WorldWideScience

Sample records for large gene family

  1. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew

    2004-06-01

    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  2. Ultra Large Gene Families: A Matter of Adaptation or Genomic Parasites?

    Directory of Open Access Journals (Sweden)

    Philipp H. Schiffer

    2016-08-01

    Full Text Available Gene duplication is an important mechanism of molecular evolution. It offers a fast track to modification, diversification, redundancy or rescue of gene function. However, duplication may also be neutral or (slightly deleterious, and often ends in pseudo-geneisation. Here, we investigate the phylogenetic distribution of ultra large gene families on long and short evolutionary time scales. In particular, we focus on a family of NACHT-domain and leucine-rich-repeat-containing (NLR-genes, which we previously found in large numbers to occupy one chromosome arm of the zebrafish genome. We were interested to see whether such a tight clustering is characteristic for ultra large gene families. Our data reconfirm that most gene family inflations are lineage-specific, but we can only identify very few gene clusters. Based on our observations we hypothesise that, beyond a certain size threshold, ultra large gene families continue to proliferate in a mechanism we term “run-away evolution”. This process might ultimately lead to the failure of genomic integrity and drive species to extinction.

  3. Identification of a novel FBN1 gene mutation in a large Pakistani family with Marfan syndrome

    NARCIS (Netherlands)

    Micheal, S.; Khan, M.I.; Akhtar, F.; Weiss, M.M.; Islam, F.; Ali, M.; Qamar, R.; Maugeri, A.; Hollander, A.I. den

    2012-01-01

    PURPOSE: To describe a novel mutation in the fibrillin-1 (FBN1) gene in a large Pakistani family with autosomal dominant Marfan syndrome (MFS). METHODS: Blood samples were collected of 11 family members affected with Marfan syndrome, and DNA was isolated by phenol-extraction. The coding exons of

  4. Evolutionary mechanisms driving the evolution of a large polydnavirus gene family coding for protein tyrosine phosphatases

    Directory of Open Access Journals (Sweden)

    Serbielle Céline

    2012-12-01

    Full Text Available Abstract Background Gene duplications have been proposed to be the main mechanism involved in genome evolution and in acquisition of new functions. Polydnaviruses (PDVs, symbiotic viruses associated with parasitoid wasps, are ideal model systems to study mechanisms of gene duplications given that PDV genomes consist of virulence genes organized into multigene families. In these systems the viral genome is integrated in a wasp chromosome as a provirus and virus particles containing circular double-stranded DNA are injected into the parasitoids’ hosts and are essential for parasitism success. The viral virulence factors, organized in gene families, are required collectively to induce host immune suppression and developmental arrest. The gene family which encodes protein tyrosine phosphatases (PTPs has undergone spectacular expansion in several PDV genomes with up to 42 genes. Results Here, we present strong indications that PTP gene family expansion occurred via classical mechanisms: by duplication of large segments of the chromosomally integrated form of the virus sequences (segmental duplication, by tandem duplications within this form and by dispersed duplications. We also propose a novel duplication mechanism specific to PDVs that involves viral circle reintegration into the wasp genome. The PTP copies produced were shown to undergo conservative evolution along with episodes of adaptive evolution. In particular recently produced copies have undergone positive selection in sites most likely involved in defining substrate selectivity. Conclusion The results provide evidence about the dynamic nature of polydnavirus proviral genomes. Classical and PDV-specific duplication mechanisms have been involved in the production of new gene copies. Selection pressures associated with antagonistic interactions with parasitized hosts have shaped these genes used to manipulate lepidopteran physiology with evidence for positive selection involved in

  5. A large and functionally diverse family of Fad2 genes in safflower (Carthamus tinctorius L.

    Directory of Open Access Journals (Sweden)

    Cao Shijiang

    2013-01-01

    Full Text Available Abstract Background The application and nutritional value of vegetable oil is highly dependent on its fatty acid composition, especially the relative proportion of its two major fatty acids, i.e oleic acid and linoleic acid. Microsomal oleoyl phosphatidylcholine desaturase encoded by FAD2 gene is known to introduce a double bond at the Δ12 position of an oleic acid on phosphatidylcholine and convert it to linoleic acid. The known plant FAD2 enzymes are encoded by small gene families consisting of 1-4 members. In addition to the classic oleate Δ12-desaturation activity, functional variants of FAD2 that are capable of undertaking additional or alternative acyl modifications have also been reported in a limited number of plant species. In this study, our objective was to identify FAD2 genes from safflower and analyse their differential expression profile and potentially diversified functionality. Results We report here the characterization and functional expression of an exceptionally large FAD2 gene family from safflower, and the temporal and spatial expression profiles of these genes as revealed through Real-Time quantitative PCR. The diversified functionalities of some of the safflower FAD2 gene family members were demonstrated by ectopic expression in yeast and transient expression in Nicotiana benthamiana leaves. CtFAD2-1 and CtFAD2-10 were demonstrated to be oleate desaturases specifically expressed in developing seeds and flower head, respectively, while CtFAD2-2 appears to have relatively low oleate desaturation activity throughout the plant. CtFAD2-5 and CtFAD2-8 are specifically expressed in root tissues, while CtFAD2-3, 4, 6, 7 are mostly expressed in the cotyledons and hypocotyls in young safflower seedlings. CtFAD2-9 was found to encode a novel desaturase operating on C16:1 substrate. CtFAD2-11 is a tri-functional enzyme able to introduce a carbon double bond in either cis or trans configuration, or a carbon triple (acetylenic bond

  6. Reconstruction of Oomycete Genome Evolution Identifies Differences in Evolutionary Trajectories Leading to Present-Day Large Gene Families

    NARCIS (Netherlands)

    Seidl, M.F.; Ackerveken, van den G.; Govers, F.; Snel, B.

    2012-01-01

    The taxonomic class of oomycetes contains numerous pathogens of plants and animals but is related to nonpathogenic diatoms and brown algae. Oomycetes have flexible genomes comprising large gene families that play roles in pathogenicity. The evolutionary processes that shaped the gene content have

  7. Analysis of large deletions in BRCA1, BRCA2 and PALB2 genes in Finnish breast and ovarian cancer families

    International Nuclear Information System (INIS)

    Pylkäs, Katri; Erkko, Hannele; Nikkilä, Jenni; Sólyom, Szilvia; Winqvist, Robert

    2008-01-01

    BRCA1 and BRCA2 are the two most important genes associated with familial breast and ovarian cancer susceptibility. In addition, PALB2 has recently been identified as a breast cancer susceptibility gene in several populations. Here we have evaluated whether large genomic rearrangement in these genes could explain some of Finnish breast and/or ovarian cancer families. Altogether 61 index patients of Northern Finnish breast and/or ovarian cancer families were analyzed by Multiplex ligation-dependent probe amplification (MLPA) method in order to identify exon deletions and duplications in BRCA1, BRCA2 and PALB2. The families have been comprehensively screened for germline mutation in these genes by conventional methods of mutation analysis and were found negative. We identified one large deletion in BRCA1, deleting the most part of the gene (exon 1A-13) in one family with family history of ovarian cancer. No large genomic rearrangements were identified in either BRCA2 or PALB2. In Finland, women eligible for BRCA1 or BRCA2 mutation screening, when found negative, could benefit from screening for large genomic rearrangements at least in BRCA1. On the contrary, the genomic rearrangements in PALB2 seem not to contribute to the hereditary breast cancer susceptibility

  8. Members of a large retroposon family are determinants of post-transcriptional gene expression in Leishmania.

    Directory of Open Access Journals (Sweden)

    Frédéric Bringaud

    2007-09-01

    Full Text Available Trypanosomatids are unicellular protists that include the human pathogens Leishmania spp. (leishmaniasis, Trypanosoma brucei (sleeping sickness, and Trypanosoma cruzi (Chagas disease. Analysis of their recently completed genomes confirmed the presence of non-long-terminal repeat retrotransposons, also called retroposons. Using the 79-bp signature sequence common to all trypanosomatid retroposons as bait, we identified in the Leishmania major genome two new large families of small elements--LmSIDER1 (785 copies and LmSIDER2 (1,073 copies--that fulfill all the characteristics of extinct trypanosomatid retroposons. LmSIDERs are approximately 70 times more abundant in L. major compared to T. brucei and are found almost exclusively within the 3'-untranslated regions (3'UTRs of L. major mRNAs. We provide experimental evidence that LmSIDER2 act as mRNA instability elements and that LmSIDER2-containing mRNAs are generally expressed at lower levels compared to the non-LmSIDER2 mRNAs. The considerable expansion of LmSIDERs within 3'UTRs in an organism lacking transcriptional control and their role in regulating mRNA stability indicate that Leishmania have probably recycled these short retroposons to globally modulate the expression of a number of genes. To our knowledge, this is the first example in eukaryotes of the domestication and expansion of a family of mobile elements that have evolved to fulfill a critical cellular function.

  9. Screening for large genomic rearrangements in the FANCA gene reveals extensive deletion in a Finnish breast cancer family.

    Science.gov (United States)

    Solyom, Szilvia; Winqvist, Robert; Nikkilä, Jenni; Rapakko, Katrin; Hirvikoski, Pasi; Kokkonen, Hannaleena; Pylkäs, Katri

    2011-03-28

    A portion of familial breast cancer cases are caused by mutations in the same genes that are inactivated in the downstream part of Fanconi anemia (FA) signaling pathway. Here we have assessed the FANCA gene for breast cancer susceptibility by examining blood DNA for aberrations from 100 Northern Finnish breast cancer families using the MLPA method. We identified a novel heterozygous deletion, removing the promoter and 12 exons of the gene in one family. This allele was absent from 124 controls. We conclude that FANCA deletions might contribute to breast cancer susceptibility, potentially in combination with other germline mutations. To our knowledge, this is the first study reporting a large deletion in an upstream FA gene in familial breast cancer. Copyright © 2010 Elsevier Ireland Ltd. All rights reserved.

  10. Exome sequencing of a large family identifies potential candidate genes contributing risk to bipolar disorder.

    Science.gov (United States)

    Zhang, Tianxiao; Hou, Liping; Chen, David T; McMahon, Francis J; Wang, Jen-Chyong; Rice, John P

    2018-03-01

    Bipolar disorder is a mental illness with lifetime prevalence of about 1%. Previous genetic studies have identified multiple chromosomal linkage regions and candidate genes that might be associated with bipolar disorder. The present study aimed to identify potential susceptibility variants for bipolar disorder using 6 related case samples from a four-generation family. A combination of exome sequencing and linkage analysis was performed to identify potential susceptibility variants for bipolar disorder. Our study identified a list of five potential candidate genes for bipolar disorder. Among these five genes, GRID1(Glutamate Receptor Delta-1 Subunit), which was previously reported to be associated with several psychiatric disorders and brain related traits, is particularly interesting. Variants with functional significance in this gene were identified from two cousins in our bipolar disorder pedigree. Our findings suggest a potential role for these genes and the related rare variants in the onset and development of bipolar disorder in this one family. Additional research is needed to replicate these findings and evaluate their patho-biological significance. Copyright © 2017 Elsevier B.V. All rights reserved.

  11. Age distribution of human gene families shows significant roles of both large- and small-scale duplications in vertebrate evolution.

    Science.gov (United States)

    Gu, Xun; Wang, Yufeng; Gu, Jianying

    2002-06-01

    The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.

  12. A large gene family in fission yeast encodes spore killers that subvert Mendel’s law

    Science.gov (United States)

    Hu, Wen; Jiang, Zhao-Di; Suo, Fang; Zheng, Jin-Xin; He, Wan-Zhong; Du, Li-Lin

    2017-01-01

    Spore killers in fungi are selfish genetic elements that distort Mendelian segregation in their favor. It remains unclear how many species harbor them and how diverse their mechanisms are. Here, we discover two spore killers from a natural isolate of the fission yeast Schizosaccharomyces pombe. Both killers belong to the previously uncharacterized wtf gene family with 25 members in the reference genome. These two killers act in strain-background-independent and genome-location-independent manners to perturb the maturation of spores not inheriting them. Spores carrying one killer are protected from its killing effect but not that of the other killer. The killing and protecting activities can be uncoupled by mutation. The numbers and sequences of wtf genes vary considerably between S. pombe isolates, indicating rapid divergence. We propose that wtf genes contribute to the extensive intraspecific reproductive isolation in S. pombe, and represent ideal models for understanding how segregation-distorting elements act and evolve. DOI: http://dx.doi.org/10.7554/eLife.26057.001 PMID:28631610

  13. The Caenorhabditis chemoreceptor gene families

    Directory of Open Access Journals (Sweden)

    Robertson Hugh M

    2008-10-01

    Full Text Available Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Conclusion Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  14. The Caenorhabditis chemoreceptor gene families.

    Science.gov (United States)

    Thomas, James H; Robertson, Hugh M

    2008-10-06

    Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Based on manual curation and sequence comparisons among putative G-protein-coupled chemoreceptor genes in the nematode Caenorhabditis elegans, we identified approximately 1300 genes and 400 pseudogenes in the 19 largest gene families, most of which fall into larger superfamilies. In the related species C. briggsae and C. remanei, we identified most or all genes in each of the 19 families. For most families, C. elegans has the largest number of genes and C. briggsae the smallest number, suggesting changes in the importance of chemoperception among the species. Protein trees reveal family-specific and species-specific patterns of gene duplication and gene loss. The frequency of strict orthologs varies among the families, from just over 50% in two families to less than 5% in three families. Several families include large species-specific expansions, mostly in C. elegans and C. remanei. Chemoreceptor gene families in Caenorhabditis species are large and evolutionarily dynamic as a result of gene duplication and gene loss. These dynamics shape the chemoreceptor gene complements in Caenorhabditis species and define the receptor space available for chemosensory responses. To explain these patterns, we propose the gray pawn hypothesis: individual genes are of little significance, but the aggregate of a large number of diverse genes is required to cover a large phenotype space.

  15. High incidence of large deletions in the PMS2 gene in Spanish Lynch syndrome families.

    Science.gov (United States)

    Brea-Fernández, A J; Cameselle-Teijeiro, J M; Alenda, C; Fernández-Rozadilla, C; Cubiella, J; Clofent, J; Reñé, J M; Anido, U; Milá, M; Balaguer, F; Castells, A; Castellvi-Bel, S; Jover, R; Carracedo, A; Ruiz-Ponte, C

    2014-06-01

    Lynch syndrome (LS) is caused by germline mutations in one of the four mismatch repair (MMR) genes. Defects in this pathway lead to microsatellite instability (MSI) in DNA tumors, which constitutes the molecular hallmark of this disease. Selection of patients for genetic testing in LS is usually based on fulfillment of diagnostic clinical criteria (i.e. Amsterdam criteria or the revised Bethesda guidelines). However, following these criteria PMS2 mutations have probably been underestimated as their penetrances appear to be lower than those of the other MMR genes. The use of universal MMR study-based strategies, using MSI testing and immunohistochemical (IHC) staining, is being one proposed alternative. Besides, germline mutation detection in PMS2 is complicated by the presence of highly homologous pseudogenes. Nevertheless, specific amplification of PMS2 by long-range polymerase chain reaction (PCR) and the improvement of the analysis of large deletions/duplications by multiplex ligation-dependent probe amplification (MLPA) overcome this difficulty. By using both approaches, we analyzed 19 PMS2-suspected carriers who have been selected by clinical or universal strategies and found five large deletions and one frameshift mutation in PMS2 in six patients (31%). Owing to the high incidence of large deletions found in our cohort, we recommend MLPA analysis as the first-line method for searching germline mutations in PMS2. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  16. Targeted Enrichment of Large Gene Families for Phylogenetic Inference: Phylogeny and Molecular Evolution of Photosynthesis Genes in the Portullugo Clade (Caryophyllales).

    Science.gov (United States)

    Moore, Abigail J; Vos, Jurriaan M De; Hancock, Lillian P; Goolsby, Eric; Edwards, Erika J

    2018-05-01

    Hybrid enrichment is an increasingly popular approach for obtaining hundreds of loci for phylogenetic analysis across many taxa quickly and cheaply. The genes targeted for sequencing are typically single-copy loci, which facilitate a more straightforward sequence assembly and homology assignment process. However, this approach limits the inclusion of most genes of functional interest, which often belong to multi-gene families. Here, we demonstrate the feasibility of including large gene families in hybrid enrichment protocols for phylogeny reconstruction and subsequent analyses of molecular evolution, using a new set of bait sequences designed for the "portullugo" (Caryophyllales), a moderately sized lineage of flowering plants (~ 2200 species) that includes the cacti and harbors many evolutionary transitions to C$_{\\mathrm{4}}$ and CAM photosynthesis. Including multi-gene families allowed us to simultaneously infer a robust phylogeny and construct a dense sampling of sequences for a major enzyme of C$_{\\mathrm{4}}$ and CAM photosynthesis, which revealed the accumulation of adaptive amino acid substitutions associated with C$_{\\mathrm{4}}$ and CAM origins in particular paralogs. Our final set of matrices for phylogenetic analyses included 75-218 loci across 74 taxa, with ~ 50% matrix completeness across data sets. Phylogenetic resolution was greatly improved across the tree, at both shallow and deep levels. Concatenation and coalescent-based approaches both resolve the sister lineage of the cacti with strong support: Anacampserotaceae $+$ Portulacaceae, two lineages of mostly diminutive succulent herbs of warm, arid regions. In spite of this congruence, BUCKy concordance analyses demonstrated strong and conflicting signals across gene trees. Our results add to the growing number of examples illustrating the complexity of phylogenetic signals in genomic-scale data.

  17. Homozygous missense mutation in the LMAN2L gene segregates with intellectual disability in a large consanguineous Pakistani family.

    Science.gov (United States)

    Rafiullah, Rafiullah; Aslamkhan, Muhammad; Paramasivam, Nagarajan; Thiel, Christian; Mustafa, Ghulam; Wiemann, Stefan; Schlesner, Matthias; Wade, Rebecca C; Rappold, Gudrun A; Berkel, Simone

    2016-02-01

    Intellectual disability (ID) is a neurodevelopmental disorder affecting 1%-3% of the population worldwide. It is characterised by high phenotypic and genetic heterogeneity and in most cases the underlying cause of the disorder is unknown. In our study we investigated a large consanguineous family from Baluchistan, Pakistan, comprising seven affected individuals with a severe form of autosomal recessive ID (ARID) and epilepsy, to elucidate a putative genetic cause. Whole exome sequencing (WES) of a trio, including a child with ID and epilepsy and its healthy parents that were part of this large family, revealed a homozygous missense variant p.R53Q in the lectin mannose-binding 2-like (LMAN2L) gene. This homozygous variant was co-segregating in the family with the phenotype of severe ID and infantile epilepsy; unaffected family members were heterozygous variant carriers. The variant was predicted to be pathogenic by five different in silico programmes and further three-dimensional structure modelling of the protein suggests that variant p.R53Q may impair protein-protein interaction. LMAN2L (OMIM: 609552) encodes for the lectin, mannose-binding 2-like protein which is a cargo receptor in the endoplasmic reticulum important for glycoprotein transport. Genome-wide association studies have identified an association of LMAN2L to different neuropsychiatric disorders. This is the first report linking LMAN2L to a phenotype of severe ARID and seizures, indicating that the deleterious homozygous p.R53Q variant very likely causes the disorder. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

  18. Regulatory patterns of a large family of defensin-like genes expressed in nodules of Medicago truncatula.

    Directory of Open Access Journals (Sweden)

    Sumitha Nallu

    Full Text Available Root nodules are the symbiotic organ of legumes that house nitrogen-fixing bacteria. Many genes are specifically induced in nodules during the interactions between the host plant and symbiotic rhizobia. Information regarding the regulation of expression for most of these genes is lacking. One of the largest gene families expressed in the nodules of the model legume Medicago truncatula is the nodule cysteine-rich (NCR group of defensin-like (DEFL genes. We used a custom Affymetrix microarray to catalog the expression changes of 566 NCRs at different stages of nodule development. Additionally, bacterial mutants were used to understand the importance of the rhizobial partners in induction of NCRs. Expression of early NCRs was detected during the initial infection of rhizobia in nodules and expression continued as nodules became mature. Late NCRs were induced concomitantly with bacteroid development in the nodules. The induction of early and late NCRs was correlated with the number and morphology of rhizobia in the nodule. Conserved 41 to 50 bp motifs identified in the upstream 1,000 bp promoter regions of NCRs were required for promoter activity. These cis-element motifs were found to be unique to the NCR family among all annotated genes in the M. truncatula genome, although they contain sub-regions with clear similarity to known regulatory motifs involved in nodule-specific expression and temporal gene regulation.

  19. CONFIRMATION OF X-LINKED INHERITANCE AND PROVISIONAL MAPPING OF THE KERATOSIS FOLLICULARIS SPINULOSA DECALVANS GENE ON XP IN A LARGE DUTCH FAMILY

    NARCIS (Netherlands)

    Oosterwijk, JC; NELEN, M; VANZANDVOORT, PM; VANOSCH, LDM; ORANJE, AP; WITTEBOLPOST, D; VANOOST, BA

    In a large Dutch family with keratosis follicularis spinulosa decalvans (KFSD, MIM 308800), DNA linkage analysis was performed in order to locate the gene. Pedigree analysis and lod score calculation confirmed X-linked inheritance and revealed significant linkage to DNA markers on Xp. A maximum lod

  20. A novel HSF4 gene mutation (p.R405X causing autosomal recessive congenital cataracts in a large consanguineous family from Pakistan

    Directory of Open Access Journals (Sweden)

    Cheema Abdul

    2008-11-01

    Full Text Available Abstract Background Hereditary cataracts are most frequently inherited as autosomal dominant traits, but can also be inherited in an autosomal recessive or X-linked fashion. To date, 12 loci for autosomal recessive cataracts have been mapped including a locus on chromosome 16q22 containing the disease-causing gene HSF4 (Genbank accession number NM_001040667. Here, we describe a family from Pakistan with the first nonsense mutation in HSF4 thus expanding the mutational spectrum of this heat shock transcription factor gene. Methods A large consanguineous Pakistani family with autosomal recessive cataracts was collected from Quetta. Genetic linkage analysis was performed for the common known autosomal recessive cataracts loci and linkage to a locus containing HSF4 (OMIM 602438 was found. All exons and adjacent splice sites of the heat shock transcription factor 4 gene (HSF4 were sequenced. A mutation-specific restriction enzyme digest (HphI was performed for all family members and unrelated controls. Results The disease phenotype perfectly co-segregated with markers flanking the known cataract gene HSF4, whereas other autosomal recessive loci were excluded. A maximum two-point LOD score with a Zmax = 5.6 at θ = 0 was obtained for D16S421. Direct sequencing of HSF4 revealed the nucleotide exchange c.1213C > T in this family predicting an arginine to stop codon exchange (p.R405X. Conclusion We identified the first nonsense mutation (p.R405X in exon 11 of HSF4 in a large consanguineous Pakistani family with autosomal recessive cataract.

  1. Immunoglobulin Heavy Chain Variable Region and Major Histocompatibility Region Genes Are Linked to Induced Graves' Disease in Females From Two Very Large Families of Recombinant Inbred Mice

    Science.gov (United States)

    Aliesky, Holly; Banuelos, Bianca; Magana, Jessica; Williams, Robert W.; Rapoport, Basil

    2014-01-01

    Graves' hyperthyroidism is caused by antibodies to the TSH receptor (TSHR) that mimic thyroid stimulation by TSH. Stimulating TSHR antibodies and hyperthyroidism can be induced by immunizing mice with adenovirus expressing the human TSHR A-subunit. Prior analysis of induced Graves' disease in small families of recombinant inbred (RI) female mice demonstrated strong genetic control but did not resolve trait loci for TSHR antibodies or elevated serum T4. We investigated the genetic basis for induced Graves' disease in female mice of two large RI families and combined data with earlier findings to provide phenotypes for 178 genotypes. TSHR antibodies measured by inhibition of TSH binding to its receptor were highly significantly linked in the BXD set to the major histocompatibility region (chromosome 17), consistent with observations in 3 other RI families. In the LXS family, we detected linkage between T4 levels after TSHR-adenovirus immunization and the Ig heavy chain variable region (Igvh, chromosome 12). This observation is a key finding because components of the antigen binding region of Igs determine antibody specificity and have been previously linked to induced thyroid-stimulating antibodies. Data from the LXS family provide the first evidence in mice of a direct link between induced hyperthyroidism and Igvh genes. A role for major histocompatibility genes has now been established for genetic susceptibility to Graves' disease in both humans and mice. Future studies using arrays incorporating variation in the complex human Ig gene locus will be necessary to determine whether Igvh genes are also linked to Graves' disease in humans. PMID:25051451

  2. Gene cluster statistics with gene families.

    Science.gov (United States)

    Raghupathy, Narayanan; Durand, Dannie

    2009-05-01

    Identifying genomic regions that descended from a common ancestor is important for understanding the function and evolution of genomes. In distantly related genomes, clusters of homologous gene pairs are evidence of candidate homologous regions. Demonstrating the statistical significance of such "gene clusters" is an essential component of comparative genomic analyses. However, currently there are no practical statistical tests for gene clusters that model the influence of the number of homologs in each gene family on cluster significance. In this work, we demonstrate empirically that failure to incorporate gene family size in gene cluster statistics results in overestimation of significance, leading to incorrect conclusions. We further present novel analytical methods for estimating gene cluster significance that take gene family size into account. Our methods do not require complete genome data and are suitable for testing individual clusters found in local regions, such as contigs in an unfinished assembly. We consider pairs of regions drawn from the same genome (paralogous clusters), as well as regions drawn from two different genomes (orthologous clusters). Determining cluster significance under general models of gene family size is computationally intractable. By assuming that all gene families are of equal size, we obtain analytical expressions that allow fast approximation of cluster probabilities. We evaluate the accuracy of this approximation by comparing the resulting gene cluster probabilities with cluster probabilities obtained by simulating a realistic, power-law distributed model of gene family size, with parameters inferred from genomic data. Surprisingly, despite the simplicity of the underlying assumption, our method accurately approximates the true cluster probabilities. It slightly overestimates these probabilities, yielding a conservative test. We present additional simulation results indicating the best choice of parameter values for data

  3. A missense mutation in the alpha-actinin 1 gene (ACTN1 is the cause of autosomal dominant macrothrombocytopenia in a large French family.

    Directory of Open Access Journals (Sweden)

    Paul Guéguen

    Full Text Available Inherited thrombocytopenia is a heterogeneous group of disorders characterized by a reduced number of blood platelets. Despite the identification of nearly 20 causative genes in the past decade, approximately half of all subjects with inherited thrombocytopenia still remain unexplained in terms of the underlying pathogenic mechanisms. Here we report a six-generation French pedigree with an autosomal dominant mode of inheritance and the identification of its genetic basis. Of the 55 subjects available for analysis, 26 were diagnosed with isolated macrothrombocytopenia. Genome-wide linkage analysis mapped a 10.9 Mb locus to chromosome 14 (14q22 with a LOD score of 7.6. Candidate gene analysis complemented by targeted next-generation sequencing identified a missense mutation (c.137GA; p.Arg46Gln in the alpha-actinin 1 gene (ACTN1 that segregated with macrothrombocytopenia in this large pedigree. The missense mutation occurred within actin-binding domain of alpha-actinin 1, a functionally critical domain that crosslinks actin filaments into bundles. The evaluation of cultured mutation-harboring megakaryocytes by electron microscopy and the immunofluorescence examination of transfected COS-7 cells suggested that the mutation causes disorganization of the cellular cytoplasm. Our study concurred with a recently published whole-exome sequence analysis of six small Japanese families with congenital macrothrombocytopenia, adding ACTN1 to the growing list of thrombocytopenia genes.

  4. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

    Directory of Open Access Journals (Sweden)

    Dullat Harpreet K

    2011-03-01

    Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

  5. The Caenorhabditis chemoreceptor gene families

    OpenAIRE

    Robertson Hugh M; Thomas James H

    2008-01-01

    Abstract Background Chemoreceptor proteins mediate the first step in the transduction of environmental chemical stimuli, defining the breadth of detection and conferring stimulus specificity. Animal genomes contain families of genes encoding chemoreceptors that mediate taste, olfaction, and pheromone responses. The size and diversity of these families reflect the biology of chemoperception in specific species. Results Based on manual curation and sequence comparisons among putative G-protein-...

  6. Genome-Wide Comparative Gene Family Classification

    Science.gov (United States)

    Frech, Christian; Chen, Nansheng

    2010-01-01

    Correct classification of genes into gene families is important for understanding gene function and evolution. Although gene families of many species have been resolved both computationally and experimentally with high accuracy, gene family classification in most newly sequenced genomes has not been done with the same high standard. This project has been designed to develop a strategy to effectively and accurately classify gene families across genomes. We first examine and compare the performance of computer programs developed for automated gene family classification. We demonstrate that some programs, including the hierarchical average-linkage clustering algorithm MC-UPGMA and the popular Markov clustering algorithm TRIBE-MCL, can reconstruct manual curation of gene families accurately. However, their performance is highly sensitive to parameter setting, i.e. different gene families require different program parameters for correct resolution. To circumvent the problem of parameterization, we have developed a comparative strategy for gene family classification. This strategy takes advantage of existing curated gene families of reference species to find suitable parameters for classifying genes in related genomes. To demonstrate the effectiveness of this novel strategy, we use TRIBE-MCL to classify chemosensory and ABC transporter gene families in C. elegans and its four sister species. We conclude that fully automated programs can establish biologically accurate gene families if parameterized accordingly. Comparative gene family classification finds optimal parameters automatically, thus allowing rapid insights into gene families of newly sequenced species. PMID:20976221

  7. Identification of an extensive gene cluster among a family of PPOs in Trifolium pratense L. (red clover using a large insert BAC library

    Directory of Open Access Journals (Sweden)

    Thomas Ann

    2009-07-01

    Full Text Available Abstract Background Polyphenol oxidase (PPO activity in plants is a trait with potential economic, agricultural and environmental impact. In relation to the food industry, PPO-induced browning causes unacceptable discolouration in fruit and vegetables: from an agriculture perspective, PPO can protect plants against pathogens and environmental stress, improve ruminant growth by increasing nitrogen absorption and decreasing nitrogen loss to the environment through the animal's urine. The high PPO legume, red clover, has a significant economic and environmental role in sustaining low-input organic and conventional farms. Molecular markers for a range of important agricultural traits are being developed for red clover and improved knowledge of PPO genes and their structure will facilitate molecular breeding. Results A bacterial artificial chromosome (BAC library comprising 26,016 BAC clones with an average 135 Kb insert size, was constructed from Trifolium pratense L. (red clover, a diploid legume with a haploid genome size of 440–637 Mb. Library coverage of 6–8 genome equivalents ensured good representation of genes: the library was screened for polyphenol oxidase (PPO genes. Two single copy PPO genes, PPO4 and PPO5, were identified to add to a family of three, previously reported, paralogous genes (PPO1–PPO3. Multiple PPO1 copies were identified and characterised revealing a subfamily comprising three variants PPO1/2, PPO1/4 and PPO1/5. Six PPO genes clustered within the genome: four separate BAC clones could be assembled onto a predicted 190–510 Kb single BAC contig. Conclusion A PPO gene family in red clover resides as a cluster of at least 6 genes. Three of these genes have high homology, suggesting a more recent evolutionary event. This PPO cluster covers a longer region of the genome than clusters detected in rice or previously reported in tomato. Full-length coding sequences from PPO4, PPO5, PPO1/5 and PPO1/4 will facilitate

  8. Unusual evolutionary conservation and further species-specific adaptations of a large family of nonclassical MHC class Ib genes across different degrees of genome ploidy in the amphibian subfamily Xenopodinae.

    Science.gov (United States)

    Edholm, Eva-Stina; Goyos, Ana; Taran, Joseph; De Jesús Andino, Francisco; Ohta, Yuko; Robert, Jacques

    2014-06-01

    Nonclassical MHC class Ib (class Ib) genes are a family of highly diverse and rapidly evolving genes wherein gene numbers, organization, and expression markedly differ even among closely related species rendering class Ib phylogeny difficult to establish. Whereas among mammals there are few unambiguous class Ib gene orthologs, different amphibian species belonging to the anuran subfamily Xenopodinae exhibit an unusually high degree of conservation among multiple class Ib gene lineages. Comparative genomic analysis of class Ib gene loci of two divergent (~65 million years) Xenopodinae subfamily members Xenopus laevis (allotetraploid) and Xenopus tropicalis (diploid) shows that both species possess a large cluster of class Ib genes denoted as Xenopus/Silurana nonclassical (XNC/SNC). Our study reveals two distinct phylogenetic patterns among these genes: some gene lineages display a high degree of flexibility, as demonstrated by species-specific expansion and contractions, whereas other class Ib gene lineages have been maintained as monogenic subfamilies with very few changes in their nucleotide sequence across divergent species. In this second category, we further investigated the XNC/SNC10 gene lineage that in X. laevis is required for the development of a distinct semi-invariant T cell population. We report compelling evidence of the remarkable high degree of conservation of this gene lineage that is present in all 12 species of the Xenopodinae examined, including species with different degrees of ploidy ranging from 2, 4, 8 to 12 N. This suggests that the critical role of XNC10 during early T cell development is conserved in amphibians.

  9. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 3. Genomewide ... Teosinte branched1/cycloidea/proliferating cell factor1 (TCP) proteins are a large family of transcriptional regulators in angiosperms. They are ... To the best of our knowledge, this is the first study of a genomewide analysis of apple TCP gene family.

  10. Deep RNA-Seq profile reveals biodiversity, plant-microbe interactions and a large family of NBS-LRR resistance genes in walnut (Juglans regia) tissues.

    Science.gov (United States)

    Chakraborty, Sandeep; Britton, Monica; Martínez-García, P J; Dandekar, Abhaya M

    2016-03-01

    Deep RNA-Seq profiling, a revolutionary method used for quantifying transcriptional levels, often includes non-specific transcripts from other co-existing organisms in spite of stringent protocols. Using the recently published walnut genome sequence as a filter, we present a broad analysis of the RNA-Seq derived transcriptome profiles obtained from twenty different tissues to extract the biodiversity and possible plant-microbe interactions in the walnut ecosystem in California. Since the residual nature of the transcripts being analyzed does not provide sufficient information to identify the exact strain, inferences made are constrained to the genus level. The presence of the pathogenic oomycete Phytophthora was detected in the root through the presence of a glyceraldehyde-3-phosphate dehydrogenase. Cryptococcus, the causal agent of cryptococcosis, was found in the catkins and vegetative buds, corroborating previous work indicating that the plant surface supported the sexual cycle of this human pathogen. The RNA-Seq profile revealed several species of the endophytic nitrogen fixing Actinobacteria. Another bacterial species implicated in aerobic biodegradation of methyl tert-butyl ether (Methylibium petroleiphilum) is also found in the root. RNA encoding proteins from the pea aphid were found in the leaves and vegetative buds, while a serine protease from mosquito with significant homology to a female reproductive tract protease from Drosophila mojavensis in the vegetative bud suggests egg-laying activities. The comprehensive analysis of RNA-seq data present also unraveled detailed, tissue-specific information of ~400 transcripts encoded by the largest family of resistance (R) genes (NBS-LRR), which possibly rationalizes the resistance of the specific walnut plant to the pathogens detected. Thus, we elucidate the biodiversity and possible plant-microbe interactions in several walnut (Juglans regia) tissues in California using deep RNA-Seq profiling.

  11. Site-specific protein O-glycosylation modulates proprotein processing - Deciphering specific functions of the large polypeptide GalNAc-transferase gene family

    DEFF Research Database (Denmark)

    Schjoldager, Katrine Ter-Borch Gram; Clausen, Henrik

    2012-01-01

    Posttranslational modifications (PTMs) greatly expand the function and regulation of proteins, and glycosylation is the most abundant and diverse PTM. Of the many different types of protein glycosylation, one is quite unique; GalNAc-type (or mucin-type) O-glycosylation, where biosynthesis...... and considerable redundancy. Recently we have begun to uncover human diseases associated with deficiencies in GalNAc-T genes (GALNTs). Thus deficiencies in individual GALNTs produce cell and protein specific effects and subtle distinct phenotypes such as hyperphosphatemia with hyperostosis (GALNT3...

  12. The ACBP gene family in Rhodnius prolixus

    DEFF Research Database (Denmark)

    Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C

    2016-01-01

    The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...

  13. The Eucalyptus terpene synthase gene family.

    Science.gov (United States)

    Külheim, Carsten; Padovan, Amanda; Hefer, Charles; Krause, Sandra T; Köllner, Tobias G; Myburg, Alexander A; Degenhardt, Jörg; Foley, William J

    2015-06-11

    Terpenoids are abundant in the foliage of Eucalyptus, providing the characteristic smell as well as being valuable economically and influencing ecological interactions. Quantitative and qualitative inter- and intra- specific variation of terpenes is common in eucalypts. The genome sequences of Eucalyptus grandis and E. globulus were mined for terpene synthase genes (TPS) and compared to other plant species. We investigated the relative expression of TPS in seven plant tissues and functionally characterized five TPS genes from E. grandis. Compared to other sequenced plant genomes, Eucalyptus grandis has the largest number of putative functional TPS genes of any sequenced plant. We discovered 113 and 106 putative functional TPS genes in E. grandis and E. globulus, respectively. All but one TPS from E. grandis were expressed in at least one of seven plant tissues examined. Genomic clusters of up to 20 genes were identified. Many TPS are expressed in tissues other than leaves which invites a re-evaluation of the function of terpenes in Eucalyptus. Our data indicate that terpenes in Eucalyptus may play a wider role in biotic and abiotic interactions than previously thought. Tissue specific expression is common and the possibility of stress induction needs further investigation. Phylogenetic comparison of the two investigated Eucalyptus species gives insight about recent evolution of different clades within the TPS gene family. While the majority of TPS genes occur in orthologous pairs some clades show evidence of recent gene duplication, as well as loss of function.

  14. Study of a large Anglo-Saxon family with beta-thalassaemia trait.

    Science.gov (United States)

    Raik, E; Powell, E; Gordon, S

    1976-01-01

    Study of a large Anglo-Saxon family with beta-thalassaemia trait revealed evidence of consanguinity, moreover both branches of the family shared a Spanish ancestor. The manifestations of the disorder were varied in severity and yet the degree of severity appeared to breed true within any individual part of the family. Our explanation for the inheritance pattern observed in the family was to postulate the existence of two non-allelic genes influencing the rate of beta-chain synthesis.

  15. The human protein disulfide isomerase gene family

    Directory of Open Access Journals (Sweden)

    Galligan James J

    2012-07-01

    Full Text Available Abstract Enzyme-mediated disulfide bond formation is a highly conserved process affecting over one-third of all eukaryotic proteins. The enzymes primarily responsible for facilitating thiol-disulfide exchange are members of an expanding family of proteins known as protein disulfide isomerases (PDIs. These proteins are part of a larger superfamily of proteins known as the thioredoxin protein family (TRX. As members of the PDI family of proteins, all proteins contain a TRX-like structural domain and are predominantly expressed in the endoplasmic reticulum. Subcellular localization and the presence of a TRX domain, however, comprise the short list of distinguishing features required for gene family classification. To date, the PDI gene family contains 21 members, varying in domain composition, molecular weight, tissue expression, and cellular processing. Given their vital role in protein-folding, loss of PDI activity has been associated with the pathogenesis of numerous disease states, most commonly related to the unfolded protein response (UPR. Over the past decade, UPR has become a very attractive therapeutic target for multiple pathologies including Alzheimer disease, Parkinson disease, alcoholic and non-alcoholic liver disease, and type-2 diabetes. Understanding the mechanisms of protein-folding, specifically thiol-disulfide exchange, may lead to development of a novel class of therapeutics that would help alleviate a wide range of diseases by targeting the UPR.

  16. Familial Interstitial Pulmonary Fibrosis: A Large Family with Atypical Clinical Features

    Directory of Open Access Journals (Sweden)

    Ranji Chibbar

    2010-01-01

    Full Text Available A large kindred of familial pulmonary fibrosis is reported. Six members from the first two generations of this particular kindred were described more than 40 years previously; six more individuals from the third and fourth generations have also been evaluated. The proband, now 23 years of age, has mild disease; the other 11 documented affected family members all died from their disease at an average age of 37 years (range 25 to 50 years. The pathology was that of usual interstitial pneumonia, as is typical in idiopathic pulmonary fibrosis. However, the initial radiographic pattern in many of these individuals was upper lobe and nodular and, along with the young age, was atypical for idiopathic pulmonary fibrosis. Several genetic abnormalities have been associated with familial pulmonary fibrosis. The present study examined the genes coding for surfactant protein-C, ATP-binding cassette protein A3 and telomerase, and found no abnormalities.

  17. Dlx homeobox gene family expression in osteoclasts.

    Science.gov (United States)

    Lézot, F; Thomas, B L; Blin-Wakkach, C; Castaneda, B; Bolanos, A; Hotton, D; Sharpe, P T; Heymann, D; Carles, G F; Grigoriadis, A E; Berdal, A

    2010-06-01

    Skeletal growth and homeostasis require the finely orchestrated secretion of mineralized tissue matrices by highly specialized cells, balanced with their degradation by osteoclasts. Time- and site-specific expression of Dlx and Msx homeobox genes in the cells secreting these matrices have been identified as important elements in the regulation of skeletal morphology. Such specific expression patterns have also been reported in osteoclasts for Msx genes. The aim of the present study was to establish the expression patterns of Dlx genes in osteoclasts and identify their function in regulating skeletal morphology. The expression patterns of all Dlx genes were examined during the whole osteoclastogenesis using different in vitro models. The results revealed that Dlx1 and Dlx2 are the only Dlx family members with a possible function in osteoclastogenesis as well as in mature osteoclasts. Dlx5 and Dlx6 were detected in the cultures but appear to be markers of monocytes and their derivatives. In vivo, Dlx2 expression in osteoclasts was examined using a Dlx2/LacZ transgenic mouse. Dlx2 is expressed in a subpopulation of osteoclasts in association with tooth, brain, nerve, and bone marrow volumetric growths. Altogether the present data suggest a role for Dlx2 in regulation of skeletal morphogenesis via functions within osteoclasts. (c) 2010 Wiley-Liss, Inc.

  18. NDP gene mutations in 14 French families with Norrie disease.

    Science.gov (United States)

    Royer, Ghislaine; Hanein, Sylvain; Raclin, Valérie; Gigarel, Nadine; Rozet, Jean-Michel; Munnich, Arnold; Steffann, Julie; Dufier, Jean-Louis; Kaplan, Josseline; Bonnefont, Jean-Paul

    2003-12-01

    Norrie disease is a rare X-inked recessive condition characterized by congenital blindness and occasionally deafness and mental retardation in males. This disease has been ascribed to mutations in the NDP gene on chromosome Xp11.1. Previous investigations of the NDP gene have identified largely sixty disease-causing sequence variants. Here, we report on ten different NDP gene allelic variants in fourteen of a series of 21 families fulfilling inclusion criteria. Two alterations were intragenic deletions and eight were nucleotide substitutions or splicing variants, six of them being hitherto unreported, namely c.112C>T (p.Arg38Cys), c.129C>G (p.His43Gln), c.133G>A (p.Val45Met), c.268C>T (p.Arg90Cys), c.382T>C (p.Cys128Arg), c.23479-1G>C (unknown). No NDP gene sequence variant was found in seven of the 21 families. This observation raises the issue of misdiagnosis, phenocopies, or existence of other X-linked or autosomal genes, the mutations of which would mimic the Norrie disease phenotype. Copyright 2003 Wiley-Liss, Inc.

  19. The claudin gene family: expression in normal and neoplastic tissues

    International Nuclear Information System (INIS)

    Hewitt, Kyle J; Agarwal, Rachana; Morin, Patrice J

    2006-01-01

    The claudin (CLDN) genes encode a family of proteins important in tight junction formation and function. Recently, it has become apparent that CLDN gene expression is frequently altered in several human cancers. However, the exact patterns of CLDN expression in various cancers is unknown, as only a limited number of CLDN genes have been investigated in a few tumors. We identified all the human CLDN genes from Genbank and we used the large public SAGE database to ascertain the gene expression of all 21 CLDN in 266 normal and neoplastic tissues. Using real-time RT-PCR, we also surveyed a subset of 13 CLDN genes in 24 normal and 24 neoplastic tissues. We show that claudins represent a family of highly related proteins, with claudin-16, and -23 being the most different from the others. From in silico analysis and RT-PCR data, we find that most claudin genes appear decreased in cancer, while CLDN3, CLDN4, and CLDN7 are elevated in several malignancies such as those originating from the pancreas, bladder, thyroid, fallopian tubes, ovary, stomach, colon, breast, uterus, and the prostate. Interestingly, CLDN5 is highly expressed in vascular endothelial cells, providing a possible target for antiangiogenic therapy. CLDN18 might represent a biomarker for gastric cancer. Our study confirms previously known CLDN gene expression patterns and identifies new ones, which may have applications in the detection, prognosis and therapy of several human cancers. In particular we identify several malignancies that express CLDN3 and CLDN4. These cancers may represent ideal candidates for a novel therapy being developed based on CPE, a toxin that specifically binds claudin-3 and claudin-4

  20. Neutrino bi-large mixings and family

    International Nuclear Information System (INIS)

    Bando, Masako; Obara, Midori

    2004-01-01

    After a brief review of quark-lepton relations in grand unified theories (GUT), we show that the Pati-Salam relation with only one type of Higgs field configuration with ''four zero symmetric texture'' can reproduce two large neutrino mixings as well as observed mass differences. This is quite in contrast to the case of SU(5) where bi-large mixings essentially come from the charged lepton sector with non-symmetric charged lepton mass matrix. (author)

  1. Comparative genome analysis of PHB gene family reveals deep evolutionary origins and diverse gene function.

    Science.gov (United States)

    Di, Chao; Xu, Wenying; Su, Zhen; Yuan, Joshua S

    2010-10-07

    PHB (Prohibitin) gene family is involved in a variety of functions important for different biological processes. PHB genes are ubiquitously present in divergent species from prokaryotes to eukaryotes. Human PHB genes have been found to be associated with various diseases. Recent studies by our group and others have shown diverse function of PHB genes in plants for development, senescence, defence, and others. Despite the importance of the PHB gene family, no comprehensive gene family analysis has been carried to evaluate the relatedness of PHB genes across different species. In order to better guide the gene function analysis and understand the evolution of the PHB gene family, we therefore carried out the comparative genome analysis of the PHB genes across different kingdoms. The relatedness, motif distribution, and intron/exon distribution all indicated that PHB genes is a relatively conserved gene family. The PHB genes can be classified into 5 classes and each class have a very deep evolutionary origin. The PHB genes within the class maintained the same motif patterns during the evolution. With Arabidopsis as the model species, we found that PHB gene intron/exon structure and domains are also conserved during the evolution. Despite being a conserved gene family, various gene duplication events led to the expansion of the PHB genes. Both segmental and tandem gene duplication were involved in Arabidopsis PHB gene family expansion. However, segmental duplication is predominant in Arabidopsis. Moreover, most of the duplicated genes experienced neofunctionalization. The results highlighted that PHB genes might be involved in important functions so that the duplicated genes are under the evolutionary pressure to derive new function. PHB gene family is a conserved gene family and accounts for diverse but important biological functions based on the similar molecular mechanisms. The highly diverse biological function indicated that more research needs to be carried out

  2. The role of retrotransposons in gene family expansions: insights from the mouse Abp gene family.

    Science.gov (United States)

    Janoušek, Václav; Karn, Robert C; Laukaitis, Christina M

    2013-05-29

    Retrotransposons have been suggested to provide a substrate for non-allelic homologous recombination (NAHR) and thereby promote gene family expansion. Their precise role, however, is controversial. Here we ask whether retrotransposons contributed to the recent expansions of the Androgen-binding protein (Abp) gene families that occurred independently in the mouse and rat genomes. Using dot plot analysis, we found that the most recent duplication in the Abp region of the mouse genome is flanked by L1Md_T elements. Analysis of the sequence of these elements revealed breakpoints that are the relicts of the recombination that caused the duplication, confirming that the duplication arose as a result of NAHR using L1 elements as substrates. L1 and ERVII retrotransposons are considerably denser in the Abp regions than in one Mb flanking regions, while other repeat types are depleted in the Abp regions compared to flanking regions. L1 retrotransposons preferentially accumulated in the Abp gene regions after lineage separation and roughly followed the pattern of Abp gene expansion. By contrast, the proportion of shared vs. lineage-specific ERVII repeats in the Abp region resembles the rest of the genome. We confirmed the role of L1 repeats in Abp gene duplication with the identification of recombinant L1Md_T elements at the edges of the most recent mouse Abp gene duplication. High densities of L1 and ERVII repeats were found in the Abp gene region with abrupt transitions at the region boundaries, suggesting that their higher densities are tightly associated with Abp gene duplication. We observed that the major accumulation of L1 elements occurred after the split of the mouse and rat lineages and that there is a striking overlap between the timing of L1 accumulation and expansion of the Abp gene family in the mouse genome. Establishing a link between the accumulation of L1 elements and the expansion of the Abp gene family and identification of an NAHR-related breakpoint in

  3. The nitrate transporter (NRT gene family in poplar.

    Directory of Open Access Journals (Sweden)

    Hua Bai

    Full Text Available Nitrate is an important nutrient required for plant growth. It also acts as a signal regulating plant development. Nitrate is actively taken up and transported by nitrate transporters (NRT, which form a large family with many members and distinct functions. In contrast to Arabidopsis and rice there is little information about the NRT family in woody plants such as Populus. In this study, a comprehensive analysis of the Populus NRT family was performed. Sixty-eight PtNRT1/PTR, 6 PtNRT2, and 5 PtNRT3 genes were identified in the P. trichocarpa genome. Phylogenetic analysis confirmed that the genes of the NRT family are divided into three clades: NRT1/PTR with four subclades, NRT2, and NRT3. Topological analysis indicated that all members of PtNRT1/PTR and PtNRT2 have 8 to 12 trans-membrane domains, whereas the PtNRT3 proteins have no or up to two trans-membrane domains. Four PtNRT3 members were predicted as secreted proteins. Microarray analyses revealed tissue-specific expression patterns of PtNRT genes with distinct clusters of NRTs for roots, for the elongation zone of the apical stem segment and the developing xylem and a further cluster for leaves, bark and wood. A comparison of different poplar species (P. trichocarpa, P. tremula, P. euphratica, P. fremontii x P. angustifolia, and P. x canescens showed that the tissue-specific patterns of the NRT genes varied to some extent with species. Bioinformatic analysis of putative cis-regulatory elements in the promoter regions of PtNRT family retrieved motifs suggesting the regulation of the NRT genes by N metabolism, by energy and carbon metabolism, and by phytohormones and stress. Multivariate analysis suggested that the combination and abundance of motifs in distinct promoters may lead to tissue-specificity. Our genome wide analysis of the PtNRT genes provides a valuable basis for functional analysis towards understanding the role of nitrate transporters for tree growth.

  4. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, M.C.; Monsuur, A.J.; Poell, J.; Slot, R. van 't; Meijer, J.W.R.; Meijer, G.A.; Mulder, C.J.; Mearin, M.L.; Wijmenga, C.

    2007-01-01

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  5. The SPINK gene family and celiac disease susceptibility

    NARCIS (Netherlands)

    Wapenaar, Martin C.; Monsuur, Alienke J.; Poell, Jos; Slot, Ruben Van 't; Meijer, Jos W. R.; Meijer, Gerrit A.; Mulder, Chris J.; Mearin, Maria Luisa; Wijmenga, Cisca

    The gene family of serine protease inhibitors of the Kazal type (SPINK) are functional and positional candidate genes for celiac disease (CD). Our aim was to assess the gut mucosal gene expression and genetic association of SPINK1, -2, -4, and -5 in the Dutch CD population. Gene expression was

  6. Little Brother Joins the Large Family

    Science.gov (United States)

    2006-12-01

    On the night of 15 December 2006, the fourth and last-to-be-installed VLTI Auxiliary Telescope (AT4) obtained its 'First Light'. The first images demonstrate that AT4 will be able to deliver the excellent image quality already delivered by the first three ATs. It will soon join its siblings to perform routinely interferometric measurements. ESO PR Photo 51a/06 ESO PR Photo 51a/06 VLT Auxiliary Telescope The VLT is composed of four 8.2-m Unit Telescope (Antu, Kueyen, Melipal and Yepun). They have been progressively put into service together with a vast suite of the most advanced astronomical instruments and are operated every night in the year. Contrary to other large astronomical telescopes, the VLT was designed from the beginning with the use of interferometry as a major goal. The VLT Interferometer (VLTI) combines starlight captured by two or three 8.2- VLT Unit Telescopes, dramatically increasing the spatial resolution and showing fine details of a large variety of celestial objects. ESO PR Photo 51b/06 ESO PR Photo 51b/06 One AT Under the Sky However, most of the time the large telescopes are used for other research purposes. They are therefore only available for interferometric observations during a limited number of nights every year. Thus, in order to exploit the VLTI each night and to achieve the full potential of this unique setup, some other (smaller), dedicated telescopes were included into the overall VLT concept. These telescopes, known as the VLTI Auxiliary Telescopes (ATs), are mounted on tracks and can be placed at precisely defined "parking" observing positions on the observatory platform. From these positions, their light beams are fed into the same common focal point via a complex system of reflecting mirrors mounted in an underground system of tunnels. The Auxiliary Telescopes are real technological jewels. They are placed in ultra-compact enclosures, complete with all necessary electronics, an air conditioning system and cooling liquid for

  7. Identification and expression profiling analysis of TCP family genes involved in growth and development in maize.

    Science.gov (United States)

    Chai, Wenbo; Jiang, Pengfei; Huang, Guoyu; Jiang, Haiyang; Li, Xiaoyu

    2017-10-01

    The TCP family is a group of plant-specific transcription factors. TCP genes encode proteins harboring bHLH structure, which is implicated in DNA binding and protein-protein interactions and known as the TCP domain. TCP genes play important roles in plant development and have been evolutionarily and functionally elaborated in various plants, however, no overall phylogenetic analysis or expression profiling of TCP genes in Zea mays has been reported. In the present study, a systematic analysis of molecular evolution and functional prediction of TCP family genes in maize ( Z . mays L.) has been conducted. We performed a genome-wide survey of TCP genes in maize, revealing the gene structure, chromosomal location and phylogenetic relationship of family members. Microsynteny between grass species and tissue-specific expression profiles were also investigated. In total, 29 TCP genes were identified in the maize genome, unevenly distributed on the 10 maize chromosomes. Additionally, ZmTCP genes were categorized into nine classes based on phylogeny and purifying selection may largely be responsible for maintaining the functions of maize TCP genes. What's more, microsynteny analysis suggested that TCP genes have been conserved during evolution. Finally, expression analysis revealed that most TCP genes are expressed in the stem and ear, which suggests that ZmTCP genes influence stem and ear growth. This result is consistent with the previous finding that maize TCP genes represses the growth of axillary organs and enables the formation of female inflorescences. Altogether, this study presents a thorough overview of TCP family in maize and provides a new perspective on the evolution of this gene family. The results also indicate that TCP family genes may be involved in development stage in plant growing conditions. Additionally, our results will be useful for further functional analysis of the TCP gene family in maize.

  8. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family.

    Science.gov (United States)

    Karn, Robert C; Laukaitis, Christina M

    2012-01-01

    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  9. Polymorphism in the interferon-{alpha} gene family

    Energy Technology Data Exchange (ETDEWEB)

    Golovleva, I.; Lundgren, E.; Beckman, L. [Univ. of Umea (Sweden); Kandefer-Szerszen, M. [Maria Curie-Sklodowska Univ., Lublin (Poland)

    1996-09-01

    A pronounced genetic polymorphism of the interferon type I gene family has been assumed on the basis of RFLP analysis of the genomic region as well as the large number of sequences published compared to the number of loci. However, IFNA2 is the only locus that has been carefully analyzed concerning gene frequency, and only naturally occurring rare alleles have been found. We have extended the studies on a variation of expressed sequences by studying the IFNA1, IFNA2, IFNA10, IFNA13, IFNA14, and IFNA17 genes. Genomic white-blood-cell DNA from a population sample of blood donors and from a family material were screened by single-nucleotide primer extension (allele-specific primer extension) of PCR fragments. Because of sequence similarities, in some cases {open_quotes}nested{close_quotes} PCR was used, and, when applicable, restriction analysis or control sequencing was performed. All individuals carried the interferon-{alpha} 1 and interferon-{alpha} 13 variants but not the LeIF D variant. At the IFNA2 and IFNA14 loci only one sequence variant was found, while in the IFNA10 and IFNA17 groups two alleles were detected in each group. The IFNA10 and IFNA17 alleles segregated in families and showed a close fit to the Hardy-Weinberg equilibrium. There was a significant linkage disequilibrium between IFNA10 and IFNA17 alleles. The fact that the extent of genetic polymorphism was lower than expected suggests that a majority of the previously described gene sequences represent nonpolymorphic rare mutants that may have arisen in tumor cell lines. 44 refs., 4 figs., 4 tabs.

  10. Amelogenesis Imperfecta: 1 Family, 2 Phenotypes, and 2 Mutated Genes.

    Science.gov (United States)

    Prasad, M K; Laouina, S; El Alloussi, M; Dollfus, H; Bloch-Zupan, A

    2016-12-01

    Amelogenesis imperfecta (AI) is a clinically and genetically heterogeneous group of diseases characterized by enamel defects. The authors have identified a large consanguineous Moroccan family segregating different clinical subtypes of hypoplastic and hypomineralized AI in different individuals within the family. Using targeted next-generation sequencing, the authors identified a novel heterozygous nonsense mutation in COL17A1 (c.1873C>T, p.R625*) segregating with hypoplastic AI and a novel homozygous 8-bp deletion in C4orf26 (c.39_46del, p.Cys14Glyfs*18) segregating with hypomineralized-hypoplastic AI in this family. This study highlights the phenotypic and genotypic heterogeneity of AI that can exist even within a single consanguineous family. Furthermore, the identification of novel mutations in COL17A1 and C4orf26 and their correlation with distinct AI phenotypes can contribute to a better understanding of the pathophysiology of AI and the contribution of these genes to amelogenesis. © International & American Associations for Dental Research 2016.

  11. Msx homeobox gene family and craniofacial development.

    Science.gov (United States)

    Alappat, Sylvia; Zhang, Zun Yi; Chen, Yi Ping

    2003-12-01

    Vertebrate Msx genes are unlinked, homeobox-containing genes that bear homology to the Drosophila muscle segment homeobox gene. These genes are expressed at multiple sites of tissue-tissue interactions during vertebrate embryonic development. Inductive interactions mediated by the Msx genes are essential for normal craniofacial, limb and ectodermal organ morphogenesis, and are also essential to survival in mice, as manifested by the phenotypic abnormalities shown in knockout mice and in humans. This review summarizes studies on the expression, regulation, and functional analysis of Msx genes that bear relevance to craniofacial development in humans and mice. Key words: Msx genes, craniofacial, tooth, cleft palate, suture, development, transcription factor, signaling molecule.

  12. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    NARCIS (Netherlands)

    Hu, H; Haas, S.A.; Chelly, J.; Esch, H. Van; Raynaud, M.; Brouwer, A.P. de; Weinert, S.; Froyen, G.; Frints, S.G.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.; Jensen, C.; Hambrock, M.; Fischer, U.; Langnick, C.; Feldkamp, M.; Wissink-Lindhout, W.; Lebrun, N.; Castelnau, L.; Rucci, J.; Montjean, R.; Dorseuil, O.; Billuart, P.; Stuhlmann, T.; Shaw, M.; Corbett, M.A.; Gardner, A.; Willis-Owen, S.; Tan, C.; Friend, K.L.; Belet, S.; Roozendaal, K.E. van; Jimenez-Pocquet, M.; Moizard, M.P.; Ronce, N.; Sun, R.; O'Keeffe, S.; Chenna, R.; Bommel, A. van; Goke, J.; Hackett, A.; Field, M.; Christie, L.; Boyle, J.; Haan, E.; Nelson, J.; Turner, G.; Baynam, G.; Gillessen-Kaesbach, G.; Muller, U.; Steinberger, D.; Budny, B.; Badura-Stronka, M.; Latos-Bielenska, A.; Ousager, L.B.; Wieacker, P.; Rodriguez Criado, G.; Bondeson, M.L.; Anneren, G.; Dufke, A.; Cohen, M.; Maldergem, L. Van; Vincent-Delorme, C.; Echenne, B.; Simon-Bouy, B.; Kleefstra, T.; Willemsen, M.H.; Fryns, J.P.; Devriendt, K.; Ullmann, R.; Vingron, M.; Wrogemann, K.; Wienker, T.F.; Tzschach, A.; Bokhoven, H. van; Gecz, J.; Jentsch, T.J.; Chen, W.; Ropers, H.H.; Kalscheuer, V.M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or

  13. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    DEFF Research Database (Denmark)

    Hu, H; Haas, S A; Chelly, J

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes...

  14. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes

    OpenAIRE

    Hu, H.; Haas, S.A.; Chelly, J.; Van Esch, H.; Raynaud, M.; de Brouwer, A.P.M.; Weinert, S.; Froyen, G.; Frints, S.G.M.; Laumonnier, F.; Zemojtel, T.; Love, M.I.; Richard, H.; Emde, A.K.; Bienek, M.

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of ...

  15. Vertebrate gene predictions and the problem of large genes

    DEFF Research Database (Denmark)

    Wang, Jun; Li, ShengTing; Zhang, Yong

    2003-01-01

    To find unknown protein-coding genes, annotation pipelines use a combination of ab initio gene prediction and similarity to experimentally confirmed genes or proteins. Here, we show that although the ab initio predictions have an intrinsically high false-positive rate, they also have a consistent...

  16. Recurrent APC gene mutations in Polish FAP families

    Directory of Open Access Journals (Sweden)

    Pławski Andrzej

    2007-12-01

    Full Text Available Abstract The molecular diagnostics of genetically conditioned disorders is based on the identification of the mutations in the predisposing genes. Hereditary cancer disorders of the gastrointestinal tracts are caused by mutations of the tumour suppressor genes or the DNA repair genes. Occurrence of recurrent mutation allows improvement of molecular diagnostics. The mutation spectrum in the genes causing hereditary forms of colorectal cancers in the Polish population was previously described. In the present work an estimation of the frequency of the recurrent mutations of the APC gene was performed. Eight types of mutations occurred in 19.4% of our FAP families and these constitute 43% of all Polish diagnosed families.

  17. Identification of a novel Gig2 gene family specific to non-amniote vertebrates.

    Directory of Open Access Journals (Sweden)

    Yi-Bing Zhang

    Full Text Available Gig2 (grass carp reovirus (GCRV-induced gene 2 is first identified as a novel fish interferon (IFN-stimulated gene (ISG. Overexpression of a zebrafish Gig2 gene can protect cultured fish cells from virus infection. In the present study, we identify a novel gene family that is comprised of genes homologous to the previously characterized Gig2. EST/GSS search and in silico cloning identify 190 Gig2 homologous genes in 51 vertebrate species ranged from lampreys to amphibians. Further large-scale search of vertebrate and invertebrate genome databases indicate that Gig2 gene family is specific to non-amniotes including lampreys, sharks/rays, ray-finned fishes and amphibians. Phylogenetic analysis and synteny analysis reveal lineage-specific expansion of Gig2 gene family and also provide valuable evidence for the fish-specific genome duplication (FSGD hypothesis. Although Gig2 family proteins exhibit no significant sequence similarity to any known proteins, a typical Gig2 protein appears to consist of two conserved parts: an N-terminus that bears very low homology to the catalytic domains of poly(ADP-ribose polymerases (PARPs, and a novel C-terminal domain that is unique to this gene family. Expression profiling of zebrafish Gig2 family genes shows that some duplicate pairs have diverged in function via acquisition of novel spatial and/or temporal expression under stresses. The specificity of this gene family to non-amniotes might contribute to a large extent to distinct physiology in non-amniote vertebrates.

