R.B. Kitaj (1932-2007: Warburgian Artist
Directory of Open Access Journals (Sweden)
Chaney, Edward
2013-12-01
Full Text Available This essay examines the influence of Aby Warburg and the Warburg Institute, as mediated by Edgar Wind, on R.B. Kitaj from the late 1950s until his death in 2007. It is based on research in the National Portrait Gallery, the Warburg Institute Archive, the Wind archives in Oxford, Kitaj’s unpublished autobiography and correspondence between the author and the artist dating back to 1972. It explores Kitaj’s creative response to Warburg’s brand of cultural history which encouraged his early eschewal of the prevailing focus upon formal values in favour of ‘symbolic images’ and suggestive content. This tendency was enhanced by his increasing celebration of his Jewishness and aspirations towards the creation of ‘a Jewish art like the Egyptian figurative style’. Kitaj’s portrait of Ernst Gombrich (1986 was commissioned by the National Portrait Gallery at a time when he was becoming obsessed with his Jewish project while Gombrich was confirming his rejection of the category Jewish, in other than a religious context, altogether. Discussion of Jewishness and the arts in the twentieth century is supplemented by the identification of David Allan’s Origin of Painting (done in Italy in 1775 as the inspiration for Kitaj’s Los Angeles series of pictures in which his late, lamented wife is depicted as the Hebrew deity, Shekinah.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false License. 120.20 Section 120.20 Foreign Relations DEPARTMENT OF STATE INTERNATIONAL TRAFFIC IN ARMS REGULATIONS PURPOSE AND DEFINITIONS § 120.20 License. License means a document bearing the word “license” issued by the Directorate of Defense Trade...
22 CFR 20.5 - Survivor benefits.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Survivor benefits. 20.5 Section 20.5 Foreign Relations DEPARTMENT OF STATE PERSONNEL BENEFITS FOR CERTAIN FORMER SPOUSES § 20.5 Survivor benefits. (a) Type of benefits. A former spouse who meets the eligibility requirements of § 20.3 is entitled to...
22 CFR 20.4 - Retirement benefits.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Retirement benefits. 20.4 Section 20.4 Foreign Relations DEPARTMENT OF STATE PERSONNEL BENEFITS FOR CERTAIN FORMER SPOUSES § 20.4 Retirement benefits. (a) Type of benefits. (1) A former spouse who meets the qualification requirements of § 20.3 is entitled to...
20 CFR 606.22 - Application for cap.
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Application for cap. 606.22 Section 606.22... Reduction § 606.22 Application for cap. (a) Application. (1) The Governor of the State shall make... a State requests a cap on tax credit reduction. The Governor is required to notify the Department on...
20 CFR 222.22 - Relationship as divorced spouse.
2010-04-01
... 20 Employees' Benefits 1 2010-04-01 2010-04-01 false Relationship as divorced spouse. 222.22 Section 222.22 Employees' Benefits RAILROAD RETIREMENT BOARD REGULATIONS UNDER THE RAILROAD RETIREMENT ACT FAMILY RELATIONSHIPS Relationship as Divorced Spouse, Surviving Divorced Spouse, or Remarried Widow(er...
49 CFR 1242.20 - Highway grade crossings (accounts XX-17-22 and XX-18-22).
2010-10-01
... 49 Transportation 9 2010-10-01 2010-10-01 false Highway grade crossings (accounts XX-17-22 and XX... RAILROADS 1 Operating Expenses-Way and Structures § 1242.20 Highway grade crossings (accounts XX-17-22 and XX-18-22). Separate running and switching common expenses according to distribution of the running...
22 CFR 62.20 - Professors and research scholars.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Professors and research scholars. 62.20 Section... Specific Program Provisions § 62.20 Professors and research scholars. (a) Introduction. These regulations govern Exchange Visitor Program participants in the categories of professor and research scholar, except...
IL-22R Ligands IL-20, IL-22, and IL-24 Promote Wound Healing in Diabetic db/db Mice.
Kolumam, Ganesh; Wu, Xiumin; Lee, Wyne P; Hackney, Jason A; Zavala-Solorio, Jose; Gandham, Vineela; Danilenko, Dimitry M; Arora, Puneet; Wang, Xiaoting; Ouyang, Wenjun
2017-01-01
Diabetic foot ulcers (DFU) are one of the major complications in type II diabetes patients and can result in amputation and morbidity. Although multiple approaches are used clinically to help wound closure, many patients still lack adequate treatment. Here we show that IL-20 subfamily cytokines are upregulated during normal wound healing. While there is a redundant role for each individual cytokine in this subfamily in wound healing, mice deficient in IL-22R, the common receptor chain for IL-20, IL-22, and IL-24, display a significant delay in wound healing. Furthermore, IL-20, IL-22 and IL-24 are all able to promote wound healing in type II diabetic db/db mice. Mechanistically, when compared to other growth factors such as VEGF and PDGF that accelerate wound healing in this model, IL-22 uniquely induced genes involved in reepithelialization, tissue remodeling and innate host defense mechanisms from wounded skin. Interestingly, IL-22 treatment showed superior efficacy compared to PDGF or VEGF in an infectious diabetic wound model. Taken together, our data suggest that IL-20 subfamily cytokines, particularly IL-20, IL-22, and IL-24, might provide therapeutic benefit for patients with DFU.
LLW Forum meeting report, October 20--22, 1997
International Nuclear Information System (INIS)
Norris, C.; Brown, H.; Lovinger, T.; Scheele, L.; Shaker, M.A.
1997-10-01
The Low-Level Radioactive Waste Forum met in Annapolis, Maryland, on October 20--22, 1997. Twenty-six Forum Participants, Alternate Forum Participants, and meeting designees representing 22 compacts and states participated. A report on the meeting is given under the following subtitles: New developments in states and compacts; Discussion with NRC Commissioner McGaffigan; Regulatory issues session; Executive session; LLW forum business session; DOE low-level waste management program; Transportation of radioactive waste; Environmental equity: Title VI; Congressional studies on Ward Valley Site; Implementation of DOE's strategy for waste management; Relicensing Envirocare; Draft agreement for uniform application of manifesting procedures; CRCPD report; Panel: Future of low-level radioactive waste management; Agenda planning: February 1998; Resolutions; and Attendance
22 CFR 135.20 - Standards for financial management systems.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Standards for financial management systems. 135... Financial Administration § 135.20 Standards for financial management systems. (a) A State must expand and... of applicable statutes. (b) The financial management systems of other grantees and subgrantees must...
22 CFR 11.20 - Foreign Service specialist career candidate appointments.
2010-04-01
..., background investigation, and final review process required of career candidates, but normally they will not... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Foreign Service specialist career candidate... SERVICE OFFICERS § 11.20 Foreign Service specialist career candidate appointments. (a) General...
22 CFR 518.20 - Purpose of financial and program management.
2010-04-01
... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Purpose of financial and program management. 518... ORGANIZATIONS Post-Award Requirements Financial and Program Management § 518.20 Purpose of financial and program management. Sections 518.21 through 518.28 prescribe standards for financial management systems, methods for...
LLW Forum meeting report, July 20--22, 1994
International Nuclear Information System (INIS)
1994-01-01
The Low-Level Radioactive Waste Forum (LLW Forum) is an association of state and compact representative, appointed by governors and compact commissions, established to facilitate state and compact commission implementation of the Low-Level radioactive Waste Policy Act of 1980 and the Low-Level Radioactive Waste Policy Amendments act of 1985 and to promote the objectives of low-level radioactive waste regional compacts. The forum provides an opportunity for states and compacts to share information with one another and to exchange views with officials of federal agencies. This report details activities of the meeting held July 20-22, 1994
Nomoto, R; Maruyama, F; Ishida, S; Tohya, M; Sekizaki, T; Osawa, Ro
2015-02-01
In order to clarify the taxonomic position of serotypes 20, 22 and 26 of Streptococcus suis, biochemical and molecular genetic studies were performed on isolates (SUT-7, SUT-286(T), SUT-319, SUT-328 and SUT-380) reacted with specific antisera of serotypes 20, 22 or 26 from the saliva of healthy pigs as well as reference strains of serotypes 20, 22 and 26. Comparative recN gene sequencing showed high genetic relatedness among our isolates, but marked differences from the type strain S. suis NCTC 10234(T), i.e. 74.8-75.7 % sequence similarity. The genomic relatedness between the isolates and other strains of species of the genus Streptococcus, including S. suis, was calculated using the average nucleotide identity values of whole genome sequences, which indicated that serotypes 20, 22 and 26 should be removed taxonomically from S. suis and treated as a novel genomic species. Comparative sequence analysis revealed 99.0-100 % sequence similarities for the 16S rRNA genes between the reference strains of serotypes 20, 22 and 26, and our isolates. Isolate STU-286(T) had relatively high 16S rRNA gene sequence similarity with S. suis NCTC 10234(T) (98.8 %). SUT-286(T) could be distinguished from S. suis and other closely related species of the genus Streptococcus using biochemical tests. Due to its phylogenetic and phenotypic similarities to S. suis we propose naming the novel species Streptococcus parasuis sp. nov., with SUT-286(T) ( = JCM 30273(T) = DSM 29126(T)) as the type strain. © 2015 IUMS.
RAF V Sweatman (162/2014) [2015] ZASCA 22 (20 march 2015) A ...
African Journals Online (AJOL)
RAF V Sweatman (162/2014) [2015] ZASCA 22 (20 march 2015) A simple illustration of the SCA's statutory ... Log in or Register to get access to full text downloads. ... The effect is that one of the primary purposes of the Amendment Act is ...
ELOVL4 protein preferentially elongates 20:5n3 to very long chain PUFAs over 20:4n6 and 22:6n3[S
Yu, Man; Benham, Aaron; Logan, Sreemathi; Brush, R. Steven; Mandal, Md Nawajes A.; Anderson, Robert E.; Agbaga, Martin-Paul
2012-01-01
We hypothesized that reduction/loss of very long chain PUFAs (VLC-PUFAs) due to mutations in the ELOngase of very long chain fatty acid-4 (ELOVL4) protein contributes to retinal degeneration in autosomal dominant Stargardt-like macular dystrophy (STGD3) and age-related macular degeneration; hence, increasing VLC-PUFA in the retina of these patients could provide some therapeutic benefits. Thus, we tested the efficiency of elongation of C20-C22 PUFA by the ELOVL4 protein to determine which substrates are the best precursors for biosynthesis of VLC-PUFA. The ELOVL4 protein was expressed in pheochromocytoma cells, while green fluorescent protein-expressing and nontransduced cells served as controls. The cells were treated with 20:5n3, 22:6n3, and 20:4n6, either individually or in equal combinations. Both transduced and control cells internalized and elongated the supplemented FAs to C22-C26 precursors. Only ELOVL4-expressing cells synthesized C28-C38 VLC-PUFA from these precursors. In general, 20:5n3 was more efficiently elongated to VLC-PUFA in the ELOVL4-expressing cells, regardless of whether it was in combination with 22:6n3 or with 20:4n6. In each FA treatment group, C34 and C36 VLC-PUFAs were the predominant VLC-PUFAs in the ELOVL4-expressing cells. In summary, 20:5n3, followed by 20:4n6, seems to be the best precursor for boosting the synthesis of VLC-PUFA by ELOVL4 protein. PMID:22158834
International Nuclear Information System (INIS)
Varlamov, V.V.; Stepanov, M.E.
2002-01-01
Data published in the literature on various photonuclear reactions for the 20,22 Ne isotopes and for their natural mixture are analyzed with the aim of exploring special features of the decay of giant-dipole-resonance states in these two isotopes. With the aid of data on the abundances of the isotopes and on the energy reaction thresholds, the cross sections for the reactions 20,22 Ne[(γ, n) + (γ, np)] and 20,22 Ne[(γ, p) + (γ, np)] are broken down into the contributions from the one-nucleon reactions (γ, n) and (γ, p) and the contributions from the reactions (γ, np). The cross sections evaporation model used here to treat the deexcitation of residual nucle(γ, p) 19,21 F in the energy range E γ = 16.0-28.0 MeV and the cross sections for the reactions 20,22 Ne(γ, np) 18,20 F in the energy range E γ = 23.3-28.0 MeV are estimated. The behavior of the cross-section ratio r = σ(γ, p)/σ(γ, n) for the 22 Ne nucleus as a function of energy is analyzed, and the isospin components of the giant dipole resonance in the 22 Ne nucleus are identified. The contributions of the isospin components of the giant dipole resonance in the 22 Ne nucleus to the cross sections for various photonuclear reactions are determined on the basis of an analysis of the diagram of the excitation and decay of pure isospin states in the 22 Ne nucleus and in nuclei neighboring it, which are members of the corresponding isospin multiplets. The isospin splitting of the giant dipole resonance and the ratio of the intensities of the isospin components are determined to be ΔE = 4.57 ± 0.69 MeV and R = 0.24 ± 0.04, respectively
Locus pietatis et vitae II, Vranov u Brna 20.–22. 9. 2010
Czech Academy of Sciences Publication Activity Database
Freemanová, Michaela
2010-01-01
Roč. 47, č. 4 (2010), s. 407-409 ISSN 0018-7003. [Locus pietatis et vitae II. Vranov u Brna, 20.09.2010–22.09.2010] Institutional research plan: CEZ:AV0Z90580513 Keywords : history * monastic orders * conference Subject RIV: AL - Art, Architecture, Cultural Heritage
40 CFR 264.231 - Special requirements for hazardous wastes FO20, FO21, FO22, FO23, FO26, and FO27.
2010-07-01
... HAZARDOUS WASTE TREATMENT, STORAGE, AND DISPOSAL FACILITIES Surface Impoundments § 264.231 Special requirements for hazardous wastes FO20, FO21, FO22, FO23, FO26, and FO27. (a) Hazardous Wastes FO20, FO21, FO22... surface impoundments managing hazardous wastes FO20, FO21, FO22, FO23, FO26, and FO27 in order to reduce...
Jardón-Delgado, Angel; Magos-Guerrero, Gil Alfonso; Martínez-Vázquez, Mariano
2014-01-01
A new cucurbitane-type triterpene, 20, 21, 22, 23, 24, 25, 26, 27-octanorcucurbita-5-ene-3, 11, 16-trione (1), named kinoin D, was isolated from the roots of the medicinal plant Ibervillea sonorae, (wereque). The structure of 1 was established on the basis of extensive NMR and MS studies. In addition, the known kinoins B (3) and C (5) were isolated, as were 16alpha-20,25-trihydroxy-3alpha-(2-O-alpha-L-rhamnopyranosiyl-D-glucopyranosyloxy)-(10alpha)-cucurbit-5-en-11,22-dione (6), (22S)-16alpha,22-diacetoxy-20,25-dihydroxy-3alpha-[3,4,6-tri-O-acetyl-2-O-(2,3,4-tri-O-acetyl-alpha-L-rhamnopyranosyl)-beta-glucopyranosyl]-(10alpha)-cucurbita-5,23t-dien-11-one (7) and 16alpha-acetoxy-20,25-dihydroxy-3alpha-[3,4,6-tri-O-acetyl-2-O-(2,3,4,-tri-O-acetyl-alpha-L-rhamnopyranosyl)-beta-D-glucopyranosyl]-(10alpha)-cucurbita-5-ene-11,22-dione (8). Compound 1 exhibited anti-inflammatory activity in TPA-induced edema in mice.
40 CFR 264.259 - Special requirements for hazardous wastes FO20, FO21, FO22, FO23, FO26, and FO27.
2010-07-01
... HAZARDOUS WASTE TREATMENT, STORAGE, AND DISPOSAL FACILITIES Waste Piles § 264.259 Special requirements for hazardous wastes FO20, FO21, FO22, FO23, FO26, and FO27. (a) Hazardous Wastes FO20, FO21, FO22, FO23, FO26... requirements are necessary for piles managing hazardous wastes FO20, FO21, FO22, FO23, FO26, and FO27 in order...
[Brodmann Areas 20, 21, and 22 in the Cerebral Cortex].
Kaga, Kimitaka; Minami, Shujiro B
2017-04-01
The 20, 21, and 22 areas in the temporal lobe as classified by Brodmann are almost identical with Economo and Koskinas's TA, TE1, and TE2, and, generally, with the gyrus, middle temporal gyrus, and inferior temporal gyrus according to brain anatomy. Before Brodmann's classification, Flechsig published his book "Soul and Brain" in 1897, in which primary, secondary, and association areas in the brain were classified. More recently, results from research using magnetic resonance imaging (MRI) and fMRI support the parcellation of the cerebral cortex proposed by Flechsig, Brodmann, and Economo more than one century ago.
2010-04-01
...-Award Requirements Financial and Program Management § 435.22 Payment. (a) Introduction. Payment methods..., and (ii) Financial management systems that meet the standards for fund control and accountability as..., Payment Management System, Rockville, MD 20852. Interest amounts up to $250 per year may be retained by...
22 CFR 20.9 - Application procedure.
2010-04-01
... by June 22, 1990 or, if an exception is made for compelling cause to this deadline, within 60 days... divorce or annulment that establish eligibility and fully identify the Foreign Service employee or former...
International Nuclear Information System (INIS)
Satpathy, L.; Schmid, K.W.; Krewald, S.; Faessler, A.
1974-01-01
Multi-Configuration-Hartree-Fock (MCHF) calculations with angular momentum projection before the variation of the internal degree of freedom have been performed for the nuclei Ne 20 and Ne 22 . This procedure yields different correlated intrinsic states for the different members of a rotational band. Thus, the angular momentum dependence of correlations has been studied. Experimentally, the ground state spectra of Ne 20 and Ne 22 show properties similar to the phase transitions observed in some rare earth nuclei which have been well reproduced through the present calculations. The calculated spectra show a significant improvement compared to the ones obtained by variation before the angular momentum projection is effected. (author)
Specialists' meeting on advanced controls for fast reactors, Argonne, Illinois, USA June 20-22, 1989
International Nuclear Information System (INIS)
1989-01-01
The Specialists' Meeting on ''Advanced Controls for Fast Reactors'' was held in Argonne, Illinois, USA, from June 20 to 22, 1989. The meeting was sponsored by the International Atomic Energy Agency on the recommendation of the IAEA International Working Group on Fast Reactors and was hosted by Argonne National Laboratory and the US Department of Energy. It was attended by 20 participants and observers from Argentina, France, Germany, Japan, India, the USSR, the United Kingdom, the United States of America, and the IAEA. The purpose of the meeting was to provide an opportunity for participating countries to review and discuss their views on design and technology for advanced control in fast reactors. During the meeting papers were presented by the participants on behalf of their countries and organizations. Presentations were followed by open discussions on the subjects covered by the papers and summaries of the discussions were drafted. After the formal sessions were completed, a final discussion session was held and summaries, general conclusions and recommendations were approved by consensus. A separate abstract was prepared for each of the 22 papers presented at this meeting. Refs, figs, tabs, diagrams and photos
Deformation and orientation effects in the binary symmetric decay of 20,21,22Ne*
International Nuclear Information System (INIS)
Singh, BirBikram; Kaur, Manpreet; Gupta, Raj K.
2014-01-01
We have extended the study of binary symmetric decay (BSD) of extremely light mass compound systems 20,21,22 Ne* formed in 10,11 B+ 10,11 B reactions at E lab = 48 MeV, to explore the role of deformations and orientations, using the Dynamical Cluster decay Model (DCM). In the present work, we find that with inclusion of quadruple deformations and 'hot compact' orientations of nuclei σ ff increases in comparison to the case of spherical considerations of nuclei
Directory of Open Access Journals (Sweden)
Eriko Kage-Nakadai
Full Text Available In multicellular organisms, the surface barrier is essential for maintaining the internal environment. In mammals, the barrier is the stratum corneum. Fatty acid transport protein 4 (FATP4 is a key factor involved in forming the stratum corneum barrier. Mice lacking Fatp4 display early neonatal lethality with features such as tight, thick, and shiny skin, and a defective skin barrier. These symptoms are strikingly similar to those of a human skin disease called restrictive dermopathy. FATP4 is a member of the FATP family that possesses acyl-CoA synthetase activity for very long chain fatty acids. How Fatp4 contributes to skin barrier function, however, remains to be elucidated. In the present study, we characterized two Caenorhabditis elegans genes, acs-20 and acs-22, that are homologous to mammalian FATPs. Animals with mutant acs-20 exhibited defects in the cuticle barrier, which normally prevents the penetration of small molecules. acs-20 mutant animals also exhibited abnormalities in the cuticle structure, but not in epidermal cell fate or cell integrity. The acs-22 mutants rarely showed a barrier defect, whereas acs-20;acs-22 double mutants had severely disrupted barrier function. Moreover, the barrier defects of acs-20 and acs-20;acs-22 mutants were rescued by acs-20, acs-22, or human Fatp4 transgenes. We further demonstrated that the incorporation of exogenous very long chain fatty acids into sphingomyelin was reduced in acs-20 and acs-22 mutants. These findings indicate that C. elegans Fatp4 homologue(s have a crucial role in the surface barrier function and this model might be useful for studying the fundamental molecular mechanisms underlying human skin barrier and relevant diseases.
de Juan-Franco, Elena; Rodríguez-Frade, J M; Mellado, M; Lechuga, Laura M
2013-09-30
We have implemented a Surface Plasmon Resonance (SPR) immunosensor based on a sandwich assay for the simultaneous detection of the two main hGH isoforms, of 22 kDa (22K) and 20 kDa (20K). An oriented-antibody sensor surface specific for both hormone isoforms was assembled by using the biotin-streptavidin system. The immunosensor functionality was checked for the direct detection of the 22K hGH isoform in buffer, which gave high specificity and reproducibility (intra and inter-assay mean coefficients of variation of 8.23% and 9% respectively). The selective determination of the 22K and 20K hGH isoforms in human serum samples in a single assay was possible by using two specific anti-hGH monoclonal antibodies. The detection limit for both hormone isoforms was 0.9 ng mL(-1) and the mean coefficient of variation was below 7.2%. The excellent reproducibility and sensitivity obtained indicate the high performance of this immunosensor for implementing an anti-doping test. Copyright © 2013 Elsevier B.V. All rights reserved.
Ge22As20Se58 glass ultrafast laser inscribed waveguides for mid-IR integrated optics
DEFF Research Database (Denmark)
Morris, James M.; Mackenzie, Mark D.; Petersen, Christian Rosenberg
2018-01-01
Ultrafast laser inscription has been used to produce channel waveguides in Ge22As20Se58 glass (GASIR-1, Umicore N.V). The mode field diameter and waveguide losses at 2.94 mu m were measured along with the waveguide dispersion in the 1 to 4.5 mu m range, which is used to estimate the zero-dispersi...... ultrafast laser inscribed waveguide devices in GASIR-1 for mid-IR integrated optics applications. Published by The Optical Society under the terms of the Creative Commons Attribution 4.0 License.......Ultrafast laser inscription has been used to produce channel waveguides in Ge22As20Se58 glass (GASIR-1, Umicore N.V). The mode field diameter and waveguide losses at 2.94 mu m were measured along with the waveguide dispersion in the 1 to 4.5 mu m range, which is used to estimate the zero......-dispersion wavelength. Z-scan measurements of bulk samples have also been performed to determine the nonlinear refractive index. Finally, midIR supercontinuum generation has been shown when pumping the waveguides with femtosecond pulses centered at 4.6 mu m. Supercontinuum spanning approximately 4 mu m from 2.5 to 6...
International Nuclear Information System (INIS)
Singh, BirBikram; Kaur, Manpreet; Kaur, Varinderjit; Gupta, Raj K.
2014-01-01
The dynamical cluster-decay model (DCM) of Gupta and collaborators has been successfully applied to the decay of number of hot and rotating compound nuclei in different mass regions, formed in low-energy heavy ion reactions. Recently, its application to the binary symmetric decay (BSD) of very light mass compound systems 20,21,22 Ne formed in 10,11 B+ 10,11 B reactions at E lab =48 MeV is extended, as the experimental data for σ BSD Expt . is available, namely, for 20 Ne (∼ 270 mb), 21 Ne ( 22 Ne ( BSD DCM for the BSD of the three Ne systems is calculated, comprising fusion-fission σ ff and deep inelastic scattering/orbiting σorb contributions (evaluated empirically here) from compound nucleus CN and non-compound nucleus nCN processes, respectively. The significant observation from this study is that, of the total σ BSD DCM , σ ff contribution is very strong for the decay of 20 Ne (=195.270 mb; >70%), followed by 21 Ne (=65.723 mb; ∼50%) and 22 Ne (=8.677 mb; almost 10%). This means that the process of collective clusterization within the DCM is playing very strong role for the decay of 20 Ne
Structure of IL-22 Bound to Its High-Affinity IL-22R1 Chain
Energy Technology Data Exchange (ETDEWEB)
Jones, B.C.; Logsdon, N.J.; Walter, M.R. (UAB)
2008-09-29
IL-22 is an IL-10 family cytokine that initiates innate immune responses against bacterial pathogens and contributes to immune disease. IL-22 biological activity is initiated by binding to a cell-surface complex composed of IL-22R1 and IL-10R2 receptor chains and further regulated by interactions with a soluble binding protein, IL-22BP, which shares sequence similarity with an extracellular region of IL-22R1 (sIL-22R1). IL-22R1 also pairs with the IL-20R2 chain to induce IL-20 and IL-24 signaling. To define the molecular basis of these diverse interactions, we have determined the structure of the IL-22/sIL-22R1 complex. The structure, combined with homology modeling and surface plasmon resonance studies, defines the molecular basis for the distinct affinities and specificities of IL-22 and IL-10 receptor chains that regulate cellular targeting and signal transduction to elicit effective immune responses.
H4K20me0 marks post-replicative chromatin and recruits the TONSL₋MMS22L DNA repair complex
Energy Technology Data Exchange (ETDEWEB)
Saredi, Giulia; Huang, Hongda; Hammond, Colin M.; Alabert, Constance; Bekker-Jensen, Simon; Forne, Ignasi; Reverón-Gómez, Nazaret; Foster, Benjamin M.; Mlejnkova, Lucie; Bartke, Till; Cejka, Petr; Mailand, Niels; Imhof, Axel; Patel, Dinshaw J.; Groth, Anja [UCopenhagen; (MSKCC); (ICL); (LMU); (Zurich)
2016-06-22
Here, we report that after DNA replication, chromosomal processes including DNA repair and transcription take place in the context of sister chromatids. While cell cycle regulation can guide these processes globally, mechanisms to distinguish pre- and post-replicative states locally remain unknown. In this paper we reveal that new histones incorporated during DNA replication provide a signature of post-replicative chromatin, read by the human TONSL–MMS22L1, 2, 3, 4 homologous recombination complex. We identify the TONSL ankyrin repeat domain (ARD) as a reader of histone H4 tails unmethylated at K20 (H4K20me0), which are specific to new histones incorporated during DNA replication and mark post-replicative chromatin until the G2/M phase of the cell cycle. Accordingly, TONSL–MMS22L binds new histones H3–H4 both before and after incorporation into nucleosomes, remaining on replicated chromatin until late G2/M. H4K20me0 recognition is required for TONSL–MMS22L binding to chromatin and accumulation at challenged replication forks and DNA lesions. Consequently, TONSL ARD mutants are toxic, compromising genome stability, cell viability and resistance to replication stress. Finally, together, these data reveal a histone-reader-based mechanism for recognizing the post-replicative state, offering a new angle to understand DNA repair with the potential for targeted cancer therapy.
Enhanced glass forming ability and refrigerant capacity of a Gd55Ni22Mn3Al20 bulk metallic glass
International Nuclear Information System (INIS)
Xia, L.; Chan, K.C.; Tang, M.B.
2011-01-01
Highlights: → A new Gd 55 Ni 22 Mn 3 Al 20 bulk metallic glass (BMG) was synthesized by minor Mn addition. → The BMG has enhanced glass forming ability and excellent refrigerant capacity (RC). → The RC of the BMG reaches a high value of 825 J kg -1 under a field of 3979 kA/m. → Its excellent RC is related to its large effective magnetic moment. - Abstract: In this work, a small amount of Mn was added to a Gd 55 Ni 25 Al 20 glass forming alloy, as a replacement for Ni, and a Gd 55 Ni 22 Mn 3 Al 20 bulk metallic glass (BMG) was obtained by suction casting. Its glass forming ability (GFA) was characterized by X-ray diffraction and differential scanning calorimetry, and its magnetic properties were measured using a magnetic property measurement system. It is found that the minor Mn addition can significantly improve both the GFA and the magnetocaloric effect (MCE) of the alloy. The refrigerant capacity (RC) of the BMG can reach a high value of 825 J kg -1 under a field of 3979 kA/m, which is about 29% larger than that of a Gd 55 Ni 25 Al 20 BMG. The effect of the minor Mn addition on the GFA and MCE of the BMG was investigated in the study.
β-delayed charged particle decays of neutron-deficient nuclei 20Mg and 23Si and 22Si
International Nuclear Information System (INIS)
Babo, Mathieu
2016-01-01
The neutron-deficient nuclei 20 Mg, 23 Si and 22 Si were produced by fragmentation at NSCL, at MSU (USA), and implanted into an array of 3 double sided stripped Si detectors, surrounded by 16 high-purity Ge detectors. This novel arrangement allowed the detection of the charged particles emitted by the unbound excited states in coincidence with the γ rays emitted by the de-excitation of the daughter. The βp decay of 20 Mg is very well-known and therefore was used to test and optimize the analysis program. The β-delayed proton transitions to the first 3 excited states in 19 Ne were identified and compared to previous measurements. The half-life, the branching ratio of the transitions and the excitation energies, including the IAS, were measured and are in good agreement with the adopted values. The study of the β+ decay of 23 Si allowed the identification of 14 excited states in 23 Al. The emission of 2 protons from the IAS was unambiguously identified. The measurement of the IAS energy allowed a better determination of the mass excess of 23 Si, giving 23.27 (7) MeV. A possible β3p decay channel was also tentatively identified. Most of the theoretical predictions are in favor of a 2-proton radioactive 22 Si. The β2p decays to the first excited state and the ground state of 20 Na were identified. The branching ratio of the decay to the IAS is 2.05 (44) %, and the IAS excitation energy was measured to be 9040 (54) keV. The additional measurement of the half-life gives T 1/2 = 30.38 (45) ms, and allowed the determination of the partial half-life. In this study, we propose a parameterization of the statistical rate function f for the superallowed Fermi β decays. This allow the first indirect mass measurement of 22 Si ground state, 31.49 (14) MeV. The two-proton threshold is then S2p = 645 (100) keV and does not allow 2p radioactivity. (author) [fr
DEFF Research Database (Denmark)
Sanmartín, Gerard Such; Bache, N.; Bosch, J.
2015-01-01
Human growth hormone (GH) is suspected to be widely and illegally used in sport to improve athletes' performance. For the detection of GH abuse, blood samples are screened for abnormal ratios between the 22 and 20kDa GH proteoforms that demonstrate the administration of the synthetic hormone....... Current detection methods are based on classical immunoassays as they provide sufficient sensitivity for the detection of GH proteoforms. These antibody based methods, however, suffer from unclear selectivity and potential cross-reactivity towards similar proteins. For unambiguous GH detection, we report...... a Mass Spectrometry ImmunoAssay (MSIA) that first enriches GH from plasma with an antibody of relatively low specificity, and subsequently quantifies the 22 and 20kDa proteoforms by Selected Reaction Monitoring (SRM) LC-MS/MS analysis. This method proved superior to an antibody-free strategy based on GH...
Nunes, Miguel Baptista, Ed.; McPherson, Maggie, Ed.; Kommers, Piet, Ed.; Isaias, Pedro, Ed.
2017-01-01
These proceedings contain the papers of the International Conference e-Learning 2017, which was organised by the International Association for Development of the Information Society, 20-22 July, 2017. This conference is part of the Multi Conference on Computer Science and Information Systems 2017, 20-23 July, which had a total of 652 submissions.…
International Nuclear Information System (INIS)
Fazakas, É.; Zadorozhnyy, V.; Louzguine-Luzgin, D.V.
2015-01-01
Highlights: • Three new refractory alloys namely: Al 25 Ti 25 Ni 25 Cu 25 , Al 22.5 Ti 22.5 Ni 20 Cu 20 Fe 15 and Al 20 Ti 20 Ni 20 Cu 20 Fe 20 , were produced by induction-melting and casting. • This kind of alloys exhibits high resistance to annealing softening. • Most the alloys in the annealed state possess even higher Vickers microhardness than the as-cast alloys. • The Al 22.5 Ti 22.5 Ni 20 Cu 20 Fe 15 and Al 20 Ti 20 Ni 20 Cu 20 Fe 20 alloys annealed at 973 K show the highest compressive stress and ductility values. - Abstract: In this work, we investigated the microstructure and mechanical properties of Al 25 Ti 25 Ni 25 C u25 Al 22.5 Ti 22.5 Ni 20 Cu 20 Fe 15 and Al 20 Ti 20 Ni 20 Cu 20 Fe 20 high entropy alloys, produced by arc melting and casting in an inert atmosphere. The structure of these alloys was studied by X-ray diffractometry and scanning electron microscopy. The as-cast alloys were heat treated at 773, 973 and 1173 K for 1800 s to investigate the effects of aging on the plasticity, hardness and elastic properties. Compared to the conventional high-entropy alloys the Al 25 Ti 25 Ni 25 Cu 25 , Al 22.5 Ti 22.5 Ni 20 Cu 20 Fe 15 and Al 20 Ti 20 Ni 20 Cu 20 Fe 20 alloys are relatively hard and ductile. Being heat treated at 973 K the Al 22.5 Ti 22.5 Ni 20 Cu 20 Fe 15 alloy shows considerably high strength and relatively homogeneous deformation under compression. The plasticity, hardness and elastic properties of the studied alloys depend on the fraction and intrinsic properties of the constituent phases. Significant hardening effect by the annealing is found.
A contribution to the study of excited states of Neon 22 and Sodium 22
International Nuclear Information System (INIS)
Chambon, Bernard.
1976-01-01
The experimental study of 22 Ne has been performed. A differentially pump gas target has been used, in conjunction with E+ΔE detectors. Angular distribution measurements have been performed on the 21 Ne(d,p) 22 Ne reaction in the Esub(d) energy range from 3 to 3.6MeV. Angular momentum has been identified and spectroscopic factors extracted for 18 levels by comparison with DWBA predictions. Spin and parities of some excited levels were deduced. The study of the 21 Ne(t,d) 22 Ne reaction corroborates the results concerning the first excited state (2 + ). Experimental results are compared with the predictions of the unified rotational model and of the shell-model. The 20 Ne(t,p) 22 Ne reaction was studied at 3MeV and 3.4MeV bombarding energies. The total cross-section of most groups was analyzed in terms of Hauser-Feshbach theory and several final-state spin predictions are made. The angular distribution of the 20 Ne(t,p) 22 Ne (Esub(x)=6.24MeV) reaction was analyzed by double stripping DWBA theory and indicates 0 + for this state, the isobaric analog of which has been identified at 6.83MeV in 22 Na. Furthermore, several new isobaric analog pairs in 22 Na and 22 Ne are identified via the study of excitation functions for the reactions 21 Ne(p,p) 21 Ne and 21 Ne(p,p') 21 Ne for Esub(p)=0.6-2MeV. Implications of the present results with regard to the identification of band structure in 22 Na are discussed [fr
40 CFR 264.317 - Special requirements for hazardous wastes FO20, FO21, FO22, FO23, FO26, and FO27.
2010-07-01
... HAZARDOUS WASTE TREATMENT, STORAGE, AND DISPOSAL FACILITIES Landfills § 264.317 Special requirements for... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Special requirements for hazardous wastes FO20, FO21, FO22, FO23, FO26, and FO27. 264.317 Section 264.317 Protection of Environment...
40 CFR 264.283 - Special requirements for hazardous wastes FO20, FO21, FO22, FO23, FO26, and FO27.
2010-07-01
... HAZARDOUS WASTE TREATMENT, STORAGE, AND DISPOSAL FACILITIES Land Treatment § 264.283 Special requirements... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Special requirements for hazardous wastes FO20, FO21, FO22, FO23, FO26, and FO27. 264.283 Section 264.283 Protection of Environment...
JEF-2.2 radioactive decay data
International Nuclear Information System (INIS)
1994-08-01
This work deals with the JEF-2.2 radioactive decay data and is divided into four tables. The first table presents the origin of the JEF-2.2 radioactive decay data and subsequent modifications. The second one is a summary of the JEF-2.2 radioactive decay data file. The third one describes the JEF-2.2 fission products and the main decay and fission yield data. The last one consists of the main decay parameters from the JEF-2.2, ENDF/B-VI and JNDC-2.0 libraries. (O.L.). 100 figs., 4 tabs
United Nations Educational, Scientific and Cultural Organization (UNESCO), 2006
2006-01-01
The Section of Education for Peace and Human Rights of the Division for the Promotion of Quality Education held an expert meeting on Intercultural Education from March 20-22, 2006 at UNESCO Headquarters, bringing together international experts from Australia, Bolivia, Egypt, Finland, Hungary, Korea, Lebanon, Mexico, Nigeria, South Africa and the…
Energy Technology Data Exchange (ETDEWEB)
Fazakas, É., E-mail: eva.fazakas@bayzoltan.hu [WPI-Advaced Institute for Materials Research, Tohoku University, Katahira 2-1-1, Aoba-Ku, Sendai 980-8577 (Japan); Wigner Research Center for Physics, Hungarian Academy of Sciences, H-1525, P.O.B. 49 (Hungary); Bay Zoltán Nonprofit Ltd., For Applied Research H-1116 Budapest, Fehérvári út 130 (Hungary); Zadorozhnyy, V. [National University of Science and Technology «MISIS», Leninsky prosp., 4, Moscow 119049 (Russian Federation); Louzguine-Luzgin, D.V. [WPI-Advaced Institute for Materials Research, Tohoku University, Katahira 2-1-1, Aoba-Ku, Sendai 980-8577 (Japan)
2015-12-15
Highlights: • Three new refractory alloys namely: Al{sub 25}Ti{sub 25}Ni{sub 25}Cu{sub 25}, Al{sub 22.5}Ti{sub 22.5}Ni{sub 20}Cu{sub 20}Fe{sub 15} and Al{sub 20}Ti{sub 20}Ni{sub 20}Cu{sub 20}Fe{sub 20}, were produced by induction-melting and casting. • This kind of alloys exhibits high resistance to annealing softening. • Most the alloys in the annealed state possess even higher Vickers microhardness than the as-cast alloys. • The Al{sub 22.5}Ti{sub 22.5}Ni{sub 20}Cu{sub 20}Fe{sub 15} and Al{sub 20}Ti{sub 20}Ni{sub 20}Cu{sub 20}Fe{sub 20} alloys annealed at 973 K show the highest compressive stress and ductility values. - Abstract: In this work, we investigated the microstructure and mechanical properties of Al{sub 25}Ti{sub 25}Ni{sub 25}C{sub u25} Al{sub 22.5}Ti{sub 22.5}Ni{sub 20}Cu{sub 20}Fe{sub 15} and Al{sub 20}Ti{sub 20}Ni{sub 20}Cu{sub 20}Fe{sub 20} high entropy alloys, produced by arc melting and casting in an inert atmosphere. The structure of these alloys was studied by X-ray diffractometry and scanning electron microscopy. The as-cast alloys were heat treated at 773, 973 and 1173 K for 1800 s to investigate the effects of aging on the plasticity, hardness and elastic properties. Compared to the conventional high-entropy alloys the Al{sub 25}Ti{sub 25}Ni{sub 25}Cu{sub 25}, Al{sub 22.5}Ti{sub 22.5}Ni{sub 20}Cu{sub 20}Fe{sub 15} and Al{sub 20}Ti{sub 20}Ni{sub 20}Cu{sub 20}Fe{sub 20} alloys are relatively hard and ductile. Being heat treated at 973 K the Al{sub 22.5}Ti{sub 22.5}Ni{sub 20}Cu{sub 20}Fe{sub 15} alloy shows considerably high strength and relatively homogeneous deformation under compression. The plasticity, hardness and elastic properties of the studied alloys depend on the fraction and intrinsic properties of the constituent phases. Significant hardening effect by the annealing is found.
Mastering JavaServer Faces 2.2
Leonard, Anghel
2014-01-01
A homogenous guide integrating the features of JSF 2.x (2.0, 2.1 and 2.2), following a "learning through examples" paradigm with its main focus on the advanced concepts of JSF. If you are a web developer who uses JSF, this is the book for you. Catering to an intermediate-advanced audience, the book assumes you have fundamental knowledge of JSF. It is intended for the developer who wants to improve their skills with the combined power of JSF 2.0, 2.1, and 2.2.
Directory of Open Access Journals (Sweden)
Bertrand A. R. V.
2006-11-01
Full Text Available De ce 10e Colloque de l' ASTEO sur l'exploitation des océans (Paris, 20-22 janvier 1982 nous retiendrons les points suivants : - la reconnaissance unanime du rôle primordial joué par le secteur pétrolier dans l'exploitation des richesse océaniques ; - la grande qualité des communications consacrées à l'exploitation pétrolière marine. On retiendra aussi une excellente table ronde consacrée aux sources d'énergie utilisables en propulsion sous-marine et susceptibles de menacer le quasi monopole des classique batteries au plomb. Les batteries évoluées, dont le développement industriel coûterait trop cher en l'absence de débouchés commerciaux suffisants (le marché de la traction électrique automobile paraissant leur échapper, semblent abandonnées. Les piles à combustible à hydrogène et à électrolyte basique (type IFP et les moteurs Stirling à stockage thermique se présentaient comme les meilleures solutions de remplacement. Mais un conférencier a créé la surprise en présentant un moteur diesel en circuit fermé qui a été certifié par Lloyds Register et dont on parle pour équiper le sous-marin Argyronète. This 10th ASTEO Symposium on Ocean Exploitation (Paris, 20-22 January 1982 concentrated on the following two points: (i unanimous recognition of the primordial rote played by the petroleum sector in exploiting the wealth contained in the ocean, and (ii the high quality of the papers devoted to offshore petroleum operations. There was also an excellent round-table discussion devoted to energy sources that can be used for subsea propulsion and that might act as a threat to the quasi-monopoly of conventional lead batteries. So-called sophisticated batteries, for which industrial development would be too expensive in the absence of a sufficient potential market (since the market for electric automotive traction appears to be beyond their reach, appear to have been abandoned. Hydrogen and basic electrolyte fuel cells
Wijaya Hardiati
2012-01-01
Librarian has many alternative to classify DDC (Dewey Decimal Classification) number. not only use printed DDC, but now DDC software to help identify DDC number is available. One of them is Athenaeum Light 8.5, DFW (Dewey For Windows) Version 1.00, WebDewey 2.0, e-DDC (electronic-Dewey Decimal Classification) Edition 22. In this paper, it will roll out about how to use software with it excess and deficiency.
International Nuclear Information System (INIS)
Henes, D.; Straub, S.; Blum, W.; Moehlig, H.; Granacher, J.; Berger, C.
1999-01-01
The current state of development of the composite model of deformation of the martensitic steel X 20(22) CrMoV 12 1 under conditions of creep is briefly described. The model is able to reproduce differences in monotonic creep strength of different melts with slightly different initial microstructures and to simulate cyclic creep with alternating phases of tension and compression. (orig.)
Directory of Open Access Journals (Sweden)
Wijaya Hardiati
2012-05-01
Full Text Available Librarian has many alternative to classify DDC (Dewey Decimal Classification number. not only use printed DDC, but now DDC software to help identify DDC number is available. One of them is Athenaeum Light 8.5, DFW (Dewey For Windows Version 1.00, WebDewey 2.0, e-DDC (electronic-Dewey Decimal Classification Edition 22. In this paper, it will roll out about how to use software with it excess and deficiency.
Him, Nik Raikhan Nik; Zainuddin, Mohammad Fiqri; Basha, Anuar Zain Anuar
2017-12-01
The paper focused on microbial degradation of Bisphenol A (BPA) as a safe and fast method to reduce BPA contamination in water. BPA is found in waste water, sea water and home water pipeline and it is nondegradable pollutant. Biodegradation is suggested to be practical solution for large volume of BPA. Biodegradation plays an important role and the effect of low concentration significantly decreased the degradation rate. Pseudomonas aeruginosa NR.22 (Ps.NR.22) which has been isolated from a lake at Seksyen 2, Shah Alam, was used. In Malaysia, Ps.NR.22 isolation agar is used for the BPA degradation process. It was stained with Gram negative-rod shaped bacteria that confirmed to carry a 16S rRNA gene. BPA as a sole carbon has been tested at various concentrations. The research showed that BPA was degraded at 10, 20, 30, 40 and 50 ppm and the bacteria growth rate was excellent in 20 ppm BPA. Degradation of BPA was carried out for 9 hours to 18 hours and the maximum degradation was recorded at 9 hours. The value of the highest peak of growth at 540 nm was 2.0617 using 20 ppm BPA. This novel Pseudomonas aeruginosa NR.22 has great potential to be used in waste water treatment.
Lawaty, Andreas
2011-01-01
Arvustus : Nordosteuropa als Geschichtsregion. Beiträge des III. Internationalen Symposiums zur deutschen Kultur und Geschichte im europäischen Nordosten vom 20.-22. September 2001 in Tallinn. Lübeck : Verlag Schmidt-Römhild 2006. (Veröffentlihungen der Aue-Stiftung. 17)
Broadhurst, C. Leigh; Schmidt, Walter F.; Kim, Moon S.; Nguyen, Julie K.; Qin, Jianwei; Chao, Kuanglin; Bauchan, Gary L.; Shelton, Daniel R.
2016-05-01
The structural, cognitive and visual development of the human brain and retina strictly require long-chain polyunsaturated fatty acids (LC-PUFA). Excluding water, the mammalian brain is about 60% lipid. One of the great unanswered questions with respect to biological science in general is the absolute necessity of the LC-PUFA docosahexaenoic acid (DHA; 22:6n-3) in these fast signal processing tissues. A lipid of the same chain length with just one less diene group, docosapentaenoic acid (DPA; 22:5n-6) is fairly abundant in terrestrial food chains yet cannot substitute for DHA. Gradient Temperature Raman spectroscopy (GTRS) applies the temperature gradients utilized in differential scanning calorimetry to Raman spectroscopy, providing a straightforward technique to identify molecular rearrangements that occur near and at phase transitions. Herein we apply GTRS to DPA, and DHA from -100 to 20°C. 20 Mb three-dimensional data arrays with 1°C increments and first/second derivatives allows complete assignment of solid, liquid and transition state vibrational modes, including low intensity/frequency vibrations that cannot be readily analyzed with conventional Raman. DPA and DHA show significant spectral changes with premelting (-33 and -60°C, respectively) and melting (-27 and -44°C, respectively). The CH2-(HC=CH)-CH2 moieties are not identical in the second half of the DHA and DPA structures. The DHA molecule contains major CH2 twisting (1265 cm-1) with no noticeable CH2 bending, consistent with a flat helical structure with small pitch. Further modeling of neuronal membrane phospholipids must take into account this structure for DHA, which would be configured parallel to the hydrophilic head group line.
17 JOHN 12,20-22 AS A MISSIONARY TEXT: AN EXEGETICAL ...
African Journals Online (AJOL)
(John 3,17) and executor of judgement (John 5,27). By this singular act of glorification, other sheep that are not of the fold would be gathered under one Shepherd (John 10,16; 11,49-52). John 12,22 is ladened with the verb of movement ― e;r cetai. First, it is Philip going to Andrew and then both of them going to Jesus.
CINP 2005 Regional Meeting, 20-22 April 2005
Directory of Open Access Journals (Sweden)
Anissa Abi-Dargham
2005-04-01
Full Text Available List of abstract titles and authors: 1. Antipsychotics across the spectrum: An overview of their mechanisms of action Anissa Abi-Dargham 2. Recent advances in the treatment of common anxiety disorders Christer Allgulander 3. Psychiatry in Africa: The myths, the realities and the exotic O Gureje 4. Mental Health policy developmet in Kenya and Tanznia - A DFID funded project Rachel Jenkins, David Kima, Joseph Mbatia, Frank Njenga 5. Vascular factors in Alzheimer's disease R N Kalaria 6. Depression as an immunologically based Neurodegenerative disorder Brian Leonard 7. Eight years of progress in Arican Psychiatry F Njenga 8. Treatment of Depression: Present and future Dr R.M. Pinder 9. Imaging the Serotinergic system in impulsive aggressive personality disorder patients Larry J Siever, Antonia S. New, Mari Goodman, Monte Buchsbaum, Erin Hazlett, Karen O'Flynn, Anissa Abi-argham, Marc Lauelle 10. Mode of action of Atypical antipsychotic rugs: Focus on A2 Adrnoceptors T.H. Svensson Neuroscience: Selected Abstracts 11. Chemical odulato of Fronto-execuitive functions: Neropsychiatric implications Trevor W Robbins 12. Neural mechanisms of recognition memory and of social atacnt Prof. G Horn 13. Estrogen signling after estrogen receptor ß (ERß Jan-Ake Gustafsson 14. Getting Lost: Hippocampal contributions to agerelated memory dysfunction Carol Barnes Metals and the brain: Selected abstracts 15. Modeling the contributin of iron mismanagement to Neurological disorders Prof. J R C Connor 16. Aluminium-triggered fibrillogenesis of B-Amyloids Prof. PZ Zatta, Dr D Drago, Mr G Tognon, Dr F Ricchelli Psychiatry in Africa: 17. Psychosocal aspects of Khat use among the youth of Nairobi Ms T M Khamis 18. PTSD among motor vehicle accident survivors, Kenya Dr F A Ongecha 19. Psychiatric relities within African context - The Kenyan case Study Prof. D M N Ndetei 20. Adolescent-parenta interactions from infancy, Nairobi Kenya Dr L K Ksakhala, Prof. D M N Ndetei 21
Sodium-22 influx into erythrocytes from diabetic hypertensive patients on maintenance hemodialysis
International Nuclear Information System (INIS)
Gambhir, K.K.; Mathews, J.; Parui, R.; Cruz, I.A.; Hosten, A.O.; Dillard, M.G.
1990-01-01
We have studied the percentage of 22Na+ uptake in cell suspensions; 0.4 to 2.0 x 10(9) erythrocytes/mL from diabetic uremic patients with secondary hypertension and from normal subjects. Suspensions from diabetic uremic patients with secondary hypertension 0.42 +/- 0.06 to 2.05 +/- 0.28; normal subjects showed a percentage uptake of 22Na+ of 0.27 +/- 0.05 to 1.28 +/- 0.22. The uptake of 22Na+ in 2.0 x 10(9) cells/mL was 60% more (P less than .05) in diabetic uremic patients than in the controls. These studies indicate that 22Na+ influx determinations may be used to distinguish secondary hypertensive patients from normal subjects
21 CFR 203.20 - Sales restrictions.
2010-04-01
... 21 Food and Drugs 4 2010-04-01 2010-04-01 false Sales restrictions. 203.20 Section 203.20 Food and Drugs FOOD AND DRUG ADMINISTRATION, DEPARTMENT OF HEALTH AND HUMAN SERVICES (CONTINUED) DRUGS: GENERAL PRESCRIPTION DRUG MARKETING Sales Restrictions § 203.20 Sales restrictions. Except as provided in § 203.22 or...
Laidla, Janet, 1982-
2008-01-01
Arvustus: Nordosteuropa als Geschichtsregion : Beiträge des III. Internationalen Symposiums zur Deutschen Kultur und Geschichte im Europäischen Nordosten vom 20. - 22. September 2001 in Tallinn (Estland). (Helsinki : Aue-Stiftung ; Lübeck : Scmidt-Römhild, 2006)
Fokkema, M.R.; Smit, E.N.; Martini, I.A.; Woltil, H.A.; Boersma, E.R.; Muskiet, F.A.J.
2002-01-01
BACKGROUND: Early suspicion of essential fatty acid deficiency (EFAD) or omega3-deficiency may rather focus on polyunsaturated fatty acid (PUFA) or long-chain PUFA (LCP) analyses than clinical symptoms. We determined cut-off values for biochemical EFAD, omega3-and omega3/22:6omega3 [docosahexaenoic
Smit, EN; Martini, IA; Woltil, HA; Boersma, ER; Muskiet, FAJ
2002-01-01
Background. Early suspicion of essential fatty acid deficiency (EFAD) or omega3-deficiency may rather focus on polyunsaturated fatty acid (PUFA) or long-chain PUFA (LCP) analyses than clinical symptoms. We determined cut-off values for biochemical EFAD, omega3-and omega3/22:6omega3 [docosahexaenoic
Smit, EN; Martini, IA; Woltil, HA; Boersma, ER; Muskiet, FAJ
Background. Early suspicion of essential fatty acid deficiency (EFAD) or omega3-deficiency may rather focus on polyunsaturated fatty acid (PUFA) or long-chain PUFA (LCP) analyses than clinical symptoms. We determined cut-off values for biochemical EFAD, omega3-and omega3/22:6omega3 [docosahexaenoic
Evolution of optically selected quasars with z<2.2 and B<20
International Nuclear Information System (INIS)
Marshall, H.L.
1985-01-01
Several complete samples of optically selected quasars are combined to give details of the quasar luminosity function and its evolution for redshifts less than 2.2. Sufficient coverage of the Hubble diagram is obtained that luminosity-dependent density evolution models can be tested and compared against pure luminosity evolution models. Although luminosity-dependent evolution is indicated if the evolution function has an exponential form, the data are consistent with a power-law evolution model that is independent of luminosity. When the sample is split into halves by redshift, a better fit is obtained with a power-law evolution model than with an exponential model. Furthermore, the luminosity function is consistent with a power-law shape whose slope is independent of redshift. Pure luminosity evolution models wherein luminosities evolve as (1+z)/sup 3.5/ and the luminosity functioin is given by dN/dLproportionalL/sup -3.6/ are consistent with these results and fit the data very well. These results suggest that the same mass supply and energy generation mechanisms apply over several decades of optical luminosity and for z<2.2
Energy Technology Data Exchange (ETDEWEB)
Logsdon, Naomi J.; Allen, Christopher E.; Rajashankar, Kanagalaghatta R.; Walter, Mark R. (Cornell); (UAB)
2012-02-08
Interleukin-20 (IL-20) is an IL-10-family cytokine that regulates innate and adaptive immunity in skin and other tissues. In addition to protecting the host from various external pathogens, dysregulated IL-20 signaling has been shown to contribute to the pathogenesis of human psoriasis. IL-20 signals through two cell-surface receptor heterodimers, IL-20R1-IL-20R2 and IL-22R1-IL-20R2. In this report, crystals of the IL-20-IL-20R1-IL-20R2 ternary complex have been grown from polyethylene glycol solutions. The crystals belonged to space group P4{sub 1}2{sub 1}2 or P4{sub 3}2{sub 1}2, with unit-cell parameters a = 111, c = 135 {angstrom}, and diffracted X-rays to 3 {angstrom} resolution. The crystallographic asymmetric unit contains one IL-20-IL-20R1-IL-20R2 complex, corresponding to a solvent content of approximately 54%.
