, we characterize the human C6orf211 gene product as “acidic residue methyltransferase-1” (Armt1, an enzyme that specifically targets proliferating cell nuclear antigen (PCNA in breast cancer cells, predominately methylating glutamate side chains. Armt1 homologs share structural similarities with the SAM-dependent methyltransferases, and negative regulation of activity by automethylation indicates a means for cellular control. Notably, shRNA-based knockdown of Armt1 expression in two breast cancer cell lines altered survival in response to genotoxic stress. Increased sensitivity to UV, adriamycin, and MMS was observed in SK-Br-3 cells, while in contrast, increased resistance to these agents was observed in MCF7 cells. Together, these results lay the foundation for defining the mechanism by which this post-translational modification operates in the DNA damage response (DDR.

  6. DNA Fragmentation Factor 45 (DFF45 Gene at 1p36.2 Is Homozygously Deleted and Encodes Variant Transcripts in Neuroblastoma Cell Line

    Directory of Open Access Journals (Sweden)

    Hong Wei Yang

    2001-01-01

    Full Text Available Recently, loss of heterozygosity (LOH studies suggest that more than two tumor suppressor genes lie on the short arm of chromosome 1 (1p in neuroblastoma (NB. To identify candidate tumor suppressor genes in NB, we searched for homozygous deletions in 20 NB cell lines using a high-density STS map spanning chromosome 1 p36, a common LOH region in NB. We found that the 45-kDa subunit of the DNA fragmentation factor (DFF45 gene was homozygously deleted in an NB cell line, NB-1. DFF45 is the chaperon of DFF40, and both molecules are necessary for caspase 3 to induce apoptosis. DFF35, a splicing variant of DFF45, is an inhibitor of DFF40. We examined 20 NB cell lines for expression and mutation of DFF45 gene by reverse transcription (RT-polymerase chain reaction (PCR and RT-PCR-single-strand conformation polymorphism. Some novel variant transcripts of the DFF45 gene were found in NB cell lines, but not in normal adrenal gland and peripheral blood. These variants may not serve as chaperons of DFF40, but as inhibitors like DFF35, thus disrupting the balance between DFF45 and DFF40. No mutations of the DFF45 gene were found in any NB cell line, suggesting that the DFF45 is not a tumor suppressor gene for NB. However, homozygous deletion of the DFF45 gene in the NB-1 cell line may imply the presence of unknown tumor suppressor genes in this region.

  7. Hydrodynamic delivery of plasmid DNA encoding human FcγR-Ig dimers blocks immune-complex mediated inflammation in mice.

    Science.gov (United States)

    Shashidharamurthy, R; Machiah, D; Bozeman, E N; Srivatsan, S; Patel, J; Cho, A; Jacob, J; Selvaraj, P

    2012-09-01

    Therapeutic use and function of recombinant molecules can be studied by the expression of foreign genes in mice. In this study, we have expressed human Fcγ receptor-Ig fusion molecules (FcγR-Igs) in mice by administering FcγR-Ig plasmid DNAs hydrodynamically and compared their effectiveness with purified molecules in blocking immune-complex (IC)-mediated inflammation in mice. The concentration of hydrodynamically expressed FcγR-Igs (CD16A(F)-Ig, CD32A(R)-Ig and CD32A(H)-Ig) reached a maximum of 130 μg ml(-1) of blood within 24 h after plasmid DNA administration. The in vivo half-life of FcγR-Igs was found to be 9-16 days and western blot analysis showed that the FcγR-Igs were expressed as a homodimer. The hydrodynamically expressed FcγR-Igs blocked 50-80% of IC-mediated inflammation up to 3 days in a reverse passive Arthus reaction model. Comparative analysis with purified molecules showed that hydrodynamically expressed FcγR-Igs are more efficient than purified molecules in blocking IC-mediated inflammation and had a higher half-life. In summary, these results suggest that the administration of a plasmid vector with the FcγR-Ig gene can be used to study the consequences of blocking IC binding to FcγRs during the development of inflammatory diseases. This approach may have potential therapeutic value in treating IC-mediated inflammatory autoimmune diseases such as lupus, arthritis and autoimmune vasculitis.

  8. Lutzomyia longipalpis saliva or salivary protein LJM19 protects against Leishmania braziliensis and the saliva of its vector, Lutzomyia intermedia.

    Directory of Open Access Journals (Sweden)

    Natalia M Tavares

    Full Text Available BACKGROUND: Leishmania transmission occurs in the presence of insect saliva. Immunity to Phlebotomus papatasi or Lutzomyia longipalpis saliva or salivary components confers protection against an infection by Leishmania in the presence of the homologous saliva. However, immunization with Lutzomyia intermedia saliva did not protect mice against Leishmania braziliensis plus Lu. intermedia saliva. In the present study, we have studied whether the immunization with Lu. longipalpis saliva or a DNA plasmid coding for LJM19 salivary protein would be protective against L. braziliensis infection in the presence of Lu. intermedia saliva, the natural vector for L. braziliensis. METHODOLOGY/PRINCIPAL FINDINGS: Immunization with Lu. longipalpis saliva or with LJM19 DNA plasmid induced a Delayed-Type Hypersensitivity (DTH response against Lu. longipalpis as well as against a Lu. intermedia saliva challenge. Immunized and unimmunized control hamsters were then intradermally infected in the ears with L. braziliensis in the presence of Lu. longipalpis or Lu. intermedia saliva. Animals immunized with Lu. longipalpis saliva exhibited smaller lesion sizes as well as reduced disease burdens both at lesion site and in the draining lymph nodes. These alterations were associated with a significant decrease in the expression levels of IL-10 and TGF-β. Animals immunized with LJM19 DNA plasmid presented similar findings in protection and immune response and additionally increased IFN-γ expression. CONCLUSIONS/SIGNIFICANCE: Immunization with Lu. longipalpis saliva or with a DNA plasmid coding LJM19 salivary protein induced protection in hamsters challenged with L. braziliensis plus Lu. intermedia saliva. These findings point out an important role of immune response against saliva components, suggesting the possibility to develop a vaccine using a single component of Lu. longipalpis saliva to generate protection against different species of Leishmania, even those

  9. Deprivation of L-Arginine Induces Oxidative Stress Mediated Apoptosis in Leishmania donovani Promastigotes: Contribution of the Polyamine Pathway

    Science.gov (United States)

    Mandal, Abhishek; Das, Sushmita; Roy, Saptarshi; Ghosh, Ayan Kumar; Sardar, Abul Hasan; Verma, Sudha; Saini, Savita; Singh, Ruby; Abhishek, Kumar; Kumar, Ajay; Mandal, Chitra; Das, Pradeep

    2016-01-01

    The growth and survival of intracellular parasites depends on the availability of extracellular nutrients. Deprivation of nutrients viz glucose or amino acid alters redox balance in mammalian cells as well as some lower organisms. To further understand the relationship, the mechanistic role of L-arginine in regulation of redox mediated survival of Leishmania donovani promastigotes was investigated. L-arginine deprivation from the culture medium was found to inhibit cell growth, reduce proliferation and increase L-arginine uptake. Relative expression of enzymes, involved in L-arginine metabolism, which leads to polyamine and trypanothione biosynthesis, were downregulated causing decreased production of polyamines in L-arginine deprived parasites and cell death. The resultant increase in reactive oxygen species (ROS), due to L-arginine deprivation, correlated with increased NADP+/NADPH ratio, decreased superoxide dismutase (SOD) level, increased lipid peroxidation and reduced thiol content. A deficiency of L-arginine triggered phosphatidyl serine externalization, a change in mitochondrial membrane potential, release of intracellular calcium and cytochrome-c. This finally led to DNA damage in Leishmania promastigotes. In summary, the growth and survival of Leishmania depends on the availability of extracellular L-arginine. In its absence the parasite undergoes ROS mediated, caspase-independent apoptosis-like cell death. Therefore, L-arginine metabolism pathway could be a probable target for controlling the growth of Leishmania parasites and disease pathogenesis. PMID:26808657

  10. Antileishmanial activity and tubulin polymerization inhibition of podophyllotoxin derivatives on Leishmania infantum

    Directory of Open Access Journals (Sweden)