  18. Hereditary neuropathy with liability to pressure palsy: an investigation in a rare and large Chinese family.

    Science.gov (United States)

    He, Yuan; Wu, Qiang; Xu, Zhipeng; Wang, Qianqian; Wang, Weili; Li, Dezhong; Liu, Wanhong; He, Xiaohua

    2012-01-01

    Hereditary neuropathy with liability to pressure palsy (HNPP), mainly associated with the peripheral myelin protein 22 (PMP22) gene, is generally an autosomal-dominant inherited peripheral neuropathy. The present large family including four generations provides an exciting opportunity to gain important insights into HNPP in China. A large 43-member family with ten members suspected to be affected by HNPP was studied. Neurologic examinations, electrophysiological and neuropathological studies and molecular genetic testing were used for these kindred. Clinically, the proband had limb hyposthenia and atrophy, and his mother showed declined tendon reflexes in the right lower limb. Electrophysiologically, sensory and motor nerve conduction velocities were generalized reduced. Sural nerve biopsy for the proband showed focal thickesning of the myelin sheaths. Furthermore, real-time quantitative PCR demonstrated that the PMP22 gene has a higher Ct value than reference gene in all suspected patients. These results indicated that the family is indeed a rare and large pedigree of HNPP caused by the deletion of PMP22 gene. Given that the suspected patient in the fourth generation is absent, this family is still worthy of further follow-up study. Copyright © 2012 S. Karger AG, Basel.

  19. Novel skeletal muscle ryanodine receptor mutation in a large Brazilian family with malignant hyperthermia.

    Science.gov (United States)

    McWilliams, S; Nelson, T; Sudo, R T; Zapata-Sudo, G; Batti, M; Sambuughin, N

    2002-07-01

    Malignant hyperthermia (MH) is an autosomal dominant disorder that predisposes susceptible individuals to a potentially life-threatening crisis when exposed to commonly used anesthetics. Mutations in the skeletal muscle calcium release channel, ryanodine receptor (RYR1) are associated with MH in over 50% of affected families. Linkage analysis of the RYR1 gene region at 19q13 was performed in a large Brazilian family and a distinct disease co-segregating haplotype was revealed in the majority of members with diagnosis of MH. Subsequent sequencing of RYR1 mutational hot spots revealed a nucleotide substitution of C to T at position 7062, causing a novel amino acid change from Arg2355 to Cys associated with MH in the family. Haplotype analysis of the RYR1 gene area at 19q13 in the family with multiple MH members is an important tool in identification of genetic cause underlying this disease.

  20. Interferon induced IFIT family genes in host antiviral defense.

    Science.gov (United States)

    Zhou, Xiang; Michal, Jennifer J; Zhang, Lifan; Ding, Bo; Lunney, Joan K; Liu, Bang; Jiang, Zhihua

    2013-01-01

    Secretion of interferons (IFNs) from virus-infected cells is a hallmark of host antiviral immunity and in fact, IFNs exert their antiviral activities through the induction of antiviral proteins. The IFN-induced protein with tetratricopeptide repeats (IFITs) family is among hundreds of IFN-stimulated genes. This family contains a cluster of duplicated loci. Most mammals have IFIT1, IFIT2, IFIT3 and IFIT5; however, bird, marsupial, frog and fish have only IFIT5. Regardless of species, IFIT5 is always adjacent to SLC16A12. IFIT family genes are predominantly induced by type I and type III interferons and are regulated by the pattern recognition and the JAK-STAT signaling pathway. IFIT family proteins are involved in many processes in response to viral infection. However, some viruses can escape the antiviral functions of the IFIT family by suppressing IFIT family genes expression or methylation of 5' cap of viral molecules. In addition, the variants of IFIT family genes could significantly influence the outcome of hepatitis C virus (HCV) therapy. We believe that our current review provides a comprehensive picture for the community to understand the structure and function of IFIT family genes in response to pathogens in human, as well as in animals.

  1. The ALMT Gene Family Performs Multiple Functions in Plants

    Directory of Open Access Journals (Sweden)

    Jie Liu

    2018-02-01

    Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.

  2. Identification of ALK as the Major Familial Neuroblastoma Predisposition Gene

    Science.gov (United States)

    Mossë, Yalë P; Laudenslager, Marci; Longo, Luca; Cole, Kristina A; Wood, Andrew; Attiyeh, Edward F; Laquaglia, Michael J; Sennett, Rachel; Lynch, Jill E; Perri, Patrizia; Laureys, Geneviève; Speleman, Frank; Hakonarson, Hakon; Torkamani, Ali; Schork, Nicholas J; Brodeur, Garrett M; Tonini, Gian Paolo; Rappaport, Eric; Devoto, Marcella; Maris, John M

    2009-01-01

    SUMMARY Survival rates for the childhood cancer neuroblastoma have not substantively improved despite dramatic escalation in chemotherapy intensity. Like most human cancers, this embryonal malignancy can be inherited, but the genetic etiology of familial and sporadically occurring neuroblastoma was largely unknown. Here we show that germline mutations in the anaplastic lymphoma kinase gene (ALK) explain the majority of hereditary neuroblastomas, and that activating mutations can also be somatically acquired. We first identified a significant linkage signal at the short arm of chromosome 2 (maximum nonparametric LOD=4.23 at rs1344063) using a whole-genome scan in neuroblastoma pedigrees. Resequencing of regional candidate genes identified three separate missense mutations in the tyrosine kinase domain of ALK (G1128A, R1192P and R1275Q) that segregated with the disease in eight separate families. Examination of 491 sporadically occurring human neuroblastoma samples showed that the ALK locus was gained in 22.8%, and highly amplified in an additional 3.3%, and that these aberrations were highly associated with death from disease (P=0.0003). Resequencing of 194 high-risk neuroblastoma samples showed somatically acquired mutations within the tyrosine kinase domain in 12.4%. Nine of the ten mutations map to critical regions of the kinase domain and were predicted to be oncogenic drivers with high probability. Mutations resulted in constitutive phosphorylation consistent with activation, and targeted knockdown of ALK mRNA resulted in profound growth inhibition of 4 of 4 cell lines harboring mutant or amplified ALK, as well as 2 of 6 wild type for ALK. Our results demonstrate that heritable mutations of ALK are the major cause of familial neuroblastoma, and that germline or acquired activation of this cell surface kinase is a tractable therapeutic target for this lethal pediatric malignancy. PMID:18724359

  3. A Patient With Desmoid Tumors and Familial FAP Having Frame Shift Mutation of the APC Gene

    Directory of Open Access Journals (Sweden)

    Sanambar Sadighi

    2017-02-01

    Full Text Available Desmoids tumors, characterized by monoclonal proliferation of myofibroblasts, could occur in 5-10% of patients with familial adenomatous polyposis (FAP as an extra-colonic manifestation of the disease. FAP can develop when there is a germ-line mutation in the adenomatous polyposis coli gene. Although mild or attenuated FAP may follow mutations in 5΄ extreme of the gene, it is more likely that 3΄ extreme mutations haveamore severe manifestation of thedisease. A 28-year-old woman was admitted to the Cancer Institute of Iran with an abdominal painful mass. She had strong family history of FAP and underwent prophylactic total colectomy. Pre-operative CT scans revealed a large mass. Microscopic observation showed diffuse fibroblast cell infiltration of the adjacent tissue structures. Peripheral blood DNA extraction followed by adenomatous polyposis coli gene exon by exon sequencing was performed to investigate the mutation in adenomatous polyposis coli gene. Analysis of DNA sequencing demonstrated a mutation of 4 bpdeletions at codon 1309-1310 of the exon 16 of adenomatous polyposis coli gene sequence which was repeated in 3 members of the family. Some of them had desmoid tumor without classical FAP history. Even when there is no familial history of adenomatous polyposis, the adenomatous polyposis coli gene mutation should be investigated in cases of familial desmoids tumors for a suitable prevention. The 3΄ extreme of the adenomatous polyposis coli gene is still the best likely location in such families.

  4. Evaluation of Gene-Based Family-Based Methods to Detect Novel Genes Associated With Familial Late Onset Alzheimer Disease

    Directory of Open Access Journals (Sweden)

    Maria V. Fernández

    2018-04-01

    Full Text Available Gene-based tests to study the combined effect of rare variants on a particular phenotype have been widely developed for case-control studies, but their evolution and adaptation for family-based studies, especially studies of complex incomplete families, has been slower. In this study, we have performed a practical examination of all the latest gene-based methods available for family-based study designs using both simulated and real datasets. We examined the performance of several collapsing, variance-component, and transmission disequilibrium tests across eight different software packages and 22 models utilizing a cohort of 285 families (N = 1,235 with late-onset Alzheimer disease (LOAD. After a thorough examination of each of these tests, we propose a methodological approach to identify, with high confidence, genes associated with the tested phenotype and we provide recommendations to select the best software and model for family-based gene-based analyses. Additionally, in our dataset, we identified PTK2B, a GWAS candidate gene for sporadic AD, along with six novel genes (CHRD, CLCN2, HDLBP, CPAMD8, NLRP9, and MAS1L as candidate genes for familial LOAD.

  5. Molecular evolution of the major chemosensory gene families in insects.

    Science.gov (United States)

    Sánchez-Gracia, A; Vieira, F G; Rozas, J

    2009-09-01

    Chemoreception is a crucial biological process that is essential for the survival of animals. In insects, olfaction allows the organism to recognise volatile cues that allow the detection of food, predators and mates, whereas the sense of taste commonly allows the discrimination of soluble stimulants that elicit feeding behaviours and can also initiate innate sexual and reproductive responses. The most important proteins involved in the recognition of chemical cues comprise moderately sized multigene families. These families include odorant-binding proteins (OBPs) and chemosensory proteins (CSPs), which are involved in peripheral olfactory processing, and the chemoreceptor superfamily formed by the olfactory receptor (OR) and gustatory receptor (GR) families. Here, we review some recent evolutionary genomic studies of chemosensory gene families using the data from fully sequenced insect genomes, especially from the 12 newly available Drosophila genomes. Overall, the results clearly support the birth-and-death model as the major mechanism of evolution in these gene families. Namely, new members arise by tandem gene duplication, progressively diverge in sequence and function, and can eventually be lost from the genome by a deletion or pseudogenisation event. Adaptive changes fostered by environmental shifts are also observed in the evolution of chemosensory families in insects and likely involve reproductive, ecological or behavioural traits. Consequently, the current size of these gene families is mainly a result of random gene gain and loss events. This dynamic process may represent a major source of genetic variation, providing opportunities for FUTURE specific adaptations.

  6. Identification of metalloprotease gene families in sugarcane

    Directory of Open Access Journals (Sweden)

    O.H.P. Ramos

    2001-12-01

    Full Text Available Metalloproteases play a key role in many physiological processes in mammals such as cell migration, tissue remodeling and processing of growth factors. They have also been identified as important factors in the patho-physiology of a number of human diseases, including cancer and hypertension. Many bacterial pathogens rely on proteases in order to infect the host. Several classes of metalloproteases have been described in humans, bacteria, snake venoms and insects. However, the presence and characterization of plant metalloproteases have rarely been described in the literature. In our research, we searched the sugarcane expressed sequence tag (SUCEST DNA library in order to identify, by homology with sequences deposited in other databases, metalloprotease gene families expressed under different conditions. Protein sequences from Arabidopsis thaliana and Glycine max were used to search the SUCEST data bank. Conserved regions corresponding to different metalloprotease domains and sequence motifs were identified in the reads to characterize each group of enzymes. At least four classes of sugarcane metalloproteases have been identified, i.e. matrix metalloproteases, zincins, inverzincins, and ATP-dependent metalloproteases. Each enzyme class was analyzed for its expression in different conditions and tissues.Metaloproteases exercem papéis importantes em muitos processos fisiológicos em mamíferos tais como migração celular, remodelamento tecidual e processamento de fatores de crescimento. Estas enzimas estão envolvidas também na pato-fisiologia de um grande número de doenças humanas como hipertensão e câncer. Muitas bactérias patogênicas dependem de proteases para infectar o hospedeiro. Diversas classes de metaloproteases foram descritas em seres humanos, bactérias, venenos de serpentes e insetos. No entanto, a presença e a caracterização de metaloproteases em plantas estão pouco descritas na literatura. Neste trabalho, foi

  7. Annotation and analysis of a large cuticular protein family with the R&R Consensus in Anopheles gambiae

    Directory of Open Access Journals (Sweden)

    He Ningjia

    2008-01-01

    Full Text Available Abstract Background The most abundant family of insect cuticular proteins, the CPR family, is recognized by the R&R Consensus, a domain of about 64 amino acids that binds to chitin and is present throughout arthropods. Several species have now been shown to have more than 100 CPR genes, inviting speculation as to the functional importance of this large number and diversity. Results We have identified 156 genes in Anopheles gambiae that code for putative cuticular proteins in this CPR family, over 1% of the total number of predicted genes in this species. Annotation was verified using several criteria including identification of TATA boxes, INRs, and DPEs plus support from proteomic and gene expression analyses. Two previously recognized CPR classes, RR-1 and RR-2, form separate, well-supported clades with the exception of a small set of genes with long branches whose relationships are poorly resolved. Several of these outliers have clear orthologs in other species. Although both clades are under purifying selection, the RR-1 variant of the R&R Consensus is evolving at twice the rate of the RR-2 variant and is structurally more labile. In contrast, the regions flanking the R&R Consensus have diversified in amino-acid composition to a much greater extent in RR-2 genes compared with RR-1 genes. Many genes are found in compact tandem arrays that may include similar or dissimilar genes but always include just one of the two classes. Tandem arrays of RR-2 genes frequently contain subsets of genes coding for highly similar proteins (sequence clusters. Properties of the proteins indicated that each cluster may serve a distinct function in the cuticle. Conclusion The complete annotation of this large gene family provides insight on the mechanisms of gene family evolution and clues about the need for so many CPR genes. These data also should assist annotation of other Anopheles genes.

  8. Genome organization and expression of the rat ACBP gene family

    DEFF Research Database (Denmark)

    Mandrup, S; Andreasen, P H; Knudsen, J

    1993-01-01

    pool former. We have molecularly cloned and characterized the rat ACBP gene family which comprises one expressed and four processed pseudogenes. One of these was shown to exist in two allelic forms. A comprehensive computer-aided analysis of the promoter region of the expressed ACBP gene revealed...

  9. APC gene mutations and extraintestinal phenotype of familial adenomatous polyposis

    NARCIS (Netherlands)

    Giardiello, F. M.; Petersen, G. M.; Piantadosi, S.; Gruber, S. B.; Traboulsi, E. I.; Offerhaus, G. J.; Muro, K.; Krush, A. J.; Booker, S. V.; Luce, M. C.; Laken, S. J.; Kinzler, K. W.; Vogelstein, B.; Hamilton, S. R.

    1997-01-01

    Familial adenomatous polyposis (FAP) is caused by germline mutation of the adenomatous polyposis coli (APC) gene on chromosome 5q. This study assessed genotype-phenotype correlations for extraintestinal lesions in FAP. Mutations of the APC gene were compared with the occurrence of seven

  10. Understanding the mechanisms of ATPase beta family genes for cellular thermotolerance in crossbred bulls.

    Science.gov (United States)

    Deb, Rajib; Sajjanar, Basavaraj; Singh, Umesh; Alex, Rani; Raja, T V; Alyethodi, Rafeeque R; Kumar, Sushil; Sengar, Gyanendra; Sharma, Sheetal; Singh, Rani; Prakash, B

    2015-12-01

    Na+/K+-ATPase is an integral membrane protein composed of a large catalytic subunit (alpha), a smaller glycoprotein subunit (beta), and gamma subunit. The beta subunit is essential for ion recognition as well as maintenance of the membrane integrity. Present study was aimed to analyze the expression pattern of ATPase beta subunit genes (ATPase B1, ATPase B2, and ATPase B3) among the crossbred bulls under different ambient temperatures (20-44 °C). The present study was also aimed to look into the relationship of HSP70 with the ATPase beta family genes. Our results demonstrated that among beta family genes, transcript abundance of ATPase B1 and ATPase B2 is significantly (P ATPase Β1, ATPase B2, and ATPase B3 is highly correlated (P ATPase beta family genes for cellular thermotolerance in cattle.

  11. Discovery and functional prioritization of Parkinson's disease candidate genes from large-scale whole exome sequencing

    NARCIS (Netherlands)

    I. Jansen (Iris); Ye, H. (Hui); Heetveld, S. (Sasja); Lechler, M.C. (Marie C.); Michels, H. (Helen); Seinstra, R.I. (Renée I.); Lubbe, S.J. (Steven J.); Drouet, V. (Valérie); S. Lesage (Suzanne); E. Majounie (Elisa); Gibbs, J.R. (J.Raphael); M.A. Nalls (Michael); M. Ryten (Mina); Botia, J.A. (Juan A.); J. Vandrovcova (Jana); J. Simón-Sánchez (Javier); Castillo-Lizardo, M. (Melissa); P. Rizzu (Patrizia); Blauwendraat, C. (Cornelis); Chouhan, A.K. (Amit K.); Li, Y. (Yarong); Yogi, P. (Puja); N. Amin (Najaf); C.M. van Duijn (Cornelia); Morris, H.R. (Huw R.); Brice, A. (Alexis); A. Singleton (Andrew); David, D.C. (Della C.); Nollen, E.A. (Ellen A.); A. Jain (Ashok); J.M. Shulman; P. Heutink (Peter); D.G. Hernandez (Dena); S. Arepalli (Sampath); J. Brooks (Janet); Price, R. (Ryan); Nicolas, A. (Aude); S. Chong (Sean); M.R. Cookson (Mark); A. Dillman (Allissa); M. Moore (Matt); B.J. Traynor (Bryan); A. Singleton (Andrew); V. Plagnol (Vincent); Nicholas W Wood,; U.-M. Sheerin (Una-Marie); Jose M Bras,; K. Charlesworth (Kate); M. Gardner (Mac); R. Guerreiro (Rita); D. Trabzuni (Danyah); Hardy, J. (John); M. Sharma; M. Saad (Mohamad); Javier Simón-Sánchez,; C. Schulte (Claudia); J.C. Corvol (Jean-Christophe); Dürr, A. (Alexandra); M. Vidailhet (M.); S. Sveinbjörnsdóttir (Sigurlaug); R.A. Barker (Roger); Caroline H Williams-Gray,; Y. Ben-Shlomo; H.W. Berendse (Henk W.); K.D. van Dijk (Karin); D. Berg (Daniela); K. Brockmann; K.D. Wurster (Kathrin); Mätzler, W. (Walter); Gasser, T. (Thomas); M. Martinez (Maria); R.M.A. de Bie (Rob); A. Biffi (Alessandro); D. Velseboer (Daan); B.R. Bloem (Bastiaan); B. Post (Bart); M. Wickremaratchi (Mirdhu); B. van de Warrenburg (Bart); Z. Bochdanovits (Zoltan); M. von Bonin (Malte); H. Pétursson (Hjörvar); O. Riess (Olaf); D.J. Burn (David); Lubbe, S. (Steven); Cooper, J.M. (J Mark); N.H. McNeill (Nathan); Schapira, A. (Anthony); Lungu, C. (Codrin); Chen, H. (Honglei); Dong, J. (Jing); Chinnery, P.F. (Patrick F.); G. Hudson (Gavin); Clarke, C.E. (Carl E.); C. Moorby (Catriona); C. Counsell (Carl); P. Damier (Philippe); J.-F. Dartigues; P. Deloukas (Panagiotis); E. Gray (Emma); T. Edkins (Ted); Hunt, S.E. (Sarah E.); S.C. Potter (Simon); A. Tashakkori-Ghanbaria (Avazeh); G. Deuschl (Günther); D. Lorenz (Delia); D.T. Dexter (David); F. Durif (Frank); J. Evans (Jonathan Mark); Langford, C. (Cordelia); T. Foltynie (Thomas); A.M. Goate (Alison); C. Harris (Clare); J.J. van Hilten (Jacobus); A. Hofman (Albert); J.R. Hollenbeck (John R.); J.L. Holton (Janice); Hu, M. (Michele); X. Huang (Xiaohong); Illig, T. (Thomas); P.V. Jónsson (Pálmi); J.-C. Lambert; S.S. O'Sullivan (Sean); T. Revesz (Tamas); K. Shaw (Karen); A.J. Lees (Andrew); P. Lichtner (Peter); P. Limousin (Patricia); G. Lopez; Escott-Price, V. (Valentina); J. Pearson (Justin); N. Williams (Nigel); E. Mudanohwo (Ese); J.S. Perlmutter (Joel); Pollak, P. (Pierre); F. Rivadeneira Ramirez (Fernando); A.G. Uitterlinden (André); S.J. Sawcer (Stephen); H. Scheffer (Hans); I. Shoulson (Ira); L. Shulman (Lee); Smith, C. (Colin); R. Walker (Robert); C.C.A. Spencer (Chris C.); A. Strange (Amy); H. Stefansson (Hreinn); F. Bettella (Francesco); J-A. Zwart (John-Anker); Stockton, J.D. (Joanna D.); D. Talbot; C.M. Tanner (Carlie); F. Tison (François); S. Winder-Rhodes (Sophie); K.P. Bhatia (Kailash)

    2017-01-01

    textabstractBackground: Whole-exome sequencing (WES) has been successful in identifying genes that cause familial Parkinson's disease (PD). However, until now this approach has not been deployed to study large cohorts of unrelated participants. To discover rare PD susceptibility variants, we

  12. Identification of pathogenic gene variants in small families with intellectually disabled siblings by exome sequencing.

    Science.gov (United States)

    Schuurs-Hoeijmakers, Janneke H M; Vulto-van Silfhout, Anneke T; Vissers, Lisenka E L M; van de Vondervoort, Ilse I G M; van Bon, Bregje W M; de Ligt, Joep; Gilissen, Christian; Hehir-Kwa, Jayne Y; Neveling, Kornelia; del Rosario, Marisol; Hira, Gausiya; Reitano, Santina; Vitello, Aurelio; Failla, Pinella; Greco, Donatella; Fichera, Marco; Galesi, Ornella; Kleefstra, Tjitske; Greally, Marie T; Ockeloen, Charlotte W; Willemsen, Marjolein H; Bongers, Ernie M H F; Janssen, Irene M; Pfundt, Rolph; Veltman, Joris A; Romano, Corrado; Willemsen, Michèl A; van Bokhoven, Hans; Brunner, Han G; de Vries, Bert B A; de Brouwer, Arjan P M

    2013-12-01

    Intellectual disability (ID) is a common neurodevelopmental disorder affecting 1-3% of the general population. Mutations in more than 10% of all human genes are considered to be involved in this disorder, although the majority of these genes are still unknown. We investigated 19 small non-consanguineous families with two to five affected siblings in order to identify pathogenic gene variants in known, novel and potential ID candidate genes. Non-consanguineous families have been largely ignored in gene identification studies as small family size precludes prior mapping of the genetic defect. Using exome sequencing, we identified pathogenic mutations in three genes, DDHD2, SLC6A8, and SLC9A6, of which the latter two have previously been implicated in X-linked ID phenotypes. In addition, we identified potentially pathogenic mutations in BCORL1 on the X-chromosome and in MCM3AP, PTPRT, SYNE1, and ZNF528 on autosomes. We show that potentially pathogenic gene variants can be identified in small, non-consanguineous families with as few as two affected siblings, thus emphasising their value in the identification of syndromic and non-syndromic ID genes.

  13. Evolution of the YABBY gene family in seed plants.

    Science.gov (United States)

    Finet, Cédric; Floyd, Sandra K; Conway, Stephanie J; Zhong, Bojian; Scutt, Charles P; Bowman, John L

    2016-01-01

    Members of the YABBY gene family of transcription factors in angiosperms have been shown to be involved in the initiation of outgrowth of the lamina, the maintenance of polarity, and establishment of the leaf margin. Although most of the dorsal-ventral polarity genes in seed plants have homologs in non-spermatophyte lineages, the presence of YABBY genes is restricted to seed plants. To gain insight into the origin and diversification of this gene family, we reconstructed the evolutionary history of YABBY gene lineages in seed plants. Our findings suggest that either one or two YABBY genes were present in the last common ancestor of extant seed plants. We also examined the expression of YABBY genes in the gymnosperms Ephedra distachya (Gnetales), Ginkgo biloba (Ginkgoales), and Pseudotsuga menziesii (Coniferales). Our data indicate that some YABBY genes are expressed in a polar (abaxial) manner in leaves and female cones in gymnosperms. We propose that YABBY genes already acted as polarity genes in the last common ancestor of extant seed plants. © 2016 Wiley Periodicals, Inc.

  14. Molecular Evolution of the Glycosyltransferase 6 Gene Family in Primates

    Directory of Open Access Journals (Sweden)

    Eliane Evanovich

    2016-01-01

    Full Text Available Glycosyltransferase 6 gene family includes ABO, Ggta1, iGb3S, and GBGT1 genes and by three putative genes restricted to mammals, GT6m6, GTm6, and GT6m7, only the latter is found in primates. GT6 genes may encode functional and nonfunctional proteins. Ggta1 and GBGT1 genes, for instance, are pseudogenes in catarrhine primates, while iGb3S gene is only inactive in human, bonobo, and chimpanzee. Even inactivated, these genes tend to be conversed in primates. As some of the GT6 genes are related to the susceptibility or resistance to parasites, we investigated (i the selective pressure on the GT6 paralogs genes in primates; (ii the basis of the conservation of iGb3S in human, chimpanzee, and bonobo; and (iii the functional potential of the GBGT1 and GT6m7 in catarrhines. We observed that the purifying selection is prevalent and these genes have a low diversity, though ABO and Ggta1 genes have some sites under positive selection. GT6m7, a putative gene associated with aggressive periodontitis, may have regulatory function, but experimental studies are needed to assess its function. The evolutionary conservation of iGb3S in humans, chimpanzee, and bonobo seems to be the result of proximity to genes with important biological functions.

  15. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS

    Directory of Open Access Journals (Sweden)

    Lawton Jennifer

    2012-03-01

    Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family

  16. Members of the barley NAC transcription factor gene family show differential co-regulation with senescence-associated genes during senescence of flag leaves

    DEFF Research Database (Denmark)

    Christiansen, Michael W; Gregersen, Per L.

    2014-01-01

    -expressed with members of the NAC gene family. In conclusion, a list of up to 15 NAC genes from barley that are strong candidates for being regulatory factors of importance for senescence and biotic stress-related traits affecting the productivity of cereal crop plants has been generated. Furthermore, a list of 71...... in the NAC transcription factor family during senescence of barley flag leaves was studied. Several members of the NAC transcription factor gene family were up-regulated during senescence in a microarray experiment, together with a large range of senescence-associated genes, reflecting the coordinated...... activation of degradation processes in senescing barley leaf tissues. This picture was confirmed in a detailed quantitative reverse transcription–PCR (qRT–PCR) experiment, which also showed distinct gene expression patterns for different members of the NAC gene family, suggesting a group of ~15 out of the 47...

  17. New Sequences with Low Correlation and Large Family Size

    Science.gov (United States)

    Zeng, Fanxin

    In direct-sequence code-division multiple-access (DS-CDMA) communication systems and direct-sequence ultra wideband (DS-UWB) radios, sequences with low correlation and large family size are important for reducing multiple access interference (MAI) and accepting more active users, respectively. In this paper, a new collection of families of sequences of length pn-1, which includes three constructions, is proposed. The maximum number of cyclically distinct families without GMW sequences in each construction is φ(pn-1)/n·φ(pm-1)/m, where p is a prime number, n is an even number, and n=2m, and these sequences can be binary or polyphase depending upon choice of the parameter p. In Construction I, there are pn distinct sequences within each family and the new sequences have at most d+2 nontrivial periodic correlation {-pm-1, -1, pm-1, 2pm-1,…,dpm-1}. In Construction II, the new sequences have large family size p2n and possibly take the nontrivial correlation values in {-pm-1, -1, pm-1, 2pm-1,…,(3d-4)pm-1}. In Construction III, the new sequences possess the largest family size p(d-1)n and have at most 2d correlation levels {-pm-1, -1,pm-1, 2pm-1,…,(2d-2)pm-1}. Three constructions are near-optimal with respect to the Welch bound because the values of their Welch-Ratios are moderate, WR_??_d, WR_??_3d-4 and WR_??_2d-2, respectively. Each family in Constructions I, II and III contains a GMW sequence. In addition, Helleseth sequences and Niho sequences are special cases in Constructions I and III, and their restriction conditions to the integers m and n, pm≠2 (mod 3) and n≅0 (mod 4), respectively, are removed in our sequences. Our sequences in Construction III include the sequences with Niho type decimation 3·2m-2, too. Finally, some open questions are pointed out and an example that illustrates the performance of these sequences is given.

  18. msh/Msx gene family in neural development.

    Science.gov (United States)

    Ramos, Casto; Robert, Benoît

    2005-11-01

    The involvement of Msx homeobox genes in skull and tooth formation has received a great deal of attention. Recent studies also indicate a role for the msh/Msx gene family in development of the nervous system. In this article, we discuss the functions of these transcription factors in neural-tissue organogenesis. We will deal mainly with the interactions of the Drosophila muscle segment homeobox (msh) gene with other homeobox genes and the repressive cascade that leads to neuroectoderm patterning; the role of Msx genes in neural-crest induction, focusing especially on the differences between lower and higher vertebrates; their implication in patterning of the vertebrate neural tube, particularly in diencephalon midline formation. Finally, we will examine the distinct activities of Msx1, Msx2 and Msx3 genes during neurogenesis, taking into account their relationships with signalling molecules such as BMP.

  19. The sieve element occlusion gene family in dicotyledonous plants.

    Science.gov (United States)

    Ernst, Antonia M; Rüping, Boris; Jekat, Stephan B; Nordzieke, Steffen; Reineke, Anna R; Müller, Boje; Bornberg-Bauer, Erich; Prüfer, Dirk; Noll, Gundula A

    2011-01-01

    Sieve element occlusion (SEO) genes encoding forisome subunits have been identified in Medicago truncatula and other legumes. Forisomes are structural phloem proteins uniquely found in Fabaceae sieve elements. They undergo a reversible conformational change after wounding, from a condensed to a dispersed state, thereby blocking sieve tube translocation and preventing the loss of photoassimilates. Recently, we identified SEO genes in several non-Fabaceae plants (lacking forisomes) and concluded that they most probably encode conventional non-forisome P-proteins. Molecular and phylogenetic analysis of the SEO gene family has identified domains that are characteristic for SEO proteins. Here, we extended our phylogenetic analysis by including additional SEO genes from several diverse species based on recently published genomic data. Our results strengthen the original assumption that SEO genes seem to be widespread in dicotyledonous angiosperms, and further underline the divergent evolution of SEO genes within the Fabaceae.

  20. Prenatal molecular diagnosis of oculocutaneous albinism (OCA) in a large cohort of Israeli families.

    Science.gov (United States)

    Rosenmann, Ada; Bejarano-Achache, Idit; Eli, Dalia; Maftsir, Genia; Mizrahi-Meissonnier, Liliana; Blumenfeld, Anat

    2009-10-01

    To present our accumulated data on prenatal molecular diagnosis of oculocutaneous albinism (OCA) in a large cohort of Israeli albino families. Albinism consists of variable phenotypes, but only families with predicted severely handicapped albino offspring, who declared their wish to terminate a pregnancy of such a fetus, are eligible for prenatal testing. Prenatal testing is not offered otherwise. Following detailed genetic investigation and counseling, molecular prenatal testing was performed using the combination of mutation screening, direct sequencing, and haplotype analysis. A total of 55 prenatal tests were performed in 37 families; in 26 families the propositus was the child, and in 11, a parent or a close relative. In 32 families tyrosinase (TYR) mutations were diagnosed. In 5 families a P gene mutation was detected. Twelve albino fetuses were diagnosed. Following further genetic counseling, all couples elected to terminate the pregnancy. Three additional pregnancies were terminated for other reasons. Families with increased risk for an albino child with severe visual handicap, seek premarital and prenatal genetic counseling and testing, for the prevention of affected offspring. Our combined methods of molecular genetic testing enable a nationwide approach for prevention of albinism. The same paradigm can be applied to other populations affected with albinism.

  1. Evolution of the vertebrate insulin receptor substrate (Irs) gene family.

    Science.gov (United States)

    Al-Salam, Ahmad; Irwin, David M

    2017-06-23

    Insulin receptor substrate (Irs) proteins are essential for insulin signaling as they allow downstream effectors to dock with, and be activated by, the insulin receptor. A family of four Irs proteins have been identified in mice, however the gene for one of these, IRS3, has been pseudogenized in humans. While it is known that the Irs gene family originated in vertebrates, it is not known when it originated and which members are most closely related to each other. A better understanding of the evolution of Irs genes and proteins should provide insight into the regulation of metabolism by insulin. Multiple genes for Irs proteins were identified in a wide variety of vertebrate species. Phylogenetic and genomic neighborhood analyses indicate that this gene family originated very early in vertebrae evolution. Most Irs genes were duplicated and retained in fish after the fish-specific genome duplication. Irs genes have been lost of various lineages, including Irs3 in primates and birds and Irs1 in most fish. Irs3 and Irs4 experienced an episode of more rapid protein sequence evolution on the ancestral mammalian lineage. Comparisons of the conservation of the proteins sequences among Irs paralogs show that domains involved in binding to the plasma membrane and insulin receptors are most strongly conserved, while divergence has occurred in sequences involved in interacting with downstream effector proteins. The Irs gene family originated very early in vertebrate evolution, likely through genome duplications, and in parallel with duplications of other components of the insulin signaling pathway, including insulin and the insulin receptor. While the N-terminal sequences of these proteins are conserved among the paralogs, changes in the C-terminal sequences likely allowed changes in biological function.

  2. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-01-01

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  3. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles

    2000-09-18

    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  4. Airfoil family design for large offshore wind turbine blades

    International Nuclear Information System (INIS)

    Méndez, B; Munduate, X; Miguel, U San

    2014-01-01

    Wind turbine blades size has scaled-up during last years due to wind turbine platform increase especially for offshore applications. The EOLIA project 2007-2010 (Spanish Goverment funded project) was focused on the design of large offshore wind turbines for deep waters. The project was managed by ACCIONA Energia and the wind turbine technology was designed by ACCIONA Windpower. The project included the design of a wind turbine airfoil family especially conceived for large offshore wind turbine blades, in the order of 5MW machine. Large offshore wind turbines suffer high extreme loads due to their size, in addition the lack of noise restrictions allow higher tip speeds. Consequently, the airfoils presented in this work are designed for high Reynolds numbers with the main goal of reducing blade loads and mantainig power production. The new airfoil family was designed in collaboration with CENER (Spanish National Renewable Energy Centre). The airfoil family was designed using a evolutionary algorithm based optimization tool with different objectives, both aerodynamic and structural, coupled with an airfoil geometry generation tool. Force coefficients of the designed airfoil were obtained using the panel code XFOIL in which the boundary layer/inviscid flow coupling is ineracted via surface transpiration model. The desing methodology includes a novel technique to define the objective functions based on normalizing the functions using weight parameters created from data of airfoils used as reference. Four airfoils have been designed, here three of them will be presented, with relative thickness of 18%, 21%, 25%, which have been verified with the in-house CFD code, Wind Multi Block WMB, and later validated with wind tunnel experiments. Some of the objectives for the designed airfoils concern the aerodynamic behavior (high efficiency and lift, high tangential coefficient, insensitivity to rough conditions, etc.), others concern the geometry (good for structural design

  5. Airfoil family design for large offshore wind turbine blades

    Science.gov (United States)

    Méndez, B.; Munduate, X.; San Miguel, U.

    2014-06-01

    Wind turbine blades size has scaled-up during last years due to wind turbine platform increase especially for offshore applications. The EOLIA project 2007-2010 (Spanish Goverment funded project) was focused on the design of large offshore wind turbines for deep waters. The project was managed by ACCIONA Energia and the wind turbine technology was designed by ACCIONA Windpower. The project included the design of a wind turbine airfoil family especially conceived for large offshore wind turbine blades, in the order of 5MW machine. Large offshore wind turbines suffer high extreme loads due to their size, in addition the lack of noise restrictions allow higher tip speeds. Consequently, the airfoils presented in this work are designed for high Reynolds numbers with the main goal of reducing blade loads and mantainig power production. The new airfoil family was designed in collaboration with CENER (Spanish National Renewable Energy Centre). The airfoil family was designed using a evolutionary algorithm based optimization tool with different objectives, both aerodynamic and structural, coupled with an airfoil geometry generation tool. Force coefficients of the designed airfoil were obtained using the panel code XFOIL in which the boundary layer/inviscid flow coupling is ineracted via surface transpiration model. The desing methodology includes a novel technique to define the objective functions based on normalizing the functions using weight parameters created from data of airfoils used as reference. Four airfoils have been designed, here three of them will be presented, with relative thickness of 18%, 21%, 25%, which have been verified with the in-house CFD code, Wind Multi Block WMB, and later validated with wind tunnel experiments. Some of the objectives for the designed airfoils concern the aerodynamic behavior (high efficiency and lift, high tangential coefficient, insensitivity to rough conditions, etc.), others concern the geometry (good for structural design

  6. Clinical and linkage study of a large family with simple ectopia lentis linked to FBN1

    Energy Technology Data Exchange (ETDEWEB)

    Edwards, M.J.; Roberts, J.; Partington, M.W. [Newcastle and Northern New South Wales Genetics Service (Australia); Colley, P.W. [John Hunter Hospital, Newcastle (Australia); Hollway, G.E.; Kozman, H.M.; Mulley, J.C. [Adelaide Children`s Hospital, North Adelaide (Australia)

    1994-10-15

    Simple ectopia lentis (EL) was studied in a large family, by clinical examination and analysis of linkage to markers in the region of FBN1, the gene for fibrillin which causes Marfan syndrome on chromosome 15. No patient had clinical or echocardiographic evidence of Marfan syndrome, although there was a trend towards relatively longer measurements of height; lower segment; arm span; middle finger, hand, and foot length in the affected members of the family, compared with unaffected sibs of the same sex. Analysis of linkage to intragenic FBN1 markers was inconclusive because they were relatively uninformative. Construction of a multipoint background map from the CEPH reference families identified microsatellite markers linked closely to FBN1 which could demonstrate linkage of EL in this family to the FBN1 region. LINKMAP analysis detected a multipoint lod score of 5.68 at D15S119, a marker approximately 6 cM distal to FBN1, and a multipoint lod score of 5.04 at FBN1. The EL gene in this family is likely to be allelic to Marfan syndrome, and molecular characterization of the FBN1 mutation should now be possible. 25 refs., 6 figs., 2 tabs.

  7. Targeted sequencing of established and candidate colorectal cancer genes in the Colon Cancer Family Registry Cohort.

    Science.gov (United States)

    Raskin, Leon; Guo, Yan; Du, Liping; Clendenning, Mark; Rosty, Christophe; Lindor, Noralane M; Gruber, Stephen B; Buchanan, Daniel D

    2017-11-07

    The underlying genetic cause of colorectal cancer (CRC) can be identified for 5-10% of all cases, while at least 20% of CRC cases are thought to be due to inherited genetic factors. Screening for highly penetrant mutations in genes associated with Mendelian cancer syndromes using next-generation sequencing (NGS) can be prohibitively expensive for studies requiring large samples sizes. The aim of the study was to identify rare single nucleotide variants and small indels in 40 established or candidate CRC susceptibility genes in 1,046 familial CRC cases (including both MSS and MSI-H tumor subtypes) and 1,006 unrelated controls from the Colon Cancer Family Registry Cohort using a robust and cost-effective DNA pooling NGS strategy. We identified 264 variants in 38 genes that were observed only in cases, comprising either very rare (minor allele frequency cancer susceptibility genes BAP1, CDH1, CHEK2, ENG, and MSH3 . For the candidate CRC genes, we identified likely pathogenic variants in the helicase domain of POLQ and in the LRIG1 , SH2B3 , and NOS1 genes and present their clinicopathological characteristics. Using a DNA pooling NGS strategy, we identified novel germline mutations in established CRC susceptibility genes in familial CRC cases. Further studies are required to support the role of POLQ , LRIG1 , SH2B3 and NOS1 as CRC susceptibility genes.

  8. Genome-wide analysis of the WRKY gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Xiong, Wangdan; Xu, Xueqin; Zhang, Lin; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2013-07-25

    The WRKY proteins, which contain highly conserved WRKYGQK amino acid sequences and zinc-finger-like motifs, constitute a large family of transcription factors in plants. They participate in diverse physiological and developmental processes. WRKY genes have been identified and characterized in a number of plant species. We identified a total of 58 WRKY genes (JcWRKY) in the genome of the physic nut (Jatropha curcas L.). On the basis of their conserved WRKY domain sequences, all of the JcWRKY proteins could be assigned to one of the previously defined groups, I-III. Phylogenetic analysis of JcWRKY genes with Arabidopsis and rice WRKY genes, and separately with castor bean WRKY genes, revealed no evidence of recent gene duplication in JcWRKY gene family. Analysis of transcript abundance of JcWRKY gene products were tested in different tissues under normal growth condition. In addition, 47 WRKY genes responded to at least one abiotic stress (drought, salinity, phosphate starvation and nitrogen starvation) in individual tissues (leaf, root and/or shoot cortex). Our study provides a useful reference data set as the basis for cloning and functional analysis of physic nut WRKY genes. Copyright © 2013 Elsevier B.V. All rights reserved.

  9. Human heavy-chain variable region gene family nonrandomly rearranged in familial chronic lymphocytic leukemia

    International Nuclear Information System (INIS)

    Shen, A.; Humphries, C.; Tucker, P.; Blattner, F.

    1987-01-01

    The authors have identified a family of human immunoglobulin heavy-chain variable-region (V/sub H/) genes, one member of which is rearranged in two affected members of a family in which the father and four of five siblings developed chronic lymphocytic leukemia. Cloning and sequencing of the rearranged V/sub H/ genes from leukemic lymphocytes of three affected siblings showed that two siblings had rearranged V/sub H/ genes (V/sub H/TS1 and V/sub H/WS1) that were 90% homologous. The corresponding germ-line gene, V/sub H/251, was found to part of a small (four gene) V/sub H/ gene family, which they term V/sub H/V. The DNA sequence homology to V/sub H/WS1 (95%) and V/sub H/TS1 (88%) and identical restriction sites on the 5' side of V/sub H/ confirm that rearrangement of V/sub H/251 followed by somatic mutation produced the identical V/sub H/ gene rearrangements in the two siblings. V/sub H/TS1 is not a functional V/sub H/ gene; a functional V/sub H/ rearrangement was found on the other chromosome of this patient. The other two siblings had different V/sub H/ gene rearrangements. All used different diversity genes. Mechanisms proposed for nonrandom selection of a single V/sub H/ gene include developmental regulation of this V/sub H/ gene rearrangement or selection of a subpopulation of B cells in which this V/sub H/ has been rearranged

  10. Phylogenetic analysis of the expansion of the MATH-BTB gene family in the grasses.

    Science.gov (United States)

    Juranić, Martina; Dresselhaus, Thomas

    2014-01-01

    MATH-BTB proteins are known to act as substrate-specific adaptors of cullin3 (CUL3)-based ubiquitin E3 ligases to target protein for ubiquitination. In a previous study we reported the presence of 31 MATH-BTB genes in the maize genome and determined the regulatory role of the MATH-BTB protein MAB1 during meiosis to mitosis transition. In contrast to maize, there are only 6 homologous genes in the model plant Arabidopsis, while this family has largely expanded in grasses. Here, we report a phylogenetic analysis of the MATH-BTB gene family in 9 land plant species including various mosses, eudicots, and grasses. We extend a previous classification of the plant MATH-BTB family and additionally arrange the expanded group into 5 grass-specific clades. Synteny studies indicate that expansion occurred to a large extent due to local gene duplications. Expression studies of 3 closely related MATH-BTB genes in maize (MAB1-3) indicate highly specific expression pattern. In summary, this work provides a solid base for further studies comparing genetic and functional information of the MATH-BTB family especially in the grasses.

  11. Transcriptomic and phylogenetic analysis of Culex pipiens quinquefasciatus for three detoxification gene families

    Directory of Open Access Journals (Sweden)

    Yan Liangzhen

    2012-11-01

    Full Text Available Abstract Background The genomes of three major mosquito vectors of human diseases, Anopheles gambiae, Aedes aegypti, and Culex pipiens quinquefasciatus, have been previously sequenced. C. p. quinquefasciatus has the largest number of predicted protein-coding genes, which partially results from the expansion of three detoxification gene families: cytochrome P450 monooxygenases (P450, glutathione S-transferases (GST, and carboxyl/cholinesterases (CCE. However, unlike An. gambiae and Ae. aegypti, which have large amounts of gene expression data, C. p. quinquefasciatus has limited transcriptomic resources. Knowledge of complete gene expression information is very important for the exploration of the functions of genes involved in specific biological processes. In the present study, the three detoxification gene families of C. p. quinquefasciatus were analyzed for phylogenetic classification and compared with those of three other dipteran insects. Gene expression during various developmental stages and the differential expression responsible for parathion resistance were profiled using the digital gene expression (DGE technique. Results A total of 302 detoxification genes were found in C. p. quinquefasciatus, including 71 CCE, 196 P450, and 35 cytosolic GST genes. Compared with three other dipteran species, gene expansion in Culex mainly occurred in the CCE and P450 families, where the genes of α-esterases, juvenile hormone esterases, and CYP325 of the CYP4 subfamily showed the most pronounced expansion on the genome. For the five DGE libraries, 3.5-3.8 million raw tags were generated and mapped to 13314 reference genes. Among 302 detoxification genes, 225 (75% were detected for expression in at least one DGE library. One fourth of the CCE and P450 genes were detected uniquely in one stage, indicating potential developmentally regulated expression. A total of 1511 genes showed different expression levels between a parathion-resistant and a

  12. Small Mutations of the DMD Gene in Taiwanese Families

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa

    2008-06-01

    Conclusion: Most identified mutations either led to a predictable premature stop codon or resulted in splicing defects, which caused defective function of dystrophin. Our findings extend the mutation spectrum of the DMD gene. Molecular characterization of the affected families is important for genetic counseling and prenatal diagnosis.

  13. Genetic diversity of bitter taste receptor gene family in Sichuan

    Indian Academy of Sciences (India)

    Genetic diversity of bitter taste receptor gene family in Sichuan domestic and Tibetan chicken populations. YUAN SU DIYAN LI UMA GAUR YAN WANG NAN WU BINLONG CHEN HONGXIAN XU HUADONG YIN YAODONG HU QING ZHU. RESEARCH ARTICLE Volume 95 Issue 3 September 2016 pp 675-681 ...

  14. Genomewide analysis of TCP transcription factor gene family in ...

    Indian Academy of Sciences (India)

    2014-12-09

    Dec 9, 2014 ... study of a genomewide analysis of apple TCP gene family. These results provide .... synthesize the first-strand cDNA using the PrimeScript First. Strand cDNA ..... only detected in the stem, leaf and fruit (figure 8). When.

  15. Identification of the trehalose-6-phosphate synthase gene family in ...

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... stress, however, our study mainly analysed the TPS gene family under freezing conditions in winter wheat .... size the first-strand cDNA using the Fermentas RevertAid ..... In the stem of Dongnongdongmai 1, TaTPS1, 2, 3, 4, 8,.

  16. Gene family size conservation is a good indicator of evolutionary rates.

    Science.gov (United States)

    Chen, Feng-Chi; Chen, Chiuan-Jung; Li, Wen-Hsiung; Chuang, Trees-Juen

    2010-08-01

    The evolution of duplicate genes has been a topic of broad interest. Here, we propose that the conservation of gene family size is a good indicator of the rate of sequence evolution and some other biological properties. By comparing the human-chimpanzee-macaque orthologous gene families with and without family size conservation, we demonstrate that genes with family size conservation evolve more slowly than those without family size conservation. Our results further demonstrate that both family expansion and contraction events may accelerate gene evolution, resulting in elevated evolutionary rates in the genes without family size conservation. In addition, we show that the duplicate genes with family size conservation evolve significantly more slowly than those without family size conservation. Interestingly, the median evolutionary rate of singletons falls in between those of the above two types of duplicate gene families. Our results thus suggest that the controversy on whether duplicate genes evolve more slowly than singletons can be resolved when family size conservation is taken into consideration. Furthermore, we also observe that duplicate genes with family size conservation have the highest level of gene expression/expression breadth, the highest proportion of essential genes, and the lowest gene compactness, followed by singletons and then by duplicate genes without family size conservation. Such a trend accords well with our observations of evolutionary rates. Our results thus point to the importance of family size conservation in the evolution of duplicate genes.

  17. Dichotomy in the NRT gene families of dicots and grass species.

    Directory of Open Access Journals (Sweden)

    Darren Plett

    Full Text Available A large proportion of the nitrate (NO(3(- acquired by plants from soil is actively transported via members of the NRT families of NO(3(- transporters. In Arabidopsis, the NRT1 family has eight functionally characterised members and predominantly comprises low-affinity transporters; the NRT2 family contains seven members which appear to be high-affinity transporters; and there are two NRT3 (NAR2 family members which are known to participate in high-affinity transport. A modified reciprocal best hit (RBH approach was used to identify putative orthologues of the Arabidopsis NRT genes in the four fully sequenced grass genomes (maize, rice, sorghum, Brachypodium. We also included the poplar genome in our analysis to establish whether differences between Arabidopsis and the grasses may be generally applicable to monocots and dicots. Our analysis reveals fundamental differences between Arabidopsis and the grass species in the gene number and family structure of all three families of NRT transporters. All grass species possessed additional NRT1.1 orthologues and appear to lack NRT1.6/NRT1.7 orthologues. There is significant separation in the NRT2 phylogenetic tree between NRT2 genes from dicots and grass species. This indicates that determination of function of NRT2 genes in grass species will not be possible in cereals based simply on sequence homology to functionally characterised Arabidopsis NRT2 genes and that proper functional analysis will be required. Arabidopsis has a unique NRT3.2 gene which may be a fusion of the NRT3.1 and NRT3.2 genes present in all other species examined here. This work provides a framework for future analysis of NO(3(- transporters and NO(3(- transport in grass crop species.

  18. Evolution of the MAGUK protein gene family in premetazoan lineages

    Directory of Open Access Journals (Sweden)

    Ruiz-Trillo Iñaki

    2010-04-01

    Full Text Available Abstract Background Cell-to-cell communication is a key process in multicellular organisms. In multicellular animals, scaffolding proteins belonging to the family of membrane-associated guanylate kinases (MAGUK are involved in the regulation and formation of cell junctions. These MAGUK proteins were believed to be exclusive to Metazoa. However, a MAGUK gene was recently identified in an EST survey of Capsaspora owczarzaki, an unicellular organism that branches off near the metazoan clade. To further investigate the evolutionary history of MAGUK, we have undertook a broader search for this gene family using available genomic sequences of different opisthokont taxa. Results Our survey and phylogenetic analyses show that MAGUK proteins are present not only in Metazoa, but also in the choanoflagellate Monosiga brevicollis and in the protist Capsaspora owczarzaki. However, MAGUKs are absent from fungi, amoebozoans or any other eukaryote. The repertoire of MAGUKs in Placozoa and eumetazoan taxa (Cnidaria + Bilateria is quite similar, except for one class that is missing in Trichoplax, while Porifera have a simpler MAGUK repertoire. However, Vertebrata have undergone several independent duplications and exhibit two exclusive MAGUK classes. Three different MAGUK types are found in both M. brevicollis and C. owczarzaki: DLG, MPP and MAGI. Furthermore, M. brevicollis has suffered a lineage-specific diversification. Conclusions The diversification of the MAGUK protein gene family occurred, most probably, prior to the divergence between Metazoa+choanoflagellates and the Capsaspora+Ministeria clade. A MAGI-like, a DLG-like, and a MPP-like ancestral genes were already present in the unicellular ancestor of Metazoa, and new gene members have been incorporated through metazoan evolution within two major periods, one before the sponge-eumetazoan split and another within the vertebrate lineage. Moreover, choanoflagellates have suffered an independent MAGUK

  19. PlantTribes: a gene and gene family resource for comparative genomics in plants

    OpenAIRE

    Wall, P. Kerr; Leebens-Mack, Jim; Müller, Kai F.; Field, Dawn; Altman, Naomi S.; dePamphilis, Claude W.

    2007-01-01

    The PlantTribes database (http://fgp.huck.psu.edu/tribe.html) is a plant gene family database based on the inferred proteomes of five sequenced plant species: Arabidopsis thaliana, Carica papaya, Medicago truncatula, Oryza sativa and Populus trichocarpa. We used the graph-based clustering algorithm MCL [Van Dongen (Technical Report INS-R0010 2000) and Enright et al. (Nucleic Acids Res. 2002; 30: 1575–1584)] to classify all of these species’ protein-coding genes into putative gene families, ca...

  20. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.

    Science.gov (United States)

    Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J

    2014-07-22

    Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.

  1. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  2. Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.

    Science.gov (United States)

    Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning

    2016-01-01

    WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of

  3. Early evolution of the LIM homeobox gene family

    Energy Technology Data Exchange (ETDEWEB)

    Srivastava, Mansi; Larroux, Claire; Lu, Daniel R; Mohanty, Kareshma; Chapman, Jarrod; Degnan, Bernard M; Rokhsar, Daniel S

    2010-01-01

    LIM homeobox (Lhx) transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons) indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In Nematostella, Lhx gene expression is correlated with neural

  4. Early evolution of the LIM homeobox gene family

    Directory of Open Access Journals (Sweden)

    Degnan Bernard M

    2010-01-01

    Full Text Available Abstract Background LIM homeobox (Lhx transcription factors are unique to the animal lineage and have patterning roles during embryonic development in flies, nematodes and vertebrates, with a conserved role in specifying neuronal identity. Though genes of this family have been reported in a sponge and a cnidarian, the expression patterns and functions of the Lhx family during development in non-bilaterian phyla are not known. Results We identified Lhx genes in two cnidarians and a placozoan and report the expression of Lhx genes during embryonic development in Nematostella and the demosponge Amphimedon. Members of the six major LIM homeobox subfamilies are represented in the genomes of the starlet sea anemone, Nematostella vectensis, and the placozoan Trichoplax adhaerens. The hydrozoan cnidarian, Hydra magnipapillata, has retained four of the six Lhx subfamilies, but apparently lost two others. Only three subfamilies are represented in the haplosclerid demosponge Amphimedon queenslandica. A tandem cluster of three Lhx genes of different subfamilies and a gene containing two LIM domains in the genome of T. adhaerens (an animal without any neurons indicates that Lhx subfamilies were generated by tandem duplication. This tandem cluster in Trichoplax is likely a remnant of the original chromosomal context in which Lhx subfamilies first appeared. Three of the six Trichoplax Lhx genes are expressed in animals in laboratory culture, as are all Lhx genes in Hydra. Expression patterns of Nematostella Lhx genes correlate with neural territories in larval and juvenile polyp stages. In the aneural demosponge, A. queenslandica, the three Lhx genes are expressed widely during development, including in cells that are associated with the larval photosensory ring. Conclusions The Lhx family expanded and diversified early in animal evolution, with all six subfamilies already diverged prior to the cnidarian-placozoan-bilaterian last common ancestor. In

  5. Plant ion channels: gene families, physiology, and functional genomics analyses.

    Science.gov (United States)

    Ward, John M; Mäser, Pascal; Schroeder, Julian I

    2009-01-01

    Distinct potassium, anion, and calcium channels in the plasma membrane and vacuolar membrane of plant cells have been identified and characterized by patch clamping. Primarily owing to advances in Arabidopsis genetics and genomics, and yeast functional complementation, many of the corresponding genes have been identified. Recent advances in our understanding of ion channel genes that mediate signal transduction and ion transport are discussed here. Some plant ion channels, for example, ALMT and SLAC anion channel subunits, are unique. The majority of plant ion channel families exhibit homology to animal genes; such families include both hyperpolarization- and depolarization-activated Shaker-type potassium channels, CLC chloride transporters/channels, cyclic nucleotide-gated channels, and ionotropic glutamate receptor homologs. These plant ion channels offer unique opportunities to analyze the structural mechanisms and functions of ion channels. Here we review gene families of selected plant ion channel classes and discuss unique structure-function aspects and their physiological roles in plant cell signaling and transport.

  6. Large-scale gene function analysis with the PANTHER classification system.

    Science.gov (United States)

    Mi, Huaiyu; Muruganujan, Anushya; Casagrande, John T; Thomas, Paul D

    2013-08-01

    The PANTHER (protein annotation through evolutionary relationship) classification system (http://www.pantherdb.org/) is a comprehensive system that combines gene function, ontology, pathways and statistical analysis tools that enable biologists to analyze large-scale, genome-wide data from sequencing, proteomics or gene expression experiments. The system is built with 82 complete genomes organized into gene families and subfamilies, and their evolutionary relationships are captured in phylogenetic trees, multiple sequence alignments and statistical models (hidden Markov models or HMMs). Genes are classified according to their function in several different ways: families and subfamilies are annotated with ontology terms (Gene Ontology (GO) and PANTHER protein class), and sequences are assigned to PANTHER pathways. The PANTHER website includes a suite of tools that enable users to browse and query gene functions, and to analyze large-scale experimental data with a number of statistical tests. It is widely used by bench scientists, bioinformaticians, computer scientists and systems biologists. In the 2013 release of PANTHER (v.8.0), in addition to an update of the data content, we redesigned the website interface to improve both user experience and the system's analytical capability. This protocol provides a detailed description of how to analyze genome-wide experimental data with the PANTHER classification system.

  7. Genetic heterogeneity in familial exudative vitreoretinopathy; exclusion of the EVR1 locus on chromosome 11q in a large autosomal dominant pedigree

    OpenAIRE

    Bamashmus, M; Downey, L; Inglehearn, C; Gupta, S; Mansfield, D

    2000-01-01

    BACKGROUND/AIMS—Familial exudative vitreoretinopathy (FEVR) is associated with mutations in the Norrie disease gene in X linked pedigrees and with linkage to the EVR1 locus at 11q13 in autosomal dominant cases. A large autosomal dominant FEVR family was studied, both clinically and by linkage analysis, to determine whether it differed from the known forms of FEVR.
METHODS—Affected members and obligate gene carriers from this family were examined by slit lamp biomicroscopy, indirect ophthalmos...

  8. Chromosomal evolution of the PKD1 gene family in primates

    Directory of Open Access Journals (Sweden)

    Krawczak Michael

    2008-09-01

    Full Text Available Abstract Background The autosomal dominant polycystic kidney disease (ADPKD is mostly caused by mutations in the PKD1 (polycystic kidney disease 1 gene located in 16p13.3. Moreover, there are six pseudogenes of PKD1 that are located proximal to the master gene in 16p13.1. In contrast, no pseudogene could be detected in the mouse genome, only a single copy gene on chromosome 17. The question arises how the human situation originated phylogenetically. To address this question we applied comparative FISH-mapping of a human PKD1-containing genomic BAC clone and a PKD1-cDNA clone to chromosomes of a variety of primate species and the dog as a non-primate outgroup species. Results Comparative FISH with the PKD1-cDNA clone clearly shows that in all primate species studied distinct single signals map in subtelomeric chromosomal positions orthologous to the short arm of human chromosome 16 harbouring the master PKD1 gene. Only in human and African great apes, but not in orangutan, FISH with both BAC and cDNA clones reveals additional signal clusters located proximal of and clearly separated from the PKD1 master genes indicating the chromosomal position of PKD1 pseudogenes in 16p of these species, respectively. Indeed, this is in accordance with sequencing data in human, chimpanzee and orangutan. Apart from the master PKD1 gene, six pseudogenes are identified in both, human and chimpanzee, while only a single-copy gene is present in the whole-genome sequence of orangutan. The phylogenetic reconstruction of the PKD1-tree reveals that all human pseudogenes are closely related to the human PKD1 gene, and all chimpanzee pseudogenes are closely related to the chimpanzee PKD1 gene. However, our statistical analyses provide strong indication that gene conversion events may have occurred within the PKD1 family members of human and chimpanzee, respectively. Conclusion PKD1 must have undergone amplification very recently in hominid evolution. Duplicative

  9. Phylogenetic analysis of the MS4A and TMEM176 gene families.

    Directory of Open Access Journals (Sweden)

    Jonathan Zuccolo

    2010-02-01

    Full Text Available The MS4A gene family in humans includes CD20 (MS4A1, FcRbeta (MS4A2, Htm4 (MS4A3, and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells.Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus. A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio. The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus. Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system.Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells.

  10. Phylogenetic Analysis of the MS4A and TMEM176 Gene Families

    Science.gov (United States)

    Zuccolo, Jonathan; Bau, Jeremy; Childs, Sarah J.; Goss, Greg G.; Sensen, Christoph W.; Deans, Julie P.

    2010-01-01

    Background The MS4A gene family in humans includes CD20 (MS4A1), FcRβ (MS4A2), Htm4 (MS4A3), and at least 13 other syntenic genes encoding membrane proteins, most having characteristic tetraspanning topology. Expression of MS4A genes is variable in tissues throughout the body; however, several are limited to cells in the hematopoietic system where they have known roles in immune cell functions. Genes in the small TMEM176 group share significant sequence similarity with MS4A genes and there is evidence of immune function of at least one of the encoded proteins. In this study, we examined the evolutionary history of the MS4A/TMEM176 families as well as tissue expression of the phylogenetically earliest members, in order to investigate their possible origins in immune cells. Principal Findings Orthologs of human MS4A genes were found only in mammals; however, MS4A gene homologs were found in most jawed vertebrates. TMEM176 genes were found only in mammals and bony fish. Several unusual MS4A genes having 2 or more tandem MS4A sequences were identified in the chicken (Gallus gallus) and early mammals (opossum, Monodelphis domestica and platypus, Ornithorhyncus anatinus). A large number of highly conserved MS4A and TMEM176 genes was found in zebrafish (Danio rerio). The most primitive organism identified to have MS4A genes was spiny dogfish (Squalus acanthus). Tissue expression of MS4A genes in S. acanthias and D. rerio showed no evidence of expression restricted to the hematopoietic system. Conclusions/Significance Our findings suggest that MS4A genes first appeared in cartilaginous fish with expression outside of the immune system, and have since diversified in many species into their modern forms with expression and function in both immune and nonimmune cells. PMID:20186339

  11. Gene coexpression measures in large heterogeneous samples using count statistics.

    Science.gov (United States)

    Wang, Y X Rachel; Waterman, Michael S; Huang, Haiyan

    2014-11-18

    With the advent of high-throughput technologies making large-scale gene expression data readily available, developing appropriate computational tools to process these data and distill insights into systems biology has been an important part of the "big data" challenge. Gene coexpression is one of the earliest techniques developed that is still widely in use for functional annotation, pathway analysis, and, most importantly, the reconstruction of gene regulatory networks, based on gene expression data. However, most coexpression measures do not specifically account for local features in expression profiles. For example, it is very likely that the patterns of gene association may change or only exist in a subset of the samples, especially when the samples are pooled from a range of experiments. We propose two new gene coexpression statistics based on counting local patterns of gene expression ranks to take into account the potentially diverse nature of gene interactions. In particular, one of our statistics is designed for time-course data with local dependence structures, such as time series coupled over a subregion of the time domain. We provide asymptotic analysis of their distributions and power, and evaluate their performance against a wide range of existing coexpression measures on simulated and real data. Our new statistics are fast to compute, robust against outliers, and show comparable and often better general performance.