Selective incorporation of various C-22 polyunsaturated fatty acids in Ehrlich ascites tumor cells
International Nuclear Information System (INIS)
Masuzawa, Y.; Okano, S.; Waku, K.; Sprecher, H.; Lands, W.E.
1986-01-01
Three 14 C-labeled 22-carbon polyunsaturated fatty acids, 7,10,13,16-[ 14 C]docosatetraenoic acid (22:4(n-6)), 7,10,13,16,19-[ 14 C]docosapentaenoic acid (22:5(n-3)), and 4,7,10,13,16,19-[ 14 C]docosahexaenoic acid (22:6(n-3)), were compared with [ 3 H]arachidonic acid (20:4(n-6] and [14C]linoleic acid (18:2(n-6)) to characterize their incorporation into the lipids of Ehrlich ascites cells. The relatively rapid incorporation of the labeled 22-carbon acids into phosphatidic acid indicated that substantial amounts of these acids may be incorporated through the de novo pathway of phospholipid synthesis. In marked contrast to 20:4(n-6), the 22-carbon acids were incorporated much less into choline glycerophospholipids (CGP) and inositol glycerophospholipids (IGP). No selective preference was apparent for the (n-3) or (n-6) type of fatty acids. The amounts of the acids incorporated into diacylglycerophosphoethanolamine were in the order of: 22:6(n-3) greater than 20:4(n-6) much greater than 22:5(n-3) greater than or equal to 22:4(n-6) greater than 18:2(n-6), whereas for alkylacylglycerophosphoethanolamine they were in the order of: 22:4(n-6) greater than 22:6(n-3) greater than 22:5(n-3) much greater than 20:4(n-6) greater than 18:2(n-6). Of the mechanisms possibly responsible for the selective entry of 22-carbon acids into ethanolamine glycerophospholipids, the most reasonable explanation was that the cytidine-mediated ethanolamine phosphotransferase may have a unique double selectivity: for hexaenoic species of diacylglycerol and for 22-carbon polyunsaturated fatty acid-containing species of alkylacylglycerol. The relative distribution of fatty acids between newly incorporated and already maintained lipid classes suggested that IGP may function in Ehrlich cells as an intermediate pool for the retention of polyunsaturated fatty acids in glycerolipids
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Appeals. 171.22 Section 171.22 Foreign Relations DEPARTMENT OF STATE ACCESS TO INFORMATION AVAILABILITY OF INFORMATION AND RECORDS TO THE PUBLIC Executive Order 12958 Provisions § 171.22 Appeals. Any denial of a mandatory declassification review request...
22 CFR 228.22 - Air transportation.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Air transportation. 228.22 Section 228.22... for USAID Financing § 228.22 Air transportation. (a) The eligibility of air transportation is... U.S. flag air carriers for all international air travel and transportation, unless such service is...
International Nuclear Information System (INIS)
Sharma, Sonal; Mishra, J.K.; Ramarao, B.V.; Pande, Manjiri; Bhagwat, P.V.
2015-01-01
A 20 kW, 325 MHz solid state amplifier is being developed in BARC for Fermi Lab collaboration. It is proposed to combine 22 RF amplifiers to get output power of 20 kW. For this purpose a 22 way coaxial power combiner has been designed using CST microwave studio. This combiner is based on Wilkinson combining technology. The inner conductor of the combiner is split into 22 equal plates. Each plate has 1-5/8 flange at input port. These plates are connected to a common disc. The combined output is a 3-1/8 flanged port. The return loss obtained at the combined port is better than 28 dB indicating a very good match. The transmission from the combined port to each split port is about -13.5 dB representing a low insertion loss and equal split. The return loss each of the split port is obtained by simultaneous excitation of each port. The return loss at each port is better than 26 dB. Fabrication of the combiner is under process. The material used for inner conductor will be ETP copper and outer conductor will be made of aluminium. Along with the above design a separate design of 6-1/8″ to N type adapter has been completed in CST microwave studio. A number of these adapters will be used for high power waveguide load characterization which is being developed in BARC. The return loss at each port is better than 30 dB and insertion loss is less than 0.05 dB. Fabrication of these adapters is under process. (author)
7 CFR 1484.22 - How are Cooperator program funds allocated?
2010-01-01
... Section 1484.22 Agriculture Regulations of the Department of Agriculture (Continued) COMMODITY CREDIT... performance and past demand expansion performance will cover not more than a 6-year period, to the extent such... (20%). (c) Past Demand Expansion Performance (20%). (d) Future Demand Expansion Goals (10%). (e...
Interaction cross section study of the two-neutron halo nucleus 22C
Directory of Open Access Journals (Sweden)
Y. Togano
2016-10-01
Full Text Available The interaction cross sections (σI of the very neutron-rich carbon isotopes 19C, 20C and 22C have been measured on a carbon target at 307, 280, and 235 MeV/nucleon, respectively. A σI of 1.280±0.023 b was obtained for 22C, significantly larger than for 19,20C, supporting the halo character of 22C. A 22C root-mean-squared matter radius of 3.44±0.08 fm was deduced using a four-body Glauber reaction model. This value is smaller than an earlier estimate (of 5.4±0.9 fm derived from a σI measurement on a hydrogen target at 40 MeV/nucleon. These new, higher-precision σI data provide stronger constraints for assessing the consistency of theories describing weakly bound nuclei.
22 CFR 52.1 - Celebration of marriage.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Celebration of marriage. 52.1 Section 52.1 Foreign Relations DEPARTMENT OF STATE NATIONALITY AND PASSPORTS MARRIAGES § 52.1 Celebration of marriage. Foreign Service officers are forbidden to celebrate marriages. [31 FR 13546, Oct. 20, 1966] ...
The EU 20/20/2020 targets. An overview of the EMF22 assessment
Energy Technology Data Exchange (ETDEWEB)
Boehringer, Christoph [Department of Economics, Carl on Ossietzky University, Oldenburg (Germany); Rutherford, Thomas F. [Centre for Energy Policy and Economics, ETH, Zurich (Switzerland); Tol, Richard S.J. [Economic and Social Research Institute, Dublin (Ireland); Institute for Environmental Studies, Vrije Universiteit, Amsterdam (Netherlands); Department of Spatial Economics, Vrije Universiteit, Amsterdam (Netherlands)
2009-07-01
Three computable general equilibrium models are used to estimate the economic implications of a stylized version of EU climate policy. If implemented at the lowest possible cost, the 20% emissions reduction would lead to a welfare loss of 0.5-2.0% by 2020. Second-best policies increase costs. A policy with two carbon prices (one for the ETS, one for the non-ETS) could increase costs by up to 50%. A policy with 28 carbon prices (one for the ETS, one each for each Member State) could increase costs by another 40%. The renewables standard could raise the costs of emissions reduction by 90%. Overall, the inefficiencies in policy lead to a cost that is 100-125% too high. The models differ greatly in the detail of their results. The ETS/non-ETS split may have a negligible impact on welfare, while the renewables standard may even improve welfare. The models agree, however, that the distortions introduced by total EU package imply a substantial welfare loss over and above the costs needed to meet the climate target. The marginal, total and excess costs reported here are notably higher than those in the impact assessment of the European Commission. (author)
Building complex carbon skeletons with ethynyl[2.2]paracyclophanes
Directory of Open Access Journals (Sweden)
Ina Dix
2014-08-01
Full Text Available Ethynyl[2.2]paracyclophanes are shown to be useful substrates for the preparation of complex, highly unsaturated carbon frameworks. Thus both the pseudo-geminal- 2 and the pseudo-ortho-diethynylcyclophane 4 can be dimerized by Glaser coupling to the respective dimers 9/10 and 11/12. Whereas the former isomer pair could not be separated so far, the latter provided the pure diastereomers after extensive column chromatography/recrystallization. Isomer 11 is chiral and could be separated on a column impregnated with cellulose tris(3,5-dimethylphenylcarbamate. The bridge-extended cyclophane precursor 18 furnished the ring-enlarged cyclophanes 19 and 20 on Glaser–Hay coupling. Cross-coupling of 4 and the planar building block 1,2-diethynylbenzene (1 yielded the chiral hetero dimer 22 as the main product. An attempt to prepare the biphenylenophane 27 from the triacetylene 24 by CpCo(CO2-catalyzed cycloisomerization resulted in the formation of the cyclobutadiene Co-complex 26. Besides by their usual spectroscopic and analytical data, the new cyclophanes 11, 12, 19, 20, 22, and 26 were characterized by X-ray structural analysis.
22 CFR 512.22 - Deduction from pay.
2010-04-01
... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Deduction from pay. 512.22 Section 512.22... 1982 Salary Offset § 512.22 Deduction from pay. (a) Deduction by salary offset, from an employee's disposable current pay, shall be subject to the following circumstances: (1) When funds are available, the...
AGS 20th anniversary celebration
Energy Technology Data Exchange (ETDEWEB)
Baggett, N.V. (ed.)
1980-05-22
On May 22, 1980, a symposium was held at Brookhaven to celebrate the 20th birthday of the AGS, to recall its beginnings, and to review major discoveries that have been made with its beams. The talks at the symposium are recorded in this volume.
AGS 20th anniversary celebration
International Nuclear Information System (INIS)
Baggett, N.V.
1980-01-01
On May 22, 1980, a symposium was held at Brookhaven to celebrate the 20th birthday of the AGS, to recall its beginnings, and to review major discoveries that have been made with its beams. The talks at the symposium are recorded in this volume
Stellar origin of the 22Ne excess in cosmic rays
International Nuclear Information System (INIS)
Casse, M.; Paul, J.A.
1982-01-01
The 22 Ne excess at the cosmic-ray source is discussed in terms of a 22 Ne-rich component injected and accelerated by carbon-rich Wolf-Rayet stars. The overabundance of 22 Ne relative to 20 Ne predicted at the surface of these stars is estimated to a factor approx.120 with respect to solar system abundances. In order to give rise to a 22 Ne excess of about 3 at the cosmic-ray sources as inferred from observations, the carbon-rich Wolf-Rayet contribution to the primary cosmic-ray flux is to be at maximum 1/60. This component would be energized by strong stellar winds producing quasi-standing shocks around the Wolf-Rayet stars
Environmental background level of cosmic ray produced 22Na
International Nuclear Information System (INIS)
Tokuyama, H.; Oonishi, M.; Matsuura, H.
1993-01-01
The annual deposition rate of cosmogenic 22 Na has been studied at Fukui City, Japan, to obtain the current background level. The deposition rate was found to range from 0.16 to 0.22 Bq m -2 y -1 with a mean value of 0.20 Bq m -2 y -1 for the years 1986-1990. The author's results agree fairly well with those observed for the years 1975-1977 in Tokyo. The 22 Na concentration in rain water was also estimated. The mean value for this period was found to be 0.09 mBq litre -1 , which is about one-third of that detected during the latter half of the 1950's. The high levels of environmental 22 Na in the 1950's are attributed to the many nuclear weapon tests conducted at that time. At present, however, the 22 Na from these weapons tests has practically decayed and the concentration in rain water has decreased to the natural background level. (Author)
Chromosome 22 microdeletion in children with syndromic ...
African Journals Online (AJOL)
Cytogenetic study and fluorescence in situ hybridization (FISH) were performed in the patients. The study revealed that 2 patients were with chromosomal aberrations [one with 46,XY, add (13)(p13) & the other with 47,XX,+13]. In addition, FISH revealed 4 patients (20%) with 22q11.2 microdeletion syndrome. The congenital ...
48 CFR 52.222-20 - Walsh-Healey Public Contracts Act.
2010-10-01
... Contracts Act. 52.222-20 Section 52.222-20 Federal Acquisition Regulations System FEDERAL ACQUISITION... Clauses 52.222-20 Walsh-Healey Public Contracts Act. As prescribed in 22.610, insert the following clause in solicitations and contracts covered by the Act: Walsh-Healey Public Contracts Act (OCT 2010) If...
Directory of Open Access Journals (Sweden)
Arnovia Christine Sabatiana
2017-01-01
Full Text Available Air conditioning system merupakan mesin sistem refrigerasi kompresi uap sederhana. Kemudian dimodifikasi menjadi dua indoor unit dan satu outdoor unit. Dimana outdoor unit memiliki dua jenis kondenser yaitu, water cooled condenser dan air cooled condenser. Pembuangan kalor pada bagian water cooled condenser dimanfaatkan untuk memanaskan air yang nantinya dapat digunakan untuk kebutuhan sehari-hari kedepannya. Penggunaan refrigeran CFC atau HCFC mengakibatkan beberapa dampak negatif terhadap lingkungan dan penggunaan mesin refrigerasi ini, diantaranya dapat merusak lapisan ozone, pemanasan global dan tidak hemat energi listrik. Penelitian pada ini adalah untuk menganalisis dan membandingkan performansi suatu sistem refrigerasi sederhana yang mampu menghemat konsumsi energi dan ramah lingkungan. Metoda penelitian ini dilakukan pertama menggunakan R-22 sebagai refrigeran primernya dan selanjutnya dilakukan proses retrofitting (penggantian refrigeran dengan menggunakan MC-22. Selanjutnya analisis dilakukan berdasarkan data dari setiap titik-titik pengukuran dengan begitu akan diperoleh suatu sistem refrigerasi dengan performansi yang paling baik dengan konsumsi energi listrik yang sedikit, serta sistem refrigerasi yang ramah lingkungan. Sistem tersebut aladah yang menggunakan MC-22 baik menggunakan atau tanpa pre-cooling dengan nilai COPelektrik 3,786; dan 3,933, COPthermal 4,501; dan 4,670, dan nilai penghematan energi listrik sekitar 20% lebih hemat dibanding sistem yang menggunakan R-22.
Directory of Open Access Journals (Sweden)
Tomasz Pudłocki
2017-12-01
Full Text Available “Intellectuals and the First World War: Central European Perspective”, a conference organized on October 20–22, 2016 in Kraków, was a perfect opportunity to discuss the phenomenon of the 1914–1918 conflict and its impact on the lives of intellectuals and the creators of culture. Many important scientific studies or cultural activities were interrupted by the war as a result of the conscription of the intellectuals and their death either on the WW1 fronts or as civilian victims. On the other hand, the war was also an opportunity for many to redirect professional careers in new directions e.g. in the service of military propaganda. The conference was organized by the Institute of History of the Jagiellonian University with the financial support of the Kraków City Council – City of Kraków. The conference brought together nearly 30 speakers from the European Union and the United States of America.
22 CFR 120.22 - Technical assistance agreement.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Technical assistance agreement. 120.22 Section... DEFINITIONS § 120.22 Technical assistance agreement. An agreement (e.g., contract) for the performance of a... license to manufacture defense articles. Assembly of defense articles is included under this section...
Effect of Perovskite coating on oxide scale growth on Fe-22Cr
DEFF Research Database (Denmark)
Persson, Åsa; Mikkelsen, Lars; Hendriksen, Peter Vang
2006-01-01
A coating consisting of La0.85Sr0.15MnO3 (LSM) was deposited onto two Fe 22 wt % Cr alloys Crofer 22APU and Sandvik lC44Mo20. The evolution of the oxide layers developing underneath the coatings during oxidation was investigated. The effect of the LSM coating on oxidation rate and microstructure ...
2010-04-01
... cost principles govern the implementation and management of State highway safety programs carried out under 23 U.S.C. 402. Cost principles include those referenced in 49 CFR 18.22 and those set forth in... Implementation and Management of the Highway Safety Program § 1200.20 General. Except as otherwise provided in...
22 CFR 42.22 - Returning resident aliens.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Returning resident aliens. 42.22 Section 42.22... Returning resident aliens. (a) Requirements for returning resident status. An alien shall be classifiable as... presented that: (1) The alien had the status of an alien lawfully admitted for permanent residence at the...
CT study of infantile cerebral vitamin B1 deficiency (analysis of 22 cases)
International Nuclear Information System (INIS)
Liu Bin; Xi Meifang; Wang Mengding; Wang Chaoxiu
1998-01-01
Purpose: To study the CT features of infantile cerebral vitamin B 1 deficiency. Methods: The authors retrospectively reviewed the clinical manifestations and CT findings of 22 cases of infantile vitamin B 1 deficiency. Results: The main clinical signs were seizure malaise dullness and vomiting. CT scans showed bilateral symmetrical hypodense foci in lenticular nucleus (20/22), head of caudate nucleus (15/22), thalamus (3/22), anterior limb of internal capsule (4/22), external capsule (1/22) and para-ventricle white matter (2/22), and in many cases, signs of cerebral atrophy. 22 cases received thiamine treatment and were fully recovered. Conclusion: The authors concluded that bilateral symmetric hypodense foci in lenticular nucleus thalamus, head of caudate nucleus, anterior limb of internal capsule, external capsule and para-ventricle white matter were important CT signs suggestive of infantile cerebral vitamin B 1 deficiency
Accurate stereochemistry for two related 22,26-epiminocholestene derivatives
International Nuclear Information System (INIS)
Vega-Baez, José Luis; Sandoval-Ramírez, Jesús; Meza-Reyes, Socorro; Montiel-Smith, Sara; Gómez-Calvario, Victor; Bernès, Sylvain
2008-01-01
Regioselective opening of ring E of solasodine under various conditions afforded (25R)-22,26-epimino@@cholesta-5,22(N)-di@@ene-3β,16β-diyl diacetate (previously known as 3,16-diacetyl pseudosolasodine B), C 31 H 47 NO 4 , or (22S,25R)-16β-hydr@@oxy-22,26-epimino@@cholesta-5-en-3β-yl acetate (a derivative of the naturally occurring alkaloid oblonginine), C 29 H 47 NO 3 . In both cases, the reactions are carried out with retention of chirality at the C16, C20 and C25 stereogenic centers, which are found to be S, S and R, respectively. Although pseudosolasodine was synthesized 50 years ago, these accurate assignments clarify some controversial points about the actual stereochemistry for these alkaloids. This is of particular importance in the case of oblonginine, since this compound is currently under consideration for the treatment of aphasia arising from apoplexy; the present study defines a diastereoisomerically pure compound for pharmacological studies
Food sources of total omega 3 fatty acids (18:3 + 20:5 + 22:6), listed in descending order by percentages of their contribution to intake, based on data from the National Health and Nutrition Examination Survey 2005-2006
Bala, Niraj; Singh, Harpreet; Prakash, Satya; Karthikeyan, J.
2012-01-01
High temperature corrosion accompanied by erosion is a severe problem, which may result in premature failure of the boiler tubes. One countermeasure to overcome this problem is the use of thermal spray protective coatings. In the current investigation high velocity oxy-fuel (HVOF) and cold spray processes have been used to deposit commercial Ni-20Cr powder on T22 boiler steel. To evaluate the performance of the coatings in actual conditions the bare as well as the coated steels were subjected to cyclic exposures, in the superheater zone of a coal fired boiler for 15 cycles. The weight change and thickness loss data were used to establish kinetics of the erosion-corrosion. X-ray diffraction, surface and cross-sectional field emission scanning electron microscope/energy dispersive spectroscopy (FE-SEM/EDS) and x-ray mapping techniques were used to analyse the as-sprayed and corroded specimens. The HVOF sprayed coating performed better than its cold sprayed counterpart in actual boiler environment.
22 CFR 18.22 - Notice of disciplinary action.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Notice of disciplinary action. 18.22 Section 18... INTEREST Administrative Enforcement Proceedings § 18.22 Notice of disciplinary action. Upon the issuance of... Department during the period of suspension. The Director General shall take other appropriate disciplinary...
22 CFR 212.22 - Protection of personal privacy.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Protection of personal privacy. 212.22 Section... Information for Public Inspection and Copying § 212.22 Protection of personal privacy. To the extent required to prevent a clearly unwarranted invasion of personal privacy, USAID may delete identifying details...
Zelazowski, Przemyslaw; Huntingford, Chris; Mercado, Lina M.; Schaller, Nathalie
2018-02-01
Global circulation models (GCMs) are the best tool to understand climate change, as they attempt to represent all the important Earth system processes, including anthropogenic perturbation through fossil fuel burning. However, GCMs are computationally very expensive, which limits the number of simulations that can be made. Pattern scaling is an emulation technique that takes advantage of the fact that local and seasonal changes in surface climate are often approximately linear in the rate of warming over land and across the globe. This allows interpolation away from a limited number of available GCM simulations, to assess alternative future emissions scenarios. In this paper, we present a climate pattern-scaling set consisting of spatial climate change patterns along with parameters for an energy-balance model that calculates the amount of global warming. The set, available for download, is derived from 22 GCMs of the WCRP CMIP3 database, setting the basis for similar eventual pattern development for the CMIP5 and forthcoming CMIP6 ensemble. Critically, it extends the use of the IMOGEN (Integrated Model Of Global Effects of climatic aNomalies) framework to enable scanning across full uncertainty in GCMs for impact studies. Across models, the presented climate patterns represent consistent global mean trends, with a maximum of 4 (out of 22) GCMs exhibiting the opposite sign to the global trend per variable (relative humidity). The described new climate regimes are generally warmer, wetter (but with less snowfall), cloudier and windier, and have decreased relative humidity. Overall, when averaging individual performance across all variables, and without considering co-variance, the patterns explain one-third of regional change in decadal averages (mean percentage variance explained, PVE, 34.25 ± 5.21), but the signal in some models exhibits much more linearity (e.g. MIROC3.2(hires): 41.53) than in others (GISS_ER: 22.67). The two most often considered variables
Amorphous-to-Cu51Zr14 phase transformation in Cu60Ti20Zr20 alloy
International Nuclear Information System (INIS)
Cao, Q P; Zhou, Y H; Horsewell, A; Jiang, J Z
2003-01-01
The kinetics of an amorphous-to-Cu 51 Zr 14 phase transformation in an as-cast Cu 60 Ti 20 Zr 20 rod have been investigated by differential scanning calorimetry. The relative volume fractions of the transferred crystalline phase as a function of annealing time, obtained at 713, 716, 723, 728, and 733 K, have been analysed in detail using 14 nucleation and growth models together with the JMA model. A time-dependent nucleation process is revealed. A steady-state nucleation rate of the order of 10 22 - 10 23 nuclei m -3 s -1 in the temperature range 713-733 K and an activation energy of the order of 550 kJmol -1 for the phase transformation in the as-cast Cu 60 Ti 20 Zr 20 rod were detected, for which some possible reasons are suggested
National Oceanic and Atmospheric Administration, Department of Commerce — NCEI Accession 0156922 includes chemical, discrete sample, physical and profile data collected from G.O. SARS in the Norwegian Sea from 2012-03-20 to 2012-03-22....
Infrared observations of the eclipsing millisecond pulsar 1957 + 20
International Nuclear Information System (INIS)
Eales, S.A.; Becklin, E.E.; Zuckerman, B.
1990-01-01
We have taken 2.2-μm images, over the entire range of orbital phase, of the eclipsing millisecond pulsar 1957 + 20. We show that the 2.2-μm flux from the pulsar system is variable, and that the infrared light curve is similar to the optical light curve. Four additional images at 1.2 μm show that there is a possible infrared excess from the system. (author)
International Nuclear Information System (INIS)
Brown, David; Jouanne, Cedric; Malvagi, Fausto; Coste-Delclaux, Mireille; Hawari, Ayman I.; Mattoon, Caleb; Zerkin, Viktor; ); Cornock, Mark; Conlin, Jeremy; Lloydge, Zhigang; Oleynik, Dmitry S.; Cabellos, Oscar; Mills, Robert W.; Kim, Do Heon; Leal, Luiz Carlos; White, Morgan c.; Dunn, Michael; Kahler, Albert C. skip; Mcnabb, Dennis P.; Roubtsov, Danila; Cho, Young-Sik; Beck, Bret; Haeck, Wim
2015-05-01
WPEC subgroup 38 (SG38) was formed to develop a new structure for storing nuclear reaction data, that is meant to eventually replace ENDF-6 as the standard way to store and share evaluations. The work of SG38 covers the following tasks: Designing flexible, general-purpose data containers; Determining a logical and easy-to-understand top-level hierarchy for storing evaluated nuclear reaction data; Creating a particle database for storing particles, masses and level schemes; Specifying the infrastructure (plotting, processing, etc.) that must accompany the new structure; Developing an Application Programming Interface or API to allow other codes to access data stored in the new structure; Specifying what tests need to be implemented for quality assurance of the new structure and associated infrastructure; Ensuring documentation and governance of the structure and associated infrastructure. This document is the proceedings of the SG38 meeting which took place at the NEA Headquarters, on 20-22 May 2015. It comprises all the available presentations (slides) given by the participants: - 1) Recent updates to the top-level hierarchy, review draft requirements document (D. Brown); - 2) Properties of Particles (PoPs) database (C.M. Mattoon); - 3) Proposed General Purpose Data Containers (B. Beck); - 4) Feedback on GND Specifications (C. Jouanne); - 5) Using XML in the IAEA-NDS: status, feedback and proposals (V. Zerkin); - 6) Observations Related to Thermal Neutron Scattering Law Data (A.I. Hawari); - 7) Meeting Notes (D.P. Mcnabb)
Accurate stereochemistry for two related 22,26-epiminocholestene derivatives
Energy Technology Data Exchange (ETDEWEB)
Vega-Baez, José Luis; Sandoval-Ramírez, Jesús; Meza-Reyes, Socorro; Montiel-Smith, Sara; Gómez-Calvario, Victor [Facultad de Ciencias Químicas, Benemérita Universidad Autónoma de Puebla, Ciudad Universitaria, San Manuel, 72000 Puebla, Pue. (Mexico); Bernès, Sylvain, E-mail: sylvain-bernes@hotmail.com [DEP Facultad de Ciencias Químicas, UANL, Guerrero y Progreso S/N, Col. Treviño, 64570 Monterrey, NL (Mexico); Facultad de Ciencias Químicas, Benemérita Universidad Autónoma de Puebla, Ciudad Universitaria, San Manuel, 72000 Puebla, Pue. (Mexico)
2008-04-01
Regioselective opening of ring E of solasodine under various conditions afforded (25R)-22,26-epimino@@cholesta-5,22(N)-di@@ene-3β,16β-diyl diacetate (previously known as 3,16-diacetyl pseudosolasodine B), C{sub 31}H{sub 47}NO{sub 4}, or (22S,25R)-16β-hydr@@oxy-22,26-epimino@@cholesta-5-en-3β-yl acetate (a derivative of the naturally occurring alkaloid oblonginine), C{sub 29}H{sub 47}NO{sub 3}. In both cases, the reactions are carried out with retention of chirality at the C16, C20 and C25 stereogenic centers, which are found to be S, S and R, respectively. Although pseudosolasodine was synthesized 50 years ago, these accurate assignments clarify some controversial points about the actual stereochemistry for these alkaloids. This is of particular importance in the case of oblonginine, since this compound is currently under consideration for the treatment of aphasia arising from apoplexy; the present study defines a diastereoisomerically pure compound for pharmacological studies.
Hot corrosion of the steel SA213-T22 and SA213-TP347H in 80% V2O5-20%Na2SO4 mixture
International Nuclear Information System (INIS)
Almeraya, F.; Martinez-Villafane, A.; Gaona, C.; Romero, M.A.; Malo, J.M.
1998-01-01
Many hot corrosion problems in industrial and utility boilers are caused by molten salts. The corrosion processes which occur in salts are of an electrochemical nature, and so they can be studied using electrochemical test methods. In this research, electrochemical techniques in molten salt systems have been used for the measurements of molten corrosion processes. Electrochemical test methods are described here for a salt mixture of 80%V 2 O 5 -20%NaSO 4 at 540-680 degree centigrade. To establish better the electrochemical corrosion rate measurements for molten salt systems, information from electrochemical potentiodynamic polarization curves, such as polarization resistance and Tafeol slopes were used in this study to generate corrosion rate data. The salt was contained in a quartz crucible inside a stainless retort. The atmosphere used was air. A thermocouple sheathed with quartz glass was introduced into the molten salt for temperature monitoring and control. Two materials were tested in the molten mixture: SA213-T22 and SA213-TP347H steels. The corrosion rates values obtained using electrochemical methods were around 0.58-7.14 mm/yr (22.9-281 mpy). The corrosion rate increase with time. (Author) 7 refs
Directory of Open Access Journals (Sweden)
Christodoulou Evangelos A
2009-07-01
Full Text Available Abstract Background The SRS-22 is a valid instrument for the assessment of the health related quality of life of patients with Idiopathic scoliosis. The SRS-22 questionnaire was developed in USA and has been widely used in the English speaking countries. Recently it has been translated and validated in many other languages. The purpose of this study is to evaluate the reliability and validity of the adapted Greek version of the refined Scoliosis Research Society-22 Questionnaire. Methods Following the steps of cross – cultural adaptation the adapted Greek version of the SRS-22 questionnaire and a validated Greek version of the SF-36 questionnaire were mailed to 68 patients treated surgically for Idiopathic Scoliosis. 51 out of the 68 patients returned the 1st set of questionnaires, while a second set was emailed to 30 randomly selected patients of the first time responders. 20 out of the 30 patients returned the 2nd set. The mean age at the time of operation was16,2 years and the mean age at the time of evaluation was 21,2 years. Descriptive statistics for content analysis were calculated. Reliability assessment was determined by estimating Cronbach's α and intraclass correlation coefficient (ICC respectively. Concurrent validity was evaluated by comparing SRS-22 domains with relevant domains in the SF-36 questionnaire using Pearson's Correlation Coefficient (r. Results The calculated Cronbach's α of internal consistency for three of the corresponding domains (pain 0.85; mental health 0.87; self image 0.83 were very satisfactory and for two domains (function/activity 0.72 and satisfaction 0.67 were good. The ICC of all domains of SRS-22 questionnaire was high (ICC>0.70, demonstrating very satisfactory or excellent test/retest reproducibility. Considering concurrent validity all correlations were found to be statistically significant at the 0.01 level among related domains and generally demonstrated high correlation coefficient. Conclusion
CCL20, (gamma)(delta) T cells, and IL-22 in corneal epithelial healing
After corneal epithelial abrasion, leukocytes and platelets rapidly enter the corneal stroma, and CCR6 (+) IL-17(+) gamma delta T cells migrate into the epithelium. Gamma delta T-cell-deficient (TCRd(-/-)) mice have significantly reduced inflammation and epithelial wound healing. Epithelial CCL20 mR...
Directory of Open Access Journals (Sweden)
Romero, M. A.
1998-02-01
Full Text Available Many hot corrosion problems in industrial and utility boilers are caused by molten salts. The corrosion processes which occur in salts are of an electrochemical nature, and so they can be studied using electrochemical test methods. In this research, electrochemical techniques in molten salt systems have been used for the measurements of molten corrosion processes. Electrochemical test methods are described here for a salt mixture of 80%V2O5-20%Na2SO4 at 540-680°C. To establish better the electrochemical corrosion rate mearurements for molten salt systems, information from electrochemical potentiodynamic polarization curves, such as polarization resistance and Tafel slopes were used in this study to generate corrosion rate data. The salt was contained in a quartz crucible inside a stainless steel retort. The atmosphere used was air. A thermocouple sheathed with quartz glass was introduced into the molten salt for temperature monitoring and control. Two materials were tested in the molten mixture: SA213-T22 and SA213-TP347H steels. The corrosion rates values obtained using electrochemical methods were around 0.58-7.14 mm/yr (22.9-281 mpy. The corrosion rate increase with time.Muchos problemas de corrosión por depósitos salinos en la industria eléctrica, especialmente en los generadores de vapor, se deben al ataque por sales fundidas. El proceso de corrosión en sales fundidas es de naturaleza electroquímica; así, puede estudiarse empleando técnicas electroquímicas. Este proceso de corrosión en un sistema de sales fundidas, mezcla de 80%V2O5 y 20%Na2SO4 a temperaturas comprendidas entre 540 y 680°C, se evaluó en esta investigación por medio de técnicas electroquímicas. Para medir la velocidad de corrosión por depósitos salinos se parte de curvas de polarización potenciodinámicas determinando la resistencia de polarización por extrapolación de las pendientes de Tafel. Las sales se fundieron en un crisol de cuarzo dentro de un
Yang, Jie; Li, Xuwen; Sun, Ting; Gao, Yan; Chen, Yanxin; Jin, Yongri; Li, Yang
2016-02-01
A series of oxidized products have been systematically semisynthesized from 20(S)-ginsenoside Rg3, Rh2, 20(S)-protopanaxadiol (PPD) and their 20(R)-epimers and the majority of these products were evaluated for their cytotoxic activity against HeLa cells and HepG2 cells by MTT assay for the first time. Twenty-two products were obtained and elucidated based on comprehensive (1)H NMR, (13)C NMR, two-dimensional (2D) NMR, and mass spectral data and the results reported in previous literature. All the four ocotillol type saponins (20S,24R(δ86, δ85); 20S,24S(δ87, δ88); 20R,24R(δ86, δ86); 20R,24S(δ86, δ87) were obtained. In addition, eight compounds (3, 8, 9, 10, 15, 16, 19 and 22) with the cyclized side chain were firstly identified. Most of the tested compounds possessed cytotoxicity to a certain degree against the two types of cells which implied these oxidized products could play a certain role on anti-cancer functions of the raw materials in vivo. Meanwhile, the results proved that the configurations at C-20 or C-24 and the number of glycosyl at C-3 have important influence on the cytotoxicity. The products 1, 2, 11-17, 20 and 22 should possess great activities and deserved further investigation as potential cytotoxic agents. Copyright © 2015 Elsevier Inc. All rights reserved.
The Interleukin-20 Cytokine Family in Liver Disease
Directory of Open Access Journals (Sweden)
Esther Caparrós
2018-05-01
Full Text Available The three main causes of inflammation and chronic injury in the liver are viral hepatitis, alcohol consumption, and non-alcoholic steatohepatitis, all of which can lead to liver fibrosis, cirrhosis, and hepatocellular carcinoma, which in turn may prompt the need for liver transplant. The interleukin (IL-20 is a subfamily part of the IL-10 family of cytokines that helps the liver respond to damage and disease, they participate in the control of tissue homeostasis, and in the immunological responses developed in this organ. The best-studied member of the family in inflammatory balance of the liver is the IL-22 cytokine, which on the one hand may have a protective role in fibrosis progression but on the other may induce liver tissue susceptibility in hepatocellular carcinoma development. Other members of the family might also carry out this dual function, as some of them share IL receptor subunits and signal through common intracellular pathways. Investigators are starting to consider the potential for targeting IL-20 subfamily members in liver disease. The recently explored role of miRNA in the transcriptional regulation of IL-22 and IL-24 opens the door to promising new approaches for controlling the local immune response and limiting organ injury. The IL-20RA cytokine receptor has also been classified as being under miRNA control in non-alcoholic steatohepatitis. Moreover, researchers have proposed combining anti-inflammatory drugs with IL-22 as a hepatoprotective IL for alcoholic liver disease (ALD treatment, and clinical trials of ILs for managing severe alcoholic-derived liver degeneration are ongoing. In this review, we focus on exploring the role of the IL-20 subfamily of cytokines in viral hepatitis, ALD, non-alcoholic steatohepatitis, and hepatocellular carcinoma, as well as delineating the main strategies explored so far in terms of therapeutic possibilities of the IL-20 subfamily of cytokines in liver disease.
27 CFR 20.44 - Disapproval of application.
2010-04-01
... and Users Application for Permit, Form 5150.22 § 20.44 Disapproval of application. The appropriate TTB..., a partner) is, by reason of their business experience, financial standing, or trade connections, not... statement as to any material fact, in connection with the application; or (d) The premises at which the...
22 CFR 22.3 - Remittances in the United States.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Remittances in the United States. 22.3 Section...-DEPARTMENT OF STATE AND FOREIGN SERVICE § 22.3 Remittances in the United States. (a) Type of remittance. Remittances shall be in the form of: (1) Check or bank draft drawn on a bank in the United States; (2) money...
Poriferasta-5,22E,25-trien-3β-ol,22-dehidrokolesterol dari daun Kalanchoe serrata (Crassulaceae
Directory of Open Access Journals (Sweden)
Fajar Fauzi Abdullah
2017-03-01
Full Text Available Dalam penelitian berkelanjutan untuk pencarian senyawa metabolit sekunder baru dari tumbuhan Kalanchoe Indonesia, telah dilakukan kajian fitokimia terhadap Kalanchoe serrata. Daun segar K. serrata sebanyak 14,8 kg diekstraksi dengan metanol pada temperatur kamar. Ekstrak metanol (292 g dipartisi berturut-turut dengan n-heksana dan metilenklorida. Ekstrak metilenklorida (0,80 g selanjutnya dipisahkan pada kromatografi cair vakum pada silika gel G60 dengan eluen kloroform-aseton yang meningkat kepolarannya sehingga dihasilkan 10 fraksi yang dikelompokan berdasarkan analisis KLT. Padatan yang diperoleh pada fraksi yang terelusi dengan 20% aseton selanjutnya dipisahkan pada kromatografi kolom pada silika gel (230-400 mesh dengan eluen kloroform dan dimurnikan lebih lanjut dengan kristalisasi pada aseton sehingga dihasilkan isolat berbentuk kristal jarum tak-berwarna sebanyak 23 mg. Isolat menunjukkan titik leleh 115-118oC dan memberikan warna hijau-kebiruan pada uji Liebermann-Burchard menunjukkan adanya kerangka steroid. Hasil analisis spektroskopi yang meliputi UV, IR, 1D-NMR dan 2D-NMR menunjukan bahwa isolat merupakan turunan sterol dan diidentifikasi sebagai poriferasta-5,22E,25-trien-3β-ol,22-dehidrokolesterol.
Directory of Open Access Journals (Sweden)
Květoslava Křížková
Full Text Available The insulin gene mutation c.137G>A (R46Q, which changes an arginine at the B22 position of the mature hormone to glutamine, causes the monogenic diabetes variant maturity-onset diabetes of the young (MODY. In MODY patients, this mutation is heterozygous, and both mutant and wild-type (WT human insulin are produced simultaneously. However, the patients often depend on administration of exogenous insulin. In this study, we chemically synthesized the MODY mutant [GlnB22]-insulin and characterized its biological and structural properties. The chemical synthesis of this insulin analogue revealed that its folding ability is severely impaired. In vitro and in vivo tests showed that its binding affinity and biological activity are reduced (both approximately 20% that of human insulin. Comparison of the solution structure of [GlnB22]-insulin with the solution structure of native human insulin revealed that the most significant structural effect of the mutation is distortion of the B20-B23 β-turn, leading to liberation of the B chain C-terminus from the protein core. The distortion of the B20-B23 β-turn is caused by the extended conformational freedom of the GlnB22 side chain, which is no longer anchored in a hydrogen bonding network like the native ArgB22. The partially disordered [GlnB22]-insulin structure appears to be one reason for the reduced binding potency of this mutant and may also be responsible for its low folding efficiency in vivo. The altered orientation and flexibility of the B20-B23 β-turn may interfere with the formation of disulfide bonds in proinsulin bearing the R46Q (GlnB22 mutation. This may also have a negative effect on the WT proinsulin simultaneously biosynthesized in β-cells and therefore play a major role in the development of MODY in patients producing [GlnB22]-insulin.
International Nuclear Information System (INIS)
Ahmed, W.A.; El-Kabany, H.
2004-01-01
Urinary nuclear matrix protein-22 (NMP-22) and tissue polypeptide specific antigen (TPS) were determined as potential marker for early detection of bladder tumors in patients with high risk (Bilharzial-patients), monitoring and follow up bladder cancer patients. The objective was to determine sensitivity and specificity of markers for bilharzial and cancer lesions. The levels of two parameters were determined pre and post operation. A total of 110 individuals, 20 healthy, 20 bilharzial patients and 70 bladder cancer patients with confirmed diagnosis were investigated. Urine samples were assayed for NMP-22 and TPS test kits. Some bladder cancer patients were selected to follow up. NMP-22 showed highly significant increase (P,0.001) more than TPS (P<0.01) in bladder cancer patients when compared with bilharzial and control group. Overall sensitivity is 7.8% for TPS and 98.5% for NMP-22
Tropical Veterinarian - Vol 20, No 1 (2002)
African Journals Online (AJOL)
Comparative study of the prevalence of leptospirosis in vaccinated and unvaccinated dogs in Ibadan, Nigeria · EMAIL FULL TEXT EMAIL FULL TEXT · DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. C.A. Agunloye, A.T.P. Ajuwape, H.O. Nottidge, 22-26. http://dx.doi.org/10.4314/tv.v20i1.4505 ...
The Palmitoylation State of PMP22 Modulates Epithelial Cell Morphology and Migration
Directory of Open Access Journals (Sweden)
Susie J. Zoltewicz
2012-11-01
Full Text Available PMP22 (peripheral myelin protein 22, also known as GAS 3 (growth-arrest-specific protein 3, is a disease-linked tetraspan glycoprotein of peripheral nerve myelin and constituent of intercellular junctions in epithelia. To date, our knowledge of the post-translational modification of PMP22 is limited. Using the CSS-Palm 2.0 software we predicted that C85 (cysteine 85, a highly conserved amino acid located between the second and third transmembrane domains, is a potential site for palmitoylation. To test this, we mutated C85S (C85 to serine and established stable cells lines expressing the WT (wild-type or the C85S-PMP22. In Schwann and MDCK (Madin–Darby canine kidney cells mutating C85 blocked the palmitoylation of PMP22, which we monitored using 17-ODYA (17-octadecynoic acid. While palmitoylation was not necessary for processing the newly synthesized PMP22 through the secretory pathway, overexpression of C85S-PMP22 led to pronounced cell spreading and uneven monolayer thinning. To further investigate the functional significance of palmitoylated PMP22, we evaluated MDCK cell migration in a wound-healing assay. While WT-PMP22 expressing cells were resistant to migration, C85S cells displayed lamellipodial protrusions and migrated at a similar rate to vector control. These findings indicate that palmitoylation of PMP22 at C85 is critical for the role of the protein in modulating epithelial cell shape and motility.
2010-04-01
... against unauthorized disclosure and is marked to indicate its classified status when in documentary form... documentary material, regardless of its physical form or characteristics that is owned by, produced by or for... Management. ...
Polish adaptation of scoliosis research society-22 questionnaire.
Glowacki, Maciej; Misterska, Ewa; Laurentowska, Maria; Mankowski, Przemyslaw
2009-05-01
Polish adaptation of the original version of Scoliosis Research Society (SRS) instrument. The transcultural adaptation of SRS-22 and evaluation of its internal consistency. High psychometric value of the SRS-22 Questionnaire has made it an effective evaluation instrument in clinically assessing the functional status of patients with adolescent idiopathic scoliosis. First, 2 translators translated the original version into Polish. Afterwards, the translators identified differences between the translations and produced a consensus version. In the third stage, 2 native English speakers produced back translations. Finally, a team of 2 orthopedic surgeons, translators, a statistician and a psychologist reviewed all the translations to produce a prefinal version. The questionnaire was administered to 60 girls at the age of 16.6, SD 2.0 with adolescent idiopathic scoliosis treated with the Cotrel-Dubousset method in Pediatric Orthopaedics and Traumatology Clinic in Poznań. The internal consistency in the Polish version equaled 0.89 for the overall result and 0.81 for function, 0.81 for pain, 0.80 for mental health, 0.77 for self-image, and 0.69 for treatment satisfaction domains, respectively. The Polish version of SRS-22 is characterized by high internal consistency for all domains and for the overall score, which makes it an evaluation tool after surgical treatment compatible with the original SRS-22.
Rare genome-wide copy number variation and expression of schizophrenia in 22q11.2 deletion syndrome
Bassett, Anne S.; Lowther, Chelsea; Merico, Daniele; Costain, Gregory; Chow, Eva W C; Van Amelsvoort, Therese; McDonald-Mcginn, Donna M.; Gur, Raquel E.; Swillen, Ann; van den Bree, Marianne B M; Murphy, Kieran C.; Gothelf, Doron; Bearden, Carrie E.; Eliez, Stephan; Kates, Wendy R.; Philip, Nicole; Sashi, Vandana; Campbell, Linda E.; Vorstman, Jacob; Cubells, Joseph; Repetto, Gabriela M.; Simon, Tony J.; Boot, Erik; Heung, Tracy; Evers, Rens; Vingerhoets, Claudia; Van Duin, Esther; Zackai, Elaine; Vergaelen, Elfi; Devriendt, Koen; Vermeesch, Joris R.; Owen, Michael J; Murphy, Clodagh M.; Michaelovosky, Elena; Kushan, Leila; Schneider, Maude; Fremont, Wanda; Busa, Tiffany; Hooper, Stephen R.; McCabe, Kathryn; Duijff, Sasja; Isaev, Karin; Pellecchia, Giovanna; Wei, John; Gazzellone, Matthew J.; Scherer, Stephen W.; Emanuel, Beverly S.; Guo, Tingwei; Morrow, Bernice E.; Marshall, Christian R.
2017-01-01
Objective: Chromosome 22q11.2 deletion syndrome (22q11.2DS) is associated with a more than 20-fold increased risk for developing schizophrenia. The aim of this studywas to identify additional genetic factors (i.e., "second hits") that may contribute to schizophrenia expression. Method: Through an
Psychopathology and cognition in children with 22q11.2 deletion syndrome
Niarchou, Maria; Zammit, Stanley; van Goozen, Stephanie H. M.; Thapar, Anita; Tierling, Hayley M.; Owen, Michael J.; van den Bree, Marianne B. M.
2014-01-01
Background Children with 22q11.2 deletion syndrome (22q11.2DS) have been reported to have high rates of cognitive and psychiatric problems. Aims To establish the nature and prevalence of psychiatric disorder and neurocognitive impairment in children with 22q11.2DS and test whether risk of psychopathology is mediated by the children’s intellectual impairment. Method Neurocognition and psychopathology were assessed in 80 children with 22q11.2DS (mean age 10.2 years, s.d. = 2.1) and 39 sibling controls (mean age 10.9 years, s.d. = 2.0). Results More than half (54%) of children with 22q11.2DS met diagnostic criteria for one or more DSM-IV-TR psychiatric disorder. These children had lower IQ (mean 76.8, s.d. = 13.0) than controls (mean 108.6, s.d. = 15.2) (Ppsychopathology was not mediated by intellectual impairment. Conclusions 22q11.2DS is not related to a specific psychiatric phenotype in children. Moreover, the deletion has largely independent effects on IQ and risk of psychopathology, indicating that psychopathology in 22q11.2DS is not a non-specific consequence of generalised cognitive impairment. PMID:24115343
IL22/IL-22R pathway induces cell survival in human glioblastoma cells.
Directory of Open Access Journals (Sweden)
Hussein Akil
Full Text Available Interleukin-22 (IL-22 is a member of the IL-10 cytokine family that binds to a heterodimeric receptor consisting of IL-22 receptor 1 (IL-22R1 and IL-10R2. IL-22R expression was initially characterized on epithelial cells, and plays an essential role in a number of inflammatory diseases. Recently, a functional receptor was detected on cancer cells such as hepatocarcinoma and lung carcinoma, but its presence was not reported in glioblastoma (GBM. Two GBM cell lines and 10 primary cell lines established from patients undergoing surgery for malignant GBM were used to investigate the expression of IL-22 and IL-22R by using quantitative RT-PCR, western blotting and confocal microscopy studies. The role of IL-22 in proliferation and survival of GBM cell lines was investigated in vitro by BrdU and ELISA cell death assays. We report herein that the two subunits of the IL-22R complex are expressed on human GBM cells. Their activation, depending on exogenous IL-22, induced antiapoptotic effect and cell proliferation. IL-22 treatment of GBM cells resulted in increased levels of phosphorylated Akt, STAT3 signaling protein and its downstream antiapoptotic protein Bcl-xL and decreased level of phosphorylated ERK1/2. In addition, IL-22R subunits were expressed in all the 10 tested primary cell lines established from GBM tumors. Our results showed that IL-22R is expressed on GBM established and primary cell lines. Depending on STAT3, ERK1/2 and PI3K/Akt pathways, IL-22 induced GBM cell survival. These data are consistent with a potential role of IL-22R in tumorigenesis of GBM. Since endogenous IL-22 was not detected in all studied GBM cells, we hypothesize that IL-22R could be activated by immune microenvironmental IL-22 producing cells.
Honarpisheh, Hedieh; Glusac, Earl J; Ko, Christine J
2014-12-01
Tumors with similar or identical histopathologic features have been termed basaloid follicular hamartoma (BFH) or infundibulocystic basal cell carcinoma (BCC). BCC typically lacks immunoreactivity with cytokeratin 20 (CK20) and pleckstrin homology-like domain, family A, member 1 protein (PHLDA1). A series of BFH and infundibulocystic BCC were investigated to determine the pattern of CK20 and PHLDA1 labeling in these lesions. Thirty-six samples of BFH (n = 14) and infundibulocystic BCC (n = 22) were collected. CK20 and PHLDA1 staining was performed and evaluated. All the lesions were small (average of 3 mm), well circumscribed, and composed of basaloid to squamoid cells arranged in islands resembling ramifying rootlets with interspersed horn cysts. CK20-positive cells were present in all 36 cases (average, 22/mm(2)), throughout the tumor, including deeper portions, irrespective of original diagnosis. Six of thirty cases (20%; 5 infundibulocystic BCC, 1 BFH) were focally PHLDA1 positive. Findings on hematoxylin and eosin staining and those of CK20 staining in BFH and infundibulocystic BCC were similar, and in most cases were indistinguishable. The CK20 labeling was similar to that of trichoepithelioma. The findings add a degree of support to the argument that BFH and infundibulocystic BCC represent the same lesion and, further, a benign one. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
28 CFR 22.22 - Revelation of identifiable data.
2010-07-01
... STATISTICAL INFORMATION § 22.22 Revelation of identifiable data. (a) Except as noted in paragraph (b) of this section, research and statistical information relating to a private person may be revealed in identifiable... sections 223(a)(12)(A), 223(a)(13), 223(a)(14), and 243 of the Juvenile Justice and Delinquency Prevention...
International Nuclear Information System (INIS)
2008-01-01
The last decade has seen significant progress in several countries on the siting of repositories for deep disposal of long-lived radioactive waste. In parallel with this, regulatory authorities have developed and expanded the regulations that will be applied, firstly in deciding applications to proceed with repository development and, secondly, to provide the basis for ongoing supervision of repository development work. A workshop to be held in Tokyo 20-22 January 2009 will examine current issues in regulation for geological disposal of long-lived radioactive waste. A questionnaire was developed and sent to regulatory organisations in order to collect relevant data and structure the workshop along the themes of highest interest. The questionnaire answers are summarised herein along with the main findings in order to inform the discussions that will be held in the Tokyo workshop. (authors)
Bartolini, R; Calaga, R; Einfeld, D; Giovannozzi, M; Koutchouk, J-P; Milardi, C; Safranek, J; Tomás, R; Wenninger, J; Zimmermann, F
2012-01-01
The LHC, its luminosity upgrade HL-LHC, its injectors upgrade LIU and other high performance storage rings around the world are facing challenging requirements for optics measurements, correction and modelling. This workshop aims to do a review of the existing techniques to measure and control linear and non-linear optics parameters. The precise optics determination has proven to be a key ingredient to improve the performance of the past and present accelerators. From 20 to 22 June 2011 an international workshop, “OMCM,” was held at CERN with the goal of assessing the limits of the present techniques and evaluating new paths for improvement. The OMCM workshop was sponsored and supported by CERN and by the European Commission under the FP7 “Research Infrastructures” project EuCARD, grant agreement no. 227579.
Directory of Open Access Journals (Sweden)
Ratna Ningsih S
2015-01-01
Full Text Available One kind of calixarenes, i.e. 4,10,16,22-tetramethoxycalix[4]arene (4, has been synthesized from anethole (1, which was isolated from anise oil. The synthesis of 4 was carried out via acid-catalyzed procedure. The reaction route consists of three stages, i.e. (i oxidation of 1 with KMnO4 at 40oC for 15 minutes, (ii reduction p-anisaldehyde (2 with NaBH4 at 76oC for 3 hours, and (iii cyclotetramerization of p-anisilalcohol (3 with AlCl3 at 20oC for 2 hours. Oxidation of 1 produced 2 in 77%, whereas reduction of 2 gave 3 in 55 %. The cyclotetramerization of 3 yielded 4 in 95 %. Key Words: 4,10,16,22-tetramethoxycalix[4]arene, Anise Oil, Anethole
Calibration of the SH134-20 Standard Gain Horn
DEFF Research Database (Denmark)
Pivnenko, Sergey; Breinbjerg, Olav
This report documents the measurement of the linearly polarized SH134-20 Standard Gain Horn. The measurement comprises on-axis gain, on-axis polarization characteristics, and reflection coefficient at 111 frequencies in the frequency range from 22-33 GHz. The measurement was carried out at the DTU...
Microstructural analysis of hot press formed 22MnB5 steel
Aziz, Nuraini; Aqida, Syarifah Nur; Ismail, Izwan
2017-10-01
This paper presents a microstructural study on hot press formed 22MnB5 steel for enhanced mechanical properties. Hot press forming process consists of simultaneous forming and quenching of heated blank. The 22MnB5 steel was processed at three different parameter settings: quenching time, water temperature and water flow rate. 22MnB5 was processed using 33 full factorial design of experiment (DOE). The full factorial DOE was designed using three factors of quenching time, water temperature and water flow rate at three levels. The factors level were quenching time range of 5 - 11 s, water temperature; 5 - 27°C and water flow rate; 20 - 40 L/min. The as-received and hot press forming processed steel was characterised for metallographic study and martensitic structure area percentage using JEOL Field Emission Scanning Electron Microscopic (FESEM). From the experimental finding, the hot press formed 22MnB5 steel consisted of 50 to 84% martensitic structure area. The minimum quenching time of 8 seconds was required to obtain formed sample with high percentage of martensite. These findings contribute to initial design of processing parameters in hot press forming of 22MnB5 steel blanks for automotive component.
Spectroscopic Classification of MASTER OT J044212.20+230616.7
Shivvers, I.; Kelly, P. L.; Clubb, K. I.; Filippenko, A. V.
2014-09-01
We report that inspection of a CCD spectrum (range 330-1000 nm), obtained on September 22 UT with the 3-m Shane reflector (+ Kast) at Lick Observatory, shows that MASTER OT J044212.20+230616.7 (ATel #6484) is a Type IIn supernova.
Schneider, Maude; Eliez, Stephan; Birr, Julie; Menghetti, Sarah; Debbané, Martin; Van der Linden, Martial
2016-03-01
The 22q11.2 deletion syndrome (22q11.2DS) is associated with cognitive and functional impairments and increased risk for schizophrenia. We characterized multitasking abilities of adolescents with 22q11.2DS using an experimental naturalistic setting and examined whether multitasking impairments were associated with real-world functioning and negative symptoms. Thirty-nine adolescents (19 with 22q11.2DS and 20 controls) underwent the Multitasking Evaluation for Adolescents. Real-world functioning and clinical symptoms were assessed in participants with 22q11.2DS. Adolescents with 22q11.2DS performed poorly in the multitasking evaluation. Our data also suggest that multitasking abilities are related to adaptive functioning in the practical domain and negative symptoms. This study shows that adolescents with 22q11.2DS are characterized by multitasking impairments, which may be relevant for several aspects of the clinical phenotype.