    José Miguel Escudero-Martínez

    2017-12-01

    Full Text Available Leishmania microtubules play an important role not only in cell division, but also in keeping the shape of the parasite and motility of its free-living stages. Microtubules result from the self-assembly of alpha and beta tubulins, two phylogenetically conserved and very abundant eukaryotic proteins in kinetoplastids. The colchicine binding domain has inspired the discovery and development of several drugs currently in clinical use against parasites. However, this domain is less conserved in kinetoplastids and may be selectively targeted by new compounds. This report shows the antileishmanial effect of several series of compounds (53, derived from podophyllotoxin (a natural cyclolignan isolated from rhizomes of Podophyllum spp. and podophyllic aldehyde, on a transgenic, fluorescence-emitting strain of Leishmania infantum. These compounds were tested on both promastigotes and amastigote-infected mouse splenocytes, and in mammalian – mouse non-infected splenocytes and liver HepG2 cells – in order to determine selective indexes of the drugs. Results obtained with podophyllotoxin derivatives showed that the hydroxyl group at position C-7α was a structural requisite to kill the parasites. On regards podophyllic aldehyde, derivatives with C9-aldehyde group integrated into a bicyclic heterostructure displayed more potent antileishmanial effects and were relatively safe for host cells. Docking studies of podophyllotoxin and podophyllic aldehyde derivatives showed that these compounds share a similar pattern of interaction at the colchicine site of Leishmania tubulin, thus pointing to a common mechanism of action. However, the results obtained suggested that despite tubulin is a remarkable target against leishmaniasis, there is a poor correlation between inhibition of tubulin polymerization and antileishmanial effect of many of the compounds tested, fact that points to alternative pathways to kill the parasites. Keywords: Leishmania, Tubulin, DNA

  11. Molecular mechanisms of drug resistance in natural Leishmania populations vary with genetic background.

    Directory of Open Access Journals (Sweden)

    Saskia Decuypere

    Full Text Available The evolution of drug-resistance in pathogens is a major global health threat. Elucidating the molecular basis of pathogen drug-resistance has been the focus of many studies but rarely is it known whether a drug-resistance mechanism identified is universal for the studied pathogen; it has seldom been clarified whether drug-resistance mechanisms vary with the pathogen's genotype. Nevertheless this is of critical importance in gaining an understanding of the complexity of this global threat and in underpinning epidemiological surveillance of pathogen drug resistance in the field. This study aimed to assess the molecular and phenotypic heterogeneity that emerges in natural parasite populations under drug treatment pressure. We studied lines of the protozoan parasite Leishmania (L. donovani with differential susceptibility to antimonial drugs; the lines being derived from clinical isolates belonging to two distinct genetic populations that circulate in the leishmaniasis endemic region of Nepal. Parasite pathways known to be affected by antimonial drugs were characterised on five experimental levels in the lines of the two populations. Characterisation of DNA sequence, gene expression, protein expression and thiol levels revealed a number of molecular features that mark antimonial-resistant parasites in only one of the two populations studied. A final series of in vitro stress phenotyping experiments confirmed this heterogeneity amongst drug-resistant parasites from the two populations. These data provide evidence that the molecular changes associated with antimonial-resistance in natural Leishmania populations depend on the genetic background of the Leishmania population, which has resulted in a divergent set of resistance markers in the Leishmania populations. This heterogeneity of parasite adaptations provides severe challenges for the control of drug resistance in the field and the design of molecular surveillance tools for widespread

  12. Adenine phosphoribosyltransferase-deficient Leishmania donovani

    International Nuclear Information System (INIS)

    Kaur, K.; Iovannisci, D.M.; Ullman, B.

    1986-01-01

    To elucidate the relative roles of two routes for adenine salvage, the authors use biochemical genetic approaches to isolate clonal strains of Leishmania donovani promasatigotes genetically deficient in APRTase activity. The studies suggest that the metabolic rate of adenine in these organisms is initiated by deamination. The radiolabel incorporation experiments and biochemical experiments are described in which the rate of uptake of radiolabelled purine nucleobases (C 14) was determined. Results are presented

  13. Aislamiento de tres cepas de leishmania

    Directory of Open Access Journals (Sweden)

    Florentino Rey

    1942-08-01

    Full Text Available Con el ánimo de estudiar el problema parasitológico de la Leishmaniasis cutánea en Colombia, emprendimos algunas experiencias al respecto. Este es un estudio de aislamiento de tres cepas de Leishmania obtenidas de tres enfermos de distintas regiones del país, Investigadores colombianos que se han ocupado con anterioridad de este problema, obtuvieron siempre resultados negativos. Comunicaciones posteriores informarán sobre estudios experimentales de las cepas mencionadas.

  14. Leishmania infantum and Leishmania braziliensis: differences and similarities to evade the innate immune system

    Directory of Open Access Journals (Sweden)

    Sarah Athayde Couto Falcão

    2016-08-01

    Full Text Available Visceral Leishmaniasis is a severe form of the disease, caused by Leishmania infantum in the New World. Patients present an anergic immune response that favors parasite establishment and spreading through tissues like bone marrow and liver. On the other hand, Leishmania braziliensis causes localized cutaneous lesions, which can be self healing in some individuals. Interactions between host and parasite are essential to understand disease pathogenesis and progression. In this context, dendritic cells (DCs act as essential bridges that connect innate and adaptive immune responses. In this way, the aim of this study was to compare the effects of these two Leishmania species, in some aspects of human dendritic cells biology to better understanding of the evasion mechanisms of Leishmania from host innate immune response. To do so, DCs were obtained from monocytes from whole peripheral blood’s healthy volunteers donors and infected with L. infantum or L. braziliensis for 24 hours. We observed similar rates of infection (around 40% as well as parasite burden for both Leishmania species. Concerning surface molecules, we observed that both parasites induced CD86 expression when DCs were infected for 24h. On the other hand, we detected a lower surface expression of CD209 in the presence of both L. braziliensis and L. infantum, but only the last one promoted the survival of dendritic cells after 24 hours. Therefore, DCs infected by both Leishmania species showed a higher expression of CD86 and a decrease of CD209 expression, suggesting that both enter DCs through CD209 molecule. However, only L. infantum had the ability to inhibit DC apoptotic death, as an evasion mechanism that enables its spreading to organs like bone marrow and liver. Lastly, L. braziliensis was more silent parasite, once it did not inhibit DC apoptosis in our in vitro model.

  15. The use of radionuclide DNA probe technology for epidemiological studies of tegumentary leishmaniasis in Mato Grosso state, Brazil

    Energy Technology Data Exchange (ETDEWEB)

    Andrade, Antero Silva Ribeiro de [Centro de Desenvolvimento da Tecnologia Nuclear (CDTN/CNEN), Belo Horizonte, MG (Brazil); Fernandes, Octavio [Fundacao Oswaldo Cruz (FIOCRUZ), Rio de Janeiro, RJ (Brazil). Dept. de Medicina Tropical; Heub, Marcia; Fontes, Cor Jesus [Universidade Federal do Mato Grosso, Cuiaba, MT (Brazil). Hospital Universitario Julio Muller; Carvalho, Maria de Lourdes Ribeiro; Melo, Maria Norma de [Universidade Federal de Minas Gerais, Belo Horizonte, MG (Brazil). Dept. de Parasitologia

    2005-10-15

    DNA hybridisation, using probes labelled with 32 P, was used to type Leishmania samples isolated from patients living in endemic areas of Mato Grosso State (Brazil), and clinically diagnosed as having tegumentary leishmaniasis. k DNA cloned mini-circle probes specific for the Leishmania mexicana and Leishmania braziliensis complexes were used. The results showed that L. braziliensis is the predominant group infecting human patients in the state. Sixty-eight samples were typed, 64 samples (94.1%) belonging to the L. braziliensis complex and only four (5.9%) belonging to the L. mexicana complex. Accurate identification of the Leishmania permits better orientation of the medical follow-up, since clinical manifestations may vary depending on the complex to which the parasite belongs. The epidemiological information furnished by the identification of the Leishmania in given endemic area is also essential for the design of appropriate control measures. (author)

  16. The use of radionuclide DNA probe technology for epidemiological studies of tegumentary leishmaniasis in Mato Grosso state, Brazil

    International Nuclear Information System (INIS)

    Andrade, Antero Silva Ribeiro de; Fernandes, Octavio; Heub, Marcia; Fontes, Cor Jesus; Carvalho, Maria de Lourdes Ribeiro; Melo, Maria Norma de