  12. A comprehensive family-based replication study of schizophrenia genes

    DEFF Research Database (Denmark)

    Aberg, Karolina A; Liu, Youfang; Bukszár, Jozsef

    2013-01-01

     768 control subjects from 6 databases and, after quality control 6298 individuals (including 3286 cases) from 1811 nuclear families. MAIN OUTCOMES AND MEASURES Case-control status for SCZ. RESULTS Replication results showed a highly significant enrichment of SNPs with small P values. Of the SNPs...... in an independent family-based replication study that, after quality control, consisted of 8107 SNPs. SETTING Linkage meta-analysis, brain transcriptome meta-analysis, candidate gene database, OMIM, relevant mouse studies, and expression quantitative trait locus databases. PATIENTS We included 11 185 cases and 10...

  13. Massive expansion of the calpain gene family in unicellular eukaryotes

    Directory of Open Access Journals (Sweden)

    Zhao Sen

    2012-09-01

    Full Text Available Abstract Background Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists. Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Results Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. Conclusions The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  14. Massive expansion of the calpain gene family in unicellular eukaryotes.

    Science.gov (United States)

    Zhao, Sen; Liang, Zhe; Demko, Viktor; Wilson, Robert; Johansen, Wenche; Olsen, Odd-Arne; Shalchian-Tabrizi, Kamran

    2012-09-29

    Calpains are Ca2+-dependent cysteine proteases that participate in a range of crucial cellular processes. Dysfunction of these enzymes may cause, for instance, life-threatening diseases in humans, the loss of sex determination in nematodes and embryo lethality in plants. Although the calpain family is well characterized in animal and plant model organisms, there is a great lack of knowledge about these genes in unicellular eukaryote species (i.e. protists). Here, we study the distribution and evolution of calpain genes in a wide range of eukaryote genomes from major branches in the tree of life. Our investigations reveal 24 types of protein domains that are combined with the calpain-specific catalytic domain CysPc. In total we identify 41 different calpain domain architectures, 28 of these domain combinations have not been previously described. Based on our phylogenetic inferences, we propose that at least four calpain variants were established in the early evolution of eukaryotes, most likely before the radiation of all the major supergroups of eukaryotes. Many domains associated with eukaryotic calpain genes can be found among eubacteria or archaebacteria but never in combination with the CysPc domain. The analyses presented here show that ancient modules present in prokaryotes, and a few de novo eukaryote domains, have been assembled into many novel domain combinations along the evolutionary history of eukaryotes. Some of the new calpain genes show a narrow distribution in a few branches in the tree of life, likely representing lineage-specific innovations. Hence, the functionally important classical calpain genes found among humans and vertebrates make up only a tiny fraction of the calpain family. In fact, a massive expansion of the calpain family occurred by domain shuffling among unicellular eukaryotes and contributed to a wealth of functionally different genes.

  15. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T

    2012-08-01

    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  16. Retrospective analysis of cohort database: Phenotypic variability in a large dataset of patients confirmed to have homozygous familial hypercholesterolemia

    NARCIS (Netherlands)

    Raal, Frederick J.; Sjouke, Barbara; Hovingh, G. Kees; Isaac, Barton F.

    2016-01-01

    These data describe the phenotypic variability in a large cohort of patients confirmed to have homozygous familial hypercholesterolemia. Herein, we describe the observed relationship of treated low-density lipoprotein cholesterol with age. We also overlay the low-density lipoprotein receptor gene

  17. Broad scan linkage analysis in a large Tourette family pedigree

    Energy Technology Data Exchange (ETDEWEB)

    Peiffer, A.; Leppert, M. [Univ. of Utah Health Sciences Center, Salt Lake City, UT (United States); Wetering, B.J.M. van der [Univ. Hospital Rotterdam (Netherlands)

    1994-09-01

    Attempts to find a gene causing Tourette syndrome (TS) using linkage analysis have been unsuccessful even though as much as 65% of the autosomal genetic map has been excluded by the pooled results from several laboratories collaborating worldwide. One reason for this failure may be the misclassification of affection status of marry-in spouses. Specifically, we have found that six unrelated spouses in our Utah TS pedigree suffer from TS, obsessive-compulsive disorder or chronic motor tics. In light of these findings we decided to conduct a complete genomic scan from this Utah kindred with polymorphic markers in three related sibships in which there was no assortative mating. A linkage study assuming autosomal dominant inheritance was done using tetranucleotide repeat markers developed at the University of Utah. We selected markers that were less than 300 bp in size and that gave a heterozygosity of over 70% upon analysis in 4 CEPH families. Results to date with 95 markers run at an interval of 30 cM (covering 61% of the genome) show no evidence of linkage. We intend to extend the coverage to 100% of the genome. Pending completion of this scan, failure to provide evidence of linkage in our TS pedigree might then be attributed to phenotypic misclassification or erroneous assumptions regarding the genetic model of transmission.

  18. Leiomodins: larger members of the tropomodulin (Tmod) gene family

    Science.gov (United States)

    Conley, C. A.; Fritz-Six, K. L.; Almenar-Queralt, A.; Fowler, V. M.

    2001-01-01

    The 64-kDa autoantigen D1 or 1D, first identified as a potential autoantigen in Graves' disease, is similar to the tropomodulin (Tmod) family of actin filament pointed end-capping proteins. A novel gene with significant similarity to the 64-kDa human autoantigen D1 has been cloned from both humans and mice, and the genomic sequences of both genes have been identified. These genes form a subfamily closely related to the Tmods and are here named the Leiomodins (Lmods). Both Lmod genes display a conserved intron-exon structure, as do three Tmod genes, but the intron-exon structure of the Lmods and the Tmods is divergent. mRNA expression analysis indicates that the gene formerly known as the 64-kDa autoantigen D1 is most highly expressed in a variety of human tissues that contain smooth muscle, earning it the name smooth muscle Leiomodin (SM-Lmod; HGMW-approved symbol LMOD1). Transcripts encoding the novel Lmod gene are present exclusively in fetal and adult heart and adult skeletal muscle, and it is here named cardiac Leiomodin (C-Lmod; HGMW-approved symbol LMOD2). Human C-Lmod is located near the hypertrophic cardiomyopathy locus CMH6 on human chromosome 7q3, potentially implicating it in this disease. Our data demonstrate that the Lmods are evolutionarily related and display tissue-specific patterns of expression distinct from, but overlapping with, the expression of Tmod isoforms. Copyright 2001 Academic Press.

  19. Genome wide identification and expression analysis of Homeodomain leucine zipper subfamily IV (HDZ IV gene family from Musa accuminata

    Directory of Open Access Journals (Sweden)

    Ashutosh ePandey

    2016-02-01

    Full Text Available The homedodomain zipper family (HD-ZIP of transcription factors is present only in plants and plays important role in the regulation of plant-specific processes. The subfamily IV of HDZ transcription factors (HD-ZIP IV has primarily been implicated in the regulation of epidermal structure development. Though this gene family is present in all lineages of land plants, members of this gene family have not been identified in banana, which is one of the major staple fruit crops. In the present work, we identified 21 HDZIV genes in banana by the computational analysis of banana genome resource. Our analysis suggested that these genes putatively encode proteins having all the characteristic domains of HDZIV transcription factors. The phylogenetic analysis of the banana HDZIV family genes further confirmed that after separation from a common ancestor, the banana and poales lineages might have followed distinct evolutionary paths. Further, we conclude that segmental duplication played a major role in the evolution of banana HDZIV genes. All the identified banana HDZIV genes expresses in different banana tissue, however at varying levels. The transcript levels of some of the banana HDZIV genes were also detected in banana fruit pulp, suggesting their putative role in fruit attributes. A large number of genes of this family showed modulated expression under drought and salinity stress. Taken together, the present work lays a foundation for elucidation of functional aspects of the banana HDZIV genes and for their possible use in the banana improvement programs.

  20. Evolutionary history of chordate PAX genes: dynamics of change in a complex gene family.

    Directory of Open Access Journals (Sweden)

    Vanessa Rodrigues Paixão-Côrtes

    Full Text Available Paired box (PAX genes are transcription factors that play important roles in embryonic development. Although the PAX gene family occurs in animals only, it is widely distributed. Among the vertebrates, its 9 genes appear to be the product of complete duplication of an original set of 4 genes, followed by an additional partial duplication. Although some studies of PAX genes have been conducted, no comprehensive survey of these genes across the entire taxonomic unit has yet been attempted. In this study, we conducted a detailed comparison of PAX sequences from 188 chordates, which revealed restricted variation. The absence of PAX4 and PAX8 among some species of reptiles and birds was notable; however, all 9 genes were present in all 74 mammalian genomes investigated. A search for signatures of selection indicated that all genes are subject to purifying selection, with a possible constraint relaxation in PAX4, PAX7, and PAX8. This result indicates asymmetric evolution of PAX family genes, which can be associated with the emergence of adaptive novelties in the chordate evolutionary trajectory.

  1. X-exome sequencing of 405 unresolved families identifies seven novel intellectual disability genes.

    Science.gov (United States)

    Hu, H; Haas, S A; Chelly, J; Van Esch, H; Raynaud, M; de Brouwer, A P M; Weinert, S; Froyen, G; Frints, S G M; Laumonnier, F; Zemojtel, T; Love, M I; Richard, H; Emde, A-K; Bienek, M; Jensen, C; Hambrock, M; Fischer, U; Langnick, C; Feldkamp, M; Wissink-Lindhout, W; Lebrun, N; Castelnau, L; Rucci, J; Montjean, R; Dorseuil, O; Billuart, P; Stuhlmann, T; Shaw, M; Corbett, M A; Gardner, A; Willis-Owen, S; Tan, C; Friend, K L; Belet, S; van Roozendaal, K E P; Jimenez-Pocquet, M; Moizard, M-P; Ronce, N; Sun, R; O'Keeffe, S; Chenna, R; van Bömmel, A; Göke, J; Hackett, A; Field, M; Christie, L; Boyle, J; Haan, E; Nelson, J; Turner, G; Baynam, G; Gillessen-Kaesbach, G; Müller, U; Steinberger, D; Budny, B; Badura-Stronka, M; Latos-Bieleńska, A; Ousager, L B; Wieacker, P; Rodríguez Criado, G; Bondeson, M-L; Annerén, G; Dufke, A; Cohen, M; Van Maldergem, L; Vincent-Delorme, C; Echenne, B; Simon-Bouy, B; Kleefstra, T; Willemsen, M; Fryns, J-P; Devriendt, K; Ullmann, R; Vingron, M; Wrogemann, K; Wienker, T F; Tzschach, A; van Bokhoven, H; Gecz, J; Jentsch, T J; Chen, W; Ropers, H-H; Kalscheuer, V M

    2016-01-01

    X-linked intellectual disability (XLID) is a clinically and genetically heterogeneous disorder. During the past two decades in excess of 100 X-chromosome ID genes have been identified. Yet, a large number of families mapping to the X-chromosome remained unresolved suggesting that more XLID genes or loci are yet to be identified. Here, we have investigated 405 unresolved families with XLID. We employed massively parallel sequencing of all X-chromosome exons in the index males. The majority of these males were previously tested negative for copy number variations and for mutations in a subset of known XLID genes by Sanger sequencing. In total, 745 X-chromosomal genes were screened. After stringent filtering, a total of 1297 non-recurrent exonic variants remained for prioritization. Co-segregation analysis of potential clinically relevant changes revealed that 80 families (20%) carried pathogenic variants in established XLID genes. In 19 families, we detected likely causative protein truncating and missense variants in 7 novel and validated XLID genes (CLCN4, CNKSR2, FRMPD4, KLHL15, LAS1L, RLIM and USP27X) and potentially deleterious variants in 2 novel candidate XLID genes (CDK16 and TAF1). We show that the CLCN4 and CNKSR2 variants impair protein functions as indicated by electrophysiological studies and altered differentiation of cultured primary neurons from Clcn4(-/-) mice or after mRNA knock-down. The newly identified and candidate XLID proteins belong to pathways and networks with established roles in cognitive function and intellectual disability in particular. We suggest that systematic sequencing of all X-chromosomal genes in a cohort of patients with genetic evidence for X-chromosome locus involvement may resolve up to 58% of Fragile X-negative cases.

  2. Interleukin 10 gene promoter polymorphism and risk of diffuse large ...

    African Journals Online (AJOL)

    Purpose: Given the importance of understanding the genetic variations involved in the pathogenesis of non-Hodgkin's lymphoma (NHL), this work was designed to study the impact of IL-10 (1082 G/A; rs1800896 and 819 C/T; rs1800871) gene promoter polymorphism on susceptibility of Egyptians to diffuse large B cell ...

  3. Diverse roles of ERECTA family genes in plant development.

    Science.gov (United States)

    Shpak, Elena D

    2013-12-01

    Multiple receptor-like kinases (RLKs) enable intercellular communication that coordinates growth and development of plant tissues. ERECTA family receptors (ERfs) are an ancient family of leucine-rich repeat RLKs that in Arabidopsis consists of three genes: ERECTA, ERL1, and ERL2. ERfs sense secreted cysteine-rich peptides from the EPF/EPFL family and transmit the signal through a MAP kinase cascade. This review discusses the functions of ERfs in stomata development, in regulation of longitudinal growth of aboveground organs, during reproductive development, and in the shoot apical meristem. In addition the role of ERECTA in plant responses to biotic and abiotic factors is examined. Elena D. Shpak (Corresponding author). © 2013 Institute of Botany, Chinese Academy of Sciences.

  4. Molecular study of the perforin gene in familial hematological malignancies

    Directory of Open Access Journals (Sweden)

    El Abed Rim

    2011-09-01

    Full Text Available Abstract Perforin gene (PRF1 mutations have been identified in some patients diagnosed with the familial form of hemophagocytic lymphohistiocytosis (HLH and in patients with lymphoma. The aim of the present study was to determine whether patients with a familial aggregation of hematological malignancies harbor germline perforin gene mutations. For this purpose, 81 unrelated families from Tunisia and France with aggregated hematological malignancies were investigated. The variants detected in the PRF1 coding region amounted to 3.7% (3/81. Two of the three variants identified were previously described: the p.Ala91Val pathogenic mutation and the p.Asn252Ser polymorphism. A new p.Ala 211Val missense substitution was identified in two related Tunisian patients. In order to assess the pathogenicity of this new variation, bioinformatic tools were used to predict its effects on the perforin protein structure and at the mRNA level. The segregation of the mutant allele was studied in the family of interest and a control population was screened. The fact that this variant was not found to occur in 200 control chromosomes suggests that it may be pathogenic. However, overexpression of mutated PRF1 in rat basophilic leukemia cells did not affect the lytic function of perforin differently from the wild type protein.

  5. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer

    2012-03-29

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  6. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean

    2012-01-01

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  7. The Perceptions and Views on Family Interaction and Relationships of Middle Children from Large Families: An Informal Mini Survey.

    Science.gov (United States)

    Hall, Elena C. Thomas

    In Adler's Theory of Individual Psychology the significance of birth order position in the family constellation depends on the interpretation given to it by the child, which in turn influences his character. This study surveyed the perceptions of middle children in large families. Subjects (N=13) were middle children in families of more than five…

  8. Bioinformatics Analysis of MAPKKK Family Genes in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Wei Li

    2016-04-01

    Full Text Available Mitogen‐activated protein kinase kinase kinase (MAPKKK is a component of the MAPK cascade pathway that plays an important role in plant growth, development, and response to abiotic stress, the functions of which have been well characterized in several plant species, such as Arabidopsis, rice, and maize. In this study, we performed genome‐wide and systemic bioinformatics analysis of MAPKKK family genes in Medicago truncatula. In total, there were 73 MAPKKK family members identified by search of homologs, and they were classified into three subfamilies, MEKK, ZIK, and RAF. Based on the genomic duplication function, 72 MtMAPKKK genes were located throughout all chromosomes, but they cluster in different chromosomes. Using microarray data and high‐throughput sequencing‐data, we assessed their expression profiles in growth and development processes; these results provided evidence for exploring their important functions in developmental regulation, especially in the nodulation process. Furthermore, we investigated their expression in abiotic stresses by RNA‐seq, which confirmed their critical roles in signal transduction and regulation processes under stress. In summary, our genome‐wide, systemic characterization and expressional analysis of MtMAPKKK genes will provide insights that will be useful for characterizing the molecular functions of these genes in M. truncatula.

  9. Consequences of a novel caveolin-3 mutation in a large German family.

    Science.gov (United States)

    Fischer, Dirk; Schroers, Anja; Blümcke, Ingmar; Urbach, Horst; Zerres, Klaus; Mortier, Wilhelm; Vorgerd, Matthias; Schröder, Rolf

    2003-02-01

    Mutations in the human caveolin-3 gene (cav-3) on chromosome 3p25 have been described in limb girdle muscular dystrophy, rippling muscle disease, hyperCKemia, and distal myopathy. Here, we describe the genetic, myopathological, and clinical findings in a large German family harboring a novel heterozygous mutation (GAC-->GAA) in codon 27 of the cav-3 gene. This missense mutation causes an amino acid change from asparagine to glutamate (Asp27Glu) in the N-terminal region of the Cav-3 protein, which leads to a drastic decrease of Cav-3 protein expression in skeletal muscle tissue. In keeping with an autosomal dominant mode of inheritance, this novel cav-3 mutation was found to cosegregate with neuromuscular involvement in the reported family. Ultrastructural analysis of Cav-3-deficient muscle showed an abnormal folding of the plasma membrane as well as multiple vesicular structures in the subsarcolemmal region. Neurological examination of all nine subjects from three generations harboring the novel cav-3 mutation showed clear evidence of rippling muscle disease. However, only two of these nine patients showed isolated signs of rippling muscle disease without muscle weakness or atrophy, whereas five had additional signs of a distal myopathy and two fulfilled the diagnostic criteria of a coexisting limb girdle muscular dystrophy. These findings indicate that mutations in the human cav-3 gene can lead to different and overlapping clinical phenotypes even within the same family. Different clinical phenotypes in caveolinopathies may be attributed to so far unidentified modifying factors/genes in the individual genetic background of affected patients.

  10. Repair of DNA damage in the human metallothionein gene family

    International Nuclear Information System (INIS)

    Leadon, S.A.; Snowden, M.M.

    1987-01-01

    In order to distinguish enhanced repair of a sequence due to its transcriptional activity from enhanced repair due to chromatin alterations brought about by integration of a sequence into the genome, we have investigated the repair of damage both in endogenous genes and in cell lines that contain an integrated gene with an inducible promoter. The endogenous genes we are studying are the metallothioneins (MTs), a multigene family in man consisting of about 10-12 members. Cultured cells were exposed to 10-J/m 2 uv light and allowed to repair in the presence of bromodeoxyuridine. The DNA was then isolated, digested with Eco RI, and fully hybrid density DNA made by semiconservative synthesis was separated from unreplicated DNA by centrifugation in CsCl density gradients. Unreplicated, parental-density DNA was then reacted with a monoclonal antibody against bromouracil. 1 ref., 1 fig., 1 tab

  11. Genome-wide identification and expression analysis of the WRKY gene family in cassava

    Directory of Open Access Journals (Sweden)

    Yunxie eWei

    2016-02-01

    Full Text Available The WRKY family, a large family of transcription factors (TFs found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta. In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing 3 exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  12. Genome-Wide Identification and Expression Analysis of the WRKY Gene Family in Cassava.

    Science.gov (United States)

    Wei, Yunxie; Shi, Haitao; Xia, Zhiqiang; Tie, Weiwei; Ding, Zehong; Yan, Yan; Wang, Wenquan; Hu, Wei; Li, Kaimian

    2016-01-01

    The WRKY family, a large family of transcription factors (TFs) found in higher plants, plays central roles in many aspects of physiological processes and adaption to environment. However, little information is available regarding the WRKY family in cassava (Manihot esculenta). In the present study, 85 WRKY genes were identified from the cassava genome and classified into three groups according to conserved WRKY domains and zinc-finger structure. Conserved motif analysis showed that all of the identified MeWRKYs had the conserved WRKY domain. Gene structure analysis suggested that the number of introns in MeWRKY genes varied from 1 to 5, with the majority of MeWRKY genes containing three exons. Expression profiles of MeWRKY genes in different tissues and in response to drought stress were analyzed using the RNA-seq technique. The results showed that 72 MeWRKY genes had differential expression in their transcript abundance and 78 MeWRKY genes were differentially expressed in response to drought stresses in different accessions, indicating their contribution to plant developmental processes and drought stress resistance in cassava. Finally, the expression of 9 WRKY genes was analyzed by qRT-PCR under osmotic, salt, ABA, H2O2, and cold treatments, indicating that MeWRKYs may be involved in different signaling pathways. Taken together, this systematic analysis identifies some tissue-specific and abiotic stress-responsive candidate MeWRKY genes for further functional assays in planta, and provides a solid foundation for understanding of abiotic stress responses and signal transduction mediated by WRKYs in cassava.

  13. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah

    2017-12-01

    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  14. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  15. Familial Dilated Cardiomyopathy Caused by a Novel Frameshift in the BAG3 Gene.

    Directory of Open Access Journals (Sweden)

    Rocio Toro

    Full Text Available Dilated cardiomyopathy, a major cause of chronic heart failure and cardiac transplantation, is characterized by left ventricular or biventricular heart dilatation. In nearly 50% of cases the pathology is inherited, and more than 60 genes have been reported as disease-causing. However, in 30% of familial cases the mutation remains unidentified even after comprehensive genetic analysis. This study clinically and genetically assessed a large Spanish family affected by dilated cardiomyopathy to search for novel variations.Our study included a total of 100 family members. Clinical assessment was performed in alive, and genetic analysis was also performed in alive and 1 deceased relative. Genetic screening included resequencing of 55 genes associated with sudden cardiac death, and Sanger sequencing of main disease-associated genes. Genetic analysis identified a frame-shift variation in BAG3 (p.H243Tfr*64 in 32 patients. Genotype-phenotype correlation identified substantial heterogeneity in disease expression. Of 32 genetic carriers (one deceased, 21 relatives were clinically affected, and 10 were asymptomatic. Seventeen of the symptomatic genetic carriers exhibited proto-diastolic septal knock by echocardiographic assessment.We report p.H243Tfr*64_BAG3 as a novel pathogenic variation responsible for familial dilated cardiomyopathy. This variation correlates with a more severe phenotype of the disease, mainly in younger individuals. Genetic analysis in families, even asymptomatic individuals, enables early identification of individuals at risk and allows implementation of preventive measures.

  16. Comparative genomic analysis of the WRKY III gene family in populus, grape, arabidopsis and rice.

    Science.gov (United States)

    Wang, Yiyi; Feng, Lin; Zhu, Yuxin; Li, Yuan; Yan, Hanwei; Xiang, Yan

    2015-09-08

    WRKY III genes have significant functions in regulating plant development and resistance. In plant, WRKY gene family has been studied in many species, however, there still lack a comprehensive analysis of WRKY III genes in the woody plant species poplar, three representative lineages of flowering plant species are incorporated in most analyses: Arabidopsis (a model plant for annual herbaceous dicots), grape (one model plant for perennial dicots) and Oryza sativa (a model plant for monocots). In this study, we identified 10, 6, 13 and 28 WRKY III genes in the genomes of Populus trichocarpa, grape (Vitis vinifera), Arabidopsis thaliana and rice (Oryza sativa), respectively. Phylogenetic analysis revealed that the WRKY III proteins could be divided into four clades. By microsynteny analysis, we found that the duplicated regions were more conserved between poplar and grape than Arabidopsis or rice. We dated their duplications by Ks analysis of Populus WRKY III genes and demonstrated that all the blocks were formed after the divergence of monocots and dicots. Strong purifying selection has played a key role in the maintenance of WRKY III genes in Populus. Tissue expression analysis of the WRKY III genes in Populus revealed that five were most highly expressed in the xylem. We also performed quantitative real-time reverse transcription PCR analysis of WRKY III genes in Populus treated with salicylic acid, abscisic acid and polyethylene glycol to explore their stress-related expression patterns. This study highlighted the duplication and diversification of the WRKY III gene family in Populus and provided a comprehensive analysis of this gene family in the Populus genome. Our results indicated that the majority of WRKY III genes of Populus was expanded by large-scale gene duplication. The expression pattern of PtrWRKYIII gene identified that these genes play important roles in the xylem during poplar growth and development, and may play crucial role in defense to drought

  17. Exome sequencing of Pakistani consanguineous families identifies 30 novel candidate genes for recessive intellectual disability.

    Science.gov (United States)

    Riazuddin, S; Hussain, M; Razzaq, A; Iqbal, Z; Shahzad, M; Polla, D L; Song, Y; van Beusekom, E; Khan, A A; Tomas-Roca, L; Rashid, M; Zahoor, M Y; Wissink-Lindhout, W M; Basra, M A R; Ansar, M; Agha, Z; van Heeswijk, K; Rasheed, F; Van de Vorst, M; Veltman, J A; Gilissen, C; Akram, J; Kleefstra, T; Assir, M Z; Grozeva, D; Carss, K; Raymond, F L; O'Connor, T D; Riazuddin, S A; Khan, S N; Ahmed, Z M; de Brouwer, A P M; van Bokhoven, H; Riazuddin, S

    2017-11-01

    Intellectual disability (ID) is a clinically and genetically heterogeneous disorder, affecting 1-3% of the general population. Although research into the genetic causes of ID has recently gained momentum, identification of pathogenic mutations that cause autosomal recessive ID (ARID) has lagged behind, predominantly due to non-availability of sizeable families. Here we present the results of exome sequencing in 121 large consanguineous Pakistani ID families. In 60 families, we identified homozygous or compound heterozygous DNA variants in a single gene, 30 affecting reported ID genes and 30 affecting novel candidate ID genes. Potential pathogenicity of these alleles was supported by co-segregation with the phenotype, low frequency in control populations and the application of stringent bioinformatics analyses. In another eight families segregation of multiple pathogenic variants was observed, affecting 19 genes that were either known or are novel candidates for ID. Transcriptome profiles of normal human brain tissues showed that the novel candidate ID genes formed a network significantly enriched for transcriptional co-expression (P<0.0001) in the frontal cortex during fetal development and in the temporal-parietal and sub-cortex during infancy through adulthood. In addition, proteins encoded by 12 novel ID genes directly interact with previously reported ID proteins in six known pathways essential for cognitive function (P<0.0001). These results suggest that disruptions of temporal parietal and sub-cortical neurogenesis during infancy are critical to the pathophysiology of ID. These findings further expand the existing repertoire of genes involved in ARID, and provide new insights into the molecular mechanisms and the transcriptome map of ID.

  18. Candidate genes for COPD in two large data sets.

    Science.gov (United States)

    Bakke, P S; Zhu, G; Gulsvik, A; Kong, X; Agusti, A G N; Calverley, P M A; Donner, C F; Levy, R D; Make, B J; Paré, P D; Rennard, S I; Vestbo, J; Wouters, E F M; Anderson, W; Lomas, D A; Silverman, E K; Pillai, S G

    2011-02-01

    Lack of reproducibility of findings has been a criticism of genetic association studies on complex diseases, such as chronic obstructive pulmonary disease (COPD). We selected 257 polymorphisms of 16 genes with reported or potential relationships to COPD and genotyped these variants in a case-control study that included 953 COPD cases and 956 control subjects. We explored the association of these polymorphisms to three COPD phenotypes: a COPD binary phenotype and two quantitative traits (post-bronchodilator forced expiratory volume in 1 s (FEV₁) % predicted and FEV₁/forced vital capacity (FVC)). The polymorphisms significantly associated to these phenotypes in this first study were tested in a second, family-based study that included 635 pedigrees with 1,910 individuals. Significant associations to the binary COPD phenotype in both populations were seen for STAT1 (rs13010343) and NFKBIB/SIRT2 (rs2241704) (p<0.05). Single-nucleotide polymorphisms rs17467825 and rs1155563 of the GC gene were significantly associated with FEV₁ % predicted and FEV₁/FVC, respectively, in both populations (p<0.05). This study has replicated associations to COPD phenotypes in the STAT1, NFKBIB/SIRT2 and GC genes in two independent populations, the associations of the former two genes representing novel findings.

  19. Gene screening in a Chinese family with Marfan syndrome

    Directory of Open Access Journals (Sweden)

    Wen-Jiao Xia

    2016-05-01

    Full Text Available AIM:To analyze the causative gene mutation for Marfan syndrome(MFSwith autosomal dominant hereditary in a Chinese family in Liaoning Province,China. METHODS: Venous blood was collected and candidate gene was selected to design primers according to the clinical phenotype. With genomic polymerase chain reaction(PCRperformed, the coding exons and their flanking intron in sequences of candidate gene were sequenced,DNA fragments separated by agarose gel electrophoresis and direct sequencing method was used to determine the pathogenic gene.RESULTS:Phenotype of the proband was presented as ectopic lentis. Sequencing of the coding regions of FBN1 gene showed the presence of a heterozygous A→G transversion at nucleotide 640 in the 7 exon of FBN1 and the missense mutation made for Glycine into Serine(G214S. CONCLUSION:A heterozygous mutation of FBN1 c.A640G(p.G214Sis responsible for the Marfan syndrome in the four generation Chinese pedigree.

  20. Genome-wide Identification and Expression Analysis of the CDPK Gene Family in Grape, Vitis spp.

    Science.gov (United States)

    Zhang, Kai; Han, Yong-Tao; Zhao, Feng-Li; Hu, Yang; Gao, Yu-Rong; Ma, Yan-Fei; Zheng, Yi; Wang, Yue-Jin; Wen, Ying-Qiang

    2015-06-30

    Calcium-dependent protein kinases (CDPKs) play vital roles in plant growth and development, biotic and abiotic stress responses, and hormone signaling. Little is known about the CDPK gene family in grapevine. In this study, we performed a genome-wide analysis of the 12X grape genome (Vitis vinifera) and identified nineteen CDPK genes. Comparison of the structures of grape CDPK genes allowed us to examine their functional conservation and differentiation. Segmentally duplicated grape CDPK genes showed high structural conservation and contributed to gene family expansion. Additional comparisons between grape and Arabidopsis thaliana demonstrated that several grape CDPK genes occured in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of grapevine and Arabidopsis. Phylogenetic analysis divided the grape CDPK genes into four groups. Furthermore, we examined the expression of the corresponding nineteen homologous CDPK genes in the Chinese wild grape (Vitis pseudoreticulata) under various conditions, including biotic stress, abiotic stress, and hormone treatments. The expression profiles derived from reverse transcription and quantitative PCR suggested that a large number of VpCDPKs responded to various stimuli on the transcriptional level, indicating their versatile roles in the responses to biotic and abiotic stresses. Moreover, we examined the subcellular localization of VpCDPKs by transiently expressing six VpCDPK-GFP fusion proteins in Arabidopsis mesophyll protoplasts; this revealed high variability consistent with potential functional differences. Taken as a whole, our data provide significant insights into the evolution and function of grape CDPKs and a framework for future investigation of grape CDPK genes.

  1. The Tomato Terpene Synthase Gene Family1[W][OA

    Science.gov (United States)

    Falara, Vasiliki; Akhtar, Tariq A.; Nguyen, Thuong T.H.; Spyropoulou, Eleni A.; Bleeker, Petra M.; Schauvinhold, Ines; Matsuba, Yuki; Bonini, Megan E.; Schilmiller, Anthony L.; Last, Robert L.; Schuurink, Robert C.; Pichersky, Eran

    2011-01-01

    Compounds of the terpenoid class play numerous roles in the interactions of plants with their environment, such as attracting pollinators and defending the plant against pests. We show here that the genome of cultivated tomato (Solanum lycopersicum) contains 44 terpene synthase (TPS) genes, including 29 that are functional or potentially functional. Of these 29 TPS genes, 26 were expressed in at least some organs or tissues of the plant. The enzymatic functions of eight of the TPS proteins were previously reported, and here we report the specific in vitro catalytic activity of 10 additional tomato terpene synthases. Many of the tomato TPS genes are found in clusters, notably on chromosomes 1, 2, 6, 8, and 10. All TPS family clades previously identified in angiosperms are also present in tomato. The largest clade of functional TPS genes found in tomato, with 12 members, is the TPS-a clade, and it appears to encode only sesquiterpene synthases, one of which is localized to the mitochondria, while the rest are likely cytosolic. A few additional sesquiterpene synthases are encoded by TPS-b clade genes. Some of the tomato sesquiterpene synthases use z,z-farnesyl diphosphate in vitro as well, or more efficiently than, the e,e-farnesyl diphosphate substrate. Genes encoding monoterpene synthases are also prevalent, and they fall into three clades: TPS-b, TPS-g, and TPS-e/f. With the exception of two enzymes involved in the synthesis of ent-kaurene, the precursor of gibberellins, no other tomato TPS genes could be demonstrated to encode diterpene synthases so far. PMID:21813655

  2. Genome-wide analysis of WRKY gene family in Cucumis sativus.

    Science.gov (United States)

    Ling, Jian; Jiang, Weijie; Zhang, Ying; Yu, Hongjun; Mao, Zhenchuan; Gu, Xingfang; Huang, Sanwen; Xie, Bingyan

    2011-09-28

    WRKY proteins are a large family of transcriptional regulators in higher plant. They are involved in many biological processes, such as plant development, metabolism, and responses to biotic and abiotic stresses. Prior to the present study, only one full-length cucumber WRKY protein had been reported. The recent publication of the draft genome sequence of cucumber allowed us to conduct a genome-wide search for cucumber WRKY proteins, and to compare these positively identified proteins with their homologs in model plants, such as Arabidopsis. We identified a total of 55 WRKY genes in the cucumber genome. According to structural features of their encoded proteins, the cucumber WRKY (CsWRKY) genes were classified into three groups (group 1-3). Analysis of expression profiles of CsWRKY genes indicated that 48 WRKY genes display differential expression either in their transcript abundance or in their expression patterns under normal growth conditions, and 23 WRKY genes were differentially expressed in response to at least one abiotic stresses (cold, drought or salinity). The expression profile of stress-inducible CsWRKY genes were correlated with those of their putative Arabidopsis WRKY (AtWRKY) orthologs, except for the group 3 WRKY genes. Interestingly, duplicated group 3 AtWRKY genes appear to have been under positive selection pressure during evolution. In contrast, there was no evidence of recent gene duplication or positive selection pressure among CsWRKY group 3 genes, which may have led to the expressional divergence of group 3 orthologs. Fifty-five WRKY genes were identified in cucumber and the structure of their encoded proteins, their expression, and their evolution were examined. Considering that there has been extensive expansion of group 3 WRKY genes in angiosperms, the occurrence of different evolutionary events could explain the functional divergence of these genes.

  3. Genome-wide analysis of the sox family in the calcareous sponge Sycon ciliatum: multiple genes with unique expression patterns

    Directory of Open Access Journals (Sweden)

    Fortunato Sofia

    2012-07-01

    Full Text Available Abstract Background Sox genes are HMG-domain containing transcription factors with important roles in developmental processes in animals; many of them appear to have conserved functions among eumetazoans. Demosponges have fewer Sox genes than eumetazoans, but their roles remain unclear. The aim of this study is to gain insight into the early evolutionary history of the Sox gene family by identification and expression analysis of Sox genes in the calcareous sponge Sycon ciliatum. Methods Calcaronean Sox related sequences were retrieved by searching recently generated genomic and transcriptome sequence resources and analyzed using variety of phylogenetic methods and identification of conserved motifs. Expression was studied by whole mount in situ hybridization. Results We have identified seven Sox genes and four Sox-related genes in the complete genome of Sycon ciliatum. Phylogenetic and conserved motif analyses showed that five of Sycon Sox genes represent groups B, C, E, and F present in cnidarians and bilaterians. Two additional genes are classified as Sox genes but cannot be assigned to specific subfamilies, and four genes are more similar to Sox genes than to other HMG-containing genes. Thus, the repertoire of Sox genes is larger in this representative of calcareous sponges than in the demosponge Amphimedon queenslandica. It remains unclear whether this is due to the expansion of the gene family in Sycon or a secondary reduction in the Amphimedon genome. In situ hybridization of Sycon Sox genes revealed a variety of expression patterns during embryogenesis and in specific cell types of adult sponges. Conclusions In this study, we describe a large family of Sox genes in Sycon ciliatum with dynamic expression patterns, indicating that Sox genes are regulators in development and cell type determination in sponges, as observed in higher animals. The revealed differences between demosponge and calcisponge Sox genes repertoire highlight the need to

  4. Evolution and expression analysis of the grape (Vitis vinifera L.) WRKY gene family.

    Science.gov (United States)

    Guo, Chunlei; Guo, Rongrong; Xu, Xiaozhao; Gao, Min; Li, Xiaoqin; Song, Junyang; Zheng, Yi; Wang, Xiping

    2014-04-01

    WRKY proteins comprise a large family of transcription factors that play important roles in plant defence regulatory networks, including responses to various biotic and abiotic stresses. To date, no large-scale study of WRKY genes has been undertaken in grape (Vitis vinifera L.). In this study, a total of 59 putative grape WRKY genes (VvWRKY) were identified and renamed on the basis of their respective chromosome distribution. A multiple sequence alignment analysis using all predicted grape WRKY genes coding sequences, together with those from Arabidopsis thaliana and tomato (Solanum lycopersicum), indicated that the 59 VvWRKY genes can be classified into three main groups (I-III). An evaluation of the duplication events suggested that several WRKY genes arose before the divergence of the grape and Arabidopsis lineages. Moreover, expression profiles derived from semiquantitative PCR and real-time quantitative PCR analyses showed distinct expression patterns in various tissues and in response to different treatments. Four VvWRKY genes showed a significantly higher expression in roots or leaves, 55 responded to varying degrees to at least one abiotic stress treatment, and the expression of 38 were altered following powdery mildew (Erysiphe necator) infection. Most VvWRKY genes were downregulated in response to abscisic acid or salicylic acid treatments, while the expression of a subset was upregulated by methyl jasmonate or ethylene treatments.

  5. Corporate Social Responsibility in Large Family and Founder Firms

    NARCIS (Netherlands)

    J.H. Block (Jörn); M. Wagner (Marcus)

    2010-01-01

    textabstractBased on arguments about long-term orientation and corporate reputation, we argue that family and founder firms differ from other firms with regard to corporate social responsibility. Using Bayesian analysis, we then show that family and founder ownership are associated with a lower

  6. A novel ATP1A2 gene mutation in an Irish familial hemiplegic migraine kindred.

    LENUS (Irish Health Repository)

    Fernandez, Desiree M

    2012-02-03

    OBJECTIVE: We studied a large Irish Caucasian pedigree with familial hemiplegic migraine (FHM) with the aim of finding the causative gene mutation. BACKGROUND: FHM is a rare autosomal-dominant subtype of migraine with aura, which is linked to 4 loci on chromosomes 19p13, 1q23, 2q24, and 1q31. The mutations responsible for hemiplegic migraine have been described in the CACNA1A gene (chromosome 19p13), ATP1A2 gene (chromosome 1q23), and SCN1A gene (chromosome 2q24). METHODS: We performed linkage analyses in this family for chromosome 1q23 and performed mutation analysis of the ATP1A2 gene. RESULTS: Linkage to the FHM2 locus on chromosome 1 was demonstrated. Mutation screening of the ATP1A2 gene revealed a G to C substitution in exon 22 resulting in a novel protein variant, D999H, which co-segregates with FHM within this pedigree and is absent in 50 unaffected individuals. This residue is also highly conserved across species. CONCLUSIONS: We propose that D999H is a novel FHM ATP1A2 mutation.

  7. Penetrance and clinical consequences of a gross SDHB deletion in a large family.

    Science.gov (United States)

    Solis, D C; Burnichon, N; Timmers, H J L M; Raygada, M J; Kozupa, A; Merino, M J; Makey, D; Adams, K T; Venisse, A; Gimenez-Roqueplo, A-P; Pacak, K

    2009-04-01

    Mutations in the gene encoding subunit B of the mitochondrial enzyme succinate dehydrogenase (SDHB) are inherited in an autosomal dominant manner and are associated with hereditary paraganglioma (PGL) and pheochromocytoma. The phenotype of patients with SDHB point mutations has been previously described. However, the phenotype and penetrance of gross SDHB deletions have not been well characterized as they are rarely described. The objective was to describe the phenotype and estimate the penetrance of an exon 1 large SDHB deletion in one kindred. A retrospective and prospective study of 41 relatives across five generations was carried out. The main outcome measures were genetic testing, clinical presentations, plasma catecholamines and their O-methylated metabolites. Of the 41 mutation carriers identified, 11 were diagnosed with PGL, 12 were found to be healthy carriers after evaluation, and 18 were reportedly healthy based on family history accounts. The penetrance of PGL related to the exon 1 large SDHB deletion in this family was estimated to be 35% by age 40. Variable expressivity of the phenotype associated with a large exon 1 SDHB deletion was observed, including low penetrance, diverse primary PGL tumor locations, and malignant potential.

  8. Differential expression pattern of UBX family genes in Caenorhabditis elegans

    International Nuclear Information System (INIS)

    Yamauchi, Seiji; Sasagawa, Yohei; Ogura, Teru; Yamanaka, Kunitoshi

    2007-01-01

    UBX (ubiquitin regulatory X)-containing proteins belong to an evolutionary conserved protein family and determine the specificity of p97/VCP/Cdc48p function by binding as its adaptors. Caenorhabditis elegans was found to possess six UBX-containing proteins, named UBXN-1 to -6. However, no general or specific function of them has been revealed. During the course of understanding not only their function but also specified function of p97, we investigated spatial and temporal expression patterns of six ubxn genes in this study. Transcript analyses showed that the expression pattern of each ubxn gene was different throughout worm's development and may show potential developmental dynamics in their function, especially ubxn-5 was expressed specifically in the spermatogenic germline, suggesting a crucial role in spermatogenesis. In addition, as ubxn-4 expression was induced by ER stress, it would function as an ERAD factor in C. elegans. In vivo expression analysis by using GFP translational fusion constructs revealed that six ubxn genes show distinct expression patterns. These results altogether demonstrate that the expression of all six ubxn genes of C. elegans is differently regulated

  9. Global Analysis of miRNA Gene Clusters and Gene Families Reveals Dynamic and Coordinated Expression

    Directory of Open Access Journals (Sweden)

    Li Guo

    2014-01-01

    Full Text Available To further understand the potential expression relationships of miRNAs in miRNA gene clusters and gene families, a global analysis was performed in 4 paired tumor (breast cancer and adjacent normal tissue samples using deep sequencing datasets. The compositions of miRNA gene clusters and families are not random, and clustered and homologous miRNAs may have close relationships with overlapped miRNA species. Members in the miRNA group always had various expression levels, and even some showed larger expression divergence. Despite the dynamic expression as well as individual difference, these miRNAs always indicated consistent or similar deregulation patterns. The consistent deregulation expression may contribute to dynamic and coordinated interaction between different miRNAs in regulatory network. Further, we found that those clustered or homologous miRNAs that were also identified as sense and antisense miRNAs showed larger expression divergence. miRNA gene clusters and families indicated important biological roles, and the specific distribution and expression further enrich and ensure the flexible and robust regulatory network.

  10. Differential roles of TGIF family genes in mammalian reproduction

    Directory of Open Access Journals (Sweden)

    Renfree Marilyn B

    2011-09-01

    Full Text Available Abstract Background TG-interacting factors (TGIFs belong to a family of TALE-homeodomain proteins including TGIF1, TGIF2 and TGIFLX/Y in human. Both TGIF1 and TGIF2 act as transcription factors repressing TGF-β signalling. Human TGIFLX and its orthologue, Tex1 in the mouse, are X-linked genes that are only expressed in the adult testis. TGIF2 arose from TGIF1 by duplication, whereas TGIFLX arose by retrotransposition to the X-chromosome. These genes have not been characterised in any non-eutherian mammals. We therefore studied the TGIF family in the tammar wallaby (a marsupial mammal to investigate their roles in reproduction and how and when these genes may have evolved their functions and chromosomal locations. Results Both TGIF1 and TGIF2 were present in the tammar genome on autosomes but TGIFLX was absent. Tammar TGIF1 shared a similar expression pattern during embryogenesis, sexual differentiation and in adult tissues to that of TGIF1 in eutherian mammals, suggesting it has been functionally conserved. Tammar TGIF2 was ubiquitously expressed throughout early development as in the human and mouse, but in the adult, it was expressed only in the gonads and spleen, more like the expression pattern of human TGIFLX and mouse Tex1. Tammar TGIF2 mRNA was specifically detected in round and elongated spermatids. There was no mRNA detected in mature spermatozoa. TGIF2 protein was specifically located in the cytoplasm of spermatids, and in the residual body and the mid-piece of the mature sperm tail. These data suggest that tammar TGIF2 may participate in spermiogenesis, like TGIFLX does in eutherians. TGIF2 was detected for the first time in the ovary with mRNA produced in the granulosa and theca cells, suggesting it may also play a role in folliculogenesis. Conclusions The restricted and very similar expression of tammar TGIF2 to X-linked paralogues in eutherians suggests that the evolution of TGIF1, TGIF2 and TGIFLX in eutherians was accompanied by

  11. Analysis of the WUSCHEL-RELATED HOMEOBOX gene family in Pinus pinaster: New insights into the gene family evolution.

    Science.gov (United States)

    Alvarez, José M; Bueno, Natalia; Cañas, Rafael A; Avila, Concepción; Cánovas, Francisco M; Ordás, Ricardo J

    2018-02-01

    WUSCHEL-RELATED HOMEOBOX (WOX) genes are key players controlling stem cells in plants and can be divided into three clades according to the time of their appearance during plant evolution. Our knowledge of stem cell function in vascular plants other than angiosperms is limited, they separated from gymnosperms ca 300 million years ago and their patterning during embryogenesis differs significantly. For this reason, we have used the model gymnosperm Pinus pinaster to identify WOX genes and perform a thorough analysis of their gene expression patterns. Using transcriptomic data from a comprehensive range of tissues and stages of development we have shown three major outcomes: that the P. pinaster genome encodes at least fourteen members of the WOX family spanning all the major clades, that the genome of gymnosperms contains a WOX gene with no homologues in angiosperms representing a transitional stage between intermediate- and WUS-clade proteins, and that we can detect discrete WUS and WOX5 transcripts for the first time in a gymnosperm. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

  12. Mutation in TWINKLE in a Large Iranian Family with Progressive External Ophthalmoplegia, Myopathy, Dysphagia and Dysphonia, and Behavior Change.

    Science.gov (United States)

    Tafakhori, Abbas; Yu Jin Ng, Alvin; Tohari, Sumanty; Venkatesh, Byrappa; Lee, Hane; Eskin, Ascia; Nelson, Stanley F; Bonnard, Carine; Reversade, Bruno; Kariminejad, Ariana

    2016-02-01

    TWINKLE (c10orf2) gene is responsible for autosomal dominant progressive external ophthalmoplegia (PEO). In rare cases, additional features such as muscle weakness, peripheral neuropathy, ataxia, cardiomyopathy, dysphagia, dysphonia, cataracts, depression, dementia, parkinsonism, and hearing loss have been reported in association with heterozygous mutations of the TWINKLE gene. We have studied a large Iranian family with myopathy, dysphonia, dysphagia, and behavior change in addition to PEO in affected members. We identified a missense mutation c.1121G > A in the c10orf2 gene in all affected members. Early death is a novel feature seen in affected members of this family that has not been reported to date. The association of PEO, myopathy, dysphonia, dysphagia, behavior change and early death has not been previously reported in the literature or other patients with this mutation.

  13. Structural and functional studies of a family of Dictyostelium discoideum developmentally regulated, prestalk genes coding for small proteins

    Directory of Open Access Journals (Sweden)

    Escalante Ricardo

    2008-01-01

    Full Text Available Abstract Background The social amoeba Dictyostelium discoideum executes a multicellular development program upon starvation. This morphogenetic process requires the differential regulation of a large number of genes and is coordinated by extracellular signals. The MADS-box transcription factor SrfA is required for several stages of development, including slug migration and spore terminal differentiation. Results Subtractive hybridization allowed the isolation of a gene, sigN (SrfA-induced gene N, that was dependent on the transcription factor SrfA for expression at the slug stage of development. Homology searches detected the existence of a large family of sigN-related genes in the Dictyostelium discoideum genome. The 13 most similar genes are grouped in two regions of chromosome 2 and have been named Group1 and Group2 sigN genes. The putative encoded proteins are 87–89 amino acids long. All these genes have a similar structure, composed of a first exon containing a 13 nucleotides long open reading frame and a second exon comprising the remaining of the putative coding region. The expression of these genes is induced at10 hours of development. Analyses of their promoter regions indicate that these genes are expressed in the prestalk region of developing structures. The addition of antibodies raised against SigN Group 2 proteins induced disintegration of multi-cellular structures at the mound stage of development. Conclusion A large family of genes coding for small proteins has been identified in D. discoideum. Two groups of very similar genes from this family have been shown to be specifically expressed in prestalk cells during development. Functional studies using antibodies raised against Group 2 SigN proteins indicate that these genes could play a role during multicellular development.

  14. Large family of quantum weak coin-flipping protocols

    International Nuclear Information System (INIS)

    Mochon, Carlos

    2005-01-01

    Each classical public-coin protocol for coin flipping is naturally associated with a quantum protocol for weak coin flipping. The quantum protocol is obtained by replacing classical randomness with quantum entanglement and by adding a cheat detection test in the last round that verifies the integrity of this entanglement. The set of such protocols defines a family which contains the protocol with bias 0.192 previously found by the author, as well as protocols with bias as low as 1/6 described herein. The family is analyzed by identifying a set of optimal protocols for every number of messages. In the end, tight lower bounds for the bias are obtained which prove that 1/6 is optimal for all protocols within the family

  15. Emergence of switch-like behavior in a large family of simple biochemical networks.

    Directory of Open Access Journals (Sweden)

    Dan Siegal-Gaskins

    2011-05-01

    Full Text Available Bistability plays a central role in the gene regulatory networks (GRNs controlling many essential biological functions, including cellular differentiation and cell cycle control. However, establishing the network topologies that can exhibit bistability remains a challenge, in part due to the exceedingly large variety of GRNs that exist for even a small number of components. We begin to address this problem by employing chemical reaction network theory in a comprehensive in silico survey to determine the capacity for bistability of more than 40,000 simple networks that can be formed by two transcription factor-coding genes and their associated proteins (assuming only the most elementary biochemical processes. We find that there exist reaction rate constants leading to bistability in ∼90% of these GRN models, including several circuits that do not contain any of the TF cooperativity commonly associated with bistable systems, and the majority of which could only be identified as bistable through an original subnetwork-based analysis. A topological sorting of the two-gene family of networks based on the presence or absence of biochemical reactions reveals eleven minimal bistable networks (i.e., bistable networks that do not contain within them a smaller bistable subnetwork. The large number of previously unknown bistable network topologies suggests that the capacity for switch-like behavior in GRNs arises with relative ease and is not easily lost through network evolution. To highlight the relevance of the systematic application of CRNT to bistable network identification in real biological systems, we integrated publicly available protein-protein interaction, protein-DNA interaction, and gene expression data from Saccharomyces cerevisiae, and identified several GRNs predicted to behave in a bistable fashion.

  16. A Novel Locus Harbouring a Functional CD164 Nonsense Mutation Identified in a Large Danish Family with Nonsyndromic Hearing Impairment

    DEFF Research Database (Denmark)

    Nyegaard, Mette; Rendtorff, Nanna D; Nielsen, Morten S

    2015-01-01

    Nonsyndromic hearing impairment (NSHI) is a highly heterogeneous condition with more than eighty known causative genes. However, in the clinical setting, a large number of NSHI families have unexplained etiology, suggesting that there are many more genes to be identified. In this study we used SNP......-based linkage analysis and follow up microsatellite markers to identify a novel locus (DFNA66) on chromosome 6q15-21 (LOD 5.1) in a large Danish family with dominantly inherited NSHI. By locus specific capture and next-generation sequencing, we identified a c.574C>T heterozygous nonsense mutation (p.R192......-genome and exome sequence data. The predicted effect of the mutation was a truncation of the last six C-terminal residues of the cytoplasmic tail of CD164, including a highly conserved canonical sorting motif (YXX phi). In whole blood from an affected individual, we found by RT-PCR both the wild...

  17. Gene structure, transcripts and calciotropic effects of the PTH family of peptides in Xenopus and chicken

    Directory of Open Access Journals (Sweden)

    Power Deborah M

    2010-12-01

    Full Text Available Abstract Background Parathyroid hormone (PTH and PTH-related peptide (PTHrP belong to a family of endocrine factors that share a highly conserved N-terminal region (amino acids 1-34 and play key roles in calcium homeostasis, bone formation and skeletal development. Recently, PTH-like peptide (PTH-L was identified in teleost fish raising questions about the evolution of these proteins. Although PTH and PTHrP have been intensively studied in mammals their function in other vertebrates is poorly documented. Amphibians and birds occupy unique phylogenetic positions, the former at the transition of aquatic to terrestrial life and the latter at the transition to homeothermy. Moreover, both organisms have characteristics indicative of a complex system in calcium regulation. This study investigated PTH family evolution in vertebrates with special emphasis on Xenopus and chicken. Results The PTH-L gene is present throughout the vertebrates with the exception of placental mammals. Gene structure of PTH and PTH-L seems to be conserved in vertebrates while PTHrP gene structure is divergent and has acquired new exons and alternative promoters. Splice variants of PTHrP and PTH-L are common in Xenopus and chicken and transcripts of the former have a widespread tissue distribution, although PTH-L is more restricted. PTH is widely expressed in fish tissue but from Xenopus to mammals becomes largely restricted to the parathyroid gland. The N-terminal (1-34 region of PTH, PTHrP and PTH-L in Xenopus and chicken share high sequence conservation and the capacity to modify calcium fluxes across epithelia suggesting a conserved role in calcium metabolism possibly via similar receptors. Conclusions The parathyroid hormone family contains 3 principal members, PTH, PTHrP and the recently identified PTH-L. In teleosts there are 5 genes which encode PTHrP (2, PTH (2 and PTH-L and in tetrapods there are 3 genes (PTHrP, PTH and PTH-L, the exception is placental mammals which

  18. Retrospective analysis of cohort database: Phenotypic variability in a large dataset of patients confirmed to have homozygous familial hypercholesterolemia

    Directory of Open Access Journals (Sweden)

    Frederick J. Raal

    2016-06-01

    Full Text Available These data describe the phenotypic variability in a large cohort of patients confirmed to have homozygous familial hypercholesterolemia. Herein, we describe the observed relationship of treated low-density lipoprotein cholesterol with age. We also overlay the low-density lipoprotein receptor gene (LDLR functional status with these phenotypic data. A full description of these data is available in our recent study published in Atherosclerosis, “Phenotype Diversity Among Patients With Homozygous Familial Hypercholesterolemia: A Cohort Study” (Raal et al., 2016 [1].

  19. A Genome-Wide Identification of the WRKY Family Genes and a Survey of Potential WRKY Target Genes in Dendrobium officinale.

    Science.gov (United States)

    He, Chunmei; Teixeira da Silva, Jaime A; Tan, Jianwen; Zhang, Jianxia; Pan, Xiaoping; Li, Mingzhi; Luo, Jianping; Duan, Jun

    2017-08-23

    The WRKY family, one of the largest families of transcription factors, plays important roles in the regulation of various biological processes, including growth, development and stress responses in plants. In the present study, 63 DoWRKY genes were identified from the Dendrobium officinale genome. These were classified into groups I, II, III and a non-group, each with 14, 28, 10 and 11 members, respectively. ABA-responsive, sulfur-responsive and low temperature-responsive elements were identified in the 1-k upstream regulatory region of DoWRKY genes. Subsequently, the expression of the 63 DoWRKY genes under cold stress was assessed, and the expression profiles of a large number of these genes were regulated by low temperature in roots and stems. To further understand the regulatory mechanism of DoWRKY genes in biological processes, potential WRKY target genes were investigated. Among them, most stress-related genes contained multiple W-box elements in their promoters. In addition, the genes involved in polysaccharide synthesis and hydrolysis contained W-box elements in their 1-k upstream regulatory regions, suggesting that DoWRKY genes may play a role in polysaccharide metabolism. These results provide a basis for investigating the function of WRKY genes and help to understand the downstream regulation network in plants within the Orchidaceae.

  20. GECKO: a complete large-scale gene expression analysis platform

    Directory of Open Access Journals (Sweden)

    Heuer Michael

    2004-12-01

    Full Text Available Abstract Background Gecko (Gene Expression: Computation and Knowledge Organization is a complete, high-capacity centralized gene expression analysis system, developed in response to the needs of a distributed user community. Results Based on a client-server architecture, with a centralized repository of typically many tens of thousands of Affymetrix scans, Gecko includes automatic processing pipelines for uploading data from remote sites, a data base, a computational engine implementing ~ 50 different analysis tools, and a client application. Among available analysis tools are clustering methods, principal component analysis, supervised classification including feature selection and cross-validation, multi-factorial ANOVA, statistical contrast calculations, and various post-processing tools for extracting data at given error rates or significance levels. On account of its open architecture, Gecko also allows for the integration of new algorithms. The Gecko framework is very general: non-Affymetrix and non-gene expression data can be analyzed as well. A unique feature of the Gecko architecture is the concept of the Analysis Tree (actually, a directed acyclic graph, in which all successive results in ongoing analyses are saved. This approach has proven invaluable in allowing a large (~ 100 users and distributed community to share results, and to repeatedly return over a span of years to older and potentially very complex analyses of gene expression data. Conclusions The Gecko system is being made publicly available as free software http://sourceforge.net/projects/geckoe. In totality or in parts, the Gecko framework should prove useful to users and system developers with a broad range of analysis needs.

  1. Large-scale inference of gene function through phylogenetic annotation of Gene Ontology terms: case study of the apoptosis and autophagy cellular processes.

    Science.gov (United States)

    Feuermann, Marc; Gaudet, Pascale; Mi, Huaiyu; Lewis, Suzanna E; Thomas, Paul D

    2016-01-01

    We previously reported a paradigm for large-scale phylogenomic analysis of gene families that takes advantage of the large corpus of experimentally supported Gene Ontology (GO) annotations. This 'GO Phylogenetic Annotation' approach integrates GO annotations from evolutionarily related genes across ∼100 different organisms in the context of a gene family tree, in which curators build an explicit model of the evolution of gene functions. GO Phylogenetic Annotation models the gain and loss of functions in a gene family tree, which is used to infer the functions of uncharacterized (or incompletely characterized) gene products, even for human proteins that are relatively well studied. Here, we report our results from applying this paradigm to two well-characterized cellular processes, apoptosis and autophagy. This revealed several important observations with respect to GO annotations and how they can be used for function inference. Notably, we applied only a small fraction of the experimentally supported GO annotations to infer function in other family members. The majority of other annotations describe indirect effects, phenotypes or results from high throughput experiments. In addition, we show here how feedback from phylogenetic annotation leads to significant improvements in the PANTHER trees, the GO annotations and GO itself. Thus GO phylogenetic annotation both increases the quantity and improves the accuracy of the GO annotations provided to the research community. We expect these phylogenetically based annotations to be of broad use in gene enrichment analysis as well as other applications of GO annotations.Database URL: http://amigo.geneontology.org/amigo. © The Author(s) 2016. Published by Oxford University Press.

  2. Novel Variations of FANCA Gene Provokes Fanconi Anemia: Molecular Diagnosis in a Special Chinese Family.

    Science.gov (United States)

    Li, Niu; Song, Aiyun; Ding, Lixia; Zhu, Hua; Li, Guoqiang; Miao, Yan; Wang, Jian; Li, Benshang; Chen, Jing

    2018-07-01

    Fanconi anemia (FA) is a rare autosomal recessive or X-linked disorder with highly variable clinical manifestations and an incidence of ∼1 to 5 in 1 million births. To date, 15 bona fide FA genes have been reported to be responsible for the known FA complementation groups and the FANCA gene accounts for almost 60%. In the present study, we report a special Chinese family, which has 2 children with classic FA characteristics. Via 2-step analysis of the whole-exome sequencing data and verification using multiplex ligation-dependent probe amplification test, one child was found to have a novel compound heterozygous mutation of a splicing variant (c.1471-1G>A) and a large intragenic deletion (exons 23-30 del) of the FANCA gene. The other child had the same splicing variant and another novel large deletion (exons 1-18 del) in the FANCA gene. Clone sequencing showed the c.1471-1G>A variant generate an altered transcript with 1 cryptic splice site in intron 15, resulting in a premature termination codon (p.Val490HisfsX6). This study not only shows the complexity of FA molecular diagnosis via comprehensively studying the FA pathogenic genes and the mutational spectrum, but also has significant reference value for the future molecular diagnosis of FA.

  3. Molecular evolution of the polyamine oxidase gene family in Metazoa

    Directory of Open Access Journals (Sweden)

    Polticelli Fabio

    2012-06-01

    Full Text Available Abstract Background Polyamine oxidase enzymes catalyze the oxidation of polyamines and acetylpolyamines. Since polyamines are basic regulators of cell growth and proliferation, their homeostasis is crucial for cell life. Members of the polyamine oxidase gene family have been identified in a wide variety of animals, including vertebrates, arthropodes, nematodes, placozoa, as well as in plants and fungi. Polyamine oxidases (PAOs from yeast can oxidize spermine, N1-acetylspermine, and N1-acetylspermidine, however, in vertebrates two different enzymes, namely spermine oxidase (SMO and acetylpolyamine oxidase (APAO, specifically catalyze the oxidation of spermine, and N1-acetylspermine/N1-acetylspermidine, respectively. Little is known about the molecular evolutionary history of these enzymes. However, since the yeast PAO is able to catalyze the oxidation of both acetylated and non acetylated polyamines, and in vertebrates these functions are addressed by two specialized polyamine oxidase subfamilies (APAO and SMO, it can be hypothesized an ancestral reference for the former enzyme from which the latter would have been derived. Results We analysed 36 SMO, 26 APAO, and 14 PAO homologue protein sequences from 54 taxa including various vertebrates and invertebrates. The analysis of the full-length sequences and the principal domains of vertebrate and invertebrate PAOs yielded consensus primary protein sequences for vertebrate SMOs and APAOs, and invertebrate PAOs. This analysis, coupled to molecular modeling techniques, also unveiled sequence regions that confer specific structural and functional properties, including substrate specificity, by the different PAO subfamilies. Molecular phylogenetic trees revealed a basal position of all the invertebrates PAO enzymes relative to vertebrate SMOs and APAOs. PAOs from insects constitute a monophyletic clade. Two PAO variants sampled in the amphioxus are basal to the dichotomy between two well supported

  4. Genome-wide identification of WRKY family genes and their response to cold stress in Vitis vinifera

    Science.gov (United States)

    WRKY transcription factors are one of the largest families of transcriptional regulators in plants. WRKY genes are not only found to play significant roles in biotic and abiotic stress response, but also regulate growth and development. Grapevine (Vitis vinifera) production is largely limited by str...

  5. Gender diversity in top-management positions in large family and nonfamily businesses

    OpenAIRE

    Kay, Rosemarie; Schlömer-Laufen, Nadine

    2016-01-01

    (Why) does the sex ratio in top-management positions in large family and nonfamily businesses differ? Using a unique data set and estimating (fractional) logit regressions we show that the female share in top-management positions in family businesses exceeds the one in nonfamily businesses. One reason is the selection mechanism social homophily from which females in family businesses benefit more because of a higher female share in the decision making body in family businesses. Another reason...

  6. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution.

    Science.gov (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A

    2015-06-08

    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    International Nuclear Information System (INIS)

    Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.