DEFF Research Database (Denmark)
Martinenaite, Evelina; Munir Ahmad, Shamaila; Hansen, Morten
2016-01-01
Tumor cells and tumor-infiltrating macrophages produce the chemokine CCL22, which attracts regulatory T cells (Tregs) into the tumor microenvironment, decreasing anticancer immunity. Here, we investigated the possibility of targeting CCL22-expressing cells by activating specific T cells. We...... analyzed the CCL22 protein signal sequence, identifying a human leukocyte antigen A2- (HLA-A2-) restricted peptide epitope, which we then used to stimulate peripheral blood mononuclear cells (PMBCs) to expand populations of CCL22-specific T cells in vitro. T cells recognizing an epitope derived from...... the signal-peptide of CCL22 will recognize CCL22-expressing cells even though CCL22 is secreted out of the cell. CCL22-specific T cells recognized and killed CCL22-expressing cancer cells. Furthermore, CCL22-specific T cells lysed acute monocytic leukemia cells in a CCL22 expression-dependent manner. Using...
Gl(2/2)-oscillators and Gl(2/2)-dynamical symmetry
International Nuclear Information System (INIS)
Kamupingene, A.H.; Nguyen Anh Ky.
1991-07-01
Extending the concept of the dynamical symmetry, we identify the Lie superalgebra Gl(2/2) as a dynamical (super-)algebra of a class of non-canonical quantum systems, whose dynamical variables and quantities can be realized in terms of the Gl(2/2)-generators. In this way, a new class of harmonic oscillators is established. As a consequence of the choice of the dynamical variables the Heisenberg algebra and the Hermitian condition for the Gl(2/2)-representations are also given. (author). 12 refs
Directory of Open Access Journals (Sweden)
P. Zelazowski
2018-02-01
Full Text Available Global circulation models (GCMs are the best tool to understand climate change, as they attempt to represent all the important Earth system processes, including anthropogenic perturbation through fossil fuel burning. However, GCMs are computationally very expensive, which limits the number of simulations that can be made. Pattern scaling is an emulation technique that takes advantage of the fact that local and seasonal changes in surface climate are often approximately linear in the rate of warming over land and across the globe. This allows interpolation away from a limited number of available GCM simulations, to assess alternative future emissions scenarios. In this paper, we present a climate pattern-scaling set consisting of spatial climate change patterns along with parameters for an energy-balance model that calculates the amount of global warming. The set, available for download, is derived from 22 GCMs of the WCRP CMIP3 database, setting the basis for similar eventual pattern development for the CMIP5 and forthcoming CMIP6 ensemble. Critically, it extends the use of the IMOGEN (Integrated Model Of Global Effects of climatic aNomalies framework to enable scanning across full uncertainty in GCMs for impact studies. Across models, the presented climate patterns represent consistent global mean trends, with a maximum of 4 (out of 22 GCMs exhibiting the opposite sign to the global trend per variable (relative humidity. The described new climate regimes are generally warmer, wetter (but with less snowfall, cloudier and windier, and have decreased relative humidity. Overall, when averaging individual performance across all variables, and without considering co-variance, the patterns explain one-third of regional change in decadal averages (mean percentage variance explained, PVE, 34.25 ± 5.21, but the signal in some models exhibits much more linearity (e.g. MIROC3.2(hires: 41.53 than in others (GISS_ER: 22.67. The two most often
International Nuclear Information System (INIS)
Kaeldstroem, M.; Kumar, N.; Heikkilae, T.; Tiitta, M.; Salmi, T.; Murzin, D. Yu.
2011-01-01
Catalytic transformation of levoglucosan (1-6-anhdyro-β-D-glucopyranose) was carried out in a fixed bed reactor at 573 K over zeolite and mesoporous material catalysts. Proton forms of MCM-22-30 and MCM-41-20 catalysts were tested in the conversion, changing also the residence time. The yield of the transformation product phases was substantially influenced by the structures, at the same time the formation of the different compounds were dependent on the structures of the acidic zeolite catalysts. Oxygenated species were the main liquid product, consisting mainly of aldehydes and furfurals (glycolaldehyde, formaldehyde, acetaldehyde, furfural, 5-methylfurfural, acetic acid). The formation of the liquid products was higher over MCM-41-20 than over MCM-22-30 for all the oxygenated species except acetic acid, indicating larger formation of non-condensable products over the microporous material. By increasing the residence time the formation of acetic acid increased in transformations over MCM-22, however, such increase also led to generation of more gases with both catalysts. The deactivation due to coking was more severe over the zeolite compared to the mesoporous material. It was, however, possible to successfully regenerate the spent zeolites without changing the structure. -- Highlights: → Transformation of levoglucosan (1-6-anhdyro-β-D-glucopyranose) was done at 573 K. → MCM-22-30 and MCM-41-20 catalysts were tested. → Oxygenated species (glycolaldehyde, formaldehyde, acetaldehyde, furfural, 5-methylfurfural, acetic acid) were the main liquid products. → Acidity had an influence on product distribution and deactivation.
Five-membered ring annelation in [2.2]paracyclophanes by aldol condensation
Directory of Open Access Journals (Sweden)
Henning Hopf
2014-08-01
Full Text Available Under basic conditions 4,5,12,13-tetraacetyl[2.2]paracyclophane (9 cyclizes by a double aldol condensation to provide the two aldols 12 and 15 in a 3:7 ratio. The structures of these compounds were obtained from X-ray structural analysis, spectroscopic data, and mechanistic considerations. On acid treatment 12 is dehydrated to a mixture of the condensed five-membered [2.2]paracyclophane derivatives 18–20, whereas 15 yields a mixture of the isomeric cyclopentadienones 21–23. The structures of these elimination products are also deduced from X-ray and spectroscopic data. The sequence presented here constitutes the simplest route so far to cyclophanes carrying an annelated five-membered ring.
East and Central African Journal of Surgery - Vol 22, No 1 (2017)
African Journals Online (AJOL)
Fast track surgery at the University Teaching Hospital of Kigali: a randomized controlled trial study in abdominal surgery · EMAIL FREE FULL TEXT EMAIL FREE FULL TEXT DOWNLOAD FULL TEXT DOWNLOAD FULL TEXT. L Ndayizeye, A.K. Kiswezi, 12-20. http://dx.doi.org/10.4314/ecajs.v22i1.2 ...
Energy Technology Data Exchange (ETDEWEB)
Almeraya, F; Martinez-Villafane, A; Gaona, C; Romero, M A; Malo, J M
1998-06-01
Many hot corrosion problems in industrial and utility boilers are caused by molten salts. The corrosion processes which occur in salts are of an electrochemical nature, and so they can be studied using electrochemical test methods. In this research, electrochemical techniques in molten salt systems have been used for the measurements of molten corrosion processes. Electrochemical test methods are described here for a salt mixture of 80%V{sub 2}O{sub 5}-20%NaSO{sub 4} at 540-680 degree centigree. To establish better the electrochemical corrosion rate measurements for molten salt systems, information from electrochemical potentiodynamic polarization curves, such as polarization resistance and Tafeol slopes were used in this study to generate corrosion rate data. The salt was contained in a quartz crucible inside a stainless retort. The atmosphere used was air. A thermocouple sheathed with quartz glass was introduced into the molten salt for temperature monitoring and control. Two materials were tested in the molten mixture: SA213-T22 and SA213-TP347H steels. The corrosion rates values obtained using electrochemical methods were around 0.58-7.14 mm/yr (22.9-281 mpy). The corrosion rate increase with time. (Author) 7 refs.
22 CFR 11.5 - Certification for appointment to class 7 or 8.
2010-04-01
... abroad (to a maximum of 2 years of such civilian service), or Peace Corps volunteer service, will be... examination in a foreign language, but the appointment will be subject to the condition that the newly..., adequate proficiency in a foreign language is achieved. (22 U.S.C. 1221 et seq.) [37 FR 19356, Sept. 20...
Nuclear quadrupole interaction measurements of 19F* and 22Na* on Graphite
International Nuclear Information System (INIS)
Djoko-Surono, Th; Martin, Peter W
1996-01-01
Time differential perturbed angular distribution (TDPAD) technique has been used to investigate nuclear quadrupole interactions of 19 F * and 22 Na * in graphite. We concentrated the measurements on pseudo single crystal graphite called Highly Oriented Pyrolytic Graphite for it has an ordered structure in which the c-axes of the microcrystals aligned in a certain direction with the mosaic spread less than 1 o , while the a- and b-axes randomly oriented on a plane perpendicular to the c-axes. Interactions between quadrupole moment of 19 F * and 22 Na * with its surroundings electric field gradient were studied by detecting the γ-rays distribution, W(Θ,t). For 1 9F * we found one static interaction. The corresponding electric field gradient was V zz =3.24(19)x10 22 V/m 2 . In the case of 22 Na * we found no evidence of nuclear quadrupole interaction, however, we were able to conclude that |QV 22 | 19 bV/m 2 . Using theoretical calculation Q=0.06 barn, we find that |V zz | 20 V/m 2 . These results indicate that the value efg depend on two factors, the host crystal and the core electrons. The core electrons contribution to the total efg is considerably large
Recovery From Anorexia Nervosa and Bulimia Nervosa at 22-Year Follow-Up.
Eddy, Kamryn T; Tabri, Nassim; Thomas, Jennifer J; Murray, Helen B; Keshaviah, Aparna; Hastings, Elizabeth; Edkins, Katherine; Krishna, Meera; Herzog, David B; Keel, Pamela K; Franko, Debra L
2017-02-01
The course of eating disorders is often protracted, with fewer than half of adults achieving recovery from anorexia nervosa or bulimia nervosa. Some argue for palliative management when duration exceeds a decade, yet outcomes beyond 20 years are rarely described. This study investigates early and long-term recovery in the Massachusetts General Hospital Longitudinal Study of Anorexia and Bulimia Nervosa. Females with DSM-III-R/DSM-IV anorexia nervosa or bulimia nervosa were assessed at 9 and at 20 to 25 years of follow-up (mean [SD] = 22.10 [1.10] years; study initiated in 1987, last follow-up conducted in 2013) via structured clinical interview (Longitudinal Interval Follow-Up Evaluation of Eating Disorders [LIFE-EAT-II]). Seventy-seven percent of the original cohort was re-interviewed, and multiple imputation was used to include all surviving participants from the original cohort (N = 228). Kaplan-Meier curves estimated recovery by 9-year follow-up, and McNemar test examined concordance between recovery at 9-year and 22-year follow-up. At 22-year follow-up, 62.8% of participants with anorexia nervosa and 68.2% of participants with bulimia nervosa recovered, compared to 31.4% of participants with anorexia nervosa and 68.2% of participants with bulimia nervosa by 9-year follow-up. Approximately half of those with anorexia nervosa who had not recovered by 9 years progressed to recovery at 22 years. Early recovery was associated with increased likelihood of long-term recovery in anorexia nervosa (odds ratio [OR] = 10.5; 95% CI, 3.77-29.28; McNemar χ²₁ = 31.39; P bulimia nervosa (OR = 1.0; 95% CI, 0.49-2.05; McNemar χ²₁ = 0; P = 1.0). At 22 years, approximately two-thirds of females with anorexia nervosa and bulimia nervosa were recovered. Recovery from bulimia nervosa happened earlier, but recovery from anorexia nervosa continued over the long term, arguing against the implementation of palliative care for most individuals with eating disorders. © Copyright
Directory of Open Access Journals (Sweden)
Argeo Magliocca
1978-01-01
Full Text Available In the South Atlantic nearly the Brazilian coast, at low latitudes, the layer of minimum oxygen concentration shows distinct values between the Equatorial region (7ºS and the region limited by latitudes of 18-22ºS. In the vicinity of the Equator the minimum concentration is remarkably clear (2,0 ml/l at 7ºS and at 22ºS the minima values raise up to 4.0-4.5 ml/l. The minimum oxygen layer follows the isopynics surfaces (σt = 26.8-27.2 in depths of 300-400 m (7ºS and 600-800 m (22ºS . The oxygen concentration in this area results from a biochemical and physical processes, due to the presence of poor water Brazil Current southward and the rich one Intermediate Antartic water flowing northward.
Evaluation of {sup 23}Na(n,2n){sup 22}Na reaction cross-sections
Energy Technology Data Exchange (ETDEWEB)
Manokhin, V N [Institute of Physics and Power Engineering, Obninsk (Russian Federation)
1997-06-01
Using available experimental data and (n,2n) excitation function systematics {sup 23}Na(n,2n){sup 22}Na reaction cross-sections were evaluated for energies ranging from the reaction threshold to 20 MeV. (author). 21 refs, 1 fig., 2 tabs.
Biodegradation of hydrocarbon remnants by biological activators in the presence of INIPOL EAP 22
Energy Technology Data Exchange (ETDEWEB)
Bergueiro, J. R.; Luengo, M. C.; Socias, S.; Perez, F.; Laseca, D. [Universidad de las Islas Baleares, Palma de Mallorca (Spain); Perez-Navarro, A.; Morales, N. [Universidad Alfonso X El Sabio, Madrid (Spain)
1997-10-01
Degradation of highly weathered hydrocarbon mixtures resulting from an accidental spill in an oil refinery was studied, using BIOLEN IG 30 as the degradation agent microorganism, and INIPOL EAP 22 as the biodegradation accelerator. Results show that BIOLEN IG 30 is able to degrade highly weathered hydrocarbons at 20 degrees C, in the presence of INIPOL EAP 22. BIOLEN IG 30 is also able to degrade the total ionic and anionic dispersants in FINASOL OSR 51 (a dispersant), even in the absence of a biodegradation accelerator. 10 refs., 7 tabs., 3 figs.
Biodegradation of hydrocarbon remnants by biological activators in the presence of INIPOL EAP 22
International Nuclear Information System (INIS)
Bergueiro, J. R.; Luengo, M. C.; Socias, S.; Perez, F.; Laseca, D.; Perez-Navarro, A.; Morales, N.
1997-01-01
Degradation of highly weathered hydrocarbon mixtures resulting from an accidental spill in an oil refinery was studied, using BIOLEN IG 30 as the degradation agent microorganism, and INIPOL EAP 22 as the biodegradation accelerator. Results show that BIOLEN IG 30 is able to degrade highly weathered hydrocarbons at 20 degrees C, in the presence of INIPOL EAP 22. BIOLEN IG 30 is also able to degrade the total ionic and anionic dispersants in FINASOL OSR 51 (a dispersant), even in the absence of a biodegradation accelerator. 10 refs., 7 tabs., 3 figs
International Nuclear Information System (INIS)
Schellhammer, W.
1977-01-01
Non-destructive and metallographic investigations with a view to relaxation cracking and hot cracking were carried out in 53 component-specific welds with wall thicknesses of 40 to 360 mm and 21 experimental welds with wall thicknesses of 140 to 275 mm of high-temperature, fine-grained structural steel 22 NiMoCr 37 as well as in 27 component-specific welds of high-strength, fine-grained structural steel 20 MnMoNi 55. Non-destructive tests and conventional metallographic analyses by means of transverse structure micrography were unable to give a sufficiently accurate picture of the two types of cracks in the micro- and millimeter range, a 'volumetric' method was employed (tangential structure micrography with stepwise abrasion) which permitted semi-automatic and fast evaluation. The experimental results showed the selective influence of several elements and led to the development of a method to evaluate the cumulative effect of the chemical elements on relaxation cracking and hot cracking by addition of the selective influence. The method gives quantitative data on material optimisation with regard to the reduction of brittle and crack-prone states and confirms the findings of welding simulation tests. (orig./IHOE) 891 IHOE/orig.- 892 HIS [de
Simons, M C; Ben-Amotz, R; Popovitch, C
2014-10-01
To report complications and owner satisfaction for dogs and cats following partial caudectomy. Medical records of dogs and cats (n = 22) that underwent partial caudectomy between 2008 and 2013 were retrospectively reviewed. Signalment, reason for amputation, level of amputation, and complications were recorded. Owners were contacted via telephone to obtain follow-up data. The most common reason for partial caudectomy was tail wounds (16 of 22; 72 · 7%). Complications were typically minor incisional crusting (4 of 20; 20%). Major complications (3 of 20; 15%) included prolonged healing after partial incisional dehiscence, continued self-trauma requiring revision surgery, and severe inflammation with ulceration requiring revision surgery. The majority of owners surveyed (10 of 12; 83 · 3%) were satisfied with the post-operative outcome and would recommend this procedure if warranted. Partial caudectomy is well tolerated in both dogs and cats with no loss of function. Pet owners did not perceive any behavioural changes following partial caudectomy. However, in cases of continued self-mutilation and/or incisional dehiscence, revision procedures may be required. © 2014 British Small Animal Veterinary Association.
Male-pattern baldness susceptibility locus at 20p11.
Richards, J.B.; Yuan, X.; Geller, F.; Waterworth, D.; Bataille, V.; Glass, D.; Song, K.; Waeber, G.; Vollenweider, P.; Aben, K.K.H.; Kiemeney, L.A.L.M.; Walters, B.; Soranzo, N.; Thorsteinsdottir, U.; Kong, A.; Rafnar, T.; Deloukas, P.; Sulem, P.; Stefansson, H.; Stefansson, K.; Spector, T.D.; Mooser, V.
2008-01-01
We conducted a genome-wide association study for androgenic alopecia in 1,125 men and identified a newly associated locus at chromosome 20p11.22, confirmed in three independent cohorts (n = 1,650; OR = 1.60, P = 1.1 x 10(-14) for rs1160312). The one man in seven who harbors risk alleles at both
Journal of Education for Sustainable Development, 2012
2012-01-01
The United Nations Conference on Sustainable Development (Rio+20) was held in Rio de Janeiro, Brazil, 20-22 June 2012, marking the twentieth anniversary of the United Nations Conference on Sustainable Development in Rio de Janeiro in 1992 and the tenth anniversary of the 2002 World Summit on Sustainable Development in Johannesburg. With more than…
(E,E-6,6′-Dimethoxy-2,2′-[o-phenylenebis(nitrilomethylidyne]diphenol
Directory of Open Access Journals (Sweden)
Yong Wang
2009-04-01
Full Text Available In the title compound, C22H20N2O4, the central benzene ring forms dihedral angles of 3.2 (2 and 61.1 (1° with the two outer substituted benzene rings. Intramolecular O—H...N hydrogen bonds are formed by both hydroxyl groups.
20 CFR 437.22 - Allowable costs.
2010-04-01
... CFR Part 31. Contract Cost Principles and Procedures, or uniform cost accounting standards that comply... COOPERATIVE AGREEMENTS TO STATE AND LOCAL GOVERNMENTS Post-Award Requirements Financial Administration § 437...) Applicable cost principles. For each kind of organization, there is a set of Federal principles for...
The Dermatophagoides farinae group 22 allergen: cloning and expression in Escherichia coli.
Cui, Yu-bao; Cai, Hong-xing; Zhou, Ying; Wang, Nan; Yu, Li-li; Yang, Li; Zhang, Cheng-bo
2015-09-01
Dermatophagoides farinae (Hughes) (Acari: Pyroglyphidae) and other domestic mites produce allergens that affect people worldwide. Here, the complementary DNA (cDNA) coding for group 22 allergen of D. farinae (Der f 22) from China was cloned, sequenced, and expressed successfully. The cDNA encoding Der f 22 was synthesized by reverse transcription polymerase chain reaction (RT-PCR), then ligated to the pCold-TF for expression in Escherichia coli BL21 cells. The purified recombinant fusion protein was identified by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE), Western-blotting, and tandem matrix-assisted laser desorption ionization time-of-flight (MALDI-TOF/TOF). The full-length cDNA comprised 468 nucleotides and was 99.57% (466/468) identical with the reference sequence (GenBank: DQ643992). After the plasmid pCold-TF-Der f 22 was transformed into E. coli BL21 and expressed with the induction of IPTG, SDS-PAGE showed a specific band for the recombinant fusion protein. The recombinant fusion protein, which was purified by chromatography, bound with a His-tagged antibody by Western blotting. MALDI-TOF/TOF mass spectrometry revealed that the structure of the recombinant protein was identical to the predicted Der f 22 structure. The hydrophilic protein contains a signal peptide of 20 amino acids, and the mature Der f 22 consists of 135 amino acid residues with a molecular weight of 14.7 kDa and theoretical isoelectric points (pI) of 6.38. Its secondary structure comprises an alpha helix (38.5%), beta-sheet (45.9%), random coils (11.85%), and beta-turns (11.1%). This work represents the first reported full-length sequence and successful cloning of Der f 22 from D. farinae in China; bioinformatics analysis can be used to further study the allergenicity and clinical utility of the recombinant Der f 22. © 2015 ARS-AAOA, LLC.
Interleukin-22: immunobiology and pathology
Dudakov, Jarrod A.; Hanash, Alan M.; van den Brink, Marcel R.M.
2015-01-01
Interleukin-22 (IL-22) is a recently described IL-10 family cytokine that is produced by T-helper (Th)-17 cells, γδ T cells, NKT cells and newly described innate lymphoid cells (ILCs). Knowledge of IL-22 biology has rapidly evolved since its discovery in 2000, and a role for IL-22 has been identified in numerous tissues including the intestines, lung, liver, kidney, thymus, pancreas and skin. IL-22 primarily targets non-hematopoietic epithelial and stromal cells where it can promote proliferation and play a role in tissue regeneration. In addition, IL-22 regulates host defense at barrier surfaces. However, IL-22 has also been linked to several conditions involving inflammatory tissue pathology. In this review, we will assess the current understanding of this cytokine, including its physiologic and pathologic effects on epithelial cell function. PMID:25706098
Bis(μ-biphenyl-2,2′-dicarboxylatobis[(2,2′-bipyridinecopper(II
Directory of Open Access Journals (Sweden)
Zhe An
2009-04-01
Full Text Available The title compound, [Cu2(C14H8O42(C10H8N22], was obtained by solvothermal synthesis. The CuII atom is coordinated by one chelating 2,2′-bipyridine ligand and two carboxyl groups from different biphenyl-2,2′-dicarboxylate ligands, leading to a distorted octahedral environment. Each carboxylate group makes one short Cu—O bond [1.9608 (14 and 1.9701 (14 Å] and one longer Cu—O contact [2.4338 (17 and 2.5541 (17 Å] to each CuII atom. The biphenyl-2,2′-dicarboxylate ligands bridge between CuII atoms, forming a dinuclear complex around a crystallographic inversion centre.
Peripheral myelin protein-22 (PMP22 modulates alpha 6 integrin expression in the human endometrium
Directory of Open Access Journals (Sweden)
Braun Jonathan
2011-04-01
Full Text Available Abstract Background PMP22, a member of the GAS3 family of tetraspan proteins, is associated with a variety of neurological diseases. Previous studies have shown that PMP22 is expressed in proliferative endometrium, but its function within this tissue is poorly understood. In this study, we first characterized the expression of PMP22 in the human menstrual cycle and began to characterize its function in the endometrium. Methods Using a combination of immunohistochemistry and quantitative PCR, we characterized the expression of PMP22 in both proliferative and secretory endometrium. Differences in PMP22 expression between proliferative and secretory endometrium were determined using a Mann-Whitney U test. In order to investigate the influence of PMP22 on α6 integrin expression, cells were created that ectopically overexpressed PMP22 or expressed a siRNA to inhibit its expression. These cells were analyzed for changes in integrins and binding to extracellular matrices. Results In this study, we show that PMP22 expression is higher in proliferative phase than secretory phase. Functionally, we have begun to characterize the functional significance of this expression. Previous studies have suggested a link between PMP22 and α6 integrin, and therefore we asked whether PMP22 could associate or potentially modulate the expression of α6 integrin. Expression of both PMP22 and α6 integrin were detectable in endometrial epithelial and stromal cells, and we show that both proteins can associate and colocalize with each other. To understand if PMP22 directly altered the expression of a6 integrin, we examined cell lines with modulated levels of the protein. Overexpression of PMP22 was sufficient to increase α6 integrin surface expression with a concominant increase in binding to the extracellular matrix laminin, while a reduction in PMP22 suppressed α6 integrin surface expression. Conclusion These findings suggest a physiologic role for PMP22 on the
Peripheral myelin protein-22 (PMP22) modulates alpha 6 integrin expression in the human endometrium.
Rao, Rajiv G; Sudhakar, Deepthi; Hogue, Claire P; Amici, Stephanie; Gordon, Lynn K; Braun, Jonathan; Notterpek, Lucia; Goodglick, Lee; Wadehra, Madhuri
2011-04-25
PMP22, a member of the GAS3 family of tetraspan proteins, is associated with a variety of neurological diseases. Previous studies have shown that PMP22 is expressed in proliferative endometrium, but its function within this tissue is poorly understood. In this study, we first characterized the expression of PMP22 in the human menstrual cycle and began to characterize its function in the endometrium. Using a combination of immunohistochemistry and quantitative PCR, we characterized the expression of PMP22 in both proliferative and secretory endometrium. Differences in PMP22 expression between proliferative and secretory endometrium were determined using a Mann-Whitney U test. In order to investigate the influence of PMP22 on α6 integrin expression, cells were created that ectopically overexpressed PMP22 or expressed a siRNA to inhibit its expression. These cells were analyzed for changes in integrins and binding to extracellular matrices. In this study, we show that PMP22 expression is higher in proliferative phase than secretory phase. Functionally, we have begun to characterize the functional significance of this expression. Previous studies have suggested a link between PMP22 and α6 integrin, and therefore we asked whether PMP22 could associate or potentially modulate the expression of α6 integrin. Expression of both PMP22 and α6 integrin were detectable in endometrial epithelial and stromal cells, and we show that both proteins can associate and colocalize with each other. To understand if PMP22 directly altered the expression of a6 integrin, we examined cell lines with modulated levels of the protein. Overexpression of PMP22 was sufficient to increase α6 integrin surface expression with a concominant increase in binding to the extracellular matrix laminin, while a reduction in PMP22 suppressed α6 integrin surface expression. These findings suggest a physiologic role for PMP22 on the expression of α6 integrin. We predict that this may be important for the
Gan, Lu; Zhou, Qiaoling; Li, Xiaozhao; Chen, Chen; Meng, Ting; Pu, Jiaxi; Zhu, Mengyuan; Xiao, Chenggen
2018-04-01
IgA nephropathy (IgAN), the most common glomerulonephritis, has an unclear pathogenesis. The role of Th22 cells, which are intimately related to proteinuria and progression in IgAN, in mediating infection-related IgAN is unclear. This study aimed to characterize the association between intrinsic renal cells (tubular epithelial cells and mesangial cells) and Th22 cells in immune regulation of infection-related IgAN and to elucidate the impact of Th22 lymphocytosis; the proinflammatory cytokines IL-1, IL-6, and TNF-α; and CCL chemokines on kidney fibrosis. Hemolytic streptococcus infection induced an increase in IL-1, IL-6, and TNF-α, resulting in Th22 cell differentiation from T lymphocytes obtained from patients with IgAN, and the CCL20-CCR6, CCL22-CCR4, and/or CCL27-CCR10 axes facilitated Th22 cell chemotaxis. The increased amount of Th22 cells caused an increase in TGF-β1 levels, and anti-CD80, anti-CD86, and CTLA-4Ig treatment reduced TGF-β1 levels by inhibiting Th22 lymphocytosis and secretion of cytokines and chemokines, thus potentially relieving kidney fibrosis. Our data suggest that Th22 cells might be recruited into the kidneys via the CCL20-CCR6, CCL22-CCR4, and/or CCL27-CCR10 axes by mesangial cells and tubular epithelial cells in infection-related IgAN. Th22 cell overrepresentation was attributed to stimulation of the B7-CTLA-4Ig antigen-presenting pathway and IL-1, IL-6, and TNF-α.
International Nuclear Information System (INIS)
Anderson, R.P.; Armstrong, D.R.
1977-01-01
Previous experimental and theoretical studies of R-22 vapor explosions are reviewed. Results from two experimental investigations of vapor explosions in a medium scale R-22/water system are reported. Measurements following the drop of an unrestrained mass of R-22 into a water tank demonstrated the existence of two types of interaction behavior. Release of a constrained mass of R-22 beneath the surface of a water tank improved the visual resolution of the system thus allowing identification of two interaction mechansims: at low water temperatures, R-22/water contact would produce immediate violent boiling; at high water temperatures a vapor film formed around its R-22 as it was released, explosions were generated by a surface wave which initiated at a single location and propagated along the vapor film as a shock wave. A new vapor explosion model is proposed, it suggests explosions are the result of a sequence of three independent steps: an initial mixing phase, a trigger and growth phase, and a mature phase where a propagating shock wave accelerates the two liquids into a collapsing vapor layer causing a high velocity impact which finely fragments and intermixes the two liquids
22 CFR 135.22 - Allowable costs.
2010-04-01
... Procedures, or uniform cost accounting standards that comply with cost principles acceptable to the Federal... AGREEMENTS TO STATE AND LOCAL GOVERNMENTS Post-Award Requirements Financial Administration § 135.22 Allowable... principles. For each kind of organization, there is a set of Federal principles for determining allowable...
Energy Technology Data Exchange (ETDEWEB)
Vries, Femke A.T. de [Department of Toxicogenetics, Leiden University Medical Center, P.O. Box 9600, 2300 RC Leiden (Netherlands); Zonneveld, Jose B.M. [Department of Toxicogenetics, Leiden University Medical Center, P.O. Box 9600, 2300 RC Leiden (Netherlands); Groot, Anton J. de [Department of Toxicogenetics, Leiden University Medical Center, P.O. Box 9600, 2300 RC Leiden (Netherlands); Koning, Roman I. [Department of Molecular Cell Biology, Leiden University Medical Center, Leiden (Netherlands); Zeeland, Albert A. van [Department of Toxicogenetics, Leiden University Medical Center, P.O. Box 9600, 2300 RC Leiden (Netherlands); Pastink, Albert [Department of Toxicogenetics, Leiden University Medical Center, P.O. Box 9600, 2300 RC Leiden (Netherlands)]. E-mail: A.Pastink@lumc.nl
2007-02-03
The Saccharomyces cerevisiae Rad52 protein has a crucial role in the repair of DNA double-strand breaks by homologous recombination. In vitro, Rad52 displays DNA binding and strand annealing activities and promotes Rad51-mediated strand exchange. Schizosaccharomyces pombe has two Rad52 homologues, Rad22A and Rad22B. Whereas rad22A deficient strains exhibit severe defects in repair and recombination, rad22B mutants have a much less severe phenotype. To better understand the role of Rad22A and Rad22B in double-strand break repair, both proteins were purified to near homogeneity. Using gel retardation and filter binding assays, binding of Rad22A and Rad22B to short single-stranded DNAs was demonstrated. Binding of Rad22A to double-stranded oligonucleotides or linearized plasmid molecules containing blunt ends or short single-stranded overhangs could not be detected. Rad22B also does not bind efficiently to short duplex oligonucleotides but binds readily to DNA fragments containing 3'-overhangs. Rad22A as well as Rad22B efficiently promote annealing of complementary single-stranded DNAs. In the presence of Rad22A annealing of complementary DNAs is almost 90%. Whereas in reactions containing Rad22B the maximum level of annealing is 60%, most likely due to inhibition of the reaction by duplex DNA. Gel-filtration experiments and electron microscopic analyses indicate self-association of Rad22A and Rad22B and the formation of multimeric structures as has been observed for Rad52 in yeast and man.
International Nuclear Information System (INIS)
Sarlar, Kagan; Kucuk, Ilker
2015-01-01
The effect of Fe concentration on the glass forming ability (GFA) and magnetic properties in Co (40.2−x) Fe (20.1+x) Ni 6.7 B 22.7 Si 5.3 Nb 5 (x=0–10) bulk metallic glasses were investigated. By suction casting method, the bulk metallic glasses with diameters up to 2 mm were produced. We try to find out which Fe concentration makes an influence on Co based system's magnetic properties and glass forming ability. The curves of thermal analysis, obtained using differential scanning calorimetry (DSC), show that the Co (40.2−x) Fe (20.1+x) Ni 6.7 B 22.7 Si 5.3 Nb 5 (x=0–10) have a supercooled liquid region (∆T x ) of about 44 K. The saturation magnetizations (J s ) for as-cast BMG alloys were in the range of 0.62 T−0.81 T. - Highlights: • The effect of Fe concentration on the glass forming ability. • The substitution of an appropriate amount of Fe can enhance the GFA. • The substitution of Fe for Co also improves soft magnetic properties of the BMGs. • The high of J s 0.62−0.81 T with a low H c of 2−289 A/m of the alloys
Decays of 22Al and 26P: discovery of beta-delayed two-proton radioactivity
International Nuclear Information System (INIS)
Cable, M.D.
1983-02-01
A helium-jet system and the 24 Mg( 3 He,p4n) 22 Al and 28 Si( 3 He,p4n) 26 P reactions have been used to discover the only known odd-odd, T/sub Z/ = -2 nuclides, 22 Al(t/sub 1/2/ approx. 70ms) and 26 P(t/sub 1/2/ approx. 20 ms). Observations of beta-delayed protons from each isotope (laboratory energies 7.839 +- 0.015 MeV and 8.149 +- 0.021 MeV for 22 Al and 7.269 +- 0.015 MeV and 6.827 +- 0.050 MeV for 26 P) established the existence of these nuclides and provided a measurement of the mass excesses of the lowest T = 2 states in their beta decay daughters, 22 Mg and 26 Si (13.650 +- 0.015 MeV and 5.936 +- 0.015 MeV, respectively). Measurement of these masses confirmed that these T = 2 states were unbound to two-proton emission as had been predicted theoretically
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false State. 1205.22 Section 1205.22 Agriculture... Procedures for Conduct of Sign-up Period Definitions § 1205.22 State. The term State means each of the 50 states. ...
48 CFR 22.610 - Contract clause.
2010-10-01
... PROGRAMS APPLICATION OF LABOR LAWS TO GOVERNMENT ACQUISITIONS Walsh-Healey Public Contracts Act 22.610... Contracts Act, in solicitations and contracts covered by the Act (see 22.603, 22.604, and 22.605). [61 FR... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Contract clause. 22.610...
2010-04-01
... 19 Customs Duties 3 2010-04-01 2010-04-01 false [Reserved] 210.22 Section 210.22 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE ADJUDICATION AND ENFORCEMENT Motions § 210.22 [Reserved] ...
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Definitions. 22.801 Section 22.801 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SOCIOECONOMIC PROGRAMS APPLICATION OF LABOR LAWS TO GOVERNMENT ACQUISITIONS Equal Employment Opportunity 22.801...
Ye, Jing; Wang, Menglong; Jiang, Huimin; Ji, Qingwei; Huang, Ying; Liu, Jianfang; Zeng, Tao; Xu, Yao; Wang, Zhen; Lin, Yingzhong; Wan, Jun
2017-11-03
Interleukin (IL)-22 plays important roles in the development of arterial disease, including atherosclerosis and hypertension. However, the relationship between IL-22 and acute thoracic aortic dissection (TAD) remains unknown. Blood samples were collected from patients with chest pain who underwent computed tomography angiography of the thoracic aorta but had no known preoperative diagnosis of coronary artery disease, peripheral artery disease, arthritis, and/or membranous nephropathy. Patients were divided into non-AD (NAD) and TAD groups, and the plasma concentrations of IL-22, IL-6 and tumor necrosis factor (TNF)-α were measured. In addition, aortic tissue samples from acute TAD patients and normal donors were collected, and the expression levels of IL-22 and IL-22 receptor 1 (IL-22R1) were measured. IL-22, IL-6 and TNF-α levels were significantly higher in acute TAD patients than in NAD patients (IL-22, NAD group: 27.0 (19.1, 38.6) pg/ml vs. TAD group: 32.9 (20.6, 58.3) pg/ml, pTAD (OR 1.169, 95% CI 1.069 to 1.277; p=0.001). In addition, compared with aortic tissue of normal controls, TAD aortas showed increased expression of IL-22 and IL-22R1, especially in the torn section (IL-22, non-torn section: 2.8±0.5/HPF vs. torn section 2.8±0.5/HPF, pTAD. Copyright © 2017 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Jiang Hui; Li Haoran; Wang Congmin; Tan Taijun; Han Shijun
2003-01-01
The isothermal and isobaric (vapour + liquid) equilibria for (2,2-dimethoxypropane + methanol) and (2,2-dimethoxypropane + acetone) measured with an inclined ebulliometer are presented. The experimental results are analysed using the UNIQUAC equation with the temperature-dependent binary parameters with satisfactory results. Isobaric (vapour + liquid) equilibria data for these systems at p=99.99 kPa are compared with the literature data. Experimental vapour pressure of 2,2-dimethoxypropane are also included
Evaluation report on SCTF Core-III Test S3-22
International Nuclear Information System (INIS)
Okubo, Tsutomu; Iguchi, Tadashi; Iwamura, Takamichi; Akimoto, Hajime; Ohnuki, Akira; Abe, Yutaka; Murao, Yoshio; Adachi, Hiromichi.
1991-07-01
Two tests (Tests S3-20 and S3-22) were conducted with JAERI's Slab Core Test Facility (SCTF) Core-III in order to investigate water break-through and core cooling behaviors under the intermittent ECC water delivery from the hot legs to one location in the upper plenum and the alternate ECC water delivery to two locations in the upper plenum during reflooding, respectively. This report presents an analysis on Test S3-22 (the alternate case). Subcooled ECC water was injected alternately just above the upper core support plate above Bundles 7 and 8 and Bundles 3 and 4. The total injection rate from both injection ports was the same as that in SCTF Test S3-20 and Test S3-13. Analyzing the test data together with those of Tests S3-13 and S3-20 the following has been found: (1) Alternate break-through occurred immediately corresponding to the alternate ECC water injection except for one period, during which no break-through was observed. However, there observed a difference in break-through behavior that break-through was strong above the low power region, whereas weak above the high power region. (2) Although its break-through behavior was different, nearly the same core cooling as in the continuous or intermittent ECC water delivery case was observed except for the period around quench. (3) Around quench time, degraded core cooling comparing to the continuous or intermittent ECC water delivery case was observed. That is, quench time at the midplane level of the present test was 35 s later than in the continuous case. This is considered to result from decrease in core water inventory caused by water sealing at the cross-over leg. (J.P.N.)
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Policy. 22.1401 Section 22.1401 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SOCIOECONOMIC PROGRAMS APPLICATION OF LABOR LAWS TO GOVERNMENT ACQUISITIONS Employment of Workers with Disabilities 22.1401 Policy...
Xanthobacter sp. C20 contains a novel bioconversion pathway for limonene
Werf, M.J. van der; Keijzer, P.M.; Schaft, P.H. van der
2000-01-01
Xanthobacter sp. C20 was isolated from sediment of the river Rhine using cyclohexane as sole source of carbon and energy. Xanthobacter sp. C20 converted both enantiomers of limonene quantitatively into limonene-8,9-epoxide, a not previously described bioconversion product of limonene. With (4R)-limonene, (4R,8R)-limonene-8,9-epoxide was formed as the only reaction product, while (4S)-limonene was converted into a (78:22) mixture of (4S,8R)- and (4S,8S)-limonene-8,9-epoxide. Cytochrome P-450 w...
2010-07-01
... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Definitions. 105.22 Section 105.22... Security Officer Employment § 105.22 Definitions. As used in this subpart: (a) Authorized employer means... equipment); protect against fire, theft, misappropriation, vandalism, violence, terrorism, and other illegal...
2010-07-01
... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Fees. 802.22 Section 802.22 Judicial... Privacy Act § 802.22 Fees. The Agency shall charge fees under the Privacy Act for duplication of records... Information Act (See § 802.10(i)(1)). ...
14 CFR 372.22 - Discrimination.
2010-01-01
... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Discrimination. 372.22 Section 372.22... REGULATIONS OVERSEAS MILITARY PERSONNEL CHARTERS Conditions and Limitations § 372.22 Discrimination. No... any unjust discrimination or any undue or unreasonable prejudice or disadvantage in any respect...
48 CFR 22.1303 - Applicability.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Applicability. 22.1303 Section 22.1303 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SOCIOECONOMIC... organizations where the workers are recruited outside of the United States. [66 FR 53488, Oct. 22, 2001, as...
17 CFR 270.22e-2 - Pricing of redemption requests in accordance with Rule 22c-1.
2010-04-01
... 17 Commodity and Securities Exchanges 3 2010-04-01 2010-04-01 false Pricing of redemption requests in accordance with Rule 22c-1. 270.22e-2 Section 270.22e-2 Commodity and Securities Exchanges....22e-2 Pricing of redemption requests in accordance with Rule 22c-1. An investment company shall not be...
Diethyl 2,2-bis(3,5-di-tert-butyl-4-hydroxybenzylmalonate
Directory of Open Access Journals (Sweden)
Tao Zeng
2012-02-01
Full Text Available The title molecule, C37H56O6, possesses twofold symmetry, with the twofold axis passing through the quaternary C atom. In the crystal, neighbouring molecules are linked via O—H...O hydrogen bonds involving the phenol OH group and the carbonyl O atom, forming chains propagating in [101]. Within these chains, rings are formed with an R22(20 motif. There are also C—H...O interactions present within the rings.
2010-07-01
... 32 National Defense 5 2010-07-01 2010-07-01 false Diligence. 776.22 Section 776.22 National Defense Department of Defense (Continued) DEPARTMENT OF THE NAVY MISCELLANEOUS RULES PROFESSIONAL CONDUCT... Professional Conduct § 776.22 Diligence. (a) Diligence. A covered attorney shall act with reasonable diligence...
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Pistachios. 983.22 Section 983.22 Agriculture... and Orders; Fruits, Vegetables, Nuts), DEPARTMENT OF AGRICULTURE PISTACHIOS GROWN IN CALIFORNIA, ARIZONA, AND NEW MEXICO Definitions § 983.22 Pistachios. Pistachios means the nuts of the pistachio tree...
2010-07-01
... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Pregnancy. 551.22 Section 551.22 Judicial Administration BUREAU OF PRISONS, DEPARTMENT OF JUSTICE INSTITUTIONAL MANAGEMENT MISCELLANEOUS Birth Control, Pregnancy, Child Placement, and Abortion § 551.22 Pregnancy. (a) The Warden shall ensure that each pregnant...
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Sublot. 932.22 Section 932.22 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements and... Handling Definitions § 932.22 Sublot. Sublot means a quantity of olives resulting from the separation by...
Deletion of fibroblast growth factor 22 (FGF22) causes a depression-like phenotype in adult mice.
Williams, Aislinn J; Yee, Patricia; Smith, Mitchell C; Murphy, Geoffrey G; Umemori, Hisashi
2016-07-01
Specific growth factors induce formation and differentiation of excitatory and inhibitory synapses, and are essential for brain development and function. Fibroblast growth factor 22 (FGF22) is important for specifying excitatory synapses during development, including in the hippocampus. Mice with a genetic deletion of FGF22 (FGF22KO) during development subsequently have fewer hippocampal excitatory synapses in adulthood. As a result, FGF22KO mice are resistant to epileptic seizure induction. In addition to playing a key role in learning, the hippocampus is known to mediate mood and anxiety. Here, we explored whether loss of FGF22 alters affective, anxiety or social cognitive behaviors in mice. We found that relative to control mice, FGF22KO mice display longer duration of floating and decreased latency to float in the forced swim test, increased immobility in the tail suspension test, and decreased preference for sucrose in the sucrose preference test, which are all suggestive of a depressive-like phenotype. No differences were observed between control and FGF22KO mice in other behavioral assays, including motor, anxiety, or social cognitive tests. These results suggest a novel role for FGF22 specifically in affective behaviors. Copyright © 2016 Elsevier B.V. All rights reserved.
2010-01-01
... 7 Agriculture 1 2010-01-01 2010-01-01 false Authentication. 1.22 Section 1.22 Agriculture Office of the Secretary of Agriculture ADMINISTRATIVE REGULATIONS Official Records § 1.22 Authentication. When a request is received for an authenticated copy of a document that the agency determines to make...
2010-04-01
... 19 Customs Duties 3 2010-04-01 2010-04-01 false Reply. 212.22 Section 212.22 Customs Duties UNITED STATES INTERNATIONAL TRADE COMMISSION INVESTIGATIONS OF UNFAIR PRACTICES IN IMPORT TRADE IMPLEMENTATION OF THE EQUAL ACCESS TO JUSTICE ACT Procedures for Considering Applications § 212.22 Reply. Within 15...
2010-10-01
... 47 Telecommunication 2 2010-10-01 2010-10-01 false Scope. 22.801 Section 22.801 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES PUBLIC MOBILE SERVICES Air-Ground Radiotelephone Service § 22.801 Scope. The rules in this subpart govern the licensing and operation of air-ground...
47 CFR 22.1035 - Construction period.
2010-10-01
... 47 Telecommunication 2 2010-10-01 2010-10-01 false Construction period. 22.1035 Section 22.1035 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES PUBLIC MOBILE SERVICES Offshore Radiotelephone Service § 22.1035 Construction period. The construction period (see § 22.142) for...
Radioimmunological activity of 22K variant of human growth hormone
International Nuclear Information System (INIS)
Camillo, M.A.P.; Ribela, M.T.C.P.; Rogero, J.R.
1986-01-01
From a preparation of human growth hormone its integral variant (hGH-22K) was isolated by isoelectric focusing, having a pI of 5,20 and relative mobility (Rm) of 0,621 in the polyacrylamide gel electrophoresis. Several experiments for the characterization of the isolated variant were carried out. The immunological properties was tested by radioimmunoassay (RIE), in which the activity of the isolated variant and the activity of the total preparation were compared. The dose response-curves obtained by RIE were found to be considered parallels (p [pt
2010-01-01
... 12 Banks and Banking 5 2010-01-01 2010-01-01 false State. 583.22 Section 583.22 Banks and Banking OFFICE OF THRIFT SUPERVISION, DEPARTMENT OF THE TREASURY DEFINITIONS FOR REGULATIONS AFFECTING SAVINGS AND LOAN HOLDING COMPANIES § 583.22 State. The term State includes the District of Columbia and the...
2010-10-01
... 49 Transportation 1 2010-10-01 2010-10-01 false Purpose. 22.1 Section 22.1 Transportation Office of the Secretary of Transportation SHORT-TERM LENDING PROGRAM (STLP) General § 22.1 Purpose. The purpose of the DOT OSDBU STLP is to provide financial assistance in the form of short-term loans from...
2010-07-01
... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Water. 230.22 Section 230.22... Chemical Characteristics of the Aquatic Ecosystem § 230.22 Water. (a) Water is the part of the aquatic... the liquid phase and is contained by the substrate. Water forms part of a dynamic aquatic life...
22 CFR 213.22 - Salary offset when USAID is the creditor agency.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Salary offset when USAID is the creditor agency... Administrative Offset § 213.22 Salary offset when USAID is the creditor agency. (a) Due process requirements... through salary offset, USAID will first provide the employee with the opportunity to pay in full the...
2010-07-01
... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Default. 22.17 Section 22.17 Protection... Procedures § 22.17 Default. (a) Default. A party may be found to be in default: after motion, upon failure to... hearing. Default by respondent constitutes, for purposes of the pending proceeding only, an admission of...
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Discovery. 22.21 Section 22.21 Labor Office of the Secretary of Labor PROGRAM FRAUD CIVIL REMEDIES ACT OF 1986 § 22.21 Discovery. (a) The following types of discovery are authorized: (1) Requests for production of documents for inspection and copying; (2) Requests...
2010-07-01
... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Audit. 735.22 Section 735.22 Mineral Resources... ENFORCEMENT § 735.22 Audit. The agency shall arrange for an independent audit no less frequently than once..., Attachment P. The audits will be performed in accordance with the “Standards for Audit of Governmental...
Laur, Mati, 1955-
2013-01-01
Arvustus: Russland an der Ostsee : imperiale Strategien der Macht und kulturelle Wahrnehmungsmuster (16. bis 20. Jahrhundert) = Russia on the Baltic : imperial strategies of power and cultural patterns of perception (16th-20th centuries). (Quellen und Studien zur Baltischen Geschichte, 22). Hrsg. von Kartsen Brüggemann und Bradley Woodworth. Böhlau Verlag. Wien u.a. 2012.
Directory of Open Access Journals (Sweden)
Abel, E.
2012-01-01
Full Text Available Aims: The goal of the study is to isolate species of bacteria that capable of utilizing 2,2-dichloropropionic acid (2,2-DCP as sole carbon source from soil sample collected from surrounding lake water located in Universiti Teknologi Malaysia, Skudai, Johor. Methodology and Results: Genomic DNA from bacterium SE1 was extracted and PCR amplification was carried out using universal primers, Fd1 (5’ - AGA GTT TGA TCC TGGCTC AG - 3’ and rP1 (5’- ACG GTC ATA CCT TGT TAC GAC TT - 3’ before sending for sequencing. The 16S rDNA nucleotide sequences were compared with Basic Local Alignment Search Tool nucleotide (BLASTn and further analyzed using phylogenetic tree of Neighbour-Joining method (MEGA 5. Phylogenetic analysis indicated that SE1 strain clearly shared 97% homology to the genus of Serratia marcescens and therefore designated as Serratia marcescens sp. SE1. SE1 exhibited the ability to utilize 2,2-DCP as sole carbon source at 20 mM concentration with cell doubling time of 5 h and maximum chloride ion release of 38 μmolCl-/mL. This result suggests that the dehalogenase enzyme present in the bacteria has high affinity towards the substrate. Based on morphological and partial biochemical characteristics, strain SE1 was a non-motile Gram negative bacterium with red colonies, that gave a catalase positive reaction. Conclusion, significance and impact of study: A better understanding of dehalogenases enzyme produce by this S. marcescens sp. SE1 in general will be useful to be used as bioremediation tools for environmental management. This is the first reported case that Serratia sp. has the ability to degrade halogenated compound.
Zhang, Weihua; Ungar, Kurt; Stukel, Matthew; Mekarski, Pawel
2014-04-01
In this study, a digital gamma-gamma coincidence/anticoincidence spectrometer was developed and examined for low-level cosmogenic (22)Na and (7)Be in air-filter sample monitoring. The spectrometer consists of two bismuth germanate scintillators (BGO) and an XIA LLC Digital Gamma Finder (DGF)/Pixie-4 software and card package. The spectrometer design allows a more selective measurement of (22)Na with a significant background reduction by gamma-gamma coincidence events processing. Hence, the system provides a more sensitive way to quantify trace amounts of (22)Na than normal high resolution gamma spectrometry providing a critical limit of 3 mBq within a 20 h count. The use of a list-mode data acquisition technique enabled simultaneous determination of (22)Na and (7)Be activity concentrations using a single measurement by coincidence and anticoincidence mode respectively. Copyright © 2014 Elsevier Ltd. All rights reserved.
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Definitions. 22.2 Section 22.2 Labor Office of the Secretary of Labor PROGRAM FRAUD CIVIL REMEDIES ACT OF 1986 § 22.2 Definitions. (a) ALJ means an Administrative... accounting or bookkeeping entry made— (1) With respect to a claim or to obtain the approval or payment of a...
International Nuclear Information System (INIS)
Hubert, F.; Dufour, J.P.; Moral, R. del; Fleury, A.; Jean, D.; Pravikoff, M.S.; Delagrange, H.; Geissel, H.; Schmidt, K.H.; Hanelt, E.
1989-01-01
The beta-gamma spectroscopic study of 22 O is presented. This nucleus, produced as a projectile-like fragment from the interaction of a 60 MeV/n 40 Ar beam with a Be target, has been separated by the LISE spectrometer. Several gamma rays from 22 O decay have been observed, from which a half-life of (2.25±0.15) s has been determined. Accurate excitation energies have been deduced for several states in 22 F. A partial beta decay scheme of 22 O has been established. Experimental results have been compared with shell model calculations. (orig.)
Improvement in properties of welded joints of titanium alloy VT22 by thermocyclic treatment
International Nuclear Information System (INIS)
Lyasotskaya, V.S.; Kulikov, F.R.; Kirillov, Yu.G.; Ravdonikas, N.Yu.
1983-01-01
The results of investigations of the thermocyclic treatment (TCT) effect on the structure and properties of butt welded joints of tubes (with external diameter 180 mm and wall thickness 20-25 mm) of the VT22 alloy are presented. Welded joints have been obtained by means of multipassing automatic argon-arc (ARAW) and electron-beam (ELB) welding. It is shown that TCT of welded joints of the VT22 alloy results in formation in all zones of substructure with disperse precipitations of α-phase which is analogous to the structure of near welded seam zone metal immediately after welding. As a result of TCT and subsequent TT of welded joints poligonization and recrystallization processes of α- and #betta#-phases, changes in parameters of structural components and thin phase structure take place. TCT with strengthening TT or annealing leads to strength increase, while TCT with annealing besides that improves placticity and impact strength of the VT22 alloy welded joints
2010-01-01
... an index or combination of indices to which changes in the interest rate will be linked. This index... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Index. 34.22 Section 34.22 Banks and Banking... Mortgages § 34.22 Index. (a) In general. If a national bank makes an ARM loan to which 12 CFR 226.19(b...
Energy Technology Data Exchange (ETDEWEB)
Venchiarutti, Celia; Richter, Stephan; Jakopic, Rozle; Aregbe, Yetunde [European Commission, Joint Research Centre (JRC), Geel (Belgium). Institute for Reference Materials and Measurements (IRMM); Varga, Zsolt; Mayer, Klaus [European Commission, Joint Research Centre (JRC), Karlsruhe (Germany). Institute for Transuranium Elements (ITU)
2015-07-01
The REIMEP-22 inter-laboratory comparison aimed at determining the production date of a uranium certified test sample (i.e. the last chemical separation date of the material). Participants in REIMEP-22 on ''U Age Dating - Determination of the production date of a uranium certified test sample'' received one low-enriched 20 mg uranium sample for mass spectrometry measurements and/or one 50 mg uranium sample for a-spectrometry measurements, with an undisclosed value for the production date. They were asked to report the isotope amount ratios n({sup 230}Th)/n({sup 234}U) for the 20 mg uranium sample and/or the activity ratios A({sup 230}Th)/A({sup 234}U) for the 50 mg uranium sample in addition to the calculated production date of the certified test samples with its uncertainty. Reporting of the {sup 231}Pa/{sup 235}U ratio and the respective calculated production date was optional. Eleven laboratories reported results in REIMEP-22. Two of them reported results for both the 20 mg and 50 mg uranium certified test samples. The measurement capability of the participants was assessed against the independent REIMEP-22 reference value by means of z- and zeta-scores in compliance with ISO 13528:2005. Furthermore a performance assessment criterion for acceptable uncertainty was applied to evaluate the participants' results. In general, the REIMEP-22 participants' results were satisfactory. This confirms the analytical capabilities of laboratories to determine accurately the age of uranium materials with low amount of ingrown thorium (young certified test sample). The Joint Research Centre of the European Commission (EC-JRC) organised REIMEP-22 in parallel to the preparation and certification of a uranium reference material certified for the production date (IRMM-1000a and IRMM-1000b).