    2005-01-01

    DNA hybridisation, using probes labelled with 32 P, was used to type Leishmania samples isolated from patients living in endemic areas of Mato Grosso State (Brazil), and clinically diagnosed as having tegumentary leishmaniasis. k DNA cloned mini-circle probes specific for the Leishmania mexicana and Leishmania braziliensis complexes were used. The results showed that L. braziliensis is the predominant group infecting human patients in the state. Sixty-eight samples were typed, 64 samples (94.1%) belonging to the L. braziliensis complex and only four (5.9%) belonging to the L. mexicana complex. Accurate identification of the Leishmania permits better orientation of the medical follow-up, since clinical manifestations may vary depending on the complex to which the parasite belongs. The epidemiological information furnished by the identification of the Leishmania in given endemic area is also essential for the design of appropriate control measures. (author)

  17. Leishmania infantum EndoG is an endo/exo-nuclease essential for parasite survival.

    Directory of Open Access Journals (Sweden)

    Eva Rico

    Full Text Available EndoG, a member of the DNA/RNA non-specific ββα-metal family of nucleases, has been demonstrated to be present in many organisms, including Trypanosomatids. This nuclease participates in the apoptotic program in these parasites by migrating from the mitochondrion to the nucleus, where it takes part in the degradation of genomic DNA that characterizes this process. We now demonstrate that Leishmania infantum EndoG (LiEndoG is an endo-exonuclease that has a preferential 5' exonuclease activity on linear DNA. Regardless of its role during apoptotic cell death, this enzyme seems to be necessary during normal development of the parasites as indicated by the reduced growth rates observed in LiEndoG hemi-knockouts and their poor infectivity in differentiated THP-1 cells. The pro-life role of this protein is also corroborated by the higher survival rates of parasites that over-express this protein after treatment with the LiEndoG inhibitor Lei49. Taken together, our results demonstrate that this enzyme plays essential roles in both survival and death of Leishmania parasites.

  18. Screening For Inhibitors Of Essential Leishmania Glucose Transporters

    Science.gov (United States)

    2011-07-01

    parasite life cycle and, unlike he amastigote form that lives inside mammalian macrophages, s viable provided that an alternative energy source such as pro...glucose transporters havebeenvalidated asnewdrug targets for proto- zoan parasites including Plasmodium falciparum, Leishmania mexicana and Trypanosoma...such as Leishmania species, Trypanosoma rucei, and Plasmodium falciparum, the causative agents of leish- aniasis, African sleeping sickness, and malaria

  19. Erythema exsudativum multiforme after a Leishmania skin test

    NARCIS (Netherlands)

    Wind, Bas S.; Guimarães, Luiz H.; Machado, Paulo R. L.

    2014-01-01

    A 45-year-old otherwise healthy male from an endemic region for Leishmania braziliensis infection in Bahia, Brazil, presented with three erosive hemorrhagic infiltrated plaques on the left shin accompanied with lymphadenopathy in the groin since one month. A Leishmania skin test performed on the

  20. [Eco-epidemiological aspects, natural detection and molecular identification of Leishmania spp. in Lutzomyia reburra, Lutzomyia barrettoi majuscula and Lutzomyia trapidoi].

    Science.gov (United States)

    Arrivillaga-Henríquez, Jazzmín; Enríquez, Sandra; Romero, Vanessa; Echeverría, Gustavo; Pérez-Barrera, Jorge; Poveda, Ana; Navarro, Juan-Carlos; Warburg, Alon; Benítez, Washington

    2017-03-29

    The province of Pichincha in Ecuador is an endemic area of cutaneous leishmaniasis, where anthropophilic sand flies with natural infection by Leishmania, have been reported as vectors. However, the role in transmission of zoophilic species has not been evaluated. To evaluate natural infection by Leishmania in two zoophilic phlebotomine sand fly species, Lutzomyia reburra and Lu. barrettoi majuscula, and one anthropophilic species, Lu. trapidoi, as well as the endophagy and synanthropism of these species in the northwest of Pichincha. Phlebotomines were collected using CDC light traps in different habitats and altitudes with presence of cutaneous leishmaniasis. Leishmania infection was detected using genomic DNA from females of the collected sand flies. We amplified the internal transcribed spacer gene of ribosomal RNA I (ITS1), the mitochondrial topoisomerase II gene (mtTOPOII), and the nuclear topoisomerase II gene (TopoII). Percentages of positivity for Leishmania, at spatio-temporal scale, proportion of endophagy and synanthropism index were calculated. Natural infection was determined for Le. amazonensis in Lu. reburra (9.5%) and Lu. b. majuscula (23.8%), while in Lu. trapidoi we detected Le. amazonensis, Le. brazilienis and Le. naiffi-lainsoni. Phlebotomines were asynanthropic and with low endophagy. Natural infection with Le. amazonensis was recorded for the first time in Lu. reburra and Lu. b. majuscula, demonstrating the importance of zoophilic phlebotomines in the maintenance of the Leishmania transmission cycle in endemic foci.

  1. Genome sequencing of the lizard parasite Leishmania tarentolae reveals loss of genes associated to the intracellular stage of human pathogenic species

    Science.gov (United States)

    Raymond, Frédéric; Boisvert, Sébastien; Roy, Gaétan; Ritt, Jean-François; Légaré, Danielle; Isnard, Amandine; Stanke, Mario; Olivier, Martin; Tremblay, Michel J.; Papadopoulou, Barbara; Ouellette, Marc; Corbeil, Jacques

    2012-01-01

    The Leishmania tarentolae Parrot-TarII strain genome sequence was resolved to an average 16-fold mean coverage by next-generation DNA sequencing technologies. This is the first non-pathogenic to humans kinetoplastid protozoan genome to be described thus providing an opportunity for comparison with the completed genomes of pathogenic Leishmania species. A high synteny was observed between all sequenced Leishmania species. A limited number of chromosomal regions diverged between L. tarentolae and L. infantum, while remaining syntenic to L. major. Globally, >90% of the L. tarentolae gene content was shared with the other Leishmania species. We identified 95 predicted coding sequences unique to L. tarentolae and 250 genes that were absent from L. tarentolae. Interestingly, many of the latter genes were expressed in the intracellular amastigote stage of pathogenic species. In addition, genes coding for products involved in antioxidant defence or participating in vesicular-mediated protein transport were underrepresented in L. tarentolae. In contrast to other Leishmania genomes, two gene families were expanded in L. tarentolae, namely the zinc metallo-peptidase surface glycoprotein GP63 and the promastigote surface antigen PSA31C. Overall, L. tarentolae's gene content appears better adapted to the promastigote insect stage rather than the amastigote mammalian stage. PMID:21998295

  2. Molecular detection and identification of Leishmania spp. in naturally infected Phlebotomus tobbi and Sergentomyia dentata in a focus of human and canine leishmaniasis in western Turkey.

    Science.gov (United States)

    Özbel, Yusuf; Karakuş, Mehmet; Arserim, Suha K; Kalkan, Şaban Orçun; Töz, Seray

    2016-03-01

    Human visceral leishmaniasis (VL) is reported from 38 provinces of Turkey and dogs are accepted as main reservoir hosts. Kuşadası town, belonging to Aydın province and located in western part of Turkey, is endemic for human and canine visceral leishmaniasis caused by Leishmania infantum MON1 and MON98. In this study, phlebotomine survey was conducted to determine the vector sand fly species and to identify sand fly blood meal sources. In August and September 2012, 1027 sand fly specimens were caught using CDC light traps. Eight Phlebotomus and two Sergentomyia species with the dominancy of Phlebotomus tobbi (61.34%) were detected. A total of 622 female sand flies (571 Phlebotomus; 51 Sergentomyia) were checked for Leishmania infection by direct dissection of the midgut. The half of the midgut content was inoculated into NNN culture for isolation of the parasite. Leishmania species-specific ITS1 real time PCR, conventional PCR assays of ITS1 and hsp70 genes and subsequent sequencing were performed from extracted DNAs. A region of cytochrome b (cyt-b) gene of vertebrates based PCR was used to determine the source of blood meal of sand flies. In microscopical examinations, two female specimens (0.32%) were found naturally infected with high number and different stages of promastigotes. No growth was observed in NNN culture but Leishmania DNA was obtained from both specimens. First positive specimen was identified as P. tobbi and L. infantum DNA was detected. Second specimen was Sergentomyia dentata, but Leishmania DNA could not be identified on species level. A total of 16 blood-fed female P. tobbi specimens were used for blood meal analysis and eight, three and one specimens were positive for human, dog and mouse, respectively. This is the first detection of Leishmania promastigotes using microscopical examination in P. tobbi and S. dentata in human and canine visceral leishmaniasis endemic area in western part of Turkey. Our results indicate that, (i) P. tobbi is

  3. The uvsI gene of Aspergillus nidulans required for UV-mutagenesis encodes a homolog to REV3, a subunit of the DNA polymerase zeta of yeast involved in translesion DNA synthesis.