    2009-01-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  8. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    Energy Technology Data Exchange (ETDEWEB)

    Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: alzari@pasteur.fr [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)

    2009-10-01

    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.

  9. The WRKY Transcription Factor Family in Citrus: Valuable and Useful Candidate Genes for Citrus Breeding.

    Science.gov (United States)

    Ayadi, M; Hanana, M; Kharrat, N; Merchaoui, H; Marzoug, R Ben; Lauvergeat, V; Rebaï, A; Mzid, R

    2016-10-01

    WRKY transcription factors belong to a large family of plant transcriptional regulators whose members have been reported to be involved in a wide range of biological roles including plant development, adaptation to environmental constraints and response to several diseases. However, little or poor information is available about WRKY's in Citrus. The recent release of completely assembled genomes sequences of Citrus sinensis and Citrus clementina and the availability of ESTs sequences from other citrus species allowed us to perform a genome survey for Citrus WRKY proteins. In the present study, we identified 100 WRKY members from C. sinensis (51), C. clementina (48) and Citrus unshiu (1), and analyzed their chromosomal distribution, gene structure, gene duplication, syntenic relation and phylogenetic analysis. A phylogenetic tree of 100 Citrus WRKY sequences with their orthologs from Arabidopsis has distinguished seven groups. The CsWRKY genes were distributed across all ten sweet orange chromosomes. A comprehensive approach and an integrative analysis of Citrus WRKY gene expression revealed variable profiles of expression within tissues and stress conditions indicating functional diversification. Thus, candidate Citrus WRKY genes have been proposed as potentially involved in fruit acidification, essential oil biosynthesis and abiotic/biotic stress tolerance. Our results provided essential prerequisites for further WRKY genes cloning and functional analysis with an aim of citrus crop improvement.

  10. Genomic and expression analysis of the flax (Linum usitatissimum) family of glycosyl hydrolase 35 genes.

    Science.gov (United States)

    Hobson, Neil; Deyholos, Michael K

    2013-05-23

    Several β-galactosidases of the Glycosyl Hydrolase 35 (GH35) family have been characterized, and many of these modify cell wall components, including pectins, xyloglucans, and arabinogalactan proteins. The phloem fibres of flax (Linum usitatissimum) have gelatinous-type cell walls that are rich in crystalline cellulose and depend on β-galactosidase activity for their normal development. In this study, we investigate the transcript expression patterns and inferred evolutionary relationships of the complete set of flax GH35 genes, to better understand the functions of these genes in flax and other species. Using the recently published flax genome assembly, we identified 43 β-galactosidase-like (BGAL) genes, based on the presence of a GH35 domain. Phylogenetic analyses of their protein sequences clustered them into eight sub-families. Sub-family B, whose members in other species were known to be expressed in developing flowers and pollen, was greatly under represented in flax (p-value < 0.01). Sub-family A5, whose sole member from arabidopsis has been described as its primary xyloglucan BGAL, was greatly expanded in flax (p-value < 0.01). A number of flax BGALs were also observed to contain non-consensus GH35 active sites. Expression patterns of the flax BGALs were investigated using qRT-PCR and publicly available microarray data. All predicted flax BGALs showed evidence of expression in at least one tissue. Flax has a large number of BGAL genes, which display a distinct distribution among the BGAL sub-families, in comparison to other closely related species with available whole genome assemblies. Almost every flax BGAL was expressed in fibres, the majority of which expressed predominately in fibres as compared to other tissues, suggesting an important role for the expansion of this gene family in the development of this species as a fibre crop. Variations displayed in the canonical GH35 active site suggest a variety of roles unique to flax, which will require

  11. Genomewide analysis of MATE-type gene family in maize reveals ...

    Indian Academy of Sciences (India)

    Huasheng Zhu and Jiandong Wu contributed equally to this work. As a group of secondary active transporters, the MATE gene family consists of multiple genes that widely exist in ..... Roots of the stress-treated plants were collected at 0,.

  12. TreeFam: a curated database of phylogenetic trees of animal gene families

    DEFF Research Database (Denmark)

    Li, Heng; Coghlan, Avril; Ruan, Jue

    2006-01-01

    TreeFam is a database of phylogenetic trees of gene families found in animals. It aims to develop a curated resource that presents the accurate evolutionary history of all animal gene families, as well as reliable ortholog and paralog assignments. Curated families are being added progressively......, based on seed alignments and trees in a similar fashion to Pfam. Release 1.1 of TreeFam contains curated trees for 690 families and automatically generated trees for another 11 646 families. These represent over 128 000 genes from nine fully sequenced animal genomes and over 45 000 other animal proteins...

  13. Genome-wide identification, phylogeny and expression analysis of SUN, OFP and YABBY gene family in tomato.

    Science.gov (United States)

    Huang, Zejun; Van Houten, Jason; Gonzalez, Geoffrey; Xiao, Han; van der Knaap, Esther

    2013-04-01

    Members of the plant-specific gene families IQD/SUN, OFP and YABBY are thought to play important roles in plant growth and development. YABBY family members are involved in lateral organ polarity and growth; OFP members encode transcriptional repressors, whereas the role of IQD/SUN members is less clear. The tomato fruit shape genes SUN, OVATE, and FASCIATED belong to IQD/SUN, OFP and the YABBY gene family, respectively. A gene duplication resulting in high expression of SUN leads to elongated fruit, whereas a premature stop codon in OVATE and a large inversion within FASCIATED control fruit elongation and a flat fruit shape, respectively. In this study, we identified 34 SlSUN, 31 SlOFP and 9 SlYABBY genes in tomato and identified their position on 12 chromosomes. Genome mapping analysis showed that the SlSUN, SlOFP, and SlYABBY genes were enriched on the top and bottom segments of several chromosomes. In particular, on chromosome 10, a cluster of SlOFPs were found to originate from tandem duplication events. We also constructed three phylogenetic trees based on the protein sequences of the IQ67, OVATE and YABBY domains, respectively, from members of these families in Arabidopsis and tomato. The closest putative orthologs of the Arabidopsis and tomato genes were determined by the position on the phylogenetic tree and sequence similarity. Furthermore, expression analysis showed that some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Also, certain family members overlapped with known QTLs controlling fruit shape in Solanaceous plants. Combined, these results may help elucidate the roles of SUN, OFP and YABBY family members in plant growth and development.

  14. Genome-wide identification and characterization of the bHLH gene family in tomato.

    Science.gov (United States)

    Sun, Hua; Fan, Hua-Jie; Ling, Hong-Qing

    2015-01-22

    The basic helix-loop-helix (bHLH) proteins are a large superfamily of transcription factors, and play a central role in a wide range of metabolic, physiological, and developmental processes in higher organisms. Tomato is an important vegetable crop, and its genome sequence has been published recently. However, the bHLH gene family of tomato has not been systematically identified and characterized yet. In this study, we identified 159 bHLH protein-encoding genes (SlbHLH) in tomato genome and analyzed their structures. Although bHLH domains were conserved among the bHLH proteins between tomato and Arabidopsis, the intron sequences and distribution of tomato bHLH genes were extremely different compared with Arabidopsis. The gene duplication analysis showed that 58.5% and 6.3% of SlbHLH genes belonged to low-stringency and high-stringency duplication, respectively, indicating that the SlbHLH genes are mainly generated via short low-stringency region duplication in tomato. Subsequently, we classified the SlbHLH genes into 21 subfamilies by phylogenetic tree analysis, and predicted their possible functions by comparison with their homologous genes of Arabidopsis. Moreover, the expression profile analysis of SlbHLH genes from 10 different tissues showed that 21 SlbHLH genes exhibited tissue-specific expression. Further, we identified that 11 SlbHLH genes were associated with fruit development and ripening (eight of them associated with young fruit development and three with fruit ripening). The evolutionary analysis revealed that 92% SlbHLH genes might be evolved from ancestor(s) originated from early land plant, and 8% from algae. In this work, we systematically identified SlbHLHs by analyzing the tomato genome sequence using a set of bioinformatics approaches, and characterized their chromosomal distribution, gene structures, duplication, phylogenetic relationship and expression profiles, as well predicted their possible biological functions via comparative analysis

  15. Identification of a novel gene family that includes the interferon-inducible human genes 6–16 and ISG12

    Directory of Open Access Journals (Sweden)

    Parker Nadeene

    2004-01-01

    Full Text Available Abstract Background The human 6–16 and ISG12 genes are transcriptionally upregulated in a variety of cell types in response to type I interferon (IFN. The predicted products of these genes are small (12.9 and 11.5 kDa respectively, hydrophobic proteins that share 36% overall amino acid identity. Gene disruption and over-expression studies have so far failed to reveal any biochemical or cellular roles for these proteins. Results We have used in silico analyses to identify a novel family of genes (the ISG12 gene family related to both the human 6–16 and ISG12 genes. Each ISG12 family member codes for a small hydrophobic protein containing a conserved ~80 amino-acid motif (the ISG12 motif. So far we have detected 46 family members in 25 organisms, ranging from unicellular eukaryotes to humans. Humans have four ISG12 genes: the 6–16 gene at chromosome 1p35 and three genes (ISG12(a, ISG12(b and ISG12(c clustered at chromosome 14q32. Mice have three family members (ISG12(a, ISG12(b1 and ISG12(b2 clustered at chromosome 12F1 (syntenic with human chromosome 14q32. There does not appear to be a murine 6–16 gene. On the basis of phylogenetic analyses, genomic organisation and intron-alignments we suggest that this family has arisen through divergent inter- and intra-chromosomal gene duplication events. The transcripts from human and mouse genes are detectable, all but two (human ISG12(b and ISG12(c being upregulated in response to type I IFN in the cell lines tested. Conclusions Members of the eukaryotic ISG12 gene family encode a small hydrophobic protein with at least one copy of a newly defined motif of ~80 amino-acids (the ISG12 motif. In higher eukaryotes, many of the genes have acquired a responsiveness to type I IFN during evolution suggesting that a role in resisting cellular or environmental stress may be a unifying property of all family members. Analysis of gene-function in higher eukaryotes is complicated by the possibility of

  16. Genetic linkage analyses and Cx50 mutation detection in a large multiplex Chinese family with hereditary nuclear cataract.

    Science.gov (United States)

    He, Wei; Li, Xin; Chen, Jiajing; Xu, Ling; Zhang, Feng; Dai, Qiushi; Cui, Hao; Wang, Duen-Mei; Yu, Jun; Hu, Songnian; Lu, Shan

    2011-03-01

    The aim of the study was to characterize the underlying mutation in a large multiplex Chinese family with hereditary nuclear cataract. A 6-generation Chinese family having hereditary nuclear cataract was recruited and clinically verified. Blood DNA samples were obtained from 53 available family members. Linkage analyses were performed on the known candidate regions for hereditary cataract with 36 polymorphic microsatellite markers. To identify mutations related to cataract, a direct sequencing approach was applied to a candidate gene residing in our linkage locus. A linkage locus was identified with a maximum 2-point LOD score of 4.31 (recombination fraction = 0) at marker D1S498 and a maximum multipoint LOD score of 5.7 between markers D1S2344 and D1S498 on chromosome 1q21.1, where the candidate gene Cx50 is located. Direct sequencing of Cx50 showed a 139 G to A transition occurred in all affected family members. This transitional mutation resulted in a replacement of aspartic acid by asparagine at residue 47 (D47N) and led to a loss-of-function of the protein. The D47N mutation of Cx50 causes the hereditary nuclear cataract in this family in an autosomal dominant mode of inheritance with incomplete penetrance.

  17. Cytokinin Regulation of Gene Expression in the AHP Gene Family in Arabidopsis thaliana

    Czech Academy of Sciences Publication Activity Database

    Hradilová, Jana; Malbeck, Jiří; Brzobohatý, Břetislav

    2007-01-01

    Roč. 26, č. 3 (2007), s. 229-244 ISSN 0721-7595 R&D Projects: GA MŠk LN00A081; GA MŠk 1M06030; GA MŠk(CZ) LC06034; GA AV ČR(CZ) IAA600380507; GA AV ČR IAA600040612 Institutional research plan: CEZ:AV0Z50380511; CEZ:AV0Z50040702 Source of funding: V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje ; V - iné verejné zdroje Keywords : gene expression * AHP gene family * cytokinin signal transduction Subject RIV: EF - Botanics Impact factor: 2.220, year: 2007

  18. Molecular cloning of RBCS genes in Selaginella and the evolution of the rbcS gene family

    Directory of Open Access Journals (Sweden)

    Wang Bo

    2015-01-01

    Full Text Available Rubisco small subunits (RBCS are encoded by a nuclear rbcS multigene family in higher plants and green algae. However, owing to the lack of rbcS sequences in lycophytes, the characteristics of rbcS genes in lycophytes is unclear. Recently, the complete genome sequence of the lycophyte Selaginella moellendorffii provided the first insight into the rbcS gene family in lycophytes. To understand further the characteristics of rbcS genes in other Selaginella, the full length of rbcS genes (rbcS1 and rbcS2 from two other Selaginella species were isolated. Both rbcS1 and rbcS2 genes shared more than 97% identity among three Selaginella species. RBCS proteins from Selaginella contained the Pfam RBCS domain F00101, which was a major domain of other plant RBCS proteins. To explore the evolution of the rbcS gene family across Selaginella and other plants, we identified and performed comparative analysis of the rbcS gene family among 16 model plants based on a genome-wide analysis. The results showed that (i two rbcS genes were obtained in Selaginella, which is the second fewest number of rbcS genes among the 16 representative plants; (ii an expansion of rbcS genes occurred in the moss Physcomitrella patens; (iii only RBCS proteins from angiosperms contained the Pfam PF12338 domains, and (iv a pattern of concerted evolution existed in the rbcS gene family. Our study provides new insights into the evolution of the rbcS gene family in Selaginella and other plants.

  19. Analysis of four families with the Stickler syndrome by linkage studies. Identification of a new premature stop codon in the COL2A1 gene in a family

    Energy Technology Data Exchange (ETDEWEB)

    Bonaventure, J.; Lasselin, C. [Hopital Necker, Paris (France); Toutain, A. [CHU Bretonneau, Tours (France)] [and others

    1994-09-01

    The Stickler syndrome is an arthro-ophthalmopathy which associates progressive myopia with vitreal degeneration and retinal detachment. Cleft palate, cranio-facial abnormalities, deafness and osteoarthritis are often associated symptoms. Genetic heterogeneity of this autosomal dominant disease was consistent with its large clinical variability. Linkage studies have provided evidence for cosegregation of the disease with COL2A1, the gene coding for type II collagen, in about 50% of the families. Four additional families are reported here. Linkage analyses by using a VNTR located in the 3{prime} region of the gene were achieved. In three families, positive lod scores were obtained with a cumulative maximal value of 3.5 at a recombination fraction of 0. In one of these families, single strand conformation analysis of 25 exons disclosed a new mutation in exon 42. Codon for glutamic acid at position a1-803 was converted into a stop codon. The mutation was detected in DNA samples from all the affected members of the family but not in the unaffected. This result confirms that most of the Stickler syndromes linked to COL2A1 are due to premature stop codons. In a second family, an abnormal SSCP pattern of exon 34 was detected in all the affected individuals. The mutation is likely to correspond to a splicing defect in the acceptor site of intron 33. In one family the disease did not segregate with the COL2A1 locus. Further linkage studies with intragenic dimorphic sites in the COL10A1 gene and highly polymorphic markers close to the COL9A1 locus indicated that this disorder did not result from defects in these two genes.

  20. The ABC gene family in arthropods: comparative genomics and role in insecticide transport and resistance.

    Science.gov (United States)

    Dermauw, Wannes; Van Leeuwen, Thomas

    2014-02-01

    About a 100 years ago, the Drosophila white mutant marked the birth of Drosophila genetics. The white gene turned out to encode the first well studied ABC transporter in arthropods. The ABC gene family is now recognized as one of the largest transporter families in all kingdoms of life. The majority of ABC proteins function as primary-active transporters that bind and hydrolyze ATP while transporting a large diversity of substrates across lipid membranes. Although extremely well studied in vertebrates for their role in drug resistance, less is known about the role of this family in the transport of endogenous and exogenous substances in arthropods. The ABC families of five insect species, a crustacean and a chelicerate have been annotated in some detail. We conducted a thorough phylogenetic analysis of the seven arthropod and human ABC protein subfamilies, to infer orthologous relationships that might suggest conserved function. Most orthologous relationships were found in the ABCB half transporter, ABCD, ABCE and ABCF subfamilies, but specific expansions within species and lineages are frequently observed and discussed. We next surveyed the role of ABC transporters in the transport of xenobiotics/plant allelochemicals and their involvement in insecticide resistance. The involvement of ABC transporters in xenobiotic resistance in arthropods is historically not well documented, but an increasing number of studies using unbiased differential gene expression analysis now points to their importance. We give an overview of methods that can be used to link ABC transporters to resistance. ABC proteins have also recently been implicated in the mode of action and resistance to Bt toxins in Lepidoptera. Given the enormous interest in Bt toxicology in transgenic crops, such findings will provide an impetus to further reveal the role of ABC transporters in arthropods. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.

  1. Molecular characterization of edestin gene family in Cannabis sativa L.

    Science.gov (United States)

    Docimo, Teresa; Caruso, Immacolata; Ponzoni, Elena; Mattana, Monica; Galasso, Incoronata

    2014-11-01

    Globulins are the predominant class of seed storage proteins in a wide variety of plants. In many plant species globulins are present in several isoforms encoded by gene families. The major seed storage protein of Cannabis sativa L. is the globulin edestin, widely known for its nutritional potential. In this work, we report the isolation of seven cDNAs encoding for edestin from the C. sativa variety Carmagnola. Southern blot hybridization is in agreement with the number of identified edestin genes. All seven sequences showed the characteristic globulin features, but they result to be divergent members/forms of two edestin types. According to their sequence similarity four forms named CsEde1A, CsEde1B, CsEde1C, CsEde1D have been assigned to the edestin type 1 and the three forms CsEde2A, CsEde2B, CsEde2C to the edestin type 2. Analysis of the coding sequences revealed a high percentage of similarity (98-99%) among the different forms belonging to the same type, which decreased significantly to approximately 64% between the forms belonging to different types. Quantitative RT-PCR analysis revealed that both edestin types are expressed in developing hemp seeds and the amount of CsEde1 was 4.44 ± 0.10 higher than CsEde2. Both edestin types exhibited a high percentage of arginine (11-12%), but CsEde2 resulted particularly rich in methionine residues (2.36%) respect to CsEde1 (0.82%). The amino acid composition determined in CsEde1 and CsEde2 types suggests that these seed proteins can be used to improve the nutritional quality of plant food-stuffs. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  2. Action of multiple intra-QTL genes concerted around a co-localized transcription factor underpins a large effect QTL

    Science.gov (United States)

    Dixit, Shalabh; Kumar Biswal, Akshaya; Min, Aye; Henry, Amelia; Oane, Rowena H.; Raorane, Manish L.; Longkumer, Toshisangba; Pabuayon, Isaiah M.; Mutte, Sumanth K.; Vardarajan, Adithi R.; Miro, Berta; Govindan, Ganesan; Albano-Enriquez, Blesilda; Pueffeld, Mandy; Sreenivasulu, Nese; Slamet-Loedin, Inez; Sundarvelpandian, Kalaipandian; Tsai, Yuan-Ching; Raghuvanshi, Saurabh; Hsing, Yue-Ie C.; Kumar, Arvind; Kohli, Ajay

    2015-01-01

    Sub-QTLs and multiple intra-QTL genes are hypothesized to underpin large-effect QTLs. Known QTLs over gene families, biosynthetic pathways or certain traits represent functional gene-clusters of genes of the same gene ontology (GO). Gene-clusters containing genes of different GO have not been elaborated, except in silico as coexpressed genes within QTLs. Here we demonstrate the requirement of multiple intra-QTL genes for the full impact of QTL qDTY12.1 on rice yield under drought. Multiple evidences are presented for the need of the transcription factor ‘no apical meristem’ (OsNAM12.1) and its co-localized target genes of separate GO categories for qDTY12.1 function, raising a regulon-like model of genetic architecture. The molecular underpinnings of qDTY12.1 support its effectiveness in further improving a drought tolerant genotype and for its validity in multiple genotypes/ecosystems/environments. Resolving the combinatorial value of OsNAM12.1 with individual intra-QTL genes notwithstanding, identification and analyses of qDTY12.1has fast-tracked rice improvement towards food security. PMID:26507552

  3. Identification of Variants in RET and IHH Pathway Members in a Large Family With History of Hirschsprung Disease.

    Science.gov (United States)

    Sribudiani, Y; Chauhan, R K; Alves, M M; Petrova, L; Brosens, E; Harrison, C; Wabbersen, T; de Graaf, B M; Rügenbrink, T; Burzynski, G; Brouwer, R W W; IJcken, W F J van; Maas, S M; de Klein, A; Osinga, J; Eggen, B J L; Burns, A J; Brooks, A S; Shepherd, I T; Hofstra, R M W

    2018-03-27

    Hirschsprung disease (HSCR) is an inherited congenital disorder characterized by absence of enteric ganglia in the distal part of the gut. Variants in ret proto-oncogene (RET) have been associated with up to 50% of familial and 35% of sporadic cases. We searched for variants that affect disease risk in a large, multi-generational family with history of HSCR in a linkage region previously associated with the disease (4q31.3-q32.3) and exome wide. We performed exome sequencing analyses of a family in the Netherlands with 5 members diagnosed with HSCR and 2 members diagnosed with functional constipation. We initially focused on variants in genes located in 4q31.3-q32.3. However, we also performed an exome-wide analysis in which known HSCR or HSCR-associated gene variants predicted to be deleterious were prioritized for further analysis. Candidate genes were expressed in HEK293, COS-7, and Neuro-2a cells and analyzed by luciferase and immunoblot assays. Morpholinos were designed to target exons of candidate genes and injected into 1-cell stage zebrafish embryos. Embryos were allowed to develop and stained for enteric neurons. Within the linkage region, we identified 1 putative splice variant in the LPS responsive beige-like anchor protein gene (LRBA). Functional assays could not confirm its predicted effect on mRNA splicing or on expression of the mab-21 like 2 gene (MAB21L2), which is embedded in LRBA. Zebrafish that developed following injection of the lrba morpholino had a shortened body axis and subtle gut morphological defects, but no significant reduction in number of enteric neurons compared with controls. Outside the linkage region, members of 1 branch of the family carried a previously unidentified RET variant or an in-frame deletion in the glial cell line derived neurotrophic factor gene (GDNF), which encodes a ligand of RET. This deletion was located 6 base pairs before the last codon. We also found variants in the indian hedgehog gene (IHH) and its mediator

  4. The IQD gene family in soybean: structure, phylogeny, evolution and expression.

    Directory of Open Access Journals (Sweden)

    Lin Feng

    Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

  5. Translational repression of the cpw-wpc gene family in the malaria parasite Plasmodium

    KAUST Repository

    Rao, Pavitra N.

    2016-06-14

    The technical challenges of working with the sexual stages of the malaria parasite Plasmodium have hindered the characterization of sexual stage antigens in the quest for a successful malaria transmission-blocking vaccine. One such predicted and largely uncharacterized group of sexual stage candidate antigens is the CPW-WPC family of proteins. CPW-WPC proteins are named for a characteristic domain that contains two conserved motifs, CPxxW and WPC. Conserved across Apicomplexa, this family is also present earlier in the Alveolata in the free-living, non-parasitophorous, photosynthetic chromerids, Chromera and Vitrella. In P. falciparum and P. berghei blood stage parasites the transcripts of all nine cpw-wpc genes have been detected in gametocytes. RNA immunoprecipitation followed by reverse transcriptase-PCR reveals all P. berghei cpw-wpc transcripts to be bound by the translational repressors DOZI and CITH, and thus are likely under translational control prior to transmission from the rodent host to the mosquito vector in P. berghei. The GFP tagging of two endogenous P. berghei genes confirmed translational silencing in the gametocyte and translation in ookinetes. Establishing a luciferase transgene assay we show that the 3′ untranslated region of PF3D7_1331400 controls protein expression of this reporter in P. falciparum gametocytes. Our analyses suggest that cpw-wpc genes are translationally silenced in gametocytes across Plasmodium spp. and activated during ookinete formation and thus may have a role in transmission to the mosquito.

  6. Mapping of Wnt-Frizzled interactions by multiplex CRISPR targeting of receptor gene families.

    Science.gov (United States)

    Voloshanenko, Oksana; Gmach, Philipp; Winter, Jan; Kranz, Dominique; Boutros, Michael

    2017-11-01

    Signaling pathway modules are often encoded by several closely related paralogous genes that can have redundant roles and are therefore difficult to analyze by loss-of-function analysis. A typical example is the Wnt signaling pathway, which in mammals is mediated by 19 Wnt ligands that can bind to 10 Frizzled (FZD) receptors. Although significant progress in understanding Wnt-FZD receptor interactions has been made in recent years, tools to generate systematic interaction maps have been largely lacking. Here we generated cell lines with multiplex mutant alleles of FZD1 , FZD2 , and FZD7 and demonstrate that these cells are unresponsive to canonical Wnt ligands. Subsequently, we performed genetic rescue experiments with combinations of FZDs and canonical Wnts to create a functional ligand-receptor interaction map. These experiments showed that whereas several Wnt ligands, such as Wnt3a, induce signaling through a broad spectrum of FZD receptors, others, such as Wnt8a, act through a restricted set of FZD genes. Together, our results map functional interactions of FZDs and 10 Wnt ligands and demonstrate how multiplex targeting by clustered regularly interspaced short palindromic repeat (CRISPR)/Cas9 can be used to systematically elucidate the functions of multigene families.-Voloshanenko, O., Gmach, P., Winter, J., Kranz, D., Boutros, M. Mapping of Wnt-Frizzled interactions by multiplex CRISPR targeting of receptor gene families. © The Author(s).

  7. Translational repression of the cpw-wpc gene family in the malaria parasite Plasmodium

    KAUST Repository

    Rao, Pavitra N.; Santos, Jorge M.; Pain, Arnab; Templeton, Thomas J.; Mair, Gunnar R.

    2016-01-01

    The technical challenges of working with the sexual stages of the malaria parasite Plasmodium have hindered the characterization of sexual stage antigens in the quest for a successful malaria transmission-blocking vaccine. One such predicted and largely uncharacterized group of sexual stage candidate antigens is the CPW-WPC family of proteins. CPW-WPC proteins are named for a characteristic domain that contains two conserved motifs, CPxxW and WPC. Conserved across Apicomplexa, this family is also present earlier in the Alveolata in the free-living, non-parasitophorous, photosynthetic chromerids, Chromera and Vitrella. In P. falciparum and P. berghei blood stage parasites the transcripts of all nine cpw-wpc genes have been detected in gametocytes. RNA immunoprecipitation followed by reverse transcriptase-PCR reveals all P. berghei cpw-wpc transcripts to be bound by the translational repressors DOZI and CITH, and thus are likely under translational control prior to transmission from the rodent host to the mosquito vector in P. berghei. The GFP tagging of two endogenous P. berghei genes confirmed translational silencing in the gametocyte and translation in ookinetes. Establishing a luciferase transgene assay we show that the 3′ untranslated region of PF3D7_1331400 controls protein expression of this reporter in P. falciparum gametocytes. Our analyses suggest that cpw-wpc genes are translationally silenced in gametocytes across Plasmodium spp. and activated during ookinete formation and thus may have a role in transmission to the mosquito.

  8. Large-scale deletions of the ABCA1 gene in patients with hypoalphalipoproteinemia.

    Science.gov (United States)

    Dron, Jacqueline S; Wang, Jian; Berberich, Amanda J; Iacocca, Michael A; Cao, Henian; Yang, Ping; Knoll, Joan; Tremblay, Karine; Brisson, Diane; Netzer, Christian; Gouni-Berthold, Ioanna; Gaudet, Daniel; Hegele, Robert A

    2018-06-04

    Copy-number variations (CNVs) have been studied in the context of familial hypercholesterolemia but have not yet been evaluated in patients with extremes of high-density lipoprotein (HDL) cholesterol levels. We evaluated targeted next-generation sequencing data from patients with very low HDL cholesterol (i.e. hypoalphalipoproteinemia) using the VarSeq-CNV caller algorithm to screen for CNVs disrupting the ABCA1, LCAT or APOA1 genes. In four individuals, we found three unique deletions in ABCA1: a heterozygous deletion of exon 4, a heterozygous deletion spanning exons 8 to 31, and a heterozygous deletion of the entire ABCA1 gene. Breakpoints were identified using Sanger sequencing, and the full-gene deletion was also confirmed using exome sequencing and the Affymetrix CytoScanTM HD Array. Before now, large-scale deletions in candidate HDL genes have not been associated with hypoalphalipoproteinemia; our findings indicate that CNVs in ABCA1 may be a previously unappreciated genetic determinant of low HDL cholesterol levels. By coupling bioinformatic analyses with next-generation sequencing data, we can successfully assess the spectrum of genetic determinants of many dyslipidemias, now including hypoalphalipoproteinemia. Published under license by The American Society for Biochemistry and Molecular Biology, Inc.

  9. Diagnostic Yield of Sequencing Familial Hypercholesterolemia Genes in Severe Hypercholesterolemia

    Science.gov (United States)

    Khera, Amit V.; Won, Hong-Hee; Peloso, Gina M.; Lawson, Kim S.; Bartz, Traci M.; Deng, Xuan; van Leeuwen, Elisabeth M.; Natarajan, Pradeep; Emdin, Connor A.; Bick, Alexander G.; Morrison, Alanna C.; Brody, Jennifer A.; Gupta, Namrata; Nomura, Akihiro; Kessler, Thorsten; Duga, Stefano; Bis, Joshua C.; van Duijn, Cornelia M.; Cupples, L. Adrienne; Psaty, Bruce; Rader, Daniel J.; Danesh, John; Schunkert, Heribert; McPherson, Ruth; Farrall, Martin; Watkins, Hugh; Lander, Eric; Wilson, James G.; Correa, Adolfo; Boerwinkle, Eric; Merlini, Piera Angelica; Ardissino, Diego; Saleheen, Danish; Gabriel, Stacey; Kathiresan, Sekar

    2017-01-01

    Background About 7% of US adults have severe hypercholesterolemia (untreated LDL cholesterol ≥190 mg/dl). Such high LDL levels may be due to familial hypercholesterolemia (FH), a condition caused by a single mutation in any of three genes. Lifelong elevations in LDL cholesterol in FH mutation carriers may confer CAD risk beyond that captured by a single LDL cholesterol measurement. Objectives Assess the prevalence of a FH mutation among those with severe hypercholesterolemia and determine whether CAD risk varies according to mutation status beyond the observed LDL cholesterol. Methods Three genes causative for FH (LDLR, APOB, PCSK9) were sequenced in 26,025 participants from 7 case-control studies (5,540 CAD cases, 8,577 CAD-free controls) and 5 prospective cohort studies (11,908 participants). FH mutations included loss-of-function variants in LDLR, missense mutations in LDLR predicted to be damaging, and variants linked to FH in ClinVar, a clinical genetics database. Results Among 8,577 CAD-free control participants, 430 had LDL cholesterol ≥190 mg/dl; of these, only eight (1.9%) carried a FH mutation. Similarly, among 11,908 participants from 5 prospective cohorts, 956 had LDL cholesterol ≥190 mg/dl and of these, only 16 (1.7%) carried a FH mutation. Within any stratum of observed LDL cholesterol, risk of CAD was higher among FH mutation carriers when compared with non-carriers. When compared to a reference group with LDL cholesterol <130 mg/dl and no mutation, participants with LDL cholesterol ≥190 mg/dl and no FH mutation had six-fold higher risk for CAD (OR 6.0; 95%CI 5.2–6.9) whereas those with LDL cholesterol ≥190 mg/dl as well as a FH mutation demonstrated twenty-two fold increased risk (OR 22.3; 95%CI 10.7–53.2). Conclusions Among individuals with LDL cholesterol ≥190 mg/dl, gene sequencing identified a FH mutation in <2%. However, for any given observed LDL cholesterol, FH mutation carriers are at substantially increased risk for CAD

  10. Transcriptome profiling in conifers and the PiceaGenExpress database show patterns of diversification within gene families and interspecific conservation in vascular gene expression

    Directory of Open Access Journals (Sweden)

    Raherison Elie

    2012-08-01

    Full Text Available Abstract Background Conifers have very large genomes (13 to 30 Gigabases that are mostly uncharacterized although extensive cDNA resources have recently become available. This report presents a global overview of transcriptome variation in a conifer tree and documents conservation and diversity of gene expression patterns among major vegetative tissues. Results An oligonucleotide microarray was developed from Picea glauca and P. sitchensis cDNA datasets. It represents 23,853 unique genes and was shown to be suitable for transcriptome profiling in several species. A comparison of secondary xylem and phelloderm tissues showed that preferential expression in these vascular tissues was highly conserved among Picea spp. RNA-Sequencing strongly confirmed tissue preferential expression and provided a robust validation of the microarray design. A small database of transcription profiles called PiceaGenExpress was developed from over 150 hybridizations spanning eight major tissue types. In total, transcripts were detected for 92% of the genes on the microarray, in at least one tissue. Non-annotated genes were predominantly expressed at low levels in fewer tissues than genes of known or predicted function. Diversity of expression within gene families may be rapidly assessed from PiceaGenExpress. In conifer trees, dehydrins and late embryogenesis abundant (LEA osmotic regulation proteins occur in large gene families compared to angiosperms. Strong contrasts and low diversity was observed in the dehydrin family, while diverse patterns suggested a greater degree of diversification among LEAs. Conclusion Together, the oligonucleotide microarray and the PiceaGenExpress database represent the first resource of this kind for gymnosperm plants. The spruce transcriptome analysis reported here is expected to accelerate genetic studies in the large and important group comprised of conifer trees.

  11. A large deletion in GPR98 causes type IIC Usher syndrome in male and female members of an Iranian family.

    Science.gov (United States)

    Hilgert, N; Kahrizi, K; Dieltjens, N; Bazazzadegan, N; Najmabadi, H; Smith, R J H; Van Camp, G

    2009-04-01

    Usher syndrome (USH) is a clinically and genetically heterogeneous disease. The three recognised clinical phenotypes (types I, II and III; USH1, USH2 and USH3) are caused by mutations in nine different genes. USH2C is characterised by moderate to severe hearing loss, retinitis pigmentosa and normal vestibular function. One earlier report describes mutations in GPR98 (VLGR1) in four families segregating this phenotype. To detect the disease-causing mutation in an Iranian family segregating USH2C. In this family, five members had a phenotype compatible with Usher syndrome, and two others had nonsyndromic hearing loss. Mutation analysis of all 90 coding exons of GPR98. Consistent with these clinical findings, the five subjects with USH carried a haplotype linked to the USH2C locus, whereas the two subjects with nonsyndromic hearing loss did not. We identified a new mutation in GPR98 segregating with USH2C in this family. The mutation is a large deletion g.371657_507673del of exons 84 and 85, presumably leading to a frameshift. A large GPR98 deletion of 136 017 bp segregates with USH2C in an Iranian family. To our knowledge, this is only the second report of a GPR98 mutation, and the first report on male subjects with USH2C and a GPR98 mutation.

  12. Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

    Directory of Open Access Journals (Sweden)

    Gadagkar Sudhindra R

    2010-04-01

    Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions

  13. Search for intracranial aneurysm susceptibility gene(s using Finnish families

    Directory of Open Access Journals (Sweden)

    Ryynänen Markku

    2002-08-01

    Full Text Available Abstract Background Cerebrovascular disease is the third leading cause of death in the United States, and about one-fourth of cerebrovascular deaths are attributed to ruptured intracranial aneurysms (IA. Epidemiological evidence suggests that IAs cluster in families, and are therefore probably genetic. Identification of individuals at risk for developing IAs by genetic tests will allow concentration of diagnostic imaging on high-risk individuals. We used model-free linkage analysis based on allele sharing with a two-stage design for a genome-wide scan to identify chromosomal regions that may harbor IA loci. Methods We previously estimated sibling relative risk in the Finnish population at between 9 and 16, and proceeded with a genome-wide scan for loci predisposing to IA. In 85 Finnish families with two or more affected members, 48 affected sibling pairs (ASPs were available for our genetic study. Power calculations indicated that 48 ASPs were adequate to identify chromosomal regions likely to harbor predisposing genes and that a liberal stage I lod score threshold of 0.8 provided a reasonable balance between detection of false positive regions and failure to detect real loci with moderate effect. Results Seven chromosomal regions exceeded the stage I lod score threshold of 0.8 and five exceeded 1.0. The most significant region, on chromosome 19q, had a maximum multipoint lod score (MLS of 2.6. Conclusions Our study provides evidence for the locations of genes predisposing to IA. Further studies are necessary to elucidate the genes and their role in the pathophysiology of IA, and to design genetic tests.

  14. Fast and simple protein-alignment-guided assembly of orthologous gene families from microbiome sequencing reads.

    Science.gov (United States)

    Huson, Daniel H; Tappu, Rewati; Bazinet, Adam L; Xie, Chao; Cummings, Michael P; Nieselt, Kay; Williams, Rohan

    2017-01-25

    Microbiome sequencing projects typically collect tens of millions of short reads per sample. Depending on the goals of the project, the short reads can either be subjected to direct sequence analysis or be assembled into longer contigs. The assembly of whole genomes from metagenomic sequencing reads is a very difficult problem. However, for some questions, only specific genes of interest need to be assembled. This is then a gene-centric assembly where the goal is to assemble reads into contigs for a family of orthologous genes. We present a new method for performing gene-centric assembly, called protein-alignment-guided assembly, and provide an implementation in our metagenome analysis tool MEGAN. Genes are assembled on the fly, based on the alignment of all reads against a protein reference database such as NCBI-nr. Specifically, the user selects a gene family based on a classification such as KEGG and all reads binned to that gene family are assembled. Using published synthetic community metagenome sequencing reads and a set of 41 gene families, we show that the performance of this approach compares favorably with that of full-featured assemblers and that of a recently published HMM-based gene-centric assembler, both in terms of the number of reference genes detected and of the percentage of reference sequence covered. Protein-alignment-guided assembly of orthologous gene families complements whole-metagenome assembly in a new and very useful way.

  15. Study on superhigh energy γ-ray family events with large-scale Fe emulsion chambers

    International Nuclear Information System (INIS)

    Ren Jingru; Lu Suiling; Su Shi

    1990-01-01

    Using a large-scale iron emulsion chamber, a big γ-ray family event with observed energy ΣE r = 7631 TeV was obtained. This paper described the advantages of iron emulsion chamber for studying big families and the characteristics of the event observed, together with a comparison with the Monte-Carlo simulation results

  16. Clinical Polymorphism of Stargardt Disease in a Large Consanguineous Tunisian Family; Implications for Nosology

    Directory of Open Access Journals (Sweden)

    Leila El Matri

    2013-01-01

    Full Text Available Purpose: To describe the polymorphic expression of Stargardt disease in a large Tunisian family with clinical intra- and interfamilial variation of the condition. Methods: Twelve subjects from two related families with autosomal recessive Stargardt disease were enrolled. A detailed clinical examination including visual acuity and visual field measurement, fundus photography, fluorescein angiography, electroretinography (ERG and color vision testing was performed for all subjects. Results: The youngest child from family A manifested typical Stargardt disease while her two brothers presented with Stargardt disease-fundus flavimaculatus (STGD-FFM and her two sisters demonstrated a peculiar phenotype overlapping Stargardt disease and cone-rod dystrophy; their phenotypic manifestation corresponded well with ERG groups I, II and III, respectively. This uncommon occurrence of an age-related decline in ERG amplitude and worsening of fundus changes is suggestive of a grading pattern in Stargardt disease. Their two cousins in family B, displayed the STGD-FFM phenotype. Despite clinically similar STGD-FFM patterns in both families, age of onset and progression of the phenotype in family B differed from family A. Conclusion: This is the first report on phenotypic variation of Stargardt disease in a large Tunisian family. Regarding phenotype and severity of visual symptoms, family A demonstrated Stargardt disease at various stages of progression. In addition, STGDFFM appeared to be an independent clinical entity in family B. These findings imply that further parameters are required to classify Stargardt′s disease.

  17. The analysis of a large Danish family supports the presence of a susceptibility locus for adenoma and colorectal cancer on chromosome 11q24

    DEFF Research Database (Denmark)

    Rudkjøbing, Laura Aviaja; Eiberg, Hans; Mikkelsen, Hanne Birte

    2015-01-01

    Hereditary colorectal cancer accounts for approximately 30 % of all colorectal cancers, but currently only 5 % of these families can be explained by highly penetrant, inherited mutations. In the remaining 25 % it is not possible to perform a gene test to identify the family members who would...... benefit from prophylactic screening. Consequently, all family members are asked to follow a screening program. The purpose of this study was to localize a new gene which causes colorectal cancer. We performed a linkage analysis using data from a SNP6.0 chip in one large family with 12 affected family...... areas on chromosome 2 and chromosome 11 with the highest possible LOD scores of 2.6. Two other studies have identified 11q24 as a candidate area for colorectal cancer susceptibility and this area is supported by our results....

  18. Molecular analysis of the NDP gene in two families with Norrie disease.

    Science.gov (United States)

    Rivera-Vega, M Refugio; Chiñas-Lopez, Silvet; Vaca, Ana Luisa Jimenez; Arenas-Sordo, M Luz; Kofman-Alfaro, Susana; Messina-Baas, Olga; Cuevas-Covarrubias, Sergio Alberto

    2005-04-01

    To describe the molecular defects in the Norrie disease protein (NDP) gene in two families with Norrie disease (ND). We analysed two families with ND at molecular level through polymerase chain reaction, DNA sequence analysis and GeneScan. Two molecular defects found in the NDP gene were: a missense mutation (265C > G) within codon 97 that resulted in the interchange of arginine by proline, and a partial deletion in the untranslated 3' region of exon 3 of the NDP gene. Clinical findings were more severe in the family that presented the partial deletion. We also diagnosed the carrier status of one daughter through GeneScan; this method proved to be a useful tool for establishing female carriers of ND. Here we report two novel mutations in the NDP gene in Mexican patients and propose that GeneScan is a viable mean of establishing ND carrier status.

  19. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    to efficiently search for and identify gene families. The FGF output displays the results as visual phylogenetic trees including information on gene structure, chromosome position, duplication fate and selective pressure. It is particularly useful to identify pseudogenes and detect changes in gene structure. FGF...

  20. FGF: A web tool for Fishing Gene Family in a whole genome database

    DEFF Research Database (Denmark)

    Zheng, Hongkun; Shi, Junjie; Fang, Xiaodong

    2007-01-01

    Gene duplication is an important process in evolution. The availability of genome sequences of a number of organisms has made it possible to conduct comprehensive searches for duplicated genes enabling informative studies of their evolution. We have established the FGF (Fishing Gene Family) progr...... is freely available on a web server at http://fgf.genomics.org.cn/...

  1. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  2. Multiple independent insertions of 5S rRNA genes in the spliced-leader gene family of trypanosome species.

    Science.gov (United States)

    Beauparlant, Marc A; Drouin, Guy

    2014-02-01

    Analyses of the 5S rRNA genes found in the spliced-leader (SL) gene repeat units of numerous trypanosome species suggest that such linkages were not inherited from a common ancestor, but were the result of independent 5S rRNA gene insertions. In trypanosomes, 5S rRNA genes are found either in the tandemly repeated units coding for SL genes or in independent tandemly repeated units. Given that trypanosome species where 5S rRNA genes are within the tandemly repeated units coding for SL genes are phylogenetically related, one might hypothesize that this arrangement is the result of an ancestral insertion of 5S rRNA genes into the tandemly repeated SL gene family of trypanosomes. Here, we use the types of 5S rRNA genes found associated with SL genes, the flanking regions of the inserted 5S rRNA genes and the position of these insertions to show that most of the 5S rRNA genes found within SL gene repeat units of trypanosome species were not acquired from a common ancestor but are the results of independent insertions. These multiple 5S rRNA genes insertion events in trypanosomes are likely the result of frequent founder events in different hosts and/or geographical locations in species having short generation times.

  3. Molecular evolution of the actin-like MreB protein gene family in wall-less bacteria.

    Science.gov (United States)

    Ku, Chuan; Lo, Wen-Sui; Kuo, Chih-Horng

    2014-04-18

    The mreB gene family encodes actin-like proteins that determine cell shape by directing cell wall synthesis and often exists in one to three copies in the genomes of non-spherical bacteria. Intriguingly, while most wall-less bacteria do not have this gene, five to seven mreB homologs are found in Spiroplasma and Haloplasma, which are both characterized by cell contractility. To investigate the molecular evolution of this gene family in wall-less bacteria, we sampled the available genome sequences from these two genera and other related lineages for comparative analysis. The gene phylogenies indicated that the mreB homologs in Haloplasma are more closely related to those in Firmicutes, whereas those in Spiroplasma form a separate clade. This finding suggests that the gene family expansions in these two lineages are the results of independent ancient duplications. Moreover, the Spiroplasma mreB homologs can be classified into five clades, of which the genomic positions are largely conserved. The inference of gene gains and losses suggests that there has been an overall trend to retain only one homolog from each of the five mreB clades in the evolutionary history of Spiroplasma. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.

  4. A large-scale benchmark of gene prioritization methods.

    Science.gov (United States)

    Guala, Dimitri; Sonnhammer, Erik L L

    2017-04-21

    In order to maximize the use of results from high-throughput experimental studies, e.g. GWAS, for identification and diagnostics of new disease-associated genes, it is important to have properly analyzed and benchmarked gene prioritization tools. While prospective benchmarks are underpowered to provide statistically significant results in their attempt to differentiate the performance of gene prioritization tools, a strategy for retrospective benchmarking has been missing, and new tools usually only provide internal validations. The Gene Ontology(GO) contains genes clustered around annotation terms. This intrinsic property of GO can be utilized in construction of robust benchmarks, objective to the problem domain. We demonstrate how this can be achieved for network-based gene prioritization tools, utilizing the FunCoup network. We use cross-validation and a set of appropriate performance measures to compare state-of-the-art gene prioritization algorithms: three based on network diffusion, NetRank and two implementations of Random Walk with Restart, and MaxLink that utilizes network neighborhood. Our benchmark suite provides a systematic and objective way to compare the multitude of available and future gene prioritization tools, enabling researchers to select the best gene prioritization tool for the task at hand, and helping to guide the development of more accurate methods.

  5. Gender in childhood obesity: family environment, hormones, and genes.

    Science.gov (United States)

    Wisniewski, Amy B; Chernausek, Steven D

    2009-01-01

    The prevalence of obesity among children in the United States represents a pool of latent morbidity. Though the prevalence of obesity has increased in both boys and girls, the causes and consequences differ between the sexes. Thus, interventions proposed to treat and prevent childhood obesity will need to account for these differences. This review examines gender differences in the presentation of obesity in children and describes environmental, hormonal, and genetic factors that contribute to observed gender differences. A search of peer-reviewed, published literature was performed with PubMed for articles published from January 1974 through October 2008. Search terms used were obesity, sex, gender, hormones, family environment, body composition, adiposity, and genes. Studies of children aged 0 to 18 years were included, and only articles published in English were reviewed for consideration. Articles that illustrated gender differences in either the presentation or underlying mechanisms of obesity in children were reviewed for content, and their bibliographies were used to identify other relevant literature. Gender differences in childhood obesity have been understudied partially because of how we define the categories of overweight and obesity. Close examination of studies revealed that gender differences were common, both before and during puberty. Boys and girls differ in body composition, patterns of weight gain, hormone biology, and the susceptibility to certain social, ethnic, genetic, and environmental factors. Our understanding of how gender differences in pediatric populations relate to the pathogenesis of obesity and the subsequent development of associated comorbid states is critical to developing and implementing both therapeutic and preventive interventions.

  6. Mutation c.255delA in the PARK2 gene as cause of juvenile Parkinson´s disease in a large Colombian family Una mutación en el gen PARK2 causa enfermedad de Parkinson juvenil en una extensa familia colombiana

    Directory of Open Access Journals (Sweden)

    Nicolas Pineda Trujillo

    2009-05-01

    -hansi-theme-font:minor-latin; mso-bidi-font-family:"Times New Roman"; mso-bidi-theme-font:minor-bidi; mso-fareast-language:EN-US;} .MsoPapDefault {mso-style-type:export-only; margin-bottom:10.0pt; line-height:115%;} @page Section1 {size:612.0pt 792.0pt; margin:70.85pt 3.0cm 70.85pt 3.0cm; mso-header-margin:36.0pt; mso-footer-margin:36.0pt; mso-paper-source:0;} div.Section1 {page:Section1;} -->

    family: ";Times New Roman";,";serif";;" lang="EN-US">Parkinson´s is a common disease (PD caused by degeneration of dopaminergic neurons in the substantia nigra and other brain areas. Several genes and mutations have been mplicated in its pathogenesis, the latter have been identified mainly in the PARK2 gene.

    family: ";Times New Roman";,";serif";;" lang="EN-US">We report the evaluation of this gene and of its flanking region in a large family from the southwestern part of Colombia. The parents are first cousins and four out of their ten children were affected at juvenile age.

  7. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi

    2007-11-01

    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  8. Malaysia: where big is still better. For Malays, large families are part of the plan.

    Science.gov (United States)

    1993-11-03

    The benefits of various-sized families in Malaysia were discussed by several women and supplemented with official statements on family planning (FP). The Director of the National Population and Family Development, Dr. Raj Karim, advised that maternal health is jeopardized when women have more than five children. About 30% of reproductive age women in Malaysia have five or more children. A Federation of FP Associations spokesperson agreed that women should be advised of the dangers of bearing over five children, of the importance of spacing births two to four years apart, and of the ideal age of childbearing (21-39 years). The government lacks an official policy on family size. The government position is, however, compatible with Islamic teachings on spacing in order to protect the health of the mother and child. Islamic law does not permit sterilization or abortion. The "fatwas" of Islamic teaching may have been misconstrued by those not using any form of contraception. Dr. Karim, who has five children, reported that having a large family can be difficult for a woman with a job, a career, and a husband or when both parents work. Most Malays desire large families. The average Malay family size was 4.1 children in 1990; Malaysian Chinese have fertility of 2.3 children and Malaysian Indians have 2.6 children. People say that the benefits outweigh the hardships of a large family.

  9. Large-scale event extraction from literature with multi-level gene normalization.

    Directory of Open Access Journals (Sweden)

    Sofie Van Landeghem

    Full Text Available Text mining for the life sciences aims to aid database curation, knowledge summarization and information retrieval through the automated processing of biomedical texts. To provide comprehensive coverage and enable full integration with existing biomolecular database records, it is crucial that text mining tools scale up to millions of articles and that their analyses can be unambiguously linked to information recorded in resources such as UniProt, KEGG, BioGRID and NCBI databases. In this study, we investigate how fully automated text mining of complex biomolecular events can be augmented with a normalization strategy that identifies biological concepts in text, mapping them to identifiers at varying levels of granularity, ranging from canonicalized symbols to unique gene and proteins and broad gene families. To this end, we have combined two state-of-the-art text mining components, previously evaluated on two community-wide challenges, and have extended and improved upon these methods by exploiting their complementary nature. Using these systems, we perform normalization and event extraction to create a large-scale resource that is publicly available, unique in semantic scope, and covers all 21.9 million PubMed abstracts and 460 thousand PubMed Central open access full-text articles. This dataset contains 40 million biomolecular events involving 76 million gene/protein mentions, linked to 122 thousand distinct genes from 5032 species across the full taxonomic tree. Detailed evaluations and analyses reveal promising results for application of this data in database and pathway curation efforts. The main software components used in this study are released under an open-source license. Further, the resulting dataset is freely accessible through a novel API, providing programmatic and customized access (http://www.evexdb.org/api/v001/. Finally, to allow for large-scale bioinformatic analyses, the entire resource is available for bulk download from

  10. THE DEVELOPMENT OF SERVICES IN THE FIELD OF SOCIAL WORK WITH LARGE FAMILIES

    Directory of Open Access Journals (Sweden)

    Юлія Ібрагім

    2015-09-01

    Full Text Available The development of social services in the field of social work with large families is analyzed and their basic functions are defined in the article. The necessity of implementation of the system of guaranteed social and educational support to families depending on the type of large families, which would be provided by governmental and nongovernmental organizations, including public organizations are considered and analyzed. The statistical data on the number and proportion of large families in Ukraine in general and namely in Kharkiv region are provided. The principle of subsidiarity, which is the basis of the full development of the state and is based on the redistribution of responsibility for the formation of family welfare from the state to the family, and receipt of primary social and pedagogical support of public organizations in case you are unable to solve certain problems is disclosed. The article also presents practical experience in providing social and educational support by public organization Association of large families “AMMA”” in Kharkiv.

  11. Gene Structures, Evolution and Transcriptional Profiling of the WRKY Gene Family in Castor Bean (Ricinus communis L.).

    Science.gov (United States)

    Zou, Zhi; Yang, Lifu; Wang, Danhua; Huang, Qixing; Mo, Yeyong; Xie, Guishui

    2016-01-01

    WRKY proteins comprise one of the largest transcription factor families in plants and form key regulators of many plant processes. This study presents the characterization of 58 WRKY genes from the castor bean (Ricinus communis L., Euphorbiaceae) genome. Compared with the automatic genome annotation, one more WRKY-encoding locus was identified and 20 out of the 57 predicted gene models were manually corrected. All RcWRKY genes were shown to contain at least one intron in their coding sequences. According to the structural features of the present WRKY domains, the identified RcWRKY genes were assigned to three previously defined groups (I-III). Although castor bean underwent no recent whole-genome duplication event like physic nut (Jatropha curcas L., Euphorbiaceae), comparative genomics analysis indicated that one gene loss, one intron loss and one recent proximal duplication occurred in the RcWRKY gene family. The expression of all 58 RcWRKY genes was supported by ESTs and/or RNA sequencing reads derived from roots, leaves, flowers, seeds and endosperms. Further global expression profiles with RNA sequencing data revealed diverse expression patterns among various tissues. Results obtained from this study not only provide valuable information for future functional analysis and utilization of the castor bean WRKY genes, but also provide a useful reference to investigate the gene family expansion and evolution in Euphorbiaceus plants.

  12. Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

    Science.gov (United States)

    Bargsten, Joachim W; Folta, Adam; Mlynárová, Ludmila; Nap, Jan-Peter

    2013-01-01

    As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes). The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

  13. Snf2 family gene distribution in higher plant genomes reveals DRD1 expansion and diversification in the tomato genome.

    Directory of Open Access Journals (Sweden)

    Joachim W Bargsten

    Full Text Available As part of large protein complexes, Snf2 family ATPases are responsible for energy supply during chromatin remodeling, but the precise mechanism of action of many of these proteins is largely unknown. They influence many processes in plants, such as the response to environmental stress. This analysis is the first comprehensive study of Snf2 family ATPases in plants. We here present a comparative analysis of 1159 candidate plant Snf2 genes in 33 complete and annotated plant genomes, including two green algae. The number of Snf2 ATPases shows considerable variation across plant genomes (17-63 genes. The DRD1, Rad5/16 and Snf2 subfamily members occur most often. Detailed analysis of the plant-specific DRD1 subfamily in related plant genomes shows the occurrence of a complex series of evolutionary events. Notably tomato carries unexpected gene expansions of DRD1 gene members. Most of these genes are expressed in tomato, although at low levels and with distinct tissue or organ specificity. In contrast, the Snf2 subfamily genes tend to be expressed constitutively in tomato. The results underpin and extend the Snf2 subfamily classification, which could help to determine the various functional roles of Snf2 ATPases and to target environmental stress tolerance and yield in future breeding.

  14. Undefined familial colorectal cancer and the role of pleiotropism in cancer susceptibility genes.

    Science.gov (United States)

    Dobbins, Sara E; Broderick, Peter; Chubb, Daniel; Kinnersley, Ben; Sherborne, Amy L; Houlston, Richard S

    2016-10-01

    Although family history is a major risk factor for colorectal cancer (CRC) a genetic diagnosis cannot be obtained in over 50 % of familial cases when screened for known CRC cancer susceptibility genes. The genetics of undefined-familial CRC is complex and recent studies have implied additional clinically actionable mutations for CRC in susceptibility genes for other cancers. To clarify the contribution of non-CRC susceptibility genes to undefined-familial CRC we conducted a mutational screen of 114 cancer susceptibility genes in 847 patients with early-onset undefined-familial CRC and 1609 controls by analysing high-coverage exome sequencing data. We implemented American College of Medical Genetics and Genomics standards and guidelines for assigning pathogenicity to variants. Globally across all 114 cancer susceptibility genes no statistically significant enrichment of likely pathogenic variants was shown (6.7 % cases 57/847, 5.3 % controls 85/1609; P = 0.15). Moreover there was no significant enrichment of mutations in genes such as TP53 or BRCA2 which have been proposed for clinical testing in CRC. In conclusion, while we identified genes that may be considered interesting candidates as determinants of CRC risk warranting further research, there is currently scant evidence to support a role for genes other than those responsible for established CRC syndromes in the clinical management of familial CRC.

  15. XLID-Causing Mutations and Associated Genes Challenged in Light of Data From Large-Scale Human Exome Sequencing

    OpenAIRE

    Piton, Amélie; Redin, Claire; Mandel, Jean-Louis

    2013-01-01

    Because of the unbalanced sex ratio (1.3–1.4 to 1) observed in intellectual disability (ID) and the identification of large ID-affected families showing X-linked segregation, much attention has been focused on the genetics of X-linked ID (XLID). Mutations causing monogenic XLID have now been reported in over 100 genes, most of which are commonly included in XLID diagnostic gene panels. Nonetheless, the boundary between true mutations and rare non-disease-causing variants often remains elusive...

  16. Whole Exome Sequencing Reveals Genetic Predisposition in a Large Family with Retinitis Pigmentosa

    Directory of Open Access Journals (Sweden)

    Juan Wu

    2014-01-01

    Full Text Available Next-generation sequencing has become more widely used to reveal genetic defect in monogenic disorders. Retinitis pigmentosa (RP, the leading cause of hereditary blindness worldwide, has been attributed to more than 67 disease-causing genes. Due to the extreme genetic heterogeneity, using general molecular screening alone is inadequate for identifying genetic predispositions in susceptible individuals. In order to identify underlying mutation rapidly, we utilized next-generation sequencing in a four-generation Chinese family with RP. Two affected patients and an unaffected sibling were subjected to whole exome sequencing. Through bioinformatics analysis and direct sequencing confirmation, we identified p.R135W transition in the rhodopsin gene. The mutation was subsequently confirmed to cosegregate with the disease in the family. In this study, our results suggest that whole exome sequencing is a robust method in diagnosing familial hereditary disease.

  17. A novel mutation in the MITF may be digenic with GJB2 mutations in a large Chinese family of Waardenburg syndrome type II.

    Science.gov (United States)

    Yan, Xukun; Zhang, Tianyu; Wang, Zhengmin; Jiang, Yi; Chen, Yan; Wang, Hongyan; Ma, Duan; Wang, Lei; Li, Huawei

    2011-12-20

    Waardenburg syndrome type II (WS2) is associated with syndromic deafness. A subset of WS2, WS2A, accounting for approximately 15% of patients, is attributed to mutations in the microphthalmia-associated transcription factor (MITF) gene. We examined the genetic basis of WS2 in a large Chinese family. All 9 exons of the MITF gene, the single coding exon (exon 2) of the most common hereditary deafness gene GJB2 and the mitochondrial DNA (mtDNA) 12S rRNA were sequenced. A novel heterozygous mutation c.[742_743delAAinsT;746_747delCA] in exon 8 of the MITF gene co-segregates with WS2 in the family. The MITF mutation results in a premature termination codon and a truncated MITF protein with only 247 of the 419 wild type amino acids. The deaf proband had this MITF gene heterozygous mutation as well as a c.[109G>A]+[235delC] compound heterozygous pathogenic mutation in the GJB2 gene. No pathogenic mutation was found in mtDNA 12S rRNA in this family. Thus, a novel compound heterozygous mutation, c.[742_743delAAinsT;746_747delCA] in MITF exon 8 was the key genetic reason for WS2 in this family, and a digenic effect of MITF and GJB2 genes may contribute to deafness of the proband. Copyright © 2011. Published by Elsevier Ltd.

  18. Analysis of Copy Number Variation in the Abp Gene Regions of Two House Mouse Subspecies Suggests Divergence during the Gene Family Expansions.

    Science.gov (United States)

    Pezer, Željka; Chung, Amanda G; Karn, Robert C; Laukaitis, Christina M

    2017-06-01

    The Androgen-binding protein ( Abp ) gene region of the mouse genome contains 64 genes, some encoding pheromones that influence assortative mating between mice from different subspecies. Using CNVnator and quantitative PCR, we explored copy number variation in this gene family in natural populations of Mus musculus domesticus ( Mmd ) and Mus musculus musculus ( Mmm ), two subspecies of house mice that form a narrow hybrid zone in Central Europe. We found that copy number variation in the center of the Abp gene region is very common in wild Mmd , primarily representing the presence/absence of the final duplications described for the mouse genome. Clustering of Mmd individuals based on this variation did not reflect their geographical origin, suggesting no population divergence in the Abp gene cluster. However, copy number variation patterns differ substantially between Mmd and other mouse taxa. Large blocks of Abp genes are absent in Mmm , Mus musculus castaneus and an outgroup, Mus spretus , although with differences in variation and breakpoint locations. Our analysis calls into question the reliance on a reference genome for interpreting the detailed organization of genes in taxa more distant from the Mmd reference genome. The polymorphic nature of the gene family expansion in all four taxa suggests that the number of Abp genes, especially in the central gene region, is not critical to the survival and reproduction of the mouse. However, Abp haplotypes of variable length may serve as a source of raw genetic material for new signals influencing reproductive communication and thus speciation of mice. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  19. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants.

    Science.gov (United States)

    Rawal, H C; Singh, N K; Sharma, T R

    2013-01-01

    Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL) and peroxidase A (POX A) enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula), fruits (Vitis vinifera), cereals (Sorghum bicolor, Zea mays, and Oryza sativa), trees (Populus trichocarpa), and model dicot (Arabidopsis thaliana) and monocot (Brachypodium distachyon) species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  20. Conservation, Divergence, and Genome-Wide Distribution of PAL and POX A Gene Families in Plants

    Directory of Open Access Journals (Sweden)

    H. C. Rawal

    2013-01-01

    Full Text Available Genome-wide identification and phylogenetic and syntenic comparison were performed for the genes responsible for phenylalanine ammonia lyase (PAL and peroxidase A (POX A enzymes in nine plant species representing very diverse groups like legumes (Glycine max and Medicago truncatula, fruits (Vitis vinifera, cereals (Sorghum bicolor, Zea mays, and Oryza sativa, trees (Populus trichocarpa, and model dicot (Arabidopsis thaliana and monocot (Brachypodium distachyon species. A total of 87 and 1045 genes in PAL and POX A gene families, respectively, have been identified in these species. The phylogenetic and syntenic comparison along with motif distributions shows a high degree of conservation of PAL genes, suggesting that these genes may predate monocot/eudicot divergence. The POX A family genes, present in clusters at the subtelomeric regions of chromosomes, might be evolving and expanding with higher rate than the PAL gene family. Our analysis showed that during the expansion of POX A gene family, many groups and subgroups have evolved, resulting in a high level of functional divergence among monocots and dicots. These results will act as a first step toward the understanding of monocot/eudicot evolution and functional characterization of these gene families in the future.