Energy Technology Data Exchange (ETDEWEB)
Kaur, Narinder [Semiconductor Materials and Device Laboratory, Department of Semiconductor Science, Dongguk University-Seoul, Seoul 100715 (Korea, Republic of); Kumar, Manoj [School of Mechanical, Materials & Energy Engineering, Indian Institute of Technology Ropar, Rupnagar, Punjab (India); Sharma, Sanjeev K.; Kim, Deuk Young [Semiconductor Materials and Device Laboratory, Department of Semiconductor Science, Dongguk University-Seoul, Seoul 100715 (Korea, Republic of); Kumar, S.; Chavan, N.M.; Joshi, S.V. [International Advanced Research Centre for Powder Metallurgy & New Materials (ARCI), Hyderabad 500005 (India); Singh, Narinder [Department of Chemistry, Indian Institute of Technology Ropar, Rupnagar, Punjab (India); Singh, Harpreet, E-mail: harpreetsingh@iitrpr.ac.in [School of Mechanical, Materials & Energy Engineering, Indian Institute of Technology Ropar, Rupnagar, Punjab (India)
2015-02-15
Highlights: • A presynthesized Ni-20Cr nanocrystalline powder was successfully deposited on T22 and SA 516 boilers steels using cold spray process. • The coatings are observed to have more than 2-folds microhardness in comparison with the base steels. • The coating was successful in reducing the weight gain of T22 and SA 516 steel by 71% and 94%. - Abstract: In the current investigation, high temperature oxidation behavior of a novel cold-spray Ni-20Cr nanostructured coating was studied. The nanocrystalline Ni-20Cr powder was synthesized by the investigators using ball milling, which was deposited on T22 and SA 516 steels by cold spraying. The crystallite size based upon Scherrer's formula for the developed coatings was found to be in nano-range for both the substrates. The accelerated oxidation testing was performed in a laboratory tube furnace at a temperature 900 °C under thermal cyclic conditions. Each cycle comprised heating for one hour at 900 °C followed by cooling for 20 min in ambient air. The kinetics of oxidation was established using weight change measurements for the bare and the coated steels. The oxidation products were characterized by X-ray Diffraction (XRD), Scanning Electron Microscopy/Energy Dispersive Spectroscopy (SEM/EDS) and X-ray mapping techniques. It was found from the results that the coating was successful in reducing the weight gain of SA213-T22 and SA 516-Grade 70 steel by 71% and 94%, respectively. This may be attributed to relatively denser structure, lower porosity and lower oxide content of the coating. Moreover, the developed nano-structured Ni-20Cr powder coating was found to perform better than its counterpart micron-sized Ni-20Cr powder coating, in terms of offering higher oxidation resistance and hardness.
Protein Profiling Reveals Novel Proteins in Pollen and Pistil of W22 (ga1; Ga1 in Maize
Directory of Open Access Journals (Sweden)
Jin Yu
2014-05-01
Full Text Available Gametophytic factors mediate pollen-pistil interactions in maize (Zea mays L. and play active roles in limiting gene flow among maize populations and between maize and teosinte. This study was carried out to identify proteins and investigate the mechanism of gametophytic factors using protein analysis. W22 (ga1; which did not carry a gametophytic factor and W22 (Ga1, a near iso-genic line, were used for the proteome investigation. SDS-PAGE was executed to investigate proteins in the pollen and pistil of W22 (ga1 and W22 (Ga1. A total of 44 differentially expressed proteins were identified in the pollen and pistil on SDS-PAGE using LTQ-FTICR MS. Among the 44 proteins, a total of 24 proteins were identified in the pollen of W22 (ga1 and W22 (Ga1 whereas 20 differentially expressed proteins were identified from the pistil of W22 (ga1 and W22 (Ga1. However, in pollen, 2 proteins were identified only in the W22 (ga1 and 12 proteins only in the W22 (Ga1 whereas 10 proteins were confirmed from the both of W22 (ga1 and W22 (Ga1. In contrary, 10 proteins were appeared only in the pistil of W22 (ga1 and 7 proteins from W22 (Ga1 while 3 proteins confirmed in the both of W22 (ga1 and W22 (Ga1. Moreover, the identified proteins were generally involved in hydrolase activity, nucleic acid binding and nucleotide binding. These results help to reveal the mechanism of gametophytic factors and provide a valuable clue for the pollen and pistil research in maize.
Sathira-Angkura, Vera; Pithankuakul, Kongkit; Sakulpipatana, Susana; Piyaskulkaew, Chaiwat; Kunakornsawat, Sombat
2012-04-20
Cross-sectional observational study to investigate psychometric properties of an adapted Thai version of the refined Scoliosis Research Society-22 (SRS-22) questionnaire. To evaluate the reliability and validity of the adapted Thai version of the refined SRS-22 questionnaire. The SRS-22 questionnaire is a valid instrument for assessing the health-related quality of life for patients with adolescent idiopathic scoliosis. Recently, the questionnaire has been translated and validated in many languages for non-English-speaking countries. Translation/retranslation of the English version of the SRS-22 was conducted, and the cross-cultural adaptation process was performed. The Thai version SRS-22 and previously validated Thai version Short-Form survey version 2.0 (SF-36V2) questionnaires were administered to 77 patients with adolescent idiopathic scoliosis who had surgical treatment. Fifty-eight patients (52 adolescent girls) had filled out the first set of questionnaires. Thirty patients of the first-time responders completed the second set of questionnaires. The mean age at the time of operation was 14.6 years and the mean age at the time of the final follow-up was 18.7 years. The mean preoperative scoliosis curve magnitude was 55.4° (range, 30°-95°) and postoperative curve magnitude was 20.1° (range, 0°-60°). Internal consistency was determined with Cronbach α coefficient. Intraclass correlation coefficient was used for test-retest reliability. Concurrent validity was evaluated by comparing SRS-22 domains with relevant domains in the SF-36V2 questionnaire, using the Pearson correlation coefficient. The mean overall Cronbach α coefficient of the adapted Thai version SRS-22 was 0.76. The 2 of corresponding domains (mental health = 0.80 and self-image = 0.83) had satisfactory internal consistency and the remaining domains (pain = 0.78; function/activity = 0.74; and satisfaction = 0.76) were good. The intraclass correlation coefficient for 5 domains was ranged from
Shamsdin, Seyedeh Azra; Alborzi, Abdolvahab; Rasouli, Manoochehr; Ghaderi, Abbas; Lankrani, Kamran B; Dehghani, Seyed Mohsen; Pouladfar, Gholam Reza
2017-06-01
An association exists between Helicobacter pylori (H. pylori), peptic ulcers, gastritis, and sometimes gastric carcinomas. Th22 cells have protective and inflammatory roles in defense against microbes. We investigated the frequencies of Th22, Tc22, Th22/17, and Tc22/17 cells in addition to the changes in levels of cytokines IL-22, IL-6, IL-23, TNF-α, IL-1β, and TGF-β in sera from patients with H. pylori-associated gastritis, and peptic ulcer, and in uninfected patients. A total of 76 patients with H. pylori-associated disorders formed the studied group. Frequencies of T-cell subsets were determined by flow cytometry. Levels of cytokines IL-22, IL-6, IL-23, TNF-α, IL-1β, and TGF-β in the sera and supernatants of patients were measured by ELISA and flow cytometry. The study participants included 32 males and 44 females with a mean age of 38.5±15.3 years. We divided the infected group into peptic ulcer and gastritis (mild, moderate, active chronic, and chronic). The frequencies of Th22, Tc22, and Tc22/17 increased significantly in the peptic ulcer, moderate, active chronic, and chronic gastritis groups compared to the uninfected group. Th22/17 only increased significantly in the chronic gastritis group. We observed significant increases in IL-22 in the moderate and active chronic gastritis, IL-23 in the active chronic and chronic gastritis, and TNF-α in the peptic ulcer and moderate gastritis groups. Following in vitro antigenic stimulation, we observed significantly higher levels of IL-1β, IL-23, and IL-6 in the active chronic gastritis group, as well as IL-6 and IL-1β in the chronic gastritis group compared to the uninfected group. Increased Th22, Tc22, and Tc22/17 cells and IL-22 levels appear to be influential in progression and severity of H. pylori infection. Th22/17 can be an interesting therapeutic target for chronic H. pylori infections where eradication is more difficult. © 2016 John Wiley & Sons Ltd.
VENCHIARUTTI CELIA; VARGA ZSOLT; RICHTER Stephan; JAKOPIC Rozle; MAYER Klaus; AREGBE Yetunde
2015-01-01
The REIMEP-22 inter-laboratory comparison aimed at determining the production date of a uranium certified test sample (i.e. the last chemical separation date of the material). Participants in REIMEP-22 on "U Age Dating - Determination of the production date of a uranium certified test sample" received one low-enriched 20 mg uranium sample for mass spectrometry measurements and/or one 50 mg uranium sample for D-spectrometry measurements, with an undisclosed value for the production date. They ...
Basic data report for Drillhole WIPP 22 (Waste Isolation Pilot Plant, WIPP)
International Nuclear Information System (INIS)
1980-03-01
WIPP 22 is an exploratory borehole whose objective is to determine the nature of the near-surface formations after seismic information indicated a possible fault. The borehole is located in section 20, T.22S., R.31E., in eastern Eddy County, New Mexico, and was drilled between March 14 and 30, 1978. The hole was drilled to a depth of 1448 feet and encountered, from top to bottom, surficial Holocene deposits (6', including artificial fill for drill pad), the Mescalero caliche (7'), the Santa Rosa Sandstone (68'), the Dewey Lake Red Beds (492'), the Rustler Formation (311'), and the upper portion of the Salado Formation (565'). Cuttings were collected at 10-foot intervals. A suite of geophysical logs was run to measure acoustic velocities, density, and radioactivity. On the basis of comparison with other geologic sections drilled in the area, the WIPP 22 section is a normal stratigraphic sequence and it does not show structural disruption. The WIPP is to demonstrate (through limited operations) disposal technology for transuranic defense wastes. The WIPP will also provide facilities to research interactions between high-level waste and salt
DEFF Research Database (Denmark)
Getschman, A E; Imai, Y; Larsen, O
2017-01-01
signaling. When given in an IL-23-dependent mouse model for psoriasis, CCL20 S64C prevented psoriatic inflammation and the up-regulation of IL-17A and IL-22. Our results validate CCR6 as a tractable therapeutic target for psoriasis and demonstrate the value of CCL20 S64C as a lead compound....
Sound & Vibration 20 Design Guidelines for Health Care Facilities
Tocci, Gregory; Cavanaugh, William
2013-01-01
Sound, vibration, noise and privacy have significant impacts on health and performance. As a result, they are recognized as essential components of effective health care environments. However, acoustics has only recently become a prominent consideration in the design, construction, and operation of healthcare facilities owing to the absence, prior to 2010, of clear and objective guidance based on research and best practices. Sound & Vibration 2.0 is the first publication to comprehensively address this need. Sound & Vibration 2.0 is the sole reference standard for acoustics in health care facilities and is recognized by: the 2010 FGI Guidelines for the Design and Construction of Health Care Facilities (used in 60 countries); the US Green Building Council’s LEED for Health Care (used in 87 countries); The Green Guide for Health Care V2.2; and the International Code Council (2011). Sound & Vibration 2.0 was commissioned by the Facility Guidelines Institute in 2005, written by the Health Care Acous...
International Nuclear Information System (INIS)
Horton, D.G.; Johnson, V.G.
2000-01-01
Three new Resource Conservation and Recovery Act (RCRA) groundwater monitoring wells were installed at the single-shell tank farm Waste Management Area (WMA) S-SX in October 1999 through February 2000 in fulfillment of Tri-Party Agreement (Ecology 1996) milestone M-24-41. The wells are 299-W22-48, 299-W22-49, and 299-W22-50. Well 299-W22-48 is located east of the southeast corner of 241-S tank farm and is a new downgradient well in the monitoring network. Well 299-W22-49 is located on the east side of the 241-SX tank farm, adjacent to well 299-W22-39, which it replaces in the monitoring network. Well 299-W22-50 is located at the southeast corner of the 241-SX tank farm and is a replacement for downgradient monitoring well 299-W22-46, which is going dry. The original assessment monitoring plan for WMA S-SX was issued in 1996 (Caggiano 1996). That plan was updated for the continued assessment at WMA S-SX in 1999 (Johnson and Chou 1999). The updated plan provides justification for the new wells. The new wells were constructed to the specifications and requirements described in Washington Administrative Code (WAC) 173-160 and WAC 173-303, the updated assessment plan for WMA S-SX (Johnson and Chou 1999), and the description of work for well drilling and construction. This document compiles information on the drilling and construction, well development, pump installation, and sediment and groundwater sampling applicable to the installation of wells 299-W22-48, 299-W22-49 and 299-W22-50. Appendix A contains the Well Summary Sheets (as-built diagrams), the Well Construction Summary Reports, and the geologist's logs. Appendix B contains results of laboratory analyses of the physical properties of sediment samples obtained during drilling. Appendix C contains borehole geophysical logs, and Appendix D contains the analytical results from groundwater samples obtained during well drilling and construction
Energy Technology Data Exchange (ETDEWEB)
DG Horton; VG Johnson
2000-05-18
Three new Resource Conservation and Recovery Act (RCRA) groundwater monitoring wells were installed at the single-shell tank farm Waste Management Area (WMA) S-SX in October 1999 through February 2000 in fulfillment of Tri-Party Agreement (Ecology 1996) milestone M-24-41. The wells are 299-W22-48, 299-W22-49, and 299-W22-50. Well 299-W22-48 is located east of the southeast corner of 241-S tank farm and is a new downgradient well in the monitoring network. Well 299-W22-49 is located on the east side of the 241-SX tank farm, adjacent to well 299-W22-39, which it replaces in the monitoring network. Well 299-W22-50 is located at the southeast corner of the 241-SX tank farm and is a replacement for downgradient monitoring well 299-W22-46, which is going dry. The original assessment monitoring plan for WMA S-SX was issued in 1996 (Caggiano 1996). That plan was updated for the continued assessment at WMA S-SX in 1999 (Johnson and Chou 1999). The updated plan provides justification for the new wells. The new wells were constructed to the specifications and requirements described in Washington Administrative Code (WAC) 173-160 and WAC 173-303, the updated assessment plan for WMA S-SX (Johnson and Chou 1999), and the description of work for well drilling and construction. This document compiles information on the drilling and construction, well development, pump installation, and sediment and groundwater sampling applicable to the installation of wells 299-W22-48, 299-W22-49 and 299-W22-50. Appendix A contains the Well Summary Sheets (as-built diagrams), the Well Construction Summary Reports, and the geologist's logs. Appendix B contains results of laboratory analyses of the physical properties of sediment samples obtained during drilling. Appendix C contains borehole geophysical logs, and Appendix D contains the analytical results from groundwater samples obtained during well drilling and construction.
Toscano, M J; Booth, F; Wilkins, L J; Avery, N C; Brown, S B; Richards, G; Tarlton, J F
2015-05-01
Keel fractures in the laying hen are the most critical animal welfare issue facing the egg production industry, particularly with the increased use of extensive systems in response to the 2012 EU directive banning conventional battery cages. The current study is aimed at assessing the effects of 2 omega-3 (n3) enhanced diets on bone health, production endpoints, and behavior in free-range laying hens. Data was collected from 2 experiments over 2 laying cycles, each of which compared a (n3) supplemented diet with a control diet. Experiment 1 employed a diet supplemented with a 60:40 fish oil-linseed mixture (n3:n6 to 1.35) compared with a control diet (n3:n6 to 0.11), whereas the n3 diet in Experiment 2 was supplemented with a 40:60 fish oil-linseed (n3:n6 to 0.77) compared to the control diet (n3:n6 to 0.11). The n3 enhanced diet of Experiment 1 had a higher n3:n6 ratio, and a greater proportion of n3 in the long chain (C20/22) form (0.41 LC:SC) than that of Experiment 2 (0.12 LC:SC). Although dietary treatment was successful in reducing the frequency of fractures by approximately 27% in Experiment 2, data from Experiment 1 indicated the diet actually induced a greater likelihood of fracture (odds ratio: 1.2) and had substantial production detriment. Reduced keel breakage during Experiment 2 could be related to changes in bone health as n3-supplemented birds demonstrated greater load at failure of the keel, and tibiae and humeri that were more flexible. These results support previous findings that n3-supplemented diets can reduce fracture likely by increasing bone strength, and that this can be achieved without detriment to production. However, our findings suggest diets with excessive quantities of n3, or very high levels of C20/22, may experience health and production detriments. Further research is needed to optimize the quantity and type of n3 in terms of bone health and production variables and investigate the potential associated mechanisms. © 2015
Properties of Lithium-11 and Carbon-22 at leading order in halo effective field theory
Directory of Open Access Journals (Sweden)
Acharya Bijaya
2016-01-01
Full Text Available We study the 11Li and 22C nuclei at leading order (LO in halo effective field theory (Halo EFT. Using the value of the 22C rms matter radius deduced in Ref. [1] as an input in a LO calculation, we simultaneously constrain the values of the two-neutron (2n separation energy of 22C and the virtual-state energy of the 20C−neutron system (hereafter denoted 21C. The 1−σ uncertainty of the input rms matter radius datum, along with the theory error estimated from the anticipated size of the higher-order terms in the Halo EFT expansion, gives an upper bound of about 100 keV for the 2n separation energy. We also study the electric dipole excitation of 2n halo nuclei to a continuum state of two neutrons and the core at LO in Halo EFT. We first compare our results with the 11Li data from a Coulomb dissociation experiment and obtain good agreement within the theoretical uncertainty of a LO calculation. We then obtain the low-energy spectrum of B(E1 of this transition at several different values of the 2n separation energy of 22C and the virtual-state energy of 21C. Our predictions can be compared to the outcome of an ongoing experiment on the Coulomb dissociation of 22C to obtain tighter constraints on the two- and three-body energies in the 22C system.
Peripheral myelin protein 22 alters membrane architecture
Mittendorf, Kathleen F.; Marinko, Justin T.; Hampton, Cheri M.; Ke, Zunlong; Hadziselimovic, Arina; Schlebach, Jonathan P.; Law, Cheryl L.; Li, Jun; Wright, Elizabeth R.; Sanders, Charles R.; Ohi, Melanie D.
2017-01-01
Peripheral myelin protein 22 (PMP22) is highly expressed in myelinating Schwann cells of the peripheral nervous system. PMP22 genetic alterations cause the most common forms of Charcot-Marie-Tooth disease (CMTD), which is characterized by severe dysmyelination in the peripheral nerves. However, the functions of PMP22 in Schwann cell membranes remain unclear. We demonstrate that reconstitution of purified PMP22 into lipid vesicles results in the formation of compressed and cylindrically wrapped protein-lipid vesicles that share common organizational traits with compact myelin of peripheral nerves in vivo. The formation of these myelin-like assemblies depends on the lipid-to-PMP22 ratio, as well as on the PMP22 extracellular loops. Formation of the myelin-like assemblies is disrupted by a CMTD-causing mutation. This study provides both a biochemical assay for PMP22 function and evidence that PMP22 directly contributes to membrane organization in compact myelin. PMID:28695207
Benign chronic neutropenia with abnormalities involving 16q22, affecting mother and daughter.
Glasser, Lewis; Meloni-Ehrig, Aurelia; Joseph, Plakyil; Mendiola, Jennifer
2006-04-01
We report a case of familial, chronic, benign neutropenia in a 17-year-old female showing (1) the spontaneous expression of a heritable rare fragile site at 16q22 and (2) a deletion at the same region. The del(16)(q22), which most likely originated from the fragile site, was the main clonal abnormality detected in the patient's bone marrow cells, whereas a few cells with either del(16)(q22) or fra(16)(q22) were seen in the patient's peripheral blood. Interestingly, the del(16q) was also detected in the patient's uncultured cells, as demonstrated by FISH, excluding an in vitro origin of the del(16q) during culture. The bone marrow was hypocellular with decreased neutrophils and their precursors. Absolute neutrophil counts ranged from (0.62 to 1.24) x 10(9)/L with a median value of 1.02 x 10(9)/L. The patient had a more severe neutropenia than her mother, which correlated with the presence of more cells with del(16q) in the marrow. The patient's mother, who was also diagnosed with neutropenia, revealed only a few cells with the rare fra(16)(q22) in her peripheral blood cells, whereas her bone marrow showed cells with both fra(16)(q22) and del(16)(q22), although the del(16q) was present in only 2/20 cells. Some possible candidate genes contributing to the pathogenesis of the neutropenia are discussed. Chromosome abnormalities involving the 16q22 breakpoint have been observed in myelodysplastic syndrome (MDS) and acute myeloid leukemia (AML). In this patient, the del(16)(q22) risk factor is unknown for subsequent development of MDS or AML. Another point to consider is the need to determine the origin of a chromosome abnormality, particularly when the clinical picture does not fit the chromosome findings. Although, the observation of a constitutional structural abnormality in a mosaic form is an extremely rare event, it is somewhat different in the case of a fragile site expression, which can, as in this case, be present in some cells and not in others. Copyright 2006
47 CFR 22.880 - Information exchange.
2010-10-01
... 47 Telecommunication 2 2010-10-01 2010-10-01 false Information exchange. 22.880 Section 22.880 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES PUBLIC MOBILE SERVICES Air-Ground Radiotelephone Service Commercial Aviation Air-Ground Systems § 22.880 Information exchange. (a...
47 CFR 22.973 - Information exchange.
2010-10-01
... 47 Telecommunication 2 2010-10-01 2010-10-01 false Information exchange. 22.973 Section 22.973 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES PUBLIC MOBILE SERVICES Cellular Radiotelephone Service § 22.973 Information exchange. (a) Prior notification. Public safety/CII...
Berliner, Jonathan L; Verma, Kushagra; Lonner, Baron S; Penn, Phedra U; Bharucha, Neil J
2013-02-01
Previous studies of the Scoliosis Research Society (SRS) 22 discriminative validity have lacked sufficiently matched study groups and were limited to a comparison with three or fewer subgroups of disease severity. To evaluate the discriminative validity of SRS-22 by assessing the questionnaire's ability to discriminate among five groups of pretreatment adolescent idiopathic scoliosis (AIS) patients with increasing curve severity. Retrospective review of prospectively administered surveys. Two hundred eighty-six SRS-22 questionnaires were issued to two AIS pretreatment patient populations: 67 nonoperative and 219 preoperative. Study subjects were separated into five subgroups depending on the major Cobb angle (nonoperative 0°-19° and 20°-40° and preoperative 41°-50°, 51°-60°, and >60°). Each group (n=31) was matched for age (within 1 year) and sex (23 females and 8 males), resulting in a total of 155 study subjects. Analysis of variance was used to determine statistically significant differences (pself-image than all three preoperative groups. Both nonoperative groups' total scores were significantly higher than all three preoperative groups' scores, with the exception of the 20° to 40° subgroup versus the >60° subgroup. No significant differences were found between groups within the same planned treatment category. The SRS-22 questionnaire demonstrated good discriminative validity between small nonoperative curves and larger surgical curves within the pain, image, and total domains. However, SRS-22 lacked the ability to differentiate between small intervals of curve magnitude, suggesting a limitation to the questionnaire's discriminative capacity. The discriminative validity of the Scoliosis Research Society (SRS) 22 has not been clearly defined. Our analysis of 155 adolescent idiopathic scoliosis patients evaluates the instrument's discriminative validity among five age- and sex-matched curve-severity subgroups. The SRS-22 questionnaire lacked the
30 CFR 725.22 - Financial management.
2010-07-01
.... An agency shall use generally accepted accounting principles and practices, consistently applied... 30 Mineral Resources 3 2010-07-01 2010-07-01 false Financial management. 725.22 Section 725.22... PROGRAM REGULATIONS REIMBURSEMENTS TO STATES § 725.22 Financial management. (a) The agency shall account...
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Trade demand. 984.22 Section 984.22 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... Regulating Handling Definitions § 984.22 Trade demand. (a) Inshell. The quantity of merchantable inshell...
Directory of Open Access Journals (Sweden)
Donnici Claudio Luis
1998-01-01
Full Text Available The preparation of key precursors for many 2,2?-bipyridine derivatives such as 4,4?-dicarboxy- 2,2?-bipyridine (I, 6,6?-dicarboxy-2,2?-bipyridine- acid (II, 4,4?-dinitro-2,2?-bipyridine-N,N-dioxide (III, 6,6?-dicarbothioamide-2,2?-bipyridine (IV and mono-N-oxide-2,2?-bipyridine (VII through more efficient methods is described. The syntheses of the novel ligands 4,4?-dihydroxamic-2,2?-bipyridine (V and 6,6?-dihydroxamic-2,2?-bipyridine (VI are also reported.
20 CFR 320.22 - Notice of hearing.
2010-04-01
... of the specific issues involved in the case. The hearings officer shall make every effort to hold the... no event shall said notice be filed later than five business days prior to the scheduled date of the... good cause shown, or upon his or her own motion, reschedule the time and/or place of the hearing. If an...
20 CFR 617.22 - Approval of training.
2010-04-01
.... Perkins Vocational and Applied Technology Education Act, and employers). (i) This means that training is...) Conditions for approval. Training shall be approved for an adversely affected worker if the State agency...) available for an adversely affected worker. (i) This means that for the worker for whom approval of training...
1 CFR 22.2 - Authority citation.
2010-01-01
... 1 General Provisions 1 2010-01-01 2010-01-01 false Authority citation. 22.2 Section 22.2 General Provisions ADMINISTRATIVE COMMITTEE OF THE FEDERAL REGISTER PREPARATION, TRANSMITTAL, AND PROCESSING OF DOCUMENTS PREPARATION OF NOTICES AND PROPOSED RULES Notices § 22.2 Authority citation. The authority under...
47 CFR 22.909 - Cellular markets.
2010-10-01
... 47 Telecommunication 2 2010-10-01 2010-10-01 false Cellular markets. 22.909 Section 22.909... Cellular Radiotelephone Service § 22.909 Cellular markets. Cellular markets are standard geographic areas used by the FCC for administrative convenience in the licensing of cellular systems. Cellular markets...
Interleukin-22 predicts severity and death in advanced liver cirrhosis: a prospective cohort study
Directory of Open Access Journals (Sweden)
Kronenberger Bernd
2012-09-01
Full Text Available Abstract Background Interleukin-22 (IL-22, recently identified as a crucial parameter of pathology in experimental liver damage, may determine survival in clinical end-stage liver disease. Systematic analysis of serum IL-22 in relation to morbidity and mortality of patients with advanced liver cirrhosis has not been performed so far. Methods This is a prospective cohort study including 120 liver cirrhosis patients and 40 healthy donors to analyze systemic levels of IL-22 in relation to survival and hepatic complications. Results A total of 71% of patients displayed liver cirrhosis-related complications at study inclusion. A total of 23% of the patients died during a mean follow-up of 196 ± 165 days. Systemic IL-22 was detectable in 74% of patients but only in 10% of healthy donors (P P = 0.006, hepatorenal syndrome (P P = 0.001. Patients with elevated IL-22 (>18 pg/ml, n = 57 showed significantly reduced survival compared to patients with regular (≤18 pg/ml levels of IL-22 (321 days versus 526 days, P = 0.003. Other factors associated with reduced overall survival were high CRP (≥2.9 mg/dl, P = 0.005, hazard ratio (HR 0.314, confidence interval (CI (0.141 to 0.702, elevated serum creatinine (P = 0.05, HR 0.453, CI (0.203 to 1.012, presence of liver-related complications (P = 0.028, HR 0.258, CI (0.077 to 0.862, model of end stage liver disease (MELD score ≥20 (P = 0.017, HR 0.364, CI (0.159 to 0.835 and age (P = 0.011, HR 0.955, CI (0.922 to 0.989. Adjusted multivariate Cox proportional-hazards analysis identified elevated systemic IL-22 levels as independent predictors of reduced survival (P = 0.007, HR 0.218, CI (0.072 to 0.662. Conclusions In patients with liver cirrhosis, elevated systemic IL-22 levels are predictive for reduced survival independently from age, liver-related complications, CRP, creatinine and the MELD score. Thus, processes that lead to a rise in systemic interleukin-22 may be relevant for prognosis of advanced liver
Medical Surveillance Monthly Report (MSMR). Volume 20, Number 2, February 2013
2013-02-01
transmitted diseases (STDs) syphilis and gonorrhea had to be broadened to include Chlamydia trachomatis (CT) and human papillomavi- rus (HPV) infections...last remaining class of eff ective antimicrobials and the only antibiotics recommended for gonorrhea treatment, have been reported in Asia and...654. Accessed: 20 February 2012 22. Kirkcaldy RD, Bolan GA, Wasserheit JN. Cephalosporin-resistant gonorrhea in North America. JAMA. 2013;309:185
49 CFR 173.115 - Class 2, Divisions 2.1, 2.2, and 2.3-Definitions.
2010-10-01
... substances of Class 8, PG I are forbidden from transportation in an aerosol container. (7) Flammable... 2.1, 2.2, and 2.3—Definitions. (a) Division 2.1 (Flammable gas). For the purpose of this subchapter, a flammable gas (Division 2.1) means any material which is a gas at 20 °C (68 °F) or less and 101.3...
International Nuclear Information System (INIS)
Nabais, Catarina; Schneider, Raphaël; Willmann, Patrick; Billaud, Denis
2012-01-01
Highlights: ► 2,2′-bipyridine capped Sn nanoparticles as anode materials for Li-ion batteries. ► High dispersion of Sn nanoparticles at the surface of the graphite matrix. ► The introduction of 2,2′-bipyridine improves the capacity and cycling stability. ► A stable reversible capacity of ca. 480 mA h g −1 after 20 cycles was observed. - Abstract: Monodisperse and small tin nanoparticles were prepared from a 2,2′-bipyridine–tin(+2) chloride complex using sodium borohydride as reducing agent. When the synthesis was conducted in the presence of graphite, Sn particles with an average diameter of ca. 29 nm well-dispersed at the surface of graphite were obtained. Electrochemical lithium insertion was carried out in these materials. A stable reversible capacity of ca. 480 mA h g −1 , value 37% higher than that of pure graphite, was found.
7 CFR 1218.22 - United States.
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false United States. 1218.22 Section 1218.22 Agriculture... INFORMATION ORDER Blueberry Promotion, Research, and Information Order Definitions § 1218.22 United States. United States means collectively the 50 states, the District of Columbia, the Commonwealth of Puerto Rico...
2010-10-01
... 49 Transportation 1 2010-10-01 2010-10-01 false Claim process. 22.69 Section 22.69 Transportation Office of the Secretary of Transportation SHORT-TERM LENDING PROGRAM (STLP) Loan Administration § 22.69 Claim process. After reasonable efforts have been exhausted to collect on a delinquent debt, the...
27 CFR 10.22 - Employee associations.
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Employee associations. 10.22 Section 10.22 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU, DEPARTMENT OF THE TREASURY LIQUORS COMMERCIAL BRIBERY Commercial Bribery § 10.22 Employee associations. Gifts...
DEFF Research Database (Denmark)
Kerr, DA; Antel, JP; Arnold, DL
2007-01-01
On July 20-22nd 2006, the second International Rare Neuroimmunologic Disorders Symposium was held in Baltimore, Maryland. The purpose of this symposium was to bring together diverse groups interested in immune-mediated disorders of the nervous system. The symposium was not disease-specific but at...
2010-10-01
... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false Civil rights. 401.22 Section 401.22..., DEVELOPMENT AND ENHANCEMENT § 401.22 Civil rights. Each application for Federal assistance, grant-in-aid award... Assisted Programs of the Civil Rights Act of 1964 and with the Secretary's regulations promulgated...
45 CFR 605.22 - Existing facilities.
2010-10-01
... 45 Public Welfare 3 2010-10-01 2010-10-01 false Existing facilities. 605.22 Section 605.22 Public... Accessibility § 605.22 Existing facilities. (a) Accessibility. A recipient shall operate each program or... existing facilities or every part of a facility accessible to and usable by qualified handicapped persons...
45 CFR 1151.22 - Existing facilities.
2010-10-01
... 45 Public Welfare 3 2010-10-01 2010-10-01 false Existing facilities. 1151.22 Section 1151.22... Prohibited Accessibility § 1151.22 Existing facilities. (a) A recipient shall operate each program or... make each of its existing facilities or every part of a facility accessible to and usable by...
30 CFR 282.22 - Delineation Plan.
2010-07-01
... 30 Mineral Resources 2 2010-07-01 2010-07-01 false Delineation Plan. 282.22 Section 282.22 Mineral... § 282.22 Delineation Plan. All exploration activities shall be conducted in accordance with a Delineation Plan submitted by the lessee and approved by the Director. The Delineation Plan shall describe the...
2010-04-01
... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Housing plans. 81.22 Section 81.22 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development THE... LOAN MORTGAGE CORPORATION (FREDDIE MAC) Housing Goals § 81.22 Housing plans. (a) If the Secretary...
2010-01-01
... 7 Agriculture 7 2010-01-01 2010-01-01 false Loan closing. 774.22 Section 774.22 Agriculture... SPECIAL PROGRAMS EMERGENCY LOAN FOR SEED PRODUCERS PROGRAM § 774.22 Loan closing. (a) Conditions. The applicant must meet all conditions specified by the loan approval official in the notification of loan...
7 CFR 1735.22 - Loan security.
2010-01-01
... 7 Agriculture 11 2010-01-01 2010-01-01 false Loan security. 1735.22 Section 1735.22 Agriculture... GENERAL POLICIES, TYPES OF LOANS, LOAN REQUIREMENTS-TELECOMMUNICATIONS PROGRAM Loan Purposes and Basic Policies § 1735.22 Loan security. (a) RUS makes loans only if, in the judgment of the Administrator, the...
7 CFR 1738.22 - Loan security.
2010-01-01
... 7 Agriculture 11 2010-01-01 2010-01-01 false Loan security. 1738.22 Section 1738.22 Agriculture... RURAL BROADBAND ACCESS LOANS AND LOAN GUARANTEES Loan Purposes and Basic Policies § 1738.22 Loan security. (a) RUS makes loans only if, in the judgment of the Administrator, the security therefore is...
Weisman, O; Feldman, R; Burg-Malki, M; Keren, M; Geva, R; Diesendruck, G; Gothelf, D
2017-12-01
Numerous studies have assessed the socio-cognitive profile in Williams syndrome (WS) and, independently, in 22q11.2 deletion syndrome (22q11.2DS). Yet, a cross-syndrome comparison of these abilities between individuals with these two syndromes with known social deficits has not been conducted. Eighty-two children participated in four study groups: WS (n = 18), 22q112.DS (n = 24), age-matched individuals with idiopathic developmental disability (IDD; n = 20) and typically developing (TD) controls (n = 20). Participants completed four socio-cognitive tests: facial emotion recognition, mental state attribution, differentiating real from apparent emotions and trait inference based on motives and actions-outcomes. The current findings demonstrate that children with WS were better in labelling happy faces compared with children with 22q11.2DS, partially reflecting their exaggerated social drive. In the false belief task, however, the WS and IDD groups performed poorly compared with the 22q11.2DS group, possibly due to their difficulty to interpret subtle social cues. When asked to identify the gap between real-negative vs. apparent-positive emotions, the 22q11.2DS group performed similarly to TD children but better than the WS group, possibly due to their anxious personality and their innate bias towards negatively valence cues. Finally, individuals with WS were more willing to become friends with a story character even when the character's motives were negative, reflecting their difficulty to avoid potentially harmful real-life situations. Overall, our multi-facet socio-cognitive battery uncovered strengths and weaknesses in social cognition that are syndrome-specific, shared among the genetic syndromes, or common to the three clinical groups compared with healthy controls. Our findings underscore the need to devise age-specific and condition-specific assessment tools and intervention programs towards improving these children's socio-cognitive deficits. © 2017
34 CFR 104.22 - Existing facilities.
2010-07-01
... 34 Education 1 2010-07-01 2010-07-01 false Existing facilities. 104.22 Section 104.22 Education... Accessibility § 104.22 Existing facilities. (a) Accessibility. A recipient shall operate its program or activity.... This paragraph does not require a recipient to make each of its existing facilities or every part of a...
2010-07-01
... 31 Money and Finance: Treasury 1 2010-07-01 2010-07-01 false Legal review. 3.22 Section 3.22 Money and Finance: Treasury Office of the Secretary of the Treasury CLAIMS REGULATIONS AND INDEMNIFICATION OF DEPARTMENT OF TREASURY EMPLOYEES Claims Under the Small Claims Act § 3.22 Legal review. Claims...
12 CFR 404.22 - Government contracts.
2010-01-01
... 12 Banks and Banking 4 2010-01-01 2010-01-01 false Government contracts. 404.22 Section 404.22 Banks and Banking EXPORT-IMPORT BANK OF THE UNITED STATES INFORMATION DISCLOSURE Access to Records Under the Privacy Act of 1974 § 404.22 Government contracts. (a) Approval by Assistant General Counsel for...
7 CFR 1955.22 - State supplements.
2010-01-01
... 7 Agriculture 14 2010-01-01 2009-01-01 true State supplements. 1955.22 Section 1955.22 Agriculture... Real and Chattel Property § 1955.22 State supplements. State Supplements will be prepared with the... supplements will be submitted to the National Office for post approval in accordance with FmHA or its...
12 CFR 1282.22 - Housing plans.
2010-01-01
... 12 Banks and Banking 7 2010-01-01 2010-01-01 false Housing plans. 1282.22 Section 1282.22 Banks and Banking FEDERAL HOUSING FINANCE AGENCY HOUSING GOALS AND MISSION ENTERPRISE HOUSING GOALS AND MISSION Housing Goals § 1282.22 Housing plans. (a) If the Director determines, under § 1282.21, that an...
40 CFR 209.22 - Other discovery.
2010-07-01
... PRACTICE GOVERNING PROCEEDINGS UNDER THE NOISE CONTROL ACT OF 1972 Rules of Practice Governing Hearings for Orders Issued Under Section 11(d) of the Noise Control Act § 209.22 Other discovery. (a) Further... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Other discovery. 209.22 Section 209.22...
28 CFR 104.22 - Advance Benefits.
2010-07-01
... 28 Judicial Administration 2 2010-07-01 2010-07-01 false Advance Benefits. 104.22 Section 104.22... Filing for Compensation; Application for Advance Benefits § 104.22 Advance Benefits. (a) Advance Benefits. Eligible Claimants may apply for immediate “Advance Benefits” in a fixed amount as follows: (1) $50,000 for...
21 CFR 820.22 - Quality audit.
2010-04-01
... 21 Food and Drugs 8 2010-04-01 2010-04-01 false Quality audit. 820.22 Section 820.22 Food and... QUALITY SYSTEM REGULATION Quality System Requirements § 820.22 Quality audit. Each manufacturer shall establish procedures for quality audits and conduct such audits to assure that the quality system is in...
International Nuclear Information System (INIS)
Hubert, F.; Dufour, J.P.; Del Moral, R.; Fleury, A.; Jean, D.; Pravikoff, M.S.; Geissel, H.; Schmidt, K.H.; Hanelt, E.
1989-01-01
The study of light nuclei far from stability has been recently renewed by the possibility of production through the projectile fragmentation of intermediate energy heavy ion beams at GANIL. The results presented here have been obtained with the Projectile Fragments Isotopic Separation method developed at the LISE spectrometer. 22 O is a Tz = 3 nucleus and is the first in a series of seven such nuclei in the sd shell extending from 22 O to 24 Mg. Although the half life of 22 O was previously measured by Murphy et al., the present study is the first beta-gamma spectroscopy on this neutron rich nucleus. Five gamma lines have been attributed to the β decay of 22 O with a measured half life of T = (2.25±0.15)s and a partial decay scheme has been established
Directory of Open Access Journals (Sweden)
Rhea U. Vallente-Samonte
2000-09-01
Full Text Available Homologies between chromosome banding patterns and DNA sequences in the great apes and humans suggest an apparent common origin for these two lineages. The availability of DNA probes for specific regions of human chromosomes (5q31, 10q22, 13q32-33 and 19q13.1 led us to cross-hybridize these to chimpanzee (Pan troglodytes, PTR, gorilla (Gorilla gorilla, GGO and orangutan (Pongo pygmaeus, PPY chromosomes in a search for equivalent regions in the great apes. Positive hybridization signals to the chromosome 5q31-specific DNA probe were observed at HSA 5q31, PTR 4q31, GGO 4q31 and PPY 4q31, while fluorescent signals using the chromosome 10q22-specific DNA probe were noted at HSA 10q22, PTR 8q22, GGO 8q22 and PPY 7q22. The chromosome arms showing hybridization signals to the Quint-EssentialTM 13-specific DNA probe were identified as HSA 13q32-33, PTR 14q32-33, GGO 14q32-33 and PPY 14q32-33, while those presenting hybridization signals to the chromosome 19q13.1-specific DNA probe were identified as HSA 19q13.1, PTR 20q13, GGO 20q13 and PPY 20q13. All four probes presumably hybridized to homologous chromosomal locations in the apes, which suggests a homology of certain unique DNA sequences among hominoid species.Homologias entre os padrões de bandamento de cromossomos e seqüências de DNA em grandes macacos e humanos sugerem uma aparente origem comum para estas duas linhagens. A disponibilidade de sondas de DNA para regiões específicas de cromossomos humanos (5q31, 10q22, 13q32-33 e 19q13.1 nos levou a realizar hibridação cruzada com cromossomos de chimpanzé (Pan troglodytes, PTR, gorila (Gorilla gorilla, GGO e orangotango (Pongo pygmaeus, PPY em um pesquisa de regiões equivalentes em grandes macacos. Sinais positivos de hibridação para a sonda de DNA específica para o cromossomo 5q31 foram observados em HSA 5q31, PTR 4q31, GGO 4q31 e PPY 4q31, enquanto que sinais fluorescentes usando a sonda de DNA específica para o cromossomo 10q22 foram
Passive Corrosion Behavior of Alloy 22
International Nuclear Information System (INIS)
R.B. Rebak; J.H. Payer
2006-01-01
Alloy 22 (NO6022) was designed to stand the most aggressive industrial applications, including both reducing and oxidizing acids. Even in the most aggressive environments, if the temperature is lower than 150 F (66 C) Alloy 22 would remain in the passive state having particularly low corrosion rates. In multi-ionic solutions that may simulate the behavior of concentrated ground water, even at near boiling temperatures, the corrosion rate of Alloy 22 is only a few nano-meters per year because the alloy is in the complete passive state. The corrosion rate of passive Alloy 22 decreases as the time increases. Immersion corrosion testing also show that the newer generation of Ni-Cr-Mo alloys may offer a better corrosion resistance than Alloy 22 only in some highly aggressive conditions such as in hot acids
Sa, Susan M; Valdez, Patricia A; Wu, Jianfeng; Jung, Kenneth; Zhong, Fiona; Hall, Linda; Kasman, Ian; Winer, Jane; Modrusan, Zora; Danilenko, Dimitry M; Ouyang, Wenjun
2007-02-15
IL-19, IL-20, IL-22, IL-24, and IL-26 are members of the IL-10 family of cytokines that have been shown to be up-regulated in psoriatic skin. Contrary to IL-10, these cytokines signal using receptor complex R1 subunits that are preferentially expressed on cells of epithelial origin; thus, we henceforth refer to them as the IL-20 subfamily cytokines. In this study, we show that primary human keratinocytes (KCs) express receptors for these cytokines and that IL-19, IL-20, IL-22, and IL-24 induce acanthosis in reconstituted human epidermis (RHE) in a dose-dependent manner. These cytokines also induce expression of the psoriasis-associated protein S100A7 and keratin 16 in RHE and cause persistent activation of Stat3 with nuclear localization. IL-22 had the most pronounced effects on KC proliferation and on the differentiation of KCs in RHE, inducing a decrease in the granular cell layer (hypogranulosis). Furthermore, gene expression analysis performed on cultured RHE treated with these cytokines showed that IL-19, IL-20, IL-22, and IL-24 regulate many of these same genes to variable degrees, inducing a gene expression profile consistent with inflammatory responses, wound healing re-epithelialization, and altered differentiation. Many of these genes have also been found to be up-regulated in psoriatic skin, including several chemokines, beta-defensins, S100 family proteins, and kallikreins. These results confirm that IL-20 subfamily cytokines are important regulators of epidermal KC biology with potentially pivotal roles in the immunopathology of psoriasis.
Anodic behavior of alloy 22 in bicarbonate containing media: Effect of alloying
International Nuclear Information System (INIS)
Zadorozne, N S; Giordano, C M; Rebak, R B; Ares, A E; Carranza, R M
2012-01-01
Alloy 22 is one of the candidates for the manufacture of high level nuclear waste containers. These containers provide services in natural environments characterized by multi-ionic solutions.It is estimated they could suffer three types of deterioration: general corrosion, localized corrosion (specifically crevice corrosion) and stress corrosion cracking (SCC). It has been confirmed that the presence of bicarbonate and chloride ions is necessary to produce cracking, . It has also been determined that the susceptibility to SCC could be related to the occurrence of an anodic peak in the polarization curves in these media at potentials below transpassivity. The aim of this work is to study the effect of alloying elements on the anodic behavior of Alloy 22 in media containing bicarbonate and chloride ions at different concentrations and temperatures. Polarization curves were made on alloy 22 (Ni-22% Cr-13% Mo), Ni-Mo (Ni-28, 5% Mo) and Ni-Cr (Ni-20% Cr) in the following solutions: 1 mol/L NaCl at 90 o C, and 1.148 mol/L NaHCO 3 ; 1.148 mol/L NaHCO 3 + 1 mol/L NaCl; 1.148 mol/L NaHCO 3 + 0.1 mol/L NaCl, at 90 o C, 75 o C, 60 o C and 25 o C. It was found that alloy 22 has a anodic current density peak at potentials below transpassivity, only in the presence of bicarbonate ions. Curves performed in 1 mol/L NaCl did not show any anodic peak, in any of the tested alloys. The curves made on alloys Ni-Mo and Ni-Cr in the presence of bicarbonate ions, allowed to determine that Cr, is responsible for the appearance of the anodic peak in alloy 22. The curves of alloy Ni-Mo showed no anodic peak in the studied conditions. The potential at which the anodic peak appears in alloy 22 and Ni-Cr alloy, increases with decreasing temperature. The anodic peak was also affected by solution composition. When chloride ion is added to bicarbonate solutions, the anodic peak is shifted to higher potential and current densities, depending on the concentration of added chloride ions (author)
Directory of Open Access Journals (Sweden)
A.R. Fernandes
2017-12-01
Full Text Available The reduction of the particle size of drugs of pharmaceutical interest down to the nano-sized range has dramatically changed their physicochemical properties. The greatest disadvantage of nanocrystals is their inherent instability, due to the risk of crystal growth. Thus, the selection of an appropriate stabilizer is crucial to obtain long-term physicochemically stable nanocrystals. High pressure homogenization has enormous advantages, including the possibility of scaling up, lack of organic solvents and the production of small particles diameter with low polydispersity index. The sequential use of high shear homogenization followed by high pressure homogenization, can modulate nanoparticles’ size for different administration routes. The present study focuses on the optimization of the production process of two formulations composed of different surfactants produced by High Shear Homogenization followed by hot High Pressure Homogenization. To build up the surface response charts, a 22 full factorial design experiment, based on 2 independent variables, was used to develop optimized formulations. The effects of the production process on the mean particle size and polydispersity index were evaluated. The best ibuprofen nanocrystal formulations were obtained using 0.20% Tween 80 and 1.20% PVP K30 (F1 and 0.20% Tween 80 and 1.20% Span 80 (F2. The estimation of the long-term stability of the aqueous suspensions of ibuprofen nanocrystals was studied using the LUMISizer. The calculated instability index suggests that F1 was more stable when stored at 4 °C and 22 °C, whereas F2 was shown to be more stable when freshly prepared.
10 CFR 75.22 - Accounting records.
2010-01-01
... 10 Energy 2 2010-01-01 2010-01-01 false Accounting records. 75.22 Section 75.22 Energy NUCLEAR... Accounting and Control for Facilities § 75.22 Accounting records. (a) The accounting records required by § 75... determination of the book inventory at any time; (2) All measurement results that are used for determination of...
2010-01-01
... 16 Commercial Practices 1 2010-01-01 2010-01-01 false Tax claims. 460.22 Section 460.22 Commercial Practices FEDERAL TRADE COMMISSION TRADE REGULATION RULES LABELING AND ADVERTISING OF HOME INSULATION § 460.22 Tax claims. Do not say or imply that your product qualifies for a tax benefit unless it is true. ...
32 CFR 518.22 - Reports control.
2010-07-01
... 32 National Defense 3 2010-07-01 2010-07-01 true Reports control. 518.22 Section 518.22 National... RELATIONS THE FREEDOM OF INFORMATION ACT PROGRAM Reports § 518.22 Reports control. (a) General. (1) The... requirement outlined is assigned Report Control Symbol DD-DA&M(A)1365, FOIA Report to Congress. (b) Reporting...
49 CFR 1018.22 - Personal interviews.
2010-10-01
... 49 Transportation 8 2010-10-01 2010-10-01 false Personal interviews. 1018.22 Section 1018.22... § 1018.22 Personal interviews. (a) The Board may seek an interview with the debtor at the offices of the... grant an interview with a debtor upon the debtor's request. The Board will not reimburse a debtor's...
The 20-20-20 Airships NASA Centennial Challenge
Kiessling, Alina; Diaz, Ernesto; Rhodes, Jason; Ortega, Sam; Eberly, Eric
2015-08-01
A 2013 Keck Institute for Space Studies (KISS) study examined airships as a possible platform for Earth and space science. Airships, lighter than air, powered, maneuverable vehicles, could offer significant gains in observing time, sky and ground coverage, data downlink capability, and continuity of observations over existing suborbital options at competitive prices. The KISS study recommended three courses of action to spur the development and use of airships as a science platform. One of those recommendations was that a prize competition be developed to demonstrate a stratospheric airship. Consequently, we have been developing a NASA Centennial Challenge; (www.nasa.gov/challenges) to spur innovation in stratospheric airships as a science platform. We anticipate a multi-million dollar class prize for the first organization to fly a powered airship that remains stationary at 20km (65,000 ft) altitude for over 20 hours with a 20kg payload. The design must be scalable to longer flights with more massive payloads. A second prize tier, for a 20km flight lasting 200 hours with a 200kg payload would incentivize a further step toward a scientifically compelling and viable new platform. This technology would also have broad commercial applications including communications, asset tracking, and surveillance. Via the 20-20-20 Centennial Challenge, we are seeking to spur private industry (or non-profit institutions, including Universities) to demonstrate the capability for sustained airship flights as astronomy and Earth science platforms.
2010-07-01
... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Security. 1275.22 Section... THE NIXON ADMINISTRATION Preservation and Protection § 1275.22 Security. The Archivist is responsible for providing adequate security for the Presidential historical materials. ...
2010-01-01
... in the United States, including paid advertising, sales promotion, and publicity. Promotion... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1219.22 Section 1219.22 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE HASS AVOCADO PROMOTION, RESEARCH...
48 CFR 22.1402 - Applicability.
2010-10-01
... Section 22.1402 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SOCIOECONOMIC PROGRAMS APPLICATION OF LABOR LAWS TO GOVERNMENT ACQUISITIONS Employment of Workers with Disabilities 22... clause at 52.222-36, Affirmative Action for Workers with Disabilities, implements the Act. (b) The...
12 CFR 22.8 - Determination fees.
2010-01-01
... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Determination fees. 22.8 Section 22.8 Banks and... HAZARDS § 22.8 Determination fees. (a) General. Notwithstanding any Federal or State law other than the... home securing the loan is located or will be located in a special flood hazard area. A determination...
2010-01-01
... 12 Banks and Banking 3 2010-01-01 2010-01-01 false Lending test. 228.22 Section 228.22 Banks and... REINVESTMENT (REGULATION BB) Standards for Assessing Performance § 228.22 Lending test. (a) Scope of test. (1) The lending test evaluates a bank's record of helping to meet the credit needs of its assessment area...
Interleukin-22 Inhibits Bleomycin-Induced Pulmonary Fibrosis
Directory of Open Access Journals (Sweden)
Minrui Liang
2013-01-01
Full Text Available Pulmonary fibrosis is a progressive and fatal fibrotic disease of the lungs with unclear etiology. Recent insight has suggested that early injury/inflammation of alveolar epithelial cells could lead to dysregulation of tissue repair driven by multiple cytokines. Although dysregulation of interleukin- (IL- 22 is involved in various pulmonary pathophysiological processes, the role of IL-22 in fibrotic lung diseases is still unclear and needs to be further addressed. Here we investigated the effect of IL-22 on alveolar epithelial cells in the bleomycin- (BLM- induced pulmonary fibrosis. BLM-treated mice showed significantly decreased level of IL-22 in the lung. IL-22 produced γδT cells were also decreased significantly both in the tissues of lungs and spleens. Administration of recombinant human IL-22 to alveolar epithelial cell line A549 cells ameliorated epithelial to mesenchymal transition (EMT and partially reversed the impaired cell viability induced by BLM. Furthermore, blockage of IL-22 deteriorated pulmonary fibrosis, with elevated EMT marker (α-smooth muscle actin (α-SMA and overactivated Smad2. Our results indicate that IL-22 may play a protective role in the development of BLM-induced pulmonary fibrosis and may suggest IL-22 as a novel immunotherapy tool in treating pulmonary fibrosis.
2010-07-01
... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Appearances. 22.10 Section 22.10 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY GENERAL CONSOLIDATED RULES OF PRACTICE GOVERNING... and ethics required of practitioners before the courts of the United States. ...
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Policy. 22.1802 Section 22.1802 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SOCIOECONOMIC PROGRAMS...-Verify program provides an Internet-based means of verifying employment eligibility of workers employed...
Directory of Open Access Journals (Sweden)
Wei-Cheng Pan
2010-06-01
Full Text Available The title centrosymmetric coordination polymer, {[Cu(C22H20N2O6(H2O2]Br2}n, formed by the reaction of the flexible double betaine ligand 2,2′-{[p-phenylenebis(oxymethylene]bis(pyridine-3,1-diyl}diacetic acid with CuBr2, contains a Cu(II atom (overline1 symmetry which is surrounded by two water molecules and bridged by two anions in a square-planar coordination. In the crystal, polymeric zigzag chains are linked via O—H...Br interactions, forming a two-dimensional network extending parallel to (011.
2010-01-01
... Promotion. Promotion means any action, including but not limited to paid advertising and retail or food... 7 Agriculture 10 2010-01-01 2010-01-01 false Promotion. 1230.22 Section 1230.22 Agriculture... AND ORDERS; MISCELLANEOUS COMMODITIES), DEPARTMENT OF AGRICULTURE PORK PROMOTION, RESEARCH, AND...