    Science.gov (United States)

    Han, K Y; Chae, S K; Han, D M

    1998-07-01

    Defects in the uvsI gene of Aspergillus nidulans resulted in high UV sensitivity and reductions of spontaneous and UV-induced reversion of certain alleles, uvsl;uvsA double mutants exhibited high methyl methane sulfonate (MMS)-sensitivity in contrast to the slight sensitivity of the component single mutants. Using such a double mutant as recipient, a clone complementing uvsI501 has been isolated from a chromosome III specific library. The deduced amino acid sequence from the 1.1-kb sequenced region, a part of the 5.2-kb DNA fragment showing uvsI-complementing activity, had a 62% identity with REV3 of yeast. Disruptants of the cloned gene demonstrated the same level of sensitivity to UV light as uvsI and failed to complement uvsI501 in heterozygous diploids.

  4. A diagnostic assay based on variable intergenic region distinguishes between Leishmania donovani and Leishmania infantum

    Czech Academy of Sciences Publication Activity Database

    Chocholová, Eva; Jirků, Milan; Lukeš, Julius

    2008-01-01

    Roč. 55, č. 1 (2008), s. 75-78 ISSN 0015-5683 R&D Projects: GA MŠk LC07032; GA MŠk 2B06129 Institutional research plan: CEZ:AV0Z60220518 Keywords : Leishmania * assay * diagnosis Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 1.307, year: 2008

  5. The Genome Sequence of Leishmania (Leishmania) amazonensis: Functional Annotation and Extended Analysis of Gene Models

    Science.gov (United States)

    Real, Fernando; Vidal, Ramon Oliveira; Carazzolle, Marcelo Falsarella; Mondego, Jorge Maurício Costa; Costa, Gustavo Gilson Lacerda; Herai, Roberto Hirochi; Würtele, Martin; de Carvalho, Lucas Miguel; e Ferreira, Renata Carmona; Mortara, Renato Arruda; Barbiéri, Clara Lucia; Mieczkowski, Piotr; da Silveira, José Franco; Briones, Marcelo Ribeiro da Silva; Pereira, Gonçalo Amarante Guimarães; Bahia, Diana

    2013-01-01

    We present the sequencing and annotation of the Leishmania (Leishmania) amazonensis genome, an etiological agent of human cutaneous leishmaniasis in the Amazon region of Brazil. L. (L.) amazonensis shares features with Leishmania (L.) mexicana but also exhibits unique characteristics regarding geographical distribution and clinical manifestations of cutaneous lesions (e.g. borderline disseminated cutaneous leishmaniasis). Predicted genes were scored for orthologous gene families and conserved domains in comparison with other human pathogenic Leishmania spp. Carboxypeptidase, aminotransferase, and 3′-nucleotidase genes and ATPase, thioredoxin, and chaperone-related domains were represented more abundantly in L. (L.) amazonensis and L. (L.) mexicana species. Phylogenetic analysis revealed that these two species share groups of amastin surface proteins unique to the genus that could be related to specific features of disease outcomes and host cell interactions. Additionally, we describe a hypothetical hybrid interactome of potentially secreted L. (L.) amazonensis proteins and host proteins under the assumption that parasite factors mimic their mammalian counterparts. The model predicts an interaction between an L. (L.) amazonensis heat-shock protein and mammalian Toll-like receptor 9, which is implicated in important immune responses such as cytokine and nitric oxide production. The analysis presented here represents valuable information for future studies of leishmaniasis pathogenicity and treatment. PMID:23857904

  6. Nitric oxide production by Peromyscus yucatanicus (Rodentia infected with Leishmania (Leishmania mexicana

    Directory of Open Access Journals (Sweden)

    Elsy Nalleli Loría-Cervera

    2013-04-01

    Full Text Available Peromyscus yucatanicus (Rodentia: Cricetidae is a primary reservoir of Leishmania (Leishmania mexicana (Kinetoplastida: Trypanosomatidae. Nitric oxide (NO generally plays a crucial role in the containment and elimination of Leishmania. The aim of this study was to determine the amount of NO produced by P. yucatanicus infected with L. (L. mexicana. Subclinical and clinical infections were established in P. yucatanicus through inoculation with 1 x 10 2 and 2.5 x 10 6 promastigotes, respectively. Peritoneal macrophages were cultured alone or co-cultured with lymphocytes with or without soluble Leishmania antigen. The level of NO production was determined using the Griess reaction. The amount of NO produced was significantly higher (p ≤ 0.0001 in co-cultured macrophages and lymphocytes than in macrophages cultured alone. No differences in NO production were found between P. yucatanicus with subclinical L. (L. mexicana infections and animals with clinical infections. These results support the hypothesis that the immunological mechanisms of NO production in P. yucatanicus are similar to those described in mouse models of leishmaniasis and, despite NO production, P. yucatanicus is unable to clear the parasite infection.

  7. SnoVault and encodeD: A novel object-based storage system and applications to ENCODE metadata.

    Directory of Open Access Journals (Sweden)

    Benjamin C Hitz

    Full Text Available The Encyclopedia of DNA elements (ENCODE project is an ongoing collaborative effort to create a comprehensive catalog of functional elements initiated shortly after the completion of the Human Genome Project. The current database exceeds 6500 experiments across more than 450 cell lines and tissues using a wide array of experimental techniques to study the chromatin structure, regulatory and transcriptional landscape of the H. sapiens and M. musculus genomes. All ENCODE experimental data, metadata, and associated computational analyses are submitted to the ENCODE Data Coordination Center (DCC for validation, tracking, storage, unified processing, and distribution to community resources and the scientific community. As the volume of data increases, the identification and organization of experimental details becomes increasingly intricate and demands careful curation. The ENCODE DCC has created a general purpose software system, known as SnoVault, that supports metadata and file submission, a database used for metadata storage, web pages for displaying the metadata and a robust API for querying the metadata. The software is fully open-source, code and installation instructions can be found at: http://github.com/ENCODE-DCC/snovault/ (for the generic database and http://github.com/ENCODE-DCC/encoded/ to store genomic data in the manner of ENCODE. The core database engine, SnoVault (which is completely independent of ENCODE, genomic data, or bioinformatic data has been released as a separate Python package.

  8. Lutzomyia sand fly diversity and rates of infection by Wolbachia and an exotic Leishmania species on Barro Colorado Island, Panama.

    Directory of Open Access Journals (Sweden)

    Jorge Azpurua

    2010-03-01

    Full Text Available Sand flies (Diptera, Psychodidae, Phlebotominae in the genus Lutzomyia are the predominant vectors of the protozoan disease leishmaniasis in the New World. Within the watershed of the Panama Canal, the cutaneous form of leishmaniasis is a continuous health threat for residents, tourists and members of an international research community. Here we report the results of screening a tropical forest assemblage of sand fly species for infection by both Leishmania and a microbe that can potentially serve in vector population control, the cytoplasmically transmitted rickettsia, Wolbachia pipientis. Knowing accurately which Lutzomyia species are present, what their evolutionary relationships are, and how they are infected by strains of both Leishmania and Wolbachia is of critical value for building strategies to mitigate the impact of this disease in humans.We collected, sorted and then used DNA sequences to determine the diversity and probable phylogenetic relationships of the Phlebotominae occurring in the understory of Barro Colorado Island in the Republic of Panama. Sequence from CO1, the DNA barcoding gene, supported 18 morphology-based species determinations while revealing the presence of two possible "cryptic" species, one (Lu. sp. nr vespertilionis within the Vespertilionis group, the other (Lu. gomezi within the Lutzomyia-cruciata series. Using ITS-1 and "minicircle" primers we detected Leishmania DNA in 43.3% of Lu. trapidoi, 26.3% of Lu. gomezi individuals and in 0% of the other 18 sand fly species. Identical ITS-1 sequence was obtained from the Leishmania infecting Lu. trapidoi and Lu. gomezi, sequence which was 93% similar to Leishmania (viannia naiffi in GenBank, a species previously unknown in Panama, but recognized as a type of cutaneous leishmaniasis vectored broadly across northern and central South America. Distinct strains of the intracellular bacterium Wolbachia were detected in three of 20 sand fly species, including Lu. trapidoi

  9. An Innovative Field-Applicable Molecular Test to Diagnose Cutaneous Leishmania Viannia spp. Infections.

    Directory of Open Access Journals (Sweden)