  1. Transcriptional profiling of the human fibrillin/LTBP gene family, key regulators of mesenchymal cell functions

    DEFF Research Database (Denmark)

    Davis, Margaret R.; Andersson, Robin; Severin, Jessica

    2014-01-01

    in the structure of the extracellular matrix and controlling the bioavailability of TGFβ family members. Genes encoding these proteins show differential expression in mesenchymal cell types which synthesize the extracellular matrix. We have investigated the promoter regions of the seven gene family members using...... of the family members were expressed in a range of mesenchymal and other cell types, often associated with use of alternative promoters or transcription start sites within a promoter in different cell types. FBN3 was the lowest expressed gene, and was found only in embryonic and fetal tissues. The different...

  2. The NAC transcription factor family in maritime pine (Pinus Pinaster): molecular regulation of two genes involved in stress responses.

    Science.gov (United States)

    Pascual, Ma Belén; Cánovas, Francisco M; Ávila, Concepción

    2015-10-24

    NAC transcription factors comprise a large plant-specific gene family involved in the regulation of diverse biological processes. Despite the growing number of studies on NAC transcription factors in various species, little information is available about this family in conifers. The goal of this study was to identify the NAC transcription family in maritime pine (Pinus pinaster), to characterize ATAF-like genes in response to various stresses and to study their molecular regulation. We have isolated two maritime pine NAC genes and using a transient expression assay in N. benthamiana leaves estudied the promoter jasmonate response. In this study, we identified 37 NAC genes from maritime pine and classified them into six main subfamilies. The largest group includes 12 sequences corresponding to stress-related genes. Two of these NAC genes, PpNAC2 and PpNAC3, were isolated and their expression profiles were examined at various developmental stages and in response to various types of stress. The expression of both genes was strongly induced by methyl jasmonate (MeJA), mechanical wounding, and high salinity. The promoter regions of these genes were shown to contain cis-elements involved in the stress response and plant hormonal regulation, including E-boxes, which are commonly found in the promoters of genes that respond to jasmonate, and binding sites for bHLH proteins. Using a transient expression assay in N. benthamiana leaves, we found that the promoter of PpNAC3 was rapidly induced upon MeJA treatment, while this response disappeared in plants in which the transcription factor NbbHLH2 was silenced. Our results suggest that PpNAC2 and PpNAC3 encode stress-responsive NAC transcription factors involved in the jasmonate response in pine. Furthermore, these data also suggest that the jasmonate signaling pathway is conserved between angiosperms and gymnosperms. These findings may be useful for engineering stress tolerance in pine via biotechnological approaches.

  3. Saltatory Evolution of the Ectodermal Neural Cortex Gene Family at the Vertebrate Origin

    Science.gov (United States)

    Feiner, Nathalie; Murakami, Yasunori; Breithut, Lisa; Mazan, Sylvie; Meyer, Axel; Kuraku, Shigehiro

    2013-01-01

    The ectodermal neural cortex (ENC) gene family, whose members are implicated in neurogenesis, is part of the kelch repeat superfamily. To date, ENC genes have been identified only in osteichthyans, although other kelch repeat-containing genes are prevalent throughout bilaterians. The lack of elaborate molecular phylogenetic analysis with exhaustive taxon sampling has obscured the possible link of the establishment of this gene family with vertebrate novelties. In this study, we identified ENC homologs in diverse vertebrates by means of database mining and polymerase chain reaction screens. Our analysis revealed that the ENC3 ortholog was lost in the basal eutherian lineage through single-gene deletion and that the triplication between ENC1, -2, and -3 occurred early in vertebrate evolution. Including our original data on the catshark and the zebrafish, our comparison revealed high conservation of the pleiotropic expression pattern of ENC1 and shuffling of expression domains between ENC1, -2, and -3. Compared with many other gene families including developmental key regulators, the ENC gene family is unique in that conventional molecular phylogenetic inference could identify no obvious invertebrate ortholog. This suggests a composite nature of the vertebrate-specific gene repertoire, consisting not only of de novo genes introduced at the vertebrate origin but also of long-standing genes with no apparent invertebrate orthologs. Some of the latter, including the ENC gene family, may be too rapidly evolving to provide sufficient phylogenetic signals marking orthology to their invertebrate counterparts. Such gene families that experienced saltatory evolution likely remain to be explored and might also have contributed to phenotypic evolution of vertebrates. PMID:23843192

  4. CRDB: database of chemosensory receptor gene families in vertebrate.

    Directory of Open Access Journals (Sweden)

    Dong Dong

    Full Text Available Chemosensory receptors (CR are crucial for animals to sense the environmental changes and survive on earth. The emergence of whole-genome sequences provides us an opportunity to identify the entire CR gene repertoires. To completely gain more insight into the evolution of CR genes in vertebrates, we identified the nearly all CR genes in 25 vertebrates using homology-based approaches. Among these CR gene repertoires, nearly half of them were identified for the first time in those previously uncharacterized species, such as the guinea pig, giant panda and elephant, etc. Consistent with previous findings, we found that the numbers of CR genes vary extensively among different species, suggesting an extreme form of 'birth-and-death' evolution. For the purpose of facilitating CR gene analysis, we constructed a database with the goals to provide a resource for CR genes annotation and a web tool for exploring their evolutionary patterns. Besides a search engine for the gene extraction from a specific chromosome region, an easy-to-use phylogenetic analysis tool was also provided to facilitate online phylogeny study of CR genes. Our work can provide a rigorous platform for further study on the evolution of CR genes in vertebrates.

  5. Classification and evolutionary analysis of the basic helix-loop-helix gene family in the green anole lizard, Anolis carolinensis.

    Science.gov (United States)

    Liu, Ake; Wang, Yong; Zhang, Debao; Wang, Xuhua; Song, Huifang; Dang, Chunwang; Yao, Qin; Chen, Keping

    2013-08-01

    Helix-loop-helix (bHLH) proteins play essential regulatory roles in a variety of biological processes. These highly conserved proteins form a large transcription factor superfamily, and are commonly identified in large numbers within animal, plant, and fungal genomes. The bHLH domain has been well studied in many animal species, but has not yet been characterized in non-avian reptiles. In this study, we identified 102 putative bHLH genes in the genome of the green anole lizard, Anolis carolinensis. Based on phylogenetic analysis, these genes were classified into 43 families, with 43, 24, 16, 3, 10, and 3 members assigned into groups A, B, C, D, E, and F, respectively, and 3 members categorized as "orphans". Within-group evolutionary relationships inferred from the phylogenetic analysis were consistent with highly conserved patterns observed for introns and additional domains. Results from phylogenetic analysis of the H/E(spl) family suggest that genome and tandem gene duplications have contributed to this family's expansion. Our classification and evolutionary analysis has provided insights into the evolutionary diversification of animal bHLH genes, and should aid future studies on bHLH protein regulation of key growth and developmental processes.

  6. A shared promoter region suggests a common ancestor for the human VCX/Y, SPANX, and CSAG gene families and the murine CYPT family

    DEFF Research Database (Denmark)

    Hansen, Martin A; Nielsen, John E; Retelska, Dorota

    2008-01-01

    , sequences corresponding to the shared promoter region of the CYPT family were identified at 39 loci. Most loci were located immediately upstream of genes belonging to the VCX/Y, SPANX, or CSAG gene families. Sequence comparison of the loci revealed a conserved CYPT promoter-like (CPL) element featuring TATA...... cell types. The genomic regions harboring the gene families were rich in direct and inverted segmental duplications (SD), which may facilitate gene conversion and rapid evolution. The conserved CPL and the common expression profiles suggest that the human VCX/Y, SPANX, and CSAG2 gene families together......Many testis-specific genes from the sex chromosomes are subject to rapid evolution, which can make it difficult to identify murine genes in the human genome. The murine CYPT gene family includes 15 members, but orthologs were undetectable in the human genome. However, using refined homology search...

  7. Repeat-associated plasticity in the Helicobacter pylori RD gene family.

    Science.gov (United States)

    Shak, Joshua R; Dick, Jonathan J; Meinersmann, Richard J; Perez-Perez, Guillermo I; Blaser, Martin J

    2009-11-01

    The bacterium Helicobacter pylori is remarkable for its ability to persist in the human stomach for decades without provoking sterilizing immunity. Since repetitive DNA can facilitate adaptive genomic flexibility via increased recombination, insertion, and deletion, we searched the genomes of two H. pylori strains for nucleotide repeats. We discovered a family of genes with extensive repetitive DNA that we have termed the H. pylori RD gene family. Each gene of this family is composed of a conserved 3' region, a variable mid-region encoding 7 and 11 amino acid repeats, and a 5' region containing one of two possible alleles. Analysis of five complete genome sequences and PCR genotyping of 42 H. pylori strains revealed extensive variation between strains in the number, location, and arrangement of RD genes. Furthermore, examination of multiple strains isolated from a single subject's stomach revealed intrahost variation in repeat number and composition. Despite prior evidence that the protein products of this gene family are expressed at the bacterial cell surface, enzyme-linked immunosorbent assay and immunoblot studies revealed no consistent seroreactivity to a recombinant RD protein by H. pylori-positive hosts. The pattern of repeats uncovered in the RD gene family appears to reflect slipped-strand mispairing or domain duplication, allowing for redundancy and subsequent diversity in genotype and phenotype. This novel family of hypervariable genes with conserved, repetitive, and allelic domains may represent an important locus for understanding H. pylori persistence in its natural host.

  8. Ancient signals: comparative genomics of plant MAPK and MAPKK gene families

    DEFF Research Database (Denmark)

    Hamel, Louis-Philippe; Nicole, Marie-Claude; Sritubtim, Somrudee

    2006-01-01

    MAPK signal transduction modules play crucial roles in regulating many biological processes in plants, and their components are encoded by highly conserved genes. The recent availability of genome sequences for rice and poplar now makes it possible to examine how well the previously described...... Arabidopsis MAPK and MAPKK gene family structures represent the broader evolutionary situation in plants, and analysis of gene expression data for MPK and MKK genes in all three species allows further refinement of those families, based on functionality. The Arabidopsis MAPK nomenclature appears sufficiently...

  9. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  10. The PIN gene family in cotton (Gossypium hirsutum): genome-wide identification and gene expression analyses during root development and abiotic stress responses.

    Science.gov (United States)

    He, Peng; Zhao, Peng; Wang, Limin; Zhang, Yuzhou; Wang, Xiaosi; Xiao, Hui; Yu, Jianing; Xiao, Guanghui

    2017-07-03

    Cell elongation and expansion are significant contributors to plant growth and morphogenesis, and are often regulated by environmental cues and endogenous hormones. Auxin is one of the most important phytohormones involved in the regulation of plant growth and development and plays key roles in plant cell expansion and elongation. Cotton fiber cells are a model system for studying cell elongation due to their large size. Cotton is also the world's most utilized crop for the production of natural fibers for textile and garment industries, and targeted expression of the IAA biosynthetic gene iaaM increased cotton fiber initiation. Polar auxin transport, mediated by PIN and AUX/LAX proteins, plays a central role in the control of auxin distribution. However, very limited information about PIN-FORMED (PIN) efflux carriers in cotton is known. In this study, 17 PIN-FORMED (PIN) efflux carrier family members were identified in the Gossypium hirsutum (G. hirsutum) genome. We found that PIN1-3 and PIN2 genes originated from the At subgenome were highly expressed in roots. Additionally, evaluation of gene expression patterns indicated that PIN genes are differentially induced by various abiotic stresses. Furthermore, we found that the majority of cotton PIN genes contained auxin (AuxREs) and salicylic acid (SA) responsive elements in their promoter regions were significantly up-regulated by exogenous hormone treatment. Our results provide a comprehensive analysis of the PIN gene family in G. hirsutum, including phylogenetic relationships, chromosomal locations, and gene expression and gene duplication analyses. This study sheds light on the precise roles of PIN genes in cotton root development and in adaption to stress responses.

  11. Evolution of the defensin-like gene family in grass genomes

    Indian Academy of Sciences (India)

    that the DEFL gene family is subjected to purifying selection. However, sliding window analysis .... sorghum from DOE-JGI Community Sequencing Program ..... This work was supported by the National Key Technologies Re- search and ...

  12. Complexity of rice Hsp100 gene family: lessons from rice genome ...

    Indian Academy of Sciences (India)

    Madhu Sudhan

    2007-03-29

    Mar 29, 2007 ... Chaperonins are a class of molecular chaperones found in prokaryotes and in the ... Keywords. Chaperone, gene family, Hsp100, Oryza sativa ..... Sculpting the proteome with AAA+ proteases and disassembly machines; Cell ...

  13. Exclusion of known gene for enamel development in two Brazilian families with amelogenesis imperfecta.

    Science.gov (United States)

    Santos, Maria C L G; Hart, P Suzanne; Ramaswami, Mukundhan; Kanno, Cláudia M; Hart, Thomas C; Line, Sergio R P

    2007-01-31

    Amelogenesis imperfecta (AI) is a genetically heterogeneous group of diseases that result in defective development of tooth enamel. Mutations in several enamel proteins and proteinases have been associated with AI. The object of this study was to evaluate evidence of etiology for the six major candidate gene loci in two Brazilian families with AI. Genomic DNA was obtained from family members and all exons and exon-intron boundaries of the ENAM, AMBN, AMELX, MMP20, KLK4 and Amelotin gene were amplified and sequenced. Each family was also evaluated for linkage to chromosome regions known to contain genes important in enamel development. The present study indicates that the AI in these two families is not caused by any of the known loci for AI or any of the major candidate genes proposed in the literature. These findings indicate extensive genetic heterogeneity for non-syndromic AI.

  14. A family with X-linked anophthalmia: exclusion of SOX3 as a candidate gene.

    Science.gov (United States)

    Slavotinek, Anne; Lee, Stephen S; Hamilton, Steven P

    2005-10-01

    We report on a four-generation family with X-linked anophthalmia in four affected males and show that this family has LOD scores consistent with linkage to Xq27, the third family reported to be linked to the ANOP1 locus. We sequenced the SOX3 gene at Xq27 as a candidate gene for the X-linked anophthalmia based on the high homology of this gene to SOX2, a gene previously mutated in bilateral anophthlamia. However, no amino acid sequence alterations were identified in SOX3. We have improved the definition of the phenotype in males with anophthalmia linked to the ANOP1 locus, as microcephaly, ocular colobomas, and severe renal malformations have not been described in families linked to ANOP1. (c) 2005 Wiley-Liss, Inc.

  15. Genetic heterogeneity in familial exudative vitreoretinopathy; exclusion of the EVR1 locus on chromosome 11q in a large autosomal dominant pedigree.

    Science.gov (United States)

    Bamashmus, M A; Downey, L M; Inglehearn, C F; Gupta, S R; Mansfield, D C

    2000-04-01

    Familial exudative vitreoretinopathy (FEVR) is associated with mutations in the Norrie disease gene in X linked pedigrees and with linkage to the EVR1 locus at 11q13 in autosomal dominant cases. A large autosomal dominant FEVR family was studied, both clinically and by linkage analysis, to determine whether it differed from the known forms of FEVR. Affected members and obligate gene carriers from this family were examined by slit lamp biomicroscopy, indirect ophthalmoscopy, and in some cases fluorescein angiography. Patient DNAs were genotyped for markers at the EVR1 locus on chromosome 11q13. The clinical evaluation in this family is consistent with previous descriptions of FEVR pedigrees, but linkage analysis proves that it has a form of FEVR genetically distinct from the EVR1 locus on 11q. This proves that there are at least three different loci associated with comparable FEVR phenotypes, a situation similar to that existing for many forms of retinal degeneration.

  16. A recurrent G367R mutation in MYOC associated with juvenile open angle glaucoma in a large Chinese family

    Directory of Open Access Journals (Sweden)

    Yi-Hua Yao

    2018-03-01

    Full Text Available AIM: To identify the mutations of MYOC, OPTN, CYP1B1 and WDR36 in a large Chinese family affected by juvenile open angle glaucoma (JOAG. METHODS: Of 114 members of one family were recruited in this study. Blood samples from twelve members of this pedigree were collected for further research. As a control, 100 unrelated subjects were recruited from the same hospital. The exon and flanking intron sequences of candidate genes were amplified using the polymerase chain reaction and direct DNA sequencing. RESULTS: The proband (III:10 was a seventy-three years old woman with binocular JOAG at the age of 31. A recurrent heterozygous mutation (c.1099G>A of MYOC was identified in the three JOAG patients and another suspect. This transition was located in the first base pair of codon 367 (GGA>AGA in exon 3 of MYOC and was predicted to be a missense substitution of glycine to arginine (p.G367R in myocilin. Mutations in OPTN, CYP1B1 or WDR36 were not detected in this study. The G367R mutation was not present in unaffected family members or in 100 ethnically matched controls. Other variants of the coding regions of candidate genes were not detected in all participants. To date, this family was the largest to have been identified as carrying a certain MYOC mutation in China, further evidence of a founder effect for the G367R MYOC mutant was provided by our data. CONCLUSION: A MYOC c.1099G>A mutation in an autosomal dominant JOAG family is identified and the characteristic phenotypes among the patients are summarized. Genetic testing could be utilized in high-risk populations and be helpful not only for genetic counseling, but also for early diagnosis and treatment of affected patients or carriers of inherited JOAG.

  17. "It's good to know": experiences of gene identification and result disclosure in familial epilepsies.

    Science.gov (United States)

    Vears, Danya F; Dunn, Karen L; Wake, Samantha A; Scheffer, Ingrid E

    2015-05-01

    Recognition of the role of genetics in the epilepsies has increased dramatically, impacting on clinical practice across many epilepsy syndromes. There is limited research investigating the impact of gene identification on individuals and families with epilepsy. While research has focused on the impact of delivering genetic information to families at the time of diagnosis in genetic diseases more broadly, little is known about how genetic results in epileptic diseases influences people's lives many years after it has been conveyed. This study used qualitative methods to explore the experience of receiving a genetic result in people with familial epilepsy. Interviews were conducted with individuals with familial epilepsies in whom the underlying genetic mutation had been identified. Recorded interviews underwent thematic analysis. 20 individuals from three families with different epilepsy syndromes and causative genes were interviewed. Multiple generations within families were studied. The mean time from receiving the genetic result prior to interview was 10.9 years (range 5-14 years). Three major themes were identified: 1) living with epilepsy: an individual's experience of the severity of epilepsy in their family influenced their view. 2) Clinical utility of the test: participants expressed varying reactions to receiving a genetic result. While for some it provided helpful information and relief, others were not surprised by the finding given the familial context. Some valued the use of genetic information for reproductive decision-making, particularly in the setting of severely affected family members. While altruistic reasons for participating in genetic research were discussed, participants emphasised the benefit of participation to them and their families. 3) 'Talking about the family genes': individuals reported poor communication between family members about their epilepsy and its genetic implications. The results provide important insights into the family

  18. A large pericardial effusion and bilateral pleural effusions as the initial manifestations of Familial Mediterranean Fever

    OpenAIRE

    Schembri, Emma Louise; Mifsud, Simon; Cassar Demarco, Daniela; Coleiro, Bernard; Mallia, Carmel

    2015-01-01

    Familial Mediterranean Fever (FMF) is a condition characterized by recurrent febrile poly-serositis. Typical presentations of the disease include episodes of fever, abdominal pain and joint pains. Chest pain is a less common presentation. We report a case of FMF which presented with a large pericardial effusion and bilateral pleural effusions in a lady who had no positive family history and negative genetic testing.

  19. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.).

    Science.gov (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui

    2015-09-01

    In higher plants, sucrose synthase (Sus, EC 2.4.1.13) is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  20. Gene-Environment Interplay, Family Relationships, and Child Adjustment

    Science.gov (United States)

    Horwitz, Briana N.; Neiderhiser, Jenae M.

    2011-01-01

    This paper reviews behavioral genetic research from the past decade that has moved beyond simply studying the independent influences of genes and environments. The studies considered in this review have instead focused on understanding gene-environment interplay, including genotype-environment correlation (rGE) and genotype x environment…

  1. Identification and analysis of YELLOW protein family genes in the silkworm, Bombyx mori

    Directory of Open Access Journals (Sweden)

    Yi Yong-Zhu

    2006-08-01

    Full Text Available Abstract Background The major royal jelly proteins/yellow (MRJP/YELLOW family possesses several physiological and chemical functions in the development of Apis mellifera and Drosophila melanogaster. Each protein of the family has a conserved domain named MRJP. However, there is no report of MRJP/YELLOW family proteins in the Lepidoptera. Results Using the YELLOW protein sequence in Drosophila melanogaster to BLAST silkworm EST database, we found a gene family composed of seven members with a conserved MRJP domain each and named it YELLOW protein family of Bombyx mori. We completed the cDNA sequences with RACE method. The protein of each member possesses a MRJP domain and a putative cleavable signal peptide consisting of a hydrophobic sequence. In view of genetic evolution, the whole Bm YELLOW protein family composes a monophyletic group, which is distinctly separate from Drosophila melanogaster and Apis mellifera. We then showed the tissue expression profiles of Bm YELLOW protein family genes by RT-PCR. Conclusion A Bombyx mori YELLOW protein family is found to be composed of at least seven members. The low homogeneity and unique pattern of gene expression by each member among the family ensure us to prophesy that the members of Bm YELLOW protein family would play some important physiological functions in silkworm development.

  2. Distinct Gene Expression Signatures in Lynch Syndrome and Familial Colorectal Cancer Type X

    DEFF Research Database (Denmark)

    Valentin, Mev; Therkildsen, Christina; Veerla, Srinivas

    2013-01-01

    Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects.......Heredity is estimated to cause at least 20% of colorectal cancer. The hereditary nonpolyposis colorectal cancer subset is divided into Lynch syndrome and familial colorectal cancer type X (FCCTX) based on presence of mismatch repair (MMR) gene defects....

  3. Analysis of unstable DNA sequence in FRM1 gene in Polish families with fragile X syndrome

    International Nuclear Information System (INIS)

    Milewski, Michal; Bal, Jerzy; Obersztyn, Ewa; Bocian, Ewa; Mazurczak, Tadeusz; Zygulska, Marta; Horst, Juergen; Deelen, Wout H.; Halley, Dicky J.J.

    1996-01-01

    The unstable DNA sequence in the FMR1 gene was analyzed in 85 individuals from Polish families with fragile X syndrome in order to characterize mutations responsible for the disease in Poland. In all affected individuals classified on the basis of clinical features and expression of the fragile site at X(q27.3) a large expansion of the unstable sequence (full mutation) was detected. About 5% (2 of 43) of individuals with full mutation did not express the fragile site. Among normal alleles, ranging in size from 20 to 41 CGC repeats, allele with 29 repeats was the most frequent (37%). Transmission of premutated and fully mutated alleles to the offspring was always associated with size increase. No change in repeat number was found when normal alleles were transmitted. (author). 19 refs., 4 figs, 1 tab

  4. Novel genetic variants in miR-191 gene and familial ovarian cancer

    International Nuclear Information System (INIS)

    Shen, Jie; DiCioccio, Richard; Odunsi, Kunle; Lele, Shashikant B; Zhao, Hua

    2010-01-01

    Half of the familial aggregation of ovarian cancer can't be explained by any known risk genes, suggesting the existence of other genetic risk factors. Some of these unknown factors may not be traditional protein encoding genes. MicroRNA (miRNA) plays a critical role in tumorigenesis, but it is still unknown if variants in miRNA genes lead to predisposition to cancer. Considering the fact that miRNA regulates a number of tumor suppressor genes (TSGs) and oncogenes, genetic variations in miRNA genes could affect the levels of expression of TSGs or oncogenes and, thereby, cancer risk. To test this hypothesis in familial ovarian cancer, we screened for genetic variants in thirty selected miRNA genes, which are predicted to regulate key ovarian cancer genes and are reported to be misexpressed in ovarian tumor tissues, in eighty-three patients with familial ovarian cancer. All of the patients are non-carriers of any known BRCA1/2 or mismatch repair (MMR) gene mutations. Seven novel genetic variants were observed in four primary or precursor miRNA genes. Among them, three rare variants were found in the precursor or primary precursor of the miR-191 gene. In functional assays, the one variant located in the precursor of miR-191 resulted in conformational changes in the predicted secondary structures, and consequently altered the expression of mature miR-191. In further analysis, we found that this particular variant exists in five family members who had ovarian cancer. Our findings suggest that there are novel genetic variants in miRNA genes, and those certain genetic variants in miRNA genes can affect the expression of mature miRNAs and, consequently, might alter the regulation of TSGs or oncogenes. Additionally, the variant might be potentially associated with the development of familial ovarian cancer

  5. a photoreceptor gene mutation in an indigenous black african family

    African Journals Online (AJOL)

    MUTATION IN AN INDIGENOUS. BLACK AFRICAN FAMILY WITH. RETINITIS PIGMENTOSA. IDENTIFIED USING A RAPID. SCREENING APPROACH FOR. COMMON RHODOPSIN. MUTATIONS. JGreenberg, T Franz, R Goliath, R Ramesar. Hereditary retinal degenerations may be subdivided into those affecting ...

  6. Genome-wide identification and comparative expression analysis reveal a rapid expansion and functional divergence of duplicated genes in the WRKY gene family of cabbage, Brassica oleracea var. capitata.

    Science.gov (United States)

    Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi

    2015-02-15

    WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Family-specific aggregation of lipid GWAS variants confers the susceptibility to familial hypercholesterolemia in a large Austrian family

    NARCIS (Netherlands)

    Nikkola, Elina; Ko, Arthur; Alvarez, Marcus; Cantor, Rita M.; Garske, Kristina; Kim, Elliot; Gee, Stephanie; Rodriguez, Alejandra; Muxel, Reinhard; Matikainen, Niina; Söderlund, Sanni; Motazacker, Mahdi M.; Borén, Jan; Lamina, Claudia; Kronenberg, Florian; Schneider, Wolfgang J.; Palotie, Aarno; Laakso, Markku; Taskinen, Marja-Riitta; Pajukanta, Päivi

    2017-01-01

    Background and aims: Hypercholesterolemia confers susceptibility to cardiovascular disease (CVD). Both serum total cholesterol (TC) and LDL-cholesterol (LDL-C) exhibit a strong genetic component (heritability estimates 0.41-0.50). However, a large part of this heritability cannot be explained by the

  8. [Analysis of the NDP gene in a Chinese family with X-linked recessive Norrie disease].

    Science.gov (United States)

    Mei, Libin; Huang, Yanru; Pan, Qian; Liang, Desheng; Wu, Lingqian

    2015-05-01

    The purpose of the current research was to investigate the NDP (Norrie disease protein) gene in one Chinese family with Norrie disease (ND) and to characterize the related clinical features. Clinical data of the proband and his family members were collected. Complete ophthalmic examinations were carried out on the proband. Genomic DNA was extracted from peripheral blood leukocytes of 35 family members. Molecular analysis of the NDP gene was performed by polymerase chain reaction and direct sequencing of all exons and flanking regions. A hemizygous NDP missense mutation c.362G > A (p.Arg121Gln) in exon 3 was identified in the affected members, but not in any of the unaffected family individuals. The missense mutation c.362G > A in NDP is responsible for the Norrie disease in this family. This discovery will help provide the family members with accurate and reliable genetic counseling and prenatal diagnosis.

  9. Identification of the WRKY gene family and functional analysis of two genes in Caragana intermedia.

    Science.gov (United States)

    Wan, Yongqing; Mao, Mingzhu; Wan, Dongli; Yang, Qi; Yang, Feiyun; Mandlaa; Li, Guojing; Wang, Ruigang

    2018-02-09

    WRKY transcription factors, one of the largest families of transcriptional regulators in plants, play important roles in plant development and various stress responses. The WRKYs of Caragana intermedia are still not well characterized, although many WRKYs have been identified in various plant species. We identified 53 CiWRKY genes from C. intermedia transcriptome data, 28 of which exhibited complete open reading frames (ORFs). These CiWRKYs were divided into three groups via phylogenetic analysis according to their WRKY domains and zinc finger motifs. Conserved domain analysis showed that the CiWRKY proteins contain a highly conserved WRKYGQK motif and two variant motifs (WRKYGKK and WKKYEEK). The subcellular localization of CiWRKY26 and CiWRKY28-1 indicated that these two proteins localized exclusively to nuclei, supporting their role as transcription factors. The expression patterns of the 28 CiWRKYs with complete ORFs were examined through quantitative real-time PCR (qRT-PCR) in various tissues and under different abiotic stresses (drought, cold, salt, high-pH and abscisic acid (ABA)). The results showed that each CiWRKY responded to at least one stress treatment. Furthermore, overexpression of CiWRKY75-1 and CiWRKY40-4 in Arabidopsis thaliana suppressed the drought stress tolerance of the plants and delayed leaf senescence, respectively. Fifty-three CiWRKY genes from the C. intermedia transcriptome were identified and divided into three groups via phylogenetic analysis. The expression patterns of the 28 CiWRKYs under different abiotic stresses suggested that each CiWRKY responded to at least one stress treatment. Overexpression of CiWRKY75-1 and CiWRKY40-4 suppressed the drought stress tolerance of Arabidopsis and delayed leaf senescence, respectively. These results provide a basis for the molecular mechanism through which CiWRKYs mediate stress tolerance.

  10. Molecular, phylogenetic and comparative genomic analysis of the cytokinin oxidase/dehydrogenase gene family in the Poaceae.

    Science.gov (United States)

    Mameaux, Sabine; Cockram, James; Thiel, Thomas; Steuernagel, Burkhard; Stein, Nils; Taudien, Stefan; Jack, Peter; Werner, Peter; Gray, John C; Greenland, Andy J; Powell, Wayne

    2012-01-01

    The genomes of cereals such as wheat (Triticum aestivum) and barley (Hordeum vulgare) are large and therefore problematic for the map-based cloning of agronomicaly important traits. However, comparative approaches within the Poaceae permit transfer of molecular knowledge between species, despite their divergence from a common ancestor sixty million years ago. The finding that null variants of the rice gene cytokinin oxidase/dehydrogenase 2 (OsCKX2) result in large yield increases provides an opportunity to explore whether similar gains could be achieved in other Poaceae members. Here, phylogenetic, molecular and comparative analyses of CKX families in the sequenced grass species rice, brachypodium, sorghum, maize and foxtail millet, as well as members identified from the transcriptomes/genomes of wheat and barley, are presented. Phylogenetic analyses define four Poaceae CKX clades. Comparative analyses showed that CKX phylogenetic groupings can largely be explained by a combination of local gene duplication, and the whole-genome duplication event that predates their speciation. Full-length OsCKX2 homologues in barley (HvCKX2.1, HvCKX2.2) and wheat (TaCKX2.3, TaCKX2.4, TaCKX2.5) are characterized, with comparative analysis at the DNA, protein and genetic/physical map levels suggesting that true CKX2 orthologs have been identified. Furthermore, our analysis shows CKX2 genes in barley and wheat have undergone a Triticeae-specific gene-duplication event. Finally, by identifying ten of the eleven CKX genes predicted to be present in barley by comparative analyses, we show that next-generation sequencing approaches can efficiently determine the gene space of large-genome crops. Together, this work provides the foundation for future functional investigation of CKX family members within the Poaceae. © 2011 National Institute of Agricultural Botany (NIAB). Plant Biotechnology Journal © 2011 Society for Experimental Biology, Association of Applied Biologists and Blackwell

  11. Truncating mutation in the NHS gene: phenotypic heterogeneity of Nance-Horan syndrome in an asian Indian family.

    Science.gov (United States)

    Ramprasad, Vedam Lakshmi; Thool, Alka; Murugan, Sakthivel; Nancarrow, Derek; Vyas, Prateep; Rao, Srinivas Kamalakar; Vidhya, Authiappan; Ravishankar, Krishnamoorthy; Kumaramanickavel, Govindasamy

    2005-01-01

    A four-generation family containing eight affected males who inherited X-linked developmental lens opacity and microcornea was studied. Some members in the family had mild to moderate nonocular clinical features suggestive of Nance-Horan syndrome. The purpose of the study was to map genetically the gene in the large 57-live-member Asian-Indian pedigree. PCR-based genotyping was performed on the X-chromosome, by using fluorescent microsatellite markers (10-cM intervals). Parametric linkage analysis was performed by using two disease models, assuming either recessive or dominant X-linked transmission by the MLINK/ILINK and FASTLINK (version 4.1P) programs (http:www.hgmp.mrc.ac.uk/; provided in the public domain by the Human Genome Mapping Project Resources Centre, Cambridge, UK). The NHS gene at the linked region was screened for mutation. By fine mapping, the disease gene was localized to Xp22.13. Multipoint analysis placed the peak LOD of 4.46 at DSX987. The NHS gene mapped to this region. Mutational screening in all the affected males and carrier females (heterozygous form) revealed a truncating mutation 115C-->T in exon 1, resulting in conversion of glutamine to stop codon (Q39X), but was not observed in unaffected individuals and control subjects. conclusions. A family with X-linked Nance-Horan syndrome had severe ocular, but mild to moderate nonocular, features. The clinical phenotype of the truncating mutation (Q39X) in the NHS gene suggests allelic heterogeneity at the NHS locus or the presence of modifier genes. X-linked families with cataract should be carefully examined for both ocular and nonocular features, to exclude Nance-Horan syndrome. RT-PCR analysis did not suggest nonsense-mediated mRNA decay as the possible mechanism for clinical heterogeneity.

  12. The SOD gene family in tomato: identification, phylogenetic relationships and expression patterns

    Directory of Open Access Journals (Sweden)

    kun feng

    2016-08-01

    Full Text Available Superoxide dismutases (SODs are critical antioxidant enzymes that protect organisms from reactive oxygen species (ROS caused by adverse conditions, and have been widely found in the cytoplasm, chloroplasts, and mitochondria of eukaryotic and prokaryotic cells. Tomato (Solanum lycopersicum L. is an important economic crop and is cultivated worldwide. However, abiotic and biotic stresses severely hinder growth and development of the plant, which affects the production and quality of the crop. To reveal the potential roles of SOD genes under various stresses, we performed a systematic analysis of the tomato SOD gene family and analyzed the expression patterns of SlSOD genes in response to abiotic stresses at the whole-genome level. The characteristics of the SlSOD gene family were determined by analyzing gene structure, conserved motifs, chromosomal distribution, phylogenetic relationships, and expression patterns. We determined that there are at least nine SOD genes in tomato, including four Cu/ZnSODs, three FeSODs, and one MnSOD, and they are unevenly distributed on 12 chromosomes. Phylogenetic analyses of SOD genes from tomato and other plant species were separated into two groups with a high bootstrap value, indicating that these SOD genes were present before the monocot-dicot split. Additionally, many cis-elements that respond to different stresses were found in the promoters of nine SlSOD genes. Gene expression analysis based on RNA-seq data showed that most genes were expressed in all tested tissues, with the exception of SlSOD6 and SlSOD8, which were only expressed in young fruits. Microarray data analysis showed that most members of the SlSOD gene family were altered under salt- and drought-stress conditions. This genome-wide analysis of SlSOD genes helps to clarify the function of SlSOD genes under different stress conditions and provides information to aid in further understanding the evolutionary relationships of SOD genes in plants.

  13. Phylogenomic analysis of UDP glycosyltransferase 1 multigene family in Linum usitatissimum identified genes with varied expression patterns

    Science.gov (United States)

    2012-01-01

    Background The glycosylation process, catalyzed by ubiquitous glycosyltransferase (GT) family enzymes, is a prevalent modification of plant secondary metabolites that regulates various functions such as hormone homeostasis, detoxification of xenobiotics and biosynthesis and storage of secondary metabolites. Flax (Linum usitatissimum L.) is a commercially grown oilseed crop, important because of its essential fatty acids and health promoting lignans. Identification and characterization of UDP glycosyltransferase (UGT) genes from flax could provide valuable basic information about this important gene family and help to explain the seed specific glycosylated metabolite accumulation and other processes in plants. Plant genome sequencing projects are useful to discover complexity within this gene family and also pave way for the development of functional genomics approaches. Results Taking advantage of the newly assembled draft genome sequence of flax, we identified 137 UDP glycosyltransferase (UGT) genes from flax using a conserved signature motif. Phylogenetic analysis of these protein sequences clustered them into 14 major groups (A-N). Expression patterns of these genes were investigated using publicly available expressed sequence tag (EST), microarray data and reverse transcription quantitative real time PCR (RT-qPCR). Seventy-three per cent of these genes (100 out of 137) showed expression evidence in 15 tissues examined and indicated varied expression profiles. The RT-qPCR results of 10 selected genes were also coherent with the digital expression analysis. Interestingly, five duplicated UGT genes were identified, which showed differential expression in various tissues. Of the seven intron loss/gain positions detected, two intron positions were conserved among most of the UGTs, although a clear relationship about the evolution of these genes could not be established. Comparison of the flax UGTs with orthologs from four other sequenced dicot genomes indicated that

  14. Phylogenomic analysis of UDP glycosyltransferase 1 multigene family in Linum usitatissimum identified genes with varied expression patterns

    Directory of Open Access Journals (Sweden)

    Barvkar Vitthal T

    2012-05-01

    Full Text Available Abstract Background The glycosylation process, catalyzed by ubiquitous glycosyltransferase (GT family enzymes, is a prevalent modification of plant secondary metabolites that regulates various functions such as hormone homeostasis, detoxification of xenobiotics and biosynthesis and storage of secondary metabolites. Flax (Linum usitatissimum L. is a commercially grown oilseed crop, important because of its essential fatty acids and health promoting lignans. Identification and characterization of UDP glycosyltransferase (UGT genes from flax could provide valuable basic information about this important gene family and help to explain the seed specific glycosylated metabolite accumulation and other processes in plants. Plant genome sequencing projects are useful to discover complexity within this gene family and also pave way for the development of functional genomics approaches. Results Taking advantage of the newly assembled draft genome sequence of flax, we identified 137 UDP glycosyltransferase (UGT genes from flax using a conserved signature motif. Phylogenetic analysis of these protein sequences clustered them into 14 major groups (A-N. Expression patterns of these genes were investigated using publicly available expressed sequence tag (EST, microarray data and reverse transcription quantitative real time PCR (RT-qPCR. Seventy-three per cent of these genes (100 out of 137 showed expression evidence in 15 tissues examined and indicated varied expression profiles. The RT-qPCR results of 10 selected genes were also coherent with the digital expression analysis. Interestingly, five duplicated UGT genes were identified, which showed differential expression in various tissues. Of the seven intron loss/gain positions detected, two intron positions were conserved among most of the UGTs, although a clear relationship about the evolution of these genes could not be established. Comparison of the flax UGTs with orthologs from four other sequenced dicot

  15. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    Science.gov (United States)

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  16. Natural killer cell receptor genes in the family Equidae: not only Ly49.

    Directory of Open Access Journals (Sweden)

    Jan Futas

    Full Text Available Natural killer (NK cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for

  17. Natural Killer Cell Receptor Genes in the Family Equidae: Not only Ly49

    Science.gov (United States)

    Futas, Jan; Horin, Petr

    2013-01-01

    Natural killer (NK) cells have important functions in immunity. NK recognition in mammals can be mediated through killer cell immunoglobulin-like receptors (KIR) and/or killer cell lectin-like Ly49 receptors. Genes encoding highly variable NK cell receptors (NKR) represent rapidly evolving genomic regions. No single conservative model of NKR genes was observed in mammals. Single-copy low polymorphic NKR genes present in one mammalian species may expand into highly polymorphic multigene families in other species. In contrast to other non-rodent mammals, multiple Ly49-like genes appear to exist in the horse, while no functional KIR genes were observed in this species. In this study, Ly49 and KIR were sought and their evolution was characterized in the entire family Equidae. Genomic sequences retrieved showed the presence of at least five highly conserved polymorphic Ly49 genes in horses, asses and zebras. These findings confirmed that the expansion of Ly49 occurred in the entire family. Several KIR-like sequences were also identified in the genome of Equids. Besides a previously identified non-functional KIR-Immunoglobulin-like transcript fusion gene (KIR-ILTA) and two putative pseudogenes, a KIR3DL-like sequence was analyzed. In contrast to previous observations made in the horse, the KIR3DL sequence, genomic organization and mRNA expression suggest that all Equids might produce a functional KIR receptor protein molecule with a single non-mutated immune tyrosine-based inhibition motif (ITIM) domain. No evidence for positive selection in the KIR3DL gene was found. Phylogenetic analysis including rhinoceros and tapir genomic DNA and deduced amino acid KIR-related sequences showed differences between families and even between species within the order Perissodactyla. The results suggest that the order Perissodactyla and its family Equidae with expanded Ly49 genes and with a potentially functional KIR gene may represent an interesting model for evolutionary biology of

  18. carboxylate synthase gene family in Arabidopsis, rice, grapevine

    African Journals Online (AJOL)

    Yomi

    2012-01-16

    Jan 16, 2012 ... evolutionary relationships of ACS genes in the four plant species. Chromosomal .... classification was consistent with the report from. Jakubowicz et al. ..... Analysis of the genome sequence of the flowering plant Arabidopsis ...

  19. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands

    NARCIS (Netherlands)

    Florijn, Ralph J.; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J. J. M.; Mannens, Marcel M. A. M.; Tijmes, Nel; Brooks, Simon P.; Hardcastle, Alison J.; Bergen, Arthur A. B.

    2006-01-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the

  20. Germline heterozygous variants in genes associated with familial hemophagocytic lymphohistiocytosis as a cause of increased bleeding

    DEFF Research Database (Denmark)

    Fager Ferrari, Marcus; Leinoe, Eva; Rossing, Maria

    2018-01-01

    Familial hemophagocytic lymphohistiocytosis (FHL) is caused by biallelic variants in genes regulating granule secretion in cytotoxic lymphocytes. In FHL3-5, the affected genes UNC13D, STX11 and STXBP2 have further been shown to regulate the secretion of platelet granules, giving rise to compromised...

  1. Linkage studies and mutation analysis of the PDEB gene in 23 families with Leber congenital amaurosis

    DEFF Research Database (Denmark)

    Riess, O; Weber, B; Nørremølle, Anne

    1992-01-01

    as to whether mutations in the human PDEB gene might cause LCA. We have previously cloned and characterized the human homologue of the mouse Pdeb gene and have mapped it to chromosome 4p16.3. In this study, a total of 23 LCA families of various ethnic backgrounds have been investigated. Linkage analysis using...

  2. Expressional and Biochemical Characterization of Rice Disease Resistance Gene Xa3/Xa26 Family

    Institute of Scientific and Technical Information of China (English)

    Songjie Xu; Yinglong Cao; Xianghua Li; Shiping Wang

    2007-01-01

    The rice (Oryza sativa L.) Xa3/Xa26 gene, conferring race-specific resistance to bacterial blight disease and encoding a leucine-rich repeat (LRR) receptor kinase-like protein, belongs to a multigene family consisting of tandem clustered homologous genes, colocalizing with several uncharacterized genes for resistance to bacterial blight or fungal blast. To provide more information on the expressional and biochemical characteristics of the Xa3/Xa26 family, we analyzed the family members. Four Xa3/Xa26 family members in the indica rice variety Teqing, which carries a bacterial blight resistance gene with a chromosomal location tightly linked to Xa3/Xa26, and five Xa3/Xa26 family members in the japonica rice variety Nipponbare, which carries at least one uncharacterized blast resistance gene, were constitutively expressed in leaf tissue. The result suggests that some of the family members may be candidates of these uncharacterized resistance genes. At least five putative N-glycosylation sites in the LRR domain of XA3/XA26 protein are not glycosylated. The XA3/XA26 and its family members MRKa and MRKc all possess the consensus sequences of paired cysteines, which putatively function in dimerization of the receptor proteins for signal transduction, immediately before the first LRR and immediately after the last LRR. However, no homo-dimer between the XA3/XA26 molecules or hetero-dimer between XA3/XA26 and MRKa or MRKc were formed, indicating that XA3/XA26 protein might function either as a monomer or a hetero-dimer formed with other protein outside of the XA3/XA26 family. These results provide valuable information for further extensive investigation into this multiple protein family.

  3. Ixodes scapularis tick serine proteinase inhibitor (serpin gene family; annotation and transcriptional analysis

    Directory of Open Access Journals (Sweden)

    Chalaire Katelyn C

    2009-05-01

    Full Text Available Abstract Background Serine proteinase inhibitors (Serpins are a large superfamily of structurally related, but functionally diverse proteins that control essential proteolytic pathways in most branches of life. Given their importance in the biology of many organisms, the concept that ticks might utilize serpins to evade host defenses and immunizing against or disrupting their functions as targets for tick control is an appealing option. Results A sequence homology search strategy has allowed us to identify at least 45 tick serpin genes in the Ixodes scapularis genome that are structurally segregated into 32 intronless and 13 intron-containing genes. Nine of the intron-containing serpins occur in a cluster of 11 genes that span 170 kb of DNA sequence. Based on consensus amino acid residues in the reactive center loop (RCL and signal peptide scanning, 93% are putatively inhibitory while 82% are putatively extracellular. Among the 11 different amino acid residues that are predicted at the P1 sites, 16 sequences possess basic amino acid (R/K residues. Temporal and spatial expression analyses revealed that 40 of the 45 serpins are differentially expressed in salivary glands (SG and/or midguts (MG of unfed and partially fed ticks. Ten of the 38 serpin genes were expressed from six to 24 hrs of feeding while six and fives genes each are predominantly or exclusively expressed in either MG and SG respectively. Conclusion Given the diversity among tick species, sizes of tick serpin families are likely to be variable. However this study provides insight on the potential sizes of serpin protein families in ticks. Ticks must overcome inflammation, complement activation and blood coagulation to complete feeding. Since these pathways are regulated by serpins that have basic residues at their P1 sites, we speculate that I. scapularis may utilize some of the serpins reported in this study to manipulate host defense. We have discussed our data in the context of

  4. Genome-wide identification and expression analysis of the mitogen-activated protein kinase gene family in cassava

    Directory of Open Access Journals (Sweden)

    Yan Yan

    2016-08-01

    Full Text Available Mitogen-activated protein kinases (MAPKs play central roles in plant developmental processes, hormone signaling transduction, and responses to abiotic stress. However, no data are currently available about the MAPK family in cassava, an important tropical crop. Herein, 21 MeMAPK genes were identified from cassava. Phylogenetic analysis indicated that MeMAPKs could be classified into four subfamilies. Gene structure analysis demonstrated that the number of introns in MeMAPK genes ranged from 1 to 10, suggesting large variation among cassava MAPK genes. Conserved motif analysis indicated that all MeMAPKs had typical protein kinase domains. Transcriptomic analysis suggested that MeMAPK genes showed differential expression patterns in distinct tissues and in response to drought stress between wild subspecies and cultivated varieties. Interaction networks and co-expression analyses revealed that crucial pathways controlled by MeMAPK networks may be involved in the differential response to drought stress in different accessions of cassava. Expression of nine selected MAPK genes showed that these genes could comprehensively respond to osmotic, salt, cold, oxidative stressors, and abscisic acid (ABA signaling. These findings yield new insights into the transcriptional control of MAPK gene expression, provide an improved understanding of abiotic stress responses and signaling transduction in cassava, and lead to potential applications in the genetic improvement of cassava cultivars.

  5. A Large PROP1 Gene Deletion in a Turkish Pedigree

    Directory of Open Access Journals (Sweden)

    Suheyla Gorar

    2018-01-01

    Full Text Available Pituitary-specific paired-like homeodomain transcription factor, PROP1, is associated with multiple pituitary hormone deficiency. Alteration of the gene encoding the PROP1 may affect somatotropes, thyrotropes, and lactotropes, as well as gonadotropes and corticotropes. We performed genetic analysis of PROP1 gene in a Turkish pedigree with three siblings who presented with short stature. Parents were first degree cousins. Index case, a boy, had somatotrope, gonadotrope, thyrotrope, and corticotrope deficiency. However, two elder sisters had somatotroph, gonadotroph, and thyrotroph deficiency and no corticotroph deficiency. On pituitary magnetic resonance, partial empty sella was detected with normal bright spot in all siblings. In genetic analysis, we found a gross deletion involving PROP1 coding region. In conclusion, we report three Turkish siblings with a gross deletion in PROP1 gene. Interestingly, although little boy with combined pituitary hormone deficiency has adrenocorticotropic hormone (ACTH deficiency, his elder sisters with the same gross PROP1 deletion have no ACTH deficiency. This finding is in line with the fact that patients with PROP1 mutations may have different phenotype/genotype correlation.

  6. Differential and correlation analyses of microarray gene expression data in the CEPH Utah families

    DEFF Research Database (Denmark)

    Tan, Qihua; Zhao, Jinghua; Li, Shuxia

    2008-01-01

    -regulated genes identifies cell-cell signaling as an important functional category implicated in human aging. Sex-dependent gene expression is characterized by genes that may escape X-inactivation and, most interestingly, such a pattern is not affected by the aging process. Analysis on sibship correlation on gene...... expression revealed a large number of significant genes suggesting the importance of a genetic mechanism in regulating transcriptional activities. In addition, we observe an interesting pattern of sibship correlation on gene expression that increases exponentially with the mean of gene expression reflecting...

  7. The importance of melanoma inhibitory activity gene family in the tumor progression of oral cancer.

    Science.gov (United States)

    Sasahira, Tomonori; Bosserhoff, Anja Katrin; Kirita, Tadaaki

    2018-05-01

    Oral squamous cell carcinoma has a high potential for locoregional invasion and nodal metastasis. Consequently, early detection of such malignancies is of immense importance. The melanoma inhibitory activity (MIA) gene family comprises MIA, MIA2, transport and Golgi organization protein 1 (TANGO), and otoraplin (OTOR). These members of the MIA gene family have a highly conserved Src homology 3 (SH3)-like structure. Although the molecules of this family share 34-45% amino acid homology and 47-59% cDNA sequence homology, those members, excluding OTOR, play different tumor-associated functions. MIA has a pivotal role in the progression and metastasis of melanoma; MIA2 and TANGO have been suggested to possess tumor-suppressive functions; and OTOR is uniquely expressed in cochlea of the inner ear. Therefore, the definite functions of the MIA gene family in cancer cells remain unclear. Since the members of the MIA gene family are secreted proteins, these molecules might be useful tumor markers that can be detected in the body fluids, including serum and saliva. In this review, we described the molecular biological functions of the MIA gene family in oral cancer. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  8. Deletion of Xpter encompassing the SHOX gene and PAR1 region in familial patients with Leri-Weill Dyschondrosteosis syndrome.

    Science.gov (United States)

    Mutesa, L; Vanbellinghen, J F; Hellin, A C; Segers, K; Jamar, M; Pierquin, G; Bours, V

    2009-01-01

    Heterozygote deletions or mutations of pseudoautosomal 1 region (PAR1) encompassing the short stature homeobox-containing (SHOX) gene cause Leri-Weill Dyschondrosteosis (LWD), which is a dominantly inherited osteochondroplasia characterized by short stature with mesomelic shortening of the upper and lower limbs and Madelung deformity of the wrists. SHOX is expressed by both sex chromosomes in males and females and plays an important role in bone growth and development. Clinically, the LWD expression is variable and more severe in females than males due to sex differences in oestrogen levels. Here, we report two familial cases of LWD with a large Xp terminal deletion (approximately 943 kb) of distal PAR1 encompassing the SHOX gene. In addition, the proband had mental retardation which appeared to be from recessive inheritance in the family.

  9. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton

    2014-06-01

    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  10. Duplications and losses in gene families of rust pathogens highlight putative effectors.

    Science.gov (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M

    2014-01-01

    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  11. Common mutations identified in the MLH1 gene in familial Lynch syndrome

    Directory of Open Access Journals (Sweden)

    Jisha Elias

    2017-12-01

    In this study we identified three families with Lynch syndrome from a rural cancer center in western India (KCHRC, Goraj, Gujarat, where 70-75 CRC patients are seen annually. DNA isolated from the blood of consented family members of all three families (8-10 members/family was subjected to NGS sequencing methods on an Illumina HiSeq 4000 platform. We identified unique mutations in the MLH1 gene in all three HNPCC family members. Two of the three unrelated families shared a common mutation (154delA and 156delA. Total 8 members of a family were identified as carriers for 156delA mutation of which 5 members were unaffected while 3 were affected (age of onset: 1 member <30yrs & 2 were>40yr. The family with 154delA mutation showed 2 affected members (>40yr carrying the mutations.LYS618DEL mutation found in 8 members of the third family showed that both affected and unaffected carried the mutation. Thus the common mutations identified in the MLH1 gene in two unrelated families had a high risk for lynch syndrome especially above the age of 40.

  12. Genome-Wide Analysis of the RNA Helicase Gene Family in Gossypium raimondii

    Directory of Open Access Journals (Sweden)

    Jie Chen

    2014-03-01

    Full Text Available The RNA helicases, which help to unwind stable RNA duplexes, and have important roles in RNA metabolism, belong to a class of motor proteins that play important roles in plant development and responses to stress. Although this family of genes has been the subject of systematic investigation in Arabidopsis, rice, and tomato, it has not yet been characterized in cotton. In this study, we identified 161 putative RNA helicase genes in the genome of the diploid cotton species Gossypium raimondii. We classified these genes into three subfamilies, based on the presence of either a DEAD-box (51 genes, DEAH-box (52 genes, or DExD/H-box (58 genes in their coding regions. Chromosome location analysis showed that the genes that encode RNA helicases are distributed across all 13 chromosomes of G. raimondii. Syntenic analysis revealed that 62 of the 161 G. raimondii helicase genes (38.5% are within the identified syntenic blocks. Sixty-six (40.99% helicase genes from G. raimondii have one or several putative orthologs in tomato. Additionally, GrDEADs have more conserved gene structures and more simple domains than GrDEAHs and GrDExD/Hs. Transcriptome sequencing data demonstrated that many of these helicases, especially GrDEADs, are highly expressed at the fiber initiation stage and in mature leaves. To our knowledge, this is the first report of a genome-wide analysis of the RNA helicase gene family in cotton.

  13. Only male matrilineal relatives with Leber's hereditary optic neuropathy in a large Chinese family carrying the mitochondrial DNA G11778A mutation

    International Nuclear Information System (INIS)

    Qu Jia; Li Ronghua; Tong Yi; Hu Yongwu; Zhou Xiangtian; Qian Yaping; Lu Fan; Guan Minxin

    2005-01-01

    We report here the characterization of a five-generation large Chinese family with Leber's hereditary optic neuropathy (LHON). Very strikingly, six affected individuals of 38 matrilineal relatives (17 females/21 males) are exclusively males in this Chinese family. These matrilineal relatives in this family exhibited late-onset/progressive visual impairment with a wide range of severity, ranging from blindness to normal vision. The age of onset in visual impairment varies from 17 to 30 years. Sequence analysis of the complete mitochondrial genome in this pedigree revealed the presence of the G11778A mutation in ND4 gene and 29 other variants. This mitochondrial genome belongs to the Southern Chinese haplogroup B5b. We showed that the G11778A mutation is present at near homoplasmy in matrilineal relatives of this Chinese family but not in 164 Chinese controls. Incomplete penetrance of LHON in this family indicates the involvement of modulatory factors in the phenotypic expression of visual dysfunction associated with the G11778A mutation. However, none of other mtDNA variants are evolutionarily conserved and implicated to have significantly functional consequence. Thus, nuclear modifier gene(s) or environmental factor(s) seem to account for the penetrance and phenotypic variability of LHON in this Chinese family carrying the G11778A mutation

  14. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Directory of Open Access Journals (Sweden)

    Petar Petrov

    Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  15. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Science.gov (United States)

    Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W

    2015-01-01

    "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  16. Enamelin/ameloblastin gene polymorphisms in autosomal amelogenesis imperfecta among Syrian families.

    Science.gov (United States)

    Dashash, Mayssoon; Bazrafshani, Mohamed Riza; Poulton, Kay; Jaber, Saaed; Naeem, Emad; Blinkhorn, Anthony Stevenson

    2011-02-01

      This study was undertaken to investigate whether a single G deletion within a series of seven G residues (codon 196) at the exon 9-intron 9 boundary of the enamelin gene ENAM and a tri-nucleotide deletion at codon 180 in exon 7 (GGA vs deletion) of ameloblastin gene AMBN could have a role in autosomal amelogenesis imperfecta among affected Syrian families.   A new technique - size-dependent, deletion screening - was developed to detect nucleotide deletion in ENAM and AMBN genes. Twelve Syrian families with autosomal-dominant or -recessive amelogenesis imperfecta were included.   A homozygous/heterozygous mutation in the ENAM gene (152/152, 152/153) was identified in affected members of three families with autosomal-dominant amelogenesis imperfecta and one family with autosomal-recessive amelogenesis imperfecta. A heterozygous mutation (222/225) in the AMBN gene was identified. However, no disease causing mutations was found. The present findings provide useful information for the implication of ENAM gene polymorphism in autosomal-dominant/-recessive amelogenesis imperfecta.   Further investigations are required to identify other genes responsible for the various clinical phenotypes. © 2010 Blackwell Publishing Asia Pty Ltd.

  17. Two desmin gene mutations associated with myofibrillar myopathies in Polish families.

    Directory of Open Access Journals (Sweden)

    Jakub Piotr Fichna

    Full Text Available Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P and a small deletion of nine nucleotides (A357_E359del, previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization.

  18. Two Desmin Gene Mutations Associated with Myofibrillar Myopathies in Polish Families

    Science.gov (United States)

    Berdynski, Mariusz; Sikorska, Agata; Filipek, Slawomir; Redowicz, Maria Jolanta; Kaminska, Anna; Zekanowski, Cezary

    2014-01-01

    Desmin is a muscle-specific intermediate filament protein which forms a network connecting the sarcomere, T tubules, sarcolemma, nuclear membrane, mitochondria and other organelles. Mutations in the gene coding for desmin (DES) cause skeletal myopathies often combined with cardiomyopathy, or isolated cardiomyopathies. The molecular pathomechanisms of the disease remain ambiguous. Here, we describe and comprehensively characterize two DES mutations found in Polish patients with a clinical diagnosis of desminopathy. The study group comprised 16 individuals representing three families. Two mutations were identified: a novel missense mutation (Q348P) and a small deletion of nine nucleotides (A357_E359del), previously described by us in the Polish population. A common ancestry of all the families bearing the A357_E359del mutation was confirmed. Both mutations were predicted to be pathogenic using a bioinformatics approach, including molecular dynamics simulations which helped to rationalize abnormal behavior at molecular level. To test the impact of the mutations on DES expression and the intracellular distribution of desmin muscle biopsies were investigated. Elevated desmin levels as well as its atypical localization in muscle fibers were observed. Additional staining for M-cadherin, α-actinin, and myosin heavy chains confirmed severe disruption of myofibrill organization. The abnormalities were more prominent in the Q348P muscle, where both small atrophic fibers as well large fibers with centrally localized nuclei were observed. We propose that the mutations affect desmin structure and cause its aberrant folding and subsequent aggregation, triggering disruption of myofibrils organization. PMID:25541946

  19. Identification and description of three families with familial Alzheimer disease that segregate variants in the SORL1 gene.

    Science.gov (United States)

    Thonberg, Håkan; Chiang, Huei-Hsin; Lilius, Lena; Forsell, Charlotte; Lindström, Anna-Karin; Johansson, Charlotte; Björkström, Jenny; Thordardottir, Steinunn; Sleegers, Kristel; Van Broeckhoven, Christine; Rönnbäck, Annica; Graff, Caroline

    2017-06-09

    Alzheimer disease (AD) is a progressive neurodegenerative disorder and the most common form of dementia. The majority of AD cases are sporadic, while up to 5% are families with an early onset AD (EOAD). Mutations in one of the three genes: amyloid beta precursor protein (APP), presenilin 1 (PSEN1) or presenilin 2 (PSEN2) can be disease causing. However, most EOAD families do not carry mutations in any of these three genes, and candidate genes, such as the sortilin-related receptor 1 (SORL1), have been suggested to be potentially causative. To identify AD causative variants, we performed whole-exome sequencing on five individuals from a family with EOAD and a missense variant, p.Arg1303Cys (c.3907C > T) was identified in SORL1 which segregated with disease and was further characterized with immunohistochemistry on two post mortem autopsy cases from the same family. In a targeted re-sequencing effort on independent index patients from 35 EOAD-families, a second SORL1 variant, c.3050-2A > G, was found which segregated with the disease in 3 affected and was absent in one unaffected family member. The c.3050-2A > G variant is located two nucleotides upstream of exon 22 and was shown to cause exon 22 skipping, resulting in a deletion of amino acids Gly1017- Glu1074 of SORL1. Furthermore, a third SORL1 variant, c.5195G > C, recently identified in a Swedish case control cohort included in the European Early-Onset Dementia (EU EOD) consortium study, was detected in two affected siblings in a third family with familial EOAD. The finding of three SORL1-variants that segregate with disease in three separate families with EOAD supports the involvement of SORL1 in AD pathology. The cause of these rare monogenic forms of EOAD has proven difficult to find and the use of exome and genome sequencing may be a successful route to target them.

  20. Diverse expression of sucrose transporter gene family in Zea mays

    Indian Academy of Sciences (India)

    2015-03-04

    Mar 4, 2015 ... In this study, we identified four sucrose transporter genes. (ZmSUT1 .... strand synthesis was done with forward and reverse primers designed at .... Qazi H. A., Paranjpe S. and Bhargava S. 2012 Stem sugar accu- mulation in ...

  1. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    DEFF Research Database (Denmark)

    Møller, Rikke S.; Larsen, Line H.G.; Johannesen, Katrine M.

    2016-01-01

    -causing variant in 49 (23%) of the 216 patients. The variants were found in 19 different genes including SCN1A, STXBP1, CDKL5, SCN2A, SCN8A, GABRA1, KCNA2, and STX1B. Patients with neonatal-onset epilepsies had the highest rate of positive findings (57%). The overall yield for patients with EEs was 32%, compared...

  2. Gene Panel Testing in Epileptic Encephalopathies and Familial Epilepsies

    DEFF Research Database (Denmark)

    Møller, Rikke S; Larsen, Line H G; Johannesen, Katrine M

    2016-01-01

    In recent years, several genes have been causally associated with epilepsy. However, making a genetic diagnosis in a patient can still be difficult, since extensive phenotypic and genetic heterogeneity has been observed in many monogenic epilepsies. This study aimed to analyze the genetic basis o...

  3. Genetic diversity of bitter taste receptor gene family in Sichuan ...

    Indian Academy of Sciences (India)

    Previous research had revealed that chicken has only three bitter taste receptor genes (Tas2r1, ... Journal of Genetics, DOI 10.1007/s12041-016-0684-4, Vol. ..... between red-winged blackbirds and European starlings. ... Academic Press,.

  4. The KDM5 family is required for activation of pro-proliferative cell cycle genes during adipocyte differentiation

    DEFF Research Database (Denmark)

    Brier, Ann-Sofie B; Loft, Anne; Madsen, Jesper G S

    2017-01-01

    The KDM5 family of histone demethylases removes the H3K4 tri-methylation (H3K4me3) mark frequently found at promoter regions of actively transcribed genes and is therefore generally considered to contribute to corepression. In this study, we show that knockdown (KD) of all expressed members...... of the KDM5 family in white and brown preadipocytes leads to deregulated gene expression and blocks differentiation to mature adipocytes. KDM5 KD leads to a considerable increase in H3K4me3 at promoter regions; however, these changes in H3K4me3 have a limited effect on gene expression per se. By contrast......, genome-wide analyses demonstrate that KDM5A is strongly enriched at KDM5-activated promoters, which generally have high levels of H3K4me3 and are associated with highly expressed genes. We show that KDM5-activated genes include a large set of cell cycle regulators and that the KDM5s are necessary...

  5. A novel mutation in PGAP2 gene causes developmental delay, intellectual disability, epilepsy and microcephaly in consanguineous Saudi family.