48 CFR 22.603 - Applicability.
2010-10-01
... PROGRAMS APPLICATION OF LABOR LAWS TO GOVERNMENT ACQUISITIONS Walsh-Healey Public Contracts Act 22.603 Applicability. The requirements in 22.602 apply to contracts (including for this purpose, indefinite-delivery contracts, basic ordering agreements, and blanket purchase agreements) and subcontracts under Section 8(a...
2010-10-01
... 22.1403 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SOCIOECONOMIC PROGRAMS APPLICATION OF LABOR LAWS TO GOVERNMENT ACQUISITIONS Employment of Workers with Disabilities 22.1403 Waivers... the clause at 52.222-36, Affirmative Action for Workers with Disabilities, for— (1) Any contract if a...
48 CFR 22.1101 - Applicability.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Applicability. 22.1101 Section 22.1101 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SOCIOECONOMIC... their blue-collar service workers and some white-collar service workers fairly, but it does not cover...
Pulsed Nd:YAG laser welding of Cu54Ni6Zr22Ti18 bulk metallic glass
International Nuclear Information System (INIS)
Kim, Jong Hyun; Lee, Changhee; Lee, D.M.; Sun, J.H.; Shin, S.Y.; Bae, J.C.
2007-01-01
Pulsed Nd:YAG laser was used to weld Cu 54 Ni 6 Zr 22 Ti 18 (numbers indicate at.%) metallic glass with glass forming ability of 6 mm. Through a single pulse irradiation on the glassy plate, the pulse condition for welding without crystallization was investigated. Under the selected pulse condition, the Cu 54 Ni 6 Zr 22 Ti 18 plate was periodically welded with different welding speeds. For the welding speed of 60 mm/min, no crystallization was observed in both weldment and heat-affected zone. For the 20 mm/min, the crystallized areas with a band shape were observed along the welding direction
Pacemakers in patients with familial dysautonomia--a review of experience with 20 patients.
Gold-von Simson, Gabrielle; Rutkowski, Monika; Berlin, Dena; Axelrod, Felicia B
2005-02-01
Familial dysautonomia (FD) is a genetic disease associated with a high incidence of sudden death. If fatal bradyarrhythmia is an etiological factor then the incidence of sudden death should decrease after pacemaker placement. Retrospective review of 596 registered FD patients revealed that 22 FD patients (3.7%) had pacemakers placed between December 1984 and June 2003. Clinical and electrocardiographic indications for placement and demographic data were assessed for 20 of the 22 patients (10 males, 10 females, ages 4 to 48 years). Two patients were excluded because of insufficient data. Prior to pacemaker placement, presenting symptoms were syncope and cardiac arrest, 16/20 (80%) and 6/20 (30 %), respectively. Asystole was the most frequent electrocardiographic finding and was documented in 17/20 patients (85 %). Other electrocardiographic abnormalities included bradycardia, AV block, prolonged QTc and prolonged JTc. The average duration of pacemaker utilization was 5.7 years (range 5 months to 14.5 years). Complications included infection (1 patient) and wire migration (2 patients). In the one patient with infection, the pacemaker was permanently removed. This patient then experienced multiple syncopal episodes and death. There were 7 other deaths. Three deaths occurred suddenly without preceding events, and 4 patients had non-cardiac causes of death. None of these 7 deceased patients had recurrence of syncope after pacemaker placement. In the 12 surviving patients, 6 had recurrence of syncope but none had cardiac arrest. Pacemaker placement may protect FD patients from fatal bradyarrhythmia and may decrease the incidence of syncope. However, data are limited and prospective analysis is needed.
Axis I psychiatric diagnoses in adolescents and young adults with 22q11 deletion syndrome
Ousley, O.Y.; Smearman, E.; Fernandez-Carriba, S.; Rockers, K.A.; Coleman, K.; Walker, E.F.; Cubells, J.F.
2017-01-01
Background 22q11.2 deletion syndrome (22q11DS) associates with schizophrenia spectrum disorders (SSDs), autism spectrum disorders (ASDs), and other psychiatric disorders, but co-occurrence of diagnoses are not well described. Methods We evaluated the co-occurrence of SSDs, ASDs and other axis I psychiatric diagnoses in 31 adolescents and adults with 22q11DS, assessing ASDs using either stringent Collaborative Program for Excellence in Autism (ASD-CPEA) criteria, or less stringent DSM-IV criteria alone (ASD-DSM-IV). Results Ten (32%) individuals met criteria for an SSD, five (16%) for ASD-CPEA, and five others (16%) for ASD-DSM-IV. Of those with ASD-CPEA, one (20%) met SSD criteria. Of those with ASD-DSM-IV, four (80%) met SSD criteria. Depressive disorders (8 individuals; 26%) and anxiety disorders (7; 23%) sometimes co-occurred with SSDs and ASDs. SSDs, ASDs, and anxiety occurred predominantly among males and depression predominantly among females. Conclusions Individuals with 22q11DS can manifest SSDs in the presence or absence of ASDs and other axis I diagnoses. The results suggest that standard clinical care should include childhood screening for ASDs, and later periodic screening for all axis I diagnoses. PMID:23916466
10-20-30 training increases performance and lowers blood pressure and VEGF in runners
DEFF Research Database (Denmark)
Gliemann, Lasse; Gunnarsson, Thomas Gunnar Petursson; Hellsten, Ylva
2015-01-01
into either a control group (CON; n = 28), or a 10-20-30 training group (10-20-30; n = 132) replacing two of three weekly training sessions with 10-20-30 training for 8 weeks and performance of a 5-km run (5-K) and BP was measured. VO2max was measured and resting muscle biopsies were taken in a subgroup......The present study examined the effect of training by the 10-20-30 concept on performance, blood pressure (BP), and skeletal muscle angiogenesis as well as the feasibility of completing high-intensity interval training in local running communities. One hundred sixty recreational runners were divided......-20-30 increased VO2max but did not influence muscle fiber area, distribution or capillarization, whereas the expression of the pro-angiogenic vascular endothelial growth factor (VEGF) was lowered by 22%. No changes were observed in CON. These results suggest that 10-20-30 training is an effective and easily...
Fabrication of implanted $^{22}$Na targets
2002-01-01
A knowledge of the $^{22}$Na(p,$\\gamma$)$^{23}$ Mg reaction rate is of significant astrophysical interest. In order to complete previous studies of this reaction, radioactive $^{22}$Na targets of high purity are required. We ask for support to fabricate these targets via the implantation technique at ISOLDE GPS (off—line mode) using $^{22}$Na nuclides in an Al matrix produced in Nov. 1990 at the PSI (Zürich). The $^{22}$Na nuclides are released and ionized in a surface ionisation source, mass-analyzed at ISOLDE GPS, and implanted in a Ni-Ta backing and a C—foil in a special implantation setup.
Chen, Guangtong; Li, Jie; Yan, Sensen; Lin, Haijun; Wu, Juanjuan; Zhai, Xuguang; Song, Yan; Li, Jianlin
2017-08-01
Biocatalysis of 20(R)-panaxatriol (PT) was performed by the fungus Mucor racemosus. Six metabolites (1-6) including five new compounds were obtained, and their structures were elucidated as 20(R),25-epoxy-12β,24β-dihydroxydammaran-3,6-dione (2), 20(R),25-epoxy-12β,22β-dihydroxydammaran-3,6-dione (3), 20(R),25-epoxy-23β-hydroxydammaran-3,6,12-trione (4), 20(R),25-epoxy-12β,23α- dihydroxydammaran-3,6-dione (5), and 20(R),25-epoxy-12β-hydroxydammaran-3,6,23-trione (6) by spectroscopic analysis. Pharmacological studies revealed that compounds 2, 3 and 5 exhibited significant antihepatic fibrosis activity, while 4 and 6 showed cytotoxicity against HSC-T6 cells.
Web 2.0, Library 2.0, and Librarian 2.0:Preparing for the 2.0 World
Abram, S.
2007-10-01
There is a global conversation going on right now about the next generation of the web. It's happening under the name of Web 2.0. It's the McLuhanesque hot web where true human interaction takes precedence over merely `cool' information delivery and e-mail. It's about putting information into the real context of our users' lives, research, work and play. Concurrently, a group of information professionals are having a conversation about the vision for what Library 2.0 will look like in this Web 2.0 ecosystem. Some are even going so far as to talk about Web 3.0! Web 2.0 is coming fast and it's BIG! What are the skills and competencies that Librarian 2.0 will need? Come and hear an overview of Web 2.0 and a draft vision for Library 2.0 and an opinion about what adaptations we'll need to make to thrive in this future scenario. Let's talk about the Librarian 2.0 in our users' future!
Design of 20 W fiber-coupled green laser diode by Zemax
Qi, Yunfei; Zhao, Pengfei; Wu, Yulong; Chen, Yongqi; Zou, Yonggang
2017-09-01
We represent a design of a 20 W, fiber-coupled diode laser module based on 26 single emitters at 520 nm. The module can produce more than 20 W output power from a standard fiber with core diameter of 400 μm and numerical aperture (NA) of 0.22. To achieve a 20 W laser beam, the spatial beam combination and polarization beam combination by polarization beam splitter are used to combine output of 26 single emitters into a single beam, and then an aspheric lens is used to couple the combined beam into an optical fiber. The simulation shows that the total coupling efficiency is more than 95%. Project supported by the National Key R& D Program of China (No. 2016YFB0402105), the Key Deployment Program of the Chinese Academy of Sciences (No. KGZD-SW-T01-2), and the National Natural Science Foundation of China (No. 61404135).
Excited states in 22Mg via the 12C(12C,2n)22Mg reaction
International Nuclear Information System (INIS)
Jewett, Cybele; Baktash, Cyrus; Bardayan, Daniel W.; Blackmon, Jeff C.; Chipps, K.; Galindo-Uribarri, Alfredo; Greife, U.; Gross, Carl J.; Jones, K. L.; Liang, Junjien; Livesay, Jake; Kozub, R. L.; Nesaraja, Caroline D; Radford, David C.; Sarazin, F.; Smith, Michael Scott; Thomas, J. S.; Yu, Chang-Hong
2007-01-01
The 12C(12C, 2n)22Mg reaction was measured with the CLARION array and the RMS separator at the Holifield Facility of Oak Ridge National Laboratory. This experiment was performed to gather more information on the excited states in 22Mg, which might be of relevance to recent radioactive ion beam measurements of the astrophysically important 21Na(p,γ)22Mg reaction. The results are compared to direct measurements, transfer experiments and a competing experiment performed with Gammasphere
Directory of Open Access Journals (Sweden)
Raymond E. Lai
2018-04-01
Full Text Available Many drugs, hormones, components of herbal medicines, environmental pesticides and toxins are Solute Carrier family 22 (SLC22 substrates. The last twenty years has seen great progress in determining SLC22 tissue expression profiles, membrane localization, energetics, substrate profiles and biopharmaceutical significance. However, much still remains to be answered in terms of SLC22 family member's roles in ‘normal’ physiology as compared to pathophysiological states, as well as in drug interactions that impact pharmacokinetics, efficacy and toxicity. This review begins with a brief synopsis of SLC22 family discovery, function and tissue expression. Subsequent sections provide examples establishing a role for SLC22 transporters in food-drug, herbal supplement-drug, endogenous substrate-drug and drug–drug interactions. Keywords: Hepatic transport, Nephrotoxicity, Organic anion transporter, Organic cation transporter, Renal transport
Two stellar-mass black holes in the globular cluster M22.
Strader, Jay; Chomiuk, Laura; Maccarone, Thomas J; Miller-Jones, James C A; Seth, Anil C
2012-10-04
Hundreds of stellar-mass black holes probably form in a typical globular star cluster, with all but one predicted to be ejected through dynamical interactions. Some observational support for this idea is provided by the lack of X-ray-emitting binary stars comprising one black hole and one other star ('black-hole/X-ray binaries') in Milky Way globular clusters, even though many neutron-star/X-ray binaries are known. Although a few black holes have been seen in globular clusters around other galaxies, the masses of these cannot be determined, and some may be intermediate-mass black holes that form through exotic mechanisms. Here we report the presence of two flat-spectrum radio sources in the Milky Way globular cluster M22, and we argue that these objects are black holes of stellar mass (each ∼10-20 times more massive than the Sun) that are accreting matter. We find a high ratio of radio-to-X-ray flux for these black holes, consistent with the larger predicted masses of black holes in globular clusters compared to those outside. The identification of two black holes in one cluster shows that ejection of black holes is not as efficient as predicted by most models, and we argue that M22 may contain a total population of ∼5-100 black holes. The large core radius of M22 could arise from heating produced by the black holes.
Directory of Open Access Journals (Sweden)
Monique N O'Leary
Full Text Available Most yeast ribosomal protein genes are duplicated and their characterization has led to hypotheses regarding the existence of specialized ribosomes with different subunit composition or specifically-tailored functions. In yeast, ribosomal protein genes are generally duplicated and evidence has emerged that paralogs might have specific roles. Unlike yeast, most mammalian ribosomal proteins are thought to be encoded by a single gene copy, raising the possibility that heterogenous populations of ribosomes are unique to yeast. Here, we examine the roles of the mammalian Rpl22, finding that Rpl22(-/- mice have only subtle phenotypes with no significant translation defects. We find that in the Rpl22(-/- mouse there is a compensatory increase in Rpl22-like1 (Rpl22l1 expression and incorporation into ribosomes. Consistent with the hypothesis that either ribosomal protein can support translation, knockdown of Rpl22l1 impairs growth of cells lacking Rpl22. Mechanistically, Rpl22 regulates Rpl22l1 directly by binding to an internal hairpin structure and repressing its expression. We propose that ribosome specificity may exist in mammals, providing evidence that one ribosomal protein can influence composition of the ribosome by regulating its own paralog.
Blard, P.-H.; Braucher, R.; Lavé, J.; Bourlès, D.
2013-11-01
Many geomorphologic applications, notably glacier chronologies, require improvements in both the precision and the accuracy of the cosmogenic dating tool. Of particular importance is the need to better constrain the spatial variability of the cosmogenic nuclides production rates at high elevation and low latitudes. One strategy that can be adopted for this is to couple absolute calibrations, from independently dated surfaces, with cross-calibration studies, performed by measuring several cosmogenic nuclides in the same rock. In the present study, we report the highest-elevation (>4800 m) cross-calibration published to date, comprising measurements of cosmogenic 3He and 10Be in cogenetic pyroxene and quartz. The samples were collected from six dacitic moraine boulders, exposed from 32 to 65 ka at 4820 m on the flanks of the Uturuncu volcano (22° S, 67° W), Southern Lipez (Bolivia). The samples yield a remarkably tight cluster of 3He-10Be production ratios, with a weighted mean of 33.3±0.9 (1σ). This production ratio is undistinguishable, within uncertainties, from the 3He-10Be production ratio of 32.3±0.9 determined in the same mineral pair at low elevation (1333 m) by Amidon et al. (2009). These results agree at the 1σ level and suggest that any hypothetical increase of the 3He-10Be production ratio in pyroxene and quartz is likely to be lower than 5% over this elevation range (1000-5000 m). Moreover, the production ratio is almost insensitive to the Li content of the pyroxene (20 to 50 ppm Li), suggesting that the cosmogenic thermal neutron production of 3He is very low in this setting. The high-elevation 3He-10Be production ratio is used in combination with a local determination of the 3He production rate in the high Central Altiplano (3800 m) (Blard et al., 2013) to establish a local 10Be production rate of 30.0±1.4 at g yr at 3800 m and 20° S. After scaling to sea-level high latitude with the time-dependent Lal/Stone model, this yields a 10Be production
Directory of Open Access Journals (Sweden)
Giselle C. L. Rosanova
2010-04-01
Full Text Available CONTEXTUALIZAÇÃO: A validade concorrente, relevante na adaptação transcultural, refere-se à relação entre o desempenho do instrumento de interesse e o desempenho de instrumento semelhante com validade conhecida. OBJETIVO: Realizar a validação concorrente da versão brasileira do questionário revisado da Scoliosis Research Society (Br-SRS-22r com a versão brasileira do Short Form-36 (Br-SF-36. MÉTODOS: Foram selecionados 54 pacientes com escoliose idiopática com média de 19,9 anos (±7,7 e curvaturas com média de 31,6° (±20,5° graus Cobb, variando entre 10º e 92º. Os questionários tiveram seus resultados convertidos em escores, e a análise estatística correlacionou os domínios concorrentes utilizando o cálculo de coeficiente de Spearman. RESULTADOS: Os domínios de melhor correlação foram função do Br-SRS-22r com função física do Br-SF-36 (r=0,83 e dor do Br-SRS-22r com dor do Br-SF-36 (r=0,86. Entretanto, os domínios autoimagem e satisfação com o tratamento do Br-SRS-22r apresentaram baixa correlação com seus domínios concorrentes do Br-SF-36. DISCUSSÃO: Houve uma correlação satisfatória entre os questionários, sendo que as melhores correlações indicam maior semelhança nos parâmetros avaliados entre os respectivos instrumentos. As melhores correlações foram as dos domínios função e dor, não ocorrendo em saúde mental, possivelmente devido às dificuldades de interpretação de suas questões no Br-SF-36. Para os domínios autoimagem e satisfação com o tratamento do Br-SRS-22r, a correlação é pouco satisfatória por não serem especificamente abordados pelo SF-36. CONCLUSÃO: A versão brasileira do SRS-22r apresentou resultados satisfatórios para a validação concorrente com o Br-SF-36, sendo considerada válida para a versão adaptada à cultura brasileira.BACKGROUND: An important parameter in cross-cultural adaptations, and concurrent validity are the relationships between the
Mevi, Gabriele; Muscari, Giovanni; Bertagnolio, Pietro Paolo; Fiorucci, Irene; Pace, Giandomenico
2018-02-01
The new ground-based 22 GHz spectrometer, VESPA-22 (water Vapor Emission Spectrometer for Polar Atmosphere at 22 GHz) measures the 22.23 GHz water vapor emission line with a bandwidth of 500 MHz and a frequency resolution of 31 kHz. The integration time for a measurement ranges from 6 to 24 h, depending on season and weather conditions. Water vapor spectra are collected using the beam-switching technique. VESPA-22 is designed to operate automatically with little maintenance; it employs an uncooled front-end characterized by a receiver temperature of about 180 K and its quasi-optical system presents a full width at half maximum of 3.5°. Every 30 min VESPA-22 measures also the sky opacity using the tipping curve technique. The instrument calibration is performed automatically by a noise diode; the emission temperature of this element is estimated twice an hour by observing alternatively a black body at ambient temperature and the sky at an elevation of 60°. The retrieved profiles obtained inverting 24 h integration spectra present a sensitivity larger than 0.8 from about 25 to 75 km of altitude during winter and from about 30 to 65 km during summer, a vertical resolution from about 12 to 23 km (depending on altitude), and an overall 1σ uncertainty lower than 7 % up to 60 km altitude and rapidly increasing to 20 % at 75 km. In July 2016, VESPA-22 was installed at the Thule High Arctic Atmospheric Observatory located at Thule Air Base (76.5° N, 68.8° W), Greenland, and it has been operating almost continuously since then. The VESPA-22 water vapor mixing ratio vertical profiles discussed in this work are obtained from 24 h averaged spectra and are compared with version 4.2 of concurrent Aura/Microwave Limb Sounder (MLS) water vapor vertical profiles. In the sensitivity range of VESPA-22 retrievals, the intercomparison from July 2016 to July 2017 between VESPA-22 dataset and Aura/MLS dataset convolved with VESPA-22 averaging kernels shows an average difference
PREFACE: 22nd International Congress on X-Ray Optics and Microanalysis
Falkenberg, Gerald; Schroer, Christian G.
2014-04-01
ICXOM22 The 22nd edition of the International Congress on X-ray Optics and Microanalysis (ICXOM 22) was held from 2-6 September 2013, in Hamburg, Germany. The congress was organized by scientists from DESY in collaboration with TU Dresden and Helmholtz-Zentrum Geesthacht, who also formed the scientific advisory board. The congress was hosted in the historical lecture hall building of the University of Hamburg located in the city center. ICXOM22 was attended by about 210 registered participants, including 67 students, and was open for listeners. The attendance was split between 26 countries (Germany 120, rest of Europe 57, America 20, Asia 8, Australia 6). The ICXOM series is a forum for the discussion of new developments in instrumentation, methods and applications in the fields of micro- and nano-analysis by means of X-ray beams. Following the trend of the last 10 years, the conference focusses more and more on synchrotron radiation rather than X-ray laboratory sources. Besides micro-beam X-ray fluorescence and absorption spectroscopy, different methods based on diffraction and full-field imaging were covered. Newly introduced to the ICXOM series was scanning coherent X-ray diffraction imaging, which was shown to evolve into a mature method for the imaging of nanostructures, defects and strain fields. New developments on fast X-ray detectors were discussed (Lambda, Maia) and advances in X-ray optics — like the generation of a sub 5nm point focus by Multilayer Zone plates — were presented. Talks on micro- and nano-analysis applications were distributed in special sessions on bio-imaging, Earth and environmental sciences, and Cultural heritage. The congress featured nine keynote and ten plenary talks, 56 talks in 14 parallel sessions and about 120 posters in three afternoon sessions. Seventeen commercial exhibitors exposed related X-ray instrumentation products, and two luncheon seminars on detector electronics were given. This allowed us to keep the student
Prestige oil spill information and assessment Galicia, Spain January 20-22, 2003 : Meeting summaries
International Nuclear Information System (INIS)
2003-01-01
In mid-November 2002, an oil spill occurred off the coast of northwest Spain when the tanker, Prestige, broke apart and sank. The vast majority of the heavy fuel oil it transported was released into the sea along 900 kilometres of Spanish coastline. More than 20,000 people were affected as bans on fish and shellfish harvesting were issued. A delegation from Newfoundland left for Galicia, Spain in December 2002, to learn from the experience in an effort to enhance spill prevention and response for the Newfoundland and Labrador coastline. A brief overview of the Galicia region of Spain was provided, followed by general information concerning the jurisdictional complexity of Galicia. A number of issues and topics were discussed, such as: marine traffic corridors, safe havens; communication with the public; oil recovery operations; compensation; spill prevention; ban on fishing and shellfish harvesting; and, fishing industry's role in response operations. Tours of the areas affected were organized for the delegation. Upon return to Newfoundland, the delegation shared their acquired information and initiated discussions with the federal government concerning intergovernmental issues on oil spill prevention and response
48 CFR 22.1400 - Scope of subpart.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Scope of subpart. 22.1400 Section 22.1400 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SOCIOECONOMIC PROGRAMS APPLICATION OF LABOR LAWS TO GOVERNMENT ACQUISITIONS Employment of Workers with Disabilities 22...
Confirmation that the conotruncal anomaly face syndrome is associated with a deletion within 22q11.2
Energy Technology Data Exchange (ETDEWEB)
Matsuoka, Rumiko; Takao, Atsuyoshi; Kimura, Misa; Kondo, Chisato; Ando, Masahiko; Momma, Kazuo; Imamura, Shin-ichiro [Heart Institute, Tokyo (Japan); Joh-o, Kunitaka [Welfare Pension Hospital, Kyushu (Japan); Ikeda, Kazuo [Sapporo Medical Univ. (Japan); Nishibatake, Makoto [Kagoshima Seikyo Hospital (Japan)
1994-11-15
The so-called {open_quotes}conotruncal anomaly face syndrome{close_quotes} (CTAFS) is characterized by a peculiar facial appearance associated with congenital heart disease (CHD), especially cardiac outflow tract defects such as tetralogy of Fallot (TOF), double outlet ring ventricle (DORV), and truncus arteriosus (TAC). CTAFS and the DiGeorge anomaly (DGA) have many similar phenotypic characteristics, suggesting that they share a common cause. In many cases DGA is known to be associated with monosomy for a region of chromosome 22q11.2. Fifty CTAFS patients and 10 DGA patients, 11 parents couples and 10 mothers of CTAFS patients, and 3 parents couples and 2 mothers of DGA patients were examined by fluorescent in situ hybridization (FISH) using the N25 (D22S75) DGCR probe (Oncor). Monosomy for a region of 22q11.2 was found in 42 CTAFS, 9 DGA, 4 mothers, and 1 father who had CTAF without CHD. The remaining 8 CTAFS patients, 1 DGA patient and 1 mother who had questionable CTAF without CHD, showed no such chromosome abnormality. For the control, 60 patients who had CHD without CTAF or other know malformation syndromes were examined and had no deletion of 22q11.2. Therefore, we conclude that CTAFS is a part of the CATCH 22 syndrome; cardiac defects, abnormal faces, thymic hypoplasia, cleft palate, and hypocalcemia (CATCH) resulting from 22q11.2 deletions. 20 refs., 3 figs., 2 tabs.
40 CFR 73.22-73.24 - [Reserved
2010-07-01
... 40 Protection of Environment 16 2010-07-01 2010-07-01 false [Reserved] 73.22-73.24 Section 73.22-73.24 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) AIR PROGRAMS (CONTINUED) SULFUR DIOXIDE ALLOWANCE SYSTEM Allowance Allocations §§ 73.22-73.24 [Reserved] ...
Lifescience Database Archive (English)
Full Text Available FC (Link to library) FC-AI22 (Link to dictyBase) - - - Contig-U15369-1 | Contig-U15732-1 FC-AI...22P (Link to Original site) FC-AI22F 583 FC-AI22Z 683 FC-AI22P 1266 - - Show FC-AI22 Library FC (...Link to library) Clone ID FC-AI22 (Link to dictyBase) Atlas ID - NBRP ID - dictyBase ID - Link to Contig Con...tig-U15369-1 | Contig-U15732-1 Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/FC/FC-AI/FC-AI...22Q.Seq.d/ Representative seq. ID FC-AI22P (Link to Original site) Representative DNA sequence >FC-AI22 (FC-AI
Minagawa, M; Yasuda, T; Someya, T; Kohno, Y; Saeki, N; Hashimoto, Y
2000-01-01
We treated an extremely tall 13-year-old girl with a growth hormone (GH)-secreting macroadenoma and GH levels of 120-495 ng/ml with a combination of preoperative octreotide infusion, surgery and postoperative octreotide infusion plus estrogen, which resulted in reduced tumor size prior to surgery, reduced GH levels and completely suppressed growth after surgery. 20K GH is produced by alternative splicing of 22K GH mRNA and the ratio of 20K GH to 22K GH is within a small range in the normal population and high in a GH-secreting tumor. The 20K/22K GH ratio in this patient was persistently elevated during each phase of the treatment and may serve as a sensitive index of tumor-derived GH secretion. Copyright 2000 S. Karger AG, Basel.
Applin, Zachary T.; Gentry, Garl L., Jr.; Takallu, M. A.
1995-01-01
A wind tunnel investigation was conducted on a generic, high-wing transport model in the Langley 14- by 22-Foot Subsonic Tunnel. This report contains pressure data that document effects of various model configurations and free-stream conditions on wing pressure distributions. The untwisted wing incorporated a full-span, leading-edge Krueger flap and a part-span, double-slotted trailing-edge flap system. The trailing-edge flap was tested at four different deflection angles (20 deg, 30 deg, 40 deg, and 60 deg). Four wing configurations were tested: cruise, flaps only, Krueger flap only, and high lift (Krueger flap and flaps deployed). Tests were conducted at free-stream dynamic pressures of 20 psf to 60 psf with corresponding chord Reynolds numbers of 1.22 x 10(exp 6) to 2.11 x 10(exp 6) and Mach numbers of 0.12 to 0.20. The angles of attack presented range from 0 deg to 20 deg and were determined by wing configuration. The angle of sideslip ranged from minus 20 deg to 20 deg. In general, pressure distributions were relatively insensitive to free-stream speed with exceptions primarily at high angles of attack or high flap deflections. Increasing trailing-edge Krueger flap significantly reduced peak suction pressures and steep gradients on the wing at high angles of attack. Installation of the empennage had no effect on wing pressure distributions. Unpowered engine nacelles reduced suction pressures on the wing and the flaps.
36 CFR 1150.22 - Signature of documents.
2010-07-01
... 36 Parks, Forests, and Public Property 3 2010-07-01 2010-07-01 false Signature of documents. 1150.22 Section 1150.22 Parks, Forests, and Public Property ARCHITECTURAL AND TRANSPORTATION BARRIERS... Documents for Proceedings on Citations § 1150.22 Signature of documents. The signature of a party...
29 CFR 1921.22 - Computation of time.
2010-07-01
... 29 Labor 7 2010-07-01 2010-07-01 false Computation of time. 1921.22 Section 1921.22 Labor Regulations Relating to Labor (Continued) OCCUPATIONAL SAFETY AND HEALTH ADMINISTRATION, DEPARTMENT OF LABOR... WORKERS' COMPENSATION ACT Miscellaneous § 1921.22 Computation of time. Sundays and holidays shall be...
Lifescience Database Archive (English)
Full Text Available OPAQUE2ZM22Z S000017 17-May-2001 (last modified) uchi Opaque-2 (O2) target sequence...ene: maize 22-kD zein; transacting factor: 02; O2; opaque; 22-kD zein; seed; ACGT; opaque-2; maize (Zea mays) TCCACGTAGA ...
Substituted 2,2'-bipyridines by nickel-catalysis: 4,4'-di-tert-butyl-2,2'-bipyridine.
Buonomo, Joseph A; Everson, Daniel A; Weix, Daniel J
2013-11-01
A simple, ligand-free synthesis of the important bipyridyl ligand 4,4'-di- tert -butyl-2,2'-bipyridine is presented. 5,5'-bis(trifluoromethyl)-2,2'-bipyridine is also synthesized by the same protocol. The syntheses efficiently couple the parent 2-chlorpyridies by a nickel-catalyzed dimerization with manganese powder as the terminal reductant.
6 CFR 7.22 - Classification pending review.
2010-01-01
... 6 Domestic Security 1 2010-01-01 2010-01-01 false Classification pending review. 7.22 Section 7.22 Domestic Security DEPARTMENT OF HOMELAND SECURITY, OFFICE OF THE SECRETARY CLASSIFIED NATIONAL SECURITY INFORMATION Classified Information § 7.22 Classification pending review. (a) Whenever persons who do not have...
Rasmussen, D. J.; Bittermann, Klaus; Buchanan, Maya K.; Kulp, Scott; Strauss, Benjamin H.; Kopp, Robert E.; Oppenheimer, Michael
2018-03-01
Sea-level rise (SLR) is magnifying the frequency and severity of extreme sea levels (ESLs) that can cause coastal flooding. The rate and amount of global mean sea-level (GMSL) rise is a function of the trajectory of global mean surface temperature (GMST). Therefore, temperature stabilization targets (e.g. 1.5 °C and 2.0 °C of warming above pre-industrial levels, as from the Paris Agreement) have important implications for coastal flood risk. Here, we assess, in a global network of tide gauges, the differences in the expected frequencies of ESLs between scenarios that stabilize GMST warming at 1.5 °C, 2.0 °C, and 2.5 °C above pre-industrial levels. We employ probabilistic, localized SLR projections and long-term hourly tide gauge records to estimate the expected frequencies of historical and future ESLs for the 21st and 22nd centuries. By 2100, under 1.5 °C, 2.0 °C, and 2.5 °C GMST stabilization, the median GMSL is projected to rise 48 cm (90% probability of 28-82 cm), 56 cm (28-96 cm), and 58 cm (37-93 cm), respectively. As an independent comparison, a semi-empirical sea level model calibrated to temperature and GMSL over the past two millennia estimates median GMSL rise within 7-8 cm of these projections. By 2150, relative to the 2.0 °C scenario and based on median sea level projections, GMST stabilization of 1.5 °C spares the inundation of lands currently home to about 5 million people, including 60 000 individuals currently residing in Small Island Developing States. We quantify projected changes to the expected frequency of historical 10-, 100-, and 500-year ESL events using frequency amplification factors that incorporate uncertainty in both local SLR and historical return periods of ESLs. By 2150, relative to a 2.0 °C scenario, the reduction in the frequency amplification of the historical 100 year ESL event arising from a 1.5 °C GMST stabilization is greatest in the eastern United States, with ESL event
Kuroda, Yukiko; Ohashi, Ikuko; Saito, Toshiyuki; Nagai, Jun-ichi; Ida, Kazumi; Naruto, Takuya; Iai, Mizue; Kurosawa, Kenji
2014-08-01
Kuechler et al. [2011] reported five patients with interstitial deletions in 8q22.2-q22.3 who had intellectual disability, epilepsy, and dysmorphic features. We report on a new patient with the smallest overlapping de novo deletion in 8q22.3 and refined the phenotype. The proposita was an 8-year-old girl, who developed seizures at 10 months, and her epileptic seizure became severe and difficult to control with antiepileptic drugs. She also exhibited developmental delay and walked alone at 24 months. She was referred to us for evaluation for developmental delay and epilepsy at the age of 8 years. She had intellectual disability (IQ 37 at 7 years) and autistic behavior, and spoke two word sentences at 8 years. She had mild dysmorphic features, including telecanthus and thick vermilion of the lips. Array comparative genomic hybridization detected a 1.36 Mb deletion in 8q22.3 that encompassed RRM2B and NCALD, which encode the small subunit of p53-inducible ribonucleotide reductase and neurocalcin delta in the neuronal calcium sensor family of calcium-binding proteins, respectively. The minimum overlapping region between the present and previously reported patients is considered to be a critical region for the phenotype of the deletion in 8q22.3. We suggest that the deletion in 8q22.3 may represent a clinically recognizable condition, which is characterized by intellectual disability and epilepsy. © 2014 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Starnawska, A; Hansen, C S; Sparsø, T
2017-01-01
Individuals with 22q11.2 deletion syndrome (DS) have an increased risk of comorbid mental disorders including schizophrenia, attention deficit hyperactivity disorder, depression, as well as intellectual disability. Although most 22q11.2 deletion carriers have the long 3-Mb form of the hemizygous...... with mental disorder later in life. DNA methylation was measured genome-wide from neonatal dried blood spots in a cohort of 164 individuals with 22q11.2DS, including 48 individuals diagnosed with a psychiatric disorder. Among several CpG sites with P-value...-98), in NOSIP (P-value=5.12 × 10-8) with disorders of psychological development (F80-89) and in SEMA4B (P-value=4.02 × 10-7) with schizophrenia spectrum disorders (F20-29). In conclusion, our study suggests an association of DNA methylation differences at birth with development of mental disorder later in life...
10 CFR 10.22 - Notice to individual.
2010-01-01
... 10 Energy 1 2010-01-01 2010-01-01 false Notice to individual. 10.22 Section 10.22 Energy NUCLEAR... NATIONAL SECURITY INFORMATION OR AN EMPLOYMENT CLEARANCE Procedures § 10.22 Notice to individual. A... Counsel, and signed by the Director, Office of Administration, must be presented to each individual whose...
21 CFR 1306.22 - Refilling of prescriptions.
2010-04-01
... 21 Food and Drugs 9 2010-04-01 2010-04-01 false Refilling of prescriptions. 1306.22 Section 1306.22 Food and Drugs DRUG ENFORCEMENT ADMINISTRATION, DEPARTMENT OF JUSTICE PRESCRIPTIONS Controlled... 75 FR 16308, Mar. 31, 2010, § 1306.22 was revised, effective June 1, 2010. For the convenience of the...
45 CFR 99.22 - Rights of parties.
2010-10-01
... 45 Public Welfare 1 2010-10-01 2010-10-01 false Rights of parties. 99.22 Section 99.22 Public Welfare DEPARTMENT OF HEALTH AND HUMAN SERVICES GENERAL ADMINISTRATION PROCEDURE FOR HEARINGS FOR THE CHILD CARE AND DEVELOPMENT FUND Hearing Procedures § 99.22 Rights of parties. All parties may: (a...
27 CFR 22.152 - Reconsignment in transit.
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Reconsignment in transit. 22.152 Section 22.152 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU... Disposition of Tax-Free or Recovered Alcohol § 22.152 Reconsignment in transit. (a) Reconsignment. Tax-free...
19 CFR 162.22 - Seizure of conveyances.
2010-04-01
... 19 Customs Duties 2 2010-04-01 2010-04-01 false Seizure of conveyances. 162.22 Section 162.22... TREASURY (CONTINUED) INSPECTION, SEARCH, AND SEIZURE Seizures § 162.22 Seizure of conveyances. (a) General applicability. If it shall appear to any officer authorized to board conveyances and make seizures that there...
34 CFR 300.22 - Individualized education program.
2010-07-01
... CHILDREN WITH DISABILITIES General Definitions Used in This Part § 300.22 Individualized education program. Individualized education program or IEP means a written statement for a child with a disability that is developed... 34 Education 2 2010-07-01 2010-07-01 false Individualized education program. 300.22 Section 300.22...
Ding, Qianlan; Wu, Xi; Lu, Yeling; Chen, Changming; Shen, Rui; Zhang, Xi; Jiang, Zhengwen; Wang, Xuefeng
2016-07-01
To develop a digitalized intron 22 inversion (Inv22) detection in patients with severe haemophilia A. The design included two tests: A genotyping test included two multiplex pre-amplification of LD-PCR (PLP) with two combinations of five primers to amplify wild-type and chimeric int22h alleles; a carrier mosaicism test was similar to the genotyping test except only amplification of chimeric int22h alleles by removing one primer from each of two combinations. AccuCopy detection was used to quantify PLP products. PLP product patterns in the genotyping test allowed identifying all known Inv22. Quantitative patterns accurately represented the product patterns. The results of 164 samples detected by the genotyping test were consistent with those obtained by LD-PCR detection. Limit of detection (LOD) of the carrier mosaicism test was at least 2% of heterozygous cells with Inv22. Performing the test in two obligate mothers with negative Inv22 from two sporadic pedigrees mosaic rates of blood and hair root of the mother from pedigree 1 were 8.3% and >20%, respectively and negative results were obtained in pedigree 2. AccuCopy quantification combined with PLP (AQ-PLP) method was confirmed to be rapid and reliable for genotyping Inv22 and highly sensitive to carrier mosaicism detection. Copyright © 2016 Elsevier B.V. All rights reserved.
A 20 year retrospective histomorphological analysis of juvenile soft tissue tumors
Directory of Open Access Journals (Sweden)
Odokuma Emmanuel Igho
2016-01-01
Full Text Available Introduction: Soft tissue tumours (STT are defined traditionally as mesenchymal proliferations that occur in the extra-.skeletal nonepithelial tissues of the body excluding viscera, meninges and lymphoreticular system. These tumours occur in children where they may result in severe debilitating disease. This study was therefore aimed at determining the age, gender and site distribution of soft tissue tumours in the young. Materials and Methods: The records of all pathology consultations during the 20 year period from (1990-2010, from the Department of Morbid Anatomy/Histopathology, University of Benin Teaching Hospital from birth to 20 years, were utilized for this study. The lesions were standardized in accordance with the world health organization (WHO classification. Permission for this study was obtained from the UBTH ethics committee (protocol number ADM/E22/A/VOL.VII/142. Results: A total of 139 lesions were recorded, 72 males and 67 females with a male/female ratio of 1.1:1. Benign tumours constituted 113(81% while malignant tumours accounted for 26(19%. This study demonstrated that, nerve sheath tumours and vascular tumours accounted for 25% of STT in children followed by adipocytic tumours 22%, skeletal muscle tumours 17%, fibrohistiocytic tumours 7%, fibroblastic tumours 5%, and perivascular tumours 1% respectively. Majority of these tumours were located in the head and lower extremities with fewer in the upper extremities and trunk. These lesions were predominant in females of the older age group (10-20 years unlike in their male counterparts. Conclusion: This study has shown that benign soft tissue tumours are more prevalent than the malignant varieties in juveniles.
Directory of Open Access Journals (Sweden)
Andrii I. Buvailo
2012-12-01
Full Text Available The reaction between copper(II nitrate and (E-N-(3-amino-2,2-dimethylpropyl-2-(hydroxyiminopropanamide led to the formation of the dinuclear centrosymmetric copper(II title complex, (C8H18N3O22[Cu2(C8H15N3O22(C8H17N3O22](C9H16N3O42·2CH3CN, in which an inversion center is located at the midpoint of the Cu2 unit in the center of the neutral [Cu2(C8H15N3O22(C8H17N3O22] complex fragment. The Cu2+ ions are connected by two N—O bridging groups [Cu...Cu separation = 4.0608 (5 Å] while the CuII ions are five-coordinated in a square-pyramidal N4O coordination environment. The complex molecule co-crystallizes with two molecules of acetonitrile, two molecules of the protonated ligand (E-3-[2-(hydroxyiminopropanamido]-2,2-dimethylpropan-1-aminium and two negatively charged (E-{3-[2-(hydroxyiminopropanamido]-2,2-dimethylpropyl}carbamate anions, which were probably formed as a result of condensation between (E-N-(3-amino-2,2-dimethylpropyl-2-(hydroxyiminopropanamide and hydrogencarbonate anions. In the crystal, the complex fragment [Cu2(C8H15N3O22(C8H17N3O22] and the ion pair C8H18N3O2+.C9H16N3O4− are connected via an extended system of hydrogen bonds.
Adrenal vein sampling in 22 patients with primary aldosteronism
International Nuclear Information System (INIS)
Kanamoto, Takaaki; Ueda, Hiroyuki; Hiraoka, Taizo; Ito, Hirofumi; Hayakawa, Katsumi; Chusho, Hideki; Yoshimasa, Takaaki; Tanikake, Masato
2007-01-01
We evaluated 22 patients who had been diagnosed with primary aldosteronism (PA) and undergone adrenal venous sampling (AVS) in our hospital. Blood sampling was technically successful in all patients and, in terms of results, endocrinologically successful in 20 and unsuccessful in 2. We achieved a success rate of over 90% by preoperatively confirming the vascular anatomy by multi detector row CT (MDCT), selecting a catheter suitable for insertion into the right adrenal vein, and using an extension tube for children at the time of sampling. Of the 14 patients diagnosed with aldosterone producing adenoma (APA) by AVS, 7 underwent adrenal adenomectomy, and achieved improvement in blood pressure and biochemical test results. Thus, AVS is useful for the diagnosis and treatment planning of PA, and the demand for it will grow in the future. (author)
On osp(2|2) conformal field theories
International Nuclear Information System (INIS)
Ding Xiangmao; Gould, Mark D; Mewton, Courtney J; Zhang Yaozhong
2003-01-01
We study the conformal field theories corresponding to current superalgebras osp(2|2) (1) k and osp(2|2) (2) k . We construct the free field realizations, screen currents and primary fields of these current superalgebras at general level k. All the results for osp(2|2) (2) k are new, and the results for the primary fields of osp(2|2) (1) k also seem to be new. Our results are expected to be useful in the supersymmetric approach to Gaussian disordered systems such as the random bond Ising model and the Dirac model
34 CFR 603.22 - Inclusion on list.
2010-07-01
... 34 Education 3 2010-07-01 2010-07-01 false Inclusion on list. 603.22 Section 603.22 Education Regulations of the Offices of the Department of Education (Continued) OFFICE OF POSTSECONDARY EDUCATION... § 603.22 Inclusion on list. Any State agency which desires to be listed by the Secretary as meeting the...
International Nuclear Information System (INIS)
Nieto, J.M.; Salagre, P.; Medina, F.; Sueiras, J.E.; Solans, X.
1993-01-01
The crystal structure of hydrated strontium decavanadate, Sr 3 V 10 O 28 .22H 2 O, has been determined. It contains two types of strontium ions: the first is coordinated to seven water molecules which define a pentagonal bipyramid; the second bonds to five molecules of water and three O atoms of different decavanadate ions, thereby bridging between decavanadate ions to produce layers of formula [Sr 2 V 10 O 38 H 20 ] n on the crystallographic plane (100). The heptacoordinated Sr and the five molecules of water associated with it are located between the different layers. (orig.)
10 CFR 1045.22 - No comment policy.
2010-01-01
... 10 Energy 4 2010-01-01 2010-01-01 false No comment policy. 1045.22 Section 1045.22 Energy DEPARTMENT OF ENERGY (GENERAL PROVISIONS) NUCLEAR CLASSIFICATION AND DECLASSIFICATION Identification of Restricted Data and Formerly Restricted Data Information § 1045.22 No comment policy. (a) Authorized holders of RD and FRD shall not confirm or expand...
12 CFR 563e.22 - Lending test.
2010-01-01
... 12 Banks and Banking 5 2010-01-01 2010-01-01 false Lending test. 563e.22 Section 563e.22 Banks and... Assessing Performance § 563e.22 Lending test. (a) Scope of test. (1) The lending test evaluates a savings... community development lending criterion. (b) Performance criteria. The OTS evaluates a savings association's...
39 CFR 3060.22 - Financial status report.
2010-07-01
... 39 Postal Service 1 2010-07-01 2010-07-01 false Financial status report. 3060.22 Section 3060.22... THEORETICAL COMPETITIVE PRODUCTS ENTERPRISE § 3060.22 Financial status report. The Postal Service shall file a Financial Status Report in the form and content of Table 2, below. Table 2—Annual Summary of Competitive...
Spectral flow as a map between N=(2,0)-models
International Nuclear Information System (INIS)
Athanasopoulos, P.; Faraggi, A.E.; Gepner, D.
2014-01-01
The space of (2,0) models is of particular interest among all heterotic-string models because it includes the models with the minimal SO(10) unification structure, which is well motivated by the Standard Model of particle physics data. The fermionic Z 2 ×Z 2 heterotic-string models revealed the existence of a new symmetry in the space of string configurations under the exchange of spinors and vectors of the SO(10) GUT group, dubbed spinor–vector duality. In this paper we generalize this idea to arbitrary internal rational conformal field theories (RCFTs). We explain how the spectral flow operator normally acting within a general (2,2) theory can be used as a map between (2,0) models. We describe the details, give an example and propose more simple currents that can be used in a similar way
International Nuclear Information System (INIS)
Hubert, F.; Dufour, J.P.; Moral, R. Del; Fleury, A.; Jean, D.; Pravikoff, M.S.; Geissel, H.; Schmidt, K.H.; Hanelt, E.
1991-01-01
22 O nuclei were produced as fragments of a 60 MeV/n 40 Ar beam interacting with a thick Be target. They were selected from all the produced nuclei with the LISE separator. γ spectra in coincidence with the β decay were measured. Partial decay scheme of 22 O is given. Similarities between experiments and calculations are discussed. (G.P.) 10 refs.; 3 figs
The 20-20-20 Airship Challenge
Kiessling, Alina; Diaz, Ernesto; Miller, Sarah; Rhodes, Jason
2014-06-01
A NASA Centennial Challenge; (http://www.nasa.gov/directorates/spacetech/centennial_challenges/index.html) is in development to spur innovation in stratospheric airships as a science platform. We anticipate a million dollar class prize for the first organization to fly a powered airship that remains stationary at 20km (65,000 ft) altitude for over 20 hours with a 20kg payload. The design must be scalable to longer flights with more massive payloads.In NASA’s constrained budget environment, there are few opportunities for space missions in astronomy and Earth science, and these have very long lead times. We believe that airships (powered, maneuverable, lighter-than-air vehicles) could offer significant gains in observing time, sky and ground coverage, data downlink capability, and continuity of observations over existing suborbital options at competitive prices. We seek to spur private industry (or non-profit institutions, including FFRDCs and Universities) to demonstrate the capability for sustained airship flights as astronomy and Earth science platforms. This poster will introduce the challenge in development and provide details of who to contact for more information.
Directory of Open Access Journals (Sweden)
M. Chirkov
2016-03-01
Full Text Available We report on HCFC-22 data acquired by the Michelson Interferometer for Passive Atmospheric Sounding (MIPAS in the reduced spectral resolution nominal observation mode. The data cover the period from January 2005 to April 2012 and the altitude range from the upper troposphere (above cloud top altitude to about 50 km. The profile retrieval was performed by constrained nonlinear least squares fitting of modelled spectra to the measured limb spectral radiances. The spectral ν4-band at 816.5 ± 13 cm−1 was used for the retrieval. A Tikhonov-type smoothing constraint was applied to stabilise the retrieval. In the lower stratosphere, we find a global volume mixing ratio of HCFC-22 of about 185 pptv in January 2005. The rate of linear growth in the lower latitudes lower stratosphere was about 6 to 7 pptv year−1 in the period 2005–2012. The profiles obtained were compared with ACE-FTS satellite data v3.5, as well as with MkIV balloon profiles and cryosampler balloon measurements. Between 13 and 22 km, average agreement within −3 to +5 pptv (MIPAS – ACE with ACE-FTS v3.5 profiles is demonstrated. Agreement with MkIV solar occultation balloon-borne measurements is within 10–20 pptv below 30 km and worse above, while in situ cryosampler balloon measurements are systematically lower over their full altitude range by 15–50 pptv below 24 km and less than 10 pptv above 28 km. MIPAS HCFC-22 time series below 10 km altitude are shown to agree mostly well to corresponding time series of near-surface abundances from the NOAA/ESRL and AGAGE networks, although a more pronounced seasonal cycle is obvious in the satellite data. This is attributed to tropopause altitude fluctuations and subsidence of polar winter stratospheric air into the troposphere. A parametric model consisting of constant, linear, quasi-biennial oscillation (QBO and several sine and cosine terms with different periods has been fitted to the temporal variation of stratospheric
32 CFR 2001.22 - Derivative classification.
2010-07-01
... 32 National Defense 6 2010-07-01 2010-07-01 false Derivative classification. 2001.22 Section 2001.22 National Defense Other Regulations Relating to National Defense INFORMATION SECURITY OVERSIGHT OFFICE, NATIONAL ARCHIVES AND RECORDS ADMINISTRATION CLASSIFIED NATIONAL SECURITY INFORMATION...
29 CFR 22.41 - Stay pending appeal.
2010-07-01
... 29 Labor 1 2010-07-01 2010-07-01 true Stay pending appeal. 22.41 Section 22.41 Labor Office of the Secretary of Labor PROGRAM FRAUD CIVIL REMEDIES ACT OF 1986 § 22.41 Stay pending appeal. (a) An initial decision is stayed automatically pending disposition of a motion for reconsideration or of an appeal to the...
Energy Technology Data Exchange (ETDEWEB)
Bolognesi, P. [CNR-IMIP, Area della Ricerca di Roma 1, CP10, 00016 Monterotondo Scalo (Italy); Otranto, S. [CONICET and Depto. de Fisica, Universidad Nacional del Sur, 8000 Bahia Blanca (Argentina); Garibotti, C.R. [CONICET and Centro Atomico Bariloche, 8400 S.C. de Bariloche (Argentina); Flammini, R. [CNR-IMIP, Area della Ricerca di Roma 1, CP10, 00016 Monterotondo Scalo (Italy); Alberti, G. [CNR-IMIP, Area della Ricerca di Roma 1, CP10, 00016 Monterotondo Scalo (Italy); Avaldi, L. [CNR-IMIP, Area della Ricerca di Roma 1, CP10, 00016 Monterotondo Scalo (Italy)]. E-mail: lorenzo.avaldi@imip.cnr.it
2005-06-15
The triple differential cross-section (TDCS) for the photo-double ionisation of Ne leading to the Ne{sup 2+}(2s{sup -2}2p{sup 6}) has been measured 20 eV above threshold in equal-energy-sharing conditions. The results are compared with the recently introduced SC3 model, which can be used to study targets different from He since it allows an easy implementation with different initial-state wavefunctions.
Low-energy radioactive ion beam production of 22Mg
International Nuclear Information System (INIS)
Duy, N.N.; Kubono, S.; Yamaguchi, H.; Kahl, D.; Wakabayashi, Y.; Teranishi, T.; Iwasa, N.; Kwon, Y.K.; Khiem, L.H.; Kim, Y.H.; Song, J.S.; Hu, J.; Ayyad, Y.
2013-01-01
The 22 Mg nucleus plays an important role in nuclear astrophysics, specially in the 22 Mg(α,p) 25 Al and proton capture 22 Mg(p,γ) 23 Al reactions. It is believed that 22 Mg is a waiting point in the αp-process of nucleosynthesis in novae. We proposed a direct measurement of the 22 Mg+α resonance reaction in inverse kinematics using a radioactive ion (RI) beam. A 22 Mg beam of 3.73 MeV/u was produced at CRIB (Center for Nuclear Study (CNS) low-energy RI Beam) facility of the University of Tokyo located at RIKEN (Japan) in 2011. In this paper we present the results about the production of the 22 Mg beam used for the direct measurement of the scattering reaction 22 Mg(α,α) 22 Mg, and the stellar reaction 22 Mg(α,p) 25 Al in the energy region concerning an astrophysical temperature of T 9 =1–3 GK
Chen, Chih-Ping; Lin, Shuan-Pei; Chern, Schu-Rern; Wu, Peih-Shan; Su, Jun-Wei; Lee, Chen-Chi; Wang, Wayseen
2014-03-01
To present an array comparative genomic hybridization (aCGH) characterization of a 12p11.22-p11.21 microdeletion and 22q11.2 microduplication in an adolescent girl with autism, mental retardation, facial dysmorphism, microcephaly, behavior problems, and an apparently balanced reciprocal translocation of t(8;12)(q24.3;p11.2). A 13-year-old girl was referred to the hospital because of autism, mental retardation, and difficulty in the self-care of her menstruation. Cytogenetic analysis revealed an apparently balanced reciprocal translocation and a karyotype of 46,XX,t(8;12) (q24.3;p11.2)dn. The girl manifested microcephaly, hypertelorism, flat facial profile, prominent forehead, thick scalp hair, upslanting palpebral fissures, broad nasal bridge, bulbous nose, right simian crease, bilateral clinodactyly of the fifth fingers, bilateral pes cavus, learning difficulties, mental retardation, emotional instability, cognitive impairment, behavior problems, jumping-like gaits, and autistic spectrum disorder. aCGH was performed to evaluate genomic imbalance in this patient. aCGH analysis revealed a 1.37-Mb 12p11.22-p11.21 microdeletion or arr [hg 19] 12p11.22-p11.21 (30,645,008-32,014,774)×1 and a 367-kb 22q11.21 microduplication or arr [hg 19] 22q11.21 (18,657,470-19,024,306)×3. The 1.37-Mb 12p11.22-p11.21 microdeletion encompassed 26 genes including IPO8, CAPRIN2, and DDX11, and the 367-kb 22q11.21 microduplication encompassed 20 genes including USP18, DGCR6, PRODH, and DGCR2. An apparently balanced translocation may be in fact affected by concurrent deletion and duplication in two different chromosomal regions. Our presentation provides information on diagnostic phenotype of 12p11.22-p11.21 microdeletion and 22q11.2 microduplication. Copyright © 2014. Published by Elsevier B.V.