    Omar A Saldarriaga

    2016-04-01

    Full Text Available Cutaneous and mucosal leishmaniasis is widely distributed in Central and South America. Leishmania of the Viannia subgenus are the most frequent species infecting humans. L. (V. braziliensis, L. (V. panamensis are also responsible for metastatic mucosal leishmaniasis. Conventional or real time PCR is a more sensitive diagnostic test than microscopy, but the cost and requirement for infrastructure and trained personnel makes it impractical in most endemic regions. Primary health systems need a sensitive and specific point of care (POC diagnostic tool. We developed a novel POC molecular diagnostic test for cutaneous leishmaniasis caused by Leishmania (Viannia spp. Parasite DNA was amplified using isothermal Recombinase Polymerase Amplification (RPA with primers and probes that targeted the kinetoplast DNA. The amplification product was detected by naked eye with a lateral flow (LF immunochromatographic strip. The RPA-LF had an analytical sensitivity equivalent to 0.1 parasites per reaction. The test amplified the principal L. Viannia species from multiple countries: L. (V. braziliensis (n = 33, L. (V. guyanensis (n = 17, L. (V. panamensis (n = 9. The less common L. (V. lainsoni, L. (V. shawi, and L. (V. naiffi were also amplified. No amplification was observed in parasites of the L. (Leishmania subgenus. In a small number of clinical samples (n = 13 we found 100% agreement between PCR and RPA-LF. The high analytical sensitivity and clinical validation indicate the test could improve the efficiency of diagnosis, especially in chronic lesions with submicroscopic parasite burdens. Field implementation of the RPA-LF test could contribute to management and control of cutaneous and mucosal leishmaniasis.

  10. Transcriptome profiling identifies genes/pathways associated with experimental resistance to paromomycin in Leishmania donovani

    Directory of Open Access Journals (Sweden)

    Aditya Verma

    2017-12-01

    Full Text Available Widespread resistance towards antimony and reports of relapses following miltefosine treatment has severely affected the management of visceral leishmaniasis (VL in the Indian subcontinent. Paromomycin (PMM, an aminoglycoside antibiotic, has been licensed for VL treatment in India in 2007. Although its use is still restricted in the field, unraveling the molecular mechanism of resistance towards PMM is the key to preserve the drug. In this study, PMM resistant lines were selected up to 100 μM of PMM in three distinct field isolates of Leishmania donovani at promastigote stage. The resistance induced at promastigote level was also evident in amastigotes which showed 6 fold decreases in PMM susceptibility. Comparative transcriptome profiling of PMM resistant (PMM-R and the corresponding PMM sensitive (PMM-S parasites revealed modulated expression of 500 genes (1.5 fold cut off in PMM-R parasites. Selected genes were validated for their modulated expression by quantitative real-time PCR. Functional classification and pathway analysis of modulated genes indicated probable adaptations in drug resistant lines which included a reduced oxidative phosphorylation; b increased glycosomal succinate fermentation and substrate level phosphorylation; c dependency on lipids and amino acids for energy generation; d reduced DNA synthesis and increased DNA damage repair and e decreased protein synthesis and degradation. Interestingly, PMM-R parasites showed a marked increase in PMM susceptibility in presence of verapamil and amlodipine, antagonists of Ca2+ channel that are also modulators of ABC transporters. Moreover, infection of macrophages by PMM-R parasites led to modulated nitric oxide (NO levels while reactive oxygen species (ROS level remained unaltered. The present study highlights the putative mechanisms of PMM resistance in Leishmania. Keywords: Leishmania donovani, Drug resistance, Paromomycin, Transcriptome, ABC transporters, Nitric oxide, Visceral

  11. Histopatologia da forma localizada de leishmaniose cutânea por Leishmania (Leishmania amazonensis Histopathology of the localized form of cutaneous leishmaniasis due to Leishmania (Leishmania amazonensis

    Directory of Open Access Journals (Sweden)

    Mário A. P. Moraes

    1994-10-01

    Full Text Available São descritas as alterações microscópicas presentes na forma localizada (ulcerada da Leishmaniose cutânea produzida por Leishmania (Leishmania amazonensis. Nesse tipo de manifestação, menos conhecido do que a forma anérgica ou difusa devida ao mesmo agente, as lesões são clinicamente idênticas às de leishmaniose cutânea causada por espécies outras de Leishmania, pertencentes ao subgênero Viannia. Na infecção localizada por L. (L. amazonensis, entretanto, há um aspecto peculiar, só recentemente conhecido, ou seja, cerca de 50% dos indivíduos atingidos não reagem ao teste de Montenegro. A principal característica histológica observada foi a acumulação na derme, quase sempre focal, de numerosos macrófagos contendo no citoplasma um grande vacúolo cheio de amastigotas. O quadro é semelhante ao da forma difusa, porém sem o aspecto histiocitomatóide, próprio da última. Afora esses grupos de macrófagos, vêem-se também, na forma localizada, muitas células mononucleares da inflamação, principalmente plasmócitos e macrófagos não parasitados. Os acúmulos de macrófagos com amastigotas, quando volumosos, podem sofrer necrose na parte central; os parasitos, contidos nas células, são destruídos com elas ou liberados, e sua eliminação através da úlcera deve contribuir para a cura do processo. Esse tipo de necrose nunca foi descrito em casos da forma difusa. Não houve grande diferença, no quadro histológico, entre pacientes Montenegro-negativos e positivos. Apenas em alguns casos, do grupo Montenegro-positivo, havia granulomas formados por histiócitos epitelióides sem parasitos. Quanto à persistência das células com parasitos nas lesões, observou-se que aos seis meses ou mais de evolução, em ambos os grupos, ainda estavam elas presentes. Tal achado não é comum na leishmaniose tegumentar por L. (V. braziliensis.The microscopic changes found in the localized form of the human cutaneous leishmaniasis due

  12. Molecular Cloning of a cDNA Encoding for Taenia solium TATA-Box Binding Protein 1 (TsTBP1) and Study of Its Interactions with the TATA-Box of Actin 5 and Typical 2-Cys Peroxiredoxin Genes.

    Science.gov (United States)

    Rodríguez-Lima, Oscar; García-Gutierrez, Ponciano; Jiménez, Lucía; Zarain-Herzberg, Ángel; Lazzarini, Roberto; Landa, Abraham

    2015-01-01

    TATA-box binding protein (TBP) is an essential regulatory transcription factor for the TATA-box and TATA-box-less gene promoters. We report the cloning and characterization of a full-length cDNA that encodes a Taenia solium TATA-box binding protein 1 (TsTBP1). Deduced amino acid composition from its nucleotide sequence revealed that encodes a protein of 238 residues with a predicted molecular weight of 26.7 kDa, and a theoretical pI of 10.6. The NH2-terminal domain shows no conservation when compared with to pig and human TBP1s. However, it shows high conservation in size and amino acid identity with taeniids TBP1s. In contrast, the TsTBP1 COOH-terminal domain is highly conserved among organisms, and contains the amino acids involved in interactions with the TATA-box, as well as with TFIIA and TFIIB. In silico TsTBP1 modeling reveals that the COOH-terminal domain forms the classical saddle structure of the TBP family, with one α-helix at the end, not present in pig and human. Native TsTBP1 was detected in T. solium cysticerci´s nuclear extract by western blot using rabbit antibodies generated against two synthetic peptides located in the NH2 and COOH-terminal domains of TsTBP1. These antibodies, through immunofluorescence technique, identified the TBP1 in the nucleus of cells that form the bladder wall of cysticerci of Taenia crassiceps, an organism close related to T. solium. Electrophoretic mobility shift assays using nuclear extracts from T. solium cysticerci and antibodies against the NH2-terminal domain of TsTBP1 showed the interaction of native TsTBP1 with the TATA-box present in T. solium actin 5 (pAT5) and 2-Cys peroxiredoxin (Ts2-CysPrx) gene promoters; in contrast, when antibodies against the anti-COOH-terminal domain of TsTBP1 were used, they inhibited the binding of TsTBP1 to the TATA-box of the pAT5 promoter gene.

  13. Arginine and Polyamines Fate in Leishmania Infection

    Science.gov (United States)

    Muxel, Sandra M.; Aoki, Juliana I.; Fernandes, Juliane C. R.; Laranjeira-Silva, Maria F.; Zampieri, Ricardo A.; Acuña, Stephanie M.; Müller, Karl E.; Vanderlinde, Rubia H.; Floeter-Winter, Lucile M.