    Science.gov (United States)

    Naseer, Muhammad Imran; Rasool, Mahmood; Jan, Mohammed M; Chaudhary, Adeel G; Pushparaj, Peter Natesan; Abuzenadah, Adel M; Al-Qahtani, Mohammad H

    2016-12-15

    PGAP2 (Post-GPI Attachment to Proteins 2) gene is involved in lipid remodeling steps of Glycosylphosphatidylinositol (GPI)-anchor maturation. At the surface of the cell this gene is required for proper expression of GPI-anchored proteins. Hyperphosphatasia with mental retardation syndrome-3 is an autosomal recessive disorder usually characterized by severe mental retardation. Mutations in the PGAP2 gene cause hyperphosphatasia mental retardation syndrome-3. We have identified a large consanguineous family from Saudi origin segregating developmental delay, intellectual disability, epilepsy and microcephaly. Whole exome sequencing with 100× coverage was performed on two affected siblings of the family. Data analysis in the patient revealed a novel missense mutation c.191C>T in PGAP2 gene resulting in Alanine to Valine substitution (Ala64Val). The mutation was reconfirmed and validated by subsequent Sanger sequencing method. The mutation was ruled out in 100 unrelated healthy controls. We suggest that this pathogenic mutation disrupts the proper function of the gene proteins resulting in the disease state. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. A family-based association study identified CYP17 as a candidate gene for obesity susceptibility in Caucasians.

    Science.gov (United States)

    Yan, H; Guo, Y; Yang, T-L; Zhao, L-J; Deng, H-W

    2012-08-06

    The cytochrome P450c17α gene (CYP17) encodes a key biosynthesis enzyme of estrogen, which is critical in regulating adipogenesis and adipocyte development in humans. We therefore hypothesized that CYP17 is a candidate gene for predicting obesity. In order to test this hypothesis, we performed a family-based association test to investigate the relationship between the CYP17 gene and obesity phenotypes in a large sample comprising 1873 subjects from 405 Caucasian nuclear families of European origin recruited by the Osteoporosis Research Center of Creighton University, USA. Both single SNPs and haplotypes were tested for associations with obesity-related phenotypes, including body mass index (BMI) and fat mass. We identified three SNPs to be significantly associated with BMI, including rs3740397, rs6163, and rs619824. We further characterized the linkage disequilibrium structure for CYP17 and found that the whole CYP17 gene was located in a single-linkage disequilibrium block. This block was observed to be significantly associated with BMI. A major haplotype in this block was significantly associated with both BMI and fat mass. In conclusion, we suggest that the CYP17 gene has an effect on obesity in the Caucasian population. Further independent studies will be needed to confirm our findings.

  7. Atypical Features in a Large Turkish Family Affected with Friedreich Ataxia

    Directory of Open Access Journals (Sweden)

    Semiha Kurt

    2016-01-01

    Full Text Available Here, we describe the clinical features of several members of the same family diagnosed with Friedreich ataxia (FRDA and cerebral lesions, demyelinating neuropathy, and late-age onset without a significant cardiac involvement and presenting with similar symptoms, although genetic testing was negative for the GAA repeat expansion in one patient of the family. The GAA repeat expansion in the frataxin gene was shown in all of the family members except in a young female patient. MRI revealed arachnoid cysts in two patients; MRI was consistent with both cavum septum pellucidum-cavum vergae and nodular signal intensity increase in one patient. EMG showed demyelinating sensorimotor polyneuropathy in another patient. The GAA expansion-negative 11-year-old female patient had mental-motor retardation, epilepsy, and ataxia. None of the patients had significant cardiac symptoms. Description of FRDA families with different ethnic backgrounds may assist in identifying possible phenotypic and genetic features of the disease. Furthermore, the genetic heterogeneity observed in this family draws attention to the difficulty of genetic counseling in an inbred population and to the need for genotyping all affected members before delivering comprehensive genetic counseling.

  8. The zebrafish progranulin gene family and antisense transcripts

    Directory of Open Access Journals (Sweden)

    Baranowski David

    2005-11-01

    Full Text Available Abstract Background Progranulin is an epithelial tissue growth factor (also known as proepithelin, acrogranin and PC-cell-derived growth factor that has been implicated in development, wound healing and in the progression of many cancers. The single mammalian progranulin gene encodes a glycoprotein precursor consisting of seven and one half tandemly repeated non-identical copies of the cystine-rich granulin motif. A genome-wide duplication event hypothesized to have occurred at the base of the teleost radiation predicts that mammalian progranulin may be represented by two co-orthologues in zebrafish. Results The cDNAs encoding two zebrafish granulin precursors, progranulins-A and -B, were characterized and found to contain 10 and 9 copies of the granulin motif respectively. The cDNAs and genes encoding the two forms of granulin, progranulins-1 and -2, were also cloned and sequenced. Both latter peptides were found to be encoded by precursors with a simplified architecture consisting of one and one half copies of the granulin motif. A cDNA encoding a chimeric progranulin which likely arises through the mechanism of trans-splicing between grn1 and grn2 was also characterized. A non-coding RNA gene with antisense complementarity to both grn1 and grn2 was identified which may have functional implications with respect to gene dosage, as well as in restricting the formation of the chimeric form of progranulin. Chromosomal localization of the four progranulin (grn genes reveals syntenic conservation for grna only, suggesting that it is the true orthologue of mammalian grn. RT-PCR and whole-mount in situ hybridization analysis of zebrafish grns during development reveals that combined expression of grna and grnb, but not grn1 and grn2, recapitulate many of the expression patterns observed for the murine counterpart. This includes maternal deposition, widespread central nervous system distribution and specific localization within the epithelial

  9. Evolutionary study of vertebrate and invertebrate members of the dystrophin and utrophin gene family

    Energy Technology Data Exchange (ETDEWEB)

    Roberts, R.G.; Nicholson, L.; Bobrow, M. [Paediatric Research Unit, London (United Kingdom)] [and others

    1994-09-01

    Vertebrates express two members of the dystrophin gene family. The prototype, dystrophin, is expressed in muscle and neural tissue, and is defective in the human disorders Duchenne and Becker muscular dystrophy (DMD, BMD). The dystrophin homologue utrophin is more generally expressed but has not yet been associated with a genetic disorder. The function of neither protein is clear. A comparison of human utrophin with the known dystrophins (human, mouse, chicken, Torpedo) suggests that dystrophin and utrophin diverged before the vertebrate radiation. We have used reverse-transcript PCR (RT-PCR) directed by degenerate primers to characterize dystrophin and utrophin transcripts from a range of vertebrate and invertebrate animals. Our results suggest that the duplication leading to distinct dystrophin and utrophin genes occurred close to the point of divergence of urochordates from the cephalochordate-vertebrate lineage. This divergence may have occurred to fulfill a novel role which arose at this point, or may reflect a need for separate regulation of the neuromuscular and other functions of the ancient dystrophin. Our data include sequences of the first non-human utrophins to be characterized, and show these to be substantially more divergent than their cognate dystrophins. In addition, our results provide a large body of information regarding the tolerance of amino acid positions in the cysteine-rich and C-terminal domains to substitution. This will aid the interpretations of DMD and BMD missense mutations in these regions.

  10. Functional analysis of the ATP-binding cassette (ABC) transporter gene family of Tribolium castaneum.

    Science.gov (United States)

    Broehan, Gunnar; Kroeger, Tobias; Lorenzen, Marcé; Merzendorfer, Hans

    2013-01-16

    The ATP-binding cassette (ABC) transporters belong to a large superfamily of proteins that have important physiological functions in all living organisms. Most are integral membrane proteins that transport a broad spectrum of substrates across lipid membranes. In insects, ABC transporters are of special interest because of their role in insecticide resistance. We have identified 73 ABC transporter genes in the genome of T. castaneum, which group into eight subfamilies (ABCA-H). This coleopteran ABC family is significantly larger than those reported for insects in other taxonomic groups. Phylogenetic analysis revealed that this increase is due to gene expansion within a single clade of subfamily ABCC. We performed an RNA interference (RNAi) screen to study the function of ABC transporters during development. In ten cases, injection of double-stranded RNA (dsRNA) into larvae caused developmental phenotypes, which included growth arrest and localized melanization, eye pigmentation defects, abnormal cuticle formation, egg-laying and egg-hatching defects, and mortality due to abortive molting and desiccation. Some of the ABC transporters we studied in closer detail to examine their role in lipid, ecdysteroid and eye pigment transport. The results from our study provide new insights into the physiological function of ABC transporters in T. castaneum, and may help to establish new target sites for insect control.

  11. Zebrafish Expression Ontology of Gene Sets (ZEOGS): a tool to analyze enrichment of zebrafish anatomical terms in large gene sets.

    Science.gov (United States)

    Prykhozhij, Sergey V; Marsico, Annalisa; Meijsing, Sebastiaan H

    2013-09-01

    The zebrafish (Danio rerio) is an established model organism for developmental and biomedical research. It is frequently used for high-throughput functional genomics experiments, such as genome-wide gene expression measurements, to systematically analyze molecular mechanisms. However, the use of whole embryos or larvae in such experiments leads to a loss of the spatial information. To address this problem, we have developed a tool called Zebrafish Expression Ontology of Gene Sets (ZEOGS) to assess the enrichment of anatomical terms in large gene sets. ZEOGS uses gene expression pattern data from several sources: first, in situ hybridization experiments from the Zebrafish Model Organism Database (ZFIN); second, it uses the Zebrafish Anatomical Ontology, a controlled vocabulary that describes connected anatomical structures; and third, the available connections between expression patterns and anatomical terms contained in ZFIN. Upon input of a gene set, ZEOGS determines which anatomical structures are overrepresented in the input gene set. ZEOGS allows one for the first time to look at groups of genes and to describe them in terms of shared anatomical structures. To establish ZEOGS, we first tested it on random gene selections and on two public microarray datasets with known tissue-specific gene expression changes. These tests showed that ZEOGS could reliably identify the tissues affected, whereas only very few enriched terms to none were found in the random gene sets. Next we applied ZEOGS to microarray datasets of 24 and 72 h postfertilization zebrafish embryos treated with beclomethasone, a potent glucocorticoid. This analysis resulted in the identification of several anatomical terms related to glucocorticoid-responsive tissues, some of which were stage-specific. Our studies highlight the ability of ZEOGS to extract spatial information from datasets derived from whole embryos, indicating that ZEOGS could be a useful tool to automatically analyze gene expression

  12. Zebrafish Expression Ontology of Gene Sets (ZEOGS): A Tool to Analyze Enrichment of Zebrafish Anatomical Terms in Large Gene Sets

    Science.gov (United States)

    Marsico, Annalisa

    2013-01-01

    Abstract The zebrafish (Danio rerio) is an established model organism for developmental and biomedical research. It is frequently used for high-throughput functional genomics experiments, such as genome-wide gene expression measurements, to systematically analyze molecular mechanisms. However, the use of whole embryos or larvae in such experiments leads to a loss of the spatial information. To address this problem, we have developed a tool called Zebrafish Expression Ontology of Gene Sets (ZEOGS) to assess the enrichment of anatomical terms in large gene sets. ZEOGS uses gene expression pattern data from several sources: first, in situ hybridization experiments from the Zebrafish Model Organism Database (ZFIN); second, it uses the Zebrafish Anatomical Ontology, a controlled vocabulary that describes connected anatomical structures; and third, the available connections between expression patterns and anatomical terms contained in ZFIN. Upon input of a gene set, ZEOGS determines which anatomical structures are overrepresented in the input gene set. ZEOGS allows one for the first time to look at groups of genes and to describe them in terms of shared anatomical structures. To establish ZEOGS, we first tested it on random gene selections and on two public microarray datasets with known tissue-specific gene expression changes. These tests showed that ZEOGS could reliably identify the tissues affected, whereas only very few enriched terms to none were found in the random gene sets. Next we applied ZEOGS to microarray datasets of 24 and 72 h postfertilization zebrafish embryos treated with beclomethasone, a potent glucocorticoid. This analysis resulted in the identification of several anatomical terms related to glucocorticoid-responsive tissues, some of which were stage-specific. Our studies highlight the ability of ZEOGS to extract spatial information from datasets derived from whole embryos, indicating that ZEOGS could be a useful tool to automatically analyze gene

  13. The SULTR gene family in maize (Zea mays L.): Gene cloning and expression analyses under sulfate starvation and abiotic stress.

    Science.gov (United States)

    Huang, Qin; Wang, Meiping; Xia, Zongliang

    2018-01-01

    Sulfur is an essential macronutrient required for plant growth, development and stress responses. The family of sulfate transporters (SULTRs) mediates the uptake and translocation of sulfate in higher plants. However, basic knowledge of the SULTR gene family in maize (Zea mays L.) is scarce. In this study, a genome-wide bioinformatic analysis of SULTR genes in maize was conducted, and the developmental expression patterns of the genes and their responses to sulfate starvation and abiotic stress were further investigated. The ZmSULTR family includes eight putative members in the maize genome and is clustered into four groups in the phylogenetic tree. These genes displayed differential expression patterns in various organs of maize. For example, expression of ZmSULTR1;1 and ZmSULTR4;1 was high in roots, and transcript levels of ZmSULTR3;1 and ZmSULTR3;3 were high in shoots. Expression of ZmSULTR1;2, ZmSULTR2;1, ZmSULTR3;3, and ZmSULTR4;1 was high in flowers. Also, these eight genes showed differential responses to sulfate deprivation in roots and shoots of maize seedlings. Transcript levels of ZmSULTR1;1, ZmSULTR1;2, and ZmSULTR3;4 were significantly increased in roots during 12-day-sulfate starvation stress, while ZmSULTR3;3 and ZmSULTR3;5 only showed an early response pattern in shoots. In addition, dynamic transcriptional changes determined via qPCR revealed differential expression profiles of these eight ZmSULTR genes in response to environmental stresses such as salt, drought, and heat stresses. Notably, all the genes, except for ZmSULTR3;3, were induced by drought and heat stresses. However, a few genes were induced by salt stress. Physiological determination showed that two important thiol-containing compounds, cysteine and glutathione, increased significantly under these abiotic stresses. The results suggest that members of the SULTR family might function in adaptations to sulfur deficiency stress and adverse growing environments. This study will lay a

  14. The Vein Patterning 1 (VEP1 gene family laterally spread through an ecological network.

    Directory of Open Access Journals (Sweden)

    Rosa Tarrío

    Full Text Available Lateral gene transfer (LGT is a major evolutionary mechanism in prokaryotes. Knowledge about LGT--particularly, multicellular--eukaryotes has only recently started to accumulate. A widespread assumption sees the gene as the unit of LGT, largely because little is yet known about how LGT chances are affected by structural/functional features at the subgenic level. Here we trace the evolutionary trajectory of VEin Patterning 1, a novel gene family known to be essential for plant development and defense. At the subgenic level VEP1 encodes a dinucleotide-binding Rossmann-fold domain, in common with members of the short-chain dehydrogenase/reductase (SDR protein family. We found: i VEP1 likely originated in an aerobic, mesophilic and chemoorganotrophic α-proteobacterium, and was laterally propagated through nets of ecological interactions, including multiple LGTs between phylogenetically distant green plant/fungi-associated bacteria, and five independent LGTs to eukaryotes. Of these latest five transfers, three are ancient LGTs, implicating an ancestral fungus, the last common ancestor of land plants and an ancestral trebouxiophyte green alga, and two are recent LGTs to modern embryophytes. ii VEP1's rampant LGT behavior was enabled by the robustness and broad utility of the dinucleotide-binding Rossmann-fold, which provided a platform for the evolution of two unprecedented departures from the canonical SDR catalytic triad. iii The fate of VEP1 in eukaryotes has been different in different lineages, being ubiquitous and highly conserved in land plants, whereas fungi underwent multiple losses. And iv VEP1-harboring bacteria include non-phytopathogenic and phytopathogenic symbionts which are non-randomly distributed with respect to the type of harbored VEP1 gene. Our findings suggest that VEP1 may have been instrumental for the evolutionary transition of green plants to land, and point to a LGT-mediated 'Trojan Horse' mechanism for the evolution of

  15. Genome-Wide Analysis of the Aquaporin Gene Family in Chickpea (Cicer arietinum L.).

    Science.gov (United States)

    Deokar, Amit A; Tar'an, Bunyamin

    2016-01-01

    Aquaporins (AQPs) are essential membrane proteins that play critical role in the transport of water and many other solutes across cell membranes. In this study, a comprehensive genome-wide analysis identified 40 AQP genes in chickpea ( Cicer arietinum L.). A complete overview of the chickpea AQP (CaAQP) gene family is presented, including their chromosomal locations, gene structure, phylogeny, gene duplication, conserved functional motifs, gene expression, and conserved promoter motifs. To understand AQP's evolution, a comparative analysis of chickpea AQPs with AQP orthologs from soybean, Medicago, common bean, and Arabidopsis was performed. The chickpea AQP genes were found on all of the chickpea chromosomes, except chromosome 7, with a maximum of six genes on chromosome 6, and a minimum of one gene on chromosome 5. Gene duplication analysis indicated that the expansion of chickpea AQP gene family might have been due to segmental and tandem duplications. CaAQPs were grouped into four subfamilies including 15 NOD26-like intrinsic proteins (NIPs), 13 tonoplast intrinsic proteins (TIPs), eight plasma membrane intrinsic proteins (PIPs), and four small basic intrinsic proteins (SIPs) based on sequence similarities and phylogenetic position. Gene structure analysis revealed a highly conserved exon-intron pattern within CaAQP subfamilies supporting the CaAQP family classification. Functional prediction based on conserved Ar/R selectivity filters, Froger's residues, and specificity-determining positions suggested wide differences in substrate specificity among the subfamilies of CaAQPs. Expression analysis of the AQP genes indicated that some of the genes are tissue-specific, whereas few other AQP genes showed differential expression in response to biotic and abiotic stresses. Promoter profiling of CaAQP genes for conserved cis -acting regulatory elements revealed enrichment of cis -elements involved in circadian control, light response, defense and stress responsiveness

  16. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

    Science.gov (United States)

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-06-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  17. Assembled Plastid and Mitochondrial Genomes, as well as Nuclear Genes, Place the Parasite Family Cynomoriaceae in the Saxifragales.

    Science.gov (United States)

    Bellot, Sidonie; Cusimano, Natalie; Luo, Shixiao; Sun, Guiling; Zarre, Shahin; Gröger, Andreas; Temsch, Eva; Renner, Susanne S

    2016-08-03

    Cynomoriaceae, one of the last unplaced families of flowering plants, comprise one or two species or subspecies of root parasites that occur from the Mediterranean to the Gobi Desert. Using Illumina sequencing, we assembled the mitochondrial and plastid genomes as well as some nuclear genes of a Cynomorium specimen from Italy. Selected genes were also obtained by Sanger sequencing from individuals collected in China and Iran, resulting in matrices of 33 mitochondrial, 6 nuclear, and 14 plastid genes and rDNAs enlarged to include a representative angiosperm taxon sampling based on data available in GenBank. We also compiled a new geographic map to discern possible discontinuities in the parasites' occurrence. Cynomorium has large genomes of 13.70-13.61 (Italy) to 13.95-13.76 pg (China). Its mitochondrial genome consists of up to 49 circular subgenomes and has an overall gene content similar to that of photosynthetic angiosperms, while its plastome retains only 27 of the normally 116 genes. Nuclear, plastid and mitochondrial phylogenies place Cynomoriaceae in Saxifragales, and we found evidence for several horizontal gene transfers from different hosts, as well as intracellular gene transfers. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Genome-wide investigation and transcriptome analysis of the WRKY gene family in Gossypium.

    Science.gov (United States)

    Ding, Mingquan; Chen, Jiadong; Jiang, Yurong; Lin, Lifeng; Cao, YueFen; Wang, Minhua; Zhang, Yuting; Rong, Junkang; Ye, Wuwei

    2015-02-01

    WRKY transcription factors play important roles in various stress responses in diverse plant species. In cotton, this family has not been well studied, especially in relation to fiber development. Here, the genomes and transcriptomes of Gossypium raimondii and Gossypium arboreum were investigated to identify fiber development related WRKY genes. This represents the first comprehensive comparative study of WRKY transcription factors in both diploid A and D cotton species. In total, 112 G. raimondii and 109 G. arboreum WRKY genes were identified. No significant gene structure or domain alterations were detected between the two species, but many SNPs distributed unequally in exon and intron regions. Physical mapping revealed that the WRKY genes in G. arboreum were not located in the corresponding chromosomes of G. raimondii, suggesting great chromosome rearrangement in the diploid cotton genomes. The cotton WRKY genes, especially subgroups I and II, have expanded through multiple whole genome duplications and tandem duplications compared with other plant species. Sequence comparison showed many functionally divergent sites between WRKY subgroups, while the genes within each group are under strong purifying selection. Transcriptome analysis suggested that many WRKY genes participate in specific fiber development processes such as fiber initiation, elongation and maturation with different expression patterns between species. Complex WRKY gene expression such as differential Dt and At allelic gene expression in G. hirsutum and alternative splicing events were also observed in both diploid and tetraploid cottons during fiber development process. In conclusion, this study provides important information on the evolution and function of WRKY gene family in cotton species.

  19. A novel heterozygous mutation in the Indian hedgehog gene (IHH) is associated with brachydactyly type A1 in a Chinese family.

    Science.gov (United States)

    Liu, Mugen; Wang, Xu; Cai, Zhou; Tang, Zhaohui; Cao, Kangsheng; Liang, Bo; Ren, Xiang; Liu, Jing Yu; Wang, Qing K

    2006-01-01

    Brachydactyly type A1 (BDA1) is caused by mutations in the Indian hedgehog gene, IHH, on chromosome 2q35-36. In this study, a large five-generation Chinese family with BDA1 was identified and characterized. All affected family members demonstrated significant homogeneous phenotype and some unique clinical features different from those associated with the reported BDA1 mutations in IHH. Linkage analysis showed that the BDA1 gene in the family was linked to marker D2S126 close to IHH with a LOD score of 4.74 at a recombination fraction of 0. DNA sequence analysis revealed a heterozygous C to T transition at nucleotide 461 of IHH, resulting in a novel T154I substitution. The T154I mutation co-segregated with all affected individuals in the family, and was not present in normal family members or 200 normal controls. These results expand the spectrum of clinical phenotype associated with IHH mutations.

  20. R47H Variant of TREM2 Associated With Alzheimer Disease in a Large Late-Onset Family

    Science.gov (United States)

    Korvatska, Olena; Leverenz, James B.; Jayadev, Suman; McMillan, Pamela; Kurtz, Irina; Guo, Xindi; Rumbaugh, Malia; Matsushita, Mark; Girirajan, Santhosh; Dorschner, Michael O.; Kiianitsa, Kostantin; Yu, Chang-En; Brkanac, Zoran; Garden, Gwenn A.; Raskind, Wendy H.; Bird, Thomas D.

    2016-01-01

    Importance The R47H variant in the triggering receptor expressed on myeloid cells 2 gene (TREM2), a modulator of the immune response of microglia, is a strong genetic risk factor for Alzheimer disease (AD) and possibly other neurodegenerative disorders. Objective To investigate a large family with late-onset AD (LOAD), in which R47H cosegregated with 75% of cases. Design, Setting, and Participants This study includes genetic and pathologic studies of families with LOAD from 1985 to 2014. A total of 131 families with LOAD (751 individuals) were included from the University of Washington Alzheimer Disease Research Center. To identify LOAD genes/risk factors in the LOAD123 family with 21 affected members and 12 autopsies, we sequenced 4 exomes. Candidate variants were tested for cosegregation with the disease. TREM2 R47H was genotyped in an additional 130 families with LOAD. We performed clinical and neuropathological assessments of patients with and without R47H and evaluated the variant's effect on brain pathology, cellular morphology, and expression of microglial markers. Main Outcomes and Measures We assessed the effect of TREM2 genotype on age at onset and disease duration. We compared Braak and Consortium to Establish a Registry for Alzheimer's Disease scores, presence of α-synuclein and TAR DNA-binding protein 43 aggregates, and additional vascular or Parkinson pathology in TREM2 R47H carriers vs noncarriers. Microglial activation was assessed by quantitative immunohistochemistry and morphometry. Results Twelve of 16 patients with AD in the LOAD123 family carried R47H. Eleven patients with dementia had apolipoprotein E 4 (ApoE4) and R47H genotypes. We also found a rare missense variant, D353N, in a nominated AD risk gene, unc-5 homolog C (UNC5C), in 5 affected individuals in the LOAD123 family. R47H carriers demonstrated a shortened disease duration (mean [SD], 6.7 [2.8] vs 11.1 [6.6] years; 2-tailed t test; P = .04) and more frequent α-synucleinopathy. The

  1. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Directory of Open Access Journals (Sweden)

    Saleha S

    2016-06-01

    Full Text Available Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family.

  2. Gene mapping in an anophthalmic pedigree of a consanguineous Pakistani family opened new horizons for research

    Science.gov (United States)

    Ajmal, M; Zafar, S; Hameed, A

    2016-01-01

    ABSTRACT Clinical anophthalmia is a rare inherited disease of the eye and phenotype refers to the absence of ocular tissue in the orbit of eye. Patients may have unilateral or bilateral anophthalmia, and generally have short palpebral fissures and small orbits. Anophthalmia may be isolated or associated with a broader syndrome and may have genetic or environmental causes. However, genetic cause has been defined in only a small proportion of cases, therefore, a consanguineous Pakistani family of the Pashtoon ethnic group, with isolated clinical anophthalmia was investigated using linkage mapping. A family pedigree was created to trace the possible mode of inheritance of the disease. Blood samples were collected from affected as well as normal members of this family, and screened for disease-associated mutations. This family was analyzed for linkage to all the known loci of clinical anophthalmia, using microsatellite short tandem repeat (STR) markers. Direct sequencing was performed to find out disease-associated mutations in the candidate gene. This family with isolated clinical anophthalmia, was mapped to the SOX2 gene that is located at chromosome 3q26.3-q27. However, on exonic and regulatory regions mutation screening of the SOX2 gene, the disease-associated mutation was not identified. It showed that another gene responsible for development of the eye might be present at chromosome 3q26.3-q27 and needs to be identified and screened for the disease-associated mutation in this family. PMID:27785411

  3. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups.

    Science.gov (United States)

    Shiao, S Pamela K; Grayson, James; Yu, Chong Ho; Wasek, Brandi; Bottiglieri, Teodoro

    2018-02-16

    For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene-environment interactions and predictors of colorectal cancer (CRC) by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black). We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls ( p relation to gene-environment interactions in the prevention of CRC.

  4. Aux/IAA Gene Family in Plants: Molecular Structure, Regulation, and Function

    Directory of Open Access Journals (Sweden)

    Jie Luo

    2018-01-01

    Full Text Available Auxin plays a crucial role in the diverse cellular and developmental responses of plants across their lifespan. Plants can quickly sense and respond to changes in auxin levels, and these responses involve several major classes of auxin-responsive genes, including the Auxin/Indole-3-Acetic Acid (Aux/IAA family, the auxin response factor (ARF family, small auxin upregulated RNA (SAUR, and the auxin-responsive Gretchen Hagen3 (GH3 family. Aux/IAA proteins are short-lived nuclear proteins comprising several highly conserved domains that are encoded by the auxin early response gene family. These proteins have specific domains that interact with ARFs and inhibit the transcription of genes activated by ARFs. Molecular studies have revealed that Aux/IAA family members can form diverse dimers with ARFs to regulate genes in various ways. Functional analyses of Aux/IAA family members have indicated that they have various roles in plant development, such as root development, shoot growth, and fruit ripening. In this review, recently discovered details regarding the molecular characteristics, regulation, and protein–protein interactions of the Aux/IAA proteins are discussed. These details provide new insights into the molecular basis of the Aux/IAA protein functions in plant developmental processes.

  5. Evaluating the feasibility of using candidate DNA barcodes in discriminating species of the large Asteraceae family.

    Science.gov (United States)

    Gao, Ting; Yao, Hui; Song, Jingyuan; Zhu, Yingjie; Liu, Chang; Chen, Shilin

    2010-10-26

    Five DNA regions, namely, rbcL, matK, ITS, ITS2, and psbA-trnH, have been recommended as primary DNA barcodes for plants. Studies evaluating these regions for species identification in the large plant taxon, which includes a large number of closely related species, have rarely been reported. The feasibility of using the five proposed DNA regions was tested for discriminating plant species within Asteraceae, the largest family of flowering plants. Among these markers, ITS2 was the most useful in terms of universality, sequence variation, and identification capability in the Asteraceae family. The species discriminating power of ITS2 was also explored in a large pool of 3,490 Asteraceae sequences that represent 2,315 species belonging to 494 different genera. The result shows that ITS2 correctly identified 76.4% and 97.4% of plant samples at the species and genus levels, respectively. In addition, ITS2 displayed a variable ability to discriminate related species within different genera. ITS2 is the best DNA barcode for the Asteraceae family. This approach significantly broadens the application of DNA barcoding to resolve classification problems in the family Asteraceae at the genera and species levels.

  6. Evaluating the feasibility of using candidate DNA barcodes in discriminating species of the large Asteraceae family

    Directory of Open Access Journals (Sweden)

    Liu Chang

    2010-10-01

    Full Text Available Abstract Background Five DNA regions, namely, rbcL, matK, ITS, ITS2, and psbA-trnH, have been recommended as primary DNA barcodes for plants. Studies evaluating these regions for species identification in the large plant taxon, which includes a large number of closely related species, have rarely been reported. Results The feasibility of using the five proposed DNA regions was tested for discriminating plant species within Asteraceae, the largest family of flowering plants. Among these markers, ITS2 was the most useful in terms of universality, sequence variation, and identification capability in the Asteraceae family. The species discriminating power of ITS2 was also explored in a large pool of 3,490 Asteraceae sequences that represent 2,315 species belonging to 494 different genera. The result shows that ITS2 correctly identified 76.4% and 97.4% of plant samples at the species and genus levels, respectively. In addition, ITS2 displayed a variable ability to discriminate related species within different genera. Conclusions ITS2 is the best DNA barcode for the Asteraceae family. This approach significantly broadens the application of DNA barcoding to resolve classification problems in the family Asteraceae at the genera and species levels.

  7. The role of IL-4 gene 70 bp VNTR and ACE gene I/D variants in Familial Mediterranean fever.

    Science.gov (United States)

    Yigit, Serbülent; Tural, Sengul; Tekcan, Akın; Tasliyurt, Turker; Inanir, Ahmet; Uzunkaya, Süheyla; Kismali, Gorkem

    2014-05-01

    Familial Mediterranean fever (FMF) is characterized by recurrent attacks of fever and inflammation in the peritoneum, synovium, or pleura, accompanied by pain. It is an autosomal recessive disease caused by mutations in the MEFV (MEditerranean FeVer) gene. Patients with similar genotypes exhibit phenotypic diversity. As a result, the variations in different genes could be responsible for the clinical findings of this disease. In previous studies genes encoding Angiotensin-Converting Enzyme (ACE) and IL-4 (Interleukin-4) were found to be associated with rheumatologic and autoimmune diseases. In the present study we hypothesized whether ACE I/D or IL-4 70 bp variable tandem repeats (VNTR) genes are associated with FMF and its clinical findings in Turkish patients. Genomic DNA obtained from 670 persons (339 patients with FMF and 331 healthy controls) was used in the study. Genotypes for an ACE gene I/D polymorphism and IL-4 gene 70 bp VNTR were determined by polymerase chain reaction with specific primers. To our knowledge, this is the first study examining ACE gene I/D polymorphism and IL-4 gene 70 bp VNTR polymorphism in FMF patients. As a result, there was a statistically significant difference between the groups with respect to genotype distribution (pACE gene DD genotype was associated with an increased risk in FMF [pACE genotype frequencies according to the clinical characteristics, we found a statistically significant association between DD+ID genotype and fever (p=0.04). In addition IL-4 gene P1P1 genotype was associated with FMF (pACE gene and P1 allele or P1P1 genotype of IL-4 gene may be important molecular markers for susceptibility of FMF. Copyright © 2014 Elsevier Ltd. All rights reserved.

  8. [PAX3 gene mutation analysis for two Waardenburg syndrome type Ⅰ families and their prenatal diagnosis].

    Science.gov (United States)

    Bai, Y; Liu, N; Kong, X D; Yan, J; Qin, Z B; Wang, B

    2016-12-07

    Objective: To analyze the mutations of PAX3 gene in two Waardenburg syndrome type Ⅰ (WS1) pedigrees and make prenatal diagnosis for the high-risk 18-week-old fetus. Methods: PAX3 gene was first analyzed by Sanger sequencing and multiplex ligation-dependent probe amplification(MLPA) for detecting pathogenic mutation of the probands of the two pedigrees. The mutations were confirmed by MLPA and Sanger in parents and unrelated healthy individuals.Prenatal genetic diagnosis for the high-risk fetus was performed by amniotic fluid cell after genotyping. Results: A heterozygous PAX3 gene gross deletion (E7 deletion) was identified in all patients from WS1-01 family, and not found in 20 healthy individuals.Prenatal diagnosis in WS1-01 family indicated that the fetus was normal. Molecular studies identified a novel deletion mutation c. 1385_1386delCT within the PAX3 gene in all affected WS1-02 family members, but in none of the unaffected relatives and 200 healthy individuals. Conclusions: PAX3 gene mutation is etiological for two WS1 families. Sanger sequencing plus MLPA is effective and accurate for making gene diagnosis and prenatal diagnosis.

  9. Distribution of mutations in the PEX gene in families with X-linked hypophosphataemic rickets (HYP).

    Science.gov (United States)

    Rowe, P S; Oudet, C L; Francis, F; Sinding, C; Pannetier, S; Econs, M J; Strom, T M; Meitinger, T; Garabedian, M; David, A; Macher, M A; Questiaux, E; Popowska, E; Pronicka, E; Read, A P; Mokrzycki, A; Glorieux, F H; Drezner, M K; Hanauer, A; Lehrach, H; Goulding, J N; O'Riordan, J L

    1997-04-01

    Mutations in the PEX gene at Xp22.1 (phosphate-regulating gene with homologies to endopeptidases, on the X-chromosome), are responsible for X-linked hypophosphataemic rickets (HYP). Homology of PEX to the M13 family of Zn2+ metallopeptidases which include neprilysin (NEP) as prototype, has raised important questions regarding PEX function at the molecular level. The aim of this study was to analyse 99 HYP families for PEX gene mutations, and to correlate predicted changes in the protein structure with Zn2+ metallopeptidase gene function. Primers flanking 22 characterised exons were used to amplify DNA by PCR, and SSCP was then used to screen for mutations. Deletions, insertions, nonsense mutations, stop codons and splice mutations occurred in 83% of families screened for in all 22 exons, and 51% of a separate set of families screened in 17 PEX gene exons. Missense mutations in four regions of the gene were informative regarding function, with one mutation in the Zn2+-binding site predicted to alter substrate enzyme interaction and catalysis. Computer analysis of the remaining mutations predicted changes in secondary structure, N-glycosylation, protein phosphorylation and catalytic site molecular structure. The wide range of mutations that align with regions required for protease activity in NEP suggests that PEX also functions as a protease, and may act by processing factor(s) involved in bone mineral metabolism.

  10. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  11. Molecular analysis of recombination in a family with Duchenne muscular dystrophy and a large pericentric X chromosome inversion

    Energy Technology Data Exchange (ETDEWEB)

    Shashi, V.; Golden, W.L.; Allinson, P.S. [Univ. of Virginia Health Sciences Center, Charlottesville, VA (United States)] [and others

    1996-06-01

    It has been demonstrated in animal studies that, in animals heterozygous for pericentric chromosomal inversions, loop formation is greatly reduced during meiosis. This results in absence of recombination within the inverted segment, with recombination seen only outside the inversion. A recent study in yeast has shown that telomeres, rather than centromeres, lead in chromosome movement just prior to meiosis and may be involved in promoting recombination. We studied by cytogenetic analysis and DNA polymorphisms the nature of meiotic recombination in a three-generation family with a large pericentric X chromosome inversion, inv(X)(p21.1q26), in which Duchenne muscular dystrophy (DMD) was cosegregating with the inversion. On DNA analysis there was no evidence of meiotic recombination between the inverted and normal X chromosomes in the inverted segment. Recombination was seen at the telomeric regions, Xp22 and Xq27-28. No deletion or point mutation was found on analysis of the DMD gene. On the basis of the FISH results, we believe that the X inversion is the mutation responsible for DMD in this family. Our results indicate that (1) pericentric X chromosome inversions result in reduction of recombination between the normal and inverted X chromosomes; (2) meiotic X chromosome pairing in these individuals is likely initiated at the telomeres; and (3) in this family DMD is caused by the pericentric inversion. 50 refs., 7 figs., 1 tab.

  12. Two Paralogous Families of a Two-Gene Subtilisin Operon Are Widely Distributed in Oral Treponemes

    Science.gov (United States)

    Correia, Frederick F.; Plummer, Alvin R.; Ellen, Richard P.; Wyss, Chris; Boches, Susan K.; Galvin, Jamie L.; Paster, Bruce J.; Dewhirst, Floyd E.

    2003-01-01

    Certain oral treponemes express a highly proteolytic phenotype and have been associated with periodontal diseases. The periodontal pathogen Treponema denticola produces dentilisin, a serine protease of the subtilisin family. The two-gene operon prcA-prtP is required for expression of active dentilisin (PrtP), a putative lipoprotein attached to the treponeme's outer membrane or sheath. The purpose of this study was to examine the diversity and structure of treponemal subtilisin-like proteases in order to better understand their distribution and function. The complete sequences of five prcA-prtP operons were determined for Treponema lecithinolyticum, “Treponema vincentii,” and two canine species. Partial operon sequences were obtained for T. socranskii subsp. 04 as well as 450- to 1,000-base fragments of prtP genes from four additional treponeme strains. Phylogenetic analysis demonstrated that the sequences fall into two paralogous families. The first family includes the sequence from T. denticola. Treponemes possessing this operon family express chymotrypsin-like protease activity and can cleave the substrate N-succinyl-alanyl-alanyl-prolyl-phenylalanine-p-nitroanilide (SAAPFNA). Treponemes possessing the second paralog family do not possess chymotrypsin-like activity or cleave SAAPFNA. Despite examination of a range of protein and peptide substrates, the specificity of the second protease family remains unknown. Each of the fully sequenced prcA and prtP genes contains a 5′ hydrophobic leader sequence with a treponeme lipobox. The two paralogous families of treponeme subtilisins represent a new subgroup within the subtilisin family of proteases and are the only subtilisin lipoprotein family. The present study demonstrated that the subtilisin paralogs comprising a two-gene operon are widely distributed among treponemes. PMID:14617650

  13. The Mycobacterium leprae antigen 85 complex gene family: identification of the genes for the 85A, 85C, and related MPT51 proteins

    NARCIS (Netherlands)

    Rinke de Wit, T. F.; Bekelie, S.; Osland, A.; Wieles, B.; Janson, A. A.; Thole, J. E.

    1993-01-01

    The genes for two novel members (designated 85A and 85C) of the Mycobacterium leprae antigen 85 complex family of proteins and the gene for the closely related M. leprae MPT51 protein were isolated. The complete DNA sequence of the M. leprae 85C gene and partial sequences of the 85A and MPT51 genes

  14. Analysis of factor VIII gene inversions in 164 unrelated hemophilia A families

    Energy Technology Data Exchange (ETDEWEB)

    Vnencak-Jones, L.; Phillips, J.A. III; Janco, R.L. [Vanderbilt Univ. School of Medicine, Nashville, TN (United States)] [and others

    1994-09-01

    Hemophilia A is an X-linked recessive disease with variable phenotype and both heterogeneous and wide spread mutations in the factor VIII (F8) gene. As a result, diagnostic carrier or prenatal testing often relies upon laborious DNA linkage analysis. Recently, inversion mutations resulting from an intrachromosomal recombination between DNA sequences in one of two A genes {approximately}500 kb upstream from the F8 gene and a homologous A gene in intron 22 of the F8 gene were identified and found in 45% of severe hemophiliacs. We have analyzed banked DNA collected since 1986 from affected males or obligate carrier females representing 164 unrelated hemophilia A families. The disease was sporadic in 37%, familial in 54% and in 10% of families incomplete information was given. A unique deletion was identified in 1/164, a normal pattern was observed in 110/164 (67%), and 53/164 (32%) families had inversion mutations with 43/53 (81%) involving the distal A gene (R3 pattern) and 10/53 (19%) involving the proximal A gene (R2 pattern). While 19% of all rearrangements were R2, in 35 families with severe disease (< 1% VIII:C activity) all 16 rearrangements seen were R3. In 18 families with the R3 pattern and known activities, 16 (89%) had levels < 1%, with the remaining 2 families having {le} 2.4% activity. Further, 18 referrals specifically noted the production of inhibitors and 8/18 (45%) had the R3 pattern. Our findings demonstrate that the R3 inversion mutation patterns is (1) only seen with VIII:C activity levels of {le} 2.4%, (2) seen in 46% of families with severe hemophilia, (3) seen in 45% of hemophiliacs known to have inhibitors, (4) not correlated with sporadic or familial disease and (5) not in disequilibrium with the Bcl I or Taq I intron 18 or ST14 polymorphisms. Finally, in families positive for an inversion mutation, direct testing offers a highly accurate and less expensive alternative to DNA linkage analysis.

  15. Mutation analysis of pre-mRNA splicing genes in Chinese families with retinitis pigmentosa

    Science.gov (United States)

    Pan, Xinyuan; Chen, Xue; Liu, Xiaoxing; Gao, Xiang; Kang, Xiaoli; Xu, Qihua; Chen, Xuejuan; Zhao, Kanxing; Zhang, Xiumei; Chu, Qiaomei; Wang, Xiuying

    2014-01-01

    Purpose Seven genes involved in precursor mRNA (pre-mRNA) splicing have been implicated in autosomal dominant retinitis pigmentosa (adRP). We sought to detect mutations in all seven genes in Chinese families with RP, to characterize the relevant phenotypes, and to evaluate the prevalence of mutations in splicing genes in patients with adRP. Methods Six unrelated families from our adRP cohort (42 families) and two additional families with RP with uncertain inheritance mode were clinically characterized in the present study. Targeted sequence capture with next-generation massively parallel sequencing (NGS) was performed to screen mutations in 189 genes including all seven pre-mRNA splicing genes associated with adRP. Variants detected with NGS were filtered with bioinformatics analyses, validated with Sanger sequencing, and prioritized with pathogenicity analysis. Results Mutations in pre-mRNA splicing genes were identified in three individual families including one novel frameshift mutation in PRPF31 (p.Leu366fs*1) and two known mutations in SNRNP200 (p.Arg681His and p.Ser1087Leu). The patients carrying SNRNP200 p.R681H showed rapid disease progression, and the family carrying p.S1087L presented earlier onset ages and more severe phenotypes compared to another previously reported family with p.S1087L. In five other families, we identified mutations in other RP-related genes, including RP1 p. Ser781* (novel), RP2 p.Gln65* (novel) and p.Ile137del (novel), IMPDH1 p.Asp311Asn (recurrent), and RHO p.Pro347Leu (recurrent). Conclusions Mutations in splicing genes identified in the present and our previous study account for 9.5% in our adRP cohort, indicating the important role of pre-mRNA splicing deficiency in the etiology of adRP. Mutations in the same splicing gene, or even the same mutation, could correlate with different phenotypic severities, complicating the genotype–phenotype correlation and clinical prognosis. PMID:24940031

  16. Members of the Dof transcription factor family in Triticum aestivum are associated with light-mediated gene regulation.

    Science.gov (United States)

    Shaw, Lindsay M; McIntyre, C Lynne; Gresshoff, Peter M; Xue, Gang-Ping

    2009-11-01

    DNA binding with One Finger (Dof) protein is a plant-specific transcription factor implicated in the regulation of many important plant-specific processes, including photosynthesis and carbohydrate metabolism. This study has identified 31 Dof genes (TaDof) in bread wheat through extensive analysis of current nucleotide databases. Phylogenetic analysis suggests that the TaDof family can be divided into four clades. Expression analysis of the TaDof family across all major organs using quantitative RT-PCR and searches of the wheat genome array database revealed that the majority of TaDof members were predominately expressed in vegetative organs. A large number of TaDof members were down-regulated by drought and/or were responsive to the light and dark cycle. Further expression analysis revealed that light up-regulated TaDof members were highly correlated in expression with a number of genes that are involved in photosynthesis or sucrose transport. These data suggest that the TaDof family may have an important role in light-mediated gene regulation, including involvement in the photosynthetic process.

  17. Genome-wide identification of the SWEET gene family in wheat.

    Science.gov (United States)

    Gao, Yue; Wang, Zi Yuan; Kumar, Vikranth; Xu, Xiao Feng; Yuan, De Peng; Zhu, Xiao Feng; Li, Tian Ya; Jia, Baolei; Xuan, Yuan Hu

    2018-02-05

    The SWEET (sugars will eventually be exported transporter) family is a newly characterized group of sugar transporters. In plants, the key roles of SWEETs in phloem transport, nectar secretion, pollen nutrition, stress tolerance, and plant-pathogen interactions have been identified. SWEET family genes have been characterized in many plant species, but a comprehensive analysis of SWEET members has not yet been performed in wheat. Here, 59 wheat SWEETs (hereafter TaSWEETs) were identified through homology searches. Analyses of phylogenetic relationships, numbers of transmembrane helices (TMHs), gene structures, and motifs showed that TaSWEETs carrying 3-7 TMHs could be classified into four clades with 10 different types of motifs. Examination of the expression patterns of 18 SWEET genes revealed that a few are tissue-specific while most are ubiquitously expressed. In addition, the stem rust-mediated expression patterns of SWEET genes were monitored using a stem rust-susceptible cultivar, 'Little Club' (LC). The resulting data showed that the expression of five out of the 18 SWEETs tested was induced following inoculation. In conclusion, we provide the first comprehensive analysis of the wheat SWEET gene family. Information regarding the phylogenetic relationships, gene structures, and expression profiles of SWEET genes in different tissues and following stem rust disease inoculation will be useful in identifying the potential roles of SWEETs in specific developmental and pathogenic processes. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members

    Directory of Open Access Journals (Sweden)

    Tianyu Zhou

    2015-01-01

    Full Text Available Peroxisome proliferators-activated receptor (PPAR gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3′ UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3′ UTR are essential for PPARs evolution and diversity functions acquired.

  19. Evolutionary Pattern and Regulation Analysis to Support Why Diversity Functions Existed within PPAR Gene Family Members.

    Science.gov (United States)

    Zhou, Tianyu; Yan, Xiping; Wang, Guosong; Liu, Hehe; Gan, Xiang; Zhang, Tao; Wang, Jiwen; Li, Liang

    2015-01-01

    Peroxisome proliferators-activated receptor (PPAR) gene family members exhibit distinct patterns of distribution in tissues and differ in functions. The purpose of this study is to investigate the evolutionary impacts on diversity functions of PPAR members and the regulatory differences on gene expression patterns. 63 homology sequences of PPAR genes from 31 species were collected and analyzed. The results showed that three isolated types of PPAR gene family may emerge from twice times of gene duplication events. The conserved domains of HOLI (ligand binding domain of hormone receptors) domain and ZnF_C4 (C4 zinc finger in nuclear in hormone receptors) are essential for keeping basic roles of PPAR gene family, and the variant domains of LCRs may be responsible for their divergence in functions. The positive selection sites in HOLI domain are benefit for PPARs to evolve towards diversity functions. The evolutionary variants in the promoter regions and 3' UTR regions of PPARs result into differential transcription factors and miRNAs involved in regulating PPAR members, which may eventually affect their expressions and tissues distributions. These results indicate that gene duplication event, selection pressure on HOLI domain, and the variants on promoter and 3' UTR are essential for PPARs evolution and diversity functions acquired.

  20. Identification and characterization of NF-YB family genes in tung tree.

    Science.gov (United States)

    Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun

    2015-12-01

    The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.

  1. Quantitative linkage genome scan for atopy in a large collection of Caucasian families

    DEFF Research Database (Denmark)

    Webb, BT; van den Oord, E; Akkari, A

    2007-01-01

    adulthood, asthma is frequently associated also with quantitative measures of atopy. Genome wide quantitative multipoint linkage analysis was conducted for serum IgE levels and percentage of positive skin prick test (SPT(per)) using three large groups of families originally ascertained for asthma....... In this report, 438 and 429 asthma families were informative for linkage using IgE and SPT(per) which represents 690 independent families. Suggestive linkage (LOD >/= 2) was found on chromosomes 1, 3, and 8q with maximum LODs of 2.34 (IgE), 2.03 (SPT(per)), and 2.25 (IgE) near markers D1S1653, D3S2322-D3S1764...... represents one of the biggest genome scans so far reported for asthma related phenotypes. This study also demonstrates the utility of increased sample sizes and quantitative phenotypes in linkage analysis of complex disorders....

  2. Quantitative linkage genome scan for atopy in a large collection of Caucasian families

    DEFF Research Database (Denmark)

    Webb, BT; van den Oord, E; Akkari, A

    2007-01-01

    Quantitative phenotypes correlated with a complex disorder offer increased power to detect linkage in comparison to affected-unaffected classifications. Asthma is a complex disorder characterized by periods of bronchial obstruction and increased bronchial hyper reactivity. In childhood and early...... adulthood, asthma is frequently associated also with quantitative measures of atopy. Genome wide quantitative multipoint linkage analysis was conducted for serum IgE levels and percentage of positive skin prick test (SPT(per)) using three large groups of families originally ascertained for asthma....... In this report, 438 and 429 asthma families were informative for linkage using IgE and SPT(per) which represents 690 independent families. Suggestive linkage (LOD >/= 2) was found on chromosomes 1, 3, and 8q with maximum LODs of 2.34 (IgE), 2.03 (SPT(per)), and 2.25 (IgE) near markers D1S1653, D3S2322-D3S1764...

  3. AtTZF gene family localizes to cytoplasmic foci

    OpenAIRE

    Pomeranz, Marcelo; Lin, Pei-Chi; Finer, John; Jang, Jyan-Chyun

    2010-01-01

    In eukaryotes, mRNA turnover and translational repression represent important regulatory steps in gene expression. Curiously, when under cellular stresses, factors involved in these processes aggregate into cytoplasmic foci known as Processing bodies (P-bodies) and Stress Granules (SGs). In animals, CCCH Tandem Zinc Finger (TZF) proteins play important roles in mRNA decay within P-bodies. TTP, a P-body localized mammalian TZF, can bind to the 3'UTRs of mRNAs containing AU-rich elements (AREs)...

  4. A mutation in the Norrie disease gene (NDP) associated with X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Chen, Z Y; Battinelli, E M; Fielder, A; Bundey, S; Sims, K; Breakefield, X O; Craig, I W

    1993-10-01

    Familial exudative vitreoretinopathy (FEVR) is a hereditary disorder characterized by an abnormality of the peripheral retina. Both autosomal dominant (adFEVR) and X-linked (XLFEVR) forms have been described, but the biochemical defect(s) underlying the symptoms are unknown. Molecular analysis of the Norrie gene locus (NDP) in a four generation FEVR family (shown previously to exhibit linkage to the X-chromosome markers DXS228 and MAOA (Xp11.4-p11.3)) reveals a missense mutation in the highly conserved region of the NDP gene, which caused a neutral amino acid substitution (Leu124Phe), was detected in all of the affected males, but not in the unaffected family members, nor in normal controls. The observations suggest that phenotypes of both XLFEVR and Norrie disease can result from mutations in the same gene.

  5. [Mutation analysis of FGFR3 gene in a family featuring hereditary dwarfism].

    Science.gov (United States)

    Zhang, Qiong; Jiang, Hai-ou; Quan, Qing-li; Li, Jun; He, Ting; Huang, Xue-shuang

    2011-12-01

    To investigate the clinical symptoms and potential mutation in FGFR3 gene for a family featuring hereditary dwarfism in order to attain diagnosis and provide prenatal diagnosis. Five patients and two unaffected relatives from the family, in addition with 100 healthy controls, were recruited. Genome DNA was extracted. Exons 10 and 13 of the FGFR3 gene were amplified using polymerase chain reaction (PCR). PCR products were sequenced in both directions. All patients had similar features including short stature, short limbs, lumbar hyperlordosis but normal craniofacial features. A heterozygous mutation G1620T (N540K) was identified in the cDNA from all patients but not in the unaffected relatives and 100 control subjects. A heterozygous G380R mutation was excluded. The hereditary dwarfism featured by this family has been caused by hypochondroplasia (HCH) due to a N540K mutation in the FGFR3 gene.

  6. Characterization of a large deletion in the {beta}-globin gene cluster in a newborn with hemoglobin FE

    Energy Technology Data Exchange (ETDEWEB)

    Louie, E.; Dietz, L.; Shafer, F. [Children`s Hosptial, Oakland, CA (United States)] [and others

    1994-09-01

    A sample on a newborn with hemoglobin FE screen results was obtained to investigate whether E/E or B/{beta}{degrees} thalassemia was present using polymerase chain reaction (PCR) methodology. The newborn appeared homozygous for the hemoglobin E mutation in our initial study, but the parents` genotypes did not support this diagnosis. The father is homozygous for the absence of the hemoglobin E mutation (non E/non E) and the mother is heterozygous (E/non E) for this mutation. The limitation of PCR analysis is an assumption that the amplification of the two {beta}-globin alleles is equivalent. A large deletion on one {beta}-globin gene, which would produce E/{beta}{degrees} thalassemia, would be missed if it included part or the entire region subjected to amplification. The family results were consistent with either non-paternity, sample mix-up or such a deletion of the {beta}-globin gene in the father and child. To rule out the possibility of non-paternity, two polymorphic loci (HLA on chromosome 6 and a VNTR system of chromosome 17) that are outside of the {beta}-globin gene were analyzed and show that inheritance is consistent and the likelihood of a sample mix-up is then reduced. We therefore believe there is a gene deletion in this family. At the present time, analyses of the RFLPs that are 5{prime} of the {beta}-globin gene cluster show that the polymorphisms most distal from the 5{prime} {beta}-globin gene are not being inherited as expected. These results support our interpretation that a deletion exists in the father and was inherited by the child. The father`s clinical picture of possible HPFH (the father has 12% hemoglobin F) also supports the interpretation of a deletion in this family. Deletions of the {beta}-globin gene within this ethnic group are rare. Currently, Southern blots on the family are being probed to determine the extent of the putative deletion.

  7. Comparative Genomics of Chrysochromulina Ericina Virus and Other Microalga-Infecting Large DNA Viruses Highlights Their Intricate Evolutionary Relationship with the Established Mimiviridae Family.

    Science.gov (United States)

    Gallot-Lavallée, Lucie; Blanc, Guillaume; Claverie, Jean-Michel

    2017-07-15

    Chrysochromulina ericina virus CeV-01B (CeV) was isolated from Norwegian coastal waters in 1998. Its icosahedral particle is 160 nm in diameter and encloses a 474-kb double-stranded DNA (dsDNA) genome. This virus, although infecting a microalga (the haptophyceae Haptolina ericina , formerly Chrysochromulina ericina ), is phylogenetically related to members of the Mimiviridae family, initially established with the acanthamoeba-infecting mimivirus and megavirus as prototypes. This family was later split into two genera ( Mimivirus and Cafeteriavirus ) following the characterization of a virus infecting the heterotrophic stramenopile Cafeteria roenbergensis (CroV). CeV, as well as two of its close relatives, which infect the unicellular photosynthetic eukaryotes Phaeocystis globosa (Phaeocystis globosa virus [PgV]) and Aureococcus anophagefferens (Aureococcus anophagefferens virus [AaV]), are currently unclassified by the International Committee on Viral Taxonomy (ICTV). The detailed comparative analysis of the CeV genome presented here confirms the phylogenetic affinity of this emerging group of microalga-infecting viruses with the Mimiviridae but argues in favor of their classification inside a distinct clade within the family. Although CeV, PgV, and AaV share more common features among them than with the larger Mimiviridae , they also exhibit a large complement of unique genes, attesting to their complex evolutionary history. We identified several gene fusion events and cases of convergent evolution involving independent lateral gene acquisitions. Finally, CeV possesses an unusual number of inteins, some of which are closely related despite being inserted in nonhomologous genes. This appears to contradict the paradigm of allele-specific inteins and suggests that the Mimiviridae are especially efficient in spreading inteins while enlarging their repertoire of homing genes. IMPORTANCE Although it infects the microalga Chrysochromulina ericina , CeV is more closely

  8. XLID-causing mutations and associated genes challenged in light of data from large-scale human exome sequencing.

    Science.gov (United States)

    Piton, Amélie; Redin, Claire; Mandel, Jean-Louis

    2013-08-08

    Because of the unbalanced sex ratio (1.3-1.4 to 1) observed in intellectual disability (ID) and the identification of large ID-affected families showing X-linked segregation, much attention has been focused on the genetics of X-linked ID (XLID). Mutations causing monogenic XLID have now been reported in over 100 genes, most of which are commonly included in XLID diagnostic gene panels. Nonetheless, the boundary between true mutations and rare non-disease-causing variants often remains elusive. The sequencing of a large number of control X chromosomes, required for avoiding false-positive results, was not systematically possible in the past. Such information is now available thanks to large-scale sequencing projects such as the National Heart, Lung, and Blood (NHLBI) Exome Sequencing Project, which provides variation information on 10,563 X chromosomes from the general population. We used this NHLBI cohort to systematically reassess the implication of 106 genes proposed to be involved in monogenic forms of XLID. We particularly question the implication in XLID of ten of them (AGTR2, MAGT1, ZNF674, SRPX2, ATP6AP2, ARHGEF6, NXF5, ZCCHC12, ZNF41, and ZNF81), in which truncating variants or previously published mutations are observed at a relatively high frequency within this cohort. We also highlight 15 other genes (CCDC22, CLIC2, CNKSR2, FRMPD4, HCFC1, IGBP1, KIAA2022, KLF8, MAOA, NAA10, NLGN3, RPL10, SHROOM4, ZDHHC15, and ZNF261) for which replication studies are warranted. We propose that similar reassessment of reported mutations (and genes) with the use of data from large-scale human exome sequencing would be relevant for a wide range of other genetic diseases. Copyright © 2013 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.

  9. Diagnosing CADASIL using MRI: evidence from families with known mutations of Notch 3 gene

    International Nuclear Information System (INIS)

    Chawda, S.J.; Lange, R.P.J. de; St-Clair, D.; Hourihan, M.D.; Halpin, S.F.S.

    2000-01-01

    Clinical data and MRI findings are presented on 18 subjects from two families with neuropathologically confirmed CADASIL. DNA analysis revealed mutations in exon 4 of Notch 3 gene in both families. All family members with mutations in Notch 3 gene had extensive abnormalities on MRI, principally lesions in the white matter of the frontal lobes and in the external capsules. Of several family members in whom a diagnosis of CADASIL was suspected on the basis of minor symptoms, one had MRI changes consistent with CADASIL; none of these cases carried a mutation in the Notch 3 gene. MRI and clinical features that may alert the radiologist to the diagnosis of CADASIL are reviewed. However, a wide differential diagnosis exists for the MRI appearances of CADASIL, including multiple sclerosis and small-vessel disease secondary to hypertension. The definitive diagnosis cannot be made on MRI alone and requires additional evidence, where available, from a positive family history and by screening DNA for mutations of Notch 3 gene. (orig.)

  10. New mutations in the NHS gene in Nance-Horan Syndrome families from the Netherlands.

    Science.gov (United States)

    Florijn, Ralph J; Loves, Willem; Maillette de Buy Wenniger-Prick, Liesbeth J J M; Mannens, Marcel M A M; Tijmes, Nel; Brooks, Simon P; Hardcastle, Alison J; Bergen, Arthur A B

    2006-09-01

    Mutations in the NHS gene cause Nance-Horan Syndrome (NHS), a rare X-chromosomal recessive disorder with variable features, including congenital cataract, microphthalmia, a peculiar form of the ear and dental anomalies. We investigated the NHS gene in four additional families with NHS from the Netherlands, by dHPLC and direct sequencing. We identified an unique mutation in each family. Three out of these four mutations were not reported before. We report here the first splice site sequence alteration mutation and three protein truncating mutations. Our results suggest that X-linked cataract and NHS are allelic disorders.

  11. Evaluation of the norrie disease gene in a family with incontinentia pigmenti.

    Science.gov (United States)

    Shastry, B S; Trese, M T

    2000-01-01

    Incontinentia pigmenti (IP) is an ectodermal multisystem disorder which can affect dental, ocular, cardiac and neurologic structures. The ocular changes of IP can have a very similar appearance to the retinal detachment of X-linked familial exudative vitreoretinopathy, which has been shown to be caused by the mutations in the Norrie disease gene. Therefore, it is of interest to determine whether similar mutations in the gene can account for the retinal pathology in patients with IP. To test our hypothesis, we have analyzed the entire Norrie disease gene for a family with IP, by single strand conformational polymorphism followed by DNA sequencing. The sequencing data revealed no disease-specific sequence alterations. These data suggest that ocular findings of IP are perhaps associated with different genes and there is no direct relationship between the genotype and phenotype. Copyright 2000 S. Karger AG, Basel

  12. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Directory of Open Access Journals (Sweden)

    Naoki Takata

    Full Text Available EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  13. Evolutionary relationship and structural characterization of the EPF/EPFL gene family.

    Science.gov (United States)

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that AtEPF1/EPF2-like peptides form an additional disulfide bond in their loop regions and show greater flexibility in these regions than AtEPFL9/Stomagen-like peptides. This study uncovered the evolutionary relationship and the conformational divergence of proteins encoded by the EPF/EPFL family genes.

  14. Functional Annotation, Genome Organization and Phylogeny of the Grapevine (Vitis vinifera Terpene Synthase Gene Family Based on Genome Assembly, FLcDNA Cloning, and Enzyme Assays

    Directory of Open Access Journals (Sweden)

    Toub Omid

    2010-10-01

    Full Text Available Abstract Background Terpenoids are among the most important constituents of grape flavour and wine bouquet, and serve as useful metabolite markers in viticulture and enology. Based on the initial 8-fold sequencing of a nearly homozygous Pinot noir inbred line, 89 putative terpenoid synthase genes (VvTPS were predicted by in silico analysis of the grapevine (Vitis vinifera genome assembly 1. The finding of this very large VvTPS family, combined with the importance of terpenoid metabolism for the organoleptic properties of grapevine berries and finished wines, prompted a detailed examination of this gene family at the genomic level as well as an investigation into VvTPS biochemical functions. Results We present findings from the analysis of the up-dated 12-fold sequencing and assembly of the grapevine genome that place the number of predicted VvTPS genes at 69 putatively functional VvTPS, 20 partial VvTPS, and 63 VvTPS probable pseudogenes. Gene discovery and annotation included information about gene architecture and chromosomal location. A dense cluster of 45 VvTPS is localized on chromosome 18. Extensive FLcDNA cloning, gene synthesis, and protein expression enabled functional characterization of 39 VvTPS; this is the largest number of functionally characterized TPS for any species reported to date. Of these enzymes, 23 have unique functions and/or phylogenetic locations within the plant TPS gene family. Phylogenetic analyses of the TPS gene family showed that while most VvTPS form species-specific gene clusters, there are several examples of gene orthology with TPS of other plant species, representing perhaps more ancient VvTPS, which have maintained functions independent of speciation. Conclusions The highly expanded VvTPS gene family underpins the prominence of terpenoid metabolism in grapevine. We provide a detailed experimental functional annotation of 39 members of this important gene family in grapevine and comprehensive information

  15. Positive selection in the SLC11A1 gene in the family Equidae

    DEFF Research Database (Denmark)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

    2016-01-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

  16. Genome-wide identification and characterization of the SBP-box gene family in Petunia.

    Science.gov (United States)

    Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng

    2018-03-12

    SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative

  17. [Study of gene mutation and pathogenetic mechanism for a family with Waardenburg syndrome].