Blois, Sandra M; Tirado-González, Irene; Wu, Julie; Barrientos, Gabriela; Johnson, Briana; Warren, James; Freitag, Nancy; Klapp, Burghard F; Irmak, Ster; Ergun, Suleyman; Dveskler, Gabriela S
2012-06-01
Mouse and human pregnancy-specific glycoproteins (PSG) are known to exert immunomodulatory functions during pregnancy by inducing maternal leukocytes to secrete anti-inflammatory cytokines that promote a tolerogenic decidual microenvironment. Many such anti-inflammatory mediators also function as proangiogenic factors, which, along with the reported association of murine PSG with the uterine vasculature, suggest that PSG may contribute to the vascular adaptations necessary for successful implantation and placental development. We observed that PSG22 is strongly expressed around the embryonic crypt on Gestation Day 5.5, indicating that trophoblast giant cells are the main source of PSG22 during the early stages of pregnancy. PSG22 treatment up-regulated the secretion of transforming growth factor beta 1 and vascular endothelial growth factor A (VEGFA) in murine macrophages, uterine dendritic cells, and natural killer cells. A possible role of PSGs in uteroplacental angiogenesis is further supported by the finding that incubation of endothelial cells with PSG22 resulted in the formation of tubes in the presence and absence of VEGFA. We determined that PSG22, like human PSG1 and murine PSG17 and PSG23, binds to the heparan sulfate chains in syndecans. Therefore, our findings indicate that despite the independent evolution and expansion of human and rodent PSG, members in both families have conserved functions that include their ability to induce anti-inflammatory cytokines and proangiogenic factors as well as to induce the formation of capillary structures by endothelial cells. In summary, our results indicate that PSG22, the most abundant PSG expressed during mouse early pregnancy, is likely a major contributor to the establishment of a successful pregnancy.
Laansoo, Karin, 1976-
2002-01-01
Prantsuse kunstnikud Delphine Reist, Laurent Faulon, Sebastien Perroud ja Mathiue Werchowsky tegid Tallinnas Kalinini tehasehoones squart'näituse "Neli laulu Siivile". Kuraator Andres Lõo.Four songs for Siivi, kunstinäitus (2002 : Tallinn)
Energy Technology Data Exchange (ETDEWEB)
Sarlar, Kagan [Physics Department, Faculty of Arts and Sciences, Uludag University, Gorukle Campus, 16059 Bursa (Turkey); Physics Department, Kamil Ozdag Faculty of Sciences, Karamanoglu Mehmetbey University, YunusEmre Campus, 70100 Karaman (Turkey); Kucuk, Ilker, E-mail: ikucuk@uludag.edu.tr [Physics Department, Faculty of Arts and Sciences, Uludag University, Gorukle Campus, 16059 Bursa (Turkey)
2015-01-15
The effect of Fe concentration on the glass forming ability (GFA) and magnetic properties in Co{sub (40.2−x)}Fe{sub (20.1+x)}Ni{sub 6.7}B{sub 22.7}Si{sub 5.3}Nb{sub 5} (x=0–10) bulk metallic glasses were investigated. By suction casting method, the bulk metallic glasses with diameters up to 2 mm were produced. We try to find out which Fe concentration makes an influence on Co based system's magnetic properties and glass forming ability. The curves of thermal analysis, obtained using differential scanning calorimetry (DSC), show that the Co{sub (40.2−x)}Fe{sub (20.1+x)}Ni{sub 6.7}B{sub 22.7}Si{sub 5.3}Nb{sub 5} (x=0–10) have a supercooled liquid region (∆T{sub x}) of about 44 K. The saturation magnetizations (J{sub s}) for as-cast BMG alloys were in the range of 0.62 T−0.81 T. - Highlights: • The effect of Fe concentration on the glass forming ability. • The substitution of an appropriate amount of Fe can enhance the GFA. • The substitution of Fe for Co also improves soft magnetic properties of the BMGs. • The high of J{sub s} 0.62−0.81 T with a low H{sub c} of 2−289 A/m of the alloys.
48 CFR 22.1408 - Contract clause.
2010-10-01
... Section 22.1408 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SOCIOECONOMIC PROGRAMS APPLICATION OF LABOR LAWS TO GOVERNMENT ACQUISITIONS Employment of Workers with Disabilities 22.1408 Contract clause. (a) Insert the clause at 52.222-36, Affirmative Action for Workers with...
48 CFR 22.1406 - Complaint procedures.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Complaint procedures. 22.1406 Section 22.1406 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SOCIOECONOMIC PROGRAMS APPLICATION OF LABOR LAWS TO GOVERNMENT ACQUISITIONS Employment of Workers with...
A technique for determining electron losses for a 20 MeV microtron
International Nuclear Information System (INIS)
Harisha, P.; Nayak, A.R.; Mehta, S.K.; Soni, H.C.; Siddappa, K.
1999-01-01
A 22 orbit, 20 MeV electron microtron is used as a preaccelerator for the 700 MeV booster synchrotron at INDUS-1, CAT, Indore. Estimation of electron losses at the RF cavity from each orbit is important in obtaining the radiation doses from the body of the microtron. Radiation mapping of the microtron can be used to estimate these loss terms as an alternate to actual measurement by using a measuring probe. (author)
The Effect of Response Style on Self-Reported Conscientiousness Across 20 Countries
Mõttus, René; Allik, Jüri; Realo, Anu; Rossier, Jérôme; Zecca, Gregory; Ah-Kion, Jennifer; Amoussou-Yéyé, Dénis; Bäckström, Martin; Barkauskiene, Rasa; Barry, Oumar; Bhowon, Uma; Björklund, Fredrik; Bochaver, Aleksandra; Bochaver, Konstantin; de Bruin, Gideon
2012-01-01
Rankings of countries on mean levels of self-reported Conscientiousness continue to puzzle researchers. Based on the hypothesis that cross-cultural differences in the tendency to prefer extreme response categories of ordinal rating scales over moderate categories can influence the comparability of self-reports, this study investigated possible effects of response style on the mean levels of self-reported Conscientiousness in 22 samples from 20 countries. Extreme and neutral responding were es...
Yu, Andrea C; Zambrano, Regina M; Cristian, Ingrid; Price, Sue; Bernhard, Birgitta; Zucker, Marc; Venkateswaran, Sunita; McGowan-Jordan, Jean; Armour, Christine M
2017-06-01
Isolated 7p22.3p22.2 deletions are rarely described with only two reports in the literature. Most other reported cases either involve a much larger region of the 7p arm or have an additional copy number variation. Here, we report five patients with overlapping microdeletions at 7p22.3p22.2. The patients presented with variable developmental delays, exhibiting relative weaknesses in expressive language skills and relative strengths in gross, and fine motor skills. The most consistent facial features seen in these patients included a broad nasal root, a prominent forehead a prominent glabella and arched eyebrows. Additional variable features amongst the patients included microcephaly, metopic ridging or craniosynostosis, cleft palate, cardiac defects, and mild hypotonia. Although the patients' deletions varied in size, there was a 0.47 Mb region of overlap which contained 7 OMIM genes: EIP3B, CHST12, LFNG, BRAT1, TTYH3, AMZ1, and GNA12. We propose that monosomy of this region represents a novel microdeletion syndrome. We recommend that individuals with 7p22.3p22.2 deletions should receive a developmental assessment and a thorough cardiac exam, with consideration of an echocardiogram, as part of their initial evaluation. © 2017 Wiley Periodicals, Inc.
DEFF Research Database (Denmark)
Kragstrup, Tue Wenzel; Greisen, Stinne Ravn; Nielsen, Morten Aagaard
2016-01-01
BACKGROUND: Rheumatoid arthritis (RA) is often characterized by the presence of rheumatoid factor, anti-citrullinated protein antibodies, and bone erosions. Current therapies can compromise immunity, leading to risk of infection. The interleukin-20 receptor (IL-20R) axis comprising IL-19, IL-20...... the production of the IL-20R cytokines by monocytes/macrophages. Increased baseline plasma concentrations of IL-20 and IL-24 were associated with Sharp-van der Heijde score progression after 24 months (Spearman's rho = 0.19 and 0.26, both P ... by osteoclast precursors and in multinucleated osteoclasts. IL-20 and IL-24 increased the secretion of monocyte chemoattractant protein 1 by these cells. CONCLUSIONS: This study suggests that IL-20 and IL-24 link RA-associated autoantibodies with radiographic progression via the IL-22R1. Modulation of this axis...
Microbial contamination in 20-peso banknotes in Monterrey, Mexico.
Rocha-Gámez, Judith; Tejeda-Villarreal, Paula Nelly; Macías-Cárdenas, Patricia; Canizales-Oviedo, Jorge; Garza-González, Elvira; Ramírez-Villarreal, Elsa Guadalupe
2012-09-01
The authors' aim was to isolate and identify bacteria or yeast that may be present on the surface of 20-peso banknotes from the metropolitan area of Monterrey, Mexico. They randomly studied a total of 70 20-peso banknotes for the presence of bacteria and species of Candida by conventional methods. Out of the 70 banknotes, 48 (69%) were found to be contaminated. The most prevalent species observed was Candida kruseii (19 bills, 27%) followed by Burkholderia cepacia (9 bills, 13%); 22 (31%) bills showed no growth. Of the 48 contaminated bills, four (5.7%) yielded bacteria considered pathogenic and the other 44 bills (63%) yielded bacteria considered potentially pathogenic. Eleven bills showed more than one microbial species. The results of the authors' study show that contamination occurs on paper currency in the metropolitan area of Monterrey. The authors' findings provide evidence that currency banknotes may represent a threat to human health.
Nance-Horan syndrome: linkage analysis in 4 families refines localization in Xp22.31-p22.13 region.
Toutain, A; Ronce, N; Dessay, B; Robb, L; Francannet, C; Le Merrer, M; Briard, M L; Kaplan, J; Moraine, C
1997-02-01
Nance-Horan syndrome (NHS) is an X-linked disease characterized by severe congenital cataract with microcornea, distinctive dental findings, evocative facial features and mental impairment in some cases. Previous linkage studies have placed the NHS gene in a large region from DXS143 (Xp22.31) to DXS451 (Xp22.13). To refine this localization further, we have performed linkage analysis in four families. As the maximum expected Lod score is reached in each family for several markers in the Xp22.31-p22.13 region and linkage to the rest of the X chromosome can be excluded, our study shows that NHS is a genetically homogeneous condition. An overall maximum two-point Lod score of 9.36 (theta = 0.00) is obtained with two closely linked markers taken together. DXS207 and DXS1053 in Xp22.2. Recombinant haplotypes indicate that the NHS gene lies between DXS85 and DXS1226. Multipoint analysis yield a maximum Lod score of 9.45 with the support interval spanning a 15-cM region that includes DXS16 and DXS1229/365. The deletion map of the Xp22.3-Xp21.3 region suggests that the phenotypic variability of NHS is not related to gross rearrangement of sequences of varying size but rather to allelic mutations in a single gene, presumably located proximal to DXS16 and distal to DXS1226. Comparison with the map position of the mouse Xcat mutation supports the location of the NHS gene between the GRPR and PDHA1 genes in Xp22.2.
2016-12-01
developed significantly larger and markedly more vascularized thymic tumors than those observed in Rpl22þ/þ control mice. But, unlike Rpl22þ/þ or Rpl22þ...hypoxia (31). Alternatively, we did not observe obvious necrosis in the center of the large thymic tumors from Rpl22-deficent mice, suggesting Rpl22...Orthop Res 2004;22:1175–81. 32. Loeffler S, Fayard B, Weis J, Weissenberger J. Interleukin-6 induces tran- scriptional activation of vascular endothelial
Dimethyl 2,2′-[Carbonylbis(azanediyl](2S,2′S-bis[3-(4-hydroxyphenylpropanoate
Directory of Open Access Journals (Sweden)
Raffaella Mancuso
2018-02-01
Full Text Available The thus-far unknown ureic derivative dimethyl 2,2′-[carbonylbis(azanediyl](2S,2′S-bis[3-(4-hydroxyphenylpropanoate] has been efficiently synthesized by enantiospecific oxidative carbonylation of readily available l-tyrosine methyl ester, using a very simple catalytic system (PdI2 in conjunction with KI under relatively mild conditions (100 °C for 5 h in DME as the solvent and under 20 atm of a 4:1 mixture CO-air.
Directory of Open Access Journals (Sweden)
Karl Peltzer
2014-07-01
Full Text Available Obesity among young people increases lifetime cardiovascular risk. This study assesses the prevalence of overweight/obesity and its associated factors among a random sample of university students from 22 universities in 22 low, middle income and emerging economy countries. This cross-sectional survey comprised of a self-administered questionnaire and collected anthropometric measurements. The study population was 6773 (43.2% males and 8913 (56.8% females, aged 16 to 30 years (mean 20.8 years, SD = 2.6. Body mass index (BMI was used for weight status. Among men, the prevalence of underweight was 10.8%, normal weight 64.4%, overweight 18.9% and obesity 5.8%, while among women, the prevalence of underweight was 17.6%, normal weight 62.1%, overweight 14.1% and obesity 5.2%. Overall, 22% were overweight or obese (24.7% men and 19.3% women. In multivariate regression among men, younger age, coming from a higher income country, consciously avoiding fat and cholesterol, physically inactivity, current tobacco use and childhood physical abuse, and among women older age, coming from a higher income country, frequent organized religious activity, avoiding fat and cholesterol, posttraumatic stress symptoms and physical childhood abuse were associated overweight or obesity. Several gender specific risk factors identified can be utilized in health promotion programmes.
Peltzer, Karl; Pengpid, Supa; Samuels, T Alafia; Özcan, Neslihan Keser; Mantilla, Carolina; Rahamefy, Onja H; Wong, Mee Lian; Gasparishvili, Alexander
2014-07-21
Obesity among young people increases lifetime cardiovascular risk. This study assesses the prevalence of overweight/obesity and its associated factors among a random sample of university students from 22 universities in 22 low, middle income and emerging economy countries. This cross-sectional survey comprised of a self-administered questionnaire and collected anthropometric measurements. The study population was 6773 (43.2%) males and 8913 (56.8%) females, aged 16 to 30 years (mean 20.8 years, SD = 2.6). Body mass index (BMI) was used for weight status. Among men, the prevalence of underweight was 10.8%, normal weight 64.4%, overweight 18.9% and obesity 5.8%, while among women, the prevalence of underweight was 17.6%, normal weight 62.1%, overweight 14.1% and obesity 5.2%. Overall, 22% were overweight or obese (24.7% men and 19.3% women). In multivariate regression among men, younger age, coming from a higher income country, consciously avoiding fat and cholesterol, physically inactivity, current tobacco use and childhood physical abuse, and among women older age, coming from a higher income country, frequent organized religious activity, avoiding fat and cholesterol, posttraumatic stress symptoms and physical childhood abuse were associated overweight or obesity. Several gender specific risk factors identified can be utilized in health promotion programmes.
Peltzer, Karl; Pengpid, Supa; Samuels, T. Alafia; Özcan, Neslihan Keser; Mantilla, Carolina; Rahamefy, Onja H.; Wong, Mee Lian; Gasparishvili, Alexander
2014-01-01
Obesity among young people increases lifetime cardiovascular risk. This study assesses the prevalence of overweight/obesity and its associated factors among a random sample of university students from 22 universities in 22 low, middle income and emerging economy countries. This cross-sectional survey comprised of a self-administered questionnaire and collected anthropometric measurements. The study population was 6773 (43.2%) males and 8913 (56.8%) females, aged 16 to 30 years (mean 20.8 years, SD = 2.6). Body mass index (BMI) was used for weight status. Among men, the prevalence of underweight was 10.8%, normal weight 64.4%, overweight 18.9% and obesity 5.8%, while among women, the prevalence of underweight was 17.6%, normal weight 62.1%, overweight 14.1% and obesity 5.2%. Overall, 22% were overweight or obese (24.7% men and 19.3% women). In multivariate regression among men, younger age, coming from a higher income country, consciously avoiding fat and cholesterol, physically inactivity, current tobacco use and childhood physical abuse, and among women older age, coming from a higher income country, frequent organized religious activity, avoiding fat and cholesterol, posttraumatic stress symptoms and physical childhood abuse were associated overweight or obesity. Several gender specific risk factors identified can be utilized in health promotion programmes. PMID:25050651
Camargo, U; Toledo, R A; Cintra, J R; Nunes, D P T; Acayaba de Toledo, R; Brandão de Mattos, C C; Mattos, L C
2012-05-07
Genes located outside the HLA region (6p21) have been considered as candidates for susceptibility to ankylosing spondylitis. We tested the hypothesis that the G22A polymorphism of the adenosine deaminase gene (ADA; 20q13.11) is associated with ankylosing spondylitis in 166 Brazilian subjects genotyped for the HLA*27 gene (47 patients and 119 controls matched for gender, age and geographic origin). The HLA-B*27 gene and the G22A ADA polymorphism were identified by PCR with sequence-specific oligonucleotide probes and PCR-RFLP, respectively. There were no significant differences in frequencies of ADA genotypes [odds ratio (OR) = 1.200, 95% confidence interval (CI) = 0.3102-4.643, P > 0.8] and ADA*01 and ADA*02 alleles (OR = 1.192, 95%CI = 0.3155-4.505, P > 0.8) in patients versus controls. We conclude that the G22A polymorphism is not associated with ankylosing spondylitis.
48 CFR 22.804-2 - Construction.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Construction. 22.804-2... Construction. (a) Construction contractors that hold a nonexempt (see 22.807) Government construction contract... affirmative action requirements that specify goals for minorities and women in covered construction trades...
48 CFR 22.102-2 - Administration.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Administration. 22.102-2 Section 22.102-2 Federal Acquisition Regulations System FEDERAL ACQUISITION REGULATION SOCIOECONOMIC... facilities, including requirements for workers in all occupations and skills from local labor market areas or...
Directory of Open Access Journals (Sweden)
Joensson Eva
2006-06-01
Full Text Available Abstract Background Low-carbohydrate diets in the management of obese patients with type 2 diabetes seem intuitively attractive due to their potent antihyperglycemic effect. We previously reported that a 20 % carbohydrate diet was significantly superior to a 55–60 % carbohydrate diet with regard to bodyweight and glycemic control in 2 non-randomised groups of obese diabetes patients observed closely over 6 months. The effect beyond 6 months of reduced carbohydrate has not been previously reported. The objective of the present study, therefore, was to determine to what degree the changes among the 16 patients in the low-carbohydrate diet group at 6-months were preserved or changed 22 months after start, even without close follow-up. In addition, we report that, after the 6 month observation period, two thirds of the patients in the high-carbohydrate changed their diet. This group also showed improvement in bodyweight and glycemic control. Method Retrospective follow-up of previously studied subjects on a low carbohydrate diet. Results The mean bodyweight at the start of the initial study was 100.6 ± 14.7 kg. At six months it was 89.2 ± 14.3 kg. From 6 to 22 months, mean bodyweight had increased by 2.7 ± 4.2 kg to an average of 92.0 ± 14.0 kg. Seven of the 16 patients (44% retained the same bodyweight from 6 to 22 months or reduced it further; all but one had lower weight at 22 months than at the beginning. Initial mean HbA1c was 8.0 ± 1.5 %. After 6 and 12 months it was 6.6 ± 1.0 % and 7.0 ± 1.3 %, respectively. At 22 months, it was still 6.9 ± 1.1 %. Conclusion Advice on a 20 % carbohydrate diet with some caloric restriction to obese patients with type 2 diabetes has lasting effect on bodyweight and glycemic control.
Yrast and high spin states in 22Ne
International Nuclear Information System (INIS)
Szanto, E.M.; Toledo, A.S. de
1982-08-01
High spin states in 22 Ne have been investigated by the reactions 11 B( 13 C,d) 22 Ne and 13 C( 11 B,d) 22 Ne up to E* approximately=19 MeV. Yrast states were observed at 11.02 MeV (8 + ) and 15.46 MeV (10 + ) excitation energy. A backbending in 22 Ne is observed around spin 8 + . The location of high spin states I [pt
49 CFR 845.22 - Technical panel.
2010-10-01
... 49 Transportation 7 2010-10-01 2010-10-01 false Technical panel. 845.22 Section 845.22... Technical panel. The Director, Bureau of Accident Investigation, or the Director, Bureau of Field Operations, shall designate members of the Board's technical staff to participate in the hearing and initially...
7 CFR 993.22 - Consumer package.
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Consumer package. 993.22 Section 993.22 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing Agreements... weight of mixed dried fruit in the lot consists of standard processed prunes or standard prunes. ...
Yu, Qingzhong; Estevez, Carlos N; Roth, Jason P; Hu, Haixia; Zsak, Laszlo
2011-06-01
The second matrix (M2) gene of avian metapneumovirus subgroup C (aMPV-C) contains two overlapping open reading frames (ORFs), encoding two putative proteins, M2-1 and M2-2. Both proteins are believed to be involved in viral RNA transcription or replication. To further characterize the function of the M2-2 protein in virus replication, the non-overlapping region of the M2-2 ORF was deleted from an infectious cDNA clone of the aMPV-C strain, and a viable virus was rescued by using reverse genetics technology. The recombinant virus, raMPV-C ΔM2-2, was characterized in vitro and in vivo. In Vero cells, raMPV-C ΔM2-2 replicated slightly less efficiently than the parental virus, 10-fold reduction at 48-h post-infection. The raMPV-C ΔM2-2 virus induced typical cytopathic effects (CPE) that were indistinguishable from those seen with the parental virus infection. In specific-pathogen-free (SPF) turkeys, raMPV-C ΔM2-2 was attenuated and caused no clinical signs of disease. Less than 20% of the inoculated birds shed detectable virus in tracheal tissue during the first 5 days post-infection, and no virus shedding was detected afterward. Forty percent of infected birds produced a weak antibody response at 14 days post-infection. Upon challenge with a virulent aMPV-C strain, more than 80% of the raMPV-C ΔM2-2-inoculated birds showed typical disease signs and virus shedding in tracheal tissue. These results suggest that the M2-2 protein of aMPV-C virus is not essential for virus replication in vitro, but is required for sufficient virus replication to maintain pathogenicity and immunogenicity in the natural host.
Congenital Heart Disease as a Warning Sign for the Diagnosis of the 22q11.2 Deletion
Directory of Open Access Journals (Sweden)
Marcília S. Grassi
2014-11-01
Full Text Available Background: To alert for the diagnosis of the 22q11.2 deletion syndrome (22q11.2DS in patients with congenital heart disease (CHD. Objective: To describe the main CHDs, as well as phenotypic, metabolic and immunological findings in a series of 60 patients diagnosed with 22q11.2DS. Methods: The study included 60 patients with 22q11.2DS evaluated between 2007 and 2013 (M:F=1.3, age range 14 days to 20 years and 3 months at a pediatric reference center for primary immunodeficiencies. The diagnosis was established by detection of the 22q11.2 microdeletion using FISH (n = 18 and/or MLPA (n = 42, in association with clinical and laboratory information. Associated CHDs, progression of phenotypic facial features, hypocalcemia and immunological changes were analyzed. Results: CHDs were detected in 77% of the patients and the most frequent type was tetralogy of Fallot (38.3%. Surgical correction of CHD was performed in 34 patients. Craniofacial dysmorphisms were detected in 41 patients: elongated face (60% and/or elongated nose (53.3%, narrow palpebral fissure (50%, dysplastic, overfolded ears (48.3%, thin lips (41.6%, elongated fingers (38.3% and short stature (36.6%. Hypocalcemia was detected in 64.2% and decreased parathyroid hormone (PTH level in 25.9%. Decrease in total lymphocytes, CD4 and CD8 counts were present in 40%, 53.3% and 33.3%, respectively. Hypogammaglobulinemia was detected in one patient and decreased concentrations of immunoglobulin M (IgM in two other patients. Conclusion: Suspicion for 22q11.2DS should be raised in all patients with CHD associated with hypocalcemia and/or facial dysmorphisms, considering that many of these changes may evolve with age. The 22q11.2 microdeletion should be confirmed by molecular testing in all patients.
Congenital Heart Disease as a Warning Sign for the Diagnosis of the 22q11.2 Deletion
International Nuclear Information System (INIS)
Grassi, Marcília S.; Jacob, Cristina M. A.; Kulikowski, Leslie D.; Pastorino, Antonio C.; Dutra, Roberta L.; Miura, Nana; Jatene, Marcelo B.; Pegler, Stephanie P.; Kim, Chong A.; Carneiro-Sampaio, Magda
2014-01-01
To alert for the diagnosis of the 22q11.2 deletion syndrome (22q11.2DS) in patients with congenital heart disease (CHD). To describe the main CHDs, as well as phenotypic, metabolic and immunological findings in a series of 60 patients diagnosed with 22q11.2DS. The study included 60 patients with 22q11.2DS evaluated between 2007 and 2013 (M:F=1.3, age range 14 days to 20 years and 3 months) at a pediatric reference center for primary immunodeficiencies. The diagnosis was established by detection of the 22q11.2 microdeletion using FISH (n = 18) and/or MLPA (n = 42), in association with clinical and laboratory information. Associated CHDs, progression of phenotypic facial features, hypocalcemia and immunological changes were analyzed. CHDs were detected in 77% of the patients and the most frequent type was tetralogy of Fallot (38.3%). Surgical correction of CHD was performed in 34 patients. Craniofacial dysmorphisms were detected in 41 patients: elongated face (60%) and/or elongated nose (53.3%), narrow palpebral fissure (50%), dysplastic, overfolded ears (48.3%), thin lips (41.6%), elongated fingers (38.3%) and short stature (36.6%). Hypocalcemia was detected in 64.2% and decreased parathyroid hormone (PTH) level in 25.9%. Decrease in total lymphocytes, CD4 and CD8 counts were present in 40%, 53.3% and 33.3%, respectively. Hypogammaglobulinemia was detected in one patient and decreased concentrations of immunoglobulin M (IgM) in two other patients. Suspicion for 22q11.2DS should be raised in all patients with CHD associated with hypocalcemia and/or facial dysmorphisms, considering that many of these changes may evolve with age. The 22q11.2 microdeletion should be confirmed by molecular testing in all patients
Congenital Heart Disease as a Warning Sign for the Diagnosis of the 22q11.2 Deletion
Energy Technology Data Exchange (ETDEWEB)
Grassi, Marcília S., E-mail: marcilia.grassi@hc.fm.usp.br; Jacob, Cristina M. A. [Instituto da Criança - HC-FMUSP, São Paulo, SP (Brazil); Kulikowski, Leslie D. [Departamento de Patologia da Faculdade de Medicina da Universidade de São Paulo, São Paulo, SP (Brazil); Pastorino, Antonio C. [Instituto da Criança - HC-FMUSP, São Paulo, SP (Brazil); Dutra, Roberta L. [Departamento de Patologia da Faculdade de Medicina da Universidade de São Paulo, São Paulo, SP (Brazil); Miura, Nana; Jatene, Marcelo B. [Instituto do Coração - HC-FMUSP, São Paulo, SP (Brazil); Pegler, Stephanie P.; Kim, Chong A.; Carneiro-Sampaio, Magda [Instituto da Criança - HC-FMUSP, São Paulo, SP (Brazil)
2014-11-15
To alert for the diagnosis of the 22q11.2 deletion syndrome (22q11.2DS) in patients with congenital heart disease (CHD). To describe the main CHDs, as well as phenotypic, metabolic and immunological findings in a series of 60 patients diagnosed with 22q11.2DS. The study included 60 patients with 22q11.2DS evaluated between 2007 and 2013 (M:F=1.3, age range 14 days to 20 years and 3 months) at a pediatric reference center for primary immunodeficiencies. The diagnosis was established by detection of the 22q11.2 microdeletion using FISH (n = 18) and/or MLPA (n = 42), in association with clinical and laboratory information. Associated CHDs, progression of phenotypic facial features, hypocalcemia and immunological changes were analyzed. CHDs were detected in 77% of the patients and the most frequent type was tetralogy of Fallot (38.3%). Surgical correction of CHD was performed in 34 patients. Craniofacial dysmorphisms were detected in 41 patients: elongated face (60%) and/or elongated nose (53.3%), narrow palpebral fissure (50%), dysplastic, overfolded ears (48.3%), thin lips (41.6%), elongated fingers (38.3%) and short stature (36.6%). Hypocalcemia was detected in 64.2% and decreased parathyroid hormone (PTH) level in 25.9%. Decrease in total lymphocytes, CD4 and CD8 counts were present in 40%, 53.3% and 33.3%, respectively. Hypogammaglobulinemia was detected in one patient and decreased concentrations of immunoglobulin M (IgM) in two other patients. Suspicion for 22q11.2DS should be raised in all patients with CHD associated with hypocalcemia and/or facial dysmorphisms, considering that many of these changes may evolve with age. The 22q11.2 microdeletion should be confirmed by molecular testing in all patients.
Rare Genome-Wide Copy Number Variation and Expression of Schizophrenia in 22q11.2 Deletion Syndrome.
Bassett, Anne S; Lowther, Chelsea; Merico, Daniele; Costain, Gregory; Chow, Eva W C; van Amelsvoort, Therese; McDonald-McGinn, Donna; Gur, Raquel E; Swillen, Ann; Van den Bree, Marianne; Murphy, Kieran; Gothelf, Doron; Bearden, Carrie E; Eliez, Stephan; Kates, Wendy; Philip, Nicole; Sashi, Vandana; Campbell, Linda; Vorstman, Jacob; Cubells, Joseph; Repetto, Gabriela M; Simon, Tony; Boot, Erik; Heung, Tracy; Evers, Rens; Vingerhoets, Claudia; van Duin, Esther; Zackai, Elaine; Vergaelen, Elfi; Devriendt, Koen; Vermeesch, Joris R; Owen, Michael; Murphy, Clodagh; Michaelovosky, Elena; Kushan, Leila; Schneider, Maude; Fremont, Wanda; Busa, Tiffany; Hooper, Stephen; McCabe, Kathryn; Duijff, Sasja; Isaev, Karin; Pellecchia, Giovanna; Wei, John; Gazzellone, Matthew J; Scherer, Stephen W; Emanuel, Beverly S; Guo, Tingwei; Morrow, Bernice E; Marshall, Christian R
2017-11-01
Chromosome 22q11.2 deletion syndrome (22q11.2DS) is associated with a more than 20-fold increased risk for developing schizophrenia. The aim of this study was to identify additional genetic factors (i.e., "second hits") that may contribute to schizophrenia expression. Through an international consortium, the authors obtained DNA samples from 329 psychiatrically phenotyped subjects with 22q11.2DS. Using a high-resolution microarray platform and established methods to assess copy number variation (CNV), the authors compared the genome-wide burden of rare autosomal CNV, outside of the 22q11.2 deletion region, between two groups: a schizophrenia group and those with no psychotic disorder at age ≥25 years. The authors assessed whether genes overlapped by rare CNVs were overrepresented in functional pathways relevant to schizophrenia. Rare CNVs overlapping one or more protein-coding genes revealed significant between-group differences. For rare exonic duplications, six of 19 gene sets tested were enriched in the schizophrenia group; genes associated with abnormal nervous system phenotypes remained significant in a stepwise logistic regression model and showed significant interactions with 22q11.2 deletion region genes in a connectivity analysis. For rare exonic deletions, the schizophrenia group had, on average, more genes overlapped. The additional rare CNVs implicated known (e.g., GRM7, 15q13.3, 16p12.2) and novel schizophrenia risk genes and loci. The results suggest that additional rare CNVs overlapping genes outside of the 22q11.2 deletion region contribute to schizophrenia risk in 22q11.2DS, supporting a multigenic hypothesis for schizophrenia. The findings have implications for understanding expression of psychotic illness and herald the importance of whole-genome sequencing to appreciate the overall genomic architecture of schizophrenia.
Decreased DGCR8 expression and miRNA dysregulation in individuals with 22q11.2 deletion syndrome.
Directory of Open Access Journals (Sweden)
Chantal Sellier
Full Text Available Deletion of the 1.5-3 Mb region of chromosome 22 at locus 11.2 gives rise to the chromosome 22q11.2 deletion syndrome (22q11DS, also known as DiGeorge and Velocardiofacial Syndromes. It is the most common micro-deletion disorder in humans and one of the most common multiple malformation syndromes. The syndrome is characterized by a broad phenotype, whose characterization has expanded considerably within the last decade and includes many associated findings such as craniofacial anomalies (40%, conotruncal defects of the heart (CHD; 70-80%, hypocalcemia (20-60%, and a range of neurocognitive anomalies with high risk of schizophrenia, all with a broad phenotypic variability. These phenotypic features are believed to be the result of a change in the copy number or dosage of the genes located in the deleted region. Despite this relatively clear genetic etiology, very little is known about which genes modulate phenotypic variations in humans or if they are due to combinatorial effects of reduced dosage of multiple genes acting in concert. Here, we report on decreased expression levels of genes within the deletion region of chromosome 22, including DGCR8, in peripheral leukocytes derived from individuals with 22q11DS compared to healthy controls. Furthermore, we found dysregulated miRNA expression in individuals with 22q11DS, including miR-150, miR-194 and miR-185. We postulate this to be related to DGCR8 haploinsufficiency as DGCR8 regulates miRNA biogenesis. Importantly we demonstrate that the level of some miRNAs correlates with brain measures, CHD and thyroid abnormalities, suggesting that the dysregulated miRNAs may contribute to these phenotypes and/or represent relevant blood biomarkers of the disease in individuals with 22q11DS.
Rolla, Simona; Alchera, Elisa; Imarisio, Chiara; Bardina, Valentina; Valente, Guido; Cappello, Paola; Mombello, Cristina; Follenzi, Antonia; Novelli, Francesco; Carini, Rita
2016-02-01
The mechanisms responsible for the evolution of steatosis towards NASH (non-alcoholic steatohepatitis) and fibrosis are not completely defined. In the present study we evaluated the role of CD4(+) T-helper (Th) cells in this process. We analysed the infiltration of different subsets of CD4(+) Th cells in C57BL/6 mice fed on a MCD (methionine choline-deficient) diet, which is a model reproducing all phases of human NASH progression. There was an increase in Th17 cells at the beginning of NASH development and at the NASH-fibrosis transition, whereas levels of Th22 cells peaked between the first and the second expansion of Th17 cells. An increase in the production of IL (interleukin)-6, TNFα (tumour necrosis factor α), TGFβ (transforming growth factor β) and CCL20 (CC chemokine ligand 20) accompanied the changes in Th17/Th22 cells. Livers of IL-17(-/-) mice were protected from NASH development and characterized by an extensive infiltration of Th22 cells. In vitro, IL-17 exacerbated the JNK (c-Jun N-terminal kinase)-dependent mouse hepatocyte lipotoxicity induced by palmitate. IL-22 prevented lipotoxicity through PI3K (phosphoinositide 3-kinase)-mediated inhibition of JNK, but did not play a protective role in the presence of IL-17, which up-regulated the PI3K/Akt inhibitor PTEN (phosphatase and tensin homologue deleted on chromosome 10). Consistently, livers of IL-17(-/-) mice fed on the MCD diet displayed decreased activation of JNK, reduced expression of PTEN and increased phosphorylation of Akt compared with livers of wild-type mice. Hepatic infiltration of Th17 cells is critical for NASH initiation and development of fibrosis in mice, and reflects an infiltration of Th22 cells. Th22 cells are protective in NASH, but only in the absence of IL-17. These data strongly support the potentiality of clinical applications of IL-17 inhibitors that can prevent NASH by both abolishing the lipotoxic action of IL-17 and allowing IL-22-mediated protection. © 2016 Authors
Movement Demands of Elite Under-20s and Senior International Rugby Union Players.
Directory of Open Access Journals (Sweden)
Daniel J Cunningham
Full Text Available This study compared the movement demands of elite international Under-20 age grade (U20s and senior international rugby union players during competitive tournament match play. Forty elite professional players from an U20 and 27 elite professional senior players from international performance squads were monitored using 10Hz global positioning systems (GPS during 15 (U20s and 8 (senior international tournament matches during the 2014 and 2015 seasons. Data on distances, velocities, accelerations, decelerations, high metabolic load (HML distance and efforts, and number of sprints were derived. Data files from players who played over 60 min (n = 258 were separated firstly into Forwards and Backs, and more specifically into six positional groups; FR-Front Row (prop & hooker, SR-Second Row, BR-Back Row (Flankers & No.8, HB-Half Backs (scrum half & outside half, MF-Midfield (centres, B3 -Back Three (wings & full back for match analysis. Linear mixed models revealed significant differences between U20 and senior teams in both the forwards and backs. In the forwards the seniors covered greater HML distance (736.4 ± 280.3 vs 701.3 ± 198.7m, p = 0.01 and severe decelerations (2.38 ± 2.2 vs 2.28 ± 1.65, p = 0.05 compared to the U20s, but performed less relative HSR (3.1 ± 1.6 vs 3.2 ± 1.5, p < 0.01, moderate (19.4 ± 10.5 vs 23.6 ± 10.5, p = 0.01 and high accelerations (2.2 ± 1.9 vs 4.3 ± 2.7, p < 0.01 and sprint•min-1 (0.11 ± 0.06 vs 0.11 ± 0.05, p < 0.01. Senior backs covered a greater relative distance (73.3 ± 8.1 vs 69.1 ± 7.6 m•min-1, p < 0.01, greater High Metabolic Load (HML distance (1138.0 ± 233.5 vs 1060.4 ± 218.1m, p < 0.01, HML efforts (112.7 ± 22.2 vs 98.8 ± 21.7, p < 0.01 and heavy decelerations (9.9 ± 4.3 vs 9.5 ± 4.4, p = 0.04 than the U20s backs. However, the U20s backs performed more relative HSR (7.3 ± 2.1 vs 7.2 ± 2.1, p <0.01 and sprint•min-1 (0.26 ± 0.07 vs 0.25 ± 0.07, p < 0.01. Further investigation
22q11.2 Deletion syndrome is associated with perioperative outcome in tetralogy of Fallot.
Mercer-Rosa, Laura; Pinto, Nelangi; Yang, Wei; Tanel, Ronn; Goldmuntz, Elizabeth
2013-10-01
We sought to investigate the impact of 22q11.2 deletion on perioperative outcome in tetralogy of Fallot. We conducted a retrospective review of patients with tetralogy of Fallot who underwent complete surgical reconstruction at The Children's Hospital of Philadelphia between 1995 and 2006. Inclusion criteria included diagnosis of tetralogy of Fallot and known genotype. Fisher exact and Mann-Whitney tests were used for categoric and continuous variables, respectively. Regression analysis was used to determine whether deletion status predicts outcome. We studied 208 subjects with tetralogy of Fallot, 164 (79%) without and 44 (20%) with 22q11.2 deletion syndrome. There were no differences in sex, race, gestational age, age at diagnosis, admission weight, and duration of mechanical ventilation. Presenting anatomy, survival, complications and reoperations were also comparable between patients with and without 22q11.2 deletion syndrome. Those with 22q11.2 deletion syndrome had more aortopulmonary shunts preceding complete surgical repair (21% vs 7%, P = .02). This association was present after adjustment for presenting anatomy (stenosis, atresia, or absence of pulmonary valve and common atrioventricular canal) and surgical era. In addition, those with 22q11.2 deletion syndrome had longer cardiopulmonary bypass time (84 vs 72 minutes, P = .02) and duration of intensive care (6 vs 4 days, P = .007). Genotype affects early operative outcomes in tetralogy of Fallot resulting, in particular, in longer duration of intensive care. Future studies are required to determine factors contributing to such differences in this susceptible population. Copyright © 2013 The American Association for Thoracic Surgery. Published by Mosby, Inc. All rights reserved.
Understanding Large-scale Structure in the SSA22 Protocluster Region Using Cosmological Simulations
Topping, Michael W.; Shapley, Alice E.; Steidel, Charles C.; Naoz, Smadar; Primack, Joel R.
2018-01-01
We investigate the nature and evolution of large-scale structure within the SSA22 protocluster region at z = 3.09 using cosmological simulations. A redshift histogram constructed from current spectroscopic observations of the SSA22 protocluster reveals two separate peaks at z = 3.065 (blue) and z = 3.095 (red). Based on these data, we report updated overdensity and mass calculations for the SSA22 protocluster. We find {δ }b,{gal}=4.8+/- 1.8 and {δ }r,{gal}=9.5+/- 2.0 for the blue and red peaks, respectively, and {δ }t,{gal}=7.6+/- 1.4 for the entire region. These overdensities correspond to masses of {M}b=(0.76+/- 0.17)× {10}15{h}-1 {M}ȯ , {M}r=(2.15+/- 0.32)× {10}15{h}-1 {M}ȯ , and {M}t=(3.19+/- 0.40)× {10}15{h}-1 {M}ȯ for the red, blue, and total peaks, respectively. We use the Small MultiDark Planck (SMDPL) simulation to identify comparably massive z∼ 3 protoclusters, and uncover the underlying structure and ultimate fate of the SSA22 protocluster. For this analysis, we construct mock redshift histograms for each simulated z∼ 3 protocluster, quantitatively comparing them with the observed SSA22 data. We find that the observed double-peaked structure in the SSA22 redshift histogram corresponds not to a single coalescing cluster, but rather the proximity of a ∼ {10}15{h}-1 {M}ȯ protocluster and at least one > {10}14{h}-1 {M}ȯ cluster progenitor. Such associations in the SMDPL simulation are easily understood within the framework of hierarchical clustering of dark matter halos. We finally find that the opportunity to observe such a phenomenon is incredibly rare, with an occurrence rate of 7.4{h}3 {{{Gpc}}}-3. Based on data obtained at the W.M. Keck Observatory, which is operated as a scientific partnership among the California Institute of Technology, the University of California, and the National Aeronautics and Space Administration, and was made possible by the generous financial support of the W.M. Keck Foundation.
De novo interstitial deletions of 9q22.1-22.3 in two unrelated cases with different phenotype
Energy Technology Data Exchange (ETDEWEB)
Mohamed, A.N.; Bawle, E.; Conard, J. [Wayne State Univ., Detroit, MI (United States)] [and others
1994-09-01
Deletions involving the long arm of chromosome 9 are rare. A recent review, particularly with deletions of 9q22-32 region, failed to recognize a distinct pattern of dysmorphies and malformations. Herein, we described two phenotypically abnormal unrelated cases with interstitial deletion of chromosome 9 at band q22.1-q22.3. Parents of both cases exhibited normal karyotypes, indicating that the deletions were de novo events. Therefore, the clinical features present in these two cases can be attributed to partial monosomy for the deleted band 9q22. The first case was a 2-day-old baby with ambiguous genitalia, hydrocephalus, cleft palate and lip, polycystic kidney, absence of uterus on ultrasound and one gonad in the labiosacral region. Chromosome analysis showed a male karyotype, 46,XY,del(9)(q22.1q22.3). The absence of monosomy X cell line and the normal histology of testicular tissue were against the diagnosis of mixed gonadal dysgenesis or XY gonadal dysgenesis. The second 3-day-old newborn baby girl presented with right side hypoplastic heart and pulmonary atresia. In addition, the patient showed multiple dysmorphic features including epicanthal fold, low-set ears, depressed nasal bridge, hypertelorism, and micrognathia. The uvula is absent with slight cleft palate. Bilateral clinodactyly of 5th fingers and severe club feet were also present. The external genitalia was of a normal female phenotype. Chromosome study also indicated interstatial deletion of band 9q22. Although both cases appeared to have the same chromosomal anomalies, neither a discrete facial appearance nor a common pattern of malformations was noted.
International Nuclear Information System (INIS)
Boniface, G.R.; Lee, F.T.; Milner, L.J.; Walker, K.Z.
1990-01-01
The monoclonal antibody DD-3B6/22 recognizes the D-dimer (DD) epitope of human cross-linked fibrin and is currently being investigated as a potential thrombosis imaging agent. The pharmacokinetic profiles of 99m Tc labelled intact and Fab' fragments of DD-3B6/22 were determined in rabbits and gave whole body clearance estimates of 0.06 ± 0.01 and 1.61 ± 0.24 mL/min/kg respectively. The effect of heparin, radiological contrast media and free DD antigen levels on in vitro binding of 99m Tc-DD-3B6/22 Fab' was determined by inhibition assays to immobilized antigen and human clots. No effect on binding was demonstrated with heparin or contrast media at clinically significant concentrations. DD supernata concentrations of between 8-20 μg/mL were required to inhibit the in vitro binding 99m Tc-DD-3B6/22 Fab' to immobilized antigen or blood clot by 50%. Localisation studies of 99m Tc-DD-3B6/22 Fab' in a rabbit jugular vein clot model were carried out in animals co-administered free DD antigen. Results indicated minimal inhibition of 99m Tc-DD-3B6/22 Fab' clot localization after 4 hours up to a level of 16 μg/mL DD plasma concentration. These results suggest that thrombosis imaging with radiolabelled DD-3B6/22 should be unduly affected by the co-administration of heparin or venographic contrast media in the clinical setting, whilst free antigen effect should not occur within clinically relevant titres. 21 refs., 2 tabs., 4 figs
18 CFR 420.22 - Prohibition; sanctions.
2010-04-01
... 18 Conservation of Power and Water Resources 2 2010-04-01 2010-04-01 false Prohibition; sanctions. 420.22 Section 420.22 Conservation of Power and Water Resources DELAWARE RIVER BASIN COMMISSION... established water pricing schedules of the Commission) of any such use, withdrawal or diversion, and invoke...
36 CFR 2.2 - Wildlife protection.
2010-07-01
... 36 Parks, Forests, and Public Property 1 2010-07-01 2010-07-01 false Wildlife protection. 2.2... PROTECTION, PUBLIC USE AND RECREATION § 2.2 Wildlife protection. (a) The following are prohibited: (1) The taking of wildlife, except by authorized hunting and trapping activities conducted in accordance with...
48 CFR 22.602 - Statutory requirements.
2010-10-01
... PROGRAMS APPLICATION OF LABOR LAWS TO GOVERNMENT ACQUISITIONS Walsh-Healey Public Contracts Act 22.602 Statutory requirements. Except for the exemptions at 22.604, all contracts subject to the Walsh-Healey Public Contracts Act (the Act) (41 U.S.C. 35-45) and entered into by any executive department...
27 CFR 11.22 - Consignment sales.
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Consignment sales. 11.22... OF THE TREASURY LIQUORS CONSIGNMENT SALES Unlawful Sales Arrangements § 11.22 Consignment sales. Consignment sales are arrangements wherein the trade buyer is under no obligation to pay for distilled spirits...
Energy Technology Data Exchange (ETDEWEB)
Becheva, E
2004-11-01
Elastic and inelastic proton scattering on the unstable nuclei {sup 22}O was measured in inverse kinematics at the GANIL facility. A secondary beam of {sup 22}O at 46.6 MeV/A with intensity of {approx} 1000 pps, impinged on a (CH{sub 2}){sub n} target. Recoiling protons were detected in the silicon strip array MUST. We measured the angular distributions of the ground and 2{sub 1}{sup +} states of {sup 22}O. Phenomenological and microscopic analysis of the data were performed. The phenomenological analysis using a global potential parameterization of Becchetti and Greenlees and CH89 yields a value of the deformation parameter {beta}{sub p,p}, = 0.23{+-}0.04 for {sup 22}O, much lower than that of {sup 20}O. The ratio of neutron and proton matrix element M{sub n}/M{sub p} is found equal to 1.46{+-}0.50. The microscopic analysis used of densities and transition densities calculated within HFB and QRPA models respectively. Optical potential were obtained through both folding and JLM procedures. A ratio M{sub n}/M{sub p}=2.5{+-}1.0 is deduced. Contrary of {sup 20}O, {sup 22}O behaviours like a doubly magic nucleus, suggesting a pronounced sub-shell closure at N=14. To develop the study of direct reactions induced by radioactive beams, we have developed and built, a new multi-detector MUST II devoted to light charged particle detection. In this work we established the requirements for the CsI(Tl) detector stage, and test four CsI detector prototypes, constructed by the SCIONIX company. (author)
Goupil, Mathieu; Cousineau-Côté, Vincent; Aumont, Francine; Sénéchal, Serge; Gaboury, Louis; Hanna, Zaher; Jolicoeur, Paul; de Repentigny, Louis
2014-10-26
The tissue-signaling cytokines IL-17 and IL-22 are critical to host defense against oral Candida albicans infection, by their induction of oral antimicrobial peptide expression and recruitment of neutrophils. Mucosal Th17 cells which produce these cytokines are preferentially depleted in HIV-infected patients. Here, we tested the hypothesis that defective IL-17- and IL-22-dependent host responses to C. albicans determine the phenotype of susceptibility to oropharyngeal candidiasis (OPC) in transgenic (Tg) mice expressing HIV-1. Naïve CD4+ T-cells and the differentiated Th1, Th2, Th17, Th1Th17 and Treg lineages were all profoundly depleted in cervical lymph nodes (CLNs) of these Tg mice. However, naive CD4+ cells from Tg mice maintained the capacity to differentiate into these lineages in response to polarizing cytokines in vitro. Expression of Il17, Il22, S100a8 and Ccl20 was enhanced in oral mucosal tissue of non-Tg, but not of Tg mice, after oral infection with C. albicans. Treatment of infected Tg mice with the combination of IL-17 and IL-22, but not IL-17 or Il-22 alone, significantly reduced oral burdens of C. albicans and abundance of Candida hyphae in the epithelium of tongues of infected Tg mice, and restored the ability of the Tg mice to up-regulate expression of S100a8 and Ccl20 in response to C. albicans infection. These findings demonstrate that defective IL-17- and IL-22-dependent induction of innate mucosal immunity to C. albicans is central to the phenotype of susceptibility to OPC in these HIV transgenic mice.
International Nuclear Information System (INIS)
Kappernman, J.G.; Albertson, V.D.
1991-01-01
This paper reports that for many electric utility systems, Solar Cycle 22 has been the first introduction to the phenomena of Geomagnetic Disturbances and the disrupting and damaging effects that they can have upon modern power systems. For all intents and purposes, Power Industry awareness of Cycle 22 started with a bang during the Great Geomagnetic Storm of March 13, 1989. This storm caused a blackout to the entire Province of Quebec, permanently damaged a large nuclear plant GSU transformer in New Jersey, and created enough havoc across the entire North American power grid to create the plausible threat of a massive power system blackout. The flurry of activity and investigation that followed has led many engineers to realize that their power systems are indeed vulnerable to this phenomena and if anything are becoming ever more vulnerable as the system grows to meet future requirements. As a result some organizations such as Hydro Quebec, PSE and G, and the PJM Pool now implement strategic measures as a remedial response to detection of geomagnetic storm conditions. Many more companies pay particularly close attention to storm forecasts and alerts, and the industry in general has accelerated research and monitoring activities through their own means of in concert with the Electric Power Research Institute (EPRI)
44 CFR 62.22 - Judicial review.
2010-10-01
... of process for all judicial proceedings where a claimant is suing the Administrator of FEMA pursuant... 44 Emergency Management and Assistance 1 2010-10-01 2010-10-01 false Judicial review. 62.22... ADJUSTMENT OF CLAIMS Claims Adjustment, Claims Appeals, and Judicial Review § 62.22 Judicial review. (a) Upon...
De Luca, Maria Antonietta; Castelli, M Paola; Loi, Barbara; Porcu, Alessandra; Martorelli, Mariella; Miliano, Cristina; Kellett, Kathryn; Davidson, Colin; Stair, Jacqueline L; Schifano, Fabrizio; Di Chiara, Gaetano
2016-06-01
In order to investigate the in vivo dopamine (DA) stimulant properties of selected 3rd generation Spice/K2 cannabinoids, BB-22, 5F-PB-22, 5F-AKB-48 and STS-135, their in vitro affinity and agonist potency at native rat and mice CB1 receptors was studied. The compounds bind with high affinity to CB1 receptors in rat cerebral cortex homogenates and stimulate CB1-induced [(35)S]GTPγS binding with high potency and efficacy. BB-22 and 5F-PB-22 showed the lowest Ki of binding to CB1 receptors (0.11 and 0.13 nM), i.e., 30 and 26 times lower respectively than that of JWH-018 (3.38 nM), and a potency (EC50, 2.9 and 3.7 nM, respectively) and efficacy (Emax, 217% and 203%, respectively) as CB1 agonists higher than JWH-018 (EC50, 20.2 nM; Emax, 163%). 5F-AKB-48 and STS-135 had higher Ki for CB1 binding, higher EC50 and lower Emax as CB1 agonists than BB-22 and 5F-PB-22 but still comparatively more favourable than JWH-018. The agonist properties of all the compounds were abolished or drastically reduced by the CB1 antagonist/inverse agonist AM251 (0.1 μM). No activation of G-protein was observed in CB1-KO mice. BB-22 (0.003-0.01 mg/kg i.v.) increased dialysate DA in the accumbens shell but not in the core or in the medial prefrontal cortex, with a bell shaped dose-response curve and an effect at 0.01 mg/kg and a biphasic time-course. Systemic AM251 (1.0 mg/kg i.p.) completely prevented the stimulant effect of BB-22 on dialysate DA in the NAc shell. All the other compounds increased dialysate DA in the NAc shell at doses consistent with their in vitro affinity for CB1 receptors (5F-PB-22, 0.01 mg/kg; 5F-AKB-48, 0.1 mg/kg; STS-135, 0.15 mg/kg i.v.). 3rd generation cannabinoids can be even more potent and super-high CB1 receptor agonists compared to JWH-018. Future research will try to establish if these properties can explain the high toxicity and lethality associated with these compounds. Copyright © 2015 Elsevier Ltd. All rights reserved.
Dallmeijer, A.J.; Scholtes, V.A.B.; Brehm, M.A.; Becher, J.G.
2013-01-01
OBJECTIVE: The aim of this study was to determine the test-retest reliability of the 20-sec Wingate anaerobic test in children with cerebral palsy. DESIGN: Participants were 22 ambulant children with cerebral palsy, with Gross Motor Function Classification System levels I (limitations in advanced
Dallmeijer, Annet J.; Scholtes, Vanessa A. B.; Brehm, Merel-Anne; Becher, Jules G.
2013-01-01
Objective: The aim of this study was to determine the test-retest reliability of the 20-sec Wingate anaerobic test in children with cerebral palsy. Design: Participants were 22 ambulant children with cerebral palsy, with Gross Motor Function Classification System levels I (limitations in advanced
7 CFR 22.304 - Multiyear planning and programming.
2010-01-01
... 7 Agriculture 1 2010-01-01 2010-01-01 false Multiyear planning and programming. 22.304 Section 22.304 Agriculture Office of the Secretary of Agriculture RURAL DEVELOPMENT COORDINATION Roles and Responsibilities of State Governments § 22.304 Multiyear planning and programming. State and multicounty...
50 CFR 253.22 - State projects.
2010-10-01
... 50 Wildlife and Fisheries 7 2010-10-01 2010-10-01 false State projects. 253.22 Section 253.22... State projects. (a) General—(1) Designation of state agency. The Governor of each state shall notify the... participation under the Act, to sign project documents, and to receive payments. (2) States that choose to...
Intercomparison of delayed neutron summation calculations among JEF2.2, ENDF/B-VI and JNDC-V2
Energy Technology Data Exchange (ETDEWEB)
Sagisaka, Mitsuyuki [Nagoya Univ. (Japan); Oyamatsu, K.; Kukita, Y.