    2018-01-01

    Leishmania is a protozoan parasite that alternates its life cycle between the sand fly and the mammalian host macrophages, involving several environmental changes. The parasite responds to these changes by promoting a rapid metabolic adaptation through cellular signaling modifications that lead to transcriptional and post-transcriptional gene expression regulation and morphological modifications. Molecular approaches such as gene expression regulation, next-generation sequencing (NGS), microRNA (miRNA) expression profiling, in cell Western blot analyses and enzymatic activity profiling, have been used to characterize the infection of murine BALB/c and C57BL/6 macrophages, as well as the human monocytic cell-lineage THP-1, with Leishmania amazonensis wild type (La-WT) or arginase knockout (La-arg-). These models are being used to elucidate physiological roles of arginine and polyamines pathways and the importance of arginase for the establishment of the infection. In this review, we will describe the main aspects of Leishmania-host interaction, focusing on the arginine and polyamines pathways and pointing to possible targets to be used for prognosis and/or in the control of the infection. The parasite enzymes, arginase and nitric oxide synthase-like, have essential roles in the parasite survival and in the maintenance of infection. On the other hand, in mammalian macrophages, defense mechanisms are activated inducing alterations in the mRNA, miRNA and enzymatic profiles that lead to the control of infection. Furthermore, the genetic background of both parasite and host are also important to define the fate of infection. PMID:29379478

  14. Asymptomatic Leishmania Infected Children: A Seroprevalence and Molecular Survey in a Rural Area of Fars Province, Southern Iran

    Directory of Open Access Journals (Sweden)

    Akram Layegh Gigloo

    2018-01-01

    Full Text Available The current study aimed to evaluate the seroprevalence of visceral leishmaniasis in asymptomatic healthy children in a rural area of Fars province, Southern Iran. Blood samples were taken from 617 asymptomatic healthy children and serum samples along with buffy coat were separated from the blood. The serum samples were assessed for antibodies against Leishmania infantum by an indirect ELISA and the buffy coats were tested for the presence of L. infantum DNA by molecular method. Of the 617 recruited children, 297 (48.1% were female and 317 (51.4% were male. Anti-Leishmania antibodies were detected in 17 (2.8% of the children. From those 17 seropositive cases, 5 (29.4% were male and 12 (70.6% cases were female. Children aged 5–8 years had the highest seroprevalence rate; however, no associations were found between seropositivity to Leishmania and gender or age of the children. Moreover, L. infantum DNA was detected in buffy coat of 8 (1.3% of 617 children. Three of the PCR-positive cases were seropositive whereas 14 of seropositive subjects (82.3% were PCR-negative. Findings of the current study revealed a considerable subclinical leishmanial infection in children in the studied rural area in the south of Iran. Results of the current study could be used for surveillance, prevention, and control of VL in the area.

  15. Expression and subcellular localization of ORC1 in Leishmania major

    International Nuclear Information System (INIS)

    Kumar, Diwakar; Mukherji, Agnideep; Saha, Swati

    2008-01-01

    The mechanism of DNA replication is highly conserved in eukaryotes, with the process being preceded by the ordered assembly of pre-replication complexes (pre-RCs). Pre-RC formation is triggered by the association of the origin replication complex (ORC) with chromatin. Leishmania major appears to have only one ORC ortholog, ORC1. ORC1 in other eukaryotes is the largest of the ORC subunits and is believed to play a significant role in modulating replication initiation. Here we report for the first time, the cloning of ORC1 from L. major, and the analysis of its expression in L. major promastigotes. In human cells ORC1 levels have been found to be upregulated in G1 and subsequently degraded, thus playing a role in controlling replication initiation. We examine the subcellular localization of L. major ORC1 in relation to the different stages of the cell cycle. Our results show that, unlike what is widely believed to be the case with ORC1 in human cells, ORC1 in L. major is nuclear at all stages of the cell cycle

  16. DNA probes

    International Nuclear Information System (INIS)

    Castelino, J.

    1992-01-01

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with 32 P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism's genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens

  17. DNA probes

    Energy Technology Data Exchange (ETDEWEB)

    Castelino, J

    1993-12-31

    The creation of DNA probes for detection of specific nucleotide segments differs from ligand detection in that it is a chemical rather than an immunological reaction. Complementary DNA or RNA is used in place of the antibody and is labelled with {sup 32}P. So far, DNA probes have been successfully employed in the diagnosis of inherited disorders, infectious diseases, and for identification of human oncogenes. The latest approach to the diagnosis of communicable and parasitic infections is based on the use of deoxyribonucleic acid (DNA) probes. The genetic information of all cells is encoded by DNA and DNA probe approach to identification of pathogens is unique because the focus of the method is the nucleic acid content of the organism rather than the products that the nucleic acid encodes. Since every properly classified species has some unique nucleotide sequences that distinguish it from every other species, each organism`s genetic composition is in essence a finger print that can be used for its identification. In addition to this specificity, DNA probes offer other advantages in that pathogens may be identified directly in clinical specimens 10 figs, 2 tabs

  18. Arginase activity of Leishmania isolated from patients with cutaneous leishmaniasis.

    Science.gov (United States)

    Badirzadeh, A; Taheri, T; Abedi-Astaneh, F; Taslimi, Y; Abdossamadi, Z; Montakhab-Yeganeh, H; Aghashahi, M; Niyyati, M; Rafati, S

    2017-09-01

    Cutaneous leishmaniasis (CL) is one of the most important vector-borne parasitic diseases, highly endemic in Iran, and its prevalence is increasing all over the country. Arginase (ARG) activity in isolated Leishmania parasites from CL patients is yet to be explored. This study aimed to compare the ARG activity of isolated Leishmania promastigotes from CL patients with a standard strain of Leishmania major and its influences on the disease pathogenesis. We recruited 16 confirmed CL patients from Qom Province, in central Iran; after detection of Leishmania species using PCR-RFLP, we assessed the levels of ARG in the isolated promastigotes and determined the parasites' growth rate. Only L. major was identified from CL patients. The level of ARG activity in the isolated Leishmania promastigotes from CL patients was significantly higher than that obtained from the standard strain of L. major. No significant correlations between ARG activity and lesion size, number or duration were observed; in contrast, a significant negative correlation was seen between ARG level and Leishmania' growth rate. The obtained results suggest that increased ARG expression and activity in the isolated Leishmania promastigotes might contribute to the higher parasite infectivity and play a major role in the pathogenicity of the CL. © 2017 John Wiley & Sons Ltd.

  19. Phlebotomine Sand Fly Fauna and Leishmania Infection in the Vicinity of the Serra do Cipó National Park, a Natural Brazilian Heritage Site

    Directory of Open Access Journals (Sweden)

    Rosana Silva Lana

    2015-01-01

    Full Text Available In the New World, the leishmaniases are primarily transmitted to humans through the bites of Leishmania-infected Lutzomyia (Diptera: Psychodidae phlebotomine sand flies. Any or both of two basic clinical forms of these diseases are endemic to several cities in Brazil—the American cutaneous leishmaniasis (ACL and the American visceral leishmaniasis (AVL. The present study was conducted in the urban area of a small-sized Brazilian municipality (Jaboticatubas, in which three cases of AVL and nine of ACL have been reported in the last five years. Jaboticatubas is an important tourism hub, as it includes a major part of the Serra do Cipó National Park. Currently, no local data is available on the entomological fauna or circulating Leishmania. During the one-year period of this study, we captured 3,104 phlebotomine sand flies belonging to sixteen Lutzomyia species. In addition to identifying incriminated or suspected vectors of ACL with DNA of the etiological agent of AVL and vice versa, we also detected Leishmania DNA in unexpected Lutzomyia species. The expressive presence of vectors and natural Leishmania infection indicates favorable conditions for the spreading of leishmaniases in the vicinity of the Serra do Cipó National Park.

  20. The current status of phlebotomine sand flies in Albania and incrimination of Phlebotomus neglectus (Diptera, Psychodidae) as the main vector of Leishmania infantum.