    Science.gov (United States)

    Chen, Hongsheng; Liao, Xinbin; Liu, Yalan; He, Chufeng; Zhang, Hua; Jiang, Lu; Feng, Yong; Mei, Lingyun

    2017-08-10

    To explore the pathogenetic mechanism of a family affected with Waardenburg syndrome. Clinical data of the family was collected. Potential mutation of the MITF, SOX10 and SNAI2 genes were screened. Plasmids for wild type (WT) and mutant MITF proteins were constructed to determine their exogenous expression and subcellular distribution by Western blotting and immunofluorescence assay, respectively. A heterozygous c.763C>T (p.R255X) mutation was detected in exon 8 of the MITF gene in the proband and all other patients from the family. No pathological mutation of the SOX10 and SNAI2 genes was detected. The DNA sequences of plasmids of MITF wild and mutant MITF R255X were confirmed. Both proteins were detected with the expected size. WT MITF protein only localized in the nucleus, whereas R255X protein showed aberrant localization in the nucleus as well as the cytoplasm. The c.763C>T mutation of the MITF gene probably underlies the disease in this family. The mutation can affect the subcellular distribution of MITF proteins in vitro, which may shed light on the molecular mechanism of Waardenburg syndrome caused by mutations of the MITF gene.

  18. Prevalence of variations in melanoma susceptibility genes among Slovenian melanoma families

    Directory of Open Access Journals (Sweden)

    Besic Nikola

    2008-09-01

    Full Text Available Abstract Background Two high-risk genes have been implicated in the development of CM (cutaneous melanoma. Germline mutations of the CDKN2A gene are found in CDK4 gene reported to date. Beside those high penetrance genes, certain allelic variants of the MC1R gene modify the risk of developing the disease. The aims of our study were: to determine the prevalence of germline CDKN2A mutations and variants in members of families with familial CM and in patients with multiple primary CM; to search for possible CDK4 mutations, and to determine the frequency of variations in the MC1R gene. Methods From January 2001 until January 2007, 64 individuals were included in the study. The group included 28 patients and 7 healthy relatives belonging to 25 families, 26 patients with multiple primary tumors and 3 children with CM. Additionally 54 healthy individuals were included as a control group. Mutations and variants of the melanoma susceptibility genes were identified by direct sequencing. Results Seven families with CDKN2A mutations were discovered (7/25 or 28.0%. The L94Q mutation found in one family had not been previously reported in other populations. The D84N variant, with possible biological impact, was discovered in the case of patient without family history but with multiple primary CM. Only one mutation carrier was found in the control group. Further analysis revealed that c.540C>T heterozygous carriers were more common in the group of CM patients and their healthy relatives (11/64 vs. 2/54. One p14ARF variant was discovered in the control group and no mutations of the CDK4 gene were found. Most frequently found variants of the MC1R gene were T314T, V60L, V92M, R151C, R160W and R163Q with frequencies slightly higher in the group of patients and their relatives than in the group of controls, but the difference was statistically insignificant. Conclusion The present study has shown high prevalence of p16INK4A mutations in Slovenian population of

  19. A family of conjugate gradient methods for large-scale nonlinear equations

    Directory of Open Access Journals (Sweden)

    Dexiang Feng

    2017-09-01

    Full Text Available Abstract In this paper, we present a family of conjugate gradient projection methods for solving large-scale nonlinear equations. At each iteration, it needs low storage and the subproblem can be easily solved. Compared with the existing solution methods for solving the problem, its global convergence is established without the restriction of the Lipschitz continuity on the underlying mapping. Preliminary numerical results are reported to show the efficiency of the proposed method.

  20. A family of conjugate gradient methods for large-scale nonlinear equations.

    Science.gov (United States)

    Feng, Dexiang; Sun, Min; Wang, Xueyong

    2017-01-01

    In this paper, we present a family of conjugate gradient projection methods for solving large-scale nonlinear equations. At each iteration, it needs low storage and the subproblem can be easily solved. Compared with the existing solution methods for solving the problem, its global convergence is established without the restriction of the Lipschitz continuity on the underlying mapping. Preliminary numerical results are reported to show the efficiency of the proposed method.

  1. Comprehensive identification and expression analysis of Hsp90s gene family in Solanum lycopersicum.

    Science.gov (United States)

    Zai, W S; Miao, L X; Xiong, Z L; Zhang, H L; Ma, Y R; Li, Y L; Chen, Y B; Ye, S G

    2015-07-14

    Heat shock protein 90 (Hsp90) is a protein produced by plants in response to adverse environmental stresses. In this study, we identified and analyzed Hsp90 gene family members using a bioinformatic method based on genomic data from tomato (Solanum lycopersicum L.). The results illustrated that tomato contains at least 7 Hsp90 genes distributed on 6 chromosomes; protein lengths ranged from 267-794 amino acids. Intron numbers ranged from 2-19 in the genes. The phylogenetic tree revealed that Hsp90 genes in tomato (Solanum lycopersicum L.), rice (Oryza sativa L.), and Arabidopsis (Arabidopsis thaliana L.) could be divided into 5 groups, which included 3 pairs of orthologous genes and 4 pairs of paralogous genes. Expression analysis of RNA-sequence data showed that the Hsp90-1 gene was specifically expressed in mature fruits, while Hsp90-5 and Hsp90-6 showed opposite expression patterns in various tissues of cultivated and wild tomatoes. The expression levels of the Hsp90-1, Hsp90-2, and Hsp90- 3 genes in various tissues of cultivated tomatoes were high, while both the expression levels of genes Hsp90-3 and Hsp90-4 were low. Additionally, quantitative real-time polymerase chain reaction showed that these genes were involved in the responses to yellow leaf curl virus in tomato plant leaves. Our results provide a foundation for identifying the function of the Hsp90 gene in tomato.

  2. Partial loss of heterozygosity events at the mutated gene in tumors from MLH1/MSH2 large genomic rearrangement carriers

    Energy Technology Data Exchange (ETDEWEB)

    Zavodna, Katarina; Krivulcik, Tomas; Bujalkova, Maria Gerykova [Laboratory of Cancer Genetics, Cancer Research Institute of Slovak Academy of Sciences, Vlarska 7, 833 91 Bratislava (Slovakia); Slamka, Tomas; Martinicky, David; Ilencikova, Denisa [National Cancer Institute, Department of Oncologic Genetics, Klenova 1, 833 01 Bratislava (Slovakia); Bartosova, Zdena [Laboratory of Cancer Genetics, Cancer Research Institute of Slovak Academy of Sciences, Vlarska 7, 833 91 Bratislava (Slovakia)

    2009-11-20

    Depending on the population studied, large genomic rearrangements (LGRs) of the mismatch repair (MMR) genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC). It has been reported that loss of heterozygosity (LOH) at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification) in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. We found six rearrangements in the MSH2 gene (five deletions and dup5-6), and one aberration in the MLH1 gene (del5-6). The MSH2 deletions were of three types (del1, del1-3, del1-7). We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1 or MSH2 gene (heterozygous LGR region, SNP, or

  3. Partial loss of heterozygosity events at the mutated gene in tumors from MLH1/MSH2 large genomic rearrangement carriers

    Directory of Open Access Journals (Sweden)

    Ilencikova Denisa

    2009-11-01

    Full Text Available Abstract Background Depending on the population studied, large genomic rearrangements (LGRs of the mismatch repair (MMR genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC. It has been reported that loss of heterozygosity (LOH at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. Methods The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. Results We found six rearrangements in the MSH2 gene (five deletions and dup5-6, and one aberration in the MLH1 gene (del5-6. The MSH2 deletions were of three types (del1, del1-3, del1-7. We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. Conclusion LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1

  4. Partial loss of heterozygosity events at the mutated gene in tumors from MLH1/MSH2 large genomic rearrangement carriers

    International Nuclear Information System (INIS)

    Zavodna, Katarina; Krivulcik, Tomas; Bujalkova, Maria Gerykova; Slamka, Tomas; Martinicky, David; Ilencikova, Denisa; Bartosova, Zdena

    2009-01-01

    Depending on the population studied, large genomic rearrangements (LGRs) of the mismatch repair (MMR) genes constitute various proportions of the germline mutations that predispose to hereditary non-polyposis colorectal cancer (HNPCC). It has been reported that loss of heterozygosity (LOH) at the LGR region occurs through a gene conversion mechanism in tumors from MLH1/MSH2 deletion carriers; however, the converted tracts were delineated only by extragenic microsatellite markers. We sought to determine the frequency of LGRs in Slovak HNPCC patients and to study LOH in tumors from LGR carriers at the LGR region, as well as at other heterozygous markers within the gene to more precisely define conversion tracts. The main MMR genes responsible for HNPCC, MLH1, MSH2, MSH6, and PMS2, were analyzed by MLPA (multiplex ligation-dependent probe amplification) in a total of 37 unrelated HNPCC-suspected patients whose MLH1/MSH2 genes gave negative results in previous sequencing experiments. An LOH study was performed on six tumors from LGR carriers by combining MLPA to assess LOH at LGR regions and sequencing to examine LOH at 28 SNP markers from the MLH1 and MSH2 genes. We found six rearrangements in the MSH2 gene (five deletions and dup5-6), and one aberration in the MLH1 gene (del5-6). The MSH2 deletions were of three types (del1, del1-3, del1-7). We detected LOH at the LGR region in the single MLH1 case, which was determined in a previous study to be LOH-negative in the intragenic D3S1611 marker. Three tumors displayed LOH of at least one SNP marker, including two cases that were LOH-negative at the LGR region. LGRs accounted for 25% of germline MMR mutations identified in 28 Slovakian HNPCC families. A high frequency of LGRs among the MSH2 mutations provides a rationale for a MLPA screening of the Slovakian HNPCC families prior scanning by DNA sequencing. LOH at part of the informative loci confined to the MLH1 or MSH2 gene (heterozygous LGR region, SNP, or

  5. New mutation of the MPZ gene in a family with the Dejerine-Sottas disease phenotype.

    Science.gov (United States)

    Floroskufi, Paraskewi; Panas, Marios; Karadima, Georgia; Vassilopoulos, Demetris

    2007-05-01

    Charcot-Marie-Tooth disease type 1B is associated with mutations in the myelin protein zero gene. In the present study a new myelin protein zero gene mutation (c.89T>C,Ile30Thr) was detected in a family with the Dejerine-Sottas disease phenotype. The results support the hypothesis that severe, early-onset neuropathy may be related to either an alteration of a conserved amino acid or a disruption of the tertiary structure of myelin protein zero.

  6. Genome-wide analysis of the GRAS gene family in Prunus mume.

    Science.gov (United States)

    Lu, Jiuxing; Wang, Tao; Xu, Zongda; Sun, Lidan; Zhang, Qixiang

    2015-02-01

    Prunus mume is an ornamental flower and fruit tree in Rosaceae. We investigated the GRAS gene family to improve the breeding and cultivation of P. mume and other Rosaceae fruit trees. The GRAS gene family encodes transcriptional regulators that have diverse functions in plant growth and development, such as gibberellin and phytochrome A signal transduction, root radial patterning, and axillary meristem formation and gametogenesis in the P. mume genome. Despite the important roles of these genes in plant growth regulation, no findings on the GRAS genes of P. mume have been reported. In this study, we discerned phylogenetic relationships of P. mume GRAS genes, and their locations, structures in the genome and expression levels of different tissues. Out of 46 identified GRAS genes, 45 were located on the 8 P. mume chromosomes. Phylogenetic results showed that these genes could be classified into 11 groups. We found that Group X was P. mume-specific, and three genes of Group IX clustered with the rice-specific gene Os4. We speculated that these genes existed before the divergence of dicotyledons and monocotyledons and were lost in Arabidopsis. Tissue expression analysis indicated that 13 genes showed high expression levels in roots, stems, leaves, flowers and fruits, and were related to plant growth and development. Functional analysis of 24 GRAS genes and an orthologous relationship analysis indicated that many functioned during plant growth and flower and fruit development. Our bioinformatics analysis provides valuable information to improve the economic, agronomic and ecological benefits of P. mume and other Rosaceae fruit trees.

  7. Genome-wide analysis of the WRKY gene family in cotton.

    Science.gov (United States)

    Dou, Lingling; Zhang, Xiaohong; Pang, Chaoyou; Song, Meizhen; Wei, Hengling; Fan, Shuli; Yu, Shuxun

    2014-12-01

    WRKY proteins are major transcription factors involved in regulating plant growth and development. Although many studies have focused on the functional identification of WRKY genes, our knowledge concerning many areas of WRKY gene biology is limited. For example, in cotton, the phylogenetic characteristics, global expression patterns, molecular mechanisms regulating expression, and target genes/pathways of WRKY genes are poorly characterized. Therefore, in this study, we present a genome-wide analysis of the WRKY gene family in cotton (Gossypium raimondii and Gossypium hirsutum). We identified 116 WRKY genes in G. raimondii from the completed genome sequence, and we cloned 102 WRKY genes in G. hirsutum. Chromosomal location analysis indicated that WRKY genes in G. raimondii evolved mainly from segmental duplication followed by tandem amplifications. Phylogenetic analysis of alga, bryophyte, lycophyta, monocot and eudicot WRKY domains revealed family member expansion with increasing complexity of the plant body. Microarray, expression profiling and qRT-PCR data revealed that WRKY genes in G. hirsutum may regulate the development of fibers, anthers, tissues (roots, stems, leaves and embryos), and are involved in the response to stresses. Expression analysis showed that most group II and III GhWRKY genes are highly expressed under diverse stresses. Group I members, representing the ancestral form, seem to be insensitive to abiotic stress, with low expression divergence. Our results indicate that cotton WRKY genes might have evolved by adaptive duplication, leading to sensitivity to diverse stresses. This study provides fundamental information to inform further analysis and understanding of WRKY gene functions in cotton species.

  8. Genome-wide survey and characterization of the WRKY gene family in Populus trichocarpa.

    Science.gov (United States)

    He, Hongsheng; Dong, Qing; Shao, Yuanhua; Jiang, Haiyang; Zhu, Suwen; Cheng, Beijiu; Xiang, Yan

    2012-07-01

    WRKY transcription factors participate in diverse physiological and developmental processes in plants. They have highly conserved WRKYGQK amino acid sequences in their N-termini, followed by the novel zinc-finger-like motifs, Cys₂His₂ or Cys₂HisCys. To date, numerous WRKY genes have been identified and characterized in a number of herbaceous species. Survey and characterization of WRKY genes in a ligneous species would facilitate a better understanding of the evolutionary processes and functions of this gene family. In this study, 104 poplar WRKY genes (PtWRKY) were identified in the latest poplar genome sequence. According to their structural features, the predicted members were divided into the previously defined groups I-III, as described in rice. In addition, chromosomal localization of the genes demonstrated that there might be WRKY gene hot spots in 2.3 Mb regions on chromosome 14. Furthermore, approximately 83% (86 out of 104) WRKY genes participated in gene duplication events, including 69% (29 out of 42) gene pairs which exhibited segmental duplication. Using semi-quantitative RT-PCR, the expression patterns of subgroup III genes were investigated under different stresses [cold, drought, salinity and salicylic acid (SA)]. The data revealed that these genes presented different expression levels in response to various stress conditions. Expression analysis exhibited PtWRKY76 gene induced markedly in 0.1 mM SA or 25% PEG-6000 treatment. The results presented here provide a fundamental clue for cloning specific function genes in further studies and applications. This study identified 104 poplar WRKY genes and demonstrated WRKY gene hot spots on chromosome 14. Furthermore, semi-quantitative RT-PCR showed variable stress responses in subgroup III.

  9. Diversification and evolution of the SDG gene family in Brassica rapa after the whole genome triplication.

    Science.gov (United States)

    Dong, Heng; Liu, Dandan; Han, Tianyu; Zhao, Yuxue; Sun, Ji; Lin, Sue; Cao, Jiashu; Chen, Zhong-Hua; Huang, Li

    2015-11-24

    Histone lysine methylation, controlled by the SET Domain Group (SDG) gene family, is part of the histone code that regulates chromatin function and epigenetic control of gene expression. Analyzing the SDG gene family in Brassica rapa for their gene structure, domain architecture, subcellular localization, rate of molecular evolution and gene expression pattern revealed common occurrences of subfunctionalization and neofunctionalization in BrSDGs. In comparison with Arabidopsis thaliana, the BrSDG gene family was found to be more divergent than AtSDGs, which might partly explain the rich variety of morphotypes in B. rapa. In addition, a new evolutionary pattern of the four main groups of SDGs was presented, in which the Trx group and the SUVR subgroup evolved faster than the E(z), Ash groups and the SUVH subgroup. These differences in evolutionary rate among the four main groups of SDGs are perhaps due to the complexity and variability of the regions that bind with biomacromolecules, which guide SDGs to their target loci.

  10. [Genome-wide identification and bioinformatic analysis of PPR gene family in tomato].

    Science.gov (United States)

    Ding, Anming; Li, Ling; Qu, Xu; Sun, Tingting; Chen, Yaqiong; Zong, Peng; Li, Zunqiang; Gong, Daping; Sun, Yuhe

    2014-01-01

    Pentatricopeptide repeats (PPRs) genes constitute one of the largest gene families in plants, which play a broad and essential role in plant growth and development. In this study, the protein sequences annotated by the tomato (S. lycopersicum L.) genome project were screened with the Pfam PPR sequences. A total of 471 putative PPR-encoding genes were identified. Based on the motifs defined in A. thaliana L., protein structure and conserved sequences for each tomato motif were analyzed. We also analyzed phylogenetic relationship, subcellular localization, expression and GO analysis of the identified gene sequences. Our results demonstrate that tomato PPR gene family contains two subfamilies, P and PLS, each accounting for half of the family. PLS subfamily can be divided into four subclasses i.e., PLS, E, E+ and DYW. Each subclass of sequences forms a clade in the phylogenetic tree. The PPR motifs were found highly conserved among plants. The tomato PPR genes were distributed over 12 chromosomes and most of them lack introns. The majority of PPR proteins harbor mitochondrial or chloroplast localization sequences, whereas GO analysis showed that most PPR proteins participate in RNA-related biological processes.

  11. Rapid expansion of the protein disulfide isomerase gene family facilitates the folding of venom peptides

    DEFF Research Database (Denmark)

    Safavi-Hemami, Helena; Li, Qing; Jackson, Ronneshia L.

    2016-01-01

    Formation of correct disulfide bonds in the endoplasmic reticulum is a crucial step for folding proteins destined for secretion. Protein disulfide isomerases (PDIs) play a central role in this process. We report a previously unidentified, hypervariable family of PDIs that represents the most...... diverse gene family of oxidoreductases described in a single genus to date. These enzymes are highly expressed specifically in the venom glands of predatory cone snails, animals that synthesize a remarkably diverse set of cysteine-rich peptide toxins (conotoxins). Enzymes in this PDI family, termed...

  12. The nuclear IκB family of proteins controls gene regulation and immune homeostasis.

    Science.gov (United States)

    MaruYama, Takashi

    2015-10-01

    The inhibitory IκB family of proteins is subdivided into two groups based on protein localization in the cytoplasm or in the nucleus. These proteins interact with NF-κB, a major transcription factor regulating the expression of many inflammatory cytokines, by modulating its transcriptional activity. However, nuclear IκB family proteins not only interact with NF-κB to change its transcriptional activity, but they also bind to chromatin and control gene expression. This review provides an overview of nuclear IκB family proteins and their role in immune homeostasis. Copyright © 2015 Elsevier B.V. All rights reserved.

  13. A novel COL4A3 mutation causes autosomal-recessive Alport syndrome in a large Turkish family.

    Science.gov (United States)

    Uzak, Asli Subasioglu; Tokgoz, Bulent; Dundar, Munis; Tekin, Mustafa

    2013-03-01

    Alport syndrome (AS) is a genetically heterogeneous disorder that is characterized by hematuria, progressive renal failure typically resulting in end-stage renal disease, sensorineural hearing loss, and variable ocular abnormalities. Only 15% of cases with AS are autosomal recessive and are caused by mutations in the COL4A3 or COL4A4 genes, encoding type IV collagen. Clinical data in a large consanguineous family with four affected members were reviewed, and genomic DNA was extracted. For mapping, 15 microsatellite markers flanking COL4A3, COL4A4, and COL4A5 in 16 family members were typed. For mutation screening, all coding exons of COL4A3 were polymerase chain reaction- amplified and Sanger-sequenced from genomic DNA. The disease locus was mapped to chromosome 2q36.3, where COL4A3 and COL4A4 reside. Sanger sequencing revealed a novel mis-sense mutation (c.2T>C; p.M1T) in exon 1 of COL4A3. The identified nucleotide change was not found in 100 healthy ethnicity-matched controls via Sanger sequencing. We present a large consanguineous Turkish family with AS that was found to have a COL4A3 mutation as the cause of the disease. Although the relationship between the various genotypes and phenotypes in AS has not been fully elucidated, detailed clinical and molecular analyses are helpful for providing data to be used in genetic counseling. It is important to identify new mutations to clarify their clinical importance, to assess the prognosis of the disease, and to avoid renal biopsy for final diagnosis.

  14. Gene Environment Interactions and Predictors of Colorectal Cancer in Family-Based, Multi-Ethnic Groups

    Directory of Open Access Journals (Sweden)

    S. Pamela K. Shiao

    2018-02-01

    Full Text Available For the personalization of polygenic/omics-based health care, the purpose of this study was to examine the gene–environment interactions and predictors of colorectal cancer (CRC by including five key genes in the one-carbon metabolism pathways. In this proof-of-concept study, we included a total of 54 families and 108 participants, 54 CRC cases and 54 matched family friends representing four major racial ethnic groups in southern California (White, Asian, Hispanics, and Black. We used three phases of data analytics, including exploratory, family-based analyses adjusting for the dependence within the family for sharing genetic heritage, the ensemble method, and generalized regression models for predictive modeling with a machine learning validation procedure to validate the results for enhanced prediction and reproducibility. The results revealed that despite the family members sharing genetic heritage, the CRC group had greater combined gene polymorphism rates than the family controls (p < 0.05, on MTHFR C677T, MTR A2756G, MTRR A66G, and DHFR 19 bp except MTHFR A1298C. Four racial groups presented different polymorphism rates for four genes (all p < 0.05 except MTHFR A1298C. Following the ensemble method, the most influential factors were identified, and the best predictive models were generated by using the generalized regression models, with Akaike’s information criterion and leave-one-out cross validation methods. Body mass index (BMI and gender were consistent predictors of CRC for both models when individual genes versus total polymorphism counts were used, and alcohol use was interactive with BMI status. Body mass index status was also interactive with both gender and MTHFR C677T gene polymorphism, and the exposure to environmental pollutants was an additional predictor. These results point to the important roles of environmental and modifiable factors in relation to gene–environment interactions in the prevention of CRC.

  15. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    Energy Technology Data Exchange (ETDEWEB)

    Kang, Qing-lin [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Xu, Jia [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Zhang, Zeng [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); He, Jin-wei [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Lu, Lian-song [Department of Orthopedic Surgery, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Medical College of Soochow University, Suzhou, Jiangsu province 215000 (China); Fu, Wen-zhen [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China); Zhang, Zhen-lin, E-mail: zzl2002@medmail.com.cn [Metabolic Bone Disease and Genetic Research Unit, Department of Osteoporosis and Bone Diseases, Shanghai Jiao Tong University Affiliated Sixth People' s Hospital, Shanghai 200233 (China)

    2012-07-13

    Highlights: Black-Right-Pointing-Pointer In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. Black-Right-Pointing-Pointer We identified three novel PHEX gene mutations in four unrelated families with XLH. Black-Right-Pointing-Pointer We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. Black-Right-Pointing-Pointer We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  16. Three novel PHEX gene mutations in four Chinese families with X-linked dominant hypophosphatemic rickets

    International Nuclear Information System (INIS)

    Kang, Qing-lin; Xu, Jia; Zhang, Zeng; He, Jin-wei; Lu, Lian-song; Fu, Wen-zhen; Zhang, Zhen-lin

    2012-01-01

    Highlights: ► In our study, all of the patients were of Han Chinese ethnicity, which were rarely reported. ► We identified three novel PHEX gene mutations in four unrelated families with XLH. ► We found that the relationship between the phenotype and genotype of the PHEX gene was not invariant. ► We found that two PHEX gene sites, p.534 and p.731, were conserved. -- Abstract: Background: X-linked hypophosphatemia (XLH), the most common form of inherited rickets, is a dominant disorder that is characterized by renal phosphate wasting with hypophosphatemia, abnormal bone mineralization, short stature, and rachitic manifestations. The related gene with inactivating mutations associated with XLH has been identified as PHEX, which is a phosphate-regulating gene with homologies to endopeptidases on the X chromosome. In this study, a variety of PHEX mutations were identified in four Chinese families with XLH. Methods: We investigated four unrelated Chinese families who exhibited typical features of XLH by using PCR to analyze mutations that were then sequenced. The laboratory and radiological investigations were conducted simultaneously. Results: Three novel mutations were found in these four families: one frameshift mutation, c.2033dupT in exon 20, resulting in p.T679H; one nonsense mutation, c.1294A > T in exon 11, resulting in p.K432X; and one missense mutation, c.2192T > C in exon 22, resulting in p.F731S. Conclusions: We found that the PHEX gene mutations were responsible for XLH in these Chinese families. Our findings are useful for understanding the genetic basis of Chinese patients with XLH.

  17. Comprehensive Genomic Identification and Expression Analysis of the Phosphate Transporter (PHT) Gene Family in Apple.

    Science.gov (United States)

    Sun, Tingting; Li, Mingjun; Shao, Yun; Yu, Lingyan; Ma, Fengwang

    2017-01-01

    Elemental phosphorus (Pi) is essential to plant growth and development. The family of phosphate transporters (PHTs) mediates the uptake and translocation of Pi inside the plants. Members include five sub-cellular phosphate transporters that play different roles in Pi uptake and transport. We searched the Genome Database for Rosaceae and identified five clusters of phosphate transporters in apple ( Malus domestica ), including 37 putative genes. The MdPHT1 family contains 14 genes while MdPHT2 has two, MdPHT3 has seven, MdPHT4 has 11, and MdPHT5 has three. Our overview of this gene family focused on structure, chromosomal distribution and localization, phylogenies, and motifs. These genes displayed differential expression patterns in various tissues. For example, expression was high for MdPHT1;12, MdPHT3;6 , and MdPHT3;7 in the roots, and was also increased in response to low-phosphorus conditions. In contrast, MdPHT4;1, MdPHT4;4 , and MdPHT4;10 were expressed only in the leaves while transcript levels of MdPHT1;4, MdPHT1;12 , and MdPHT5;3 were highest in flowers. In general, these 37 genes were regulated significantly in either roots or leaves in response to the imposition of phosphorus and/or drought stress. The results suggest that members of the PHT family function in plant adaptations to adverse growing environments. Our study will lay a foundation for better understanding the PHT family evolution and exploring genes of interest for genetic improvement in apple.

  18. Novel mutations in Norrie disease gene in Japanese patients with Norrie disease and familial exudative vitreoretinopathy.

    Science.gov (United States)

    Kondo, Hiroyuki; Qin, Minghui; Kusaka, Shunji; Tahira, Tomoko; Hasebe, Haruyuki; Hayashi, Hideyuki; Uchio, Eiichi; Hayashi, Kenshi

    2007-03-01

    To search for mutations in the Norrie disease gene (NDP) in Japanese patients with familial exudative vitreoretinopathy (FEVR) and Norrie disease (ND) and to delineate the mutation-associated clinical features. Direct sequencing after polymerase chain reaction of all exons of the NDP gene was performed on blood collected from 62 probands (31 familial and 31 simplex) with FEVR, from 3 probands with ND, and from some of their family members. The clinical symptoms and signs in the patients with mutations were assessed. X-inactivation in the female carriers was examined in three FEVR families by using leukocyte DNA. Four novel mutations-I18K, K54N, R115L, and IVS2-1G-->A-and one reported mutation, R97P, in the NDP gene were identified in six families. The severity of vitreoretinopathy varied among these patients. Three probands with either K54N or R115L had typical features of FEVR, whereas the proband with R97P had those of ND. Families with IVS2-1G-->A exhibited either ND or FEVR characteristics. A proband with I18K presented with significant phenotypic heterogeneity between the two eyes. In addition, affected female carriers in a family harboring the K54N mutation presented with different degrees of vascular abnormalities in the periphery of the retina. X-inactivation profiles indicated that the skewing was not significantly different between affected and unaffected women. These observations indicate that mutations of the NDP gene can cause ND and 6% of FEVR cases in the Japanese population. The X-inactivation assay with leukocytes may not be predictive of the presence of a mutation in affected female carriers.

  19. Genic regions of a large salamander genome contain long introns and novel genes

    Directory of Open Access Journals (Sweden)

    Bryant Susan V

    2009-01-01

    Full Text Available Abstract Background The basis of genome size variation remains an outstanding question because DNA sequence data are lacking for organisms with large genomes. Sixteen BAC clones from the Mexican axolotl (Ambystoma mexicanum: c-value = 32 × 109 bp were isolated and sequenced to characterize the structure of genic regions. Results Annotation of genes within BACs showed that axolotl introns are on average 10× longer than orthologous vertebrate introns and they are predicted to contain more functional elements, including miRNAs and snoRNAs. Loci were discovered within BACs for two novel EST transcripts that are differentially expressed during spinal cord regeneration and skin metamorphosis. Unexpectedly, a third novel gene was also discovered while manually annotating BACs. Analysis of human-axolotl protein-coding sequences suggests there are 2% more lineage specific genes in the axolotl genome than the human genome, but the great majority (86% of genes between axolotl and human are predicted to be 1:1 orthologs. Considering that axolotl genes are on average 5× larger than human genes, the genic component of the salamander genome is estimated to be incredibly large, approximately 2.8 gigabases! Conclusion This study shows that a large salamander genome has a correspondingly large genic component, primarily because genes have incredibly long introns. These intronic sequences may harbor novel coding and non-coding sequences that regulate biological processes that are unique to salamanders.

  20. Genomic sequence and organization of two members of a human lectin gene family

    International Nuclear Information System (INIS)

    Gitt, M.A.; Barondes, S.H.

    1991-01-01

    The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family

  1. Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family

    OpenAIRE

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...

  2. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce

    2009-08-01

    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  3. Gene Structures, Evolution, Classification and Expression Profiles of the Aquaporin Gene Family in Castor Bean (Ricinus communis L..

    Directory of Open Access Journals (Sweden)

    Zhi Zou

    Full Text Available Aquaporins (AQPs are a class of integral membrane proteins that facilitate the passive transport of water and other small solutes across biological membranes. Castor bean (Ricinus communis L., Euphobiaceae, an important non-edible oilseed crop, is widely cultivated for industrial, medicinal and cosmetic purposes. Its recently available genome provides an opportunity to analyze specific gene families. In this study, a total of 37 full-length AQP genes were identified from the castor bean genome, which were assigned to five subfamilies, including 10 plasma membrane intrinsic proteins (PIPs, 9 tonoplast intrinsic proteins (TIPs, 8 NOD26-like intrinsic proteins (NIPs, 6 X intrinsic proteins (XIPs and 4 small basic intrinsic proteins (SIPs on the basis of sequence similarities. Functional prediction based on the analysis of the aromatic/arginine (ar/R selectivity filter, Froger's positions and specificity-determining positions (SDPs showed a remarkable difference in substrate specificity among subfamilies. Homology analysis supported the expression of all 37 RcAQP genes in at least one of examined tissues, e.g., root, leaf, flower, seed and endosperm. Furthermore, global expression profiles with deep transcriptome sequencing data revealed diverse expression patterns among various tissues. The current study presents the first genome-wide analysis of the AQP gene family in castor bean. Results obtained from this study provide valuable information for future functional analysis and utilization.

  4. Childhood temperament: passive gene-environment correlation, gene-environment interaction, and the hidden importance of the family environment.

    Science.gov (United States)

    Lemery-Chalfant, Kathryn; Kao, Karen; Swann, Gregory; Goldsmith, H Hill

    2013-02-01

    Biological parents pass on genotypes to their children, as well as provide home environments that correlate with their genotypes; thus, the association between the home environment and children's temperament can be genetically (i.e., passive gene-environment correlation) or environmentally mediated. Furthermore, family environments may suppress or facilitate the heritability of children's temperament (i.e., gene-environment interaction). The sample comprised 807 twin pairs (mean age = 7.93 years) from the longitudinal Wisconsin Twin Project. Important passive gene-environment correlations emerged, such that home environments were less chaotic for children with high effortful control, and this association was genetically mediated. Children with high extraversion/surgency experienced more chaotic home environments, and this correlation was also genetically mediated. In addition, heritability of children's temperament was moderated by home environments, such that effortful control and extraversion/surgency were more heritable in chaotic homes, and negative affectivity was more heritable under crowded or unsafe home conditions. Modeling multiple types of gene-environment interplay uncovered the complex role of genetic factors and the hidden importance of the family environment for children's temperament and development more generally.

  5. Genome-wide analysis of the GRAS gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Wu, Z Y; Wu, P Z; Chen, Y P; Li, M R; Wu, G J; Jiang, H W

    2015-12-29

    GRAS proteins play vital roles in plant growth and development. Physic nut (Jatropha curcas L.) was found to have a total of 48 GRAS family members (JcGRAS), 15 more than those found in Arabidopsis. The JcGRAS genes were divided into 12 subfamilies or 15 ancient monophyletic lineages based on the phylogenetic analysis of GRAS proteins from both flowering and lower plants. The functions of GRAS genes in 9 subfamilies have been reported previously for several plants, while the genes in the remaining 3 subfamilies were of unknown function; we named the latter families U1 to U3. No member of U3 subfamily is present in Arabidopsis and Poaceae species according to public genome sequence data. In comparison with the number of GRAS genes in Arabidopsis, more were detected in physic nut, resulting from the retention of many ancient GRAS subfamilies and the formation of tandem repeats during evolution. No evidence of recent duplication among JcGRAS genes was observed in physic nut. Based on digital gene expression data, 21 of the 48 genes exhibited differential expression in four tissues analyzed. Two members of subfamily U3 were expressed only in buds and flowers, implying that they may play specific roles. Our results provide valuable resources for future studies on the functions of GRAS proteins in physic nut.

  6. Characterization and expression of the cytochrome P450 gene family in diamondback moth, Plutella xylostella (L.).

    Science.gov (United States)

    Yu, Liying; Tang, Weiqi; He, Weiyi; Ma, Xiaoli; Vasseur, Liette; Baxter, Simon W; Yang, Guang; Huang, Shiguo; Song, Fengqin; You, Minsheng

    2015-03-10

    Cytochrome P450 monooxygenases are present in almost all organisms and can play vital roles in hormone regulation, metabolism of xenobiotics and in biosynthesis or inactivation of endogenous compounds. In the present study, a genome-wide approach was used to identify and analyze the P450 gene family of diamondback moth, Plutella xylostella, a destructive worldwide pest of cruciferous crops. We identified 85 putative cytochrome P450 genes from the P. xylostella genome, including 84 functional genes and 1 pseudogene. These genes were classified into 26 families and 52 subfamilies. A phylogenetic tree constructed with three additional insect species shows extensive gene expansions of P. xylostella P450 genes from clans 3 and 4. Gene expression of cytochrome P450s was quantified across multiple developmental stages (egg, larva, pupa and adult) and tissues (head and midgut) using P. xylostella strains susceptible or resistant to insecticides chlorpyrifos and fiprinol. Expression of the lepidopteran specific CYP367s predominantly occurred in head tissue suggesting a role in either olfaction or detoxification. CYP340s with abundant transposable elements and relatively high expression in the midgut probably contribute to the detoxification of insecticides or plant toxins in P. xylostella. This study will facilitate future functional studies of the P. xylostella P450s in detoxification.

  7. Positive selection in the SLC11A1 gene in the family Equidae.

    Science.gov (United States)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

    2016-05-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

  8. Identification of Candidate Gene Variants in Korean MODY Families by Whole-Exome Sequencing.

    Science.gov (United States)

    Shim, Ye Jee; Kim, Jung Eun; Hwang, Su-Kyeong; Choi, Bong Seok; Choi, Byung Ho; Cho, Eun-Mi; Jang, Kyoung Mi; Ko, Cheol Woo

    2015-01-01

    To date, 13 genes causing maturity-onset diabetes of the young (MODY) have been identified. However, there is a big discrepancy in the genetic locus between Asian and Caucasian patients with MODY. Thus, we conducted whole-exome sequencing in Korean MODY families to identify causative gene variants. Six MODY probands and their family members were included. Variants in the dbSNP135 and TIARA databases for Koreans and the variants with minor allele frequencies >0.5% of the 1000 Genomes database were excluded. We selected only the functional variants (gain of stop codon, frameshifts and nonsynonymous single-nucleotide variants) and conducted a case-control comparison in the family members. The selected variants were scanned for the previously introduced gene set implicated in glucose metabolism. Three variants c.620C>T:p.Thr207Ile in PTPRD, c.559C>G:p.Gln187Glu in SYT9, and c.1526T>G:p.Val509Gly in WFS1 were respectively identified in 3 families. We could not find any disease-causative alleles of known MODY 1-13 genes. Based on the predictive program, Thr207Ile in PTPRD was considered pathogenic. Whole-exome sequencing is a valuable method for the genetic diagnosis of MODY. Further evaluation is necessary about the role of PTPRD, SYT9 and WFS1 in normal insulin release from pancreatic beta cells. © 2015 S. Karger AG, Basel.

  9. Novel glucokinase gene mutation in the first Macedonian family tested for MODY.

    Science.gov (United States)

    Kocova, M; Elblova, L; Pruhova, S; Lebl, J; Dusatkova, P

    2017-08-01

    We present a boy with mild hyperglycemia detected during an upper respiratory infection. Novel splicing mutation in the intron 1 of the GCK gene (c.45+1G>A) was detected, and was subsequently confirmed in his father. This is the first case of genetically confirmed Macedonian family with MODY. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. [The mutation analysis of PAH gene and prenatal diagnosis in classical phenylketonuria family].

    Science.gov (United States)

    Yan, Yousheng; Hao, Shengju; Yao, Fengxia; Sun, Qingmei; Zheng, Lei; Zhang, Qinghua; Zhang, Chuan; Yang, Tao; Huang, Shangzhi

    2014-12-01

    To characterize the mutation spectrum of phenylalanine hydroxylase (PAH) gene and perform prenatal diagnosis for families with classical phenylketonuria. By stratified sequencing, mutations were detected in the exons and flaking introns of PAH gene of 44 families with classical phenylketonuria. 47 fetuses were diagnosed by combined sequencing with linkage analysis of three common short tandem repeats (STR) (PAH-STR, PAH-26 and PAH-32) in the PAH gene. Thirty-one types of mutations were identified. A total of 84 mutations were identified in 88 alleles (95.45%), in which the most common mutation have been R243Q (21.59%), EX6-96A>G (6.82%), IVS4-1G>A (5.86%) and IVS7+2T>A (5.86%). Most mutations were found in exons 3, 5, 6, 7, 11 and 12. The polymorphism information content (PIC) of these three STR markers was 0.71 (PAH-STR), 0.48 (PAH-26) and 0.40 (PAH-32), respectively. Prenatal diagnosis was performed successfully with the combined method in 47 fetuses of 44 classical phenylketonuria families. Among them, 11 (23.4%) were diagnosed as affected, 24 (51.1%) as carriers, and 12 (25.5%) as unaffected. Prenatal diagnosis can be achieved efficiently and accurately by stratified sequencing of PAH gene and linkage analysis of STR for classical phenylketonuria families.

  11. The role of retrotransposons in gene family expansions in the human and mouse genomes

    Czech Academy of Sciences Publication Activity Database

    Janoušek, Václav; Laukaitis, C. M.; Yanchukov, Alexey; Karn, R. C.

    2016-01-01

    Roč. 8, č. 9 (2016), s. 2632-2650 ISSN 1759-6653 R&D Projects: GA MŠk EE2.3.20.0303 Institutional support: RVO:68081766 Keywords : gene families * transposable elements * retrotransposons * LINE * LTR * SINE Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.979, year: 2016

  12. Identification of the 14-3-3 gene family in Rafflesia cantleyi

    Science.gov (United States)

    Rosli, Khadijah; Wan, Kiew-Lian

    2018-04-01

    Rafflesia is known to be the largest flower in the world. Due to its size and appearance, it is considered to be very unique. Little is known about the molecular biology of this rare parasitic flowering plant as it is very difficult to locate and has a short life-span as a flower. Physiological activities in plants are regulated by signalling regulators such as the members of the 14-3-3 gene family. The number of members of this gene family varies in plants and there are thirteen known members in Arabidopsis thaliana. Their role is to bind to phosphorylated targets to complete signal transduction processes. Sequence comparison using BLAST of transcriptome data from three different Rafflesia cantleyi floral bud stages against the Swissprot database revealed 27 transcripts annotated as members of this gene family. All of the transcripts were expressed during floral bud stage 1 (S1) while 14 and four transcripts were expressed during floral bud stages 2 (S2) and 3 (S3), respectively. Significant downregulation was recorded for six and nine transcripts at S1 vs. S2 and S2 vs. S3 respectively. This gene family may play a critical role as signalling regulators during the development of Rafflesia floral bud.

  13. [Analysis of USH2A gene mutation in a Chinese family affected with Usher syndrome].

    Science.gov (United States)

    Li, Pengcheng; Liu, Fei; Zhang, Mingchang; Wang, Qiufen; Liu, Mugen

    2015-08-01

    To investigate the disease-causing mutation in a Chinese family affected with Usher syndrome type II. All of the 11 members from the family underwent comprehensive ophthalmologic examination and hearing test, and their genomic DNA were isolated from venous leukocytes. PCR and direct sequencing of USH2A gene were performed for the proband. Wild type and mutant type minigene vectors containing exon 42, intron 42 and exon 43 of the USH2A gene were constructed and transfected into Hela cells by lipofectamine reagent. Reverse transcription (RT)-PCR was carried out to verify the splicing of the minigenes. Pedigree analysis and clinical diagnosis indicated that the patients have suffered from autosomal recessive Usher syndrome type II. DNA sequencing has detected a homozygous c.8559-2A>G mutation of the USH2A gene in the proband, which has co-segregated with the disease in the family. The mutation has affected a conserved splice site in intron 42, which has led to inactivation of the splice site. Minigene experiment has confirmed the retaining of intron 42 in mature mRNA. The c.8559-2A>G mutation in the USH2A gene probably underlies the Usher syndrome type II in this family. The splice site mutation has resulted in abnormal splicing of USH2A pre-mRNA.

  14. [Gene mutation analysis and prenatal diagnosis of a family with Bartter syndrome].

    Science.gov (United States)

    Li, Long; Ma, Na; Li, Xiu-Rong; Gong, Fei; DU, Juan

    2016-08-01

    To investigate the mutation of related genes and prenatal diagnosis of a family with Bartter syndrome (BS). The high-throughput capture sequencing technique and PCR-Sanger sequencing were used to detect pathogenic genes in the proband of this family and analyze the whole family at the genomic level. After the genetic cause was clarified, the amniotic fluid was collected from the proband's mother who was pregnant for 5 months for prenatal diagnosis. The proband carried compound heterozygous mutations of c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene; c.88C>T(p.Arg30*) had been reported as a pathogenic mutation, and c.968+2T>A was a new mutation. Pedigree analysis showed that the two mutations were inherited from the mother and father, respectively. Prenatal diagnosis showed that the fetus did not inherit the mutations from parents and had no mutations at the two loci. The follow-up visit confirmed that the infant was in a healthy state, which proved the accuracy of genetic diagnosis and prenatal diagnosis. The compound heterozygous mutations c.88C>T(p.Arg30*) and c.968+2T>A in the CLCNKB gene are the cause of BS in the proband, and prenatal diagnosis can prevent the risk of recurrence of BS in this family.

  15. A novel AVP gene mutation in a Turkish family with neurohypophyseal diabetes insipidus.

    Science.gov (United States)

    Ilhan, M; Tiryakioglu, N O; Karaman, O; Coskunpinar, E; Yildiz, R S; Turgut, S; Tiryakioglu, D; Toprak, H; Tasan, E

    2016-03-01

    Familial neurohypophyseal diabetes insipidus (FNDI) is a rare, autosomal dominant, inherited disorder which is characterized by severe polydipsia and polyuria generally presenting in early childhood. In the present study, we aimed to analyze the AVP gene in a Turkish family with FNDI. Four patients with neurohypophyseal diabetes insipidus and ten healthy members of the family were studied. Diabetes insipidus was diagnosed by the water deprivation test in affected family members. Mutation analysis was performed by sequencing the whole coding region of AVP-NPII gene using DNA isolated from peripheral blood samples. Urine osmolality was low (C in all patients. c.-3A>C mutation in 5'UTR of AVP gene in this family might lead to the truncation of signal peptide, aggregation of AVP in the cytoplasm instead of targeting in the endoplasmic reticulum, thereby could disrupt AVP secretion without causing neuronal cytotoxicity, which might explain the presence of bright spot. The predicted effect of this mutation should be investigated by further in vitro molecular studies.

  16. The SKP1-like gene family of Arabidopsis exhibits a high degree of differential gene expression and gene product interaction during development.

    Directory of Open Access Journals (Sweden)

    Mohammad H Dezfulian

    Full Text Available The Arabidopsis thaliana genome encodes several families of polypeptides that are known or predicted to participate in the formation of the SCF-class of E3-ubiquitin ligase complexes. One such gene family encodes the Skp1-like class of polypeptide subunits, where 21 genes have been identified and are known to be expressed in Arabidopsis. Phylogenetic analysis based on deduced polypeptide sequence organizes the family of ASK proteins into 7 clades. The complexity of the ASK gene family, together with the close structural similarity among its members raises the prospect of significant functional redundancy among select paralogs. We have assessed the potential for functional redundancy within the ASK gene family by analyzing an expanded set of criteria that define redundancy with higher resolution. The criteria used include quantitative expression of locus-specific transcripts using qRT-PCR, assessment of the sub-cellular localization of individual ASK:YFP auto-fluorescent fusion proteins expressed in vivo as well as the in planta assessment of individual ASK-F-Box protein interactions using bimolecular fluorescent complementation techniques in combination with confocal imagery in live cells. The results indicate significant functional divergence of steady state transcript abundance and protein-protein interaction specificity involving ASK proteins in a pattern that is poorly predicted by sequence-based phylogeny. The information emerging from this and related studies will prove important for defining the functional intersection of expression, localization and gene product interaction that better predicts the formation of discrete SCF complexes, as a prelude to investigating their molecular mode of action.

  17. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    International Nuclear Information System (INIS)

    Macqueen, Daniel J.; Bower, Neil I.; Johnston, Ian A.

    2010-01-01

    Research highlights: → The expanded akirin gene family of Atlantic salmon was characterised. → akirin paralogues are regulated between mono- and multi-nucleated muscle cells. → akirin paralogues positioned within known genetic networks controlling myogenesis. → Co-expression of akirin paralogues is evident across cell types/during myogenesis. → Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3β and 14-3-3γ. All akirin paralogues were expressed ubiquitously across ten tissues, although mRNA levels

  18. Positioning the expanded akirin gene family of Atlantic salmon within the transcriptional networks of myogenesis

    Energy Technology Data Exchange (ETDEWEB)

    Macqueen, Daniel J., E-mail: djm59@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Bower, Neil I., E-mail: nib@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom); Johnston, Ian A., E-mail: iaj@st-andrews.ac.uk [Laboratory of Physiological and Evolutionary Genomics, Scottish Oceans Institute, University of St Andrews, St Andrews, Fife KY16 8LB (United Kingdom)

    2010-10-01

    Research highlights: {yields} The expanded akirin gene family of Atlantic salmon was characterised. {yields} akirin paralogues are regulated between mono- and multi-nucleated muscle cells. {yields} akirin paralogues positioned within known genetic networks controlling myogenesis. {yields} Co-expression of akirin paralogues is evident across cell types/during myogenesis. {yields} Selection has likely maintained common regulatory elements among akirin paralogues. -- Abstract: Vertebrate akirin genes usually form a family with one-to-three members that regulate gene expression during the innate immune response, carcinogenesis and myogenesis. We recently established that an expanded family of eight akirin genes is conserved across salmonid fish. Here, we measured mRNA levels of the akirin family of Atlantic salmon (Salmo salar L.) during the differentiation of primary myoblasts cultured from fast-skeletal muscle. Using hierarchical clustering and correlation, the data was positioned into a network of expression profiles including twenty further genes that regulate myogenesis. akirin1(2b) was not significantly regulated during the maturation of the cell culture. akirin2(1a) and 2(1b), along with IGF-II and several igfbps, were most highly expressed in mononuclear cells, then significantly and constitutively downregulated as differentiation proceeded and myotubes formed/matured. Conversely, akirin1(1a), 1(1b), 1(2a), 2(2a) and 2(2b) were expressed at lowest levels when mononuclear cells dominated the culture and highest levels when confluent layers of myotubes were evident. However, akirin1(2a) and 2(2a) were first upregulated earlier than akirin1(1a), 1(1b) and 2(2b), when rates of myoblast proliferation were highest. Interestingly, akirin1(1b), 1(2a), 2(2a) and 2(2b) formed part of a module of co-expressed genes involved in muscle differentiation, including myod1a, myog, mef2a, 14-3-3{beta} and 14-3-3{gamma}. All akirin paralogues were expressed ubiquitously across ten

  19. Genome-Wide Identification and Expression Analysis of WRKY Gene Family in Capsicum annuum L.

    Science.gov (United States)

    Diao, Wei-Ping; Snyder, John C; Wang, Shu-Bin; Liu, Jin-Bing; Pan, Bao-Gui; Guo, Guang-Jun; Wei, Ge

    2016-01-01

    The WRKY family of transcription factors is one of the most important families of plant transcriptional regulators with members regulating multiple biological processes, especially in regulating defense against biotic and abiotic stresses. However, little information is available about WRKYs in pepper (Capsicum annuum L.). The recent release of completely assembled genome sequences of pepper allowed us to perform a genome-wide investigation for pepper WRKY proteins. In the present study, a total of 71 WRKY genes were identified in the pepper genome. According to structural features of their encoded proteins, the pepper WRKY genes (CaWRKY) were classified into three main groups, with the second group further divided into five subgroups. Genome mapping analysis revealed that CaWRKY were enriched on four chromosomes, especially on chromosome 1, and 15.5% of the family members were tandemly duplicated genes. A phylogenetic tree was constructed depending on WRKY domain' sequences derived from pepper and Arabidopsis. The expression of 21 selected CaWRKY genes in response to seven different biotic and abiotic stresses (salt, heat shock, drought, Phytophtora capsici, SA, MeJA, and ABA) was evaluated by quantitative RT-PCR; Some CaWRKYs were highly expressed and up-regulated by stress treatment. Our results will provide a platform for functional identification and molecular breeding studies of WRKY genes in pepper.

  20. Embryonic expression of zebrafish MiT family genes tfe3b, tfeb, and tfec.

    Science.gov (United States)

    Lister, James A; Lane, Brandon M; Nguyen, Anhthu; Lunney, Katherine

    2011-11-01

    The MiT family comprises four genes in mammals: Mitf, Tfe3, Tfeb, and Tfec, which encode transcription factors of the basic-helix-loop-helix/leucine zipper class. Mitf is well-known for its essential role in the development of melanocytes, however the functions of the other members of this family, and of interactions between them, are less well understood. We have now characterized the complete set of MiT genes from zebrafish, which totals six instead of four. The zebrafish genome contain two mitf (mitfa and mitfb), two tfe3 (tfe3a and tfe3b), and single tfeb and tfec genes; this distribution is shared with other teleosts. We present here the sequence and embryonic expression patterns for the zebrafish tfe3b, tfeb, and tfec genes, and identify a new isoform of tfe3a. These findings will assist in elucidating the roles of the MiT gene family over the course of vertebrate evolution. Copyright © 2011 Wiley-Liss, Inc.

  1. Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

    International Nuclear Information System (INIS)

    Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

    2003-01-01

    The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

  2. The Vitis vinifera sugar transporter gene family: phylogenetic overview and macroarray expression profiling

    Directory of Open Access Journals (Sweden)

    Atanassova Rossitza

    2010-11-01

    Full Text Available Abstract Background In higher plants, sugars are not only nutrients but also important signal molecules. They are distributed through the plant via sugar transporters, which are involved not only in sugar long-distance transport via the loading and the unloading of the conducting complex, but also in sugar allocation into source and sink cells. The availability of the recently released grapevine genome sequence offers the opportunity to identify sucrose and monosaccharide transporter gene families in a woody species and to compare them with those of the herbaceous Arabidopsis thaliana using a phylogenetic analysis. Results In grapevine, one of the most economically important fruit crop in the world, it appeared that sucrose and monosaccharide transporter genes are present in 4 and 59 loci, respectively and that the monosaccharide transporter family can be divided into 7 subfamilies. Phylogenetic analysis of protein sequences has indicated that orthologs exist between Vitis and Arabidospis. A search for cis-regulatory elements in the promoter sequences of the most characterized transporter gene families (sucrose, hexoses and polyols transporters, has revealed that some of them might probably be regulated by sugars. To profile several genes simultaneously, we created a macroarray bearing cDNA fragments specific to 20 sugar transporter genes. This macroarray analysis has revealed that two hexose (VvHT1, VvHT3, one polyol (VvPMT5 and one sucrose (VvSUC27 transporter genes, are highly expressed in most vegetative organs. The expression of one hexose transporter (VvHT2 and two tonoplastic monosaccharide transporter (VvTMT1, VvTMT2 genes are regulated during berry development. Finally, three putative hexose transporter genes show a preferential organ specificity being highly expressed in seeds (VvHT3, VvHT5, in roots (VvHT2 or in mature leaves (VvHT5. Conclusions This study provides an exhaustive survey of sugar transporter genes in Vitis vinifera and

  3. Identification of two new mutations in the GPR98 and the PDE6B genes segregating in a Tunisian family.

    Science.gov (United States)

    Hmani-Aifa, Mounira; Benzina, Zeineb; Zulfiqar, Fareeha; Dhouib, Houria; Shahzadi, Amber; Ghorbel, Abdelmonem; Rebaï, Ahmed; Söderkvist, Peter; Riazuddin, Sheikh; Kimberling, William J; Ayadi, Hammadi

    2009-04-01

    Autosomal recessive retinitis pigmentosa (ARRP) is a genetically heterogeneous disorder. ARRP could be associated with extraocular manifestations that define specific syndromes such as Usher syndrome (USH) characterized by retinal degeneration and congenital hearing loss (HL). The USH type II (USH2) associates RP and mild-to-moderate HL with preserved vestibular function. At least three genes USH2A, the very large G-protein-coupled receptor, GPR98, and DFNB31 are responsible for USH2 syndrome. Here, we report on the segregation of non-syndromic ARRP and USH2 syndrome in a consanguineous Tunisian family, which was previously used to define USH2B locus. With regard to the co-occurrence of these two different pathologies, clinical and genetic reanalysis of the extended family showed (i) phenotypic heterogeneity within USH2 patients and (ii) excluded linkage to USH2B locus. Indeed, linkage analysis disclosed the cosegregation of the USH2 phenotype with the USH2C locus markers, D5S428 and D5S618, whereas the ARRP perfectly segregates with PDE6B flanking markers D4S3360 and D4S2930. Molecular analysis revealed two new missense mutations, p.Y6044C and p.W807R, occurring in GPR98 and PDE6B genes, respectively. In conclusion, our results show that the USH2B locus at chromosome 3p23-24.2 does not exist, and we therefore withdraw this locus designation. The combination of molecular findings for GPR98 and PDE6B genes enable us to explain the phenotypic heterogeneity and particularly the severe ocular affection first observed in one USH2 patient. This report presents an illustration of how consanguinity could increase familial clustering of multiple hereditary diseases within the same family.

  4. Genomic Organization, Phylogenetic Comparison and Differential Expression of the SBP-Box Family Genes in Grape

    Science.gov (United States)

    Hou, Hongmin; Li, Jun; Gao, Min; Singer, Stacy D.; Wang, Hao; Mao, Linyong; Fei, Zhangjun; Wang, Xiping

    2013-01-01

    Background The SBP-box gene family is specific to plants and encodes a class of zinc finger-containing transcription factors with a broad range of functions. Although SBP-box genes have been identified in numerous plants including green algae, moss, silver birch, snapdragon, Arabidopsis, rice and maize, there is little information concerning SBP-box genes, or the corresponding miR156/157, function in grapevine. Methodology/Principal Findings Eighteen SBP-box gene family members were identified in Vitis vinifera, twelve of which bore sequences that were complementary to miRNA156/157. Phylogenetic reconstruction demonstrated that plant SBP-domain proteins could be classified into seven subgroups, with the V. vinifera SBP-domain proteins being more closely related to SBP-domain proteins from dicotyledonous angiosperms than those from monocotyledonous angiosperms. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologs of several grape SBP genes were found in corresponding syntenic blocks of Arabidopsis. Expression analysis of the grape SBP-box genes in various organs and at different stages of fruit development in V. quinquangularis ‘Shang-24’ revealed distinct spatiotemporal patterns. While the majority of the grape SBP-box genes lacking a miR156/157 target site were expressed ubiquitously and constitutively, most genes bearing a miR156/157 target site exhibited distinct expression patterns, possibly due to the inhibitory role of the microRNA. Furthermore, microarray data mining and quantitative real-time RT-PCR analysis identified several grape SBP-box genes that are potentially involved in the defense against biotic and abiotic stresses. Conclusion The results presented here provide a further understanding of SBP-box gene function in plants, and yields additional insights into the mechanism of stress management in grape, which may have important implications for the future success of this crop. PMID:23527172

  5. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family.

    Science.gov (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee

    2013-12-01

    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  6. Phylogenetic analysis of members of the Phycodnaviridae virus family, using amplified fragments of the major capsid protein gene.

    Science.gov (United States)

    Larsen, J B; Larsen, A; Bratbak, G; Sandaa, R-A

    2008-05-01

    Algal viruses are considered ecologically important by affecting host population dynamics and nutrient flow in aquatic food webs. Members of the family Phycodnaviridae are also interesting due to their extraordinary genome size. Few algal viruses in the Phycodnaviridae family have been sequenced, and those that have been have few genes in common and low gene homology. It has hence been difficult to design general PCR primers that allow further studies of their ecology and diversity. In this study, we screened the nine type I core genes of the nucleocytoplasmic large DNA viruses for sequences suitable for designing a general set of primers. Sequence comparison between members of the Phycodnaviridae family, including three partly sequenced viruses infecting the prymnesiophyte Pyramimonas orientalis and the haptophytes Phaeocystis pouchetii and Chrysochromulina ericina (Pyramimonas orientalis virus 01B [PoV-01B], Phaeocystis pouchetii virus 01 [PpV-01], and Chrysochromulina ericina virus 01B [CeV-01B], respectively), revealed eight conserved regions in the major capsid protein (MCP). Two of these regions also showed conservation at the nucleotide level, and this allowed us to design degenerate PCR primers. The primers produced 347- to 518-bp amplicons when applied to lysates from algal viruses kept in culture and from natural viral communities. The aim of this work was to use the MCP as a proxy to infer phylogenetic relationships and genetic diversity among members of the Phycodnaviridae family and to determine the occurrence and diversity of this gene in natural viral communities. The results support the current legitimate genera in the Phycodnaviridae based on alga host species. However, while placing the mimivirus in close proximity to the type species, PBCV-1, of Phycodnaviridae along with the three new viruses assigned to the family (PoV-01B, PpV-01, and CeV-01B), the results also indicate that the coccolithoviruses and phaeoviruses are more diverged from this

  7. Sulfur restriction extends fission yeast chronological lifespan through Ecl1 family genes by downregulation of ribosome.

    Science.gov (United States)

    Ohtsuka, Hokuto; Takinami, Masahiro; Shimasaki, Takafumi; Hibi, Takahide; Murakami, Hiroshi; Aiba, Hirofumi

    2017-07-01

    Nutritional restrictions such as calorie restrictions are known to increase the lifespan of various organisms. Here, we found that a restriction of sulfur extended the chronological lifespan (CLS) of the fission yeast Schizosaccharomyces pombe. The restriction decreased cellular size, RNA content, and ribosomal proteins and increased sporulation rate. These responses depended on Ecl1 family genes, the overexpression of which results in the extension of CLS. We also showed that the Zip1 transcription factor results in the sulfur restriction-dependent expression of the ecl1 + gene. We demonstrated that a decrease in ribosomal activity results in the extension of CLS. Based on these observations, we propose that sulfur restriction extends CLS through Ecl1 family genes in a ribosomal activity-dependent manner. © 2017 John Wiley & Sons Ltd.

  8. Genome-wide identification and characterization of WRKY gene family in peanut

    Directory of Open Access Journals (Sweden)

    Hui eSong

    2016-04-01

    Full Text Available WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA and jasmonic acid (JA treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.

  9. Genome-Wide Identification and Characterization of WRKY Gene Family in Peanut.

    Science.gov (United States)

    Song, Hui; Wang, Pengfei; Lin, Jer-Young; Zhao, Chuanzhi; Bi, Yuping; Wang, Xingjun

    2016-01-01

    WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA) and jasmonic acid (JA) treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.

  10. Runx family genes in a cartilaginous fish, the elephant shark (Callorhinchus milii.

    Directory of Open Access Journals (Sweden)

    Giselle Sek Suan Nah

    Full Text Available The Runx family genes encode transcription factors that play key roles in hematopoiesis, skeletogenesis and neurogenesis and are often implicated in diseases. We describe here the cloning and characterization of Runx1, Runx2, Runx3 and Runxb genes in the elephant shark (Callorhinchus milii, a member of Chondrichthyes, the oldest living group of jawed vertebrates. Through the use of alternative promoters and/or alternative splicing, each of the elephant shark Runx genes expresses multiple isoforms similar to their orthologs in human and other bony vertebrates. The expression profiles of elephant shark Runx genes are similar to those of mammalian Runx genes. The syntenic blocks of genes at the elephant shark Runx gene loci are highly conserved in human, but represented by shorter conserved blocks in zebrafish indicating a higher degree of rearrangements in this teleost fish. Analysis of promoter regions revealed conservation of binding sites for transcription factors, including two tandem binding sites for Runx that are totally conserved in the distal promoter regions of elephant shark Runx1-3. Several conserved noncoding elements (CNEs, which are putative cis-regulatory elements, and miRNA binding sites were identified in the elephant shark and human Runx gene loci. Some of these CNEs and miRNA binding sites are absent in teleost fishes such as zebrafish and fugu. In summary, our analysis reveals that the genomic organization and expression profiles of Runx genes were already complex in the common ancestor of jawed vertebrates.