1998-03-01
We perform intercomparison of delayed neutron activities calculated with JEF2.2, ENDF/B-VI and JNDC-V2 with a simple new method. Significant differences are found at t < 20 (s) for major fissioning systems. The differences are found to stem from fission yields or decay data of several nuclides. The list of these nuclides are also given for the future experimental determination of these nuclear data. (author)
Sinter ageing of equiatomic Al20Co20Cu20Zn20Ni20 high entropy alloy via mechanical alloying
International Nuclear Information System (INIS)
Mohanty, Sutanuka; Gurao, N.P.; Biswas, Krishanu
2014-01-01
The present investigation reports for the first time, the sinter ageing of equiatomic Al 20 Co 20 Cu 20 Ni 20 Zn 20 high entropy alloy (HEA), being synthesized by high energy ball milling of elemental powder blend under protective argon atmosphere, followed by consolidation of the milled powder by spark plasma sintering at different temperatures and applied pressure of 50 MPa. The detailed X-ray diffraction and transmission electron microscopy (TEM) studies indicate the presence of single phase, FCC β supersaturated solid solution in the ball milled powder. However, the sintering of the as-milled powder reveals the formation of α with ordered FCC (L1 2 ) structure within the grains of FCC γ. The microstructural analysis using TEM shows the precipitation of near cuboidal shaped α phase within the grains of γ. The size and shape of the precipitates depend on the sintering temperature. Hardness measurement of the sintered alloys suggests age hardening of the as-milled powder during sintering. The sinter age hardening of HEA is attributed to the fine scale precipitation of α phase. Detailed variation of the hardness and microstructural evolution are reported here to elucidate this novel finding
International Nuclear Information System (INIS)
Adhikari, S.; Basu, C.; Mitra, A.K.; Behera, B.R.; Ray, S.; Kumar, Suresh; Chatterjee, A.
2008-01-01
The nucleus 22 Ne like 18 O and 20 Ne has been sparsely investigated experimentally for an 18 O + α cluster structure. Only one experiment has reported the 22 Ne alpha cluster states using the same reaction but a much higher energy. One other experiment also reported the states with a different target and the results of these experiments are different. Therefore the 22 Ne structure has been analyzed in this work
Amini Behbahani A; Sattari M; Mofid R; Ganji A
2014-01-01
IL-22 is a cytokine that is assumed to improve anti-microbial defense of epidermal and epithelial cells and the cells of gastrointestinal and respiratory systems. With respect to absence of enough relevant articles in this regard the aim of this study was to evaluate the correlation between IL-22 gene expression in gingival tissues as well as its concentration in GCF and periodontal diseases. Gingival samples obtained from 60 patients of three different groups (healthy, gingivitis and chronic...
2018-04-22T22:05:49Z https://www.ajol.info/index.php/all/oai oai:ojs ...
African Journals Online (AJOL)
article/72344 2018-04-22T22:05:48Z afrrev:ART The Subtle Plague: Materialistic Visage of Neocolonialism and Its Consequences in Armah's Fragments Ogbeide, OV This paper examines the materialistic visage of neocolonialism in Ayi ...
International Nuclear Information System (INIS)
Qu Weizheng; Zhao Jinping; Huang Fei; Deng Shenggui
2012-01-01
According to the variation pattern of the solar magnetic field polarity and its relation to the relative sunspot number, we established the time series of the sunspot magnetic field polarity index and analyzed the strength and polarity cycle characteristics of the solar magnetic field. The analysis showed the existence of a cycle with about a 22-year periodicity in the strength and polarity of the solar magnetic field, which proved the Hale proposition that the 11-year sunspot cycle is one-half of the 22-year solar magnetic cycle. By analyzing the atmospheric temperature field, we found that the troposphere and the stratosphere in the middle latitude of both the northern and southern hemispheres exhibited a common 22-year quasicycle in the atmospheric temperature, which is believed to be attributable to the 22-year solar magnetic cycle.
49 CFR 218.22 - Utility employee.
2010-10-01
... 49 Transportation 4 2010-10-01 2010-10-01 false Utility employee. 218.22 Section 218.22... employee. (a) A utility employee shall be subject to the Hours of Service Act, and the requirements for... parts 217, 219, and 228 of this chapter. (b) A utility employee shall perform service as a member of...
Directory of Open Access Journals (Sweden)
G. Mevi
2018-02-01
Full Text Available The new ground-based 22 GHz spectrometer, VESPA-22 (water Vapor Emission Spectrometer for Polar Atmosphere at 22 GHz measures the 22.23 GHz water vapor emission line with a bandwidth of 500 MHz and a frequency resolution of 31 kHz. The integration time for a measurement ranges from 6 to 24 h, depending on season and weather conditions. Water vapor spectra are collected using the beam-switching technique. VESPA-22 is designed to operate automatically with little maintenance; it employs an uncooled front-end characterized by a receiver temperature of about 180 K and its quasi-optical system presents a full width at half maximum of 3.5°. Every 30 min VESPA-22 measures also the sky opacity using the tipping curve technique. The instrument calibration is performed automatically by a noise diode; the emission temperature of this element is estimated twice an hour by observing alternatively a black body at ambient temperature and the sky at an elevation of 60°. The retrieved profiles obtained inverting 24 h integration spectra present a sensitivity larger than 0.8 from about 25 to 75 km of altitude during winter and from about 30 to 65 km during summer, a vertical resolution from about 12 to 23 km (depending on altitude, and an overall 1σ uncertainty lower than 7 % up to 60 km altitude and rapidly increasing to 20 % at 75 km. In July 2016, VESPA-22 was installed at the Thule High Arctic Atmospheric Observatory located at Thule Air Base (76.5° N, 68.8° W, Greenland, and it has been operating almost continuously since then. The VESPA-22 water vapor mixing ratio vertical profiles discussed in this work are obtained from 24 h averaged spectra and are compared with version 4.2 of concurrent Aura/Microwave Limb Sounder (MLS water vapor vertical profiles. In the sensitivity range of VESPA-22 retrievals, the intercomparison from July 2016 to July 2017 between VESPA-22 dataset and Aura/MLS dataset
The 20-20-20 Package. Reform of Ets and scenarios cost analysis
International Nuclear Information System (INIS)
Clo, S.
2008-01-01
This article firstly analyses the important improvements that the European Commission indents to bring to the Ets, to its framework and functioning. The article intends to assess the impact of the 20-20-20 Package to the Italian industry, by analysing the different cost scenarios presented in the European Commission Impact Assessment. [it
1974-08-31
IPACK INCISION/WOUNO/CAVITY 30 IESTABLISH DRAINAGE IN PERIAPICAL ABSCESS 31 IESTABLISH DRAINAGE IN PERIODONTAL CYST/ ABSCESS 32 IINSERT DRAIN/WOUND...Medicine 20 Submarine Medicine 07 Internal Medicine 21 General Dentistry 08 Obstetrics/Gynecology 22 Endodontics 09 Ophthalmology 23 Periodontics 10...FOR PLACUE INOEX 14 ISCORE PLAQUE INDEX 15 ICHART PLAQUE INDEX 16 JEXAMINE MOUTH FOR PERIODONTAL . INDEXJ 17 ISCORE PERIO DISEASE INDEX 18 ICHART
22 CFR 127.10 - Civil penalty.
2010-04-01
... 22 Foreign Relations 1 2010-04-01 2010-04-01 false Civil penalty. 127.10 Section 127.10 Foreign... Civil penalty. (a) The Assistant Secretary of State for Political-Military Affairs is authorized to impose a civil penalty in an amount not to exceed that authorized by 22 U.S.C. 2778, 2779a and 2780 for...
Directory of Open Access Journals (Sweden)
Phelan Mary C
2008-05-01
Full Text Available Abstract The deletion 22q13.3 syndrome (deletion 22q13 syndrome or Phelan-McDermid syndrome is a chromosome microdeletion syndrome characterized by neonatal hypotonia, global developmental delay, normal to accelerated growth, absent to severely delayed speech, and minor dysmorphic features. The deletion occurs with equal frequency in males and females and has been reported in mosaic and non-mosaic forms. Due to lack of clinical recognition and often insufficient laboratory testing, the syndrome is under-diagnosed and its true incidence remains unknown. Common physical traits include long eye lashes, large or unusual ears, relatively large hands, dysplastic toenails, full brow, dolicocephaly, full cheeks, bulbous nose, and pointed chin. Behavior is autistic-like with decreased perception of pain and habitual chewing or mouthing. The loss of 22q13.3 can result from simple deletion, translocation, ring chromosome formation and less common structural changes affecting the long arm of chromosome 22, specifically the region containing the SHANK3 gene. The diagnosis of deletion 22q13 syndrome should be considered in all cases of hypotonia of unknown etiology and in individuals with absent speech. Although the deletion can sometimes be detected by high resolution chromosome analysis, fluorescence in situ hybridization (FISH or array comparative genomic hybridization (CGH is recommended for confirmation. Differential diagnosis includes syndromes associated with hypotonia, developmental delay, speech delay and/or autistic-like affect (Prader-Willi, Angelman, Williams, Smith-Magenis, Fragile X, Sotos, FG, trichorhinophalangeal and velocardiofacial syndromes, autism spectrum disorders, cerebral palsy. Genetic counseling is recommended and parental laboratory studies should be considered to identify cryptic rearrangements and detect parental mosaicism. Prenatal diagnosis should be offered for future pregnancies in those families with inherited rearrangements
Electronic and ionization spectra of 1,1-diamino-2,2-dinitroethylene, FOX-7.
Borges, Itamar
2014-03-01
Singlet, triplet and ionized states of the energetic molecule 1,1-diamino-2,2-dinitroethylene, known as FOX-7 or DADNE, were investigated using the symmetry-adapted-cluster configuration interaction (SAC-CI) ab initio wave function. The 20 computed singlet transitions, with 2 exceptions, were bright. The most intense singlet transitions were of the n₀→π type-typical of molecules having nitro groups. Fast intersystem crossing (ISC) from the 1¹A, 2¹A and 8¹A bright singlet transitions is possible. Other feasible ISC processes are discussed. The computed singlet and ionization spectra have similar features when compared to nitramide and N,N-dimethylnitramine molecules, which have only a nitro group. The ionization energies of the first 20 states have differences in comparison with Koopmans' energy values that can reach 3 eV. Moreover, the character of the first ionized states, dominated by single ionizations, is not the same when compared with the character resulting from application of Koopmans' theorem.
9 CFR 592.22 - Where service is offered.
2010-01-01
... 9 Animals and Animal Products 2 2010-01-01 2010-01-01 false Where service is offered. 592.22 Section 592.22 Animals and Animal Products FOOD SAFETY AND INSPECTION SERVICE, DEPARTMENT OF AGRICULTURE EGG PRODUCTS INSPECTION VOLUNTARY INSPECTION OF EGG PRODUCTS General § 592.22 Where service is offered...
40 CFR 22.52 - Information exchange and discovery.
2010-07-01
... Procedure Act § 22.52 Information exchange and discovery. Respondent's information exchange pursuant to § 22.19(a) shall include information on any economic benefit resulting from any activity or failure to act... 40 Protection of Environment 1 2010-07-01 2010-07-01 false Information exchange and discovery. 22...
10 CFR 473.22 - Initial review by manager.
2010-01-01
... 10 Energy 3 2010-01-01 2010-01-01 false Initial review by manager. 473.22 Section 473.22 Energy... Certification of Grants, Cooperative Agreements, Contracts, and Projects § 473.22 Initial review by manager. (a) Upon expiration of the time for filing information under these regulations, the manager shall— (1...
Ionospheric effects at low latitudes during the March 22, 1979, geomagnetic storm
International Nuclear Information System (INIS)
Fesen, C.G.; Crowley, G.; Roble, R.G.
1989-01-01
This paper investigates the response of the equatorial ionosphere to the neutral atmosphere perturbations produced by the magnetic storm of March 22, 1979. A numerical model of the equatorial ionosphere is used to calculate the maximum electron densities and F layer heights associated with a storm-perturbed neutral atmosphere and circulation model. Possible electric field perturbations due to the storm are ignored. The neutral atmosphere and dynamics are simulated by the National Center for Atmospheric Research thermospheric general circulation model (TGCM) for the storm day of March 22, 1979, and the preceding quiet day. The most striking feature of the TGCM storm day simulations is the presence of waves in the neutral composition, wind, and temperature fields which propagate from high latitudes to the equator. The TGCM-calculated fields for the two days are input into a low-latitude ionosphere model which calculates n max and h max between ±20 degree dip latitude. The calculated nighttime 6300-angstrom airglow emission and the altitude profiles of electron concentration are also highly perturbed by the storm. Examination of ionosonde data for March 22, 1979, shows remarkable agreement between the measured and predicted changes in f 0 F 2 and h max near 140 degree W. Poorer agreement near 70 degree W may be due to the neglect of electric field perturbations and the approximations inherent in the modeling. The results of these simulations indicate that the major factor influencing the storm time ionospheric behavior in this case is the neutral wind
Donnici,Claudio Luis; Máximo Filho,Daniel Henrique; Moreira,Leda Lúcia Cruz; Reis,Genuína Teixeira dos; Cordeiro,Estefania Santos; Oliveira,Ione Ma. Ferreira de; Carvalho,Sandra; Paniago,Eucler B.
1998-01-01
The preparation of key precursors for many 2,2’-bipyridine derivatives such as 4,4’-dicarboxy- 2,2’-bipyridine (I), 6,6’-dicarboxy-2,2’-bipyridine- acid (II), 4,4’-dinitro-2,2’-bipyridine-N,N-dioxide (III), 6,6’-dicarbothioamide-2,2’-bipyridine (IV) and mono-N-oxide-2,2’-bipyridine (VII) through more efficient methods is described. The syntheses of the novel ligands 4,4’-dihydroxamic-2,2’-bipyridine (V) and 6,6’-dihydroxamic-2,2’-bipyridine (VI) are also reported. Neste trabalho relatamos ...
Integrating web 2.0 in clinical research education in a developing country.
Amgad, Mohamed; AlFaar, Ahmad Samir
2014-09-01
The use of Web 2.0 tools in education and health care has received heavy attention over the past years. Over two consecutive years, Children's Cancer Hospital - Egypt 57357 (CCHE 57357), in collaboration with Egyptian universities, student bodies, and NGOs, conducted a summer course that supports undergraduate medical students to cross the gap between clinical practice and clinical research. This time, there was a greater emphasis on reaching out to the students using social media and other Web 2.0 tools, which were heavily used in the course, including Google Drive, Facebook, Twitter, YouTube, Mendeley, Google Hangout, Live Streaming, Research Electronic Data Capture (REDCap), and Dropbox. We wanted to investigate the usefulness of integrating Web 2.0 technologies into formal educational courses and modules. The evaluation survey was filled in by 156 respondents, 134 of whom were course candidates (response rate = 94.4 %) and 22 of whom were course coordinators (response rate = 81.5 %). The course participants came from 14 different universities throughout Egypt. Students' feedback was positive and supported the integration of Web 2.0 tools in academic courses and modules. Google Drive, Facebook, and Dropbox were found to be most useful.
7 CFR 318.13-22 - Bananas from Hawaii.
2010-01-01
... 7 Agriculture 5 2010-01-01 2010-01-01 false Bananas from Hawaii. 318.13-22 Section 318.13-22... SERVICE, DEPARTMENT OF AGRICULTURE STATE OF HAWAII AND TERRITORIES QUARANTINE NOTICES Regulated Articles From Hawaii and the Territories § 318.13-22 Bananas from Hawaii. (a) Green bananas (Musa spp.) of the...
7 CFR 46.22 - Accounting for dumped produce.
2010-01-01
... 7 Agriculture 2 2010-01-01 2010-01-01 false Accounting for dumped produce. 46.22 Section 46.22... Market Receivers § 46.22 Accounting for dumped produce. A clear and complete record shall be maintained..., shall be obtained to prove the produce was actually without commercial value, unless there is a specific...
Tetraethylammonium (2,2′-bipyridinetetracyanidocobaltate(III sesquihydrate acetonitrile solvate
Directory of Open Access Journals (Sweden)
Ganna Lyubartseva
2010-04-01
Full Text Available The title complex, (C8H20N[Co(CN4(C10H8N2]·CH3CN·1.5H2O, consists of tetraethyl ammonium cations, mononuclear [CoIIIbpy(CN4]− anions and uncoordinated water and acetonitrile molecules. The CoIII atom is six-coordinated by two 2,2′-bipyridine (bpy N atoms and four cyanide C atoms in a distorted octahedral geometry. The acute bite angle of the chelating bpy [82.28 (8°] is the main factor accounting for this distortion. In addition, the tetraethylammonium cation is significantly disordered [occupancy ratio 0.611 (3:0.389 (3]. The presence of water molecules, one of which is disordered over two positions about an inversion center, results in the formation of a network of O—H...N hydrogen bonds involving the cyanide N atoms.
4 CFR 22.4 - Appeal File [Rule 4].
2010-01-01
... alternative organization of the appeal file is permitted, such as by document type or topic, documents within... 4 Accounts 1 2010-01-01 2010-01-01 false Appeal File [Rule 4]. 22.4 Section 22.4 Accounts... OFFICE CONTRACT APPEALS BOARD § 22.4 Appeal File [Rule 4]. (a) Duties of the Contracting Officer. (1...
Erythrocyte 22Na+ influx in hypertension
International Nuclear Information System (INIS)
Shalev, O.; Eaton, J.W.; Ben-Ishay, D.
1984-01-01
We assessed 22Na+ uptake by erythrocytes (RBC) from 38 individuals with essential hypertension and 37 healthy controls. All subjects were male, white, non-obese and with normal renal function, obviating sex, race, hormonal, ponderal and renal factors known to influence RBC Na+ handling. The mean +/- sem 22Na+ uptake of the patients was 284 +/- 16 mumole/liter RBC/hour while that of normal controls was 249 +/- 11 mumole/liter RBC/hour; although the difference reached borderline significance, individual values showed considerable overlap. Consequently, in our population, RBC 22Na+ uptake is not a reliable marker for essential hypertension. We believe that previous studies should be reassessed with regard to patients' characteristics and future studies employ rigorous criteria in selection of subjects
Systematic structure of the neutron drip-line {sup 22}C nucleus
Energy Technology Data Exchange (ETDEWEB)
Ismail, Atef [Fundamental and Applied Sciences Department, Universiti Teknologi Petronas, Bandar Seri Iskandar, 31750 Tronoh, Perak, Malaysia and Department of Physics, Al-Azhar University, 71524 Assiut (Egypt); Cheong, Lee Yen; Yahya, Noorhana [Fundamental and Applied Sciences Department, Universiti Teknologi PETRONAS, Bandar Seri Iskandar, 31750 Tronoh, Perak (Malaysia); Tammam, M. [Department of Physics, Al-Azhar University, 71524 Assiut (Egypt)
2014-10-24
In the present work we systematically discuss the nuclear structure of the the heaviest particle-bound carbon isotope, {sup 22}C. The ground state wave function of the carbon isotope is calculated using the {sup 20}C core plus two-valence neutron based on a phenomenological mean-field MF potential. We apply the deduced wave function to provide the nuclear matter density which is necessary in the calculations of the total reaction cross section. Calculations show that there is a reasonable good description of the experimental binding energy BE and root-mean square RMS radius. The exotic structure and configuration of the ground state carbon isotope is explained and a consistent explanation on the two-neutron halo (Borromean) nucleus is given.
Tween 20 increases intestinal transport of doxorubicin in vitro but not in vivo
DEFF Research Database (Denmark)
Al-Sharaf, Amal; Holm, Rene; Nielsen, Carsten Uhd
2016-01-01
co-administered with P-gp inhibitors (non-ionic surfactants) in vitro and in vivo . The aim of the present study was thus to investigate if different non-ionic surfactants would have a similar effect on the in vitro and in vivo absorption of doxorubicin. This was investigated in vitro in Caco-2 cells...... and by oral co-administration of doxorubicin together with tween 20 to male Sprague Dawley rats. 200 μM (0.025%) tween 20 increased the intestinal absorptive permeability of doxorubicin in vitro by 48 ± 4% from 8.8 × 10(-6)cm/s to 13.0 × 10(-6)cm/s. Further, the efflux ratio was reduced from 2.2 ± 0.06 to 1.2...
4 CFR 22.2 - Board Consideration [Rule 2].
2010-01-01
... 4 Accounts 1 2010-01-01 2010-01-01 false Board Consideration [Rule 2]. 22.2 Section 22.2 Accounts... OFFICE CONTRACT APPEALS BOARD § 22.2 Board Consideration [Rule 2]. (a) Offices. The office of the Board... consideration of a matter by all members of the Contract Appeals Board will not be granted in any appeal filed...
12 CFR 22.10 - Notice of servicer's identity.
2010-01-01
... 12 Banks and Banking 1 2010-01-01 2010-01-01 false Notice of servicer's identity. 22.10 Section 22... SPECIAL FLOOD HAZARDS § 22.10 Notice of servicer's identity. (a) Notice requirement. When a bank makes... designee) in writing of the identity of the servicer of the loan. The Director of FEMA has designated the...
27 CFR 22.62 - Change in trade name.
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Change in trade name. 22.62 Section 22.62 Alcohol, Tobacco Products and Firearms ALCOHOL AND TOBACCO TAX AND TRADE BUREAU... Original Qualification § 22.62 Change in trade name. Where there is to be a change in, or addition of, a...
25 CFR 117.22 - Disbursements to legal guardians.
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Disbursements to legal guardians. 117.22 Section 117.22... COMPETENCY § 117.22 Disbursements to legal guardians. Any disbursement authorized to be made to an Indian by... to the guardian. All expenditures by a guardian of the funds of his ward must be approved in writing...
[Study of Basal metabolic rate of 81 young adults aged 20-29 years old in Changsha].
Zhou, X; Mao, D Q; Luo, J Y; Wu, J H; Zhuo, Q; Li, Y M
2017-07-06
Objective: To determine the basal metabolic rate (BMR) of young adults aged between 20-29 years old in Changsha. Methods: We recruited volunteers to join in our research project from April to May, 2015. All recruited volunteers must meet the inclusion criteria: aged 20-29 years old, height between 164-180 centimeters in males and 154-167 centimeters in females, in good health condition, and with no habit of regular physical exercise in last year. Finally, 81 qualified volunteers were selected as research objects, including 43 males and 38 females. The BMR, resting lying metabolism rate and resting sitting metabolism rate of the subjects were detected, and the determined BMR was compared with the calculated results: from the adjusted Schofield equation. Results The BMR, resting lying metabolism rate and resting sitting metabolism rate among males were (166.10±22.09), (174.22±24.56), and (179.54±23.35) kJ·m(-2)·h(-1), respectively, which were all higher than those among females were (137.70±20.04), (149.79±19.25), and (167.78±26.02) kJ·m(-2)·h(-1), respectively, ( PBMR of males and females calculated from the adjusted Schofield equation were (160.83±3.93), and (140.29±4.18) kJ·m(-2)·h(-1), respectively, and there was no significantly statistical difference found between the determined BMR and the calculated results from Schofield equation (adjusted) classified by sex, all P values >0.05. Conclusion: The BMR of young adults aged 20-29 years old in Changsha was in the national average level, and the adjusted Schofield equation displayed fine accuracy in predicting BMR of young adults aged 20-29 years old in Changsha.
7 CFR 3405.22 - Evaluation of program.
2010-01-01
... 7 Agriculture 15 2010-01-01 2010-01-01 false Evaluation of program. 3405.22 Section 3405.22 Agriculture Regulations of the Department of Agriculture (Continued) COOPERATIVE STATE RESEARCH, EDUCATION, AND EXTENSION SERVICE, DEPARTMENT OF AGRICULTURE HIGHER EDUCATION CHALLENGE GRANTS PROGRAM...
van Paassen, Barbara W; van der Kooi, Anneke J; van Spaendonck-Zwarts, Karin Y; Verhamme, Camiel; Baas, Frank; de Visser, Marianne
2014-03-19
PMP22 related neuropathies comprise (1) PMP22 duplications leading to Charcot-Marie-Tooth disease type 1A (CMT1A), (2) PMP22 deletions, leading to Hereditary Neuropathy with liability to Pressure Palsies (HNPP), and (3) PMP22 point mutations, causing both phenotypes. Overall prevalence of CMT is usually reported as 1:2,500, epidemiological studies show that 20-64% of CMT patients carry the PMP22 duplication. The prevalence of HNPP is not well known. CMT1A usually presents in the first two decades with difficulty walking or running. Distal symmetrical muscle weakness and wasting and sensory loss is present, legs more frequently and more severely affected than arms. HNPP typically leads to episodic, painless, recurrent, focal motor and sensory peripheral neuropathy, preceded by minor compression on the affected nerve. Electrophysiological evaluation is needed to determine whether the polyneuropathy is demyelinating. Sonography of the nerves can be useful. Diagnosis is confirmed by finding respectively a PMP22 duplication, deletion or point mutation. Differential diagnosis includes other inherited neuropathies, and acquired polyneuropathies. The mode of inheritance is autosomal dominant and de novo mutations occur. Offspring of patients have a chance of 50% to inherit the mutation from their affected parent. Prenatal testing is possible; requests for prenatal testing are not common. Treatment is currently symptomatic and may include management by a rehabilitation physician, physiotherapist, occupational therapist and orthopaedic surgeon. Adult CMT1A patients show slow clinical progression of disease, which seems to reflect a process of normal ageing. Life expectancy is normal.
Milla, M. E.; Brown, B. M.; Sauer, R. T.
1993-01-01
Many mutant variants of the P22 Arc repressor are subject to intracellular proteolysis in Escherichia coli, which precludes their expression at levels sufficient for purification and subsequent biochemical characterization. Here we examine the effects of several different C-terminal extension sequences on the expression and activity of a set of Arc mutants. We show that two tail sequences, KNQHE (st5) and H6KNQHE (st11), increase the expression levels of most mutants from 10- to 20-fold and, ...
Directory of Open Access Journals (Sweden)
Stefania Tomyn
2011-12-01
Full Text Available In the mononuclear title complex, [Zn(C10H8N22(C2H6OS2](C24H20B2·C2H6OS, the ZnII ion is coordinated by four N atoms of two bidentate 2,2′-bipyridine molecules and by the O atoms of two cis-disposed dimethyl sulfoxide molecules in a distorted octahedral geometry. The S atom and the methyl groups of one of the coordinated dimethyl sulfoxide molecules are disordered in a 0.509 (2:0.491 (2 ratio. The crystal packing is stabilized by C—H...O hydrogen bonds between the dimethyl sulfoxide solvent molecules and tetraphenylborate anions.
National Research Council Canada - National Science Library
Day, John
1998-01-01
The purpose of this paper is to establish the critical need for the continued development and introduction of the F-22 Raptor as the air superiority fighter for the joint forces of the United States...
7 CFR 996.22 - USDA-approved laboratory.
2010-01-01
..., Agricultural Marketing Service, USDA, that chemically analyze peanuts for aflatoxin content. Quality and... 7 Agriculture 8 2010-01-01 2010-01-01 false USDA-approved laboratory. 996.22 Section 996.22 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing...
47 CFR 22.923 - Cellular system configuration.
2010-10-01
... 47 Telecommunication 2 2010-10-01 2010-10-01 false Cellular system configuration. 22.923 Section... MOBILE SERVICES Cellular Radiotelephone Service § 22.923 Cellular system configuration. Mobile stations... directly or through cellular repeaters. Auxiliary test stations may communicate with base or mobile...
Directory of Open Access Journals (Sweden)
Rafael Fabiano M. Rosa
2010-09-01
Full Text Available OBJETIVO: Relatar dois pacientes com a síndrome de Emanuel (SE ou cromossomo supernumerário der(22t(11;22, secundária a translocações balanceadas familiares, apresentando fenótipos distintos. DESCRIÇÃO DE CASO: O primeiro paciente é uma menina branca de cinco anos de idade, apresentando hipotonia, atraso no desenvolvimento neuropsicomotor, movimentos estereotipados, microcefalia, ptose palpebral, orelhas proeminentes, fossetas e apêndices pré-auriculares, e imperfuração anal. As avaliações adicionais identificaram hipoplasia cerebral e estenose da válvula pulmonar. Possuía história também de laringotraqueomalácia e fenda palatina. O segundo paciente é um menino branco de seis meses de idade com hipotonia, movimentos coreoatetóticos, déficit de crescimento, microcefalia, microssomia hemifacial, fenda palatina, microtia, apêndices pré-auriculares e polegares proximalmente implantados. A ecocardiografia demonstrou estenose da válvula pulmonar, comunicação interatrial e interventricular, persistência do canal arterial e da veia cava superior esquerda. A radiografia de tórax identificou uma costela cervical. O cariótipo por bandas GTG mostrou a presença, em ambos os pacientes, de um cromossomo adicional der(22t(11;22, secundário a uma translocação balanceada materna no primeiro caso e paterna no segundo caso. COMENTÁRIOS: Apesar de a primeira paciente apresentar achados frequentes da SE, o caso adicional representa a segunda descrição da literatura com um fenótipo de espectro óculo-aurículo-vertebral (EOAV. Assim, ambos salientam a variabilidade clínica observada na SE e a importância da avaliação cariotípica em indivíduos com fenótipo de EOAV.OBEJECTIVE: To report two patients with Emanuel syndrome (ES or supernumerary chromosome der(22t(11;22, secondary to familial balanced translocations, presenting distinct phenotypes. CASES DESCRIPTION: The first patient was a five-year-old white girl presenting
Regulated release of Ca2+ from respiring mitochondria by Ca2+/2H+ antiport.
Fiskum, G; Lehninger, A L
1979-07-25
Simultaneous measurements of oxygen consumption and transmembrane transport of Ca2+, H+, and phosphate show that the efflux of Ca2+ from respiring tightly coupled rat liver mitochondria takes place by an electroneutral Ca2+/2H+ antiport process that is ruthenium red-insensitive and that is regulated by the oxidation-reduction state of the mitochondrial pyridine nucleotides. When mitochondrial pyridine nucleotides are kept in a reduced steady state, the efflux of Ca2+ is inhibited; when they are in an oxidized state, Ca2+ efflux is activated. These processes were demonstrated by allowing phosphate-depleted mitochondria respiring on succinate in the presence of rotenone to take up Ca2+ from the medium. Upon subsequent addition of ruthenium red to block Ca2+ transport via the electrophoretic influx pathway, and acetoacetate, to bring mitochondrial pyridine nucleotides into the oxidized state, Ca2+ efflux and H+ influx ensued. The observed H+ influx/Ca2+ efflux ratio was close to the value 2.0 predicted for the operation of an electrically neutral Ca2+/2H+ antiport process.
Fifteenth nuclear accident dosimetry intercomparison study: August 14--22, 1978
International Nuclear Information System (INIS)
Sims, C.S.
1979-05-01
The fifteenth in the continuing series of Nuclear Accident Dosimetry Intercomparison Studies was held August 14--22, 1978 at the Oak Ridge National Laboratory. The Health Physics Research Reactor, operated in the pulse mode, served as the radiation source. Using different shielding configurations, nuclear accidents with three different neutron and gamma spectra were simulated. Participants from 19 organizations, the most in the history of the studies, exposed dosimeters set up as area monitors as well as dosimeters mounted on phantoms for personnel monitoring. Although many participants performed accurate measurements, the composite dose results, in the majority of cases, failed to meet established nuclear criticality accident dosimetry guidelines which suggest accuracies of +- 25% for neutron dose and +- 20% for gamma dose. This indicates that many participants need to improve their dosimetry systems, their analytical techniques, or both
Alanay, Ahmet; Cil, Akin; Berk, Haluk; Acaroglu, R Emre; Yazici, Muharrem; Akcali, Omer; Kosay, Can; Genc, Yasemin; Surat, Adil
2005-11-01
Outcome study to determine the internal consistency, and validity of adapted Turkish version of Scoliosis Research Society-22 (SRS-22) Instrument. To evaluate the validity and reliability of adapted Turkish Version of SRS-22 questionnaire. The SRS-22 questionnaire is a widely accepted questionnaire to assess the health-related quality of life for scoliotic patients in the United States. However, its adaptation in languages other than the source language is necessary for its multinational use. Translation/retranslation of the English version of the SRS-22 was done, and all steps for cross-cultural adaptation process were performed properly by an expert committee. Later, SRS-22 questionnaires and previously validated Short Form-36 (SF-36) outcome instruments were mailed to 82 patients who had been surgically treated for idiopathic scoliosis. All patients had a minimum of 2 years follow-up. Fifty-four patients (66%) responded to the first set of questionnaires. Forty-seven of the first time respondents returned their second survey. The average age of the 47 patients (12 male, 35 female) was 19.8 years (range, 14-31 years). The two measures of reliability as internal consistency and reproducibility were determined by Cronbach alpha statistics and intraclass correlation coefficient, respectively. Concurrent validity was measured by comparing with an already validated questionnaire (SF-36). Measurement was made using the Pearson correlation coefficient (r). The study demonstrated satisfactory internal consistency with high Cronbach alpha values for the four of the corresponding domains (pain, 0.72; self-image, 0.80; mental health, 0.72; and satisfaction, 0.83). However, the Cronbach alpha value for function/activity domain (0.48) was considerably lower than the original questionnaire. The intraclass correlation coefficient for the same domains was 0.80, 0.82, 0.78, 0.81, and 0.76, respectively, demonstrating a satisfactory test/retest reproducibility. Considering
Tetralogy of Fallot associated with deletion in the DiGeorge region of chromosome 22 (22q11)
Energy Technology Data Exchange (ETDEWEB)
D`Angelo, J.A.; Pillers, D.M.; Jett, P.L. [Oregon Health Sciences Univ. Portland, OR (United States)] [and others
1994-09-01
Cardiac conotruncal defects, such as Tetralogy of Fallot (TOF), are associated with DiGeorge syndrome which has been mapped to the q11 region of chromosome 22 and includes abnormalities of neural crest and branchial arch development. Patients with conotruncal defects and velo-cardio-facial syndrome may have defects in the 22q11 region but not show the complete DiGeorge phenotype consisting of cardiac, thymus, and parathyroid abnormalities. We report two neonates with TOF and small deletions in the DiGeorge region of chromosome 22 (46,XX,del(22)(q11.21q11.23) and 46,XY,del(22)(q11.2q11.2)) using both high-resolution cytogenetics and fluorescence in situ hybridization (FISH). The first patient is a female with TOF and a family history of congenital heart disease. The mother has pulmonic stenosis and a right-sided aortic arch, one brother has TOF, and a second brother has a large VSD. The patient had intrauterine growth retardation and had thrombocytopenia due to maternal IgG platelet-directed autoantibody. Lymphocyte populations, both T and B cells, were reduced in number but responded normally to stimulation. The findings were not attributed to a DiGeorge phenotype. Although she had transient neonatal hypocalcemia, her parathyroid hormone level was normal. The patient was not dysmorphic in the newborn period but her mother had features consistent with velo-cardio-facial syndrome. The second patient was a male with TOF who was not dysmorphic and had no other significant clinical findings and no family history of heart disease. Lymphocyte testing did not reveal a specific immunodeficiency. No significant postnatal hypocalcemia was noted. These cases illustrate that there is a wide spectrum of clinical features associated with defects of the 22q11 region. We recommend karyotype analysis, including FISH probes specific to the DiGeorge region, in any patient with conotruncal cardiac defects.
New NA22 results on correlations
International Nuclear Information System (INIS)
De Wolf, E.A.
1993-01-01
Recent NA22 results from π + p and K + p inelastic interactions at √s = 22 GeV on invariant-mass and Q 2 -dependence of two- and three-particle factorial cumulants are discussed in relation to earlier intermittency studies. The absence of Bose-Einstein type correlations among identical particles, and too large resonance production rates, are responsible for the strong disagreements of models with intermittency data. 6 figs., 17 refs
50 CFR 16.22 - Injurious wildlife permits.
2010-10-01
... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false Injurious wildlife permits. 16.22 Section 16.22 Wildlife and Fisheries UNITED STATES FISH AND WILDLIFE SERVICE, DEPARTMENT OF THE INTERIOR TAKING, POSSESSION, TRANSPORTATION, SALE, PURCHASE, BARTER, EXPORTATION, AND IMPORTATION OF WILDLIFE AND...
9 CFR 78.22 - Brucellosis reactor bison.
2010-01-01
... 9 Animals and Animal Products 1 2010-01-01 2010-01-01 false Brucellosis reactor bison. 78.22... AGRICULTURE INTERSTATE TRANSPORTATION OF ANIMALS (INCLUDING POULTRY) AND ANIMAL PRODUCTS BRUCELLOSIS Restrictions on Interstate Movement of Bison Because of Brucellosis § 78.22 Brucellosis reactor bison. (a...
Single-neutron knockout from 20C and the structure of 19C
Directory of Open Access Journals (Sweden)
J.W. Hwang
2017-06-01
Full Text Available The low-lying unbound level structure of the halo nucleus 19C has been investigated using single-neutron knockout from 20C on a carbon target at 280 MeV/nucleon. The invariant mass spectrum, derived from the momenta of the forward going beam velocity 18C fragment and neutrons, was found to be dominated by a very narrow near threshold (Erel=0.036(1 MeV peak. Two less strongly populated resonance-like features were also observed at Erel=0.84(4 and 2.31(3 MeV, both of which exhibit characteristics consistent with neutron p-shell hole states. Comparisons of the energies, measured cross sections and parallel momentum distributions to the results of shell-model and eikonal reaction calculations lead to spin-parity assignments of 5/21+ and 1/21− for the levels at Ex=0.62(9 and 2.89(10 MeV with Sn=0.58(9 MeV. Spectroscopic factors were also deduced and found to be in reasonable accord with shell-model calculations. The valence neutron configuration of the 20C ground state is thus seen to include, in addition to the known 1s1/22 component, a significant 0d5/22 contribution. The level scheme of 19C, including significantly the 1/21− cross-shell state, is well accounted for by the YSOX shell-model interaction developed from the monopole-based universal interaction.
Directory of Open Access Journals (Sweden)
Romild Ulla
2011-07-01
Full Text Available Abstract Background For decades, symptoms of anxiety and depression have been included among psychological factors associated with development of hypertension. Although this has been questioned in recent studies, most findings have been based on a single assessment of mental distress at baseline. We examined these associations using repeated assessments of anxiety, depression and blood pressure. Methods Data on 17,410 men and women aged 20 to 67 participating in the Nord-Trøndelag Health Study (HUNT in Norway in 1984-86 were re-examined 11 and 22 years later. The main outcome was change in mean blood pressure (mm Hg during follow-up. Results We found that a high symptom level score (≥80th percentile of combined anxiety and depression at baseline, as compared to a lower symptom level, was associated with lower mean systolic (-0.67 mm Hg, p = 0.044 and diastolic (-0.25 mm Hg, p = 0.201 blood pressure at year 22. A high symptom level present at all three examinations was associated with a stronger decrease in mean systolic (-1.59 mm Hg, p = 0.004 and diastolic (-0.78 mm Hg, p = 0.019 blood pressure and with a 20% (p = 0.001 lower risk of developing hypertension (BP ≥140/90 mm Hg at year 22. The associations were only slightly attenuated in multivariate analyses, with no evidence of a mediating effect of alteration in heart rate. Conclusions This study do not support previous hypothesis that emotional stress may be a cause of hypertension. Our findings indicate that symptoms of anxiety and depression are associated with decrease in blood pressure, particularly when a high symptom level can be detected over decades.
7 CFR 946.22 - Establishment and membership.
2010-01-01
... 7 Agriculture 8 2010-01-01 2010-01-01 false Establishment and membership. 946.22 Section 946.22 Agriculture Regulations of the Department of Agriculture (Continued) AGRICULTURAL MARKETING SERVICE (Marketing... in acreage within districts and within the production area during recent years; (2) The importance of...
Ps 22 in Gospels’ interpretation of Passion
Directory of Open Access Journals (Sweden)
Sylwester Jędrzejewski
2012-09-01
Full Text Available Ps 22 is a piece of artistically high poetry, clear images and metaphors, historical and prophetic references. The conviction of biblical scholars that the New Testament writers has recognized in Ps 22 prophetic witness of passion, accompanies the Church from its beginnings. The words of Jesus on the cross, taken from Ps 22: 2, have a character of lamentable re-symbolization of the prayer of Israel. These words establish a theological answer in the form of suitable credo as well. Dramatic question “why?” is connected with a proclamation and identification “My God”. The personal experience of oppression and death is included by Jesus in the history of his nation and in the experience of God. Ps 22 in the Gospels’ passion context becomes a proclamation form of prayer and a very personal, expressed in such dramatic circumstances confession of the faith.
Czech Academy of Sciences Publication Activity Database
Žabka, Ján; Šimková, Ludmila; Jalový, Z.; Polášek, Miroslav
2014-01-01
Roč. 20, č. 3 (2014), s. 233-247 ISSN 1469-0667 R&D Projects: GA ČR GAP206/11/0727 Institutional support: RVO:61388955 Keywords : 2,2-dinitroethene-1,1-diamine * electrospray ionization * chemical ionization Subject RIV: CF - Physical ; Theoretical Chemistry Impact factor: 1.000, year: 2014
48 CFR 22.1019 - Additional classes of service employees.
2010-10-01
... regarding the agreement or disagreement of the employees' representative or the employees themselves... service employees. 22.1019 Section 22.1019 Federal Acquisition Regulations System FEDERAL ACQUISITION... of 1965, as Amended 22.1019 Additional classes of service employees. (a) If the contracting officer...
Substituted 2,2′-bipyridines by nickel-catalysis: 4,4′-di-tert-butyl-2,2′-bipyridine
Buonomo, Joseph A.; Everson, Daniel A.; Weix, Daniel J.
2013-01-01
A simple, ligand-free synthesis of the important bipyridyl ligand 4,4′-di-tert-butyl-2,2′-bipyridine is presented. 5,5′-bis(trifluoromethyl)-2,2′-bipyridine is also synthesized by the same protocol. The syntheses efficiently couple the parent 2-chlorpyridies by a nickel-catalyzed dimerization with manganese powder as the terminal reductant.
Energy Technology Data Exchange (ETDEWEB)
Parent, Kristin N. [University of California, San Diego, Department of Chemistry and Biochemistry, La Jolla, CA 92093 (United States); Gilcrease, Eddie B. [University of Utah School of Medicine, Division of Microbiology and Immunology, Department of Pathology, Salt Lake City, UT 84112 (United States); Casjens, Sherwood R., E-mail: sherwood.casjens@path.utah.edu [University of Utah School of Medicine, Division of Microbiology and Immunology, Department of Pathology, Salt Lake City, UT 84112 (United States); Baker, Timothy S., E-mail: tsb@ucsd.edu [University of California, San Diego, Department of Chemistry and Biochemistry, La Jolla, CA 92093 (United States); University of California, San Diego, Division of Biological Sciences, La Jolla, CA 92093 (United States)
2012-06-05
Coat proteins of tailed, dsDNA phages and in herpesviruses include a conserved core similar to the bacteriophage HK97 subunit. This core is often embellished with other domains such as the telokin Ig-like domain of phage P22. Eighty-six P22-like phages and prophages with sequenced genomes share a similar set of virion assembly genes and, based on comparisons of twelve viral assembly proteins (structural and assembly/packaging chaperones), these phages are classified into three groups (P22-like, Sf6-like, and CUS-3-like). We used cryo-electron microscopy and 3D image reconstruction to determine the structures of Sf6 procapsids and virions ({approx} 7 A resolution), and the structure of the entire, asymmetric Sf6 virion (16-A resolution). The Sf6 coat protein is similar to that of P22 yet it has differences in the telokin domain and in its overall quaternary organization. Thermal stability and agarose gel experiments show that Sf6 virions are slightly less stable than those of P22. Finally, bacterial host outer membrane proteins A and C were identified in lipid vesicles that co-purify with Sf6 particles, but are not components of the capsid.
45 CFR 1310.22 - Children with disabilities.
2010-10-01
... with disabilities must be transported in the same vehicles used to transport other children enrolled in... 45 Public Welfare 4 2010-10-01 2010-10-01 false Children with disabilities. 1310.22 Section 1310... START PROGRAM HEAD START TRANSPORTATION Special Requirements § 1310.22 Children with disabilities. (a...
50 CFR 10.22 - Law enforcement offices.
2010-10-01
... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false Law enforcement offices. 10.22 Section 10... GENERAL PROVISIONS Addresses § 10.22 Law enforcement offices. Service law enforcement offices and their areas of responsibility follow. Mail should be addressed: “Assistant Regional Director, Division of Law...
Arterial injury promotes medial chondrogenesis in Sm22 knockout mice.
Shen, Jianbin; Yang, Maozhou; Jiang, Hong; Ju, Donghong; Zheng, Jian-Pu; Xu, Zhonghui; Liao, Tang-Dong; Li, Li
2011-04-01
Expression of SM22 (also known as SM22alpha and transgelin), a vascular smooth muscle cells (VSMCs) marker, is down-regulated in arterial diseases involving medial osteochondrogenesis. We investigated the effect of SM22 deficiency in a mouse artery injury model to determine the role of SM22 in arterial chondrogenesis. Sm22 knockout (Sm22(-/-)) mice developed prominent medial chondrogenesis 2 weeks after carotid denudation as evidenced by the enhanced expression of chondrogenic markers including type II collagen, aggrecan, osteopontin, bone morphogenetic protein 2, and SRY-box containing gene 9 (SOX9). This was concomitant with suppression of VSMC key transcription factor myocardin and of VSMC markers such as SM α-actin and myosin heavy chain. The conversion tendency from myogenesis to chondrogenesis was also observed in primary Sm22(-/-) VSMCs and in a VSMC line after Sm22 knockdown: SM22 deficiency altered VSMC morphology with compromised stress fibre formation and increased actin dynamics. Meanwhile, the expression level of Sox9 mRNA was up-regulated while the mRNA levels of myocardin and VSMC markers were down-regulated, indicating a pro-chondrogenic transcriptional switch in SM22-deficient VSMCs. Furthermore, the increased expression of SOX9 was mediated by enhanced reactive oxygen species production and nuclear factor-κB pathway activation. These findings suggest that disruption of SM22 alters the actin cytoskeleton and promotes chondrogenic conversion of VSMCs.
Abu-Gabal, Khadiga; Katta, Maha; Ibrahim, Raghda
2017-01-01
Introduction Adenosine and deoxyadenosine metabolism is influenced by adenosine deaminase (ADA) enzyme. ADA increases in different diseases and is considered as one of the markers for cell-mediated immunity. Pregnancy is associated with depressed cell-mediated immunity. The level of ADA expression, which seems to play a key role in maintaining pregnancy, is influenced by adenosine deaminase G22A gene polymorphism. We aimed in our study to evaluate the association of ADA G22A gene polymorphism with recurrent spontaneous abortion (RSA) in Egyptian women. Material and methods Adenosine deaminase G22A gene polymorphism was genotyped in 40 patients (age range 22-39 years) with a history of RSA, selected from those attending the Gynaecology and Obstetrics Clinic of Beni-Suef University Hospital, and 20 age-matched healthy women as a control group, using polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) analysis. Results In our study, no statistically significant difference was found between RSA patients and control group as regards ADA G22A genotypes (p = 0.653) and alleles (p = 0.697). A comparison of the frequencies of ADA alleles in RSA patients as regards the below-35-years-old age group revealed that ADA 2(A) allele was associated with a low risk for RSA in patients aged 35 years old or younger (p = 0.008). Conclusions In conclusion, our study revealed an age-dependent protective value of ADA 2(A) allele in recurrent spontaneous abortions among the Egyptian population. PMID:29204093
Global and regional emission estimates for HCFC-22
Directory of Open Access Journals (Sweden)
E. Saikawa
2012-11-01
Full Text Available HCFC-22 (CHClF2, chlorodifluoromethane is an ozone-depleting substance (ODS as well as a significant greenhouse gas (GHG. HCFC-22 has been used widely as a refrigerant fluid in cooling and air-conditioning equipment since the 1960s, and it has also served as a traditional substitute for some chlorofluorocarbons (CFCs controlled under the Montreal Protocol. A low frequency record on tropospheric HCFC-22 since the late 1970s is available from measurements of the Southern Hemisphere Cape Grim Air Archive (CGAA and a few Northern Hemisphere air samples (mostly from Trinidad Head using the Advanced Global Atmospheric Gases Experiment (AGAGE instrumentation and calibrations. Since the 1990s high-frequency, high-precision, in situ HCFC-22 measurements have been collected at these AGAGE stations. Since 1992, the Global Monitoring Division of the National Oceanic and Atmospheric Administration/Earth System Research Laboratory (NOAA/ESRL has also collected flasks on a weekly basis from remote sites across the globe and analyzed them for a suite of halocarbons including HCFC-22. Additionally, since 2006 flasks have been collected approximately daily at a number of tower sites across the US and analyzed for halocarbons and other gases at NOAA. All results show an increase in the atmospheric mole fractions of HCFC-22, and recent data show a growth rate of approximately 4% per year, resulting in an increase in the background atmospheric mole fraction by a factor of 1.7 from 1995 to 2009. Using data on HCFC-22 consumption submitted to the United Nations Environment Programme (UNEP, as well as existing bottom-up emission estimates, we first create globally-gridded a priori HCFC-22 emissions over the 15 yr since 1995. We then use the three-dimensional chemical transport model, Model for Ozone and Related Chemical Tracers version 4 (MOZART v4, and a Bayesian inverse method to estimate global as well as regional annual emissions. Our inversion indicates
Directory of Open Access Journals (Sweden)
Zehra Nur Yuksekdag
2008-06-01
Full Text Available Exopolysaccharides (EPSs production was studied by Lactobacillus delbrueckii subsp. bulgaricus (B3, G12 and Streptococcus thermophilus (W22 in the medium containing various carbon sources (glucose, fructose, sucrose or lactose. For all the strains, glucose was the most efficient carbon source and B3, G12 and W22 strains produced 211, 175 and 120 EPS mg/L respectively. Also, the influence of different concentrations of glucose (5,10,15,20,25,30 g/L on EPS production and growth was studied. The results indicated that EPS production and growth were stimulated by the high glucose concentration (30 g/L.
Franko, Debra L; Tabri, Nassim; Keshaviah, Aparna; Murray, Helen B; Herzog, David B; Thomas, Jennifer J; Coniglio, Kathryn; Keel, Pamela K; Eddy, Kamryn T
2018-01-01
The objective of this study was to investigate predictors of long-term recovery from eating disorders 22 years after entry into a longitudinal study. One hundred and seventy-six of the 228 surviving participants (77.2%) were re-interviewed 20-25 years after study entry using the Longitudinal Interval Follow-up Evaluation to assess ED recovery. The sample consisted of 100 women diagnosed with anorexia nervosa (AN) and 76 with bulimia nervosa (BN) at study entry. A comorbid diagnosis of major depression at the start of the study strongly predicted having a diagnosis of AN-Restricting type at the 22-year assessment. A higher body mass index (BMI) at study intake decreased the odds of being diagnosed with AN-Binge Purge type, relative to being recovered, 22 years later. The only predictor that increased the likelihood of having a diagnosis of BN at the 22-year assessment was the length of time during the study when the diagnostic criteria for BN were met. Together, these results indicate that the presence and persistence of binge eating and purging behaviors were poor prognostic indicators and that comorbidity with depression is particularly pernicious in AN. Treatment providers might pay particular attention to these issues in an effort to positively influence recovery over the long-term. Copyright © 2017 Elsevier Ltd. All rights reserved.
48 CFR 22.1505 - Solicitation provision and contract clause.
2010-10-01
....222-19, Child Labor—Cooperation with Authorities and Remedies, in all solicitations and contracts for... contract clause. 22.1505 Section 22.1505 Federal Acquisition Regulations System FEDERAL ACQUISITION... contract clause. (a) Except as provided in paragraph (b) of 22.1503, insert the provision at 52.222-18...
24 CFR 58.22 - Limitations on activities pending clearance.
2010-04-01
... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Limitations on activities pending clearance. 58.22 Section 58.22 Housing and Urban Development Office of the Secretary, Department of Housing... RESPONSIBILITIES General Policy: Environmental Review Procedures § 58.22 Limitations on activities pending...
Energy Technology Data Exchange (ETDEWEB)
Johnson, K.M.
2003-10-23
This documentation describes the procedures and methods used to measure total carbon dioxide (TCO{sub 2}) total alkalinity (TALK), and partial pressure of CO{sub 2} (pCO{sub 2}) at hydrographic stations on the North Atlantic Ocean sections AR24, A24, A20, and A22 during the R/V Knorr Cruises 147-2, 151-2, 151-3, and 151-4 in 1996 and 1997. Conducted as part of the World Ocean Circulation Experiment (WOCE), the expeditions began at Woods Hole, Massachusetts, on October 24, 1996, and ended at Woods Hole on September 3, 1997. Instructions for accessing the data are provided. A total of 5,614 water samples were analyzed for discrete TCO{sub 2} using two single-operator multiparameter metabolic analyzers (SOMMAs) coupled to a coulometer for extracting and detecting CO{sub 2}. The overall accuracy of the TCO{sub 2} determination was {+-} 1.59 {micro}mol/kg. The TALK was determined in a total of 6,088 discrete samples on all sections by potentiometric titration using an automated titration system developed at the University of Miami. The accuracy of the TALK determination was {+-} 3 {micro}mol/kg. A total of 2,465 discrete water samples were collected for determination of pCO{sub 2} in seawater on sections A24, A20, and A22. The pCO{sub 2} was measured by means of an equilibrator-IR system by scientists from Lamont-Doherty Earth Observatory. The precision of the measurements was estimated to be about {+-} 0.15%, based on the reproducibility of the replicate equilibrations on a single hydrographic station. The North Atlantic data set is available as a numeric data package (NDP) from the Carbon Dioxide Information Analysis Center. The NDP consists of 12 ASCII data files, one Ocean Data View-formatted data file, a NDP-082 ASCII text file, a NDP-082 PDF file, and this printed documentation, which describes the contents and format of all files, as well as the procedures and methods used to obtain the data.
Spectrophotometric determination of yttrium with 2-(2-thiazolylazo)-5-dimethylaminophenol
International Nuclear Information System (INIS)
Tsurumi, Chikao; Furuya, Keiichi.
1975-01-01
Spectrophotometric determination of small amounts of yttrium with 2-(2-thiazolylazo)-5-dimethylaminophenol (TAM) in the presence of zephiramine was investigated. The recommended procedures were as follows; 2.0 ml of water, 7.0 ml of TAM-methanolic solution (2x10 -4 mol/l) and 2.0 ml of zephiramine-aqueous solution (1x10 -2 mol/l) were added to a solution containing less than 35 μg of yttrium and its pH was adjusted to 8.0 with 0.1 mol/l ammonium chloride-0.1 mol/l ammonium hydroxide solution. The solution was transferred to a 25 ml volumetric flask and diluted to the mark with water. After 20 minutes, the absorbance at 575 nm against a reagent blank was measured. The color of yttrium-TAM complex is reddish-violet in the presence of zephiramine and is stable for 90 minutes after color development. The yttrium-TAM complex shows an absorption maximum at 575 nm. The absorbance at 575 nm is constant in a pH range from 7.5 to 8.3. The molar extinction coefficient at this wavelength is 7.2x10 4 l.mol -1 .cm -1 . The band obeys Beer's law up to the concentration of 1.4 μg/ml of yttrium. The molar ratio of yttrium to TAM in the complex is 1 : 2. A number of ions interfere with the determination can be masked by the addition of various masking agents and removed in terms of trioctylamine-xylene extraction. Manganese, tantalum, tin(II), citrate and tartrate ions interfere with the determination. (auth.)