    Science.gov (United States)

    Velo, Enkelejda; Bongiorno, Gioia; Kadriaj, Perparim; Myrseli, Teita; Crilly, James; Lika, Aldin; Mersini, Kujtim; Di Muccio, Trentina; Bino, Silvia; Gramiccia, Marina; Gradoni, Luigi; Maroli, Michele

    2017-01-01

    The incidence of visceral leishmaniasis (VL) in Albania is higher than in other countries of southern Europe, however the role of local sand fly species in the transmission of Leishmania infantum was not addressed conclusively. In 2006, a country-wide collection of sand flies performed in 14 sites selected based on recent occurrence of VL cases showed that Phlebotomus neglectus was by far the most prevalent species (95.6%). Furthermore, 15% of pools made from 422 P. neglectus females tested positive for Leishmania sp. genomic DNA. In the same year, Culicoides trapping was performed for bluetongue disease surveillance in 91 sites of southern Albania, targeting livestock farms regardless recent occurrence of VL in the surveyed areas. In 35 sites where sand flies were collected along with midges, Phlebotomus perfiliewi was the most prevalent among the Phlebotomus species identified, however search for leishmanial DNA in females of this species was unsuccessful. In 2011, sand flies were trapped in 4 sites of north Albania characterized by high VL incidence, and females were dissected to search for Leishmania infections. Both P. neglectus and P. tobbi were collected at high densities. Two positive specimens were detected from a sample of 64 P. neglectus trapped in one site (3.1%). Parasites were successfully cultured from one specimen and characterized as belonging to Leishmania infantum zymodeme MON-1, the only zymodeme so far identified as the agent of human and canine leishmaniasis in the country. Altogether our studies indicate that P. neglectus is the main leishmaniasis vector in Albania.

  1. Phlebotomine Sand Fly Fauna and Leishmania Infection in the Vicinity of the Serra do Cipó National Park, a Natural Brazilian Heritage Site

    Science.gov (United States)

    Lana, Rosana Silva; Michalsky, Érika Monteiro; Fortes-Dias, Consuelo Latorre; França-Silva, João Carlos; Lara-Silva, Fabiana de Oliveira; Lima, Ana Cristina Vianna Mariano da Rocha; Moreira de Avelar, Daniel; Martins, Juliana Cristina Dias; Dias, Edelberto Santos

    2015-01-01

    In the New World, the leishmaniases are primarily transmitted to humans through the bites of Leishmania-infected Lutzomyia (Diptera: Psychodidae) phlebotomine sand flies. Any or both of two basic clinical forms of these diseases are endemic to several cities in Brazil—the American cutaneous leishmaniasis (ACL) and the American visceral leishmaniasis (AVL). The present study was conducted in the urban area of a small-sized Brazilian municipality (Jaboticatubas), in which three cases of AVL and nine of ACL have been reported in the last five years. Jaboticatubas is an important tourism hub, as it includes a major part of the Serra do Cipó National Park. Currently, no local data is available on the entomological fauna or circulating Leishmania. During the one-year period of this study, we captured 3,104 phlebotomine sand flies belonging to sixteen Lutzomyia species. In addition to identifying incriminated or suspected vectors of ACL with DNA of the etiological agent of AVL and vice versa, we also detected Leishmania DNA in unexpected Lutzomyia species. The expressive presence of vectors and natural Leishmania infection indicates favorable conditions for the spreading of leishmaniases in the vicinity of the Serra do Cipó National Park. PMID:25793193

  2. Leishmania major methionine sulfoxide reductase A is required for resistance to oxidative stress and efficient replication in macrophages.

    Directory of Open Access Journals (Sweden)

    Fiona M Sansom

    Full Text Available Leishmania are protozoan parasites that proliferate within the phagolysome of mammalian macrophages. While a number of anti-oxidant systems in these parasites have been shown to protect against endogenous as well as host-generated reactive oxygen species, the potential role of enzymes involved in the repair of oxidatively damaged proteins remains uncharacterized. The Leishmania spp genomes encode a single putative methionine sulfoxide reductase (MsrA that could have a role in reducing oxidized free and proteinogenic methionine residues. A GFP-fusion of L. major MsrA was shown to have a cytoplasmic localization by immunofluorescence microscopy and subcellular fractionation. An L. major msrA null mutant, generated by targeted replacement of both chromosomal allelles, was viable in rich medium but was unable to reduce exogenous methionine sulfoxide when cultivated in the presence of this amino acid, indicating that msrA encodes a functional MsrA. The ΔmsrA mutant exhibited increased sensitivity to H(2O(2 compared to wild type parasites and was unable to proliferate normally in macrophages. Wild type sensitivity to H(2O(2 and infectivity in macrophages was restored by complementation of the mutant with a plasmid encoding MsrA. Unexpectedly, the ΔmsrA mutant was able to induce normal lesions in susceptible BALB/c indicating that this protein is not essential for pathogenesis in vivo. Our results suggest that Leishmania MsrA contributes to the anti-oxidative defences of these parasites, but that complementary oxidative defence mechansims are up-regulated in lesion amastigotes.

  3. Diagnosis of Leishmania (Leishmania chagasi infection in dogs and the relationship with environmental and sanitary aspects in the municipality of Palmas, state of Tocantins, Brazil

    Directory of Open Access Journals (Sweden)

    Julio Gomes Bigeli

    2012-02-01

    Full Text Available INTRODUCTION: The aim of the present study was to identify the presence of Leishmania (Leishmania chagasi infection in dogs in the City of Palmas, Tocantins, Brazil, using the PCR technique to list the hot spots of infected dogs in the city and associate their occurrence to significant environmental changes at capture sites. METHODS: DNA was extracted from blood of dogs, and the PCR were performed with primers RV1/RV2. After screening the population studied, the regions of the city that had the highest occurrence of canine infection were detected. These sites were visited, and ecological parameters denoting anthropogenic disturbance were evaluated. RESULTS: Some important features were listed in the regions visited, such as low urbanization, lack of public collection of sewage, limited garbage collection, vacant lots with tall vegetation, decaying organic matter, and, most importantly, the occurrence of stray dogs and poultry in homes. CONCLUSIONS: The methodology for screening the population was very efficient, especially in evaluating a large number of individuals in a short time, with a high degree of automation. The results indicate an association between the observed parameters and the occurrence of infection in dogs. The model presented in the city is ideal for studies of disease progression and expansion and for the evaluation of control measures adopted for canine VL.

  4. A calmodulin-like protein (LCALA) is a new Leishmania amazonensis candidate for telomere end-binding protein.

    Science.gov (United States)

    Morea, Edna G O; Viviescas, Maria Alejandra; Fernandes, Carlos A H; Matioli, Fabio F; Lira, Cristina B B; Fernandez, Maribel F; Moraes, Barbara S; da Silva, Marcelo S; Storti, Camila B; Fontes, Marcos R M; Cano, Maria Isabel N

    2017-11-01

    Leishmania spp. telomeres are composed of 5'-TTAGGG-3' repeats associated with proteins. We have previously identified LaRbp38 and LaRPA-1 as proteins that bind the G-rich telomeric strand. At that time, we had also partially characterized a protein: DNA complex, named LaGT1, but we could not identify its protein component. Using protein-DNA interaction and competition assays, we confirmed that LaGT1 is highly specific to the G-rich telomeric single-stranded DNA. Three protein bands, with LaGT1 activity, were isolated from affinity-purified protein extracts in-gel digested, and sequenced de novo using mass spectrometry analysis. In silico analysis of the digested peptide identified them as a putative calmodulin with sequences identical to the T. cruzi calmodulin. In the Leishmania genome, the calmodulin ortholog is present in three identical copies. We cloned and sequenced one of the gene copies, named it LCalA, and obtained the recombinant protein. Multiple sequence alignment and molecular modeling showed that LCalA shares homology to most eukaryotes calmodulin. In addition, we demonstrated that LCalA is nuclear, partially co-localizes with telomeres and binds in vivo the G-rich telomeric strand. Recombinant LCalA can bind specifically and with relative affinity to the G-rich telomeric single-strand and to a 3'G-overhang, and DNA binding is calcium dependent. We have described a novel candidate component of Leishmania telomeres, LCalA, a nuclear calmodulin that binds the G-rich telomeric strand with high specificity and relative affinity, in a calcium-dependent manner. LCalA is the first reported calmodulin that binds in vivo telomeric DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  5. Cyclic nucleotide specific phosphodiesterases of Leishmania major

    Directory of Open Access Journals (Sweden)

    Linder Markus

    2006-03-01

    Full Text Available Abstract Background Leishmania represent a complex of important human pathogens that belong to the systematic order of the kinetoplastida. They are transmitted between their human and mammalian hosts by different bloodsucking sandfly vectors. In their hosts, the Leishmania undergo several differentiation steps, and their coordination and optimization crucially depend on numerous interactions between the parasites and the physiological environment presented by the fly and human hosts. Little is still known about the signalling networks involved in these functions. In an attempt to better understand the role of cyclic nucleotide signalling in Leishmania differentiation and host-parasite interaction, we here present an initial study on the cyclic nucleotide-specific phosphodiesterases of Leishmania major. Results This paper presents the identification of three class I cyclic-nucleotide-specific phosphodiesterases (PDEs from L. major, PDEs whose catalytic domains exhibit considerable sequence conservation with, among other, all eleven human PDE families. In contrast to other protozoa such as Dictyostelium, or fungi such as Saccharomyces cerevisiae, Candida ssp or Neurospora, no genes for class II PDEs were found in the Leishmania genomes. LmjPDEA contains a class I catalytic domain at the C-terminus of the polypeptide, with no other discernible functional domains elsewhere. LmjPDEB1 and LmjPDEB2 are coded for by closely related, tandemly linked genes on chromosome 15. Both PDEs contain two GAF domains in their N-terminal region, and their almost identical catalytic domains are located at the C-terminus of the polypeptide. LmjPDEA, LmjPDEB1 and LmjPDEB2 were further characterized by functional complementation in a PDE-deficient S. cerevisiae strain. All three enzymes conferred complementation, demonstrating that all three can hydrolyze cAMP. Recombinant LmjPDEB1 and LmjPDEB2 were shown to be cAMP-specific, with Km values in the low micromolar range

  6. Impact of phlebotomine sand flies on U.S. military operations at Tallil Air Base, Iraq: 4. Detection and identification of leishmania parasites in sand flies.