  11. Diversifying Selection in the Wheat Stem Rust Fungus Acts Predominantly on Pathogen-Associated Gene Families and Reveals Candidate Effectors

    Directory of Open Access Journals (Sweden)

    Jana eSperschneider

    2014-09-01

    Full Text Available Plant pathogens cause severe losses to crop plants and threaten global food production. One striking example is the wheat stem rust fungus, Puccinia graminis f. sp. tritici, which can rapidly evolve new virulent pathotypes in response to resistant host lines. Like several other filamentous fungal and oomycete plant pathogens, its genome features expanded gene families that have been implicated in host-pathogen interactions, possibly encoding effector proteins that interact directly with target host defence proteins. Previous efforts to understand virulence largely relied on the prediction of secreted, small and cysteine-rich proteins as candidate effectors and thus delivered an overwhelming number of candidates. Here, we implement an alternative analysis strategy that uses the signal of adaptive evolution as a line of evidence for effector function, combined with comparative information and expression data. We demonstrate that in planta up-regulated genes that are rapidly evolving are found almost exclusively in pathogen-associated gene families, affirming the impact of host-pathogen co-evolution on genome structure and the adaptive diversification of specialised gene families. In particular, we predict 42 effector candidates that are conserved only across pathogens, induced during infection and rapidly evolving. One of our top candidates has recently been shown to induce genotype-specific hypersensitive cell death in wheat. This shows that comparative genomics incorporating the evolutionary signal of adaptation is powerful for predicting effector candidates for laboratory verification. Our system can be applied to a wide range of pathogens and will give insight into host-pathogen dynamics, ultimately leading to progress in strategies for disease control.

  12. Horizontal gene transfer and nucleotide compositional anomaly in large DNA viruses

    Directory of Open Access Journals (Sweden)

    Ogata Hiroyuki

    2007-12-01

    Full Text Available Abstract Background DNA viruses have a wide range of genome sizes (5 kb up to 1.2 Mb, compared to 0.16 Mb to 1.5 Mb for obligate parasitic bacteria that do not correlate with their virulence or the taxonomic distribution of their hosts. The reasons for such large variation are unclear. According to the traditional view of viruses as gifted "gene pickpockets", large viral genome sizes could originate from numerous gene acquisitions from their hosts. We investigated this hypothesis by studying 67 large DNA viruses with genome sizes larger than 150 kb, including the recently characterized giant mimivirus. Given that horizontally transferred DNA often have anomalous nucleotide compositions differing from the rest of the genome, we conducted a detailed analysis of the inter- and intra-genome compositional properties of these viruses. We then interpreted their compositional heterogeneity in terms of possible causes, including strand asymmetry, gene function/expression, and horizontal transfer. Results We first show that the global nucleotide composition and nucleotide word usage of viral genomes are species-specific and distinct from those of their hosts. Next, we identified compositionally anomalous (cA genes in viral genomes, using a method based on Bayesian inference. The proportion of cA genes is highly variable across viruses and does not exhibit a significant correlation with genome size. The vast majority of the cA genes were of unknown function, lacking homologs in the databases. For genes with known homologs, we found a substantial enrichment of cA genes in specific functional classes for some of the viruses. No significant association was found between cA genes and compositional strand asymmetry. A possible exogenous origin for a small fraction of the cA genes could be confirmed by phylogenetic reconstruction. Conclusion At odds with the traditional dogma, our results argue against frequent genetic transfers to large DNA viruses from their

  13. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  14. Genome-wide survey of Aux/IAA gene family members in potato (Solanum tuberosum): Identification, expression analysis, and evaluation of their roles in tuber development

    International Nuclear Information System (INIS)

    Gao, Junpeng; Cao, Xiaoli; Shi, Shandang; Ma, Yuling; Wang, Kai; Liu, Shengjie; Chen, Dan; Chen, Qin; Ma, Haoli

    2016-01-01

    The Auxin/indole-3-acetic acid (Aux/IAA) genes encode short-lived nuclear proteins that are known to be involved in the primary cellular responses to auxin. To date, systematic analysis of the Aux/IAA genes in potato (Solanum tuberosum) has not been conducted. In this study, a total of 26 potato Aux/IAA genes were identified (designated from StIAA1 to StIAA26), and the distribution of four conserved domains shared by the StIAAs were analyzed based on multiple sequence alignment and a motif-based sequence analysis. A phylogenetic analysis of the Aux/IAA gene families of potato and Arabidopsis was also conducted. In order to assess the roles of StIAA genes in tuber development, the results of RNA-seq studies were reformatted to analyze the expression patterns of StIAA genes, and then verified by quantitative real-time PCR. A large number of StIAA genes (12 genes) were highly expressed in stolon organs and in during the tuber initiation and expansion developmental stages, and most of these genes were responsive to indoleacetic acid treatment. Our results suggested that StIAA genes were involved in the process of tuber development and provided insights into functional roles of potato Aux/IAA genes. - Highlights: • A systematic analysis of the potato AUX/IAA gene family were performed. • StIAA genes were related to auxin perception and signal transduction. • Candidate StIAA genes likely related to tuber initiation and expansion were screened.

  15. Genome-wide survey of Aux/IAA gene family members in potato (Solanum tuberosum): Identification, expression analysis, and evaluation of their roles in tuber development

    Energy Technology Data Exchange (ETDEWEB)

    Gao, Junpeng [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Innovation Experimental College, Northwest A& F University, Yangling, Shaanxi 712100 (China); Cao, Xiaoli; Shi, Shandang [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Ma, Yuling [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Innovation Experimental College, Northwest A& F University, Yangling, Shaanxi 712100 (China); Wang, Kai; Liu, Shengjie [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Chen, Dan [School of Life Sciences and Technology, Xidian University, Xi' an, Shaanxi 710071 (China); Chen, Qin [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China); Ma, Haoli, E-mail: mahaoli@nwsuaf.edu.cn [State Key Laboratory of Crop Stress Biology for Arid Areas, College of Agronomy, Northwest A& F University, Yangling, Shaanxi 712100 (China)

    2016-03-04

    The Auxin/indole-3-acetic acid (Aux/IAA) genes encode short-lived nuclear proteins that are known to be involved in the primary cellular responses to auxin. To date, systematic analysis of the Aux/IAA genes in potato (Solanum tuberosum) has not been conducted. In this study, a total of 26 potato Aux/IAA genes were identified (designated from StIAA1 to StIAA26), and the distribution of four conserved domains shared by the StIAAs were analyzed based on multiple sequence alignment and a motif-based sequence analysis. A phylogenetic analysis of the Aux/IAA gene families of potato and Arabidopsis was also conducted. In order to assess the roles of StIAA genes in tuber development, the results of RNA-seq studies were reformatted to analyze the expression patterns of StIAA genes, and then verified by quantitative real-time PCR. A large number of StIAA genes (12 genes) were highly expressed in stolon organs and in during the tuber initiation and expansion developmental stages, and most of these genes were responsive to indoleacetic acid treatment. Our results suggested that StIAA genes were involved in the process of tuber development and provided insights into functional roles of potato Aux/IAA genes. - Highlights: • A systematic analysis of the potato AUX/IAA gene family were performed. • StIAA genes were related to auxin perception and signal transduction. • Candidate StIAA genes likely related to tuber initiation and expansion were screened.

  16. Developmental Regulation of Gonadotropin-releasing Hormone Gene Expression by the MSX and DLX Homeodomain Protein Families*

    Science.gov (United States)

    Givens, Marjory L.; Rave-Harel, Naama; Goonewardena, Vinodha D.; Kurotani, Reiko; Berdy, Sara E.; Swan, Christo H.; Rubenstein, John L. R.; Robert, Benoit; Mellon, Pamela L.

    2010-01-01

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development. PMID:15743757

  17. Developmental regulation of gonadotropin-releasing hormone gene expression by the MSX and DLX homeodomain protein families.

    Science.gov (United States)

    Givens, Marjory L; Rave-Harel, Naama; Goonewardena, Vinodha D; Kurotani, Reiko; Berdy, Sara E; Swan, Christo H; Rubenstein, John L R; Robert, Benoit; Mellon, Pamela L

    2005-05-13

    Gonadotropin-releasing hormone (GnRH) is the central regulator of the hypothalamic-pituitary-gonadal axis, controlling sexual maturation and fertility in diverse species from fish to humans. GnRH gene expression is limited to a discrete population of neurons that migrate through the nasal region into the hypothalamus during embryonic development. The GnRH regulatory region contains four conserved homeodomain binding sites (ATTA) that are essential for basal promoter activity and cell-specific expression of the GnRH gene. MSX and DLX are members of the Antennapedia class of non-Hox homeodomain transcription factors that regulate gene expression and influence development of the craniofacial structures and anterior forebrain. Here, we report that expression patterns of the Msx and Dlx families of homeodomain transcription factors largely coincide with the migratory route of GnRH neurons and co-express with GnRH in neurons during embryonic development. In addition, MSX and DLX family members bind directly to the ATTA consensus sequences and regulate transcriptional activity of the GnRH promoter. Finally, mice lacking MSX1 or DLX1 and 2 show altered numbers of GnRH-expressing cells in regions where these factors likely function. These findings strongly support a role for MSX and DLX in contributing to spatiotemporal regulation of GnRH transcription during development.

  18. Differential evolution of members of the rhomboid gene family with conservative and divergent patterns.

    Science.gov (United States)

    Li, Qi; Zhang, Ning; Zhang, Liangsheng; Ma, Hong

    2015-04-01

    Rhomboid proteins are intramembrane serine proteases that are involved in a plethora of biological functions, but the evolutionary history of the rhomboid gene family is not clear. We performed a comprehensive molecular evolutionary analysis of the rhomboid gene family and also investigated the organization and sequence features of plant rhomboids in different subfamilies. Our results showed that eukaryotic rhomboids could be divided into five subfamilies (RhoA-RhoD and PARL). Most orthology groups appeared to be conserved only as single or low-copy genes in all lineages in RhoB-RhoD and PARL, whereas RhoA genes underwent several duplication events, resulting in multiple gene copies. These duplication events were due to whole genome duplications in plants and animals and the duplicates might have experienced functional divergence. We also identified a novel group of plant rhomboid (RhoB1) that might have lost their enzymatic activity; their existence suggests that they might have evolved new mechanisms. Plant and animal rhomboids have similar evolutionary patterns. In addition, there are mutations affecting key active sites in RBL8, RBL9 and one of the Brassicaceae PARL duplicates. This study delineates a possible evolutionary scheme for intramembrane proteins and illustrates distinct fates and a mechanism of evolution of gene duplicates. © 2014 The Authors. New Phytologist © 2014 New Phytologist Trust.

  19. Identification and molecular characterization of the nicotianamine synthase gene family in bread wheat.

    Science.gov (United States)

    Bonneau, Julien; Baumann, Ute; Beasley, Jesse; Li, Yuan; Johnson, Alexander A T

    2016-12-01

    Nicotianamine (NA) is a non-protein amino acid involved in fundamental aspects of metal uptake, transport and homeostasis in all plants and constitutes the biosynthetic precursor of mugineic acid family phytosiderophores (MAs) in graminaceous plant species. Nicotianamine synthase (NAS) genes, which encode enzymes that synthesize NA from S-adenosyl-L-methionine (SAM), are differentially regulated by iron (Fe) status in most plant species and plant genomes have been found to contain anywhere from 1 to 9 NAS genes. This study describes the identification of 21 NAS genes in the hexaploid bread wheat (Triticum aestivum L.) genome and their phylogenetic classification into two distinct clades. The TaNAS genes are highly expressed during germination, seedling growth and reproductive development. Fourteen of the clade I NAS genes were up-regulated in root tissues under conditions of Fe deficiency. Protein sequence analyses revealed the presence of endocytosis motifs in all of the wheat NAS proteins as well as chloroplast, mitochondrial and secretory transit peptide signals in four proteins. These results greatly expand our knowledge of NAS gene families in graminaceous plant species as well as the genetics underlying Fe nutrition in bread wheat. © 2016 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  20. Genome-wide analysis of the MYB gene family in physic nut (Jatropha curcas L.).

    Science.gov (United States)

    Zhou, Changpin; Chen, Yanbo; Wu, Zhenying; Lu, Wenjia; Han, Jinli; Wu, Pingzhi; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

    2015-11-01

    The MYB proteins comprise one of the largest transcription factor families in plants, and play key roles in regulatory networks controlling development, metabolism, and stress responses. A total of 125 MYB genes (JcMYB) have been identified in the physic nut (Jatropha curcas L.) genome, including 120 2R-type MYB, 4 3R-MYB, and 1 4R-MYB genes. Based on exon-intron arrangement of MYBs from both lower (Physcomitrella patens) and higher (physic nut, Arabidopsis, and rice) plants, we can classify plant MYB genes into ten groups (MI-X), except for MIX genes which are nonexistent in higher plants. We also observed that MVIII genes may be one of the most ancient MYB types which consist of both R2R3- and 3R-MYB genes. Most MYB genes (76.8% in physic nut) belong to the MI group which can be divided into 34 subgroups. The JcMYB genes were nonrandomly distributed on its 11 linkage groups (LGs). The expansion of MYB genes across several subgroups was observed and resulted from genome triplication of ancient dicotyledons and from both ancient and recent tandem duplication events in the physic nut genome. The expression patterns of several MYB duplicates in the physic nut showed differences in four tissues (root, stem, leaf, and seed), and 34 MYB genes responded to at least one abiotic stressor (drought, salinity, phosphate starvation, and nitrogen starvation) in leaves and/or roots based on the data analysis of digital gene expression tags. Overexpression of the JcMYB001 gene in Arabidopsis increased its sensitivity to drought and salinity stresses. Copyright © 2015 Elsevier B.V. All rights reserved.

  1. The essence of NAC gene family to the cultivation of drought-resistant soybean (Glycine max L. Merr.) cultivars.

    Science.gov (United States)

    Hussain, Reem M; Ali, Mohammed; Feng, Xing; Li, Xia

    2017-02-28

    The NAC gene family is notable due to its large size, as well as its relevance in crop cultivation - particularly in terms of enhancing stress tolerance of plants. These plant-specific proteins contain NAC domain(s) that are named after Petunia NAM and Arabidopsis ATAF1/2 and CUC2 transcription factors based on the consensus sequence they have. Despite the knowledge available regarding NAC protein function, an extensive study on the possible use of GmNACs in developing soybean cultivars with superior drought tolerance is yet to be done. In response to this, our study was carried out, mainly through means of phylogenetic analysis (rice and Arabidopsis NAC genes served as seeding sequences). Through this, 139 GmNAC genes were identified and later grouped into 17 clusters. Furthermore, real-time quantitative PCR was carried out on drought-stressed and unstressed leaf tissues of both sensitive (B217 and H228) and tolerant (Jindou 74 and 78) cultivars. This was done to analyze the gene expression of 28 dehydration-responsive GmNAC genes. Upon completing the analysis, it was found that GmNAC gene expression is actually dependent on genotype. Eight of the 28 selected genes (GmNAC004, GmNAC021, GmNAC065, GmNAC066, GmNAC073, GmNAC082, GmNAC083 and GmNAC087) were discovered to have high expression levels in the drought-resistant soybean varieties tested. This holds true for both extreme and standard drought conditions. Alternatively, the drought-sensitive cultivars exhibited lower GmNAC expression levels in comparison to their tolerant counterparts. The study allowed for the identification of eight GmNAC genes that could be focused upon in future attempts to develop superior soybean varieties, particularly in terms of drought resistance. This study revealed that there were more dehydration-responsive GmNAC genes as (GmNAC004, GmNAC005, GmNAC020 and GmNAC021) in addition to what were reported in earlier inquiries. It is important to note though, that discovering such

  2. Large-scale gene expression reveals different adaptations of Hyalopterus persikonus to winter and summer host plants.

    Science.gov (United States)

    Cui, Na; Yang, Peng-Cheng; Guo, Kun; Kang, Le; Cui, Feng

    2017-06-01

    Host alternation, an obligatory seasonal shifting between host plants of distant genetic relationship, has had significant consequences for the diversification and success of the superfamily of aphids. However, the underlying molecular mechanism remains unclear. In this study, the molecular mechanism of host alternation was explored through a large-scale gene expression analysis of the mealy aphid Hyalopterus persikonus on winter and summer host plants. More than four times as many unigenes of the mealy aphid were significantly upregulated on summer host Phragmites australis than on winter host Rosaceae plants. In order to identify gene candidates related to host alternation, the differentially expressed unigenes of H. persikonus were compared to salivary gland expressed genes and secretome of Acyrthosiphon pisum. Genes involved in ribosome and oxidative phosphorylation and with molecular functions of heme-copper terminal oxidase activity, hydrolase activity and ribosome binding were potentially upregulated in salivary glands of H. persikonus on the summer host. Putative secretory proteins, such as detoxification enzymes (carboxylesterases and cytochrome P450s), antioxidant enzymes (peroxidase and superoxide dismutase), glutathione peroxidase, glucose dehydrogenase, angiotensin-converting enzyme, cadherin, and calreticulin, were highly expressed in H. persikonus on the summer host, while a SCP GAPR-1-like family protein and a salivary sheath protein were highly expressed in the aphids on winter hosts. These results shed light on phenotypic plasticity in host utilization and seasonal adaptation of aphids. © 2016 Institute of Zoology, Chinese Academy of Sciences.

  3. NHS Gene Mutations in Ashkenazi Jewish Families with Nance-Horan Syndrome.

    Science.gov (United States)

    Shoshany, Nadav; Avni, Isaac; Morad, Yair; Weiner, Chen; Einan-Lifshitz, Adi; Pras, Eran

    2017-09-01

    To describe ocular and extraocular abnormalities in two Ashkenazi Jewish families with infantile cataract and X-linked inheritance, and to identify their underlying mutations. Seven affected members were recruited. Medical history, clinical findings, and biometric measurements were recorded. Mutation analysis of the Nance-Horan syndrome (NHS) gene was performed by direct sequencing of polymerase chain reaction-amplified exons. An unusual anterior Y-sutural cataract was documented in the affected male proband. Other clinical features among examined patients included microcorneas, long and narrow faces, and current or previous dental anomalies. A nonsense mutation was identified in each family, including a previously described 742 C>T, p.(Arg248*) mutation in Family A, and a novel mutation 2915 C>A, p.(Ser972*) in Family B. Our study expands the repertoire of NHS mutations and the related phenotype, including newly described anterior Y-sutural cataract and dental findings.

  4. Molecular analysis of the Duchenne muscular dystrophy gene in Spanish individuals: Deletion detection and familial diagnosis

    Energy Technology Data Exchange (ETDEWEB)

    Patino, A.; Garcia-Delgado, M.; Narbona, J. [Univ. of Navarra, Pamplona (Spain)

    1995-11-06

    Deletion studies were performed in 26 Duchenne muscular dystrophy (DMD) patients through amplification of nine different exons by multiplex polymerase chain reaction (PCR). DNA from paraffin-embedded muscle biopsies was analyzed in 12 of the 26 patients studied. Optimization of this technique is of great utility because it enables analysis of material stored in pathology archives. PCR deletion detection, useful in DMD-affected boys, is problematic in determining the carrier state in female relatives. For this reason, to perform familial linkage diagnosis, we made use of a dinucleotide repeat polymorphism (STRP, or short tandem repeat polymorphism) located in intron 49 of the gene. We designed a new pair of primers that enabled the detection of 22 different alleles in relatives in the 14 DMD families studied. The use of this marker allowed familial diagnosis in 11 of the 14 DMD families and detection of de novo deletions in 3 of the probands. 8 refs., 5 figs., 2 tabs.

  5. The evolutionary history of the SAL1 gene family in eutherian mammals

    Directory of Open Access Journals (Sweden)

    Callebaut Isabelle

    2011-05-01

    Full Text Available Abstract Background SAL1 (salivary lipocalin is a member of the OBP (Odorant Binding Protein family and is involved in chemical sexual communication in pig. SAL1 and its relatives may be involved in pheromone and olfactory receptor binding and in pre-mating behaviour. The evolutionary history and the selective pressures acting on SAL1 and its orthologous genes have not yet been exhaustively described. The aim of the present work was to study the evolution of these genes, to elucidate the role of selective pressures in their evolution and the consequences for their functions. Results Here, we present the evolutionary history of SAL1 gene and its orthologous genes in mammals. We found that (1 SAL1 and its related genes arose in eutherian mammals with lineage-specific duplications in rodents, horse and cow and are lost in human, mouse lemur, bushbaby and orangutan, (2 the evolution of duplicated genes of horse, rat, mouse and guinea pig is driven by concerted evolution with extensive gene conversion events in mouse and guinea pig and by positive selection mainly acting on paralogous genes in horse and guinea pig, (3 positive selection was detected for amino acids involved in pheromone binding and amino acids putatively involved in olfactory receptor binding, (4 positive selection was also found for lineage, indicating a species-specific strategy for amino acid selection. Conclusions This work provides new insights into the evolutionary history of SAL1 and its orthologs. On one hand, some genes are subject to concerted evolution and to an increase in dosage, suggesting the need for homogeneity of sequence and function in certain species. On the other hand, positive selection plays a role in the diversification of the functions of the family and in lineage, suggesting adaptive evolution, with possible consequences for speciation and for the reinforcement of prezygotic barriers.

  6. Unequal rates of Y chromosome gene divergence during speciation of the family Ursidae.

    Science.gov (United States)

    Nakagome, Shigeki; Pecon-Slattery, Jill; Masuda, Ryuichi

    2008-07-01

    Evolution of the bear family Ursidae is well investigated in terms of morphological, paleontological, and genetic features. However, several phylogenetic ambiguities occur within the subfamily Ursinae (the family Ursidae excluding the giant panda and spectacled bear), which may correlate with behavioral traits of female philopatry and male-biased dispersal which form the basis of the observed matriarchal population structure in these species. In the process of bear evolution, we investigate the premise that such behavioral traits may be reflected in patterns of variation among genes with different modes of inheritance: matrilineal mitochondrial DNA (mtDNA), patrilineal Y chromosome, biparentally inherited autosomes, and the X chromosome. In the present study, we sequenced 3 Y-linked genes (3,453 bp) and 4 X-linked genes (4,960 bp) and reanalyzed previously published sequences from autosome genes (2,347 bp) in ursid species to investigate differences in evolutionary rates associated with patterns of inheritance. The results describe topological incongruence between sex-linked genes and autosome genes and between nuclear DNA and mtDNA. In more ancestral branches within the bear phylogeny, Y-linked genes evolved faster than autosome and X-linked genes, consistent with expectations based on male-driven evolution. However, this pattern changes among branches leading to each species within the lineage of Ursinae whereby the evolutionary rates of Y-linked genes have fewer than expected substitutions. This inconsistency between more recent nodes of the bear phylogeny with more ancestral nodes may reflect the influences of sex-biased dispersal as well as molecular evolutionary characteristics of the Y chromosome, and stochastic events in species natural history, and phylogeography unique to ursine bears.

  7. Gene amplification as a cause of inherited thyroxine-binding globulin excess in two Japanese families

    Energy Technology Data Exchange (ETDEWEB)

    Mori, Yuichi; Miura, Yoshitaka; Saito, Hidehiko [Toyota Memorial Hospital (Japan)] [and others

    1995-12-01

    T{sub 4}-binding globulin (TBG) is the major thyroid hormone transport protein in man. Inherited abnormalities in the level of serum TBG have been classified as partial deficiency, complete deficiency, and excess. Sequencing analysis of the TBG gene, located on Xq21-22, has uncovered the molecular defects causing partial and complete deficiency. However, the mechanism leading to inherited TBG excess remains unknown. In this study, two Japanese families, F-A and F-T, with inherited TBG excess were analyzed. Serum TBG levels in hemizygous males were 58 and 44 {mu}g/mL, 3- and 2-fold the normal value, respectively. The molecule had normal properties in terms of heat stability and isoelectric focussing pattern. The sequence of the coding region and the promoter activity of the TBG gene were also indistinguishable between hemizygotes and normal subjects. The gene dosage of TBG relative to that of {beta}-globin, which is located on chromosome 11, and Duchenne muscular dystropy, which is located on Xp, was evaluated by coamplification of these target genes using polymerase chain reaction and subsequent quantitation by HPLC. The TBG/{beta}-globin ratios of the affected male and female of F-A were 3.13 and 4.13 times, respectively, that in the normal males. The TBG/Duchenne muscular dystrophy ratios were 2.92 and 2.09 times the normal value, respectively. These results are compatible with three copies of TBG gene on the affected X-chromosome. Similarly, a 2-fold increase in gene dosage was demonstrated in the affected hemizygote of F-T. A 3-fold tandem amplification of the TBG gene was shown by in situ hybridization of prometaphase and interphase chromosomes from the affected male with a biotinylated genomic TBG probe, confirming the gene dosage results. Gene amplification of TBG is the cause of inherited TBG excess in these two families. 35 refs., 3 figs., 2 tabs.

  8. Genomic Survey and Expression Profiling of the MYB Gene Family in Watermelon

    Directory of Open Access Journals (Sweden)

    Qing XU

    2018-01-01

    Full Text Available Myeloblastosis (MYB proteins constitute one of the largest transcription factor (TF families in plants. They are functionally diverse in regulating plant development, metabolism, and multiple stress responses. However, the function of watermelon MYB proteins remains elusive to date. Here, a genome-wide identification of watermelon MYB TFs was performed by bioinformatics analysis. A total of 162 MYB genes were identified from watermelon (ClaMYB. A comprehensive overview of the ClaMYB genes was undertaken, including the gene structures, chromosomal distribution, gene duplication, conserved protein motif, and phylogenetic relationship. According to the analyses, the watermelon MYB genes were categorized into three groups (R1R2R3-MYB, R2R3-MYB, and MYB-related. Amino acid alignments for all MYB motifs of ClaMYBs demonstrated high conservation. Investigation of their chromosomal localization revealed that these ClaMYB genes distributed across the 11 watermelon chromosomes. Gene duplication analyses showed that tandem duplication events contributed predominantly to the expansion of the MYB gene family in the watermelon genome. Phylogenetic comparison of the ClaMYB proteins with Arabidopsis MYB proteins revealed that watermelon MYB proteins underwent a more diverse evolution after divergence from Arabidopsis. Some watermelon MYBs were found to cluster into the functional clades of Arabidopsis MYB proteins. Expression analysis under different stress conditions identified a group of watermelon MYB proteins implicated in the plant stress responses. The comprehensive investigation of watermelon MYB genes in this study provides a useful reference for future cloning and functional analysis of watermelon MYB proteins. Keywords: watermelon, MYB transcription factor, abiotic stress, phylogenetic analysis

  9. Expression of REG family genes in human inflammatory bowel diseases and its regulation

    Directory of Open Access Journals (Sweden)

    Chikatsugu Tsuchida

    2017-12-01

    Full Text Available The pathophysiology of inflammatory bowel disease (IBD reflects a balance between mucosal injury and reparative mechanisms. Some regenerating gene (Reg family members have been reported to be expressed in Crohn's disease (CD and ulcerative colitis (UC and to be involved as proliferative mucosal factors in IBD. However, expression of all REG family genes in IBD is still unclear. Here, we analyzed expression of all REG family genes (REG Iα, REG Iβ, REG III, HIP/PAP, and REG IV in biopsy specimens of UC and CD by real-time RT-PCR. REG Iα, REG Iβ, and REG IV genes were overexpressed in CD samples. REG IV gene was also overexpressed in UC samples. We further analyzed the expression mechanisms of REG Iα, REG Iβ, and REG IV genes in human colon cells. The expression of REG Iα was significantly induced by IL-6 or IL-22, and REG Iβ was induced by IL-22. Deletion analyses revealed that three regions (− 220 to − 211, − 179 to − 156, and − 146 to − 130 in REG Iα and the region (− 274 to− 260 in REG Iβ promoter were responsible for the activation by IL-22/IL-6. The promoters contain consensus transcription factor binding sequences for MZF1, RTEF1/TEAD4, and STAT3 in REG Iα, and HLTF/FOXN2F in REG Iβ, respectively. The introduction of siRNAs for MZF1, RTEF1/TEAD4, STAT3, and HLTF/FOXN2F abolished the transcription of REG Iα and REG Iβ. The gene activation mechanisms of REG Iα/REG Iβ may play a role in colon mucosal regeneration in IBD.

  10. [Genome-wide identification and expression analysis of the WRKY gene family in peach].

    Science.gov (United States)

    Gu, Yan-bing; Ji, Zhi-rui; Chi, Fu-mei; Qiao, Zhuang; Xu, Cheng-nan; Zhang, Jun-xiang; Zhou, Zong-shan; Dong, Qing-long

    2016-03-01

    The WRKY transcription factors are one of the largest families of transcriptional regulators and play diverse regulatory roles in biotic and abiotic stresses, plant growth and development processes. In this study, the WRKY DNA-binding domain (Pfam Database number: PF03106) downloaded from Pfam protein families database was exploited to identify WRKY genes from the peach (Prunus persica 'Lovell') genome using HMMER 3.0. The obtained amino acid sequences were analyzed with DNAMAN 5.0, WebLogo 3, MEGA 5.1, MapInspect and MEME bioinformatics softwares. Totally 61 peach WRKY genes were found in the peach genome. Our phylogenetic analysis revealed that peach WRKY genes were classified into three Groups: Ⅰ, Ⅱ and Ⅲ. The WRKY N-terminal and C-terminal domains of Group Ⅰ (group I-N and group I-C) were monophyletic. The Group Ⅱ was sub-divided into five distinct clades (groupⅡ-a, Ⅱ-b, Ⅱ-c, Ⅱ-d and Ⅱ-e). Our domain analysis indicated that the WRKY regions contained a highly conserved heptapeptide stretch WRKYGQK at its N-terminus followed by a zinc-finger motif. The chromosome mapping analysis showed that peach WRKY genes were distributed with different densities over 8 chromosomes. The intron-exon structure analysis revealed that structures of the WRKY gene were highly conserved in the peach. The conserved motif analysis showed that the conserved motifs 1, 2 and 3, which specify the WRKY domain, were observed in all peach WRKY proteins, motif 5 as the unknown domain was observed in group Ⅱ-d, two WRKY domains were assigned to GroupⅠ. SqRT-PCR and qRT-PCR results indicated that 16 PpWRKY genes were expressed in roots, stems, leaves, flowers and fruits at various expression levels. Our analysis thus identified the PpWRKY gene families, and future functional studies are needed to reveal its specific roles.

  11. Genome-wide identification and expression analysis of the CIPK gene family in cassava

    Directory of Open Access Journals (Sweden)

    Wei eHu

    2015-10-01

    Full Text Available Cassava is an important food and potential biofuel crop that is tolerant to multiple abiotic stressors. The mechanisms underlying these tolerances are currently less known. CBL-interacting protein kinases (CIPKs have been shown to play crucial roles in plant developmental processes, hormone signaling transduction, and in the response to abiotic stress. However, no data is currently available about the CPK family in cassava. In this study, a total of 25 CIPK genes were identified from cassava genome based on our previous genome sequencing data. Phylogenetic analysis suggested that 25 MeCIPKs could be classified into four subfamilies, which was supported by exon-intron organizations and the architectures of conserved protein motifs. Transcriptomic analysis of a wild subspecies and two cultivated varieties showed that most MeCIPKs had different expression patterns between wild subspecies and cultivatars in different tissues or in response to drought stress. Some orthologous genes involved in CIPK interaction networks were identified between Arabidopsis and cassava. The interaction networks and co-expression patterns of these orthologous genes revealed that the crucial pathways controlled by CIPK networks may be involved in the differential response to drought stress in different accessions of cassava. Nine MeCIPK genes were selected to investigate their transcriptional response to various stimuli and the results showed the comprehensive response of the tested MeCIPK genes to osmotic, salt, cold, oxidative stressors, and ABA signaling. The identification and expression analysis of CIPK family suggested that CIPK genes are important components of development and multiple signal transduction pathways in cassava. The findings of this study will help lay a foundation for the functional characterization of the CIPK gene family and provide an improved understanding of abiotic stress responses and signaling transduction in cassava.

  12. Identification and characterisation of a hyper-variable apoplastic effector gene family of the potato cyst nematodes.

    Science.gov (United States)

    Eves-van den Akker, Sebastian; Lilley, Catherine J; Jones, John T; Urwin, Peter E

    2014-09-01

    Sedentary endoparasitic nematodes are obligate biotrophs that modify host root tissues, using a suite of effector proteins to create and maintain a feeding site that is their sole source of nutrition. Using assumptions about the characteristics of genes involved in plant-nematode biotrophic interactions to inform the identification strategy, we provide a description and characterisation of a novel group of hyper-variable extracellular effectors termed HYP, from the potato cyst nematode Globodera pallida. HYP effectors comprise a large gene family, with a modular structure, and have unparalleled diversity between individuals of the same population: no two nematodes tested had the same genetic complement of HYP effectors. Individuals vary in the number, size, and type of effector subfamilies. HYP effectors are expressed throughout the biotrophic stages in large secretory cells associated with the amphids of parasitic stage nematodes as confirmed by in situ hybridisation. The encoded proteins are secreted into the host roots where they are detectable by immunochemistry in the apoplasm, between the anterior end of the nematode and the feeding site. We have identified HYP effectors in three genera of plant parasitic nematodes capable of infecting a broad range of mono- and dicotyledon crop species. In planta RNAi targeted to all members of the effector family causes a reduction in successful parasitism.

  13. Identification and characterisation of a hyper-variable apoplastic effector gene family of the potato cyst nematodes.

    Directory of Open Access Journals (Sweden)

    Sebastian Eves-van den Akker

    2014-09-01

    Full Text Available Sedentary endoparasitic nematodes are obligate biotrophs that modify host root tissues, using a suite of effector proteins to create and maintain a feeding site that is their sole source of nutrition. Using assumptions about the characteristics of genes involved in plant-nematode biotrophic interactions to inform the identification strategy, we provide a description and characterisation of a novel group of hyper-variable extracellular effectors termed HYP, from the potato cyst nematode Globodera pallida. HYP effectors comprise a large gene family, with a modular structure, and have unparalleled diversity between individuals of the same population: no two nematodes tested had the same genetic complement of HYP effectors. Individuals vary in the number, size, and type of effector subfamilies. HYP effectors are expressed throughout the biotrophic stages in large secretory cells associated with the amphids of parasitic stage nematodes as confirmed by in situ hybridisation. The encoded proteins are secreted into the host roots where they are detectable by immunochemistry in the apoplasm, between the anterior end of the nematode and the feeding site. We have identified HYP effectors in three genera of plant parasitic nematodes capable of infecting a broad range of mono- and dicotyledon crop species. In planta RNAi targeted to all members of the effector family causes a reduction in successful parasitism.

  14. Multifunctionality and diversity of GDSL esterase/lipase gene family in rice (Oryza sativa L. japonica genome: new insights from bioinformatics analysis

    Directory of Open Access Journals (Sweden)

    Chepyshko Hanna

    2012-07-01

    Full Text Available Abstract Background GDSL esterases/lipases are a newly discovered subclass of lipolytic enzymes that are very important and attractive research subjects because of their multifunctional properties, such as broad substrate specificity and regiospecificity. Compared with the current knowledge regarding these enzymes in bacteria, our understanding of the plant GDSL enzymes is very limited, although the GDSL gene family in plant species include numerous members in many fully sequenced plant genomes. Only two genes from a large rice GDSL esterase/lipase gene family were previously characterised, and the majority of the members remain unknown. In the present study, we describe the rice OsGELP (Oryza sativa GDSL esterase/lipase protein gene family at the genomic and proteomic levels, and use this knowledge to provide insights into the multifunctionality of the rice OsGELP enzymes. Results In this study, an extensive bioinformatics analysis identified 114 genes in the rice OsGELP gene family. A complete overview of this family in rice is presented, including the chromosome locations, gene structures, phylogeny, and protein motifs. Among the OsGELPs and the plant GDSL esterase/lipase proteins of known functions, 41 motifs were found that represent the core secondary structure elements or appear specifically in different phylogenetic subclades. The specification and distribution of identified putative conserved clade-common and -specific peptide motifs, and their location on the predicted protein three dimensional structure may possibly signify their functional roles. Potentially important regions for substrate specificity are highlighted, in accordance with protein three-dimensional model and location of the phylogenetic specific conserved motifs. The differential expression of some representative genes were confirmed by quantitative real-time PCR. The phylogenetic analysis, together with protein motif architectures, and the expression profiling were

  15. Polymorphisms in the estrogen receptor 1 and vitamin C and matrix metalloproteinase gene families are associated with susceptibility to lymphoma.

    Directory of Open Access Journals (Sweden)

    Christine F Skibola

    Full Text Available BACKGROUND: Non-Hodgkin lymphoma (NHL is the fifth most common cancer in the U.S. and few causes have been identified. Genetic association studies may help identify environmental risk factors and enhance our understanding of disease mechanisms. METHODOLOGY/PRINCIPAL FINDINGS: 768 coding and haplotype tagging SNPs in 146 genes were examined using Illumina GoldenGate technology in a large population-based case-control study of NHL in the San Francisco Bay Area (1,292 cases 1,375 controls are included here. Statistical analyses were restricted to HIV- participants of white non-Hispanic origin. Genes involved in steroidogenesis, immune function, cell signaling, sunlight exposure, xenobiotic metabolism/oxidative stress, energy balance, and uptake and metabolism of cholesterol, folate and vitamin C were investigated. Sixteen SNPs in eight pathways and nine haplotypes were associated with NHL after correction for multiple testing at the adjusted q<0.10 level. Eight SNPs were tested in an independent case-control study of lymphoma in Germany (494 NHL cases and 494 matched controls. Novel associations with common variants in estrogen receptor 1 (ESR1 and in the vitamin C receptor and matrix metalloproteinase gene families were observed. Four ESR1 SNPs were associated with follicular lymphoma (FL in the U.S. study, with rs3020314 remaining associated with reduced risk of FL after multiple testing adjustments [odds ratio (OR = 0.42, 95% confidence interval (CI = 0.23-0.77 and replication in the German study (OR = 0.24, 95% CI = 0.06-0.94. Several SNPs and haplotypes in the matrix metalloproteinase-3 (MMP3 and MMP9 genes and in the vitamin C receptor genes, solute carrier family 23 member 1 (SLC23A1 and SLC23A2, showed associations with NHL risk. CONCLUSIONS/SIGNIFICANCE: Our findings suggest a role for estrogen, vitamin C and matrix metalloproteinases in the pathogenesis of NHL that will require further validation.

  16. Linkage and candidate gene analysis of X-linked familial exudative vitreoretinopathy.

    Science.gov (United States)

    Shastry, B S; Hejtmancik, J F; Plager, D A; Hartzer, M K; Trese, M T

    1995-05-20

    Familial exudative vitreoretinopathy (FEVR) is a hereditary eye disorder characterized by avascularity of the peripheral retina, retinal exudates, tractional detachment, and retinal folds. The disorder is most commonly transmitted as an autosomal dominant trait, but X-linked transmission also occurs. To initiate the process of identifying the gene responsible for the X-linked disorder, linkage analysis has been performed with three previously unreported three- or four-generation families. Two-point analysis showed linkage to MAOA (Zmax = 2.1, theta max = 0) and DXS228 (Zmax = 0.5, theta max = 0.11), and this was further confirmed by multipoint analysis with these same markers (Zmax = 2.81 at MAOA), which both lie near the gene causing Norrie disease. Molecular genetic analysis further reveals a missense mutation (R121W) in the third exon of the Norrie's disease gene that perfectly cosegregates with the disease through three generations in one family. This mutation was not detected in the unaffected family members and six normal unrelated controls, suggesting that it is likely to be the pathogenic mutation. Additionally, a polymorphic missense mutation (H127R) was detected in a severely affected patient.

  17. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica

    NARCIS (Netherlands)

    Pessina, S.; Pavan, S.N.C.; Catalano, D.; Gallotta, A.; Visser, R.G.F.; Bai, Y.; Malnoy, M.; Schouten, H.J.

    2014-01-01

    Background Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO

  18. Isolation, structural analysis, and expression characteristics of the maize nuclear factor Y gene families

    International Nuclear Information System (INIS)

    Zhang, Zhongbao; Li, Xianglong; Zhang, Chun; Zou, Huawen; Wu, Zhongyi

    2016-01-01

    NUCLEAR FACTOR-Y (NF-Y) has been shown to play an important role in growth, development, and response to environmental stress. A NF-Y complex, which consists of three subunits, NF-YA, NF-YB, and, NF-YC, binds to CCAAT sequences in a promoter to control the expression of target genes. Although NF-Y proteins have been reported in Arabidopsis and rice, a comprehensive and systematic analysis of ZmNF-Y genes has not yet been performed. To examine the functions of ZmNF-Y genes in this family, we isolated and characterized 50 ZmNF-Y (14 ZmNF-YA, 18 ZmNF-YB, and 18 ZmNF-YC) genes in an analysis of the maize genome. The 50 ZmNF-Y genes were distributed on all 10 maize chromosomes, and 12 paralogs were identified. Multiple alignments showed that maize ZmNF-Y family proteins had conserved regions and relatively variable N-terminal or C-terminal domains. The comparative syntenic map illustrated 40 paralogous NF-Y gene pairs among the 10 maize chromosomes. Microarray data showed that the ZmNF-Y genes had tissue-specific expression patterns in various maize developmental stages and in response to biotic and abiotic stresses. The results suggested that ZmNF-YB2, 4, 8, 10, 13, and 16 and ZmNF-YC6, 8, and 15 were induced, while ZmNF-YA1, 3, 4, 6, 7, 10, 12, and 13, ZmNF-YB15, and ZmNF-YC3 and 9 were suppressed by drought stress. ZmNF-YA3, ZmNF-YA8 and ZmNF-YA12 were upregulated after infection by the three pathogens, while ZmNF-YA1 and ZmNF-YB2 were suppressed. These results indicate that the ZmNF-Ys may have significant roles in the response to abiotic and biotic stresses. - Highlights: • We indicated a total of 50 members of ZmNF-Y gene family in maize genome. • We analyzed gene structure, protein architecture of ZmNF-Y genes. • Evolution pattern and phylogenic relationships were analyzed among 50 ZmNF-Y genes. • Expression pattern of ZmNF-Ys were detected in various maize tissues. • Transcript levels of ZmNF-Ys were measured under various abiotic and biotic stresses.

  19. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

    Science.gov (United States)

    Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

    2007-09-01

    The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

  20. The large soybean (Glycine max) WRKY TF family expanded by segmental duplication events and subsequent divergent selection among subgroups.

    Science.gov (United States)

    Yin, Guangjun; Xu, Hongliang; Xiao, Shuyang; Qin, Yajuan; Li, Yaxuan; Yan, Yueming; Hu, Yingkao

    2013-10-03

    WRKY genes encode one of the most abundant groups of transcription factors in higher plants, and its members regulate important biological process such as growth, development, and responses to biotic and abiotic stresses. Although the soybean genome sequence has been published, functional studies on soybean genes still lag behind those of other species. We identified a total of 133 WRKY members in the soybean genome. According to structural features of their encoded proteins and to the phylogenetic tree, the soybean WRKY family could be classified into three groups (groups I, II, and III). A majority of WRKY genes (76.7%; 102 of 133) were segmentally duplicated and 13.5% (18 of 133) of the genes were tandemly duplicated. This pattern was not apparent in Arabidopsis or rice. The transcriptome atlas revealed notable differential expression in either transcript abundance or in expression patterns under normal growth conditions, which indicated wide functional divergence in this family. Furthermore, some critical amino acids were detected using DIVERGE v2.0 in specific comparisons, suggesting that these sites have contributed to functional divergence among groups or subgroups. In addition, site model and branch-site model analyses of positive Darwinian selection (PDS) showed that different selection regimes could have affected the evolution of these groups. Sites with high probabilities of having been under PDS were found in groups I, II c, II e, and III. Together, these results contribute to a detailed understanding of the molecular evolution of the WRKY gene family in soybean. In this work, all the WRKY genes, which were generated mainly through segmental duplication, were identified in the soybean genome. Moreover, differential expression and functional divergence of the duplicated WRKY genes were two major features of this family throughout their evolutionary history. Positive selection analysis revealed that the different groups have different evolutionary rates

  1. An Efficient Test for Gene-Environment Interaction in Generalized Linear Mixed Models with Family Data.

    Science.gov (United States)

    Mazo Lopera, Mauricio A; Coombes, Brandon J; de Andrade, Mariza

    2017-09-27

    Gene-environment (GE) interaction has important implications in the etiology of complex diseases that are caused by a combination of genetic factors and environment variables. Several authors have developed GE analysis in the context of independent subjects or longitudinal data using a gene-set. In this paper, we propose to analyze GE interaction for discrete and continuous phenotypes in family studies by incorporating the relatedness among the relatives for each family into a generalized linear mixed model (GLMM) and by using a gene-based variance component test. In addition, we deal with collinearity problems arising from linkage disequilibrium among single nucleotide polymorphisms (SNPs) by considering their coefficients as random effects under the null model estimation. We show that the best linear unbiased predictor (BLUP) of such random effects in the GLMM is equivalent to the ridge regression estimator. This equivalence provides a simple method to estimate the ridge penalty parameter in comparison to other computationally-demanding estimation approaches based on cross-validation schemes. We evaluated the proposed test using simulation studies and applied it to real data from the Baependi Heart Study consisting of 76 families. Using our approach, we identified an interaction between BMI and the Peroxisome Proliferator Activated Receptor Gamma ( PPARG ) gene associated with diabetes.

  2. [Analysis of SOX10 gene mutation in a family affected with Waardenburg syndrome type II].

    Science.gov (United States)

    Zheng, Lei; Yan, Yousheng; Chen, Xue; Zhang, Chuan; Zhang, Qinghua; Feng, Xuan; Hao, Shen

    2018-02-10

    OBJECTIVE To detect potential mutation of SOX10 gene in a pedigree affected with Warrdenburg syndrome type II. METHODS Genomic DNA was extracted from peripheral blood samples of the proband and his family members. Exons and flanking sequences of MITF, PAX3, SOX10, SNAI2, END3 and ENDRB genes were analyzed by chip capturing and high throughput sequencing. Suspected mutations were verified with Sanger sequencing. RESULTS A c.127C>T (p.R43X) mutation of the SOX10 gene was detected in the proband, for which both parents showed a wild-type genotype. CONCLUSION The c.127C>T (p.R43X) mutation of SOX10 gene probably underlies the ocular symptoms and hearing loss of the proband.

  3. Identification and characterization of two novel bla(KLUC resistance genes through large-scale resistance plasmids sequencing.

    Directory of Open Access Journals (Sweden)

    Teng Xu

    Full Text Available Plasmids are important antibiotic resistance determinant carriers that can disseminate various drug resistance genes among species or genera. By using a high throughput sequencing approach, two groups of plasmids of Escherichia coli (named E1 and E2, each consisting of 160 clinical E. coli strains isolated from different periods of time were sequenced and analyzed. A total of 20 million reads were obtained and mapped onto the known resistance gene sequences. As a result, a total of 9 classes, including 36 types of antibiotic resistant genes, were identified. Among these genes, 25 and 27 single nucleotide polymorphisms (SNPs appeared, of which 9 and 12 SNPs are nonsynonymous substitutions in the E1 and E2 samples. It is interesting to find that a novel genotype of bla(KLUC, whose close relatives, bla(KLUC-1 and bla(KLUC-2, have been previously reported as carried on the Kluyvera cryocrescens chromosome and Enterobacter cloacae plasmid, was identified. It shares 99% and 98% amino acid identities with Kluc-1 and Kluc-2, respectively. Further PCR screening of 608 Enterobacteriaceae family isolates yielded a second variant (named bla(KLUC-4. It was interesting to find that Kluc-3 showed resistance to several cephalosporins including cefotaxime, whereas bla(KLUC-4 did not show any resistance to the antibiotics tested. This may be due to a positively charged residue, Arg, replaced by a neutral residue, Leu, at position 167, which is located within an omega-loop. This work represents large-scale studies on resistance gene distribution, diversification and genetic variation in pooled multi-drug resistance plasmids, and provides insight into the use of high throughput sequencing technology for microbial resistance gene detection.

  4. A Clinical and Molecular Genetic Study of 50 Families with Autosomal Recessive Parkinsonism Revealed Known and Novel Gene Mutations.

    Science.gov (United States)

    Taghavi, Shaghayegh; Chaouni, Rita; Tafakhori, Abbas; Azcona, Luis J; Firouzabadi, Saghar Ghasemi; Omrani, Mir Davood; Jamshidi, Javad; Emamalizadeh, Babak; Shahidi, Gholam Ali; Ahmadi, Mona; Habibi, Seyed Amir Hassan; Ahmadifard, Azadeh; Fazeli, Atena; Motallebi, Marzieh; Petramfar, Peyman; Askarpour, Saeed; Askarpour, Shiva; Shahmohammadibeni, Hossein Ali; Shahmohammadibeni, Neda; Eftekhari, Hajar; Shafiei Zarneh, Amir Ehtesham; Mohammadihosseinabad, Saeed; Khorrami, Mehdi; Najmi, Safa; Chitsaz, Ahmad; Shokraeian, Parasto; Ehsanbakhsh, Hossein; Rezaeidian, Jalal; Ebrahimi Rad, Reza; Madadi, Faranak; Andarva, Monavvar; Alehabib, Elham; Atakhorrami, Minoo; Mortazavi, Seyed Erfan; Azimzadeh, Zahra; Bayat, Mahdis; Besharati, Amir Mohammad; Harati-Ghavi, Mohammad Ali; Omidvari, Samareh; Dehghani-Tafti, Zahra; Mohammadi, Faraz; Mohammad Hossein Pour, Banafsheh; Noorollahi Moghaddam, Hamid; Esmaili Shandiz, Ehsan; Habibi, Arman; Taherian-Esfahani, Zahra; Darvish, Hossein; Paisán-Ruiz, Coro

    2018-04-01

    In this study, the role of known Parkinson's disease (PD) genes was examined in families with autosomal recessive (AR) parkinsonism to assist with the differential diagnosis of PD. Some families without mutations in known genes were also subject to whole genome sequencing with the objective to identify novel parkinsonism-related genes. Families were selected from 4000 clinical files of patients with PD or parkinsonism. AR inheritance pattern, consanguinity, and a minimum of two affected individuals per family were used as inclusion criteria. For disease gene/mutation identification, multiplex ligation-dependent probe amplification, quantitative PCR, linkage, and Sanger and whole genome sequencing assays were carried out. A total of 116 patients (50 families) were examined. Fifty-four patients (46.55%; 22 families) were found to carry pathogenic mutations in known genes while a novel gene, not previously associated with parkinsonism, was found mutated in a single family (2 patients). Pathogenic mutations, including missense, nonsense, frameshift, and exon rearrangements, were found in Parkin, PINK1, DJ-1, SYNJ1, and VAC14 genes. In conclusion, variable phenotypic expressivity was seen across all families.

  5. Genome-wide survey of Aux/IAA gene family members in potato (Solanum tuberosum): Identification, expression analysis, and evaluation of their roles in tuber development.

    Science.gov (United States)

    Gao, Junpeng; Cao, Xiaoli; Shi, Shandang; Ma, Yuling; Wang, Kai; Liu, Shengjie; Chen, Dan; Chen, Qin; Ma, Haoli

    2016-03-04

    The Auxin/indole-3-acetic acid (Aux/IAA) genes encode short-lived nuclear proteins that are known to be involved in the primary cellular responses to auxin. To date, systematic analysis of the Aux/IAA genes in potato (Solanum tuberosum) has not been conducted. In this study, a total of 26 potato Aux/IAA genes were identified (designated from StIAA1 to StIAA26), and the distribution of four conserved domains shared by the StIAAs were analyzed based on multiple sequence alignment and a motif-based sequence analysis. A phylogenetic analysis of the Aux/IAA gene families of potato and Arabidopsis was also conducted. In order to assess the roles of StIAA genes in tuber development, the results of RNA-seq studies were reformatted to analyze the expression patterns of StIAA genes, and then verified by quantitative real-time PCR. A large number of StIAA genes (12 genes) were highly expressed in stolon organs and in during the tuber initiation and expansion developmental stages, and most of these genes were responsive to indoleacetic acid treatment. Our results suggested that StIAA genes were involved in the process of tuber development and provided insights into functional roles of potato Aux/IAA genes. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. The FTF gene family regulates virulence and expression of SIX effectors in Fusarium oxysporum.

    Science.gov (United States)

    Niño-Sánchez, Jonathan; Casado-Del Castillo, Virginia; Tello, Vega; De Vega-Bartol, José J; Ramos, Brisa; Sukno, Serenella A; Díaz Mínguez, José María

    2016-09-01

    The FTF (Fusarium transcription factor) gene family comprises a single copy gene, FTF2, which is present in all the filamentous ascomycetes analysed, and several copies of a close relative, FTF1, which is exclusive to Fusarium oxysporum. An RNA-mediated gene silencing system was developed to target mRNA produced by all the FTF genes, and tested in two formae speciales: F. oxysporum f. sp. phaseoli (whose host is common bean) and F. oxysporum f. sp. lycopersici (whose host is tomato). Quantification of the mRNA levels showed knockdown of FTF1 and FTF2 in randomly isolated transformants of both formae speciales. The attenuation of FTF expression resulted in a marked reduction in virulence, a reduced expression of several SIX (Secreted In Xylem) genes, the best studied family of effectors in F. oxysporum, and lower levels of SGE1 (Six Gene Expression 1) mRNA, the presumptive regulator of SIX expression. Moreover, the knockdown mutants showed a pattern of colonization of the host plant similar to that displayed by strains devoid of FTF1 copies (weakly virulent strains). Gene knockout of FTF2 also resulted in a reduction in virulence, but to a lesser extent. These results demonstrate the role of the FTF gene expansion, mostly the FTF1 paralogues, as a regulator of virulence in F. oxysporum and suggest that the control of effector expression is the mechanism involved. © 2016 The Authors Molecular Plant Pathology Published by British Society for Plant Pathology and John Wiley & Sons Ltd.

  7. Genome-wide characterization of phenylalanine ammonia-lyase gene family in watermelon (Citrullus lanatus).

    Science.gov (United States)

    Dong, Chun-Juan; Shang, Qing-Mao

    2013-07-01

    Phenylalanine ammonia-lyase (PAL), the first enzyme in the phenylpropanoid pathway, plays a critical role in plant growth, development, and adaptation. PAL enzymes are encoded by a gene family in plants. Here, we report a genome-wide search for PAL genes in watermelon. A total of 12 PAL genes, designated ClPAL1-12, are identified . Nine are arranged in tandem in two duplication blocks located on chromosomes 4 and 7, and the other three ClPAL genes are distributed as single copies on chromosomes 2, 3, and 8. Both the cDNA and protein sequences of ClPALs share an overall high identity with each other. A phylogenetic analysis places 11 of the ClPALs into a separate cucurbit subclade, whereas ClPAL2, which belongs to neither monocots nor dicots, may serve as an ancestral PAL in plants. In the cucurbit subclade, seven ClPALs form homologous pairs with their counterparts from cucumber. Expression profiling reveals that 11 of the ClPAL genes are expressed and show preferential expression in the stems and male and female flowers. Six of the 12 ClPALs are moderately or strongly expressed in the fruits, particularly in the pulp, suggesting the potential roles of PAL in the development of fruit color and flavor. A promoter motif analysis of the ClPAL genes implies redundant but distinctive cis-regulatory structures for stress responsiveness. Finally, duplication events during the evolution and expansion of the ClPAL gene family are discussed, and the relationships between the ClPAL genes and their cucumber orthologs are estimated.

  8. Genome-Wide Identification, Characterization and Expression Analysis of the Solute Carrier 6 Gene Family in Silkworm (Bombyx mori).

    Science.gov (United States)

    Tang, Xin; Liu, Huawei; Chen, Quanmei; Wang, Xin; Xiong, Ying; Zhao, Ping

    2016-10-03

    The solute carrier 6 (SLC6) gene family, initially known as the neurotransmitter transporters, plays vital roles in the regulation of neurotransmitter signaling, nutrient absorption and motor behavior. In this study, a total of 16 candidate genes were identified as SLC6 family gene homologs in the silkworm (Bombyx mori) genome. Spatio-temporal expression patterns of silkworm SLC6 gene transcripts indicated that these genes were highly and specifically expressed in midgut, brain and gonads; moreover, these genes were expressed primarily at the feeding stage or adult stage. Levels of expression for most midgut-specific and midgut-enriched gene transcripts were down-regulated after starvation but up-regulated after re-feeding. In addition, we observed that expression levels of these genes except for BmSLC6-15 and BmGT1 were markedly up-regulated by a juvenile hormone analog. Moreover, brain-enriched genes showed differential expression patterns during wandering and mating processes, suggesting that these genes may be involved in modulating wandering and mating behaviors. Our results improve our understanding of the expression patterns and potential physiological functions of the SLC6 gene family, and provide valuable information for the comprehensive functional analysis of the SLC6 gene family.

  9. Mutational Analysis of the TYR and OCA2 Genes in Four Chinese Families with Oculocutaneous Albinism.

    Science.gov (United States)

    Wang, Yun; Wang, Zhi; Chen, Mengping; Fan, Ning; Yang, Jie; Liu, Lu; Wang, Ying; Liu, Xuyang

    2015-01-01

    Oculocutaneous albinism (OCA) is an autosomal recessive disorder. The most common type OCA1 and OCA2 are caused by homozygous or compound heterozygous mutations in the tyrosinase gene (TYR) and OCA2 gene, respectively. The purpose of this study was to evaluate the molecular basis of oculocutaneous albinism in four Chinese families. Four non-consanguineous OCA families were included in the study. The TYR and OCA2 genes of all individuals were amplified by polymerase chain reaction (PCR), sequenced and compared with a reference database. Four patients with a diagnosis of oculocutaneous albinism, presented with milky skin, white or light brown hair and nystagmus. Genetic analyses demonstrated that patient A was compound heterozygous for c.1037-7T.A, c.1037-10_11delTT and c.1114delG mutations in the TYR gene; patient B was heterozygous for c.593C>T and c.1426A>G mutations in the OCA2 gene, patients C and D were compound heterozygous mutations in the TYR gene (c.549_550delGT and c.896G>A, c.832C>T and c.985T>C, respectively). The heterozygous c.549_550delGT and c.1114delG alleles in the TYR gene were two novel mutations. Interestingly, heterozygous members in these pedigrees who carried c.1114delG mutations in the TYR gene or c.1426A>G mutations in the OCA2 gene presented with blond or brown hair and pale skin, but no ocular disorders when they were born; the skin of these patients accumulated pigment over time and with sun exposure. This study expands the mutation spectrum of oculocutaneous albinism. It is the first time, to the best of our knowledge, to report that c.549_550delGT and c.1114delG mutations in the TYR gene were associated with OCA. The two mutations (c.1114delG in the TYR gene and c.1426A>G in the OCA2 gene) may be responsible for partial clinical manifestations of OCA.

  10. Phylogenetic relationships of the Fox (Forkhead) gene family in the Bilateria

    Science.gov (United States)

    Mazet, Francoise; Yu, Jr Kai; Liberles, David A.; Holland, Linda Z.; Shimeld, Sebastian M.

    2003-01-01

    The Forkhead or Fox gene family encodes putative transcription factors. There are at least four Fox genes in yeast, 16 in Drosophila melanogaster (Dm) and 42 in humans. Recently, vertebrate Fox genes have been classified into 17 groups named FoxA to FoxQ. Here, we extend this analysis to invertebrates, using available sequences from D. melanogaster, Anopheles gambiae (Ag), Caenorhabditis elegans (Ce), the sea squirt Ciona intestinalis (Ci) and amphioxus Branchiostoma floridae (Bf), from which we also cloned several Fox genes. Phylogenetic analyses lend support to the previous overall subclassification of vertebrate genes, but suggest that four subclasses (FoxJ, L, N and Q) could be further subdivided to reflect their relationships to invertebrate genes. We were unable to identify orthologs of Fox subclasses E, H, I, J, M and Q1 in D. melanogaster, A. gambiae or C. elegans, suggesting either considerable loss in ecdysozoans or the evolution of these subclasses in the deuterostome lineage. Our analyses suggest that the common ancestor of protostomes and deuterostomes had a minimum complement of 14 Fox genes.

  11. Identification of the first large deletion in the CLDN16 gene in a patient with FHHNC and late-onset of chronic kidney disease: case report.

    Science.gov (United States)

    Yamaguti, Paulo Marcio; dos Santos, Pollyanna Almeida Costa; Leal, Bruno Sakamoto; Santana, Viviane Brandão Bandeira de Mello; Mazzeu, Juliana Forte; Acevedo, Ana Carolina; Neves, Francisco de Assis Rocha

    2015-07-02

    Familial hypomagnesemia with hypercalciuria and nephrocalcinosis is a rare autosomal recessive renal disease characterized by tubular disorders at the thick ascending limb of Henle's loop. It is caused by mutations in the tight junction structural proteins claudin-16 or claudin-19, which are encoded by the CLDN16 and CLDN19 genes, respectively. Patients exhibit excessive wasting of calcium and magnesium, nephrocalcinosis, chronic kidney disease, and early progression to end-stage renal failure during infancy. We here report the phenotype and molecular analysis of a female Brazilian patient with a novel large homozygous deletion in the CLDN16 gene. The proband, born from consanguineous parents, presented the first symptoms at age 20. Clinical examination revealed hypocalcemia, hypomagnesemia, nephrocalcinosis, mild myopia, high serum levels of uric acid and intact parathyroid hormone, and moderate chronic kidney disease (stage 3). She and her mother were subjected to CLDN16 and CLDN19 mutational analysis. In addition, the multiplex ligation-dependent probe amplification method was used to confirm a CLDN16 multi-exon deletion. Direct sequencing revealed a normal CLDN19 sequence and suggested a large deletion in the CLDN16 gene. Multiplex ligation-dependent probe amplification showed a homozygous CLDN16 multi-exon deletion (E2_E5del). The patient initiated conventional treatment for familial hypomagnesemia with hypercalciuria and nephrocalcinosis and progressed to end-stage kidney disease after five years. This study provides the first report of a large homozygous deletion in the CLDN16 gene causing familial hypomagnesemia with hypercalciuria and nephrocalcinosis with late onset of the first symptoms. This description expands the phenotypic and genotypic characterization of the disease. The late-onset chronic kidney disease in the presence of a homozygous deletion in the CLDN16 gene reinforces the great variability of genotype-phenotype manifestation in patients with

  12. Genome-wide characterization, evolution, and expression analysis of the leucine-rich repeat receptor-like protein kinase (LRR-RLK) gene family in Rosaceae genomes.

    Science.gov (United States)

    Sun, Jiangmei; Li, Leiting; Wang, Peng; Zhang, Shaoling; Wu, Juyou

    2017-10-10

    Leucine-rich repeat receptor-like protein kinase (LRR-RLK) is the largest gene family of receptor-like protein kinases (RLKs) and actively participates in regulating the growth, development, signal transduction, immunity, and stress responses of plants. However, the patterns of LRR-RLK gene family evolution in the five main Rosaceae species for which genome sequences are available have not yet been reported. In this study, we performed a comprehensive analysis of LRR-RLK genes for five Rosaceae species: Fragaria vesca (strawberry), Malus domestica (apple), Pyrus bretschneideri (Chinese white pear), Prunus mume (mei), and Prunus persica (peach), which contained 201, 244, 427, 267, and 258 LRR-RLK genes, respectively. All LRR-RLK genes were further grouped into 23 subfamilies based on the hidden Markov models approach. RLK-Pelle_LRR-XII-1, RLK-Pelle_LRR-XI-1, and RLK-Pelle_LRR-III were the three largest subfamilies. Synteny analysis indicated that there were 236 tandem duplicated genes in the five Rosaceae species, among which subfamilies XII-1 (82 genes) and XI-1 (80 genes) comprised 68.6%. Our results indicate that tandem duplication made a large contribution to the expansion of the subfamilies. The gene expression, tissue-specific expression, and subcellular localization data revealed that LRR-RLK genes were differentially expressed in various organs and tissues, and the largest subfamily XI-1 was highly expressed in all five Rosaceae species, suggesting that LRR-RLKs play important roles in each stage of plant growth and development. Taken together, our results provide an overview of the LRR-RLK family in Rosaceae genomes and the basis for further functional studies.

  13. A novel RUNX2 missense mutation predicted to disrupt DNA binding causes cleidocranial dysplasia in a large Chinese family