Substituted 2,2′-bipyridines by nickel-catalysis: 4,4′-di-tert-butyl-2,2′-bipyridine
Buonomo, Joseph A.; Everson, Daniel A.; Weix, Daniel J.
2014-01-01
A simple, ligand-free synthesis of the important bipyridyl ligand 4,4′-di-tert-butyl-2,2′-bipyridine is presented. 5,5′-bis(trifluoromethyl)-2,2′-bipyridine is also synthesized by the same protocol. The syntheses efficiently couple the parent 2-chlorpyridies by a nickel-catalyzed dimerization with manganese powder as the terminal reductant. PMID:25221358
Le, H. Carl; Lupu, Mihaela; Kotedia, Khushali; Rosen, Neal; Solit, David; Koutcher, Jason A.
2010-01-01
17-Allylamino, 17-Demethoxygeldanamycin (17-AAG), an effective inhibitor of the heat shock protein hsp90, preferentially inhibiting tumor hsp90 compared to hsp90 from normal cells (1), has shown promising results against several cancers, including hormone resistant prostate cancer. Levels of several oncogenic proteins critical to tumor growth and progression, such as AR (androgen receptor) and HER2/neu, were reduced 4 hours post 17-AAG treatment. Post treatment metabolic changes have also been observed in several tumor cell lines. In this study total choline (t-cho) distributions in hormone sensitive CWR22 and hormone resistant CWR22r prostate cancer xenograft tumors in mice were measured before, 4 hours and 48 hours after a single bolus 17-AAG treatment at 100 mg/kg using proton MRS. Our results show that tumor t-cho levels declined 4 hours after the treatment for CWR22 (P = 0.001) and 48 hours post treatment for CWR22r (P=0.003). Metabolic changes, in particular of t-cho intensity detected by 1H MRSI, are consistent with the observed immunohistochemistry changes, tumor growth inhibition for CWR22r (P=0.01 at 14 days post treatment) and a constant PSA level versus increasing PSA for control CWR22 (P=0.01). Metabolic changes in t-cho by proton MRSI can be used as an early biomarker of response for advanced stage prostate cancer in targeted therapy such as 17-AAG. PMID:19780165
48 CFR 52.219-22 - Small Disadvantaged Business Status.
2010-10-01
.... Status as a small business and status as a small disadvantaged business for general statistical purposes... Business Status. 52.219-22 Section 52.219-22 Federal Acquisition Regulations System FEDERAL ACQUISITION... Clauses 52.219-22 Small Disadvantaged Business Status. As prescribed in 19.308(b), insert the following...
37 CFR 360.22 - Form and content of claims.
2010-07-01
.... 360.22 Section 360.22 Patents, Trademarks, and Copyrights COPYRIGHT ROYALTY BOARD, LIBRARY OF CONGRESS SUBMISSION OF ROYALTY CLAIMS FILING OF CLAIMS TO ROYALTY FEES COLLECTED UNDER COMPULSORY LICENSE Digital Audio Recording Devices and Media Royalty Claims § 360.22 Form and content of claims. (a) Forms. (1...
40 CFR 227.22 - Assessment of impact.
2010-07-01
... FOR THE EVALUATION OF PERMIT APPLICATIONS FOR OCEAN DUMPING OF MATERIALS Impact of the Proposed Dumping on Other Uses of the Ocean § 227.22 Assessment of impact. The assessment of impact on other uses... 40 Protection of Environment 24 2010-07-01 2010-07-01 false Assessment of impact. 227.22 Section...
7 CFR 1410.22 - CRP conservation plan.
2010-01-01
... productive capability of the soil, improve water quality, protect wildlife or wetlands, protect a public well... plans and revisions of such plans shall be subject to the approval of CCC. (f) Mid-cover management... 7 Agriculture 10 2010-01-01 2010-01-01 false CRP conservation plan. 1410.22 Section 1410.22...
27 CFR 22.122 - Losses in transit.
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Losses in transit. 22.122... OF THE TREASURY LIQUORS DISTRIBUTION AND USE OF TAX-FREE ALCOHOL Losses § 22.122 Losses in transit. (a) Reporting losses. Upon discovering any loss of tax-free alcohol while in transit, the carrier...
27 CFR 22.123 - Losses on premises.
2010-04-01
... 27 Alcohol, Tobacco Products and Firearms 1 2010-04-01 2010-04-01 false Losses on premises. 22.123... OF THE TREASURY LIQUORS DISTRIBUTION AND USE OF TAX-FREE ALCOHOL Losses § 22.123 Losses on premises. (a) Recording of losses. A permittee shall determine and record, in the records prescribed by subpart...
Energy Technology Data Exchange (ETDEWEB)
Qu Weizheng; Zhao Jinping; Huang Fei; Deng Shenggui, E-mail: quweizhe@ouc.edu.cn [College of Environment Oceanography, Ocean University of China, Qingdao 266100 (China)
2012-07-15
According to the variation pattern of the solar magnetic field polarity and its relation to the relative sunspot number, we established the time series of the sunspot magnetic field polarity index and analyzed the strength and polarity cycle characteristics of the solar magnetic field. The analysis showed the existence of a cycle with about a 22-year periodicity in the strength and polarity of the solar magnetic field, which proved the Hale proposition that the 11-year sunspot cycle is one-half of the 22-year solar magnetic cycle. By analyzing the atmospheric temperature field, we found that the troposphere and the stratosphere in the middle latitude of both the northern and southern hemispheres exhibited a common 22-year quasicycle in the atmospheric temperature, which is believed to be attributable to the 22-year solar magnetic cycle.
Exon: CBRC-TNIG-22-0123 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TNIG-22-0123 GGAGCAGGCCGCTACCACCGCAAACAGCAGCAGGTGTTAGAAGCACGCcatcagcttcatcagcttcatcatcaccatcacca...tgatggtgatcatcatcactaccaccgataccaccatcatcatcatcactatggttatggtgatggttttgaccatcatcactatcatcaccatcatcaccaccaccgtcatcTGTGGGCGACTCACCTGTGCTGCAGGTGA ...
Exon: CBRC-TNIG-22-0164 [SEVENS
Lifescience Database Archive (English)
Full Text Available gtatggactcagaccagcatggactcagaccagCATGGACTCAGACCAGTATGGACCCAATGGACCAGTATGGACTCCAGCATGGACTCAGACCAGTATGGACTCAGACCG ... ...CBRC-TNIG-22-0164 atggactcagaccagtatggacccaatggaccagtatggactccagcatggactcagaccagtatggactcagacca
Exon: CBRC-HSAP-22-0003 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-HSAP-22-0003 CGGCAGATCGTCCCACGGGGACAGTCTCTTGTGGTCTGTGTCTCCCCCTTCAGCCCCCTGTGGGGCAGTGAGCCTCCTGCTCTGCTTCTGTGGGTGCATCAGAGCCCCCCCAGATGCCcacacgcagacgcgcacaggcctgcacgtggaaacacagacatgcgcacacgcaggcccacacacagacgcacacagagctgcacgtggagacacgtgcgcacacgcaggcccacacgcaggcccacacacaggtgcacgcggacctgcacgtggagacacagatgtgtgcacatgcaggcccacacacaG ...
11 CFR 111.22 - Ex parte communications.
2010-01-01
... 11 Federal Elections 1 2010-01-01 2010-01-01 false Ex parte communications. 111.22 Section 111.22 Federal Elections FEDERAL ELECTION COMMISSION GENERAL COMPLIANCE PROCEDURE (2 U.S.C. 437g, 437d(a... and any attorney or staff member of the Office of General Counsel in the course of representing the...
20 CFR 606.20 - Cap on tax credit reduction.
2010-04-01
... 20 Employees' Benefits 3 2010-04-01 2010-04-01 false Cap on tax credit reduction. 606.20 Section 606.20 Employees' Benefits EMPLOYMENT AND TRAINING ADMINISTRATION, DEPARTMENT OF LABOR TAX CREDITS... Tax Credit Reduction § 606.20 Cap on tax credit reduction. (a) Applicability. Subsection (f) of...
Tajwar, Razia; Shahid, Saher; Zafar, Rehan; Akhtar, Muhammad Waheed
2017-11-01
Xylanase XynB of the hyperthermophile Thermotoga maritima, which belongs to glycoside hydrolase family 10 (GH10), does not have an associated carbohydrate binding module (CBM) in the native state. CBM6 and CBM22 from a thermophile Clostridium thermocellum were fused to the catalytic domain of XynB (XynB-C) to determine the effects on activity and other properties. XynB-B22C and XynB-CB22, produced by fusing CBM22 to the N- and C-terminal of XynB-C, showed 1.7- and 3.24-fold increase in activity against the insoluble birchwood xylan, respectively. Similarly, CBM6 when attached to the C-terminal of XynB-C resulted in 2.0-fold increase in activity, whereas its attachment to the N-terminal did not show any increase of activity. XynB-B22C and XynB-CB22 retained all the activity, whereas XynB-B6C and XynB-CB6 lost 17 and 11% of activity, respectively, at 60°C for 4h. Thermostability data and the secondary structure contents obtained by molecular modelling are in agreement with the data from circular dichroism analysis. Molecular modelling analysis showed that the active site residues of the catalytic domain and the binding residues of CBM6 and CBM22 were located on the surface of molecule, except XynB-B6C, where the binding residues were found somewhat buried. In the case of XynB-CB22, the catalytic and the binding residues seem to be located favorably adjacent to each other, thus showing higher increase in activity. This study shows that the active site residues of the catalytic domain and the binding residues of the CBM are arranged in a unique fashion, not reported before. Copyright © 2017 Elsevier Inc. All rights reserved.
Singh, Prithvi Raj; Saxena, A. K.; Tiwari, C. M.
2018-04-01
We applied fast Fourier transform techniques and Morlet wavelet transform on the time series data of coronal index, solar flare index, and galactic cosmic ray, for the period 1986-2008, in order to investigate the long- and mid-term periodicities including the Rieger ({˜ }130 to {˜ }190 days), quasi-period ({˜ }200 to {˜ }374 days), and quasi-biennial periodicities ({˜ }1.20 to {˜ }3.27 years) during the combined solar cycles 22-23. We emphasize the fact that a lesser number of periodicities are found in the range of low frequencies, while the higher frequencies show a greater number of periodicities. The rotation rates at the base of convection zone have periods for coronal index of {˜ }1.43 years and for solar flare index of {˜ }1.41 year, and galactic cosmic ray, {˜ }1.35 year, during combined solar cycles 22-23. In relation to these two solar parameters (coronal index and solar flare index), for the solar cycles 22-23, we found that galactic cosmic ray modulation at mid cut-off rigidity (Rc = 2.43GV) is anti-correlated with time-lag of few months.
TWT design requirements for 30/20 GHz digital communications' satellite
Stankiewicz, N.; Anzic, G.
1979-01-01
The rapid growth of communication traffic (voice, data, and video) requires the development of additional frequency bands before the 1990's. The frequencies currently in use for satellite communications at 6/4 GHz are crowded and demands for 14/12 GHz systems are increasing. Projections are that these bands will be filled to capacity by the late 1980's. The next higher frequency band allocated for satellite communications is at 30/20 GHz. For interrelated reasons of efficiency, power level, and system reliability criteria, a candidate for the downlink amplifier in a 30/20 GHz communications' satellite is a dual mode traveling wave tube (TWT) equipped with a highly efficient depressed collector. A summary is given of the analyses which determine the TWT design requirements. The overall efficiency of such a tube is then inferred from a parametric study and from experimental data on multistaged depressed collectors. The expected TWT efficiency at 4 dB below output saturation is 24 percent in the high mode and 22 percent in the low mode.
50 CFR 14.22 - Certain antique articles.
2010-10-01
... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false Certain antique articles. 14.22 Section 14....22 Certain antique articles. Any person may import at any Customs Service port designated for such purpose, any article (other than scrimshaw, defined in 16 U.S.C 1539(f)(1)(B) and 50 CFR 217.12 as any art...
48 CFR 22.403-2 - Copeland Act.
2010-10-01
... 48 Federal Acquisition Regulations System 1 2010-10-01 2010-10-01 false Copeland Act. 22.403-2... Construction 22.403-2 Copeland Act. The Copeland (Anti-Kickback) Act (18 U.S.C. 874 and 40 U.S.C. 3145) makes... person is entitled under a contract of employment. The Copeland Act also requires each contractor and...
22 CFR 1421.8 - Administrative law judge.
2010-04-01
... Law Judge to conduct a hearing in cases under 22 U.S.C. 4115, and such other matters as may be... 22 Foreign Relations 2 2010-04-01 2010-04-01 true Administrative law judge. 1421.8 Section 1421.8... TERMS AS USED IN THIS SUBCHAPTER § 1421.8 Administrative law judge. Administrative law judge means the...
Directory of Open Access Journals (Sweden)
A. V. Mikhailov
1997-11-01
Full Text Available A self-consistent method for day-time F2-region modelling was applied to the analysis of Millstone Hill incoherent scatter observations during the storm period of March 16-22, 1990. The method allows us to calculate in a self-consistent way neutral composition, temperature and meridional wind as well as the ionized species height distribution. Theoretically calculated Ne(h profiles fit the observed daytime ones with great accuracy in the whole range of heights above 150 km for both quiet and disturbed days. The overall increase in Tex by 270 K from March 16 to March 22 reflects the increase of solar activity level during the period in question. A 30% decrease in [O] and a two-fold increase in [N2] are calculated for the disturbed day of March 22 relative to quiet time prestorm conditions. Only a small reaction to the first geomagnetic disturbance on March 18 and the initial phase of the second storm on March 20 was found in [O] and [N2] variations. The meridional neutral wind inferred from plasma vertical drift clearly demonstrates the dependence on the geomagnetic activity level being more equatorward on disturbed days. Small positive F2-layer storm effects on March 18 and 20 are totally attributed to the decrease in the northward neutral wind but not to changes in neutral composition. A moderate (by a factor of 1.5 O/N2 ratio decrease relative to the MSIS-83 model prediction is required to describe the observed NmF2 decrease on the most disturbed day of March 22, but virtually no change of this ratio is needed for March 21.
25 CFR 227.22 - Diligence and prevention of waste.
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Diligence and prevention of waste. 227.22 Section 227.22... IN WIND RIVER INDIAN RESERVATION, WYOMING, FOR OIL AND GAS MINING Operations § 227.22 Diligence and prevention of waste. The lessee shall exercise diligence in drilling and operating wells for oil and gas on...
25 CFR 23.22 - Purpose of tribal government grants.
2010-04-01
... 25 Indians 1 2010-04-01 2010-04-01 false Purpose of tribal government grants. 23.22 Section 23.22... Grants to Indian Tribes for Title II Indian Child and Family Service Programs § 23.22 Purpose of tribal government grants. (a) Grants awarded under this subpart are for the establishment and operation of tribally...
Calculation of Savannah River K Reactor Mark-22 assembly LOCA/ECS power limits
International Nuclear Information System (INIS)
Fischer, S.R.; Farman, R.F.; Birdsell, S.A.
1992-01-01
This paper summarizes the results of TRAC-PF1/MOD3 calculations of Mark-22 fuel assembly of loss-of-coolant accident/emergency cooling system (LOCA/ECS) power limits for the Savannah River Site (SRS) K Reactor. This effort was part of a larger effort undertaken by the Los Alamos National Laboratory for the US Department of Energy to perform confirmatory power limits calculations for the SRS K Reactor. A method using a detailed three-dimensional (3D) TRAC model of the Mark-22 fuel assembly was developed to compute LOCA/ECS power limits. Assembly power was limited to ensure that no point on the fuel assembly walls would exceed the local saturation temperature. The detailed TRAC model for the Mark-22 assembly consisted of three concentric 3D vessel components which simulated the two targets, two fuel tubes, and three main flow channels of the fuel assembly. The model included 100% eccentricity between the assembly annuli and a 20% power tilt. Eccentricity in the radial alignment of the assembly annuli arises because axial spacer ribs that run the length of the fuel and targets are used. Wall-shear, interfacial-shear, and wall heat-transfer correlations were developed and implemented in TRAC-PF1/MOD3 specifically for modeling flow and heat transfer in the narrow ribbed annuli encountered in the Mark-22 fuel assembly design. We established the validity of these new constitutive models using separate-effects benchmarks. TRAC system calculations of K Reactor indicated that the limiting ECS-phase accident is a double-ended guillonite break in a process water line at the pump discharge (i.e., a PDLOCA). The fuel assembly with the minimum cooling potential is identified from this system calculation. Detailed assembly calculations then were performed using appropriate boundary conditions obtained from this limiting system LOCA. Coolant flow rates and pressure boundary conditions were obtained from this system calculation and applied to the detailed assembly model
Le, H Carl; Lupu, Mihaela; Kotedia, Khushali; Rosen, Neal; Solit, David; Koutcher, Jason A
2009-11-01
17-Allylamino, 17-demethoxygeldanamycin (17-AAG), an effective inhibitor of the heat shock protein hsp90, preferentially inhibiting tumor hsp90 compared to hsp90 from normal cells, has shown promising results against several cancers, including hormone-resistant prostate cancer. Levels of several oncogenic proteins critical to tumor growth and progression, such as androgen receptor and HER2/neu, were reduced 4 h post 17-allylamino, 17-demethoxygeldanamycin treatment. Posttreatment metabolic changes have also been observed in several tumor cell lines. In this study, total choline distributions in hormone sensitive CWR22 and hormone resistant CWR22r prostate cancer xenograft tumors in mice were measured before and at 4 h and 48 h after a single-bolus 17-allylamino, 17-demethoxygeldanamycin treatment at 100 mg/kg, using proton MR spectroscopy. Our results show that tumor total choline levels declined 4 h after the treatment for CWR22 (P = 0.001) and 48 h post treatment for CWR22r (P = 0.003). Metabolic changes, in particular of total choline intensity detected by proton magnetic resonance spectroscopic imaging (MRSI), are consistent with the observed immunohistochemistry changes, tumor growth inhibition for CWR22r (P = 0.01 at 14 days post treatment), and a constant prostate specific antigen level versus increasing prostate specific antigen for control CWR22 (P = 0.01). Metabolic changes in total choline by proton MRSI can be used as an early biomarker of response for advanced-stage prostate cancer in targeted therapy such as 17-allylamino, 17-demethoxygeldanamycin. (c) 2009 Wiley-Liss, Inc.
Exon: CBRC-TNIG-22-0029 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TNIG-22-0029 caccaccagcaccaccagcaccagcaccagcaccaccagcaccagcaccagcaccagcaccagcaccagcagcaccagcacca...gcagcaccagcagcaccagcagcaccagcaccagcaccagcaccagcaccagcaccaccagcaccaccagcaccagcaccagcagcaccagcaccaccagcaccaccagcacca...gcaccagcaccagcagcaccagcagcaccagcaccagcagcaccaccagcaccagcaccaccaccagcaccatcagcaccaccagcaacaccagcaccaccCTACTGGTTCCCCGACCCGCTC ...
Cruise>Climate Variability and Predictability (CLIVAR) A22,A20 (AT20, EM122)
National Oceanic and Atmospheric Administration, Department of Commerce — The hydrographic surveys will consist of approximately 180 full water column CTD/LADCP casts along the trackline. Each cast will acquire up to 36 water samples on...
Crystallogenesis of bacteriophage P22 tail accessory factor gp26 at acidic and neutral pH
Energy Technology Data Exchange (ETDEWEB)
Cingolani, Gino, E-mail: cingolag@upstate.edu; Andrews, Dewan [Department of Biochemistry and Molecular Biology, SUNY Upstate Medical University, 750 East Adams Street, Syracuse, NY 13210 (United States); Casjens, Sherwood [Department of Pathology, Division of Cell Biology and Immunology, University of Utah Medical School, Salt Lake City, UT 84112 (United States); Department of Biochemistry and Molecular Biology, SUNY Upstate Medical University, 750 East Adams Street, Syracuse, NY 13210 (United States)
2006-05-01
The crystallogenesis of bacteriophage P22 tail-fiber gp26 is described. To study possible pH-induced conformational changes in gp26 structure, native trimeric gp26 has been crystallized at acidic pH (4.6) and a chimera of gp26 fused to maltose-binding protein (MBP-gp26) has been crystallized at neutral and alkaline pH (7-10). Gp26 is one of three phage P22-encoded tail accessory factors essential for stabilization of viral DNA within the mature capsid. In solution, gp26 exists as an extended triple-stranded coiled-coil protein which shares profound structural similarities with class I viral membrane-fusion protein. In the cryo-EM reconstruction of P22 tail extracted from mature virions, gp26 forms an ∼220 Å extended needle structure emanating from the neck of the tail, which is likely to be brought into contact with the cell’s outer membrane when the viral DNA-injection process is initiated. To shed light on the potential role of gp26 in cell-wall penetration and DNA injection, gp26 has been crystallized at acidic, neutral and alkaline pH. Crystals of native gp26 grown at pH 4.6 diffract X-rays to 2.0 Å resolution and belong to space group P2{sub 1}, with a dimer of trimeric gp26 molecules in the asymmetric unit. To study potential pH-induced conformational changes in the gp26 structure, a chimera of gp26 fused to maltose-binding protein (MBP-gp26) was generated. Hexagonal crystals of MBP-gp26 were obtained at neutral and alkaline pH using the high-throughput crystallization robot at the Hauptman–Woodward Medical Research Institute, Buffalo, NY, USA. These crystals diffract X-rays to beyond 2.0 Å resolution. Structural analysis of gp26 crystallized at acidic, neutral and alkaline pH is in progress.
GAR22β regulates cell migration, sperm motility, and axoneme structure.
Gamper, Ivonne; Fleck, David; Barlin, Meltem; Spehr, Marc; El Sayad, Sara; Kleine, Henning; Maxeiner, Sebastian; Schalla, Carmen; Aydin, Gülcan; Hoss, Mareike; Litchfield, David W; Lüscher, Bernhard; Zenke, Martin; Sechi, Antonio
2016-01-15
Spatiotemporal cytoskeleton remodeling is pivotal for cell adhesion and migration. Here we investigated the function of Gas2-related protein on chromosome 22 (GAR22β), a poorly characterized protein that interacts with actin and microtubules. Primary and immortalized GAR22β(-/-) Sertoli cells moved faster than wild-type cells. In addition, GAR22β(-/-) cells showed a more prominent focal adhesion turnover. GAR22β overexpression or its reexpression in GAR22β(-/-) cells reduced cell motility and focal adhesion turnover. GAR22β-actin interaction was stronger than GAR22β-microtubule interaction, resulting in GAR22β localization and dynamics that mirrored those of the actin cytoskeleton. Mechanistically, GAR22β interacted with the regulator of microtubule dynamics end-binding protein 1 (EB1) via a novel noncanonical amino acid sequence, and this GAR22β-EB1 interaction was required for the ability of GAR22β to modulate cell motility. We found that GAR22β is highly expressed in mouse testes, and its absence resulted in reduced spermatozoa generation, lower actin levels in testes, and impaired motility and ultrastructural disorganization of spermatozoa. Collectively our findings identify GAR22β as a novel regulator of cell adhesion and migration and provide a foundation for understanding the molecular basis of diverse cytoskeleton-dependent processes. © 2016 Gamper et al. This article is distributed by The American Society for Cell Biology under license from the author(s). Two months after publication it is available to the public under an Attribution–Noncommercial–Share Alike 3.0 Unported Creative Commons License (http://creativecommons.org/licenses/by-nc-sa/3.0).
39 CFR 2.2 - Agent for receipt of process.
2010-07-01
... 39 Postal Service 1 2010-07-01 2010-07-01 false Agent for receipt of process. 2.2 Section 2.2 Postal Service UNITED STATES POSTAL SERVICE THE BOARD OF GOVERNORS OF THE U.S. POSTAL SERVICE GENERAL AND TECHNICAL PROVISIONS (ARTICLE II) § 2.2 Agent for receipt of process. The General Counsel of the Postal...
Prof. Dr. Hilbrand Boschma 22 April 1893 - 22 July 1976 : Obituary and bibliography
Vervoort, W.
1977-01-01
Hilbrand Boschma, professor emeritus of systematic zoology and former director of the Rijksmuseum van Natuurlijke Historie (National Museum of Natural History), Leiden, Netherlands, passed away on 22 July, 1976, in Leiden at the age of 83. Born of peasant stock in IJsbrechtum, Wymbritseradeel, in
Study of the reaction 22Ne(131 MeV) + 208Pb with a PIAVE-ALPI test beam and the PRISMA-CLARA set-up
International Nuclear Information System (INIS)
Mason, P.; Marginean, N.; Stefanini, A.M.
2005-01-01
An opportunity to study the system 22 Ne+ 208 Pb in the proximity of the Coulomb barrier with the PRISMACLARA apparatus was given by a test of the PIAVE-ALPI accelerator in mid-December 2005. The 22 Ne projectiles, having the kinetic energy of 131 MeV, collided with a 208 Pb target 300 μg/cm 2 thick. (The beam was run for ∼20 hours with a current of ∼6 particle-nA). The reaction products, mainly originated by scattering or transfer processes, were detected by the PRISMA spectrometer (positioned in the proximity of the grazing angle, ∼70 degrees), coupled to the CLARA array of germanium detectors
2010-03-09
... Airworthiness Directives; AeroSpace Technologies of Australia Pty Ltd Models N22B, N22S, and N24A Airplanes... authority for Australia, has issued AD GAF-N22-52, Amendment 1, dated January 2010 (referred to after this... examining the MCAI in the AD docket. Relevant Service Information AeroSpace Technologies of Australia...
Exon: CBRC-TNIG-22-0288 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TNIG-22-0288 GGCCTTCCCCACGGCACTGCGGGAGTCACGGGTGGCCGAGGAGGAGGAGGTGAGGAAGTCCCGCTCTGCTCCTgcaccagcaccagcacc...aacaccagcaccaccagcaccaacaccagcaccagcaccagcaccaacaccagcaccaccagcaccaacaccagcaccagtaccagcaccaacaccagcacca...cgagcaccaacaccaggacgaacaccagcaccacgagcaccaacaccaggaggaacaccagcaccaacaccaacaccaacaccaacaccaacaccaccaacaccagcacca...acaccaacaccaccaacaccaacaccaacaccaacaccaccagcaccaacaccagcaccaacaccagcaccaacaccaacacc...accagcaccaacaccagcagcaccaacaccaacaccagcaccaacaccaacaccaacaccaacaccaccagcaccagcaccaacaccaacaccaccaacaccagcacc
ISP 22 OECD/NEA/CSNI International standard problem n. 22. Evaluation of post-test analyses
International Nuclear Information System (INIS)
1992-07-01
The present report deals with the open re-evaluation of the originally double-blind CSNI International Standard Problem 22 based on the test SP-FW-02 performed in the SPES facility. The SPES apparatus is an experimental simulator of the Westinghouse PWR-PUN plant. The test SP-FW-02 (ISP22) simulates a complete loss of feedwater with delayed injection of auxiliary feedwater. The main parts of the report are: outline of the test facility and of the SP-FW-02 experiment; overview of pre-test activities; overview of input models used by post-test participants; evaluation of participant predictions; evaluation of qualitative and quantitative code accuracy of pre-test and post-test calculations
African Journals Online (AJOL)
jenny
2006-02-22
Feb 22, 2006 ... Southern African Journal of Environmental Education, Vol. .... To this end, a planning conference on environmental .... mathematics, physics, chemistry, biology, geography, agriculture, home economics and human and.
ALDH2*2 and peer drinking in East Asian college students.
O'Shea, Taryn; Thomas, Nathaniel; Webb, Bradley Todd; Dick, Danielle M; Kendler, Kenneth S; Chartier, Karen G
2017-11-01
The ALDH2*2 allele (A-allele) at rs671 is more commonly carried by Asians and is associated with alcohol-related flushing, a strong adverse reaction to alcohol that is protective against drinking. Social factors, such as having friends who binge drink, also contribute to drinking in Asian youth. This study examined the interplay between ALDH2*2, peer drinking, and alcohol consumption in college students. We hypothesized that the relationship between ALDH2*2 and standard grams of ethanol per month would vary based on the level of peer drinking. Subjects (N = 318, 63.25% female) were East Asian college students in the United States who reported drinking alcohol. Data were from the freshman year of a university survey that included a saliva DNA sample. ALDH2*2 status was coded ALDH2*2(+) (A/G and A/A genotypes) and ALDH2*2(-) (G/G genotype). Peer drinking was students' perception of how many of their friends "got drunk". Main effects of ALDH2*2(-) and having more friends who got drunk were associated with greater alcohol consumption. The ALDH2*2 × peer drunkenness interaction showed a stronger positive association with alcohol consumption for ALDH2*2(-) versus ALDH2*2(+) at increasing levels of peer drunkenness. Follow-up comparisons within each peer drunkenness level identified significantly higher alcohol consumption for ALDH2*2(-) compared to ALDH2*2(+) at the all friends got drunk level. There was evidence of a stronger effect for ALDH2*2(-) compared to ALDH2*2(+) with greater alcohol use when students were more exposed to peer drinking. Findings contribute to a growing literature on the interrelationships between genetic influences and more permissive environments for alcohol consumption.
Exon: CBRC-TNIG-22-0334 [SEVENS
Lifescience Database Archive (English)
Full Text Available GAGAACCTGGAGCCGGGTCTggaggaccaggagaaccaggagaaccaggagaaccTGGATCCAGGCCTGGAGGACCAGAGAACCTGGAGCCGGGTCTGGAGAAGCAGCATGTGTCAGGAGGAG ... ...CBRC-TNIG-22-0334 gagaaccaggagaaccaggaCCCTGGTCTggaggaccaggagaaccaggagaaccaggaCCCTGGTCTggagaaccaggagaacca...ggagaaccTGGATCCAGGCCTGGAGGACCAGAGAACCTGGAGCCAGGTCTGGAGGACCAGGAGAACCAGGAGAACCTGGATCCAGGTCTAGAGGACCA
Exon: CBRC-TNIG-22-0261 [SEVENS
Lifescience Database Archive (English)
Full Text Available CBRC-TNIG-22-0261 acaccagtccaccagacaccagtccaccagtccaccagtccaccaggccaccagtccaccagtccaccagtccacca...ggtccccagacaccagtccaccagacaccagcccaccagtccaccagacaccagcccaccagtccaccagacaccagcccaccagtccaccagacaccagtccaccagtccacca...ggccaccagacaccagtccaccagtccaccagacaccagtccaccagtccaccaggtccccagacaccagtccaccagacaccagtccaccagtccaccagtccaccagtcacc...agtccaccagtccaccagtccaccaggccaccagacaccagtccaccagtccaccagtccaccagtcaccagtccacca...gtccaccagtccaccaggccaccagacaccagtccaccagtccaccaggccaccagGCACCAAGTGCTGCAGCTGCAGGCTGTTTCTGCCTCCTGGTAG ...
The First 24 Years of Reverse Monte Carlo Modelling, Budapest, Hungary, 20-22 September 2012
Keen, David A.; Pusztai, László
2013-11-01
the collection of research papers within this special issue will communicate the vibrancy of this field to the wider scientific community by showing the current 'state of the art' research opportunities using the RMC method. Furthermore, by including a small number of papers from colleagues working on similar disordered problems with complementary analysis techniques, we hope that the RMC method may be placed in a broader scientific context. Acknowledgments We are very grateful to IOP Publishing for their willingness to publish this collection of papers which celebrates the 24th anniversary of the first RMC publication in a special issue of Journal of Physics: Condensed Matter and for their co-ordination during the refereeing process. References [1] McGreevy R L 2001 J. Phys.: Condens. Matter 13 R877 [2] Keen D A and Pusztai L (ed) 2010 J. Phys.: Condens. Matter 22 (Special issue on the first 21 years of reverse Monte Carlo modelling) [3] Keen D A and Pusztai L (ed) 2007 J. Phys.: Condens. Matter 19 (Special issue on the first eighteen years of reverse Monte Carlo modelling) [4] Keen D A, Pusztai L and Dove M T (ed) 2005 J. Phys.: Condens. Matter 17 (Special issue on the first fifteen years of reverse Monte Carlo modelling) [5] Tucker M G, Keen D A, Dove M T, Goodwin A L and Hui Q 2007 J. Phys.: Condens. Matter 19 335218 [6] Gereben O and Pusztai L 2012 J. Comput. Chem. 33 2285 Reverse Monte Carlo modelling The First 24 Years of Reverse Monte Carlo Modelling, Budapest, Hungary, 20-22 September 2012David A Keen and László Pusztai Conformational analysis of bis(methylthio)methane and diethyl sulfide molecules in the liquid phase: reverse Monte Carlo studies using classical interatomic potential functionsOrsolya Gereben and László Pusztai Towards a robust ad hoc data correction approach that yields reliable atomic pair distribution functions from powder diffraction dataSimon J L Billinge and Christopher L Farrow The atomic scale structure of CXV carbon: wide-angle x
Functional and comparative genomics analyses of pmp22 in medaka fish
Directory of Open Access Journals (Sweden)
Kawarabayasi Yutaka
2009-06-01
Full Text Available Abstract Background Pmp22, a member of the junction protein family Claudin/EMP/PMP22, plays an important role in myelin formation. Increase of pmp22 transcription causes peripheral neuropathy, Charcot-Marie-Tooth disease type1A (CMT1A. The pathophysiological phenotype of CMT1A is aberrant axonal myelination which induces a reduction in nerve conduction velocity (NCV. Several CMT1A model rodents have been established by overexpressing pmp22. Thus, it is thought that pmp22 expression must be tightly regulated for correct myelin formation in mammals. Interestingly, the myelin sheath is also present in other jawed vertebrates. The purpose of this study is to analyze the evolutionary conservation of the association between pmp22 transcription level and vertebrate myelin formation, and to find the conserved non-coding sequences for pmp22 regulation by comparative genomics analyses between jawed fishes and mammals. Results A transgenic pmp22 over-expression medaka fish line was established. The transgenic fish had approximately one fifth the peripheral NCV values of controls, and aberrant myelination of transgenic fish in the peripheral nerve system (PNS was observed. We successfully confirmed that medaka fish pmp22 has the same exon-intron structure as mammals, and identified some known conserved regulatory motifs. Furthermore, we found novel conserved sequences in the first intron and 3'UTR. Conclusion Medaka fish undergo abnormalities in the PNS when pmp22 transcription increases. This result indicates that an adequate pmp22 transcription level is necessary for correct myelination of jawed vertebrates. Comparison of pmp22 orthologs between distantly related species identifies evolutionary conserved sequences that contribute to precise regulation of pmp22 expression.
Directory of Open Access Journals (Sweden)
Mulatinho Milene
2012-06-01
Full Text Available Abstract Background Recently, array-comparative genomic hybridization (aCGH platforms have significantly improved the resolution of chromosomal analysis allowing the identification of genomic copy number gains and losses smaller than 5 Mb. Here we report on a young man with unexplained severe mental retardation, autism spectrum disorder, congenital malformations comprising hypospadia and omphalocele, and episodes of high blood pressure. An ~ 6 Mb interstitial deletion that includes the causative genes is identified by oligonucleotide-based aCGH. Results Our index case exhibited a de novo chromosomal abnormality at 2q22 [del(2(q22.1q22.3dn] which was not visible at the 550 haploid band level. The deleted region includes eight genes: HNMT, SPOPL, NXPH2, LOC64702, LRP1B, KYNU, ARHGAP15 and GTDC1. Discussion aCGH revealed an ~ 6 Mb deletion in 2q22.1 to 2q22.3 in an as-yet unique clinical case associated with intellectual disability, congenital malformations and autism spectrum disorder. Interestingly, the deletion is co-localized with a fragile site (FRA2K, which could be involved in the formation of this chromosomal aberration. Further studies are needed to determine if deletions of 2q22.1 to 2q22.3 define a new microdeletion syndrome.
2010-10-01
... APPLICATION OF LABOR LAWS TO GOVERNMENT ACQUISITIONS Prohibition of Acquisition of Products Produced by Forced or Indentured Child Labor 22.1500 Scope. This subpart applies to acquisitions of supplies that exceed...
Robin sequence associated with karyotypic mosaicism involving chromosome 22 abnormalities
Energy Technology Data Exchange (ETDEWEB)
Salinas, C.F.; Jastrzab, J.M.; Centu, E.S. [Medical Univ. of South Carolina, Charleston, SC (United States)
1994-09-01
Robin sequence is characterized by cleft palate, hypoplastic mandible, glossoptosis and respiratory difficulties. The Robin sequence may be observed as an isolated defect or as part of about 33 syndromes; however, to our knowledge, it has never been reported associated with chromosome 22 abnormalities. We examined a two-month-old black boy with a severe case of Robin sequence. Exam revealed a small child with hypoplastic mandible, glossoptosis, high palate and respiratory difficulty with continuous apnea episodes resulting in cyanotic lips and nails. In order to relieve the upper airway obstruction, his tongue was attached to the lower lip. Later a tracheostomy was performed. On follow-up exam, this patient was found to have developmental delay. Cytogenetic studies of both peripheral blood and fibroblast cells showed mosaicism involving chromosome 22 abnormalities which were designated as follows: 45,XY,-22/46,XY,-22,+r(22)/46,XY. Fluorescence in situ hybridization (FISH) studies confirmed the identity of the r(22) and showed the presence of the DiGeorge locus (D22575) but the absence of the D22539 locus which maps to 22q13.3. Reported cases of r(22) show no association with Robin sequence. However, r(22) has been associated with flat bridge of the nose, bulbous tip of the nose, epicanthus and high palate, all characteristics that we also observed in this case. These unusual cytogenetic findings may be causally related to the dysmorphology found in the patient we report.
Ataxia and peripheral nerve hypomyelination in ADAM22-deficient mice
Directory of Open Access Journals (Sweden)
Ino Mitsuhiro
2005-05-01
Full Text Available Abstract Background ADAM22 is a member of the ADAM gene family, but the fact that it is expressed only in the nervous systems makes it unique. ADAM22's sequence similarity to other ADAMs suggests it to be an integrin binder and thus to have a role in cell-cell or cell-matrix interactions. To elucidate the physiological functions of ADAM22, we employed gene targeting to generate ADAM22 knockout mice. Results ADAM22-deficient mice were produced in a good accordance with the Mendelian ratio and appeared normal at birth. After one week, severe ataxia was observed, and all homozygotes died before weaning, probably due to convulsions. No major histological abnormalities were detected in the cerebral cortex or cerebellum of the homozygous mutants; however, marked hypomyelination of the peripheral nerves was observed. Conclusion The results of our study demonstrate that ADAM22 is closely involved in the correct functioning of the nervous system. Further analysis of ADAM22 will provide clues to understanding the mechanisms of human diseases such as epileptic seizures and peripheral neuropathy.
Energy Technology Data Exchange (ETDEWEB)
Eckels, S J; Tesene, B A
1999-07-01
This paper reports pressure drops during condensation for R-22, R-134a, R-410a, and R-407c in three enhanced tubes and one smooth tube. The test tubes were a 3/8 inch outer diameter smooth tube, a 3/8 inch outer diameter microfin tube, a 5/16 inch outer diameter microfin tube, and a 5/8 inch outer diameter microfin tube. Pressure drops are reported at four mass fluxes, at two saturation temperatures, and over a range of average qualities in the test tubes. The pressure drops for R-410a were approximately 40% lower than those of R-22 in both tubes. R-407c had 10% to 20% lower pressure drops than R-22, while 134-a had slightly larger pressure drops than R-22. The microfin tube pressure drops were, on average, 40% to 80% higher than those for the smooth tube for all refrigerants. The pressure drop penalty of the microfin tube was shown to decrease with increased quality.
EVOLUTION OF WHITE DWARF STARS WITH HIGH-METALLICITY PROGENITORS: THE ROLE OF 22Ne DIFFUSION
International Nuclear Information System (INIS)
Althaus, L. G.; Corsico, A. H.; GarcIa-Berro, E.; Renedo, I.; Isern, J.; Rohrmann, R. D.
2010-01-01
Motivated by the strong discrepancy between the main-sequence turnoff age and the white dwarf cooling age in the metal-rich open cluster NGC 6791, we compute a grid of white dwarf evolutionary sequences that incorporates for the first time the energy released by the processes of 22 Ne sedimentation and of carbon/oxygen phase separation upon crystallization. The grid covers the mass range from 0.52 to 1.0 M sun , and is appropriate for the study of white dwarfs in metal-rich clusters. The evolutionary calculations are based on a detailed and self-consistent treatment of the energy released from these two processes, as well as on the employment of realistic carbon/oxygen profiles, of relevance for an accurate evaluation of the energy released by carbon/oxygen phase separation. We find that 22 Ne sedimentation strongly delays the cooling rate of white dwarfs stemming from progenitors with high metallicities at moderate luminosities, while carbon/oxygen phase separation adds considerable delays at low luminosities. Cooling times are sensitive to possible uncertainties in the actual value of the diffusion coefficient of 22 Ne. Changing the diffusion coefficient by a factor of 2 leads to maximum age differences of ∼8%-20% depending on the stellar mass. We find that the magnitude of the delays resulting from chemical changes in the core is consistent with the slowdown in the white dwarf cooling rate that is required to solve the age discrepancy in NGC 6791.
African Journals Online (AJOL)
jenny
2006-02-22
Feb 22, 2006 ... Exploring Educators' Expectations and. Experiences of ... project and is sponsored by major corporate bodies. The project aims ... To explore participants' expectations and experiences of INSET the following research strategy.
Hematological abnormalities and 22q11.2 deletion syndrome
Directory of Open Access Journals (Sweden)
Rafael Fabiano Machado Rosa
2011-01-01
Full Text Available The 22q11.2 deletion syndrome (22q11DS is a common genetic disease characterized by broad phenotypic variability. Despite the small number of studies describing hematological alterations in individuals with 22q11DS, it appears that these abnormalities are more frequent than previously imagined. Thus, the objective of our study was to report on a patient with 22q11DS presenting thrombocytopenia and large platelets and to review the literature. The patient, a 13-year-old boy, was originally evaluated due to craniofacial dysmorphia and speech delay. He also had a history of behavioral changes, neuropsychomotor delay and recurrent otitis/sinusitis. The identification of a 22q11.2 microdeletion by fluorescent in situ hybridization diagnosed the syndrome. Despite his hematological alterations, he only had a history of epistaxis and bruising of the upper and lower limbs. Assessments of the prothrombin time, thrombin time, partial thromboplastin time, bleeding time, fibrinogen levels and platelet aggregation (including the ristocetin induced platelet aggregation test were all normal. Hematological alterations observed in 22q11DS are directly related to the genetic disorder itself (especially in respect to deletion of the GPIb gene and secondary to some clinical findings, such as immunodeficiency. Macrothrombocytopenia is increasingly being considered a feature of the broad spectrum of 22q11DS and may potentially be a clinical marker for the syndrome.
Energy Technology Data Exchange (ETDEWEB)
Wang, Y.; Cai, X.Q.; Yang, Z.W., E-mail: tjuyangzhenwen@163.com; Qiu, Q.W.; Wang, D.P.; Liu, Y.C.
2016-10-01
Ti{sub 45}Ni{sub 45}Nb{sub 10} (at.%) brazing alloy, fabricated by arc melting, was successfully used to braze Ti−22Al−25Nb (at.%) alloy. The microstructures of Ti{sub 45}Ni{sub 45}Nb{sub 10} brazing alloy and Ti−22Al−25Nb alloy brazed joints were analyzed using scanning electron microscopy (SEM), energy dispersive spectroscopy (EDS), electron backscatter diffraction (EBSD), and micro-area X-ray diffraction (XRD). The effects of the brazing parameters on the interfacial microstructure and mechanical properties of the Ti−22Al−25Nb alloy brazed joints were investigated. The results showed that the joint was primarily comprised of two characteristic zones: diffusion zone I and central zone II, and the reaction phases formed in the brazed joint were the B2, O, τ{sub 3}, and Ti{sub 2}Ni phase. The crystal orientation of B2 phase in diffusion zone I was consistent with that in the Ti−22Al−25Nb substrate. The O phase was precipitated from the B2 phase. As the brazing temperature or holding time increased, τ{sub 3} was gradually replaced by the B2 phase, and the Ti{sub 2}Ni phase decreased and ultimately disappeared. The maximum shear strength achieved at room temperature was 318 MPa when the joint was brazed at 1180 °C for 20 min, whereas it was 278 MPa at 650 °C. Crack primarily propagated in the τ{sub 3} compound, which was extremely hard and brittle, and partially traversed the B2 and O phases. - Highlights: • Ti{sub 45}Ni{sub 45}Nb{sub 10} alloy was successfully developed to braze Ti−22Al−25Nb alloy. • Ti−22Al−25Nb alloy was transformed from B2 phase into the O + B2 duplex phase after brazing. • Crystal orientation of B2 in joint was dependent on metal substrate. • Correlation between joint microstructure and mechanical properties was revealed. • Ti−22Al−25Nb brazed joint had excellent ambient and high temperature strength.
47 CFR 22.383 - In-building radiation systems.
2010-10-01
... MOBILE SERVICES Operational and Technical Requirements Technical Requirements § 22.383 In-building radiation systems. Licensees may install and operate in-building radiation systems without applying for... 47 Telecommunication 2 2010-10-01 2010-10-01 false In-building radiation systems. 22.383 Section...
2010-10-01
...) Procuring commercial sex acts during the period of performance of the contract; or (3) Using forced labor in... APPLICATION OF LABOR LAWS TO GOVERNMENT ACQUISITIONS Combating Trafficking in Persons 22.1703 Policy. The...
2010-07-01
... recipient of an award). (c) Have a satisfactory record of integrity and business ethics. (d) Be otherwise... Procedures § 22.415 Standards. To be qualified, a potential recipient must: (a) Have the management...
47 CFR 22.401 - Description and purposes of developmental authorizations.
2010-10-01
... leading to the potential development of a new Public Mobile Service or technology; or, (c) Stations... authorizations. 22.401 Section 22.401 Telecommunication FEDERAL COMMUNICATIONS COMMISSION (CONTINUED) COMMON CARRIER SERVICES PUBLIC MOBILE SERVICES Developmental Authorizations § 22.401 Description and purposes of...
2016-01-01
Please note that the next series of Academic Training Lectures will take place on 19 and 20 January 2016. The lectures will be given by Andrzej Nowak (TIK Services, Switzerland). An Introduction to Parallelism, Concurrency and Acceleration (1/2) on Tuesday, 19 January from 11 a.m. to 12 noon https://indico.cern.ch/event/404682/ An Introduction to Parallelism, Concurrency and Acceleration (2/2) on Wednesday, 20 January from 11 a.m. to 12 noon https://indico.cern.ch/event/404683/ at CERN IT Amphitheatre (31-3-004) Description: Concurrency and parallelism are firm elements of any modern computing infrastructure, made even more prominent by the emergence of accelerators. These lectures offer an introduction to these important concepts. We will begin with a brief refresher of recent hardware offerings to modern-day programmers. We will then open the main discu...
Sciences et éthique | conférence d'Axel Kahn | 20 novembre
2012-01-01
Mardi 20 novembre 2012 à 20h30 Globe de la science et de l'innovation Route de Meyrin, 1211 Genève En français Tout public - entrée libre Nombre de places limité - réservation indispensable Réservation au +41 22 767 76 76 Parce que « le savoir est pouvoir pour l'homme de se rendre comme maître et possesseur de la nature », nous sommes collectivement de plus en plus savant et de plus en plus puissant. Reste à ce que notre sagesse nous conduise à utiliser nos pouvoirs au profit des personnes, et non à leur détriment, en d'autres termes, à ce que le progrès scientifique constitue une chance et non une menace. Pour qu'il en soit ainsi, il importe de non seulement développer les sciences et les techniques mais aussi de leur assigner des objectifs au centre desquels résident l'...
McDonald-McGinn, Donna M.; Sullivan, Kathleen E.; Marino, Bruno; Philip, Nicole; Swillen, Ann; Vorstman, Jacob A. S.; Zackai, Elaine H.; Emanuel, Beverly S.; Vermeesch, Joris R.; Morrow, Bernice E.; Scambler, Peter J.; Bassett, Anne S.
2016-01-01
22q11.2 deletion syndrome (22q11.2DS) is the most common chromosomal microdeletion disorder, estimated to result mainly from de novo non-homologous meiotic recombination events occurring in approximately 1 in every 1,000 fetuses. The first description in the English language of the constellation of findings now known to be due to this chromosomal difference was made in the 1960s in children with DiGeorge syndrome, who presented with the clinical triad of immunodeficiency, hypoparathyroidism and congenital heart disease. The syndrome is now known to have a heterogeneous presentation that includes multiple additional congenital anomalies and later-onset conditions, such as palatal, gastrointestinal and renal abnormalities, autoimmune disease, variable cognitive delays, behavioural phenotypes and psychiatric illness — all far extending the original description of DiGeorge syndrome. Management requires a multidisciplinary approach involving paediatrics, general medicine, surgery, psychiatry, psychology, interventional therapies (physical, occupational, speech, language and behavioural) and genetic counselling. Although common, lack of recognition of the condition and/or lack of familiarity with genetic testing methods, together with the wide variability of clinical presentation, delays diagnosis. Early diagnosis, preferably prenatally or neonatally, could improve outcomes, thus stressing the importance of universal screening. Equally important, 22q11.2DS has become a model for understanding rare and frequent congenital anomalies, medical conditions, psychiatric and developmental disorders, and may provide a platform to better understand these disorders while affording opportunities for translational strategies across the lifespan for both patients with 22q11.2DS and those with these associated features in the general population. PMID:27189754
Molecular Mechanisms and Diagnosis of Chromosome 22q11.2 Rearrangements
Emanuel, Beverly S.
2008-01-01
Several recurrent, constitutional genomic disorders are present on chromosome 22q. These include the translocations and deletions associated with DiGeorge and velocardiofacial syndrome and the translocations that give rise to the recurrent t(11;22) supernumerary der(22) syndrome (Emanuel syndrome). The rearrangement breakpoints on 22q cluster…
Energy Technology Data Exchange (ETDEWEB)
Misawa, Takahiro; Mori, Sumito [Research Institute for Electronic Science, Hokkaido University, Sapporo, Hokkaido 001-0020 (Japan); Komine, Takashi [Faculty of Engineering, Ibaraki University, Hitachi, Ibaraki 316-8511 (Japan); Fujioka, Masaya; Nishii, Junji [Research Institute for Electronic Science, Hokkaido University, Sapporo, Hokkaido 001-0020 (Japan); Kaiju, Hideo, E-mail: kaiju@es.hokudai.ac.jp [Research Institute for Electronic Science, Hokkaido University, Sapporo, Hokkaido 001-0020 (Japan)
2016-12-30
Graphical abstract: This paper presents the first demonstration of the formation of Ni{sub 78}Fe{sub 22} thin films sandwiched between low-softening-point (LSP) glasses used in spin quantum cross (SQC) devices and the theoretical prediction of spin filter effect in Ni{sub 78}Fe{sub 22}-based SQC devices. The fomation of the LSP-glass/Ni{sub 78}Fe{sub 22}/LSP-glass structures was successfully demonstrated using a newly proposed thermal pressing technique. Interestingly, this technique gives rise to both a highly-oriented crystal growth in Ni{sub 78}Fe{sub 22} thin films and a 100-fold enhancement in coercivity, in contrast to those of as-deposited Ni{sub 78}Fe{sub 22} thin films. This remarkable increase in coercivity can be explained by the calculation based on two-dimensional random anisotropy model. These excellent features on structural and magnetic properties allowed us to achieve that the stray magnetic field was uniformly generated from the Ni{sub 78}Fe{sub 22} thin-film edge in the direction perpendicular to the cross section of the LSP-glass/Ni{sub 78}Fe{sub 22}/LSP-glass structures. As we calculated the stray magnetic field generated between the two edges of Ni{sub 78}Fe{sub 22} thin-film electrodes in SQC devices, a high stray field of approximately 5 kOe was generated when the gap distance between two edges of the Ni{sub 78}Fe{sub 22} thin-film electrodes was less than 5 nm and the thickness of Ni{sub 78}Fe{sub 22} was greater than 20 nm. These experimental and calculated results suggest that Ni{sub 78}Fe{sub 22} thin films sandwiched between LSP glasses can be used as electrodes in SQC devices, providing a spin-filter effect, and also our proposed techniques utilizing magnetic thin-film edges will open up new opportunities for the creation of high performance spin devices, such as large magnetoresistance devices and nanoscale spin injectors. Our paper is of strong interest to the broad audience of Applied Surface Science, as it demonstrates that the
African Journals Online (AJOL)
jenny
2006-02-22
Feb 22, 2006 ... into the construction, conceptualisation and implementation of the curriculum. .... defining development pathways that are not water or energy intensive. ... equitable access to an effective education while at the same time ...
2010-04-01
.... (b) The terms labor organization, and conditions of employment as used herein shall have the meanings... means any appropriate technique, not inconsistent with the provisions of 22 U.S.C. 4110, used by the...
African Journals Online (AJOL)
jenny
2006-02-22
Feb 22, 2006 ... The health message communicated in the materials ..... research as a rational process of co-mediated reflexive engagement under the facilitating hand .... In participatory approaches the message is closely scaffolded and ...
USP22 regulates oncogenic signaling pathways to drive lethal cancer progression.
Schrecengost, Randy S; Dean, Jeffry L; Goodwin, Jonathan F; Schiewer, Matthew J; Urban, Mark W; Stanek, Timothy J; Sussman, Robyn T; Hicks, Jessica L; Birbe, Ruth C; Draganova-Tacheva, Rossitza A; Visakorpi, Tapio; DeMarzo, Angelo M; McMahon, Steven B; Knudsen, Karen E
2014-01-01
Increasing evidence links deregulation of the ubiquitin-specific proteases 22 (USP22) deubitiquitylase to cancer development and progression in a select group of tumor types, but its specificity and underlying mechanisms of action are not well defined. Here we show that USP22 is a critical promoter of lethal tumor phenotypes that acts by modulating nuclear receptor and oncogenic signaling. In multiple xenograft models of human cancer, modeling of tumor-associated USP22 deregulation demonstrated that USP22 controls androgen receptor accumulation and signaling, and that it enhances expression of critical target genes coregulated by androgen receptor and MYC. USP22 not only reprogrammed androgen receptor function, but was sufficient to induce the transition to therapeutic resistance. Notably, in vivo depletion experiments revealed that USP22 is critical to maintain phenotypes associated with end-stage disease. This was a significant finding given clinical evidence that USP22 is highly deregulated in tumors, which have achieved therapeutic resistance. Taken together, our findings define USP22 as a critical effector of tumor progression, which drives lethal phenotypes, rationalizing this enzyme as an appealing therapeutic target to treat advanced disease.