    Science.gov (United States)

    Coleman, Russell E; Hochberg, Lisa P; Swanson, Katherine I; Lee, John S; McAvin, James C; Moulton, John K; Eddington, David O; Groebner, Jennifer L; O'Guinn, Monica L; Putnam, John L

    2009-05-01

    Sand flies collected between April 2003 and November 2004 at Tallil Air Base, Iraq, were evaluated for the presence of Leishmania parasites using a combination of a real-time Leishmania-generic polymerase chain reaction (PCR) assay and sequencing of a 360-bp fragment of the glucose-6-phosphate-isomerase (GPI) gene. A total of 2,505 pools containing 26,574 sand flies were tested using the real-time PCR assay. Leishmania DNA was initially detected in 536 pools; however, after extensive retesting with the real-time PCR assay, a total of 456 pools were considered positive and 80 were considered indeterminate. A total of 532 samples were evaluated for Leishmania GPI by sequencing, to include 439 PCR-positive samples, 80 PCR-indeterminate samples, and 13 PCR-negative samples. Leishmania GPI was detected in 284 samples that were sequenced, to include 281 (64%) of the PCR-positive samples and 3 (4%) of the PCR-indeterminate samples. Of the 284 sequences identified as Leishmania, 261 (91.9%) were L. tarentolae, 18 (6.3%) were L. donovani-complex parasites, 3 (1.1%) were L. tropica, and 2 were similar to both L. major and L. tropica. Minimum field infection rates were 0.09% for L. donovani-complex parasites, 0.02% for L. tropica, and 0.01% for the L. major/tropica-like parasite. Subsequent sequencing of a 600-bp region of the "Hyper" gene of 12 of the L. donovani-complex parasites showed that all 12 parasites were L. infantum. These data suggest that L. infantum was the primary leishmanial threat to U.S. military personnel deployed to Tallil Air Base. The implications of these findings are discussed.

  7. The Polymerase chain reaction as a tool of molecular diagnosis of Leishmania infection in the Sudan

    International Nuclear Information System (INIS)

    Hashim, Amna Osman Yousif

    1997-06-01

    Leishmaniasis, manifesting on it's different clinical forms is endemic in different regions of the Sudan. diagnosis of the disease in the Sudan is usually done using simple methods such as microscopical examination of slit smirs, Histological sections and cultures. Serological diagnosis using enzymes linked immunosorbent assay (ELISA)- and direct agglutination test (DAT) are sometimes used as more sensitive tool has thrown light on the epidemiology of the disease in the Sudan. This study was conducted on 126 subjects to identify the parasites-causing the different clinical manifestations, to determine the genetic diversity of different isolates of Lieshmania- and to detect parasites in the peripheral blood of subjects from highly endemic foci. The study population consisted of 7 with suspected VL, 12 with suspected ML, 14 with suspected PKDL, 2 with sporotrichoid CL and 89 healthy games wardens and army soldiers from highly endemic foci. Parasites were cultured in biphasic medium and subcultured in liquid medium until mass production was stabilized. Extraction of DNA was done using three methods which were phenol/ chloroform/ isoamylalcohol, K buffer and proteinase K as well as lysing of the parasite with distilled water. The KDNA was amplified using species namely AJSI and DeB8. The products were analysed on 1.5% agarose gel-and were visualized and photographed with U.V. transilluminator and camera. Characteristic bands of 700 and 800 b.p corresponding to the full length of mini circle of L.major and L.donovani respectively were obtained on amplification of KDNA from patients with VL and CL. In some cases lower bands of 400 and 500 b.p PKDL and multiple bands for sporotrichoid CL.Leishmania DNA was detected from the conjucativa of the eye of a patient with PKDL. The genetic diversity of Leishmania parasite was determined by digesting PCR products from PKDL, sporotrichoids CL and VL patients. Different patterns were produced for each digesting product. This result

  8. The Polymerase chain reaction as a tool of molecular diagnosis of Leishmania infection in the Sudan

    Energy Technology Data Exchange (ETDEWEB)

    Hashim, Amna Osman Yousif [Department of Zoology, Faculty of Science, University of Khartoum, Khartoum (Sudan)

    1997-06-01

    Leishmaniasis, manifesting on it`s different clinical forms is endemic in different regions of the Sudan. diagnosis of the disease in the Sudan is usually done using simple methods such as microscopical examination of slit smirs, Histological sections and cultures. Serological diagnosis using enzymes linked immunosorbent assay (ELISA)- and direct agglutination test (DAT) are sometimes used as more sensitive tool has thrown light on the epidemiology of the disease in the Sudan. This study was conducted on 126 subjects to identify the parasites-causing the different clinical manifestations, to determine the genetic diversity of different isolates of Lieshmania- and to detect parasites in the peripheral blood of subjects from highly endemic foci. The study population consisted of 7 with suspected VL, 12 with suspected ML, 14 with suspected PKDL, 2 with sporotrichoid CL and 89 healthy games wardens and army soldiers from highly endemic foci. Parasites were cultured in biphasic medium and subcultured in liquid medium until mass production was stabilized. Extraction of DNA was done using three methods which were phenol/ chloroform/ isoamylalcohol, K buffer and proteinase K as well as lysing of the parasite with distilled water. The KDNA was amplified using species namely AJSI and DeB8. The products were analysed on 1.5% agarose gel-and were visualized and photographed with U.V. transilluminator and camera. Characteristic bands of 700 and 800 b.p corresponding to the full length of mini circle of L.major and L.donovani respectively were obtained on amplification of KDNA from patients with VL and CL. In some cases lower bands of 400 and 500 b.p PKDL and multiple bands for sporotrichoid CL.Leishmania DNA was detected from the conjucativa of the eye of a patient with PKDL. The genetic diversity of Leishmania parasite was determined by digesting PCR products from PKDL, sporotrichoids CL and VL patients. Different patterns were produced for each digesting product. This result

  9. Functional and genetic evidence that nucleoside transport is highly conserved in Leishmania species: Implications for pyrimidine-based chemotherapy

    Directory of Open Access Journals (Sweden)

    Khalid J.H. Alzahrani

    2017-08-01

    Full Text Available Leishmania pyrimidine salvage is replete with opportunities for therapeutic intervention with enzyme inhibitors or antimetabolites. Their uptake into cells depends upon specific transporters; therefore it is essential to establish whether various Leishmania species possess similar pyrimidine transporters capable of drug uptake. Here, we report a comprehensive characterization of pyrimidine transport in L. major and L. mexicana. In both species, two transporters for uridine/adenosine were detected, one of which also transported uracil and the antimetabolites 5-fluoruracil (5-FU and 5F,2′deoxyuridine (5F,2′dUrd, and was designated uridine-uracil transporter 1 (UUT1; the other transporter mediated uptake of adenosine, uridine, 5F,2′dUrd and thymidine and was designated Nucleoside Transporter 1 (NT1. To verify the reported L. donovani model of two NT1-like genes encoding uridine/adenosine transporters, and an NT2 gene encoding an inosine transporter, we cloned the corresponding L. major and L. mexicana genes, expressing each in T. brucei. Consistent with the L. donovani reports, the NT1-like genes of either species mediated the adenosine-sensitive uptake of [3H]-uridine but not of [3H]-inosine. Conversely, the NT2-like genes mediated uptake of [3H]-inosine but not [3H]-uridine. Among pyrimidine antimetabolites tested, 5-FU and 5F,2′dUrd were the most effective a